Note: Descriptions are shown in the official language in which they were submitted.
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Method for assaying replication of HBV and testing susceptibility to
drugs.
The present invention relates to the cloning of replication-competent HBV DNA
genomes, to methods for measuring the replication capacity of HBV, e.g. HBV
present in a biological sample, possibly in the presence of a pharmaceutical
product,
in particular an antiviral agent. The invention relates in particular to
phenotypic
assays allowing to test the susceptibility of HBV to drugs or to screen drugs
on HBV.
More particularly, the invention concerns such methods to determine the
susceptibility of the viral strains present in a patient to the available
drugs and
therefore tailor antiviral therapy to the virological situation.
The invention also relates to primers, primers pairs and kits used in
amplification, as well as to vectors comprising replication-competent HBV DNA
genomes and cells, e.g. cell lines transfected with such vectors.
Despite the development of an efficient vaccine, chronic Hepatitis B virus
(HBV) infection is still a major public health problem worldwide. Indeed, more
than
400 million people are chronic carriers of the virus and are at high risk of
developing
cirrhosis and hepatocellular carcinoma.
HBV is a DNA virus that replicates its genome via a reverse transcriptase
phase. The spontaneous error rate of the viral reverse transcriptase leads to
the
heterogeneity of HBV genome. Illustrating the latter point, eight genotypes (A
to H)
have been identified, and HBV mutants which are selected either during the
natural
course of the infection or during therapy, have been described.
Recently, major progress has been made in the field of antiviral therapy of
chronic hepatitis B, with the development of nucleoside analogues that inhibit
the
viral polymerase. Hence, lamivudine has been approved two years ago and is now
largely used in clinical practice worldwide. Although it inhibits
significantly viral
replication, the emergence of drug resistant mutants harbouring mutations in
conserved domains of the viral polymerase is observed with a prevalence in
patient
increasing from 15 at year one to 75 % at year four of therapy. As these
mutants may
represent a new threat for human health, new antiviral agents were needed to
combat them. Thus, other inhibitors, such as adefovir dipivoxil, entecavir,
emtricitabine, clevudine, and telbivudine, have been recently studied for
their anti-
HBV properties in experimental models and are currently evaluated in clinical
trials.
1
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
However, in vitro studies have also shown that lamivudine resistant strains
may be
cross-resistant to some of these drugs (e.g. emtricitabine), while sensitive
to other.
This observation warrants a close monitoring of viral population in vivo and
emphasises the development of drug resistance assay (or phenotypic assay).
Therefore, it will be important in the future, in the clinical setting, to
know in
each patient the susceptibility of the viral strains to the available drugs
and therefore
tailor antiviral therapy to the virological situation.
To date, no efficient phenotypic drug susceptibility assay has been developed
for HBV. With the current and future development of new anti-HBV molecules,
phenotypic drug susceptibility testing should become an important issue for
the
management of patient infected with resistant HBV isolates.
The mechanism of HBV entry into cells has not been completely elucidated.
After uncoating, the HBV DNA is brought into the nucleus of the host cell,
where it is
repaired to the covalently closed circular form (cccDNA). Once recircularized,
enhancer and promoter activities start producing the various HBV RNA
transcripts.
There are sub-genomic transcripts. which serve as mRNA for the expression of
the X
and the surface proteins. The larger genomic transcripts are longer than one
genome
in length and serve to produce e, core and polymerase proteins. And a
particular
genomic transcript, lacking the ATG start codon for the a protein, is
designated the
pregenomic RNA (pgRNA). This pgRNA, which is the template for the synthesis of
HBV DNA by reverse transcription, is longer than one genome in length (i.e.
about
1.1 genome unit) and therefore contains a terminally-redundant RNA strand. The
redundant sequence comprises about 200 nucleotides, including direct repeat 1
(DR1 ) as well as the stem-loop. See for more details G-H Wang et al., Cell
1992, 71:
663-670, G-H Wang et al., J. Virol. 1993, 67: 6507-6512).
When studying HBV mutants in vitro, plasmidic vectors containing the genomic
information required for the initiation of HBV replication in cells after
transfection are
used; such plasmids are replication competent. These plasmids contain from 1.1
to 2
HBV genomes. Classic methods to study mutants rely on site directed
mutagenesis
of well established replication competent HBV constructs (laboratory strains
only, not
clinical) or on the introduction of HBV genome fragments (i.e. "cassette
exchange")
from clinical isolates in replication-competent HBV constructs (idem). PCR-
mediated
transfer of HBV genome cassettes or on site directed mutagenesis within a well
established replication-competent laboratory strain allowed for instance to
confirm
2
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
that some mutants selected in vivo in patients during antiviral therapy were
indeed
conferring resistance to lamivudine (Seigneres B., et al., Hepatology 2002,
36: 710-
722; Pichoud C. et al., Hepatology 1999, 29: 230-237; Allen M.I. et al.,
Hepatology
1998, 27: 1670-1677; Bock C.T. et al., Gastroenterology 2002, 122: 264-273).
However these methods do not allow to studying the whole HBV genetic
information
from the clinical isolates and may therefore exclude some important mutations
located in other parts of the genome or result in mosaic HBV genomes.
Gunther et al~(J. Virol. 1995, 69, 9: 5437-5444) have first described a method
for PCR amplification of full-length HBV genomes (i.e. one genome unit) that
was
meant to facilitate the analysis of natural HBV isolates. The full-length
amplicon was
either directly used for transfection experiment of hepatoma cell line or
cloned prior to
its use. Both approaches involved the utilization of the Sap-I restriction
enzyme
(From New England Biolabs), which is a quite expensive and inefficient
restriction
enzyme. The tranfected full-length genome is circularized in the nucleus of
cells by
host enzymes (which remain to be identified) to give rise to covalently closed
circular
HBV DNA, which is the natural template for transcription of HBV genes. In this
case
the endogenous HBV promoter is used for the transcription. The same method is
used in S. Gunther et al., J. Clin. Microb 1998, 36, 2 : 531-538). The process
of host
mediated circularization of linear HBV DNA is highly inefficient and represent
therefore a major limitation for the analysis of all HBV mutants. Due to the
low level of
HBV circular template generated a low level of HBV DNA synthesis (replication)
is
obtained. This low level of HBV DNA synthesis hampers the analysis of viral
replication and drug susceptibility testing. Other limitations of the
Gunther's method
are the high amount of amplification products that is necessary for cell
transfection,
and the absence of "an easy to use" continuous source of material for cell
transfections and phenotypic studies. Although interesting for fundamental
research,
this method does not seem appropriate in the context of a standardized
phenotypic
assay which requires solid replication level and production of easily
detectable
amount of viral particles in the cell culture medium.
M. Schories et al. (J. of Hepatology 2000, 33, 799-811 ), describe the
molecular characterization of an HBV mutant isolated from a patient via 2 PCR
amplification of overlapping regions. After identification of an interesting
mutation, a
sub-cloning strategy (referred as "cassette exchange" above) was used to
insert the
3
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
mutation in the background of a laboratory HBV strain. The clones obtained
contain
two HBV genomes.
P.P. Ulrich et al., J. of Medical Virology 1990, 32 : 109-118, describe the
molecular characterization of an HBV mutant isolated from a patient via
amplification
of the circulating DNA. Mutations were detected by sequencing. For biologic
evaluation of these mutations on HBV replication and expression of HBeAg, in
vifro,
HepG2 cells were transfected with the cloned, re-circularised mutant HBV DNA.
This
document teaches that a complete (one unit) HBV genome can be amplified by PCR
and is replication competent in vitro. W.E. Delaney et al. describes
construction of a
baculovirus vector containing a 1.3 HBV unit genome allowing infection of
eucaryote
cells and production of 1.3 HBV genomes in these cells.
Most of works described in these prior publications are based on mutagenesis
or cassette exchange strategies (cloning or sub-cloning of fragment). In all
cases the
vectors constructed are using the endogenous promoter and cloning (or
subcloning)
methods do not comprise means allowing the rapid and standardized cloning of
HBV
DNA from samples. Therefore, they can not be used in clinical survey or in
drug
susceptibility assays.
J. Kruining et al., J. Hepatol. 1995, 22 : 263-267 describes cell lines stably
transfected with HBV. These cells lines are used to test drugs but do not
concern
testing drugs with respect to clinical HBV mutants.
There is thus still a need for an efficient method allowing to evaluate the
replication capacity of HBV and to test the susceptibility of HBV isolates to
drugs
and/or to test the antiviral activity of drugs on HBV, in particular in
clinical survey.
An objective of the invention is to propose a rapid and reproducible cloning
of
replication-competent HBV DNA genomes from patient samples.
Another objective of the invention is to propose a rapid and reproducible
phenotypic assay method allowing to test the susceptibility of HBV isolates
with
respect to drugs. In particular, this object aims to determine the
susceptibility of the
viral strains present in a patient to the available drugs and therefore tailor
antiviral
therapy to the virological situation.
Another objective of the invention is to propose a method allowing to rapidly
produce in vitro HBV replication competent clones useful for phenotypic
analysis or
for functional analysis.
4
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Still another objective of the invention is to propose a rapid and
reproducible
assay method allowing to test the antiviral activity of current and future
drugs to
particular HBV or to HBV variants or to HBV field isolates.
Still another objective is to propose a method allowing to study the
replication
capacity of wild-types and mutants of HBV
Still another objective is to allow the production of cell lines
constitutively
producing HBV particles.
