Note: Descriptions are shown in the official language in which they were submitted.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
MODIFIED PHYTASES
Field of the invention
The present invention relates to modified phytases.
Background of the invention
~o
Phytate is abundant in plants as a storage form of phosphate. Monogastric
animals are not able to liberate phosphate from phytate and therefore require
supplementation of phosphate to their feed. Nowadays, the enzyme phytase is
supplemented to animal feed to liberate phosphate from phytate.
15 Typically, phytase is added to animal feed during the process of feed
preparation. In some stages of the animal feed production process, phytase is
subjected
to conditions of relatively high temperature and relatively high humidity.
These
conditions have a negative influence on the activity of labile compounds like
enzymes.
The phytase derived from Aspergillus niger is commonly used for feed
2o applications due to favourable properties of this phytase. For instance, it
has a broad pH
optimum in the acidic range, a broad specificity coupled to a relatively high
specific
activity and a high affinity for phytic acid, so that even at low phytic acid
concentrations
the enzyme degrades phytic acid effectively. It further quite smoothly removes
5 of the 6
phosphates from phytate without significant accumulation of intermediates, it
does not
25 need co-factors for activity or stability and it is not very sensitive to
inhibition by feed
ingredient and metal ions.
However, the thermostability of Aspergillus niger phytase is relatively low.
Therefore, there is a need for a phytase with the same favourable properties
as
Aspergillus niger phytase combined with a high stability and activity at high
so temperatures.
The present invention discloses modified phytases with favourable properties,
for
instance with respect to resistance to high temperature and humidity.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-2-
Description of the Figures
Figure 1. Aspergillus niger active site residues.
Figure 2. IHP-S model coordinates of active site residues of Aspergillus niger
phytase
complexed with phytic acid (IHP 550H)
Figure 3. Productivity of phytases versus temperature.
Detailed description of the invention
In the context of the present invention, a phytase is an enzyme which
catalyses
the hydrolysis of phytate (myoinositol hexakisphosphate) to one or more of the
following
compounds: myoinositol penta-, tetra-, tri-, di- and mono-phosphate and/or
myoinositol.
~s It is thereby generally known that some phytases are not able to
substantially hydrolyse
myoinositol monophosphate to myoinositol. Phytase enzymes can be 3-phytases or
6-
phytases (EC 3.1.3.8 or EC 3.1.3.26, respectively), referring to the position
of the first
ester bond that is hydrolysed.
A first aspect of the present invention relates to a polypeptide that is a
modified
2o phytase. The polypeptide according to the invention is modified as compared
to a model
phytase in such a way that the polypeptide according to the invention, when
aligned to
the model phytase, contains a modification selected from the group consisting
of: a
substitution of an amino acid as present in the model phytase for a different
amino acid,
a deletion of an amino acid as present in the model phytase, or an insertion
of an amino
25 acid. The alignment of the polypeptide according to the invention to a
model phytase is
done in such a way as to obtain a maximal amount of homologous (identical)
residues
between the polypeptide according to the invention and the model phytase.
In a preferred embodiment of the invention, the'modification is a
substitution.
The number of modifications may be at least one, preferably at least 10, more
3o preferably at least 20, more preferably at least 30, more preferably at
least 40, more
preferably at least 50, more preferably at least 70, more preferably at least
80.
In the present invention, a denotation like e.g. "5QS" means that the amino
acid
in position 5 of the model phytase in question is substituted with either Q or
S. The
nature of the original amino acid residue may depend on the model phytase that
is used.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-3-
A denotation like e.g. "Q5S" means that a specific amino acid residue present
in the
model phytase, e.g. Q, is substituted with a different amino acid, e.g. S.
The modified phytase is modified as compared to the model phytase in
preferably at least one of the following positions: 5, 6, 13, 19, 21, 29, 31,
36, 39, 43, 53,
s 69, 78, 81, 85, 87, 99, 112, 113, 122, 125, 126, 128, 137, 147, 148, 157,
160, 163, 165,
169, 172, 176, 178, 180, 181, 182, 183, 189, 194, 197, 201, 203, 211, 213,
215, 218,
222, 223, 225, 232, 233, 242, 246, 247, 248, 249, 250, 251, 252, 254, 269,
291, 296,
310, 312, 315, 322, 330, 342, 346, 362, 365, 367, 368, 372, 374, 375, 382,
384, 395,
414, 417, 425, 428, 438, 440; or in preferably at least one of the following
positions: 13,
~ 0 19, 21, 29, 31, 36, 39, 43, 53, 69, 78, 81, 85, 87, 99, 112, 113, 122,
125, 126, 128, 137,
147, 148, 157, 160, 163, 165, 169, 172, 176, 178, 180, 181, 182, 183, 189,
194, 197,
201, 203, 211, 213, 215, 218, 222, 223, 225, 232, 233, 242, 246, 247, 248,
249, 250,
251, 252, 254, 269, 291, 296, 310, 312, 315, 322, 330, 342, 346, 362, 365,
367, 368,
372, 374, 375, 382, 384, 395, 414, 417, 425, 428, 438, 440; or in preferably
at least one
~s of the following positions: 13, 19, 21, 29, 36, 39, 43, 53, 69, 81, 85, 87,
99, 112, 113,
122, 125, 126, 128, 137, 147, 148, 157, 160, 165, 169, 172, 176, 178, 181,
183, 189,
197, 201, 203, 213, 218, 222, 223, 225, 232, 233, 246, 247, 248, 249, 250,
251, 252,
291, 296, 310, 312, 315, 322, 330, 342, 346, 362, 365, 367, 368, 372, 374,
375, 382,
384, 395, 417, 425, 438, 440. Even more preferably, the modified phytase is
modified as
2o compared to the model phytase in at least one of the following positions
31, 78, 163,
180, 182, 194, 211, 215, 242, 254, 269, 414, 428, 440.
In particular, the modified phytase contains at least one of the following
modifications as compared to the model phytase: 5QS, 6SH, 13G, 19P, 21 I, 29S,
31 FY,
36D, 39A, 43D, 53V, 69S, 78EA, 81 K, 85A, 87K, 99T, 112Q, 113M, 1228, 125K,
126A,
25 128A, 137A, 147A, 148E, 157A, 160A, 163RG, 165N, 169A, 172V, 1761, 178P,
180AG,
181 A, 182STG, 183Y, 189H, 194VA, 197E, 201 G, 203D, 211 TL, 213A, 215SA,
218A,
222A, 223H, 225P, 232E, 233D, 242SP, 246V, 247A, 2488, 249T, 250S, 251 D,
252A,
254KE, 269NQ, 291A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S,
365S,
367E, 368E, 372Y, 374A, 375S, 382A, 384A, 395K, 414PA, 417K, 425D, 428RKE,
30 438N, 440AE; or more preferably at least one of the following modifications
as
compared to the model phytase: 5QS, 6SH, 13G, 19P, 211, 29S, 31Y, 36D, 39A,
43D,
53V, 69S, 78A, 81 K, 85A, 87K, 99T, 112Q, 113M, 1228, 125K, 126A, 128A, 137A,
147A, 148E, 157A, 160A, 1636, 165N, 169A, 172V, 1761, 178P, 1806, 181A, 1826,
183Y, 189H, 194A, 197E, 201 G, 203D, 211 L, 213A, 215A, 218A, 222A, 223H,
225P,
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-4-
232E, 233D, 242P, 246V, 247A, 2488, 249T, 250S, 251 D, 252A, 254E, 269Q, 291A,
296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y,
374A, 375S, 382A, 384A, 395K, 414A, 417K, 425D, 428E, 438N, 440E.
Most preferably, the modified phytase contains at least one of the following
modifications as compared to the model phytase: 31Y, 78A, 1636, 1806, 1826,
194A,
211 L, 215A, 242P, 254E, 269Q, 414A, 428E, 440E.
The position numbering as used throughout the present invention is according
to
the position numbering of SEQ ID N0:1.
The model phytase as used in the present invention is a phytase obtainable
from
~o a filamentous fungus from the genus Aspergillus, preferably from the
species
Aspergillus niger, or a variant phytase derived from any of these phytases. It
is thereby
known that phytases within individual strains of the species Aspergillus niger
show a low
degree of variation, i.e. the homology of these phytases is at least 90%. It
is also known
that the species Aspergillus niger comprises species formerly known as
Aspergillus
15 ficuum and Aspergillus awamori. Most preferably, the model phytase is the
phytase
obtainable from Aspergillus niger NRRL 3135, as indicated in SEQ ID N0:1.
An especially preferred model phytase is a phytase containing a combination of
specific amino acid residues that are uniquely present in Aspergillus niger
phytase.
The especially preferred model phytase contains the same amino acid residues
2o in the active site as the amino acids present in Aspergillus niger phytase
at the
corresponding positions. To this end, the present invention discloses a method
to define
those residues in the active site of Aspergillus niger phytase that are
present within a
certain distance of bound phytate.
The amino acid residues which form the active site of Aspergillus niger
phytase
2s and which are relevant for the catalytic properties in the degradation of
phytic acid by
Aspergillus niger phytase were identified using the 3D structure of the
Aspergillus niger
phytase which is available from the Protein Data Bank (PDB) as entry 1 IHP
(Kostrewa et
al. Nature Structural Biology, 1997, 4, 185). The Aspergillus niger 3D
structure does not
contain the substrate phytic acid (myo-inositol hexakisphosphate). However,
the 3D
so structure of an E.coli phytase complexed with phytic acid is available (PDB
entry 1 DKQ,
Lim et al., Nature Structural Biology, 2000, 7, 108). Although sequence
homology is low,
both phytases show substantial structural resemblance. The superposition of
the atomic
coordinates for Aspergillus niger phytase(11HP) and E.coli phytase was started
using
only the alpha carbon atoms of those residues which exhibit a similar folding
pattern in
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-5-
both phytases. Subsequently, the number of residues which were included in the
superposition were extended in an iterative process until no further
improvement of the
superposition could be obtained. Quality of the superposition was judged using
the root
mean square deviation of the atoms used for the superposition. In the final
superposition
s the amino acid segments 1 DKQ: 6-22, 46-66, 83-106, 246-257, 268-278, 296-
313, 328-
338, 346-351, 375-381, 392-398 were superimposed onto 11HP:48-64, 104-124, 133-
156, 270-281, 293-303, 331-348, 379-389, 397-402, 406-412, 422-428.
After the superposition the substrate phytic acid was taken from the E.coli
phytase active site and transferred to the corresponding site in Aspergillus
niger
~o phytase. Subsequently the Aspergillus niger phytase complexed with the
phytic acid was
subjected to energy minimization allowing substrate and active site resid~.~es
to shift
while keeping the remainder of the structure fixed. The energy minimizations
were
conducted with the Insight & Discover program (Accelrys, San Diego CA) with
the
forcefield CVFF using a SGI Octane workstation. The resulting model for
Aspergillus
~s niger phytase complexed with phytic acid was coded IHP-S. It was found that
calculation
of the solvent accessible surface for those amino acid residues, which had at
least one
atom within a distance of 7 Angstroms from any atom of the substrate phytic
acid,
resulted in a smooth continuous surface outlining a pocket that accomodated
the phytic
acid almost perfectly. The atomic coordinates of the residues that contribute
to this
zo active site pocket are given in Figure 1. In addition the IHP-S model was
used to identify
different zones of residues around the substrate. Results are given in Figure
2.
Thus, in the context of the present invention, the active site amino acid
residues
of Aspergillus niger phytase are those amino acid residues that are within a
certain
distance from phytic acid when bound in the active site. Preferably, said
distance is 6
25 Angstrom, more preferably 7 Angstrom.
Thus, the especially preferred model phytase contains the amino acids Q27,
Y28, R58, H59, R62, P64, T65, S67, K68, Y72, D103, S140, 8142, V143, E179,
D188,
F243, KN277, K278, H282, S337, H338, D339, N340, F380 (within 6 Angstrom
distance), preferably the amino acids Q27, Y28, R58, H59, G60, R62, Y63, P64,
T65,
so DE66, S67, K68, K71, Y72, D103, S140, 8142, V143, E179, D188, E196, D239,
F243,
Q274, KN277, K278, H282, 5337, H338, D339, N340, 6341, V378, F380 (within 7
Angstrom distance).
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-6-
The especially preferred model phytase additionally contains the following
amino
acids as present in Aspergillus nigerphytase: A35, A46, N130, S141, 6167,
Q168,
D174, T191, E199, E205, L220, T235, D244, 1268, H306, 6341, K356, A381.
