Note: Descriptions are shown in the official language in which they were submitted.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-1 -
IMPROVED METHOD FOR THE PREVENTION OR REDUCTION OF HAZE IN
BEVERAGES
The invention relates to a method for the prevention or reduction of
haze in a beverage by the addition of an endoprotease and to new beverages
obtainable by the method according to the invention. It also relates to new
endoproteases.
Haze is a well-known phenomenon in the beverage industry. Haze
can for example be present in beer, wine and fruit juice. Haze formation can
occur at
different stages during the brewing process. In "Enzymes in food processing"
edited by
T. Nagodawithana and G. Reed, 3rd edition, Academic press Inc., San Diego,
Chapter
V, p.448-449, it has been proposed that the haze in beer is the result of
interactions
between beer proteins and polyphenolic procyanidins. It is explained that in
beer haze
is often formed upon chilling of the beer. Beer is fermented and then
maturated, often
under chilled conditions. To achieve clarity, beer is often filtered while
cold. In spite of
the filtration, beer often becomes cloudy after it is packaged and distributed
to
customers and chilled again before serving. Eventually haze is even formed in
beer
when it is not or no longer chilled and sediment may develop. Haze formation
is
undesirable because the cloudiness caused by haze formation resembles
cloudiness
produced by microbial spoilage, which is undesirable, especially for bright
beers.
In "Industrial Enzymology", 2"d edition, Chapter 2.6, p.124-125, it has
been described that haze in beer can result form the cross-linkage of the high
molecular weight hordein fraction of malt, containing a high proportion of
hydrophobic
amino acids, which combines with polyphenols principally consisting of
proanthocyanidins and catechins (flavanoids). It is described that small
amounts of
carbohydrates and trace mineral ions are also involved in haze formation, as
well as
oxidation, which is stated to play an important part in polymerization of
polyphenols to
produce irreversible haze. It is proposed that polyphenols combine slowly with
protein
to form chill haze when cooled, but which redissolve when warmed up.
Eventually,
however, as polyphenols polymerize and increase in size they become insoluble
at
room temperature to form irreversible or permanent haze.
In several other publications it has been proposed that the formation
of haze in for example beer, wine and fruit juice, coffees and teas is the
result of
interactions between proteins and polyphenols (K.J. Siebert et al, J. Agric.
Food Chem.
44 (1996) 1997-2005 and K.J. Siebert et al, J. Agric. Food Chem. 44 (1996) 80-
85, K.J.
Siebert, J. Agric. Food Chem. 47 (1999) 353-362). Since its discovery by L.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-2-
Wallerstein in 1911, it has been known that a method for the reduction of
chill haze
formation in beer is the addition of papain to the beer. Papain is an extract
of papaya
having proteolytic activity. In "Enzymes in food processing" edited by T.
Nagodawithana and G. Reed, 3rd edition, Academic press Inc., San Diego,
Chapter V,
p.448-449 papain is described as being far superior to any other enzyme for
the
prevention of chill haze in beer. The exact mechanism by which papain works,
however, has never been determined ("Enzymes in food processing" edited by T.
Nagodawithana and G. Reed, 3rd edition, Academic press Inc., San Diego,
Chapter V,
p.448-449).
A disadvantage of the use of papain however, is that it has a
negative effect on foam. Proteins are necessary to form stable foam on beer.
By its
proteolytic activity, however, papain adversely affects head foam stability.
Haze formation in wine has been discussed in e.g. "Enzymes in food
processing" edited by T. Nagodawithana and G. Reed, 3rd edition, Academic
press
Inc., San Diego, Chapter 16, p.425, where it is described that grape proteins
are held
responsible for the formation of haze during the storage of wine. If
precipitation is
formed in wine after bottling, the wine becomes less attractive to the
consumer, which
will affect sales. To prevent precipitation, for example bentonite is used.
Although
bentonite and other adsorbents are successful in removing the proteins, it is
not
selective and removes other desirable compounds from wine, often affecting the
organoleptic properties of wine. In addition, the use of bentonite results in
a
considerable loss of wine and it the dumping of waste containing bentonite
presents
difficulties.
Although the mechanism is not well understood, it is assumed that
the addition of papain hydrolyses the protein in beer to such an extent that a
protein-
polyphenol haze is not formed or is formed to a smaller extent. Bentonite is
used for a
similar reason in wine: by absorbing proteins it prevents the formation of
protein-
polyphenol haze and precipitates. Instead of removing the protein, however,
polyphenols may be removed to reduce or prevent haze formation. A typical
example
of a compound used to remove polyphenols from beverages is
polyvinylpolypyrrolidon
(PVPP). Lately it has been recognized that polyphenols are important anti-
oxidants.
Because of all the beneficial effects attributed to anti-oxidants, the option
of removing
polyphenols from beverages is not the most attractive way to prevent the
formation of
haze.
Since all known techniques for the prevention or removal of haze
have drawbacks, there is still a need for a new method for the prevention or
reductigrt
CA 02490020 2010-04-26
70500-113
-3-
of haze in beverages.
It is an object of the present invention to provide a method for the
prevention or reduction of haze in a beverage.
According to one aspect of the present invention, there is provided
method for the prevention or reduction of haze in a beverage comprising adding
a
proline-specific endoprotease, a hydroxy-prolyl-specific endoprotease, an
alanine-
specific endoprotease, or any combination thereof, and an auxiliary enzyme to
the
beverage in order to further reduce or prevent haze formation in the beverage.
CA 02490020 2010-04-26
70500-113
- 3a -
Surprisingly, it has been found that this object is achieved by
providing a method for the prevention or reduction of haze in a beverage
wherein an
endoprotease with an acidic pH optimum is added to the beverage. Preferably
this
endoprotease is an isolated endoprotease that has prolyl-specific endoprotease
activity
and/or hydroxyprolyl-specific activity and/or alanine specific activity.
In the framework of this invention the term "beverage" includes
beverages in all stages of their preparation. ~ Thus, a beverage is not only a
beverage
ready for consumption but also any composition used to prepare the beverage.
For
example, wort as used in beer preparation is encompassed by the term
"beverage" as
used herein. Also, the addition of a prolyl-specific endoprotease during the
preparation
of a beverage to compositions that are not or not entirely liquid is intended
to fall within
the method according to the invention. A prolyl-specific endoprotease added to
a mash
at the start of beer brewing is an example of such a composition.
A prolyl specific endoprotease (Endo-Pro) is defined as a preferably
purified endoprotease that cuts proteins or peptides near or at places where
the protein
or peptide contains a prolyl-residue in its chain. Preferably, in a method
according to
the invention, a prolyl specific endoprotease is used that cuts proteins or
peptides at
places where.the protein or peptide contains a prolyl-residue.
The terms Endo-Pro, prolyl-specific endoprotease, proline-specific
endoprotease, proline-specific endopeptidase and peptide having a prolyl-
specific
activity or.similar, expressions are. used interchangeably..
A hydroxy-prolyl specific endoprotease (Endo-Hydroxy-Pro) is
defined as a preferably purified endoprotease that cuts proteins or peptides
near or at
places where the protein or peptide contains a hydroxy-prolyl-residue in its
chain.
Preferably, in a method according to the invention, a hydroxy-prolyl specific
endoprotease is used that cuts proteins or peptides at places where the
protein or
peptide contains a hydroxy-prolyl-residue.
An alanine specific endoprotease (Endo-Ala) is defined as a
preferably purified endoprotease that cuts proteins or peptides near or at
places where
the protein or peptide contains an alanine-residue in its chain. Preferably,
in a method
according to the invention, an alanine-specific endoprotease is used that cuts
proteins
or peptides at places where the protein or peptide contains an alanine-
residue.
Endoproteases having a prolyl-specific activity are known (E.C.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-4-
3.4.21.26). However, the use of prolyl-specific endoproteases or even hydroxy-
prolyl
specific endoproteases or alanine specific endoproteases for the prevention or
reduction of haze in beverages has never been described or suggested.
The words peptide and protein are used interchangeably herein.
Also, the words "haze", "cloudiness" and "turbidity" are used interchangeably.
In an even more preferred method according to the invention, a
prolyl-specific endoprotease is used that cuts prolyl-residues at their C-
terminus. A
prolyl-specific endoprotease that cuts prolyl-residues at their NH2-terminus
is for
example described in a publication in Nature of 15 January 1998, Vol.391,
p.301-304.
Further haze reduction in a beverage may be achieved by treatment
with a prolyl specific and/or hydroxyprolyl specific and/or alanine specific
endoprotease
in combination with an auxiliary enzyme.
Under certain conditions and in certain beverages, it may be that a
further reduction of haze is desired than the level of haze reduction that is
achievable
with an Endo-Pro, Endo-Hydroxy-Pro and/or Endo-Ala treatment alone. In such
cases it
may be beneficial to add an auxiliary proteolytic enzyme before, during or
after the
Endo-Pro, Endo-Hydroxy-Pro and/or Endo-Ala treatment. Such auxiliary enzymes
may
be endoproteases or exoproteases such as tripeptidylpeptidases and/or
carboxypeptidases and/or peptidyl-dipeptidases.
Object of this additional treatment is to further increase the solubility
of the peptides that remain after Endo-Pro, Endo-Hydroxy-Pro and/or Endo-Ala
treatment and/or to further reduce the interaction of the remaining
polypeptides with
polyphenols.
This objective is met in that an exoproteases such as
tripeptidylpeptidase and/or carboxypeptidase and/or peptidyl-dipeptidases is
added to
the beverage that is able to remoe the carboxy-terminal proline residues from
the
peptides that remain after Endo-Pro treatment. Alternatively, or in
combination with
such an exopeptidase, the peptides that remain after Endo-Pro treatment may be
further solubilised by treatment with an endoprotease. Especially suited for
that
purpose are enzymes that are able to cleave peptide bonds at either the N- or
C-
terminal position of glycine, alanine, serine, asparagine and glutamine
residues.
Carboxypeptidases that have activity towards synthetic chromogenic
peptides FA-Pro or FA Pro-Pro were found to very useful as auxiliary enzymes
Auxiliary Endo-Proteolytic enzymes with specificities as mentioned
above may be commercially obtained or may alternatively be selected with
methods
known in the art, for instance with the aid of synthetic chromogenic peptides
such as
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-5-
Z-A-A-A-pNA
wherein
pNA = paranitroanilide,
Z = benzyioxycarbonyl,
A = amino acid glycine, alanine, serine, asparagines or giutamine
Auxiliary peptidyl-dipeptidases that have activity towards synthetic
chromogenic peptides such as FA-Leu-Pro or FA-Phe-Pro wherein FA=
furylacryloyl
were found to be very useful.
The treatment with auxiliary enzymes should preferably have no
adverse effect on the taste, texture or mouth-feel of the beverage. It is
preferred that
these auxiliary enzymes have an acidic pH optimum or are active under acidic
conditions, preferably below, at or around pH 6.0, 5.0, 4.5 or 4.0 or even
more
preferred below, at or around pH 3Ø
In the production of most beers, special attention is required when
adding (auxiliary) proteolytic enzymes in order not to destroy the ability of
the beer to
form foam.
In a conventional beer brewing process, cereals are milled and
mashed and the resulting mash is filtered to give the wort. The wort is then
boiled to
inactivate all residual enzymic activities and subsequently used to support
yeast
growth. After yeast growth and filtering, the beer is lagered. It has been
described that
in this lagering stage, papain (collupuline) may be added to the beverage in
order to
prevent haze formation. However, the papaine destroys the foam forming ability
of the
beer.
Responsible for beer foam is a protein called LTP1 (Lipid Transfer
Protein), a 10 kDa barley protein with a very sturdy 3-dimensional structure
so that
proteases normally present during the mashing stage cannot hydrolyse this
molecule.
However, during the wort boiling stage, LTP1 unfolds so that it becomes
susceptible to
enzymatic cleavage. To be active in foam formation, the LTP1 needs a certain
minimum size. It is now thought that incubation with Collupuline during
lagering
(i.e.after wort boiling) destroys LTP1 and thereby the foam forming ability of
the beer.
The use of an acidic endoprotease, in particular Endo-Pro, Endo-
Hydroxy-Pro and/or Endo-Ala during either the mashing or the lagering stage
reduces
haze formation, but does not destroy or seriously affect LTP1 and therefore
the use of
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-6-
such enzymes has no negative effects on foam formation.
Moreover, the removal of a carboxy-terminal proline residue from the
peptides that resulted from the digestion with Endo-Pro, resulted in an
additional
reduction of haze in beer. Remarkably good results in this respect were
obtained when
a proline-specific carboxypeptidase isolated from Xanthomonas was used in
combination with Endo-Pro. Also, peptidyl-dipeptidase A (EC 3.4.15.1) was
successfully used to that effect.
Milk-clotting enzymes like Fromase are also very well suited as auxiliary
enzyme in the reduction or prevention of haze when used in combination with
Endo-
Pro. Fromase is well suited for this purpose since it does not affect LPT1
and
therewith preserves the foam forming ability of the beer.
Fromase is a commercial product (DSM Food Specialities) obtained
from Rhizomucor miehei that is used in cheese production. Fromase is a so-
called
aspartic protease (EC 3.4.23). These enzymes are characterised by very low pH
optima and an outspoken preference for cleaving peptide bonds between bulky,
hydrophobic amino acid residues such as Phe-Phe, Phe-Tyr and Leu-Tyr. Other
aspartic acid proteases are pepsin, cathepsin and the various acid proteases
from
different fungi.
Further haze reduction in wine may also be achieved by additional
treatment with auxiliary enzymes in combination with Endo-Pro, Endo-Hydroxy-
Pro or
Endo-Ala hydrolysis.
A protein called chitinase is known to be the main cause of haze
problems in wine. This chitinase originates from the grape and is rich in
glycine, alanine
and serine residues. Since wine has a very low pH, we tried to hydrolyse this
chitinase
with a complex mixture of acidic endoproteases. Addition of high
concentrations of a
product called AP 50.000 from Shin Nihon, Japan had no effect on haze
formation in
wine. This finding corresponds with the conclusions of Ferreira et al. (Trends
in Food
Science & Technology 12 (2002) 230-239 stating that all strategies based on
the
proteolysis of wine proteins have proved unsuccessful in practice and are
probably
futile.
Incubation of wine (white and red) with an enzyme preparation
according to the invention is described in Example 7. A further reduction of
the haze in
wine could be obtained by using auxiliary enzymes such as an exopeptidase that
removed the carboxy-terminal proline residues and/or an endoprotease with
specificity
for glycine.
An additional advantage of using Endo-Pro in wine (or any other
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-7-
beverage with a very low pH) is that the Endo-Pro used in the experiments of
Example
7 is also capable of cleaving peptide bonds after alanine residues as well as
at
hydroxy-proline residues under acidic conditions (Example 13).
To quantify the amount of haze in a beverage, a turbidimeter is often
used. In a turbidimeter the amount of light is measured that is scattered at a
prediscribed angle relative to the direction of the incident light beam.
Turbidity
measurements are very suitable for the measurement of haze formed as the
result of
protein-polyphenol interactions.
A polyphenol is defined as a compound having a chemical structure
which contains at least two aromatic rings substituted with at least one
hydroxyl group
or having a chemical structure which contains at least one aromatic ring
substituted
with at least two hydroxyl groups.
Examples of polyphenols are tannins and flavonoids, which include
for example catechins, flavonols :and anthocyanins.
As is typical for enzyme activities, the activity of prolyl-specific
endoproteases is dependent on the pH. In a preferred embodiment of the method
according to the invention, an endoprotease is added to the beverage having a
maximum prolyl specific activity at a pH that corresponds to the pH of the
beverage it is
added to. Preferred beverages are beverages containing proteins. In another
preferred
embodiment, the beverage contains proteins and polyphenols. Preferred
beverages
are beverages having a pH value below 7.
The method according to the invention is advantageously applied to
beer, wine and fruit juice. It may also advantageously be applied to alcoholic
beverages
other than beer and wine.
The term "beer" as used herein is intended to cover at least beer
prepared from mashes prepared from unrnalted cereals as well as all mashes
prepared
from malted cereals, and all mashes prepared from a mixture of malted and
unmalted
cereals. The term "beer" also covers beers prepared with adjuncts, and beers
with all
possible alcohol contents.
Fruit juice may be juice obtained from for example red berries,
strawberries, apples, pears, tomatoes, citrus fruits, vegetables etc.
The amount of proline-specific endoprotease that is added to a
beverage in the method according to the invention may vary between wide
limits. In a
preferred embodiment of the method according to the invention at least 150
milli-units
of proline-specific endoprotease activity, whereby the activity was determined
by an
activity measurements using Z-Gly-Pro-pNA as a substrate, per gram protein in
the
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-8-
beverage is added.
More preferably, at least 500 milli-units of proline-specific
endoprotease is added to the beverage, and most preferably, at least 1 unit of
proline-
specific endoprotease is added.
A maximum amount of proline-specific endoprotease activity to be
added cannot be specified. The maximum amount is for example dependent on the
desired amount of haze reduction or prevention, the composition of the
beverage, the
,pH of the beverage and the pH at which the endoprotease has its maximum
activity.
A prolyl-specific endoprotease may be added at different stages
during the preparation of a beverage.
During the preparation process of beer, the prolyl-specific
endoprotease is advantageously added to a mash. In another embodiment, the
prolyl-
specific endoprotease Endo-Pro is added to a fermented beer. The prolyl-
specific
endoprotease may advantageously be added to the mashing or maturation step in
a
process for the preparation of beer. Most preferred is the addition of the
enzyme to the
wort after the boiling step.
During the preparation of wine, the prolyl-specific endoprotease is
preferably added to a fermented wine. The prolyl-specific endoprotease may
advantageously be added after alcoholic fermentation or after malolactic
fermentation
in a process for the production of a wine. However, the enzyme may also be
added to
the clear grape juice, i.e. before the alcoholic fermentation.
In a process for the preparation of a fruit juice, the prolyl-specific
endoprotease is preferably added during the maceration or depectinization.
Since haze formation often occurs in acidic beverages such as for
example beer, wine and fruit juice, prolyl-specific endoproteases having a
prolyl
specific activity at a pH value below 7 are preferably used. More preferable,
prolyl-
specific endoproteases having a maximum prolyl specific activity at a pH value
below
7.0, or 6.0 are used in the method according to the invention. Most preferred
are
endoproteases with a pH optimum at or below pH 5Ø
The present invention provides such a peptide, having proline-
specific endoprotease activity with a pH optimum around pH 5.0, or between 4.0
and
5Ø
The present invention further provides an isolated polypeptide that
has proline-specific endoprotease activity selected from the group consisting
of:
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-9-
(a) a polypeptide which has an amino acid sequence which has at least 40%
overall amino acid sequence identity with SEQ ID NO: 4, SEQ ID NO: 5, OR
SEQ ID NO: 7 or a fragment thereof;
(b) a polypeptide which is encoded by a polynucleotide which hybridizes with
(i) the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3 3 OR
SEQ ID NO: 6 or a fragment thereof which is at least 80% or 90%
identical over 60, preferably over 100 nucleotides, more preferably at least
90% identical over 200 nucleotides, or (ii) a nucleic acid' sequence
complementary to the nucleic acid sequence of (i)
It also provides a nucleic acid molecule encoding the prolyl-specific
endoprotease Endo-Pro.
The invention also relates to purified or isolated polypeptides having
prolyl-specific endoprotease activity. Preferred are purified prolyl-specific
endoproteases having a maximum activity at pH values below 7.