The present invention is based on the cloning into a vector of HBV DNA
covering more-than-full-length (i.e. cloning of about 1.1 genome unit) HBV
genome,
such that a pgRNA can be synthesized from this DNA post-cell-transfection. The
pgRNA synthesis in the host cells initiates the HBV intracellular cycle with
viral gene
expression, including synthesis of intracellular replicative intermediates,
which
comprise single stranded DNA, double stranded linear DNA, relaxed circular DNA
and the minor species of replicative intermediates. The invention allows the
rapid
cloning of replication-competent HBV DNA genomes. Then, it is possible to
evaluate
the level of HBV DNA synthesis in the cells, e.g. by Southern blot, or of RNAs
synthesis, e.g. by Northern blot, or of viral protein expression, e.g. by
Western blot,
ELISA or RIA, in the presence or in the absence of antiviral agent to be
evaluated. It
is also possible to analyse the level of virus production, in particular by
measuring the
level of virion DNA or of Dane particles in the extra-cellular medium or
supernatant,
using Southern blot or real time PCR method or similar, in the presence or in
the
absence of antiviral agent to be evaluated.
A first object of the invention is thus a method for measuring the replication
capacity of HBV, e.g. HBV present in a biological sample, possibly in the
presence of
a pharmaceutical product, in particular an antiviral agent, the method
comprising:
(a) possibly extracting nucleic acids contained in the biological sample;
(b) PCR amplifying HBV nucleic acids using at least two primer pairs
selected so as to obtain at least two amplified HBV genomic fragments
representing more-than-full-length HBV genome and which upon
assembly represent a linear continuous DNA sequence transcriptable in
pgRNA ;
(c) cloning the fragments obtained under (b) into a vector under the control
of a promoter, preferably a heterologous promoter, so producing a
s
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
vector containing a linear continuous DNA sequence (about 1.1
genome unit in length) transcriptable in pgRNA under control of said
promoter ;
(d) transfecting or transducing susceptible cells with the vector;
(e) culturing the transfected or transduced cells in conditions allowing
synthesis of HBV pgRNA from the cloned HBV DNA;
(f) possibly treating the cultured cells with the pharmaceutical product, in
particular antiviral agent; and
(g) determining the replication capacity of the HBV, possibly incidence of
the pharmaceutical product, in particular antiviral agent, on viral gene
expression and/or viral replication.
The biological sample may be derived from a patient. It can be a sample of
blood or serum, but can be any body fluid or else a liver biopsy sample, or
any
preparation issued therefrom. The biological sample may also be derived from a
viral
culture. It can be a cell culture supernatant. Generally speaking a biological
sample
can be any type of sample containing one or several HBV clones.
Step (a) provides the extraction of DNA from the biological sample. This can
be made by any usual method. These methods may comprise a chromatography
column-based purification, in particular affinity chromatography, and/or
differential
precipitation of proteins and nucleic acids. Use may be made of commercial
purification kits, as those used in the examples.
The cloning of the HBV DNA covering more-than-full-length HBV genome is
done by amplifying (step (b)) at least two, preferably two, HBV genomic
fragments,
then subjecting the amplicons with suitable restriction enzymes to ligate the
v~ihole
insert in the vector (step (c)).
Each HBV genomic fragment is amplified in step (b) using suitable primer
pairs.
The HBV are classified into the genetic groups A to H based on divergence of
the complete nucleotide sequence. Such sequences are available in articles and
in
GenBank for each genotype. In the present specification, the numbering of
nucleotides is by reference to the whole HBV genomic DNA sequence published in
H. Norder et al. (Virology 1994, 198, 489-503, incorporated herein by
reference;
6
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Figure 1 of this article presents an alignment of the genome of various HBV
clones
representing genotypes C, E and F, with the sequence of clone pHBV-3200 which
is
3221 nucleotides long) or the one of a genotype C HBV published in GenBank
under
access number AB048704 (incorporated herein by reference). The length of the
genome of the various HBV is variable. That is to say that numbering of
nucleotides
should only be considered as illustrative embodiments.
As it will be described in more details infra, according to a very
advantageous
characteristic of the invention, use is made of primers that are complementary
to a
well-conserved region inside HBV genotypes. These primers are thus able to
hybridise to the various HBV present in a sample, representing the so-called
quasi-
species. The method allows one to clone and amplify the quasi-species, and
then to
apply the tests according to the invention not only with respect to one HBV
isolate,
but with respect to the HBV population infecting a patient.
In a first embodiment, the aim is to clone a more-than-full-length (i.e. about
1.1 genome unit) HBV genome under the control of an heterologous promoter. The
vector is made containing a heterologous promoter operatively linked to the
HBV
sequence so that a pgRNA may be synthesized under the control of that
promoter.
And the primer pairs for PCR amplifications are made so as to allows one to
obtain
this continuous HBV DNA sequence transcriptable in pgRNA, which DNA sequence
represents more than one HBV unit genome (i.e. about 1.1 genome unit; so-
called
more-than-full length). Advantageously, the heterologous promoter is strong
which
means that transcription level is higher than with the endogenous promoter.
In this embodiment, by definition, a more-than-full-length HBV genome is a
continuous sequence comprising, or consisting essentially of, HBV nucleotides
(from
5' to 3')
- an about 1-unit genome starting in 5' from and including the nucleotide
representing the +1 of transcription (in general nucleotide A, position 1818
in
H. Norder et al.; in some cases however, the +1 of transcription has revealed
to be the nucleotide in 5' of said A, i.e. C, or in 3', i.e. A) to the first
nucleotide
in 5' of the ATG of the pre-C gene (nucleotide 1813 in H. Norder et al.), plus
- a sub-genomic fragment starting from and including the A of the ATG of the
pre-C gene (nucleotide 1814 in H. Norder et al.) and extending to and
including the polyA attachment site (nucleotide 1960 in H. Norder et al.),
thus
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
comprising the polyA sequence TATAAA, nucleotides 1916-1920 in H. Norder
et al.). These fragments are overlapping if one refers to the circular genome.
The whole sequence corresponds to at least about 1.1 genome unit (it is by
definition a more-than-full-length genome) and is able to produce a pgRNA.
If one refers to H. Norder at al. or in GenBank AB048704, the more-than-full-
length HBV genome comprises from 5' to 3' nucleotides 1818 to 1813 and 1814 to
1960. The number of nucleotides may be variable depending on the HBV. For
instance, some HBV lack several nucleotides at positions 2806 to 2611 and 2884
to
2886 (Norder et al., Figure 1 ). It is however evident that this teaching
extends itself to
any HBV. In one embodiment, the more-than-full-length HBV genome comprises
from 5' to 3' nucleotides 1818 to 1813 and 1814 to 1960 of an HBV genomic
sequence aligned with the one disclosed in H. Norder et al, or in GenBank
AB048704
(alignment means that spaces are introduced for the missing nucleotides, as
was
done for instance in Norder et al., or that possible supplemental nucleotides
are not
considered). In a particular embodiment, the more-than-full-length HBV genome
comprises nucleotides 1816 to 1813 and 1814 to 2016 of an HBV genomic sequence
aligned with the sequence as mentioned above. Genomic map of an HBV clone is
easily available after sequence alignment so that the one skilled in the art
may easily
determine with precision for every HBV clone any HBV genomic region and in
particular those used in the invention, such as the +1 of transcription, the
pre-C gene
and its ATG, the polyA attachment site, so that the so-called more-than-full-
length
HBV genome can be determined.
Also, the more-than-full-length HBV genome can be longer and for instance
can comprise further nucleotides situated in 5' of the said +1 of
transcription. In that
event however, it is necessary that the longer sequence does not comprise in
5' a
functional ATG for the pre-C gene (A and/or T and/or G mutated or deleted) and
preferably do not contain the endogenous HBV promoter which physiologically
drives
the expression of pgRNA (located between position 1744 and 1795). Also, it can
be
longer at the 3' end. In practice, one may bear in mind that: the location of
the primer
determines the length of the sequence; it is preferred to choose a primer
which is
complementary to a well-conserved region inside HBV genotypes and as close as
possible of the polyA attachment site; and the sensibility of the PCR is
better with
smaller amplicons.
8
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
In this first embodiment, amplification is preferably made of two fragments
whose DNA sequence comprises HBV nucleotides (from 5' to 3')
- the first fragment comprises a HBV DNA sequence comprising at its 5' end the
nucleotide representing the +1 of transcription, and
- the second fragment comprises a HBV DNA sequence comprising at its 3' end
the polyA attachment site
the 3' end of the first fragment and the 5' end of the second fragment being
overlapping and preferably comprising a restriction site in the overlapping
part, so
that upon restriction treatment both fragments can be ligated to give rise to
the more-
than-full-length HBV genome.
Two primers pairs are designed to amplify such first and second amplicons,
respectively.
The primers disclosed herein have been designed after multiple sequence
alignment with more than 200 whole HBV genomes, and in the end checked with
respect to a total of about 500 whole HBV genomes. As it is the case with the
herein
disclosed primers, primers useful in the invention are better designed from
well-
conserved regions, in order to allows one to apply the invention regardless of
the
genotypes and main natural mutations of the field HBV. In order to allow
representing
most if not all HBV genomes, an embodiment provides for the use of a mixture
of
different primers which differ only by the variations necessary to represent
all
possibilities. For instance, if the HBV genomes can be classified into two
families
regarding a specific genomic region targeted by the primer, the primer
designed to be
complementary to this region may be a mixture of two primers, representing
each
one of these groups.
