Note: Descriptions are shown in the official language in which they were submitted.
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
s Immunomodulation Using Altered Dendritic Cells
Field of the Invention
The invention relates to altered immune cells and their use in methods
to alter the immune system in a mammal. More specifically, the invention is
to directed to the alteration of gene expression in dendritic cells (D~C) and
their
use in various methods to alter T cell activity for the treatment of a variety
of
immune disorders.
Background of the Invention
is Throughout this application, various references are cited in parentheses
to describe more fully the state of the art to which this invention pertains.
Full
bibliographic information for each citation is found at the end of the
specification,
immediately preceding the claims. The disclosure of these references are
hereby incorporated by reference into the present disclosure.
2o Dendritic cells (DC) are the most potent antigen presenting cell (APC)
endowed with the unique ability to stimulate and polarize naive T cells to
either Th1 or Th2 phenotypes (Maldonado-Lopez, R. et al., 2001.13:275). DC
also play a critical role in the maintenance of self tolerance by curtailing T
cell
responses directly or indirectly through the generation of T regulatory cells
2s (Belt, G. T., et al., 2002. Immunol Cell Biol 80:463; Mahnke, K., et al.,
2002.
Immunol Cell Biol 80:477; Min W.P. et al., J. Immunol. in press). The
difference between DC subsets that stimulate and those that suppress
immune responses seems to reside in the expression of co-stimulatory
molecules and cytokines (Jonuleit, H., et al., 2001. Trends Immunol 22:394;
3o Lu, L., et al., 2002. Transplantation 73:S19). The subset of DC called
tolerogenic DC (Tol-DC) have a distinct phenotype, suppress activation of
conventional T cells and activate T regulatory cells (Treg) in an antigen-
specific manner (Chang, C.C. et al., 2002. Nat Immunol. Mar;3(3), 237-43;
Gilliet M., et al., 2002. J. Exp. Med. Mar 18;195(6):695-704; Roncarlo, M.G.
et
i
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
al., 2001. J. Exp. Med. Jan 15;193(2):F5-9; Kawahata, K., et al., 2002. Feb 1;
168(3):1103-12.). Tol-DC possess reduced expression of the co-stimulatory
molecules CD40, CD80 and CD86 and reduced ability to secrete T cell
activating cytokines such as interleukin-12. Generally, expression of
s interleukin-12 (IL-12) seems to stimulate Th1 activation (O'Garra, A., et
al.,
1995. Res Immunol. 146:466), whereas production of IL-10 by DC stimulates
Th2 activation (Liu, L., et al., 1998. Int Immunol 10:1017), and in some cases
regulatory T cell generation (Akbari, O., et al., 2001. Nat Immunol 2:725;
McGuirk, P., et al., 2002. J. Exp Med 195:221 ). Understanding this duality in
to function has led to DC based immunotherapies, which have been used to
potentiate T cell responses (in the case of cancer vaccines) or diminish them
(in autoimmune disorders and transplantation) (Pardoll, D. M. 1998. Cancer
Vaccines. Nat Med 4:525; Morel, P.A. et al., 2001. Trends Immunol. 22:546;
Prud'homme, G. J. 2000. J Gene Med 2:222).
~s Tolerogenic DC are generally in an immature state exemplified by
suppressed expression of co-stimulatory molecules and IL-12. Various
agents have been used to inhibit maturation of DC in order to promote
tolerance. These agents are used to generate DC that express lower levels of
co-stimulatory molecules. The proteosome inhibitor PSI (N-
2o benzyloxycarbonyl-Ile-Glu(O-tert-butyl)-Ala-leucinal) blocks NF-KB
activation
and results in the in vitro production of tolerogenic DC (Yoshimura, S., et
al.,
2001. Eur J. Immunol. 2001 Jun;31 (6):1883-93). N-acetylcysteine is an
antioxidant which similarly blocks NF-KB activation and generates immature,
tolerogenic dendritic cells (Verhasselt. V., et al., 1999. J. Immunol. Mar
2s 1;162(5): 2569-74). Vitamin D3 also inhibits dendritic cell maturation and
leads to production of tolerogenic dendritic cells (Piemonti L., et al., 2000.
J.
Immunol. May 1;164(9):4443-51). A disadvantage of using such agents is that
there is no direct control of the resulting DC phenotype. Furthermore, DC
exhibit plasticity in an in vivo environment which is disadvantageous for
using
so DC directly in immunotherapy. Therefore the ability to generate DC with a
specific phenotype and function would be advantageous.
Post-Transcriptional gene silencing is a mechanism that functions to
inhibit viral replication in many eukaryotic organisms (Hannon, G.J. 2002.
RNA Interference. Nature 418:244; Cogoni, C., et al., 2000. Curr Opin Genet
2
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
Dev 10:638). This process is mediated by double stranded RNA (dsRNA) and
can evoke many cellular reactions including the non-specific inhibition of
protein synthesis seen in the interferon response of mammalian cells (Levy,
D. E. et al., 2001. Cytokine Growth Factor Rev 12:143). It has recently been
s discovered that short sequences of RNA that are 21 nucleotides in length
(known as small interfering RNA or siRNA) can bypass the broad suppression
of the interferon response and can lead to the specific degradation of cognate
mRNA (Elbashir, S. M., et al., 2001. Nature 411:494; Moss, E.G. 2001. Curr
Biol 11:R772). This process, known as RNA interference (RNAi), is specific
to as a single substitution in the 21 nucleotide sequence can abrogate its
effects,
and is extremely efficient, since the siRNA is incorporated into an enzymatic
complex that conducts multiple rounds of target mRNA degradation (Tuschl,
T. 2002. Nat Biotechnol 20:446). As such, RNAi provides a useful tool for
inhibiting endogenous gene expression, and could provide a means to
is effectively modulate immune responses. Various methods of RNAi have been
described for the altering gene expression in plant cells, drosophila and
human melanoma cells as is described for example in U.S. Patent Application
No. 2002/0162126A1, PCT/US01/10188, PCT/EP01/13968 and U.S. Patent
Application No. 2002/0173478A1.
20 In general, RNA interference has been found to be unpredictable with
low efficiency when used in vertebrate species (Fjose et al., Biotechnol.
Annu.
Rev. 7:31-57, 2001). Methods of RNA interference have not been previously
contemplated for use in the transformation of immune cells and in particular
the transformation of antigen presenting cells (APC) such as dendritic cells
2s (DC) to produce a desired stable phenotype that can be further used in
vitro,
ex vivo and/or in vivo methods for the modulation of immune responses via
the inhibition or stimulation of T cell activity. Furthermore, immune cells
specifically designed to silence and thus suppress the expression of specific
endogenous genes to affect T cell functioning have not been previously
3o contemplated, nor contemplated for use in methods of treating immune
disorders.
Summary of the Invention
3
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
The present invention provides immune cells that exhibit a targeted
gene-specific knockout phenotype that can be used therapeutically to
modulate immune responses in a mammal. More specifically, the present
invention provides altered DC that do not express one or more genes
encoding a molecule involved in DC activity, and as such, suppress or
stimulate immune system functioning via the modulation of T cell activity.
The present invention also encompasses therapeutic methods for the
treatment of a variety of immune disorders with the use of the altered DC. In
embodiments of the invention, the DC may be transfected in vitro to produce a
to desired DC phenotype and then either used ex vivo or alternatively used in
vivo as administered to a mammalian subject.
According to an aspect of the present invention there is provided a
mammalian immune cell that exhibits a targeted gene-specific knockout
phenotype, said immune cell being capable of altering an immune response in
is a mammal via the modulation of T cell activity. In embodiments, the immune
cell may be selected from an endothelial cell or an antigen presenting cell
(APC). In more preferred embodiments, the immune cells is an APC selected
from the group consisting of DC, macrophages, myeloid cells, B lymphocytes
and mixtures thereof.