The invention provides an isolated polypeptide having the amino acid
sequence according to SEQ ID NO: 4,SEQ ID NO: 5 or SEQ ID NO: 7, or an amino
acid sequence obtainable by expressing the polynucleotide sequences of SEQ ID
NO:
1, SEQ ID NO: 2, SEQ ID NO: 3, OR SEQ ID NO: 6 in an appropriate host. Also, a
peptide or polypeptide comprising a functional equivalent of the above
polypeptides is
comprised within the present invention. The above polypeptides are
collectively
comprised in the term "polypeptides according to the invention"
The terms "peptide" and "oligopeptide" are considered synonymous
(as is commonly recognized) and each term can be used interchangeably as the
context requires to indicate a chain of at least two amino acids coupled by
peptidyl
linkages. The word "polypeptide" is used herein for chains containing more
than seven
amino acid residues. All oligopeptide and polypeptide formulas or sequences
herein
are written from left to right and in the direction from amino terminus to
carboxy
terminus. The one-letter code of amino acids used herein is commonly known in
the art
and can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual,
2"d,ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold
Spring
Harbor, NY, 1989)
By "isolated" or "purified" polypeptide or protein is intended a
polypeptide or protein removed from its native environment. For example,
recombinantly produced polypeptides and proteins expressed in host cells are
considered isolated for the purpose of the invention as are native or
recombinant
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-10-
polypeptides which have been substantially purified by any suitable technique
such as,
for example, a simple ultrafiltration step to separate the enzyme from the
cell mass or
the single-step purification method disclosed in Smith and Johnson, Gene 67:31-
40
(1988).
The polypeptide according to the invention can be recovered and
purified from recombinant cell cultures by well-known methods including
ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite chromatography and
lectin
chromatography. Most preferably, high performance liquid chromatography
("HPLC") is
employed for purification.
Polypeptides of the present invention include naturally purified
products, products of chemical synthetic procedures, and products produced by
recombinant techniques from a prokaryotic or eukaryotic host, including, for
example,
bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the
host
employed in a recombinant production procedure, the polypeptides of the
present
invention may be glycosylated or may be non-glycosylated. In addition,
polypeptides of
the invention may also include an initial modified methionine residue, in some
cases as
a result of host-mediated processes.
An advantageous embodiment of the invention concerns a purified or
isolated polypeptide having Endo-Pro activity. Such purified or isolated
polypeptide
may be obtained from a fermentation broth wherein an organism according to the
invention, such as an A. niger strain carrying a polynucleotide according to
the
invention, has been cultured. A person skilled in the art will know how to
obtain at least
partially purified enzyme from the supernatant of such a culture. In its most
basic form
the producing cells are separated from the fermentation broth by
centrifugation. The
resulting liquid is then filtered using a filter-aid, followed by an ultra-
filtration step so
that an enzyme solution containing 1 to 50 enzyme units per millilitre is
obtained. Under
ideal conditions the enzyme can be used as such, i.e. without additional
purification. If
required the shelf stability of the enzyme can be improved by spray drying or
stabilizing
the enzyme by lowering the water activity of the enzyme solution e.g. by
adding a
polyol and a preservative.
A particularly advantageous method of purification is the following.
After culturing the cells in an appropriate fermentation broth, the cells were
separated
from the culture supernatant by centrifugation. The supernatant had a hazy
look.
Larger particles remaining in the supernatant were then subsequently removed
by
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-11-
filtration with 0,5% Dicalite or preferably 1.0% Dicalite in order to prevent
clogging of
the filter that is applied in the next step. Next, Germ reduction filtration
was applied to
decrease the amount of germs in the solution. Still, the filtrate was not
clear. A Millipore
filter with a Molecular weight cut-off value of 10kDalton was subsequently
used for
further reduction of water, salt and sugar content of the solution. A pressure
of 1 bar
was applied over the filter. Typical yields obtained were between 50 and 92 %
.based
on units present in the fermentation broth versus units obtained in the
purified
ultrafiltrate. Typical concentrations of enzyme in the ultrafiltrate result in
an prolyl-
specific endoprotease activity in the range of 4 to 10 Units per ml.
Further purification was obtained by applying either of the following
methods:
Lab-scale purification was performed using the Akta Explorer on a 24
ml Q-sepharose FF column (bed height 12 cm / diameter 1.6 cm). 10 ml UF-
concentrate was diluted 10 times in buffer A and applied to the column.
Proteins were
eluted in a gradient: 0 to 50 % B in 20 CV. Buffer A was 20 mM NaAc pH 5.1.
Buffer B
was 20 mM NaAc + 1 M NaCl pH 5.1. Flow was 5 ml/min.
Purification was performed using the Akta purifier according to work
instruction W-0894.A on a 500 ml Q-sepharose FF column (bed height 23.5 cm /
diameter 5 cm).,.200 ml U F-concentrate was diluted 10 times in buffer A and
applied to
the column. Proteins were eluted in a gradient: 0 to 40 % B in 20 CV. Buffer A
was
20 mM NaAc pH 5.1. Buffer B was 20 mM NaAc + 1 M NaCI pH 5.1. Flow was
10mi/min. Fractions were manually collected.
The obtained product exhibited a single peak on HPSEC and
appeared as a single band in SDS PAGE and IEF. It may thus be concluded that
prolyl-
specific endoprotease may be purified to homogeneity using Q-sepharose FF.
Estimated purity was over 90% and specific activity on Z-gly-Pro-pNA was at
least
0.094U/mg.
Polypeptides of the invention may be in an isolated form. It will be
understood that the polypeptide may be mixed with carriers or diluents which
will not
interfere with the intended purpose of the polypeptide and still be regarded
as isolated.
A polypeptide of the invention may also be in a more substantially purified
form, in
which case it will generally comprise the polypeptide in a preparation in
which more
than 70%, e.g. more than 80%, 90%, 95%, 98% or 99% of the proteins in the
preparation is a polypeptide of the invention.
Polypeptides of the invention may be provided in a form such that
they are outside their natural cellular environment. Thus, they may be
substantially
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-12-
isolated or purified, as discussed above, or in a cell in which they do not
occur in
nature, for example a cell of other fungal species, animals, plants or
bacteria.
Advantageously, isolated or purified prolyl-specific endoprotease are
used in the method according to the invention.
An isolated or purified proline-specific endoprotease according to the
invention preferably has at least 10 units of proline specific endoprotease
activity per
gram of proteinaceous material. These units should be measured using the
synthetic
peptide Z-Gly-Pro-pNA at 37 degrees C and pH 5, as described in the Methods
section.
Proline-specific endoproteases are widely found in animals and
plants, but their presence in microorganisms appears to be limited. To date,
proline-
specific endoprotease have been identified in species of Aspergillus (EP 0 522
428),
Flavobacterium (EP 0 967 285) and Aeromonas (J.Biochem.1 13, 790-796),
Xanthomonas and Bacteroides. In contrast to the proline-specific enzymes from
most
of these organisms which are active around pH 8, the enzymes according to the
invention are optimally active at acidic pH, some even have a pH optimum
around pH 5
or below. The proline-specific endoproteases of the invention may be isolated
from one
of the above-mentioned microbial species, particularly from a species of
Aspergillus.
Preferably, the acidic proline-specific endoprotease Endo-Pro is isolated from
a strain
of Aspergillus niger. More preferably, the proline-specific endoprotease is
isolated from
an Aspergillus niger host engineered to overexpress a gene encoding a proline-
specific
endoprotease, although other hosts, such as E. coli are suitable expression
vectors.
For example, the cloning and overproduction of the Flavobacterium derived
proline-
specific endoprotease in, amongst others, E.coli has made certain proline-
specific
endoproteases available in a pure form. An example of such an overproducing
construct is provided in the World Journal of Microbiology &Biotechnology, Vol
11,pp
209-212. An Aspergillus niger host is preferably used to produce a non-
recombinant
self-construct utilizing A. niger promoters to drive the expression of a gene
encoding an
A. niger proline-specific endoprotease.
In a first embodiment, the present invention provides an isolated
polypeptide having an amino acid sequence which has an overall degree of amino
acid
sequence identity to amino acids of SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO:
7
(i.e. the polypeptide) of at least about 40%, preferably at least about 50%,
preferably at
least about 60%, preferably at least about 65%, preferably at least about 70%,
more
preferably at least about 80%, even more preferably at least about 90%, still
more
preferably at least about 95%, and most preferably at least about 97%, and
which has
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-13-
proline specific endoprotease activity.
For the purposes of the present invention, the degree of identity
between two or more amino acid sequences is determined by BLAST P protein
database search program (Altschul et al., 1997, Nucleic Acids Research 25:
3389-
3402) with matrix Blosum 62 and an expected threshold of 10.
A polypeptide of the invention may comprise the amino acid
sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7 or a
substantially homologous sequence, or a fragment of either sequence having
proline
specific endoprotease activity. In general, the naturally occurring amino acid
sequence
shown in SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7 is preferred.
The polypeptide of the invention may also comprise a naturally
occurring variant or species homologue of the polypeptide of SEQ ID NO: 4, SEQ
ID
NO: 5, OR SEQ ID NO: 7.
A variant is a polypeptide that occurs naturally in, for example, fungal,
bacterial, yeast or plant cells, the variant having proline specific
endoprotease activity
and a sequence substantially similar to the protein of SEQ ID NO: 4, SEQ ID
NO: 5,
OR SEQ ID NO: 7. The term "variants" refers to polypeptides which have the
same
essential character or basic biological functionality as the proline specific
endoprotease
of SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7, and includes allelic variants.
Preferably, a variant polypeptide has at least the same level of proline
specific
endoprotease activity as the polypeptide of SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ
ID
NO: 7. Variants include allelic variants either from the same strain as the
polypeptide
of SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7. or from a different strain of
the
same genus or species.
Similarly, a species homologue of the inventive protein is an
equivalent protein of similar sequence which is an proline specific
endoprotease and
occurs naturally in another species of Aspergillus.
Variants and species homologues can be isolated using the
procedures described herein which were used to isolate the polypeptide of SEQ
ID NO:
4, SEQ ID NO: 5, OR SEQ ID NO: 7 and performing such procedures on a suitable
cell
source, for example a bacterial, yeast, fungal or plant cell. Also possible is
to use a
probe of-the invention to probe libraries made from yeast, bacterial, fungal
or plant cells
in order to obtain clones expressing variants or species homologues of the
polypepetide of SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7. These clones can
be manipulated by conventional techniques to generate a polypeptide of the
invention
which thereafter may be produced by recombinant or synthetic techniques known
per
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-14-
se.
The sequence of the polypeptide of SEQ ID NO: 4, SEQ ID NO: 5,
OR SEQ ID NO: 7 and of variants and species homologues can also be modified to
provide polypeptides of the invention. Amino acid substitutions may be made,
for
example from 1, 2 or 3 to 10, 20 or 30 substitutions. The same number of
deletions
and insertions may also be made. These changes may be made outside regions
critical
to the function of the polypeptide, as such a modified polypeptide will retain
its proline
specific endoprotease activity.
Polypeptides of the invention include fragments of the above
mentioned full length polypeptides and of variants thereof, including
fragments of the
sequence set out in SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7. Such
fragments
will typically retain activity as an proline specific endoprotease. Fragments
may be at
least 50, 100 or 200 amino acids long or may be this number of amino acids
short of
the full length sequence shown in SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7.
Polypeptides of the invention can, if necessary, be produced by
synthetic means although usually they will be made recombinantly as described
below.
Synthetic polypeptides may be modified, for example, by the addition of
histidine
residues or a T7 tag to assist their identification or purification, or by the
addition of a
signal sequence to promote their secretion from a cell.
Thus, the variants sequences may comprise those derived from
strains of Aspergillus other than the strain from which the polypeptide of SEQ
ID NO: 4,
SEQ ID NO: 5, OR SEQ ID NO: 7 was isolated. Variants can be identified from
other
Aspergillus strains by looking for proline specific endoprotease activity and
cloning and
sequencing as described herein. Variants may include the deletion,
modification or
addition of single amino acids or groups of amino acids within the protein
sequence, as
long as the peptide maintains the basic biological functionality of the
proline specific
endoprotease of SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7.
Amino acid substitutions may be made, for example from 1, 2 or from
3 to 10, 20 or 30 substitutions. The modified polypeptide will generally
retain activity as
an proline specific endoprotease. Conservative substitutions may be made; such
substitutions are well known in the art. Preferably substitutions do not
affect the folding
or activity of the polypeptide.
Shorter polypeptide sequences are within the scope of the invention.
For example, a peptide of at least 50 amino acids or up to 60, 70, 80, 100,
150 or 200
amino acids in length is considered to fall within the scope of the invention
as long as it
demonstrates the basic biological functionality of the proline specific
endoprotease of
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-15-
SEQ ID NO: 4, SEQ ID NO: 5, OR SEQ ID NO: 7. In particular, but not
exclusively, this
aspect of the invention encompasses the situation in which the protein is a
fragment of
the complete protein sequence.
In a second embodiment, the present invention provides an to
isolated polypeptide which has proline specific endoprotease activity, and is
encoded
by polynucleotides which hybridize or are capable of hybrizing under low
stringency
conditions, more preferably medium stringency conditions, and most preferably
high
stringency conditions, with (I) the nucleic acid sequence of SEQ ID NO: 1, SEQ
ID NO:
2, SEQ ID NO: 3 OR SEQ ID NO: 6 or a nucleic acid fragment comprising at least
the
c-terminal portion of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO:
6,
but having less than all or having bases differing from the bases of SEQ ID
NO: 1, SEQ
ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6; or (ii) with a nucleic acid strand
complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6.
The term "capable of hybridizing" means that the target
polynucleotide of the invention can hybridize to the nucleic acid used as a
probe (for
example, the nucleotide sequence set forth in SEQ. ID NO: 1, SEQ ID NO: 2, SEQ
ID
NO: 3 OR SEQ ID NO: 6, or a fragment thereof, or the complement of SEQ ID NO:
1,
SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6) at a level significantly above
background. The invention also includes the polynucleotides that encode the
proline
specific endoprotease of the invention, as well as nucleotide sequences which
are
complementary thereto. The nucleotide sequence may be RNA or DNA, including
genomic DNA, synthetic DNA or cDNA. Preferably, the nucleotide sequence is DNA
and most preferably, a genomic DNA sequence. Typically, a polynucleotide of
the
invention comprises a contiguous sequence of nucleotides which is capable of
hybridizing under selective conditions to the coding sequence or the
complement of the
coding sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6.
Such nucleotides can be synthesized according to methods well known in the
art.
A polynucleotide of the invention can hybridize to the coding
sequence or the complement of the coding sequence of SEQ ID NO: 1, SEQ ID NO:
2,
SEQ ID NO: 3 OR SEQ ID NO: 6 at a level significantly above background.
Background hybridization may occur, for example, because of other cDNAs
present in
a cDNA library. The signal level generated by the interaction between a
polynucleotide
of the invention and the coding sequence or complement of the coding sequence
of
SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6 is typically at least
10
fold, preferably at least 20 fold, more preferably at least 50 fold, and even
more
preferably at least 100 fold, as intense as interactions between other
polynucleotides
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-16-
and the coding sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID
NO: 6. The intensity of interaction may be measured, for example, by
radiolabelling the
probe, for example with 32P. Selective hybridization may typically be achieved
using
conditions of low stringency (0.3M sodium chloride and 0.03M sodium citrate at
about
40 C), medium stringency (for example, 0.3M sodium chloride and 0.03M sodium
citrate at about 50 C) or high stringency (for example, 0.3M sodium chloride
and 0.03M
sodium citrate at about 60 C).
Modifications
Polynucleotides of the invention may comprise DNA or RNA. They
may be single or double stranded. They may also be polynucleotides which
include
within them synthetic or modified nucleotides including peptide nucleic acids.
A number
of different types of modifications to polynucleotides are known in the art.
These
include a methylphosphonate and phosphorothioate backbones, and addition of
acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For
the purposes
of the present invention, it is to be understood that the polynucleotides
described
herein may be modified by any method available in the art.
It is to be understood that skilled persons may, using routine
techniques, make nucleotide substitutions that do not affect the polypeptide
sequence
encoded by the polynucleotides of the invention to reflect the codon usage of
any
particular host organism in which the polypeptides of the invention are to be
expressed.
The coding sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:
3 OR SEQ ID NO: 6 may be modified by nucleotide substitutions, for example
from 1, 2
or 3 to 10, 25, 50 or 100 substitutions. The polynucleotide of SEQ ID NO: 1,
SEQ ID
NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6 may alternatively or additionally be
modified
by one or more insertions and/or deletions and/or by an extension at either or
both
ends. The modified polynucleotide generally encodes a polypeptide which has
proline
specific endoprotease activity. Degenerate substitutions may be made and/or
substitutions may be made which would result in a conservative amino acid
substitution
when the modified sequence is translated, for example as discussed with
reference to
polypeptides later.
Homologues
A nucleotide sequence which is capable of selectively hybridizing to
the complement of the DNA coding sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID
NO: 3 OR SEQ ID NO: 6 is included in the invention and will generally have at
least
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-17-
50% or 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least
98% or -at
least 99% sequence identity to the coding sequence of SEQ ID NO: 1, SEQ ID NO:
2,
SEQ ID NO: 3 OR SEQ ID NO: 6 over a region of at least 60, preferably at least
100,
more preferably at least 200 contiguous nucleotides or most preferably over
the full
length of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6. Likewise,
'a
nucleotide which encodes an active proline specific endoprotease and which is
capable
of selectively hybridizing to a fragment of a complement of the DNA coding
sequence
of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6, is also embraced
by the invention. A C-terminal fragment of the nucleic acid sequence of SEQ ID
NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6 which is at least 80% or 90%
identical
over 60, preferably over 100 nucleotides, more preferably at least 90%
identical over
200 nucleotides is encompassed by the invention.
Any combination of the above mentioned degrees of identity and
minimum sizes may be used to define polynucleotides of the invention, with the
more
stringent combinations (i.e. higher identity over longer lengths) being
preferred. Thus,
for example, a polynucleotide which is at least 80% or 90% identical over 60,
preferably
over 100 nucleotides, forms one aspect of the invention, as does a
polynucleotide
which is at least 90% identical over 200 nucleotides.
The UWGCG Package provides the BESTFIT program which may be
used to calculate identity (for example used on its default settings).
The PILEUP and BLAST N algorithms can also be used to calculate
sequence identity or to line up sequences (such as identifying equivalent or
corresponding sequences, for example on their default settings).
Software for performing BLAST analyses is publicly available through
425 the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.Clov/). This
algorithm involves first identifying high scoring sequence pair (HSPs) by
identifying
short words of length W in the query sequence that either match or satisfy
some
positive-valued threshold score T when aligned with a word of the same length
in a
database sequence. T is referred to as the neighborhood word score threshold.
These
initial neighborhood word hits act as seeds for initiating searches to find
HSPs
containing them. The word hits are extended in both directions along each
sequence
for as far as the cumulative alignment score can be increased. Extensions for
the word
hits in each direction are halted when: the cumulative alignment score falls
off by the
quantity X from its maximum achieved value; the cumulative score goes to zero
or
below, due to the accumulation of one or more negative-scoring residue
alignments; or
the end of either sequence is reached. The BLAST algorithm parameters W, T and
X
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-18-
determine the sensitivity and speed of the alignment. The BLAST program uses
as
defaults a word length (W) of 11, the BLOSUM62 scoring matrix alignments (B)
of 50,
expectation (E) of 10, M=5, N=4, and a comparison of both strands.
The BLAST algorithm performs a statistical analysis of the similarity
between two sequences. One measure of similarity provided by the BLAST
algorithm
is the smallest sum probability (P(N)), which provides an indication of the
probability by
which a match between two nucleotide or amino acid sequences would occur by
chance. For example, a sequence is considered similar to another sequence if
the
smallest sum probability in comparison of the first sequence to the second
sequence is
less than about 1, preferably less than about 0.1, more preferably less than
about 0.01,
and most preferably less than about 0.001.
