Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 312
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 312
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
1
Description
STRESS-RELATED POLYPEPTIDES AND USES THEREFOR
Cross Reference To Related Applications
This application is based on and claims priority to United States
Provisional Application Serial Number 60/463,564, filed December 26, 2002,
which is herein incorporated by reference in its entirety.
Technical Field
The presently disclosed subject matter relates, in general, to
transgenic plants. More particularly, the presently disclosed subject matter
relates to stress-related polypeptides, nucleic acid molecues encoding the
polypeptides, and uses thereof.
Table of Abbreviations
ABA - abscisic acid
AOS - active oxygen species
FPD - Functional Protein Domain
HR - hypersensitive response
HSPs - high scoring sequence pairs
LR - local resistance
PP2A - type 2A serine/threonine protein
phosphatase
SA - salicylic acid
SAR - systemic acquired resistance
Amino Acid Abbreviations and Corresponding mRNA Codons
Amino Acid 3-Letter 1-Letter mRNA Codons
Alanine Ala A GCA GCC GCG GCU
Arginine Arg R AGA AGG CGA CGC CGG CGU
Asparagine Asn N AAC AAU
Aspartic Acid Asp D GAC GAU
Cysteine Cys C UGC UGU
Glutamic Acid Glu E GAA GAG
Glutamine Gln Q CAA CAG
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
2
Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU
Isoleucine Ile I AUA AUC AUU
Leucine Leu L UUA UUG CUA CUC CUG CUU
Lysine Lys K AAA AAG
Methionine Met M AUG
Proline Pro P CCA CCC CCG CCU
Phenylalanine Phe F UUC UUU
Serine Ser S ACG AGU UCA UCC UCG UCU
Threonine Thr T ACA ACC ACG ACU
Tryptophan Trp W UGG
Tyrosine Tyr Y UAC UAU
Valine Val V GUA GUC GUG GUU
Background Art
As some of the major human staples, monocot plants such as rice,
corn, and wheat have been a target of genetic engineering for resistance to
diseases, pests, and environmental stresses of various kinds. Knowledge of
plant-pathogen interactions and the complex networks of proteins that act in
concert to respond to environmental stresses has important applications in
agriculture, providing new approaches to disease control. Modulation of
interactions between proteins that participate in stress responses can be
exploited for the development of genetically engineered plants that are
resistant to pathogens. The production of pest-resistant crops provides an
alternative to environmentally damaging pesticides for improvement of
agricultural yield.
For example, detailed knowledge of signaling pathways regulating
innate immunity can help develop strategies for durable crop protection.
Resistance to disease occurs on several levels that include local and
nonspecific systemic responses. The hypersensitive response (HR) in
plants is a mechanism of local resistance to pathogenic microbes
characterized by a rapid and localized tissue collapse and cell death at the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
3
infection site, resulting in immobilization of the intruding pathogen. This
process is triggered by pathogen elicitors and orchestrated by an oxidative
burst, which occurs rapidly after the attack (Lamb & Dixon, 1997). The
accumulation of active oxygen species (AOS) is a central theme during plant
responses to both biotic and abiotic stresses. AOS are generated at the
onset of the HR and might be instrumental in killing host tissue during the
initial stages of infection. AOS also act as signaling molecules that induce
expression of PR genes and production of other signaling molecules which
participate in the signal cascade that leads to PR gene induction. The
triggering of defense genes can extend to the uninfected tissues and the
whole plant, leading to local resistance (LR) and systemic acquired
resistance (SAR; reviewed in Martinez et al., 2000). As a result of SAR,
v
other portions of the plant are provided with long-lasting protection against
the same and unrelated pathogens.
Hydrogen peroxide from the oxidative burst plays an important role in
the localized HR not only by driving the cross-linking of cell wall structural
proteins, but also by triggering cell death in challenged cells and as a
diffusible signal for the induction in adjacent cells of genes encoding
cellular
protectants such as glutathione S-transferase and glutathione peroxidase
(Levine et al., 1994) and for the production of salicylic acid (SA). SA is
thought to act as a signaling molecule in LR and SAR through generation of
SA radicals, a likely by-product of the interaction of SA with catalases and
peroxidases, as reported by Martinez et al., 2000. These authors showed
that recognition of a bacterial pathogen by cotton triggers the oxidative
burst
that precedes the production of SA in cells undergoing the HR, and that
hydrogen peroxide is required for local and systemic accumulation of SA,
thus acting as the initiating signal for LR and SAR. The involvement of
catalase in SA-mediated induction of SAR in plants was previously
demonstrated by Chen et al., 1993 who showed that binding of catalase to
SA results in inhibition of catalase activity, and that consequent
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
4
accumulation of hydrogen peroxide induces expression of defense-related
genes associated with SAR.
The cell wall can also play a role in defense against bacterial and
fungal pathogens by receiving information from the surface of the pathogen
from molecules called elicitors, and by transmitting this information to the
plasma membrane of plant cells, resulting in gene-activated processes that
lead to resistance. One type of biochemical reaction induced by elicitors and
associated with the hypersensitive response is the synthesis and
accumulation of phytoalexins, antimicrobial compounds produced in the
plant after fungal or bacterial infection (reviewed in Hammerschmidt, 1999).
Other responses can involve the expression of proteases that activate other
signalling molecules, and enzymes that allow the plant to respond with
morphological changes to physical insult produced by pathogen attack.
Stress responses do not occur in isolation from other cellular
processes, but can be intimately linked to other aspects of plant growth and
development, such as control of the cell cycle and senescence. Some
proteins are known to act both in general pathways of cellular growth and
development as well as in response to particular stresses. For example,
type 2A serine/threonine protein '~phosphatases (PP2A) are important
regulators of signal transduction, which they affect by dephosphorylation of
other proteins (Janssens & Goris, 2001 ). There are multiple PP2A isoforms
in plants and other organisms, and they appear to be differentially expressed
in various tissues and at different stages of development (Arino et al.,
1993).
Harris et al. cites a number of reports describing the association of PP2A
subunits with a variety of cellular proteins in addition to regulatory
subunits,
suggesting that PP2As function as regulators of various signaling pathways
associated with protein synthesis, cell cycle and apoptosis (Harris et al.,
1999). PP2A enzymes have been implicated as mediators of a number of
plant growth and developmental processes.
In addition, PP2A enzymes play a role in pathogen invasion. In
animals, a variety of viral proteins target specific PP2A enzymes to
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
deregulate chosen cellular pathways in the host and promote viral progeny
(Sontag, 2001; Garcia et al., 2000). PP2A enzymes interact with many
cellular and viral proteins, and these protein-protein interactions are
critical
to modulation of PP2A signaling (Sontag, supra). The proteins interacting
5 with PP2A (e.g., PP2A) can, for example, target PP2A to different
subcellular
compartments, or affect PP2A enzyme activity.
To modulate plant responses to biotic and abiotic stresses, there is a
need for a more comprehensive udnerstanding of signaling pathways and
networks of protein-protein interactions. Further, additional factors involved
in these networks must be identified to facilitate the engineering of plants
more tolerant to biotic and abiotic stresses.
Summary
This Summary lists several embodiments of the presently disclosed
subject matter, and in many cases lists variations and permutations of these
embodiments. This Summary is merely exemplary of the numerous and
varied embodiments. Mention of one or more representative features of a
given embodiment is likewise exemplary. Such an embodiment can typically
exist with or without the features) mentioned; likewise, those features can
be applied to other embodiments of the presently disclosed subject matter,
whether listed in this Summary or not. To avoid excessive repetition, this
Summary does not list or suggest all possible combinations of such features.
The presently disclosed subject matter provides proteins and nucleic
acid molecules encoding such proteins that are involved in the control and
regulation of plant maturation and development, including proliferation,
senescence, disease-resistance, stress response including stress-
resistance, and differentiation. The presently disclosed subject matter
provides compositions comprising at least one of the proteins described
herein, as well as methods for using the proteins disclosed herein to affect
plant maturation, development, and responses to stress.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
6
The presently disclosed subject matter provides an isolated nucleic
acid molecule encoding a stress-related polypeptide, wherein the
polypeptide binds in a yeast two hybrid assay to a fragment of a protein
selected from the group consisting of OsGF14-c (SEQ IDNO: 113), OsDAD1
(SEQ ID NO: 128), Os006819-2510 (SEQ ID NO: 20), OsCRTC (SEQ ID
NO: 134), OsSGT1 (SEQ ID NO: 144), OsERP (SEQ ID NO: 146),
OsCHIB1 (SEQ ID NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2 (SEQ ID
NO: 164), and OsCAA90866 (SEQ ID NO: 170). In one embodiment, the
isolated nucleic acid molecule is derived from rice (Oryza sativa). In another
embodiment, the isolated nucleic acid molecule comprises a nucleic acid
sequence selected from the group consisting of odd numbered SEQ ID NOs:
1-111.
The presently disclosed subject matter also provides a description of
interactions between stress-related proteins and polypeptides encoded by
the isolated nucleic acid molecules disclosed herein. In one embodiment,
the isolated nucleic acid molecule comprises a nucleic acid sequence of one
of odd numbered SEQ ID NOs: 1-15 and the protein comprises an amino
acid sequence of SEQ ID NO: 114. Ln another embodiment, the isolated
nucleic acid molecule comprises a nucleic acid sequence of one of SEQ ID
NOs: 7 and 17 and the protein comprises an amino acid sequence of SEQ
ID NO: 128. In another embodiment, the isolated nucleic acid molecule
comprises a nucleic acid sequence of one of odd numbered SEQ ID NOs:
21-25 and the protein comprises an amino acid sequence of SEQ ID NO: 20.
In another embodiment, the isolated nucleic acid molecule comprises a
nucleic acid sequence of SEQ ID NO: 27 and the protein comprises an
amino acid sequence of SEQ ID NO: 134. In another embodiment, the
isolated nucleic acid molecule comprises a nucleic acid sequence of SEQ ID
NO: 29 and the protein comprises an amino acid sequence of SEQ ID NO:
138. In another embodiment, the isolated nucleic acid molecule comprises a
nucleic acid sequence of one of odd numbered SEQ ID NOs: 31-43 and the
protein comprises an amino acid sequence of SEQ ID NO: 144. In another
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
7
embodiment, the isolated nucleic acid molecule comprises a nucleic acid
sequence of one of odd numbered SEQ ID NOs: 45-67 and the protein
comprises an amino acid sequence of SEQ ID NO: 146. In another
embodiment, the isolated nucleic acid molecule comprises a nucleic acid
sequence of SEQ ID NO: 69 and the protein comprises an amino acid
sequence of SEQ ID NO: 36. In another embodiment, the isolated nucleic
acid molecule comprises a nucleic acid sequence of one of odd numbered
SEQ ID NOs: 71-77 and the protein comprises an amino acid sequence of
i
SEQ ID NO: 152. In another embodiment, the isolated nucleic acid molecule
comprises a nucleic acid sequence of one of odd numbered SEQ ID NOs:
79-95 and the protein comprises an amino acid sequence of SEQ ID NO:
156. In another embodiment, the isolated nucleic acid molecule comprises a
nucleic acid sequence of one of odd numbered SEQ ID NOs: 97-105 and the
protein comprises an amino acid sequence of SEQ ID NO: 164. In still
another embodiment, the isolated nucleic acid molecule comprises a nucleic
acid sequence of one of odd numbered SEQ ID NOs: 97 and 107-111 and
the protein comprises an amino acid sequence of SEQ ID NO: 170.
The presently disclosed subject matter also provides an isolated
nucleic acid molecule encoding a stress-related polypeptide, wherein the
nucleic acid molecule is selected from the group consisting of:
(a) a nucleic acid molecule encoding a polypeptide comprising an
amino acid sequence of one of even numbered SEQ ID NOs:
2-112;
(b) a nucleic acid molecule comprising a nucleic acid sequence of
one of odd numbered SEQ ID NOs: 1-111;
(c) a nucleic acid molecule that has a nucleic acid sequence at
least 90% identical to the nucleic acid sequence of the nucleic
acid molecule of (a) or (b);
(d) a nucleic acid molecule that hybridizes to (a) or (b) under
conditions of hybridization selected from the group consisting
of:
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
8
(i) 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM
ethylenediamine tetraacetic acid (EDTA) at 50°C with a
final wash in 2X standard saline citrate (SSC), 0.1
SDS at 50°C;
(ii) 7% SDS, 0.5 M NaP04, 1 mM EDTA at 50°C with a final
wash in 1X SSC, 0.1% SDS at 50°C;
(iii) 7% SDS, 0.5 M NaP04, 1 mM EDTA at 50°C with a final
wash in 0.5X SSC, 0.1 % SDS at 50°C;
(iv) 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM
EDTA at 50°C with a final wash in 0.1X SSC, 0.1% SDS
at 50°C; and
(v) 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM
EDTA at 50°C with a final wash in 0.1X SSC, 0.1% SDS
at 65°C;
(e) a nucleic acid molecule comprising a nucleic acid sequence
fully complementary to (a); and
(f) a nucleic acid molecule comprising a nucleic acid sequence
that is the full reverse complement of (a).
The presently disclosed subject matter also provides an isolated
stress-related polypeptide encoded by the disclosed isolated nucleic acid
molecules, or a functional fragment, domain, or feature thereof.
The presently disclosed subject matter also provides a method for
producing a polypeptide disclosed herein, the method comprising the steps
of: (a) growing cells comprising an expression cassette under suitable
growth conditions, the expression cassette comprising a nucleic acid
molecule as disclosed herein; and (b) isolating the polypeptide from the
cells.
The presently disclosed subject matter also provides a transgenic
plant cell comprising an isolated nucleic acid molecule disclosed herein. In
one embodiment, the plant is selected from the group consisting of corn (Zea
mays), Brassica sp., alfalfa (Medicago sativa), rice (Oryza sativa ssp.), rye
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
9
(Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), pearl millet
(Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet
(Setaria italica), finger millet (Eleusine coracana), sunflower (Helianthus
annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum),
soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum
tuberosum), peanut (Arachis hypogaea), cotton, sweet potato (Ipomoea
batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos
nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa
(Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado
(Persea ultilane), fig (Ficus casica), guava (Psidium guajava), mango
(Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew
(Anacardium occidentale), ~ macadamia (Macadamia integrifolia), almond
(Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum
spp.), oats, duckweed (Lemna), barley, a vegetable, an ornamental, and a
conifer. In another embodiment, the plant is rice (Oryza sativa ssp.). (n one
embodiment, the duckweed is selected from the group consisting of genus
Lemna, genus Spirodela, genus Woffia, and genus Wofiella. In one
embodiment, the vegetable is selected from the group consisting of
tomatoes, lettuce, guar, locust, bean, fenugreek, soybean, garden beans,
cowpea, mungbean, lima bean, fava bean, lentils, chickpea, green bean,
lima bean, pea, and members of the genus Cucumis. In one embodiment,
the ornamental is selected from the group consisting of impatiens, Begonia,
Pelargonium, Viola, Cyclamen, Verbena, Vinca, Tagetes, Primula, Saint
Paulia, Agertum, Amaranthus, Antihirrhinum, Aquilegia, Cineraria, Clover,
Cosmo, Cowpea, Dahlia, Datura, Delphinium, Gerbera, Gladiolus, Gloxinia,
Hippeastrum, Mesembryanthemum, Salpiglossos, and Zinnia, azalea,
hydrangea, hibiscus, rose, tulip, daffodil, petunia, carnation, poinsettia,
and
chrysanthemum. In one embodiment, the conifer is selected from the group
consisting of loblolly pine, slash pine, ponderosa pine, lodgepole pine,
Monterey pine, Douglas-fir, Western hemlock, Sitka spruce, redwood, silver
fir, balsam fir, Western red cedar, and Alaska yellow-cedar.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
In another embodiment, the transgenic plant is a plant selected from
the group consisting of Acacia, aneth, artichoke, arugula, blackberry, canola,
cilantro, clementines, escarole, eucalyptus, fennel, grapefruit, honey dew,
jicama, kiwifruit, lemon, lime, mushroom, nut, okra, orange, parsley,
5 persimmon, plantain, pomegranate, poplar, radiata pine, radicchio, Southern
pine, sweetgum, tangerine, triticale, vine, yams, apple, pear, quince, cherry,
apricot, melon, hemp, buckwheat, grape, raspberry, chenopodium,
blueberry, nectarine, peach, plum, strawberry, watermelon, eggplant,
pepper, cauliflower, Brassica, broccoli, cabbage, ultilan sprouts, onion,
10 carrot, leek, beet, broad bean, celery, radish, pumpkin, endive, gourd,
garlic,
snapbean, spinach, squash, turnip, ultilane, and zucchini.
The presently disclosed subject matter also provides an isolated
stress-related polypeptide, wherein the polypeptide binds in a yeast two
hybrid assay to a fragment of a protein selected from the group consisting of
OsGF14-c (SEQ IDNO: 113), OsDAD1 (SEQ ID NO: 128), Os006819-2510
(SEQ ID NO: 20), OsCRTC (SEQ ID NO : 134), OsSGT1 (SEQ ID NO: 144),
OsERP (SEQ ID NO: 146), OsCHIB1 (SEQ ID NO: 152), OsCS (SEQ ID
NO: 156), OsPP2A-2 (SEQ ID NO: 164), and OsCAA90866 (SEQ ID NO:
170). In one embodiment, the isolated stress-related polypeptide is selected
from the group consisting of (a) a polypeptide comprising an amino acid
sequence of even numbered SEQ ID NOs: 2-112; and (b) a polypeptide
comprising an amirio acid sequence at least 80% similar to the polypeptide
of (a) using the GCG Wisconsin Package SEQWEB~ application of GAP
with the default GAP analysis parameters. In another embodiment, the
polypeptide comprises an amino acid sequence of one of even numbered
SEQ ID NOs: 2-112.
The presently disclosed subject matter also provides an expression
cassette comprising a nucleic acid molecule encoding a stress-related
polypeptide disclosed herein. In one embodiment, the nucleic acid molecule
30. encoding a stress-related polypeptide comprises a nucleic acid sequence
selected from odd numbered SEQ ID NOs: 1-111. In one embodiment, the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
11
expression cassette further comprises a regulatory element operatively
linked to the nucleic acid molecule. In one embodiment, the regulatory.
element comprises a promoter. In one embodiment, the promoter is a plant
promoter. In another embodiment, the promoter is a constitutive promoter.
In another embodiment, the promoter is a tissue-specific or a cell type-
specific promoter. In one embodiment, the tissue-specific or cell type-
specific promoter directs expression of the expression cassette in a location
selected from the group consisting of epidermis, root, vascular tissue,
meristem, cambium, cortex, pith, leaf, flower, seed, and combinations
thereof.
The presently disclosed subject matter also provides a transgenic
plant cell comprising a disclosed expression cassette. In one embodiment,
the expression cassette comprises an isolated nucleic acid molecule
comprising a nucleic acid sequence of one of odd numbered SEQ ID NOs:
1-111.
The presently disclosed subject matter also provides transgenic
plants comprising a disclosed expression cassette, as well as transgenic
seeds and progeny of the trangenic plants disclosed herein.
The presently disclosed subject matter also provides a method for
modulating stress response of a plant cell comprising introducing into the
plant cell an expression cassette comprising an isolated nucleic acid
molecule encoding a stress-related polypeptide, wherein the polypeptide
binds in a yeast two hybrid assay to a fragment of a protein selected from
the group consisting of OsGFl4-c (SEQ IDNO: 113), OsDAD1 (SEQ ID NO:
128), Os006819-2510 (SEQ ID NO: 20), OsCRTC (SEQ ID NO: 134),
OsSGT1 (SEQ ID NO: 144), OsERP (SEQ ID NO: 146), OsCHIB1 (SEQ ID
NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2 (SEQ ID NO: 164), and
OsCAA90866 (SEQ ID NO: 170). In one embodiment of the disclosed
method, the expression of the polypeptide in the cell results in an
enhancement of a rate or extent of proliferation of the cell. In another
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
12
embodiment, the expression of the polypeptide in the cell results in a
decrease in a rate or extent of proliferation of the cell.
In another embodiment of the instant method, the isolated nucleic
acid molecule comprises a nucleic acid sequence selected from one of odd
numbered SEQ ID NOs: 1-173. In another embodiment, the isolated nucleic
acid molecule comprises a nucleic acid sequence selected from one of odd
numbered SEQ ID NOs: 1-111.
Accordingly, it is an object of the presently disclosed subject matter to
provide methods and compositions that can be used to enhance
agriculturally important plants. This object is achieved in whole or in part
by
the presently disclosed subject matter.
An object of the presently disclosed subject matter having been stated
above, other objects and advantages will become apparent to those of
ordinary skill in the art after a study of the following description of the
presently claimed subject matter and non-limiting Examples.
Brief Description of the Drawings
Figure 1 is a schematic representation of the interactions between
various, non-limiting, stress-related proteins of the invention. Arrows
indicate interaction direction between DNA binding domain fused proteins
(thick lined boxes or ovals) and activation domain fused proteins. Dotted
boxes indicate previously published interactions. Ovals rather than boxes
indicate that a protein fused to the DNA binding domain did not interact with
other proteins. Circular arrows depict self-interactions. Dotted lines
indicate
amino acid similarity between proteins. The proteins listed in the Figure can
be classified as follows: biotic stress (20251 ); abiotic stress (12464,
19902,
22844, 22874, 23059, and 23426); and chloroplast (19842, 22832, 22840,
22844, 22858, 22874, 23059, 23061, 23426, and 30846).
Figure 2 is a schematic representation of the interactions between
various, non-limiting, stress-related proteins of the invention. Arrows
indicate interaction direction between DNA binding domain fused proteins
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
13
(thick lined boxes or ovals) and activation domain fused proteins. Dotted
boxes indicate previously published interactions. Ovals rather than boxes
indicate that a protein fused to the DNA binding domain did not interact with
other proteins. Circular arrows depict self-interactions. Dotted lines
indicate
amino acid similarity between proteins. The proteins listed in the Figure can
be classified as follows: development (glutamyl amino peptidase); biotic
stress (19651, 20899, and 22823); abiotic stress (20775, 29077, 29098,
29086, and 29113).
Figure 3 is a schematic representation of the interactions between
various, non-limiting, stress-related proteins of the invention. Arrows
indicate interaction direction between DNA binding domain fused proteins
(thick lined boxes or ovals) and activation domain fused proteins. Dotted
boxes indicate previously published interactions. Ovals rather than boxes
indicate that a protein fused to the DNA binding domain did not interact with
other proteins. Circular arrows depict self-interactions. Dotted lines
indicate
amino acid similarity between proteins. The proteins listed in the Figure can
be classified as follows: biotic stress (ORF020300-2233.2, 23268, 011994-
D16, and OsPP2-A) and abiotic stress (23225, OsCAA90866, and 3209-
OS208938).
Brief Description of the Seauence Listing
SEQ ID NOs: 1-174 present nucleic acid and amino acid sequences
of the rice (Oryza sativa) polypeptides employed in the two hybrid assays
disclosed hereinbelow. For these SEQ ID NOs., the odd numbered
sequences are nucleic acid sequences, and the even numbered sequences
are the deduced amino acid sequences of the nucleic acid sequence of the
immediately preceding SEQ ID NO:. For example, SEQ ID NO: 2 is the
deduced amino acid sequence of the nucleic acid sequence presented in
SEQ ID NO: 1, SEQ ID NO: 4 is the deduced amino acid sequence of the
nucleic acid sequence presented in SEQ ID NO: 3, SEQ ID NO: 6 is the
deduced amino acid sequence of the nucleic acid sequence presented in
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
14
SEQ ID NO: 5, etc. Further description of the SEQ ID NOs. is presented in
the following Table:
SEQ ID PN Description
NOs. Number
1, 2 22858 Novel Protein 22858, Fragment, similar
to
Arabidopsis GTP Cyclohydrolase II
(BAB09512.1; e=0)
3, 4 22874 Novel Protein 22874, Fragment, similar
to
Arabidopsis Putative Phosphatidylinositol-4-
phosphate 5-kinase (NP_187603.1; 4e'~$)
5, 6 22866 Novel Protein PN22866, Fragment, Similar
to
A. Thaliana Vacuolar ATP Synthase
Subunit C
(V-ATPase C subunit; Vacuolar proton
pump C
subunit; Q9SDS7; a X52)
7, 8 23022 Novel Protein PN23022, Fragment, similar
to H.
Vulgare Plasma Membrane H+-ATPase
(CAC50884; e=0.0)
9, 10 23061 Hypothetical Protein OsContig3864,
Similar to
H. vulgare Photosystem I Reaction
Center
Subunit II, Chloroplast Precursor
(P36213; 6e $')
11, 12 29982 Novel Protein PN29982
13, 14 30846 Novel Protein PN30846
15, 16 30974 Novel Protein PN30974
17, 18 23053 Novel Protein 23053, Fragment, Similar
to
Arabidopsis Putative Na+-Dependent
Inorganic
Phosphate Cotransporter (NP 181341.1;
a ~~5)
19, 20 20462 Hypothetical Protein 006819-2510,
Similar to
Senescence-Related Protein 5 from
Hemerocallis Hybrid Cultivar
(AAC34855.1; a 97)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
21, 22 23226 Novel Protein PN23226, Callose synthase
23, 24 23485 Novel Protein PN23485, Similar to Hordeum
vulgare Coproporphyrinogen III Oxidase,
chloroplast precursor (Q42840; a X69)
25, 26 29037 Novel Protein PN29037
27, 28 29950 Novel Protein PN29950
29, 30 20551 Hypothetical Protein 003118-3674 Similar
to
Lycopersicon esculentum Calmodulin
31, 32 24060 L-aspartase-like protein-like
33, 34 23914 RNA binding domain protein
35, 36 23221 Proline rich protein
37, 38 24061 Auxin induced protein-like
39, 40 23949 HSP70-like
41, 42 28982 Archain delta COP-like
43, 44 29042 Fibrillin-like
45, 46 29984 Novel Protein PN29950
47, 48 30844 Novel protein PN30844
49, 50 30868 NAD(P) binding domain protein
51, 52 24292 Gamma adaptin-like
53, 54 29983 Novel protein PN29983
55, 56 30845 Pectinesterase-like
57, 58 31085 Receptor-like protein kinase-like
59, 60 20674 Pyruvate orthophosphate dikinase-like
61, 62 30870 Isp-4 like
63, 64 29997 Xanthine dehydrogenase-like
65, 66 30843 Ubiquitin specific protease-like
67, 68 30857 Novel protein PN30857
69, 70 20115 Ring zinc finger protein
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
16
71, 72 22823 Novel Protein PN22823, Similar to ABC
Transporter Proteins (T02187, AB043999.1,
NP_171753; e=0)
73, 74 22154 Novel Protein PN22154, Similar to A,
thaliana
Glutamyl Aminopeptidase (AL035525;
e=0)
75, 76 29041 Novel Protein PN29041, Fragment, Similar
to
A. thaliana Putative ATPase (AAG52137;
a ~~)
77, 78 22020 Novel Protein PN22020, Fragment, Similar
to
A. thaliana Putative Protein (NP_197783;
3e 3a.)
79, 80 22825 Novel Protein PN22825, Fragment
81, 82 29076 Novel Protein PN29076, Fragment
83, 84 29077 Novel Protein PN29077, Fragment, Similar
to
A. thaliana DNA-Damage Inducible Protein
DD11-Like (BAB02792; 5e'94)
85, 86 29084 Novel Protein PN29084, Fragment, Similar
to
Soybean (Glycine max) Calcium-Dependent
Protein Kinase (A43713, 2e 79)
87, 88 29115 Novel Protein PN29115, Fragment, Similar
to
A. thaliana 6,7-Dimethyl-8-Ribityllumazine
Synthase Precursor (AAIC93590, 6e 3')
89, 90 29116 Novel Protein PN29116, Fragment
91, 92 29117 Novel Protein PN29117
93, 94 29118 Novel Protein PN29118, Fragment
95, 96 29119 Novel Protein PN29119, Fragment
97, 98 21639 Hypothetical Protein ORF020300-2233.2,
Putative PP2A Regulatory Subunit, Similar
to
OsCAA90866 (AAD39930; 5e 92; CAA90866;
5e 5s)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
17
99, 100 23268 Novel Protein 23268, Similar to
Phosphoribosylanthranilate Transferase,
Chloroplast Precursor, Fragment
(AAB02913.1; 5e'95)
101, 102 26645 Novel Protein PN26645, Putative Protein
Disulfide Isomerase-Related Protein
Precursor
(BAB09470.1; a 2$)
103, 104 24162 Novel Protein PN24162, Porin-like,
Voltage-
Dependent Anion Channel Protein
(NP_201551; 3e $6)
105, 106 20618 Hypothetical Protein 011994-D16, Similar
to Z.
mays DnaJ protein (T01643; e=0)
107, 108 23045 Novel Protein PN23045
109, 110 23225 Novel Protein PN23225, Similar to
Tritticum
aestivum Initiation Factor (iso)4f
p82 Subunit
(AAA74724; e=0)
111, 112 29883 Novel Protein PN29883, Fragment
113, 114 12464 O. sativa 14-3-3 Protein Homolog GF14-c
(U65957)
115, 116 22844 O. sativa 3-Phosphoshikimate 1-
carboxyvinyltransferase (a.k.a. EPSP
Synthase ; AB052962; BAB61062.1 )
117, 118 22832 O, sativa Fructose-Bisphosphate Aldolase,
Chloroplast Precursor (Q40677)
119, 120 23426 O. sativa Chloroplast Ribulose Bisphosphate
Carboxylase, Large Chain (D00207;
P12089)
121, 122 19842 O, sativa Ribulose Bisphosphate
Carboxylase/Oxygenase Activase, Large
Isoform A1 (AB034698, BAA97583)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
18
123, 124 23059 OsContig4331, O. sativa Putative 33kDa
Oxygen-Evolving Protein of Photosystem
II
(BAB64069)
125, 126 22840 O, sativa Photosystem II 10 kDa Polypeptide
(U86018; T04177)
127, 128 20251 O. sativa Defender Against Apoptotic
Death 1
(D89727; BAA24104)
129, 130 19902 Beta-Expansin EXPB2
(U95968; AAB61710)
131, 132 24059 O. sativa Histone Deacetylase HD1
(AF332875; AAK01712.1 )
133, 134 20544 O. sativa Calreticulin Precursor
(AB021259; BAA88900)
135, 136 22883 Oryza sativa Low Temperature-Induced
Protein
5 (AB011368; BAA24979.1 )
137, 138 23878 Oryza sativa Putative Myosin
(AC090120; AAL31066.1 )
139, 140 20554 O. sativa DEHYDRIN RAB 16B (P22911
)
141, 142 19701 Soluble Starch Synthase (AF165890;
AAD49850)
143, 144 20285 OsSGT1 (gi~6581058)
145, 146 20696 Elicitor responsive protein (gi~11358958)
147, 148 24063 RAS GTPase (gi~730510)
149, 150 20621 Shaggy kinase (gi~13677093)
151, 152 19651 O. sativa Chitinase, Class III (AF296279;
AAG02504)
153, 154 20899 O. sativa Catalase A Isozyme (D29966;
BAA06232)
155, 156 19707 O. sativa Cellulose Synthase Catalytic
Subunit,
RSW1-Like (AF030052; AAC39333)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
19
157, 158 29086 O. sativa salT Gene Product (AF001395;
AAB53810.1 )
159, 160 29098 O. sativa Aquaporin (AF062393)
161, 162 29113 O. sativa DNAJ Homologue (BAB70509.1
)
163, 164 20254 O. sativa Serine/Threonine Protein
Phosphatase PP2A-2, Catalytic Subunit
(AF134552, AAD22116)
165, 166 23266 O. sativa Putative Proline-Rich Protein
AAK63900 (AC084884)
167, 168 24775 O. sativa Glutelin CAA33838 (X15833)
169, 170 20311 O. sativa Chilling-Inducible Protein
CAA90866
(Z54153, CAA90866)
171, 172 20215 O. sativa Putative 14-3-3 Protein
(AAK38492)
173, 174 23186 O. sativa Putative Pyrrolidone Carboxyl
Peptidase (AAG46136)
Detailed Description
The presently disclosed subject matter will be now be described more
fully hereinafter with reference to the accompanying Examples, in which
representative embodiments of the presently disclosed subject matter are
shown. The presently disclosed subject matter can, however, be embodied
in different forms and should not be construed as limited to the embodiments
set forth herein. Rather, these embodiments are provided so that this
disclosure will be thorough and complete, and will fully convey the scope of
the presently disclosed subject matter to those skilled in the art.
All of the patents (including published patent applications) and
publications (including GENBANK~ sequence references), which are cited
herein, are hereby incorporated by reference in their entireties to the same
extent as if each were specifically stated to be incorporated by reference.
Any inconsistency between these patents and publications and the present
disclosure shall be resolved in favor of the present disclosure.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
I. General Considerations
A goal of functional genomics is to identify genes controlling
expression of organismal phenotypes, and functional genomics employs a
variety of methodologies including, but not limited to, bioinformatics, gene
5 expression studies, gene and gene product interactions, genetics,
biochemistry, and molecular genetics. For example, bioinformatics can
assign function to a given gene by identifying genes in heterologous
organisms with a high degree of similarity (homology) at the amino acid or
nucleotide level. Studies of the expression of a gene at the mRNA or
10 polypeptide levels can assign function by linking expression of the gene to
an environmental response, a developmental process, or a genetic
(mutational) or molecular genetic (gene overexpression or underexpression)
perturbation. Expression of a gene at the mRNA level can be ascertained
either alone (for example, by Northern analysis) or in concert with other
15 genes (for example, by microarray analysis), whereas expression of a gene
at the polypeptide level can be ascertained either alone (for example, by
native or denatured polypeptide gel or immunoblot analysis) or in concert
with other genes (for example, by proteomic analysis). Knowledge of
polypeptide/polypeptide and polypeptide/DNA interactions can assign
20 function by identifying polypeptides and nucleic acid sequences acting
together in the same biological process. Genetics can assign function to a
gene by demonstrating that DNA lesions (mutations) in the gene have a
quantifiable effect on the organism, including, but not limited to, its
development; hormone biosynthesis and response; growth and growth habit
(plant architecture); mRNA expression profiles; polypeptide expression
profiles; ability to resist diseases; tolerance of abiotic stresses (for
example,
drought conditions); ability to acquire nutrients; photosynthetic efficiency;
altered primary and secondary metabolism; and the composition of various
plant organs. Biochemistry can assign function by demonstrating that the
polypeptide(s) encoded by the gene, typically when expressed in a
heterologous organism, possesses a certain enzymatic activity, either alone
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
21
or in combination with other polypeptides. Molecular genetics can assign
function by overexpressing or underexpressing the gene in the native plant
or in heterologous organisms, and observing quantifiable effects , as
disclosed in functional assignment by genetics above. In functional
genomics, any or all of these approaches are utilized, often in concert, to
assign functions to genes across any of a number of organismal phenotypes.
It is recognized by those skilled in the art that these different
methodologies can each provide data as evidence for the function of a
particular gene, and that such evidence is stronger with increasing amounts
of data used for functional assignment: in one embodiment from a single
methodology, in another embodiment from two methodologies, and in still
another embodiment from more than two methodologies. In addition, those
skilled in the art are aware that different methodologies can differ in the
strength of the evidence provided for the assignment of gene function.
Typically, but not always, a datum of biochemical, genetic, or molecular
genetic evidence is considered stronger than a datum of bioinformatic or
gene expression evidence. Finally, those skilled in the art recognize that,
for
different genes, a single datum from a single methodology can differ in terms
of the strength of the evidence provided by each distinct datum for the
assignment of the function of these different genes.
The objective of crop trait functional genomics is to identify crop trait
genes of interest, for example, genes capable of conferring useful agronomic
traits in crop plants. Such agronomic traits include, but are not limited to,
enhanced yield, whether in quantity or quality; enhanced nutrient acquisition
and metabolic efficiency; enhanced or altered nutrient composition of plant
tissues used for food, feed, fiber, or processing; enhanced utility for
agricultural or industrial processing; enhanced resistance to plant diseases;
enhanced tolerance of adverse environmental conditions (abiotic stresses)
including, but not limited to, drought, excessive cold, excessive heat, or
excessive soil salinity or extreme acidity or alkalinity; and alterations in
plant
architecture or development, including changes in developmental timing.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
22
The deployment of such identified trait genes by either transgenic or non-
transgenic means can materially improve crop plants for the benefit of
agriculture.
Cereals are the most important crop plants on the planet in terms of
both human and animal consumption. Genomic synteny (conservation of
gene order within large chromosomal segments) is observed in rice, maize,
wheat, barley, rye, oats, and other agriculturally important monocots, which
facilitates the mapping and isolation of orthologous genes from diverse
cereal species based on the sequence of a single cereal gene. Rice has the
smallest (about 420 Mb) genome among the cereal grains, and has recently
been a major focus of public and private genomic and EST sequencing
efforts. See Goff et al., 2002.