2o According to an aspect of the invention is a mammalian immune cell
exhibiting a targeted endogenous gene-specific knockout phenotype, said
immune cell altering an immune response in a mammal via the modulation of
T cell activity
According to another aspect of the present invention is a mammalian
2s immune cell that exhibits a targeted gene-specific knockout phenotype,
wherein said gene is selected from one or more of a surface marker, a
chemokine, a cytokine, an enzyme and a transcriptional factor.
According to another aspect of the present invention is an APC which
does not express one or more of a surface marker, a chemokine, a cytokine,
3o an enzyme and a transcriptional factor. In an embodiment of the invention,
the APC is a DC.
According to another aspect of the present invention is a dendritic cell
(DC) which contains at least one double-stranded RNA molecule capable of
inhibiting the expression of an endogenous target gene encoding a molecule
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
selected from the group consisting of a surface marker, a chemokine, a
cytokine, an enzyme, a transcriptional factor and combinations thereof.
According to another aspect of the present invention is a tolerogenic
dendritic cell (DC) which contains at least one double-stranded RNA molecule
s capable of inhibiting the expression of IL-12.
According to a further aspect of the invention is the use of a mammalian
immune cell that exhibits a targeted gene-specific knockout phenotype,
wherein said gene is selected from one or more of a surface marker, a
chemokine, a cytokine, an enzyme and a transcriptional factor, in a
io medicament for the treatment of an immune disorder characterized by
inappropriate T cell activity.
According to another aspect of the invention is the use of a siRNA
possessing specific homology to part or the entire exon region of a gene
encoding a surface marker, a chemokine, a cytokine, an enzyme or a
is transcriptional factor of an antigen presenting cell (APC), in a medicament
for
the treatment of an immune disorder characterized by inappropriate T cell
activity.
According to yet another aspect of the invention is a composition for the
treatment of an immune disorder, said composition comprising at least one of:
20 (a) a construct that inhibits the expression of an endogenous target
gene encoding a surface marker, a chemokine, a cytokine, an enzyme or a
transcriptional factor in an immune cell such that said immune cell alters T
cell
activity; and
(b) an immune cell wherein said immune cell comprises at least one
2s construct that inhibits the expression of an endogenous target gene
encoding
a surface marker, a chemokine, a cytokine, an enzyme or a transcriptional
factor,; and
(c) a pharmaceutically acceptable carrier,
wherein said composition alters T cell activity leading to an altered
3o immune response.
According to another aspect of the invention is a method for inhibiting
the T cell activating ability of a DC, the method comprising transforming said
DC with a constructcapable of inhibiting the expression of an endogenous
s
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
target gene encoding a surface marker, a chemokine, a cytokine, an enzyme
or a transcriptional factor.
According to still a further aspect of the invention is a method for
decreasing the immunogenicity and rejection potential of an organ for
s . transplantation, said method comprising perfusing said organ with a
composition that suppresses T cell activity, said composition comprising at
least one construct that inhibits the expression of an endogenous target gene
encoding a surface marker, a chemokine, a cytokine, an enzyme or a
transcriptional factor and a pharmaceutically acceptable carrier.
to According to another aspect of the invention is a method for making an
immune cell that alters the activity of T cells in vivo, said method
comprising;
- transforming immune cells in vitro with at least one construct that
inhibits the expression of an endogenous target gene encoding a surface
marker, a chemokine, a cytokine, an enzyme or a transcriptional factor.
is According to yet another aspect of the invention is method for the
treatment of autoimmune disorders and transplantation rejection in a
mammalian subject, said method comprising administering a therapeutically
effective amount of a composition to said subject, said composition
comprising DC that contain at least one construct that inhibits the expression
20 of an endogenous target gene encoding a surface marker, a chemokine, a
cytokine, an enzyme or a transcriptional factor, wherein said DC suppresses T
cell activity.
According to another aspect of the invention is a method for the
treatment of autoimmune disorders and transplantation rejection in a
2s mammalian subject, said method comprising administering a therapeutically
effective amount of a composition to said subject, said composition
comprising an siRNA targeted to inhibit expression of an endogenous target
gene in an antigen presenting cell, said gene encoding a surface marker, a
chemokine, a cytokine, an enzyme or a transcriptional factor, wherein said
3o siRNA suppresses T cell activity.
In aspects of the invention the construct may be any suitable construct
that can be used to target and silence a particular gene of interest. In
embodiments, the construct is siRNA or hybrid DNA/RNA provided alone or
within a suitable vector or plasmid.
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
Other features and advantages of the present invention will become
apparent from the following detailed description. It should be understood,
however, that the detailed description and the specific examples while
indicating embodiments of the invention are given by way of illustration only,
s since various changes and modifications within the spirit and scope of the
invention will become apparent to those skilled in the art from the detailed
description.
Brief Description of the Drawings
to Preferred embodiments of the present invention will now be described
more fully with reference to the accompanying drawings:
Figure 1 shows the efficacy of DC siRNA transfection. Day 7 bone
marrow derived DC (1 x 106) were transfected with unlabeled control siRNA
is (Ctrl-siRNA, left), or fluorescein labelled siRNA specific for luciferase
GL2
duplex (FI-siRNA, middle) at 60 pM concentration. FI-siRNA was also added
to day 4-cultured DC without transfection reagents (Phagocytosis, right). DC
were activated with LPS/TNFa on day 8 and the transfection efficacy was
assessed by flow cytometry on day 9. Data are representative of three
2o independent experiments.
Figure 2 shows that DC viability is not affected by siRNA transfection.
DC cultured from bone marrow progenitors and 1 x 106 day-7 immature DC
were left untreated or were transfected with GenePorter alone, siRNA-
2s IL12p35 alone, or the combination of both for 48 hrs. Percentage apoptosis
and necrosis was assessed using annexin-V and propidium iodine (Pl),
respectively, by flow cytometry. Data are representative of three independent
experiments,
3o Figure 3 shows that siRNA transfection of DC does not alter nor induce
DC maturation, In panel 3A immature DC (1 x 106) were cultured alone
(untransfected), pre-treated for 24 hrs with GenePorter (mock transfected), or
transfected with 60 pM siRNA-IL12p35. The transfected DC were
7
SUBSTITUTE SHEET (RULE 26)
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
subsequently activated for 24 hrs with 10 ng/ml LPS and 10 ng/ml TNF-a,.
Maturation was assessed by expression of CD11 c, MHC II, CD40, and CD86
by flow cytometry using FITC-conjugated antibodies (solid line), and isotype
controls (broken line). In panel 3B immature DC (1 x 106) were untreated
s (untransfected), treated with GenePorter alone (mock transfected) or
transfected with 60 pM siRNA-IL12p35 for 24 hrs at which time maturation
was assessed by expression of CD11c, MHC II, CD40, and CD86 by flow
cytometry using FITC-conjugated antibodies (solid line), and isotype controls
(broken line). Data are representative of three independently performed
to experiments.
Figure 4 shows the specificity of gene inhibition by siRNA. DC (1 x
106) were transfected with 60 pM siRNA-IL12p35, siRNA-IL12p40 or
Geneporter alone (mock transfected). The transfected DC were activated
is with 10 ng/ml LPS and 10 ng/ml TNF-a for 24 hrs. RNA from the treated DC
was extracted by the Trizol method. RT-PCR was performed to assess
expression of IL-12p35, IL-12p40 and GAPDH using primers described in the
examples section. Data are representative of three independent experiments.
