Note: Descriptions are shown in the official language in which they were submitted.
CA 02485453 2004-11-02
WO 03/097676 - 1 - PCT/FR03/01439
Polypeptide antigen inducing HN neutralizing antibodies
The present invention relates to a polypeptide antigen which derives from the
gp41
protein, and also to the use thereof for immunization against HN-related
infection.
These studies were cofinanced by the ANRS [French National Association for
A)DS
Research].
The development of a method of immunization against HN is, today, one of the
priorities of scientific research.
The major obstacles represented by the great genetic variability of the virus
and the low
exposure to the immune system of conserved neutralizing viral epitopes
considerably hinder the
development of a vaccine capable of neutralizing HN primary isolates.
The HN envelope glycoprotein, which is required to confer on the virus its
infectious
nature, represents the target for neutralizing antibodies. These
characteristics have made this
target a subject of intense investigation.
The use, for immunization purposes, of polypeptides which derive from the gp41
protein
has been described in WO 00/40616. According to that application, N-helices
may be used
alone or in combination with C-helices, to induce neutralizing antibodies.
The Applicant here proposes a novel polypeptide antigen which can be used for
therapeutic and prophylactic immunization against HIV-related infection. The
Applicant has, in
fact, revealed a polypeptide which derives from the ectodomain of the gp41
protein and which
is capable of inducing antibodies which neutralize HN primary isolates.
The present invention therefore relates to a polypeptide represented by the
formula:
N-L-C
in which:
N represents the amino acid sequence 25-81 of gp4l,
C represents the amino acid sequence 112-157 of gp4l, and
L represents a flexible linking sequence comprising from 2 to 30 amino acids.
According to a particular embodiment, N represents SEQ B7 No.l and C
represents SEQ
ID No.2.
According to a preferred embodiment, the polypeptide consists of the sequence
SEQ Ifl
No.3.
According to another embodiment, the polypeptide as defined above also
comprises a
sequence containing the epitope ERDRD.
CA 02485453 2004-11-02
- 2 -
According to a particular embodiment, the polypeptide as defined above
comprises an
additional sequence of formula (G)a-S-(H)b in which G represents a glycine
residue, H
represents a histidine residue, a is greater than or equal to 4 and b is
greater than or equal to 6,
said sequence being linked, via an amide bond, to the NHZ- or COON-terminal
end of the
polypeptide.
According to a particularly preferred embodiment, the polypeptide according to
the
present invention consists of the sequence SEQ DJ No.4.
A subject of the present invention is also a conjugate comprising a
polypeptide as
defined above, conjugated to a carrier protein or peptide.
The present invention also relates to a DNA sequence encoding a polypeptide or
a
conjugate as defined above.
A subject of the present invention is also an expression vector comprising
said DNA
sequence.
According to a preferred embodiment, the DNA encodes a polypeptide as defined
above
which also comprises a sequence containing the epitope ERDRD.
A subject of the present invention is also a host cell containing the vector
as defined
above.
According to another aspect, the present invention relates to a method for
preparing a
polypeptide as defined above, comprising expression of said polypeptide using
a host cell as
defined above.
According to another aspect, the present invention relates to a pharmaceutical
composition comprising at least one polypeptide, at least one conjugate or at
least one
expression vector as defined above, a pharmaceutically acceptable excipient
and, optionally, an
adjuvant.
According to a particular embodiment, the pharmaceutical composition comprises
a
polypeptide of sequence SEQ 1D No.4 and an adjuvant selected from the group
consisting of
DC-Chol and aluminum gel.
A subject of the present invention is also the polypeptide as defined above,
for its use as
a medicinal product, in particular for inducing specific neutralizing
antibodies in a mammal.
The present invention also relates to a method for inducing specific
neutralizing
antibodies in a mammal, comprising administration of a pharmaceutical
composition as defined
above and induction of said antibodies.
CA 02485453 2004-11-02
- 3 -
According to a preferred embodiment, the administration is carned out orally
or
intramuscularly.
The invention is described in greater detail in the following description.
The Applicant has demonstrated, surprisingly, that the polypeptide according
to the
invention induces specific IgG antibodies which neutralize HIV primary
isolates. The induction
of antibodies which neutralize primary isolates can be determined using the
neutralization test
as described in the article by C. Moog et al. (AZ17S Research and human
retroviruses, Vol.
13(I), I3-27, 1997), to which reference may be made for a complete description
of the latter. In
the context of the present invention, it is estimated that neutralizing
antibodies have been
induced by the antigen tested according to the technique of C. Moog when the
serum diluted at
least to 1/4, in the presence of HIV, leads to a 10-fold decrease in the viral
titer in comparison
to HIV alone, the viral titer being evaluated by the amount of p24 produced in
the culture
supernatant.
The induction of antibodies which neutralize primary isolates may also be
determined
using the neutralization test of D. Montefiori as described in J. Infect. Dis.
1996, 173:60-67. In
this test, the neutralizing titer is expressed by the percentage decrease in
p24 antigen produced
in the culture supernatants when the virus is incubated in the presence of
serum diluted to 114,
by comparison with the virus in the absence of serum. In the context of the
present invention, it
is considered that neutralizing antibodies have been induced when the decrease
in the level of
p24 produced reaches at least 80% with a serum diluted to 1/4.
In the context of the present invention, it is considered that the antibodies
induced by the
polypeptide according to the invention are neutralizing antibodies if
neutralizing activity is
detected for a given isolate in at least one of the two tests above.
The induction of antibodies which neutralize the HIV-I MN laboratory strain
can be
2S estimated using the MT-2 cell line according to the method of D.
Montefiori, described in: DC
Montefiori et al., J. Clin. Microbiol. 1988, 26: 231-S). In this method, the
neutralizing titer is
expressed as the inverse of the dilution of the serum (in arithmetic value)
which protects at least
SO% of cells against the cytopathogenic effect of the HIV virus.
The N and C sequences which constitute the polypeptide according to the
present
invention may be derived from any gp41 protein of HIV, including the HIV 1 and
HIV2 strains,
including laboratory strains and primary isolates. Preferably, the constituent
sequences are
derived from an HIV I strain, and in particular from an HN 1 LAI strain.
CA 02485453 2004-11-02
- 4 -
The amino acids are numbered with reference to the sequence of the gp41
fragment SEQ
ID No.B, in which the first amino acid A carries the number 1.
According to a preferred embodiment, N represents SEQ ID No. l and C
represents SEQ
ID No.2.
The nucleotide and peptide sequences of a large number of gp41 proteins are
known and
available, fox example, on the Internet on the site http://hiv-web.lanl. gov/
and also in the
corresponding Los Alamos compendia. It is clear that any sequence into which
one or more
conservative mutations which do not substantially modify immunogenicity have
been
introduced is also included in the context of the present invention.
The N and C sequences are linked to one another via a linking peptide sequence
L
comprising from 2 to 30 amino acids. This linking sequence L is a loop which
allows the N and
C sequences to pair with one another according to an anti-parallel
orientation. The polypeptide
according to the present invention is a trimer consisting of 3 N-L-C monomers
forming a
bundle in which the N-helices are paired with one another and the C-helices
are paired with the
N-helices according to an anti-parallel orientation.
The L sequences suitable in the context of the present invention may be
selected using a
secondary structure prediction program GOR (Gamier, Osguthorpe and Robson
(1078), J. MoI.
Biol., 120, 97-120 ; http://molbiol.soton.ac.uk/compute/GOR.html) on the N-L-C
sequence,
specifying, in the "helix" and "extended" windows, the unknown notion. The
percentage of
helix in the prediction of the secondary structure of L should be less than
10. The L sequences
are advantageously weakly hydrophobic, preferably hydrophilic in order to
facilitate
purification of the corresponding polypeptide. The hydrophilic nature may be
obtained by using
an amino acid which is hydrophilic in nature, such as serine, which may be
combined with
glycines. According to a preferred embodiment, the polypeptide according to
the invention has
the sequence SEQ )D No.3. This sequence may advantageously be modified in
order to decrease
its hydrophobic nature, for example by introducing at least one of the
following mutations:
W85D; L91K; I92K and W 103D, and preferably by introducing at least any two
mutations
selected from the group of the 4 mutations proposed above, or even all of said
mutations.