II. Definitions
Unless otherwise defined, all technical and scientific terms used
herein have the same meaning as commonly understood by one of ordinary
skill in the art to which the presently disclosed subject matter pertains. For
clarity of the present specification, certain definitions are presented
hereinbelow.
Following long-standing patent law convention, the terms "a" and "an"
mean "one or more" when used in this application, including in the claims.
As used herein, the term "about", when referring to a value or to an
amount of mass, weight, time, volume, concentration or percentage is meant
to encompass variations of ~20% or ~10%, in another example ~5%, in
another example ~1 %, and in still another example ~0.1 % from the specified
amount, as such variations are appropriate to practice the presently
disclosed subject matter. Unless otherwise indicated, all numbers
expressing quantities of ingredients, reaction conditions, and so forth used
in
the specification and claims are to be understood as being modified in all
instances by the term "about". Accordingly, unless indicated to the contrary,
the numerical parameters set forth in this specification and attached claims
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
23
are approximations that can vary depending upon the desired properties
sought to be obtained by the presently disclosed subject matter.
As used herein, the terms "amino acid" and "amino acid residue" are
used interchangeably and refer to any of the twenty naturally occurring
amino acids, as well as analogs, derivatives, and congeners thereof; amino
acid analogs having variant side chains; and all stereoisomers of any of any
of the foregoing. Thus, the term "amino acid" is intended to embrace all
molecules, whether natural or synthetic, which include both an amino
functionality and an acid functionality and capable of being included in a
polymer of naturally occurring amino acids.
An amino acid is formed upon chemical digestion (hydrolysis) of a
polypeptide at its peptide linkages. The amino acid residues described
herein are in one embodiment in the "L" isomeric form. However, residues in
the "D" isomeric form can be substituted for any L-amino acid residue, as
long as the desired functional property is retained by the polypeptide. NH2
refers to the free amino group present at the amino terminus of a
polypeptide. COOH refers to the free carboxy group present at the carboxy
terminus of a polypeptide. In keeping with standard polypeptide
nomenclature abbreviations for amino acid residues are shown in tabular
form, presented hereinabove.
It is noted that all amino acid residue sequences represented herein
by formulae have a left-to-right orientation in the conventional direction of
amino terminus to carboxy terminus. In addition, the phrases "amino acid"
and "amino acid residue" are broadly defined to include modified and
unusual amino acids.
Furthermore, it is noted that a dash at the beginning or end of an
amino acid residue sequence indicates a peptide bond to a further sequence
of one or more amino acid residues or a covalent bond to an amino-terminal
group such as NH2 or acetyl or to a carboxy-terminal group such as COOH.
As used herein, the terms "associated with" and "operatively linked"
refer to two nucleic acid sequences that are related physically or
functionally.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
24
For example, a promoter or regulatory DNA sequence is said to be
"associated with" a DNA sequence that encodes an RNA or a polypeptide if
the two sequences are operatively linked, or situated such that the regulator
DNA sequence will affect the expression level of the coding or structural
DNA sequence.
As used herein, the term "chimera" refers to a polypeptide that
comprises domains or other features that are derived from different
polypeptides or are in a position relative to each other that is not naturally
occurring.
As used herein, the term "chimeric construct" refers to a recombinant
nucleic acid molecule in which a promoter or regulatory nucleic acid
sequence is operatively linked to, or associated with, a nucleic acid
sequence that codes for an mRNA or which is expressed as a polypeptide,
such that the regulatory nucleic acid sequence is able to regulate
transcription or expression of the associated nucleic acid sequence. The
regulatory nucleic acid sequence of the chimeric construct is not normally
operatively linked to the associated nucleic acid sequence as found in
nature.
As used herein, the term "co-factor" refers to a natural reactant, such
as an organic molecule or a metal ion, required in an enzyme-catalyzed
reaction. A co-factor can be, for example, NAD(P), riboflavin (including FAD
and FMN), folate, molybdopterin, fihiamin, biotin, lipoic acid, pantothenic
acid
and coenzyme A, S-adenosylmethionine, pyridoxal phosphate, ubiquinone,
and menaquinone. In one embodiment, a co-factor can be regenerated and
reused.
As used herein, the terms "coding sequence" and "open reading
frame" (ORF) are used interchangeably and refer to a nucleic acid sequence
that is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense
RNA, or antisense RNA. In one embodiment, the RNA is then translated in
vivo or in vitro to produce a polypeptide.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
As used herein, the term "complementary" refers to two nucleotide
sequences that comprise antiparallel nucleotide sequences capable of
pairing with one another upon formation of hydrogen bonds between the
complementary base residues in the antiparallel nucleotide sequences. As
5 is known in the art, the nucleic acid sequences of two complementary
strands are the reverse complement of each other when each is viewed in
the 5' to 3' direction.
As is also known in the art, two sequences that hybridize to each
other under a given set of conditions do not necessarily have to be 100%
10 fully complementary. As used herein, the terms "fully complementary" and
"100% complementary" refer to sequences for which the complementary
regions are 100% in Watson-Crick base-pairing, i.e., that no mismatches
occur within the complementary regions. However, as is often the case with
recombinant molecules (for example, cDNAs) that are cloned into cloning
15 vectors, certain of these molecules can have non-complementary overhangs
on either the 5' or 3' ends that result from the cloning event. In such a
situation, it is understood that the region of 100% or full complementarity
excludes any sequences that are added to the recombinant molecule
(typically at the ends) solely as a result of, or to facilitate, the cloning
event.
20 Such sequences are, for example, polylinker sequences, linkers with
restriction enzyme recognition sites, etc.
As used herein, the terms "domain" and "feature", when used in
reference to a polypeptide or amino acid sequence, refers to a subsequence
of an amino acid sequence that has a particular biological function. Domains
25 and features that have a particular biological function include, but are
not
limited to, ligand binding, nucleic acid binding, catalytic activity,
substrate
binding, and polypeptide-polypeptide interacting domains. Similarly, when
used herein in reference to a nucleic acid sequence, a "domain", or "feature"
is that subsequence of the nucleic acid sequence that encodes a domain or
feature of a polypeptide.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
26
As used herein, the term "enzyme activity" refers to the ability of an
enzyme to catalyze the conversion of a substrate into a product. A substrate
for the enzyme can comprise the natural substrate of the enzyme but also
can comprise analogues of the natural substrate, which can also be
converted by the enzyme into a product or into an analogue of a product.
The activity of the enzyme is measured for example by determining the
amount of product in the reaction after a certain period of time, or by
determining the amount of substrate remaining in the reaction mixture after a
certain period of time. The activity of the enzyme can also be measured by
determining the amount of an unused co-factor of the reaction remaining in
the reaction mixture after a certain period of time or by determining the
amount of used co-factor in the reaction mixture after a certain period of
time. The activity of the enzyme can also be measured by determining the
amount of a donor of free energy or energy-rich molecule (e.g., ATP,
phosphoenolpyruvate, acetyl phosphate, or phosphocreatine) remaining in
the reaction mixture after a certain period of time or by determining the
amount of a used donor of free energy or energy-rich molecule (e.g., ADP,
pyruvate, acetate, or creatine) in the reaction mixture after a certain period
of
time.
As used herein, the term "expression cassette" refers to a nucleic acid
molecule capable of directing expression of a particular nucleotide sequence
in an appropriate host cell, comprising a promoter operatively linked to the
nucleotide sequence of interest which is operatively linked to termination
signals. It also typically comprises sequences required for proper translation
of the nucleotide sequence. The coding region usually encodes a
polypeptide of interest but can also encode a functional RNA of interest, for
example antisense RNA or a non-translated RNA, in the sense or antisense
direction. The expression cassefite comprising the nucleotide sequence of
interest can be chimeric, meaning that at least one of its components is
heterologous with respect to at least one of its other components. The
expression cassette can also be one that is naturally occurring but has been
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
27
obtained in a recombinant form useful for heterologous expression.
Typically, however, the expression cassette is heterologous with respect to
the host; i.e., the particular DNA sequence of the expression cassette does
not occur naturally in the host cell and was introduced into the host cell or
an
ancestor of the host cell by a transformation event. The expression of the
nucleotide sequence in the expression cassette can be under the control of
a constitutive promoter or of an inducible promoter that initiates
transcription
only when the host cell is exposed to some particular external stimulus. In
the case of a multicellular organism such as a plant, the promoter can also
be specific to a particular tissue, organ, or stage of development.
As used herein, the term "fragment" refers to a sequence that
comprises a subset of another sequence. When used in the context of a
nucleic acid or amino acid sequence, the terms "fragment" and
"subsequence" are used interchangeably. A fragment of a nucleic acid
sequence can be any number of nucleotides that is less than that found in
another nucleic acid sequence, and thus includes, but is not limited to, the
sequences of an exon or intron, a promoter, an enhancer, an origin of
replication, a 5' or 3' untranslated region, a coding region, and a
polypeptide
binding domain. It is understood that a fragment or subsequence can also
comprise less than the entirety of a nucleic acid sequence, for example, a
portion of an exon or intron, promoter, enhancer, etc. Similarly, a fragment
or subsequence of an amino acid sequence can be any number of residues
that is less than that found in a naturally occurring polypeptide, and thus
includes, but is not limited to, domains, features, repeats, etc. Also
similarly,
it is understood that a fragment or subsequence of an amino acid sequence
need not comprise the entirety of the amino acid sequence of the domain,
feature, repeat, etc. A fragment can also be a "functional fragment", in which
the fragment retains a specific biological function of the nucleic acid
sequence or amino acid sequence of interest. For example, a functional
fragment of a transcription factor can include, but is not limited to, a DNA
binding domain, a transactivating domain, or both. Similarly, a functional
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
28
fragment of a receptor tyrosine kinase includes, but is not limited to a
ligand
binding domain, a kinase domain, an ATP binding domain, and combinations
thereof.
As used herein, the term "gene" refers to a nucleic acid that encodes
an RNA, for example, nucleic acid sequences including, but not limited to,
structural genes encoding a polypeptide. The target gene can be a gene
derived from a cell, an endogenous gene, a transgene, or exogenous genes
such as genes of a pathogen, for example a virus, which is present in the
cell after infection thereof. The cell containing the target gene can be
derived from or contained in any organism, for example a plant, animal,
protozoan, virus, bacterium, or fungus. The term "gene" also refers broadly
to any segment of DNA associated with a biological function. As such, the
term "gene" encompasses sequences including but not limited to a coding
sequence, a promoter region, a transcriptional regulatory sequence, a non-
expressed DNA segment that is a specific recognition sequence for
regulatory proteins, a non-expressed DNA segment that contributes to gene
expression, a DNA segment designed to have desired parameters, or
combinations thereof. A gene can be obtained by a variety of methods,
including cloning from a biological sample, synthesis based on known or
predicted sequence information, and recombinant derivation from one or
more existing sequences.
As is understood in the art, a gene comprises a coding strand and a
non-coding strand. As used herein, the terms "coding strand" and "sense
strand" are used interchangeably, and refer to a nucleic acid sequence that
has the same sequence of nucleotides as an mRNA from which the gene
product is translated. As is also understood in the art, when the coding
strand and/or sense strand is used to refer to a DNA molecule, the
coding/sense strand includes thymidine residues instead of the uridine
residues found in the corresponding mRNA. Additionally, when used to refer
to a DNA molecule, the coding/sense strand can also include additional
elements not found in the mRNA including, but not limited to promoters,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
29
enhancers, and introns. Similarly, the terms "template strand" and
"antisense strand" are used interchangeably and refer to a nucleic acid
sequence that is complementary to the coding/sense strand.
As used herein, the terms "complementarity" and "complementary"
refer to a nucleic acid that can form one or more hydrogen bonds with
another nucleic acid sequence by either traditional Watson-Crick or other
non-traditional types of interactions. In reference to the nucleic molecules
of
the presently disclosed subject matter, the binding free energy for a nucleic
acid molecule with its complementary sequence is sufficient to allow the
relevant function of the nucleic acid to proceed, in one embodiment, RNAi
activity. For example, the degree of complementarity between the sense
and antisense strands of the siRNA construct can be the same or different
from the degree of complementarity between the antisense strand of the
siRNA and the target nucleic acid sequence. Complementarity to the target
sequence of less than 100% in the antisense strand of the siRNA duplex,
including point mutations, is not well tolerated when these changes are
located between the 3'-end and the middle of the antisense siRNA, whereas
mutations near the 5'-end of the antisense siRNA strand can exhibit a small
degree of RNAi activity (Elbashir et al., 2001 c). Determination of binding
free energies for nucleic acid molecules is well known in the art. See e.g.,
Freier et al., 1986; Turner et al., 1987.
As used herein, the phrase "percent complementarity" refers to the
percentage of contiguous residues in a nucleic acid molecule that can form
hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid
sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%,
and 100% complementary). The terms "100% complementary", "fully
complementary", and "perfectly complementary" indicate that all of the
contiguous residues of a nucleic acid sequence can hydrogen bond with the
same number of contiguous residues in a second nucleic acid sequence.
The term "gene expression" generally refers to the cellular processes
by which a biologically active polypeptide is produced from a DNA sequence
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
and exhibits a biological activity in a cell. As such, gene expression
involves
the processes of transcription and translation, but also involves post-
transcriptional and post-translational processes that can influence a
biological activity of a gene or gene product. These processes include, but
5 are not limited to RNA syntheses, processing, and transport, as well as
polypeptide synthesis, transport, and post-translational modification of
polypeptides. Additionally, processes that affect protein-protein interactions
within the cell can also affect gene expression as defined herein.
The terms "heterologous", "recombinant", and "exogenous", when
10 used herein to refer to a nucleic acid sequence (e.g., a DNA sequence) or a
gene, refer to a sequence that originates from a source foreign to the
particular host cell or, if from the same source, is modified from its
original
form. Thus, a heterologous gene in a host cell includes a gene that is
endogenous to the particular host cell but has been modified through, for
15 example, the use of DNA shuffling or other recombinant techniques (for
example, cloning the gene into a vector). The terms also include non-
naturally occurring multiple copies of a naturally occurring DNA sequence.
Thus, the terms refer to a DNA segment that is foreign or heterologous to the
cell, or homologous to the cell but in a position or form within the host cell
in
20 which the element is not ordinarily found. Similarly, when used in the
context of a polypeptide or amino acid sequence, an exogenous polypeptide
or amino acid sequence is a polypeptide or amino acid sequence that
originates from a source foreign to the particular host cell or, if from the
same source, is modified from its original form. Thus, exogenous DNA
25 segments can be expressed to yield exogenous polypeptides.
A "homologous" nucleic acid (or amino acid) sequence is a nucleic
acid (or amino acid) sequence naturally associated with a host cell into
which it is introduced.
As used herein, the terms "host cells" and "recombinant host cells"
30 are used interchangeably and refer cells (for example, plant cells) into
which
the compositions of the presently disclosed subject matter (for example, an
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
31
expression vector) can be introduced. Furthermore, the terms refer not only
to the particular plant cell into which an expression construct is initially
introduced, but also to the progeny or potential progeny of such a cell.
Because certain modifications can occur in succeeding generations due to
either mutation or environmental influences, such progeny might not, in fact,
be identical to the parent cell, but are still included within the scope of
the
term as used herein.
The phrase "hybridizing specifically to" refers to the binding,
duplexing, or hybridizing of a molecule only to a particular nucleotide
sequence under stringent conditions when that sequence is present in a
complex mixture (e.g., total cellular) DNA or RNA. The phrase "bind(s)
substantially" refers to complementary hybridization between a probe nucleic
acid and a target nucleic acid and embraces minor mismatches that can be
accommodated by reducing the stringency of the hybridization media to
achieve the desired detection of the target nucleic acid sequence.
As used herein, the term "inhibitor" refers to a chemical substance
that inactivates or decreases the biological activity of a polypeptide such as
a biosynthetic and catalytic activity, receptor, signal transduction
polypeptide, structural gene product, or transport polypeptide. The term
"herbicide" (or "herbicidal compound") is used herein to define an inhibitor
applied to a plant at any stage of development, whereby the herbicide
inhibits the growth of the plant or kills the plant.
An "isolated" nucleic acid molecule or protein, or biologically active
portion thereof, is substantially free of other cellular material, or culture
medium when produced by recombinant techniques, or substantially free of
chemical precursors or other chemicals when chemically synthesized. Thus,
the term "isolated nucleic acid" refers to a polynucleotide of genomic, cDNA,
or synthetic origin or some combination thereof, which (1 ) is not associated
with the cell in which the "isolated nucleic acid" is found in nature, or (2)
is
operatively linked to a polynucleotide to which it is not linked in nature.
Similarly, the term "isolated polypeptide" refers to a polypeptide, in certain
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
32
embodiments prepared from recombinant DNA or RNA, or of synthetic
origin, or some combination thereof, which (1 ) is not associated with
proteins
that it is normally found with in nature, (2) is isolated from the cell in
which it
normally occurs, (3) is isolated free of other proteins from the same cellular
source, (4) is expressed by a cell from a different species, or (5) does not
occur in nature.
In certain embodiments, an "isolated" nucleic acid is free of
sequences (e.g., protein encoding or regulatory sequences) that naturally
flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the
nucleic acid) in the genomic DNA of the organism from which the nucleic
acid is derived. For example, in various embodiments, the isolated nucleic
acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5
kb, or 0.1 kb of the nucleotide sequences that naturally flank the nucleic
acid
molecule in genomic DNA of the cell from which the nucleic acid is derived.
A protein fihat is substantially free of cellular material includes
preparations of
protein or polypeptide having less than about 30%, 20%, 10%, or 5%, (by
dry weight)' of contaminating protein. When the protein of the presently
disclosed subject matter, or biologically active portion thereof, is
recombinantly produced, culture medium represents less than about
30°l°,
20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein of
interest chemicals. Thus, the term "isolated", when used in the context of an
isolated DNA molecule or an isolated polypeptide, refers to a DNA molecule
or polypeptide that, by the hand of man, exists apart from its native
environment and is therefore not a product of nature. An isolated DNA
molecule or polypeptide can exist in a purified form or can exist in a non-
native environment such as, for example, in a transgenic host cell.
The term "isolated", when used in the context of an "isolated cell",
refers to a cell that has been removed from its natural environment, for
example, as a part of an organ, tissue, or organism.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
33
As used herein, the term "mature polypeptide" refers to a polypeptide
from which the transit peptide, signal peptide, and/or propeptide portions
have been removed.
As used herein, the term "minimal promoter" refers to the smallest
piece of a promoter, such as a TATA element, that can support any
transcription. A minimal promoter typically has greatly reduced promoter
activity in the absence of upstream or downstream activation. In the
presence of a suitable transcription factor, a minimal promoter can function
to permit transcription.
As used herein, the term "modified enzyme activity" refers to enzyme
activity that is different from that which naturally occurs in a plant (i.e.
enzyme activity that occurs naturally in the absence of direct or indirect
manipulation of such activity by man). In one embodiment, a modified
enzyme activity is displayed by a non-naturally occurring enzyme that is
tolerant to inhibitors that inhibit the cognate naturally occurring enzyme
activity.
'As used herein, the term "modulate" refers to an increase, decrease,
or other alteration of any, or all, chemical and biological activities or
properties of a biochemical entity, e.g., a wild-type or mutant nucleic acid
molecule. As such, the term "modulate" can refer to a change in the
expression level of a gene, or a level of RNA molecule or equivalent RNA
molecules encoding one or more proteins or protein subunits, or activity of
one or more proteins or protein subunits is. up regulated or down regulated,
such that expression, level, or activity is greater than or less than that
observed in the absence of the modulator. For example, the term
"modulate" can mean "inhibit" or "suppress", but the use of the word
"modulate" is not limited to this definition.
As used herein, the terms "inhibit", "suppress", "down regulate", and
grammatical variants thereof are used interchangeably and refer to an
activity whereby gene expression or a level of an RNA encoding one or more
gene products is reduced below that observed in the absence of a nucleic
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
34
acid molecule of the presently disclosed subject matter. In one embodiment,
inhibition with a nucleic acid molecule (for example, a dsRNA, an antisense
RNA, or an siRNA) results in a decrease in the steady state level of a target
RNA. In another embodiment, inhibition with a a nucleic acid molecule (for
example, a dsRNA, an antisense RNA, or an siRNA) results in an expression
level of a target gene that is below that level observed in the presence of an
inactive or attenuated molecule that is unable to mediate an RNAi response.
In another embodiment, inhibition of gene expression with a nucleic acid
molecule (for example, a dsRNA, an antisense RNA, or an siRNA) of the
presently disclosed subject matter is greater in the presence of the a nucleic
acid molecule than in its absence. In still another embodiment, inhibition of
gene expression is associated with an enhanced rate of degradation of the
mRNA encoded by the gene (for example, by RNAi mediated by an siRNA, a
dsRNA, or an antisense RNA).
The term "modulation" as used herein refers to both upregulation (i.e.,
activation or stimulation) and downregulation (i.e., inhibition or
suppression)
of a response. Thus, the term "modulation", when used in reference to a
functional property or biological activity or process (e.g., enzyme activity
or
receptor binding), refers to the capacity to upregulate (e.g., activate or
stimulate), downregulate (e.g., inhibit or suppress), or otherwise change a
quality of such property, activity, or process. In certain instances, such
regulation can be contingent on the occurrence of a specific event, such as
activation of a signal transduction pathway, and/or can be manifest only in
particular cell types.
The term "modulator" refers to a polypeptide, nucleic acid,
macromolecule, complex, molecule, small molecule, compound, species, or
the like (naturally occurring or non-naturally occurring), or an extract made
from biological materials such as bacteria, plants, fungi, or animal cells or
tissues, that can be capable of causing modulation. Modulators can be
evaluated for potential activity as inhibitors or activators (directly or
indirectly)
of a functional property, biological activity or process, or combination of
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
them, (e.g., agonist, partial antagonist, partial agonist, inverse agonist,
antagonist, anti-microbial agents, inhibitors of microbial infection or
proliferation, and the like) by inclusion in assays. In such assays, many
modulators can be screened at one time. The activity of a modulator can be
5 known, unknown, or partially known.
Modulators can be either selective or non-selective. As used herein,
the term "selective" when used in the context of a modulator (e.g., an
inhibitor) refers to a measurable or otherwise biologically relevant
difference
in the way the modulator interacts with one molecule (e.g., a gene of
10 interest) versus another similar but not identical molecule (e.g., a member
of
the same gene family as the gene of interest).
It must be understood that it is not required that the degree to which
the interactions differ be completely opposite. Put another way, the term
selective modulator encompasses not only those molecules that only bind to
15 mRNA transcripts from a gene of interest and not those of related family
members. The term is also intended to include modulators that are
characterized by interactions with transcripts from genes of interest and from
related family members that differ to a lesser degree. For example, selective
modulators include modulators for which conditions can be found (such as
20 the degree of sequence identity) that would allow a biologically relevant
difference in the binding of the modulator to transcripts form the gene of
interest versus transcripts from related genes.
When a selective modulator is identified, the modulator will bind to
one molecule (for example an mRNA transcript of a gene of interest) in a
25 manner that is diifierent (for example, stronger) than it binds to another
molecule (for example, an mRNA transcript of a gene related to the gene of
interest). As used herein, the modulator is said to display "selective
binding"
or "preferential binding" to the molecule to which it binds more strongly.
As used herein, the term "mutation" carries its traditional connotation
30 and refers to a change, inherited, naturally occurring or introduced, in a
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
36
nucleic acid or polypeptide sequence, and is used in its sense as generally
known to those of skill in the art.
As used herein, the term "native" refers to a gene that is naturally
present in the genome of an untransformed plant cell. Similarly, when used
in the context of a polypeptide, a "native polypeptide" is a polypeptide that
is
encoded by a native gene of an untransformed plant cell's genome.
As used herein, the term "naturally occurring" refers to an object that
is found in nature as distinct from being artificially produced by man. For
example, a polypeptide or nucleotide sequence that is present in an
organism (including a virus) in its natural state, which has not been
intentionally modified or isolated by man in the laboratory, is naturally
occurring,. As such, a polypeptide or nucleotide sequence is considered
"non-naturally occurring" if it is encoded by or present within a recombinant
molecule, even if the amino acid or nucleic acid sequence is identical to an
amino acid or nucleic acid sequence found in nature.
As used herein, the terms "nucleic acid" and "nucleic acid molecule"
refer to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA),
oligonucleotides, fragments generated by the polymerise chain reaction
(PCR), and fragments generated by any of ligation, scission, endonuclease
action, and exonuclease action. Nucleic acids can be composed of
monomers that are naturally occurring nucleotides (such as
deoxyribonucleotides and ribonucleotides), or analogs of naturally occurring
nucleotides (e.g., a-enantiomeric forms of naturally occurring nucleotides),
or a combination of both. Modified nucleotides can have modifications in
sugar moieties and/or in pyrimidine or purine base moieties. Sugar
modifications include, for example, replacement of one or more hydroxyl
groups with halogens, alkyl groups, amines, and azido groups, or sugars can
be functionalized as ethers or esters. Moreover, the entire sugar moiety can
be replaced with sterically and electronically similar structures, such as aza-
sugars and carbocyclic sugar analogs. Examples of modifications in a base
moiety include alkylated purines and pyrimidines, acylated purines or
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
37
pyrimidines, or other well-known heterocyclic substitutes. Nucleic acid
monomers can be linked by phosphodiester bonds or analogs of such
linkages. Analogs of phosphodiester linkages include phosphorothioate,
phosphorodithioate, phosphoroselenoate, phosphorodiselenoate,
phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like.
The term "nucleic acid" also includes so-called "peptide nucleic acids", which
comprise naturally occurring or modified nucleic acid bases attached to a
polyamide backbone. Nucleic acids can be either single stranded or double
stranded.
The term "operatively linked", when describing the relationship
between two nucleic acid regions, refers to a juxtaposition wherein the
regions are in a relationship permitting them to function in their intended
manner. For example, a control sequence "operatively linked" to a coding
sequence is ligated in such a way that expression of the coding sequence is
achieved under conditions compatible with the control sequences, such as
when the appropriate molecules (e.g., inducers and polymerases) are bound
to the control or regulatory sequence(s). Thus, in one embodiment, the
phrase "operatively linked" refers to a promoter connected to a coding
sequence in such a way that the transcription of that coding sequence is
controlled and regulated by that promoter. Techniques for operatively linking
a promoter to a coding sequence are well known in the art; the precise
orientation and location relative to a coding sequence of interest is
dependent, inter alia, upon the specific nature of the promoter.
Thus, the term "operatively linked" can refer to a promoter region that
is connected to a nucleotide sequence in such a way that the transcription of
that nucleotide sequence is controlled and regulated by that promoter
region. Similarly, a nucleotide sequence is said to be under the
"transcriptional control" of a promoter to which it is operatively linked.
Techniques for operatively linking a promoter region to a nucleotide
sequence are known in the art. The term "operatively linked" can also refer
to a transcription termination sequence or other nucleic acid that is
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
38
connected to a nucleotide sequence in such a way that termination of
transcription of that nucleotide sequence is controlled by that transcription
termination sequence. Additionally, the term "operatively linked" can refer to
a enhancer, silencer, or other nucleic acid regulatory sequence that when
operatively linked to an open reading frame modulates the expression of that
open reading frame, either in a positive or negative fashion.
As used herein, the phrase "percent identical"," in the context of two
nucleic acid or polypeptide sequences, refers to two or more sequences or
subsequences that have in one embodiment 60%, in another. embodiment
70%, in another embodiment 80%, in another embodiment 90%, in another
embodiment 95%, and in still another embodiment at least 99% nucleotide or
amino acid residue identity, respectively, when compared and aligned for
maximum correspondence, as measured using one of the following
sequence comparison algorithms or by visual inspection. The percent
identify exists in one embodiment over a region of the sequences that is at
least about 50 residues in length, in another embodiment over a region of at
feast about 100 residues, and in another embodiment, the percent identity
exists over at least about 150 residues. In still another embodiment, the
percent identity exists over the entire length of the sequences.
For sequence comparison, typically one sequence acts as a reference
sequence to which test sequences are compared. When using a sequence
comparison algorithm, test and reference sequences are input into a
computer, subsequence coordinates are designated if necessary, and
sequence algorithm program parameters are designated. The sequence
comparison algorithm then calculates the percent sequence identity for the
test sequences) relative to the reference sequence, based on the
designated program parameters.
Optimal alignment of sequences for comparison can be conducted,
for example, by the local homology algorithm disclosed in Smith &
Waterman, 1981, by the homology alignment algorithm disclosed in
Needieman & Wunsch, 1970, by the search for similarity method disclosed in
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
39
Pearson & Lipman, 1988, by computerized implementations of these
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the GCG Wisconsin
Package, available from Accelrys, Inc., San Diego, California, United States
of America), or by visual inspection. See generally, Ausubel et al., 1988.
One example of an algorithm that is suitable for determining percent
sequence identity and sequence similarity is the BLAST algorithm, which is
described in Altschul et al., 1990. Software for performing BLAST analysis is
publicly available through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high
scoring sequence pairs (HSPs) by identifying short words of length W in the
query sequence, which either match or satisfy some positive valued
threshold score T when aligned with a word of the same length in a database
sequence. T is referred to as the neighborhood word score threshold. See
generally, Altschul et al., 1990. These initial neighborhood word hits act as
seeds for initiating searches to find longer HSPs containing them. The word
hits are then extended in both directions along each sequence for as far as
the cumulative alignment score can be increased. Cumulative scores are
calculated using, for nucleotide sequences, the parameters M (reward score
for a pair of matching residues; always > 0) and N (penalty score for
mismatching residues; always < 0). For amino acid sequences, a scoring
matrix is used to calculate the cumulative score. Extension of the word hits
in each direction are halted when the cumulative alignment score falls off by
the quantity X from its maximum achieved value, the cumulative score goes
to zero or below due to the accumulation of one or more negative scoring
residue alignments, or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and speed of the ,
alignment. The BLASTN program (for nucleotide sequences) uses as
defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M
= 5, N = 4, and a comparison of both strands. For amino acid sequences,
the BLASTP program uses as defaults a wordlength (W) of 3, an expectation
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
(E) of 10, and the BLOSUM62 scoring matrix. See Henikoff & Henikoff,
1992.
In addition to calculating percent sequence identity, the BLAST
algorithm also performs a statistical analysis of the similarity between two
5 sequences (see e.g., Karlin & Altschul, 1993). One measure of similarity
provided by the BLAST algorithm is the smallest sum probability (P(N)),
which provides an indication of the probability by which a match between two
nucleotide or amino acid sequences would occur by chance. For example, a
test nucleic acid sequence is considered similar to a reference sequence if
10 the smallest sum probability in a comparison of the test nucleic acid
sequence to the reference nucleic acid sequence is in one embodiment less
than about 0.1, in another embodiment less than about 0.01, and in still
another embodiment less than about 0.001.
The phrase "hybridizing substantially to" refers to complementary
15 hybridization between a probe nucleic acid molecule and a target nucleic
acid molecule and embraces minor mismatches (for example,
polymorphisms) that can be accommodated by reducing the stringency of
the hybridization and/or wash media to achieve the desired hybridization.
"Stringent hybridization conditions" and "stringent hybridization wash
20 conditions" in the context of nucleic acid hybridization experiments such
as
Southern and Northern blot analysis are both sequence- and environment-
dependent. Longer sequences hybridize specifically at higher temperatures.
An extensive guide to the hybridization of nucleic acids is found in Tijssen,
1993. Generally, high stringency hybridization and wash conditions are
25 selected to be about 5°C lower than the thermal melting point (Tm)
for the
specific sequence at a defined ionic strength and pH. Typically, under
"highly stringent conditions" a probe will hybridize specifically to its
target
subsequence, but to no other sequences. Similarly, medium stringency
hybridization and wash conditions are selected to be more than about
5°C
30 lower than the Tm for the specific sequence at a defined ionic strength and
pH. Exemplary medium stringency conditions include hybridizations and
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
41
washes as for high stringency conditions, except that the temperatures for
the hybridization and washes are in one embodiment 8°C, in another
embodiment 10°C, in another embodiment 12°C, and in still
another
embodiment 15°C lower than the Tm for the specific sequence at a
defined
ionic strength and pH.
The Tm is fihe temperature (under defined ionic strength and pH) at
which 50% of the target sequence hybridizes to a perfectly matched probe.
Very stringent conditions are selected to be equal to the Tm for a particular
probe. An example of highly stringent hybridization conditions for Southern
or Northern Blot analysis of complementary nucleic acids having more than
about 100 complementary residues is overnight hybridization in 50%
formamide with 1 mg of heparin at 42°C. An example of highly stringent
wash conditions is 15 minutes in 0.1x standard saline citrate (SSC), 0.1%
(w/v) SDS at 65°C. Another example of highly stringent wash conditions
is
15 minutes in 0.2x SSC buffer at 65°C (see Sambrook and Russell, 2001
for
a description of SSC buffer and other stringency conditions). Often, a high
stringency wash is preceded by a lower stringency wash to remove
background probe signal. An example of medium stringency wash
conditions for a duplex of more than about 100 nucleotides is 15 minutes in
1X SSC at 45°C. Another example of medium stringency wash for a duplex
of more than about 100 nucleotides is 15 minutes in 4-6X SSC at 40°C.
For
short probes (e.g., about 10 to 50 nucleotides), stringent conditions
typically
involve salt concentrations of less than about 1 M Na+ ion, typically about
0.01 to 1 M Na+ ion concentration (or other salts) at pH 7.0-8.3, and the
temperature is typically at least about 30°C. Stringent conditions can
also be
achieved with the addition of destabilizing agents such as formamide. In
general, a signal to noise ratio of 2-fold (or higher) than that observed for
an
unrelated probe in the particular hybridization assay indicates detection of a
specific hybridization.
The following are examples of hybridization and wash conditions that
can be used to clone homologous nucleotide sequences that are
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
42
substantially similar to reference nucleotide sequences of the presently
disclosed subject matter: a probe nucleotide sequence hybridizes in one
example to a target nucleotide sequence in 7% sodium dodecyl sulfate
(NaDS), 0.5M NaP04, 1 mm ethylene diamine tetraacetic acid (EDTA) at
50°C followed by washing in 2X SSC, 0.1 % NaDS at 50°C; in
another
example, a probe and target sequence hybridize in 7% NaDS, 0.5 M NaPO4,
1 mm EDTA at 50°C followed by washing in 1X SSC, 0.1% NaDS at
50°C; in
another example, a probe and target sequence hybridize in 7% NaDS, 0.5 M
NaP04, 1 mm EDTA at 50°C followed by washing in 0.5X SSC, 0.1 %
NaDS
at 50°C; in another example, a probe and target sequence hybridize in
7%
NaDS, 0.5 M NaP04, 1 mm EDTA at 50°C followed by washing in 0.1X
SSC, 0.1 % NaDS at 50°C; in yet another example, a probe and
target
sequence hybridize in 7% NaDS, 0.5 M NaP04, 1 mm EDTA at 50°C
followed by washing in 0.1X SSC, 0.1 % NaDS at 65°C. In one embodiment,
hybridization conditions comprise hybridization in a roller tube for at least
12
hours at 42°'C.
The term "phenotype" refers to the entire physical, biochemical, and
physiological makeup of a cell or an organism, e.g., having any one trait or
any group of traits. As such, phenotypes result from the expression of genes
within a cell or an organism, and relate to traits that are potentially
observable or assayable.
As used herein, the terms "polypeptide", "protein", and "peptide",
which are used interchangeably herein, refer to a polymer of the 20 protein
amino acids, or amino acid analogs, regardless of its size or function.
Although "protein" is often used in reference to relatively large
polypeptides,
and "peptide" is often used in reference to small polypeptides, usage of
these terms in the art overlaps and varies. The term "polypeptide" as used
herein refers to peptides, polypeptides and proteins, unless otherwise noted.
As used herein, the terms "protein", "polypeptide" and "peptide" are used
interchangeably herein when referring to a gene product. The term
"polypeptide" encompasses proteins of all functions, including enzymes.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
43
Thus, exemplary polypeptides include gene products, naturally occurring
proteins, homologs, orthologs, paralogs, fragments, and other equivalents,
variants and analogs of the foregoing.
The terms "polypeptide fragment" or "fragment", when used in
reference to a reference polypeptide, refers to a pofypeptide in which amino
acid residues are deleted as compared to the reference polypeptide itself,
but where the remaining amino acid sequence is usually identical to the
corresponding positions in the reference polypeptide. Such deletions can
occur at the amino-terminus or carboxy-terminus of the reference
polypeptide, or alternatively both. Fragments typically are at least 5, 6, 8
or
10 amino acids long, at least 14 amino acids long, at least 20, 30, 40 or 50
amino acids long, at least 75 amino acids long, or at least 100, 150, 200,
300, 500 or more amino acids long. A fragment can retain one or more of
the biological activities of the reference polypeptide. In certain
embodiments, a fragment can comprise a domain or feature, and optionally
additional amino acids on one or both sides of the domain or feature, which
additional amino acids can number from 5, 10, 15, 20, 30, 40, 50, or up to
100 or more residues. Further, fragments can include a sub-fragment of a
specific region, which sub-fragment retains a function of the region from
which it is derived. In another embodiment, a fragment can have
immunogenic properties.