At a non-specified position, it is not critical to the invention which amino
acid
residue may be present. Such a non-specified position is a position that is
not within the
active site of Aspergillus niger phytase and that is not an Aspergillus niger
amino acid as
additionally specified above and that is not subjected to specific
modifications as
specified above.Alignment of phytases using a commonly known alignment program
will
reveal which amino acids) typically will occur at a certain position. At a
corresponding
~o non-specified position in the polypeptide of the invention, any one of such
an amino acid
may be present.
Thus, a preferred polypeptide according to the invention is a phytase that
contains the same amino acid residues in the active site as the amino acids
present in
Aspergillus niger phytase at the corresponding positions, as well as the
additionally
~s specified Aspergillus nigeramino acids (i.e. A35, A46, N130, S141, 6167,
Q168, D174,
T191, E199, E205, L220, T235, D244, 1268, H306, 6341, K356, A381 ), and that
further
contains a modification as specified above.
An especially preferred polypeptide according to the invention is a phytase
that
further contains at least one of the following amino acid residues: 31Y, 78A,
1636,
20 1806, 1826, 194A, 211 L, 215A, 242P, 254E, 269Q, 414A, 428E and/or 440E.
Another
especially preferred polypeptide according to the invention contains at least
one of the
following amino acid residues: 1806, 1826, 242P and/or 440E; or preferably at
least
1806, 1826 and/or 242P.
In particular, the present invention discloses a polypeptide that is a
modified
25 phytase according to SEQ ID N0:3, SEQ ID N0:5 or SEQ ID N0:7.
A polypeptide of the invention may comprise all of the modifications set out
above. In addition, the polypeptide of the invention may comprise additional
modifications that concern positions in the polypeptide wherein a modification
does not
affect the folding or activity of the polypeptide. Typically, such
modifications may be
so conservative substitutions, i.e. substitutions wherein a non-polar, polar
uncharged, polar
charged or aromatic amino acid is substituted for a different amino acid from
the same
category
In one embodiment, the polypeptide of the invention may comprise a polypeptide
with at least 91, preferably at least 92, more preferably at least 93, more
preferably at
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-7-
least 94, more preferably at least 95, more preferably at least 96, more
preferably at
least 97, more preferably at least 98 or most preferably at least 99% sequence
homology (identity) to SEQ ID N0:3, SEQ ID NO:5 or SEQ ID N0:7.
The polypeptide according to the invention is modified to increase
thermostability
and/or to modify specific activity and/or to modify specificity for a certain
substrate
and/or to modify the pH optimum of the enzyme and/or to improve pelleting
stability
and/or to improve bioefficacy, and/or to improve expression, transport,
maturation, and
the like, in the host organism used to produce the modified phytase, when
compared
with the model phytase.
~o In a preferred embodiment, the polypeptide according to the invention has
retained several of the biochemical properties of Aspergillus niger phytase,
in particular
of the phytase obtainable from Aspergillus niger NRRL 3135. The biochemical
property
that is retained is the Km value and/or the pH optimum at two pH values of
about 5.5
and 2.5 and/or the specific activity and/or the high activity at a
physiological
15 temperature.
In a preferred embodiment, the polypeptide according to the invention is
obtained an increased thermostability. An increased thermostability of a
modified
phytase according to the invention as compared to a model phytase may be
expressed
by a longer life-time at a given elevated temperature and/or improved
refolding /
ao reactivation characteristics and/or an unfolding at a higher temperature.
Surprisingly, the polypeptide according to the invention combines several
favourable properties of Aspergillus niger phytase with an increased
thermostability.
Amino acids important for e.g. thermostability or activity of the polypeptide
of the
invention, and therefore potentially subject to substitution, may be
identified and
25 modified according to procedures known in the art, such as site-directed
mutagenesis or
alanine-scanning mutagenesis. In the latter technique mutations are introduced
at every
residue in the molecule, and the resultant mutant molecules are tested for
biological
activity (e.g phytase activity) to identify amino acid residues that are
critical to the activity
of the molecule. Sites of enzyme-substrate interaction can also be determined
by
so analysis of crystal structure as determined by such techniques as nuclear
magnetic
resonance, crystallography or photo-affinity labelling or molecular modelling.
Polypeptides of the invention may be produced by synthetic means although
usually they will be made recombinantly by expression of a polynucleotide
sequence
encoding the polypeptide in a suitable host organism.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
_g_
The use of yeast and fungal host cells is expected to provide for such post-
translational modifications (e.g. proteolytic processing, myristilation,
glycosylation,
truncation, and tyrosine, serine or threonine phosphorylation) as may be
needed to
confer optimal biological activity on recombinant expression products of the
invention.
Polypeptides of the invention may be provided in a form such that they are
outside their natural cellular environment. Thus, they may be substantially
isolated or
purified, as discussed above, or produced in a cell in which. they do not
occur in nature,
e.g. a cell of other fungal species, animals, yeast or bacteria.
Polypeptides of the invention may be analysed by any suitable assay known to
~o the skilled person to measure an improvement as compared to a model phytase
known
in the art.
In a second aspect, the present invention provides an (e.g. isolated and/or
purified) polynucleotide comprising a polynucleotide sequence encoding the
polypeptide
of the first aspect. In particular, the present invention provides a
polynucleotide
~s comprising a polynucleotide sequence encoding the amino acid sequence set
out in
SEQ ID N0:3, SEQ ID NO:5 or SEQ ID NO:7 or a polynucleotide comprising SEQ ID
N0:2, SEQ ID N0:4 or SEQ ID NO:6. The polynucleotides of the second aspect
further
include any degenerate versions of a polynucleotide sequence encoding the
polypeptide
of the first aspect. For instance, the skilled person may, using routine
techniques, make
20 nucleotide substitutions that do not affect the protein sequence encoded in
the
polynucleotides of the invention to reflect the codon usage of any particular
host
organism in which the polypeptides of the invention are to be expressed.
The polynucleotide sequence of the second aspect may be RNA or DNA and
includes genomic DNA, synthetic DNA or cDNA. Preferably, the polynucleotide is
a DNA
Zs sequence.
Polynucleotides of the invention can be synthesized according to methods well
known in the art. They may be produced by combining oligonucleotides
synthesized
according to and along the nucleotide sequence of the polynucleotide of the
invention.
Alternatively, they may be synthesized by mutagenising a parental
polynucleotide at any
3o desired position.
For instance, the polynucleotide of the invention is constructed from a series
of
synthetic oligonucleotides with a length of 80 nucleotides, having an overlap
of about 20
nucleotides. A PCR, typically of 10 steps, is performed with a polymerase with
proofreading activity on all 80-mer oligonucleotides to anneal and extend the
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
_g_
oligonucleotides. A further PCR with a proofreading polymerase is performed
with PCR
primers situated at the 5' and 3' end of the desired fragment, to synthesise
the complete
desired fragment. The complete fragment is cloned in a suitable vector and
sequenced
to establish whether or not a correct sequence is obtained. Optionally,
sequence errors
may be corrected, for instance using the QuickChange kit from Stratagene
according to
the Manufacturer's instructions.
Polynucleotides of the invention may be used to obtain polynucleotides
encoding
a further modified polypeptide, e.g. by subjecting polynucleotides of the
invention to
mutagenesis techniques. Site-directed mutagenesis may be used to alter the
~o polynucleotides of the invention at one or more specific positions. Gene
shuffling
technology (for instance as disclosed in W095/22625, W098/27230, WO98/01581
and/or WO00/46344) may be used to obtain polynucleotide variants with a random
combination of any variant position present in any member of a starting
population of
polynucleotides, said starting population including one or more
polynucleotides
~s according to the invention.
The invention also provides vectors comprising a polynucleotide of the
invention,
including cloning and expression vectors.
The vector into which the expression cassette or polynucleotide of the
invention
is inserted may be any vector which may conveniently be subjected to
recombinant DNA
2o procedures, and the choice of the vector will often depend on the host cell
into which it is
to be introduced. Thus, the vector may be an autonomously replicating vector,
i.e. a
vector which exists as an extra-chromosomal entity, the replication of which
is
independent of chromosomal replication, e.g. a plasmid, cosmid, virus or phage
vector,
usually provided with an origin of replication. Alternatively, the vector may
be one which,
z5 when introduced into a host cell, is integrated into the host cell genome
and replicated
together with the chromosomes) into which it has been integrated. The vector
may be a
circular, e.g. a plasmid, or a linear, e.g. an expression cassette,
polynucleotide.
Preferably, the polynucleotide of the invention may be inserted into an
expression cassette. In an expression cassette, the polynucleotide of the
invention is
so operably linked to a regulatory sequence that is capable of providing for
the expression
of a polypeptide from its coding sequence by the host cell, i.e. the vector is
an
expression vector. The term "operably linked" refers to a juxtaposition
wherein the
components described are in a relationship permitting them to function in
their intended
manner. A regulatory sequence such as a promoter, an enhancer or another
expression
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-10-
regulatory signal "operably linked" to a coding sequence is positioned in such
a way that
expression of a polypeptide from its coding sequence is achieved under
conditions
compatible with the regulatory sequences.
An expression cassette for a given host cell may comprise the following
elements
operably linked to each other in a consecutive order from the 5'-end to 3'-end
relative to
the coding strand of the sequence encoding the polypeptide of the first
aspect: a
promoter sequence capable of directing transcription of the DNA sequence
encoding the
polypeptide in the given host cell; optionally, a signal sequence capable of
directing
secretion of the polypeptide from the given host cell into a culture medium; a
DNA
~o sequence encoding a mature and preferably active form of the polypeptide;
and
preferably also a transcription termination region (terminator) capable of
terminating
transcription downstream of the DNA sequence encoding the polypeptide.
Aside from the promoter native to the gene encoding a naturally occurring
predecessor of the polypeptide of the invention, other promoters may be used
to direct
~s expression of the polypeptide of the invention. The promoter may be
selected for its
efficiency in directing the expression of the polypeptide of the invention in
the desired
expression host.
Promoters/enhancers and other expression regulatory signals may be selected
to be compatible with the host cell for which the expression cassette or
vector is
Zo designed. Preferably the promoter sequence is derived from a highly
expressed gene. In
the context of this invention, a highly expressed gene is a gene whose mRNA
can make
up at least 0.01% (w/w) of the total cellular rnRNA, e.g. under induced
conditions, or
alternatively, a gene whose gene product can make up at least 0.2% (w/w) of
the total
cellular protein, or, in case of a secreted gene product, can be secreted to a
level of at
25 least 0.05g/l. Examples of preferred highly expressed genes from which
promoters are
preferably derived and/or which are comprised in preferred predetermined
target loci for
integration of expression cassettes, include but are not limited to genes
encoding
glycolytic enzymes such as triose-phosphate isomerases (TPI), glyceraldehyde-
phosphate dehydrogenases (GAPDH), phosphoglycerate kinases (PGK), pyruvate
3o kinases (PYK), alcohol dehydrogenases (ADH), as well as genes encoding
amylases,
glucoamylases, proteases, glucanases, cellobiohydrolases, ~i-galactosidases,
alcohol
(methanol) oxidases, elongation factors and ribosomal proteins. Specific
examples of
suitable highly expressed genes include e.g. the LAC4 gene from Kluyveromyces
sp.,
the methanol oxidase genes (AOX and MOX) from Hansenula and Pichia,
respectively,
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-11-
the glucoamylase (glaA) genes from A.niger and A.avvamori, the A.oryzae TAKA-
amylase gene, the A.nidulans gpdA gene and the T.reesei cellobiohydrolase
genes.
To effect expression in bacteria, prokaryotic promoters may be used, in
particular
those suitable for use in E.coli strains. Examples of strong bacterial
promoters are the
a-amylase and SPo2 promoters as well as promoters from extracellular protease
genes.
Yeast promoters include S. cerevisiae GAL4 and ADH promoters, the S. pombe
nmt 1 and adh promoter. Examples of strong yeast promoters are those
obtainable from
the genes for alcohol dehydrogenase, lactase, 3-phosphoglycerate kinase and
triosephosphate isomerase.
~o Examples of strong constitutive and/or inducible promoters which are
preferred
for use in fungal expression hosts are those which are obtainable from the
fungal genes
for xylanase (xlnA), phytase, ATP-synthetase, subunit 9 (oliC), triose
phosphate
isomerase (tpi), alcohol dehydrogenase (AdhA), a-amylase (amy),
amyloglucosidase
(AG - from the glaA gene), acetamidase (amdS) and glyceraldehyde-3-phosphate
~s dehydrogenase (gpd) promoters.