According to a particular embodiment, the polypeptide of formula N-L-C as
defined
above also comprises a sequence containing the Kennedy epitope ERDRD. The
ERDRD
sequence may be linked at the N- or C-terminal of the polypeptide, directly or
preferably via a
flexible linkage. Such a flexible linkage typically comprises about ten or so
amino acids,
preferably hydrophilic in nature. Sequences comprising glycines and serines,
such as GGR, are,
CA 02485453 2004-11-02
- 5 -
for example, perfectly suitable. The epitope ERDRD may also be inserted into
the L sequence
of the polypeptide. In such a scenario, the epitope will preferentially be
bordered by linking
sequences which provide the junction with the N and C sequences. The nature of
these
sequences can be easily determined using the GOR secondary structure
prediction program
mentioned above, the objective being for the linking sequence L to allow anti-
parallel pairing of
the N- and C-helices.
In the context of the present invention, the expression "a sequence comprising
the
epitope ERDRD" is therefore intended to mean a sequence consisting of the
epitope ERDRD,
optionally of a flexible linkage and optionally of some additional amino acids
which would
result from the method of constructing the plasmids expressing the
polypeptide, due to the use
of restriction sites. This is the case, for example, of the amino acids
RSGGGGS present at the
C-terminal of the constructs tested in example 4.
The polypeptide according to the invention may be obtained by any conventional
technique of chemical synthesis or of genetic engineering.
When the polypeptide is produced by chemical synthesis, the polypeptide
according to
the invention may be synthesized in the form of a single sequence, or in the
form of several
sequences which are then linked to one another. The chemical synthesis may be
carried out in
solid phase or in solution, these two synthesis techniques being well known to
those skilled in
the art. These techniques are in particular described by Atherton and Shepard
in "Solid phase
peptide synthesis (IRL press Oxford, 1989) and by Houbenweyl in "Methoden der
organischen
Chemie" [Methods in Organic Chemistry] published by E.Wunsch Vol. 15-I and II,
Stuttgart,
1974, and also in the following articles, which are entirely incorporated
herein by way of
reference: PE Dawson et a1. (Science 1994; 266(5186):776-9); GG Kochendoerfer
et aI. (1999;
3(6):665-71); et PE Dawson et al., Annu. Rev. Biochem. 2000; 69:923-60.
The polypeptide according to the invention may also be produced using genetic
engineering techniques well known to those skilled in the art. When the
polypeptide according
to the invention is produced by genetic engineering, it comprises, at the NHZ-
terminal end, an
additional methionine residue corresponding to the translation of the first
initiation codon.
These techniques are described in detail in Molecular Cloning: a molecular
manual, by Maniatis
et al., Cold Spring Harbor, 1989. Conventionally, the PCR technique is used to
produce the
DNA sequence encoding the polypeptide according to the invention in a form
which can be
inserted into an expression vector. The DNA sequence thus obtained is then
inserted into an
expression vector. The expression vector containing the sequence of interest
is then used to
CA 02485453 2004-11-02
- 6 -
transform a host cell which allows expression of the sequence of interest. The
polypeptide
produced is then isolated from the culture medium using conventional
chromatography
techniques well known to those skilled in the art. High performance liquid
chromatography
(HPLC) is preferably used in the purification. Typically, the cells axe
collected at the end of
culturing, by centrifugation, and are taken up in a neutral buffer, in order
to be ruptured by any
suitable means. The cell lysate is then centrifuged at approximately 10 000 g
in order to
separate the soluble material from the insoluble material. SDS-PAGE analysis
of the
supernatant and of the pellet from centrifugation will reveal whether the
polypeptide is soluble
or not. If the polypeptide is insoluble, solubiiization is obtained using a
buffer containing urea,
guanidine or other solubilizing agents. Centrifugation at this step makes it
possible to remove
debris and other insoluble products which would hamper the chromatography. The
following
step consists in loading the solubilized molecule onto an affinity column,
which may be of the
metal chelate type if a polyhistidine tail is integrated onto the polypeptide
of interest. The
system which enables the affinity purification may be varied in nature, such
as immunoaffinity,
affinity on cibachron blue, etc. At this stage, the protein exhibits a degree
of purity close to or
greater than 80%, as may be determined by SDS PAGE electrophoresis followed by
coomassie
blue staining. An additional chromatography step may be added in order to
finish the
polypeptide ; by way of example, mention may be made of gel filtration and
reverse-phase
chromatography.
- The polypeptide according to the invention may thus be obtained in purified
form, i.e. in
a form exhibiting a degree of purity of at least 80%. The degree of purity is
defined relative to
the other proteins present in the mixture which are considered to be
contaminants. This degree
is evaluated by colorimetry of an SDS-PAGE using coomassie blue. Densitometric
measurement of the bands makes it possible to quantify the degree of purity.
The degree of
purity may also be measured by reverse-phase HPLC, by measuring the area of
the various
peaks.
In the context of the present invention, any expression vector conventionally
used for
the expression of a recombinant protein may be used to synthesize the
polypeptide. This term
therefore encompasses both "live" expression vectors, such as viruses and
bacteria, and
expression vectors of the plasmid type.
Use is preferably made of vectors in which the DNA sequence of the polypeptide
according to the invention is under the control of the strong promoter, which
may or may not be
CA 02485453 2004-11-02
7 _
inducicble. By way of example of a promoter which may be used, mention may be
made of the
T7 RNA polymerase promoter.
The expression vectors preferably include at least one selectable marker. Such
markers
include, for example, the dihydrofolate reductase gene or the neomycin
resistance gene for
culturing eukaryotic cells, and the kanamycin, tetracycline or ampicillin
resistance genes for
culturing in E. coli and other bacteria.
By way of example of an expression vector which may be used in the context of
the
present invention, mention may be made of the plasmid pET28 (Novagen) or pBAD
(Invitrogen), for example; viral vectors, such as: baculoviruses, poxviruses,
in particular the
poxviruses described in patents US 5,942,235, US 5,756,103 and US 5,990,091,
which are
entirely incorporated herein by way of reference, and recombinant vaccinia
viruses, in
particular the recombinant viruses described in patents EP 83286, US 5,494,807
and
US 5,762,938, into which the DNA sequence encoding a polypeptide according to
the invention
is cloned.
In order to promote the expression and purification of the polypeptide, the
latter may be
expressed in a modified form, such as a fusion protein, and may include not
only secretion
signals, but also additional heterologous functional regions. For example, a
region of additional
amino acids, particularly charged amino acids, may be added at the N-terminal
of the
polypeptide in order to improve stability and persistence in the host cell.
Advantageously, the
polypeptide according to the present invention is produced in the form of a
fusion peptide
comprising an additional sequence of formula (G)a-S-(H)b in which G represents
a glycine
residue, H represents a histidine residue, and preferably a is greater than or
equal to 4 and b is
greater than or equal to 6, linked, via an amide bond, to the NHS- or COOH-
terminal end of the
polypeptide. This sequence allows rapid purification of the polypeptide
according to the
invention by immunoaffinity.
Any host cell conventionally used in combination with the expression vectors
described
above may be used for expression of the polypeptide.
By way of nonlirniting examples, mention may be made of the cells of E. coli,
BL21
(IamdaDE3), HB101, Top 10, CAG 1139, Bacillus, and eukaryotic cells such as
CHO or Vero.
In the context of the present invention, use will preferably be made of the
following
expression vector/cell system: pET(Cer) BL21 LamdaDE3, or BL211amdaDE3(RIL).
CA 02485453 2004-11-02
Depending on the host cell used for expressing the polypeptide, the
polypeptides of the
present invention may be glycosylated or nonglycosylated. In addition, the
polypeptides
according to the invention may also include an additional methionine residue
at the N-terminal.
A subject of the present invention is also the conjugates comprising a
polypeptide
according to the invention and a carrier protein or a carrier peptide.
The carrier protein (or peptide) strengthens the immunogenicity of the
polypeptide
according to the invention, in particular by increasing the production of
specific antibodies.
