Note: Descriptions are shown in the official language in which they were submitted.
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
Sequence specific DNA recombination in eukaryotic cells
The present invention relates to a method of sequence-specific recombination
of DNA in
eukaryotic cells, comprising the introduction of a first DNA comprising a
nucleotide sequence
containing at least one recombination sequence into a cell, introducing a
second DNA
comprising a nucleotide sequence containing at least one further recombination
sequence into a
cell, and performing the sequence specific recombination by a bacteriophage
lambda integrase
Int.
The controlled manipulation of eukaryotic genomes and the expression of
recombinant proteins
from episomal vectors are important methods for analyzing the fimction(s) of
specific genes in
living organisms. Moreover, said manipulations play a role in gene therapeutic
methods in
medicine. In this context the generation of transgenic animals, the change of
genes or gene
segments (so-called "gene targeting") and the targeted integration for foreign
DNA into the
genome of higher eukaryotes are of particular importance. Recently these
technologies could be
improved by means of characterization and application of sequence specific
recombination
systems.
Furthermore, sequence-specific integration of expression cassettes, encoding
and expressing a
desired polypeptide/product, into the genome of biotechnological relevant host
cells also gets
more significance for the production of biopharmaceuticals. Expression level
for a desired
polypeptide in a stable transformed cell lines depends on the site of
integration. By sequence
specific integration, sites could be preferably used having a high
transcription activity. The
conventional method for generating production cell lines expressing a desired
polypeptide/product is based on the random integration of the recombinant
expression vector
into the genome of the host cell. Variations in the expression level of the
integrated genes) of
interest in stable transformed cell lines are attributed mainly to differences
in chromosomal
locations and copy numbers. Random integration in the proximity of
heterochromatin results in
variable levels of transgene expression. Chromosome locations promoting the
expression of the
integrated genes) of interest are thought to be transcriptionally active
regions of euchromatin.
This randomness of integration causes a large diversity in recombinant cells
robustness,
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
productivity and quality, necessitating an elaborate screening process to
identify and isolate a
suitable cell clone expressing the desired polypeptide at high level. In
addition, the heterogeneity
also means that for each clone an optimized production process has to be
developed, making the
development of a suitable production cell line a time consuming, labor
intensive and costly
process.
Conservative sequence specific DNA recombinases have been divided into two
families.
Members of the first family, the so-called "integrase" family, catalyze the
cleavage and rejoining
of DNA strands between two defined nucleotide sequences, . which will be named
as
~o recombination sequences in the following. The recombination sequences may
be either on two
different or on one DNA molecule, resulting in inter- or intramolecular
recombination,
respectively. For intramolecular recombination, the result of the reaction
depends on the
respective orientation of the recombination sequences to each other. In the
case of an inverted,
i.e. opposite orientation of the recombination sequences, inversion of the DNA
segments lying
is between the recombination sequences occurs. In the case of direct, i.e.
tandem repeats of the
recombination sequences on a DNA substrate, a deletion occurs. In case of the
intermolecular
recombination, i.e. if both recombination sequences are located on two
.different DNA
molecules, a fusion of the two DNA molecules may occur. While members of the
integrase
family usually catalyze both intra- as well as intermolecular recombination,
the recombinases of
zo the second family of the so-called "invertases/resolvases" are only able to
catalyze the
intramolecular recombination.
At present, the recombinases which are used for the manipulation of eukaryotic
genomes belong
to the integrase family. Said recombinases are the Cre recombinase of the
bacteriophage PI and
zs the Flp recombinase from yeast (Miiller, U. (1999) Mech. Develop., 82, pp.
3). The
recombination sequences to which the Cre recombinase binds are named loxP.
LoxP is a 34 by
long nucleotide sequence consisting of two 13 by long inverted nucleotide
sequences and an 8 by
long spacer lying between the inverted sequences (Hoess, R. et al. (1985) J.
Mol. Biol., 181, pp.
351). The FRT named binding sequences for Flp are build up similarly.,
However, they differ
so from loxP (Kilby, J. et al. (1993) Trends Genet., 9, pp. 413). Therefore,
the recombination
sequences may not be replaced by each other, i.e. Cre is not able to recombine
FRT sequences
and FLP is not able to recombine loxP sequences. Both recombination systems
are active over
long distances, i.e. the DNA segment to be inverted or deleted and flanked by
two loxP or FRT
sequences may be several 10 000 base pairs long.
2
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
For example, a tissue specific recombination in a mouse system, a chromosomal
translocation in
plants and animals, and a controlled induction of the gene expression was
achieved with said rive
systems; review article of Miiller, U. (1999) Mech. Develop., 82, pp. 3. The
DNA polymerase (3
s was deleted in particular tissues of mice in this way; Gu, H. et al. (1994)
Science, 265, pp. 103.
A further example is the specific activation of the DNA tumor virus SV40
oncogene in the
mouse lenses leading to tumor formation exclusively in these tissues. The Cre-
IoxP strategy was
used also in connection with inducible promoters. For example, the expression
of the
recombinase was regulated with an interferon-inducible promoter wleading to
the deletion of a
io specific gene in the liver and not - or only to a low extent - in other
tissues; Kiihn, R. et al.
(1990 Science, 269, pp.1427.
So far three members of the invertase/resolvase family have been used for the
manipulation of
eukaryotic genomes. A mutant of the bacteriophage Mzi invertase Gin can
catalyze the inversion
~s of a DNA fragment in plant protoplasts without cofactors. However, it has
been discovered that
this mutant is hyper-recombinogenic, i.e. it catalyzes DNA strand cleavages
also at other than its
naturally recombination sequences. This leads to unintended partially lethal
recombination
events in plant protoplast genomes. The (3-recombinase from Streptococcus
pyogenes catalyses
the recombination in mouse cell cultures between two recombination sequences
as direct repeats
zo leading to the excision of the segment. However, simultaneously with
deletion also inversion has
been detected which renders the controlled use of the system for manipulation
of eukaryotic
genomes unsuitable. Mutants of the y8 resolvase from E.coli have been shown to
be active on
episomal and artificially introduced genomic recombination sequences, but the
efficiency of the
latter reaction is still rather poor.
zs
The manipulation of eukaryotic genomes with the Cre and Flp recombinase,
respectively, shows
significant disadvantages. In case of deletion, i.e. the recombination of two
tandem repeated IoxP
or FRT recombination sequences in a genome there is an irreversibly loss of
the DNA segment
lying betW een the tandem repeats. Thus, a gene located on this DNA. segment
will be lost
3o permanently for the cell and the organism. Therefore, the reconstruction of
the original state for a
new analyses of the gene function, e.g. in a later developmental stage of the
organism, is
impossible. The irreversible loss of the DNA segment caused by deletion may be
avoided by an
inversion of the respective DNA segment. A gene may be inactivated by an
inversion without
being lost and may be switched on again at a later developmental stage or in
the adult animal by
3
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
means of a timely regulated expression of the recombinase via back
recombination. However,
the use of both Cre and Flp recombinases in this modified method has the
disadvantage that the
inversion cannot be regulated as the recombination sequences will not be
altered as a result of
the recombination event. Thus, repeated recombination events occur causing the
inactivation of
s the respective gene due to the inversion of the respective DNA segment only
in some, at best in
50% of the target cells at equilibrium of the reaction. There have been
efforts to solve this
problem, at least in part, by constructing mutated IoxP sequences which cannot
be used for
further reaction after a single recombination. However, the disadvantage is
the uniqueness of the
reaction, i.e. there is no subsequent activation by back recombination after
inactivation of the
~o gene by inversion.
A further disadvantage of the Flp recombinase is its reduced heat stability at
37°C thus limiting
the efficiency of the recombination reaction in higher eukaryotes
significantly, e.g. in mice with
a body temperature of about 39°C. Therefore, Flp mutants have been
generated which exhibit a
i s higher heat stability as the wild-type recombinase. However, even these
mutant Flp enzymes still
exhibit a lower recombination efficiency than the Cre recombinase.
A further use of sequence specific recombinases resides in the medical field,
e.g. in gene therapy,
where the recombinases integrate a desired DNA segment into the genome of a
respective human
zo target cell in a stable and controlled way. Both Cre and Flp may catalyze
intermolecular
recombination. Both recombinases recombine a plasmid DNA which carnes a copy
of its
respective recombination sequence with a corresponding recombination sequence
which has
been inserted before into the eukaryotic genome via homologous recombination.
However, it is
desirable that this reaction includes a "naturally" occurring recombination
sequence in the
zs eukaryotic genome. Because loxP and FRT are 34 and 54 nucleotides long,
respectively,
occurrence of exact matches of these recombination sequences as part of the
genome is
statistically unlikely. Even if a recombination sequence would be present, the
disadvantage of the
aforementioned back reaction still exists, i.e. both Cre and Flp recombinase
may excise the
inserted DNA segment after successful integration by intramolecular
recombination.
Thus, one problem of the present invention is to provide a simple and
controllable recombination
system, and the required working means. A further problem of the present
invention is the
provision of a recombination system and the required working means, which may
carry out a
stable and targeted integration of a desired DNA sequence. A further problem
of the present
4
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
invention is the provision of methods which allows the generation of an
improved protein
expression system on the basis of one of those recombination systems.
Said problems are solved by the subject matter characterized in the claims.
s
The invention is explained in more detail with the following illustrations.
Figure 1 shows a schematic presentation of the recombination reactions namely
integration and
excision catalyzed by the wild-type integrase Int. A superhelical plasmid DNA
(top) carrying a
io copy of the recombination sequence attP is shown. AttP consists of five so-
called arm binding
sites for Int (Pl, P2, P1', P2', P3'), two core Int binding sites (C and C';
marked with black
arrows), three binding sites for IHF (Hl, H2, H'), two binding sites for Xis
(X1, X2) and the so-
called overlap region (open rectangle) where the actual DNA strand exchange
takes place. The
natural partner sequence for attP, attB, is shown on a linear DNA segment
beneath and consists
is of two core binding sites for Int (B and B'; marked with open arrows) and
the overlap region. For
the recombination between attB and attP, Int and IHF are necessary leading to
the integration of
the plasmid into the DNA segment carrying attB. Thereby, two new hybrid
recombination
sequences, attL and attR, are formed which serve ~as target sequences for the
excision. The latter
reaction requires in the wild-type situation Int and IHF, and a further
cofactor XIS encoded by
zo the phage lambda.
Figure 2 shows intra- and intermolecular recombination reactions. (A)
Intramolecular integrative
(attB x attP) recombination. (B) Intermolecular integrative (attB x attP)
recombination. (C)
Intramolecular excisive (attL x attR) recombination. (D) Intermolecular
excisive (attL x attR)
zs recombination. Substrate vectors and expected recombination products are
schematized at the
top of each panel. The fraction of GFP-expressing cells was determined by FACS
at three time
points after co-transfection of substrate and expression vectors. We show mean
values of three
assays with standard deviations indicated by vertical lines.
3o Figure 3 shows that the presence of Int arm-binding DNA sequences in att
sites stimulates
intermolecular recombination. (A) Pairs of substrate vectors for
intermolecular recombination
contain either attB or nttP in different combinations and yield products that
express GFP driven
by the CMV promoter. (B) Various combinations of substrate vectors were co-
transfected with
expression vectors for wild-type Int, mutant Int-h, or Int-h1218. At 48 hrs,
cells were analyzed by
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
FACS and the ratio of GFP-expressing cells was determined fox two pairs of
substrates.
Recombination between attP and attP served as reference, as indicated. We show
mean values of
three assays with standard deviations indicated by vertical lines. The actual
mean values of GFP-
expression cells (%) for Int were 0.08 (B x B), 1.24 (P x P), and 0.81 (P x
B). Those for Int-h
s were 1.15 (B xB), 8.07 (P x P), and 9.90 (P x B). Those for Int-h/218 were
4.01 (B x B), 17.62 (P
x P), and 16.45 (P x B).
Figure 4 shows that purified IHF protein stimulates intra- and intermolecular
integrative
recombination by wild-type Int. (A) Schematic representation of substrate
vectors which were
io incubated with or without IHF before trarisfection into HeLa cells that
transiently expressed
either wild-type Int or Int-h. (B) At 48 hrs after transfection, the fractions
of GFP-expressing
cells were analyzed by FRCS. The ratio of these fractions was plotted as
activation of
recombination by IHF. The graph shows mean values of three assays with
standard deviations
indicated by vertical lines. The actual mean values of GFP-expressing cells
(%) in the
is presence and absence of IHF, respectively, were for Int (7.93/1.26) and Int-
h (17.57/13.14) in
the case of intramolecular recombination, and for Int (13.94/3.47) and Int-h
(20.33/16.83)
analyzing intermolecular recombination.