In this first embodiment, a preferable first primer pair comprises a forward
primer A which is partially complementary to the 5' part of the pre-C gene
(which
codes for protein e), including the nucleotide representing the +1 of
transcription (as
defined above), but does not contain the ATG of the pre-C gene.
Suitable A primers are by way of example:
SEQ ID NO: 1
5' TGCGCACCGCGGCCGCGCAACTTTTTCACCTCTGCC 3'
This primer comprises a Notl site (once underlined) downstream of the G of the
start
codon of pre-C, and hybridise on nucleotides 1816 to 1835 (H. Norder et al.,
and
GenBank AB048704).
9
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
SEQ ID NO: 2
5' TGCGCACCAGGGCGCGCCAACTTTTTCACCTCTGCC 3'
This primer comprises a Ascl site (once underlined).
SEQ ID NO: 3
5' TGCGCACCCCTGCAGGGCAACTTTTTCACCTCTGCC 3'
This primer comprises a Sse8387 I site (once underlined).
SEQ ID NO: 4
5' TGCGCACCAGGTTTAAACAACTTTTTCACCTCTGCC 3'
This primer comprises a Pmel site (once underlined).
SEQ ID NO: 5
5' TGCGCACCAGCGGCCGCCAACTTTTTCACCTCTGCC 3'
This primer comprises a Notl site (once underlined).
SEQ ID NO: 6
5' TGCGCACCACCTGCAGGCAACTTTTTCACCTCTGCC 3'
This primer comprises a Sse8387 I site (once underlined).
SEQ ID NO: 7
5' TGCGCACCAGGTTTAAACAACTTTTTCACCTCTGCC 3'
This primer comprises a Pmel site (once underlined).
SEQ ID NO: 8
5' TGCGCACCAGGCGCGCCCAACTTTTTCACCTCTGCC 3'
This primer comprises a Ascl site (once underlined).
SEQ ID NO: 9
5' TGCGCACGGCGCGCCTGCAACTTTTTCACCTCTGCC 3'
This primer comprises a Ascl site (once underlined).
SEQ ID NO: 10
to
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
5' TGCGCACCCTGCAGGTGCAACTTTTTCACCTCTGCC 3'
This primer comprises a Sse8387 I site (once underlined).
SEQ ID NO: 11
5' TGCGCACCGCGGCCGCGCAACTTTTTCACCTCTGCC 3'
This primer comprises a Notl site (once underlined).
SEQ ID NO: 12
5' TGCGCACCATTAATTAACAACTTTTTCACCTCTGCC 3'
This primer comprises a Pacl site (once underlined).
In this first embodiment, it is preferred to clone HBV DNA in order to fuse
the
natural +1 of transcription of the HBV pgRNA to the +1 of transcription
determined by
the promoter contained in the vector or plasmid used for the cloning. To
achieve this
fusion at molecular level, the promoter may be first modified by the insertion
(mutagenesis), between the TATA box (or equivalent) of the basic promoter and
the
+1 of transcription, of a restriction site which is preferably not present in
any of the
known complete HBV sequences. Several restriction enzymes that recognize a
palindromic site of 8 nucleotides, such as Notl, Ascl, Pacl, Pmel, SSe83871,
do not
cut HBV genome, and can be used for this strategy. The same restriction site
is also
integrated into the tail of the primer A used for the PCR. SEQ ID NO: 1 to 12
are
examples of primers useful in this embodiment, comprising such restriction
sites. Of
course, it is evident that the one skilled in the art is able to prepare other
suitable
primers.
Generally speaking, polynucleotides useful as preferable primers in this
embodiment comprise a nucleotide sequence corresponding to a restriction site,
preferably not present in the HBV genome, situated in 5' of a sequence
complementary to the 5' end of the pre-C gene, but lacking the complete ATG of
this
pre-C gene (e.g. A, or A and T or A and T and G are missing). As appearing on
the
sequences referred SEQ ID NO: 1 to 12, the restriction site can be directly
linked to
the +1 of transcription or separated by some nucleotides (e.g. 1-3). In the
preferred
embodiment, the primer comprises SEQ ID NO: 1. On the sequences, the double
underlined sequence is complementary to the 5' part of the pre-C gene. Of
course,
the 3' end thereof may be shortened or extended to contain further
complementary
11
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
nucleotides. If one wants to keep the possibility of hybridising DNA from any
HBV, it
is preferable to not extend the primer so that it includes non-conservative
regions.
Thus the cloning of the HBV DNA involves the use of a heterologous promoter
constructed so as to contain a restriction site not present in HBV genomes and
of a
primer hybridised to the HBV DNA and comprising the same restriction site, so
that
fusion of the HBV DNA and the promoter may occur. Preferably, the natural +1
of
transcription of the HBV pgRNA is so fused to the +1 of transcription
determined by
the promoter.
This first primer pair comprises preferably a reverse primer chosen to be
complementary to a consensus or a substantially consensus sequence within the
HBV genomes.
Suitable reverse B primers are by way of example:
B1: SEQ ID NO: 13
5' GGCAGCACASCCTAGCAGCCATGG 3'
This primer comprises a Ncol site (underlined) and are useful for
amplification of
genotypes A, B, D, E and G. The primer hybridizes with nucleotides 1395-1372
(H.
Norder et al., and GenBank AB048704).
B2:SEQIDN0:14
5' GGCAGCACASCCGAGCAGCCATGG 3'
This primer comprises a Ncol site (underlined) and are useful for
amplification of
genotypes C and F. The primer hybridizes with nucleotides 1395-1372.
A mixture of both primers B1 and B2 may advantageously be used.
S means G or C. Thus in SEQ ID NO: 13 and 14, S can represent G or C. A
mixture of both can be used. Generally, the primers will be synthesized with
degeneracy, and will thus comprise both possibilities.
The second primer pair comprises preferably a forward primer chosen to be
complementary to a consensus or a substantially consensus sequence within the
HBV genomes; this primer is designed to be complementary to a region of HBV
DNA
which is in 5' with respect to that complementary with the reverse primer of
the first
primer pair. An example of such a forward primer is primer E described herein
after
and having the sequence as set forth in SEQ ID NO: 19. The best is to have
both
these forward and reverse primers complementary to HBV genomic regions which
12
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
overlap and comprise a unique natural restriction site, e.g. the Ncol site at
nucleotides 1372-1377.
Suitable forward primers are by way of example:
C1: SEQ ID NO: 15
5' ACMTCSTTTCCATGGCTGCTAGG 3'
This primer comprises a Ncol site (underlined) and are useful for
amplification of
genotypes A, B, D, E and G. The primer hybridizes with nucleotides 1363-1385
(H.
Norder et al., and GenBank AB048704).
C2: SEQ ID NO: 16
5' ACMTCSTTTCCATGGCTGCTCGG 3'
This primer comprises a Ncol site (underlined) and are useful for
amplification of
genotypes C and F. The primer hybridizes with nucleotides 1363-1385.
A mixture of both primers C1 and C2 may advantageously be used.
M means A or C, and W means A or T. Thus in SEQ ID NO: 15 and 16, M can
represent A or C, and W can represent A or T. A mixture can be used.
Generally, the
primers will be synthesized with degeneracy, and will thus comprise the
various
possibilities.
The second primer pair comprises preferably a suitable reverse primer chosen
to be complementary to a consensus or a substantially consensus sequence
within
the HBV genomes; this primer is designed to be complementary to a region of
the
HBV genome which is in 3' with respect to that of the forward primer in the
first pair of
primers and more precisely in 3' of the polyA attachment site. As a result,
the cloned
DNA obtained after recombination between both amplified fragments or
amplicons, is
longer than the HBV genome and include a redundant region including the start
codon ATG of the pre-C gene and the polyA attachment site. As mentioned above,
it
is preferred to choose a primer which is complementary to a well-conserved
region
inside HBV genotypes and as close as possible in 3' of the polyA attachment
site.
Suitable reverse primers D are by way of example:
D1: SEQ ID NO: 17
5' CTAAGGGCATGCGATACAGAGCWGAGGCGG 3'
This primer comprises a Sphl site (underlined). The 3' part of the primer
hybridizes
with nucleotides 2027-1998. The C at the 5' end corresponds to nucleotide
2039.
D2: SEQ ID NO: 18
5' CTAAGGGTCGACGATACAGAGCWGAGGCGG 3'
13
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
This primer comprises a Sall site (underlined). The 3' part of the primer
hybridizes
with nucleotides 2027-1998. The C at the 5' end corresponds to nucleotide
2039.
A mixture of both primers D1 and D2 may advantageously be used.
W means A or T. Thus in SEQ ID NO: 17 and 18, W can represent A or T. A
mixture can be used. Generally, the primers will be synthesized with
degeneracy, and
bofh possibilities will be present.
The reverse primer comprises a restriction site (e.g. a Sphl or Sall site)
which
is also present in the vector so as to allow fusion of the HBV DNA into the
vector.
Both sites are unique in the vector and in amplicons obtained by PCR with
primers C
and D).
The use of these particular primers forms a preferred embodiment. However,
as mentioned supra, the one skilled in the art is able from the present
teaching to use
other primers or to clone more than two, e.g. 3, genomic fragments with
appropriate
primer pairs. Use is preferably made in all cases of the forward primers of
type A
and/or of the reverse primers of type D.