Said carrier protein (or peptide) preferably comprises one or more T helper
epitope(s). The term
"T helper epitope" is intended to mean a chain of amino acids which, in the
context of one or
IO more class II MHC molecules, activates T helper lymphocytes. According to
an advantageous
embodiment, the carrier protein (or peptide) used improves the water-
solubility of the
polypeptide according to the invention.
As carrier protein, use may be made, for example, of phage surface proteins,
such as the
pIII or pVIII proteins of the M13 phage, bacterial surface proteins, such as
the Lama, OmpC,
IS ompA, ompF and PhoE proteins of E. coli, the CotC or CotD protein of B.
subtilis, bacterial
porins, such as Neisseria gonorrheae porin P 1, H. influenzae B porin P 1 or
P2, N. meningitidis
B class I porin or K. pneumoniae porin P40, lipoproteins, such as B. bugdorfi
OspA,
S. pneumoniae PspA, N. meningitidis B TBP2, E. coli TraT and also S.
pneumoniae adhesin A,
and the heat shock proteins, such as Hsp65 or Hsp71 of M. tuberculosis or
bovis, or Hin 47 of
20 H. influenzae type B. Detoxified bacterial toxins, such as tetanus or
diphtheria toxoid, the
cholera toxin B subunit, the cholera toxin B subunit, or the B subunit of P.
aeruginosa
endotoxin A or S. aureus exotoxin A, are also particularly suitable in the
context of the present
invention.
In the context of the present invention, as a carrier peptide, use may be
made, for
25 example, of the p24E, p24N, p24H and p24M peptides described in WO 94/29339
and also the
PADRE peptides as described by Del guercio et aI. (Vaccine (1997); Vol. 15/4,
p. 441-448).
The carrier protein (or peptide) is linked to the N- or C-terminal end of the
polypeptide
according to the invention using any conjugation method well known to those
skilled in the art.
In addition, the sequence encoding the Garner protein (or peptide) may
advantageously be fused
30 to the sequence encoding the polypeptide according to the invention, and
the resulting sequence
may be expressed in the form of a fusion protein using any conventional
method. AlI the
genetic engineering techniques which are useful for doing this are described
in Maniatis et aI.
CA 02485453 2004-11-02
_ 9 _
Said conjugates may be isolated using any conventional purification method
well known to
those skilled in the art.
A subject of the present invention is also the DNA sequences encoding the
polypeptides
and the conjugates according to the invention, and also the expression vectors
comprising said
sequences and the host cells transformed with said vectors. The DNA sequences
encoding the
polypeptides according to the invention can be easily produced by PCR using,
as a matrix, the
nucleotide sequence of a gp41 protein.
Rather than extracting and purifying the polypeptide or the conjugate
expressed by the
expression vector, it is often easier and sometimes more advantageous to use
the expression
vector itself in the vaccine according to the invention. A subject of the
present invention is
therefore any expression vector as defined above. In such a situation, the
expression vector
lacks a marker and preferably corresponds to a viral vector, in particular a
poxvirus, such as
ALVAC or NYVAC. Such a vectoz may also contain at least one other sequence
encoding an
HIV antigen. By way of example, mention may be made of the HIV antigen
sequences which
are conventionally used in the vectors described in patents US 5,942,235, US
5,756,103 and
US 5,762,938.
The expression vector according to the invention preferably comprises a
sequence
encoding a polypeptide of formula N-L-C as defined above, also comprising a
sequence
comprising the epitope ERDRD as defined above, which is linked to the N- or C-
terminal end
of said polypeptide. According to a particularly preferred embodiment, the
expression vector
comprises a sequence encoding the polypeptide of formula: AA25-AA157-
GGRERDRDRSGGGGS.
Any host cell as defined above transformed with such an expression vector is
also
included in the context of the present invention.
A subject of the present invention is also the antibodies directed against the
polypeptides
and conjugates as described above. The preparation of such antibodies is
carried out using
conventional techniques for producing polyclonal and monoclonal antibodies,
well known to
those skilled in the art.
These antibodies are particularly suitable for use in a passive immunization
scheme.
A subject of the present invention is also pharmaceutical compositions which
can be
used for the purposes of therapeutic and prophylactic immunization against HIV-
related
infection. The compositions according to the present invention comprise at
least one
polypeptide, at least one conjugate or at least one expression vector as
defined above, in an
CA 02485453 2004-11-02
- 10 -
amount suitable to induce a specific humoral response, a pharmaceutically
acceptable excipient
or diluent and, optionally, an adjuvant.
The amount of polypeptide, of conjugate or of vector in the composition
according to
the present invention depends on many parameters, as will be understood by
those skilled in the
art, such as the nature of the carrier protein, the vector used or the route
of administration. A
suitable amount is an amount such that a specific humoral immune response is
induced after
administration of said composition. The amount of polypeptide to be
administered is of the
order of 10 ~,g to 5 mg, the amount selected varying depending on the route of
administration.
The amount of conjugate to be administered will be deduced from the amounts
indicated above,
taking into account the MW of the tamer protein. The amount of expression
vector to be
administered is of the order of 10 to S 000 ~,g in the case of a nonviral
vector, and of the order
of 10E4 to l Or8 TC)1750 in the case of a viral vector.
The pharmaceutical compositions according to the present invention may also
contain
an adjuvant. Any pharmaceutically acceptable adjuvant or mixture of adjuvants
conventionally
used in the field of vaccines may be used for this purpose. By way of suitable
adjuvants,
mention may be made of aluminum salts, such as aluminum hydroxide or aluminum
phosphate,
and DC-Chol. Conventional auxiliary agents, such as wetting agents, fillers,
emulsifiers,
buffers, etc., may also be added to the composition according to the
invention.
The compositions according to the present invention may be prepared using any
conventional method known to those skilled in the art. Conventionally, the
antigens according
to the invention (i.e. polypeptide, conjugate or vector) are mixed with a
pharmaceutically
acceptable excipient or diluent, such as water or phosphate-buffered saline
solution. The
excipient or diluent will be selected as a function of the pharmaceutical form
chosen, of the
method and route of administration, and also of pharmaceutical practice.
Suitable excipients or
diluents, and also the requirements in terms of pharmaceutical formulation,
are described in
detail in Remington's Pharmaceutical Sciences, which represents a reference
work in this field.
The compositions mentioned above may be administered by any conventional route
usually used in the field of vaccines, such as the parenteral (intramuscular,
subcutaneous, etc.)
route. In the context of the present invention, intramuscular administration
will preferably be
used for the injectable compositions. Such an administration may
advantageously take place in
the thigh or arm muscles. The compositions according to the present invention
may also
advantageously be administered orally.
CA 02485453 2004-11-02
- 11 -
In fact, the Applicant has demonstrated that the polypeptide according to the
invention is
very stable in strongly acid medium (pH < or = to 3). This property makes the
polypeptide
according to the invention an immunization antigen of choice for oral
administration. In this
case, it is possible to administer the polypeptide in the form of a solution
having a pH < or =
to 3 which may or may not contain an adjuvant. In the case of the polypeptides
comprising an L
sequence which is weakly hydrophobic in nature or hydrophilic in nature, a
higher pH may be
used. The Applicant has, in fact, shown that stability of the forms comprising
loops which are
more hydrophilic is obtained over a wider pH range. The polypeptides
comprising such loops
may therefore advantageously be used for parenteral administration.
Administration via the
nasal, vaginal or rectal mucosa may also be recommended in the context of the
present
invention. The administration may also be carried out by giving a single dose
or repeated doses,
for example on DO and at 1 month, 3 months, 6 months and 12 months. Injections
on DO and at
1 month and 3 months, with a booster, the periodicity of which may be easily
determined by the
treating physician, will preferably be used.
The pharmaceutical composition according to the present invention may
advantageously
be administered according to a dosage scheme comprising the co-administration
of an
expression vector according to the invention and of a polypeptide according to
the invention, or
according to a "prime-boost" scheme in which the vector according to the
invention is
administered first and the polypeptide is administered as a booster injection.