Figure 5 schematically shows exemplary expression vector designs for the
sequence specific
zo DNA recombination in CHO-DG44 cells. "P/E" means a composite unit that
contains both
enhancer and promoter element, "P" a promoter element and "T" a transcription
termination
site required for polyadenylation of transcribed messenger RNA. "GOI" refers
to a gene of
interest, "dhfr" to the amplifiable selectable marker dihydrofolate reductase,
"FP" to a
fluorescent protein such as ZsGreen and "npt" to the selectable marker
neomycin
is phosphotransferase. An arrow indicates the site of transcription initiation
within a
transcription unit. The sequence specific recombination between the
recombination site attP
or attB located on the first DNA and the recombination site attP or attB
located on the second
DNA is depicted with a cross and is mediated by the bacteriophage lambda
integrase. "att"
refers to the attachment sites resulting from the exemplarily shown
recombination between
3o attP and cattP, attP and attB, attB and attP, or attB and attB located on
the first and second
DNA, respectively.
The term "transformation" or "to transform" , "transfection" or "to transfect"
as used herein
means any introduction of a nucleic acid sequence into a cell, resulting in
genetically modified,
6
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
recombinant, transformed or transgenic cells. The introduction can be
performed by any method
well known in the art and described, e.g. in Sambrook, J. et al. (1989)
Molecular Cloning: A
Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, New York
or Ausubel,
F.M. et al. (1994 updated) Current Protocols in Molecular Biology, New York:
Greene
s Publishing Associates and Wiley-Interscience. Methods include but are not
limited to
lipofection, electroporation, polycation (such as DEAF-dextran)-mediated
transfection,
protoplast fusion, viral infections and microinjection or may be carried Ollt
by means of the
calcium method, electroshock method, intravenous/intramusuclar injection,
aerosol inhalation or
an oocyte injection. The transformation may result in a transient or stable
transformation of the
~o host cells. The term "transformation" or "to transform" also means the
introduction of a viral
nucleic acid sequence in a way which is for the respective vims the naturally
one. The viral
nucleic acid sequence needs not to be present as a naked nucleic acid sequence
belt may be
packaged in a viral protein envelope. Thus, the term relates not only to the
method which is
usually known under the term "transformation" or "to transform". Transfection
methods that
~s provide optimal transfection frequency and expression of the introduced
nucleic acid are favored.
Suitable methods can be determined by routine procedures. For stable
transfectants the
constructs are either integrated into the host cell's genome or an artificial
chromosome/mini-
chromosome or located episomally so as to be stably maintained within the host
cell.
?o The term "recombination sequences" as used herein relates to ~ttB, attP,
attL and attR sequences
and the derivatives thereof. An example for an attB sequence is specified in
SEQ ID N0:13, an
example for an attP sequence is specified in SEQ ID N0:14, an example for an
attL sequence is
specified in SEQ ID NO:15, and an example for an attR sequence is specified in
SEQ ID N0:16.
zs The term "derivative" as used herein relates to attB, attP, attL and attR
sequences having one or
more substitutions, preferably seven, more preferably two, three, four, five
or six in the overlap
region and/or core region in contrast to naturally occurring attB, attP, czttL
and c~ttR sequences.
The term "derivative" also relates to at least one core Int binding site of
attB, attP, attL or attR.
The term "derivative" also relates to at least one core Int binding site of
attP, attL or attR plus
30 one or more copies of the arm-binding sites for Int. The term "derivative"
also relates to at least
one core Int binding site of attP, attL or attR plus one or more copies of the
IHF, FIS or XIS
factor binding sites. The term "derivative" also relates to a combination of
these features. The
term "derivative" moreover relates to any functional fragments thereof and to
endogenous
nucleotide sequences in eukaryotic cells supporting sequence-specific
recombination, e.g. attH
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
identified in the human genome (see e.g. WO 01/16345). The term "derivative"
in general
includes attB, attP, attL or attR sequences suitable for realizing the
intended use of the present
invention, which means that the sequences mediate sequence-specific
recombinantion events
driven by an integrase (wild-type or modified) of the bacteriophage lambda.
s
The term "functional fragment" relates to attB, attP, attL and attR sequences
having
substitutions, deletions, and/or insertions (including presence or absence of
wild-type or
modified protein binding sites), which do not significantly affect the use of
said sequences in
recombination events driven by an wild-type or modified integrase of the
bacteriophage lambda.
io Functionality is not significantly affected, when recombination frequency
is at least about 70%,
preferably at least about 80%, more preferably about 90%, further more
preferably at least about
95%, and most preferably more than about 100% in comparison to the
corresponding naturally
occurring recombination sequences, using the same recombinase under the same
conditions (e.g.
in vitro ~or in vivo use, identical host cell type, identical transfection
conditions, presence or
is absence of the same host factors, the same buffer conditions, identical
temperature etc.).
Alternatively, substitutions, deletions, and/or insertions in attB, attP, attL
and/or attR sequences
confer at least an enhancement of the recombination events driven by a wild-
type or modified
integrase of the bacteriophage lccmbda, whereby said enhancement may consist
for example of (i)
increasing the efficiency of recombination events (integration and/or
excision), (ii) increasing the
zo specificity of recombination, (iii) favoring excisive recombination events,
(iv) favoring
integrative recombination events, (v) relieving the requirements for some or
all host factors, in
comparison to the corresponding naturally occurnng recombination sequences
using the same
recombinase under the same conditions (see above).
zs The functionality of modified recombination sites or of modified integrase
can be demonstrated
in ways that depend on the desired particular characteristic and are known in
the art. For
example, a co-transfection assay as described in the present invention (see
Results 5.1 or
Example 3 of WO 01/16345) may be used to characterize integrase-mediated
recombination of
extrachromosomal DNA in a variety of cell lines. Briefly, cells are co-
transfected with an
30 expression vector encoding the integrase protein and a substrate vector
that is a substrate for the
recombinase, encoding a functional/non-functional reporter gene (e.g.
fluorescent protein like
GFP) and containing at least one recombination sequence therein. Upon
expression of the
integrase by the expression vector, the function of the reporter gene will be
rendered non-
functional/functional. Thus, the recombination activity can be assayed either
by recovering the
8
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
recombined substrate vector and looking for evidence of recombination at the
DNA level (for
example by performing a PCR, sequence analysis of the recombined region,
restriction enzyme
analysis, Southern blot analysis) or by looking for evidence of the
recombination at the protein
level (e.g. ELISA, Western Blotting, radioimmunoassay, immunoprecipitation,
immunostaining,
s FACS-analysis of fluorescent proteins).
The term "overlap region" as used herein defines the sequence of the
recombination sequences
where the DNA strand exchange, including strand cleavage and religation, takes
place and
relates to the consensus DNA sequence S'-TTTATAC-3' in wild-type att sites or
said sequence
~o having functional nucleotide substitutions. The only prerequisite is, that
the sequence of the
overlap region is identical between recombining partner sequences.
The term "core binding sites" relates to two imperfectly repeated copies in
inverted orientation,
separated by the overlap region, in each set of wild-type att sites. The core
binding sites are
~s essential for the recombination by binding the integrase at low affinity.
Each core binding site
consists of nine contiguous base pairs and relates to DNA sequences consisting
for the B-
sequence of the nucleotide sequence 5'-CTGCTTTTT-3', for the B'-sequence of
the nucleotide
sequence 5'-CAAGTTAGT-3' (reverse complementary strand), for the C-sequence of
the
nucleotide sequence 5'-CAGCTTTTT-3', and for the C'-sequence of the nucleotide
sequence
zo 5 ~-CAACTTAGT-3' (reverse complementary strand) in wild-type att sites or
said sequences
having functional nucleotide substitutions.
The term "arm-binding site for Int" or "arm-binding sites" as used herein
relates to the consensus
sequence S'-C/AAGTCACTAT-3' or said sequence having functional nucleotide
substitutions.
zs The arm-binding site for Int may be positioned at various distances
upstream and/or downstream
of the core Int binding site(s).
The term "homologue" or "homologous" or "similar" as used herein with regard
to
recombination sequences, arm-binding sites, and host factor binding sites
relates to a nucleic acid
~o sequence being identical for about 70%, preferably for about 80%, more
preferably for about
85%, further more preferably for about 90%, further more preferably for about
95%, and most
preferably for about 99% to naturally occurring recombination sequences, arm-
binding sites, and
host factor binding sites. As homologous or similar are considered sequences,
which e.g. using
standard parameters in the similarity algorithm BLAST of NCBI (Basic Local
Alignment Search
9
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
Tool, Altschul et al., Journal of Molecular Biology 215, 403-410 (1990))
showing a probability
of P < 10-s when compared to the recombination sequences.
The term "vector" as used herein relates to naturally occurring or
synthetically generated
s constructs for uptake, proliferation, expression or transmission of nucleic
acids in a cell, e.g.
plasmids, phagemids, cosmids, artificial chromosomes/mini-chromosomes,
bacteriophages,
viruses or retro vimses. Methods used to construct vectors are well known to a
person skilled in
the art and described in various publications. In particular techniques for
constnicting suitable
vectors, including a description of the functional and regulatory components
such as promoters,
io enhancers, termination and polyadenylation signals, selection markers,
origins of replication, and
splicing signals, are reviewed in considerable details in Sambrook, J. et al.
(1989), supra, and
references cited therein. The eukaryotic expression vectors will typically
contain also
prokaryotic sequences that facilitate the propagation of the vector in
bacteria such as an origin of
replication and antibiotic resistance genes for selection in bacteria. A
variety of eukaryotic
~s expression vectors, containing a cloning site into which a polynucleotide
can be operatively
linked, are well known in the art and some are commercially available from
companies such as
Stratagene, La Jolla, CA; Invitrogen, Carlsbad, CA; Promega, Madison, WI or BD
Biosciences
Clontech, Palo Alto, CA.
Zo The terms "gene of interest", "desired sequence", or "desired gene" as used
herein have the same
meaning and refer to a polynucleotide sequence of any length that encodes a
product of interest.
The selected sequence can be full length or a tnmcated gene, a fusion or
tagged gene, and can be
a cDNA, a genomic DNA, or a DNA fragment, preferably, a cDNA. It can be the
native
sequence, i.e. naturally occurnng form(s), or can be mutated or otherwise
modified as desired.
2s These modifications include codon optimizations to optimize codon usage in
the selected host
cell, humanization or tagging. The selected sequence can encode a secreted,
cytoplasmic,
nuclear, membrane bound or cell surface polypeptide. The "product of interest"
includes
proteins, polypeptides, fragments thereof, peptides, antisense RNA all of
which can be expressed
in the selected host cell.
The term "nucleic acid sequence", "nucleotide sequence", or "DNA sequence" as
used herein
refers to an oligonucleotide, nucleotide or polynucleotide and fragments and
portions thereof and
to DNA or RNA of genomic or synthetic origin, which may be single or double
stranded and
represent the sense or antisense strand. The sequence may be a non-coding
sequence, a coding
to
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
sequence or a mixture of both . The polynucleotides of the invention include
nucleic acid regions
wherein one or more codons have been replaced by their synonyms.
The nucleic acid sequences of the present invention can be prepared using
standard techniques
s well known to one of skill in the art. The term "encoding" or "coding"
refers to the inherent
property of specific sequences of nucleotides in a nucleic acid, such as a
gene in chromosome or
an mRNA, to serve as templates for synthesis of other polymers and
macromolecules in
biological processes having a defined sequence of nucleotides (i.e. rRNA,
tRNA, other RNA
molecules) or amino acids and the biological properties resulting therefrom.
Thus a gene encodes
io a protein, if transcription and translation of mRNA produced by that gene
produces the protein in
a cell or other biological system. Both the coding strand, the nucleotide
sequence of which is
identical to the mRNA sequence and is usually provided in sequence listings,
and non-coding
strand, used as the template for the transcription, of a gene or cDNA can be
referred to as
encoding the protein or other product of that gene or cDNA. A nucleic acid
that encodes a
is protein includes any nucleic acids that have different nucleotide sequences
but encode the same
amino acid sequence of the protein due to the degeneracy of the genetic code.