Primers and Probes
Polynucleotides of the invention include and may be used as primers,
for example as polymerase chain reaction (PCR) primers, as primers for
alternative
amplification reactions, or as probes for example labelled with a revealing
label by
conventional means using radioactive or non-radioactive labels, or the
polynucleotides
may be cloned into vectors. Such primers, probes and other fragments will be
at least
15, for example at least 20, 25, 30 or 40 nucleotides in length. They will
typically be up
to 40, 50, 60, 70, 100, 150, 200 or 300 nucleotides in length, or even up to a
few
nucleotides (such as 5 or 10 nucleotides) short of the coding sequence of SEQ
ID NO:
1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6.
In general, primers will be produced by synthetic means, involving a
step-wise manufacture of the desired nucleic acid sequence one nucleotide at a
time.
Techniques for accomplishing this using automated protocols are readily
available in
the art. Longer polynucleotides will generally be produced using recombinant
means,
for example using PCR cloning techniques. This will involve making a pair of
primers
(typically of about 15-30 nucleotides) to amplify the desired region of the
proline
specific endoprotease to be cloned, bringing the primers into contact with
mRNA,
cDNA or genomic DNA obtained from a yeast, bacterial, plant, prokaryotic or
fungal
cell, preferably of an Aspergillus strain, performing a polymerase chain
reaction under
conditions suitable for the amplification of the desired region, isolating the
amplified
fragment (e.g. by purifying the reaction mixture on an agarose gel) and
recovering the
amplified DNA. The primers may be designed to contain suitable restriction
enzyme
35' recognition sites so that the amplified DNA can be cloned into a suitable
cloning vector.
Such techniques may be used to obtain all or part of the
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-19-
polynucleotides encoding the proline specific endoprotease sequences described
herein. Introns, promoter and trailer regions.are within the scope of the
invention and
may also be obtained in an analogous manner (e.g. by recombinant means, PCR or
cloning techniques), starting with genomic DNA from a fungal, yeast, bacterial
plant or
prokaryotic cell.
The polynucleotides or primers may carry a revealing label. Suitable
labels include radioisotopes such as 32P or 35S, enzyme labels, or other
protein labels
such as biotin. Such labels may be added to polynucleotides or primers of the
invention and may be detected using techniques known to persons skilled in the
art.
Polynucleotides or primers (or fragments thereof) labelled or
unlabelled may be used in nucleic acid-based tests for detecting or sequencing
an
proline specific endoprotease or a variant thereof in a fungal sample. Such
detection
tests will generally comprise bringing a fungal sample suspected of containing
the DNA
of interest into contact with a probe comprising a polynucleotide or primer of
the
invention under hybridizing conditions, and detecting any duplex formed
between the
probe and nucleic acid in the sample. Detection may be achieved using
techniques
such as PCR or by immobilizing the probe on a solid support, removing any
nucleic
acid in the sample which is not hybridized to the probe, and then detecting
any nucleic
acid which is hybridized to the probe. Alternatively, the sample nucleic acid
may be
immobilized on a solid support, the probe hybridized and the amount of probe
bound to
such a support after the removal of any unbound probe detected.
The probes of the invention may conveniently be packaged in the.
form of a test kit in a suitable container. In such kits the probe may be
bound to a solid
support where the assay format for which the kit is designed requires such
binding.
The kit may also contain suitable reagents for treating the sample to be
probed,
hybridizing the probe to nucleic acid in the sample, control reagents,
instructions, and
the like. The probes and polynucleotides of the invention may also be used in
microassay.
Preferably, the polynucleotide of the invention is obtainable from the
same organism as the polypeptide, such as a fungus, in particular a fungus of
the
genus Aspergillus.
The polynucleotides of the invention also include variants of the
sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6 which
encode for a polypeptide having proline specific endoprotease activity.
Variants may
be formed by additions, substitutions and/or deletions. Such variants of the
coding
sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6 may thus
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-20-
encode polypeptides which have the ability to digest a polypeptide chain at
the
carboxyterminal side of proline.
Production of polynucleotides
Polynucleotides which do not have 100% identity with SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6 but fall within the scope of the
invention can be obtained in a number of ways. Thus, variants of the proline
specific
endoprotease sequence described herein may be obtained for example, by probing
genomic DNA libraries made from a range of organisms, such as those discussed
as
sources of the polypeptides of the invention. In addition, other fungal, plant
or
prokaryotic homologues of proline specific endoprotease may be obtained and
such
homologues and fragments thereof in general will be capable of hybridising to
SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6. Such sequences may be
obtained by probing cDNA libraries or genomic DNA libraries from other
species, and
probing such libraries with probes comprising all or part of SEQ ID. 1 under
conditions
of low, medium to high stringency (as described earlier). Nucleic acid probes
comprising all or part of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID
NO:
6 may be used to probe cDNA or genomic libraries from other species, such as
those
described as sources for the polypeptides of the invention.
Species homologues may also be obtained using degenerate PCR,
which uses primers designed.to target sequences within the variants and
homologues
which encode conserved amino acid sequences. The primers can contain one or
more
degenerate positions and will be used at stringency conditions lower than
those used
for cloning sequences with single sequence primers against known sequences.
Alternatively, such polynucleotides may be obtained by site directed
mutagenesis of the proline specific endoprotease sequences or variants
thereof. This
may be useful where, for example, silent codon changes to sequences are
required to
optimize codon preferences for a particular host cell in which the
polynucleotide
sequences are being expressed. Other sequence changes may be made in order to
introduce restriction enzyme recognition sites, or to alter the property or
function of the
polypeptides encoded by the polynucleotides.
The invention includes double stranded polynucleotides comprising a
polynucleotide of the invention and its complement.
The present invention also provides polynucleotides encoding the
polypeptides of the invention described above. Since such polynucleotides will
be
useful as sequences for recombinant production of polypeptides of the
invention, it is
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-21 -
not necessary for them to be capable of hybridising to the sequence of SEQ ID
NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3 OR SEQ ID NO: 6, although this will generally be
desirable. Otherwise, such polynucleotides may be labelled, used, and made as
described above if desired.
Recombinant Polynucleotides.
The invention also provides vectors comprising a polynucleotide of
the invention, including cloning and expression vectors, and in another aspect
methods
of growing, transforming or transfecting such vectors into a suitable host
cell, for
example under conditions in which expression of a polypeptide of, or encoded
by a
sequence of, the invention occurs. Provided also are host cells comprising a
polynucleotide or vector of the invention wherein the polynucleotide is
heterologous to
the genome of the host cell. The term "heterologous", usually with respect to
the host
cell, means that the polynucleotide does not naturally occur in the genome of
the host
cell or that the polypeptide is not naturally produced by that cell.
Preferably, the host
cell is a yeast cell, for example a yeast cell of the genus Kluyveromyces or
Saccharomyces or a filamentous fungal cell, for example of the genus
Aspergillus.
Polynucleotides of the invention can be incorporated into a
recombinant replicable vector, for example a cloning or expression vector. The
vector
may be used to replicate the nucleic acid in a compatible host cell. Thus, in
a further
embodiment, the invention provides a method of making polynucleotides of the
invention by introducing a polynucleotide of the invention into a replicable
vector,
introducing the vector into a compatible host cell, and growing the host cell
under
conditions which bring about replication of the vector. The vector may be
recovered
from the host cell. Suitable host cells are described below in connection with
expression vectors.
Vectors
The vector into which the expression cassette of the invention is
inserted may be any vector that may conveniently be subjected to recombinant
DNA
procedures, and the choice of the vector will often depend on the host cell
into which it
is to be introduced. Thus, the vector may be an autonomously replicating
vector, i.e. a
vector which exists as an extra-chromosomal entity, the replication of which
is
independent of chromosomal replication, such as a plasmid. Alternatively, the
vector
may be one which, when introduced into a host cell, is integrated into the
host cell
genome and replicates together with the chromosome(s) into which it has been
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-22-
integrated.
Preferably, when a polynucleotide of the invention is in a vector it is
operably linked to a regulatory sequence which is capable of providing for the
expression of the coding sequence by the host cell, i.e. the vector is an
expression
vector. The term "operably linked" refers to a juxtaposition wherein the
components
described are in a relationship permitting them to function in their intended
manner. A
regulatory sequence such as a promoter, enhancer or other expression
regulation
signal "operably linked" to a coding sequence is positioned in such a way that
expression of the coding sequence is achieved under conditions compatible with
the
control sequences.
The vectors may, for example in the case of plasmid, cosmid, virus or
phage vectors, be provided with an origin of replication, optionally a
promoter for the
expression of the polynucleotide and optionally an enhancer and/or a regulator
of the
promoter. A terminator sequence may be present, as may be a polyadenylation
sequence. The vectors may contain one or more selectable marker genes, for
example an ampicillin resistance gene in the case of a bacterial plasmid or a
neomycin
resistance gene for a mammalian vector. Vectors may be used in vitro, for
example for
the production of RNA or can be used to transfect or transform a host cell.
The DNA sequence, encoding the polypeptide is preferably
introduced into a suitable host as part of an expression construct in which
the DNA
sequence is operably linked to expression signals which are capable of
directing
expression of the DNA sequence in the host cells. For transformation of the
suitable
host with the expression construct transformation procedures are available
which are
well known to the skilled person. The expression construct can be used for
transformation of the host as part of a vector carrying a selectable marker,
or the
expression construct is co-transformed as a separate molecule together with
the vector
carrying a selectable marker. The vectors may contain one or more selectable
marker
genes.
Preferred selectable markers include but are not limited to those that
complement a defect in the host cell or confer resistance to a drug. They
include for
example versatile marker genes that can be used for transformation of most
filamentous fungi and yeasts such as acetamidase genes or cDNAs (the amdS,
niaD,
facA genes or cDNAs from A.nidulans, A.oryzae, or A.niger), or genes providing
resistance to antibiotics like G418, hygrornycin, bleomycin, kanamycin,
phleomycin or
benomyl resistance (benA). Alternatively, specific selection markers can be
used such
as auxotrophic markers which require corresponding mutant host strains: e.g.
URA3
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-23-
(from S.cerevisiae or analogous genes from other yeasts), pyre or pyrA (from
A.nidulans or A.niger), argB (from A.nidulans or A.niger) or trpC. In a
preferred
embodiment the selection marker is deleted from the transformed host cell
after
introduction of the expression construct so as to obtain transformed host
cells capable
of producing the polypeptide which are free of selection marker genes.
Other markers include ATP synthetase subunit 9 (oliC), orotidine-5'-
phosphate- decarboxylase (pvrA), the bacterial G418 resistance gene (useful in
yeast,
but not in filamentous fungi), the ampicillin resistance gene (E. coli), the
neomycin
resistance gene (Bacillus) and the E. coli uidA gene, coding for glucuronidase
(GUS).
Vectors may be used in vitro, for example for the production of RNA or to
transfect or
transform a host cell.
For most filamentous fungi and yeast, the expression construct is
preferably integrated into the genome of the host cell in order to obtain
stable
transformants. However, for certain yeasts suitable episomal vector systems
are also
available into which the expression construct can be incorporated for stable
and high
level expression. Examples thereof include vectors derived from the 2 pm, CEN
and
pKD1 plasmids of Saccharomyces and Kluyveromyces, respectively, or vectors
containing an AMA sequence (e.g. AMA1 from Aspergillus). When expression
constructs are integrated into host cell genomes, the constructs are either
integrated at
random loci in the genome, or at predetermined target loci using homologous
recombination, in which case the target loci preferably comprise a highly
expressed
gene. A highly expressed gene is a gene whose mRNA can make up at least 0.01%
(w/w) of the total cellular mRNA, for example under induced conditions, or
alternatively,
a gene whose gene product can make up at least 0.2% (w/w) of the total
cellular
protein, or, in case of a secreted gene product, can be secreted to a level of
at least
0.05 g/I.
An expression construct for a given host cell will usually contain the
following elements operably linked to each other in consecutive order from the
5'-end
to 3'-end relative to the coding strand of the sequence encoding the
polypeptide of the
first aspect: (1) a promoter sequence capable of directing transcription of
the DNA
sequence encoding the polypeptide in the given host cell, (2) preferably, a 5'-
untranslated region (leader), (3) optionally, a signal sequence capable of
directing
secretion of the polypeptide from the given host cell into the culture medium,
(4) the
DNA sequence encoding a mature and preferably active form of the polypeptide,
and
preferably also (5) a transcription termination region (terminator) capable of
terminating
transcription downstream of the DNA sequence encoding the polypeptide.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-24-
Downstream of the DNA sequence encoding the polypeptide, the
expression construct preferably contains a 3' untranslated region containing
one or
more transcription termination sites, also referred to as a terminator. The
origin of the
terminator is less critical. The terminator can for example be native to the
DNA
sequence encoding the polypeptide. However, preferably a yeast terminator is
used in
yeast host cells and a filamentous fungal terminator is used in filamentous
fungal host
cells. More preferably, the terminator is endogenous to the host cell in which
the DNA
sequence encoding the polypeptide is expressed.
Enhanced expression of the polynucleotide encoding the polypeptide
of the invention may also be achieved by the selection of heterologous
regulatory
regions, e.g. promoter, signal sequence and terminator regions, which serve to
increase expression and, if desired, secretion levels of the protein of
interest from the
chosen expression host and/or to provide for the inducible control of the
expression of
the polypeptide of the invention.
Aside from the promoter native to the gene encoding the polypeptide
of the invention, other promoters may be used to direct expression of the
polypeptide of
the invention. The promoter may be selected for its efficiency in directing
the
expression of the polypeptide of the invention in the desired expression host.
Promoters/enhancers and other expression regulation signals may be
selected to be compatible with the host cell for which the expression vector
is
designed. For example prokaryotic promoters may be used, in particular those
suitable
for use in E.coli strains. When expression of the polypeptides of the
invention is
carried out in mammalian cells, mammalian promoters may be used. Tissues-
specific
promoters, for example hepatocyte cell-specific promoters, may also be used.
Viral
promoters may also be used, for example the Moloney murine leukaemia virus
long
terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the
SV40
promoter, the human cytomegalovirus (CMV) IE promoter, herpes simplex virus
promoters or adenovirus promoters.
Suitable yeast promoters include the S. cerevisiae GAL4 and ADH
promoters and the S. pombe nmtl and adh promoter. Mammalian promoters include
the metallothionein promoter which can be induced in response to heavy metals
such
as cadmium. Viral promoters such as the SV40 large T antigen promoter or
adenovirus
promoters may also be used. All these promoters are readily available in the
art.
Mammalian promoters, such as i3-actin promoters, may be used.
Tissue-specific promoters, in particular endothelial or neuronal cell specific
promoters
(for example the DDAHI and DDAHII promoters), are especially preferred. Viral
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-25-
promoters may also be used, for example the Moloney murine leukaemia virus
long
terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the
SV40
promoter, the human cytomegalovirus (CMV) IE promoter, adenovirus, HSV
promoters
(such. as the HSV IE promoters), or HPV promoters, particularly the HPV
upstream
regulatory region (URR). Viral promoters are readily available in the art. 11
A variety of promoters can be used that are capable of directing
transcription in the host cells of the invention. Preferably the promoter
sequence is
derived from a highly expressed gene as previously defined. Examples of
preferred
highly expressed genes from which promoters are preferably derived and/or
which are
comprised in preferred predetermined target loci for integration of expression
constructs, include but are not limited to genes encoding glycolytic enzymes
such as
triose-phosphate isomerases (TPI), glyceraldehyde-phosphate dehydrogenases
(GAPDH), phosphoglycerate kinases (PGK), pyruvate kinases (PYK), alcohol
dehydrogenases (ADH), as well as genes encoding amylases, glucoamylases,
proteases, xylanases, cellobiohydrolases, (3-galactosidases, alcohol
(methanol)
oxidases, elongation factors and ribosomal proteins. Specific examples of
suitable
highly expressed genes include e.g. the LAC4 gene from Kluyveromyces sp., the
methanol oxidase genes (AOX and MOX) from Hansenula and Pichia, respectively,
the glucoamylase (glaA) genes from A.niger and A.awamori, the A.oryzae TAKA-
amylase gene, the A.nidulans gpdA gene and the T.reesei cellobiohydrolase
genes.
Examples of strong constitutive and/or inducible promoters which are
preferred for use in fungal expression hosts are those which are obtainable
from the
fungal genes for xylanase (xlnA), phytase, ATP-synthetase subunit 9 (oliC),
triose
phosphate isomerase (tpi), alcohol dehydrogenase (AdhA), amylase (amy),
amyloglucosidase (AG - from the glaA gene), acetamidase (amdS) and
glyceraldehyde-3-phosphate dehydrogenase (gpd) promoters.
Examples of strong yeast promoters which may be used include
those obtainable from the genes for alcohol dehydrogenase, lactase, 3-
phosphoglycerate kinase and triosephosphate isomerase.
Examples of strong bacterial promoters which may be used include
the amylase and SPo2 promoters as well as promoters from extracellular
protease
genes.
Promoters suitable for plant cells which may be used include
napaline synthase (nos), octopine synthase (ocs), mannopine synthase (mas),
ribulose
small subunit (rubisco ssu), histone, rice actin, phaseolin, cauliflower
mosaic virus
(CMV) 35S and 19S and circovirus promoters. The vector may further include
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-26-
sequences flanking the polynucleotide giving rise to RNA which comprise
sequences
homologous to ones from eukaryotic genomic sequences, preferably mammalian
genomic sequences, or viral genomic sequences. This will allow the
introduction of the
polynucleotides of the invention into the genome of eukaryotic cells or
viruses by
homologous recombination. In particular, a plasmid vector comprising the
expression
cassette flanked by viral sequences can be used to prepare a viral vector
suitable for
delivering the polynucleotides of the invention to a mammalian cell. Other
examples of
suitable viral vectors include herpes simplex viral vectors and retroviruses,
including
lentiviruses, adenoviruses, adeno-associated viruses and HPV viruses (such as
HPV-
16 or HPV-18). Gene transfer techniques using these viruses are known to those
skilled in the art. Retrovirus vectors for example may be used to stably
integrate the
polynucleotide giving rise to the antisense RNA into the host genome.
Replication-
defective adenovirus vectors by contrast remain episomal and therefore allow
transient
expression.
The vector may contain a polynucleotide of the invention oriented in
an antisense direction to provide for the production of antisense RNA. This
may be
used to reduce, if desirable, the levels of expression of the polypeptide.
Host Cells and Expression
In a further aspect the invention provides a process for preparing a
polypeptide of the invention which comprises cultivating a host cell
transformed or
transfected with an expression vector as described above under conditions
suitable for
expression by the vector of a coding sequence encoding the polypeptide, and
recovering the expressed polypeptide. Polynucleotides of the invention can be
incorporated into a recombinant replicable vector, such as an expression
vector. The
vector may be used to replicate the nucleic acid in a compatible host cell.
Thus in a
further embodiment, the invention provides a method of making a polynucleotide
of the
invention by introducing a polynucleotide of the invention into a replicable
vector,
introducing the vector into a compatible host cell, and growing the host cell
under
conditions which bring about the replication of the vector. The vector may be
recovered from the host cell. Suitable host cells include bacteria such as E.
coli, yeast,
mammalian cell lines and other eukaryotic cell lines, for example insect cells
such as
Sf9 cells and (e.g. filamentous) fungal cells.
Preferably the polypeptide is produced as a secreted protein in which
case the DNA sequence encoding a mature form of the polypeptide in the
expression
construct is operably linked to a DNA sequence encoding a signal sequence. In
the
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-27-
case where the gene encoding the secreted protein has in the wild type strain
a signal
sequence preferably the signal sequence used will be native (homologous) to
the DNA
sequence encoding the polypeptide.. Alternatively the signal sequence is
foreign
(heterologous) to the DNA sequence encoding the polypeptide, in which case the
signal sequence is preferably endogenous to the host cell in which the DNA
sequence
is expressed. Examples of suitable signal sequences for yeast host cells are
the signal
sequences derived from yeast MFalpha genes. Similarly, a suitable signal
sequence for
filamentous fungal host cells is e.g. a signal sequence derived from a
filamentous
fungal amyloglucosidase (AG) gene, e.g. the A.niger glaA gene. This signal
sequence
may be used in combination with the amyloglucosidase (also called
(gluco)amylase)
promoter itself, as well as in combination with other promoters. Hybrid signal
sequences may also be used within the context of the present invention.