In a second embodiment, the aim is to clone a more-than-full-length HBV genome
under the control of homologous enhancer and promoter, thus comprising the HBV
nucleotide sequence of enhancer 1 (EN 1 or enh 1, nucleotides 1180 to 1219, H.
Norder et al., and GenBank AB048704), and ending on or after a polyA
attachment
site. Before cloning, preferably two HBV genome fragments have to be
amplified.
A first primer pair comprises a forward primer E which preferably is
complementary to a consensus or a substantially consensus sequence within the
HBV genomes, this primer being designed to be complementary to a region of the
HBV genome which is in 5' of enhancer 1, preferably as close as possible of
this
enhancer.
By way of example, this forward primer E can be as set forth in
SEQ ID NO: 19
5' TAAACAATGCATGAACCTTTACCCCGTTGC 3'
This primer comprises a Nsil site (underlined). The primer hybridizes with
nucleotides
1125-1154 (H. Norder et al., and GenBank AB048704).
The first primer pair comprises a reverse primer chosen to be complementary
to a consensus or a substantially consensus sequence within the HBV genomes.
The
14
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
above described reverse primer D can be used, e.g, either D1 or D2 or D1 and
D2,
complementary to a region situated in 3' of the polyA attachment site.
Primers E and D allow to amplify a genomic fragment containing the enhancer
1, a unique Ncol site which is situated at the level of the ATG of the X gene,
and the
polyA attachment site (position 1372-1377 in Norder et al. and GenBank
AB048704).
The second primer pair comprises a forward primer and a reverse primer
allowing to amplify an about one genome unit containing the same Ncol site,
with a
forward primer designed to be complementary to a region of HBV DNA which is in
5'
with respect to that complementary with the reverse primer of the first primer
pair,
and a reverse primer designed to be complementary to a region of HBV DNA which
is in 3' with respect to that complementary with the forward primer of the
first primer
pair.
By way of example, use can be made of primers comprising the sequences
SEQ ID NO: 20 (forward primer) and SEQ ID NO: 21 (reverse primer) described in
the examples, or the following primers:
Forward primer
SEQ ID NO: 22
5' GCTCTTCTTTTTCACCTCTGCCTAATCATC 3'
containing a Sapl site; hybridizes with nucleotides 1821 to 1843.
Reverse primer
SEQ ID NO: 23
5' GCTCTTCAAAAAGTTGCATGGTGCTGGTG 3'
containing a Sapl site; hybridizes with nucleotides 1825 to 1804.
Preferably, these primers SEQ ID NO: 22 and 23 comprise further nucleotides at
the
5' end, in particular 8 or more, e.g. 8 to 15. This is to facilitate the
action of the
restriction enzyme.
All nucleotide sequences or polynucleotides and primers, as well as primers
pairs, described above are also objects of the invention.
In an embodiment, the invention concerns a primers pair for HBV amplification
comprising a forward primer comprising (1) a sequence as set forth in SEQ ID
NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID
is
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID
NO: 12, and (2) a reverse primer comprising a sequence as set forth in SEQ ID
NO:
13 or SEQ ID NO: 14 or a mixture of a reverse primer comprising a sequence as
set
forth in SEQ ID NO: 13 and a reverse primer comprising a sequence as set forth
in
SEQ ID NO: 14.
In another embodiment, the invention concerns a primers pair for HBV
amplification comprising (1 ) a forward primer comprising a sequence as set
forth in
SEQ ID NO: 15 or SEQ ID NO: 16 or SEQ ID NO: 19, or a mixture of a forward
primer comprising a sequence as set forth in SEQ ID NO: 15 and a forward
primer
comprising a sequence as set forth in SEQ ID NO: 16, and (2) a reverse primer
comprising a sequence as set forth in SEQ ID NO: 17 or SEQ ID NO: 18 or a
mixture
of a reverse primer comprising a sequence as set forth in SEQ ID NO: 17 and a
reverse primer comprising a sequence as set forth in SEQ ID NO: 18.
The invention also relates to kits for amplifying HBV, comprising two primer
pairs according to the invention. In an embodiment, the kit comprises both
primers
pairs described just before.
In still other embodiment, the invention concerns a primers pair for HBV
amplification comprising (1 ) a forward primer comprising a sequence as set
forth in
SEQ ID NO: 19, and (2) a reverse primer comprising a sequence as set forth in
SEQ
ID NO: 17 or SEQ ID NO: 18 or a mixture of a reverse primer comprising a
sequence
as set forth in SEQ ID NO: 17 and a reverse primer comprising a sequence as
set
forth in SEQ ID NO: 18.
In still other embodiments, the invention concerns a primers pair for HBV
amplification comprising (1 ) a forward primer comprising a sequence as set
forth in
SEQ ID NO: 20 or 22, and (2) a reverse primer comprising a sequence as set
forth in
SEQ ID NO: 21 or 23.
The invention also relates to a kit comprising both primers pairs described
just
before.
The one skilled in the art is able to design other primers. Following the same
scheme he is also able to amplify more than two fragments, e.g. 3 fragments,
using
the corresponding number of primer pairs, and to clone the more-than-full-
length
DNA from these fragments.
And the one skilled in the art is also able to determine the best conditions
for
the amplifications, depending on the primers which are used. The hybridisation
16
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
temperature may be determined owing the usual method based on the
determination
of the dissociation temperature. Also, generally speaking, the amplification
may
involve a number of cycles, e.g. from 20 to 60, in particular from 30 to 50,
preferably
about 40 cycles. The Taq polymerase, preferably High Fidelity Taq polymerase
(e.g.
Expand from Roche Diagnostics) may be used.
In step (c), the product of the amplification is cloned into a vector. This
leads to
a vector comprising HBV DNA covering the more-than-full-length HBV genome or
linear continuous DNA, and elements controlling the synthesis of a pgRNA from
the
DNA sequence post-cell-transfection. Such an in vitro expression vector is
also an
object of the invention. It is preferably a plasmid.
The vector comprises the elements necessary to govern synthesis of pgRNA
from an HBV DNA sequence as defined supra. This comprises a promoter able to
ensure the transcription of DNA into RNA preferably in eucaryotic cells.
In the first embodiment, the promoter is an heterologous promoter operatively
linked to the nucleotide representing the +1 of transcription of the pgRNA, as
defined
above. The vector called herein type-I vector does not comprise the ATG of the
pre-C
gene in the 5' part of the cloned HBV DNA sequence.
Potentially, vectors containing an ubiquitous mammalian promoter may
be used for constructing a type-I vector. Advantageously, the heterologous
promoter
is strong which means that transcription level is higher than with the
endogenous
promoter.
In a preferred embodiment, the heterologous promoter is the early promoter of
the cytomegalovirus or CMV-IE (Cytomegalovirus Immediate Early), in particular
of
human or murine origin, or optionally of any other origin such as rat or
guinea pig.
The CMV-IE promoter may comprise the proper promoter component, which may or
may not be associated with the enhancer component. Use is preferably made of
the
complete promoter, including the enhancer. Reference may be made to
EP-A-260 148, EP-A-323 597, US-A-5 168 062, US-A-5 385 839, US-A-4 968 615
and WO-A-87/03905, Boshart M. et al., Cell., 1985, 41, 521-530.
Other promoters include the human ubiquitine C gene promoter, the promoter
of EF-1 a gene, the early and late promoters of the SV40 virus (Simian Virus
40), the
LTR promoter of the Rous sarcoma virus, cytoskeleton gene promoters, such as,
the
desmin promoter (Kwissa M. et al., Vaccine, 2000, 18(22), 2337-2344) or the
actin
1~
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
promoter (Miyazaki J. et al., Gene, 1989, 79(2), 269-277), e.g. of the chicken
~i-actin
gene, which is also a preferred choice (Fregien N, Davidson N. Gene 1986 48, 1-
11 ).
Use is preferably made of an enhancer combined to a promoter. In a preferred
embodiment, the CMV-IE enhancer is combined to a promoter of another origin,
e.g.
with the actin promoter, in particular the chicken ~3-actin gene.
By equivalence, the sub-fragments of these promoters, maintaining adequate
promoter activity, are included in the present invention: e.g. the truncated
CMV-IE
promoters according to WO-A-98/00166. The notion of promoter according to the
invention therefore includes the derivatives and sub-fragments maintaining
adequate
promoter activity, preferably substantially similar to that of the proper
promoter from
which they are derived. With regard to CMV-IE, this notion includes the proper
promoter part and/or the enhancer part and the derivatives and sub-fragments.
As explained above, it is preferred to fuse the natural +1 of transcription of
the
HBV pgRNA to the +1 of transcription determined by the promoter contained in
the
vector or plasmid used for the cloning. To achieve this fusion at molecular
level, the
promoter may be modified by the insertion (mutagenesis), between the TATA box
(or
equivalent) of the basic promoter and its +1 of transcription, of a
restriction site which
preferably is not present in any of the known complete HBV sequences (e.g. one
of
the previously mentioned Notl, Ascl, Pacl, Pmel and SSe8387 I restriction
sites). The
restriction site has to be the same than the one present in the primer A. See
the
examples.
The cloning necessitates the ligation of the HBV DNA fragments together, and
insertion into the vector. This technique is well known to one skilled in the
art using
suitable sets of restriction enzymes and restriction sites. Preferably step
(c) is a one-
step cloning. And the primers specifically disclosed herein allow a rapid one-
step
cloning.