As used herein, the term "pre-polypeptide" refers to a polypeptide that
is normally targeted to a cellular organelle, such as a chloroplast, and still
comprises a transit peptide.
As used herein, the term "primer" refers to a sequence comprising in
one embodiment two or more deoxyribonucleotides or ribonucleotides, in
another embodiment more than three, in another embodiment more than
eight, and in yet another embodiment at least about 20 nucleotides of an
exonic or intronic region. Such oligonucleotides are in one embodiment
between ten and thirty bases in length.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
44
The term "promoter" or "promoter region" each refers to a nucleotide
sequence within a gene that is positioned 5' to a coding sequence and
functions to direct transcription of the coding sequence. The promofier
region comprises a transcriptional start site, and can additionally include
one
or more transcriptional regulatory elements. In one embodiment, a method
of the presently disclosed subject matter employs a RNA polymerase III
promoter.
A "minimal promoter" is a nucleotide sequence that has the minimal
elements required to enable basal level transcription to occur. As such,
minimal promoters are not complete promoters but rather are subsequences
of promoters that are capable of directing a basal level of transcription of a
reporter construct in an experimental system. Minimal promoters include but
are not limited to the CMV minimal promoter, the HSV-tk minimal promoter,
the simian virus 40 (SV40) minimal promoter, the human b-actin minimal
promoter, the human EF2 minimal promoter, the adenovirus E1 B minimal
promoter, and the heat shock protein (hsp) 70 minimal promoter. Minimal
promoters are often augmented with one or more transcriptional regulatory
elements to influence the transcription of an operatively linked gene. For
example, cell-type-specific or tissue-specific transcriptional regulatory
elements can be added to minimal promoters to create recombinant
promoters that direct transcription of an operatively linked nucleotide
sequence in a cell-type-specific or tissue-specific manner
Different promoters have different combinations of transcriptional
regulatory elements. Whether or not a gene is expressed in a cell is
dependent on a combination of the particular transcriptional regulatory
elements that make up the gene's promoter and the different transcription
factors that are present within the nucleus of the cell. As such, promoters
are often classified as "constitutive", "tissue-specific", "cell-type-
specific", or
"inducible", depending on their functional activities in vivo or in vitro. For
example, a constitutive promoter is one that is capable of directing
transcription of a gene in a variety of cell types. Exemplary constitutive
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
promoters include the promoters for the following genes which encode
certain constitutive or "housekeeping'' functions: hypoxanthine
phosphoribosyl transferase (HPRT), dihydrofolate reductase (DHFR;
Scharfmann et al., 1991 ), adenosine deaminase, phosphoglycerate kinase
5 (PGK), pyruvate kinase, phosphoglycerate mutase, the ~i-actin promoter
(see e.g., Williams et al., 1993), and other constitutive promoters known to
those of skill in the art. "Tissue-specific" or "cell-type-specific"
promoters, on
the other hand, direct transcription in some tissues and cell types but are
inactive in others. Exemplary tissue-specific promoters include those
10 promoters described in more detail hereinbelow, as well as other tissue-
specific and cell-type specific promoters known to those of skill in the art.
When used in the context of a promoter, the term "linked" as used
herein refers to a physical proximity of promoter elements such that they
function together to direct transcription of an operatively linked nucleotide
15 sequence
The term "transcriptional regulatory sequence" or "transcriptional
regulatory element", as used herein, each refers to a nucleotide sequence
within the promoter region that enables responsiveness to a regulatory
transcription factor. Responsiveness can encompass a decrease or an
20 increase in transcriptional output and is mediated by binding of the
transcription factor to the DNA molecule comprising the transcriptional
regulatory element. In one embodiment, a transcriptional regulatory
sequence is a transcription termination sequence, alternatively referred to
herein as a transcription termination signal.
25 The term "transcription factor" generally refers to a protein that
modulates gene expression by interaction with the transcriptional regulatory
element and cellular components for transcription, including RNA
Polymerase, Transcription Associated Factors (TAFs), chromatin-remodeling
proteins, and any other relevant protein that impacts gene transcription.
30 As used herein, "significance" or "significant" relates to a statistical
analysis of the probability that there is a non-random association between
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
46
two or more entities. To determine whether or not a relationship is
"significant" or has "significance", statistical manipulations of the data can
be
performed to calculate a probability, expressed as a "p-value". Those p-
values that fall below a user-defined cutoff point are regarded as
significant.
In one example, a p-value less than or equal to 0.05, in another example
less than 0.01, in another example less than 0.005, and in yet another
example less than 0.001, are regarded as significant.
The term "purified" refers to an object species that is the predominant
species present (i.e., on a molar basis it is more abundant than any other
individual species in the composition). A "purified fraction" is a composition
wherein the object species comprises at feast about 50 percent (on a molar
basis) of all species present. In making the determination of the purity of a
species in solution or dispersion, the solvent or matrix in which the species
is
dissolved or dispersed is usually not included in such determination; instead,
only the species (including the one of interest) dissolved or dispersed are
taken into account. Generally, a purified composition will have one species
that comprises more than about 80 percent .of all species present in the
composition, more than about 85%, 90%, 95%, 99% or more of all species
present. The object species can be purified to essential homogeneity
(contaminant species cannot be detected in the composition by conventional
detection methods) wherein the composition consists essentially of a single
species. A skilled artisan can purify a polypeptide of the presently disclosed
subject matter using standard techniques for protein purification in light of
the teachings herein. Purity of a polypeptide can be determined by a
number of methods known to those of skill in the art, including for example,
amino-terminal amino acid sequence analysis, gel electrophoresis, and
mass-spectrometry analysis.
A "reference sequence" is a defined sequence used as a basis for a
sequence comparison. A reference sequence can be a subset of a larger
sequence, for example, as a segment of a full-length nucleotide or amino
acid sequence, or can comprise a complete sequence. Generally, when
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
47
used to refer to a nucleotide sequence, a reference sequence is at feast 200,
300 or 400 nucleotides in length, frequently at least 600 nucleotides in
length, and often at least 800 nucleotides in length. Because two proteins
can each (1 ) comprise a sequence (i.e., a portion of the complete protein
sequence) that is similar between the two proteins, and (2) can further
comprise a sequence that is divergent between the two proteins, sequence
comparisons between two (or more) proteins are typically performed by
comparing sequences of the two proteins over a "comparison window"
(defined hereinabove) to identify and compare local regions of sequence
similarity.
The term "regulatory sequence" is a generic term used throughout the
specification to refer to polynucleotide sequences, such as initiation
signals,
enhancers, regulators, promoters, and termination sequences, which are
necessary or desirable to affect the expression of coding and non-coding
sequences to which they are operatively linked. Exemplary regulatory
sequences are described in Goeddel, 1990, and include, for example, the
early and late promoters of simian virus 40 (SV40), adenovirus or
cytomegalovirus immediate early promoter, the lac system, the trp system,
the TAC or TRC system, T7 promoter whose expression is directed by T7
RNA polymerise, the major operator and promoter regions of phage
lambda, the control regions for fd coat protein, the promoter for 3-
phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid
phosphatase, e.g., PhoS, the promoters of the yeast a-mating factors, the
polyhedron promoter of the baculovirus system and other sequences known
to control the expression of genes of prokaryotic or eukaryotic cells or their
viruses, and various combinations thereof. The nature and use of such
control sequences can differ depending upon the host organism. In
prokaryotes, such regulatory sequences generally include promoter,
ribosomal binding site, and transcription termination sequences. The term
"regulatory sequence" is intended to include, at a minimum, components
whose presence can influence expression, and can also include additional
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
48
components whose presence is advantageous, for example, leader
sequences and fusion partner sequences.
In certain embodiments, transcription of a polynucleotide sequence is
under the control of a promoter sequence (or other regulatory sequence) that
controls the expression of the polynucleotide in a cell-type in which
expression is intended. It will also be understood that the polynucleotide can
be under the control of regulatory sequences that are the same or difFerent
from those sequences which control expression of the naturally occurring
form of the polynucleotide.
The term "reporter gene" refers to a nucleic acid comprising a
nucleotide sequence encoding a protein that is readily detectable either by
its presence or activity, including, but not limited to, luciferase,
fluorescent
protein (e.g., green fluorescent protein), chloramphenicol acetyl transferase,
~i-galactosidase, secreted placental alkaline phosphatase, ~i-lactamase,
human growth hormone, and other secreted enzyme reporters. Generally, a
reporter gene encodes a polypeptide not otherwise produced by the host
cell, which is detectable by analysis of the cell(s), e.g., by the direct
fluorometric, radioisotopic or,spectrophotometric analysis of the cells) and
typically without the need to kill the cells for signal analysis. In certain
instances, a reporter gene encodes an enzyme, which produces a change in
fluorometric properties of the host cell, which is detectable by qualitative,
quantitative, or semiquantitative function or transcriptional activation.
Exemplary enzymes include esterases, ~3-lactamase, phosphatases,
peroxidases, proteases (tissue plasminogen activator or urokinase) and
other enzymes whose function can be detected by appropriate chromogenic
or fluorogenic substrates known to those skilled in the art or developed in
the
future.
As used herein, the term "sequencing" refers to determining the
ordered linear sequence of nucleic acids or amino acids of a DNA or protein
target sample, using conventional manual or automated laboratory
techniques.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
49
As used herein, the term "substantially pure" refers to that the
polynucleotide or polypeptide is substantially free of the sequences and
molecules with which it is associated in its natural state, and those
molecules used in the isolation procedure. The term "substantially free"
refers to that the sample is in one embodiment at least 50%, in another
embodiment at least 70%, in another embodiment 80% and in still another
embodiment 90% free of the materials and compounds with which is it
associated in nature.
As used herein, the term "target cell" refers to a cell, into which it is
desired to insert a nucleic acid sequence or polypeptide, or to otherwise
effect a modification from conditions known to be standard in the unmodified
cell. A nucleic acid sequence introduced into a target cell can be of variable
length. Additionally, a nucleic acid sequence can enter a target cell as a
component of a plasmid or other vector or as a naked sequence.
As used herein, the term "transcription" refers to a cellular process
involving the interaction of an RNA polymerase with a gene that directs the
expression as RNA of the structural information present in the coding
sequences of the gene. The process includes, but is not limited to, the
following steps: (a) the transcription initiation; (b) transcript elongation;
(c)
transcript splicing; (d) transcript capping; (e) transcript termination; (f)
transcript polyadenylation; (g) nuclear export of the transcript; (h)
transcript
editing; and (i) stabilizing the transcript.
As used herein, the term "transcription factor" refers to a cytoplasmic
or nuclear protein which binds to a gene, or binds to an RNA transcript of a
gene, or binds to another protein which binds to a gene or an RNA transcript
or another protein which in turn binds to a gene or an RNA transcript, so as
to thereby modulate expression of the gene. Such modulation can
additionally be achieved by other mechanisms; the essence of a
"transcription factor for a gene" pertains to a factor that alters the level
of
transcription of the gene in some way.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
The term "transfection" refers to the introduction of a nucleic acid,
e.g., an expression vector, into a recipient cell, which in certain instances
involves nucleic acid-mediated gene transfer. The term "transformation"
refers to a process in which a cell's genotype is changed as a result of the
5 cellular uptake of exogenous nucleic acid, For example, a transformed cell
can express a recombinant form of a polypeptide of the presently disclosed
subject matter or antisense expression can occur from the transferred gene
so that the expression of a naturally occurring form of the gene is disrupted.
The term "vector" refers to a nucleic acid capable of transporting
10 another nucleic acid to which it has been linked. One type of vector that
can
be used in accord with the presently disclosed subject matter is an episome,
i.e., a nucleic acid capable of extra-chromosomal replication. Other vectors
include those capable of autonomous replication and expression of nucleic
acids to which they are linked. Vectors capable of directing the expression
15 of genes to which they are operatively linked are referred to herein as
"expression vectors". In general, expression vectors of utility in recombinant
DNA techniques are often in the form of . plasmids. In the present
specification, "plasmid" and "vector" are used interchangeably as the plasmid
is the most commonly used form of vector. However, the presently disclosed
20 subject matter is intended to include such other forms of expression
vectors
which serve equivalent functions and which become known in the art
subsequently hereto.
The term "expression vector" as used herein refers to a DNA
sequence capable of directing expression of a particular nucleotide
25 sequence in an appropriate host cell, comprising a promoter operatively
linked to the nucleotide sequence of interest which is operatively linked to
transcription termination sequences. It also typically comprises sequences
required for proper translation of the nucleotide sequence. The construct
comprising the nucleotide sequence of interest can be chimeric. The
30 construct can also be one that is naturally occurring but has been obtained
in a recombinant form useful for heterologous expression. The nucleotide
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
51
sequence of interest; including any additional sequences designed to effect
proper expression of the nucleotide sequences, can also be referred to as
an "expression cassette".
The terms "heterologous gene", "heterologous DNA sequence",
"heterologous nucleotide sequence", "exogenous nucleic acid molecule", or
"exogenous DNA segment", as used herein, each refer to a sequence that
originates from a source foreign to an intended host cell or, if from the same
source, is modified from its original form, Thus, a heterologous gene in a
host cell includes a gene that is endogenous to the particular host cell but
has been modified, for example by mutagenesis or by isolation from native
transcriptional regulatory sequences. The terms also include non-naturally
occurring multiple copies of a naturally occurring nucleotide sequence.
Thus, the terms refer to a DNA segment that is foreign or heterologous to the
cell, or homologous to the cell but in a~ position within the host cell
nucleic
acid wherein the element is not ordinarily found.
Two nucleic acids are "recombined" when sequences from each of
the two nucleic acids are combined in a progeny nucleic acid. Two
sequences are "directly" recombined when both of the nucleic acids are
substrates for recombination. Two sequences are "indirectly recombined"
when the sequences are recombined using an intermediate such as a cross
over oligonucleotide. For indirect recombination, no more than one of the
sequences is an actual substrate for recombination, and in some cases,
neither sequence is a substrate for recombination.
As used herein, the term "regulatory elements" refers to nucleotide
sequences involved in controlling the expression of a nucleotide sequence.
Regulatory elements can comprise a promoter operatively linked to the
nucleotide sequence of interest and termination signals. Regulatory
sequences also include enhancers and silencers. They also typically
encompass sequences required for proper translation of the nucleotide
sequence.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
52
As used herein, the term "significant increase" refers to an increase in
activity (for example, enzymatic activity) that is larger than the margin of
error inherent in the measurement technique, in one embodiment an
increase by about 2 fold or greater over a baseline activity (for example, the
activity of the wild type enzyme in the presence of the inhibitor), in another
embodiment an increase by about 5 fold or greater, and in still another
embodiment an increase by about 10 fold or greater.
As used herein, the terms "significantly less" and "significantly
reduced" refer to a result (for example, an amount of a product of an
enzymatic reaction) that is reduced by more than the margin of error inherent
in the measurement technique, in one embodiment a decrease by about 2
fold or greater with respect to a baseline activity (for example, the activity
of
the wild type enzyme in the absence of the inhibitor), in another
embodiment, a decrease by about 5 fold or greater, and in still another
embodiment a decrease by about 10 fold or greater.
As used herein, the terms "specific binding" and "immunological
cross-reactivity" refer to an indicator that two molecules are substantially
similar. An indication that two nucleic acid sequences or polypeptides are
substantially similar is that the polypeptide encoded by the first nucleic
acid
is immunologically cross reactive with, or specifically binds to, the
polypeptide encoded by the second nucleic acid. Thus, a polypeptide is
typically substantially similar to a second polypeptide, for example, where
the two polypeptides differ only by conservative substitutions.
The phrase "specifically (or selectively) binds to an antibody," or
"specifically (or selectively) immunoreactive with," when referring to a
polypeptide or peptide, refers to a binding reaction which is determinative of
the presence of the polypeptide in the presence of a heterogeneous
population of polypeptides and other biologics. Thus, under designated
immunoassay conditions, the specified antibodies bind to a particular
polypeptide and do not bind in a significant amount to other polypeptides
present in the sample. Specific binding to an antibody under such conditions
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
53
can require an antibody that is selected for its specificity for a particular
polypeptide. For example, antibodies raised to the polypeptide with the
amino acid sequence encoded by any of the nucleic acid sequences of the
presently disclosed subject matter can be selected to obtain antibodies
specifically immunoreactive with that polypeptide and not with other
polypeptides except for polymorphic} variants. A variety of immunoassay
formats can be used to select antibodies specifically immunoreactive with a
particular polypeptide. For example, solid phase EL1SA immunoassays,
Western blots, or immunohistochemistry are routinely used to select
monoclonal antibodies specifically immunoreactive with a polypeptide. See
Harlow & Lane, 1988, for a description of immunoassay formats and
conditions that can be used to determine specific immunoreactivity.
Typically a specific or selective reaction will be at leasfi twice background
signal or noise and more typically more than 10 to 100 times background.
As used herein, the term "subsequence" refers to a sequence of
nucleic acids or amino acids that comprises a part of a longer sequence of
nucleic acids or amino acids (e.g., polypeptide), respectively.
As used herein, the term "substrate" refers to a molecule that an
enzyme naturally recognizes and converts to a product in the biochemical
pathway in which the enzyme naturally carries out its function; or is a
modified version of the molecule, which is also recognized by the enzyme
and is converted by the enzyme to a product in an enzymatic reaction similar
to the naturally-occurring reaction.
As used herein, the term "suitable growth conditions" refers to growth
conditions that are suitable for a certain desired outcome, for example, the
production of a recombinant polypeptide or the expression of a nucleic acid
molecule.
As used herein, the term "transformation" refers to a process for
introducing heterologous DNA into a plant cell, plant tissue, or plant.
Transformed plant cells, plant tissue, or plants are understood to encompass
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
54
not only the end product of a transformation process, but also transgenic
progeny thereof.
As used herein, the terms "transformed", "transgenic", and
"recombinant" refer to a host organism such as a bacterium or a plant into
which a heterologous nucleic acid molecule has been introduced. The
nucleic acid molecule can be stably integrated into the genome of the host or
the nucleic acid molecule can also be present as an extrachromosomal
molecule. Such an extrachromosomal molecule can be auto-replicating.
Transformed cells, tissues, or plants are understood to encompass not only
the end product of a transformation process, but also transgenic progeny
thereof. A "non-transformed," "non-transgenic", or "non-recombinant" host
refers to a wild-type organism, e.g., a bacterium or plant, which does not
contain the heterologous nucleic acid molecule.
As used herein, the term "viability" refers to a fitness parameter of a
plant. Plants are assayed for their homozygous performance of plant
development, indicating which polypeptides are essential for plant growth.
III. Nucleic Acids and Polypeptides
In one aspect, the presently disclosed subject matter provides an
isolated nucleic acid molecule encoding a stress-related polypeptide,
wherein the polypeptide binds to a fragment of a protein selected from the
group consisting of OsGF14-c (SEQ IDNO: 113), OsDAD1 (SEQ ID NO:
128), Os006819-2510 (SEQ ID NO: 20), OsCRTC (SEQ ID NO: 134),
OsSGT1 (SEQ ID NO: 144), OsERP (SEQ ID NO: 146), OsCHIB1 (SEQ ID
NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2 (SEQ ID NO: 164), and
OsCAA90866 (SEQ ID NO: 170). In certain embodiments, the isolated
nucleic acid molecule is derived from rice (i.e., Oryza sativa).
As used herein, the phrase "stress-related polypeptide" refers to a
protein or polypeptide (note that these two terms are used interchangeably
throughout) that is involved in stress, particularly plant stress. Such a
polypeptide can be involved in an increase in stress response; conversely,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
such a polypeptide can be involved in the abrogation or inhibition of stress
response. Moreover, the polypeptide can be involved in stress response, for
example, when the cell is exposed to a biotic or abiotic stress. A "stress-
related polypeptide" of the presently disclosed subject matter is identified
by
5 the ability of an increase or decrease in the level of expression of such a
polypeptide in a cell to modulate that cell's response to stress.
As used herein, term "binds" means that a stress-related polypeptide
preferentially interacts with a stated target molecule. In some embodiments,
that interaction allows a biological read-out (e.g., a positive in the yeast
two-
10 hybrid system). In some embodiments, that interaction is measurable (e.g.,
a Kp of at least 10-5 M).
Disclosed herein are rice (O. sativa)-derived cDNAs encoding plant
proteins that interact with OsGF14-c (SEQ IDNO: 113), OsDAD1 (SEQ ID
NO: 128), Os006819-2510 (SEQ ID NO: 20), OsCRTC (SEQ ID NO : 134),
15 OsSGT1 (SEQ ID NO: 144), OsERP (SEQ ID NO: 146), OsCHIBI (SEQ ID
NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2 (SEQ ID NO: 164), and
OsCAA90866 (SEQ ID NO: 170) in the yeast two-hybrid system.
In certain embodiments, the presently disclosed subject matter
provides an isolated nucleic acid molecule comprising a nucleotide
20 sequence substantially similar to the nucleotide sequence of the nucleic
acid
molecule encoding a stress-related polypeptide disclosed herein.
In a broad sense, the term "substantially similar", as used herein with
respect to a nucleotide sequence, refers to a nucleotide sequence
corresponding to a reference nucleotide sequence (i.e., a nucleotide
25 sequence of a nucleic acid molecule encoding a stress-related protein of
the
presently disclosed subject matter), wherein the corresponding sequence
encodes a polypeptide having substantially the same structure as the
polypeptide encoded by the reference nucleotide sequence. In some
embodiments, the substantially similar nucleotide sequence encodes the
30 polypeptide encoded by the reference nucleotide sequence (i.e., although
the nucleotide sequence is different, the encoded protein has the same
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
56
amino acid sequence). In some embodiments, "substantially similar" refers
to nucleotide sequences having at least 50% sequence identity, or at least
60%, 70%, 80% or 85%, or at least 90% or 95%, or at feast 96%, 97% or
99% sequence identity, compared to a reference sequence containing
nucleotide sequences encoding one of the stress-related proteins of the
presently disclosed subject matter (e.g., the proteins described below in the
Examples).
"Substantially similar" also refers to nucleotide sequences having at
least 50% identity, or at least 80% identity, or at least 95% identity, or at
least 99% identity, to a region of nucleotide sequence encoding a BIOPATH
protein and/or an Functional Protein Domain (FPD), wherein the nucleotide
sequence comparisons are conducted using GAP analysis as described '
herein. The term "substantially similar" is specifically intended to include
nucleotide sequences wherein the sequence has been modified to optimize
expression in particular cells.
A polynucleotide including a nucleotide sequence "substantially
similar" to the reference nucleotide sequence hybridizes to a polynucleotide
including the reference nucleotide sequence in one embodiment in 7%
sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM ethylenediamine
teatraacetic acid (EDTA) at 50°C with washing in 2X standard saline
citrate
(SSC), 0.1 % SDS at 50°C, in another embodiment in 7% sodium dodecyl
sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in 1X SSC,
0.1 % SDS at 50°C, in another embodiment in 7% sodium dodecyl sulfate
(SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1
SDS at 50°C, or in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1
mM
EDTA at 50°C with washing in 0.1X SSC, 0.1% SDS at 50°C, or
in still
another embodiment in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1
mM EDTA at 50°C with washing in 0.1X SSC, 0.1% SDS at 65°C.
The term "substantially similar", when used herein with respect to a
protein or polypeptide, refers to a protein or polypeptide corresponding to a
reference protein (i.e., a stress-related protein of the presently disclosed
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
57
subject matter), wherein the protein has substantially the same structure and
function as the reference protein, where only changes in amino acids
sequence that do not materially affect the polypeptide function occur. When
used for a protein or an amino acid sequence the percentage of identity
between the substantially similar and the reference protein or amino acid
sequence is at least 30%, or at least 40%, 50%, 60%, 70%, 80%, 85%, or
90%-, or at least 95%, or at least 99% with every individual number falling
within this range of at least 30% to at least 99% also being part of the
presently disclosed subject matter, using default GAP analysis parameters
with the GCG Wisconsin Package SEQWEB~ application of GAP, based on
the algorithm of Needleman & Wunsch, 1970.
In one embodiment, the polypeptide is involved in a function such as
abiotic stress tolerance, disease resistance, enhanced yield or nutritional
quality or composition. In one embodiment, the polypeptide is involved in
drought resistance.
In one embodiment, isolated polypeptides comprise the amino acid
sequences set forth in even numbered SEQ ID NOs: 2-112, and variants
having conservative amino acid modifications. The term "conservative
modified variants" refers to polypeptides that can be encoded by nucleic acid
sequences having degenerate codon substitutions wherein at least one
position of one or more selected (or all) codons is substituted with mixed-
base and/or deoxyinosine residues (Batzer et al., 1991; Ohtsuka et al., 1985;
Rossolini et al., 1994). Additionally, one skilled in the art will recognize
that
individual substitutions, deletions, or additions to a nucleic acid, peptide,
polypeptide, or polypeptide sequence that alters, adds, or deletes a single
amino acid or a small percentage of amino acids in the encoded sequence is
a "conservative modification" where the modification results in the
substitution of an amino acid with a chemically similar amino acid.
Conservative modified variants provide similar biological activity as the
unmodified polypeptide. Conservative substitution tables listing functionally
similar amino acids are known in the art. See Creighton, 1984.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
58
The term "conservatively modified variant" also refers to a peptide
having an amino acid residue sequence substantially similar to a sequence
of a polypeptide of the presently disclosed subject matter in which one or
more residues have been conservatively substituted with a functionally
similar residue. Examples of conservative substitutions include the
substitution of one non-polar (hydrophobic) residue such as isoleucine,
valine, leucine or methionine for another; the substitution of one polar
(hydrophilic) residue for another such as between arginine and lysine,
between glutamine and asparagine, between glycine and serine; the
substitution of one basic residue such as lysine, arginine or histidine for
another; or the substitution of one acidic residue, such as aspartic acid or
glutamic acid for another.
Amino acid substitutions, such as those which might be employed in
modifying the polypeptides described herein, are generally based on the
relative similarity of the amino acid side-chain substituents, for example,
their
hydrophobicity, hydrophilicity, charge, size, and the like. An analysis of the
size, shape and type of the amino acid side-chain substituents reveals that
arginine, lysine and hisfidine are all positively charged residues; that
alanine,
glycine and serine are all of similar size; and that phenylalanine, tryptophan
and tyrosine all have a generally similar shape. Therefore, based upon
these considerations, arginine, lysine and histidine; alanine, glycine and
serine; and phenylalanine, tryptophan and tyrosine; are defined herein as
biologically functional equivalents. Other biologically functionally
equivalent
changes will be appreciated by those of skill in the art.
In making biologically functional equivalent amino acid substitutions,
the hydropathic index of amino acids can be considered. Each amino acid
has been assigned a hydropathic index on the basis of their hydrophobicity
and charge characteristics, these are: isoleucine (+ 4.5); valine (+ 4.2);
leucine (+ 3.8); phenylalanine (+ 2.8); cysteine (+ 2.5); methionine (+ 1.9);
alanine (+ 1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-
0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5);
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
59
glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and
arginine (-4.5).
The importance of the hydropathic amino acid index in conferring
interactive biological function on a protein is generally understood in the
art
(Kyte & Doolittle, 1982, incorporated herein by reference). It is known that
certain amino acids can be substituted for other amino acids having a similar
hydropathic index or score and still retain a similar biological activity.
Substitutions of amino acids involve amino acids for which the hydropathic
indices are in one embodiment within ~2 of the original value, in another
embodiment within ~1 of the original value, and in still another embodiment
within ~0.5 of the original value in making changes based upon the
hydropathic index.
It is also understood in the art that the substitution of like amino acids
can be made effectively on the basis of hydrophilicity. U.S. Pat. No.
4,554,101, incorporated herein by reference, states that the greatest local
average hydrophilicity of a protein, as governed by the hydrophilicity of its
adjacent amino acids, correlates with ifs immunogenicity and antigenicity,
i.e.
with a biological property of the protein. It is understood that an amino acid
can be substituted for another having a similar hydrophilicity value and still
obtain a biologically equivalent protein.
As detailed in U.S. Patent No. 4,554,101, the following hydrophilicity
values have been assigned to amino acid residues: arginine (+3.0); lysine
(+3.0); aspartate (+3.0 ~ 1 ); glutamate (+3.0 ~ 1 ); serine (+0.3);
asparagine
(+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ~ 1 );
alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-
1.5);
leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5);
tryptophan (-3.4).
Substitutions of amino acids involve amino acids for which the
hydrophilicity values are in one embodiment within ~2 of the original value,
in
another embodiment within ~1 of the original value, and in still another
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
embodiment within ~0.5 of the original value in making changes based upon
similar hydrophilicity values.
While discussion has focused on functionally equivalent polypeptides
arising from amino acid changes, it will be appreciated that these changes
5 can be effected by alteration of the encoding DNA, taking into consideration
also that the genetic code is degenerate and that two or more codons can
code for the same amino acid.
In one embodiment, the polypeptide is expressed in a specific location
or tissue of a plant. In one embodiment, the location or tissue includes, but
10 is not limited to, epidermis, vascular tissue, meristem, cambium, cortex,
aor
pith. In another embodiment, the location or tissue is leaf or sheath, root,
flower, and developing ovule or seed. In another embodiment, the location
or tissue can be, for example, epidermis, root, vascular tissue, meristem,
cambium, cortex, pith, leaf, or flower. In yet another embodiment, the
15 location or tissue is a seed.
The polypeptides of the presently disclosed subject matter, fragments
thereof, or variants thereof, can comprise any number of contiguous amino
acid residues from a polypeptide of the presently disclosed subject matter,
wherein the number of residues is selected from the group of integers
20 consisting of from 10 to the number of residues in a full-length
polypeptide of
the presently disclosed subject matter. In one embodiment, the portion or
fragment of the polypeptide is a functional polypeptide. The presently
disclosed subject matter includes active polypeptides having specific activity
of at least in one embodiment 20%, in another embodiment 30%, in another
25 embodiment 40%, in another embodiment 50%, in another embodiment
60%, in another embodiment 70%, in another embodiment 80%, in another
embodiment 90%, and in still another embodiment 95% that of the native
(non-synthetic) endogenous polypeptide. Further, the substrate specificity
(k~at~Km) can be substantially similar to the native (non-synthetic),
30 endogenous polypeptide. Typically the Km will be at least in one
embodiment 30%, in another embodiment 40%, in another embodiment 50%
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
61
of the native, endogenous polypeptide; and in another embodiment at feast
60%, in another embodiment 70%, in another embodiment 80%, and in yet
another embodiment 90% of the native, endogenous polypeptide. Methods
of assaying and quantifying measures of activity and substrate specificity are
well known to those of skill in the art.
The isolated polypeptides of the presently disclosed subject matter
can elicit production of an antibody specifically reactive to a polypeptide of
the presently disclosed subject matter when presented as an immunogen.
Therefore, the polypeptides of the presently disclosed subject matter can be
employed as immunogens for constructing antibodies immunoreactive to a
polypeptide of the presently disclosed subject matter for such purposes
including, but not limited to, immunoassays or polypeptide purification
techniques. Immunoassays for determining binding are well known to those
of skill in the art and include, but are not limited to, enzyme-linked
immunosorbent assays (ELISAs) and competitive immunoassays.
IV. The Yeast Two-Hybrid Sstem
The yeast two-hybrid system is a well known system which is based
on the finding that most eukaryotic transcription activators are modular (see
e.g., Gyuris et al., 1993; Bartel & Fields, 1997; Feys et al., 2001 ). The
yeast
two-hybrid system uses: 1 ) a plasmid that directs the synthesis of a "bait"
(a
known protein which is brought to the yeast's DNA by being fused to a DNA
binding domain); 2) one or more reporter genes ("reporters") with upstream
binding sites for the bait; and 3) a plasmid that directs the synthesis of
proteins fused to activation domains and other useful moieties ("activation
tagged proteins", or "prey").
In all of the Examples described below, an automated, high-
throughput yeast two-hybrid assay technology (provided by Myriad Genetics
Inc., Salt Lake City, Utah, United States of America) was used to search for
protein interactions with the bait proteins. Briefly, the target protein
(e.g.,
OsE2F1 ) was expressed in yeast as a fusion to the DNA-binding domain of
the yeast Ga14p polypeptide. DNA encoding the target protein or a
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
62
fragment of this protein was amplified from cDNA by PCR or prepared from
an available clone. The resulting DNA fragment was cloned by ligation or
recombination into a DNA-binding domain vector (e.g., pGBT9, pGBT.C,
pAS2-1 ) such that an in-frame fusion between the Ga14p and target protein
sequences was created. The resulting construct, the target gene construct,
was introduced by transformation into a haploid yeast strain.
A screening protocol was then used to search the individual baits
against two activation domain libraries of assorted peptide motifs of greater
than five million cDNA clones. The libraries were derived from RNA isolated
from leaves, stems, and roots of rice plants grown in normal conditions, plus
tissues from plants exposed to various stresses (input trait library), and
from
various seed stages, callus, and early and late panicle (output trait
library).
To screen, a library of activation domain fusions (i.e., O. sativa cDNA cloned
into an activation domain vector) was introduced by transformation into a
haploid yeast strain of the opposite mating type. The yeast strain that
carried the activation domain constructs contained one or more Ga14p-
responsive reporter genes, the expression of which can be monitored. Non-
limiting examples of some yeast reporter strains include Y190, PJ69, and
CBY14a.
Yeast carrying the target gene construct was combined with yeast
carrying the activation domain library. The two yeast strains mated to form
diploid yeast and were plated on media that selected for expression of one
or more Ga14p-responsive reporter genes. Thus, both hybrid proteins (i.e.,
the target "bait" protein and the activation domain "prey" protein) were
expressed in a yeast reporter strain where an interaction between the test
proteins results in transcription of the reporter genes TRP9 and LEU2,
allowing growth on selective medium lacking tryptophan and leucine.
Colonies that arose after incubation were selected for further
characterization. The activation domain plasmid was isolated from each
colony obtained in the two-hybrid search. The sequence of the insert in this
construct was obtained by sequence analysis (e.g., Sanger's dideoxy
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
63
nucleotide chain termination method; see Ausubel et al., 1988, including
updates up to 2002). Thus, the identity of positives obtained from these
searches was determined by sequence analysis against proprietary and
public (e.g., GENBANK~) nucleic acid and protein databases.
Interaction of the activation domain fusion with the target protein was
confirmed by testing for the specificity of the interaction. The activation
domain construct was co-transformed into a yeast reporter strain with either
the original target protein construct or a variety of other DNA-binding domain
constructs. Expression of the reporter genes in the presence of the target
protein but not with other test proteins indicated that the interaction was
genuine.
To further characterize the genes encoding the interacting proteins,
the nucleic acid sequences of the baits and preys were compared with
nucleic acid sequences present on Torrey Mesa Research Institute (TMRI)'s
proprietary GENECHIP~ Rice Genome Array (Affymetrix, Santa Clara,
California, United States of America; see Zhu et al., 2001 ). The rice genome
array contained 25-mer oligonucleotide probes with sequences
corresponding to the 3' ends of 21,000 predicted open reading frames found
in approximately 42,000 contigs that make up the rice genome map (see
Goff et al., 2002). Sixteen different probes were used to measure the
expression level of each nucleic acid. The sequences of the probes are
available at http://tmri.org/gene_exp_web/. The calculated expression value
was determined based on the observed expression level minus the noise
background associated with each probe. Experiments included evaluating
the differential gene expression from various plant tissues comprising seed,
root, leaf and stem, panicle, and pollen. Gene expression was also
measured in plants exposed to environmental cold (i.e., 14°C), osmotic
pressure (growth media supplemented with 260 mM mannitol), drought
(media supplemented with 25°/a polyethylene glycol 8000), salt (media
supplemented with 150 mM NaCI), abscisic acid (ABA)-inducible stresses
(media supplemented with 50 uM ABA; see Chen et al., 2002), infection by
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
64
the fungal pathogen Magnaporthe grisea, and treatment with plant hormones
(jasmonic acid (JA; 100 p,M), gibberellin (GA3; 50 ~M), and abscisic acid)
and with herbicides benzylamino purine (BAP; 10 ~.M), 2,4-
dichlorophenoxyacetic acid (2,4-D; 2
mg/I), and BL2 (10 ~,M).
Many of the stress-related proteins of the presently disclosed subject
matter interact with one another.