In these two
dosage schemes, the expression vector according to the invention may be
replaced with any
expression vector expressing one or more HN antigens or epitopes which are
different from the
polypeptide according to the invention, and in particular with a poxvirus,
preferably ALVAC or
NYVAC. By way of example of ALVAC and NYVAC vectors which can be used for this
purpose, mention may be made of the vectors described in patents US 5,942,235,
US 5,756,103
and US 5,990,091; EP 83286, US 5,494,807 and US 5,762,938. In the context of
the
compositions which can be administered orally, use may also advantageously be
made of
bacterial vectors, such as lactobacillus or salmonella, expressing the
polypeptide according to
the invention and/or other HN antigens, such as those conventionally used in
the poxviruses
described in the US patents above. The use of these bacterial vectors for
immunization purposes
is described in detail in International Journal of Food Microbiology 41 (1998)
155-167 by
P.H. Pouwels et al. and Cell Vol. 91, 765-775, Dec., 1997 by A. Darji et al.,
to which reference
may be made for greater detail.
CA 02485453 2004-11-02
- 12 -
The present invention is also intended to cover a polypeptide, a conjugate or
a vector as
described above, and the pharmaceutical composition containing these
compounds, for their use
as a medicinal product, in particular for inducing specific neutralizing
antibodies in a mammal.
Since the antibodies induced have the property of neutralizing HIV primary
isolates, the
polypeptide according to the invention is therefore an antigen of interest for
the prophylactic
and therapeutic immunization of the human body against HN-related infection.
The present invention therefore relates to a method for inducing specific
neutralizing
antibodies in a mammal, preferably humans, comprising administration of a
pharmaceutical
composition as defined above and induction of said specific humoral response.
The expression "a specific humoral response" is intended to mean a response
comprising the production of antibodies directed specif cally against the
polypeptide according
to the invention. The specific humoral response comprises the production of
specific IgAs when
the composition according to the invention is administered mucosally. The
production of
specific antibodies may be easily determined using conventional techniques
well known to
those skilled in the art, such as ELISA, RIA or Western blotting. The
antibodies induced by the
polypeptide according to the invention are capable of neutralizing many HIV
primary isolates.
This property may be determined using the neutralization test of C. Moog or of
D. Montefiori.
The Applicant has demonstrated, surprisingly, that the polypeptide according
to the
invention is capable, after administration, of inducing antibodies capable of
neutralizing HIV
primary isolates. Said polypeptide therefore represents a valuable candidate
for developing a
vaccine which can be used for protecting and/or treating a large number of
individuals at risk
from or infected with HN.
A subject of the invention is also a diagnostic method, comprising bringing a
polypeptide according to the invention into contact with a biological sample
and detecting the
antibody/polypeptide complexes which are formed. HIV+ individuals in fact have
anti-gp41
serum antibodies. An immunoassay (such as an ELISA assay in which the
polypeptide
according to the invention is attached to the assay plate and then brought
into contact with the
serum to be tested, and the antibody/polypeptide complexes are then detected
by colorimetry
using a labeled second antibody) would therefore make it possible to diagnose
infected
individuals.
The present invention will be described in greater detail in the following
examples,
which are given purely by way of illustration of the invention and can in no
way be considered
to limit the scope of the latter.
CA 02485453 2004-11-02
- 13 -
Examine 1: Purification of the pol~peQtide according to the invention
Clo, nine:
The DNA sequence encoding the polypeptide SEQ ID No.4 was cloned in an
inducible
expression system.
The vector used is Pet-cer, which is constructed using the vector pET28 from
Novagen. The
commercial vector pET28c was amplified by PCR using 2 primers located on
either side of the
region corresponding to the F1 origin, such that the amplified product
corresponds to virtually
the entire vector of origin, minus the region comprising the F1 origin. The
unique AscI and PacI
restriction sites are provided, respectively, by the two primers which were
used for the
amplification. In parallel, the cer fragment is amplified using 2 primers
which make it possible
to obtain this fragment bordered by the AscI and PacI sites.
Vector and Cer fragment are digested with the Ascl and PacI enzymes and then
ligated to one
another.
This vector in particular comprises an expression cassette under the control
of the T7 promoter,
a polylinker downstream of the T7 promoter for cloning the gene of interest,
the CER fragment
located downstream of the polylinker, making it possible to decrease
multimerization of the
plasmids, a T7 term transcription terminator and the kanamycin resistance
gene.
Positive regulation of the promoter is obtained in the presence of T7 RNA
polymerase.
An approximately 0.5 Kb DNA fragment containing the sequence encoding the
sequence SEQ ID No.3 is obtained by PCR using a plasmid containing the
sequence encoding
the HIV-1 LAI gp160.
The BspHI and XhoI restriction sites, used for the cloning, are respectively
provided by the 5'
5' (5' gp41 SPF BspHI ) and 3' (3'gp4ITMBR/HSX) PCR primers. The 3' primer
also contains
the sequences encoding the polyhistidine chain and the flexible linkage which
connects it to the
polypeptide.
The PCR-amplified fragment was digested with the BspHI and XhoI enzymes and
inserted into
the expression vector digested with NcoI and XhoI (the NcoI and BspHI sites
produce
compatible protruding 5' ends after digestion).
The PCR amplification conditions are as follows: 97°C/30 s;
55°C/1 min; 72°C/50 s; Taq DNA
polymerase - 25 cycles.
5' primer: 5' ....TCATGACGCTGACGGTACAGGCC 3'
CA 02485453 2004-11-02
- 14 -
3' primer: 5' CCGCTCGAGCTAATGGTGATGGTGATGGTGTGACCCTCCCCCTCC
ACTTGCCCATTTATCTAA3'
The BspHI and XhoI restriction sites are indicated in italics, the initiation
codon ATG and
termination codon TAG (complementary strand) are underlined and in bold
characters.
The construct was characterized by restriction mapping and sequencing the S'
and 3' junctions
and also all of the inserted fragment.
Tests for expression under conventional conditions made it possible to obtain
and visualize,
both after staining with Coomassie blue and Western blotting analysis using an
anti
polyhistidine antibody, a product having an apparent molecular weight in
accordance with the
expected result.
Expression and purif cation:
The plasmid thus obtained is expressed in E. coli BL21 lambda DE3. The E, coli
cells
are transformed with approximately 1 ng of plasmid. The culturing of E. coli
BL21 DE 3
expressing the polypeptide is carried out in TB medium in the presence of
kanamycin (25 ~,g/ml
final concentration) with induction lasting 4 hours at 37°C, which
begins by adding 1mM of
IPTG when the OD is approximately 0.9.
Expression of the polypeptide produces approximately 30 mg of purified
polypeptide/l of
culture.
The bacteria are ruptured by sonication (4X2 min), avoiding heating the
bacterial extracts. The
polypeptide is then in the form of inclusion bodies. These inclusion bodies
are recovered by
centrifugation (for 30 min at 10 000 g, at 4°C), and are then
solubilized in a 50 mM Tris buffer
at pH 8 containing 6M urea and 500 mM NaCl. The solution is filtered through a
filter with a
0.45 ~Cm porosity (Milex HV, Millipore) before chromatography on a nickel-
sepharose column
(Hi-trap, Pharmacia). The polypeptide is loaded onto the column in the
presence of 10 mM
imidazole in the Tris-Urea buffer. The column is washed under the same
conditions, and the
purified polypeptide is then eluted by injecting a 0.5 M solution of imidazole
in the same
buffer. The polypeptide is then dialyzed into a 50 mM formate buffer at pH 2.5
before
chromatography on a reverse-phase column by HPLC, the role of which is to
remove residual
endotoxins.
After the polypeptide has been loaded, a gradient of 20 to 80% of acetonitrile
containing 0.1%
of TFA circulates through the semi-preparative column (214TP510, Vydac). The
polypeptide is
eluted between 40 and 60% of acetonitrile. The solvents are then removed by
evaporation under
CA 02485453 2004-11-02
- 15 -
a vacuum, and then by dialysis into a formate buffer at pH 2.5. The endotoxins
are completely
removed from the polypeptide obtained, the degree of purity of which is
greater than 80%. It is
stored at -45°C.