20 Figure 5 shows that siRNA-IL12p35 transfection of DC specifically
blocks IL-12 and upregulates IL-10. DC (1 x 106) were unmanipulated
(control), transfected with Geneporter alone (mock transfected), transfected
with 60 pM siRNA-IL12p35, or 60 pM siRNA-IFNy (siRNA control). The
transfected DC were activated with 10 ng/ml LPS and 10 ng/ml TNFa, for 24
2s hrs. In panel 5A the supernatants were harvested from cultures and analyzed
for IL12 p70 production using ELISA. In panel 5B the supernatants were
harvested from cultures and analyzed for IL-10 production using ELISA. Data
represent mean + SEM and are representative of three experiments (*, p <
0.01; by one-way ANOVA and Newman-Keuls test).
Figure 6 shows that siRNA-IL12p35 transfection inhibits DC
allostimulatory ability. C57BL/6 derived DC (1 x 106) were untreated
(untransfected,0), transfected with GenePorter alone (mock transfected, 0),
8
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
transfected with 60 pM siRNA-IFNy (control siRNA, 0) or transfected with 60
pM siRNA-IL12p35 (~) for 24 hrs. Allogeneic (BALB/c) T cells (2 x 105/well)
were incubated with siRNA-treated DC at the indicated numbers for 72 hrs.
Proliferation was determined using [3H]-thymidine incorporation. Data are
s representative of three independent experiments. (* p < 0.01; by one-way
ANOVA and Newman-Keuls test).
Figure 7 shows that siRNA-IL12p35-transfected DC promote Th2
polarization. In panel 7A C57/BL6 bone marrow derived DC were pretreated
to with GenePorter alone (mock transfected), transfected with 60 pM siRNA-
IL12p35 for 24 hrs. Subsequently siRNA-treated DC (106) were cultured with
allogeneic (BALB/c) T cells (10 x 106) for 48 hrs. T cells were purified from
co-culture using a T cell column and RT-PCR was performed for IL-4, IFN-y,
and GAPDH. In panel 7B C57/BL6 bone marrow derived DC were
is unmanipulated (control), pretreated with GenePorter alone (mock
transfected), transfected with 60 pM siRNA-IL12p35, or 60 pM siRNA-IFN-y
(siRNA control) for 24 hrs. siRNA-treated DC (106) were subsequently
cultured with allogeneic (BALB/c) T cells 10 x 106) for 48 hrs. Supernatants
were collected from the cultures and IFN-y (Th1 cytokine) and IL-4 (Th2
2o cytokine) production was assessed by ELISA. (* p < 0.01; by one-way ANOVA
and Newman-Keuls test).
Figure 8 shows that siRNA-IL12p35-treated DC stimulate antigen-
specific Th2 and inhibit Th1 responses in vivo. Day 7 bone marrow derived
2s DC cultured in GM-CSF and IL-4 were transfected with IL12p35-siRNA, or
mock transfected. Subsequently cells were pulsed with 10~.g/ml of KLH for 24
hrs and injected subcutaneously (5 x 105 cells/mouse) into syngeneic
C57BL/6 mice. After 10 days, T cells from lymph nodes were isolated from
recipient mice. A KLH-specific recall response was performed as described in
3o the example section. IFN-y and IL-4 response to KLH was assessed by
ELISA. Data shown are pooled from 3 independent experiments.
Detailed Description of the Preferred Embodiments
9
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
The present invention provides transformed immune cells that exhibit a
gene specific targeted knock-out phenotype. Such transformed immune cells
can be used in a variety of therapeutic in vitro, ex vivo and in vivo methods
to
modulate T cell activity and thus have use in therapeutic approaches for the
s treatment of immune disorders in mammalian subjects.
The immune cells of the invention exhibit a targeted gene-specific
knockout phenotype which imay be accomplished using any technique that
provides for the targeted silencing of an endogenous gene. In one aspect of
the invention the technique of RNAi (RNA interference) was used to create
io transformed immune cells suitable for use for the modulation of T cell
activity
in vitro, ex vivo or in vivo. In this aspect, the immune Bells are transfected
with a siRNA (small interfering RNA) designed to target and thus to degrade a
desired mRNA in order not to express the encoded protein that is involved in
T cell activity. Thus such transfected immune cells may be used to suppress
is or stimulate immune system functioning via the modulation of T cell
activity. It
is understood by those of skill in the art that any method for silencing a
specific gene may be used in the present invention. Representative
examples of suitable techniques include but are not limited to RNAi and hybrid
DNA/RNA constructs. The hybrid DNA/RNA constructs are essentially siRNA
2o constructs in which the nucleic acid composition used for silencing is
altered
to include DNA (Lamberton J. and Christian A. 2003. Mol. Biotechnol.
Jun;24(2):111-20, the entirety of the disclosure is incorporated herein by
reference).
It is desirable to modulate T cell activity, ie. suppress T cell activity in a
2s variety of immune disorders selected but not limited to the group
consisting of
septic shock, rheumatoid arthritis, transplant rejection, scleroderma, immune
mediated diabetes, chronic inflammatory bowel syndrome, HIV, cancer,
colitis, Crohn's disease, Goodpasture's syndrome, Multiple Sclerosis, Grave's
disease, Hashimoto's thyroditis, Autoimmune pernicious anemia, Autoimmune
3o Addison's disease, Vitiligo, Myasthenia gravis, Scleroderma, Systemic lupus
erythematosus, Primary Sjogren's syndrome,,Polymyositis, Pemphigus
vulgaris, Ankylosing spondylitis, Acute anterior uveitis, Hypoglycemia and
inflammation associated with chronic illness. Thus the siRNA, transfected
immune cells and compositions containing such can be used in methods to
io
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
treat the aforementioned immune disorders by the down regulation of T cell
activity leading to a prevention or decrease in an autoimmune response and
prevention of tissue/organ rejection.
Immune cells for use in the present invention may be selected from
s antigen presenting cells (APC) and endothelial cells. Both APC and
endothelial cells (Limmer A., et al., 2001. Arch Immunol Ther Exp (Warsz).
Suppl 1:S7-11; Perez V/L., et al., 1998. Cell Immunol. Oct 10;189(1):31-40)
are known to be able to activate T cells. In preferred embodiments of the
invention, the immune cells are APC that may be selected from the group
to consisting of macrophages, myeloid cells, B lymphocytes, DC and mixtures
thereof. It is also within the scope of the present invention to use other APC
capable of activating T cells through the T cell receptor as is understood by
one of skill in the art. In particularly preferred embodiments of the
invention,
the immune cell is a DC. APC such as DC are known to be phagocytic in
is nature and thus tend to take up molecules within their environment. In the
present invention DC is specifically demonstrated to be successfully altered
with siRNA to exhibit a stable phenotype. Therefore one of skill in the art
would readily understand that any APC may be altered in accordance with the
present invention and used in the methods of the invention. It is also
2o understood that a combination of different types of immune cells may be
used
in the methods of the present invention.
According to an embodiment of the invention, DC are transformed with
a designed siRNA. In this embodiment DC must be isolated from a subject
and expanded in vitro. DC are typically derived from a source such as bone
2s marrow, peripheral blood, spleen and lymph. Blood is the preferred source
of
DC because it is readily accessible and may be obtained in large quantities.
Substances which stimulate hematopoiesis (i.e. G-CSF and GM-CSF) may be
first administered to the subject in order to increase the number of DC. Blood
is treated to isolate the DC from other cell types by standard methods known
3o in the art. Isolated DC cultured in vitro may be treated with cytokines to
increase their number. Methods for isolating and ex vivo culture of DC are
known in the art and described for example in U.S. 5,199,942, 5,851,756,
6,017,527, 6,251,665, 6,458,585 and 6,475,483 (the disclosures of which are
incorporated herein by reference in their entirety).
m
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
The present invention also encompasses therapeutic methods for the
treatment of a variety of immune disorders in a mammalian subject. The
methods may involve the use of a siRNA designed for use directly in vivo to
block the expression of a gene by an immune cell, the gene expressing a
protein involved in the activity of T cells which elicits an immune disorder.