V. Controlling and Modulating the Expression of Nucleic Acid Molecules
A. General Considerations
One aspect of the presently disclosed subject matter provides
compositions and methods for modulating (i.e. increasing or decreasing) the
level of nucleic acid molecules and/or polypeptides of the presently disclosed
subject matter in plants. In particular, the nucleic acid molecules and
polypeptides of the presently disclosed subject matter are expressed
constitutively, temporally, or spatially (e.g., at developmental stages), in
certain tissues, and/or quantities, which are uncharacteristic of non-
recombinantly engineered plants. Therefore, the presently disclosed subject
matter provides utility in such exemplary applications as altering the
specified characteristics identified above.
The isolated nucleic acid molecules of the presently disclosed subject
matter are useful for expressing a polypeptide of the presently disclosed
subject matter in a recombinantly engineered cell such as a bacterial, yeast,
insect, mammalian, or plant cell. Expressing cells can produce the
polypeptide in a non-natural condition (e.g., in quantity, composition,
location
and/or time) because they have been genetically altered to do so. Those
skilled in the art are knowledgeable in the numerous expression systems
available for expression of nucleic acids encoding a polypeptide of the
presently disclosed subject matter.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
In another aspect, the presently disclosed subject matter features a
stress-related polypeptide encoded by a nucleic acid molecule disclosed
herein. In certain embodiments, the stress-related polypeptide is isolated.
The presently disclosed subject matter further provides a method for
5 modifying (i.e. increasing or decreasing) the concentration or composition
of
a polypeptide of the presently disclosed subject matter in a plant or part
thereof. Modification can be effected by increasing or decreasing the
concentration and/or the composition (i.e. the ration of the polypeptides of
the presently disclosed subject matter) in a plant. The method comprises
10 introducing into a plant cell an expression cassette comprising a nucleic
acid
molecule of the presently disclosed subject matter as disclosed above to
obtain a transformed plant cell or tissue, and culturing the transformed plant
cell or tissue. The nucleic acid molecule can be under the regulation of a
constitutive or inducible promoter. The method can further comprise
15 inducing or repressing expression of a nucleic acid molecule of a sequence
in the plant for a time sufficient to modify the concentration and/or
composition in the plant or plant part.
A plant or plant part having modified expression of a nucleic acid
molecule of the presently disclosed subject matter can be analyzed and
20 selected using methods known to those skilled in the art including, but not
limited to, Southern blotting, DNA sequencing; or PCR analysis using
primers specific to the nucleic acid molecule and detecting amplicons
produced therefrom.
In general, a concentration or composition is increased or decreased
25 by at least in one embodiment 5%, in another embodiment 10%, in another
embodiment 20%, in another embodiment 30%, in another embodiment
40%, in another embodiment 50%, in another embodiment 60%, in another
embodiment 70%, in another embodiment 80%, and in still another
embodiment 90% relative to a native confirol plant, plant part, or cell
lacking
30 the expression cassette.
B. Modulation of Expression of Nucleic Acid Molecules
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
66
The compositions of the presently disclosed subject matter include
plant nucleic acid molecules, and the amino acid sequences of the
polypeptides or partial-length polypeptides encoded by nucleic acid
molecules comprising an open reading frame. These sequences can be
employed to alter the expression of a particular gene corresponding to the
open reading frame by decreasing or eliminating expression of that plant
gene or by overexpressing a particular gene product. Methods of this
embodiment of the presently disclosed subject matter include stably
transforming a plant with a nucleic acid molecule of the presently disclosed
subject matter that includes an open reading frame operatively linked to a
promoter capable of driving expression of that open reading frame (sense or
antisense) in a plant cell. By "portion" or "fragment", as it relates to a
nucleic
acid molecule that comprises an open reading frame or a fragment thereof
encoding a partial-length polypeptide having the activity of the full length
polypeptide, is meant a sequence having in one embodiment at least 80
nucleotides, in another embodiment at least 150 nucleotides, and in still
another embodiment at least 400 nucleotides. If not employed for
expression, a "portion" or "fragment" means in representative embodiments
at least 9, or 12, or 15, or at least 20, consecutive nucleotides (e.g.,
probes
and primers or other oligonucleotides) corresponding to the nucleotide
sequence of the nucleic acid molecules of the presently disclosed subject
matter. Thus, to express a particular gene product, the method comprises
introducing into a plant, plant cell, or plant tissue an expression cassette
comprising a promoter operatively linked to an open reading frame so as to
yield a transformed differentiated plant, transformed cell, or transformed
tissue. Transformed cells or tissue can be regenerated to provide a
transformed differentiated plant. The transformed differentiated plant or
cells
thereof can express the open reading frame in an amount that alters the
amount of the gene product in the plant or cells thereof, which product is
encoded by the open reading frame. The presently disclosed subject matter
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
67
also provides a transformed plant prepared by the methodsa disclosed
herein, as well as progeny and seed thereof.
The presently disclosed subject matter further includes a nucleotide
sequence that is complementary to one (hereinafter "test" sequence) that
hybridizes under stringent conditions to a nucleic acid molecule of the
presently disclosed subject matter, as well as an RNA molecule that is
transcribed from the nucleic acid molecule. When hybridization is performed
under stringent conditions, either the test or nucleic acid molecule of
presently disclosed subject matter can be present on a support: e.g., on a
membrane or on a DNA chip. Thus, either a denatured test or nucleic acid
molecule of the presently disclosed subject matter is first bound to a support
and hybridization is effected for a specified period of time at a temperature
of, in one embodiment, between 55°C and 70°C, in 2X SSC
containing 0.1
SDS, followed by rinsing the support at the same temperature but with a
buffer having a reduced SSC concentration. Depending upon the degree of
stringency required, such reduced concentration buffers are typically 1 X
SSC containing 0.1 % SDS, 0.5X SSC containing 0.1 % SDS, or 0.1 X SSC
containing 0.1 % SDS.
In a further embodiment, the presently disclosed subject matter
provides a transformed plant host cell, or one obtained through breeding,
capable of over-expressing, under-expressing, or having a knockout of a
polypeptide-encoding gene and/or its gene product(s). The plant . cell is
transformed with at least one such expression vector wherein the plant host
cell can be used to regenerate plant tissue or an entire plant, or seed there
from, in which the effects of expression, including overexpression and
underexpression, of the introduced sequence or sequences can be
measured in vitro or in plants.
In another aspect, the presently disclosed subject matter features an
isolated stress-related polypeptide, wherein the polypeptide binds to a
fragment of a protein selected from the group consisting of OsGFl4-c (SEQ
IDNO: 113), OsDAD1 (SEQ ID NO: 128), Os006819-2510 (SEQ ID NO: 20),
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
68
OsCRTC (SEQ ID NO : 134), OsSGTI (SEQ ID NO: 144), OsERP (SEQ ID
NO: 146), OsCHIB1 (SEQ ID NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2
(SEQ ID NO: 164), and OsCAA90866 (SEQ ID NO: 170). In some
embodiments, the presently disclosed subject matter features an isolated
polypeptide comprising or consisting of an amino acid sequence
substantially similar to the amino acid sequence of an isolated stress-related
polypeptide of the presently disclosed subject matter.
Because the proteins of the presently disclosed subject matter have a
roll in stress, in certain embodiments, a cell introduced with a nucleic acid
molecule of the presently disclosed subject matter has a different stress
response as compared to a cell not introduced with the nucleic acid
molecule.
In another aspect, the presently disclosed subject matter features a
method for modulating stress response of a plant cell, the method
comprising introducing an isolated nucleic acid molecule encoding a stress-
related polypeptide into the plant cell, wherein the polypeptide binds to a
fragment of a protein selected from the group consisting of OsGF14-c (SEQ
IDNO: 113), OsDAD1 (SEQ ID NO: 128), Os006819-25,10 (SEQ ID NO: 20),
OsCRTC (SEQ ID NO : 134), OsSGT1 (SEQ ID NO: 144), OsERP (SEQ ID
NO: 146), OsCHIB1 (SEQ ID NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2
(SEQ ID NO: 164), and OsCAA90866 (SEQ ID NO: 170), wherein the
polypeptide is expressed by the cell.
In another aspect, the presently disclosed subject matter features a
method for modulating stress response of a plant cell comprising introducing
an isolated nucleic acid molecule encoding a stress-related polypeptide info
the plant cell, wherein the polypeptide binds to a fragment of a protein
selected from the group consisting of OsGF14-c (SEQ IDNO: 113), OsDAD1
(SEQ ID NO: 128), Os006819-2510 (SEQ ID NO: 20), OsCRTC (SEQ ID
NO: 134), OsSGT1 (SEQ ID NO: 144), OsERP (SEQ iD NO: 146),
OsCHIB1 (SEQ ID NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2 (SEQ ID
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
69
NO: 164), and OsCAA90866 (SEQ ID NO: 170), wherein expression of the
polypeptide encoded by the nucleic acid molecule is reduced in the cell.
As discussed herein, the stress-related proteins described herein can
affect a cell under conditions of stress (e.g., when the plant is exposed to
biotic or abiotic stress). Accordingly, by changing the amount of a stress-
related protein of the presently disclosed subject matter in a plant cell, the
response of that plant cell to stress can be modulated.
In some situations, increasing expression of a stress-related protein of
the presently disclosed subject matter in a cell will cause that cell to
increase
its stress response (in some cases, rate of proliferation). In other
situations,
increasing expression of a stress-related protein of the presently disclosed
subject matter in a cell causes that cell to reduce its stress response (in
some cases, rate of proliferation). Similarly, decreasing the expression of a
stress-related protein of the presently disclosed subject matter in a cell can
increase or decrease that cell's stress response (in some cases, rate of
proliferation). What is relevant is that the stress response of the cell
changes if the level of expression of a stress-related protein of the
presently
disclosed subject matter is either increased or decreased.
Increasing the level of expression of a stress-related protein of the
presently disclosed subject matter in a cell is a relatively simple matter.
For
example, overexpression of the protein can be accomplished by
transforming the cell with a nucleic acid molecule encoding the protein
according to standard methods such as those described above.
Reducing the level of expression of a stress-related protein of the
presently disclosed subject matter in a cell is likewise simply accomplished
using standard methods. For example, an antisense RNA or DNA
oligonucleotide that is complementary to the sense strand (i.e., the mRNA
strand) of a nucleic acid molecule encoding the protein can be administered
to the cell to reduce expression of that protein in that cell (see e.g.,
Agrawal,
1993; U.S. Patent No. 5,929,226).
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
The modulation in expression of the nucleic acid molecules of the
presently disclosed subject matter can be achieved, for example, in one of
the following ways:
1. "Sense" Suppression
5 Alteration of the expression of a nucleotide sequence of the presently
disclosed subject matter, in one embodiment reduction of its expression, is
obtained by "sense" suppression (referenced in e.g., Jorgensen et al., 1996).
In this case, the entirety or a portion of a nucleotide sequence of the
presently disclosed subject matter is comprised in a DNA molecule. The
10 DNA molecule can be operatively linked to a promoter functional in a cell
comprising the target gene, in one embodiment a plant cell, and introduced
into the cell, in which the nucleotide sequence is expressible. The nucleotide
sequence is inserted in the DNA molecule in the "sense orientation",
meaning that the coding strand of the nucleotide sequence can be
15 transcribed. In one embodiment, the nucleotide sequence is fully
translatable and all the genetic information comprised in the nucleotide
sequence, or portion thereof, is translated into a polypeptide. In another
embodiment, the nucleotide sequence is partially translatable and a short
peptide is translated. In one embodiment, this is achieved by inserting at
20 least one premature stop codon in the nucleotide sequence, which brings
translation to a halt. In another embodiment, the nucleotide sequence is
transcribed but no translation product is made. This is usually achieved by
removing the start codon, i.e. the "ATG", of the polypeptide encoded by the
nucleotide sequence. In a further embodiment, the DNA molecule
25 comprising the nucleotide sequence, or a portion thereof, is stably
integrated
in the genome of the plant cell. In another embodiment, the DNA molecule
comprising the nucleotide sequence, or a portion thereof, is comprised in an
extrachromosomally replicating molecule.
In transgenic plants containing one of the DNA molecules disclosed
30 immediately above, the expression of the nucleotide sequence
corresponding to the nucleotide sequence comprised in the DNA molecule
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
71
can be reduced. The nucleotide sequence in the DNA molecule in one
embodiment is at least 70% identical to the nucleotide sequence the
expression of which is reduced, in another embodiment is at least 80%
identical, in another embodiment is at least 90% identical, in another
embodiment is at least 95% identical, and in still another embodiment is at
least 99% identical.
2. "Antisense" Suppression
In another embodiment, the alteration of the expression of a
nucleotide sequence of the presently disclosed subject matter, for example
the reducfiion of its expression, is obtained by "antisense" suppression. The
entirety or a portion of a nucleotide sequence of the presently disclosed
subject matter is comprised in a DNA molecule. The DNA molecule can be
operatively linked to a promoter functional in a plant cell, and introduced in
a
plant cell, in which the nucleotide sequence is expressible. The nucleotide
sequence is inserted in the DNA molecule in the "antisense orientation",
meaning that the reverse complement (also called sometimes non-coding
strand) of the nucleotide sequence can be transcribed. In one embodiment,
the DNA molecule comprising the nucleotide sequence, or a portion thereof,
is stably integrated in the genome of the plant cell. In another embodiment
the DNA molecule comprising the nucleotide sequence, or a portion thereof,
is comprised in an extrachromosomalfy replicating molecule. Several
publications describing this approach are cited for further illustration
(Green
et al., 1986; van der Krol et al., 1991; Powell et af., 1989; Ecker & Davis,
1986).
In transgenic plants containing one of the DNA molecules disclosed
immediately above, the expression of the nucleotide sequence
corresponding to the nucleotide sequence comprised in the DNA molecule
can be reduced. The nucleotide sequence in the DNA molecule is in one
embodiment at (east 70% identical to the nucleotide sequence the
expression of which is reduced, in another embodiment at least 80%
identical, in another embodiment at least 90% identical, in another
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
72
embodiment at least 95% identical, and in still another embodiment at least
99% identical.
3. Homologous Recombination
In another embodiment, at least one genomic copy corresponding to a
nucleotide sequence of the presently disclosed subject matter is modified in
the genome of the plant by homologous recombination as further illustrated
in Paszkowski et al., 1988. This technique uses the ability of homologous
sequences to recognize each other and to exchange nucleotide sequences
between respective nucleic acid molecules by a process known in the art as
homologous recombination. Homologous recombination can occur between
the chromosomal copy of a nucleotide sequence in a cell and an incoming
copy of the nucleotide sequence introduced in the cell by transformation.
Specific modifications are thus accurately introduced in the chromosomal
copy of the nucleotide sequence. In one embodiment, the regulatory
elements of the nucleotide sequence of the presently disclosed subject
matter are modified. Such regulatory elements are easily obtainable by
screening a genomic library using the nucleotide sequence of the presently
disclosed subject matter, or a portion thereof, as a probe. The existing
regulatory elements are replaced by different regulatory elements, thus
altering expression of the nucleotide sequence, or they are mutated or
deleted, thus abolishing the expression of the nucleotide sequence. In
another embodiment, the nucleotide sequence is modified by deletion of a
part of the nucleotide sequence or the entire nucleotide sequence, or by
mutation. Expression of a mutated polypeptide in a plant cell is also
provided in the presently disclosed subject matter. Recent refinements of
this technique to disrupt endogenous plant genes have been disclosed
(Kempin et al., 1997 and Miao & Lam, 1995).
In one embodiment, a mutation in the chromosomal copy of a
nucleotide sequence is introduced by transforming a cell with a chimeric
oligonucleotide composed of a contiguous stretch of RNA and DNA residues
in a duplex conformation with double hairpin caps on the ends. An
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
73
additional feature of the oligonucleotide is for example the presence of 2'-O-
methylation at the RNA residues. The RNA/DNA sequence is designed to
align with the sequence of a chromosomal copy of a nucleotide sequence of
the presently disclosed subject matter and to contain the desired nucleotide
change. For example, this technique is further illustrated in U.S. Patent No.
5,501,967 and Zhu et al., 1999.
4. Ribozymes
In a further embodiment, an RNA coding for a polypeptide of the
presently disclosed subject matter is cleaved by a catalytic RNA, or
ribozyme, specific for such RNA. The ribozyme is expressed in transgenic
plants and results in reduced amounts of RNA coding for the polypeptide of
the presently disclosed subject matter in plant cells, thus leading to
reduced amounts of polypeptide accumulated in the cells. This method is
further illustrated in U.S. Patent No. 4,987,071.
5. Dominant-Negative Mutants
In another embodiment, the activity of a polypeptide encoded by the
nucleotide sequences of the presently disclosed subject matter is changed.
This is achieved by expression of dominant negative mutants of the
polypeptides in transgenic plants, leading to the loss of activity of the
endogenous polypeptide.
6. Aptamers
In a further embodiment, the activity of polypeptide of the presently
disclosed subject matter is inhibited by expressing in transgenic plants
nucleic acid ligands, so-called aptamers, which specifically bind to the
polypeptide. Aptamers can be obtained by the SELEX (Systematic Evolution
of Ligands by Exponential Enrichment) method. In the SELEX method, a
candidate mixture of single stranded nucleic acids having regions of
randomized sequence is contacted with the polypeptide and those nucleic
acids having an increased affinity to the target are partitioned from the
remainder of the candidate mixture. The partitioned nucleic acids are
amplified to yield a ligand-enriched mixture. After several iterations a
nucleic
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
74
acid with optimal affinity to the polypeptide is obtained and is used for
expression in transgenic plants. This method is further illustrated in U.S.
Patent No. 5,270,163.
7. Zinc Finger Polypeptides
A zinc finger polypeptide that binds a nucleotide sequence of the
presently disclosed subject matter or to its regulatory region can also be
used to alter expression of the nucleotide sequence. In alternative
embodiments, transcription of the nucleotide sequence is reduced or
increased. Zinc finger polypeptides are disclosed in, for example, Beerli et
al., 1998, or in WO 95/19431, WO 98/54311, or WO 96/06166, all
incorporated herein by reference in their entirety.
8. dsRNA
Alteration of the expression of a nucleotide sequence of the presently
disclosed subject matter can also be obtained by double stranded RNA
(dsRNA) interference (RNAi) as disclosed, for example, in WO 99/32619,
WO 99/53050, or WO 99/61631, all incorporated herein by reference in their
entireties. In one embodiment, the alteration of the expression of a
nucleotide sequence of the presently disclosed subject matter, in one
embodiment the reduction of ifs expression, is obtained by dsRNA
interference. The entirety, or in one embodiment a portion, of a nucleotide
sequence of the presently disclosed subject matter, can be comprised in a
DNA molecule. The size of the DNA molecule is in one embodiment from
100 to 1000 nucleotides or more; the optimal size to be determined
empirically. Two copies of the identical DNA molecule are linked, separated
by a spacer DNA molecule, such that the first and second copies are in
opposite orientations. In one embodiment, the first copy of the DNA
molecule is the reverse complement (also known as the non-coding strand)
and the second copy is the coding strand; in another embodiment, the first
copy is the coding strand, and the second copy is the reverse complement.
The size of the spacer DNA molecule is in one embodiment 200 to 10,000
nucleotides, in another embodiment 400 to 5000 nucleotides, and in yet
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
another embodiment 600 to 1500 nucleotides in length. The spacer is in one
embodiment a random piece of DNA, in another embodiment a random
piece of DNA without homology to the target organism for dsRNA
interference, and in still another embodiment a functional intron that is
5 effectively spliced by the target organism. The two copies of the DNA
molecule separated by the spacer are operatively linked to a promoter
functional ,in a plant cell, and introduced in a plant cell in which the
nucleotide sequence is expressible. In one embodiment, the DNA molecule
comprising the nucleotide sequence, or a portion thereof, is stably integrated
10 in the genome of the plant cell. In another embodiment, the DNA molecule
comprising the nucleotide sequence, or a portion thereof, is comprised in an
extrachromosomally replicating molecule. Several publications describing
this approach are cited for further illustration (Waterhouse et al., 1998;
Chuang & Meyerowitz, 2000; Smith et al., 2000).
15 In another non-limiting example, RNA interference (RNAi) or post-
transcriptional gene silencing (PTGS) can be employed to reduce the level of
expression of a stress-related protein of the presently disclosed subject
matter in a cell. As used herein, the terms "RNA interference" and "post-
transcriptional gene silencing" are used interchangeably and refer to a
20 process of sequence-specific modulation of gene expression mediated by a
small interfering RNA (siRNA; see generally Fire et al., 1998), resulting in
null or hypomorphic phenotypes. Thus, because described herein are
nucleotide sequences encoding the stress-related proteins of the presently
disclosed subject matter, RNAi can be readily designed. Indeed, constructs
25 encoding an RNAi molecule have been developed which continuously
synthesize an RNAi molecule, resulting in prolonged repression of
expression of the targeted gene (Brummelkamp et al., 2002).
In transgenic plants containing one of the DNA molecules disclosed
immediately above, the expression of the nucleotide sequence
30 corresponding to the nucleotide sequence comprised in the DNA molecule is
in one embodiment reduced. In one embodiment, the nucleotide sequence
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
76
in the DNA molecule is at least 70% identical to the nucleotide sequence the
expression of which is reduced, in another embodiment it is at least 80%
identical, in another embodiment it is at least 90% identical, in another
embodiment it is at least 95% identical, and in still another embodiment it is
at least 99% identical.
9. Insertion of a DNA Molecule,~lnsertional Muta enesis)
In one embodiment, a DNA molecule is inserted into a chromosomal
copy of a nucleotide sequence of the presently disclosed subject matter, or
into a regulatory region thereof. In one embodiment, such DNA molecule
comprises a transposable element capable of transposition in a plant cell,
such as, for example, Ac/Ds, Em/Spm, mutator. Alternatively, the DNA
molecule comprises a T-DNA border of an Agrobacterium T-DNA. The DNA
molecule can also comprise a recombinase or integrase recognition site that
can be used to remove part of the DNA molecule from the chromosome of
the planfi cell. Methods of insertional mutagenesis using T-DNA,
transposons, oligonucleotides, or other methods known to those skilled in
the art are also encompassed. Methods of using T-DNA and transposon for
insertional mutagenesis are disclosed in Winkler & Feldmann, 1989, and
Martienssen, 1998, incorporated herein by reference in their entireties.
10. Deletion Mutaaenesis
In yet another embodiment, a mutation of a nucleic acid molecule of
the presently disclosed subject matter is created in the genomic copy of the
sequence in the cell or plant by deletion of a portion of the nucleotide
sequence or regulator sequence. Methods of deletion mutagenesis are
known to those skilled in the art. See e.g., Miao & Lam, 1995.
In yet another embodiment, a deletion is created at random in a large
population of plants by chemical mutagenesis or irradiation and a plant with
a deletion in a gene of the presently disclosed subject matter is isolated by
forward or reverse genetics. Irradiation with fast neutrons or gamma rays is
known to cause deletion mutations in plants (Silverstone et al., 1998;
Bruggemann et al., 1996; Redei & Koncz, 1992). Deletion mutations in a
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
77
gene of the presently disclosed subject matter can be recovered in a reverse
genetics strategy using PCR with pooled sets of genomic DNAs as has been
shown in C. elegans (Liu et al., 1999). A forward genetics strategy involves
mutagenesis of a line bearing a trait of interest followed by screening the M2
progeny for the absence of the trait. Among these mutants would be
expected to be some that disrupt a gene of the presently disclosed subject
matter. This could be assessed by Southern blotting or PCR using primers
designed for a gene of the presently disclosed subject matter with genomic
DNA from these mutants.
11. Overexpression in a Plant Cell
In yet another embodiment, a nucleotide sequence of the presently
disclosed subject matter encoding a polypeptide is overexpressed.
Examples of nucleic acid molecules and expression cassettes for over-
expression of a nucleic acid molecule of the presently disclosed subject
matter are disclosed above. Methods known to those skilled in the art of
over-expression of nucleic acid molecules are also encompassed by the
presently disclosed subject matter.
In one embodiment, the expression of the nucleotide sequence of the
presently disclosed subject matter is altered in every cell of a plant. This
can
be obtained, for example, though homologous recombination or by insertion
into a chromosome. This can also be obtained, for example, by expressing
a sense or antisense RNA, zinc finger polypeptide or ribozyme under the
control of a promoter capable of expressing the sense or antisense RNA,
zinc finger polypeptide, or ribozyme in every cell of a plant. Constitutive,
inducible, tissue-specific, cell type-specific, or developmentally-regulated
expression are also within the scope of the presently disclosed subject
matter and result in a constitutive, inducible, tissue-specific, or
developmentally-regulated alteration of the expression of a nucleotide
sequence of the presently disclosed subject matter in the plant cell.
Constructs for expression of the sense or antisense RNA, zinc finger
polypeptide, or ribozyme, or for over-expression of a nucleotide sequence of
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
78
the presently disclosed subject matter, can be prepared and transformed into
a plant cell according to the teachings of the presently disclosed subject
matter, for example, as disclosed herein.
C. Construction of Plant Expression Vectors
Further encompassed within the presently disclosed subject matter is
a recombinant vector comprising an expression cassette according to the
embodiments of the presently disclosed subject matter. Also encompassed
are plant cells comprising expression cassettes according to the present
disclosure, and plants comprising these plant cells. In one embodiment, the
plant is a dicot. In another embodiment, the plant is a gymnosperm. In
another embodiment, the plant is a monocot. In one embodiment, the
monocot is a cereal. In one embodiment, the cereal is, for example, maize,
wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt,
emmer, teff, milo, flax, gramma grass, Tripsacum or teosinte. In another
embodiment, the cereal is sorghum.
In one embodiment, the expression cassette is expressed throughout
the plant. In another embodiment, the expression cassette is expressed in a
specific location or tissue of a plant. In one embodiment, the location or
tissue includes, but is not limited to, epidermis, root, vascular tissue,
meristem, cambium, cortex, pith, leaf, flower, and combinations thereof. ,In
another embodiment, the location or tissue is a seed.
In one embodiment, the expression cassette is involved in a function
including, but not limited to, disease resistance, yield, biotic or abiotic
stress
resistance, nutritional quality, carbon metabolism, photosynthesis, signal
transduction, cell growth, reproduction, disease processes (for example,
pathogen resistance), gene regulation, and differentiation. In one
embodiment, the polypeptide is involved in a function such as biotic or
abiotic stress tolerance, enhanced yield or proliferation, disease resistance,
or nutritional composition.
For example, a nucleic acid molecule of the presently disclosed
subject matter can be introduced, under conditions for expression, into a
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
79
host cell such that the host cell transcribes and translates the nucleic acid
molecule to produce a stress-related polypeptide. By "under conditions for
expression" is meant that a nucleic acid molecule is positioned in the cell
such that it will be expressed in that cell. For example, a nucleic acid
molecule can be located downstream of a promoter that is active in the cell,
such that the promoter will drive the expression of the polypeptide encoded
for by the nucleic acid molecule in the cell. Any regulatory sequence (e.g.,
promoter, enhancer, inducible promoter) can be linked to the nucleic acid
molecule; alternatively, the nucleic acid molecule can include its own
regulatory sequences) such that it will be expressed (i.e., transcribed and/or
translated) in a cell.
Where the nucleic acid molecule of the presently disclosed subject
matter is introduced into a cell under conditions of expression, that nucleic
acid molecule can be included in an expression cassette. Thus, the
presently disclosed subject matter further provides a host cell comprising an
expression cassette comprising a nucleic acid molecule encoding a stress-
related polypeptide as disclosed herein. Such an expression cassette can
include, in addition to the nucleic acid molecule encoding a stress-related
polypeptide of the presently disclosed subject matter, at least one regulatory
sequence (e.g., a promoter and/or an enhancer).
As such, coding sequences intended for expression in transgenic
plants can be first assembled in expression cassettes operatively linked to a
suitable promoter expressible in plants. The expression cassettes can also
comprise any further sequences required or selected for the expression of
the transgene. Such sequences include, but are not limited to, transcription
terminators, extraneous sequences to enhance expression such as introns,
vital sequences, and sequences intended for the targeting of the gene
product to specific organelles and cell compartments. These expression
cassettes can then be easily transferred to the plant transformation vectors
disclosed below. The following is a description of various components of
typical expression cassettes.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
1. Promoters
The selection of the promoter used in expression cassettes can
determine the spatial and temporal expression pattern of the transgene in
the transgenic plant. Selected promoters can express transgenes in specific
5 cell types (such as leaf epidermal cells, mesophyll cells, root cortex
cells) or
in specific tissues or organs (roots, leaves, or flowers, for example) and the
selection can reflect the desired location for accumulation of the gene
product. Alternatively, the selected promoter can drive expression of the
gene under various inducing conditions. Promoters vary in their strength;
10 i.e., their abilities to promote transcription. Depending upon the host
cell
system utilized, any one of a number of suitable promoters can be used,
including the gene's native promoter. The following are non-limiting
examples of promoters that can be used in expression cassettes.
In one non-limiting example, a plant promoter fragment can be
15 employed that will direct expression of the gene in all tissues of a
regenerated plant. Such promoters are referred to herein as "constitutive"
promoters and are active under most environmental conditions and states of
development or cell differentiation. Examples of constitutive promoters
include the cauliflower mosaic virus (CaMV) 35S transcription initiation
20 region, the 1'- or 2'-promoter derived from T-DNA of Agrobacterium
tumefaciens, and other transcription initiation regions from various plant
genes known to those of ordinary skill in the art. Such genes include for
example, the AP2 gene, ACT11 from Arabidopsis (Huang et al., 1996), Cat3
from Arabidopsis (GENBANK~ Accession No. 043147; Zhong et al., 1996),
25 the gene encoding stearoyl-acyl carrier protein desaturase from Brassica
napus (GENBANK~ Accession No. X74782; Solocombe et al., 1994), GPc1
from maize (GENBANK~ Accession No. X15596; Martinez et al., 1989), and
Gpc2 from maize (GENBANK~ Accession No. 045855; Manjunath et al.,
1997).
30 Alternatively, the plant promoter can direct expression of the nucleic
acid molecules of the presently disclosed subject matter in a specific tissue
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
81
or can be otherwise under more precise environmental or developmental
control. Examples of environmental conditions that can effect transcription
by inducible promoters include anaerobic conditions, elevated temperature,
or the presence of light. Such promoters are referred to herein as
"inducible", "cell type-specific", or "tissue-specific" promoters. Ordinary
skill
in the art will recognize that a tissue-specific promoter can drive expression
of operatively linked sequences in tissues other than the target tissue. Thus,
as used herein a tissue-specific promoter is one that drives expression
preferentially in the target tissue, but can also lead to some expression in
other tissues as well.
Examples of promoters under developmental control include
promoters that initiate transcription only (preferentially) in certain
tissues,
such as fruit, seeds, or flowers. Promoters that direct expression of nucleic
acids in ovules, flowers, or seeds are particularly useful in the presently
disclosed subject matter. As used herein a seed-specific or preferential
promoter is one that directs expression specifically or preferentially in seed
tissues. Such promoters can be, for example, ovule-specific, embryo-
specific, endosperm-specific, integument-specific, seed coat-specific, or
some combination thereof. Examples include a promoter from the ovule-
specific BEL1 gene described in Reiser et al., 1995 (GENBANK~ Accession
No. U39944). Non-limiting examples of seed specific promoters are derived
from the following genes: MAC1 from maize (Sheridan et al., 1996), Cat3
from maize (GENBANK~ Accession No. L05934; Abler et al., 1993), the
gene encoding oleosin 18 kD from maize (GENBANK~ Accession No.
J05212; Lee et al., 1994), viviparous-1 from Arabidopsis (GENBANK~
Accession No. U93215), the gene encoding oleosin from Arabidopsis
(GENBANK~ Accession No. Z17657), Atmycl from Arabidopsis (Urao et al.,
1996), the 2s seed storage protein gene family from Arabidopsis (Conceicao
et al., 1994) the gene encoding oleosin 20 kD from Brassica napus
(GENBANK~ Accession No. M63985), napA from Brassica napus
(GENBANK~ Accession No. J02798; Josefsson et al., 1987), the napin gene
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
82
family from Brassica napus (Sjodahl et al., 1995), the gene encoding the 2S
storage protein from Brassica napus (Dasgupta et al., 1993), the genes
encoding oleosin A (GENBANK~ Accession No. U09118) and oleosin B
(GENBANK~ Accession No. U09119) from soybean, and the gene encoding
low molecular weight sulphur rich protein from soybean (Choi et al., 1995).
Alternatively, particular sequences that provide the promoter with
desirable expression characteristics, or the promoter with expression
enhancement activity, could be identified and these or similar sequences
introduced into the sequences via cloning or via mutation. It is further
contemplated that these sequences can be mutagenized in order to enhance
the expression of transgenes in a particular species.
Furthermore, it is contemplated that promoters combining elements
from more than one promoter can be employed. For example, U.S. Patent
No. 5,491,288 discloses combining a Cauliflower Mosaic Virus (CaMV)
promoter with a histone promoter. Thus, the elements from the promoters
disclosed herein can be combined with elements from other promoters.
a. Constitutive Expression: the Ubiauitin Promoter
Ubiquitin is a gene product known to accumulate in many cell types
and its promoter has been cloned from several species for use in transgenic
plants (e.g., sunflower - Binet et al., 1991; maize - Christensen et al.,
1989;
and Arabidopsis - Callis et al., 1990; Norris et al., 1993). The maize
ubiquitin
promoter has been developed in transgenic monocot systems and its
sequence and vectors constructed for monocot transformation are disclosed
in the patent publication EP 0 342 926 (to Lubrizol) which is herein
incorporated by reference. Taylor et al., 1993, describes a vector (pAHC25)
that comprises the maize ubiquitin promoter and first intron and its high
activity in cell suspensions of numerous monocotyledons when introduced
via microprojectile bombardment. The Arabidopsis ubiquitin promoter is
suitable for use with the nucleotide sequences of the presently disclosed
subject matter. The ubiquitin promoter is suitable for gene expression in
transgenic plants, both monocotyledons and dicotyledons. Suitable vectors
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
83
are derivatives of pAHC25 or any of the transformation vectors disclosed
herein, modified by the introduction of the appropriate ubiquitin promoter
and/or intron sequences.
b. Constitutive Expression: the CaMV 35S Promoter
Construction of the plasmid pCGN1761 is disclosed in the published
patent application EP 0 392 225 (Example 23), which is hereby incorporated
by reference. pCGN1761 contains the "double" CaMV 35S promoter and
the tml transcriptional terminator with a unique EcoRl site between the
promoter and the terminator and has a pUC-type backbone. A derivative of
pCGN1761 is constructed which has a modified polylinker that includes Notl
and Xhol sites in addition to the existing EcoRl site. This derivative is
designated pCGN1761 ENX. pCGN1761 ENX is useful for the cloning of
cDNA sequences or coding sequences (including microbial ORF sequences)
within its polylinker for the purpose of their expression under the control of
the 35S promoter in transgenic plants. The entire 35S promoter-coding
sequence-tml terminator cassette of such a construction can be excised by
Hindlll, Sphl, Sall, and Xbal sites 5' to the promoter and Xbal, BamHl and
Bgll sites 3' to the terminator for transfer to transformation vectors such as
those disclosed below. Furthermore, the double 35S promoter fragment can
be removed by 5' excision with Hindlll, Sphl, Sall, Xbal, or Pstl, and 3'
excision with any of the polylinker restriction sites (EcoRl, Notl or Xhol)
for
replacement with another promoter. If desired, modifications around the
cloning sites can be made by the introduction of sequences that can
enhance translation. This is particularly useful when overexpression is
desired. For example, pCGN1761 ENX can be modified by optimization of
the translational initiation site as disclosed in Example 37 of U.S. Patent
No.
5,639,949, incorporated herein by reference.
c. Constitutive Expression: the Actin Promoter
Several isoforms of actin are known to be expressed in most cell
types and consequently the actin promoter can be used as a constitutive
promoter. In particular, the promoter from the rice Actl gene has been
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
84
cloned and characterized (McElroy et al., 1990). A 1.3 kilobase (kb)
fragment of the promoter was found to contain all the regulatory elements
required for expression in rice protoplasts. Furthermore, numerous
expression vectors based on the Acfl promoter have been constructed
specifically for use in monocotyledons (McElroy et al., 1991 ). These
incorporate the Actl-intron 1, Adhl 5' flanking sequence (from the maize
alcohol dehydrogenase gene) and Adhl-intron 1 and sequence from the
CaMV 35S promoter. Vectors showing highest expression were fusions of
35S and Actl intron or the Actl 5' flanking sequence and the Actl intron.
Optimization of sequences around the initiating ATG (of the ~i-glucuronidase
(GUS) reporter gene) also enhanced expression. The promoter expression
cassettes disclosed in McElroy et al., 1991, can be easily modified for gene
expression and are particularly suitable for use in monocotyledonous hosts.