Example 2: Determination of the humoral immunity after parenteral
administration
The polypeptide SEQ m No.4 was tested in guinea pigs, in rabbits and in
Cynomolgus
monkeys according to the protocols described below.
Guinea yies: Groups of 5 guinea pigs were injected 3 times, at 3-week
intervals, in the
thighs (biceps femoris muscle) with 20 p,g per dose of antigen. Upon each
injection, the
animals received 0.5 ml of the formulation (0.25 ml in each thigh).
Serum samples were taken from the animals in order to analyze the antibodies
before
immunization, and 3 and 2 weeks after the 2"d and 3rd immunizations,
respectively.
The three compositions tested: antigen + alum (aluminum phosphate, 6 mg per
dose);
antigen + alginate; and antigen in arginine buffer + alginate were prepared in
the following
way:
a- For the formulations adjuvanted with aluminum phosphate: the antigen is in
50 mM
formate medium, pH 2.5. The formulations are obtained by adding the alum to
the
antigen composition and incubating with gentle agitation for 30 minutes. The
mixture is
then centrifuged (5 minutes at 3 000 rpm), the supernatant being removed and
replaced
with PBS buffer so as to obtain a final concentration of 500 p,l/dose.
Resuspension is
carried out using an ultrasound bath.
b- For the formulation in alginate: the antigen is in 50 mM formate medium, pH
2.5. A
filtered 1% solution of alginate (LVM grade, PRONOVA) in PBS buffer is added
to
this so as to be at 1.4:1 (vol. antigen/vol. alginate). After incubation at
ambient
temperature (5 minutes), the volume of the mixture is made up with a solution
of
Tween 80, 0.67% by weight in PBS buffer, so as to obtain a final concentration
of
50 ~,l/dose. Homogenization is carried out by slight vortexing.
c- For the formulation in arginine + alginate: the antigen is in a medium of 1
M arginine
and PBS, pH 7.4. The preparation is the same as described in b-, with use, in
this case,
of a 2.75:1 (vol. antigen: vol. alginate) ratio.
CA 02485453 2004-11-02
- 16 -
Rabbits: Groups of 2 rabbits were injected 3 times, at 3-week intervals, in
the thighs with
40 ICg per dose of antigen. Upon each injection, the animals received 1 ml of
the
formulation.
Serum samples were taken from the animals in order to analyze the antibodies
before
immunization, and then 3 and 2 weeks after the 2°d and 3'~
immunizations, respectively.
d- The composition tested here: antigen + alum (aluminum phosphate, 6 mg per
dose) was
prepared in the following way: aluminum phosphate is added to the antigen in
50 mM
formate medium, pH 2.5, the entire mixture being incubated for 30 minutes at
+4°C
with gentle agitation (turning wheel). The tubes containing these preparations
are then
centrifuged (5 minutes at 3 000 rpm), the supernatant being removed and
replaced with
PBS buffer so as to obtain a final concentration of 1 ml/dose. Resuspension is
carried
out using an ultrasound bath.
Rhesus monkeys ,~macaca~ascicularis): Groups of 2 monkeys were injected 3
times, at
1-month intervals, in the thighs (rectus femoris muscle) with I00 ~.g per dose
of antigen
adsorbed onto 6 ml of alum (aluminum phosphate). Upon each injection, the
animals
received I ml of the formulation.
Serum samples were taken from the animals in order to analyze the antibodies
before
immunization, and then 4 and 2 weeks after the 2"d and 3'd immunizations,
respectively.
The composition tested here: antigen + alum was prepared in the following way:
aluminum
phosphate is added to the antigen in 50 mM formate medium, pH 2.5, the entire
mixture
being incubated for 30 minutes at 4°C with gentle agitation (turning
wheel). The tubes
containing these preparations are then centrifuged (5 minutes at 3 000 rpm),
the supernatant
being removed and replaced with PBS buffer so as to obtain a final
concentration of
1 ml/dose. Resuspension is carried out using an ultrasound bath.
The results are given in the tables below:
As shown in table 1, the polypeptide induces significant, homogeneous and
specific ELISA
antibody levels against the polypeptide according to the invention and gp160
MN/LAI-2
(hybrid glycoprotein in which the gp120 subunit derives from the HIV-1 MN
isolate and the
gp41 subunit derives from the HN-1 LAI isolate). These IgG responses virtually
reach a
CA 02485453 2004-11-02
- 17 -
plateau as soon as the 2nd injection (table 1). The formulation in alginate
appears to be 10 times
less effective, in terms of specific antibody levels induced, than the
formulation in alum.
Table 1- Guinea pig test - Antibody responses by ELISA
Anti-SEQ ID Anti-gp160
No.4 IgG MN/LAI-2
IgG
Immunogen post-2* IgG Post-3* IgG Post-2* IgG Post-3* IgG
titers titers titers titers
(logio) (iogio) (logio) (logio)
(number of (number of (number of (number of
positives) positives)) positives) positives)
polypeptide5.4 + 0.1 5.5 + 0.2 5.1 + 0.2 5.6 + 0.2
(alum) (S+l5) (5+/5) (S+/5) (5+l5)
polypeptide4.5 + 0.2 4.6 + 0.1 4.1 + 0.3 4.4 + 0.3
(alginate)(5+l5) (5+/5) (5+/5) (5+lS)
polypeptide4.3 + 0.2 4.7 + 0.2 3.8 + 0.3 4.3 + 0.2
(PBS arginine(5+/5) (S+/5) (S+l5) (5+l5)
/alginate)
* Geometric mean + standard deviation (loglo)
NB: All the preimmune sera tested are below the detection threshold (i.e. 1.9
loglo for the anti-
gp160 ELISA and 1.0 logo for the anti-polypeptide ELISA).
The neutralizing activity of the post-3rd immunization sera was then evaluated
initially with
respect to the HIV-1 MN laboratory strain, on individual sera (at the DC
Montefiori laboratory).
As shown by the results obtained, no neutralization of the MN strain was
observed.
The neutralizing activity of the post-3 sera was also evaluated with respect
to primary HIV-1
strains (laboratories of C. Moog and of D. Montefiori) (table 2). The analysis
was carried out on
individual sera. Advantageously, contrary to that which was observed for the
MN strain, the
guinea pigs showed significant neutralizing activities against several of the
viral strains tested.
CA 02485453 2004-11-02
- 28 -
Table 2 - Guinea pig test - Anti-HIV-1 neutralizing antibody responses
LaboratoryPrimary
isolates
Immunogen strain
MN Bal SF162 5768 Pavo Bx08~ Bxl7o
between97% between betweenbetween between
polypeptide
< 20 90% 94% 96% 8 and 8 and
and 16 IO
(alum)
98% and and
99% 99%
polypeptide
(PBS NT _ NT NT NT NT 4 NT
argininel
alginate)
~ Lab. D. Montefiori: Results given for the post-3 sera (arithmetic value or
%)
o Lab. C. Moog: Results given for the post-3 sera (arithmetic value)
NT: -Not tested
NB: All the preimmune sera tested are below the positivity threshold (i.e.,
depending on the
methods: < 20 for the HIV-1 MN strain and < 80% or < 4 for the primary
isolates).
CA 02485453 2004-11-02
- 19 -
Table 3 - Rabbit test - ELISA antibody responses
Anti-SEQ ID No.4
IgG
I
mmunogen -
Post-2* IgG titers Post-3* IgG titers
(loglo) (loglo)
(number of positives)(number of positives)
Polypeptide (in 4.9 + 0.04 5.1 + 0.1
alum)
(2+/2) (2+/2)
Table 4 - Monkey test - ELISA antibody responses
Anti-SEQ ID No. 4
IgG
I
mmunogen
Post-2* IgG titers Post-3* IgG titers
(loglo) (loglo)
(number ofpositives)(number ofpositives)
Polypeptide (in 5.3 0.4 5.6 0.1
alum)
(2+/2) (2+/2)
NB: The preimmune sera tested prove to be below the positivity threshold (1.0
loglo).