Using a type A primer, the vector comprises:
(a) a linear continuous or more-than-full-length HBV DNA sequence as defined
supra under the first embodiment (for sequence under the control of a
heterologous promoter), able to produce a pgRNA according to the invention
(b) a promoter modified in 5' by the presence of a restriction site in 5' of
the +1 of
transcription, with the +1 of transcription of the DNA sequence and of the
promoter being fused, the promoter controlling the synthesis of a pgRNA from
the DNA sequence post-cell-transfection. This restriction site is preferably
not
is
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
present in any of the known complete HBV sequences and can be e.g. Notl,
Ascl, Pacl, Pmel or SSe8387 I. In some particular embodiments, the promoter
sequence comprises a sequence chosen among SEQ ID NO: 24 to 29 (end
part of the specification), after putting the restriction site as indicated.
The vector may also comprise baculovirus sequences, allowing one to transfer
the vector in baculovirus. These sequences are sequences flanking a
baculovirus
genome region, e.g. gene, which is not essential for viral replication in cell
culture.
These sequences allow recombination between the vector and the baculovirus
genome, so that the cassette containing the promoter and the HBV unit becomes
inserted in the baculovirus genome upon transfer of the vector into the
baculovirus.
As it is well know, the vector can also comprise a replication origin and a
selection marker, such as a resistance gene, e.g. a blasticidin resistance
gene. This
could be helpful in the course of generating stable cell lines, to select the
cells
containing the vector.
A vector comprising the baculovirus sequence and the selection marker is
contemplated herein. The same vector could thus be used either to transfect
cells, or
to transduce cells via baculovirus, or to produce a stable line cell. In
particular, once
an interesting clone has been found from a patient sample, it is possible to
produce a
stable cell line in view of screening of efficient drugs.
The synthesis of a pgRNA initiates in the cells the HBV intracellular cycle
with
viral gene expression, including synthesis of intracellular replicative
intermediates
(which comprise single stranded DNA, double stranded linear DNA, relaxed
circular
DNA and the minor species of replicative intermediates, RNAs), gene expression
and
virus production.
Such vectors are also objects of the invention. Also, the promoters modified
as
described herein, including in the examples, constitute other objects of the
invention.
In the second embodiment, the promoter is an homologous promoter, which is
present in the cloned HBV DNA. A type-II vector is produced in a two step
procedure.
First, the amplicon obtained with the first set of primers, e.g. E-D, is
digested and
inserted into the vector. Then, the amplicon obtained with the second set of
primers,
e.g. P1-P2, is digested by Sapl, ligated (circularized) using a ligase, then
digested
with Ncol and inserted in the Ncol site present in the cloned E-D fragment.
This strategy produces a vector comprising
19
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
- a linear continuous or more-than-full-length HBV DNA sequence according to
the second embodiment
- wherein the homologous enhancer and promoter controls the synthesis of a
pgRNA from the DNA sequence post-cell-transfection.
More precisely, the vector initiates synthesis of pre-C RNA and of pgRNA.
Such vectors are also objects of the invention.
In step (d), cultured susceptible cells can be transfected or transduced with
the
vector according to the invention.
In one embodiment the susceptible cells, in particular eucaryotic cells such
as
hepatocytes, including cell lines, in particular cell lines from hepatocyte
origin, e.g.
hepatoma cell lines, e.g. Huh7 (Nakabayaski, H. et al.. Cancer Res.1982
42,3858-
3863), HepG2 (available from the ATCC, access number HB-8065) are transfected
with the vector.
At step (e), the cells are cultured to allow the vector to synthesize pgRNA
and
possibly initiate the HBV intracellular cycle as described previously.
In step (g), replication capacity of HBV is evaluated. This may involve
measuring the level of nucleic acid synthesis, protein synthesis and/or virus
production.
In one embodiment, the transfected cells may be used for studying the
replication capacity of the HBV on the cells. This may involve quantification
of viral
DNA by molecular biology techniques, e.g. by Southern blot or by real time
amplification specifically of the synthesized nucleic acids.
In another embodiment comprising step (f), these transfected cells are used
for studying the effect of antiviral agents. In step (f), when a
pharmaceutical product,
in particular the antiviral agent, is used, it is added to the cultured
transfected cells. In
an embodiment, a part of the cultured transfected cells is kept as a control,
say
without being subjected to the pharmaceutical product, in particular the
antiviral
agent, in order to have a comparison basis. In another embodiment, one or more
parts of the cultured transfected cells is/are subjected to another
pharmaceutical
product(s), in particular antiviral agent(s), which allows comparison between
different
pharmaceutical product(s), in particular antiviral agent(s). And in this
embodiment, a
control without any treatment may be added.
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
In particular embodiments, the antiviral agents used are chosen among
lamivudine, adefovir dipivoxil, entecavir, emtricitabine, clevudine,
telbivudine,
tenofovir, beta-L-FD4c and any combinations thereof.
In still another embodiment, the vector is transferred inside a baculovirus
upon
infection of an appropriate system of cells such as insect cells, and
propagated. One
may use for example the Baculovirus Autographa californica Nuclear
Polyhedrosis
Virus AcNPV. One may use for example Spodoptera frugiperda Sf9 (ATCC CRL
1711 deposit) as insect cells. The baculovirus containing the vector is then
used for
transducing eucaryotic cells such as hepatoma cells, e.g. Huh7 cells, where
the
vector can initiate pgRNA synthesis. Then in step (f), a pharmaceutical
product, in
particular an antiviral agent, is added to the cultured transduced cells. In
an
embodiment, a portion of the cultured transduced cells is kept as a control,
say
without being subjected to the pharmaceutical product, in particular the
antiviral
agent, in order to have a comparison basis. In another embodiment, one or more
portions of the cultured transduced cells is/are subjected to another
pharmaceutical
product(s), in particular antiviral agent(s), which allows comparison between
different
pharmaceutical product(s), in particular antiviral agent(s). And in this
embodiment, a
control without any treatment may be added.
In still another embodiment, the vector is used for generating cell lines
which
become able to constitutively produce HBV virions. As mentioned above, the
vector
may comprise a selection marker. Cell lines such as cell lines from hepatocyte
origin,
e.g. hepatoma cell lines, e.g. Huh7, HepG2 are transfected with the vector as
mentioned above and the cells selected owing the marker are recovered as
stable
cell line comprising the vector according to the invention. These stable cell
lines are
also an object of the invention.
As explained before, the present invention results in producing HBV pgRNA,
intracellular replicative intermediates, and HBV viral particles. It is thus
possible in
step (g) to follow difFerent parameters, in the presence or in the absence of
pharmaceutical product, in particular an antiviral agent or candidate.
In a first embodiment, the level of HBV DNA synthesis in the cells is
evaluated
and possibly compared. A general method provides the disruption of the cells,
e.g. by
physical and/or chemical treatment, for instance lysis, e.g. with Tris-EDTA
and
Nonidet P-40. The recovered sample is centrifuged, the recovered supernatant
is
21
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
subjected to DNase to eliminate transfected DNA, whereas the synthesized DNA
or
being synthesized is encapsidated. Dnase activity is neutralized using EDTA or
similar, then DNA is liberated from the capsides using proteinase K or
similar. DNA is
extracted using e.g. phenol-chloroform, and precipitated. Then measuring of
the level
of DNA may be made using any known method, in particular Southern blot or PCR.
IC5o and IC9o may be calculated.
In a second embodiment, the level of virion DNA in the extracellular medium or
supernatant is quantified and possibly compared using molecular biology
techniques,
such as dot blot, Southern blot and quantitative PCR. ICSO and IC9o may be
calculated
(Inhibition Concentration 50 % or 90 %, say dose of drug which induce a 50 %
or 90
decrease of the measured parameter).
Comparison of the results with standards can be done.
An object of the invention is thus such phenotypic assay method to test the
susceptibility of HBV isolates with respect to drugs. In particular, this
object is applied
to the determination of the susceptibility of the viral strains (e.g, the
quasi-species)
present in a patient to the available drugs, and then it is possible to adapt
antiviral
therapy to the virological situation. In a particular embodiment, the method
of the
invention comprises the following steps:
1 ) DNA extraction from serum of a patient
2) PCR amplification
3) Cloning into type-I vectors
4) Transfection of the vectors in cells, e.g. Huh7 cells, and transfer in 96
well
plaques
5) Treatment with antiviral to be evaluated
6) Quantitative PCRs and determination of ICSO and IC9o
7) Comparison with standards.
Another object of the invention is to use this phenotypic assay method for
testing the antiviral activity of current and future drugs to HBV strains or
to HBV field
isolates. In a particular embodiment, the method of the invention comprises
the
following steps:
1 ) Possibly DNA extraction from serum of a patient or from a viral culture
2) PCR amplification
3) Cloning into type-I or type-II vector
22
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
4) Transfection of the vectors in cells, e.g. Huh7 cells, or transduction of
cells via
baculovirus, or production of a stable cell. line, and e.g. transfer in 96
well
plaques
5) Treatment with antiviral to be evaluated
6) Quantitative PCRs and determination of ICSO and IC9o
7) Comparison with standards.
In the method according to the invention, when all or part of the clones
obtained from one sample (e.g. the quasi-species) is used to transfect or
transduce
cells, a multiclonal analysis is made.
The invention thus allows the screening of drugs. A further object of the
invention consists in the pharmaceutical compositions useful against HBV that
have
been prepared after selection of an active agent with the method of the
invention.