Nucleic acids and
nucleotide sequences that encode proteins may include introns.
The term "polypeptide" is used interchangeably with amino acid residue
sequences or protein
zo and refers to polymers of amino acids of any length. These terms also
include proteins that are
post-translationally modified through reactions that include, but are not
limited to, glycosylation,
acetylation, phosphorylation or protein processing. Modifications and changes,
for example
fusions to other proteins, amino acid sequence substitutions, deletions or
insertions, can be made
in the structure of a polypeptide while the molecule maintains its biological
functional activity.
zs For example certain amino acid sequence substitutions can be made in a
polypeptide or its
underlying nucleic acid coding sequence and a protein can be obtained with
like properties.
Amino acid modifications can be prepared for example by performing site-
specific mutagenesis
or polymerase chain reaction mediated mutagenesis on its underlying nucleic
acid sequence.
3o The term "expression" as used herein refers to transcription and/or
translation of a heterologous
nucleic acid sequence within a host cell. The level of expression of a desired
product in a host
cell may be determined on the basis of either the amount of corresponding mRNA
that is present
in the cell, or the amount of the desired polypeptide encoded by the selected
sequence. For
example, mRNA transcribed from a selected sequence can be quantitated by
Northern blot
11
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
hybridization, ribonuclease RNA protection, in situ hybridization to cellular
RNA or by PCR
(see Sambrook, J. et al. (1989), supra; Ausubel, F.M. et al. (1994 updated),
supra). Proteins
encoded by a selected sequence can be quantitated by various methods, e.g. by
ELISA, by
Western blotting, by radioimmunoassays, by immunoprecipitation, by assaying
for the biological
s activity of the protein, or by immunostaining of the protein followed by
FAGS analysis PCR (see
Sambrook, J. et al. (1989), supra; Ausubel, F.M. et al. (1994 updated),
supra).
An "expression cassette" defines a region within a construct that contains one
or more genes to
be transcribed, wherein the genes contained within the segment are operatively
linked to each
~o other and transcribed from a single promoter, and as result, the different
genes are at least
transcriptionally linked. More than one protein or product can be transcribed
and expressed from
each transcription unit. Each transcription unit will comprise the regulatory
elements necessary
for the transcription and translation of any of the selected sequence that are
contained within the
unit.
is
The term "operatively linked" means that two or more nucleic acid sequences or
sequence
elements are positioned in a way that permits them to function in their
intended manner. For
example, a promoter and/or enhancer is operatively linked to a coding sequence
if it acts in cis to
control or modulate the transcription of the linked sequence. Generally, but
not necessarily, the
zo DNA sequences that are operatively linked are contiguous and, where
necessary to join two
protein coding regions or in the case of a secretory leader, contiguous and in
reading frame.
The term "selection marker gene" refers to a gene that only allows cells
carrying the gene to be
specifically selected fox or against in the presence of a corresponding
selection agent. By way of
zs illustration, an antibiotic resistance gene can be used as a positive
selectable marker gene that
allows the host cell transformed with the gene to be positively selected for
in the presence of the
corresponding antibiotic; a non-transformed host cell would not be capable of
growth or survival
under the selection culture conditions. Selectable markers can be positive,
negative or
bifimctional. Positive selectable markers allow selection for cells carrying
the marker by
3o conferring resistance to a dnig or compensate for a metabolic or catabolic
defect in the host cell.
In contrast, negative selection markers allow cells carrying the marker to be
selectively
eliminated. For example, using the HSV-tk gene as a marker will make the cells
sensitive to
agents such as acyclovir and gancyclovir. The selectable marker genes used
herein, including the
amplifiable selectable genes, will include recombinantly engineered mutants
and variants,
12
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
fragments, functional equivalents, derivatives, homologs and fusions of the
native selectable
marker gene so long as the encoded product retains the selectable property.
Useful derivatives
generally have substantial sequence similarity (at the amino acid level) in
regions or domains of
the selectable marker associated with the selectable property. A variety of
marker genes have
s been described, including bifunctional (i.e. positivelnegative) markers (see
e.g. WO 92/08796
and WO 94/28143), incorporated by reference herein. For example, selectable
genes commonly
used with eukaryotic cells include the genes for aminoglycoside
phosphotransferase (APH),
hygromycin phosphotransferase (HYG), dihydrofolate reductase (DHFR), thymidine
kinase
(TK), glutamine synthetase, asparagine synthetase, and genes encoding
resistance to neomycin
~ o (G418), puromycin, histidinol D, bleomycin and phleomycin.
Selection may also be made by fluorescence activated cell sorting (FACS) using
for example a
cell surface marker, bacterial (3-galactosidase or fluorescent proteins (e.g.
green fluorescent
proteins (GFP) and their variants from Aeqzcorea victoria and Renilla
reniformis or other species;
is red fluorescent proteins, fluorescent proteins and their variants from non-
bioluminescent species
(e.g. Discosoma sp., Anemonia sp., Clavularia sp., Zoanthzcs sp.) to select
for recombinant cells.
The term "selection agent" refers to a substance that interferes with the
growth or survival of a
host cell that is deficient in a particular selectable gene. For example, to
select for the presence of
zo an antibiotic resistance gene like APH (aminoglycoside phosphotransferase)
in a transfected cell
the antibiotic Geneticin (G418) is used.
The integrase (usually and designated herein as "Int") of the bacteriophage
lambda belongs like
Cre and Flp to the integrase family of the sequence specific conservative DNA
recombinases. In
zs its natural function Int catalyses the integrative recombination between
two different
recombination sequences namely attB and attP. AttB comprises 21 nucleotides
and was
originally isolated from the E. coli genome; Mizuuchi, M. and Mizuuchi, K.
(1980) Proc. Natl.
Acad. Sci. USA, 77, pp. 3220. On the other hand attP having 243 nucleotides is
much longer and
occurs naturally in the genome of the bacteriophage lambda; Landy, A., and
Ross, W. (1977)
3o Science, 197, pp. 1147. The Int recombinase has seven binding sites
altogether in attP and two in
attB. The biological function of Int is the sequence specific integration of
the circular phage
genome into the locus attB on the E. coli chromosome. Int needs a protein co-
factor, the so-
called integration host factor (usually and designated herein as "IHF") for
the integrative
recombination; Kikuchi, Y. and Nash, H. (1978) J. Biol. Chem., 253, 7149. IHF
is needed for the
13
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
assembly of a functional recombination complex with attP. A second co-factor
for the
integration reaction is the DNA negative supercoiling of attP. Finally, the
recombination
between attB and attP leads to the formation of two new recombination
sequences, namely attL
and attR, which serve as substrate and recognition sequence for a further
recombination reaction,
s the excision reaction. A comprehensive summary of the bacteriophage lambda
integration is
given e.g. in Landy, A. (1989) Annu. Rev. Biochem., 58, pp. 913.
The excision of the phage genome out of the bacterial genome is catalyzed by
the Int
recombinase also. For this, a further co-factor is needed in addition to Int
and IHF, which is
io encoded by the bacteriophage lambda. This is the excisionase (usually and
designated herein as
"XIS") having two binding sites in attR; Gottesman, M. and Weisberg, R. (1971)
The
Bacteriophage Lambda, Cold Spring Harbor Laboratory, pp.113. In contrast to
the integrative
recombination, DNA negative supercoiling of the recombination sequences is not
necessary for
the excisive recombination. However, DNA negative supercoiling increases the
efficiency of the
is recombination reaction: A further improvement of the efficiency of the
excision reaction may be
achieved with a second co-factor namely FIS (factor for inversion
stimulation), which acts in
conjunction with XIS; Landy, A. (1989) Annu. Rev. Biochem., 58, pp.913. The
excision is
genetically the exact reverse reaction of the integration, i.e. attB and attP
are generated again. A
comprehensive summary of the bacteriophage lambda excision is given e.g. in
Landy, A. (1989)
~o Annu. Rev. Biochem., 58, pp. 913.
One aspect of the present invention relates to a method of sequence specific
recombination of
DNA in a eukaryotic cell, comprising
a) introducing a first attB, attP, attL or attR sequence or a derivative
thereof into a cell,
zs b) introducing a second attB, attP, attL or czttR sequence or a derivative
thereof into a cell,
wherein if said first DNA sequence comprises an attB sequence or a derivative
thereof said
second sequence comprises an attB, attL or attR sequence or a derivative
thereof, or wherein if
said first DNA sequence comprises an attP sequence or a derivative thereof
said second
sequence comprises an czttP, attL or attR sequence or a derivative thereof, or
wherein if said first
3o DNA sequence comprises an attL sequence or a derivative thereof said second
sequence
comprises an attB, attP or attL sequence or a derivative thereof, or wherein
if said first DNA
sequence comprises an attR sequence or a derivative thereof said second
sequence comprises an
attB, attP or attR sequence or a derivative thereof,
c) performing the sequence-specific recombination by a bacteriophage lambda
integrase Int.
14
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
Preferred is the method wherein in step c) the sequence-specific recombination
is performed by
Int or by Int and XIS, FIS, and/or IHF. Most preferred is the method wherein
in step c) the
sequence-specific recombination is performed by Int or by Int and a XIS
factor, or by Int and
s IHF, or by Int and XIS and IHF. Further preferred is the method wherein in
step c) the sequence-
specific recombination is performed by a modified Int, preferably the Int-h or
Int-h/218. In this
context, use of a modified Int together with XIS, FIS and/or IHF is also
within the meaning of
the present invention.
io In a more preferred embodiment of this method, sequence specific
recombination of DNA in a
eukaryotic cells will be performed between identically or nearly identically
recombination sites.
Therefore, the present invention relates a method of sequence specific
recombination as
described above, wherein if said first DNA sequence comprises an attB sequence
or a derivative
thereof said second sequence comprises also attB sequence or a derivative
thereof, or wherein if
is said first DNA sequence comprises an attP sequence or a derivative thereof
said second
sequence comprises an attP sequence or a derivative thereof, or wherein if
said first DNA
sequence comprises an attL sequence or a derivative thereof said second
sequence comprises an
attL sequence or a derivative thereof, or wherein if said first DNA sequence
comprises an attR
sequence or a derivative thereof said second sequence comprises an attR
sequence or a
zo derivative thereof.
The method of the present invention may be carned out not only with the
naturally occuring
attB, attP, attL, and/or attR sequences but also with modified e.g.
substituted attB, attP, attL,
and/or attR sequences. For example an integrative recombination of the
bacteriophage lambda
Zs and E. coli between attP and attB homologous sequences (mutants of the wild-
type sequences)
have been observed which have one or more substitutions in attB (Nash, H.
(1981) Annu. Rev.
Genet., 15, pp. 143; Nussinov, R. and Weisberg, R. (1986) J. Biomol. Stntct.
Dynamics, 3, pp
1134) and/or in attP (Hash, H. (1981) Annu. Rev. Genet., 15, pp.143).
3o Thus, the present invention relates to a method wherein the used attB,
attP, attL, and/or attR
sequences have one or more substitutions in comparison to the naturally
occuring attB, attP,
attL, and/or attR sequences. Preferred is a method wherein the attB, attP,
attL, and/or attR
sequences have one, two, three, four, five, six, seven or more substitutions.
The substitutions
may occur both in the overlap region and in the core region. The complete
overlap region
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
comprising seven nucleotides may be substituted also. More preferred is a
method wherein
substitutions are introduced into the attB, attP, attL, and/or attR sequences
either in the core
region or in the overlap region. Preferred is the introduction of a
substitution in the overlap
region and the simultaneous introduction of one or two substitutions in the
core region. The
s present invention also relates to a method wherein the used attB, attP,
attL, and/or attR
sequences are derivatives, including functional fragments thereof, of said
recombination sites in
comparison to the naturally occurnng attB, attP, attL, and/or attR sequences.
A modification in the form of one or more substitutions) into recombination
sequences is to be
io chosen such that the recombination can be carned out in spite of the
modification(s). Examples
for such substitutions are listed e.g. in the publications of Nash, H. (1981),
supra and Nussinov,
R. and Weisberg, R. (1986), sz~pra and are not considered to be limiting.
Further modifications
may be easily introduced e.g. by mutagenesis methods (a number of these are
described in
Ausubel, F.M. et al. (1994 updated), supra) and and may be tested for their
use by test
is recombinations as described e.g. in the examples of the present invention
(Examples 1 and 2,
results 5.1 ).