Alternatively, the methods may involve the use of an immune cell which
contains at least one double-stranded RNA molecule (siRNA) that inhibits the
expression of an endogenous target gene encoding a surface marker, a
chemokine, a cytokine, an enzyme or a transcriptional factor. In preferred
io embodiments of the invention, the methods of the invention comprise the use
of an altered (i.e. transformed) DC that contains a double-stranded RNA
molecule that inhibits the expression of an endogenous target gene encoding
a surface marker, a chemokine, a cytokine, an enzyme or a transcriptional
factor. Still in other embodiments, the therapeutic method may involve ex vivo
Is treatment of tissues and/or organs intended for transplantation. In aspects
of
the invention, the siRNA possesses specific homology to part or to the entire
exon region of a surface marker, a chemokine, a cytokine, an enzyme or a
transcriptional factor normally expressed by the immune cell such that the
gene is silenced
2o It is understood by one of skill in the art that the siRNA as herein
described may also include altered siRNA that is a hybrid DNA/RNA construct
or ariy equivalent thereof.
In preferred embodiments of the invention the transfected DC cells are
prepared by the method of RNAi. RNA interference is a mechanism of post-
2s transcriptional gene silencing. Specific gene silencing is mediated by
short
strands of duplex RNA of approximately 21 nucleotides in length (termed
small interfering RNA or siRNA) that target the cognate mRNA sequence for
degradation. While many techniques have been used to block specific
molecules in vitro and in vivo, such as anti-sense oligonucleotides (Gerwitz,
3o A. M. 1999. Curr Opin Mol Ther 1:297) and monoclonal antibodies (Drewe, E.,
et al., 2002. J Clin Pathol 55:81 ), RNAi was used in the present invention
because it provides several distinct advantages. First, mRNA degradation by
siRNA is extremely efficient as only a few copies of dsRNA are necessary to
activate the RNA induced silencing complex (RISC) (Martinet, J. A. et al.,
i2
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
2002. Cell 10:563). Once RISC is activated it can conduct multiple rounds of
gene-specific mRNA cleavage. Second, RNAi is specific, in that only
sequences with identity to one of the strands of dsRNA will be cleaved
(Hannon, G. J. 2002. Nature 41.8:244). Third, the RNAi effect is long lasting
s and can be spread to progeny cells after replication, although a dilution
effect
is evident in mammalian cells (Fire, A., et al., 1998. Nature 391:806). This
technique is relatively simple, giving rise to an in vitro knock down
phenotype
within days that can be confirmed with many antibody based detection
systems (such as ELISA or Western Blotting), or if an antibody is not
to available, by RT-PCR or functional assays.
DC may be transformed with siRNA alone, siRNA contained within a
plasmid or vector that results in the production of the siRNA, siRNA contained
within a plasmid or vector that further expresses a selected antigen and
siRNA together with a mRNA from a tumor cell. In the case of the plasmid or
is vector further expressing a selected antigen, the DC will process or modify
the
antigen in a manner~to promote the stimulation of T cell activity by the
processed or modified antigens. Methods for making siRNA and cell
transformation are described for example in U.S. Patent Application
2002/0173478, U.S. Patent Application 2002/0162126, PCT/US01/10188,
2o PCT/EP01/13968 and in Simeoni F., et al., 2003 Nucleic Acids Res Jun
1;31 (11 ):2717-24 (the disclosures of which are incorporated herein in their
entirety). Methods for producing antigen pulsed DC are known and
exemplified for example in U.S. 6,497,876 and U.S. 6,479,286 (the
disclosures of which are incorporated herein by reference in their entirety).
2s Methods for making siRNA plasmids or vectors are also known and described
for example in U.S. Patent Application 2003/0104401, in Morris M.C., et al.,
1997. Nucleic Acid Res. Jul 15:25(14):2730-6 and in Van De Wetering M., et
al., 2003, EMBO Jun;4(6):609-15 (tfie disclosures of which are incorporated
herein in their entirety). Suitable lipid-based vectors may include but are
not
30 limited to lipofectamine, lipofectin, oligofectamine and GenePorterTM
Methods for producing tumor derived RNA for pulsing DC are also known to
those of skill in the art and are described for example in U.S. Patent
Application 2002/0018769 (the disclosure of which is incorporated herein in
its
entirety).
13
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
In embodiments of the invention, DC are transformed to contain a
double-stranded RNA molecule that inhibits the expression of an endogenous
target gene encoding a protein that either suppresses T cell activation or
alternatively stimulates T cell activation. For the suppression of T cell
s activation, the immune cells of the invention are transformed with a double-
stranded RNA molecule that inhibits the expression of a gene that encodes a
co-stimulatory molecule, cytokine, adhesion molecule, enzyme or transcription
factor. Representative examples of such co-stimulatory molecules, cytokines,
adhesion molecules, enzymes and transcription factors may be selected from
to the group consisting of TNFa, IL-1, IL-1b, IL-2, TNF~i, IL-6, IL-7, IL-8,
IL-23,
IL-15, IL18, IL-12, IFNy, IFNa, lymphotoxin, DEC-25, CD11c, CD40, CD80,
CD86, MHCI, MHCII, ICAM-1, TRANCE, CD200, CD200 receptor, CD83,
CD2, CD44, CD91, TLR-4, TLR-9, 4-1BBL, nicotinic receptor, GITR-L, OX-
40L, CD-CK1, TARC/CCL17, CCL3, CCL4, CXCL9, CXCL10, IKK-~, NF-~B,
is STAT4, ICSBP/IFN, regulatory factor 8, TRAIL, Inos, arginase, FcgammaRl
and II, thrombin, MIP-1 a and MIP-1 B.
For the activation of T cells where such activation is desired, the
immune cells of the invention are transformed with a double-stranded RNA
molecule that inhibits the expression of a gene encoding a surface marker or
2o enzyme that suppresses T cell activation. Representative examples of such
surface markers and enzymes may be selected from the group consisting of
B7-H1, EP2, IL-10 receptor, VEGF-receptor, CD101, PD-L1, PD-L2, HLA-11,
DEC-205, CD36 and indoleamine 2,3-dioxygenase. It may be desirable to
activate T cells in a variety of conditions associated with immune suppression
2s such as but not limited to cancer, HIV and parasitic infections. Where
immune suppression is present, it is desirable to use the cells and methods of
the invention to increase T cell activity leading to an enhanced immune
response (Curiel T.J., et. AL, 2003. Nat Med May;9(5):562-7).
It is within the scope of the invention to transform a selected immune
3o cell with more than one double-stranded RNA molecule (an siRNA) or hybrid
DNA/RNA in order to simultaneously inhibit the expression of more than one
endogenous gene normally expressed by the immune cell. The number of
double-stranded RNA molecules transformed into any given immune cell
14
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
being dependent on the resultant extent of inhibition of the expression of the
target gene which is readily determined as is understood by one of skill in
the
art.
In the present invention in one embodiment, the induction of RNAi in DC
s was conducted using siRNA specific for IL-12 p35 (siRNA-IL12p35). It was
demonstrated that bioactive IL-12 p70 production in bone marrow-derived DC
was inhibited after stimulation with LPS and TNF-a, and was accompanied by
an increase in IL-10 production. Moreover, when siRNA-IL12p35-treated DC
were cultured with allogeneic T cells, a Th2 polarization was observed since T
io cell expression of IFN-y was reduced while IL-4 was increased. Inhibiting
IL-
12 production using siRNA-IL12p35 was associated with suppressed DC
allostimulatory function. In vivo, initiation of antigen-specific Th2
responses
was observed when DC treated with siRNA-IL12p35 were pulsed with KLH
and used for immunization experiments. Overall these results demonstrate
is for the first time that RNAi can be induced in DC and that siRNA is a
potent
tool for modulating DC function and subsequently T cell polarization.