Promoters suitable for plant cells include nopaline synthase (nos), octopine
synthase (ocs), mannopine synthase (mas), ribulose small subunit (rubisco
ssu),
histone, rice actin, phaseolin, cauliflower mosaic virus (CMV) 35S and 19S and
circovirus promoters. All these promoters are readily available in the art.
2o If the polypeptide is produced as a secreted protein, the polynucleotide
sequence
encoding a mature form of the polypeptide in the expression cassette is
operably linked
to a polynucleotide sequence encoding a signal peptide.
Preferably the signal sequence is native (homologous) to the polynucleotide
sequence encoding the polypeptide. In a preferred embodiment of the invention,
the
Zs signal sequence is obtained from the Aspergillus niger phytase gene, in
particular the
signal sequence as disclosed in EP 0 420 358. Alternatively, the signal
sequence is
foreign (heterologous) to the polynucleotide sequence encoding the
polypeptide, in
which case the signal sequence is preferably endogenous to the host cell in
which the
DNA sequence is expressed. The signal sequence may be used in combination with
the
3o promoter driving expression of the coding sequence wherefrom the signal
sequence is
obtained, e.g. the Aspergillus (niger) amyloglucosidase (also called
(gluco)amylase)
promoter in combination with the signal sequence from the amyloglucosidase
(AG)
gene, both the18 and 24 amino acid versions, as well as in combination with
other
promoters.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-12-
Hybrid signal sequences may also be used within the context of the present
invention. Examples of suitable signal sequences for yeast host cells are the
signal
sequences derived from yeast a-factor genes. A suitable signal sequence for
bacteria is
derived from the a-amylase gene (Bacillus).
In some cases, the cleavage of the signal peptide during passage of a
polypeptide through the secretory pathway may occur at more than one position,
implicating a mature polypeptide with a variable N-terminus. The present
invention
encompasses polypeptides with such variable N-termini.
Downstream of the polynucleotide sequence encoding the polypeptide there may
~o be a 3' untranslated region containing one or more transcription
termination sites (e.g. a
terminator). The origin of the terminator is less critical. The terminator can
e.g. be native
to the polynucleotide sequence encoding the polypeptide. However, preferably a
yeast
terminator is used in yeast host cells and a filamentous fungal terminator is
used in
filamentous fungal host cells. More preferably, the terminator is endogenous
to the host
~s cell (in which the polynucleotide sequence encoding the polypeptide is to
be expressed).
The vector may contain one or more selectable marker genes, to enable
selection of transformed cells from the majority of untransformed cells.
Preferred selectable markers include but are not limited to those that
complement a defect in the host cell or confer resistance to a drug. They
include e.g.
2o versatile marker genes that can be used for transformation of most
filamentous fungi
and yeasts such as acetamidase genes or cDNAs (the amdS, niaD, facA genes or
cDNAs from A.nidulans, A.oryzae, or A.niger), or genes providing resistance to
antibiotics like 6418, hygromycin, bleomycin, kanamycin, phleomycin or benomyl
resistance (benA). Alternatively, specific selection markers can be used such
as
25 auxotrophic markers which require corresponding mutant host strains: e.g.
URA3 (from
S.cerevisiae or analogous genes from other yeasts), pyrC or pyrA (from
A.nidulans or
A.niger), arg8 (from A.nidulans orA.niger) or trpC. In a preferred embodiment
the
selection marker is deleted from the transformed host cell after introduction
of the
expression construct so as to obtain transformed host cells capable of
producing the
so polypeptide which are free of selection marker genes.
Other markers include ATP synthetase, subunit 9 (oliC), orotidine-5'-phosphate-
decarboxylase (pvrA), the bacterial 6418 resistance gene (this may also be
used in
yeast, but not in fungi), the ampicillin resistance gene (E. coh), the
neomycin resistance
gene (Bacillus) and the E. coli uidA gene, coding for [3-glucuronidase (GUS).
Vectors
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-13-
may be used in vitro, for example for the production of RNA or used to
transfect or
transform a host cell.
The DNA sequence encoding the polypeptide is preferably introduced into a
suitable host as part of an expression cassette. For transformation of the
suitable host
with the expression cassette, transformation procedures are available which
are well
known to the skilled person. The expression cassette can be used for
transformation of
the host as part of a vector carrying a selectable marker, or the expression
cassette may
be co-transformed as a separate molecule together with the vector carrying a
selectable
marker. The vector may comprise one or more selectable marker genes.
~o For most filamentous fungi and yeasts, the vector or expression construct
is
preferably integrated in the genome of the host cell in order to obtain stable
transformants. However, for certain yeasts also suitable episomal vectors are
available
into which the expression construct can be incorporated for stable and high
level
expression. Examples thereof include vectors derived from the 2p, and pKD1
plasmids of
Saccharomyces and Kluyveromyces, respectively, or vectors containing an AMA
sequence (e.g. AMA1 from Aspergillus). In case the expression constructs are
integrated in the host cells genome, the constructs are either integrated at
random loci
in the genome, or at predetermined target loci using homologous recombination,
in
which case the target loci preferably comprise a highly expressed gene. A
number of
2o examples of suitable highly expressed genes are provided earlier.
Provided also are host cells comprising a polynucleotide or vector of the
invention. The polynucleotide may be heterologous to the genome of the host
cell. In
this context, the term "heterologous" means that the polynucleotide does not
naturally
occur in the genome of the host cell or that the polypeptide is not naturally
produced by
that cell.
Suitable host cells are preferably prokaryotic microorganisms such as
bacteria,
or more preferably eukaryotic organisms, for example fungi, such as yeasts or
filamentous fungi, or plant cells.
Bacteria from the genus Bacillus are very suitable as heterologous hosts
so because of their capability to secrete proteins into the culture medium.
Other bacteria
suitable as hosts are those from the genera Streptomyces and Pseudomonas.
A preferred yeast host cell for the expression of the DNA sequence encoding
the
polypeptide of the invention is of the genera Saccharomyces, Kluyveromyces,
Hansenula, Pichia, Yarrowia, and Schizosaccharomyces. More preferably a yeast
host
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-14-
cell is selected from the group consisting of the species Saccharomyces
cerevisiae,
Kluyveromyces lactis (also known as Kluyveromyces marxianus var. lactis),
Hansenula
polymorpha, Pichia pastoris, Yarrowia lipolytica,and Schizosaccharomyces
pombe.
Most preferred are filamentous fungal host cells. Preferred filarnentous
fungal
host cells are selected from the group consisting of the genera Aspergillus,
Trichoderma, Fusarium, Disporotrichum, Penicillium, Acremonium, Neurospora,
Thermoascus, Myceliophtora, Sporotrichum, Thielavia, and Talaromyces. More
preferably a filamentous fungal host cell is of the species Aspergillus oyzae,
Aspergillus
sojae, Aspergillus nidulans, or a species from the Aspergillus niger Group (as
defined by
~o Raper and Fennell, The Genus Aspergillus, The Williams & Wilkins Company,
Baltimore, pp 293-344, 1965). These include but are not limited to Aspergillus
niger,
Aspergillus awamori, Aspergillus tubingensis, Aspergillus aculeatus,
Aspergillus
foetidus, Aspergillus nidulans, Aspergillus japonicus, Aspergillus oryzae and
Aspergillus
ficuum, and further consisting of the species Trichoderma reesei, Fusarium
15 graminearum, Penicillium chrysogenum, Acremonium alabamense, Neurospora
crassa,
Myceliophtora thermophilum, Sporotrichum cellulophilum, Disporotrichum
dimorphosporum and Thielavia terrestris.
Examples of preferred expression hosts within the scope of the present
invention are fungi such as Aspergillus species and Trichoderma species;
bacteria such
2o as Bacillus species e.g. Bacillus subtilis, Bacillus licheniformis,
Bacillus
amyloliquefaciens, Pseudomonas species; and yeasts such as Kluyveromyces
species
e.g. Kluyveromyces lactis and Saccharomyces species, e.g. Saccharomyces
cerevisiae.
Host cells according to the invention further include plant cells, and the
invention
25 therefore extends to transgenic organisms, such as plants and parts
thereof, which
contain one or more cells of the invention. The transgenic (or genetically
modified) plant
may therefore have inserted (e.g. stably) into its genome a sequence encoding
one or
more of the polypeptides of the invention. The transformation of plant cells
can be
performed using known techniques, for example using a Ti or a Ri plasmid from
so Agrobacterium tumefaciens. The plasmid (or vector) may thus contain
sequences
necessary to infect a plant, and derivatives of the Ti and/or Ri plasmids may
be
employed.
Alternatively direct infection of a part of a plant, such as a leaf, root or
stem can
be effected. In this technique the plant to be infected can be wounded, for
example by
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-15-
cutting the plant with a razor or puncturing the plant with a needle or
rubbing the plant
with an abrasive. The wound is then innoculated with the Agrobacterium.
The plant or plant part can then be grown on, a suitable culture medium and
allowed to develop into a mature plant. Regeneration of transformed cells into
s genetically modified plants can be achieved by using known techniques, for
example by
selecting transformed shoots using an antibiotic and by sub-culturing the
shoots on a
medium containing the appropriate nutrients, plant hormones and the like.
A further aspect of the invention thus provides host cells transformed or
transfected with or comprising a polynucleotide or vector of the invention.
Preferably the
~o polynucleotide is carried in a vector for replication of the polynucleotide
and expression
of the polypeptide. The cells will be chosen to be compatible with the said
vector and
may for example be prokaryotic (for example bacterial), fungal, yeast or plant
cells.
A heterologous host may also be chosen wherein the polypeptide of the
invention is produced in a form which is substantially free from other
polypeptides with a
~s similar activity as the polypeptide of the invention. This may be achieved
by choosing a
host which does not normally produce such polypeptides with similar activity.
If the polynucleotides of the invention are incorporated into a recombinant
replicable vector, the vector may be used to replicate the polynucleotide in a
compatible
host cell.
zo Thus in a further aspect, the invention provides a method of producing a
polynucleotide according to the invention by introducing a polynucleotide
according to
the invention into a replicable vector, introducing the vector into a
compatible host cell,
and growing the host cell under conditions which bring about replication of
the vector.
The vector containing the polynucleotide according to the invention may be
recovered
Zs from the host cell. Suitable host cells include bacteria such as E. coli.
In a further aspect the invention provides a process for preparing a
polypeptide
according to the invention by cultivating a host cell (e.g. transformed or
transfected with
an expression vector as described above) under conditions to provide for
expression (by
the vector) of the polypeptide according to the invention, and optionally
recovering the
3o expressed polypeptide. Preferably the polypeptide is produced as a secreted
protein in
which case the polynucleotide sequence encoding a mature form of the
polypeptide in
the expression construct is operably linked to a polynucleotide sequence
encoding a
signal peptide.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-16-
The recombinant host cells according to the invention may be cultured using
procedures known in the art. For each combination of a promoter and a host
cell, culture
conditions are available which are conducive to expression of the polypeptide
of the
invention. After reaching the desired cell density or titre of the polypeptide
the culture is
stopped and the polypeptide is recovered using known procedures.
The fermentation medium may comprise a known culture medium containing a
carbon source (e.g. glucose, maltose, molasses), a nitrogen source (e.g.
ammonium
sulphate, ammonium nitrate, ammonium chloride, organic nitrogen sources e.g.
yeast
extract, malt extract, peptone), and other inorganic nutrient sources (e:g.
phosphate,
~o magnesium, potassium, zinc, iron, etc.). Optionally, an inducer may be
included.
The selection of the appropriate medium may be based on the choice of
expression host and/or based on the regulatory requirements of the expression
construct. Such media are known to those skilled in the art. The medium may,
if desired,
contain additional components favouring the transformed expression hosts over
other
15 potentially contaminating microorganisms.
The fermentation can be performed over a period of 0.5-30 days. It may be a
batch, continuous or fed-batch process, suitably at a temperature in the range
of
between 0 and 45°C and, for example, at a pH between 2 and 10.
Preferred
fermentation conditions are a temperature in the range of between 20 and
37°C and/or a
2o pH between 3 and 9. The appropriate conditions are usually selected based
on the
choice of the expression host and the protein to be expressed.
After fermentation, if necessary, the cells can be removed from the
fermentation
broth by means of centrifugation or filtration. After fermentation has stopped
or after
removal of the cells, the polypeptide of the invention may then be recovered
and, if
25 desired, purified and isolated by conventional means.