The results given above clearly show that the polypeptide according to the
invention is capable
of inducing significant specific ELISA antibody levels in all the animal
species tested. These
IgG responses increased slightly between the 2"d and 3Td injection.
These antibodies, which have the property of neutralizing primary isolates,
make the
polypeptide according to the invention a valuable candidate for immunization
in humans.
Example 3 ~ Determination of the humoral immuno~enicity of the t~olyneptide
according to the
invention administered mucosally
The polypeptide SEQ 117 No.4 was tested in BALB/c mice according to the
protocol described
below.
CA 02485453 2004-11-02
- 20 -
r BALB/c mice: Groups of 6 to 7 mice were administered intrabuccally or
intragastrically
3 times, at 2-week intervals, and once 1 month later, with 50 ~,g per dose of
antigen alone or
formulated with 5 pg of cholera toxin (CT). gp160 MN/LAI-2 was added as a
control,
formulated with 5 ~,g of cholera toxin (CT). On each administration, the
animals received
either 20 ~1, for the intrabuccal administration, or 50 ~1, for the
intragastric administration,
of the formulation.
The compositions tested were prepared in the following way: for the gp160
antigen: the
required volume of a solution of CT at 2 mg/ml in H20, to which PBS buffer is
added so as
to have the final concentration of 20 or 500 ~.1/dose, is added. The antigen
SEQ ID No.4, in
50 mM formate medium, pH 2.5, is first diluted in 50 mM formate and then a
solution of
CT at 2 mg/ml in Hz0 is added to it so as to have the final concentration of
20 or
500 ~cl/dose.
Serum samples and vaginal secretion samples were taken from the animals in
order to
analyze the antibodies before immunization, and then 2 weeks after the 4th
immunization.
The IgG and IgA responses induced in the vaginal secretions, specific for the
polypeptide, were
evaluated by ELISA and normalized, respectively, with the total IgGs and IgAs
contained in
these mucosal samples. The IgG antibody responses specific for the
polypeptide, induced in the
sera, were also evaluated by ELISA.
As shown in table 5 below, the polypeptide according to the invention induced
specific serum
IgG responses after gastric or buccal administration. For these 2 routes, the
antibody titers are
approximately 10 times greater when the polypeptide is administered in the
presence of CT,
compared to antigen alone. However, it is interesting to note that, even in
the absence of CT, a
significant humoral response is induced by the polypeptide. The buccal route
proved, overall, to
be more immunogenic than the gastric route. Contrary to the polypeptide, gp160
MNLAI-2, in
the presence of CT, induced no or virtually no antibodies against the various
antigens tested
(polypeptide, gp120 MN [produced by Agmed] and V3 MN), this being whatever the
route of
immunization.
Table 5 - Mouse test - ELISA antibody responses in the sera
CA 02485453 2004-11-02
- 21 -
Anti-Seq ID Anti-gp120 Anti-V3 MN IgG
No.4 MN
Immunization IgG IgG
route Immunogen Post4* IgG Post-4* IgG Post-4* IgG
titers titers titers
(logio) (logio) (logio)
(number of (number of (number of
positives) positives) positives)
gp160 1.5l.l 2.71.4 1.30.7
MN/LAI-2 (1 +/5) (2+/5) (I +/S)
(+ CT)
Gastric polypeptide2.2 + 1.2 NT NT
(5+/6)
polypeptide3.5 + 0.9 NT NT
(+ CT) (7+l7)
gp160 1.0+0.0 1.9+1.9 1.0+1.0
MN/LAI-2 (0+l4) (0+/4) (0+l4)
(+ CT)
Buccal polypeptide2.9 + 1.1 NT NT
((+/7)
polypeptide4.0 + 0.7 NT NT
(+ CT) (7+l7)
* Geometric mean + standard deviation (loglo); NT: Not tested
NB: All the preimmune sera tested are below the detection threshold (i.e. 1.9
loglo for the anti-
gp120 ELISA and 1.0 logio for the anti-polypeptide and anti-V3 ELISAs).
As shown in table 6 below, the polypeptide according to the invention provoked
specific IgA
and/or IgG responses in the mucosal secretions tested.
In terms of the vaginal secretions, the polypeptide administered either
buccally or gastrically
was capable, with or with CT, of provoking IgA and IgG responses, the
responses being,
however, more frequent in the presence of CT. It may be noted that the gp160
MN/LAI-2 + CT
provoked no or very few mucosal responses, as observed in the serum.
CA 02485453 2004-11-02
- 22 -
Table 6 - Mouse test - ELISA antibody responses in the mucosal secretions
Vaginal secretions
ImmunizationImmunogen Anti-polypeptide Anti-polypeptide
route IgAltotal IgA ratio*IgGltotal IgG
ratio*
(number of positives)(number of positives)
gp 160 MN/LAI-20.6 + 1. 2 0.2 + 0. 4
(+ CT) (1 +lS) (1 +l5)
polypeptide 3.7 + 7.4 2.8 + 5.2
Gastric (6+/7) (2+/7)
polypeptide 5.8+ 5.8 8.3 + 9.3
(+ CT) (6+l7) (6+l7)
gp160 MN/LAI-2 0.0 + 0.0 0.0 + 0.0
(+ CT) (D+l4) (0+l4)
Buccal polypeptide 1.3 + 1.5 1.2 + 2.9
(4+/7) (2+/7)
polypeptide 14.5 + 14.5 7.2 + 10.2
(+ CT) (7+l7) (4+l7)
* Mean of the ratios of the mice of each group X 103, the ratio being defined
as the anti-
polypeptide IgG or IgA titer (in arbitrary units) divided by the total IgG or
IgA titer (in ng/mI),
respectively.
The examples above show that the polypeptide according to the invention is
capable of
inducing, in all the animal species tested, after parenteral administration,
significant specific
serum IgG responses against the polypeptide and the gp160 MN/LAI-2. The
antibodies induced
have activity capable of neutralizing several HIV primary isolates.
The examples above also show that the polypeptide according to the invention
is capable of
inducing, after mucosal administration, serum IgG antibodies and mucosal IgG
and IgA
antibodies in vaginal secretions.
Example 4: Determination of the humoral immuno~enicity of plasmid DNA vectors
encodin a
polypeptide according to the invention administered intramuscular~
CA 02485453 2004-11-02
- 23 -
Four different plasmids were prepared and tested in order to determine their
immunogenicity.
These plasmids are:
PCA TPA gp41 PK (antigen tested from the N- to the C-terminal: AA1-AAI57-
GGRERDRDRSGGGGS)
PCA TPA gp41 SPF PK (antigen tested from the N- to the C- terminal: AA25-AA157-
GGRERDRDRSGGGGS)
PCA TPA gp41 (antigen tested from the N- to the C- terminal: AA1-AA157)
PCA TPA gp41 SPF (antigen tested from the N- to the C- terminal: AA25-AA157)
with TPA for: human tPA signal sequence, SPF for: without fusion peptide, PK
for: the
Kennedy neutralizing epitope, i.e. ERDRD, located in the intracytoplasmic
portion of gp41 at
position 746-750, within the "Kennedy peptide" sequence located between
residues 731-752
(Kennedy et al., 1986, Science, 231: 1556-59; (Vella et al., 1993, J. General
Virology, 74:
2603-07J.
The sequences encoding the polypeptides tested were amplified by PCR and
cloned into a
derivative of the expression vector pCAMycHis (Invitrogen). The modified
vector used is
obtained by replacing the existing polylinker with a different "polylinker"
containing the XbaI
and BamHI restriction sites, into which is inserted the sequence encoding the
antigen tested.
The expression of the cloned gene is under the control of the CMV promoter.
The DNA is
prepared after transformation of an E. coli strain XL-1 blue. A 2-liter
culture (LB medium +
carbenicillin at 100 mg/ml) makes it possible to obtain approximately 10 mg of
plasmid. After
alkaline lysis, the plasmid is purified on a Qiagen column (Gigaprep)
according to the protocol
indicated by the supplier.
The immunogenicity of the constructs thus obtained is evaluated in guinea pigs
according to the
following protocol: groups of 5 guinea pigs were injected 4 times, at 1-month
intervals, in the
thighs (biceps femoris muscle) with 200 ~Cg per dose of plasmid. Upon each
injection, the
animals received 1 ml of the formulation (0.5 ml in each thigh).