DC are efficiently transfected with siRNA
To establish a protocol for RNAi in DC, the siRNA-transfection efficacy
2o was first assessed. Many studies have shown a limited ability of DC to be
transfected with DNA. To determine the transfection efficacy, fluorescein
labelled siRNA was synthesized that is specific for luciferase (FL-siRNA-Luc),
a gene that does not exist in mammalian cells and thus does not affect
cellular function. siRNA lacking fluorescein (siRNA-Luc) was used as a non-
2s labelled control. FL-siRNA-Luc and siRNA-Luc were transfected by
GenePorter into bone marrow-derived and cultured DC. After 24 hrs siRNA
transfection, the percentages of DC that had incorporated FL-siRNA-Luc were
quantified by flow cytometry. As seen in Figure 1, FL-siRNA-Luc had been
successfully incorporated into 88% of the cells, as analyzed by flow
3o cytometry.
It was then assessed whether immature DC are able to internalize
naked siRNA. Immature DC on day 4 were cultured with FL-siRNA-Luc in the
absence of transfection reagent, and assessed for siRNA internalization by
flow cytometry on day 9 of culture. Despite the long incubation period, 19% of
is
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
DC still contained incorporated siRNA (Figure 1 ), suggesting that naked
siRNA may be used for transfection of DC.
siRNA transfection does not alter DC viability, maturation or phenotype
s One of the major concerns for gene transfection is that transfection
reagents may affect cellular function or viability. Although a high level of
transfection efficiency was already demonstrated using the GenePorter
method, it was further needed to establish whether siRNA or the transfection
procedure itself altered the viability of the DC. Thus, day-7 bone marrow-
lo derived DC were treated with transfection reagent (GenePorter) alone, siRNA-
IL12p35 alone, or the combination of transfection reagent and siRNA-
IL12p35. After 24 hrs of transfection, apoptosis and necrosis was assessed
using annexin-V and propidium iodine (PI) staining respectively. Compared to
untreated DC, neither the transfection protocol alone, nor the siRNA affected
is cell viability (Figure 2).
Next it was addressed whether the siRNA or the transfection procedure
affected DC maturation. DC were transfected with siRNA following activation
with LPS and TNF-a. DC maturation was assessed by flow cytometry to
analyze expression of MHC II, CD40, and CD86 or the DC-specific marker
2o CD11 c. It can be seen that neither treatment with siRNA nor mock
transfection altered DC maturation in response to LPS and TNF-a (Figure
3A).
An additional concern associated with transfecting DC with nucleic
acids is induction of maturation. Since long double stranded RNA
2s (poly(I):poly(C)) has previously been shown to induce maturation and
activation of immature DC (25), it was determined whether or not siRNA had
the same effect. Thus, immature DC were treated with siRNA-IL12p35 for 24
hrs and cell surface maturation markers were assessed by FACS. Figure 3B
illustrates that siRNA treatment alone failed to upregulate MHC II, CD40, or
3o CD86 on immature DC. Although these experiments used a concentration of
60 pM of siRNA-IL12p35, higher concentrations of siRNA-IL12p35 (up to 10
fold) were also assessed, with no alteration in viability or differentiation
(data
not shown). These data indicate that transfection of DC with siRNA-IL12p35
affects neither the viability nor phenotype.
16
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
siRNA induces specific gene silencing in DC
The specificity of siRNA induced gene silencing in DC was examined
by transfecting DC with siRNA-IL12p35 and siRNA targeted to the p40
s component of IL-12 (siRNA-IL12p40). Transcripts of IL-12 p35 and IL-12 p40
were detected by RT-PCR using primers flanking the siRNA targeted
sequence. Specific inhibition was demonstrated at the transcript level: siRNA-
IL12p35 exclusively suppressed p35 transcripts while siRNA-IL12p40
suppressed only p40 transcripts (Figure 4). In addition, both siRNA-IL12p35
to and siRNA-IL12p40 failed to affect transcripts of the house-keeping gene
GAPDH. These data suggested that siRNA-mediated gene silencing is
specific in, DC.
siRNA-IL12p35 inhibits IL-12 expression in DC
is It was verified whether siRNA-IL12p35 can block production of IL-12
protein. Since IL-12p35 is critical for the formation of the IL-12 p70
heterodimer, the production of this cytokine was assessed in the supernatant
of LPS/TNF-a-activated DC using ELISA. DC transfected with siRNA-IL12p35
were stimulated with LPS and TNF-a for 43 hrs to induce maturation and
2o cytokine expression. To confirm specificity of gene silencing, siRNA
specific
for IFN-y (siRNA-control) was used since this cytokine is not expressed in
bone marrow derived DC. Additionally, negative controls included DC
transfected with GenePorter alone (mock transfected DC) and unmanipulated
DC (untreated control). As shown in Figure 5A, siRNA-IL12p35 reduced IL-
2s 12p70 heterodimer production (as determined by ELISA) by 35-90%
compared to untreated or mock transfected DC. More importantly this effect
was specific since no significant difference in IL-12p70 production was seen
in
DC treated with the IFN-~ siRNA-control. In addition, levels of IL-10
production were tested since a reciprocal relationship with IL-12 production
3o has been previously reported (27). IL-10 production in DC treated with
siRNA-
IL12p35 was significantly and specifically upregulated compared to controls
(Figure 5B).
17
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
siRNA-IL12p35 suppresses DC allostimulatory activity
DC function can be characterized in part by their ability to stimulate
alloreactive T cells in the mixed lymphocyte reaction (MLR) (8). To determine
whether siRNA-IL12p35 affected DC allostimulatory activity, MLR was
s performed using DC transfected with siRNA-IL12p35, siRNA-control, mock
transfected, or untreated controls. Allogeneic T cells were cultured with
siRNA-transfected DC for 48 hrs at which point allostimulation was
determined by proliferation. While the control DC groups all showed similar
allostimulatory activity, DC transfected with siRNA-IL12p35 significantly
io suppressed this response (Figure 6).
siRNA-IL12p35 treated DC promote Th2 differentiation
Since IL-12p70 is a'key cytokine responsible for polarizing T cells
towards an IFN-y-producing or Th1 phenotype (Trinchieri, G. 1998. Adv
is Immunol 70:83), it was assessed whether allostimulation with DC that were
transfected with siRNA-IL12p35 could alter cytokine production from
responding T cells. Mock transfected DC stimulated high IFN-y and low IL-4
mRNA transcripts from responding T cells, however, stimulation with siRNA-
IL12p35 treated DC resulted in low IFN-y and high IL-4 transcripts (Figure
7A).
2o To confirm these results at the protein level IFN-y and IL-4 were assayed
from MLR culture supernatants using ELISA. The T cells incubated with
siRNA-IL12p35-treated DC produced low levels of IFN-y (Figure 7B) and high
levels of IL-4 (Figure 7C). In contrast, T cells incubated with untransfected
DC, GenePorter transfected DC or DC transfected with control siRNA showed
2s a cytokine profile of high IFN-a and low IL-4. These data suggest that
siRNA-
IL12p35-treated DC have the ability to polarize naive T cells along the Th2
pathway.