Preferred heterologous secretion leader sequences are those
originating from the fungal amyloglucosidase (AG) gene (glaA - both 18 and 24
amino
acid versions e.g. from Aspergillus), the MFalpha gene (yeasts e.g.
Saccharomyces
and Kluyveromyces) or the alpha-amylase gene (Bacillus).
The vectors may be transformed or transfected into a suitable host
cell as described above to provide for expression of a polypeptide of the
invention.
This process may comprise culturing a host cell transformed with an expression
vector
as described above under conditions suitable for expression of the
polypeptide, and
optionally recovering the expressed polypeptide.
A further aspect of the invention thus provides host cells transformed
or transfected with or comprising a polynucleotide or vector of the invention.
Preferably
the polynucleotide is carried in a vector which allows the replication and
expression of
the polynucleotide. The cells will be chosen to be compatible with the said
vector and
may for example be prokaryotic (for example bacterial), or eukaryotic fungal,
yeast or
plant cells.
The invention encompasses processes for the production of a
polypeptide of the invention by means of recombinant expression of a DNA
sequence
encoding the polypeptide. For this purpose the DNA sequence of the invention
can be
used for gene amplification and/or exchange of expression signals, such as
promoters,
secretion signal sequences, in order to allow economic production of the
polypeptide in
a suitable homologous or heterologous host cell. A homologous host cell is
herein
defined as a host cell which is of the same species or which is a variant
within the
same species as the species from which the DNA sequence is derived.
Suitable host cells are preferably prokaryotic microorganisms such as
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-28-
bacteria, or more preferably eukaryotic organisms, for example fungi, such as
yeasts or
filamentous fungi, or plant cells. In general, yeast cells are preferred over
filamentous
fungal cells because they are easier to manipulate. However, some proteins are
either
poorly secreted from yeasts, or in some cases are not processed properly (e.g.
hyperglycosylation in yeast). In these instances, a filamentous fungal host
organism
should be selected.
Bacteria from the genus Bacillus are very suitable as heterologous
hosts because of their capability to secrete proteins into the culture medium.
Other
bacteria suitable as hosts are those from the genera Streptomyces and
Pseudomonas.
A preferred yeast host cell for the expression of the DNA sequence encoding
the
polypeptide is one of the genus Saccharomyces, Kluyveromyces, Hansenula,
Pichia,
Yarrowia, or Schizosaccharomyces. More preferably, a yeast host cell is
selected from
the group consisting of the species Saccharomyces cerevisiae, Kluyveromyces
lactis
(also known as Kluyveromyces marxianus var. lactis), Hansenula polymorpha,
Pichia
pastoris, Yarrowia lipolytica,and Schizosaccharomyces pombe.
Most preferred for the expression of the DNA sequence encoding the
polypeptide are, however, filamentous fungal host cells. Preferred filamentous
fungal
host cells are selected from the group consisting of the genera Aspergillus,
Trichoderma, Fusarium, Disporotrichum, Penicillium, Acremonium, Neurospora,
Thermoascus, Myceliophtora, Sporotrichum, Thielavia, and Talaromyces. More
preferably a filamentous fungal host cell is of the species Aspergillus oyzae,
Aspergillus
sojae or Aspergillus nidulans or is of a species from the Aspergillus niger
Group (as
defined by Raper and Fennell, The Genus Aspergillus, The Williams & Wilkins
Company, Baltimore, pp 293-344, 1965). These include but are not limited to
Aspergillus niger, Aspergillus awamori, Aspergillus tubigensis, Aspergillus
aculeatus,
Aspergillus foetidus, Aspergillus nidulans, Aspergillus japonicus, Aspergillus
oryzae
and Aspergillus ficuum, and also those of the species Trichoderma reesei,
Fusarium
graminearum, Penicillium chrysogenum, Acremonium alabamense, Neurospora
crassa, Myceliophtora thermophilum, Sporotrichum cellulophilum, Disporotrichum
dimorphosporum and Thielavia terrestris.
Examples of preferred expression hosts within the scope of the
present invention are fungi such as Aspergillus species (in particular those
described in
EP-A-1 84,438 and EP-A-284,603) and Trichoderma species; bacteria such as
Bacillus
species (in particular those described in EP-A-134,048 and EP-A-253,455),
especially
Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens,
Pseudomonas
species; and yeasts such as Kluyveromyces species (in particular those
described in
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-29-
EP-A-096,430 such as Kluyveromyces lactis and in EP-A-301,670) and
Saccharomyyces species, such as Saccharomyces cerevisiae.
Host cells according to the invention include plant cells, and the
invention therefore extends to transgenic organisms, such as plants and parts
thereof,
which contain one or more cells of the invention. The cells may heterologously
express
the polypeptide of the invention or may heterologously contain one or more of
the
polynucleotides of the invention. The transgenic (or genetically modified)
plant may
therefore have inserted (typically stably) into its genome a sequence encoding
the
polypeptides of the invention. The transformation of plant cells can be
performed using
known techniques, for example using a Ti or a Ri plasmid from Agrobacterium
tumefaciens. The plasmid (or vector) may thus contain sequences necessary to
infect
a plant, and derivatives of the Ti and/or Ri plasmids may be employed.
The host cell may overexpress the polypeptide, and techniques for
engineering over-expression are well known and can be used in the present
invention.
The host may thus have two or more copies of the polynucleotide.
Alternatively, direct infection of a part of a plant, such as a leaf, root
or stem can be effected. In this technique the plant to be infected can be
wounded, for
example by cutting the plant with a razor, puncturing the plant with a needle
or rubbing
the plant with an abrasive. The wound is then innoculated with the
Agrobacterium.
The plant or plant part can then be grown on a suitable culture medium and
allowed to
develop into a mature plant. Regeneration of transformed cells into
genetically
modified plants can be achieved by using known techniques, for example by
selecting
transformed shoots using an antibiotic and by sub-culturing the shoots on a
medium
containing the appropriate nutrients, plant hormones and the like.
Culture of host cells and recombinant production
The invention also includes cells that have been modified to express
the proline specific endoprotease or a variant thereof. Such cells include
transient, or
preferably stably modified higher eukaryotic cell lines, such as mammalian
cells or
insect cells, lower eukaryotic cells, such as yeast and filamentous fungal
cells or
prokaryotic cells such as bacterial cells.
It is also possible for the polypeptides of the invention to be
transiently expressed in a cell line or on a membrane, such as for example in
a
baculovirus expression system. Such systems, which are adapted to express the
proteins according to the invention, are also included within the scope of the
present
invention.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-30-
According to the present invention, the production of the polypeptide
of the invention can be effected by the culturing of microbial expression
hosts, which
have been transformed with one or more polynucleotides of the present
invention, in a
conventional nutrient fermentation medium.
The recombinant host cells according to the invention may be
cultured using procedures known in the art. For each combination of a promoter
and a
host cell, culture conditions are available which are conducive to the
expression the
DNA sequence encoding the polypeptide. After reaching the desired cell density
or
titre of the polypeptide the culturing is ceased and the polypeptide is
recovered using
known procedures.
The fermentation medium can comprise a known culture medium
containing a carbon source (e.g. glucose, maltose, molasses, etc.), a nitrogen
source
(e.g. ammonium sulphate, ammonium nitrate, ammonium chloride, etc.), an
organic
nitrogen source (e.g. yeast extract, malt extract, peptone, etc.) and
inorganic nutrient
sources (e.g. phosphate, magnesium, potassium, zinc, iron, etc.). Optionally,
an
inducer (dependent on the expression construct used) may be included or
subsequently be added.
The selection of the appropriate medium may be based on the choice
of expression host and/or based on the regulatory requirements of the
expression
construct. Suitable media are well-known to those skilled in the art. The
medium may, if
desired, contain additional components favoring the transformed expression
hosts over
other potentially contaminating microorganisms.
The fermentation may be performed over a period of from 0.5-30
days. Fermentation may be a batch, continuous or fed-batch process, at a
suitable
temperature in the range of between 0 C and 45 C and, for example, at a pH
from 2 to
10. Preferred fermentation conditions include a temperature in the range of
between
20 C and 37 C and/or a pH between 3 and 9. The appropriate conditions are
usually
selected based on the choice of the expression host and the protein to be
expressed.
After fermentation, if necessary, the cells can be removed from the
fermentation broth by means of centrifugation or filtration. After
fermentation has
stopped or after removal of the cells, the polypeptide of the invention may
then be
recovered and, if desired, purified and isolated by conventional means. The
proline
specific endoprotease of the invention can be purified from fungal mycelium or
from the
culture broth into which the proline specific endoprotease is released by the
cultured
fungal cells.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-31-
In a preferred embodiment the polypeptide is obtained from a fungus,
more preferably from an Aspergillus, most preferably from Aspergillus niger.
Modifications
Polypeptides of the invention may be chemically modified, e.g. post-
translationally modified. For example, they may be glycosylated (one or more
times) or
comprise modified amino acid residues. They may also be modified by the
addition of
histidine residues to assist their purification or by the addition of a signal
sequence to
promote secretion from the cell. The polypeptide may have amino- or carboxyl-
terminal extensions, such as an amino-terminal methionine residue, a small
linker
peptide of up to about 20-25 residues, or a small extension that facilitates
purification,
such as a poly-histidine tract, an antigenic epitope or a binding domain.
A polypeptide of the invention may be labelled with a revealing label.
The revealing label may be any suitable label which allows the polypeptide to
be
detected. Suitable labels include radioisotopes, e.g. 1251, 35 S, enzymes,
antibodies,
polynucleotides and linkers such as biotin.
The polypeptides may be modified to include non-naturally occurring
amino acids or to increase the stability of the polypeptide. When the proteins
or
peptides are produced by synthetic means, such amino acids may be introduced
during
production. The proteins or peptides may also be modified following either
synthetic or
recombinant production.
The polypeptides of the invention may also be produced using D-
amino acids. In such cases the amino acids will be linked in reverse sequence
in the C
to N orientation. This is conventional in the art for producing such proteins
or peptides.
A number of side chain modifications are known in the art and may
be made to the side chains of the proteins or peptides of the present
invention. Such
modifications include, for example, modifications of amino acids by reductive
alkylation
by reaction with an aldehyde followed by reduction with NaBH4, amidination
with
methylacetimidate or acylation with acetic anhydride.
The sequences provided by the present invention may also be used
as starting materials for the construction of "second generation" enzymes.
"Second
generation" proline specific proteases are proline specific proteases, altered
by
mutagenesis techniques (e.g. site-directed mutagenesis), which have properties
that
differ from those of wild-type proline specific protease or recombinant
proline specific
proteases such as those produced by the present invention. For example, their
temperature or pH optimum, specific activity, substrate affinity or
thermostability may
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-32-
be altered so as to be better suited for use in a particular process.
Amino acids essential to the activity of the proline specific
endoprotease of the invention, and therefore preferably subject to
substitution, may be
identified according to procedures known in the art, such as site-directed
mutagenesis
or alanine-scanning mutagenesis. In the latter technique mutations are
introduced at
every residue in the molecule, and the resultant mutant molecules are tested
for
biological activity (e.g. proline specific endoprotease activity) to identify
amino acid
residues that are critical to the activity of the molecule. Sites of enzyme-
substrate
interaction can also be determined by analysis of crystal structure as
determined by
such techniques as nuclear magnetic resonance, crystallography or photo-
affinity
labelling.
The use of yeast and filamentous fungal host cells is expected to
provide for such post-translational modifications (e.g. proteolytic
processing,
myristilation, glycosylation, truncation, and tyrosine, serine or threonine
phosphorylation) as may be needed to confer optimal biological activity on
recombinant
expression products of the invention.
Preparations
Polypeptides of the invention may be in an isolated form. It will be
understood that the polypeptide may be mixed with carriers or diluents which
will not
interfere with the intended purpose of the polypeptide and still be regarded
as isolated.
A polypeptide of the invention may also be in a substantially purified form,
in which
case it will generally comprise the polypeptide in a preparation in which more
than
70%, e.g. more than 80%, 90%, 95%, 98% or 99% of the proteins in the
preparation is
a polypeptide of the invention.
Polypeptides of the invention may be provided in a form such that
they are outside their natural cellular environment. Thus, they may be
substantially
isolated or purified, as discussed above, or in a cell in which they do not
occur in
nature, for example a cell of other fungal species, animals, plants or
bacteria.
Furthermore the polypeptides according to the invention may be used in an
immobilized form so that large quantities of protein containing liquids can be
treated.
Ways to select appropriate support materials and suitable immobilization
methods have
been extensively described in the literature, for example in "Immobilization
of Enzymes
and Cells" (ed. Gordon F. Bickerstaff; ISBN 0-89603-386-4).
The invention also relates to the use of a prolyl-specific endoprotease
in the preparation of a beverage. A prolyl-specific endoprotease is used
preferably in
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-33-
the preparation of beer, wine or fruit juice. By the addition of a prolyl-
specific
endoprotease according to the method according to the invention, a reduction
or
prevention of haze is achieved By adding these prolyl-specifc endoproteases,
new
beverage are obtained. Thus, the invention also relates to beverages
obtainable by the
method according to the invention. These beverages include for example beer,
wine
and fruit juice obtainable by a method according to the invention.
An advantage of the beverages obtainable by the method according
to the invention is that these beverages have a high content of anti-oxidants.
Polyphenols are anti-oxidants. Beer is usually treated with a polyphenol-
removing
agent to prevent the formation of haze, and as a result the beer obtained has
a low
antioxidant activity. The same is true for other beverages treated with poly-
phenol
removing agents. Beer obtainable by the method according to the invention has
a
higher endogenous anti-oxidant activity. Because anti-oxidants are seen as
health
improving ingredients, the beverages obtainable by the method according to the
invention may be considered as beverages that are healthier than the same type
of
beverage prepared with polyphenol removing agents, such as PVPP.
It is another advantage of the method according to the invention that
it prevents the loss of hydrophobic polypeptides during fermentation and
conditioning of
high gravity beers. The improved extraction of hydrophobic polypeptides during
the
mashing phase of beer production thus results in higher yields and improved
beer head
stabilities. (Brey et al; Journal of the Institute of Brewing, Vol .108, No.
4, 424-433,
2002). Proline-specific endoproteases are known to reduce the hydrophobicity
of
peptides hereby improving their water solubility and diminishing their bitter
off-tastes
(WO 02/45523). In fact we demonstrate higher protein levels and improved beer
head
stabilities upon the use of Endo-Pro enzyme in Example 15. The use of proline-
specific
endoproteases optionally in combination with the auxiliary proteases specified
in the
present aplication is therefore advantageous.
It is yet another advantage of the method according to the invention
that the color of fruit juices obtainable by the method is not or less faded
than the color
of fruit juices obtained after the removal of polyphenols. Wines and fruit
juices
obtainable by the method according to the invention have improved aroma and
flavour
in comparison to beverages obtained by a method wherein bentonite or a similar
compound is used, since bentonite not only removes proteins but also aroma
and/or
flavour components.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-34-
EXAMPLES
EXAMPLE 1
Materials
Proline-specific endoprotease enzymes (Endo-Pro's)
Aspergillus niger G306 was deposited with the CBS (CBS1 09712) on
September 2001. A niger G306 contains a gene encoding a prolyl-specific
endoprotease according to the invention. The gene or cDNA obtainable from this
10 organism may be cloned and expressed in any Aspergillus niger host using
known
methods.
The following samples were used:
1) "Endo-Pro A", a proline-specific endoprotease was used in experiments with
beer.
The sample was an ultrafiltration concentrate obtained after ultrafiltration
of a
fermentation broth obtained after fermentation of an Aspergillus niger strain
comprising
a gene coding for a proline-specific endoprotease. The prolyl-specific
activity of the
Endo-Pro A sample was 5.06 U/ml, determined as described under Methods. The
protein concentration was estimated to be 50g/l, based on the specific
activity of a
sample of prolyl-specific endoprotease with a purity higher than 90%.
2) "Endo-Pro B", an proline-specific endoprotease was used in experiments with
wine.
The sample was obtained after purification over a column and had an activity
of
6.0 U/ml.
Papain
Collupulin, a liquid papain preparation commercially available from
DSM was used for experiments with papain. The activity is 5280 NF/mg. One unit
NF
is the quantity of papain activity that catalyzes the hydrolysis of casein to
produce one
microgramme equivalent of soluble tyrosine per hour at pH 6Ø The protein
concentration in the papain sample was measured, which is 119 g/l (Lowry).
Polyvinylpolypyrrolidone (PVPP)
PVPP used was a commercially available non-water soluble PVPP
under the name 'Polyclar AT".
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-35-
Beer
A malt beer (pilsener type) from "Les Trois Brasseurs" in Lille,
France, was used in all experiment performed with beer. The alcohol percentage
of
this beer was 5.2% (v/v) and the pH was 4.4. This particular beer was chosen
because
of the relative high amount of turbidity measured in this beer upon chilling,
in
comparison with other commercially available beers. The beer had a protein
concentration of 0.9 g/l, as determined by Lowry's-method.
White wine
A white wine prepared from white Sauvignon grapes was used
without any protein removal treatment. The alcoholic fermentation during wine
preparation was performed with a selected yeast VL3 from Lallemand. The
oenologic
analysis of the wine gave the following results:
Sugars (g/l) 1.1
Ethanol %vol 12.97
Total Acidity (g H2SO4/I) 4.14
Volatil acidity (g H2SO4/I) 0.22
PH 3.46
Free SO2 (mg/I) 18
Total SO2 (mg/I) 96
Glycerol (g/I) 3
Tartric acid (gh) 3
Malic acid (g/l) 2.8
Lactic acid (g/I) 0.1
Level of Folin 7
Example 2
Methods
Spectrophotometric method for determining enzyme activities
To measure the activity of the proline-specific endoprotease, a
substrate solution of 2 mM solution of N-carbobenzoxy-glycine-proline-p-nitro
anilide
(Z-GIy-Pro-pNA; m.w. 426.43; Bachem, Switserland) made in a 0.1 M citric acid
/ 0.2
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-36-
M disodium phosphate buffer pH 5.0 containing 40 % dioxan is used.
To 1 mL of buffer pH 5.0, 250 pl of the substrate solution is added followed
by 100 pl of
the enzyme solution (larger or smaller volume amounts of enzyme solution
should be
compensated for by buffer solution). The reaction mixture is incubated at 37 C
and the
release of pNA is followed by measuring the absorbance increase at 410 nm.
One unit is defined as the enzyme activity that liberates 1 pmol pNA from Z-
Gly-Pro-
pNA in 1 minute under described reaction conditions using a molar extinction
coefficient (E) of 8,800 M"1 .
The activity of the glycine-specific endoprotease isolated from Flavourzyme
1000 L
(NOVO, Denmark) was measured on the synthetic chromogenic substrate Z-Gly-Gly-
pNA at pH 5.0 and 37 degrees C using procedures as described. One unit of
glycine-
specific endoprotease is defined as the quantity of enzyme that provokes the
release of
1 micromol of pNA from Z-GIy-Gly-pNA per minute at pH 5.0 and 37 degrees C.
The activity of the proline-specific carboxypeptidase from Xanthomonas species
was
measured by measuring the quantity of proline residues released from the
synthetic
peptide Z-Pro-Pro (Bachem, Switserland) using an amino acid analyzer. One unit
is the
quality of enzyme that provokes the release of 1 micromol of proline from Z-
Pro-Pro per
hour at pH 7.0 and 37 degrees C.