Furthermore, the present invention relates to a method wherein the used attB,
attP, cattL, and/or
attR sequences comprise only of one of the respective core Int binding sites,
however, more than
zo two core Int binding sites are also preferred. In a preferred embodiment,
the present invention
relates to a method wherein the used attB, attP, attL, and/or attR sequences
consist only of one
of the respective core Int binding sites. In a further embodiment the used
attB, attP, attL, and/or
attR sequences consist of two or more core Int binding sites.
zs The present invention relates further to a method wherein the used attP,
attL, and/or attR
sequences comprise in addition to the core Int binding site one or more,
preferably two, three,
four, five or more than five, copies of the arm-binding site for Int. Said
binding site comprises a
consensus motive having the sequence 5'-C/AAGTCACTAT-3' (SEQ ID NO:1) or a
modified
sequence thereof having nucleotide substitutions and being functional with
regard to the Int
3o binding. The arm-binding sites) for Int may be positioned at various
distances upstream and/or
downstream of the core Int binding site(s).
In order to perform the method of the present invention the first
recombination sequence may
comprise further DNA sequences which allow the integration into a desired
target locus, e.g. in
16
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
the genome of the eukaryotic cell or an artificial-/minichromosome. This
recombination occurs
e.g. via the homologous recombination which is mediated by internal cellular
recombination
mechanisms. For said recombination, the further DNA sequences have to be
homologous to the
DNA of the target locus and located both 3' and 5' of the attB, attL, ccttP,
or attR sequences or
s derivatives thereof, respectively. The person skilled in the art knows how
great the degree of the
homology and how long the respective 3' and 5' sequences have to be such that
the homologous
recombination occurs with a sufficient probability; see review of Capecchi, M.
(1989) Science,
244, pp. 1288.
~o However, it is also possible to integrate the first recombination sequence
by any other
mechanism into the genome of the eukaryotic cell, or any artificial-
/minichromosome, e.g. via
random integration which is also mediated by internal cellular recombination
events. Integration
of said first recombination site via sequence-specific recombination using
sites different from
those being integrated, e.g. by using IoxPlFRT sequences, is also conceivable.
is
The second recombination sequence may also comprise DNA sequences which are
necessary for
an integration into a desired target locus via homologous recombination. For
the method of the
present invention both the first and/or the second recombination sequence may
comprise the
further DNA sequences. Preferred is a method wherein both DNA sequences
comprise the
zo further DNA sequences.
Introduction of the first and second recombination sequence with or without
further DNA
sequences may be performed both consecutively and in a co-transformation
wherein the
recombination sequences are present on two different DNA molecules. Preferred
is a method,
Zs wherein the first and second recombination sequence with or without further
DNA sequences are
present and introduced into the eukaryotic cells on a single DNA molecule.
Furthermore, the first
recombination sequence may be introduced into a cell and the second
recombination sequence
may be introduced into another cell wherein the cells are fused subsequently.
The term fusion
means crossing of organisms as well as cell fusion in the widest sense.
The method of the present invention may be used e.g. to invert a DNA segment
lying between
the indirectly orientated recombination sequences in an intramolecular
recombination.
Furthermore, the method of the present invention may be used to delete the DNA
segment lying
between the directly orientated recombination sequences in an intramolecular
recombination. If
17
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
the recombination sequences are each incorporated in 5'-3' or in 3'-5'
orientation they are present
in direct orientation. The recombination sequences are in indirect orientation
if e.g. the attB
sequence is integrated in S'-3' and the attP sequence is integrated in 3'-5'
orientation. If the
recombination sequences are each incorporated e.g. via homologous
recombination into intron
s sequences 5' and 3' of an exon and the recombination is performed by an
integrase, the exon
would be inverted in case of indirectly orientated recombination sequences and
deleted in case of
directly orientated recombination sequences, respectively. With this procedure
the polypeptide
encoded by the respective gene may lose its activity or function or the
transcription may be
stopped by the inversion or deletion such that no (complete) transcript is
generated. In this way
io e.g. the biological function of the encoded polypeptide may be
investigated. Moreover, inversion
or deletion reactions may be used to activate the expression of a gene
encoding a desired
polypeptide, e.g. by functional linkage of the open reading frame of the
encoded polypeptide
with regulatory elements which allow transcription and/or translation of the
encoded
polypeptide. Those regulatory elements include but are not limited to a
promotor and or
i ~ promotor/enhancer elements, which are well knoiyn in the art for various
eukaryotic expression
systems.
However, the first and/or second recombination sequence may comprise further
nucleic acid
sequences encoding one or more polypeptides/products of interest. For example
a structural
zo protein, an enzymatic or a regulatory protein may be introduced via the
recombination sequences
into the genome being transiently or stably expressed after intramolecular
recombination. The
introduced polypeptide/product may be an endogenous or exogenous one.
Furthermore, a marker
protein or biopharmaceutically relevant therapeutic polypeptides may be
introduced. The person
skilled in the art knows that this listing of applications of the method
according to the present
?s invention is only exemplary and not limiting. Examples of applications
according to the present
invention performed with the so far used Cre and Flp recombinases may be found
e.g. in the
review of Kilby, N. et al., (1993), Trends Genet., 9, pp.413.
Furthermore, the method of the present invention may be used to delete
or,invert DNA segments
30 on vectors by an intramolecular recombination on episomal substrates. A
deletion reaction may
be used e.g. to delete packaging sequences from so-called helper viruses. This
method has a
broad application in the industrial production of viral vectors for gene
therapeutic applications;
Hardy, S. et al., (1997), 3. Virol., 71, pp.1842.
18
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
The intermolecular recombination leads to the fusion of two DNA molecules each
having a copy
of attB, attP, attL, or attR or various combinations of att sequences or of
their derivates. For
example, attB or a derivative thereof may be introduced first via homologous
recombination in a
known, well characterized genomic locus of a cell or an artificial-
Iminchromosome.
s Subsequently an ccttB, attP, attL, or attR carrying vector or DNA-segment
may be integrated into
said genomic attB sequence via intermolecular recombination. Preferred in this
method is the co-
expression of the mutant integrase, e.g. Int-h or Int-h/218 within the
eukaryotic cell, wherein the
recombination occurs. Most preferred is the co-expression of the mutant
integrase Int-h/218.
Genes encoding for any of those mutant integrases may be located on a second
DNA vector
io being transfected, preferably co-transfected, or on the vector or DNA-
segment carrying the attP,
attL, attR or also an czttB sequence or an derivative thereof. Further
sequences may be located on
the attB, attP, attL, or attR carrying vector or DNA-segment, e.g. a gene for
a particular marker
protein flanked by loxPlFRT sequences. With this approach it may be achieved
that, e.g. in
comparative expression analyses of different genes in a cell type, said genes
are not influenced
is by positive or negative influences of the respective genomic integration
locus. Furthermore, the
method of the present invention may be used to fuse DNA segments on vectors by
an
intermolecular recombination on episomal substrates. A fusion reaction may be
used e.g. to
express recombinant proteins or relevant domains in order to screen for
phenotypes. This method
may be used in the high throughput analysis of protein functions in eukaryotic
cells and is thus of
zo considerable interest.
As mentioned above, intermolecular recombination may be used to introduce one
or more
genes) of interest encoding one or more desired polypeptide(s)/product(s)
into, e.g. episomal
substrates, artificial-/minichromosomes, or various host cell genomes
containing a first
zs recombination sequence. In this context a second DNA comprises beside at
least one
recombination sequence, e.g. attP, attB, attL, attR or any derivative thereof,
one or more
expression cassettes) for the expression of one or more desired
protein(s)/product(s). That
expression cassette may be introduced into a desired target locus via the
recombination
sequences which allows sequence-specific recombination between the DNA
comprising the
3o second recombination sequence and the expression cassette, and the first
recombination
sequence being introduced before into said episomal substrate, artificial-
/minichromosome, or
host cell genome. This embodiment may be of high interest for establishing
high expression cell
lines which are suitable for the production of biopharmaceutical products.
19
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
In this context, a first DNA comprising at least one recombination sequence
has to be introduced,
e.g. by random integration, into the genome of the host cell, an artificial-
Jminichromosomes or
episomal substrates contained within the host cell. Alternatively, host cell
may be transformed
with an artificial-/minichromosome or episomal substrate comprising a
corresponding at least
s one recombination site(s). Another way to integrate recombination sequences)
into a desired
target locus, recognized by a bacteriophage lambda integrase Int, is to use
homologous
recombination techniques as mentioned above.
To facilitate selection for stable transfectants which have introduced
recombination sequences)
io into a desired target locus, a selection marker gene is co-introduced into
the same target locus at
the same time. This may be achieved, for example, if the recombination
sequences) and a
selection marker gene are co-located on the same vector or DNA segment, which
is introduced
into the target locus, e.g. by any method mentioned above (homologous
recombination, random
integration, etc.). As the expression level of the selection marker gene
correlates with the
is transcription activity at the integration site, cells showing a high
expression level at site of
integration, cell robustness, and good growth characteristics, e.g. in a
bioreactor, can be
identified very effectively. The level of expression of the selection marker
gene can be
determined by methods well known in the art, e.g. on the basis of either the
amount of
corresponding mRNA that is present in the cell, or the amount of polypeptide
encoded by the
?o gene. For example, mRNA transcribed from the introduced gene sequence can
be quantified by
Northern blot hybridization, ribonuclease RNA protection, in situ
hybridization to cellular RNA
or by PCR (see Sambrook et al., 1989; Ausubel et al., 1994, supra). Proteins
encoded by a
selected sequence can be quantified by various methods, e.g. by ELISA, by
Western blotting, by
radioimmunoassays, by immunoprecipitation, by assaying for the biological
activity of the
as protein, by immunostaining of the protein followed by FACS analysis, or by
measuring the
fluorescence signals of a fluorescent protein (see Sambrook et al., 1989;
Ausubel et al., 1994
updated, sicpra). By such a method excellent candidates of a production cell
line for producing
biopharmaceuticals may be obtained.
3o The integrated recombination sequences) (first recombination sequence(s))
allow integration of
a further DNA molecule, e.g. a vector or DNA segment carrying at least one
further
recombination sequence (second recombination sequence) via sequence-specific
recombination
by a bacteriophage lambda integrase Int into a transcriptional active locus.
Preferably, that
further DNA molecule comprising at least one second recombination sequence
further comprises
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
an expression cassette for the expression of at least one biopharmaceutically
relevant gene of
interest. Fox this, host cells, which comprise the first integrated
recombination sequence,
preferably integrated into the host cell genome at a transcriptional active
locus, are tranfected
with a DNA molecule comprising the second recombination sequence for a
bacteriophage
s lambda integrase Int, and are cultivated under conditions that allow
sequence-specific
recombination between the first and the second recombination sequence,
preferably the
integration of the DNA molecule comprising the second recombination sequence
into the host
cell genome comprising the first recombination sequence. First and second
recombination
sequences can be either attP, attB, attL, attR or any derivative thereof,
which allows sequence-
to specific recombination by a bacteriophage lambda integrase Int or any
functional mutant thereof.
For example, if the first recombination sequence comprises attP or a
derivative thereof second
may comprises attP, attB, attL, attR or any derivative thereof.
Preferred is the method wherein the sequence-specific recombination is
performed by Int, or by
is Int and XIS, FIS and/or IHF. Most preferred is the method wherein the
sequence-specific
recombination is performed by Int or by Int and a XIS factor, or by Int and
IHF, or by Int and
XIS and IHF. Further preferred is the method wherein the sequence-specific
recombination is
performed by a modified Int, preferably the Int-h or Int-h/218. In this
context, use of a modified
Int together with XIS and/or IHF is also within the meaning of the present
invention.
?o
By this approach any DNA sequence(s), comprising a second recombination
sequence for the
bacteriophage lambda integrase Int is/are integrated into a known, well
characterized and defined
locus of the host cell. To select for cells where a sequence-specific
recombination has occurred
one can introduce, for example, a non-functional expression cassette
comprising the selection
~s marker gene, e.g. without a promoter or promoter/enhancer or only part of
the coding region of
the gene. Only if sequence-specific recombination has occurred, a complete and
functional
expression cassette with efficient expression of the selection marker gene
will be generated, thus
allowing for the selection of cells having integrated the gene of interest via
sequence specific
integration.