Serurn samples were taken from the animals in order to analyze the antibodies
before
immunization, and then 1 month after the 4th immunization.
The results are given in the tables below:
CA 02485453 2004-11-02
- 24 -
As shown in table 7, the plasmid PCA TPA gp41 SPF PK proved to be the most
immunogenic,
capable of inducing significant levels of antibodies specific for the
polypeptide according to the
invention, also recognizing gp160 MN/LAI-2. The humoral responses induced by
the other
constructs tested proved to be weaker. These results indicate that the absence
of fusion peptide
and the addition of the neutralizing epitope of the Kennedy peptide both
appear to play an
important role in the humoral immunogenicity of the plasmid.
Table 7 - Guinea pig test - Antibody responses by ELISA
Anti-SEQ ID No.4 Anti-gp160 MNILAI-2
IgG IgG
Immuno
en
g
Post-4* IgG titers Post-4* IgG titers
(loglo) (loglo)
(number of positives)(number of positives)
PCA TPA gp41 PK 1.2 + 0.4 1.9 + 0.0
(1 +l5) (0+/5)
PCA TPA gp41 SPF 3.2 + 0. 6 3.4 + 0. 7
PK
(+/) (+/)
PCATPAgpI 1.0+0.0 1.9+0.0
(0+l5) (0+l5)
PCA TPA gpl SPF 1.2 + 0.5 NT
(1 +/5)
* Geometric mean + standard deviation (logto)
NB: All the preimmune sera tested are below the detection threshold (i.e. 1.9
logo for the anti-
gp160 ELISA and 1.0 logto for the anti-polypeptide ELISA).
The results of primary isolate neutralization indicated in table 8 below show
that the plasmid
PCA TPA gp41 SPF PK is the most effective in terms of neutralization, the best
results being
obtained with the constructs lacking the gp41 fusion peptide.
CA 02485453 2004-11-02
- 25 -
Table 8 - Guinea pig test - Anti-HIV-1 neutralizing antibody responses
Immunogen Bx08 Bxl7
PCA TPA gp41 PK 4 <4
PCA TPA gp41 SPF > 4 and < or 8
PK =16
PCA TPA gp41 S < 4
PCA TPA gp41 SPF > 4 and < 16 8
~ Lab. C. Moog: Results given for the post-3 sera (arithmetic value)
NT: Not tested.
CA 02485453 2004-11-02
WO 03/097676 PCT/FR03/01439
SEQUENCE LISTING
<110> AVENTIS PASTEUR
<120> Polypeptide antigen inducing HIV-neutralizing antibodies
<130> gp41-S30
<140> PM0201
<141> 2002-05-17
<160> 8
<170> PatentIn Ver. 2.1
<210> 1
<211> 57
<212> PRT
<213> Artificial sequence
<220>
<223> Artificial sequence description: N-helix
of HIV 1 LAI gp41
<400> 1
Thr Leu Thr Val Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln
1 5 20 15
Gln Asn Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln
20 25 30
Leu Thr Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Ile Leu Ala Val
35 40 45
Glu Arg Tyr Leu Lys Asp Gln Gln Leu
50 55
<210> 2
<211> 46
<212> PRT
<213> Artificial sequence
<220>
<223> Artificial sequence description:
C-helix of HIV 1 LAI gp41
<400> 2
Trp Asn Asn Met Thr Trp Met Glu Trp Asp Arg Glu Ile Asn Asn Tyr
1 5 10 15
Thr Ser Leu Ile His Ser Leu Ile Glu Glu Ser Gln Asn Gln Gln Glu
20 25 30
Lys Asn Glu Gln Glu Leu Leu Glu Leu Asp Lys Trp Ala Ser
35 40 45
<210> 3
<211> 103
<212> PRT
1
CA 02485453 2004-11-02
<213> Artificial sequence
<220>
<223> Artificial sequence description:
ectodomain of HIV 1 LAI gp41
<400> 3
Thr Leu Thr Val GIn Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln
1 5 10 15
Gln Asn Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln
20 25 30
Leu Thr Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Ile Leu Ala Val
35 40 45
Glu Arg Tyr Leu Lys Asp Gln Gln Leu Trp Asn Asn Met Thr Trp Met
50 55 60
Glu Trp Asp Arg Glu Ile Asn Asn Tyr Thr Ser Leu Ile His Ser Leu
65 70 75 80
Ile Glu Glu Ser Gln Asn Gln Gln Glu Lys Asn Glu Gln Glu Leu Leu
85 90 95
Glu Leu Asp Lys Trp Ala Ser
100
<210> 4
<211> 113
<212> PRT
<213> Artificial sequence
<220>
<223> Artificial sequence description:
gp4l polypeptide
<400> 4
Thr Leu Thr Val Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln
1 5 10 15
Gln Asn Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln
20 25 30
Leu Thr Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Ile Leu Ala Val
35 40 45
Glu Arg Tyr Leu Lys Asp Gln Gln Leu Trp Asn Asn Met Thr Trp Met
50 5S 60
Glu Trp Asp Arg Glu IIe Asn Asn Tyr Thr Ser Leu Ile His Ser Leu
65 70 75 80
Ile Glu Glu Ser Gln Asn Gln Gln Glu Lys Asn Glu Gln Glu Leu Leu
85 90 95
Glu Leu Asp Lys Trp Ala Ser Gly Gly Gly Gly Ser His His His His
100 105 110
His
2
CA 02485453 2004-11-02
<210> 5
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: 5' primer
<400> 5
tcatgacgct gacggtacag gcc 23
<210> 6
<211> 63
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: 3' primer
<400> 6
ccgctcgagc taatggtgat ggtgatggtg tgaccctccc cctccacttg cccatttatc 60
taa 63
<210> 7
<211> 5312
<222> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: plasmid Pet Cer
<400> 7
tggcgaatgc cttaattaag gcggggcaca actcaatttg cgggtactga ttaccgcagc 60
aaagacctta ccccgaaaaa atccaggctg ctggctgaca cgatttctgc ggtttatctc 120
gatggctacg agggcagaca gtaagtggat ttaccataat cccttaattg tacgcaccgc 180
taaaacgcgt tcagcgcgat cacggcagca gacaggtaaa aatggcaaca aaccacccga 240
aaaactgccg cgatcgcgcc tgataaattt taaccgtatg aatacctatg caaccagagg 300
gtacaggcca cattaccccc acttaatcca ctgaagctgc catttttcat ggtttcacca 360
tcccagcgaa gggccatcca gcgtgcgttc ctgtatttcc gactggcgcg ccattcaggt 420
ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca 480
aatatgtatc cgctcatgaa ttaattctta gaaaaactca tcgagcatca aatgaaactg 540
caatttattc atatcaggat tatcaatacc atatttttga aaaagccgtt tctgtaatga 600
aggagaaaac tcaccgaggc agttccatag gatggcaaga tcctggtatc ggtctgcgat 660
tccgactcgt ccaacatcaa tacaacctat taatttcccc tcgtcaaaaa taaggttatc 720
aagtgagaaa tcaccatgag tgacgactga atccggtgag aatggcaaaa gtttatgcat 780
ttctttccag acttgttcaa caggccagcc attacgctcg tcatcaaaat cactcgcatc 840
aaccaaaccg ttattcattc gtgattgcgc ctgagcgaga cgaaatacgc gatcgctgtt 900
aaaaggacaa ttacaaacag gaatcgaatg caaccggcgc aggaacactg ccagcgcatc 960
aacaatattt tcacctgaat caggatattc ttctaatacc tggaatgctg ttttcccggg 1020
gatcgcagtg gtgagtaacc atgcatcatc aggagtacgg ataaaatgct tgatggtcgg 1080
aagaggcata aattccgtca gccagtttag tctgaccatc tcatctgtaa catcattggc 1140