Chill Haze measurements (Alcohol/low-temperature test according to Lucien
Chapon)
Turbidity or haze was measured with a turbidimeter ("Tannometer",
Pfeuffer Gmbh, Kitzingen, Germany) in line with the operating instructions In
cold beer
a reversible turbidity can occur which is caused by precipitated polyphenol-
protein
complexes. The addition of extra alcohol accelerates the formation of these
turbidities.
In the "chill haze test" this phenomenon is used to quantitate the polyphenol-
protein
complexes present. To calibrate the Tannometer, a formazine standard solution
was
prepared as described (Jean de Clerk, "Cours de Brasseries" 2nd Edition, Vol
2, 1963,
pp.595-596, Universite de Louvain, Belgium). The beer haze or turbidity unit
used is
the ECB which is nephelometric turbidity units as recommended by the European
Brewery Convention. Chill haze tests as described for beer may also be
performed with
alcohol free beers or worts (adapted from the Operating Instruction Guide of
the
Tannometer). In these cases ethanol is also added to the samples in an amount
sufficient to reach an alcohol content of 10% (v/v) in the samples. Ethanol
was added
to all wort samples to reach 10% (v/v) after which each sample is cooled to -8
C during
30 min. Then the haze formed (Turbidity, in units EBC) is quickly measured in
the
turbidimeter with its measuring chamber also at -8 C.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-37-
"Hot haze" measurements according to the European Brewery Convention .
The "hot haze test' is a beer haze measuring protocol as recommended by the
European Brewery Convention under number 9.30. It has been shown that storage
of
beer at elevated temperatures for relatively short periods of time will result
in a haze -
level similar to that found in the same beer after prolonged storage at room
temperature. This "hot haze" test is performed by cooling the beer overnight
in the
cooling bath at 0 C and reading the initial turbidity in the morning. Then the
beer is
placed in a bath at 60 C for 48h without agitation. Finally the beer is cooled
and kept at
0 C overnight before a final turbidity measurement at 0 C.
Heating haze tests for wine and fruit iuices.
As described by K.J. Siebert (K.J. Siebert et al, J. Agric. Food Chem.
44 (1996)) haze in beverages like wine or fruit juices can be induced by a
heating test.
The amount of haze formed is mainly a function of the levels of haze-active
proteins
and polyphenols in the beverage. In the Heating test, the turbidity of samples
(of for
example wine or fruit juice) is measured with a turbidimeter before and after
heating at
80 C during 30 min. Before measuring the turbidity, the heated sample is
cooled down
under cold water until a temperature of 22-25 C is reached. In the wine
trials (see
Example 7) the calibration of the turbidimeter was performed with NTU-
formazine
standard solutions, for the fruit juice trials (see Example 8) the NTU
turbidity standard
solution was purchased from Reagecon, Ireland. NTU= nephelometric turbidity
units.
Control experiments
1. A blank experiment was performed wherein no exogenous protein was added
during the incubation.
2. An experiment was carried out wherein beer was used that had been treated
with a large amount of PVPP (1000 g/hl) before incubation. This experiment
allowed the determination of the average amount of haze induced by the chill
haze test which is due to polyphenol-protein precipitate, because PVPP
removes polyphenols from the beer, and thus interferes with formation of haze.
3. Experiments were preformed wherein exogenous proteins (prolyl-specific
endoprotease or papain, respectively) were added to beer cooled to 0 C after
incubation at 40 C for 1 hour. Incubation at 0 C took place for 15 minutes
prior
to haze measurements. Since the enzyme and papain are not or hardly active
at 0 C, these experiments allowed discrimination between the enzyme activity
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-38-
effect and non-enzymatic protein effects.
LC/MS analysis
HPLC using a P4000 pump (ThermoquestTM, Breda, the Netherlands) equipped with
an
LCQ ion trap mass spectrometer (ThermoquestTM, Breda, the Netherlands) was
used
for the characterization of the three synthetic peptides, which were separated
using a
150 * 1 mm PEPMAP C18 300A (LC Packings, Amsterdam, The Netherlands) column
in combination with a gradient of 0.1 % formic acid in Milli Q water
(Millipore, Bedford,
MA, USA; Solution A) and 0.1 % formic acid in acetonitrile (Solution B) for
elution.
Detailed information on the individual peptides was obtained by using the
"scan
dependent" MS/MS algorithm which is a characteristic algorithm for an ion trap
mass
spectrometer. The endoprotease specificity for hydroxy proline and alanine was
checked by comparison of the experimental peptide sequences of the different
peptides , obtained with MS/MS, with the theoretical sequence information.
Example 3
Effects of the addition of a prolyl-specific endoprotease on haze formation in
beer
To a decarbonated malt beer (Les Trois Brasseurs), protein content:
0.9 g/l, various amounts of a prolyl-specific endoprotease enzyme ("Endo-Pro
A", see
Materials) were added. Two series of haze-measurements were performed. In the
first
series, the beer-Endo-Pro A compositions were incubated at 40 C for 1 hour
prior to
the Chill haze test. After incubation at 40 C, and just prior to the Chill
haze test,
ethanol was added to the beer-Endo-Pro A composition in an amount sufficient
to
increase the alcohol content to 6% (v/v). In the second series, the beer
without Endo-
Pro A was incubated at 40 C for 1 hour, and then cooled to 0 C. At 0 C, the
Endo-Pro
A was added and the resulting compositions were incubated at 0 C for 15 min.
Just
prior to the Chill haze test, ethanol was added to the beer-Endo-Pro A
composition in
an amount sufficient to increase the alcohol content to 6% (v/v).
The amounts of Endo-Pro A added and the percentage of haze
reduction relative to the haze measured when no Endo-Pro A was added are shown
in
Table 1. The amounts of Endo-Pro A added covered a large range from less than
1 %
of exogenous proteins added to more than 10 %, relative to the amount of
protein
present in the beer.
Table 1. Effect of the addition of a prolyl-specific endoprotease enzyme to a
beer on
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-39-
the amount of haze after incubation at 40 C for 1 h
"Endo-Pro A" added
Chill Haze test Haze reduction
Trial % of exogeneous
pl/10ml of beer (EBC) (%)
protein added*
1 0 0 141 0
2 0.45 0.25 116 17.7
3 0.9 0.5 101 28.4
4 1.8 1 87.4 38.0
3.6 2 81.1 42.5
6 5.4 3 69.0 51.1
7 9 5 61.3 56.5
8 18 10 48.5 65.6
9 36 20 39.9 71.7
54 30 33.4 76.3
* "% of exogenous enzyme added" reflects the amount of Endo-Pro A"-enzVme
added
expressed as a percentage of the total amount of proteins present in the beer
before
addition of the enzyme.
5
Table 2. Effect of prolyl-specific endoprotease enzyme to a beer on the amount
of haze
after incubation at 0 C for 15 min
Endo-Pro A added
% of Chill Haze test
Trial Haze reduction (%)
pl/10ml of beer exogeneous (EBC)
protein added
1 0 0 141 0
2 0.45 0.25 141 0
3 0.9 0.5 141 0
4 1.8 1 143 -1.4
5 3.6 2 145 -2.8
6 5.4 3 138 2.1
7 9 5 138 2.1
8 18 10 130 7.8
9 36 20 126 10.6
10 54 30 120 14.9
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-40-
Table 1 clearly illustrates that less haze is formed upon chilling when
a prolyl-specific endoprotease is added to beer at a temperature when the
protease is
active prior to chilling. Table 2 clearly illustrates that there is some
effect when a prolyl-
specific endoprotease is added to the beer at a temperature so low that the
protease is
not or hardly active, but the effect is very small in comparison to the effect
observed
when the protease is added at a temperature where it is active.
Example 4
Effects of the addition of Papain on haze formation in beer
To a decarbonated malt beer (Les Trois Brasseur), protein content:
0.9 g/l, various amounts of papain (from 0 to 100 g/hl) were added. Two series
of chill
haze-measurements were performed. For the first series, the beer-papain
compositions
were incubated at 40 C for 1 hour prior to the Chill haze test. Ethanol was
added to the
incubated samples to reach 6% alcohol (v/v/) prior to the haze measurements.
In the
second series, beer samples were incubated at 40 C for 1 hour and subsequently
cooled to 0 C. Then, papain was added and the samples were incubated at 0 C
for 15
min. The amounts of papain added and the percentage of haze reduction relative
to the
haze measured when no papain was added are shown in Table 3.
Table 3. Effect of papain on the amount of haze formed in beer after
incubation at 40 C
for l h
Trial Papain added
Chill Haze test Haze reduction (%)
% of exogeneous
g/hI beer (EBC) (%)
protein added
1 0 0 143 0
2 0.2 0.03 140 2.1
3 0.5 0.07 133 7.0
4 1 0.13 119 16.8
5 2 0.26 94.1 34.2
6 3(1) 0.40 91.6 35.9
7 5 0.66 83.8 41.4
8 8 1.06 82.4 42.4
9 10 1.32 84.0 41.3
10 100 13.22 81.6 42.9
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-41-
(1) 3 g/hI is the maximal dosage recommended
Table 4. Effect of papain on the amount of haze after incubation at 0 C for 15
min
Papain added
Chill Haze test Haze reduction (%)
Trial g/hl beer % of exogeneous
(EBC)C
protein added
1 0 0 143 0
2 0.2 0.03 139 2.8
3 0.5 0.07 136 4.9
4 1 0.13 135 5.6
2 0.26 134 6.3
6 3 0.40 132 7.7
7 5 0.66 136 4.9
8 8 1.06 130 9.1
9 10 1.32 122 14.7
100 13.22 138 3.5
The results in Table 3 illustrate the effect of papain on the amount of haze
formed in
5 beer upon chilling. It is clear that the effect of papain on haze levels off
when papain is
added in an amount of 3 g/hI and higher. Apparently, it is not possible to
achieve the
same amount of haze reduction with papain as with a prolyl-specific
endoprotease.
Example 5
Effects of the addition of PVPP on haze formation in beer
In both beer-prolyl-specific endoprotease experiments and the beer-
papain experiments, a control experiment was done by adding a large amount of
PVPP
(1000 g/hl) to the beer prior to incubation. After 15 min of mixing the PVPP
was
removed by filtration (No prolyl-specific endoprotease enzym or papain was
added). In
both controls almost no haze were formed during the chill haze test. Since it
is known
that PVPP removes polyphenols from beverages, these control experiments
indicate
that polyphenols do take part in haze formation in beer. To measure the PVPP
effect
on beer haze stability, different amounts of PVPP were added to a decarbonated
beer
and removed by filtration after 15 min of mixing. Prior to adding the PVPP the
beer was
incubated during 1 h at 40 C.
Table 5 shows the effect of the addition of various amounts of PVPP
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-42-
on the amount of haze present in beer upon chilling. No Endo-Pro A or papain
was
added.
Table 5. Effect of PVPP on the amount of haze present in beer upon chilling
PVPP added (g/hl) Chill Haze test (EBC) Haze reduction (%)
0 133 0
131 1.5
115 13.5
30(l) 103 22.6
50 65.2 51.0
80 48.4 63.6
100 42.1 68.3
500 17.2 87.1
1000 9.5 92.9
30g/hl maximal dosage used in breweries
5
In Table 3 it is shown that the addition of 3g of Papain / hl of beer
(which is the maximal dosage recommanded in the beer industry) after
incubation at
40 C for 1 hour induces an haze decrease of almost 36%. In the case of
addition of the
prolyl-specific endoprotease, the addition of 1 % (relative to the amount of
protein in the
10 beer) of prolyl-specific endoprotease after incubation at 40 C for 1 hour
induces a
decrease of a beer chill haze of 38% (see Table 1). In breweries, PVPP is
generally
added in a quantity that does not exceed 30 g/hI. Since PVPP reduces haze by
around
20% when it is added in that quantity, it can be concluded that both papain
and prolyl-
specific endoprotease enzymes are better haze inhibitors than PVPP.
Example 6
Endo-Pro A addition on a 100% malt mash and haze reduction in a 100% malt wort
The objective was to determine if the addition of Endo-Pro A to a
100% malt mash could result in an haze reduction in the final malt wort.
Each mashing trial begins with the mixing of 25 g of milled malt with
100 ml of water. Then, the mash is heated to 50 C and after the addition of an
amount
of "Endo-Pro A" the mash is treated according to a step-wise heating procedure
to four
successively higher temperatures. Table 6 shows that mashing temperature
profile.
During all the mashing the mash was stirred at 200 rpm. At the end of the
mashing, the
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-43-
mash is kept at room temperature and water was added to compensate the water
evaporation. Then, the mash was filtered on paper to separate the wort
(liquid) from the
solids.
Table 6. Mashing temperature profile
Steps Temperature Time
1 50 C 30 min
temperature increase 1 C/min 13 min
2 63 C 30 min
temperature increase 1 C/min 10 min
3 72 C 30 min
temperature increase 1 C/min 4 min
4 77 C 110 min
0, 200 & 500 pl Endo-Pro A was added to the mashes, respectively.
A control experiment was performed wherein 500pl of Endo-Pro A was used that
was
deactivated by heating it to 90 C during 15 min. The turbidity or haze of the
wort was
measured at room temperature and after a chill haze test. Wort chill tests are
performed as described in the Alcohol/low-temperature test according to Chapon
(Chill
Haze test -Pfeuffer Operating instructions) adding ethanol to reach 10% (v/v)
in the
sample as recommended by Chapon for alcohol-free beers.
Table 7: effect of the addition of prolyl-specific endoprotease to 100% malt
mashes on
the amount of haze formed in the resulting 100% malt worts (after Chill haze
test)
Wort Haze Endo-Pro A
Endo-Pro A
added in the Wort initial turbidity induced by haze
Trial turbidity after Chill the Chill reduction
mash
(NI) (EBC(')) Haze test Haze test eff ect
(EBC) (AEBC) (%)
1 0 10 158.5 148.5 0
2 200 15.9 59.2 43.3 70.8
3 500 22.5 49.1 26.6 82.1
500
4 12.1 160.5 148.4 0.1
(desactivated)
EBC: nephelometric turbidity units recommended by the European Brewery
Convention
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-44-
The results in Table 7 clearly indicate that when a prolyl-specific
endoprotease has been added to a malt mash, the resulting wort is much less
turbid
upon cooling than a wort prepared without the addition of a prolyl-specific
endoprotease.
To study the Endo-Pro A effect, a chill haze test was performed on
malt wort. It was observed that the addition of a prolyl-specific endoprotease
decreased
the wort chill haze. A decrease in haze formed in the Chill haze test was
observed
even at low quantities of prolyl-specific endoprotease enzyme added. When the
enzyme is deactivated prior to be added in the mash, the stabilization effect
disappears
completely i.e. the amount of haze formed is no longer reduced. The haze
decrease
induced by the addition of a prolyl-specific enzyme is very important. In the
Example a
haze reduction of up to 82 % was achieved.
In order to compare the effects of the addition of a prolyl-specific
endoprotease enzyme in malt worts and in barley worts, experiments were
performed
wherein different amounts of Endo-Pro A were added in barley mashes. The pH
were
respectively 5.6 in malt worts and 6.1 in barley worts. The results obtained
with barley
worts chill haze tests showed that as observed previously for malt worts, the
treatment
of barley mashes by a prolyl-specific endoprotease induces an important
reduction of
barley worts chill haze. Both malt and barley mashes treated with a prolyl-
specific
endoprotease result in highly stabilized worts but the effect is stronger in
malt worts
than in barley worts. Indeed, the addition in the mash of 200p1 of Endo-Pro A
induced a
haze reduction of around 59% in barley worts and more than 70% in malt worts.
The
trials performed with 500p1 of Endo-Pro A increased the haze reduction until
82% in
malt worts and did not improve the haze reduction in barley worts compared to
the
200p1 Endo-Pro A experiment. Surprisingly, the addition of Endo-Pro A to
barley
mashes resulted in clear filtered worts while the non-Endo-Pro treated mashes
resulted
in cloudy filtered worts (the barley mash filtrations were performed at room
temperature
and the turbidity of the worts was measured at room temperature without
ethanol
addition).That effect is observed whatever the amount of prolyl-specific
endoprotease
added in the barley mashes.
Example 7
Haze reduction in wine
Different dosages (0, 30, 60 150 pl) of a prolyl-specific endoprotease
(Endo-Pro B) having a specific activity of 6.0 U/ml were added to flasks
containing 500
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-45-
ml of white wine (wine as described under "Materials") and incubated at room
temperature (22-25 C) for 19 days under a nitrogen atmosphere. The wine haze
stability was measured after 0, 6, 8, 12 and 19 days using the Heating test as
described under "Methods".
The results of the experiments. are shown in Table 8. In Table 8,, wine
turbidity or haze is expressed in nephelos turbidity units (NTU). ANTU =
turbidity in
NTU measured on wine samples after heating - turbidity in NTU measured on wine
samples before heating. The quantity of bentonite required to stabilize the
proteins of
the wine was calculated according to the formula: (1.48 x A NTU) +2. As is
known, less
bentonite is needed to prevent haze formation in wine when a wine is less
susceptible
to haze formation.
Table 8. Effect of the addition of a prolyl-specific endoprotease enzyme to a
white wine
the amount of haze formed after heating the wine
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-46-
Turbidity Turbidity quantity Decrease of
Endo-Pro of haze
Incubation before after he quantity of
added A NTU bentonite reduction
time (pl/500m1) heating heating required (%) bentonite
(NTU) (NTU) (g/hI) required (%)
0 0 pl 36.8 74.5 38 58
(Control)
0 pl
25.8 63.8 38 58 0 0
(Control)
6 days 30 pl 20.2 53.5 33 51 13 12
60 p l 21.6 56 34 53 11 9
150 p l 20.5 43.3 23 37 39 36
0 p1
26.4 68 42 64 0 0
(Control)
8 days 30 pl 31.4 60.2 29 45 31 30
60 pl 29.6 56.2 27 41 36 36
150 pl 25.1 48.4 23 36 45 44
0 pl
24.4 50.1 26 40 0 0
(Control)
12 days 30 pI 23 36.9 14 23 46 43
60 pl 23 36.6 14 23 46 43
150 pl 23.9 37.9 14 23 46 43
0 pl
6.5 23.2 17 26 0 0
(Control)
19 days 30 p l 5.8 11.2 5 10 71 62
60 pl 7 11.1 4 8 76 69
150 pl 8.5 13.7 5 10 71 62
The results in Table 8 show that the addition of a prolyl-specific
endoprotease to a white wine before heating reduces the haze formed in the
wine after
heating. After 6 days of incubation at room temperature the effect is
observed. Indeed,
the haze decrease reaches 39% with 150 pl of the Endo-Pro B- added and around
12% with 30 pl or 60 pl of Endo-Pro B-. After 12 days and whatever the amount
of the
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-47-
prolyl-specific endoprotease used the haze reduction reaches 46% and exceeds
70%
after 19 days. Therefore, it is clear that a prolyl-specific endoprotease can
be used to
avoid or to strongly reduce the quantity of bentonite required to stabilize
wine against
haze-formation.
Example 8
Haze reduction in Strawberry Juice
A strawberry fruit juice was prepared as follows: strawberries were
defrosted and crushed, and subsequently blanched (heated) at 90 C in order to
destroy
all endogenous enzymes such as polyphenol oxidases, and to denaturate
proteins. The
crushed strawberries were then cooled to 50 C, macerated for 30 min at 50 C
with
600g/t of Rapidase BE super (a commercial enzyme product of DSM, France) and
pressed in a pneumatic press. In order to remove the denatured proteins the
resulting
mixture was centrifuged at a speed of 8000 rpm and filtered. The strawberry-
juice was
collected. An acidified alcohol test was negative, which confirmed that the
juice was
pectin free. The pH value of the juice was 3.3.