Modulation of antigen-specific response in vivo using siRNA-IL12p35 treated
3o DC
Although a shift from Th1 cytokine production to Th2 is seen when
naive T cells are incubated with siRNA-IL12p35-treated DC, it was
investigated whether this effect could also be obtained in vivo. To accomplish
is
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
this, siRNA-IL12p35-treated or mock transfected DC with KLH were
transfected and used as immunogens in vivo by injecting into syngeneic
hosts. Ten days after immunization with KLH-pulsed control DC, a Th1 recall
response was evident when draining lymph node cells from recipient mice
s were challenged with KLH in vitro, as determined by upregulated IFN-y and
downregulated IL-4 production (Figure 8). Under the same conditions the
siRNA-IL12p35-treated DC promoted a Th2 shift in the recall cytokine
response, showing increased IL-4 production and suppressed IFN-y. These
results suggest that antigen-pulsed and siRNA-modified DC can be used to
to modulate the Th1 vs Th2 balance in vivo during a primary immune response.
Interestingly, DC silenced by siRNA-IL12p35 showed decreased
allostimulatory capacity which is in contrast to results reported using DC
generated from IL-12 knockout mice that possess normal allostimulatory
activity (Piccotti, J.R.,. et al., 1998. J Immunol 160:1132; Tourkova I.L., et
al.,
is 2001. Immunol Lett 78:75). We attribute this discrepancy to compensatory
immunological mechanisms that may have arisen in the lifetime of the IL-12
knockout mice. This is suggested by studies that have demonstrated the
importance of IL-12 in MLR. First, IL-12 production by antigen presenting
cells was demonstrated to be critical for MLR proliferative response since
2o addition of anti-IL-12 antibodies resulted in suppression of proliferation
(Kohka, H., et al., 1999. J Interferon Cytokine Res 19:1053). Second,
overexpression of IL-12 in DC results in increased allostimulatory function
(Kelleher, P., et al., 1998. Int Immunol 10:749). Another possible explanation
for suppressed MLR in siRNA-IL12p35-transfected DC is that the increased
zs IL-10 production may act as an inhibitor of T cell proliferation (Wang
X.N., et
al., 2002. Transplantation 74:772; Tadmori W., et al., 1994. Cytokine 6:462).
Other studies examining naturally occurring Th2-promoting DC have shown
that these cells have a reduced allostimulatory function and reduced IL-12
production (Gao J.X., et al., 1999. Immunology 98:159; Khanna A., et al.,
30 2000. J Immunol 164:1346). The combination of Th2 promoting properties, as
well as poor allostimulation suggests that siRNA-IL12p35 transfected DC may
possess the phenotype of a "tolerogenic" DC and thus may be useful for
treatment of Th1 mediated autoimmune diseases and transplant rejection.
19
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
The present invention provides methods of using therapeutic
compositions comprising siRNA designed to target a specific mRNA as well
as activated and nonactivated altered (i.e.transformed) immune cells that
s contain the siRNA in embodiments as described supra. A feature of DC is
their capacity to migrate or home to T-dependent regions of lymphoid tissues
where DC may affect T cell activity and elicit a modulated immune response.
Therefore, in vivo administration of a siRNA composition v~iould be effective
in
targeting and having a modulatingeffect on T cell activity.
In one embodiment, the compositions comprise DC containing siRNA
specifically designed to degrade mRNA encoding a surface marker, a
chemokine, a cytokine, an enzyme or a transcriptional factor such that the
transformed DC leads to a lack of expression of the surface marker,
chemokine, cytokine, enzyme or transcriptional factor and as a result affect
is the activity of T cells to modulate an immune response. Such DC may be
provided as compositions for administration to a mammalian subject or as
compositions for ex vivo approaches for the treatment of cells, tissues and/or
organs for transplantation. Such compositions may contain pharmaceutically
acceptable carriers or excipients suitable for rendering the mixture
2o administrable orally or parenteraly, intravenously, intradermally,
intramuscularly or subcutaneously or transdermally. The transformed immune
cells or siRNA may be admixed or compounded with any conventional,
pharmaceutically acceptable carrier or excipient as is known to those of skill
in
the art.
2s As used herein, the term "pharmaceutically acceptable carrier" includes
any and all solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic agents, absorption delaying agents, and the like. The use of
such media and agents for pharmaceutically active substances is well known
in the art. Except insofar as any conventional media or agent is incompatible
3o with the compositions of this invention, its use in the therapeutic
formulation is
contemplated. Supplementary active ingredients can also be incorporated into
the pharmaceutical formulations.
It will be understood by those skilled in the art that any mode of
administration, vehicle or carrier conventionally employed and which is inert
Zo
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
with respect to the active agent may be utilized for preparing and
administering the pharmaceutical compositions of the present invention.
Illustrative of such methods, vehicles and carriers are those described, for
example, in Remington's Pharmaceutical Sciences, 4th ed. (1970), the
s disclosure of which is incorporated herein by reference. Those skilled in
the
art, having been exposed to the principles of the invention, will experience
no
difficulty in determining suitable and appropriate vehicles, excipients and
carriers or in compounding the active ingredients therewith to form the
pharmaceutical compositions of the invention.
io It is also understood by one of skill in the art that the compositions of
the
invention may be provided on a device for in vitro, ex vivo or in vivo use.
Suitable structures may include but are not limited to stents, heart valves,
implants and catheters.
The therapeutically effective amount of active agent to be included in
is the pharmaceutical composition of the invention depends, in each case, upon
several factors, e.g., the type, size and condition of the patient to be
treated,
the intended mode of administration, the capacity of the patient to
incorporate
the intended dosage form, etc. Generally, an amount of active agent is
included in each dosage form to provide from about 0.1 to about 250 mg/kg,
2o and preferably from about 0.1 to about 100 mg/kg.
While it is possible for the agents to be administered as the raw
substances, it is preferable in view of their potency, to present them as a
pharmaceutical formulation. The formulations of the present invention for
mammalian subject use comprise the agent, together with one or more
2s acceptable carriers therefor and optionally other therapeutic ingredients.
The
carriers) must be "acceptable" in the sense of being compatible with the other
ingredients of the formulation and not deleterious to the recipient thereof.
Desirably, the formulations should not include oxidizing agents and other
substances with which the agents are known to be incompatible. The
3o formulations may conveniently be presented in unit dosage form and may be
prepared by any of the methods well known in the art of pharmacy. All
methods include the step of bringing into association the agent with the
carrier, which constitutes one or more accessory ingredients. In general, the
formulations are prepared by uniformly and intimately bringing into
association
Zi
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
the agent with the carriers) and then, if necessary, dividing the product into
unit dosages thereof.
Formulations suitable for parenteral administration conveniently
comprise sterile aqueous preparations of the agents, which are preferably
s isotonic with the blood of the recipient. Suitable such carrier solutions
include
phosphate buffered saline, saline, water, lactated ringers or dextrose (5% in
water). Such formulations may be conveniently prepared by admixing the
agent with water to produce a solution or suspension, which is filled into a
sterile container and sealed against bacterial contamination. Preferably,
io sterile materials are used under aseptic manufacturing conditions to avoid
the
need for terminal sterilization.
Such formulations may optionally contain one or more additional
ingredients among which may be mentioned preservatives, such as methyl
hydroxybenzoate, chlorocresol, metacresol, phenol and benzalkonium
is chloride. Such materials are of special value when the formulations are
presented in multidose containers.
Compositions of the invention comprising a selected targeting siRNA
can also comprise one or more suitable adjuvants. In this embodiment siRNA
can be used as a vaccine in order to stimulate or inhibit T cell activity and
2o polarize cytokine production by these T cells. As is well known to, those
of
ordinary skill in the art, the ability of an immunogen to inducelelicit an
immune
response can be improved if, regardless of administration formulation (i.e.
recombinant virus, nucleic acid, peptide), the immunogen is coadministered
with an adjuvant. Adjuvants are described and discussed in "Vaccine Design-
2s the Subunit and Adjuvant Approach" (edited by Powell and Newman, 'Plenum
Press, New York, U.S.A., pp. 61-79 and 141-228 (1995). Adjuvants typically
enhance the immunogenicity of an immunogen but are not necessarily
immunogenic in and of themselves. Adjuvants may act by retaining the
immunogen locally near the site of administration to produce a depot effect
3o facilitating a slow, sustained release of immunizing agent to cells of the
immune system. Adjuvants can also attract cells of the, immune system to an
immunogen depot and stimulate such cells to elicit immune responses. As
such, embodiments of this invention encompass compositions further
comprising adjuvants.