,o
By the method of the present invention production cell lines are obtainable
differ from the host
cell merely by the identity of DNA sequences integrated at a defined site of
integration, e.g. into
a genomic locus. Due to less genetic variation between different cell clones a
more generic
process for the development of production cell lines can be used, thus
reducing time and capacity
21
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
for clone selection and development of an optimized production process. The
production cell
lines may be used for the manufacturing of the desired polypeptide(s).
A further aspect of the present invention therefore relates to a method of
expressing at least one
s gene of interest encoding one or more desired polypeptide(s)/products(s) in
a eukaroytic cell,
comprising
a) . introducing a first DNA comprising an attB, attP, attL or attR sequence
or a derivative
thereof into a cell;
b) introducing a second DNA comprising an attB, attP, attL or attR sequence or
a derivative
~o thereof, and at least one gene of interest into a cell,
c) contacting said cell with a bacteriophage lambda integrase Int;
d) performing the sequence-specific recombination by a bacteriophage lambda
integrase Int,
wherein the second DNA is integrated into the first DNA; and
e) cultivating said cell under conditions, wherein the genes) of interest
is/are being
i s expressed.
Preferred is that method, wherein if said first DNA sequence comprises an attB
sequence or a
derivative thereof said second sequence comprises an attB, attL or attR
sequence or a derivative
thereof, or wherein if said first DNA sequence comprises an attP sequence or a
derivative thereof
?o said second sequence comprises an attP, attL or attR sequence or a
derivative thereof, or wherein
if said first DNA sequence comprises an attL sequence or a derivative thereof
said second
sequence comprises an attB, attP or attL sequence or a derivative thereof, or
wherein if said first
DNA sequence comprises an attR sequence or a derivative thereof said second
sequence
comprises an attB, attP or attR sequence or a derivative thereof.
zs
In a more preferred embodiment of that method, the first DNA has been
integrated into the
genome, an artificial-/minichromosome or an episomal element of a host cell,
preferably at sites
showing high transcription activity, before said second DNA is introduced into
said cell.
3o The present invention also relates to a method of expressing at least one
or more genes of interest
in a host cell, wherein said host cell comprises one attB, attP, attL or attR
sequence or a
derivative thereof integrated into the genome of said host cell, comprising
a) introducing a DNA comprising an attB, attP, attL or attR sequence or a
derivative thereof,
and at least one gene of interest into said cell,
22
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
b) contacting said cell with a bacteriophage lambda integrase Int;
c) performing the sequence-specific recombination by a bacteriophage lambda
integrase Int,
wherein the second DNA is integrated into the first DNA;
d) cultivating said cell under conditions, wherein the genes) of interest
is/are being expressed.
The method may be carried out not only with an attB, attP, attL or attR
sequence or a derivative
thereof being integrated into a host cell genome by genetic engineering of
said cell, but also with
naturally occurring recombination sequence of the genome, e.g. the attH-site
described in
WO 01/16345 (5'-GAAATTCTTTTTGATACTAACTTGTGT-3'; SEQ ID N0:17) or any other
Io recombination sequence, which allows sequence-specific recombination
mediated by an Int or
any functional mutant thereof.
Those methods are preferred, wherein said sequence-specific recombination is
performed by Int
or by Int and a XIS factor, or by Int and IHF, or by Int and XIS and IHF.
Further preferred is the
is method wherein the sequence-specific recombination is performed by a
modified Int, preferably
the Int-h or Int-h/218. In this context, use of a modified Int together with
XIS and/or IHF is also
within the meaning of the present invention. Int, Int-h or Int-h/218, XIS,
and/or IHF may be
added to the cell in purified form or being co-expressed by said host cell,
wherein the sequence-
specific recombination is being performed.
zo
A further embodiment of the above mentioned methods relates to a method,
wherein the
polypeptide(s)/product(s) which is/are encoded by the genes) of interest and
being expressed in
said host cell, is/are isolated from the cells or the cell culture
supernatant, if secreted into the
culture medium.
zs
Said production cells are cultivated preferentially in semm-free medium and in
suspension
culture under conditions which are favorable for the expression of the desired
genes) and
isolating the protein of interest from the cells and/or the cell culture
supernatant. Preferably the
protein of interest is recovered from the culture medium as a secreted
polypeptide, or it can be
3o recovered from host cell lysates if expressed without a secretory signal.
It is necessary to purifiy
the protein of interest from other recombinant proteins, host cell proteins
and contaminants in a
way that substantially homogenous preparations of the protein of interest are
obtained. As a first
step often cells and/or particulate cell debris are removed from the culture
medium or lysate. The
product of interest thereafter is purified from contaminant soluble proteins,
polypeptides and
23
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
nucleic acids, for example, by fractionation on immunoaffinity or ion-exchange
columns, ethanol
precipitation, reverse phase HPLC, Sephadex chromatography on silica or on a
cation exchange
resin such as DEAE. In general, methods teaching a skilled persion how to
purify a heterologous
protein expressed by host cells, are well known in the art. Such methods are
for example
s described by Harris et al. (1995) Protein Purification: A Practical
Approach, Pickwood and
Hames, eds., IRL Press and Scopes, R. (1988) Protein Purification, Springer
Verlag. Therefore,
the aforementioned method of expressing at least one gene of interest may be
added by an
additional purification step, wherein the desired polypeptide is purified from
the host cells or
from cell culture if secreted into the culture medium.
~o
The method of the present invention may be performed in all eukaryotic cells.
Cells and cell
lines may be present e.g. in a cell culture and include but are not limited to
eukaryotic cells, such
as yeast, plant, insect or mammalian cells. For example, the cells may be
oocytes, embryonic
stem cells, hematopoietic stem cells or any type of differentiated cells. A
method is preferred
~s wherein the eukaryotic cell is a mammalian cell. More preferred is a method
wherein the
mammalian cell is a human, simian, marine, rat, rabbit, hamster, goat, bovine,
sheep or pig cell.
Preferred cell lines or "host cells" for the production of biopharmaceuticals
are human, mice, rat,
monkey, or rodent cell lines. More preferred are hamster cells, preferably
BHK21, BHK TK ,
CHO, CHO-K1, CHO-DUKX, CHO-DUKX B1, and CHO-DG44 cells or the
zo derivatives/progenies of any of such cell lines. Particularly preferred are
CHO-DG44, CHO-
DLTKX, CHO-K1 and BHK21, and even more preferred CHO-DG44 and CHO-D>JKX cells.
Furthermore, marine myeloma cells, preferably NSO and Sp2/0 cells or the
derivatives/progenies
of any of such cell lines are also known as production cell lines.
zs Host cells are most preferred, when being established, adapted, and
completely cultivated under
semm free conditions, and optionally in media which are free of any
protein/peptide of animal
origin. Commercially available media such as Ham's F12 (Sigma, Deisenhofen,
Germany),
RPMI-1640 (Sigma), Dulbecco's Modified Eagle's Medium (DMEM; Sigma), Minimal
Essential Medium (MEM; Sigma), Iscove's Modified Dulbecco's Medium (IMDM;
Sigma), CD-
3o CHO (Invitrogen, Carlsbad, CA), CHO-S-SFMII (Invtirogen), serum-free CHO
Medium
(Sigma), and protein-free CHO Medium (Sigma) are exemplary appropriate
nutrient solutions.
Any of the media may be supplemented as necessary with a variety of compounds
examples of
which are hormones and/or other growth factors (such as insulin, transferrin,
epidermal growth
factor, insulin like growth factor), salts (such as sodium chloride, calcium,
magnesium,
24
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
phosphate), buffers (such as HEPES), nucleosides (such as adenosine,
thymidine), glutamine,
glucose or other equivalent energy sources, antibiotics, trace elements. Any
other necessary
supplements may also be included at appropriate concentrations that would be
known to those
skilled in the art. 1n the present invention the use of semm-free medium is
preferred, but media
s supplemented with a suitable amount of serum can also be used for the
cultivation of host cells.
For the growth and selection of genetically modified cells expressing a
selectable gene a suitable
selection agent is added to the culture medium.
"Desired proteins/polypeptides" or "proteins/polypeptides of interest" of the
invention are for
io example, but not limited to insulin, insulin-like growth factor, hGH, tPA,
cytokines, such as
interleukines (IL), e.g. IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9,
IL-10, IL-11, IL-12,
IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, interferon (IFN) alpha, IFN beta,
IFN gamma, IFN
omega or IFN tau, tumor necrosisfactor (TNF), such as TNF alpha and TNF beta,
TNF gamma,
TRAIL; G-CSF, GM-CSF, M-CSF, MCP-1 and VEGF. Also included is the production
of
is erythropoietin or any other hormone growth factors and any other
polypeptides that can serve as
agonists or antagonists and/or have therapeutic or diagnostic use. The method
according to the
invention can also be advantageously used for production of antibodies, such
as monoclonal,
polyclonal, multispecific and single chain antibodies, or fragments thereof,
e.g. Fab, Fab',
F(ab')2, Fc and Fc'-fragments, heavy and light immunoglobulin chains and their
constant,
zo variable or hypervariable region as well as Fv- and Fd-fragments (Chamov,
S.M. et al. (1999)
Antibody Fusion Proteins, Wiley-Liss Inc.)
Fab fragments (Fragment antigen-binding = Fab) consist of the variable regions
of both chains
which are held together by the adjacent constant region. These may be formed
by protease
zs digestion, e.g. with papain, from conventional antibodies, but similar Fab
fragments may also be
produced in the mean time by genetic engineering. Further antibody fragments
include F(ab')2
fragments, which may be prepared by proteolytic cleaving with pepsin.
Using genetic engineering methods it is possible to produce shortened antibody
fragments which
3o consist only of the variable regions of the heavy (VH) and of the light
chain (VL). These are
referred to as Fv fragments (Fragment variable = fragment of the variable
part). Since these Fv-
fragments lack the covalent bonding of the two chains by the cysteines of the
constant chains, the
Fv fragments are often stabilised. It is advantageous to link the variable
regions of the heavy and
of the light chain by a short peptide fragment, e.g. of 10 to 30 amino acids,
preferably 1 S amino
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
acids. In this way a single peptide strand is obtained consisting of VH and
VL, linked by a
peptide linker. An antibody protein of this kind is known as a single-chain-Fv
(scFv). Examples
of scFv-antibody proteins of this kind known from the prior art are described
in Huston C. et al.
(1988) Proc. Natl. Acad. Sci. USA, 16, pp. 5879.
s
In recent years, various strategies have been developed for preparing scFv as
a multimeric
derivative. This is intended to lead, in particular, to recombinant antibodies
with improved
pharmacokinetic and biodistribution properties as well as with increased
binding avidity. In order
to achieve multimerisation of the scFv, scFv were prepared as fusion proteins
with
io multimerisation domains. The multimerisation domains may be, e.g. the CH3
region of an IgG or
coiled coil stmcture (helix structures) such as Leucin-zipper domains.
However, there are also
strategies in which the interaction between the VH/VL regions of the scFv are
used for the.
multimerisation (e.g. dia-, tri- and pentabodies). By diabody the skilled
person means a bivalent
homodimeric scFv derivative. The shortening of the Linker in an scFv molecule
to 5- 10 amino
is acids leads to the formation of homodimers in which an inter-chain VH/VL-
superimposition
takes place. Diabodies may additionally be stabilised by the incorporation of
disulphide bridges.
Examples of diabody-antibody proteins from the prior art can be found in
Perisic, O. et al. (1994)
Structure, 2, pp. 1217.
Zo By minibody the skilled person means a bivalent, homodimeric scFv
derivative. It consists of a
fusion protein which contains the CH3 region of an immunoglobulin, preferably
IgG, most
preferably IgGl as the dimerisation region which is connected to the scFv via
a Hinge region
(e.g. also from IgGl) and a Linker region. Examples of minibody-antibody
proteins from the
prior art can be found in Hu, S. et al. (1996) Cancer Res., 56, pp. 3055.
Zs
By triabody the skilled person means a: trivalent homotrimeric scFv derivative
(Kortt A.A. et al.
(1997) Protein Engineering, l0,pp. 423). ScFv derivatives wherein VH-VL are
fused directly
without a linker sequence lead to the formation of trimers.