aacgctacct ttgccatgtt tcagaaacaa ctctggcgca tcgggcttcc catacaatcg 1200
atagattgtc gcacctgatt gcccgacatt atcgcgagcc catttatacc catataaatc 1260
agcatccatg ttggaattta atcgcggcct agagcaagac gtttcccgtt gaatatggct 2320
cataacaccc cttgtattac tgtttatgta agcagacagt tttattgttc atgaccaaaa 1380
tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat 1440
3
CA 02485453 2004-11-02
cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc 1500
taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg 1560
gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag ttaggccacc 1620
acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg 1680
ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg 1740
ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa 1800
cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg 1860
aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga 1920
gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct 1980
gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca 2040
gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac atgttctttc 2100
ctgcgttatc ccctgattct gtgggtaacc gtattaccgc ctttgagtga gctgataccg 2160
ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc 2220
tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcaat ggtgcactct 2280
cagtacaatc tgctctgatg ccgcatagtt aagccagtat acactccgct atcgctacgt 2340
gactgggtca tggctgcgcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct 2400
tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt 2460
cagaggtttt caccgtcatc accgaaacgc gcgaggcagc tgcggtaaag ctcatcagcg 2520
tggtcgtgaa gcgattcaca gatgtctgcc tgttcatccg cgtccagctc gttgagtttc 2580
tccagaagcg ttaatgtctg gcttctgata aagcgggcca tgttaagggc ggttttttcc 2640
tgtttggtca ctgatgcctc cgtgtaaggg ggatttctgt tcatgggggt aatgataccg 2700
atgaaacgag agaggatgct cacgatacgg gttactgatg atgaacatgc ccggttactg 2760
gaacgttgtg agggtaaaca actggcggta tggatgcggc gggaccagag aaaaatcact 2820
cagggtcaat gccagcgctt cgttaataca gatgtaggtg ttccacaggg tagccagcag 2880
catcctgcga tgcagatccg gaacataatg gtgcagggcg ctgacttccg cgtttccaga 2940
ctttacgaaa cacggaaacc gaagaccatt catgttgttg ctcaggtcgc agacgttttg 3000
cagcagcagt cgcttcacgt tcgctcgcgt atcggtgatt cattctgcta accagtaagg 3060
caaccccgcc agcctagccg ggtcctcaac gacaggagca cgatcatgcg cacccgtggg 3120
gccgccatgc cggcgataat ggcctgcttc tcgccgaaac gtttggtggc gggaccagtg 3180
acgaaggctt gagcgagggc gtgcaagatt ccgaataccg caagcgacag gccgatcatc 3240
gtcgcgctcc agcgaaagcg gtcctcgccg aaaatgaccc agagcgctgc cggcacctgt 3300
cctacgagtt gcatgataaa gaagacagtc ataagtgcgg cgacgatagt catgccccgc 3360
gcccaccgga aggagctgac tgggttgaag gctctcaagg gcatcggtcg agatcccggt 3420
gcctaatgag tgagctaact tacattaatt gcgttgcgct cactgcccgc tttccagtcg 3480
ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg 3540
cgtattgggc gccagggtgg tttttctttt caccagtgag acgggcaaca gctgattgcc 3600
cttcaccgcc tggccctgag agagttgcag caagcggtcc acgctggttt gccccagcag 3660
gcgaaaatcc tgtttgatgg tggttaacgg cgggatataa catgagctgt cttcggtatc 3720
gtcgtatccc actaccgaga tatccgcacc aacgcgcagc ccggactcgg taatggcgcg 3780
cattgcgccc agcgccatct gatcgttggc aaccagcatc gcagtgggaa cgatgccctc 3840
attcagcatt tgcatggttt gttgaaaacc ggacatggca ctccagtcgc cttcccgttc 3900
cgctatcggc tgaatttgat tgcgagtgag atatttatgc cagccagcca gacgcagacg 3960
cgccgagaca gaacttaatg ggcccgctaa cagcgcgatt tgctggtgac ccaatgcgac 4020
cagatgctcc acgcccagtc gcgtaccgtc ttcatgggag aaaataatac tgttgatggg 4080
tgtctggtca gagacatcaa gaaataacgc cggaacatta gtgcaggcag cttccacagc 4140
aatggcatcc tggtcatcca gcggatagtt aatgatcagc ccactgacgc gttgcgcgag 4200
aagattgtgc accgccgctt tacaggcttc gacgccgctt cgttctacca tcgacaccac 4260
cacgctggca cccagttgat cggcgcgaga tttaatcgcc gcgacaattt gcgacggcgc 4320
gtgcagggcc agactggagg tggcaacgcc aatcagcaac gactgtttgc ccgccagttg 438D
ttgtgccacg cggttgggaa tgtaattcag ctccgccatc gccgcttcca ctttttcccg 4440
cgttttcgca gaaacgtggc tggcctggtt caccacgcgg gaaacggtct gataagagac 4500
accggcatac tctgcgacat cgtataacgt tactggtttc acattcacca ccctgaattg 4560
actctcttcc gggcgctatc atgccatacc gcgaaaggtt ttgcgccatt cgatggtgtc 4620
cgggatctcg acgctctccc ttatgcgact cctgcattag gaagcagccc agtagtaggt 4680
tgaggccgtt gagcaccgcc gccgcaagga atggtgcatg caaggagatg gcgcccaaca 4740
gtcccccggc cacggggcct gccaccatac ccacgccgaa acaagcgctc atgagcccga 4800
agtggcgagc ccgatcttcc ccatcggtga tgtcggcgat ataggcgcca gcaaccgcac 4860
ctgtggcgcc ggtgatgccg gccacgatgc gtccggcgta gaggatcgag atctcgatcc 4920
cgcgaaatta atacgactca ctatagggga attgtgagcg gataacaatt cccctctaga 4980
aataattttg tttaacttta agaaggagat ataccatggg cagcagccat catcatcatc 5040
atcacagcag cggcctggtg ccgcgcggca gccatatggc tagcatgact ggtggacagc 5100
4
CA 02485453 2004-11-02
aaatgggtcg gatccgaatt cgagctccgt cgacaagctt gcggccgcac tcgagcacca 5160
ccaccaccac cactgagatc cggctgctaa caaagcccga aaggaagctg agttggctgc 5220
_ tgccaccgct gagcaataac tagcataacc ccttggggcc tctaaacggg tcttgagggg 5280
ttttttgctg aaaggaggaa ctatatccgg at 5312
<210> 8
<211> 200
<212> PRT
<213> Artificial sequence
<220>
<223> Artificial sequence description: gp41 fragment
<400> 8
Ala Val Gly Ile Gly Ala Leu Phe Leu Gly Phe Leu Gly Ala Ala Gly
1 5 10 15
Ser Thr Met Gly Ala Ala Ser Met Thr Leu Thr Val Gln Ala Arg Gln
20 25 30
Leu Leu Ser Gly Ile Val Gln Gln Gln Asn Asn Leu Leu Arg Ala Ile
35 40 45
Glu Ala Gln Gln His Leu _Leu Gln Leu Thr Val Trp Gly Ile Lys Gln
50 55 60
Leu Gln Ala Arg Ile Leu Ala Val Glu Arg Tyr Leu Lys Asp Gln Gln
65 70 75 80
Leu Leu Gly Tle Trp Gly Cys Ser Gly Lys Leu Ile Cys Thr Thr Ala
85 90 95
Val Pro Trp Asn Ala Ser Trp Ser Asn Lys Ser Leu Glu Gln Ile Trp
100 105 110
Asn Asn Met Thr Trp Met Glu Trp Asp Arg GIu Ile Asn Asn Tyr Thr
115 120 125
Ser Leu Ile His Ser Leu Ile Glu Glu Ser Gln Asn Gln Gln Glu Lys
130 135 140
Asn Glu Gln Glu Leu Leu Glu Leu Asp Lys Trp Ala Ser Leu Trp Asn
145 150 155 160
Trp Phe Asn Ile Thr Asn Trp Leu Trp Tyr Ile Lys Asn Arg Val Arg
165 170 175
Gln Gly Tyr Ser Pro Leu Ser Phe Gln Thr His Leu Pro Thr Pro Arg
180 185 190
Gly Pro Asp Arg Pro Glu Gly Ile '
195 200