For example, promoter-containing fragments are removed from the McElroy
constructions and used to replace the double 35S promoter in
pCGN1761 ENX, which is then available for the insertion of specific gene
sequences. The fusion genes thus constructed can then be transferred to
appropriate transformation vectors. In a separate report, the rice Actl
promoter with its first intron has also been found to direct high expression
in
cultured barley cells (Chibbar et al., 1993).
d. Inducible Expression: PR-1 Promoters
The double 35S promoter in pCGN1761 ENX can be replaced with
any other promoter of choice that will result in suitably high expression
levels. By way of example, one of the chemically regulatable promoters
disclosed in U.S. Patent No. 5,614,395, such as the tobacco PR-1 a
promoter, can replace the double 35S promoter. Alternately, the Arabidopsis
PR-1 promoter disclosed in Lebel et al., 1998, can be used. The promoter of
choice can be excised from its source by restriction enzymes, but can
alternatively be PCR-amplified using primers that carry appropriate terminal
restriction sites. Should PCR-amplification be undertaken, the promoter can
be re-sequenced to check for amplification errors after the cloning of the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
amplified promoter in the target vector. The chemicallyipathogen regulatable
tobacco PR-1a promoter is cleaved from plasmid pCIB1004 (for
construction, see example 21 of EP 0 332 104, which is hereby incorporated
by reference) and transferred to plasmid pCGN1761 ENX (Uknes et al.,
5 1992). pCIB1004 is cleaved with Ncol and the resulting 3' overhang of the
linearized fragment is rendered blunt by treatment with T4 DNA polymerise.
The fragment is then cleaved with Hindlll and the resultant PR-1 a promoter-
containing fragment is gel purified and cloned into pCGN1761ENX from
which the double 35S promoter has been removed. This is accomplished by
10 cleavage with Xhol and blunting with T4 polymerise, followed by cleavage
with Hindlll, and isolation of the larger vector-terminator containing
fragment
into which the pCIB1004 promoter fragment is cloned. This generates a
pCGN1761ENX derivative with the PR-1a promoter and the tml terminator
and an intervening polylinker with unique EcoRl and Notl sites. The selected
15 coding sequence can be inserted into this vector, and the fusion products
(i.e. promoter-gene-terminator) can subsequently be transferred to any
selected transformation vector, including those disclosed herein. Various
chemical regulators can. be employed to induce expression of the selected
coding sequence in the plants transformed according to the presently
20 disclosed subject matter, including the benzothiadiazole, isonicotinic
acid,
and salicylic acid compounds disclosed in U.S. Patent Nos. 5,523,311 and
5,614,395.
e. Inducible Expression: an Ethanol-Inducibie Promoter
A promoter inducible by certain alcohols or ketones, such as ethanol,
25 can also be used to confer inducible expression of a coding sequence of the
presently disclosed subject matter. Such a promoter is for example the alcA
gene promoter from Aspergiiius nidulans (Caddick et al., 1998). In A.
nidulans, the alcA gene encodes alcohol dehydrogenase I, the expression of
which is regulated by the AIcR transcription factors in presence of the
30 chemical inducer. For the purposes of the presently disclosed subject
matter, the CAT coding sequences in plasmid paIcA:CAT comprising a alcA
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
86
gene promoter sequence fused to a minimal 35S promoter (Caddick et al.,
1998) are replaced by a coding sequence of the presently disclosed subject
matter to form an expression cassette having the coding sequence under the
control of the alcA gene promoter. This is carried out using methods known
in the art.
f. Inducible Expression: a Glucocorticoid-Inducible Promoter
Induction of expression of a nucleic acid sequence of the presently
disclosed subject matter using systems based on steroid hormones is also
provided. For example, a glucocorticoid-mediated induction system is used
(Aoyama & Chua, 1997) and gene expression is induced by application of a
glucocorticoid, for example a synthetic glucocorticoid, for example
dexamethasone, at a concentration ranging in one embodiment from 0.1 mM
to 1 mM, and in another embodiment from 10 mM to 100 mM. For the
purposes of the presently disclosed subject matter, the luciferase gene
sequences Aoyama & Chua are replaced by a nucleic acid sequence of the
presently disclosed subject matter to form an expression cassette having a
nucleic acid sequence of the presently disclosed subject matter under the
control of six copies of the GAL4 upstream activating sequences fused to the
35S minimal promoter. This is carried out using methods known in the art.
The trans-acting factor comprises the GAL4 DNA-binding domain (Keegan et
al., 1986) fused to the transactivating domain of the herpes viral polypeptide
VP16 (Triezenberg et al., 1988) fused to the hormone-binding domain of the
rat glucocorticoid receptor (Picard et al., 1988). The expression of the
fusion
polypeptide is controlled either by a promoter known in the art or disclosed
herein. A plant comprising an expression cassette comprising a nucleic acid
sequence of the presently disclosed subject matter fused to the 6x
GAL4/minimal promoter is also provided. Thus, tissue- or organ-specificity
of the fusion polypeptide is achieved leading to inducible tissue- or organ-
specificity of the nucleic acid sequence to be expressed.
g_ Root Specific Expression
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
87
Another pattern of gene expression is root expression. A suitable root
promoter is the promoter of the maize metallothionein-like (MTL) gene
disclosed in de Framond, 1991, and also in U.S. Patent No. 5,466,785, each
of which is incorporated herein by reference. This "MTL" promoter is
transferred to a suitable vector such as pCGN1761 ENX for the insertion of a
selected gene and subsequent transfer of the entire promoter-gene-
terminator cassette to a transformation vector of interest.
h. Wound-Inducible Promoters
Wound-inducible promoters can also be suitable for gene expression.
Numerous such promoters have been disclosed (e.g., Xu et al., 1993;
Logemann et al., 1989; Rohrmeier & Lehle, 1993; Firek et al., 1993; Warner
et al., 1993) and all are suitable for use with the presently disclosed
subject
matter. Logemann et al. describe the 5' upstream sequences of the
dicotyledonous potato wunl gene. Xu et al. show that a wound-inducible
promoter from the dicotyledon potato (pint) is active in the monocotyledon
rice. Further, Rohrmeier & Lehle describe the cloning of the maize Wipl
cDNA that is wound induced and which can be used to isolate the cognate
promoter using standard techniques. Similarly, Firek et al. and Warner et al.
have disclosed a wound-induced gene from the monocotyledon Asparagus
otficinalis, which is expressed at local wound and pathogen invasion sites.
Using cloning techniques well known in the art, these promoters can be
transferred to suitable vectors, fused to the genes pertaining to the
presently
disclosed subject matter, and used to express these genes at the sites of
plant wounding.
i. Pith-Preferred Expression
PCT International Publication WO 93/07278, which is herein
incorporated by reference, describes the isolation of the maize trpA gene,
which is preferentially expressed in pith cells. The gene sequence and
promoter extending up to -1726 basepairs (bp) from the start of transcription
are presented. Using standard molecular biological techniques, this
promoter, or parts thereof, can be transferred to a vector such as pCGN1761
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
88
where it can replace the 35S promoter and be used to drive the expression
of a foreign gene in a pith-preferred manner. In fact, fragments containing
the pith-preferred promoter or parts thereof can be transferred to any vector
and modified for utility in transgenic plants.
L Leaf-Specific Expression
A maize gene encoding phosphoenol carboxylase (PEPC) has been
disclosed by Hudspeth & Grula, 1989. Using standard molecular biological
techniques, the promoter for this gene can be used to drive the expression of
any gene in a leaf-specific manner in transgenic plants.
k. Pollen-Specific Expression
WO 93/07278 describes the isolation of the maize calcium-dependent
protein kinase (CDPK) gene that is expressed in pollen cells. The gene
sequence and promoter extend up to 1400 by from the start of transcription.
Using standard molecular biological techniques, this promoter or parts
thereof can be transferred to a vector such as pCGN1761 where it can
replace the 35S promoter and be used to drive the expression of a nucleic
acid sequence of the presently disclosed subject matter in a pollen-specific
manner.
2. Transcriptional Terminators
A variety of 5' and 3' transcriptional regulatory sequences are
available for use in the presently disclosed subject matter. Transoriptional
terminators are responsible for the termination of transcription and correct
mRNA polyadenylation. The 3' nontranslated regulatory DNA sequence
includes from in one embodiment about 50 to about 1,000, and in another
embodiment about 100 to about 1,000, nucleotide base pairs and contains
plant transcriptional and translational termination sequences. Appropriate
transcriptional terminators and those that are known to function in plants
include the CaMV 35S terminator, the tml terminator, the nopaline synthase
terminator, the pea rbcS E9 terminator, the terminator for the T7 transcript
from the octopine synthase gene of Agrobacferium tumefaciens, and the 3'
end of the protease inhibitor I or II genes from potato or tomato, although
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
89
other 3' elements known to those of skill in the art can also be employed.
Alternatively, a gamma coixin, oleosin 3, or other~terminator from the genus
Coix can be used.
Non-limiting 3' elements include those from the nopaline synthase
gene of Agrobacterium tumefaciens (Bevan et al., 1983), the terminator for
the T7 transcript from the octopine synthase gene of Agrobacterium
tumefaciens, and the 3' end of the protease inhibitor I or II genes from
potato
or tomato.
As the DNA sequence between the transcription initiation site and the
start of the coding sequence (i.e., the untranslated leader sequence, also
referred to as the 5' untranslated region) can influence gene expression, a
particular leader sequence can also be employed. Non-limiting leader
sequences are contemplated to include those that include sequences
predicted to direct optimum expression of the operatively linked gene; i.e.,
to
include a consensus leader sequence that can increase or maintain mRNA
stability and prevent inappropriate initiation of translation. The choice of
such sequences will be known to those of skill in the art in light of the
present disclosure. Sequences that are derived from genes that are highly
expressed in plants are useful in the presently disclosed subject matter.
Thus, a variety of transcriptional terminators are available for use in
expression cassettes. These are responsible for termination of transcription
and correct mRNA polyadenylation. Appropriate transcriptional terminators
are those that are known to function in plants and include the CaMV 35S
terminator, the tml terminator, the nopaline synthase terminator, and the pea
rbcS E9 terminator. These can be used in both monocotyledons and
dicotyledons. In addition, a gene's native transcription terminator can be
used.
3. Other Sequences for the Enhancement or Regulation of
Expression
Numerous sequences have been found to enhance gene expression
from within the transcriptional unit and these sequences can be used in
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
conjunction with the genes of the presently disclosed subject matter to
increase fiheir expression in transgenic plants.
Other sequences that have been found to enhance gene expression .
in transgenic plants include intron sequences (e.g., from Adh9, bronze1,
5 actin1, actin 2 (PCT International Publication No. WO 00/760067), or the
sucrose synthase intron), and viral leader sequences (e.g., from Tobacco
Mosaic Virus (TMV), Maize Chlorotic Mottle Virus (MCMV), or Alfalfa Mosaic
Virus (AMV)). For example, a number of non-translated leader sequences
derived from viruses are known to enhance the expression of operatively
10 linked nucleic acids. Specifically, leader sequences from Tobacco Mosaic
Virus (TMV), Maize Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus
(AMV) have been shown to be effective in enhancing expression (e.g., Gallie
et al., 1987; Skuzeski et al., 1990). Other leaders known in the art include,
but are not limited to picornavirus leaders, for example,
15 encephalomyocarditis virus (EMCV) leader (encephalomyocarditis 5'
noncoding region; Elroy-Stein et al., 1989); potyvirus leaders (e.g., Tobacco
Etch Virus (TEV) leader and Maize Dwarf Mosaic Virus (MDMV) leader);
human immunoglobulin heavy-chain binding protein (BiP) leader (Macejak et
al., 1991 ); untranslated leader from the coat protein mRNA of AMV (AMV
20 RNA 4; Jobling et al., 1987); TMV leader (Gallie et al., 1989); and maize
chlorotic mottle virus leader (Lommel et al., 1991 ). See also, Della-Cioppa
et al., 1987. Regulatory elements such as Adh intron 1 (Callis et al., 1987),
sucrose synthase intron (Vasil et al., 1989) or TMV omega element (Gallie.et
al., 1989), can further be included where desired. Non-limiting examples of
25 enhancers include elements from the CaMV 35S promoter, octopine
synthase genes (Ellis et al., 1987), the rice actin I gene, the maize alcohol
dehydrogenase gene (Callis et al., 1987), the maize shrunken I gene (Vasil
et al., 1989), TMV omega element (Gallie et al., 1989) and promoters from
non-plant eukaryotes (e.g., yeast; Ma et al., 1988).
30 A number of non-translated leader sequences derived from viruses
are also known to enhance expression, and these are particularly effective in
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
91
dicotyledonous cells. Specifically, leader sequences from Tobacco Mosaic
Virus (TMV; the "W-sequence"), Maize Chlorotic Mottle Virus (MCMV), and
Alfalfa Mosaic Virus (AMV) have been shown to be effective in enhancing
expression (see e.g., Gallie et al., 1987; Skuzeski et al., 1990). Other
leader
sequences known in the art include, but are not limited to, picornavirus
leaders, for example, EMCV (encephalomyocarditis virus) leader (5'
noncoding region; see Elroy-Stein et al., 1989); potyvirus leaders, for
example, from Tobacco Etch Virus (TEV; see Allison et al., 1986); Maize
Dwarf Mosaic Virus (MDMV; see Kong & Steinbiss 1998); human
immunoglobulin heavy-chain binding polypeptide (BiP) leader (Macejak &
Sarnow, 1991 ); untranslated leader from the coat polypeptide mRNA of
alfalfa mosaic virus (AMV; RNA 4; see Jobling & Gehrke, 1987); tobacco
mosaic virus (TMV) leader ,(Gallie et al., 1989); and Maize Chlorotic Mottle
Virus (MCMV) leader (Lommel et al., 1991 ). See also, Della-Cioppa et al.,
1987.
In addition to incorporating one or more of the aforementioned
elements into the 5' regulatory region of a target expression cassette of the
presently disclosed subject matter, other elements can also be incorporated.
Such elements include, but are not limited to, a minimal promoter. By
minimal promoter it is intended that the basal promoter elements are inactive
or nearly so in the absence of upstream or downstream activation. Such a
promoter has low background activity in plants when there is no
transactivator present or when enhancer or response element binding sites
are absent. One minimal promoter that is particularly useful for target genes
in plants is the Bz1 minimal promoter, which is obtained from the bronze1
gene of maize. ~ The Bz1 core promoter is obtained from the "myc" mutant
Bz1-luciferase construct pBz1 LucR98 via cleavage at the Nhel site located
at positions -53 to -58 (Both et al., 1991 ). The derived Bz1 core promoter
fragment thus extends from positions -53 to +227 and includes the Bz1
intron-1 in the 5' untranslated region. Also useful for the presently
disclosed
subject matter is a minimal promoter created by use of a synthetic TATA
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
92
element. The TATA element allows recognition of the promoter by RNA
polymerise factors and confers a basal level of gene expression in the
absence of activation (see generally, Mukumoto et al., 1993; Green, 2000.
4. Taraetina of the Gene Product Within the Cell
Various mechanisms for targeting gene products are known to exist in
plants and the sequences controlling the functioning of these mechanisms
have been characterized in some detail. For example, the targeting of gene
products to the chloroplast is controlled by a signal sequence found at the
amino terminal end of various polypeptides that is cleaved during chloroplast
import to yield the mature polypeptides (see e.g., Comai et al., 1988). These
signal sequences can be fused to heterologous gene products to affect the
import of heterologous products into the chloroplast (Van den Broeck et al.,
1985). DNA encoding for appropriate signal sequences can be isolated from
the 5' end of the cDNAs encoding the ribulose-1,5-bisphosphate
carboxylase/oxygenase (RUBISCO) polypeptide, the chlorophyll a/b binding
(CAB) polypeptide, the 5-enol-pyruvyl shikimate-3-phosphate (EPSP)
synthase enzyme, the GS2 polypeptide and many other polypeptides which
are known to be chloroplast localized. See also, the section entitled
"Expression With Chloroplast Targeting" in Example 37 of U.S. Patent No.
5,639,949, herein incorporated by reference.
Other gene products can be localized to other organelles such as the
mitochondrion and the peroxisome (e.g., Unger et al., 1989). The cDNAs
encoding these products can also be manipulated to effect the targeting of
heterologous gene products to these organelles. Examples of such
sequences are the nuclear-encoded ATPases and specific aspartate amino
transferase isoforms for mitochondria. Targeting cellular polypeptide bodies
has been disclosed by Rogers et al., 1985. ,
In addition, sequences have been characterized that control the
targeting of gene products to other cell compartments. Amino terminal
sequences are responsible for targeting to the endoplasmic reticulum (ER),
the apoplast, and extracellular secretion from aleurone cells (Koehler & Ho,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
93
1990). Additionally, amino terminal sequences in conjunction with carboxy
terminal sequences are responsible for vacuolar targeting of gene products
(Shinshi et al., 1990).
By the fusion of the appropriate targeting sequences disclosed above
to transgene sequences of interest it is possible to direct the transgene
product to any organelle or cell compartment. For chloroplast targeting, for
example, the chloroplast signal sequence from the RUBISCO gene, the CAB
gene, the EPSP synthase gene, or the GS2 gene is fused in frame to the
amino terminal ATG of the transgene. The signal sequence selected can
include the known cleavage site, and the fusion constructed can take into
account any amino acids after the cleavage site that are required for
cleavage. In some cases this requirement can be fulfilled by the addition of
a small number of amino acids between the cleavage site and the transgene
ATG or, alternatively, replacement of some amino acids within the transgene
sequence. Fusions constructed for chloroplast import can be tested for
efficacy of chloroplast uptake by in vitro translation of in vitro transcribed
constructions followed by in vitro chloroplast uptake using techniques
disclosed by Bartlett et al., 1982 and Wasmann et al., . 1986. These
construction techniques are well known in the art and are equally applicable
to mitochondria and peroxisomes.
The above-disclosed mechanisms for cellular targeting can be utilized
not only in conjunction with their cognate promoters, but also in conjunction
with heterologous promoters so as to effect a specific cell-targeting goal
under the transcriptional regulation of a promoter that has an expression
pattern different from that of the promoter from which the targeting signal
derives.
D. Construction of Plant Transformation Vectors
1. I ntroduction
Numerous transformation vectors available for plant transformation
are known to those of ordinary skill in the plant transformation art, and the
genes pertinent fio the presently disclosed subject matter can be used in
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
94
conjunction with any such vectors. The selection of vector will depend upon
the selected transformation technique and the target species for
transformation. For certain target species, different antibiotic or herbicide
selection markers might be employed. Selection markers used routinely in
transformation include the nptll gene, which confers resistance to kanamycin
and related antibiotics (Messing & Vieira, 1982; Bevan et al., 1983); the bar
gene, which confers resistance to the herbicide phosphinothricin (White et
al., 1990; Spencer et al., 1990); the hph gene, which confers resistance to
the antibiotic hygromycin (Blochinger & Diggelmann, 1984); the dhfr gene,
which confers resistance to methotrexate (Bourouis & Jarry, 1983); the
EPSP synthase gene, which confers resistance to glyphosate (U.S. Patent
Nos. 4,940,935 and 5,188,642); and the mannose-6-phosphate isomerase
gene, which provides the ability to metabolize mannose (U.S. Patent Nos.
5,767,378 and 5,994,629).
The compositions of the presently disclosed subject matter include
plant nucleic acid molecules, and the amino acid sequences of the
polypeptides or partial-length polypeptides encoded by nucleic acid
molecules comprising an open reading frame. These sequences can be
employed to alter the expression of a particular gene corresponding to the
open reading frame by decreasing or eliminating expression of that plant
gene or by overexpressing a particular gene product. Methods of this
embodiment of the presently disclosed subject matter include stably
transforming a plant with a nucleic acid molecule of the presently disclosed
subject matter that includes an open reading frame operatively linked to a
promoter capable of driving expression of that open reading frame (sense or
antisense) in a plant cell. By "portion" or "fragment", as it relates to a
nucleic
acid molecule that comprises an open reading frame or a fragment thereof
encoding a partial-length polypeptide having the activity of the full length
polypeptide, is meant a sequence having in one embodiment at least 80
nucleotides, in another embodiment at least 150 nucleotides, and in still
another embodiment at least 400 nucleotides. If not employed for
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
expression, a "portion" or "fragment" means in representative embodiments
afi least 9, or 12, or 15, or at least 20, consecutive nucleotides (e.g.,
probes
and primers or other oligonucleotides) corresponding to the nucleotide
sequence of the nucleic acid molecules of the presently disclosed subject
5 matter. Thus, to express a particular gene product, the method comprises
introducing into a plant, plant cell, or plant tissue an expression cassette
comprising a promoter operatively linked to an open reading frame so as to
yield a transformed differentiated plant, transformed cell, or transformed
tissue. Transformed cells or tissue can be regenerated to provide a
10 transformed differentiated plant. The transformed differentiated plant or
cells
thereof can express the open reading frame in an amount that alters the
amount of the gene product in the plant or cells thereof, which product is
encoded by the open reading frame. The presently disclosed subject matter
also provides a transformed plant prepared by the methodsa disclosed
15 herein, as well as progeny and seed thereof.
The presently disclosed subject matter further includes a nucleotide
sequence that is complementary to one (hereinafter "test" sequence) that
hybridizes under stringent conditions to a nucleic acid molecule of the
presently disclosed subject matter, as well as an RNA molecule that is
20 transcribed from the nucleic acid molecule. When hybridization is performed
under stringent conditions, either the test or nucleic acid molecule of
presently disclosed subject matter can be present on a support: e.g., on a
membrane or on a DNA chip. Thus, either a denatured test or nucleic acid
molecule of the presently disclosed subject matter is first bound to a support
25 and hybridization is effected for a specified period of time at a
temperature
of, in one embodiment, between 55°C and 70°C, in 2X SSC
containing 0.1
SDS, followed by rinsing the support at the same temperature but with a
buffer having a reduced SSC concentration. Depending upon the degree of
stringency required, such reduced concentration buffers are typically 1X
30 SSC containing 0.1 % SDS, 0.5X SSC containing 0.1 % SDS, or 0.1X SSC
containing 0.1 % SDS.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
96
In a further embodiment, the presently disclosed subject matter
provides a transformed plant host cell, or one obtained through breeding,
capable of over-expressing, under-expressing, or having a knockout of a
polypeptide-encoding gene and/or its gene product(s). The plant cell is
transformed with at least one such expression vector wherein the plant host
cell can be used to regenerate plant tissue or an entire plant, or seed there
from, in which the effects of expression, including overexpression and
underexpression, of the introduced sequence or sequences can be
measured in vitro or in plants.
In another aspect, the presently disclosed subject matter features an
isolated stress-related polypeptide, wherein the polypeptide binds to a
fragment of a protein selected from the group consisting of OsGF14-c (SEQ
IDNO: 113), OsDAD1 (SEQ ID NO: 128), Os006819-2510 (SEQ ID NO: 20),
OsCRTC (SEQ ID NO : 134), OsSGT1 (SEQ ID NO: 144), OsERP (SEQ ID
NO: 146), OsCHIB1 (SEQ ID NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2
(SEQ ID NO: 164), and OsCAA90866 (SEQ ID NO: 170). In some
embodiments, the presently disclosed subject matter features an isolated
polypeptide comprising or consisting of an amino acid sequence
substantially similar to the amino acid sequence of an isolated stress-related
polypeptide of the presently disclosed subject matter.
Because the proteins of the presently disclosed subject matter have a
roll in stress response, in certain embodiments, a cell introduced with a
nucleic acid molecule of the presently disclosed subject matter has a
different stress response as compared to a cell not introduced with the
nucleic acid molecule.
In another aspect, the presently disclosed subject matter features a
method for modulating stress response of a plant cell comprising introducing
an isolated nucleic acid molecule encoding a stress-related polypeptide into
the plant cell, wherein the polypeptide binds to a fragment of a protein
selected from the group consisting of OsGF14-c (SEQ IDNO: 113), OsDAD1
(SEQ ID NO: 128), Os006819-2510 (SEQ ID NO: 20), OsCRTC (SEQ ID
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
97
NO: 134), OsSGT1 (SEQ ID NO: 144), OsERP (SEQ ID NO: 146),
OsCHIB1 (SEQ ID NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2 (SEQ ID
NO: 164), and OsCAA90866 (SEQ ID NO: 170), wherein the polypeptide is
expressed by the cell.
In another aspect, the presently disclosed subject matter features a
method for modulating stress response of a plant cell comprising introducing
an isolated nucleic acid molecule encoding a stress-related polypeptide into
the plant cell, wherein the polypeptide binds to a fragment of a protein
selected from the group consisting of OsGFl4-c (SEQ IDNO: 113), OsDAD1
(SEQ ID NO: 128), Os006819-2510 (SEQ ID NO: 20), OsCRTC (SEQ ID
NO: 134), OsSGT1 (SEQ ID NO: 144), OsERP (SEQ ID NO: 146),
OsCHIB1 (SEQ ID NO: 152), OsCS (SEQ ID NO: 156), OsPP2A-2 (SEQ ID
NO: 164), and OsCAA90866 (SEQ ID NO: 170), wherein expression of the
polypeptide encoded by the nucleic acid molecule is reduced in the cell.
As discussed herein, the stress-related proteins described herein
affect stress response (e.g., when the plant is exposed to biotic or abiotic
stress). Accordingly, by changing the amount of a stress-related protein of
the presently disclosed subject matter in a plant cell, the stress respsone of
that plant cell can be modulated.
In some situations, increasing expression of a stress-related protein of
the presently disclosed subject matter in a cell will cause that cell to
increase
its stress response (in some cases, rate of proliferation). In other
situations,
increasing expression of a stress-related protein of the presently disclosed
subject matter in a cell causes that cell to reduce its stress response (in
some cases, rate of proliferation). Similarly, decreasing the expression of a
stress-related protein of the presently disclosed subject matter in a cell can
increase or decrease that cell's stress response (in some cases, rate of
proliferation). What is relevant is that the stress response of the cell
changes if the level of expression of a stress-related protein of the
presently
disclosed subject matter is either increased or decreased.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
98
Increasing the level of expression of a stress-related protein of the
presently disclosed subject matter in a cell is a relatively simple matter.
For
example, overexpression of the protein can be accomplished by
transforming the cell with a nucleic acid molecule encoding the protein
according to standard methods such as those described above.
Once a nucleic acid sequence of the presently disclosed subject
matter has been cloned into an expression system, it is transformed into a
plant cell. The receptor and target expression cassettes of the presently
disclosed subject matter can be introduced into the plant cell in a number of
art-recognized ways. Methods for regeneration of plants are also well known
in the art. For example, Ti plasmid vectors have been utilized for the
delivery of foreign DNA, as well as direct DNA uptake, liposomes,
electroporation, microinjection, and microprojectiles. In addition, bacteria
from the genus Agrobacterium can be utilized to transform plant cells. Below
are descriptions of representative techniques for transforming both
dicotyledonous and monocotyledonous plants, as well as a representative
plastid transformation technique.
Transformation of a plant can be undertaken with a single DNA
molecule or multiple DNA molecules (i.e., co-transformation), and both these
techniques are suitable for use with the expression cassettes of the
presently disclosed subject matter. Numerous transformation vectors are
available for plant transformation, and the expression cassettes of the
presently disclosed subject matter can be used in conjunction with any such
vectors. The selection of vector will depend upon the transformation
technique and the species targeted for transformation.
A variety of techniques are available and known for introduction of
nucleic acid molecules and expression cassettes comprising such nucleic
acid molecules into a plant cell host. These techniques include, but are not
limited to transformation with DNA employing A. tumefaciens or A.
rhizogenes as the transforming agent, liposomes, PEG precipitation,
electroporation, DNA injection, direct DNA uptake, microprojectile
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
99
bombardment, particle acceleration, and the like (see e.g., EP 0 295 959
and EP 0 138 341; see also below). However, cells other than plant cells
can be transformed with the expression cassettes of the presently disclosed
subject matter. A general descriptions of plant expression vectors and
reporter genes, and Agrobacterium and Agrobacterium-mediated gene
transfer, can be found in Gruber et al., 1993, incorporated herein by
reference in its entirety.
Expression vectors containing genomic or synthetic fragments can be
introduced into protoplasts or into intact tissues or isolated cells. In some
embodiments, expression vectors are introduced into intact tissue. "Plant
tissue" includes differentiated and undifferentiated tissues or entire plants,
including but not limited to roots, stems, shoots, leaves, pollen, seeds,
tumor
tissue, and various forms of cells and cultures such as single cells,
protoplasts, embryos, and callus tissues. The plant tissue can be in plants
or in organ, tissue, or cell culture. General methods of culturing plant
tissues
are provided, for example, by Maki et al., 1993 and by Phillips et al. 1988.
In
some embodiments, expression vectors are introduced into maize or other
plant tissues using a direct gene transfer method such as microprojectile-
mediated delivery, DNA injection, electroporation, or the like. In some
embodiments, expression vectors are introduced into plant tissues using
microprojectile media delivery with a biolistic device (see e.g., Tomes et
al.,
1995). The vectors of the presently disclosed subject matter can not only be
used for expression of structural genes but can also be used in exon-trap
cloning or in promoter trap procedures to detect differential gene expression
in varieties of tissues (Lindsey et al., 1993; Auch & Reth, 1990).
In some embodiments, the binary type vectors of the Ti and Ri
plasmids of Agrobacterium spp are employed. Ti-derived vectors can be
used to transform a wide variety of higher plants, including
monocotyledonous and dicotyledonous plants including, but not limited to
soybean, cotton, rape, tobacco, and rice (Pacciotti et al., 1985: Byrne et
al.,
1987; Sukhapinda et al., 1987; Lorz et al., 1985; Potrykus, 1985; Park et al.,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
100
1985: Hiei et al., 1994). The use of T-DNA to transform plant cells has
received extensive study and is amply described (European Patent
Application No. EP 0 120 516; Hoekema, 1985; Knauf et al., 1983; and An et
al., 1985, each of which is incorporated by reference in its entirety). For
introduction into plants, the nucleic acid molecules of the presently
disclosed
subject matter can be inserted into binary vectors as described in the
examples.
Other transformation methods are available to those skilled in the art,
such as direct uptake of foreign DNA constructs (see European Patent
Application No. EP 0 295 959), electroporation (Fromm et al., 1986), or high
velocity ballistic bombardment of plant cells with metal particles coated with
the nucleic acid constructs (Kline et al., 1987; U.S. Patent No. 4,945,050).
Once transformed, the cells can be regenerated using techniques familiar to
those of skill in the art. Of particular relevance are the recently described
methods to transform foreign genes into commercially important crops, such
as rapeseed (De Block et al., 1989), sunflower (Everett et al., 1987),
soybean (McCabe et al., 1988; Hinchee et al., 1988; Chee et al., 1989;
Christou et al., 1989; European Patent Application No. EP 0 301 749), rice
(Hiei et al., 1994), and corn (cordon Kamm et al., 1990; Fromm et al., 1990).
Of course, the choice of method might depend on the type of plant,
i.e., monocotyledonous or dicotyledonous, targeted for transformation.
Suitable methods of transforming plant cells include, but are not limited to
microinjection (Crossway et al., 1986), electroporation (Riggs et al., 1986),
Agrobacterium-mediated transformation (Hinchee et al., 1988), direct gene
transfer (Paszkowski et al., 1984), and ballistic particle acceleration using
devices available from Agracetus, Inc. (Madison, Wisconsin, United States of
America) and BioRad (Hercules, California, United States of America). See
e.g., U.S. Patent No. 4,945,050; McCabe et al., 1988; Weissinger et al.,
1988; Sanford et al., 1987 (onion); Christou et al., 1988 (soybean); McCabe
et al., 1988 (soybean); Datta et al., 1990 (rice); Klein et al., 1988 (maize);
Fromm et al., 1990 (maize); cordon-Kamm et al., 1990 (maize); Svab et al.,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
101
1990 (tobacco chloroplast); Koziel et al., 1993 (maize); Shimamoto et al.,
1989 (rice); Christou et al., 1991 (rice); European Patent Application EP 0
332 581 (orchardgrass and other Pooideae); Vasil et al., 1993 (wheat);
Weeks et al., 1993 (wheat). In one embodiment, the protoplast
transformation method for maize is employed (see European Patent
Application EP 0 292 435; U. S. Patent No. 5,350,689).
2. Vectors Suitable for Aarobacterium Transformation
Agrobacterium tumefaciens cells containing a vector comprising an
expression cassette of the presently disclosed subject matter, wherein the
vector comprises a Ti plasmid, are useful in methods of making transformed
plants. Plant cells are infected with an Agrobacterium tumefaciens as
described above to produce a transformed plant cell, and then a plant is
regenerated from the transformed plant cell. Numerous Agrobacterium
vector systems useful in carrying out the presently disclosed subject matter
are known to ordinary skill in the art.
Many- vectors are available for transformation using Agrobacterium
tumefaciens. These typically carry at least one T-DNA border sequence and
include vectors such as pBIN19 (Bevan, 1984). Below, the construction of
two typical vectors suitable for Agrobacterium transformation is disclosed.
a. pCIB200 and pCIB2001
The binary vectors pCIB200 and pCIB2001 are used for the
construction of recombinant vectors for use with Agrobacterium and are
constructed in the following manner. pTJS75kan is created by Narl digestion
of pTJS75 (Schmidhauser & Helinski, 1985) allowing excision of the
tetracycline-resistance gene, followed by insertion of an Accl fragment from
pUC4K carrying an NPTII sequence (Messing & Vieira, 1982: Bevan et al.,
1983: McBride & Summerfelt, 1990). Xhol linkers are ligated to the EcoRV
fragment of PCIB7 which contains the left and right T-DNA borders, a plant
selectable noslnptll chimeric gene and the pUC polylinker (Rothstein et al.,
1987), and the Xhol-digested fragment are cloned into Sall-digested
pTJS75kan to create pCIB200 (see also EP 0 332 104, example 19).
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
102
pCIB200 contains the following unique polylinker restriction sites: EcoRl,
Sstl, Kpnl, Bglll, Xbal, and Sall. pCIB2001 is a derivative of pCIB200
created by the insertion into the polylinker of additional restriction sites.
Unique restriction sites in the polylinker of pCIB2001 are EcoRl, Sstl, Kpnl,
Bglll, Xbal, Sall, Mlul, Bcll, Avrll, Apal, Hpal, and Stul. pCIB2001, in
addition to containing these unique restriction sites, also has plant and
bacterial kanamycin selection, left and right T-DNA borders for
Agrobacterium-mediated transformation, the RK2-derived trfA function for
mobilization between E. coli and other hosts, and the OriT and OriV
functions also from RK2. The pCIB2001 polylinker is suitable for the cloning
of plant expression cassettes containing their own regulatory signals. ,
b. pCIB10 and Hyaromycin Selection Derivatives Thereof
The binary vector pCIB10 contains a gene encoding kanamycin
resistance for selection in plants, T-DNA right and left border sequences,
and incorporates sequences from the wide host-range plasmid pRK252
allowing it to replicate in both E, coli and Agrobacterium. Its construction
is
disclosed by Rothstein et al., 1987. Various derivatives of pCIB10 can be
constructed which incorporate the gene for hygromycin B
phosphotransferase disclosed by Gritz & Davies, 1983. These derivatives
enable selection of transgenic plant cells on hygromycin only (pCIB743), or
hygromycin and kanamycin (pCIB715, pCIB717).
3. Vectors Suitable for non-Aqrobacterium Transformation
Transformation without fihe use of Agrobacterium tumefaciens
circumvents the requirement for T-DNA sequences in the chosen
transformation vector, and consequently vectors lacking these sequences
can be utilized in addition to vectors such as the ones disclosed above that
contain T-DNA sequences. Transformation techniques that do not rely on
Agrobacterium include transformation via particle bombardment, protoplast
uptake (e.g., polyethylene glycol (PEG) and electroporation), and
microinjection. The choice of vector depends largely on the species being
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
103
transformed. Below, the construction of typical vectors suitable for non-
Agrobacterium transformation is disclosed.
a. pCIB3064
pCIB3064 is a pUC-derived vector suitable for direct gene transfer
techniques in combination with selection by the herbicide BASTA~
(glufosinate ammonium or phosphinothricin). The plasmid pCIB246
comprises the CaMV 35S promoter in operational fusion to the E. coli ~i
glucuronidase (GUS) gene and the CaMV 35S transcriptional terminator and
is disclosed in the PCT International Publication WO 93/07278. The 35S
~ promoter of this vector contains two ATG sequences 5' of the start site.
These sites are mutated using standard PCR techniques in such a way as to
remove the ATGs and generate the restriction sites Sspl and Pvull. The
new restriction sites are 96 and 37 by away from the unique Sall site and
101 and 42 by away from the actual start site. The resultant derivative of
pCIB246 is designated pCIB3025. The GUS gene is then excised from
pCIB3025 by digestion with Sall and Sacl, the termini rendered blunt and
religated to generate plasmid pCIB3060. The plasmid pJIT82 is obtained
from the John Innes Centre, Norwich, England, and the 400 by Smal
fragment containing the bar gene from Streptomyces viridochromogenes is
excised and inserted into the Hpal site of pCIB3060 (Thompson et al., 1987).