Endo-Pro A/ strawberry juice incubations: Different volumes (0, 5, 10,
pl) of Endo-Pro A (5.06 U/ml) were added to 100 ml of strawberry juice and
20 incubated at 50 C for 60 min. Two control experiments were performed, (i)
one by
adding 20pl of deactivated Endo-Pro A (incubated 30 min at 80 C) and (ii) a
second
control by adding 200 mg of PVPP to 20 ml of strawberry juice previously
incubated 1 h
at 50 C. After having been mixed for 15 min at room temperature the PVPP was
removed by centrifugation.
Juice Heating test: the juice turbidity was measured before and after
heating the fruit juice samples at 80 C during 30 minutes. Before measuring
the
turbidity, the heated juices were cooled down under cold water.
The turbidity measurements were performed in a turbidimeter
previously calibrated with NTU turbidity standards from Reagecon (Ireland)
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-48-
Table 9: Effect of the addition of prolyl-specific endoprotease on the haze in
strawberry
juice
Turbidity
Endo-ProA Turbidity after
before reduction
Trial added heating 0 NTU
heating effect (%)
(NI/100ml) (NTU) (NTU)
1 0 10.1 17.5 7.4 0
2 5 9.5 15.0 5.5 25.7
3 10 9.4 15.4 6.0 18.9
5 10.2 16.9 6.7 9.4
(deactivated)
6 PVPP 1.4 2.3 0.9
5 The results in Table 9 show that the addition of 5 pl of Endo-Pro A in
100ml strawberry juice decreased haze formed after a juice heating test by
25.7%. The
addition of 101x1 of Endo-Pro A to 100ml strawberry juice did not improve the
haze
reduction effect compared to the 5pl trial. Possibly, the enzyme action is
maximal with
511 and with more enzyme addition more protein precipitation is obtained.
10 Deactivated enzyme still reduced the amount of haze formed,
however, the effect was much less pronounced. After the addition of PVPP,
hardly any
haze was observed, but the color of the sample was also removed. The fact that
the
addition of PVPP results prevents haze formation indicates that also in
strawberry juice
haze is probably the result of polyphenol-protein interactions.
Example 9
Isolation of a proline-specific carboxypeptidase from Xanthomonas species
Although many scientific reports describe exopeptidases that are able to act
on proline
residues at the carboxyterminal ends of peptide chains, the hydrolysis rate of
these
carboxypeptidases towards proline residues is very low. Moreover most of these
carboxypeptidases are not capable of releasing carboxyterminal proline
residues from
polyproline sequences. US 5,693,503 describes the purification of
carboxypeptidases
from Xanthomonas species that exhibit a surprisingly high activity towards the
release
of carboxtyterminal proline residues, even from polyproline sequences. We have
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-49-
isolated such a carboxypeptidase from several Xanthomonas species to test
their
activity in preventing haze formation.
The isolation of the desired carboxypeptidase from Xanthomonas
proved to be a difficult task since the purification method as described in US
5,693,503
was not successful in our hands and a completely new purification protocol had
to'be
developed. Of the many procedures tested the following protocol yielded
substantially
purified enzyme.
Starting from one liter of broth, cells were harvested by centrifugation,
washed once with water and then disrupted by an ultrasonic treatment at 0
degrees C.
Cell debris was removed by a centrifugation at 20000 rpm for 20 minutes and
the
resulting supernatant was recentrifuged under the same conditions. Then
ammonium
sulfate was added to the supernatant to reach 40% saturation. After low speed
centrifugation the supernatant was collected and additional ammonium sulfate
was
added to reach 80% saturation. The newly formed precipitate was collected by
low
speed centrifugation, extensively dialysed at pH 7.0, 4 degrees C and applied
to a
bacitracin-Sepharose column equilibrated in 0.05 mol/liter of tris-HCI pH 8Ø
(J. Appl.
Biochem.,1983 pp420-428). Material bound to the column was eluted using the
equilibration buffer supplemented with 1 mol/liter of NaCl and 10% (v/v)
isopropanol.
The fractions containing the enzyme activity sought were identified by
incubation with
the synthetic substrate Z-Pro-Pro as described in the Materials & Methods
section.
Fractions containing activity were then applied to a MonoQ column equilibrated
in
0.025 mol/liter Tris-HCI pH 8.5. Under these conditions the enzyme bound to
the
column and was eluted using an NaCl concentration gradient. Active fraction
were
pooled, dialysed and rechromatographed on a Mono Q column as described. The
activity of the final concentrate measured on Z-Pro-Pro at 37 degrees C and pH
7.0
was 0.5 units/ml and 0.09 units/ ml at pH 5.5. The enzyme preserved approx 50%
of
its activity after a 2-3 hours incubation at 50 degrees C at pH 5.5. This
preparation has
been used in the tests described in Example 11.
Only the enzyme isolated from Xanthomonas campestris pv
campestris showed activity under acid conditions. A similar carboxypeptidase
isolated
from X.rubrilineans showed no activity at pH 5.5 and is, therefore, less
suited for the
applications anticipated.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-50-
Example 10
Isolation of a glycine-cleaving endoprotease from Aspergillus oryzae
An endoprotease that can cleave proteins rich in glycine residues has been
identified in
papaya extracts (glycyl endopeptidase, EC 3.4.22.25). However, this enzyme has
several disadvantages for the application as envisaged because of its
relatively high
(near neutral) pH optimum and high costs if produced in a pure form. Therefore
the
identification of an acid stable, glycin-specific endoproteasethe enzyme in a
potentially
foodgrade microorganism could offer many advantages. To that end we have
screened
a number of commercially available foodgrade enzyme preparations.
The screening was carried out using the synthetic chromogenic peptide Z-Gly-
Gly-pNA
at pH 4.0 as the substrate. Six different enzyme preparations were tested and
only
Flavourzyme 1000 L (HPN 00011 from Aspergillus oryzae; NOVO, Denmark) showed
some activity towards the synthetic substrate used. To isolate the enzyme
responsible
for this activity a large number of different purification protocols had to be
tested. The
following protocol proved to be successful.
First, the excess of small molecular weight components as present in the
Flavourzyme
material was removed by an extensive dialysis. During this dialysis step the
Gly-
specific activity dropped till approx 50% of its initial value. The resulting
dialysed liquid
was then further washed and concentrated using Amicon PM-10 ultrafitration
equipment. To the resulting liquid concentrate ammonium sulfate was added
ttill 50%
and after centrifugation more ammonium sulfate was added to the supernatant to
reach
75% of the saturation level. The precipitate then obtained was collected by
low speed
centrifugation, dialysed and the resulting liquid was again concentrated using
the PM-
10 equipment. The concentrate was applied on a Sephadex G-100 gelfiltration
column
and the active fractions were pooled. The activity in each fraction was
measured using
Z-Gly-Gly-pNA at pH 4.0 as described in the Materials & Methods section. The
pooled
fractions were then subjected to ion exchange chromatography on HITrap Q
equilibrated in 0.05 mol/liter sodium acetate pH 5.0 and eluted with the same
buffer
containing 1 M NaCl. As before active fractions were identified by incubation
with Z-
Gly-Gly-pNA but now at pH 5.0, pooled and concentrated using the PM-10
equipment.
The final concentrate if measured at pH 5.0 contained 0.008 units/ml. This
solution was
used to carry out the experiments as described in Example 11.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-51 -
Example 11
Improved haze stability of 100% malt worts treated with selected auxiliary
proteases
The present Example demonstrates that the anti-haze effect of Endo-ProA can be
further improved by combining the Endo-ProA treatment with selected auxiliary
proteases. It is exemplified that a proline-specific carboxypeptidase from
Xanthomonas
campestris ("CarboxyPro") or a giycine-cleaving endoprotease from Aspergillus
oryzae
("EndoGly") significantly reduce haze formation further when used in
combination with
Endo-ProA. The present Example focuses on haze reducing effects in 100% malt
worts.
To prepare malt wort, 50 g of milled malt was mixed with 200 ml of water and
heated to
50 C. Either 0 or 15Opi of the Endo-Pro enzyme concentrate was added and the
mash
was subjected to a step-wise heating protocol as specified in Table 10. During
this
procedure the mash was stirred at 200 rpm. At the end, the mash was cooled to
room
temperature and water was added to compensate for any water evaporated.
Finally the
mash was filtered on paper to separate the wort (liquid) from the solids. The
worts thus
obtained were ' used to test the effects of the auxiliary enzymes using the
effect of
PVPP as a reference.
Table 10. Mashing temperature protocol
Steps Temperature time
1 50 C 30 min
temperature increase 1 C/min 13 min
2 63 C 30 min
temperature increase 1 C/min 10 min
3 72 C 30 min
temperature increase 1 C/min 4 min
4 77 C 10 min
Because of its high affinity for polyphenol, PVPP is widely used in the
industry to
remove beer hazes caused by polyphenol-protein aggregates. In order to
determine if
CarboxyPro or EndoGly can have a haze reducing effect as PVPP, non-Endo-Pro
treated worts were incubated with either 100pl CarboxyPro or 20pl EndoGly
during 120=
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-52-
minutes at 50 degrees C after which the resulting haze stabilities were
measured
according to the procedure described in the Materials & Methods section. As a
reference, non-Endo-Pro treated mash was incubated with PVPP for 15 minutes at
room temperature prior to filtration and then measured. The results obtained
are shown
in Table 11.
Table 11: The chill haze effects of PVPP, CarboxyPro and EndoGly on a non-Endo-
Pro
treated 100% malt wort.
Enzyme active conditions Controls
TRIALS no 1 2 3 4 5
Enzyme added in the mash
_____~__
.._............. __.._....__......_._.__..__......._..........._.._..._._.
_............. _....____._._.._...__._...._........ ..... _._ ...__.__......
Endo-Pro (pl) 0 0 0 0 0
Enzymes added in the wort 120 min at 50 C
Proline Carboxypeptidase (p1) 0 100 0 0 0
EndoGly (pl) 0 0 20 0 0
PVPP is mixed 15
Wort haze control min prior paper
filtration
..__.._...... _....... _.._
.............._..........._._......._.............__.....-
...._....._....._._.......____...__ _._........... ........
_.__......__.....__...._....__._...._............
PVPP (Control - g/hl) 30 100
Haze measurement
....... _............ _..-............ ___._.__.._._.._-...... _........
_.............. ._...... ...... _ .................... ___._ ........ _.......
_..._....... _.....__...._._...__._..__..__..._.._
_.._..__...._._.__._.__.....__.___.....__....
146 131 91.7 75.3 69.8
Wort Chill Haze test (EBC)
144 134 92.7 79.0 68.1
Haze induced by the Chill Haze
145 132.5 92.2 77.2 69.0
test (average - EBC)
Haze reduction (%) 0.0 8.6 36.4 46.8 52.4
EBC: nephelometric turbidity units recommended by the European Brewery
Convention
According to the results shown in Table 11, incubations with both
CarboxyPro and EndoGly result in worts that are less turbid upon cooling.
However,
the results also indicate that the addition of PVPP has a clearly superior
effect.
A subsequent experiment was carried out in which a wort was used
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-53-
that had been pretreated with Endo-Pro in the mashing stage. In this
experiment, the
auxiliary proteases were added to the wort in quantities of either 0, 100 or
500
microliters EndoGly or 0, 20 or 100 microliters CarboxyPro per 10 millilitres
wort. All
samples were then incubated for 120 min at 50 C after which the chill haze
test was
carried out. The results obtained are provided in Table 12.
Table 12: Wort chill haze results obtained after incubation of an Endo-Pro A
treated
100% malt wort followed by incubation with various amounts of CarboxyPro or
EndoGly.
Enzyme active conditions
TRIALS n 1 2 3 4 5 6
Enzyme added in the mash
...... _....... Endo-Pro (pl) 0 150_"_'"j""_1 50 150 150 150
Enzymes added in the wort 120 min at 50 C
Proline Carboxypeptidase (pl) 0 0 100 500 0 0
__..._..._
....... _...... __..... _..._.__.............. __.......... _-___.______
_.._........... _._.. .......... _._..._...... _...... ..........
_..._._..__._._ ._.._...._._......_.._..__ _...... ___..........
EndoGly (pl) 0 0 0 0 20 100
Haze measurement
.._..._._............. _._....... _..... __.__..._._..... _........ .-_--------
-_...__...... _.._.._ ....................... _..._.... _................
...____._._.._..__...__._....._.__.._....._....... ...__............. _._.....
_....__._............. _._._......... _...
Wort Chill Haze test (EBC) 168 79.2 68.8 58.8 63.0 40.1
168 80.6 70.0 57.7 64.8 36.0
Haze induced by the Chill Haze
168 79.9 69.4 58.3 63.9 38.1
test (average - EBC)
.._.__........ ..._......... -.._....... ............... __
..................... _........ _......._...... _..... _........ ..__
_____..._......___.._.........__......... _._..... _..._._._..
Enzymes effect on Chill Haze
0.0 52.4 58.7 65.3 62.0 77.4
Haze reduction (%)
- ------------------ ----------- ---------- -----------------------------------
----------------------------
CarboxyPro or EndoGly effect on
Endo-Pro treated wort 0.0 13.1 27.1 20.0 52.4
Haze reduction (%)
EBC: nephelometric turbidity units recommended by the European Brewery
Convention
According to the results shown in Table 12, the combination of an Endo-Pro
pretreatment with either CarboxyPro or EndoGly have significant effects on the
haze
stability of a wort. Depending upon the concentration of the auxiliary
proteases added
effects can be obtained that are superior those obtained with PVPP in non-Endo-
Pro
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-54-
treated wort (see Table 11).
Finally an experiment was carried out to test if the enzyme effects
observed are the result of non-enzymic artefacts or specific proteolytic
action. To that
end 100 pl CarboxyPro or 20tal EndoGly were added to an Endo-Pro-treated wort.
To
prevent all enzymatic activities of the auxiliary enzymes, the wort containing
these
enzymes was kept at 0 degrees C for 15 minutes (i.e. comparable with the
incubation
period used for PVPP) before measuring the wort chill haze formed. Wort
treated with
various quantities of PVPP and then filtered was used as a reference.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-55-
Table 13: Effects of the incubation of Endo-Pro-treated 100% malt wort with
CarboxyPro or EndoGly at 0 degrees C, or PVPP at room temperature
Controls
TRIALS n 1 2 3 4 5
Enzyme added in the mash
Endo-Pro A (pl) 150 150 150 150 150
enzymes added in
non-active
condition (at 0 C
Enzymes added in the wort after the Endo-Pro
treated wort was
incubated 120 min
at 50 C)
Proline Carboxypeptidase (p1) 100 0 0 0 0
EndoGly (p1) 0 20 0 0 0
PVPP is mixed 15 min with
Endo-Pro treated wort
previously incubated 120
Wort haze control
min at 50 C. PVPP removal
is performed by paper
filtration
PVPP (Control - g/hl 30 100 500
Haze measurement
............ _..._._......... _....... _........... _..._.......... ._.....
._...... ........ _..---...... _._............. -_ _......
_..__....._.._..._.._...... _._.... _......... ....... _.__........ .......
_............
77.5 82.2 66.3 59.3 52.3
Wort Chill Haze test (EBC)
65.9 60.6 53.5
Haze induced by the Chill Haze
77.5 82.2 66.1 60.0 52.9
test (average - EBC)
_.
................... _........... -......... __.._..._.._._.-............ ._-
.._.._...---_._.__......... ......... _._.._..._.. ------........
_......_........ .............. _._............ _.__..._............ -
...._.._.......
Enzymes effect on Chill Haze
53.9 51.1 60.7 64.3 68.5
Haze reduction (%)
-------------------------------------------- ------------------------ ---------
-----------------------------
Haze reduction (%) 3.0 -2.9 17.3 25.0 33.8
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-56-
EBC: nephelometric turbidity units recommended by the European Brewery
Convention
The data presented in Table 13 show that both CarboxyPro and
EndoGly if incubated at 0 degrees have no effect which implies that their
proteolytic
activities are the direct cause for haze stabilisation observed in Tables 11
and 12.
PVPP has a limited effect only (a haze reduction of a mere 17.3% versus a haze
reduction of 46.8% under conditions described in Table 11). This observation
re-
confirms the impact an Endo-Pro incubation has on the total quantity of
precipitable
polyphenol-protein present: by preventing the formation of polyphenol-protein
aggregates, the use of PVPP has almost become superfluous.
Example 12
Endo-Pro A has also Endo-Hydroxy-Pro and Endo-Ala activity
It was investigated whether Endo-Pro A also has endoprotease specificity for
hydroxy
proline and alanine. Therefore three synthetic peptides were synthesized
covering the
C-terminus of as1-caseine B, with some modifications. The peptides were:
= 0139-59, SEKTTMPLW, the original C-terminus of as1-caseine M=1 091.5
= 0139-60, SEKTTMJLW, with J being hydroxy proline M=1 107.5
= 0139-61, SEKTTMALW, with alanine substituted for proline M=1 065.5
For analyzing such complex peptide mixtures so called scan dependent MS/MS is
used. This method, in which each scan consists of three segments, is defined
as
follows:
1: full scan analysis,
2: zoomscan analysis for the determination of the charge state of the most
intense
ion in the full scan mass range,
3: MS/MS of the most intense ion in the full scan mass range to obtain amino
acid
sequence information.
All three peptides were dissolved in 0.1 % formic acid at a concentration of
75-100 g/l
and were checked for their purity in LC/MS and LC/MS/MS mode using gradient
elution. All three peptides could be identified by their protonated and doubly
protonated
molecules in LC/MS mode and in LC/MS/MS mode by total coverage of the amino
acid
sequence.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-57-
The synthetic peptides treated with Endo-ProA were diluted 50 times
before analysis. For LC/MS analysis of the peptides formed after treatment,
the
gradient has to be adapted slightly. If indeed Endo-ProA has proline and
hydroxy
proline specific specificity the peptides should be cleaved in the following
parts:
SEKTTMP and LW, with protonated molecules at m/z 793.4 and 318.1,
respectively.
SEKTTMJ and LW, with protonated molecules at m/z 809.4, and 318.1,
respectively.
Both predicted peptide masses could indeed be observed in the ion
chromatograms of
the Endo-Pro treated peptides, and were checked in LC/MS/MS mode having the
correct amino acid sequence.
The third synthetic peptide also showed the same pattern by
observing m/z767.4 of SEKTTMA and m/z318.1 of LW in the ion chromatogram.
Endo-Pro preferentially cleaves C-terminal at P, J and A, but also peptides
being 1,2,
or 3 amino acids shorter could be observed and unequivocably be identified
with
LC/MS/MS. However these percentages were all below 6 %.
An overview of the above is given in table 14.
Table 14: peptide formed for all three synthetic peptides after treatment with
Endo-Pro
A. Amino acid sequences were checked by their protonated molecule and MS/MS
characteristic.
peptide formed intensity normalized
SEKTTMPLW SEKTTMJLW SEKTTMALW
SEKT 0,43 0,33
SEKTT 0,00 0,37 0,33
SEKTTM 3,40 3,11 5,56
SEKTTMP 100,00
SEKTTMJ 100,00
SEKTTMA 100,00
Conclusion
Indeed Endo-Pro A can cleave hydroxy proline and alanine residues at their
carboxyterminal side in addition to its preference for cleaving proline..
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-58-
Example 13
PH optimum for Endo-Pro.
DNA sequences according to SEQ ID NO: 1 and SEQ ID NO: 3 were expressed in
Aspergillus niger iso 502. This resulted in polypeptides according to SEQ ID
NO: 5 and
SEQ ID NO: 4 respectively. These polypeptides will be further referred to as
Endo-Pro
RUS and Endo-Pro GAM respectively. Both enzymes were found to be very much
alike
but were also found to differ in some biological aspects. Endo-Pro RUS had a
higher
specific activity and was found somewhat more active in removing haze in beer.