Conveniently, the polypeptide of the invention is combined with suitable
(solid or
liquid) carriers or diluents including buffers to produce a polypeptide
composition. The
polypeptide may be attached to or mixed with a carrier, e.g. immobilized on a
solid
carrier. Thus the present invention provides in a further aspect a composition
so comprising a polypeptide of the invention. This may be in a form suitable
for packaging,
transport and/or storage, preferably where the activity of the polypeptide is
retained.
Compositions may be of paste, liquid, emulsion, powder, flake, granulate,
pellet or other
extrudate form.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-17-
The composition may further comprise additional ingredients such as one or
more (additional) enzymes.
The polypeptide is typically stably formulated either in liquid or dry form. .
Typically, the product is made as a composition which will optionally include,
for
example, a stabilising buffer and/or preservative.
The invention additionally relates to foodstuffs or an animal feed composition
or
additive comprising one or more polypeptides of the invention. The polypeptide
may be
present in the feed at a concentration different from its natural
concentration. Preferred
amounts are from 0.1 to 100, such as 0.5 to 50, preferably 1 to 10, mg per kg
feed.
~o The invention also relates to a process for the preparation of an animal
feed
composition, the process comprising adding to one or more edible feed
substances) or
ingredient(s), a polypeptide of the invention. The polypeptides can be added
to the
animal feed composition separately from the feed substances or ingredients,
individually
or in combination with other feed additives. The polypeptide can be an
integral part of
~s one of the feed substances or ingredients.
The polypeptides of the invention may also be added to animal feeds to improve
the breakdown of plant constituents, e.g. phytate, leading to improved
utilisation of the
plant nutrients by the animal. Advantageously, the polypeptides of the
invention may
continue to degrade phytate in the feed in vivo. Fungal based polypeptides of
the
2o invention in particular generally have lower pH optima and are capable of
releasing
important nutrients in such acidic environments as the stomach of an animal.
The polypeptides of the invention may also be used during the production of
milk
substitutes (or replacers) from soybean. These milk substitutes can be
consumed by
humans and/or animals.
25 The composition may additionally comprise (particularly when being
formulated
for use in animal feed) one or more ionophores, oxidising agents, surfactants,
rumen
protected amino acids, enzyme enhancers or enzymes which may be produced
naturally
in the gastro-intestinal tract of the animals to be fed. When added to feeds
(including
silage) for ruminants or monogastric animals (eg. poultry or swine) the feeds
may
so comprise cereals such as barley, wheat, maize, rye or oats or cereal by-
products such
as wheat bran or maize bran, or other plant materials such as soy beans and
other
legumes. The enzymes) may significantly improve the break-down of plant
material
which leads to better utilisation of the plant nutrients by the animal. As a
consequence,
growth rate and/or feed conversion may be improved.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-18-
The polypeptides of the invention are particularly applicable to animal feeds
as
they may still be active under highly acidic conditions, such as in the
stomach of
animals.
One method for the (exogenous) addition of the polypeptide of the invention is
to
s add the polypeptide as transgenic plant material and/or (e.g. transgenic)
seed. The
polypeptide may thus have been synthesized through heterologous gene
expression, for
example the gene encoding the desired enzyme may be cloned in to a plant
expression
vector, under control of the appropriate plant expression signals, e.g. a
tissue-specific
promoter, such as a seed-specific promoter. The expression vector containing
the gene
~o encoding the polypeptide can be subsequently transformed into plant cells,
and
transformed cells can be selected for regeneration into whole plants. The thus
obtained
transgenic plants can be grown and harvested, and those parts of the plants
containing
the heterologous (to the plant) polypeptide can be included in one of the
compositions,
either as such or after further processing. The heterologous polypeptide may
be
~s contained in the seed of the transgenic plants or it may be contained in
other plant parts
such as roots, stems, leaves, wood, flowers, bark and/or fruit. Suitable
plants include
cereals, such as oats, barley, wheat, maize and rice.
The addition of the polypeptide in the form of transgenic plant material, e.g.
in
transgenic seed may require the processing of the plant material so as to make
the
2o polypeptide available, or at least improve its availability. Such
processing techniques
may include various mechanical (eg. milling and/or grinding) techniques or
thermomechanical treatments such as extrusion or expansion.
The present invention thus also relates to a process for promoting growth
and/or
feed conversion in a monogastric or non-ruminant animal, the process
comprising feeding
25 the animal the polypeptide of the invention. Suitable animals include farm,
monogastric
and/or non-ruminant animals such as pigs (or piglets), poultry (such as
chickens, turkeys),
calves or veal or aquatic (e.g. marine) animals (for example fish).
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-19-
Example 1
Construction of phytase-producinu strains
DNA fragments having a sequence according to SEQ ID N0:2, SEQ ID N0:4
s and SEQ ID N0:6 were made synthetically. After verifying the DNA sequence,
these
synthetic gene fragments were fused to the A. niger phytase signal sequence
using
PCR and cloned under the control of the glucoamylase promoter. To this end,
the phyA
gene as present in the expression vector pGBTOPFYT1 as described in
international
patent application WO 98/46772 was replaced with the modified phytase genes
~o described above, yielding the vectors pTHFYT2, pTHFYT4 and pTHFYT6,
respectively.
The expression vectors pTHFYT2, pTHFYT4 and pTHFYT6 were introduced into
Aspergillus niger CBS 646.97 (described in WO 98/46772). Using PCR,
transformants
containing pTHFYT2, pTHFYT4 or pTHFYT6 were selected. In order to determine
whether these transformants were able to secrete active phytase, the
transformants
~s were grown on plates containing phytate as described by Chen (1998,
Biotechnol.
Technique12, 759-761). In this assay halo's around the Aspergillus colonies
become
visible if active phytase is secreted, due to the degradation of phytate.
Using this assay
it was shown that all expression vectors resulted in transformants secreting
active
phytase FYT2, FYT4 or FYT6 into the medium.
2o Transformants showing clear halo's were grown in shake flask. 10' spores of
selected transformants and control strains were inoculated into shake flasks,
containing
20 ml of liquid preculture medium containing per liter: 30 g maltose.H~O; 5 g
yeast
extract; 10 g hydrolyzed casein; 1 g KH~P04; 0.5 g MgS04.7Hz0; 0.03 g ZnCl2;
0.02 g
CaClz; 0.01 g MnS04 . 4H20; 0.3 g FeS04 . 7H20; 3 g Tween 80; 10 ml penicillin
(5000
25 IU/ml)/Streptomycin (5000 UGiml); pH 5.5. These cultures were grown at
34°C for 20-24
hours. 10 ml of this culture was inoculated into 100 ml of A.
nigerfermentation medium
containing per liter: 70 g maltodextrines; 25 g hydrolyzed casein; 12.5 g
yeast extract; 1
g KH2P04; 2 g K2S04; 0.5 g MgS04.7H20; 0.03 g ZnCl2; 0.02 g CaCl2; 0.01 g
MnS04.4H20; 0.3 g FeS04.7H20; 10 ml penicillin (5000 IUiml)iStreptomycin (5000
so UG/ml); adjusted to pH 5.6 with 4 N HZS04. These cultures were grown at
34°C for
about 6 days. Samples taken from the fermentation broth were centrifuged (10',
5.000
rpm in a swinging bucket centrifuge) and supernatants collected.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-20-
Example 2
Thermostability FYT2, FYT4 and FYT6
FYT2, FYT4, FYT6 and the wild type A.ficuum phytase (EP 0 420 358) were
s produced in shake flasks according to Example 1. Phytase production was
followed by
taking samples at appropriate time intervals and assaying the supernatant for
phytase
activity according to the method as described by van.Engelen et al. (Journal
of AOAC
International 1994, 77:760-764). Activity is expressed in FTU, where 1 FTU is
the
amount of enzyme that liberates 1 p.mol of inorganic orthophosphate per minute
under
~o test conditions (pH=5.5, temperature 37°C, 5mM sodium phytate). The
thermostability
was measured on supernatants as such. When required, phytase supernatants were
further concentrated by ultrafiltration.
Thermostability was measured in three different ways. Firstly, the T50 of the
phytase was determined. T50 (in °C) is the temperature at which 50% of
the activity is
15 lost after having heated the samples for 20 minutes. Experimental
conditions: Stress
test is performed in 250mM HAc/NaAc/Tween20 pH=4Ø The phytase is dosed at
about
0.6 FTU/ml. After heating the samples were immediately cooled on ice.
Subsequently
the residual phytase activity was measured in 250mM HAc/NaAc/Tween20 pH=4Ø
Results are shown in Table 1. FYT2 and FYT4 are about 8-9°C more
stable.
zo
Table 1: Thermostability of various phytases
Ph tase T50 (C) Topt (C) DSC Td C)
FYT2 74 75 79
FYT4 73 75 79
FYT6 65 68 70
Wild t a 65 64 70
Secondly, the activity of the phytases was determined during heating. When
z5 carried out as a function of the heating temperature, the experiment gives
the optimal
temperature (Topt) of the enzyme with regard to the productivity. The
incubation is
carried out over a fixed time span of 30 minutes. The amount of substrate
converted is
dependent on the enzymatic activity as well as the inactivation. Therefore
preferably the
term productivity is used instead of activity. Experimental conditions: 250mM
so HAc/NaAc/Tween20 pH=4.0, phytase dosage about 0.012 FTU/ml. The released
phosphate can be measured according standard assay methods as described
before.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-21-
Results are shown in Figure 3. FYT2 as well as FYT4 are most effective with
respect to
catalytic productivity at 75°C where the wild type control has lost its
catalytic activity
completely. Although activity starts to decrease above 75°C, Figure 3
shows that FYT2
as well as FYT4 are catalytically competent up to about 85°C. The
behaviour of FYT6 is
in between that of wild type and FYT2 or FYT4.
Thirdly, in addition to measuring the thermostability via an appropriate
activity
assay, the thermostability of the phytases was also determined directly by
determining
the temperature at which the 3-dimensional structure of the phytase enzyme
unfolds.
The heat effect that accompanies the unfolding can be measured directly by
Differential
1o Scanning Calorimetry (DSC). DSC experimental conditions: 250mM HAcINaAc
pH=4.0,
about 5mg/ml phytase, heating rate is 2.5°C/min. The results are shown
in Table 1. It
can be seen that the structure of the native enzyme is maintained at a
temperature that
is about 9°C higher for the modified phytases FYT2 and FYT4 than for
the wild type
phytase.
Example 3
Pelletina stability of FYT2, FYT4 and FYT6
Tests with two pelleting matrices, and therefore temperature settings, were
2o carried out with FYT2, FYT4 and FYT6 culture filtrates.
All granulates were made by mixing / kneading culture filtrate with the
required
amount of corn starch (C-gel from Cerestar) and water. See Tables 2 and 3 for
composition of the wet mix. After mixing and.kneading, the mixture was
extruded with a
Nica E-220 extruder and spheronised with a Fuji Paudal QJ-400G spheroniser.
The
z5 obtained particles were dried in a Glatt GPCG 1.1 fluid bed dryer. Activity
of the
granules was between 2500 and 3000 FTU/g.
Table 2: Composition of RDS 05 granule mixture
Ph tase Enz me li uid Starch Water
FYT2 176 748 123
FYT4 238 1137 194
FYT-6 377 1300 156
Wild Type 127 1300 352
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-22-
Table 3: Composition of RDS A1 granule mixture
Ph tase Enz me li Starch Water c
uid
FYT2 241 1300 274
FYT4 271 1300 259
FYT-6 290 1622 362
Wild type 109 1300 363
s 250 grams of granules were mixed in 25 kg feed with a composition according
to
Table 4, and mixed just before the test with 225 kg of the same recipe. The 25
kg of
feed was mixed in a Collete MP90 planetary mixer for 10 minutes. The 25 kg and
225 kg
of feed were mixed in a 1200 liter Nauta mixer. Samples of this mixture were
taken for
determining the pelleting stability. This 250 kg mixture was dosed in a mixer
/
~o conditioners by a dosing screw, at a speed of 600 kg/h, where it was heated
by direct
steam injection till 80°C. The residence time was about 10-15 seconds,
whereupon the
hot mixture was pushed into the pelleting press. The matrix used in the tests
was 5/45
mm (width / length; RDS 05) or 3/65 mm (width / length; RDS A1 ). The
temperature of
the pellets leaving the pelleting press was 82-83°C (RDS 05) or 91-
93°C (RDS A1).