22
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
Desirable characteristics of ideal adjuvants include:
1 ) lack of toxicity:
2) ability to stimulate a long-lasting immune response;
3) simplicity of manufacture and stability in long-term storage;
s 4) ability to elicit both cellular and humoral responses to antigens
administered by various routes, if required:
5) synergy with other adjuvants;
6) capability of selectively interacting with populations of antigen
presenting cells (APC);
l0 7) ability to specifically elicit appropriate Tr, TR1 or TH2 cell-specific
immune responses; and
8) ability to selectively increase appropriate antibody isotype levels (for
example, IgA) against antigens/immunogens.
Suitable adjuvants include, amongst others, aluminium hydroxide,
is aluminium phosphate, amphigen, tocophenols, monophosphenyl lipid A,
muramyl dlpeptide and saponins such as Quill A. Preferably, the adjuvants to
be used in the tolerance therapy according to the invention are mucosal
adjuvants such as the cholera toxine B-subunit or carbomers, which bind to
the mucosal epithelium. The amount of adjuvant depending on the nature of
2o the adjuvant itself as is understood by one of skill in the art.
Compositions of siRNA of the present invention may also be provided
within antibody labelled liposomes (immunoliposomes) or antibody-double
stranded RNA complexes. In this aspect, the siRNA is specifically targeted to
a particular cell or tissue type to elicit a localized effect on T cell
activity.
2s Specifically, the liposomes are modified to have antibodies on their
surface
that target a specific cell or tissue type. Methods for making of such
immunoliposomal compositions are known in the art and are described for
example in Selvam M.P., et.al., 1996. Antiviral Res. Dec;33(1 ):11-20 (the
disclosure of which is incorporated herein in its entirety).
so In one representative embodiment-of the invention, siRNA to TNFa is
made according to the methods of Tuschl T., et al., 1999. Genes Dev.
13:3191-97 and Tuschl T., et.al., 1998. EMBO J. 17:2637-2650 . In these
methods, 21 nucleotide base-pair sequences are chemically synthesized
23
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
using a new 5'-silyl protecting group in conjunction with a unique acid-labile
2'-orthoester protecting group, 2'-bis(acetoxyethoxy)-methyl ether (2'-ACE).
The 2'-protecting groups are rapidly and completely removed under mild
conditions in aqueous buffers. This "2'-ACETM technology (Dharmacon Inc.
CO, USA) enables the synthesis of RNA oligonucleotides in high yield. To the
siRNA specific to TNFa is admixed an agent that crosses the cell membrane
and enters the nucleus in order to achieve maximal inhibition of TNFa. Such
agents are known to those of skill in the art and may be selected from
cationic
and anionic liposomes as well as compositions of chemicals which permit
io transmembrane entrance of the siRNA without afFecting the function of the
nucleotides. In addition to compounds which allow entry of siRNA into the
cell, the siRNA may be mixed with pharmaceutically acceptable carriers as
described supra.
The composition containing the siRNA may be administered to a
is mammalian subject by a variety of methods described supra. The optimal
route of administration is dependent upon the area of the body where
suppression of TNFa is most desired. For diseases.associated with systemic
rises in TNFa, the dosage of siRNA administered can be guided by serum
ELISA measurements for levels of this cytokine. In mammalian subjects
2o where systemic intravenous administration is desired, siRNA can be infused
via a portable volumetric infusion pump at a rate between about 1-6mL/hour
depending on the volume to be infused as is understood by one of skill in the
art. Doses of 0.1 mg/kg/day to about 10mg/kglday may be administered for a
time period necessary to suppress TNFa expression.
2s Suppression of the cytokine TNFa is desirable in a variety of immune
disorders that include but are not limited to septic shock, rheumatoid
arthritis,
transplant rejection, scleroderma, immune mediated diabetes, chronic
inflammatory bowel syndrome, HIV, cancer, colitis, Crohn's diseaseand
inflammation associated with chronic illness. It is desirable to suppress the
so expression of a molecule on an immune cell such as a cytokine involved in a
particular immune related disorder. As such, the invention is applicable to
the
treatment of a variety of immune disorders associated with the expression of
surface markers, enzymes, cytokines, chemokines and transcription factors
24
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
on an immune cell such as a DC leading to a desired decrease in T cell
activity and thus alleviating the immune condition. For the treatment of
autoimmune disorders using transformed immune cells of the invention, it is
desirable to use the mammalian subjects own cells for transformation and
s reintroduction into the subject for therapy.
In another embodiment of the invention, the siRNA and/or altered .
immune cells, in particular DC that exhibits a targeted gene-specific knockout
phenotype, can be used in compositions to perfuse cells, tissues and/or
organs ex vivo for transplantation. In this aspect, mammalian donor tissues
io and/or organs are perfused ex vivo with a siRNA composition or transformed
immune cell composition of the invention prior to transplantation into a
mammalian host. In this manner, the tissue or organ is less susceptible to
rejection in the host as T cell activity is suppressed. Methods of
tissue/organ
perfusion using perfusion machines for example are known to those of skill in
is the art.
In another embodiment, the invention provides methods for generating
tolerogenic dendritic cells (DC) as for example by the suppression of
expression of IL-12 on DC using RNAi. Such tolerogenic DC can be used in
methods for the treatment of autoimmune disorders where the antigen is
2o known. DC can be isolated from a mammalian subject from bone marrow or
peripheral blood and loaded with the autoantigen. These DC are then
administered siRNA directed to IL-12 suppression as described supra or in
the examples section and then re-infused into the mammalian subject. These
DC only generate T regulatory cells and/or Th2 cells specific for the
2s autoantigen. Immunoliposomes specific to DC can be used targeted to a DC-
specific surface molecule such as DEC-205, CD11 c or CD83, the siRNA may
be administered systemically in vivo, in a manner to target DC in homeostatic
conditions.
To summarize, the present invention provides novel transformed
3o immune cells which exhibit a targeted gene-specific knockout phenotype in
order that such cells can be used therapeutically to modulate immune
responses in a mammal via alteration of T cell activity. The present invention
provides novel altered DC that do not express one or more genes encoding a
surface marker, chemokine, cytokine, enzyme or transcriptional factor that are
Zs
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
involved in DC activity, and as such, suppress or stimulate immune system
functioning via the modulation of T cell activity.
The present invention also encompasses therapeutic methods for the
treatment of a variety of immune disorders with the use of the altered immune
s cells or with the use of the siRNA. In embodiments of the invention, the
immune cells is a DC that is transfected in vitro to produce a desired DC
phenotype and then used ex vivo as a perfusion composition for a
transplantation tissue or organ or in vivo as administered to a mammalian
subject. The invention also encompasses the in vivo use of siRNA directed to
io selected molecules associated with immune cells in order to alter T cell
activity and thus treat a variety of immune disorders.
The above disclosure generally describes the present invention. A more
complete understanding can be obtained by reference to the following specific
Examples. These Examples are described solely for purposes of illustration and
is are not intended to limit the scope of the invention. Changes in form and
substitution of equivalents are contemplated as circumstances may suggest or
render expedient. Although specific terms have been employed herein, such
terms are intended in a descriptive sense and not for purposes of limitation.