1) pH optimum Endo-Pro:
Proteolytic activity of Endo-Pro's were measured using resorufin-labeled
casein and the prescription of Roche ("Universal Protease Substrate"; Cat. No
1
080 733). By treatment with proteases, resorufin-labeled peptided are released
which cannot be precipitated with trichloroacetic acid. So the more active the
Endo-
Pro enzyme is at a given temperature or pH value, the higher the light
absorption at
574 nm. lin a pH range of pH 4.5 - 4.8 - 5.0 - 5.5 - 6.0 - 7.0 - 8Ø 0.1 M
Tris/HCI
buffers were used for pH 7 and 8. For the lower pH's 0.1 M Hac buffers were
used.
The buffers contained 0.02 M CaCl2.
Reactions were performed for 30 minutes at 37 C and the data obtained
are provided in Table 15 Endo-ProRUS (6 U/mL) and Endo-ProGAM (ca. 4 U/mL)
were diluted to 0.5 U/mL. 10 pL sample was added in the incubation mixture and
volume compensated with the incubation buffer.
According to the results shown in Table 15 the pH optimum of the enzymes
is around pH 5.5. However, later on it became clear that the resorufin-labeled
casein used starts to precipitate at pH values below pH 5.5 so that below this
pH
unreliable results are obtained. To correct for that, the experiment was
repeated
under the various pH conditions mentioned but using Z-Gly-Pro-pNA rather than
resorufine-labeled casein as the chromogenic substrate. The data obtained
using
Z-Gly-Pro-pNA and a light absorption at 410nm (cf Example 2) showed a clear
activity peak around pH 4.5 for both Endo-Pro enzymes.
2) Temperature stability of Endo-Pro enzymes.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-59-
The temperature stability of both Endo-Pro enzymes was measured by heating the
two
enzymes to temperatures of either 40 - 50 - 55 and 60 C and at pH 5Ø
Samples were taken
after 0.5 - 1 - 2 - 5 and 20 hours and theEndo-ProRUS and Endo-ProGAM
activities were
diluted to approx 0.5 U/mL. Then 10 pL sample was added in the incubation
mixture containing
Z-Gly-Pro-pNA (cf Example 2) and residual enzyme activities were measured as
described in
Example 2. In the reference the 10 microliter volume was compensated with the
incubation
buffer. The Z-Gly-Pro-pNA cleaving activity of the non-heated enzyme was used
as the 100%
value.
From the results shown in Table 16 it is clear that both Endo-Pro enzymes show
excellent temperature stabilities.
Table 15 - pH optima Endo-Pro enzymes
pH RUS GAM
E574 Rel. % E574 Rel. %
4.5 0.227 30.2 0.225 24.0
4.8 0.228 38.3 0.278 29.6
5.0 0.521 69.4 0.554 59.0
5.5 0.751 100.0 0.939 100.0
6.0 0.675 89.9 0.870 92.7
7.0 0.399 53.1 0.627 66.8
8.0 0.011 1.5 0.313 33.3
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-60-
Table 16 Temperature- stabilities Endo-Pro enzymes
t RUS GAM
[hours] 4 5 5 6 4 5 5 6
0 C 0 C 5 C 0 C 0 C 0 C 5 C 0 C
0 100 100 100 100 100 100 100 100
0.5 93 102 100 67 98 94 94 84
1 105 98 98 81 102 97 92 83
2 99 102 96 74 103 95 94 79
99 99 88 67 95 88 92 80
22 104 90 66 33 105 88 82 64
Example 14
5 Haze reduction under beer fermentation and lagering conditions.
In previous Examples we have demonstrated the efficacy of enzymatic haze
prevention
at both room temperatures (cf Example 7) and at elevated temperatures. In the
present
Example we illustrate the versatility of this enzymatic Endo-Pro approach by
showing
that proline-specific endoproteases can also effectively prevent haze
formation under
conditions where it has to be active under conditions which are far from
optimal for the
enzyme. To that end we have tested whether the Endo-Pro enzyme can prevent
haze
formation in beer if added prior to beer fermentation (so that the enzyme can
work
during 10 days at 12 degrees C) or if added prior to beer lagering (so that
the enzyme
can work during 10 days at 4 degrees C).
To test the enzymatic haze preventing effect during beer fermentation, we have
used a
freshly produced, 100% malt beer containing approx 4% ethanol that had been
membrane filtered but did not undergo any treatment to remove haze forming
components. This "non-stabilized" beer was decarbonated after which various
concentrations of Endo-Pro enzyme were added (see Table 17). This mixture was
then
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-61-
incubated at 12 C during 10 days.to mimic an industrial beer fermentation as
closely as
possible.
To test the enzymatic haze preventing effect during lagering conditions,
exactly the
same starting material was used in combination with the same concentrations of
the
Endo-Pro enzyme, but now the mixture was incubated at 4 degrees C during 10
days.
In both experiments PVPP ((Polyclar AT / water un-soluble) dosages of 20, 30
and 50
grams per hectoliter of beer were used (agitated during 15 min at room
temperature
prior a paper filtration) as a reference.
In both experiments, papain (liquid DSM Collupulin; batch no 010604, the final
activity
of 5480 NFU/mg) was also included in dosages of 1, 2 and 3 grams per
hectoliter.
In all samples haze formation was measured as specified in Example 2.
Table 17: Enzymatic haze prevention during fermentation
Decarbonated,non-stabilized,100% malt beer
Trial 2 3 4 5 6 7 8 9 10 17712
Incubation Imitating fermentations conditions (12 C for 10 days)
Additions
Endo-Pro (U/I of beer) - - 0.5 1 2 4 - - - - - -
Papain (g/hl of beer) - - - - - - 1 2 3 - - -
PVPP (g/hl of beer) - - - - - - - - - 20 30 50
Haze
170 173 35 30 24 23 95 102 101 124 120 105
Chill Haze test (EBC)
173 173 44 31 22 23 95 102 97 128 121 108
Average 172 173 40 31 23 23 95 102 99 126 121 107
Chill Haze reduction effect (%) - - 77 82 87 87 45 41 43 27 30 38
EBC Haze test 60 t=0 9 9 5 4 4 4 8 10 11 5 4 4
EBC Haze test 60 t=48H 55 56 29 27 27 38 58 63 74 24 19 13
Chill Haze reduction effect (%) - - 48 52 52 31 -5 -13 -32 58 66 77
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-62-
Table 18: Enzymatic haze prevention during lagering
Decarbonated, non-stabilized, 100% malt beer
Trial 11213141-1_1 6 7 8 9 1~ 10 11 12
Incubation Imitating beer lagering (4 C for 10 days)
Additions
Endo-Pro (U/I of beer) - - 0.5 1 2 4 - - - - - -
Papain (g/hI of beer) - - - - - - 1 2 3 - - -
PVPP (g/hl of beer) - - - - - - - - - 20 30 50
Haze
124 120 40 9 9 8 85 72 64 111 115 102
Chill Haze test (EBC)
122 125 41 10 8 9 82 70 62 111 112 103
Average 123 123 41 10 8 8 84 71 63 111 114 103
Chill Haze reduction effect (%) - - 67 92 93 93 32 42 49 10 8 16
EBC Haze test 60 t=0 6 6 3 3 4 3 6 6 6 3 3 3
EBC Haze test 60 t=48H 43 42 14 13 12 17 27 26 27 19 14 7
Chill Haze reduction effect (%) - - 67 71 71 60 36 40 37 55 67 84
From the data obtained it is clear that the enzymatic haze removal can be
applied
during the fermentation as well as the Iagering part of the process. Quite
surprisingly
the enzymatic Endo-Pro process inhibits the beer chill haze better than either
papain or
PVPP and is as good as the currently used dosage of 30 grams per hectoliter of
PVPP
to fight the formation of hot haze.
Example 15.
Enzymatic haze reduction and its effect on beer foam stability and polyphenol
(anti-
oxidant) levels.
A claimed disadvantage of using proteolytic enzymes to reduce haze formation
in beer
is their negative effect on beer foam stability. Owing to excessive
proteolytic
breakdown, the cereal proteins fail to form a stable foam. In this Example we
demonstrate that, probably as the result of its high selectivity, the Endo-Pro
enzyme
has no adverse effect on beer foam stability. An important side effect of Endo-
Pro
incubations is that the resulting beers exhibit increased polyphenol levels
and thus an
increased, natural protection against oxidation.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-63-
In this experiment beer was produced in four different pilot trials all using
100% malt. In
two pilot trials Endo-Pro enzyme was added in 2 concentrations during the
mashing
step. In the two other pilot trials no enzyme was added but these beers were
treated
with PVPP to imitate the conventional removal of haze forming compounds.
.The beer was produced using the following protocol. One brew (6kg malt, 18
liters of
water) is made for each assay. The mashing was carried out for 20 minutes at
50 C,
50 C to 64 C in 10 minutes, 64 C for 20 minutes, 64 C to 74 C in 8 minutes and
finally
74 C for 30 miutes. Filtration was carried out using a Mash filter and
subsequent
washing was done with hot water. Boiling lasted 90 minutes after which hop was
added. Dry lager yeast (7.5 106 cells/ml of wort) was used for for the first
fermentation
and fermentation was carried out at 12 C. Fermentation time depended on the
decrease of the gravity but lasted approx 10 days. Beer maturation took place
at 0 C
during at least 7 days. Finally the beer was membrane-filtered and bottled.
Table 19: Beer foam stability and polyphenol levels
Micropilot trial 1 2 3 4
Enzyme added: Endo-Pro (units/kg of
0 0 33 67
malt)
PVPP treatment no yes no no
Apparent extract ( Plato) 2.01 2.16 1.94 2.11
Real extract ( Plato) 3.85 4.02 3.87 3.96
Original extract ( Plato) 11.83 12.09 12.32 12.03
Alcohol (% v/v) 5.24 5.31 5.56 5.31
Apparent attenuation (%) 83.1 82.2 84.3 82.5
Protein (g/100ml) 0.42 0.42 0.44 0.53
Polyphenols (mg/I) 192 129 168 184
Head retention value / Foam 140 136 142 146
Original, real and apparent extract: EBC 9-4 method; Apparent attenuation;
Alcohol :
EBC 9-4 method; Head retention value: Ross & Clark method; Total protein:
Kjeldahl
method ; Polyphenol: EBC 9-11 method.
CA 02490020 2004-12-06
WO 03/104382 PCT/NL03/00352
-64-
The results obtained clearly indicate that the present enzymatic haze
reduction method
has absolute no negative effects on the beer foam and increases the total
polyphenol
content of the beer in comparison with beer stabilized with PVPP. The latter
observation strongly suggests an increased, natural anti-oxidant capacity of
beers
treated with the Endo-Pro enzyme.
CA 02490020 2006-01-11
- 65/1 -
SEQUENCE LISTING
<110> DSM IP ASSETS B.V.
<120> Improved Method for the Prevention or Reduction of Haze in
Beverages
<130> PCA17090
<140> 2,490,020
<141> 2003-05-14
<150> EP 02100681.2
<151> 2002-06-07
<160> 7
<170> Patentln Ver. 2.1
<210> 1
<211> 1581
<212> DNA
<213> Aspergillus niger
<400> 1
atgcgtgcct tctccgctgt cgctgctgcg gccctggcgc tctcttgggc gtctctggct 60
caggctgctc gcccccgtct tgtgcccaag cctgtctctc ggccagcctc gagtaaatcg 120
gctgcgacca cgggcgaggc ttactttgag cagctgctgg accatcataa tccggagaag 180
ggcacctttt cccagaggta ctggtggagt actgaatact ggggtggtcc tgggtcaccg 240
gtcgtcctct ttactcctgg agaggtctct gccgatggct atgaggggta tctcaccaat 300
gggactctca ctggtgtcta tgcgcaggag atccagggtg ccgtcattct cattgagcac 360
cgctactggg gtgattcttc tccttatgag gtgctcaatg ccgaaactct tcagtacctc 420
acactggacc aagccattct ggacatgacc tacttcgccg agacggtgaa gctgcaattc 480
gataacagca cccgcagcaa tgcgcagaat gctccctggg tcatggtcgg tggatcatac 540
agtggtgcct tgacggcttg gaccgaatct gtcgcgcctg gaacgttctg ggcttaccat 600
gccactagtg ctcctgtgga ggctatctac gactattggc aatactttta ccccatccag 660
caaggtatgg cacagaactg cagcaaggac gtgtctctgg tagccgagta tgtcgacaag 720
attggaaaga acggaactgc caaggagcag caggcactca aggaattgtt tggtctggga 780
gctgttgagc attttgatga ctttgccgct gtcctcccca acggaccgta cctctggcaa 840
gacaacgact ttgccacggg atactcttcc ttcttccagt tctgtgacgc cgtcgagggt 900
gtcgaagccg gcgcggcagt aacccccggc cccgagggtg tcggcctcga aaaggccctg 960
gccaactacg caaactggtt caattcaacc attctccctg attactgcgc aagctacggc 1020
tactggaccg acgaatggag cgtcgcctgc ttcgacagct acaacgcctc gagccccatc 1080
tacaccgata cctccgtagg caatgccgtc gaccgccaat gggaatggtt cctctgcaac 1140
gagcctttct tctactggca ggacggtgct cccgagggta cctccaccat tgtgccccga 1200
ctcgtcagcg cctcctactg gcaacggcaa tgtccgctct acttccccga aacgaacggc 1260
tacacgtacg gcagcgcgaa gggtaagaac gccgccacgg tgaacagctg gaccggtgga 1320
tgggatatga cccgcaacac gacgcggttg atctggacga acgggcaata tgacccctgg 1380
cgggactccg gtgtgtcgag cactttccgg cccggtggac cgctggcgag cacggcgaat 1440
gaacccgtgc agattatccc gggcggattc cattgctcgg atttgtatat ggcggattat 1500
tatgcgaatg agggggttaa aaaggtggtg gataatgagg tgaagcagat caaggagtgg 1560
gtggaggagt attatgcctg a 1581
<210> 2
<211> 3290
<212> DNA
<213> Aspergillus niger
<400> 2
gagaggcaga aggagtcatt tatcacttgt attccaatgt attttccatt tatagatact 60
gcattcaaat gcaccgttta gcatagcatc ccacattcta tttcattcca atctcatgcc 120
attgccatccccggtattaa tttacttctc cgccttatct tgcaatcttg caatctcttt 180
ctcctcgtta tcacgcgttc ctgcaggcgc acctccgatg gcactgcagc cggagtcccc 240
CA 02490020 2006-01-11
- 65/2 -
gcggcgccgg cactactaaa gactaaagtg tctagtctag cctccaatgt gctcacctcc 300
atcagcatct catccattta tcttctgacg atgtcatctg caggctccac cccctccggc 360
cgccccgacg ctctccgacg gtgcacaaca atcaattctg cagtcacgct caagattcgt 420
ccctgccgga ctcctcatgc cgtgcctggt ttaatctatg caatggagta aggtagtatc 480
gcctagcagg agcggagttc ctgctgcgct cacgccatgg tgccggcgca gacataaatc 540
gctcgtttcc tccggcgctg gccgttctct cgagccagtt tgtctgttgt ggttgtagga 600
tcctctgttc ccctcgacag ctcacaatgc gttccttctc cgttgtcgct gccgcgtcac 660
tggcgctctc ttgggcgtct ctggcccagg ctgctcgccc ccgtcttgtg cccaagccta 720
tctctcggcc agcttcgagt aagtcggctg cgactacggg tgaggcttat tttgagcagc 780
tgctggacca tcacaacccg gagaagggaa cgttttccca gcggtactgg tggagtactg 840
aatactgggg tggacctggg tcaccggtgc gtctctgaca tttggtctta tgaccggcca 900
tattgaaact tagccggtgg caaggtccgc aatcatgagg aacattgctg attaaactag 960
gtggtcctct ttaaccctgg agaggtctct gccgatggct atgaggggta tctcaccaac 1020
gatactctca ctggtgtcta tgcgcaggag atccagggtg ccgtcattct cattgaacgt 1080
gagtgtcact gctaccatgg aaaaaagaca ttcgctgatc gaccccaatc tagaccgcta 1140
ctggggcgac tcttcgcctt atgaggtgct caatgccgaa acacttcagt atctcacact 1200
ggatcagtcc attctggaca tgacctactt cgccgagacg gtaaagctgc agttcgataa 1260
tagcagccgc agcaatgcgc agaatgctgt atgttacctt caccgctcta tgtttctgat 1320
aggtactgac aacgtagccc tgggtcatgg tcggtggctc atacagcggt gccttgacgg 1380
cttggaccga gtctatcgcg cctggaacgt tctgggctta ccatgccacc agttcgcctg 1440