Another object of the invention is a method for producing a pharmaceutical
composition to be used as antiviral drug against HBV, comprising the assay
method
according to the invention, followed by the admixture of the selected active
agent
with a pharmaceutically acceptable vehicle or excipient.
Another object of the invention is the method to rapidly clone HBV DNA from
patient samples, as disclosed herein.
To perform the teaching disclosed herein, the one skilled in the art may refer
to the usual methods of molecular biology, recombinant DNA, microbiology, as
illustrated for example in : Sambrook and Russel, Molecular Cloning: A
Laboratory
Manual, Third Edition (2001 ) Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York (herein "Sambrook et al., 1989") ; DNA Cloning: A Practical
Approach, Volumes I and II (D.N. Glover ed. 1985) ; Oligonucleotide Synthesis
(M.J.
Gait ed. 1984) ; Nucleic Acid Hybridization [B.D. Hames & S.J. Higgins eds.
(1985)] ;
Transcription and Translation [B.D. Hames & S.J. Higgins, eds. (1984)] ;
Animal Cell
Culture [R.I. Freshney, ed. (1986)] ; B. Perbal, A Practical Guide To
Molecular
Cloning (1984) ; F.M. Ausubel et al. (eds.), Current Protocols in Molecular
Biology,
John Wiley & Sons, Inc. (1994).
The present invention is additionally described by the following illustrative,
non-limiting examples, which refer to the attached drawings.
Brief description of the drawings:
23
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Figure 1 is a map of the open circular HBV genome with its open reading frames
represented. The different primers used in this study are indicated
Figure 2 represents a schematic map of pTriEX-1.1 and derived plasmids pTriEX-
Mod and pTriEX-Bsd are given as well as the detailed sequence of the basic
core
promoter (BCP) of the chicken ~i-actin gene. The modification of the BCP by
insertion
of a Not I site is shown. The whole map of circular pTriEX-1.1 is represented
on
Figure 8.
Figure 3 presents the sequence of the forward primer A used for PCR
amplification
and the primer binding site at the triple-stranded region of the HBV genome.
Figure 4 presents type-I and type-II vectors, transfection of Huh7 cells with
either
type-I, type-II, or pHBVdimer plasmids, and the result of a southern blot
analysis of
intracellular replicative HBV DNA intermediates. Lanes TI, TII, and pHBVdimer
correspond to DNA extracted from .viral core particles derived from Huh7 cells
that
were transfected respectively with type-I, type II, and pHBVdimer circular
plasmids.
Lane denoted linearized HBV correspond to a 3.2 kb linear double-stranded form
of
HBV DNA. The position of the relaxed circular (RC) and the single stranded
(SS)
forms of the HBV DNA genome are indicated on the right of the autoradiography.
DNA size markers are indicated on the left.
Figure 5 presents cloning performance and replicative status of clones
obtained. (A)
HBV DNA extracted from serum of patient before therapy (pre-therapeutic) or
when
viral resistance appear (breakthrough), was PCR amplified using two pairs of
primers, i.e. A-B and CD, and cloned in type-I vectors. Positive clones
present the
restriction pattern found in lanes 1,2, 4, A-F of the ethidium-stained agarose
gel
presented. Positive clones were used for the transfection of Huh7 cells. A
control
type-I plasmid carrying a wild type genotypes D HBV genome was used as control
(lane C+). Southern blot analysis of intracellular replicative HBV DNA
intermediates
was performed 4 days post transfection. The position of the relaxed circular
(RC) and
the single stranded (SS) forms of the HBV DNA genome are indicated on the
right of
the autoradiography.
24
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Figure 6 presents two phenotypic drug susceptibility profile after southern
blot
analysis. Two mixed population of type-I vectors obtained from the cloning of
lamivudine-sensitive (top panel) and lamivudine-resistant (botttom panel) HBV
genomes have been used for the transfection of Huh7 cells. Cells were treated
during
days, starting at day 3 post-tranfection, with increasing concentration of
lamivudine
(shown on the top of each autoradiography). A Southern blot analysis of
intracellular
replicative HBV DNA intermediates was performed. The autoradiographies
corresponding to a sensitive profile (top panel) and a resistant profile
(bottom panel)
are shown.
Figure 7 presents sensitivity profiles of the phenotypic assay. Mixtures of
type-I
clones containing either wild type derived HBV genomes or 3TC-resistant
derived
HBV genomes (containing mutation L528M and M552V)~ were used for the
transfection of Huh7 cells. Cells were left untreated or treated during 5
days, starting
at day 3 post-tranfection, with two concentration of lamivudine, i.e. 2.5 or
10 ~.M. A
Southern blot analysis of intracellular replicative HBV DNA intermediates was
performed. The composition of the mixture used is indicated on the top of the
autoradiography. A phosphoimager analysis of the blot was performed and the
results are presented on the graph underneath where the percentage of the
inhibition
of the replication is represented in function of the amount of lamivudine
used.
Figure 8 presents TriEX-1.1 plasmid.
Examples:
Materials and Methods
Plasma samples. Plasma samples, obtained from chronically HBV-infected
individuals, were stored at -20°C until analysis. A reference serum,
ACCURUN~ 325
HBV DNA positive control manufactured by BBI Diagnotics (Boston, MA), was used
for the setting up of some experiments.
Antiviral drugs. ~i-L-(-)-2',3'-dideoxy-3'-thiacytidine (3TC, lamivudine),
from Glaxo
SmithKline.
2s
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Sample preparation and PCR amplifications.
Viral DNA was extracted from 200 pl of serum using three different
commercialized kits (Master purer"" Complete DNA and RNA purification kit
[Epicentre, Madison, WI], High pure PCR template preparation kit [Roche
Diagnostics, Mannheim, Germany], and QIAampTM UItraSens virus kit [Qiagen,
Hilden, Germany]) according to manufacturer's instructions. The final volume
of
elution or resuspension was 60 pl and 5 to 10 pl were used for subsequent
polymerase-chain-reaction (PCR) amplifications. All PCR were performed using a
"hot start" procedure with the Expand high fidelity PCR system (Roche
Diagnostics,
Mannheim, Germany) according to manufacturer's instruction. Four sets of
primers
were used.
Full length HBV was amplified according to the method described by Gunther
et al~(J. Virol. 1995, 69, 9: 5437-5444 and J Clin. Microbiol. 1998, 36, 2:
531-538),
with the forward primer P1 SEQ ID NO: 20 (5'-CCGGAAAGCTTAT
GCTCTTCTTTTTCACCTCTGCCTAATCATC-3') containing Hindlll/Sapl sites, and
the reverse primer P2 SEQ ID NO: 21 (5'-CCGGAGAGCTCAT
GCTCTTCAAAAAGTTGCATGGTGCTGGTG-3') containing Sacl/Sapl sites.
A long PCR product of approximately 2800 by was amplified by 40 cycles (hot-
start; 94°C for 40 s, 55°C for 1 min, 68°C for 3 min with
an increment of 2 min after
each 10 cycle) with a forward primer A (5'-TGCGCACCGCGGCCGC
GCAACTTTTTCACCTCTGCC-3'; SEQ ID N0:1) containing a Notl site (see Figure 3)
and a reverse primer B (B1 for amplification of genotypes A, B, D, E, and G:
5'-
GGCAGCACASCCTAGCAGCCATGG-3', SEQ ID N0:13, or B2 for amplification of
genotypes C and F: 5'-GGCAGCACASCCGAGCAGCCATGG-3'; SEQ ID NO: 14)
containing a Ncol site.
A short PCR product of approximately 665 by was amplified by 40 cycles (hot-
start; 94°C for 30 s, 50°C for 30 s, 72°C for 45 s with
an increment of 5 s after each
cycle starting from cycle 11 ) with a forward primer C (C1 for amplification
of
genotypes A, B, D, E, and G: 5'-ACMTCSTTTCCATGGCTGCTAGG-3', SEQ ID
N0:15, or C2 for amplification of genotypes C and F: 5'-ACMTCSTTT
CCATGGCTGCTCGG-3'; SEQ ID NO: 16) containing a Ncol site and a reverse
primer D (D1 containing a Sphl site: 5'-CTAAGGGCATGCGATA
CAGAGCWGAGGCGG-3', SEQ ID N0:17, or D2 containing a Sall site: 5'-
CTAAGGGTCGACGATACAGAGCWGAGGCGG-3'; SEQ ID NO: 18).
26
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
An other PCR product of approximately 900 by was amplified by 40 cycles
(hot-start; 94°C for 30 s, 50°C for 30 s, 72°C for 45 s
with an increment of 5 s after
each cycle starting from cycle 11 ) with a forward primer E (5'-
TAAACAATGCATGAACCTTTACCCCGTTGC-3'; SEQ ID NO: 19) containing a Nsil
site and the reverse primer D. The location of these primers in respect with
the HBV
genome is indicated on Figure 1.
Cloning of more-than-full-length HBV genome into two different types of
vectors.
The pTriEX-1.1 vector (Novagen Inc, Madison, WI., Figure 2), containing
multiple promoters and flanking baculovirus sequences, was adapted to the
cloning
strategy by two modifications to derive pTriEX-Mod. First the Nsil site at
position 184
was removed, rendering unique the other Nsil site at position 1445, which is
located
between the CMV enhancer and the actin basic promoter. Second, a unique Notl
site
was added at position 1717, which is just upstream to the vertebrate
transcription
start (position 1727) of the vector (Figure 2). The plasmid pTriEX-Mod was
further
modified by cloning at Mlul site (position 399 in pTriEX-Mod), of the
blasticidin
cassette that was PCR amplified from pUB-Bsd (Invitrogen Ltd, Paisley, U.K.)
comprising the blasticidin gene under the control of human ubiquitin C
promoter.