2o Examples
Example 1 - Generation of bone marrow-derived DC
DC were generated from bone marrow progenitor cells as previously
described (22). Briefly, bone marrow cells were flushed from the femurs and
2s tibias of C57BL/6 mice (Jackson Labs, Bar Harbor ME), washed and cultured
in 24-well plates (2 x 106 cells/ml) in 2 ml of complete medium (RPMI-1640
supplemented with 2mM L-glutamine, 100 U/ml of penicillin, 100 ~,g of
streptomycin, 50 p.M 2-mercaptoethanol, and 10 % fetal calf serum (all from
Life Technologies, Ontario, Canada) supplemented with recombinant GM-
so CSF (10 ng/ml; Peprotech, Rocky Hill, NJ) and recombinant mouse IL-4 (10
ng/ml; Peprotech). All cultures were incubated at 37°C in 5% humidified
C02.
Non-adherent granulocytes were removed after 48 hrs of culture and fresh
medium was added. After 7 days of culture >90% of the cells expressed
26
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
characteristic DC specific markers as determined by FACS. DC were washed
and plated in 24-well plates at a concentration of 2 x 105 cells per well in
400
p,l of serum-free RPMI-1640.
s Example 2 - siRNA Synthesis and Transfection
The siRNA sequences were selected according to the method of
Elbashir et al (23). The siRNA sequences specific for IL-12p35
(AACCUGCUGAAGGAUGGUGAC), IL-12p40 (AAGAUG
ACAUCACCUGGACCU), and IFN-y (AACTGGCAAAAGGATGGTGAC) were
to synthesized and annealed by the manufacturer (Dharmacon Inc. Lafayette,
CO). siRNA for IFN-y was used as a control since bone marrow derived DC
generated by the conditions described above did not produce IFN-y after
stimulation. Transfection efficiencies were determined using unlabeled and
fluorescein labeled siRNA Luciferase GL2 Duplex (Dharmacon Inc).
is Transfection was carried out as described previously (Elbashir, S.M., 2002.
Methods 26:199). Briefly, 3 ~I of 20p,M annealed siRNA was incubated with 3
~I of GenePorter (Gene Therapy Systems, San Diego, CA) in a volume of 100
~,I RPMI-1640 (serum free) at room temperature for 30 min. This was then
added to 400 ~I of DC cell culture as described above. Mock controls were
2o transfected with 3 ~I GenePorter alone. After 4 hrs of incubation an equal
volume of RPMI-1640 supplemented with 20% FCS was added to the cells.
24-48 hrs later, transfected DC were washed and used for subsequent
experiments.
In the transfection by phagocytosis, bone marrow DC progenitors at
2s day 4 of culture were incubated in a final concentration of 60 pM FL-siRNA-
Luc. Cells remained in culture with GM-CSF and IL-4 as described above. At
day 8 of culture cells were activated with LPS/TNF-a and incorporated FL-
siRNA-Luc was assessed by flow cytometry on day 9.
3o Example 3 - DC activation and MLR
Transfected DC (1 x 106 cells) were plated in 24 well plates and
stimulated with LPS (10 ng/ml, Sigma Aldrich, St Louis, MO) + TNFa, (10
ng/ml, Peprotech) for 48 hrs, at which point supernatants were used for ELISA
27
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
and RNA was extracted from the cells for RT-PCR. For mixed leukocyte
reaction (MLR), T cells were purified from BALB/c splenocytes using nylon
wool columns and were used as responders (1 x 106/well). siRNA-treated DC
(5-40 x 103, from C57/BL6 mice) were used as stimulators. 72 hour MLR was
s performed and the cells were pulsed with 1 p,Ci [3H]-thymidine for the last
18
hrs. The cultures were harvested on to glass fiber filters (Wallac, Turku,
Finland). Radioactivity was counted using a Wallac 1450 Microbeta liquid
scintillation counter and the data were analyzed with UItraTerm 3 software.
to Example 4 - Flow cLrtometrY
Phenotypic analysis of siRNA-treated DC was performed on a
FACScan (Becton Dickinson, San Jose, CA) and analyzed using CeIIQuest
software (Becton Dickinson). The following FITC conjugated anti-mouse
mAbs were used: anti-I-Ab, anti-CD11 c, anti-CD40, and anti-CD86 (BD
is PharMingen, San Diego, CA). The annexin-V/propidium iodide method of
determining apoptosis/necrosis was used as previously described (Min W. P.,
2000. J Immunol 164:161 ). All flow cytometric analyses were performed using
appropriate isotype controls (Cedarlane Laboratories, Hornby ON, Canada).
2o Example 5 - RT-PCR
Total RNA from siRNA-treated DC (106 cells) or from T cells purified
from MLR (106 cells) was isolated by TRlzol reagent (Gibco BRL) according to
the manufacturer's instructions. First strand cDNA was synthesized using an
RNA PCR kit (Gibco BRL) with the supplied oligo d(T)16 primer. One p,mol of
2s reverse transcription reaction product was used for the subsequent PCR
reaction. The primers used for IL-12p35 and IL-12p40 flanked the sequences
targeted by siRNA (IL-12p35, forward primer 5'-
GCCAGGTGTCTTAGCCAGTC-3', reverse primer 5'-
GCTCCCTCTTGTTGTGGAAG-3'; IL-12p40, forward primer 5'-
3o ATCGTTTTGCTGGTGT CTCC-3', reverse primer 5'-
CTTTGTGGCAGGTGTACTGG-3'). In addition, IL-10, IFN-y, IL-4 and
GAPDH (internal control) primers were used as previously described (Zhu, X.,
et. al., 1994. Transplantation 58:1104). The PCR conditions were: 94°C
for 1
Zs
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
min, 60°C for 1 min, and 72°C for 1 min, and PCR was done for 35
cycles.
PCR products were visualized with ethidium bromide on 1.5% agarose gel.
Example 6 - Enzyme-linked immunosorbent assa~~ELISA)
s The siRNA-treated DC (105, C57/BL6 origin) were cultured with the
allogeneic T cells (1 x106) for 48 hrs. The supernatants were harvested and
assessed for DC cytokines (IL-12p70, IL-10) and T cell cytokines (IFN-y, IL-4)
by ELISA. Cytokine specific ELISA (Endogen, Rockford, IL) was used for
detecting ~cytokine concentrations in culture supernatants according to the
to manufacturer's instructions using a Benchmark Microplate Reader (Bio-Rad
Laboratories).
Example 7 - Immunization of mice with peptide-pulsed DC
Day 7 bone marrow-derived DC were transfection with siRNA-IL12p35,
is or transfection reagent alone as described above, and pulsed with 10 ~g/ml
of
keyhole limpet hemocyanin (KLH) (Sigma-Aldrich Rockford IL) for 24 hrs. DC
were then activated with LPS + TNFa, for 24hrs, washed extensively and used
for subsequent transfer experiments. Antigen-pulsed DC (5 x 105
cells/mouse) were injected subcutaneously into syngeneic mice. Mice were
2o sacrificed after 10 days and cell suspensions were prepared from the
draining
lymph nodes. These cells were cultured in 96-well plates at a concentration
of 4 x 105 cells/well in the presence or absence of antigen for 48 hrs at
which
point culture supernatants were used for analysing cytokine production by
ELISA.
For statistical analysis, one-way ANOVA followed by the.Newman
Keuls Test was used to determine the significance between groups for
cytokine production and MLR. Differences with p-values less than 0.05 were
considered significant.
3o Although preferred embodiments have been described herein in detail
it is understood by those of skill in the art that using no more than routine
experimentation, many equivalents to the specific embodiments of the
29
CA 02488774 2004-12-07
WO 03/104456 PCT/CA03/00867
invention described herein can be made. Such equivalents are intended to be
encompassed by the scope of the claims appended hereto.