15 After pressing the pellets fell on a cooling belt, from this belt samples
were taken for
stability testing.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-23-
Table 4: Composition of the poultry feed used in the RDS 05 and RDS A1
pelleting trials
Raw Materials Content in
RDS 05 RDS A1
~~
Maize 45 50
Peas 20.7% c 5 -
Ra a meal 4.5
Sunflower seed meal 4.5
Maize luten flower 2.5
Whole So beans toasted10
So bean Meal 46.7% 27.50 21
c
Ta ioca 62,5-67,5 starch4.72 3.85
So bean oil lant oil 3.50 1.0
Animal Fat - 3.7
Vit./Min. remix Mervit1.00 0.5
100
Limestone 1.35 1.35
Monocalcium Phos hate 1.30 0.2
Salt 0.35 0.18
NaHC03 0.25
L-L sine 0.05 0.26
DL-Methionine 0.23 0.18
L-threonine 0.03
Table 5: Pelleting yields of the thermostable phytases (RDS 05). The hot meal
temperature was 80°C. The pellet temperature reached was about 82-83
°C. Yields are
based on activity measurement before and after pelleting using the standard
phytase
assay (van.Engelen et al., Journal of AOAC International 1994, 77:760-764).
Ph tase Pelletin Yield in
FYT2 79
FYT4 81
FYT6 81
Wild t a 36
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-24-
Table 6: Pelleting yields of the thermostable phytases (RDS 01 ). The hot meal
temperature was 80°C. The pellet temperature reached was about 92-93
°C. Yields are
determined as in Table 5.
Ph tase Pelletin Yield in
FYT2 39
FYT4 37
FYT6 19
Wild type 12
The pelleting trials show a similar increase in thermostability of FYT2, FYT4
and
FYT6 as compared to wild type at 82°C, whereas at 92°C FYT2
and FYT4 show a
higher stability as compared to FYT6.
Exarnple 4
Biochemical characteristics of phytases
The specific activity of the phytases was determined after purification of the
phytases from filtrates which were obtained after filtration of fermentation
broth.
15 Purification of phytase was done by ion-exchange chromatography or affinity
chromatography or a combination of both methods.
Affinity chromatography of glycosylated phytases was carried out using a ConA
(Concanavalin A) affinity matrix (HiTrap Con A, Amersham Pharmacia Biotech).
The
phytase was bound to column in 20mM Tris10.5 M NaCI/1 mM MnCl2/1 mM CaCh
zo pH=7.4. After extensive washing of the column the phytase was eluted with
20mM Tris/
0.5 M NaCI/ 0.5M methyl-a-glucopyranosidel pH=7.4. Regeneration of the column
was
conducted with 20mM Tris pH=8.5. The pH of the buffers was set with 4N HCI.
Ion exchange chromatography was carried out using a anion exchanger
(Resource Q, Amersham Pharmacia Biotech ). Desalting and buffer changes were
done
z5 using a PD-10 gelfiltration column. The equilibration of the column was
done in 50mM
Tris, pH=7.5. After loading the phytase sample, the phytase was eluted using a
gradient
0 to 1 M NaCI in 50mM Tris pH=7.5.
The protein content of the purified phytase was determined by an E280
measurement, where 1 mg/ml phytase corresponds with OD2ao,~°m = 0.938.
For FYT2,
so FYT4 and FYT6, the OD~so,~cm at 1 mg/ml corresponds with 0.995, 0.995 and
0.963,
respectively. The activity was determined in FTU as described by van Engelen
et al.
(Journal of AOAC International 1994, 77:760-764).
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-25-
The Km values for phytic acid were determined by measuring the initial
reaction
rate as a function of the substrate concentration. The assay mixtures
contained either
1.0, 0.5, 0.2, 0,1,0.05, 0.025, 0.015 mM phytic acid in 250 mM NaAc buffer
pH=5.5. The
enzyme reaction was stopped with 15 % TCA (1:1). The liberatedyinorganic
phosphate
s was determined by mixing stopped reaction mixture with 0.6M H2S04-2%
ascorbic acid-
0.5% ammonium molybdate (1:1), incubating the mixture for 20 minutes at 50
°C and
measuring the adsorbance at 820nm (Wyss et al. Appl Env Microbiol 1999, 65 :
367-
373). Results are shown in Table 7.
~o Table 7: Catalytic properties of phytases using phytic acid as a substrate
Biochemical propert Wild T pe FYT2 FYT4 FYT6
S ecific Activit 100 102 103 98
FTU/m
Km (~,M, pH=5.5) 12 8 5 ~ 5
Table 7 shows that as compared to the wild type the specific activity as well
as
the high affinity for phytic acid is not affected by the modifications made.
15 The pH dependency of the activity of the phytases was determined by
measuring
the rate of liberation of phosphate from phytic acid at different pH values.
In principle the
standard phytase assay was used, except that the pH was varied. The activity
at pH=5.6
was taken as 100% activity. The following buffers were used to set the pH of
the
experiment: 250mM glycine in the pH range 2.8 to 3.2; 250mM NaAc in the pH
range
20 3.6 to 5.6; 250mM imidazol in the pH range 6 to 7 and 250mM Tris in the pH
range 7.5
to 9. The results are shown in Table 8.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-26-
Table 8: pH dependence of phytase enzymatic activity. The activity is given as
the
percentage of the observed maximal activity at pH = 5.6, which was .set to
100%.
Activity
relative
to activity
at pH=5.6
in
FYT2 FYT4 FYT6 Wild Type
pH value
2,8 77,7 78,7 81,7 70,4
3,2 77,0 79,7 67,9 59,3
3, 6 52, 9 54,1 45, 5 46,1
4,0 39,9 43,2 38,5 39,3
4,4 77,9 76,6 71,9 70,6
4,8 85,5 84,8 84,1 90,0
5,2 90,0 93,7 92,9 99,8
5,6 100,0 100,0 100,0 100,0
6,0 92,2 91,8 80,1 80,5
6,5 65,6 67,8 48,2 55,6
7,0 46,5 50,7 32,7 27,6
7,5 22,3 23,7 25,1 4,2
7,9 1,6 1,7 2,6 0,4
8,5 0,2 0,2 0,7 0,8
9,0 0,4 0,3 0,6 0,3
s The pH dependence of the activity of the modified phytases is very similar
as
that of wild type. In particular the feature that the wild type phytase
exhibits two pH
optima is maintained. One pH optimum is found around pH=2.5 and the second
optimum is around pH=5.5. Table 8 shows that this particular feature of wild
type
Aspergillus niger phytase is not affected by the modifications resulting in
FYT2, FYT4
~o and FYT6.
Progress curves following degradation of phytic acid by phytase as a function
of
time were recorded in 250mM NaAc, pH=5.5 at 37°C. The dosing of the
phytase was
0.05 FTU/ml at a substrate concentration of 0.2 mM phytic acid. The enzymatic
reaction
was stopped with 15 % TCA (1:1). The liberated inorganic phosphate was
determined by
~s mixing 100 pl of reaction mixture with 1400 pl 0.3M H2SO4-1% ascorbic acid-
0.27
ammonium molybdate, subsequently incubating the mixture for 20 minutes at
50°C and
measuring the adsorbance at 820nm. Results are shown in Table 9.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-27-
Table 9: Progress curves for degradation phytic acid by phytases
OD at
820nm
FYT2 FYT4 FYT6 Wild
T p_
a
Incubation Time
(min)
0 0 0 0 0
0.31 0.35 0.36 0.38
0.59 0.72 0.75 0.65
45 0.84 0.84 0.85 0.83
90 0.87 0.90 0.89 0.86
It is shown that the modified phytases behave very similar to wild type
phytase in
s liberating phosphate from phytic acid. After one hour the progress curves
reach a
plateau at about 80-85°l° of the phosphates released. All
phytase reach this plateau at a
similar rate, which indicates that the efficacy of wild type phytase in
releasing
phosphates from phytic acid is not affected by the modifications in the
modified
phytases.
~o In conclusion, the results show that the modifications of FYT2, FYT4 and
FYT6
do not affect the catalytic performance of the given modified phytases as
compared to
the wild type. It shows that avoiding any mutation of the amino acids that are
shown in
Figure 1 (Residues within 7Angstroms zone around the substrate) and further
retaining
additional Aspergillus niger amino acids does maintain the functional
properties of the
~s wild type Aspergillus niger phytase.
Example 5
Bioefficacy of modified phytases
2o Trial with liauid phvtases
A bioefficay test comparing the newly generated thermostable phytases was
performed using them in a liquid formulation applied to the pellets after
pelleting. The
enzymes were applied in such doses that the added phytase activity would be
100, 200
or 300 FTU/kg feed. The test was pen'ormed in broilers (5-33 days) fed a maize-
soy
based diet (one feed for the first 14 days of the trial, and one, slightly
different, diet
during the last 14 days). The absorbable phosphorus content of the basal diets
was 2.2
g/kg feed (day 5-19) and 1.7 g/kg feed (day 19-33). These values are well
below the
estimated requirement of the animals. Animals were housed in six floor pens
per
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-28-
10
treatment, each pen containing 14 birds. The results were calculated on the
basis of the
analyzed phytase contents (FTU/kg), using the methods outlined by Finney
(1964:
Statistical method in biological assay. Charles Griffin, London.). The results
for body
weight are presented in Table 10.
Table 10. Relative efficacy of the different phytases (applied after pelleting
as
liquids) on body weight, compared to wild type (= 100%), calculated over the
whole
experimental period (5-33 days), based on analyzed phytase activity.
Test product BW
FYT2 98
FYT4 68
FYT6 103
wild type 100
The slopes of the regression lines for all products were significantly
different
from zero. As evident from table 10, there appeared little difference between
the
products, with the exception of FYT4. Animals fed this enzyme performed not as
well as
those fed with the other phytases, but the difference was not statistically
significant.
Trial with granulated phytases
A test was performed to compare the thermostable phytases in a granulated
formulation, applied to the pellets before pelleting. This means the phytases
were put
through the pelleting process. In this trial pelleting was performed at really
high
2o temperatures: pellets were approximately 92 °C. Because the aim was
to obtain
additions of 100, 200 or 300 FTU/kg to the feed as offered to the animals, a
pre-
pelleting trial was performed to estimate the activity loss during this
process, and the
products were overdosed to such an extent that the activities mentioned were
realized.
The test was performed in a similar way as the liquid product-trial, using
broilers (5-33
days) fed a maize-soy based diet (only one diet for the whole period), having
an
absorbable phosphorus content well below the estimated requirement of these
animals
(1.9 g/kg feed). Animals were housed in six floor pens per treatment, each pen
containing 14 birds. The results of the relative slopes of the regression
lines for body
weight gain are presented in Table 11.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-29-
Table 11. . Relative efficacy of the different phytases on body weight gain
(applied as granulates, except wild type which was applied to the pellets as
liquid
formulation after pelleting) compared to wild type (= 100%), calculated over
the whole
experimental period (5-33 days), based on analyzed phytase activity.
Test product BWG
FYT2 147
FYT4 126
FYT6 137
Wild type 100
The phytase FYT2 performed best in this trial, followed by FYT6, FYT4 and wild
type.
Example 6
Single mutants of uhytase FYT2 and FYT6
The following single mutants were prepared of phytase FYT2: Y31 F, A78E,
G163R, G180A, G182S, A194V, L211T, A215S, P242S, E254K, Q269N, A414P, E428R
~5 and E440A, and of phytase FYT6: E440A.
To this end the gene encoding FYT-2 (SEQ ID N0:2) or FYT6 (SEQ ID N0:6)
was amplified by PCR in a total volume of 50 ~.I using 2.5 U Pwo polymerase
(Roche
diagnostics, GmbH, Mannheim, Germany), 100 ng DNA template, 0.5 mM dNTP, 1 x
Pwo buffer, 10 pmol DSM-1 F and 10 pmol DSM-1 R under the following conditions
5' 94
20 °C, 30x (.30" 94 °C 1" 60 °C 2' 72 °C), 5' 72
°C The amplified fragment was cloned into
the PCR°-Blunt-TOPO (Invitrogen life technologies, Carlsbad, CA, USA)
vector and
mutations were introduced using the QuickChange kit from Stratagene
(Stratagene, La
Jolla, CA, USA) according to the recommendations of the supplier.