tggaggctat ctatgacttt gtaggtgtag cctgctcttg ttatctatac ttgcagctaa 1500
ccaagccagt ggcaatactt ctaccccatt cagcaaggta tggcacagaa ctgcagcaag 1560
gatgtgtctc tggtagccga gtatgtcgac aaaattggga agaatggaac tgccaaggaa 1620
cagcaggagc tcaaagaatt gtttggtctg ggagctgttg agcattacga tgactttgcc 1680
gcgtgagtac ttcaaagtct atagacgagc ttttctgaca ggaacagtgt cctgcccaac 1740
ggaccgtacc tctggcaaga caacgacttt gtcacaggat actcttcctt cttccagttc 1800
tgtgatgctg tcgaggtgag ttaccaccag attcctcttg attgaagcaa tatactaacg 1860
gacacagggt gtcgaagccg gcgcggcagt gacccccggc cccgagggcg tcggacttga 1920
aaaggccctg gccaactacg caaactggtt caattcaacc atactcccta actgtatttc 1980
accatctctt gtctcgttcc tctcccttat cctcccagac taacctagtg acagactgcg 2040
caagctacgg ctactggacc gacgaatgga gcgtcgcctg tttcgacagc tataatgcct 2100
cgagccccat cttcaccgac acctccgtgg gtaaccctgt cgaccgccaa tgggaatggt 2160
tcctctgcaa cgagcctttc ttctggtggc aggagtgcgt accccttacc tcattcatga 2220
taacacacga acaattccac taacaaagat ccagcggtgc ccccgaggga acctccacta 2280
ttgtgccccg gctcgtcagc gcctcctact ggcaacgcca atgcccgctc tacttccccg 2340
aagttaacgg ctacacgtac ggcagcgcga agggtaaaaa ctccgctacg gtgaacagct 2400
ggacgggtgg atgggatatg acccgcaaca cgacgcggtt gatctggacg aacgggtagg 2460
tctcccccta atttccgttg aatgtgatgt gaagataaac tcaatgctaa taaattgaga 2520
aggcaatatg acccctggcg cgactccggt gtgtcgagca ctttccggcc cggtggtccg 2580
ctggttagca cggcgaacga acccgtgcag attattccgg gcgggttcca ttgctcggac 2640
ttgtatatgg aggattacta tgcgaatgag ggtgtgagga aggtggttga taatgaggtg 2700
aagcagatta aggagtgggt ggaggagtat tatgcttgat gaagatactg gtggacatat 2760
ggagtgtaca taagatgaat ggtcataaaa tgatgatggt agatacggct atggctgttg 2820
attagatggt cctttcgcat ttcctaatta ctgagcacgt gctccatggt atgggaagtg 2880
gagacgttgc tatatatatt gactgtcggg ctattgttca cggcgtagaa gctagacgct 2940
ttgtctatgt ggccttcact aaagaccgtg actctgccca gtcttccccc cttcgaggac 3000
ctggtattag ccaaacccac ccacaaacct aacaaagatc atcgtgacat tgaagtcact 3060
ctaggtactg ctggcgctga ttacagtggc tcaattcgaa catttcaaca gcacataagg 3120
gaagggtcgc ttcacttgct accttgatac gaaagcagcc acgcccaaca cttatagggg 3180
tgacaaccat cggcatgctg ggttatctac tatatctcct gattctgtgg atcctggaga 3240
tcgatctggt acactaatct actacaatgc atgtgaagta gggataggca 3290
<210> 3
<211> 1581
<212> DNA
<213> Aspergillus niger
<400> 3
atgcgttcct tctccgttgt cgctgccgcg tcactggcgc tctcttgggc gtctctggcc 60
caggctgctc gcccccgtct tgtgcccaag cctatctctc ggccagcttc gagtaagtcg 120
gctgcgacta cgggtgaggc ttattttgag cagctgctgg accatcacaa cccggagaag 180
ggaacgtttt cccagcggta ctggtggagt actgaatact ggggtggacc tgggtcaccg 240
gtggtcctct ttaaccctgg agaggtctct gccgatggct atgaggggta tctcaccaac 300
gatactctca ctggtgtcta tgcgcaggag atccagggtg ccgtcattct cattgaacac 360
CA 02490020 2006-01-11
65/3 -
cgctactggg gcgactcttc gccttatgag gtgctcaatg ccgaaacact tcagtatctc 420
acactggatc agtccattct ggacatgacc tacttcgccg agacggtaaa gctgcagttc 480
gataatagca gccgcagcaa tgcgcagaat gctccctggg tcatggtcgg tggctcatac 540
agcggtgcct tgacggcttg gaccgagtct atcgcgcctg gaacgttctg ggcttaccat 600
gccaccagtg cgcctgtgga ggctatctat gacttttggc aatacttcta ccccattcag 660
caaggtatgg cacagaactg cagcaaggat gtgtctctgg tagccgagta tgtcgacaaa 720
attgggaaga atggaactgc caaggaacag caggagctca aagaattgtt tggtctggga 780
gctgttgagc attacgatga ctttgccgct gtcctgccca acggaccgta cctctgcaaa 840
gacaacgact ttgtcacagg atactcttcc ttcttccagt tctgtgatgc tgtcgagggt 900
gtcgaagccg gcgcggcagt gacccccggc cccgagggcg tcggacttga aaaggccctg 960
gccaactacg caaactggtt caattcaacc atactcccta actactgcgc aagctacggc 1020
tactggaccg acgaatggag cgtcgcctgt ttcgacagct ataatgcctc gagccccatc 1080
ttcaccgaca cctccgtggg taaccctgtc gaccgccaat gggaatggtt cctctgcaac 1140
gagcctttct tctggtggca ggacggtgcc cccgagggaa cctccactat tgtgccccgg 1200
ctcgtcagcg cctcctactg gcaacgccaa tgcccgctct acttccccga agttaacggc 1260
tacacgtacg gcagcgcgaa gggtaaaaac tccgctacgg tgaacagctg gacgggtgga 1320
tgggatatga cccgcaacac gacgcggttg atctggacga acgggcaata tgacccctgg 1380
cgcgactccg gtgtgtcgag cactttccgg cccggtggtc cgctggttag cacggcgaac 1440
gaacccgtgc agattattcc gggcgggttc cattgctcgg acttgtatat ggaggattac 1500
tatgcgaatg agggtgtgag gaaggtggtt gataatgagg tgaagcagat taaggagtgg 1560
gtggaggagt attatgcttg a 1581
<210> 4
<211> 526
<212> PRT
<213> Aspergillus niger
<400> 4
Met Arg Ser Phe Ser Val Val Ala Ala Ala Ser Leu Ala Leu Ser Trp
1 5 10 15
Ala Ser Leu Ala Gln Ala Ala Arg Pro Arg Leu Val Pro Lys Pro Ile
20 25 30
Ser Arg Pro Ala Ser Ser Lys Ser Ala Ala Thr Thr Gly Glu Ala Tyr
35 40 45
Phe Glu Gln Leu Leu Asp His His Asn Pro Glu Lys Gly Thr Phe Ser
50 55 60
Gln Arg Tyr Trp Trp Ser Thr Glu Tyr Trp Gly Gly Pro Gly Ser Pro
65 70 75 80
Val Val Leu Phe Asn Pro Gly Glu Val Ser Ala Asp Gly Tyr Glu Gly
85 90 95
Tyr Leu Thr Asn Asp Thr Leu Thr Gly Val Tyr Ala Gln Glu Ile Gln
100 105 110
Gly Ala Val Ile Leu Ile Glu His Arg Tyr Trp Gly Asp Ser Ser Pro
115 120 125
Tyr Glu Val Leu Asn Ala Glu Thr Leu Gln Tyr Leu Thr Leu Asp Gln
130 135 140
Ser Ile Leu Asp Met Thr Tyr Phe Ala Glu Thr Val Lys Leu Gln Phe
145 150 155 160
Asp Asn Ser Ser Arg Ser Asn Ala Gln Asn Ala Pro Trp Val Met Val
165 170 175
Gly Gly Ser Tyr Ser Gly Ala Leu Thr Ala Trp Thr Glu Ser Ile Ala
180 185 190
CA 02490020 2006-01-11
65/4 -
Pro Gly Thr Phe Trp Ala Tyr His Ala Thr Ser Ala Pro Val Glu Ala
195 200 205
Ile Tyr Asp Phe Trp Gln Tyr Phe Tyr Pro Ile Gln Gln Gly Met Ala
210 215 220
Gln Asn Cys Ser Lys Asp Val Ser Leu Val Ala Glu Tyr Val Asp Lys
225 230 235 240
Ile Gly Lys Asn Gly Thr Ala Lys Glu Gln Gln Glu Leu Lys Glu Leu
245 250 255
Phe Gly Leu Gly Ala Val Glu His Tyr Asp Asp Phe Ala Ala Val Leu
260 265 270
Pro Asn Gly Pro Tyr Leu Trp Gln Asp Asn Asp Phe Val Thr Gly Tyr
275 280 285
Ser Ser Phe Phe Gln Phe Cys Asp Ala Val Glu Gly Val Glu Ala Gly
290 295 300
Ala Ala Val Thr Pro Gly Pro Glu Gly Val Gly Leu Glu Lys Ala Leu
305 310 315 320
Ala Asn Tyr Ala Asn Trp Phe Asn Ser Thr Ile Leu Pro Asn Tyr Cys
325 330 335
Ala Ser Tyr Gly Tyr Trp Thr Asp Glu Trp Ser Val Ala Cys Phe Asp
340 345 350
Ser Tyr Asn Ala Ser Ser Pro Ile Phe Thr Asp Thr Ser Val Gly Asn
355 360 365
Pro Val Asp Arg Gln Trp Glu Trp Phe Leu Cys Asn Glu Pro Phe Phe
370 375 380
Trp Trp Gln Asp Gly Ala Pro Glu Gly Thr Ser Thr Ile Val Pro Arg
385 390 395 400
Leu Val Ser Ala Ser Tyr Trp Gln Arg Gln Cys Pro Leu Tyr Phe Pro
405 410 415
Glu Val Asn Gly Tyr Thr Tyr Gly Ser Ala Lys Gly Lys Asn Ser Ala
420 425 430
Thr Val Asn Ser Trp Thr Gly Gly Trp Asp Met Thr Arg Asn Thr Thr
435 440 445
Arg Leu Ile Trp Thr Asn Gly Gln Tyr Asp Pro Trp Arg Asp Ser Gly
450 455 460
Val Ser Ser Thr Phe Arg Pro Gly Gly Pro Leu Val Ser Thr Ala Asn
465 470 475 480
Glu Pro Val Gln Ile Ile Pro Gly Gly Phe His Cys Ser Asp Leu Tyr
485 490 495
Met Glu Asp Tyr Tyr Ala Asn Glu Gly Val Arg Lys Val Val Asp Asn
500 505 510
Glu Val Lys Gln Ile Lys Glu Trp Val Glu Glu Tyr Tyr Ala
515 520 525
<210> 5
CA 02490020 2006-01-11
- 65/5 -
<211> 526
<212> PRT
<213> Aspergillus niger
<400> 5
Met Arg Ala Phe Ser Ala Val Ala Ala Ala Ala Leu Ala Leu Ser Trp
1 5 10 15
Ala Ser Leu Ala Gln Ala Ala Arg Pro Arg Leu Val Pro Lys Pro Val
20 25 30
Ser Arg Pro Ala Ser Ser Lys Ser Ala Ala Thr Thr Gly Glu Ala Tyr
35 40 45
Phe Glu Gln Leu Leu Asp His His Asn Pro Glu Lys Gly Thr Phe Ser
50 55 60
Gln Arg Tyr Trp Trp Ser Thr Glu Tyr Trp Gly Gly Pro Gly Ser Pro
65 70 75 80
Val Val Leu Phe Thr Pro Gly Glu Val Ser Ala Asp Gly Tyr Glu Gly
85 90 95
Tyr Leu Thr Asn Gly Thr Leu Thr Gly Val Tyr Ala Gln Glu Ile Gln
100 105 110
Gly Ala Val Ile Leu Ile Glu His Arg Tyr Trp Gly Asp Ser Ser Pro
115 120 125
Tyr Glu Val Leu Asn Ala Glu Thr Leu Gln Tyr Leu Thr Leu Asp Gln
130 135 140
Ala Ile Leu Asp Met Thr Tyr Phe Ala Glu Thr Val Lys Leu Gln Phe
145 150 155 160
Asp Asn Ser Thr Arg Ser Asn Ala Gln Asn Ala Pro Trp Val Met Val
165 170 175
Gly Gly Ser Tyr Ser Gly Ala Leu Thr Ala Trp Thr Glu Ser Val Ala
180 185 190
Pro Gly Thr Phe Trp Ala Tyr His Ala Thr Ser Ala Pro Val Glu Ala
195 200 205
Ile Tyr Asp Tyr Trp Gln Tyr Phe Tyr Pro Ile Gln Gln Gly Met Ala
210 215 220
Gln Asn Cys Ser Lys Asp Val Ser Leu Val Ala Glu Tyr Val Asp Lys
225 230 235 240
Ile Gly Lys Asn Gly Thr Ala Lys Glu Gln Gln Ala Leu Lys Glu Leu
245 250 255
Phe Gly Leu Gly Ala Val Glu His Phe Asp Asp Phe Ala Ala Val Leu
260 265 270
Pro Asn Gly Pro Tyr Leu Trp Gln Asp Asn Asp Phe Ala Thr Gly Tyr
275 280 285
Ser Ser Phe Phe Gln Phe Cys Asp Ala Val Glu Gly Val Glu Ala Gly
290 295 300
Ala Ala Val Thr Pro Gly Pro Glu Gly Val Gly Leu Glu Lys Ala Leu
305 310 315 320
CA 02490020 2006-01-11
- 65/6 -
Ala Asn Tyr Ala Asn Trp Phe Asn Ser Thr Ile Leu Pro Asp Tyr Cys
325 330 335
Ala Ser Tyr Gly Tyr Trp Thr Asp Glu Trp Ser Val Ala Cys Phe Asp
340 345 350
Ser Tyr Asn Ala Ser Ser Pro Ile Tyr Thr Asp Thr Ser Val Gly Asn
355 360 365
Ala Val Asp Arg Gln Trp Glu Trp Phe Leu Cys Asn Glu Pro Phe Phe
370 375 380
Tyr Trp Gln Asp Gly Ala Pro Glu Gly Thr Ser Thr Ile Val Pro Arg
385 390 395 400
Leu Val Ser Ala Ser Tyr Trp Gln Arg Gln Cys Pro Leu Tyr Phe Pro
405 410 415
Glu Thr Asn Gly Tyr Thr Tyr Gly Ser Ala Lys Gly Lys Asn Ala Ala
420 425 430
Thr Val Asn Ser Trp Thr Gly Gly Trp Asp Met Thr Arg Asn Thr Thr
435 440 445
Arg Leu Ile Trp Thr Asn Gly Gln Tyr Asp Pro Trp Arg Asp Ser Gly
450 455 460
Val Ser Ser Thr Phe Arg Pro Gly Gly Pro Leu Ala Ser Thr Ala Asn
465 470 475 480
Glu Pro Val Gln Ile Ile Pro Gly Gly Phe His Cys Ser Asp Leu Tyr
485 490 495
Met Ala Asp Tyr Tyr Ala Asn Glu Gly Val Lys Lys Val Val Asp Asn
500 505 510
Glu Val Lys Gln Ile Lys Glu Trp Val Glu Glu Tyr Tyr Ala
515 520 525
<210> 6
<211> 1551
<212> DNA
<213> Aspergillus niger
<400> 6
atgcgttcct tctccgttgt cgctgccgcg tcactggcgc tctcttgggc gtctctggcc 60
caggctgctc gcccccgtct tgtgcccaag cctatctctc ggccagcttc gagtaagtcg 120
gctgcgacta cgggtgaggc ttattttgag cagctgctgg accatcacaa cccggagaag 180
ggaacgtttt cccagcggta ctggtggagt actgaatact ggggtggacc tgggtcaccg 240
gtggtcctct ttaaccctgg agaggtctct gccgatggct atgaggggta tctcaccaac 300
gatactctca ctggtgtcta tgcgcaggag atccagggtg ccgtcattct cattgaacac 360
cgctactggg gcgactcttc gccttatgag gtgctcaatg ccgaaacact tcagtatctc 420
acactggatc agtccattct ggacatgacc tacttcgccg agacggtaaa gctgcagttc 480
gataatagca gccgcagcaa tgcgcagaat gctccctggg tcatggtcgg tggctcatac 540
agcggtgcct tgacggcttg gaccgagtct atcgcgcctg gaacgttctg ggcttaccat 600
gccaccagtg cgcctgtgga ggctatctat gactttcaag gtatggcaca gaactgcagc 660
aaggatgtgt ctctggtagc cgagtatgtc gacaaaattg ggaagaatgg aactgccaag 720
gaacagcagg agctcaaaga attgtttggt ctgggagctg ttgagcatta cgatgacttt 780
gccgctgtcc tgcccaacgg accgtacctc tggcaagaca acgactttgt cacaggatac 840
tcttccttct tccagttctg tgatgctgtc gagggtgtcg aagccggcgc ggcagtgacc 900
cccggccccg agggcgtcgg acttgaaaag gccctggcca actacgcaaa ctggttcaat 960
tcaaccatac tccctaacta ctgcgcaagc tacggctact ggaccgacga atggagcgtc 1020
gcctgtttcg acagctataa tgcctcgagc cccatcttca ccgacacctc cgtgggtaac 1080
CA 02490020 2006-01-11
- 65/7 -
cctgtcgacc gccaatggga atggttcctc tgcaacgagc ctttcttctg gtggcaggac 1140
ggtgcccccg agggaacctc cactattgtg ccccggctcg tcagcgcctc ctactggcaa 1200
cgccaatgcc cgctctactt ccccgaagtt aacggctaca cgtacggcag cgcgaagggt 1260
aaaaactccg ctacggtgaa cagctggacg ggtggatggg atatgacccg caacacgacg 1320
cggttgatct ggacgaacgg gcaatatgac ccctggctcg actccggtgt gtcgagcact 1380
ttccggcccg gtggtccgct ggttagcacg gcgaacgaac ccgtgcagat tattccgggc 1440
gggttccatt gctcggactt gtatatggag gattactatg cgaatgaggg tgtgaggaag 1500
gtggttgata atgaggtgaa gcagattaag gaatacggct atggctgttg a 1551
<210> 7
<211> 516
<212> PRT
<213> Aspergillus niger
<400> 7
Met Arg Ser Phe Ser Val Val Ala Ala Ala Ser Leu Ala Leu Ser Trp
1 5 10 15
Ala Ser Leu Ala Gln Ala Ala Arg Pro Arg Leu Val Pro Lys Pro Ile
20 25 30
Ser Arg Pro Ala Ser Ser Lys Ser Ala Ala Thr Thr Gly Glu Ala Tyr
35 40 45
Phe Glu Gln Leu Leu Asp His His Asn Pro Glu Lys Gly Thr Phe Ser
50 55 60
Gln Arg Tyr Trp Trp Ser Thr Glu Tyr Trp Gly Gly Pro Gly Ser Pro
65 70 75 80
Val Val Leu Phe Asn Pro Gly Glu Val Ser Ala Asp Gly Tyr Glu Gly
85 90 95
Tyr Leu Thr Asn Asp Thr Leu Thr Gly Val Tyr Ala Gln Glu Ile Gln
100 105 110
Gly Ala Val Ile Leu Ile Glu His Arg Tyr Trp Gly Asp Ser Ser Pro
115 120 125
Tyr Glu Val Leu Asn Ala Glu Thr Leu Gln Tyr Leu Thr Leu Asp Gln
130 135 140
Ser Ile Leu Asp Met Thr Tyr Phe Ala Glu Thr Val Lys Leu Gln Phe
145 150 155 160
Asp Asn Ser Ser Arg Ser Asn Ala Gln Asn Ala Pro Trp Val Met Val
165 170 175
Gly Gly Ser Tyr Ser Gly Ala Leu Thr Ala Trp Thr Glu Ser Ile Ala
180 185 190
Pro G1y Thr Phe Trp Ala Tyr His Ala Thr Ser Ala Pro Val Glu Ala
195 200 205
Ile Tyr Asp Phe Gln Gly Met Ala Gln Asn Cys Ser Lys Asp Val Ser
210 215 220
Leu Val Ala Glu Tyr Val Asp Lys Ile Gly Lys Asn Gly Thr Ala Lys
225 230 235 240
Glu Gln Gln Glu Leu Lys Glu Leu Phe Gly Leu Gly Ala Val Glu His
245 250 255
Tyr Asp Asp Phe Ala Ala Val Leu Pro Asn Gly Pro Tyr Leu Trp Gln
CA 02490020 2006-01-11
- 65/8 -
260 265 270
Asp Asn Asp Phe Val Thr Gly Tyr Ser Ser Phe Phe Gln Phe Cys Asp
275 280 285
Ala Val Glu Gly Val Glu Ala Gly Ala Ala Val Thr Pro Gly Pro Glu
290 295 300
Gly Val Gly Leu Glu Lys Ala Leu Ala Asn Tyr Ala Asn Trp Phe Asn
305 310 315 320
Ser Thr Ile Leu Pro Asn Tyr Cys Ala Ser Tyr Gly Tyr Trp Thr Asp
325 330 335
Glu Trp Ser Val Ala Cys Phe Asp Ser Tyr Asn Ala Ser Ser Pro Ile
340 345 350
Phe Thr Asp Thr Ser Val Gly Asn Pro Val Asp Arg Gln Trp Glu Trp
355 360 365
Phe Leu Cys Asn Glu Pro Phe Phe Trp Trp Gln Asp Gly Ala Pro Glu
370 375 380
Gly Thr Ser Thr Ile Val Pro Arg Leu Val Ser Ala Ser Tyr Trp Gln
385 390 395 400
Arg Gln Cys Pro Leu Tyr Phe Pro Glu Val Asn Gly Tyr Thr Tyr Gly
405 410 415
Ser Ala Lys Gly Lys Asn Ser Ala Thr Val Asn Ser Trp Thr Gly Gly
420 425 430
Trp Asp Met Thr Arg Asn Thr Thr Arg Leu Ile Trp Thr Asn Gly Gln
435 440 445
Tyr Asp Pro Trp Arg Asp Ser Gly Val Ser Ser Thr Phe Arg Pro Gly
450 455 460
Gly Pro Leu Val Ser Thr Ala Asn Glu Pro Val Gln Ile Ile Pro Gly
465 470 475 480
Gly Phe His Cys Ser Asp Leu Tyr Met Glu Asp Tyr Tyr Ala Asn Glu
485 490 495
Gly Val Arg Lys Val Val Asp Asn Glu Val Lys Gln Ile Lys Glu Tyr
500 505 510
Gly Tyr Gly Cys
515