The final vector, pTriEX-Bsd, was used when both transfer into baculoviruses
and generation of persistently-HBV-expressing cell line were needed. PCR
products
generated with primers A-B and E-D (or C-D) were digested by NotllNcol and
NcoIlSall respectively and cloned, in one step using standard procedures
[Sambrook,
J. and D.W. Russell, Molecular cloning : a laboratory manual. 3rd ed. 2001,
Cold
Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press. 3 v.], between
NotllXhol
sites of pTriEX-Mod to derive type-I plasmids (Figure 4).
Type-I vector comprising about 1.1 genome unit enables, post-transfection,
the synthesis of pre-genomic HBV RNA (pgRNA) under the control of a chicken
actin
promoter.
Alternatively, PCR product generated with primers E-D was digested by
Nsil/Sall and inserted between NsillXhol sites of the vector. This
intermediate
plasmid was subsequently used for the cloning of one HBV genome unit into the
unique Ncol site located at the level of the ATG of the gene X of HBV. The
insert
(one HBV genome unit) was obtained by the successive treatments of a P1-P2
full-
2~
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
length PCR product with Sapl followed by T4 ligase (circularization) then Ncol
digestion. This led to type-II vector comprising about 1.3 genome unit, which
enables
post transfection the synthesis of pgRNA under the control of natural HBV
promoter
(Figure 4).
Transfection of HBV DNA.
All cloned DNA were purified by the Qiagen technology, based on silica
columns (Qiagen Inc., Valencia, California, USA). Transfection of plasmids
into Huh7
cells was performed with Fugene-6 reagent (Roche Diagnostics, Mannheim,
Germany) according to manufacturer's instruction. Briefly, Huh7 cells were
seeded at
a density of 7 x 104 cells/cm2 and transfected 12 hours later with 150 ng of
plasmid
per cm2. The medium was changed one hour before transfection, then every day
in
case of treatment with antiviral.
Purification of HBV DNA from intracellular core particles and Southern blot
analysis.
The cells were washed once with PBS then lysed in 1 ml of lysis buffer (50mM
Tris-HCI [pH 8], 1 ri~M EDTA, 1 % Nonidet P-40) per 35 mm diameter dish. The
lysate
was incubated on ice for 15 min, and nuclei were pelleted by centrifugation
for 1 min
at 14,000 rpm. The supernatant was adjusted to 10mM MgCh and treated with 100
pg of DNAse for 1 hour at 37°C. The DNAse activity was stopped by
addition of
EDTA to a final concentration of 25mM, then proteins were digested with 0.5
mg/ml
of proteinase I< for at least 2 hours in presence of 1 % SDS and 100 mM NaCI.
Nucleic acids were phenol-chloroform extracted and iso-propanol precipitated
after
addition of 10 pg of tRNA. DNAs were separated on 1.2% agarose gel, blotted
onto
positively-charged Nylon membranes, and hybridized with a 3zP-labelled full-
length
HBV probe as described previously [Seigneres, B., et al., Hepatology, 2002.
36(3): p.
710-22.].
Purification of HBV DNA from extracellular viral particles and quantitative
PCR
analysis.
Viral DNA was extracted from cell culture medium using either the
commercialized QIAampT"" UItraSens virus kit (Qiagen, Hilden, Germany) or by
the
following procedure. One ml of clarified culture medium was supplemented up to
2s
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
10%final with polyethylene glycol (PEG), then centrifugated 1 hour at 14,000
rpm in a
bench centrifuge at 4°C. The pellet was resuspended in 1 ml of lysis
buffer and
proceeded as described above for the isolation of HBV DNA from cytoplasmic
core
particles.
Res a Its
Extraction of viral DNA from sera and PCR performance.
Several kits are available for HBV DNA isolation from serum. Three of them
have been tested to optimize the quantity/quality of the isolated HBV DNA that
will be
subsequently used as PCR-template. Some of them imply column-based
purification
while the other is based on differential precipitation of proteins and nucleic
acids. Two
hundred microliter of a reference serum were extracted using these different
approaches and real time PCR was performed to quantify the amount of DNA
obtained. The "Master purer"" Complete DNA and RNA purification kit" yielded
higher
DNA recovery, with a vDNA (viral DNA) concentration of 2.73 104 copies/~,1,
compared to the two other column-based techniques, which yielded a
concentration
of 1.08 104 copies/~.I (High pure PCR template preparation kit) and 9.77 103
copies/~,I
(QIAampT"" UItraSens virus kit) respectively. To determine whether the quality
of the
DNA obtained by these techniques was comparable, dilutions (1/10th) of these
DNA
were used for setting up PCR reactions. Primers P1 and P2, derived from the
Gunther's method, were first used for finding out the threshold of the PCR.
The PCR
was performed using the Expand high fidelity PCR system and the PCR conditions
described previously [Gunther et al. 1998 and 1995 cited above].
The vDNA obtained with QIAampTM UItraSens virus kit was the best in terms of
quality of the DNA, as a PCR product was visible in an ethidium bromide-
stained gel
when as low as 5 copies of genome were used as initial template. According to
the
extraction procedure used (see Materials and Methods), these 5 copies
corresponded to a theoretical serum titer of 300 genomes/ml. To obtain the
same
amount of amplicon using DNA extracted with the Master purer"" Complete DNA
and
RNA purification kit, 20 copies of genome/reaction (corresponding to a
theoretical
serum titer of 1200 genomes/ml) were necessary, indicating a lower quality of
this
DNA.
29
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Construction of type I vectors:
As described above, a pTriEx-1.1 (Novagen) plasmid was engineered by
introduction of a Notl site at the level of the +1 of transcription of the
chicken actin
promoter (Figure 2). No modification of the promoter activity was observed for
the
modified plasmid, i.e. pTriEX-Mod, as measured by reporter gene expression.
Primer
A located at the +1 of transcription of the pgRNA contains a Notl tail (Figure
3). This
primer A was used in combination with the reverse primer B located at the
level of the
ATG of HBV X gene to set up a PCR reaction. A conserved Ncol site, essential
for
the cloning strategy, overlaps this ATG.
The PCR products obtained with the two pairs of primers A-B and C-D2 (or E-
D2) were digested with NotllNcol and Ncol/Sall and simultaneously cloned into
pTriEX-Mod to derive types-I vectors (Figure 4). This fusion resulted in the
exclusive
production in transfected-hepatoma cells of HBV pgRNA at a steady level
regardless
of the information contained in the 1.1 unit of genome cloned altogether. In
average,
between 50 and 75% of the clones obtained presented the expected restriction
pattern and more than 75% of these clones led to formation of DNA intermediate
upon cell transfection as verified by Southern blot analysis (Figure 5). Taken
together, these data indicate that when 40 cycles of PCR are used for
generating
inserts A-B and C-D, between 40% to 65% of the resulting types I clones have
both
the expected restriction pattern and are replication-competent.
Within hepatoma cells, type-I vector enables the synthesis of pgRNA at a level
that is determined by the chicken actin promoter strength. This type of vector
is of
interest for the analysis of event of the viral cycle occurring post-
transcription. It can
be use for instance for characterizing mutations in the polymerase gene, which
are
associated with resistance to nucleoside/nucleotide analogues.
Construction of type II vectors:
A second cloning strategy was designed to construct type-II vectors in which
the synthesis of pgRNA is kept under homologous promoter. Two cloning steps
were
necessary to derive these vectors containing 1.3 unit of HBV genome.
First the PCR product of 900 by obtained with primers E-D2 was double
digested with Nsil/Sall and cloned into pTriEX-Mod opened by Nsil and Xhol.
The
unique Ncol site of the derived intermediate plasmid was then used for cloning
one
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
HBV genome unit which was generated by the successive treatment of a P1-P2-
derived PCR product with Sapl, then T4 DNA ligase, and Ncol (Figure 4).
The type-II vector allows to study transcriptional properties of HBV mutants,
such as core-promoter mutants, or to evaluate in which the intrinsic level of
synthesis
of pgRNA had an impact on the phenotype observed.
Comparison of the amounts of the intracellular replicative intermediates
observed in hepatoma Huh7 cells after transfection with type I, type II, head-
to-
tail tandemerized HBV genomes or HBV genomes with Sapl sticky ends.
The genome of a well defined HBV genotypes D (serotype ayw) was cloned i)
into type-I and type-II vectors, ii) as head-to-tail tamdem into pUC vector,
or iii)
according to Gunther's method into pUC vector. These four types of
construction
were used for transfecting hepatoma Huh7 cells.
The HBV genome cloned by Gunther's method was first released by Sapl
digestion before the transfection. The same amount of DNA (equivalent HBV
genome) was used. As expected, due to presence of the strong actin promoter,
the
type-I vector gave rise to the highest level of intracellular replicative
intermediates
(Figure 4), thus confirming the usefulness of such vector for post
transcriptionnal
phenotypic studies. Type-II vector gave rise to higher level of intracellular
replicative
intermediates than both head-to-tail tandem and Gunther's type constructions,
suggesting that type-II vector may be used as alternative of type-I vector in
a
phenotypic assay.
Description and calibration of drug susceptibility assay.