25 The sequence of the primers DSM-1 F and DSM-1 R was as follows:
DSM-1 F 5' GGCAGTCCCCGCCTCGAGAAAT 3"
DSM-1 R 5' GTCATCGCGATTAATTAATCTAAGCAAAACACTCCTCCCAGTT 3'
The following primers were used for rnutagenesis, wherein the mutated codons
so are highlighted in bold.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-30-
Mutation Primer set
Y31 F 5'- GGTCAATACTCCCCGTTCTTCTCTCTGGCAGAC - 3'
5'- GTCTGCCAGAGAGAAGAACGGGGAGTATTGACC - 3'
A78E 5' - TCCGCTCTCATTGAGGAGATCCAGAAGAACGCG - 3'
5' - CGCGTTCTTCTGGATCTCCTCAATGAGAGCGGA - 3'
~o
G163R 5' - AAGCTGGCCGATCCTCGTGCCAACCCCGGCCAA - 3'
5' - TTGGCCGGGGTTGGCACGAGGATCGGCCAGCTT - 3'
~5 G180A 5' - GTGATCATTCCCGAGGCCGCCGGCTACAACAAC - 3'
5 - GTTGTTGTAGCCGGCGGCCTCGGGAATGATCAC - 3'
G182S 5' - ATTCCCGAGGGCGCCTCATACAACAACACTCTC - 3'
20 5' - GAGAGTGTTGTTGTATGAGGCGCCCTCGGGAAT - 3'
30
A194V 5' - CACGGCACCTGCACTGTCTTCGAAGAGAGCGAA - 3'
5' - TTCGCTCTCTTCGAAGACAGTGCAGGTGCCGTG - 3'
L211 T 5' - GCCAATTTCACCGCCACGTTCGCCCCCGCCATT - 3'
5' - AATGGCGGGGGCGAACGTGGCGGTGAAATTGGC - 3'
A215S 5' - GCCCTGTTCGCCCCCTCCATTCGTGCCCGTCGT - 3'
5' - ACGACGGGCACGAATGGAGGGGGCGAACAGGGC - 3'
P242S 5' - CTCATGGACATGTGCTCCTTCGACACCGTCGCC - 3'
5' - GGCGACGGTGTCGAAGGAGCACATGTCCATGAG - 3'
E254K 5' - ACCTCCGACGCCACCAAGCTGTCCCCCTTCTGT - 3'
5' - ACAGAAGGGGGACAGCTTGGTGGCGTCGGAGGT - 3'
Q269N 5' - CATGACGAATGGATCAACTACGACTACCTCCAG - 3'
5' - CTGGAGGTAGTCGTAGTTGATCCATTCGTCATG - 3'
A414P 5' - CCGCTGCATGGGTGTCCGGTTGATAAGTTGGGG - 3'
5' - CCCCAACTTATCAACCGGACACCCATGCAGCGG - 3'
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
-31-
E428R ~ 5' -CGGGATGACTTTGTGAGGGGGTTGAGCTTTGCT - 3'
5' -AGCAAAGCTCAACCCCCTCACAAAGTCATCCCG - 3'
E440A 5' - TCCGGGGGTAACTGGGCGGAGTGTTTTGCTTAG - 3'
5' - CTAAGCAAAACACTCCGCCCAGTTACCCCCGGA - 3'
The sequence of the resulting phytase DNA fragments was checked by
~o sequence analysis. The phytase sequences were cloned in pGBTOPFYT1 and
culture
supernatants were prepared as described in Example 1.
Of each single mutant and of FYT2 and FYT6 the T50 value was determined
(see Example 2). The results are shown in Table 12.
Table 12: T50 values of phytase mutants
Phytase T50 C
FYT2-Y31 F 74
FYT2-A78E 74
FYT2-G163R 74
FYT2-G 180A 71
FYT2-G182S 73
FYT2-A194V 74
FYT2-L211 74
T
FYT2-A215S 74
FYT2-P242S 73
FYT2-E254K 73
FYT2-Q269N 74
FYT2-A414P 74
FYT2-E428R 74
FYT2-E440A 74
FYT6-E440A 65
FYT2 74
FYT6 65
Most of the obtained mutants show a T50 value that is comparable to phytase
FYT2. Surprisingly, the T50 value of FYT6, containing a combination of all
single
2o mutations, is considerably lower than that of the individual mutants.
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
SEQUENCE LISTING
<110> DSM IP Assets B.V.
<120> MODIFIED PHYTASES
<130> 20720W0
<l60> 7
<170> PatentIn version 3.l
<210> 1
<211> 444
<212> PRT
<213> ASPERGILLUS NIGER MATURE PHYTASE
<400> 1
Ala Ser Arg Asn Gln Ser Ser Cys Asp Thr Val Asp Gln Gly Tyr Gln
1 5 10 15
Cys Phe Ser Glu Thr Ser His Leu Trp Gly Gln Tyr Ala Pro Phe Phe
20 25 30
Ser Leu Ala Asn Glu Ser Val Ile Ser Pro Glu Val Pro Ala Gly Cys
35 40 45
Arg Val Thr Phe Ala Gln Val Leu Ser Arg His Gly A1a Arg Tyr Pro
50 55 60
Thr Asp Ser Lys Gly Lys Lys Tyr Ser A1a Leu Ile G1u Glu Ile Gln
65 70 75 80
Gln Asn Ala Thr Thr Phe Asp Gly Lys Tyr Ala Phe Leu Lys Thr Tyr
g5 g0 95
Asn Tyr Ser Leu Gly Ala Asp Asp Leu Thr Pro Phe Gly Glu Gln Glu
100 105 110
Leu Va1 Asn Ser Gly Ile Lys Phe Tyr Gln Arg Tyr Glu Ser Leu Thr
115 120 125
Arg Asn Ile Val Pro Phe Ile Arg Ser Ser G1y Ser Ser Arg Val Ile
130 135 140
Ala Ser Gly Lys Lys Phe Ile Glu Gly Phe Gln Ser Thr Lys Leu Lys
145 150 155 160
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Asp Pro Arg Ala Gln Pro Gly Gln Ser Ser Pro Lys Ile Asp Val Val
165 170 175
I1e Ser Glu Ala 5er Ser Ser Asn Asn Thr Leu Asp Pro G1y Thr Cys
180 185 190
Thr Val Phe Glu Asp Ser Glu Leu Ala Asp Thr Val Glu Ala Asn Phe
195 200 205
Thr Ala Thr Phe Va1 Pro Ser Ile Arg Gln Arg Leu Glu Asn Asp Leu
210 215 220
Ser Gly Val Thr Leu Thr Asp Thr Glu Val Thr Tyr Leu Met Asp Met
225 230 235 240
Cys Ser Phe Asp Thr Ile Ser Thr Ser Thr Val Asp Thr Lys Leu Sar
245 250 255
Pro Phe Cys Asp Leu Phe Thr His Asp G1u Trp Ile Asn Tyr Asp Tyr
260 265 270
Leu Gln Ser Leu Lys Lys Tyr Tyr Gly His Gly Ala Gly Asn Pro Leu
275 280 285
Gly Pro Thr Gln G1y Va1 Gly Tyr Ala Asn Glu Leu Ile Ala Arg Leu
290 295 300
Thr His Ser Pro Val His Asp Asp Thr Ser Ser Asn His Thr Leu Asp
305 3l0 315 320
Ser Ser Pro Ala Thr Phe Pro Leu Asn Ser Thr Leu Tyr Ala Asp Phe
325 330 335
Ser His Asp Asn Gly Tle Ile Ser I1e Leu Phe Ala Leu G1y Leu Tyr
340 345 350
Asn Gly Thr Lys Pro Leu Ser Thr Thr Thr Va1 Glu Asn Ile Thr Gln
355 360 365
Thr Asp Gly Phe Ser Ser Ala Trp Thr Val Pro Phe Ala Ser Arg Leu
370 375 380
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Tyr Val Glu Met Met Gln Cys Gln Ala Glu Gln Glu Pro Leu Val.Arg
385 390 395 400
Val Leu Val Asn Asp Arg Val Val Pro Leu His Gly Cys Pro Val Asp
405 410 415
Ala Leu Gly Arg Cys Thr Arg Asp Ser Phe Val Arg Gly Leu Ser Phe
420 425 430
Ala Arg Ser Gly Gly Asp Trp Ala Glu Cys Phe Ala
435 440
<210>2
<211>1335
<212>DNA
<213>SYNTHETIC
DNA
<220>
<222>CDS
<222>(1)..(1335)
<223>
<400> 2
gcc tcgagaaattcc cacagttgcgat acggtcgat ggcgggtatcaa 48
Ala SerArgAsnSer HisSerCysAsp ThrValAsp GlyGlyTyrGln
1 5 10 15
tgc ttccccgagatc tcgcatctttgg ggtcaatac tccccgtacttc 96
Cys PheProGluIle SerHisLeuTrp GlyG1nTyr SerProTyrPhe
20 25 30
tct ctggcagacgaa tcggccatctcc cctgacgtg cccgccggatgc 144
Ser LeuA1aAspGlu 5erAlaI1eSer ProAspVa1 ProAlaGlyCys
35 40 45
aga gtcactttcgtc caggtcctctcc cgtcatgga gcgcggtatccg 192
Arg ValThrPheVal GlnValLeuSer ArgHisGly AlaArgTyrPro
50 55 60
acc gactccaagtcc aagaaatactcc getctcatt gaggccatccag 240
Thr AspSerLysSer LysLysTyrSer AlaLeuIle GluAlaIleGln
65 70 75 80
aag aacgcgaccgcc tttaagggaaaa tatgccttc ctgaagacatac 288
Lys AsnAlaThrAla PheLysGlyLys TyrA1aPhe LeuLysThrTyr
85 90 95
aac tacaccttgggt gcagatgacctg actcccttc ggagaacagcag 336
Asn TyrThrLeuGly AlaAspAspLeu ThrProPhe GlyG1uG1nGln
100 105 110
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
atg gtcaactccggc atcaagttc taccgccgg aaggccctcgcc 384
tac
Met ValAsnSerGly IleLysPhe TyrArgArgTyr LysAlaLeuAla
115 120 125
agg aacatcgttcca ttcatccga gcctctggctcc agccgcgtgatc 432
Arg AsnIleValPro PheIleArg A1aSerGlySer SerArgValTle
130 135 140
gcc tccgccgagaaa ttcatcgag ggcttccagagc gccaagctggcc 480
Ala SerAlaGluLys PheIleGlu GlyPheGlnSer AlaLysLeuAla
145 150 155 160
gat cctggcgccaac cccggccaa gcctcgcccgtc atcgacgtgatc 528
Asp ProGlyAlaAsn ProGlyGln AlaSerProVal IleAspValIle
165 170 175
att cccgagggcgcc ggctacaac aacactctcgac cacggcacctgc 576
Ile ProGluGlyA1a GlyTyrAsn AsnThrLeuAsp HisGlyThrCys
180 185 190
act gccttcgaagag agcgaattg ggcgatgacgtc gaagccaatttc 624
Thr AlaPheGluGlu SerGluLeu G1yAspAspVal GluAlaAsnPhe
195 200 205
acc gccctgttcgcc cccgccatt cgtgcccgtctg gaggcccacctg 672
Thr AlaLeuPheAla ProAlaIle ArgAlaArgLeu GluAlaHisLeu
210 215 220
ccc ggtgtgactctc acagacgag gacgtgacctac ctcatggacatg 720
Pro GlyValThrLeu ThrAspGlu AspValThrTyr LeuMetAspMet
225 230 235 240
tgc cccttcgacacc gtcgcccgc acctccgacgcc accgagctgtcc 768
Cys ProPheAspThr ValAlaArg ThrSerAspAla ThrGluLeuSer
245 250 255
ccc ttctgtgacctg ttcacccat gacgaatggatc cagtacgactac 816
Pro PheCysAspLeu PheThrHis AspG1uTrpIle GlnTyrAspTyr
260 265 270
ctc cagtccttgaaa aagtattac ggccatggtgca ggtaacccgctc 864
Leu GlnSerLeuLys LysTyrTyr GlyHisG1yAla GlyAsnProLeu
275 280 285
ggc ccggcccagggc gtcggcttc getaacgagctc atcgcccgtctg 912
Gly ProAlaGlnGly ValGlyPhe AlaAsnGluLeu IleAlaArgLeu