This generated pCIB3064, which comprises the bar gene under the control
of the CaMV 35S promoter and terminator for herbicide selection, a gene for
ampicillin resistance (for selection in E. coli) and a polylinker with the
unique
sites Sphl, Pstl, Hindlll, and BamHl. This vector is suitable for the cloning
of
plant expression cassettes containing their own regulatory signals.
b. pSOG19 and pSOG35
pSOG35 is a transformation vector that utilizes the E. coli
dihydrofolate reductase (DHFR) gene as a selectable marker conferring
resistance to methotrexate. PCR is used to amplify the 35S promoter (-800
bp), intron 6 from the maize Adh1 gene (-550 bp), and 18 by of the GUS
untranslated leader sequence from pSOG10. A 250-by fragment encoding
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
104
the E. coli dihydrofolate reductase type II gene is also amplified by PCR and
these two PCR fragments are assembled with a Sacl-Pstl fragment from
pB1221 (BD Biosciences Clontech, Palo Alto, California, United States of
America) that comprises the pUC19 vector backbone and the nopaline
synthase terminator. Assembly of these fragments generates pSOG19 that
contains the 35S promoter in fusion with the intron 6 sequence, the GUS
leader, the DHFR gene, and the nopaline synthase terminator. Replacement
of the GUS leader in pSOG19 with the leader sequence from Maize
Chlorotic Mottle Virus (MCMV) generates the vector pSOG35. pSOG19 and
pSOG35 carry the pUC gene for ampicillin resistance and have Hindlll, Sphl,
Pstl, and EcoRl sites available for the cloning of foreign substances.
4. Selectable Markers for Transformation Approaches
Methods using either a form of direct gene transfer or Agrobacterium
mediated transfer usually, but not necessarily, are undertaken with a
selectable marker that can provide resistance to an antibiotic (e.g.,
kanamycin, hygromycin, or methotrexate) or a herbicide (e.g.,
phosphinothricin). The choice of selectable marker for plant transformation
is not, however, critical to the presently disclosed subject matter.
For certain plant species, different antibiotic or herbicide selection
markers can be employed. Selection markers used routinely in
transformation include the nptll gene, which confers resistance to kanamycin
and related antibiotics (Messing & Vierra, 1982; Bevan et al., 1983), the bar
gene, which confers resistance to the herbicide phosphinothricin (White et
al., 1990, Spencer et al., 1990), the hph gene, which confers resistance to
the antibiotic hygromycin (Blochinger & Diggelmann, 1984), and the dhfr
gene, which confers resistance to methotrexate (Bourouis et al., 1983).
Selection markers resulting in positive selection, such as a
phosphomannose isomerase (PMI) gene (described in PCT International
Publication No. WO 93/05163) can also be used. Other genes that can be
used for positive selection are described in PCT International Publication No.
WO 94120627 and encode xyloisomerases and phosphomanno-isomerases
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
I05
such as mannose-6-phosphate isomerase and mannose-1-phosphate
isomerase; phosphomanno mutase; mannose epimerases such as those that
convert carbohydrates to mannose or mannose to carbohydrates such as
glucose or galactose; phosphatases such as mannose or xylose phosphatase,
mannose-6-phosphatase and mannose-1-phosphatase, and permeases that
are involved in the transport of mannose, or a derivative or a precursor
thereof,
into the cell. An agent is typically used to reduce the toxicity of the
compound
to the cells, and is typically a glucose derivative such as methyl-3-O-glucose
or
phloridzin. Transformed cells are identified without damaging or killing the
non-transformed cells in the population and without co-introduction of
antibiotic or herbicide resistance genes. As described in PCT International
Publication No. WO 93/05163, in addition to the fact that the need for
antibiotic or herbicide resistance genes is eliminated, it has been shown that
the positive selection method is often far more efFicient than traditional
negative selection.
As noted above, one vector useful for direct gene transfer techniques
in combination with selection by the herbicide BASTA~ (or phosphinothricin)
is pCIB3064. This vector is based on the plasmid pCIB246, which
comprises the CaMV 35S promoter operatively linked to the E. coli ~i-
glucuronidase (GUS) gene and the CaMV 35S transcriptional terminator,
and is described in PCT International Publication No. WO 93/07278. One
gene useful for conferring resistance to phosphinothricin is the bar gene from
Streptomyces viridochromogenes (Thompson et al., 1987). This vector is
suitable for the cloning of plant expression cassettes containing their own
regulatory signals.
As noted above, an additional transformation vector is pSOG35,
which utilizes the E, coli dihydrofolate reductase (DHFR) gene as a
selectable marker conferring resistance to methotrexate. Polymerase chain
reaction (PCR) was used to amplify the 35S promoter (about 800 basepairs
(bp)), intron 6 from the maize Adh1 gene (about 550 bp), and 18 by of the
GUS untranslated leader sequence from pSOG10. A 250 by fragment
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
106
encoding the E. coli dihydrofolate reductase type II gene was also amplified
by PCR and these two PCR fragments are assembled with a Sacl-Pstl
fragment from pB1221 (BD Biosciences - Clontech, Palo Alto, California,
United States of America), which comprised the pUC19 vector backbone and
the nopaline synthase terminator. Assembly of these fragments generated
pSOG19, which contains the 35S promoter in fusion with the intron 6
sequence, the GUS leader, the DHFR gene and the nopaline synthase
terminator. Replacement of the GUS leader in pSOG19 with the leader
sequence from Maize Chlorotic Mottle Virus (MCMV) generated the vector
pSOG35. pSOGl9 and pSOG35 carry the pUC-derived gene for ampicillin
resistance, and have Hindlll, Sphl, Pstl and EcoRl sites available for the
cloning of foreign sequences.
Binary backbone vector pNOV2117 contains the T-DNA portion
flanked by the right and left border sequences, and including the
POSITECHT"" (Syngenta Corp., Wilmington, Delaware, United States of
America) plant selectable marker and the "candidate gene" gene expression
cassette. The POSITECHT"" plant selectable marker confers resistance to
mannose and in this instance consists of the maize ubiquitin promoter
driving expression of the PMI (phosphomannose isomerase) gene, followed
by the cauliflower mosaic virus transcriptional terminator.
5. Vector Suitable for Chloroplast Transformation
For expression of a nucleotide sequence of the presently disclosed
subject matter in plant plastids, plastid transformation vector pPH143 (PCT
International Publication WO 97/32011, example 36) is used. The nucleotide
sequence is inserted into pPH143 thereby replacing the protoporphyrinogen
oxidase (Protox) coding sequence. This vector is then used for plastid
transformation and selection of transformants for spectinomycin resistance.
Alternatively, the nucleotide sequence is inserted in pPH143 so that it
replaces the aadH gene. In this case, transformants are selected for
resistance to PROTOX inhibitors.
6. Transformation of Plastids
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
I07
In another embodiment, a nucleotide sequence of the presently
disclosed subject matter is directly transformed into the plastid genome.
Plastid transformation technology is described in U.S. Patent Nos.
5,451,513; 5,545,817; and 5,545,818; and in PCT International Publication
No. WO 95/16783; and in McBride et al., 1994. The basic technique for
chloroplast transformation involves introducing regions of cloned plastid DNA
flanking a selectable marker together with the gene of interest into a
suitable
target tissue, e.g., using biolistics or protoplast transformation (e.g.,
calcium
chloride or PEG mediated transformation). The 1 to 1.5 kilobase (kb)
flanking regions, termed targeting sequences, facilitate orthologous
recombination with the plastid genome and thus allow the replacement or
modification of specific regions of the plastome. Initially, point mutations
in
the chloroplast 16S rRNA and rps12 genes conferring resistance to
spectinomycin and/or streptomycin are utilized as selectable markers for
transformation (Svab et al., 1990; Staub et al., 1992). This resulted in
stable
homoplasmic transformants at a frequency of approximately one per 100
bombardments of target leaves. The presence of cloning sites between
these markers allowed creation of a plastid targeting vector for introduction
of foreign genes (Staub et al., 1993). Substantial increases in transformation
frequency are obtained by replacement of the recessive rRNA or r-protein
antibiotic resistance genes with a dominant selectable marker, the bacterial
aadA gene encoding the spectinomycin-detoxifying enzyme aminoglycoside-
3N-adenyltransferase (Staub et al., 1993). Other selectable markers useful
for plastid transformation are known in the art and encompassed within the
scope of fihe presently disclosed subject matter. Typically, approximately 15-
20 cell division cycles following transformation are required to reach a
homoplastidic state.
Plastid expression, in which genes are inserted by orthologous
recombination into all of the several thousand copies of the circular plastid
genome present in each plant cell, takes advantage of the enormous copy
number advantage over nuclear-expressed genes to permit expression
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
108
levels that can readily exceed 10% of the total soluble plant protein. In one
embodiment, a nucleotide sequence of the presently disclosed subject
matter is inserted into a plastid targeting vector and transformed into the
plastid genome of a desired plant host. Plants homoplastic for plastid
genomes containing a nucleotide sequence of the presently disclosed
subject matter are obtained, and are in one embodiment capable of high
expression of the nucleotide sequence.
An example of plastid transformation follows. Seeds of Nicotiana
tabacum c.v. 'Xanthi nc' are germinated seven per plate in a 1" circular array
on T agar medium and bombarded 12-14 days after sowing with 1 p,m
tungsten particles (M10, Biorad, Hercules, California, United States of
America) coated with DNA from plasmids pPH143 and pPH145 essentially
as disclosed (Svab & Maliga, 1993). Bombarded seedlings are incubated on
T medium for two days after which leaves are excised and placed abaxial
side up in bright light (350-500 pmol photons/m2/s) on plates of RMOP
medium (Svab et al., 1990) containing 500 pg/ml spectinomycin
dihydrochloride (Sigma, St. Louis, Missouri, United States of America).
Resistant shoots appearing underneath the bleached leaves three to eight
weeks after bombardment are subcloned onto the same selective medium,
allowed to form callus, and secondary shoots isolated and subcloned.
Complete segregation of transformed plastid genome copies
(homoplasmicity) in independent subclones is assessed by standard
techniques of Southern blotting (Sambrook & Russell, 2001 ). BamHllEcoRl-
digested total cellular DNA (Mettler, 1987) is separated on 1 % Tris-borate-
EDTA (TBE) agarose gels, transferred to nylon membranes (Amersham
Biosciences, Piscataway, New Jersey, United States of America) and probed
with 32P-labeled random primed DNA sequences corresponding to a 0.7 kb
BamHllHindlll DNA fragment from pC8 containing a portion of the rps7/12
plastid targeting sequence. Homoplasmic shoots are rooted aseptically on
spectinomycin-containing MS/IBA medium (McBride et al., 1994) and
transferred to the greenhouse.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
109
7. Transformation of Dicotyledons
Transformation techniques for dicotyledons are well known in the art
and include Agrobacterium-based techniques and techniques that do not
require Agrobacterium. Non-Agrobacterium techniques involve the uptake of
exogenous genetic material directly by protoplasts or cells. This can be
accomplished by PEG or electroporation-mediated uptake, particle
bombardment-mediated delivery, or microinjection. Examples of these
techniques are disclosed in Paszkowski et al., 1984; Potrykus et al., 1985;
Reich et al., 1986; and Klein et al., 1987. In each case the transformed cells
are regenerated to whole plants using standard techniques known in the art.
Agrobacterium-mediated transformation is a useful technique for
transformation of dicotyledons because of its high efficiency of
transformation and its broad utility with many different species.
Agrobacterium transformation typically involves the transfer of the binary
vector carrying the foreign DNA of interest (e.g., pCIB200 or pCIB2001 ) to
an appropriate Agrobacterium strain which can depend on the complement
of vir genes carried by the host Agrobacterium strain either on a co-resident
Ti plasmid or chromosomally (e.g., strain CIB542 for pCIB200 and pCIB2001
(Uknes et al., 1993). The transfer of the recombinant binary vector to
Agrobacterium is accomplished by a triparental mating procedure using E.
coli carrying the recombinant binary vector, a helper E. coli strain that
carries
a plasmid such as pRK2013 and which is able to mobilize the recombinant
binary vector to the target Agrobacterium strain. Alternatively, the
recombinant binary vector can be transferred to Agrobacterium by DNA
transformation (Hofgen & Willmitzer, 1988).
Transformation of the target plant species by recombinant
Agrobacterium usually involves co-cultivation of the Agrobacterium with
explants from the plant and follows protocols well known in the art.
Transformed tissue is regenerated on selectable medium carrying the
antibiotic or herbicide resistance marker present between the binary plasmid
T-DNA borders.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
110
Another approach to transforming plant cells with a gene involves
propelling inert or biologically active particles at plant tissues and cells.
This
technique is disclosed in U.S. Patent Nos. 4,945,050; 5,036,006; and
5,100,792; all to Sanford et al. Generally, this procedure involves propelling
inert or biologically active particles at the cells under conditions effective
to
l
penetrate the outer surface of the cell and afford incorporation within the
interior thereof. When inert particles are utilized, the vector can be
introduced into the cell by coating the particles with the vector containing
the
desired gene. Alternatively, the target cell can be surrounded by the vector
so that the vector is carried into the cell by the wake of the particle.
Biologically active particles (e.g., dried yeast cells, dried bacterium, or a
bacteriophage, each containing DNA sought to be introduced) can also be
propelled into plant cell tissue.
8. Transformation of Monocotyledons
Transformation of most monocotyledon species has now also become
routine. Exemplary techniques include direct gene transfer into protoplasts
using PEG or electroporation, and particle bombardment into callus tissue.
Transformations can be undertaken with a single DNA species or multiple
DNA species (i.e. co-transformation), and both these techniques are suitable
for use with the presently disclosed subject matter. Co-transformation can
have the advantage of avoiding complete vector construction and of
generating transgenic plants with unlinked loci for the gene of interest and
the selectable marker, enabling the removal of the selectable marker in
subsequent generations, should this be regarded as desirable. However, a
disadvantage of the use of co-transformation is the less than 100%
frequency with which separate DNA species are integrated into the genome
(Schocher et al., 1986).
Patent Applications EP 0 292 435, EP 0 392 225, and WO 93/07278
describe techniques for the preparation of callus and protoplasts from an
elite inbred line of maize, transformation of protoplasts using PEG or
electroporation, and the regeneration of maize plants from transformed
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
111
protoplasts. Gordon-Kamm et al., 1990 and Fromm et al., 1990 have
published techniques for transformation of A188-derived maize fine using
particle bombardment. Furthermore, WO 93/07278 and Koziel et al., 1993
describe techniques for the transformation of elite inbred lines of maize by
particle bombardment. This technique utilizes immature maize embryos of
1.5-2.5 mm length excised from a maize ear 14-15 days after pollination and
a PDS-1000He Biolistic particle delivery device (DuPont Biotechnology,
Wilmington, Delaware, United States of America) for bombardment.
Transformation of rice can also be undertaken by direct gene transfer
techniques utilizing protoplasts or particle bombardment. Protoplast
mediated transformation has been disclosed for Japonica-types and Indica
types (Zhang et al., 1988; Shimamoto et al., 1989; Datta et al., 1990) of
rice.
Both types are also routinely transformable using particle bombardment
(Christou et al., 1991 ). Furthermore, WO 93/21335 describes techniques for
the transformation of rice via electroporation. Casas et al., 1993 discloses
the production of transgenic sorghum plants by microprojectile
bombardment.
Patent Application EP 0 332 581 describes techniques for the
generation, transformation, and regeneration of Pooideae protoplasts.
These techniques allow the transformation of Dactylis and wheat.
Furthermore, wheat transformation has been disclosed in Vasil et al., 1992
using particle bombardment into cells of type C long-term regenerable callus,
and also by Vasil et al., 1993 and Weeks et al., 1993 using particle
bombardment of immature embryos and immature embryo-derived callus.
A representative technique for wheat transformation, however,
involves the transformation of wheat by particle bombardment of immature
embryos and includes either a high sucrose or a high maltose step prior to
gene delivery. Prior to bombardment, embryos (0.75-1 mm in length) are
plated onto MS medium with 3% sucrose (Murashige & Skoog, 1962) and 3
mg/I 2,4-dichlorophenoxyacetic acid (2,4-D) for induction of somatic
embryos, which is allowed to proceed in the dark. On the chosen day of
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
112
bombardment, embryos are removed from the induction medium and placed
onto the osmoticum (i.e. induction medium with sucrose or maltose added at
the desired concentration, typically 15%). The embryos are allowed to
plasmolyze for 2-3 hours and are then bombarded. Twenty embryos per
target plate are typical, although not critical. An appropriate gene-carrying
plasmid (such as pCIB3064 or pSG35) is precipitated onto micrometer size
gold particles using standard procedures. Each plate of embryos is shot with
the DuPont BIOLISTICS~ helium device using a burst pressure of about
1000 pounds per square inch (psi) using a standard 80 mesh screen. After
bombardment, the embryos are placed back into the dark to recover for
about 24 hours (still on osmoticum). After 24 hours, the embryos are
removed from the osmoticum and placed back onto induction medium where
they stay for about a month before regeneration. Approximately one month
later the embryo explants with developing embryogenic callus are
transferred to regeneration medium (MS + 1 mg/liter NAA, 5 mg/liter GA),
further containing the appropriate selection agent (10 mg/I BASTA~ in the
case of pCIB3064 and 2 mg/I methotrexate in the case of pSOG35). After
approximately one month, developed shoots are transferred to larger sterile
containers known as "GA7s" which contain half-strength MS, 2% sucrose,
and the same concentration of selection agent.
Transformation of monocotyledons using Agrobacterium has also
been disclosed. See WO 94/00977 and U.S. Patent No. 5,591,616, both of
which are incorporated herein by reference. See also Negrotto et al., 2000,
incorporated herein by reference. Zhao et al., 2000 specifically discloses
transformation of sorghum with Agrobacterium. See also U.S. Patent No.
6,369,298.
Rice (Oryza sativa) can be used for generating transgenic plants.
Various rice cultivars can be used (Hiei et al., 1994; Dong et al., 1996; Hiei
et al., 1997). Also, the various media constituents disclosed below can be
either varied in quantity or substituted. Embryogenic responses are initiated
and/or cultures are established from mature embryos by culturing on MS-
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
113
CIM medium (MS basal salts, 4.3 g/liter; B5 vitamins (200 x), 5 ml/liter;
Sucrose, 30 g/liter; proline, 500 mg/liter; glutamine, 500 mg/liter; casein
hydrolysate, 300 mg/liter; 2,4-D (1 mg/ml), 2 ml/liter; pH adjusted to 5.8
with
1 N KOH; Phytagel, 3 g/liter). Either mature embryos at the initial stages of
culture response or established culture lines are inoculated and co-cultivated
with the Agrobacterium tumefaciens strain LBA4404 (Agrobacterium)
containing the desired vector construction. Agrobacterium is cultured from
glycerol stocks on solid YPC medium (plus 100 mg/L spectinomycin and any
other appropriate antibiotic) for about 2 days at 28°C. Agrobacterium
is re-
suspended in liquid MS-CIM medium. The Agrobacterium culture is diluted
to an ODsoo of 0.2-0.3 and acetosyringone is added to a final concentration
of 200 p,M. Acetosyringone is added before mixing the solution with the rice
cultures to induce Agrobacterium for DNA transfer to the plant cells. For
inoculation, the plant cultures are immersed in the bacterial suspension. The
liquid bacterial suspension is removed and the inoculated cultures are
placed on co-cultivation medium and incubated at 22°C for two days. The
cultures are then transferred to MS-CIM medium 'with ticarcillin (400
mg/liter)
to inhibit the growth of Agrobacterium. For constructs utilizing the PMI
selectable marker gene (Reed et al., 2001 ), cultures are transferred to
selection medium containing mannose as a carbohydrate source (MS with
2% mannose, 300 mg/liter ticarcillin) after 7 days, and cultured for 3-4 weeks
in the dark. Resistant colonies are then transferred to regeneration induction
medium (MS with no 2,4-D, 0.5 mg/liter IAA, 1 mg/liter zeatin, 200 mg/liter
TIMENTIN~, 2% mannose, and 3% sorbitol) and grown in the dark for 14
days. Proliferating colonies are then transferred to another round of
regeneration induction media and moved to the light growth room.
Regenerated shoots are transferred to GA7 containers with GA7-1 medium
(MS with no hormones and 2% sorbitol) for 2 weeks and then moved to the
greenhouse when they are large enough and have adequate roots. Plants
are transplanted to soil in the greenhouse (To generation) grown to maturity
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
114
and the T~ seed is harvested. E. Growth and Screening of Transformed
Cells
Transgenic plant cells are then placed in an appropriate selective
medium for selection of transgenic cells, which are then grown to callus.
Shoots are grown from callus and plantlets generated from the shoot by
growing in rooting medium. The various constructs normally are joined to a
marker for selection in plant cells. Conveniently, the marker can be
resistance to a biocide (for example, an antibiotic including, but not limited
to
kanamycin, 6413, bleomycin, hygromycin, chloramphenicol, herbicide, or
the like). The particular marker used is designed to allow for the selection
of
transformed cells (as compared to cells lacking the DNA that has been
introduced). Components of DNA constructs including transcription
cassettes of the presently disclosed subject matter are prepared from
sequences that are native (endogenous) or foreign (exogenous) to the host.
As used herein, the terms "foreign" and "exogenous" refer to sequences that
are not found in the wild-type host into which the construct is introduced, or
alternatively, have been isolated from the host species and incorporated into
an expression vector. Heterologous constructs contain in one embodiment
at least one region that is not native to the gene from which the
transcription
initiation region is derived.
To confirm the presence of the transgenes in transformed cells and
plants, a variety of assays can be performed. Such assays include, for
example, "molecular biological" assays well known to those of skill in the
art,
such as Southern and Northern blotting, in situ hybridization and nucleic
acid-based amplification methods such as PCR or RT-PCR; "biochemical"
assays, such as detecting the presence of a protein product, e.g., by
immunological means (enzyme-linked immunosorbent assays (ELISAs) and
Western blots) or by enzymatic function; plant part assays, such as seed
assays; and also by analyzing the phenotype of the whole regenerated plant,
e.g., for disease or pest resistance.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
115
DNA can be isolated from cell lines or any plant parts to determine the
presence of the preselected nucleic acid segment through the use of
techniques well known to those skilled in the art. Note that intact sequences
will not always be present, presumably due to rearrangement or deletion of
sequences in the cell.
The presence of nucleic acid elements introduced through the
methods of this presently disclosed subject matter can be determined by the
polymerise chain reaction (PCR). Using this technique, discreet fragments
of nucleic acid are amplified and detected by gel electrophoresis. This type
of analysis permits one to determine whether a preselected nucleic acid
segment is present in a stable transformant. It is contemplated that using
PCR techniques it would be possible to clone fragments of the host genomic
DNA adjacent to an introduced preselected DNA segment.
Positive proof of DNA integration into the host genome and the
independent identities of transformants can be determined using the
technique of Southern hybridization. Using this technique, specific DNA
sequences that are introduced into the host genome and flanking host DNA
sequences can be identified. Hence, the Southern hybridization pattern of a
given transformant serves as an identifying characteristic of that
transformant. In addition, it is possible through Southern hybridization to
demonstrate the presence of introduced preselected DNA segments in high
molecular weight DNA: e.g., to confirm that the introduced preselected DNA
segment has been integrated into the host cell genome. Southern
hybridization provides certain information that can also be obtained using
PCR, e.g., the presence of a preselected DNA segment, but can also
demonstrate integration of an exogenous nucleic acid molecule into the
genome and can characterize each individual transformant.
It is contemplated that using the techniques of dot or slot blot
hybridization, which are modifications of Southern hybridization techniques,
the same information that is derived from PCR could be obtained (e.g., the
presence of a preselected DNA segment).
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
116
Both PCR and Southern hybridization techniques can be used to
demonstrate transmission of a preselected DNA segment to progeny. In
most instances, the characteristic Southern hybridization pattern for a given
transformant will segregate in progeny as one or more Mendelian genes
(Spencer et aL, 1992; Laursen et al., 1994), indicating stable inheritance of
the gene. The non-chimeric nature of the callus and the parental
transformants (Ro) can be suggested by germline transmission and the
identical Southern blot hybridization patterns and intensities of the
transforming DNA in callus, Ro plants, and R~ progeny that segregated for
the transformed gene.
Whereas certain DNA analysis techniques can be conducted using
DNA isolated from any part of a plant, specific RNAs might only be
expressed in particular cells or tissue types and hence it can be necessary to
prepare RNA for analysis from these tissues. PCR techniques can also be
used for detection and quantitation of RNA produced from introduced
preselected DNA molecules. In this application of PCR, it is first necessary
to reverse transcribe RNA into complementary DNA (cDNA) using an
t
enzyme such as a reverse transcriptase, and then through the use of
conventional PCR techniques, to amplify the resulting cDNA.
In some instances, PCR techniques might not demonstrate the
integrity of the RNA product. Further information about the nature of the
RNA product can be obtained by Northern blotting. This technique
demonstrates the presence of an RNA species and additionally gives
information about the integrity of that RNA. The presence or absence of an
RNA species can also be determined using dot or slot blot Northern
hybridizations using techniques known in the art. These techniques are
modifications of Northern blotting and typically demonstrate only the
presence or absence of an RNA species.
Thus, Southern blotting and PCR can be used to detect the presence
of a DNA molecule of interest. Expression can be evaluated by specifically
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
117
identifying the protein products of the introduced preselected DNA segments
or evaluating the phenotypic changes brought about by their expression.
Assays for the production and identification of specific proteins can
make use of physical-chemical, structural, functional, or other properties of
the proteins. Unique- physical-chemical or structural properties allow the
proteins fio be separated and identified by electrophoretic procedures, such
as native or denaturing gel electrophoresis or isoelectric focusing, or by
chromatographic techniques such as ion exchange or gel exclusion
chromatography. The unique structures of individual proteins offer
opportunities for use of specific antibodies to detect the presence of
individual proteins using art-recognized techniques such as an ELISA assay.
Combinations of approaches can be employed to gain additional information,
such as Western blotting, in which antibodies are used to locate individual
gene products that have been separated by electrophoretic techniques and
transferred to a solid support. Additional techniques can be employed to
confirm the identity of the product of interest, such as evaluation by amino
acid sequencing following purification. Although these are among the most
commonly employed, other procedures known to the skilled artisan can also
be used.
Assay procedures can also be used to identify the expression of
proteins by their functions, especially the ability of enzymes to catalyze
specific chemical reactions involving specific substrates and products.
These reactions can be followed by providing and quantifying the loss of
substrates or the generation of products of the reactions by physical or
chemical procedures. Examples are as varied as the enzyme to be
analyzed, and are known in the art for many different enzymes.
The expression of a gene product can also be determined by
evaluating the phenotypic results of its expression. These assays also can
take many forms including, but not limited to analyzing changes in the
chemical composition, morphology, or physiological properties of the plant.
Morphological changes can include greater stature or thicker stalks.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
118
Changes in the response of plants or plant parts to imposed treatments are
typically evaluated under carefully controlled conditions termed bioassays.
As such, protein expression levels can be measured by any standard
method. For example, antibodies (monoclonal or polyclonal) can be
generated by standard methods that specifically bind to a stress-related
protein of the presently disclosed subject matter (see methods for making
antibodies in, e.g., Ausubel et al., 1988, including updates up to 2002;
Harlow & Lane, 1988). Using such a stress-related protein-specific antibody,
protein levels can be determined by any immunological method including,
without limitation, Western blotting, immunoprecipitation, and ELISA.
Another non-limiting method for measuring protein level is by
measuring mRNA levels. For example, total mRNA can be isolated from a
cell introduced with a nucleic acid molecule of the presently disclosed
subject matter (or with an antisense of such a nucleic acid molecule) and
from an untreated cell. Northern blotting analysis using the nucleic acid
molecule that was introduced to the treated cell as a probe can indicate if
the
treated cell expresses the nucleic acid molecule at a different level (at both
the mRNA and polypeptide levels) as compared to the untreated cell.
Changes in stress response (either in unchallenged cells and plants,
or in cells and plants challenged with, for example, exposure to salt or
pathogen-infection) can be readily determined by any standard method,
such as counting the cells by any standard method. For example, cells can
be manually counted using a hemacytometer or microscope. Callus growth
and plant growth can be measured by weight and/or height. Individual cell
growth can be determined by any standard stress response assay (e.g., 3H
incorporation).
The presently disclosed subject matter further includes the
manipulation of stress response by modulation of the expression of more
than one of the stress-related proteins described herein. For example, an
increase in the level of expression of a first stress-related protein coupled
with a decrease in the level of expression of a second stress-related protein
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
119
can result in a greater change in the stress response of a cell (or plant
including such a cell) than either the increase in the level of expression of
a
first stress-related protein of the decrease in the level of expression of a
second the stress-related protein alone. The presently disclosed subject
matter has provided numerous stress-related proteins and their interrelations
with one another. Manipulation of expression of one or more of the stress-
related proteins of the presently disclosed subject matter enables the
development of genetically engineered plants (i.e., transgenic plants) that
have superior stress response under stress (e.g., biotic or abiotic stress).
VI. Plants, Breeding, and Seed Production
A. Plants
A host cell is any type of cell including, without limitation, a bacterial
cell, a yeast cell, a plant cell, an insect cell, and a mammalian cell.
Numerous such cells are commercially available, for example, from the
American Type Culture Collection, Manassas, Virginia, United States of
America.
In certain embodiments, the cell is a plant cell, which can be
regenerated to form a transgenic plant. Thus, the presently disclosed
subject matter provides a transformed (transgenic) plant cell, in plants or ex
plants, including a transformed plastid or other organelle (e.g., nucleus,
mitochondria or chloroplast). As used herein, a "transgenic plant" is a plant
having one or more plant cells that contain an exogenous nucleic acid
molecule (e.g., a nucleic acid molecule encoding a stress-related
polypeptide of the presently disclosed subject matter). Thus, a transgenic
plant can comprise a nucleic acid molecule comprising a foreign nucleic acid
sequence (i.e. a nucleic acid sequence derived from a difFerent plant
species). Alternatively or in addition, a transgenic plant can comprise a
nucleic acid molecule comprising a nucleic acid sequence from the same
plant species, wherein the nucleic acid sequence has been isolated from
that plant species. In the latter example, the nucleic acid sequence can be
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
I20
the same or different from the wild-type sequence, and can optionally include
regulatory sequences that are the same or different from those that are
found in the naturally occurring plant.
The presently disclosed subject matter can be used for transforming
cells of any plant species, including, but not limited to from corn (Zea
mays),
Brassica sp. (e.g., B. napus, 8. raps, B. juncea), particularly those Brassica
species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza
sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare),
millet (e.g., pearl millet (Pennisetum glaucum)), proso millet (Panicum
1 10 miliaceum), foxtail millet (Setaria italics), finger millet (Eleusine
coracana)),
sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat
(Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum),
potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton
(Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea
batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos
nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa
(Theobroma cacao), tea (Camellia sinensis), banana (Muss spp.), avocado
(Persea ultilane), fig (Ficus casica), guava (Psidium guajava), mango
(Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew
(Anaeardium occidentals), macadamia (Macadamia integrifolia), almond
(Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum
spp.), oats, duckweed (Lemna), barley, vegetables, ornamentals, and
conifers.
Duckweed (Lemna, see PCT International Publication No. WO
00/07210) includes members of the family Lemnaceae. There are known
four genera and 34 species of duckweed as follows: genus Lemna (L.
aequinoctialis, L. disperma, L. ecuadoriensis, L, gibba, L. japonica, L.
minor,
L. miniscula, L. obscura, L. perpusilla, L. tenera, L, trisulca,
L.turionifera, L.
valdiviana); genus Spirodela (S. intermedia, S. polyrrhiza, S. punctata);
genus VVoffia (VVa. Augusta, Vila. Arrhiza, VVa. Australina, Vila. Borealis,
Wa.
Brasiliensis, Vlla. Columbiana, VVa. Elongata, VVa. Globosa, VVa.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
121
Microscopica, Wa. Neglects) and genus Wofiella (W1. ultila, W1. ultilanen,
W1. gladiata, W1. ultila, W7. lingulata, W1. repunda, W1. rotunda, and W1.
neotropica). Any other genera or species of Lemnaceae, if they exist, are
also aspects of the presently disclosed subject matter. In one embodiment,
Lemna gibba is employed in the presently disclosed subject matter, and in
other embodiments, Lemna minor and Lemna miniscula are employed.
Lemna species can be classified using the taxonomic scheme described by
Landolt, 1986.
Vegetables within the scope of the presently disclosed subject matter
include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa),
green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas
(Lathyrus spp.), and members of the genus Cucumis such as cucumber (C.
sativus), cantaloupe (C. cantalupensis), and musk melon (C, melo).
Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla
hydrangea), hibiscus (Hibiscus rosasanensis), roses (Ross spp.), tulips
(Tulips spp.), daffodils (Narcissus spp.), petunias (Petunia hybrids),
carnations (Dianthus caryophyllus), poinsettias (Euphorbia pulcherrima), and
chrysanthemums. Conifers that can be employed in practicing the presently
disclosed subject matter include, for example, pines such as loblolly pine
(Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa),
lodgepole pine (Pinus conforta), and Monterey pine (Pinus radiata), Douglas-
fir (Pseudotsuga menziesii); Western hemlock (Tsuga ulfilane); Sitka spruce
(Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir
(Abies amabilis) and balsam fir (Abies balsamea); and cedars such as
Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis
nootkatensis).
Leguminous plants that can be employed in the presently disclosed
subject matter include beans and peas. Representative beans include guar,
locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima
bean, fava bean, lentils, chickpea, etc. Legumes include, but are not limited
to Arachis (e.g., peanuts), Vicia (e.g., crown vetch, hairy vetch, adzuki
bean,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
122
mung bean, and chickpea), Lupinus (e.g., lupine, trifolium), PHaseolus (e.g.,
common bean and lima bean), Pisum (e.g., field bean), Melilotus (e.g.,
clover), Medicago (e.g., alfalfa), Lotus (e.g., trefoil), lens (e.g..,
lentil), and
false indigo. Non-limiting forage and turf grass for use in the methods of the
presently disclosed subject matter include alfalfa, orchard grass, tall
fescue,
perennial ryegrass, creeping bent grass, and redtop.
Other plants within the scope of the presently disclosed subject matter
include Acacia, aneth, artichoke, arugula, blackberry, canola, cilantro,
clementines, escarole, eucalyptus, fennel, grapefruit, honey dew, jicama,
kiwifruit, lemon, lime, mushroom, nut, okra, orange, parsley, persimmon,
plantain, pomegranate, poplar, radiata pine, radicchio, Southern pine,
sweetgum, tangerine, triticale, vine, yams, apple, pear, quince, cherry,
apricot, melon, hemp, buckwheat, grape, raspberry, chenopodium,
blueberry, nectarine, peach, plum, strawberry, watermelon, eggplant,
pepper, cauliflower, Brassica, e.g., broccoli, cabbage, ultilan sprouts,
onion,
carrot, leek, beet, broad bean, celery, radish, pumpkin, endive, gourd,
garlic,
snapbean, spinach, squash, turnip, ultilane, and zucchini.
Ornamental plants within the scope of the presently disclosed subject
matter include impatiens, Begonia, Pelargonium, Viola, Cyclamen, Verbena,
Vinca, Tagetes, Primula, Saint Paulia, Agertum, Amaranthus, Antihirrhinum,
Aquilegia, Cineraria, Clover, Cosmo, Cowpea, Dahlia, Datura, Delphinium,
Gerbera, Gladiolus, Gloxinia, Hippeastrum, Mesembryanthemum,
Salpigiossos, and Zinnia.
In certain embodiments, transgenic plants of the presently disclosed
subject matter are crop plants and in particular cereals. Such crop plants
and cereals include, but are not limited to corn, alfalfa, sunflower, rice,
Brassica, canola, soybean, barley, soybean, sugarbeet, cotton, safflower,
peanut, sorghum, wheat, millet, and tobacco.
The presently disclosed subject matter also provides plants
comprising the disclosed compositions. In one embodiment, the plant is
characterized by a modification of a phenotype or measurable characteristic
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
123
of the plant, the modification being attributable to the expression cassette.
In one embodiment, the modification involves, for example, nutritional
enhancement, increased nutrient uptake efficiency, enhanced production of
endogenous compounds, or production of heterologous compounds. In
another embodiment, the modification includes having increased or
decreased resistance to an herbicide, an abiotic stress, or a pathogen. In
another embodiment, the modification includes having enhanced or
diminished requirement for light, water, nitrogen, or trace elements. In
another embodiment, the modification includes being enriched for an
essential amino acid as a proportion of a polypeptide fraction of the plant.