Huh7 cells were seeded in 35mm ~ dishes (7. 105 cells/dish) and allowed to
adhere for 6 hours. Cells were transfected with 1.5 ~,g of a mixture of at
least 10
clones of type-I vectors obtained from the cloning of HBV from a serum to be
tested.
This multiclonal approach was meant to mirror the viral quasispecies. The day
after, the medium was replaced by fresh medium containing different
concentrations
of the drug to be tested (e.g. lamivudine in the example given). Treatment
with drug
was renewed everyday for four days. Then cells were lysed as described above
and
a Southern blot analysis was performed to measure the amount of intracellular
replicative intermediates synthesized under drug pressure and determine the
IC5o.
Experiments were performed in triplicate. On the example given (Figure 6), for
a wild
31
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
type HBV genomes population the IC5o of lamivudine was estimated less than 100
nM while it increased to more than 50 p,M for a viral population cloned from
patient
who had a viral breakthrough under lamivudine (3TC) treatment.
To get insight on the sensitivity of the assay, incremental mixtures of
plasmids
containing either wild type derived HBV genomes or 3TC-resistant derived HBV
genomes (containing mutation L528M and M552V [Seigneres et al., 2002 supra])
were used for cell transfection. The results of a Southern blot as well as the
scan-
densitometry analysis are presented on Figure 7. These data demonstrate that
the
assay readily distinguished mixtures that comprised 25, 50, or 75% resistant
virus
from the samples with 100% drug sensitive or 100% drug-resistant HBV genomes.
Such modelisation could allows one to compare the ICSO of a treated patient
sample to detect a possible breakthrough.
Similar assay has been performed with the following drugs: emtricitabine,
clevudine, adefovir dipivoxil, tenofovir disoproxil and beta-L-FD4C,
demonstrating
that the method of the invention may be used in phenotypic assay to assess
drug
susceptibility of HBV clones.
Various promoters useful in the invention
Are represented below a partial nucleotide sequence of known promoters. The 3'
terminal part thereof is represented with the +1 of transcription in bold and
underlined
(the nucleotide on the left is noted -1 ) and the TATA box also in bold when
present.
For each promoter, a location for creating a restriction site is indicated, as
well as the
A primers) which can be used therewith, in accordance with the first
embodiment of
the invention.
Basic promoter sequence of Chicken ~ actin gene:
SEQ ID NO: 24
CGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCT
Restriction site Will replace nucleotidesPrimer A SEQ ID
NO:
Notl -10 to -3 1
Ascl -8 to -1 2
Sse8387 I -10 to -3 3
Pmel -8 to -1 4
32
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Basic promoter sequence of CMV-IE gene:
SEQ ID NO: 25
TATATAAGCAGAGCTCGTTTAGTGAACCGTCAGA
Restriction site Will replace nucleotidesPrimer A SEQ ID
NO:
Notl -9 to ~-2 5
Ascl -8 to -1 2
Sse8387 I -9 to -2 6
Pmel -8 to -1 7
Basic promoter sequence of human ubiquitin C (hUb) gene:
SEQ ID NO: 26
TATATAAGGACGCGCCGGGTGTGGCACAGCTAGT
Restriction site Will replace nucleotidesPrimer A SEQ ID
NO:
Notl -11 to -4 1
Ascl -9 to -2 8
Sse8387 I -9 to -2 6
Basic promoter sequence of human EF-1 a gene:
SEQ ID NO: 27
TATATAAGTGCAGTAGTCGCCGTGAACGTTCTT
Restriction site Will replace nucleotidesPrimer A SEQ ID
NO:
Notl -9 to -2 1
Ascl -10 to -3 9
Sse8387 I -10 to -3 10
Basic promoter sequence of early promoter of SV40 (GC rich -TATA less
promoter):
SEQ ID NO: 28
GACTAATTTTTTTTATTTATG CAGAG G C C GAG G C
Restriction site Will replace nucleotidesPrimer A SEQ ID
NO:
Notl -9 to -2 1
Ascl -9 to -2 11
Sse8387 I -10 to -3 3
33
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
Basic promoter sequence of RSV (Rows Sarcoma Virus) LTR:
SEQ ID NO: 29
TATTTAAGTGCCTAGCTCGATACAATAAACGCC
Restriction site Will replace nucleotidesPrimer A SEQ ID
NO:
Pmel -8 to -1 7
Pacl -9 to -2 12
Sse8387 I -9 to -2 6
Each sequence of basic promoter modified by any one of the restiction sites as
indicated in the attached table is an object of the invention, as well as each
promoter
containing that sequence so modified, and each vector containing that
promoter.
It should be understood that the invention defined by the attached claims is
not
limited to the particular embodiments mentioned in the foregoing description
but
includes variants which do not emerge from the scope or the spirit of the
present
invention.
34
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
SEQUENCE LISTING
<110> INSTITUT NATIONAh DE LA SANTE ET DE LA RECHERCHE MEDICALE
(INSERM)
<120> Method for assaying replication of HBV and testing
susceptibility to drugs
<130> BET 02J0923
<140> EP 02356188.9
<141> 2002-09-27
<160> 29
<170> PatentIn version 3.1
<210> 1
<21l> 36
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 1
tgcgcaccgc ggccgcgcaa ctttttcacc tctgcc 36
<210> 2
<211> 36
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 2
tgcgcaccag ggcgcgccaa ctttttcacc tctgcc 36
<210> 3
<211> 36
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 3
tgcgcacccc tgcagggcaa ctttttcacc tctgcc 36
<210> 4
<211> 36
<212> DNA
<213> artificial sequence
<220>
1/6
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
<223> oligonucleotide
<400> 4 '
tgcgcaccag gtttaaacaa ctttttcacc tctgcc 36
<210> 5
<211> 36
<212> DNA
<2l3> artificial sequence
<220>
<223> oligonucleotide
<400>. 5
tgcgcaccag cggccgccaa ctttttcacc tctgcc 36
<210> 6
<211> 36
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 6
tgcgcaccac ctgcaggcaa ctttttcacc tctgcc 36
<210> 7
<211>' 36
<2l2> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 7
tgcgcaccag gtttaaacaa ctttttcacc tctgcc 36
<210> 8
<211> 36
<212> DNA
<2l3> artificial sequence
<220>
<223> oligonucleotide
<400> 8
tgcgcaccag gcgcgcccaa ctttttcacc tctgcc 36
<210> 9
<211> 36
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 9
tgcgcacggc gcgcctgcaa ctttttcacc tctgcc 36
2/6
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
<210> 10
<211> 36
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide.
<400> 10
tgcgcaccct gcaggtgcaa ctttttcacc tctgcc 36
<210> 11
<211> 36
<212> DNA
<2l3> artificial sequence
<220>
<223> oligonucleotide
<400> l1
tgcgcaccgc ggccgcgcaa ctttttcacc tctgcc 36
<210> 12
<211> 36
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 12
tgcgcaccat taattaacaa ctttttcacc tctgcc 36
<2l0> 13
<211> 24
<212> DNA
<2l3> artificial sequence
<220>
<223> oligonucleotide
<400> 13
ggcagcacas cctagcagcc atgg 24
<210> 14
<2l1> 24
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 14
ggcagcacas ,ccgagcagcc atgg 24
<210> 15
<211> 23
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
3/6
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
<400> 15
acmtcstttc catggctgct agg 23
<210> 16
<211> 23
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 16
acmtcstttc catggctgct cgg 23
<210> 17
<211> 30
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 17
ctaagggcat gcgatacaga gcwgaggcgg 30
<210> 18
<21l> 30
<212> DNA
<213> artificial sequence
<220> v
<223> oligonucleotide
<400> 18
ctaagggtcg acgatacaga gcwgaggcgg 30
<210> 19
<211> 30
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 19
taaacaatgc atgaaccttt accccgttgc 30
<210> 20
<211> 43
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 20
ccggaaagct tatgctcttc tttttcacct ctgcctaatc atc 43
<210> 21
4/6
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
<211> 42
<212> DNA
<213> artificial sequence
<220> _
<223> oligonucleotide
<400> 21 -
ccggagagct catgctcttc aaaaagttgc atggtgctgg tg 42
<210> 22
<211> 30
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 22
gctcttcttt ttcacctctg cctaatcatc 30
<210> 23
<211> 29
<212> DNA
<213> artificial sequence
<220>
<223> oligonucleotide
<400> 23
gctcttcaaa aagttgcatg gtgctggtg 29
<2l0> 24
<211> 42
<212> DNA
<213> chicken
<400> 24
cggccctata aaaagcgaag cgcgcggcgg gcgggagtcg ct 42
<210> 25
<211> 34
<212> DNA
<213> cytomegalovirus
<400> 25
tatataagca gagctcgttt agtgaaccgt caga 34
<210> 26
<211> 34
<212> DNA
<213> human
<400> 26
tatataagga cgcgccgggt gtggcacagc tagt 34
<210> 27
<211> 33
<212> DNA
<213> human
<400> 27
5/6
CA 02500188 2005-03-23
WO 2004/029301 PCT/EP2003/012398
tatataagtg cagtagtcgc cgtgaacgtt ctt 33
<210> 28
<211> 34~
<212> DNA
<213> . SV40 virus
<400> 28
gactaatttt ttttatttat gcagaggccg aggc 34
<210> 29
<211> 33
<212> DNA
<213> Rous Sarcoma virus
<400> 29
tatttaagtg cctagctcga tacaataaac gcc 33
6/6