290 295 300
acc cactcgcctgtc caggatcac accagtaccaac cacactttggac 960
Thr HisSerProVal GlnAspHis ThrSerThrAsn HisThrLeuAsp
305 310 315 320
tcg aacccggetacc tttccgctc aacgccactctc tac gacttt 1008
gcg
Ser AsnProAlaThr PheProLeu AsnAlaThrLeu Tyr AspPhe
Ala
325 330 ~ 335
tcg catgacaacggc atgatctcc attttctttget tta tac 1056
ggt
ctg
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Ser His Asp Asn Gly Met Ile Ser Ile Phe Phe Ala Leu Gly Leu Tyr
340 345 350
aacggcactaagccg ctatctaccacg tccgtggag tccatcgaggag 1104
AsnGlyThrLysPro LeuSerThrThr SerValGlu SerIleGluGlu
355 360 365
acagatggatactcg gcctcctggacg gttccgttt getgcccgtgcc 1152
ThrAspGlyTyrSer AlaSerTrpThr ValProPhe AlaAla.ArgAla
370 375 380
tacgtcgagatgatg cagtgtcaggcg gagaaggag ccgctggtccgt 1200
TyrValGluMetMet GlnCysGlnAla GluLysGlu ProLeuValArg
385 390 395 400
gtcttggttaatgat cgcgttgtcccg ctgcatggg tgtgccgttgat 1248
ValLeuValAsnAsp ArgValValPro LeuHisGly CysA1aValAsp
405 410 415
aagttggggagatgt acccgggatgac tttgtggag gggttgagcttt 1296
LysLeuGlyArgCys ThrArgAspAsp PheValGlu GlyLeuSerPhe
420 425 430
getagatccgggggt aactgggaggag tgttttget tag 1335
A1aArgSerGlyGly AsnTrpGluGlu CysPheAla
435 440
<210> 3
<21l> 444
<212> PRT
<213> PROTEIN PRODUCED FROM 2
SEQ
TD
<400> 3
Ala Ser Arg Asn Ser His Ser Cys Asp Thr Val Asp Gly Gly Tyr Gln
1 5 10 15
Cys Phe Pro Glu Ile Ser His Leu Trp G1y G1n Tyr Ser Pro Tyr Phe
20 25 30
Ser Leu Ala Asp Glu Ser Ala Ile Ser Pro Asp Val Pro A1a Gly Cys
35 40 45
Arg Val Thr Phe Val Gln Val Leu Ser Arg His Gly Ala Arg Tyr Pro
50 55 60
Thr Asp Ser Lys Ser Lys Lys Tyr Ser A1a Leu Ile Glu Ala Ile Gln
65 70 75 80
Lys Asn Ala Thr Ala Phe Lys Gly Lys Tyr Ala Phe Leu Lys Thr Tyr
85 90 95
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Asn Tyr Thr Leu Gly A1a Asp Asp Leu Thr Pro Phe Gly Glu Gln Gln
100 105 110
Met Val Asn Ser Gly Ile Lys Phe Tyr Arg Arg Tyr Lys Ala Leu Ala
115 120 125
Arg Asn Ile Val Pro Phe Ile Arg Ala Ser Gly Ser Ser Arg Val Ile
130 135 140
A1a Ser Ala Glu Lys Phe Ile Glu Gly Phe Gln Ser Ala Lys Leu Ala
145 150 155 160
Asp Pro Gly Ala Asn Pro Gly Gln Ala Ser Pro Val Ile Asp Val Tle
165 170 175
Tle Pro Glu Gly Ala Gly Tyr Asn Asn Thr Leu Asp His Gly Thr Cys
180 185 l90
Thr Ala Phe Glu Glu Ser Glu Leu Gly Asp Asp Val Glu Ala Asn Phe
195 200 205
Thr Ala Leu Phe Ala Pro Ala Ile Arg Ala Arg Leu Glu Ala His Leu
210 215 220
Pro Gly Val Thr Leu Thr Asp Glu Asp Va1 Thr Tyr Leu Met Asp Met
225 230 235 240
Cys Pro Phe Asp Thr Val Ala Arg Thr Ser Asp Ala Thr Glu Leu Ser
245 250 255
Pro Phe Cys Asp Leu Phe Thr His Asp Glu Trp Ile Gln Tyr Asp Tyr
260 265 270
Leu G1n Ser Leu Lys Lys Tyr Tyr Gly His G1y Ala Gly Asn Pro Leu
275 280 285
Gly Pro Ala G1n Gly Val Gly Phe Ala Asn Glu Leu Ile Ala Arg Leu
290 295 300
Thr His Ser Pro Val Gln Asp His Thr Ser Thr Asn His Thr Leu Asp
305 310 315 320
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Ser Asn Pro A1a Thr Phe Pro Leu Asn Ala Thr Leu Tyr Ala Asp Phe
325 330 335
Ser His Asp Asn Gly Met I1e Ser Tle Phe Phe Ala Leu Gly Leu Tyr
340 345 350
Asn Gly Thr Lys Pro Leu Ser Thr Thr Ser Val Glu Ser Ile Glu Glu
355 360 365
Thr Asp Gly Tyr Ser Ala Ser Trp Thr Val Pro Phe Ala Ala Arg Ala
370 375 380
Tyr Val Glu Met Met Gln Cys Gln Ala Glu Lys Glu Pro Leu Val Arg
385 390 395 400
Val Leu Va1 Asn Asp Arg Val Val Pro Leu His Gly Cys Ala Val Asp
405 410 415
Lys Leu Gly Arg Cys Thr Arg Asp Asp Phe Val Glu Gly Leu Ser Phe
420 425 430
Ala Arg Ser Gly Gly Asn Trp Glu Glu Cys Phe Ala
435 440
<210> 4
<211> 1335
<212> DNA
<213> SYNTHETIC DNA
<220>
<221> CDS
<222> (1)..(1335)
<223>
<400> 4
gcc tcg aga aat caa tcc agt tgc gat acg gtc gat ggc ggg tat caa 48
Ala Ser Arg Asn Gln Ser Ser Cys Asp Thr Val Asp Gly Gly Tyr Gln
1 5 l0 15
tgc ttc ccc gag atc tcg cat ctt tgg ggt caa tac tcc ccg tac ttc 96
Cys Phe Pro Glu I1e Ser His Leu Trp Gly G1n Tyr Ser Pro Tyr Phe
20 25 30
tct ctg gca gac gaa tcg gcc atc tcc cct gac gtg ccc gcc gga tgc 144
Ser Leu Ala Asp Glu Ser Ala 2le Ser Pro Asp Val Pro Ala Gly Cys
35 40 45
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
aga gtcactttcgtc caggtcctctcc cgtcatggagcg cggtatccg 192
Arg ValThrPheVa1 GlnValLeuSer ArgHisG1yAla ArgTyrPro
50 55 60
acc gactccaagtcc aagaaatactcc getctcattgag gccatccag 240
Thr AspSerLysSer LysLysTyrSer A1aLeuIleGlu AlaT1eGln
65 70 75 80
aag aacgcgaccgcc tttaagggaaaa tatgccttcctg aagacatac 288
Lys AsnAlaThrAla PheLysGlyLys TyrAlaPheLeu LysThrTyr
85 90 95
aac tacaccttgggt gcagatgacctg actcccttcgga gaacagcag 336
Asn TyrThrLeuGly AlaAspAspLeu ThrProPheGly GluGlnGln
100 105 110
atg gtc.aactccggc atcaagttctac cgccggtacaag gccctcgcc 384
Met ValAsnSerGly IleLysPheTyr ArgArgTyrLys AlaLeuAla
115 120 125
agg aacatcgttcca ttcatccgagcc tctggctccagc cgcgtgatc 432
Arg AsnIleValPro PheI1eArgAla SerGlySerSer Arg~ValIle
l30 135 140
gcc tccgccgagaaa ttcatcgagggc ttccagagcgcc aagctggcc 480
Ala SerAlaGluLys PheI1eGluGly PheGlnSerAla LysLeuAla
145 150 155 160
gat cctggcgccaac cccggccaagcc tcgcccgtcatc gacgtgatc 528
Asp ProGlyAlaAsn ProGlyGlnAla SerProValIle AspValIle
165 170 175
att cccgagggcgcc ggctacaacaac actctcgaccac ggcacctgc 576
T1e ProGluGlyAla GlyTyrAsnAsn ThrLeuAspHis GlyThrCys
180 185 190
act gccttcgaagag agcgaattgggc gat.gacgtcgaa gccaatttc 624
Thr AlaPheGluGlu SerGluLeuGly AspAspValGlu AlaAsnPhe
195 200 205
acc gccctgttcgcc cccgccattcgt gcccgtctggag gcccacctg 672
Thr AlaLeuPheAla ProAlaIleArg AlaArgLeuGlu AlaHisLeu
210 215 220
ccc ggtgtgactctc acagacgaggac gtgacctacctc atggacatg 720
Pro GlyValThrLeu ThrAspGluAsp ValThrTyrLeu MetAspMet
225 230 235 240
tgc cccttcgacacc gtcgcccgcacc tccgacgccacc gagctgtcc 768
Cys ProPheAspThr ValAlaArgThr SerAspA1aThr GluLeuSer
245 250 255
ccc ttctgtgacctg ttcacccatgac gaatggatccag tacgactac 816
Pro PheCysAspLeu PheThrHisAsp GluTrpIleGln TyrAspTyr
260 265 270
ctc cagtccttgaaa aagtattacggc catggtgcaggt aacccgctc 864
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Leu Gln Ser Leu Lys Lys Tyr Tyr Gly His Gly Ala Gly Asn Pro Leu
275 280 285
ggcccg gcccagggc gtc,ggcttcget aacgagctcatc gcccgtctg 912
GlyPro AlaGlnGly ValGlyPheA1a AsnGluLeuIle AlaArgLeu
290 295 300
acccac tcgcctgtc caggatcacacc agtaccaaccac actttggac 960
ThrHis SerProVal GlnAspHisThr SerThrAsnHis ThrLeuAsp
305 310 315 320
tcgaac ccggetacc tttccgctcaac gccactctctac gcggacttt 1008
SerAsn ProAlaThr PheProLeuAsn AlaThrLeuTyr AlaAspPhe
325 330 335
tcgcat gacaacggc atgatctccatt ttctttgettta ggtctgtac 1056
SerHis AspAsnGly MetIleSerIle PhePheAlaLeu GlyLeuTyr
340 345 350
aacggc actaagccg ctatctaccacg tccgtggagtcc atcgaggag 1104
AsnGly ThrLysPro LeuSerThrThr SerValGluSer IleGluGlu
355 360 365
acagat ggatactcg gcctcctggacg gttccgtttget gcccgtgcc 1152
ThrAsp GlyTyrSer AlaSerTrpThr ValProPheAla AlaArgAla
370 375 380
tacgtc gagatgatg cagtgtcaggcg gagaaggagccg ctggtccgt 1200
TyrVal G1uMetMet GlnCysGlnAla GluLysG1uPro LeuValArg
385 390 395 400
gtcttg gttaatgat cgcgttgtcccg ctgcatgggtgt gccgttgat 1248
ValLeu Va1AsnAsp ArgValValPro LeuHisG1yCys AlaValAsp
405 410 415
aagttg gggagatgt acccgggatgac tttgtggagggg ttgagcttt 1296
LysLeu GlyArgCys ThrArgAspAsp PheValGluGly LeuSerPhe
420 425 430
getaga tccgggggt aactgggaggag tgttttgettag 1335
AlaArg SerGlyGly AsnTrpGluGlu CysPheAla
435 440
<210> 5
<211> 444
<212> PRT
<213> PROTEINPRODUCED FROM Q 4
SE TD
<400> 5
Ala Ser Arg Asn Gln Ser Ser Cys Asp Thr Va1 Asp Gly Gly Tyr Gln
1 5 10 15
Cys Phe Pro Glu Ile Ser His Leu Trp G1y G1n Tyr Ser Pro Tyr Phe
20 25 30
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Ser Leu Ala Asp Glu Ser Ala Ile Ser Pro Asp Val Pro Ala Gly Cys.