~o The skilled person will also be familiar with so-called miniantibodies
which have a bi-, tri- or
tetravalent structure and are derived from scFv. The multimerisation is
carried out by di-, tri- or
tetrameric coiled coil structures (Pack, P. et al. (1993) Biotechnology, 11,
pp. 1271; Lovejoy, B.
et al. (1993) Science,. 259, pp. 1288; Pack, P. et al. (1995) J. Mol. Biol.,
246, pp. 28). In a
preferred embodiment of the present invention, the gene of interest is encoded
for any of those
26
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
desired polypeptides mentioned above, preferably for a monoclonal antibody, a
derivative or
fragment thereof.
In order to perform any embodiment of the present invention, an integrase has
to act on the
s recombination sequences. The integrase or the integrase gene and/or a co-
factor or a co-factor
gene, e.g. the XIS factor or the XIS factor gene and/or IHF or the IHF gene
may be present in the
eukaryotic cell already before introducing the first and second recombination
sequence. They
may also be introduced between the introduction of the first and second
recombination sequence
or after the introduction of the first and second recombination sequence.
Purification of
~o recombinase and host factor proteins has been described in the art (Hash,
H.A. (1983) Methods
of Enzymology, 100, pp. 210; Filutowicz, M. et al. (1994) Gene, 147, pp.149).
In cases when
they are not known, cell extracts can be used or the enzymes can be partially
purified using
procedures described for example for Int or Cre recombinase. The purified
proteins can be
introduced into a cell by standard techniques, for example by means of
injection or
is microinjection or by means of a lipofection as described in example 2 of
the present invention
for IHF. The integrase used for the sequence-specific recombination is
preferably expressed in
the cell in which the reaction is earned out. For that purpose a third DNA
sequence comprising
an integrase gene is introduced into the cells. If the sequence specific
recombination is earned
OLIt e.g. with ccttLlc~ttR a XIS factor gene (fourth DNA sequence) may be
introduced into the cells
Zo in addition. Most preferred is a method wherein the third and/or fourth DNA
sequence is
integrated into the eukaryotic genome of the cell or an artificial-
/minichromosome via
homologous recombination or randomly. Further preferred is a method wherein
the third and/or
fourth DNA sequence comprises regulatory sequences resulting in a spatial
and/or temporal
expression of the integrase gene and/or XIS factor gene.
Zs
In this case a spatial expression means that the Int recombinase, the XIS
factor, and/or the IHF
factor, respectively, is expressed only in a particular cell type by use of
cell type specific
promotors and catalyzes the recombination only in these cells, e.g. in liver
cells, kidney cells,
nerve cells or cells of the immune system. In the regulation of the
integrase/XIS factor/IHF
3o expression a temporal expression may be achieved by means of promotors
being active from or
in a particular developmental stage or at a particular point of time in an
adult organism.
Furthermore, the temporal expression may be achieved by use of inducible
promotors, e.g. by
interferon or tetracycline depended promotors; see review of Miiller, U.
(1999) Mech.
Develop.,82, pp. 3.
27
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
The integrase used in the method of the present invention may be both the wild-
type and the
modified (mutated) integrase of the bacteriophage lambda. As the wild-type
integrase is only
able to perform the recombination reaction at a high efficiency with a co-
factor, namely IHF, it is
s preferred to use a modified integrase in the method of the present
invention. If the wild-type
integrase is used in the method of the present invention, IHF may be needed in
addition to
achieve a stimulation of the recombination reaction. The modified integrase is
modified such that
said integrase may carry out the recombination reaction without IHF or other
host factors such as
XIS and FIS. For example, a recombination reaction between attL~and attR
sequences may be
io preformed by a modified Int without the addition of a host factor (see
results 5.1 and Figure 2C
and 2D).
The generation of modified polypeptides and screening for the desired activity
is state of the art
and may be performed easily; Erlich, H. (1989) PCR Technology. Stockton Press.
For example,
is a nucleic acid sequence encoding for a modified integrase is intended to
include any nucleic acid
sequence that will be transcribed and translated into an integrase either in
vitro on upon
introduction of the encoding sequence into bacteria or eukaryotic cells. The
modified integrase
protein encoding sequences can be naturally occurring (by spontaneous
mutation) or
recombinantly engineered mutants and variants, tnmcated versions and
fragments, functional
Zo equivalents, derivatives, homologs and fusions of the naturally occurnng or
wild-type proteins as
long as the biological functional activity, meaning the recombinase activity,
of the encoded
polypeptide is maintained. Recombinase activity is maintained, when the
modified recombinase
has at least 50%, preferably at least 70%, more preferred at least 90%, most
preferred at least
100% of the activity of the wild-type integrase Int, measured in a co-
transfection assay with
Zs substrate vectors and expression vectors as described in results 5.1 of the
present invention or in
Example 3 of WO 01/16345. Certain amino acid sequence substitutions can be
made in an
integrase or its underlying nucleic acid coding sequence and a protein can be
obtained with like
properties. Amino acid substitutions that provide functionally equivalent
integrase polypeptides
by use of the hydropathic index of amino acids (Kyte, J. et al. (1982) J. Mol.
Biol., 157, pp. 105)
3o can be prepared by performing site-specific mutagenesis or polymerase chain
reaction mediated
mutagenesis on its underlying nucleic acid sequence. In the present invention
mutants or
modified integrases are preferred, which show in comparison to a wild-type
protein improved
recombinase activity/recombination efficiency or an recombination activity
independent of one
or more host factors. "Wild-type protein" means a complete, non truncated, non
modified,
28
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
naturally occurring gene of the encoding polypeptide. Two Int mutants
preferred are
bacteriophage lambda integrases designated as Int-h and Int-h/218; Miller et
al. (1980) Cell, 20,
pp. 721; Christ, N. and Droge, P. (1999) J. Mol. Biol., 288, pp. 825. Int-h
includes a lysine
residue instead of a glutamate residue at position 174 in comparison to wild-
type Int. Int-h/218
s includes a further lysine residue instead of a glutamate residue at position
218 and was generated
by PCR mutagenesis of the Int-h gene. Said mutants may catalyze the
recombination between
c~ttBlattB, attPlattP, attLlattL or attRlattR and all other possible
combinations, e.g. attPlattR,
ccttLlattP, attLlattB, or attRlattB or the derivatives thereof without the co-
factors IHF, XIS,
and/or FIS and negative supercoiling in E. coli, in eukaryotic cells, and in
vitro, i.e. with purified
~o substrates in a reaction tube. An improvement of the efficiency of the
recombination may be
achieved with a co-factor, e.g. FIS. The mutant Int-h/218 is preferred,
because this mutant
catalyze the recombination reaction with increased efficiency.
If the first reaction leads to an excision and the used two recombination
sequences are identical,
~s e.g, attPlP, the resulting recombination sequences after the recombination
will be identical to
those on the substrate, e.g. here two attP sequences. If however, the two
partner sequences are
different, e.g. attPlR, the recombination reaction will generate hybrid
recombination sequences
which comprise one functional half from one sequence (e.g. attP) and one half
from the other
(ccttR). A functional half recombination site can be defined as the sequence
either 5' or 3' form
zo the overlap, whereby the overlap is considered, in each case, as a part of
a funtional half site. If
the respective overlap region of the used recombination sequences is identical
the excision
reaction may be performed with any recombination sequence according to the
invention.
Additionally, the overlap region designates the orientation of the
recombination sequences to
each other also, i.e. inverted or direct. The reaction may be performed with
wilt-type Int with
zs low efficiency only, however, the addition of IHF or in the absence of IHF
the presence of arm
binding sites) in addition to the core binding site stimulates and increases
the efficiency. The
reaction may be performed without any cofactor by a modified Int.
Furthermore, a method is preferred wherein a further DNA sequence comprising a
Xis factor
3o gene is introduced into the cells. Most preferred is a method wherein the
further DNA sequence
further comprises a regulatory DNA sequence giving rise to a spatial and/or
temporal expression
of the Xis factor gene.
For example, after successful integrative intramolecular recombination
(inversion) by means of
29
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
Int leading to the activation/inactivation of a gene in a particular cell type
said gene may be
inactivated or activated at a later point of time again by means of the
induced spatial and/or
temporal expression of XIS with the simultaneously expression of Int.
s Furthermore, the invention relates to the use of any recombination sequences
or the derivative
thereof, e.g. to the derivative of attP as specified in SEQ ID NO: 2 in a
sequence specific
recombination of DNA in eukaryotic cells. The eukaryotic cell may be present
in a cell aggregate
of an organism, e.g. a mammal, having no integrase or Xis factor in its cells.
Said organism may
be used for breeding with other organisms having in their cells the integrase
or the Xis factor so
io that off springs are generated wherein the sequence specific recombination
is performed in cells
of said off springs. Thus, the invention relates also to the use of an
integrase or an integrase gene
and a Xis factor or a Xis factor gene and an IHF factor or an IHF factor gene
in a sequence .
specific recombination in eukaryotic cells. Furthermore, the present invention
relates to
eukaryotic cells and cell lines in which the method of the present invention
was performed,
is wherein said cells or cell lines are obtained after performing the method
of the present invention.
The practice of the present invention will employ, unless otherwise indicated,
conventional
techniques of cell biology, molecular biology, cell culture, immunology and
the like which are in
the skill of one in the art. These techniques are fully disclosed in the
current literature. See e.g.
zo Sambrook et al., Molecular Cloning: A Laboratory Manual, 2°'~ Ed.,
Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al., Current
Protocols in
Molecular Biology (1987, updated); Brown ed., Essential Molecular Biology, IRL
Press (1991);
Goeddel ed., Gene Expression Technology, Academic Press (1991); Bothwell et
al. eds.,
Methods for Cloning and Analysis of Eukaryotic Genes, Bartlett Publ. (1990);
Wu et al., eds.,
zs Recombinant DNA Methodology, Academic Press (1989); Kriegler, Gene Transfer
and
Expression, Stockton Press (1990); McPherson et al., PCR: A Practical
Approach, IRL Press at
Oxford University Press (1991); Gait ed., Oligonucleotide Synthesis (1984);
Miller & Calos eds.,
Gene Transfer Vectors for Mammalian Cells (1987); Butler ed., Mammalian Cell
Biotechnology
( 1991 ); Pollard et al., eds., Animal Cell Culture, Humana Press ( 1990);
Freshney et al., eds.,
3o Culture of Animal Cells, Alan R. Liss (1987); Studzinski, ed., Cell Growth
and Apoptosis, A
Practical Approach, IRL Press at Oxford University Presss (1995); Melamed et
al., eds., Flow
Cytometry and Sorting, Wiley-Liss (1990); Current Protocols in Cytometry, John
Wiley & Sons,
Inc. (updated); Wirth & Hauser, Genetic Engineering of Animals Cells, in:
Biotechnology Vol.
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
2, Piihler ed., VCH, Weinheim 663-744; the series Methods of Enzymology
(Academic Press,
Inc.), and Harlow et al., eds., Antibodies: A Laboratory Manual (1987).
All publications and patent applications mentioned in this specification are
indicative of the level
s of skill of those skilled in the art to which this invention pertains. All
publications and patent
applications cited herein are hereby incorporated by reference in their
entirety in order to more
fully describe the state of the art to which this invention pertains. The
invention generally
described above will be more readily understood by reference to the following
examples, which
are hereby included merely for the purpose of illustration of certain
embodiments of the present
io invention and are not intended to limit the invention in any way.
Examples
Methods
1. Production of expression and substrate vectors
~s The construction of mock and Int expression vectors pCMV, pCMVSSInt,
pCMVSSInt-h,
and pCMVSSInt-h/218 have been described; Lorbach, E. et al. (2000) J. Mol.
Biol, 296,
pp.1175. Int expression is driven by the human cytomegalovirus promoter.
Substrate vectors used in intramolecular recombination assays, containing
attBlattP (p~,IR) or
Zo attLlattR (p7~ER) as direct repeats, are derivatives of pGEM'~4Z (Promega).
p~,IR was
constricted by inserting attB as double-stranded oligonucleotide into
CIaI/EcoRI-cleaved
pPGKneo. This vectors is a derivative of pPGKSSInt-h, in which the Int-h gene
was replaced
by a neomycin gene (neo) using PstIlXbaI. The CMV promoter plus a hybrid
intron was
generated by PCR using pCMVSSInt as template and cloned into the KpnI/CIaI-
cleaved,
zs ~zttB-containing pPGKneo vector. This CMV-attB-neo-expression cassette was
then cloned by
PCR into BamHI-cleaved pGEM~4Z. The attP site, containing an A-to-C
substitution in the
P'-arm which deletes a translational stop signal, was generated by assembly
PCR using
primers
(attP01) 5'-GTCACTATCAGTCAAAATACAATCA-3', (SEQ ID NO: 3).