In
another embodiment, the polypeptide fraction can be, for example, total
seed polypeptide, soluble polypeptide, insoluble polypeptide, water-
extractable polypeptide, and lipid-associated polypeptide. In another
embodiment, the modification includes overexpression, underexpression,
antisense modulation, sense suppression, inducible expression, inducible
repression, or inducible modulation of a gene.
B. Breeding
The plants obtained via transformation with a nucleic acid sequence
of the presently disclosed subject matter can be any of a wide variety of
plant species, including monocots and dicots; however, the plants used in
the method, for the presently disclosed subject matter are selected in one
embodiment from the list of agronomically important target crops set forth
hereinabove. The expression of a gene of the presently disclosed subject
matter in combination with other characteristics important for production and
quality can be incorporated into plant lines through breeding. Breeding
approaches and techniques are known in the art. See e.g., Welsh, 1981;
Wood, 1983; Mayo, 1987; Singh, 1986; Wricke & Weber, 1986.
The genetic properties engineered into the transgenic seeds and
plants disclosed above are passed on by sexual reproduction or vegetative
growth and can thus be maintained and propagated in progeny plants.
Generally, the maintenance and propagation make use of known agricultural
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
124
methods developed to fit specific purposes such as tilling, sowing, or
harvesting. Specialized processes such as hydroponics or greenhouse
technologies can also be applied. As the growing crop is vulnerable to
attack and damage caused by insects or infections as well as to competition
by weed plants, measures are undertaken to control weeds, plant diseases,
insects, nematodes, and other adverse conditions to improve yield. These
include mechanical measures such as tillage of the soil or removal of weeds
and infected plants, as well as the application of agrochemicals such as
herbicides, fungicides, gametocides, nematicides, growth regulants, ripening
agents, and insecticides.
Use of the advantageous genetic properties of the transgenic plants
and seeds according to the presently disclosed subject matter can further be
made in plant breeding, which aims at the development of plants with
improved properties such as tolerance of pests, herbicides, or biotic or
abiotic stress, improved nutritional value, increased yield or proliferation,
or
improved structure causing less loss from lodging or shattering. The various
breeding steps are characterized by well-defined human intervention such as
selecting the lines to be crossed, directing pollination of the parental
lines, or
selecting appropriate progeny plants.
Depending on the desired properties, different breeding measures are
taken. The relevant techniques are well known in the art and include, but
are not limited to, hybridization, inbreeding, backcross breeding, multiline
breeding, variety blend, interspecific hybridization, aneuploid techniques,
etc.
Hybridization techniques can also include the sterilization of plants to yield
mate or female sterile plants by mechanicai, chemical, or biochemical
means. Cross-pollination of a male sterile plant with pollen of a different
line
assures that the genome of the male sterile but female fertile plant will
uniformly obtain properties of both parental lines. Thus, the transgenic
seeds and plants according to the presently disclosed subject matter can be
used for the breeding of improved plant lines that, for example, increase the
effectiveness of conventional methods such as herbicide or pesticide
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
125
treatment or allow one to dispense with said methods due to their modified
genetic properties. Alternatively new crops with improved stress tolerance
can be obtained, which, due to their optimized genetic "equipment", yield
harvested product of better quality than products that were not able to
tolerate comparable adverse developmental conditions (for example,
drought).
Additionally, The presently disclosed subject matter also provides a
transgenic plant, a seed from such a plant, and progeny plants from such a
plant including hybrids and inbreds. In representative embodiments,
transgenic plants are transgenic maize, soybean, barley, alfalfa, sunflower,
canola, soybean, cotton, peanut, sorghum, tobacco, sugarbeet, rice, wheat,
rye, turfgrass, millet, sugarcane, tomato, or potato.
A transformed (transgenic) plant of the presently disclosed subject
matter includes a plant, the genome of which is augmented by an
exogenous nucleic acid molecule, or in which a gene has been disrupted,
e.g., to result in a loss, a decrease, or an alteration in the function of the
product encoded by the gene, which plant can also have increased yields
and/or produce a better-quality product than the corresponding wild-type
plant. The nucleic acid molecules of the presently disclosed subject matter
are thus useful for targeted gene disruption, as well as for use as markers
and probes.
The presently disclosed subject matter also provides a method of
plant breeding, e.g., to prepare a crossed fertile transgenic plant. The
method comprises crossing a fertile transgenic plant comprising a particular
nucleic acid molecule of the presently disclosed subject matter with itself or
with a second plant, e.g., one lacking the particular nucleic acid molecule,
to
prepare the seed of a crossed fertile transgenic plant comprising the
particular nucleic acid molecule. The seed is then planted to obtain a
crossed fertile transgenic plant. The plant can be a monocot or a dicot. In a
particular embodiment, the plant is a cereal plant.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
126
The crossed fertile transgenic plant can have the particular nucleic
acid molecule inherited through a female parent or through a male parent.
The second plant can be an inbred plant. The crossed fertile transgenic can
be a hybrid. Also included within the presently disclosed subject matter are
seeds of any of these crossed fertile transgenic plants.
C. Seed Production
Some embodiments of the presently disclosed subject matter also
provide seed and isolated product from plants that comprise an expression
cassette comprising a promoter sequence operatively linked to an isolated
nucleic acid as disclosed herein. In some embodiments, the isolated nucleic
acid molecule is selected from the group consisting of:
a. a nucleic acid molecule encoding a polypeptide comprising an
amino acid sequence of one of even numbered SEQ ID NOs: 2-
112;
b. a nucleic acid molecule comprising a nucleic acid sequence of
one of odd numbered SEQ ID NOs: 1-111;
c. a nucleic acid molecule that has a nucleic acid sequence at least
90% identical to the nucleic acid sequence of the nucleic acid
molecule of (a) or (b) ;
d. a nucleic acid molecule that hybridizes to (a) or (b) under
conditions of hybridization selected from the group consisting of:
i. 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM
ethylenediamine tetraacetic acid (EDTA) at 50°C with a
final wash in 2X standard saline citrate (SSC), 0.1 % SDS
at 50°C;
ii. 7% SDS, 0.5 M NaP04, 1 mM EDTA at 50°C with a final
wash in 1 X SSC, 0.1 % SDS at 50°C;
iii. 7% SDS, 0.5 M NaP04, 1 mM EDTA at 50°C with a final
wash in 0.5X SSC, 0.1 % SDS at 50°C;
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
127
iv. 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM
EDTA at 50°C with a final wash in 0.1X SSC, 0.1% SDS
at 50°C; and
v. 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM
EDTA at 50°C with a final wash in 0.1X SSC, 0.1% SDS
at 65°C;
e. a nucleic acid molecule comprising a nucleic acid sequence fully
complementary to (a); and
f. a nucleic acid molecule comprising a nucleic acid sequence that
is the full reverse complement of (a).
In one embodiment the isolated product comprises an enzyme, a
nutritional polypeptide, a structural polypeptide, an amino acid, a lipid, a
fatty
acid, a polysaccharide, a sugar, an alcohol, an alkaloid, a carotenoid, a
propanoid, a steroid, a pigment, a vitamin, or a plant hormone.
Embodiments of the presently disclosed subject matter also relate to
isolated products produced by expression of an isolated nucleic acid
containing a nucleotide sequence selected from the group consisting of:
(a) a nucleotide sequence that hybridizes under conditions of
hybridization of 45°C in 1 M NaCI, followed by a final washing
step at 50°C in 0.1 M NaCI to a nucleotide sequence listed in
odd numbered sequences of SEQ ID NOs: 1-185, or a fragment,
domain, or feature thereof;
(b) a nucleotide sequence encoding a polypeptide that is an
ortholog of a polypeptide listed in even numbered sequences of
SEQ ID NOs: 2-186, or a fragment, domain, or feature thereof;
(c) a nucleotide sequence complementary (for example, fully
complementary) to (a) or (b); and
(d) a nucleotide sequence that is the reverse complement (for
example, its full reverse complement) of (a) or (b) according to
the present disclosure.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
128
In one embodiment, the product is produced in a plant. In another
embodiment, the product is produced in cell culture. In another embodiment,
the product is produced in a cell-free system. In one embodiment, the
product comprises an enzyme, a nutritional polypeptide, a structural
polypeptide, an amino acid, a lipid, a fatty acid, a polysaccharide, a sugar,
an alcohol, an alkaloid, a carotenoid, a propanoid, a steroid, a pigment, a
vitamin, or a plant hormone. In another embodiment, the product is
polypeptide comprising an amino acid sequence listed in even numbered
sequences of SEQ ID NOs: 2-112, or ortholog thereof. In one embodiment,
the polypeptide comprises an enzyme.
In seed production, germination quality and uniformity of seeds are
essential product characteristics. As it is difficult to keep a crop free from
other crop and weed seeds, to control seedborne diseases, and to produce
seed with good germination, fairly extensive and well-defined seed
production practices have been developed by seed producers who are
experienced in the art of growing, conditioning, and marketing of pure seed.
Thus, it is common practice for the farmer to buy certified seed meeting
specific quality standards instead of using seed harvested from his own crop.
Propagation material to be used as seeds is customarily treated with a
protectant coating comprising herbicides, insecticides, fungicides,
bactericides, nematicides, molluscicides, or mixtures thereof. Customarily
used protectant coatings comprise compounds such as captan, carboxin,
thiram (tetramethylthiuram disulfide; TMTD~; available from R. T. Vanderbilt
Company, Inc., Norwalk, Connecticut, United States of America), methalaxyl
(APRON XL~; available from Syngenta Corp., Wilmington, Delaware, United
States of America), and pirimiphos-methyl (ACTELLIC~; available from
Agriliance, LLC, St. Paul, Minnesota, United States of America). If desired,
these compounds are formulated together with further carriers, surfactants,
andlor application-promoting adjuvants customarily employed in the art of
formulation to provide protection against damage caused by bacterial,
fungal, or animal pests. The protectant coatings can be applied by
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
129
impregnating propagation material with a liquid formulation or by coating with
a combined wet or dry formulation. Other methods of application are also
possible such as treatment directed at the buds or the fruit.
The presently disclosed subject matter will be further described by
reference to the following detailed examples. These examples are provided
for purposes of illustration only, and are not intended to be limiting unless
otherwise specified.
Examples
The following Examples have been included to illustrate modes of the
presently disclosed subject matter. In light of the present disclosure and the
general level of skill in the art, those of skill will appreciate that the
following
Examples are intended to be exemplary only and that numerous changes,
modifications, and alterations can be employed without departing from the
scope of the presently disclosed subject matter.
Example I
The example describes the identification and characterization of rice
proteins that interact at the thylakoid of chloroplasts and other cellular
membranes. Specifically, described in this example are newly characterized
rice proteins interacting with the rice 14-3-3 protein homolog GF14-c
(OsGF14-c) and with Defender Against Apoptotic Death 1 (OsDAD1 ).
The 14-3-3 proteins (reviewed in Muslin & Xing, 2000) interact with a
variety of regulators of cellular signaling, cell cycle, and apoptosis by
binding
to their partner proteins. The high potential for specific protein-protein
interactions makes these proteins suitable for two-hybrid assays. The 14-3-
3 proteins are known to participate in protein complexes within the nucleus
and are commonly found in the cytoplasm. Studies using yeast two-hybrid
assays have also localized GF14 isoforms to the chloroplast stroma and the
stromal side of thylakoid membranes (Sehnke ef al., 2000). However, the
subcellular localization of GF14-c had not been directly assessed to date.
Investigation of the protein interactions involving OsGF14-c can lead to the
identification of its location within the cell.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
130
OsDAD1 is encoded by the rice homolog of the highly conserved DAD
gene, a suppressor of endogenous programmed cell death, or apoptosis, in
animals and plants (Apte et al., 1995; Gallois et al., 1997). In support of
this
role for DAD, expression of a DAD plant homolog has been shown to be
down-regulated during flower petal senescence (an example of programmed
cell death) and by the plant hormone ethylene, which is associated with a
variety of stress responses and developmental processes (Orzaez & Granell,
1997). While these studies have been conducted with DAD homologs from
Arabidopsis and pea, the rice DAD1 is not described in the literature. The
interaction studies provided below were aimed at further characterizing this
protein.
An automated, high-throughput yeast two-hybrid assay technology (as
described above) was used to search for rice protein that interacted with the
bait proteins OsGF14-c and OsDAD1. The sequences encoding the protein
fragments used in the search were then compared by BLAST analysis
against databases to determine the sequences of the full-length genes. The
proteins found appear to be localized to the thylakoid of chloroplasts,
vacuolar membrane and plasma membrane. The results indicate that
OsGFl4-c is a membrane,, component in rice. The subset of proteins
interacting with OsGF14-c at the thylakoid form a novel chloroplast protein
complex involved in the photosynthetic processes. This interaction study
also identifies the rice OsDAD1 as a membrane protein, in agreement with
previously characterized DAD homologs from other species. Elucidation of
the role of proteins interacting at the thylakoid and other cellular membranes
in rice chloroplasts can allow the development of herbicides specifically
targeted to disrupting the structure and function of the thylakoid or
endomembrane system.
This example provides newly characterized rice proteins interacting
with the rice 14-3-3 protein homolog GF14-c (OsGF14-c) and with Defender
Against Apoptotic Death 1 (OsDAD1 ). An automated, high-throughput yeast
two-hybrid assay technology (provided by Myriad Genetics Inc., Salt Lake
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
131
City, UT) was used to search for protein interactions with the bait proteins
OsGFl4-c and OsDAD1. The 14-3-3 proteins (reviewed in Muslin & Xing,
2000) interact with a variety of regulators of cellular signaling, cell cycle,
and
apoptosis by binding to their partner proteins. The high potential for
specific
protein-protein interactions makes these proteins suitable for two-hybrid
assays. The 14-3-3 proteins are known to participate in protein complexes
within the nucleus and are commonly found in the cytoplasm. Studies using
yeast two-hybrid assays have also localized GF14 isoforms to the
chloroplast stroma and the stromai side of thylakoid membranes (Sehnke et
al., 2000). However, the subcellular localization of GF14-c had not been
directly assessed to date. Investigation of the protein interactions involving
OsGF14-c can lead to the identification of its location within the cell.
OsDAD1 is encoded by the rice homolog of the highly conserved DAD
gene, a suppressor of endogenous programmed cell death, or apoptosis, in
animals and plants (Apte et ai,, 1995; Gallois et al., 1997). In support of
this
role for DAD, expression of a DAD plant homolog has been shown to be
down-regulated during flower petal senescence (an example of programmed
cell death) and by the plant hormone ethylene, which is associated with a
variety of stress responses and developmental processes (Orzaez & Granell,
1997). While these studies have been conducted with DAD homologs from
Arabidopsis and pea, the rice DAD1 is not described. The interaction
studies provided in this example are aimed at characterizing this protein.
Results
GF14-c was found to interact with EPSP synthase, an enzyme in the
shikimate pathway (OsBAB61062); two enzymes with roles in the Calvin
cycle reactions in chloroplasts, a rice chloroplastic aldolase (OsBAA02730)
and a the chloroplast enzyme RUBISCO (OsRBCL); the RUBISCO activase
precursor (OsRCAAI ); and two rice photosystem proteins, putative 33kDa
oxygen-evolving protein of photosystem li (OsPN23059) and photosystem II
10 kDa polypeptide (OsAAB46718). Eight additional interactors for GF14-c
are novel rice proteins: a photosystem protein (OsPN23061 ) similar to
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
132
barley (Hordeum vulgare) photosystem I reaction center subunit II,
chloroplast precursor; a protein (OsPN22858) similar to Arabidopsis thaliana
GTP cyclohydrolase II, an enzyme involved in the biosynthesis of vitamin B
riboflavin (a cofactor in the shikimate pathway); a protein (OsPN22874)
similar to A. thaliana phosphatidylinositol-4-phosphate 5 kinase (P14P5K), an
enzyme involved in signaling events associated with water-stress response
in plants; two H*-ATPases, similar to A. thaliana vacuolar ATP synthase
subunit C (OsPN22866) and to barley plasma membrane H+-ATPase
(OsPN23022); a putative dynamin homolog (OsPN30846) that is likely
localized to the chloroplast, as are other plant dynamin family members; and
two proteins of unknown function (OsPN29982 and OsPN30974).
OsDAD1 was found to interact with three membrane proteins: rice
beta-expansin (OsEXPB2), which is localized to the plasma membrane
adjacent to the cell wall; a novel putative phosphate cotransporter
(OsPN23053); and the H+-ATPase-like protein OsPN23022 that also
interacts with GF14-c.
The proteins that interacted with OsGF14-c (14-3-3 protein homolog
GF14-c) and OsDAD1 are listed in Tables 1 and 2, respectively, followed by
detailed information on each protein and a discussion of the significance of
the interactions. A diagram of the interactions is provided in Figure 1. The
nucleotide and amino acid sequences of the proteins of the Example are
provided in SEQ ID NOs: 1-18 and 114-130.
Nine of the proteins identified represent rice proteins previously
uncharacterized. Based on their presumed biological function and on the'
ability of the prey proteins to specifically interact with the bait proteins
OsGF14-c and OsDAD1, it was speculated that OsGF14-c is a membrane
component. Based on the results described below, OsGF14-c is presumably
localized to the thylakoid of rice chloroplasts and to other cellular
membranes. The proteins interacting in the thylakoid are part of a novel
protein complex and are involved in the photosynthetic processes occurring
in the chloroplasts. Knowledge of the role of proteins interacting at the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
133
thylakoid in rice could be exploited for the development of herbicides
specifically targeted to disrupting the structure and function of the
thylakoid
membrane. The interactions found in this study also identify OsDAD1 as a
likely membrane component in rice, an observation consistent with previous
reports on other animal and plant DAD homologs.
Table 1
Interacting Proteins Identified for OsGFl4-c
(14-3-3 protein homoloct GF14-c~
The names of the clones of the proteins used as baits and found as preys
are given. Nucleotide/protein sequence accession numbers for the proteins
of the Example (or related proteins) are shown in parentheses under the
protein name. The bait and prey coordinates (Coord) are the amino acids
encoded by the bait fragments) used in the search and by the interacting
prey clone(s), respectively. The source is the library from which each prey
clone was retrieved.
Gene Name Protein Name Bait Prey
(GENBANK~ Accession No.) Coord Coord
(source)
BAIT
PROTEIN
OsGF14-c O. safiva 14-3-3 Protein Homolog1-257#
PN12464 GF14-c (U65957)
(SEQ ID NO
114)
INTERACTORS
OsBAB61062 O. sativa 3-Phosphoshikimate 1-150 463-511
1-
PN22844 carboxyvinyltransferase (a.k.a. (input
EPSP
(SEQ ID NO Synthase) (AB052962; BAB61062.1 trait)
: )
116)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
134
OsPN22858 Novel Protein 22858, Fragment,1-150 27-154
(SEQ ID NO similar to Arabidopsis GTP (input
: 2)
Cyclohydrolase II (BAB09512.1; trait)
e=0)
OsPN22874 Novel Protein 22874, Fragment,1-150 1-88
(SEQ ID NO similar to Arabidopsis Putative (input
: 4)
Phosphatidylinositol-4-phosphate trait)
5-
kinase (NP_187603.1; 4e ~$)
OsBAA02730 O, sativa Fructose-Bisphosphate1-150 206-269
PN22832 Aldolase, Chloroplast Precursor (input
(Contig4280.fast(Q40677) trait)
a.Contig 1
)
(SEQ ID NO
118)
OsRBCL O. sativa Chloroplast Ribulose1-150 287-462
PN23426 Bisphosphate Carboxylase, Large (input
(SEQ ID NO Chain (D00207; P12089) trait)
:
120)
OsRCAA1 O. sativa Ribulose Bisphosphate1-150 68-210
PN19842 Carboxylase/Oxygenase Activase, (input
(SEQ ID NO Large Isoform A1 (AB034698, trait)
:
122) BAA97583)
OsPN22866 Novel Protein PN22866, Fragment,1-150 95-305
(Contig388.fasta.Similar to A. Thaliana Vacuolar (input
ATP
Contig2) Synthase Subunit C (V-ATPase trait)
C
(SEQ ID NO subunit) (Vacuolar proton pump
: 6) C
subunit) (Q9SDS7; a X52)
OsPN23022$ Novel Protein PN23022, Fragment,1-150 149-285
(SEQ ID NO similar to H. Vulgare Plasma (input
: 8)
Membrane H~-ATPase (CAC50884; trait)
e=0.0)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
135
OsPN23061 Hypothetical Protein OsContig3864,1-150 94-203
(Contig3864.fastSimilar to H. vulgare Photosystem (input
I
a.Contigl ) Reaction Center Subunit II, trait)
(SEQ ID NO Chloroplast Precursor (P36213;
: 10) 6e 8')
OsPN23059 OsContig4331, O. sativa Putative1-150 193-333
(Contig4331.fast33kDa Oxygen-Evolving Protein 90-169
of
a.Contig1 Photosystem II (BAB64069) (input
(SEQ ID NO trait)
:
132)
OsAAB46718 O. sativa Photosystem II 10 1-150 82-126
kDa
PN22840 Polypeptide (U86018; T04177) (input
(FL_R01 003_H trait)
20.g.1 a.Sp6a
TMRI)
(SEQ ID NO
126)
OsPN29982 Novel Protein PN29982 1-150 201-300
(SEQ ID NO (input
: 12)
trait)
OsPN30846 Novel Protein PN30846 1-150 1-266
(SEQ ID NO (input
: 14)
trait)
OsPN30974 Novel Protein PN30974 1-150 38-178
(SEQ ID NO (input
: 16)
trait)
NOTE: Interactions of GF14-c with the maize transcription factor Viviparous-
1 (ZmVP1 ) and with Em binding protein (EmBp) are also reported in the
literature (Schultz et al., 1998).
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
136
# Self-activating clone, i,e., it activates the reporter genes in the two-
hybrid
system in the absence of a prey protein, and thus it was not used in the
search.
$ A prey clone of OsPN23022 also interacts with a clone of Defender
Against Apoptotic Death 1 (OsDAD1 ) used as a bait, and the bait
OsDAD1 interacts with Beta-Expansin EXPB2 (OsEXPB2) and with
Novel Protein 23053, Fragment, Similar to Arabidopsis Putative Na+-
Dependent Inorganic Phosphate Cotransporter (OsPN23053). These
interactions are shown in Table 2 below.
Table 2
Interacting Proteins Identified for OsDAD1 (Defender Against Apoptotic
Death 1 .
Gene Name Protein Name Bait Prey
(GENBANIC~ Accession No.) Coord Coord
(source)
BAIT PROTEIN
OsDAD1 O. sativa Defender Against
PN20251 Apoptotic Death 1 (D89727;
(SEQ ID NO : BAA24104)
128)
INTERACTORS
OsPN23022 Novel Protein PN23022, Fragment,30-115 37-371
(SEQ ID NO : similar to H. Vulgare Plasma (input
8)
Membrane H+-ATPase trait)
(CAC50884; e=0.0)
OsPN23053 Novel Protein 23053, Fragment,30-115 2x 1-180
(SEQ ID NO : Similar to Arabidopsis Putative (input
18)
Na+-Dependent Inorganic trait)
Phosphate Cotransporter
(NP_181341.1; a X05)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
137
OsEXPB2 Beta-Expansin EXPB2 1-115 80-207
PN19902 (U95968; AAB61710) (input
(SEQ ID NO : trait)
130)
30-115 183-261
2x 80-
218
(input
trait)
Two-hybrid system using Os GF14-c as bait
GF14-c (GENBANK~ Accession #U65957) is a 256-amino acid
protein that has been reported to interact with site-specific DNA-binding
proteins (i.e., basic leucine zipper factor EmBP1 ) and tissue-specific
regulatory factors (i.e., viviparous-1; VP-1; Sohultz et al., 1998). It can
act to
form complexes with EmBP1 and VP-1 to mediate gene expression. The
14-3-3 proteins are found in virtually every eukaryotic organism and tissue
and usually consist, in any given organism, of multiple protein isoforms (De
Lille et al., 2001 ). They are thought to act as molecular scaffolds or
chaperones and to regulate the cytoplasmic and nuclear localization of
proteins with which they interact by regulating their nuclear import/export
(Zilliacus et al., 2001; reviewed by Muslin & Xing, 2000). The 14-3-3
proteins bind to a multitude of functionally diverse regulatory proteins
involved in cellular signaling pathways, cell cycling, and apoptosis. In
plants,
enzymes under the control of 14-3-3 proteins include starch synthase, Glu
synthase, F1 ATP synthase, ascorbate peroxidase, and afFeate o-methyl
transferase, plasmamembrane H+-ATPase, light- and substrate-regulated
metabolic enzymes of the nitrogen and carbon assimilation pathways, and
those involved in transcriptional regulation such as the G-box complex and
core transcription factors TBP, TFIIB, and EmBP. However, the specific 14-
3-3 isoforms required by each of these pathways have not been fully
characterized (De Lille efi al., supra). The 14-3-3 proteins have previously
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
138
been detected as participants in protein complexes within the nucleus (Bihn
et al., 1997; Imhof & Wolffe, 1999; Zilliacus et al., supra), in the
cytoplasm,
and mitochondria (De Lille et al., supra). Plant 14-3-3 proteins have also
been localized to the chloroplast stroma and the stromal side of thylakoid
membranes (Sehnke et al., supra). However, subcellular localization of
GF14-c has not been directly assessed and thus its location within the cell is
yet to be precisely defined.
Analysis of the amino acid sequence of GF14-c identified a cAMP-
and GMP-dependent phosphorylation site at amino acids 107 to 110, six
protein kinase C phosphorylation sites (amino acids 10 to 12, 29 to 31, 56 to
61, 29 to 31, 59 to 61, and 74 to 76), three casein kinase II phosphorylation
sites (amino acids 110 to 113, 120 to 123, and 177 to 180), an N-
myristoylation site (amino acids 9 to 14), and two amidation sites (amino
acids 77 to 80 and 105 to 108). The bait fragment used in this search
encodes amino acids 1 to 150 of GF14-c. A BLAST analysis comparing the
nucleotide sequence of GF14-c against TMRI's GENECHIP~ Rice Genome
Array sequence database identified probeset OS009195 at (e 48expectation
value) as the closest match. Gene expression experiments indicated that
this gene is not specifically expressed in several different tissue types and
is
not specifically induced by a broad range of stresses, herbicides and applied
hormones.
The bait protein encoding amino acids 1 to 150 of GF14-c was found
to interact with O. sativa 3-phosphoshikimate 1-carboxyvinyltransferase
(a.k.a. EPSP Synthase) (OsBAB61062). OsBAB61062 is a 511-amino acid
protein that contains an EPSP synthase signature 1 site (amino acids 162 to
176), an EPSP signature 2 site (amino acids 423 to 441 ), and it is alanine-
rich at the N-terminus. A BLAST analysis of the amino acid sequence of
OsBAB61062 determined that this protein is the rice 3-phosphoshikimate 1-
carboxyvinyltransferase (also commonly referred to as EPSP synthase)
(GENBANK~ Accession No. BAB61062.1, 83.9% identity, ~e = 0.0). This
511-amino acid enzyme is located in the chloroplasts where it catalyzes an
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
139
essential step in aromatic amino acid synthesis, referred to as the shikimate
pathway. Because EPSP synthase is essential to algae, higher plants,
bacteria, and fungi, but not present in mammals, this enzyme is a useful
herbicide and antimicrobial target.
A BLAST analysis comparing the nucleotide sequence of EPSP
synthase against TMRI's GENECHIP~ Rice Genome Array sequence
database identified probeset OS020639.1 at (e X56 expectation value) as the
closest match. Gene expression experiments indicated that this gene is
induced by jasmonic acid, a plant hormone involved in signal transduction
events associated with a plant's stress response, and by M, grisea, the
fungus that causes rice blast disease. The gene is repressed under drought
conditions.
The bait protein encoding amino acids 1 to 150 of GF14-c was found
to interact with protein 22858, a fragment which is similar to A. thaliana GTP
cyclohydrolase II (OsPN22858). This prey clone of OsPN22858 is a 460
amino acid protein fragment with a transmembrane region spanning amino
acids 182 to 198 and a possible cleavage site between amino acids 24 and
25, although no N-terminal signal peptide is present. A BLAST analysis of
OsPN22858 determined that its amino acid sequence most nearly matches
that of GTP cyclohydrolase II; 3,4-dihydroxy-2-butanone-4-phoshate
synthase from A. thaliana (GENBANK~ Accession No. BAB09512.1, 74.4%
identity, e=0). GTP cyclohydrolase II catalyzes the first committed reaction
in the biosynthesis of the B vitamin riboflavin (Ritz et al., 2001 ).
A BLAST analysis comparing the nucleotide sequence of Novel
Protein 22858 against TMRI's GENECHIP~ Rice Genome Array sequence
database identified OS015318 s at (5e ~° expectation value) as the
closest
match. The expectation value is too low for this probeset to be a reliable
indicator of the gene expression of this GTP cyclohydrolase.
The bait protein encoding amino acids 1 to 150 of GF14-c was found
to interact with Protein 22874, a fragment that is similar to A. thaliana
putative phosphatidylinositol-4-phosphate 5-kinase (OsPN22874). A BLAST
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
140
analysis of OsPN22874 determined that its 89-amino acid sequence most
nearly matches that of phosphatidylinositol-4-phosphate 5-kinase (P14P5K)
from A, thaliana (GENBANK~ Accession No. NP_187603.1, 65.5% identity,
4e ~$). P14P5K is an enzyme that plays a well-defined role in many signaling
events in many species, including the endoplasmic reticulum (ER) stress
response in plants (Shank et al., 2001 ). Animal and yeast P14P5K
phosphorylates phosphatidylinositol-4-phosphate to produce
phosphatidylinositol-4,5-bisphosphate as a precursor of two second
messengers, inositol-1,4,5-triphosphate and diacylglycerol, and as a
regulator of many cellular proteins involved in signal transduction and
cytoskeletal organization (reviewed in Mikami et al., 1998). Mikami et al.
identified a full-length cDNA clone encoding a P14P5K protein in A. thaliana
whose mRNA expression is induced by treatment of the plant with drought,
salt and abscisic acid, suggesting that this protein is involved in water-
stress
signal transduction (Mikami et al., supra). Elge et al. report that A.
thaliana
P14P5K is expressed predominantly in vascular tissues of leaves, flowers
and roots, namely in cells of the lateral meristem, i.e., the procambium (Elge
et al., 2001 ).
The bait protein encoding amino acids 1 to 150 of GF14-c was also
found to interact with O. sativa fructose-bisphosphate aldolase, a chloroplast
precursor (OsBAA02730). OsBAA02730 (GENBANK~ Accession No.
Q40677) is a 388-amino acid protein that includes a fructose-bisphosphate
aldolase class-I active site (amino acids 44 and 388), as determined by
analysis of the amino acid sequence (8.5e 22$). A BLAST analysis of the
amino acid sequence of OsBAA02730 indicated that this protein is the rice
fructose-bisphosphate aldolase, chloroplast precursor (GENBANK~
Accession No. Q40677). The gene encoding chloroplastic aldolase was
isolated along with that encoding the cytoplasmic form of the enzyme
(Tsutsumi et al., 1994). The chloroplastic aldolase is encoded at a single
locus, while the cytoplasmic form is distributed between three loci on the
genome. Aldolases are present in higher plants as two isoforms, the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
141
cytosolic and the chloroplastic types. The cytoplasmic form is highly
conserved among plants and appears to be regulated through a Ca2+-
mediated protein kinase/phosphatase pathway (Nakamura et al., 1996).
This enzyme is though to have a role in the fruit ripening process (Schwab et
al., 2001 ). The chloroplastic enzyme is involved in two major sugar
phosphate metabolic pathways of green chloroplasts: the C3 photosynthetic
carbon reaction cycle (Calvin cycle) and reactions of the starch biosynthetic
pathway. In both cases, aldolase catalyzes the formation of fructose 1,6-
biphosphate from dihydroxyacetone 3-phosphate and glyceraldehyde 3-
phosphate. These topics are reviewed by Michelis et al., 2000, who also
identified a 44-kDa heat-induced isoform of the fructose-bisphosphate
aldolase in oat chloroplast, confirming its localization to the thylakoid
membrane and suggesting that this enzyme is not embedded but rather
tends to adhere to the chloroplast membranes. Similar heat-induced
thylakoid-associated aldolase homologues were found in other plant
species.
A BLAST analysis comparing the nucleotide sequence of the aldolase
protein against TMRI's GENECHIP~ Rice Genome Array sequence
database identified probeset OS006916.1 at (e X56 expectation value) as the
closest match. Our gene expression experiments indicate that this gene is
down-regulated by jasmonic acid and drought.
In addition, the bait protein encoding amino acids 1 to 150 of GF14-c
was found to interact with O. sativa ribulose bisphosphate carboxylase large
chain precursor (RUBISCO Large Subunit; OsRBCL). A BLAST analysis of
the amino acid sequence of OsRBCL determined that this protein is the rice
chloroplast ribulose bisphosphate carboxylase, large chain precursor (RuBP
carboxylase/oxygenase, also called RUBISCO for short; GENBANK~
Accession No. P12089). RUBISCO is a 477-amino acid protein present in
the chloroplast of higher plants, with an active site in position 196-204. The
chloroplast RuBP carboxylase/oxygenase is part of the C02-fixing
multienzyme complexes bound to the thylakoid membrane (Suss et al.,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
142
1993) with roles in the Calvin cycle reactions that occur in the stroma of the
chloroplast during photosynthesis. The starting and ending compound in the
Calvin cycle is the five-carbon sugar ribulose 1,5-biphosphate (RuBP). As
its name indicates, RuBP carboxylase/oxygenase catalyzes two types of
reactions that involve RuBP. In the presence of high carbon dioxide and low
oxygen concentrations, the carboxylase activity of RUBISCO is favored and
the enzyme catalyzes the initial reaction in the Calvin cycle, the
carboxylation of RuBP, leading to the formation of 3-phosphoglyceric acid
(PGA). However, in the presence of low carbon dioxide and high oxygen
concentrations, oxygen competes with carbon dioxide as a substrate for
RUBISCO and the enzyme's oxygenase activity also occurs, resulting in
condensation of oxygen with RuBP to form 3-phosphoglycerate and
phosphoglycolate. RUBISCO is the world's most abundant enzyme,
accounting for as much as 40 percent of total soluble protein in leaves (these
topics are discussed in Raven et al., 1999).
A BLAST analysis comparing the nucleotide sequence of the
RUBISCO protein against TMRI's GENECHIP~ Rice Genome Array
sequence database identified probeset OS000296 s at (e=0 expectation
value) as the closest match. Gene expression experiments indicated that
this gene is down-regulated by BAP, 2,4-D, BL2, jasmonic acid, gibberellin,
and . abscisic acid. The gene is up-regulated under osmotic stress
conditions.
The bait protein encoding amino acids 1 to 150 of GF14-c was found
to interact with O. sativa ribulose bisphosphate carboxylase/oxygenase
activase, large isoform A1 (OsRCAA1 ). A BLAST analysis of the amino acid
sequence of OsRCAA1 determined that this 466-amino acid protein is the
rice RUBISCO activase large isoform precursor (GENBANK~ Accession No.
BAA97583). It contains two active sites (amino acid 31 to 38 and 156 to
163). RUBISCO activase is an AAA+ (ATPases associated with a variety of
cellular activities) protein that facilitates the ATP-dependent removal of
sugar
phosphates from RUBISCO active sites. This action frees the active site of
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
143
RUBISCO for spontaneous carbamylation by C02 and metal binding,
prerequisites for activity (reviewed in Salvucci et al., 2001; Salvucci &
Ogren,
1996).
The bait protein encoding amino acids 1 to 150 of GF14-c was found
to interact with protein PN22866, a fragment similar to A. thaliana vacuolar
ATP synthase subunit C (V-ATPase C subunit; vacuolar proton pump C
subunit) (OsPN22866). OsPN22866 is a 408-amino acid protein fragment.
Its amino acid sequence most nearly matches that of A. thaliana Vacuolar
ATP synfihase subunit C (V-ATPase C subunit) (Vacuolar proton pump C
subunit) (Q9SDS7, 72.7% identity, a X52), as determined by BLAST analysis.
The H+-translocating ATPases (H+-ATPase, V-ATPase) are multi-subunit
enzymes that function as essential proton pumps in eukaryotes. The
catalytic site of human V-ATPase consists of a hexamer of three A subunits
and three B subunits that bind and hydrolyze ATP and are regulated by
accessory subunits C, D, and E (van Hille et al., 1993).