35 40 45
Arg Val Thr Phe Val Gln Val Leu Ser Arg His Gly Ala Arg Tyr Pro
50 55 60
Thr Asp Ser Lys Ser Lys Lys Tyr Ser Ala Leu Ile G1u Ala Ile G1n
65 70 75 80
Lys Asn Ala Thr Ala Phe Lys Gly Lys Tyr Ala Phe Leu Lys Thr Tyr
85 90 95
Asn Tyr Thr Leu G1y Ala Asp Asp Leu Thr Pro Phe G1y Glu Gln Gln
100 105 110
Met Val Asn Ser Gly Tle Lys Phe Tyr Arg Arg Tyr Lys Ala Leu Ala
115 120 l25
Arg Asn Ile Val Pro Phe Ile Arg Ala Ser Gly 5er Ser Arg Val Ile
130 135 140
Ala Ser Ala Glu Lys Phe Ile G1u Gly Phe Gln Ser Ala Lys Leu Ala
l45 150 155 160
Asp Pro Gly Ala Asn Pro Gly Gln Ala Ser Pro Val Ile Asp Val Ile
165 170 175
Ile Pro Glu Gly Ala Gly Tyr Asn Asn Thr Leu Asp His Gly Thr Cys
180 185 190
Thr Ala Phe G1u Glu Ser Glu Leu Gly Asp Asp Val Glu Ala Asn Phe
195 200 205
Thr Ala Leu Phe Ala Pro Ala Ile Arg Ala Arg Leu Glu Ala His Leu
210 215 220
Pro Gly Val Thr Leu Thr Asp Glu Asp Val Thr Tyr Leu Met Asp Met
225 230 235 240
Cys Pro Phe Asp Thr Val Ala Arg Thr Ser Asp Ala Thr Glu Leu Ser
245 250 255
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Pro Phe Cys Asp Leu Phe Thr His Asp Glu Trp Ile Gln Tyr Asp Tyr
260 265 270
Leu Gln Ser Leu Lys Lys Tyr Tyr Gly His G1y Ala Gly Asn Pro Leu
275 280 285
Gly Pro Ala Gln Gly Va1 Gly Phe Ala Asn Glu Leu Ile Ala Arg Leu
290 295 300
Thr His Ser Pro Val Gln Asp His Thr Ser Thr Asn His Thr Leu Asp
305 310 3l5 320
Ser Asn Pro Ala Thr Phe Pro Leu Asn Ala Thr Leu Tyr Ala Asp Phe
325 330 335
Ser His Asp Asn Gly Met Ile Ser Ile Phe Phe Ala Leu Gly Leu Tyr
340 345 350
Asn Gly Thr Lys Pro Leu Ser Thr Thr Ser Val Glu Ser Ile Glu Glu
355 360 365
Thr Asp Gly Tyr Ser Ala Ser Trp Thr Val Pro Phe Ala Ala Arg Ala
370 375 380
Tyr Va1 Glu Met Met Gln Cys Gln Ala G1u Lys Glu Pro Leu Val Arg
385 390 395 400
Val Leu Val Asn Asp Arg Va1 Val Pro Leu His Gly Cys Ala Val Asp
405 410 415
Lys Leu Gly Arg Cys Thr Arg Asp Asp Phe Val Glu Gly Leu Ser Phe
420 425 430
Ala Arg Ser Gly Gly Asn Trp Glu Glu Cys Phe Ala
435 440
<210> 6
<211> 1335
<212> DNA
<213> SYNTHETIC DNA
<220>
<221> CDS
<222> (1)..(1335)
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
<223>
<400> 6
gcc tcgagaaatcaa tccagttgcgat acggtcgatggc gggtatcaa 48
Ala SerArgAsnGln SerSerCysAsp ThrValAspG1y GlyTyrGln
1 5 10 15
tgc ttccccgagatc tcgcatctttgg ggtcaatactcc ccgttcttc 96
Cys PheProG1uIle SerHisLeuTrp GlyG1nTyrSer ProPhePhe
20 25 30
tct ctggcagacgaa tcggccatctcc cctgacgtgccc gccggatgc 144
Ser LeuA1aAspGlu SerA1aIleSer ProAspValPro AlaGlyGys
35 40 45
aga gtcactttcgtc caggtcctctcc cgtcatggagcg cggtatccg 192
Arg ValThrPheVal GlnValLeuSer ArgHisGlyAla ArgTyrPro
50 55 60
acc gactccaagtcc aagaaatactcc getctcattgag gagatccag 240
Thr AspSerLysSer LysLysTyrSer AlaLeuIleGlu GluIleGln
65 70 75 80
aag aacgcgaccgcc tttaagggaaaa tatgccttcctg aagacatac 288
Lys AsnA1aThrAla PheLysGlyLys TyrA1aPheLeu LysThrTyr
85 90 95
aac tacaccttgggt gcagatgacctg actcccttcgga gaacagcag 336
Asn TyrThrLeuGly A1aAspAspLeu ThrProPheG1y G1uGlnGln
100 105 110
atg gtcaactccggc atcaagttctac cgccggtacaag gccctcgcc 384
Met ValAsnSerGly IleLysPheTyr ArgArgTyrLys A1aLeuAla
115 120 125
agg aacatcgttcca ttcatccgagcc tctggctccagc cgcgtgatc 432
Arg AsnI1eValPro PheTleArgAla SerG1ySerSer ArgValIle
130 135 140
gcc tccgccgagaaa ttcatcgagggc ttccagagcgcc aagctggcc 480
A1a SerAlaGluLys PheIleGluGly PheGlnSerAla LysLeuA1a
145 150 155 160
gat cctcgtgccaac cccggccaagcc tcgcccgtcatc gacgtgatc 528
Asp ProArgAlaAsn ProGlyGlnAla SerProValIle AspValI1e
165 170 175
att cccgaggccgcc tcatacaacaac actctcgaccac ggcacctgc 576
Ile ProGluAlaAla SerTyrAsnAsn ThrLeuAspHis GlyThrCys
180 185 190
act gtcttcgaagag agcgaattgggc gatgacgtcgaa gccaatttc 624
Thr ValPheGluGlu SerGluLeuGly AspAspValG1u AsnPhe
Ala
195 200 205
acc gccacgttcgcc ccctccattcgt gcccgtctg ctg 672
gag
gcc
cac
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Thr AlaThrPheAla ProSerIleArg AlaArgLeu Glu HisLeu
Ala
210 215 220
ccc ggtgtgactctc acagacgaggac gtgacctac ctcatggacatg 720
Pro GlyValThrLeu ThrAspGluAsp ValThrTyr LeuMetAspMet
225 230 235 240
tgc tccttcgacacc gtcgcccgcacc tccgacgcc accaagctgtcc 768
Cys SerPheAspThr ValAlaArgThr SerAspAla ThrLysLeuSer
245 250 255
ccc ttctgtgacctg ttcacccatgac gaatggatc aactacgactac 816
Pro PheCysAspLeu PheThrHisAsp GluTrpIle AsnTyrAspTyr
260 265 270
ctc cagtccttgaaa aagtattacggc catggtgca ggtaacccg.ctc 864
Leu GlnSerLeuLys LysTyrTyrGly HisGlyAla GlyAsnProLeu
275 280 285
ggc ccggcccagggc gtcggcttcget aacgagctc atcgcccgtctg 912
Gly ProAlaGlnGly ValGlyPheAla AsnGluLeu IleAlaArgLeu
290 295 300
acc cactcgcctgtc caggatcacacc agtaccaac cacactttggac 960
Thr HisSerProVal GlnAspHisThr SerThrAsn HisThrLeuAsp.
305 310 315 320
tcg aacccggetacc tttccgctcaac gccactctc tacgcggacttt 1008
Ser AsnProAlaThr PheProLeuAsn AlaThrLeu TyrAlaAspPhe
325 330 335
tcg catgacaacggc atgatctccatt ttctttget ttaggtctgtac 1056
Ser HisAspAsnGly MetIleSerIle PhePheAla LeuGlyLeuTyr
340 345 350
aac ggcactaagccg ctatctaccacg tccgtggag tccatcgaggag 1104
Asn GlyThrLysPro LeuSerThrThr SerValGlu SerIleG1uGlu
355 360 365
aca gatggatactcg gcctcctggacg gttccgttt getgcccgtgcc 1152
Thr AspG1yTyrSer AlaSerTrpThr ValProPhe AlaAlaArgAla
370 375 380
tac gtcgagatgatg cagtgtcaggcg gagaaggag ccgctggtccgt 1200
Tyr ValGluMetMet GlnCysGlnAla GluLysGlu ProLeuValArg
385 390 395 400
gtc ttggttaatgat cgcgttgtcccg ctgcatggg tgtccggttgat ~ 1248
Val LeuValAsnAsp ArgValValPro LeuHisGly CysProValAsp
405 410 415
aag ttggggagatgt acccgggatgac tttgtgagg gggttgagcttt 1296
Lys LeuGlyArgCys ThrArgAspAsp PheValArg GlyLeuSerPhe
420 425 430
get agatccgggggt aactgggaggag tgttttget tag 1335
Ala ArgSerGlyGly AsnTrpGluGlu CysPhe
Ala
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
435 440
<210> 7
<211> 444
<212> PRT
<213> PROTEIN PRODUCED FROM SEQ ID 6
<400> 7
Ala Ser Arg Asn Gln Ser Ser Cys Asp Thr Val Asp Gly Gly Tyr Gln
1 5 10 15
Cys Phe Pro Glu Ile Ser His Leu Trp Gly Gln Tyr Ser Pro Phe Phe
20 25 30
Ser Leu Ala Asp Glu Ser Ala Ile Ser Pro Asp Val Pro Ala G1y Cys
35 40 45
Arg Val Thr Phe Val Gln Val Leu Ser Arg His Gly Ala Arg Tyr Pro
50 55
Thr Asp Ser Lys Ser Lys Lys Tyr Ser Ala Leu Ile Glu Glu Ile Gln
65 70 75 80
Lys Asn Ala Thr Ala Phe Lys Gly Lys Tyr Ala Phe Leu Lys Thr Tyr
85 90 95
Asn Tyr Thr Leu Gly Ala Asp Asp Leu Thr Pro Phe Gly Glu G1n Gln
100 105 110
Met Val Asn Ser Gly Tle Lys Phe Tyr Arg Arg Tyr Lys Ala Leu Ala
115 120 125
Arg Asn Ile Val Pro Phe Ile Arg Ala Ser G1y Ser Ser Arg Val 21e
130 135 140
Ala Ser Ala Glu Lys Phe Ile Glu Gly Phe Gln Ser Ala Lys Leu Ala
145 150 155 160
Asp Pro Arg A1a Asn Pro Gly Gln Ala Ser Pro Val Ile Asp Val Tle
165 170 175
Ile Pro Glu Ala Ala Ser Tyr Asn Asn Thr Leu Asp His Gly Thr Cys
180 185 190
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Thr Val Phe Glu Glu Ser Glu Leu Gly Asp Asp Val Glu Ala Asn Phe
195 200 205
Thr Ala Thr Phe Ala Pro Ser Ile Arg Ala Arg Leu Glu Ala His Leu
210 215 220
Pro Gly Val Thr Leu Thr Asp G1u Asp Val Thr Tyr Leu Met Asp Met
225 230 235 240
Cys Ser Phe Asp Thr Va1 Ala Arg Thr Ser Asp Ala Thr Lys Leu Ser
245 250 255
Pro Phe Cys Asp Leu Phe Thr His Asp Glu Trp I1e Asn Tyr Asp Tyr
260 265 270
Leu Gln Ser Leu Lys Lys Tyr Tyr Gly His Gly Ala G1y Asn Pro Leu
275 280 285
Gly Pro Ala Gln Gly Val Gly Phe Ala Asn Glu Leu Ile Ala Arg Leu
290 295 300
Thr His Ser Pro Val Gln Asp His Thr Ser Thr Asn His Thr Leu Asp
305 310 315 320
Ser Asn Pro Ala Thr Phe Pro Leu Asn A1a Thr Leu Tyr Ala Asp Phe
325 330 335
Ser His Asp Asn Gly Met Ile Ser Ile Phe Phe Ala Leu Gly Leu Tyr
340 345 350
Asn Gly Thr Lys Pro Leu Ser Thr Thr Ser Va1 Glu Ser Ile Glu G1u
355 360 365
Thr Asp Gly Tyr Ser Ala Ser Trp Thr Val Pro Phe A1a Ala Arg A1a
370 375 380
Tyr Val Glu Met Met Gln Cys Gln Ala Glu Lys Glu Pro Leu Val Arg
385 390 395 400
Val Leu Val Asn Asp Arg Val Val Pro Leu His Gly Cys Pro Val Asp
405 410 415
CA 02485513 2004-11-09
WO 03/102174 PCT/EP03/05729
Lys Leu Gly Arg Cys Thr Arg Asp Asp Phe Val Arg Gly Leu Ser Phe
420 425 430
Ala Arg Ser Gly Gly Asn Trp Glu G1u Cys Phe Ala
435 440