30 (attP02) 5'-TGATTGTATTTTGACTGATAGTGAC-3', (SEQ ID NO: 4)
(PFP-NsiI) 5'-CCAATGCATCCTCTGTTACAGGTCACTAATAC-3', (SEQ ID NO: S)
and (P'RP-EcoRV-NotI) 5'-ATAAGAATGCGGCCGCAGATATCAGG
GAGTGGGACAAA.ATTGAA-3' (SEQ )D NO: 6).
31;1
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
pGFPattBlattP was used as template (Lorbach, E. et al. (2000) , supra). The
PCR fragment
was cleaved with NsiI and NotI and ligated to the 3'-end of a BamHI/PstI-
fragment containing
a transcriptional stop cassette, which was generated from pBS302 (Gibco/BRL).
The GFP
gene and the polyA signal was cloned by PCR using pCMVSSGFP (a derivative of
s pCMVSSInt-h, in which the Int-h gene is replaced by eGFP using PstIlXbaI).
The GFP-
containing PCR fragment was cleaved with NotI and XbaI and was then ligated
together with
the BamHIlNotI-cleaved transcriptional stop/attP fragment into the BamHIlXbaI-
cleaved
vector already containing the CMV promoter, attB, and the neo expression
cassette. p7~ER
was constricted as p7~IR, except that attL was generated by PCR using
pGFPattLlattR
to (Lorbach, E. et al. (2000), supra) as template, and was cloned into the
CIaI/EcoRI-cleaved
pPGKneo. The attR site was generated by PCR using pGFPattLlattR as template,
and the
product was cleaved with NsiI and NotI.
Substrate vectors for intermolecular recombination assays which contain the
CMV promoter
~ s in front of different attachment sites: pCMVattPmut contains three G-to-C
substitutions in the
P-arm. These changes were necessary to eliminate ATG start codons that would
prevent GFP
expression after recombination. The substitutions are outside of protein
binding sites in c~ttP
and were introduced by assembly PCR. First, two overlapping PCR products were
generated,
one with primer pair c~ttP-ATC-1/attP-2 and one with nttP-ATC-3/czttP-4.
pGFPattBlattP was
zo used as template. PCR products were gel-purified and used as templates for
PCR with primers
attP-PstI and attP-XbaI. The resulting product was digested with PstI and
XbuI, and cloned
into pCMVSSInt: The primer sequences for assembly PCR are:
(attP-ATC-1) 5'-TTTGGATAAAAAACAGACTAGATAATACTGTAAAACA
CAAGATATGCAGTCACTA-3', (SEQ ID NO: 7)
zs (attP-2) 5'-TAACGCTTACAATTTACGCGT-3', (SEQ ID NO: 8)
(attP-ATC-3) 5'-CTGCATATCTTGTGTTTTACAGTATTATCTAGTCTG
TTTTTTATCCAAAATCTAA-3', (SEQ ID NO: 9)
(attP-4) 5'CTGGACGTAGCCTTCGGGCATGGC-3', (SEQ ID NO: 10)
(attP-PstI) 5'-GACTGCTGCAGCTCTGTTACAGGTCAC-3', (SEQ ID NO: 11)
30 (attP-XbaI) S'-GACTGTCTAGAGAAATCAAATAATGAT-3' (SEQ ID NO: 12).
pCMVattB was generated by inserting attB as double-stranded oligonucleotide
into
PstI/XbaI-cleaved pCMVattPmut. pCMVattL was generated by PCR using p7~ER as
template
for attL, which was introduced into PstI/XbaI-cleaved pCMVattPmut.
32
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
Vectors which contain a transcriptional stop signal and an att site placed in
front of a
promoterless GFP gene were constructed as follows: pWSattBGFP was generated by
first
deleting a part of the hygromycin gene from pTKHyg (Clontech) using AvaI and
NdeI. The
s vector backbone was ligated after the sticky ends were made blunt by Klenow
polymerise. An
attB-GFP fragment, generated by PCR, was cloned into MfeI and HindIII sites,
thereby creating
a new NheI site 5' of attB. Finally, the transcriptional stop sequence was
inserted through.
restriction with EcoRI and NheI. pWSc~ttRGFP was generated by isolating the
BczmHIlNotI
transcriptional stop-attR fragment from p~,ER, which was inserted into
pWSattBGFP cleaved
io with the same enzymes. pWSattPGFP was generated by PCR of the ~ttP site
using
pGFPattPlattB as template, which was inserted into pWSattBGFP cleaved with
EcoRIlNotI thus
replacing attB. Plasmids were isolated from E. coli strain XL1-Blue using
affinity
chromatography (Qiagen). The nucleotide composition of relevant genetic
elements was verified
by DNA sequencing using the fluorescence-based 373A system (Applied
Biosystems).
is
2. Cell culture, recombination assays, and flow cytomery
HeLa cells were cultured in Dulbecco's modified eagle medium (DMEM)
supplemented with
10% fetal calf serum, streptomycin [0,1 mg/ml] and penicillin [100 U/ml].
Cells were passaged
twice before transfection.
zo
Typical recombination assays were performed as follows. Cells were harvested,
washed with
PBS and resuspended in RPMI 1640 without L-glutamine and phenol red (Life
Technologies).
A total of 60 pg of expression and substrate vectors at a molar ratio of 1:1
were then introduced
into approximately 1 x 107 cells at 300V and 960pF using a Gene pulser (Bio-
Rad). After
zs electroporation, cells were plated in an appropriate dilution on 10 cm
dishes. A single-cell
suspension was prepared at 24, 48, and 72 hrs after transfection. Dead cells
were excluded from
the analysis by staining with 7-amino-actinomycin D (Sigma), and cells were
analyzed by
FACScalibur (Becton Dickinson). FACS data were analyzed with CellQuestT~''
software. The
transfection efficiencies for intermolecular recombination assays were
determined for each
3o experiment by co-transfecting 40 pg pCMV with 20 pg pEGFP-C1 (Clontech);
those for
intramolecular recombination were determined with 30 pg pCMV and 30 pg pEGFP-C
1.
Experiments involving purified IHF were performed by introducing first 30 pg
of Int
expression vectors to approximately 6 x 106 cells via electroporation as
described above. After 3
33
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
to 4 hrs, about 1 x 105 cells were transfected with 2 pg of substrate vectors
for intramolecular
recombination, or with a total of 2 pg of substrate vectors at a molar ratio
of l:l for
intermolecular recombination. Substrates were pre-incubated at room
temperature with 2 ~g
purified IHF (Lange-Gustafson BJ, Nash HA., Purification and properties of Int-
h, a variant
s protein involved in site-specific recombination of bacteriophage lambda., J
Biol Chem. 1984
Oct 25;259(20):12724-32) in a low salt buffer (50 mM NaCI, 10 mM Tris-HC1, pH
8.0, 1 mM
EDTA) for at least 30 minutes. Transfection of IHF-DNA complexes was achieved
with
FuGene (Boehringer Mannheim) and the efficiencies were always in the range of
80%. Cells
were analyzed by flow cytometry after additional 48 hrs as described above.
~o
CHO-DG44/dhfr ~~ cells (Urlaub, G. et al., (1983), Cell, 33, pp. 405), grown
permanently in
suspension in the serum-free medium CHO-S-SFMII (Invitrogen, Carlsbad, CA)
supplemented
with hypoxanthine and thymidine (Invitrogen, Carlsbad, CA), are incubated in
cell culture flasks
at 37°C in a humidified atmosphere containing 5% COz. Cells are seeded
at a concentration of 1-
is 3x105 cells/mL in fresh medium every two to three days.
Stable transfections of CHO-DG44 cells are conducted using Lipofectamine Plus
reagent
(Invitrogen, Carlsbad, CA). Per transfection 6x105 exponentially growing cells
in 0,8 mL
hypoxanthine/thymidine (HT)-supplemented CHO-S-SFMII medium are seeded in a
well of a 6-
well chamber. A total of 1 pg plasmid DNA , 4 ~uL Lipofectamine and 6 pL Plus
reagent in a
zo volume of 200 yL is used for each transfection and added to the cells,
following the protocol of
the manufacturer. After incubation for 3 hours 2 mL of HT-supplemented CHO-S-
SFMII
medium is added. In the case of neomycin phosphotransferase-based selection
the medium is
replaced 2 days after transfection with CHO-S-SFMII medium, supplemented with
HT and 400
yg/mL 6418 (Invitrogen), and the mixed cell populations are selected for 2 to
3 weeks with
z> medium changes every 3 to 4 days. For the DHFR-based selection of stable
transfected CHO-
DG44 cells CHO-S-SFMII medium without hypoxanthine/thymidine is used. DHFR-
based gene
amplification is achieved by adding 5 - 2000 nM methotrexate (Sigma,
Deisenhofen, Germany)
as amplifying selection agent to the medium.
30 3. sICAM and MCP-1 ELISA
sICAM titers in supernatants of stable transfected CHO-DG44 cells are
quantified by ELISA
with standard protocols (Ausubel, F.M. et al., (1994, updated) Current
protocols in molecular
biology. New York: Greene Publishing Associated and Wiley-Interscience) using
two in house
34
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
developed sICAM specific monoclonal antibodies (as described for example in US
patents No.
5,284,931 and 5,475,091), whereby one of the antibodies is a HRPO-conjugated
antibody.
Purified sICAM protein is used as a standard. Samples are analyzes using a
Spectra Fluor Plus
reader (TECAN, Crailsheim, Germany).
s MCP-1 titers in supernatants of stable transfected CHO-DG44 cells are
quantified by ELISA
using the OptEIA human MCP-1 set according to the manufacturer's protocol (BD
Biosciences
Pharmingen, Heidelberg, Germany).
Example 1: Kinetics of intra- and intermolecular recombination reactions
io We showed in our previous studies that mutant Int catalyzed intramolecular
integrative and
excisive recombination reactions in the absence of natural accessory factors
in E. coli and in
human cells (Christ, N. et al. (1999), sz~pra; Lorbach, E. et al. (2000),
szcpra). However, an
interesting question with respect to interactions of episomal DNA segments
inside mammalian
cells concerns the ability of mutant Int to perform intermolecular
recombination, i.e. when two
is recombination sites are located on different DNA molecules in traps. We
compared therefore
first intra- and intermolecular integrative recombination reactions.
Intramolecular recombination was tested with a substrate that contains attB
and attP as direct
repeats flanking a transcriptional stop signal. This recombination cassette,
in turn, is flanked by
zo a CMV promoter and the coding region for GFP. Recombination between attB
and attP
generates hybrid sites attL and attR, and leads to excision of the stop
signal. Subsequent
expression of the GFP gene thus serves as reporter of recombination (Figure
2A, top).
Expression vectors for either Int, Int-h, or Int-h/218 were co-transfected
with the substrate
~s vector into HeLa cells. The expression vector backbone (mock) was used as
negative control.
Transfection efficiencies independently determined for each experiment were in
the range of 95
to 98% (data not shown). FAGS analyses from 3 experiments show that both
mutant Int
efficiently catalyzed recombination, leading in some experiments to about 30%
GFP-expressing
cells (Figure 2A, bottom). The nucleotide sequence of recombination products,
determined
3o indirectly by DNA sequencing of PCR fragments, confirmed that the strand-
transfer-reactions
catalyzed by mutant Int generated the expected hybrid att sites (data not
shown).
It is apparent that the double mutant Int-h/218 was more active than Int-h,
whereas wild-type Int
was almost inactive. The fraction of GFP-expressing cells increased during 48
hrs after
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
transfection and remained steady for the next 24 hrs. The time course of the
reactions also
indicates that a majority of recombination events must have occurred within
the first 24 hrs.
This correlates well with the time course of Int-h/218 expression in HeLa
cells (data not shown).
Although we cannot exclude the possibility that a fraction of GFP-expressing
cells resulted from
s inter- instead of intramolecular integrative recombination, the data set can
be used as a reference
for our analysis of intermolecular recombination.
We analyzed intermolecular integrative recombination by placing attB and attP
on separate
plasmids. Recombination translocates the CMV promoter to a position upstream
of the GFP
~o gene (Figure 2B, top). Hence, only intermolecular recombination between
attB and attP will
generate GFP-expressing cells. FACS analyses after co-transfection of the two
substrate vectors
with Int expression vectors yielded results which are comparable to those
generated with
substrates for intramolecular recombination (Figure 2B, bottom). Again, the
majority of
recombination events must have occurred within the first 24 hrs after
transfection and Int-h/218
~s was more active than Int-h. Wild-type Int generated only a very small
fraction of GFP-
expressing cells. These results demonstrate that over a time course of 24 to
72 hrs,
intermolecular integrative recombination by mutant Int is at least as
efficient as the
corresponding intramolecular reaction.
Zo The same experimental strategy was then employed to compare intra- and
intermolecular
excisive (attL x attR) recombination pathways. The results revealed again that
intermolecular
recombination by mutant Int was as efficient as intramolecular recombination
(Figure 2C and
D). The efficiency of excisive recombination reactions, however, was slightly
reduced
compared to integrative recombination. Recombination by wild-type Int was
again barely
zs detectable.
Example 2: DNA arm-binding sites in att are not required, but stimulate
recombination
The results so far show that mutant Int catalyzed integrative and excisive
recombination on
episomal substrates in a significant number of transfected cells. In contrast,
recombination
3o activities of wild-type Int was barely detectable above background. Since
excisive
recombination by wild-type Int depends on the presence of protein co-factors
IHF and XIS, but
does not require negative DNA supercoiling, this result demonstrates that
eukaryotic
counterparts of these co-factors are lacking in human cells. Further, it is
known that episomal
substrates are topologically relaxed soon after transfection (Schwikardi et
al. (2000) FEBS
36
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
Letters, 471, pp. 147). It appears, therefore, that mutant Int perform
recombination without the
formation of defined nucleoprotein complexes, such as the intasome assembled
at attP. This
raises the question of the functional role of DNA arm-binding sites in
recombination. They were
present in at least one of the partner att sites employed so far.
s
In order to investigate this question, we used intermolecular recombination
with pairs of
substrate vectors containing attB or attP in various combinations (Figure 3A).
The fraction of
GFP-expressing cells that results from recombination was determined by FAGS at
48 hrs after
co-transfection with Int expression vectors. Transfection efficiencies were
always above 90%
~o (data not shown). The results from 3 experiments show that intermolecular
recombination
between pairs of attP was as efficient as recombination between attB and attP
(Figure 3B).
However, only Int-h/218 utilized pairs of attB sites as substrate to a
significant extent. The
efficiency of this reaction was, on average, about four-fold reduced compared
to reactions
between attP and attP or attB and attP (Figure 3B) Hence, the fraction of GFP-
expressing cells
~s that results from recombination between two attB sites dropped to a level
of 4 to 5%. These
results demonstrate that the presence of arm-type sequences in att sites is
not required for
recombination by Int-h/218, but significantly stimulates the reaction. This
stimulatory effect is
even more pronounced (about eight-fold) when Int-h was used. Farther, the
residual
recombination activity observed with wild-type Int appears highly dependent on
the presence of
zo arm binding sites.
Example 3: Recombination by wild-type Int is stimulated by transfected IHF
protein
Efficient integrative recombination catalyzed by wild-type Int in vitro and in
E. coli requires the
protein co-factor IHF and supercoiling of attP. The apparent lack of either co-
factor in
as mammalian cells thus led us to investigate whether the residual
recombination activity of wild
type Int is augmented if purified IHF, pre-incubated with a supercoiled
substrate, is co-
introduced into HeLa cells. To test this possibility, we introduced first
expression vectors for
either wild-type Int or Int-h. At 3 to 4 hrs after electroporation, substrates
for intra- or
intermolecular recombination were incubated either with or without purified
IHF. Protein-DNA
~o mixtures as well as protein-free control samples were then transfected
using Fugene (Figure
4A). The fractions of GFP-expressing cells were compared after additional 48
hrs.
The results from three experiments show that intramolecular recombination by
wild-type Int
was stimulated, on average, up to five-fold due to the presence of IHF. The
fraction of GFP-
37
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
positive cells increased, for example, in one experiment from about 1% in the
absence of IHF to
6% in its presence. The stimulatory effect on intermolecular recombination was
also significant,
bLlt less pronounced (about three-fold). At 48 hrs after transfection, the
stimulation was specific
for wild-type Int since the activity of Int-h was not affected. Importantly,
controls showed that
s transfection efficiencies were also not affected by the presence of IHF
protein (data not shown).
Example 4: Improved protein expression system based on sequence-specific
recombination of
gene of interest
CHO-DG44 cells are stably transfected with a linearized first plasmid DNA
expressing the
~o fluorescent protein ZsGreenl from Zoc~nthus sp. (Clontech Laboratories
Inc., Palo Alto, CA,
U.S.A.) and the antibiotic resistance gene neomycin phosphotransferase (Figure
S). In addition,
either an attB or an attP recombination sequence (natural or modified sequence
or derivative
thereof) is placed between the gene for the fluorescent protein and its
promoter. The first
plasmid DNA, linearized by using a restriction enzyme with a single
restriction site outside the
is transcription units for both selection markers, is introduced by random
integration into the
genome of CHO-DG44. Cells with a successful stable random integration of the
first plasmid
DNA are positively selected for by cultivation in the presence of the
antibiotic 6418. Within the
heterogeneous pool of stable transfectants cells with a high transcription
activity at the
integration site of the first plasmid DNA can be isolated simply by
fluorescence activated cell
zo sorting (FACS) based on the expression level of the introduced fluorescent
protein ZsGreenl.
Cells with the highest ZsGreenl fluorescence are sorted and placed as single
cells into the wells
of a 96 well plate. The resulting cell subclones are expanded and tested by
restriction
endoncuclease mapping in Southern blot analysis for integration of a single
plasmid sequence in
a single chromosomal site. For the latter genomic DNA of the cell subclones is
digested with
zs restriction enzymes with no, one and multiple restriction sites within the
introduced first
plasmid DNA, respectively, electrophoresed on a 0.8% agarose gel and
transferred to positvely
charged nylon membrane (Amersham Biosciences, Freiburg, Germany).
Hybridization is
performed overnight at 65°C in a hybridization oven with a random-
primed FITC-dUTP labeled
probe consisting of the ZsGreenl gene according to the protocol of the Gene
Images random
3o prime labelling module (Amersham Biosciences). Candidate subclones with a
single copy insert
are subsequently tested in small scale bioreactors for their performance in a
production-
mimicking fedbatch process. Besides high expression levels during the complete
production
phase, monitored by measuring the ZsGreenl fluorescence, other important
parameters such as
high viability at high cell density, metabolism and reproducible performance
are taken into
38
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
account. This way a suitable host cell with an integrated first att
recombination sequence is
identified. To generate a production cell line producing a biopharmaceutical
by sequence-
specific recombination this host cell is transfected with a second plasmid DNA
(see Figure 5)
containing a promoterless dihydrofolate reductase gene preceded by either an
attB or an attP
s recombination sequence (natural or modified sequence or derivative thereof)
and a complete
transcription unit for the expression of the gene of interest, for example the
common cold
therapeutic sICAM (soluble intercellular adhesion molecule 1) or the human
monocyte
chemoattractant protein-1 (MCP-1). In addition the vector pCMVSSInt-h/218
expressing the
mutated (modified) bacteriophage lambda integrase is co-transfected. After
transfection,
~o transient expression of Int-h/218 is sufficient to perform the sequence-
specific intermolecular
recombination between the first att recombination site (either attP or attB)
located at a preferred
transcriptional active locus within the host cell genome and the second att
recombination site
(either attP or attB) on the introduced second DNA plasmid. To select for
cells where a
sequence-specific recombination between attP and attP, attP and attB or attB
and attB has
~s occurred, depending on the choice of the recombination sequence on the
first and second DNA
plasmid, transfected cells are transferred and cultivated in CHO-S-SFMII
medium without the
supplements hypoxanthin and thymidine. Only correct targeting results in cells
surviving the
selection by placing via recombination the promoterless dhfr-marker gene with
an upstream att
recombination site on the second DNA plasmid under the control of the promoter
sequence of
zo the ZsGreenl gene with a downstream att recombination site, thus allowing
for the efficient
expression of the dhfr selection marker gene. At the same time the functional
expression
cassette of the ZsGreenl gene is interrupted leaving behind a promoterless
ZsGreenl gene. Thus
cells do not express a fluorescent protein any longer. The non-fluorescing
cells are identified
and isolated by FACS providing a means to detect the cells producing the
protein of interest. In
zs addition, sequence-specific integration is verified by Southern Blot and
PCR analysis with
primers located in the sequences flanking the att sites before and after site-
specific
recombination followed by subsequent DNA sequencing. Expression of the protein
of interest,
sICAM or MCP-1, is assayed by ELISA.
The use of dhfr as marker gene for the generation of production cell lines
offers not only the
3o advantage of positive selection but also the possibility to increase the
productivity of the cell by
methotrexate-induced DHFR-based gene amplification even further. This is
achieved by
supplementing the hypoxanthin/thymidine-free cultivation medium CHO-S-SFMII
with
increasing amounts of methotrexate.
39
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
SEQUENCE LISTING
<110> BOEHRINGER INGELHEIM PHARMA GmbH & Co. KG
Droge, Peter
<120> Sequence specific DNA recombination in eukaryotic cells
<130> DRO-003 PCT
<140> unknown
<141> 2003-11-28
<150> CA 2,413,175
<151> 2002-11-28
<150> US 10/310,695
<151> 2002-12-05
<160> 17
<170> PatentIn version 3.1
<210> 1
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<223> Consensus sequence for Int binding-site
<220>
<221> misc feature
<222> (1)..(1)
<223> c or a
<400> 1
magtcactat 10
<210> 2
<211> 243
<212> DNA
<213> Artificial Sequence
1/5
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
<220>
<223> attP derivative
<400>
2
tctgttacaggtcactaataccatctaagtagttgattcatagtgactgcatatcttgtg 60
ttttacagtattatctagtctgttttttatccaaaatctaatttaatatattgatattta 120
tatcattttacgtttctcgttcagcttttttatactaagttggcattataaaaaagcatt 180
gcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgat 240
ttc 243
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 3
gtcactatca gtcaaaatac aatca 25
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 4
tgattgtatt ttgactgata gtgac 25
<210> 5
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 5
ccaatgcatc ctctgttaca ggtcactaat ac 32
2/5
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
<210> 6
<211> 44
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 6
ataagaatgc ggccgcagat atcagggagt gggacaaaat tgaa 44
<210> 7
<211> 55
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 7
tttggataaa aaacagacta gataatactg taaaacacaa gatatgcagt cacta 55
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 8
taacgcttac aatttacgcg t 21
<210> 9
<211> 55
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
3/5
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
<400> 9
ctgcatatct tgtgttttac agtattatct agtctgtttt ttatccaaaa tctaa 55
<210> 10
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 10
ctggacgtag ccttcgggca tggc 24
<210> 11
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 11
gactgctgca gctctgttac aggtcac 27
<210> 12
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 12
gactgtctag agaaatcaaa taatgat 27
<210> 13
<211> 21
<212> DNA
<213> Escherichia coli
<400> 13
4/5
CA 02504010 2005-04-27
WO 2004/048584 PCT/EP2003/013414
ctgctttttt atactaactt g 21
<210> 14
<211> 243
<212> DNA
<213> Bacteriophage lambda
<400>
14
tctgttacaggtcactaataccatctaagtagttgattcatagtgactgcatatgttgtg60
ttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatattta120
tatcattttacgtttctcgttcagcttttttatactaagttggcattata-~aaaaagcatt180
gcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgat240
ttc 243
<210> 15
<211> 102
<212> DNA
<213> Escherichia coli
<400> 15
ctgctttttt atactaagtt ggcattataa aaaagcattg cttatcaatt tgttgcaacg 60
aacaggtcac tatcagtcaa aataaaatca ttatttgatt tc 102
<210> 16
<211> 162
<212> DNA
<213> Escherichia coli
<400> 16
tctgttacag gtcactaata ccatctaagt agttgattca tagtgactgc atatgttgtg 60
ttttacagta ttatgtagtc tgttttttat gcaaaatcta atttaatata ttgatattta 120
tatcatttta cgtttctcgt tcagcttttt tatactaact tg 162
<210> 17
<211> 27
<212> DNA
<213> Homo sapiens
<400> 17
gaaattcttt ttgatactaa cttgtgt 27
5/5