ATPases are essential cellular energy converters that transduce the
chemical energy of ATP hydrolysis from transmembrane ionic
electrochemical potential differences. The plant ATPases are present in
chloroplasts, mitochondria and vacuoles. In vacuoles, ATPases regulate the
contents and volume of vacuoles, which depends on the coordinated
activities of transporters and channels located in the tonoplast (vacuolar
membrane). The V-ATPase uses the energy released during cleavage of
the phosphate group of cytosolic ATP to pump protons into the vacuolar
lumen, thereby creating an electrochemical H+-gradient that is the driving
force for transport of ions and metabolites. Thus V-ATPase is important as a
'house-keeping' and as a stress response enzyme. Expression of V-ATPase
has been shown to be highly regulated depending on metabolic conditions.
The V-ATPase consists of several polypeptide subunits that are located in
two major domains, a membrane peripheral domain (V~) and a membrane
integral domain (V°). Subunit C is a highly hydrophobic protein
containing
four membrane-spanning domains. The function of subunit C is unknown,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
144
although it is suggested to be directly involved in H+ transport and might be
involved in stabilization of V~. The structure, function and regulation of the
plant V-ATPase are reviewed in Ratajczak, 2000.
The bait protein encoding amino acids 1 to 150 of GF14-c was also
found to interact with protein PN23022, a fragment similar to H. Vulgate
plasma membrane H+-ATPase (OsPN23022). Protein PN23022 is a 534
amino acid fragment that includes seven transmembrane domains (amino
acids 170 to 186, 202 to 218, 226 to 242, 266 to 282, 308 to 324, 337 to
353, and 373 to 389), as predicted by analysis of its amino acid sequence.
A BLAST analysis of the amino acid sequence of OsPN23022 determined
that this protein is similar to H, vulgate plasma membrane H+-ATPase
(GENBANK~ Accession No. CAC50884; 88.2% identity, e=0 expectation
value), an enzyme that translocates protons into intracellular organelles or
across the plasma membrane of eukaryotic cells. A BLAST analysis
comparing the nucleotide sequence of Novel protein PN23022 against
TMRI's GENECHIP~ Rice Genome Array sequence database identified
OS000972 f at (e " expectation value) as the closest match. The
expectation value is too low for this probeset to be a reliable indicator of
the
gene expression of this ATPase. OsPN23022 was also found to interact
with Defender Against Apoptotic Death 1 (OsDAD1; see Table 22).
The bait protein encoding amino acids 1 to 150 of GF14-c was found
to interact with protein OsContig3864, which is similar to H. vulgate
photosystem I reaction center subunit II, chloroplast precursor (OsPN23061 ).
Analysis of the OsContig3864 amino acid sequence predicted that it is a
203-amino acid protein containing a possible cleavage site between amino
acids 21 and 22, although there appears to be no N-terminal signal peptide.
A BLAST analysis determined that the OsContig3864 clone has an amino
acid sequence that most nearly matches that of H. vulgate photosystem I
reaction center subunit II, chloroplast precursor (Photosystem I 20 kDa
subunit; PSI-D; GENBANK~ Accession No. P36213, 80% identity, 3e $6).
The photosystems (photosystems I and II) are large multi-subunit protein
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
145
complexes embedded into the photosynthetic thylakoid membrane. They
operate in series and catalyze the primary step in oxygenic phofiosynthesis,
the light-induced charge separation process by which light energy from the
sun is converted to carbon dioxide and carbohydrates in plants and
cyanobacteria. Photosystem I catalyzes the light-induced electron transfer
from plastocyanin/cytochrome c6 on the lumenal side of the membrane
(inside the thylakoids) to ferredoxin/flavodoxin at the stromal side by a
chain
of electron carriers (reviewed in Fromme et al., 2001 ).
A BLAST analysis comparing the nucleotide sequence of
OsContig3864 against TMRI's GENECHIP~ Rice Genome Array sequence
database identified probeset OS000721 at (e = 0 expectation value) as the
closest match. Gene expression experiments indicated that this gene is not
specifically expressed in several different plant tissue types and is not
specifically induced by a broad range of stresses, herbicides and applied
hormones.
The bait protein encoding amino acids 1 to 150 of GF14-c was also
found to interact with OsContig4331, an O. Sativa putative 33kDa oxygen-
evolving protein of photosystem II (OsPN23059). The two prey clones
retrieved from the input trait library encode amino acids 193 to 333 and 90 to
169 of OsContig4331. These clones are non-overlapping, suggesting that
multiple GF14-c-binding sites exist within OsContig4331. Analysis of the
OsContig4331 protein sequence predicted that it codes for a 333-amino acid
protein. The analysis also indicated that OsContig 4331 contains a possible
cleavage site between amino acids 37 and 38, although no N-terminal signal
peptide is evident. A BLAST analysis of the OsContig 4331 amino acid
sequence determined that this protein is the rice putative 33kDa oxygen-
evolving protein of photosystem II (GENBANK~ Accession No. BAB64069,
90.6% identity, a X69). Photosystem II uses photooxidation to convert water
to molecular oxygen, thereby releasing electrons into the photosynthetic
electron transfer chain.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
146
A BLAST analysis comparing the nucleotide sequence of
OsContig4331, rice Photosystem I Reaction Center Subunit II Precursor
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS000372_at (e = 0 expectation value) as the closest
match. Our gene expression experiments indicate that this gene is down-
regulated during cold stress.
The bait protein encoding amino acids 1 to 150 of GF14-c was also
found to interact with O. Sativa photosystem II 10 kDa polypeptide
(OSAAB46718). OSAAB46718 is a 126-amino acid protein fragment that
includes a predicted transmembrane domain (amino acids 102 to 118). A
BLAST analysis against the Genpept database revealed that OsAAB46718
is the Oryza sativa photosystem II lOkDa polypeptide (GENBANK~
Accession No. T04177, 91.2% identity, 2e 6~).
The bait protein encoding amino acids 1 to 150 of GF14-c was also
found to interact with protein PN29982 (OsPN29982). The 300-amino acid
sequence of the protein OsPN29982 most nearly matches that of a putative
protein of unknown function from A. thaliana (GENBANK~ Accession No.
NP_196688.1, 47% identity, 3e-054), as determined by BLAST analysis.
The second best match was CHICK LIM/homeobox protein Lhx1 (Homeobox
protein LIM-1) (GENBANK~ Accession No. P53411, 28% identity, e=0.002).
Based on the homeoboxdomain, this interaction can be similar to 14-3-3
protein interactions with transcription factors like VP1.
The bait protein encoding amino acids 1 to 150 of GF14-c was also
found to interact with protein PN30846 (OsPN30846). A BLAST analysis of
protein OsPN30846 determined that its 266-amino acid sequence most
nearly matches that of dynamin homolog from the leguminous plant
Astragalus sinicus (GENBANK~ Accession No. AAF19398.1, 70.6% identity,
2e'99). Since the discovery of the GTP-binding dynamin in rat brain,
dynamin-like proteins have been isolated from various organisms and
tissues and shown to be involved in diverse and seemingly unrelated
biological processes. Many different isoforms of dynamin-like proteins have
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
147
been identified in plant cells, and these plant homologs can be grouped into
several subfamilies, such as G68/ADL1, ADL2 and ADL3, based on their
amino acid sequence similarity (reviewed in Kim et al., 2001 ). The biological
roles have been characterized for a few of these plant dynamin-like proteins.
The dynamin-like protein ADL1 from Arabidopsis has been shown to be
localized to and to be involved in biogenesis of the thylakoid membranes of
chloroplasts (Park et al., 1998). Another Arabidopsis dynamin-like protein,
ADL2, is targeted to the plastid, and its recombinant form expressed in E.
coli binds specifically to phosphatidylinositol 4-phosphate through the
pleckstrin homology (PH) domain present in ADL2 (Kim et al., supra). Based
on the similarity between the biochemical properties of ADL2 and those of
dynamin and other related proteins, ADL2 can be involved in vesicle
formation at the chloroplast envelope membrane.
The bait protein encoding amino acids 1 to 150 of GF14-c was also
found to interact with protein PN30974 (OsPN30974). A BLAST analysis of
the novel protein OsPN30974 determined that its 476-amino acid sequence
most nearly matches that of an Arabidopsis hypothetical protein of unknown
function (GENBANK~ Accession No. NP_173623.1, 49% identity, e'3').
The next 13 best hits with an expectation value <e'5 are all Arabidopsis or
rice proteins of unknown function annotated in the public domain.
Two-hybrid system using OsDAD1 as bait
A second bait protein, namely O. sativa Defender Against Apoptotic
Death 1 (OsDADI), was used to identify interactors. OsDAD1 (GENBANK~
Accession No. BAA24104) is a 114-amino acid protein that includes three
predicted transmembrane domains (amino acids 33 to 49, 59 to 75, and 94
to 110). DAD1 is a suppressor of programmed cell death, or apoptosis, a
process in which unwanted cells are eliminated during growth and
development. DAD is a highly conserved protein with homologs identified in
animals and plants (Apte et al., 1995; Gallois ef al, 1997). Dysfunction and
down-regulation of this gene has been linked to programmed cell death in
these organisms (Lindholm et al., 2000). DAD1 is an essential subunit of the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
148
oligosaccharyltransferase that is located in the ER membrane (Lindholm et
al., supra). DAD1 expression declines dramatically upon flower anthesis
disappearance in senescent petals and is down-regulated by the plant
hormone ethylene (Orzaez & Granell, 1997), which is involved in a variety of
stress responses and developmental processes including petal senescence
(Shibuya et al., 2000), cell elongation, cell fate patterning in the root
epidermis, and fruit ripening (Ecker, 1995).
Two clones, encoding amino acids 1-115 and 30-115 of OsDAD1,
were used as baits in this Example.
OsDAD1 was found to interact with protein 23053, a fragment which
is similar to Arabidopsis putative Nay-dependent inorganic phosphate
cotransporter (OsPN23053). OsPN23053 is a protein fragment; however, its
available 379-amino acid sequence contains five predicted transmembrane
regions (amino acids 100 to 116, 118 to 134, 226 to 242, 259 to 275, and
324 to 340) and a cleavable signal peptide (amino acids 1 to 46). A BLAST
analysis determined that OsPN23053 is similar to an Arabidopsis putative
Na+-dependent inorganic phosphate cotransporter (GENBANK~ Accession
No. NP_181341.1, 55.4% identity, a ~°5). In mammals, Na+-dependent
inorganic phosphate cotransporter is present in neuronal synaptic vesicles
and endocrine synaptic-like microvesicles as a vesicular glutamate
transporter and is responsible for'storage of glutamate, the major excitatory
neurotransmitter in the mammalian central nervous system (CNS; Takamori
et al., 2000). At least two isoforms of Nay-dependent inorganic phosphate
cotransporter exist (Takamori et al., supra; Aihara et al., 2000) and are
expressed in pancreas and brain (Hayashi et al., 2001; Fujiyama et al.,
2001 ). OsPN23053 is the first of a family of Na+-dependent inorganic
phosphate cotransporters to be discovered in rice. Plants utilize glutamate
in important biological processes including protein synthesis and glutamate-
mediated signaling (Lacombe et al., 2001 ). The formation of glutamate from
glutamine during nitrogen recycling (Singh et al., 1998) and the control of
nitrogen assimilatory pathways by light-signaling (Oliveira et al., 2001 ) in
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
149
plants suggest a link between glutamate formation and fight-signal
transduction.
OsDAD1 was found to interact with beta-expansin EXPB2
(OsEXPB2). A BLAST analysis of the amino acid sequence of OsEXPB2
determined that this protein is rice beta-expansin (GENBANK~ Accession
No. AAB61710, 99.6% identity, e'S6). Expansins promote cell wall extension
in plants. Shcherban et al. isolated two cDNA clones from cucumber that
encode expansins with signal peptides predicted to direct protein secretion
to the cell wall Shcherban et al., 1995). These authors identified at least
four
distinct expansin cDNAs in rice and at least six in Arabidopsis from
collections of anonymous cDNAs (Expressed Sequence Tags). They
determined that expansins are highly conserved in size and sequence and
suggest that this muftigene family formed before the evolutionary divergence
of monocotyledons and dfcotyledons. Their analyses indicate no similarities
to known functional domains that might account for the action of expansins
on wall extension, though a series of highly conserved tryptophans can
mediate expansin binding to cellulose or other glycans.
Summary
The thyfakoid membrane of the chloroplasts contains the
photosynthetic pigments, reaction centres and electron transport chains
associated with photosynthesis. Localization of OsGF14-c to this site is
consistent with the interactions of OsGF14-c with the photosystem proteins
of this Example. The photosystems (photosystems I and II) are large multi-
subunit protein complexes embedded in the thylakoid membrane. As part of
a larger group of protein-pigment complexes, the photosynthetic reaction
centers, they catalyze the light-induced charge separation associated with
photosynthesis. Both photosystems use the energy of photons from sunlight
to translocate electrons across the thylakoid membrane via a chain of
electron carriers. The electron transfer processes are coupled to a build-up
of a difference in proton concentration across the thylakoid membrane. The
resulting electrochemical membrane potential drives the synthesis of ATP,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
150
which is used to reduce C02 to carbohydrates in the subsequent dark
reactions. OsGF14-c is found to interact with OsContig3864, similar to
photosystem I reaction center subunit II, chloroplast precursor, with
OsContig4331, the rice putafiive 33kDa oxygen-evolving protein of
photosystem Il, and with rice photosystem II 10 kDa polypeptide. The
validity of these interactions is supported by results in a report by Sehnke
et
al., 2000, in which yeast two-hybrid technology was used to identify an
interaction between a plant 14-3-3 protein and another photosystem I
subunit protein, A, thaliana photosystem I N-subunit At pPSI-N. The
interactions of OsGF14-c with OsPN23061 (OsContig3864), OsPN23059
(OsContig4331 ), and OsAAB46718 (photosystem I I 10 kDa polypeptide)
suggest that OsGF14-c has a role in coupling the physical contact between
proteins in or on the periphery of thylakoid membranes.
Given the interactions of OsGF14-c and components of the
chloroplast photosystem, some of the other profieins found to interact with
OsGF14-c in this study are likely to be localized to the chloroplast as well,
and they are possibly co-located to the thylakoid membrane as interaction
complexes. For example, OsGF14-c interacts with EPSP synthase
(OsBAB61062), a shikimate pathway enzyme located in the chloroplast,
where aromatic amino acid synthesis initiates. It is interesting to note that
an
enzyme in the shikimate pathway requires a flavin as a cofactor (Bornemann
et al., Biochemistry 35(30): 9907-9916, 1996) and that OsGF14-c also
interacts with OsPN22858, a novel protein fragment similar to A. thaliana
GTP cyclohydrolase II. GTP cyclohydrolase II participates in the
biosynthesis of the B vitamin riboflavin, which is a cofactor for enzymes
functioning in the shikimate pathway. The interactions of these proteins with
OsGFl4-c can keep key proteins of the shikimate pathway in close proximity
in or at the thylakoid. The interactions of OsGF14-c with chloroplastic
aldolase (OsBAA02730), an enzyme shown to be localized to the thylakoid
membrane and involved in the sugar phosphate metabolic pathway of
chloroplasts, and with the Calvin cycle enzyme RUBISCO (OsRBCL) and
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
151
RUBISCO activase large isoform precursor (OsRCAA1 ) further support
localization of OsGF14-c and these interactors to the thylakoid membrane.
Previous reports have identified a fructose-bisphosph~ate aldolase isoform at
the thylakoid membrane in oat chloroplasts (Michelis et al., supra).
In addition, a novel interactor identified for OsGF14-c is a putative
dynamin homolog (OsPN30846). Plant dynamin-like proteins have been
localized to the thylakoid and envelope membranes of chloroplasts Park et
al., 1998; Kim et a12001 ). Thus it is likely that this rice dynamin homolog
is a
membrane protein that resides in the chloroplast. This and the fact that
other interactors identified for OsGF14-c are present in the thylakoid of
chloroplasts substantiates the notion that the 14-3-3 protein functions as a
component of the thylakoid or envelope membrane of chloroplasts. In
further support of this hypothesis, a recombinant Arabidopsis dynamin-like
protein member of the ADL2 subfamily binds specifically to
phosphatidylinositol 4-phosphate. The interactions between dynamins and
phosphoinositides documented in the literature (reviewed in Kim et al.,
supra) are consistent with the concomitant presence of the dynamin-like
protein OsPN30846 and the phosphatidylinositol-4-phosphate 5-kinase
OsPN22874 (rice P14P5K), both interacting with OsGF14-c, at the thylakoid.
We speculate that the interactors described above are part of a protein
complex involved in the photosynthetic processes at the thylakoid
membrane.
in addition to components of the chloroplast thylakoid, OsGF14-c was
found to interact with proteins similar to a plasma membrane H+-ATPase
(OsPN23022) and to a vacuolar ATPase (OsPN22866), which suggests that
OsGF14-c is also present in plasma and vacuolar membranes. The
interactions of OsGF14-c with the ATPases can represent 14-3-3 regulation
of the plant turgor pressure. This hypothesis is corroborated by reports of
14-3-3 proteins accomplishing this function via regulation of at least one
form
of a plasma membrane H+ ATPase (reviewed in DeLille et al., 2001 ). The
interaction of the vacuolar ATPase with OsGFl4-c can occur in the vacuolar
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
152
membrane, but also in membranes of the ER, Golgi bodies, coated vesicles,
and provacuoles.
The biological significance of the interaction of OsGFl4-c with the
novel protein OsPN22874 (rice P14P5K) can be defined based on functional
homology with A. thaliana P14P5K, which is induced under water-stress
conditions and is expressed in leaves. Given the interaction of OsGF14-c
with components of the thylakoid and vacuolar membranes, the rice PIP5K
can be located in the chloroplast but it can also reside at the vacuole, with
the vacuolar ATPase. In either case, the rice PIP5K can direct synthesis of
molecules involved in kinase signaling events associated with chloroplast
protection or vacuole size regulation under abiotic stress.
Two additional interactors, OsPN29982 and OsPN30974, found for
OsGF14-c are proteins of unknown function. Nevertheless, because 14-3-3
proteins acts as chaperones, these interactions can represent a process in
which the prey proteins achieve proper protein folding, or OsGF14-c can be
responsible for proper subcellular localization of OsPN29982 and
OsPN30974. Because all other interactors for OsGFl4-c appear to be
membrane-associated proteins,. OsPN29982 and OsPN30974 are likely to
be membrane proteins and can reside at the thy(akoid or other ce((ular
membrane structures.
In summary, some of the rice proteins found to interact with OsGF14-
c appear to be located at the thylakoid membrane where they participate in
photosynthetic processes occurring in the chloroplast; these interactions are
consistent with previously reported localization of 14-3-3 proteins to the
chloroplast stroma and the stromal side of thy(akoid membranes (Sehnke et
al., 2000). Other interactors identified are associated with the plasma or
vacuolar membrane. OsGFl4-c is, thus, likely to be a membrane
component in rice. Because 14-3-3 proteins participate in many types of
signaling pathways and are thought to act as molecular chaperones
necessary for the assembly, unfolding or transport of proteins through
membranes, it is likely that OsGF14-c functions as a molecular glue or
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
153
stabilizer to regulate the function of the proteins with which it interacts at
the
thylakoid or other membrane structures. The identification of OsGF14-c as a
membrane component represents a novel observation and the first functional
characterization of the GF14-c protein in rice. In particular, the proteins
identified in this Example as interacting at the thylakoid membrane of
chloroplasts represent a novel rice protein complex.
Three interactors were identified in this study for OsDAD1. One is the
putative plasma membrane H+-ATPase (OsPN23022) that interacts with
OsGF14-c. Evidence exists that both OsDAD1 and H+-ATPase are integral
membrane proteins (Lindholm et al., 2000; Ratajczak et al., 2000). H+-
ATPase translocates protons into intracellular organelles or across the
plasma membrane of specialized cells, its activity resulting in acidification
of
intracellular compartments in eukaryotic cells. The acidic interior of
lysosomes has been shown to be necessary for apoptosis under some
conditions (Kagedal et al., 2001; Bursch, 2001 ). Thus, the activities of
these
two enzymes can be necessary for regulation of programmed cell death, and
their physical interaction can represent a step in control of this event.
Furthermore, 14-3-3 proteins have been implicated in regulation of many
cellular processes including apoptosis (van Hemert et al., 2001 ). It is
possible that the interactions of OsPN23022 with GF14-c and with OsDADI
represent steps in such regulation.
Another novel interactor found for OsDAD1 is the novel rice Na+-
dependent inorganic phosphate cotransporter. We speculate that the rice
phosphate cotransporter is also a membrane protein based on functional
homology with ifs mammalian homologs, which are localized to neuronal and
endocrine vesicles and have a role in glutamate storage (Takamori et al.,
2000). It is likely that glutamate participates in apoptosis regulation in
plants
as it does in mammals (Bezzi et al., 2001 ), and that this occurs in rice
through the association of the phosphate cotransporter OsPN23053 with
OsDAD1.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
154
Finally, OsDAD1 was found to interact with the rice beta-expansin.
Expansins are localized to the plasma membrane adjacent to the cell wall,
from which they mediate cell wall extension. Since genes regulating cell
death are part of the defense response, this interaction can be associated
with structural changes in the cell wall in response to cell death.
The interactions here reported represent the first characterization of
the DAD1 protein homolog in rice. Notably, the fact that OsDAD1 and its
interactors appear to be membrane proteins and that one of them,
OsPN23022, interacts with OsGF14-c lend further support to the notion that
OsGF14-c is a membrane component.
Example II
The rice senescence-associated protein (Os006819-2510) shares
61.4% amino acid sequence similarity with daylily Senescence-Associated
Protein 5, a protein encoded by one (DSAS) of six cDNA sequences the
levels of which increase during petal senescence. Transcripts of these
genes are found predominantly in petals, their expression increase during
petal but not leaf senescence, and they are induced by a concentration of
abscisic acid (ABA) that causes premature senescence of the petals. Petal
senescence is an example of endogenous programmed cell death, or
apoptosis, a process in which unwanted cells are eliminated during growth
and development. Genes performing a regulatory function in cell death or
survival are important to developmental processes. The rice senescence
associated protein Os006819-2510 was chosen as a bait for these
interaction studies based on its potential relevance to plant growth and
development.
To identify proteins that interacted with the rice senescence-
associated protein Os006819-2510, an automated, high-throughput yeast
two-hybrid assay technology (provided by Myriad Genetics Inc., Salt Lake
City, UT) was employed, as has been described above.
Results
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
155
The rice senescence-associated protein Os006819-2510 was found
to interact with eight rice proteins. Five interactors are known, namely, the
rice histone deacetylase HD1 (OsAAK01712), an~ enzyme involved in
regulation of core histone acetylation; the calcium-binding protein
calreticulin
precursor (OsCRTC), which also interacts with the starch biosynthetic
enzyme soluble starch synthase (OsSSS) and with a novel protein
(OsPN29950) of unknown function; low temperature-induced protein 5
(OsLIPS); the dehydrin RAB 16B, which is induced by water stress; and rice
putative myosin (OsPN23878), an actin motor protein which also interacts
with a putative calmodulin-kinase that is associated with a network of
proteins involved in cell cycle regulation (see Examples I and II). Three
interactors for senescence-associated protein are novel proteins including a
putative calllose synthase (OsPN23226), an enzyme involved in the
biosynthesis of the glucan callose; a protein similar to barley
coproporphyrinogen III oxidase, chloroplast precursor, an enzyme of the
chlorophyll biosynthetic pathway (OsPN23485); and a protein similar to
Arabidopsis Gamma Hydroxybutyrate Dehydrogenase.
The interacting proteins of this Example are listed in Tables 3-5,
followed by detailed information on each protein and a discussion of the
significance of the interactions. The nucleotide and amino acid sequences
of the proteins of the Example are provided in SEQ ID NOs: 19-30 and 131-
138.
Note that several prey proteins identified are, like the bait protein
Os006819-2510, membrane-associated molecules (OsCRTC, OsPN23226,
OsLIPS). Several appear to be associated with cell cycle processes in rice
(OsPN23878, Os003118-3674, OsCRTC, OsSSS, OsPN23226,
OsAAK01712), while others are involved in the plant stress response
(OsRAB16B, OsLIPS, OsCRTC). Some of the proteins identified represent
rice proteins previously uncharacterized. Based on the presumed biological
function of the prey proteins and on their ability to specifically interact
with
the bait protein Os006819-2510, Os006819-2510 is speculated to be
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
156
involved in cell cyclelmitotic processes and in the plant resistance to
stress,
and can actually represents a link between these processes in rice.
Proteins that participate in cell cycle regulation in rice can be targets
for genetic manipulation or for compounds that modify their level or activity,
thereby modulating the plant cell cycle. The identification of genes encoding
these proteins can allow genetic manipulation of crops or application of
compounds to effect agronomically desirable changes in plant development
or growth. Likewise, genes that are involved in conferring plants resistance
to stress have important commercial applications, as they could be used to
facilitate the generation and yield of crops.
Table 3
Interacting Proteins Identified for Os006819-2510 (Hypothetical Protein
006819-2510, Similar to Hemerocallis Senescence-Related Protein 5).
The names of the clones of the proteins used as baits and found as preys
are given. Nucleotide/protein sequence accession numbers for the proteins
of the Example (or related proteins) are shown in parentheses under the
protein name. The bait and prey coordinates (Coord) are the amino acids
encoded by the bait fragments) used in the search and by the interacting
prey clone(s), respectively. The source is the library from which each prey
clone was retrieved.
Gene Name Protein Name Bait Prey
(GENBANK~ Accession No.) Coord Coord
(source)
BAIT PROTEIN
Os006819-2510 Hypothetical Protein 006819-2510,
PN20462 Similar to Senescence-Related
(SEQ ID NO Protein 5 from Hemerocallis
: Hybrid
20) Cultivar (AAC34855.1; a 97)
INTERACTORS
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
157
OsAAK01712 O. sativa Histone Deacetylase 1-150 90-221
HD1
PN24059 (AF332875; AAK01712.1 ) (output
(SEQ ID NO
trait)
132)
OsCRTC* O. sativa Calreticulin Precursor1-273 283-301
PN20544 (AB021259; BAA88900) (output
(SEQ ID NO trait)
:
134)
OsLIP5 Oryza sativa Low Temperature- 1-150 29-60
PN22883 Induced Protein 5 (AB011368; (input
trait)
(SEQ ID NO BAA24979.1)
:
136)
OsPN23878# Oryza sativa Putative Myosin 1-150 685-888
(SEQ ID NO (AC090120; AAL31066.1) (output
:
138) trait)
OsRAB16B O. sativa DEHYDRIN RAB 16B 1-273 147-164
PN20554 (P22911 ) (output
(SEQ ID NO trait)
:
140)
OsPN23226 Novel Protein PN23226, Callose1-273 345-432
(SEQ ID NO synthase (output
:
22) trait)
OsPN23485 Novel Protein PN23485, Similar1-273 90-243
to
(SEQ ID NO Hordeum vulgare Coproporphyrinogen (output
:
24) III Oxidase, chloroplast precursor trait)
(Q42840; a X69)
OsPN29037 Novel Protein PN29037 1-150 73-165
(SEQ ID NO (input
: trait)
26)
* Additional interactions identified for OsCRTC are listed in Table 4
# Additional interactions identified for OsPN23878 are listed in Table 5
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
158
Table 4
Gene Name Protein Name Bait Prey Coord
(GENBANK~ Accession No.) Coord (source)
BAIT PROTEIN
OsCRTC Calreticulin Precursor (AB021259;
PN20544 BAA88900)
(SEQ ID NO
134)
INTERACTORS
OsPN29950 Novel Protein PN29950 1-150 7-103
(SEQ ID NO 2x 138-343
:
28) 50-343
(output
trait)
OsSSS Soluble Starch Synthase 250-425 68-270
PN19701 (AF165890; AAD49850) (input trait)
(SEQ ID NO 97-263
:
142) (output
trait)
Table 5
Gene Name Protein Name Bait Coord Prey
(GENBANK~ Accession No.) Coord
(source)
PREY PROTEIN
OsPN23878 Oryza sativa Putative Myosin
(SEQ ID NO (AC090120; AAL31066.1)
:
138)
BAIT PROTEIN
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
159
Os003118- Hypothetical Protein 003118-367475-149 824-935
3674 Similar to Lycopersicon (output
PN20551 esculentum Calmodulin trait)
(SEQ ID NO
30)
Os006819-2510 is a 276-amino acid protein that includes a cleavable
signal peptide (amino acids 1 to 27) and three transmembrane domains
(amino acids 48 to 64, 82 to 98, and 233 to 249), as predicted by analysis of
its amino acid sequence. The analysis also predicted two endoplasmic
reticulum retention motifs, one N-terminal (AFRL) and the other C-terminal
(KGGY), and a prokaryotic membrane lipoprotein lipid attachment site
beginning with amino acid 57 (Prosite). This site, when functional, is a
region of protein processing. Analysis by Pfam also identified a
transmembrane superfamily domain, also called a tetraspanin family domain,
typically found in a group of eukaryotic cell surface antigens that are
evolutionarily related and include transmembrane domains.
A BLAST analysis against the Genpept database indicated that
Os006819-2510 is similar to Senescence-Associated Protein 5 from
Hemerocallis hybrid cultivar (daylily; GENBANK~ Accession No.
AAC34855.1; 61.4% identity; a 97). In agreement with this result, the protein
with the amino acid sequence most similar (63% identity) to that of
Os006819-2510 in Myriad's proprietary database is Hypothetical Protein
005991-3479, Similar to Hemerocallis Senescence-Associated Protein 5
(Os005991-3479). In an effort to identify the components of the genetic
program that leads daylily petals to senescence and cell death ca. 24 hours
after the flower opens, the cDNA encoding senescence-associated protein 5
in petals was isolated as one of six cDNAs (designated DSA3, 4, 5, 6, 12
and 15) whose levels increase during petal senescence (Panavas et al.,
1999). However, no sequence homology was identified in the public
database for the DSA5 gene product, which remains as yet unidentified.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
160
The levels of DSA mRNAs in leaves was determined to be less than 4% of
the maximum detected in petals, with no differences between younger and
older leaves, and the DSA genes (except DSA12) are expressed at low
levels in daylily roots and (except DSA4) induced by a concentration of
abscisic acid that causes premature senescence of the petals.
Two bait fragments, encoding amino acid 1-273 and 1-150, of
Os006819-2510 were used in the yeast two-hybrid screen.
A bait fragment encoding amino acids 1-150 of Os006819-2510 was
found to interact with O. sativa histone deacetiylase HD1 (OsAAK01712). A
BLAST analysis of the amino acid sequence of OsAAK01712 indicated that
this prey protein is the rice Histone Deacetylase HD1 (GENBANK~
Accession No. AAK01712.1, 100°l° identity, a = 0.0).
Histone deacetylase
(HD) enzymes have been isolated from plants, fungi and animals (reviewed
by Lechner et al., 1996). The enzymatic activity of histone deacetylase and
that of histone acetyltransferase maintain the enzymatic equilibrium of
reversible core histone acetylation. Core histones are a group of highly
conserved nuclear proteins in eukaryotic cells; they represent the main
component of chromatin, the DNA-protein complex in which chromosomal
DNA is organized. Besides their role in chromatin structural organization,
core histones participate in gene regulation, their regulatory function being
ascribed to their ability to undergo reversible posttranslational
modifications
such as acetylation, phosphorylation, glycosylation, ADP-ribosylation, and
ubiquitination. Histone deacetylase exists as multiple enzyme forms, and
this multiplicity reflects the complex regulation of core histone acetylation.
Four nuclear HDs have been identified and characterized from germinating
maize embryos (HD1-A, HD1-BI, HD1-BII, and HD2), based on their
expression during germination, molecular weight, physiochemical properties
and inhibition by various compounds. Based on these data, Lechner et al.,
supra, suggest that HD enzymes have a role in establishing and maintaining
histone-protein interactions, and that acetylation can modulate the binding of
proteins with anionic domains to certain chromatin areas.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
161
Os006819-2510 was found to interact with O, sativa Calreticulin
Precursor (OsCRTC). A BLAST analysis of the amino acid sequence of the
prey clone OsCRTC indicated that this protein is the rice Calreticulin
Precursor (GENBANK~ Accession No. BAA88900/SwissProt #Q9SLY8,
100% identity, e=0.0). OsCRTC is a 424-amino acid protein with a cleavable
signal peptide (amino acids 1 to 29), a calreticulin family repeat motif
(amino
acids 218 to 230), and an endoplasmic reticulum targeting sequence (amino
acids 421 to 424), as predicted by analysis of the OsCRTC amino acid
sequence (see Munro & Pelham, 1987; Pelham, 1990). In agreement with
its designation as a calreticulin precursor, the analysis identified a
calreticulin
family signature calreticulin family signature (amino acids 31 to 343, 1.3e
X66;
see Michalak et al., 1992; Bergeron et al., 1994; Watanabe et al., 1994).
The analysis also predicted a transmembrane domain (amino acids 7 to 29)
and a coiled coil (amino acids 360 to 389). The cDNA encoding the rice
calreticulin OsCRTC was first identified by Li & Komatsu, who found this
gene to be involved in the regeneration of rice cultured suspension cells.
These authors report that the rice calreticulin protein is highly conserved,
showing high homology (70-93%) to other plant calreticulins, but only 50-
53% homology to mammalian calreticulins. Calreticulin (CRT) is an
endoplasmic reticulum (ER) calcium-binding protein thought to be involved in
many functions in eukaryotic cells, including Ca2+ signaling, regulation of
intracellular Ca2+ storage and store-operated Ca2+ fluxes through the plasma
membrane, modulation of endoplasmic reticulum Ca2+-ATPase function,
chaperone activity to promote protein folding, control of cell adhesion, gene
expression, and apoptosis (reviewed by Michalak et al., 1998 and by
Persson et al.,). In plants, CRT has been localized to the endoplasmic
reticulum, Golgi, plasmodesmata, and plasma membrane (Borisjuk et al.,
1998; Hassan et al., 1995; Baluska et al., 2001 ), and it has been shown to
affect cellular calcium homeostasis, as reported by Persson et al., supra.
This study shows that induction of calreticulin expression in transgenic
tobacco and Arabidopsis plants enhances the ATP-dependent Ca2+
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
162
accumulation of the endoplasmic reticulum, and that this CRT-mediated
alteration of the ER Ca2+ pool regulates ER-derived Ca2~" signals. These
results demonstrate that CRT plays a key role as a regulator of calcium
storage in the endoplasmic ER, and that the ER, in addition to the vacuole, is
an important Ca2+ store in plant cells. A role for fihe Arabidopsis
calreticulin
homolog in anther maturation or dehiscence has also been proposed
(Nelson et al., 1997) based on localization of this protein in anthers which
are degenerating at the time of maximum CRT expression. Furthermore, the
tobacco homolog of mammalian CRTC participates in protein-protein
interactions in a stress- and ATP-dependent fashion Denecke et al., 1995).
This notion supports the use of the yeast two-hybrid technology to identify
proteins that interact with OsCRTC.
OsCRTC was also used as bait and found to interact with rice Soluble
Starch Synthase (OsSSS; see Table 24) and Novel Protein PN29950
(OsPN29950). OsSSS is the rice homolog of soluble starch synthase (SSS),
one of the three enzymes involved in starch biosynthesis in plants. Starch is
the major component of yield in the world's main crop plants and one of the
most important products synthesized by plants that is used in industrial
processes. It consists of two kinds of glucose polymers: highly branched
amylopectin and relatively unbranched amylose. Starch synthase
contributes to the synthesis of amylopectin. The enzyme utilizes the
glucosyl donor ADPGIc to add glucosyl units to the nonreducing end of a
glucan chain through ~(1 -3 4) linkages, thus elongating the linear chains
(reviewed by Cao et al., 2000; Kossman & Lloyd, 2000). Distinct classes of
isoforms of starch synthase were defined on the basis of similarity in amino
acid sequence, molecular mass, and antigenic properties. Plant organs vary
greatly in the classes they possess and in the relative contribution of the
classes to soluble starch synthase activity (Smith et al., 1997 cited in Cao
ef
al., supra). OsPN29950 is a protein of unknown function determined by
BLAST analysis to be similar to putative protein from Arabidopsis thaliana
(GENBANK~ Accession No. NP_199037.1, 32% identity, 2e 29).
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
I63
Os006819-2510 was found to interact with low temperature-induced
protein 5 (OsLIPS). OsLIP5 is a 276-amino acid protein with a cleavable
signal peptide (amino acids 1 to 27) and three putative transmembrane
regions (amino acids 48 to 64, 82 to 98, and 233 to 249). A BLAST analysis
of the amino acid sequence of this prey clone determined that it is the rice
LIP5 protein (GENBANK~ Accession No. BAA24979.1, 100% identity, 8e
052). The rice LIP5 protein is a direct submission to the public database and
is not described in the literature. In yeast, LIP5 is involved in lipoic acid
metabolism (Sulo & Martin, 1993). The BLAST analysis shows that the rice
LIPS-like protein OsLIP5 is also similar to rice WS1724 (GENBANK~
Accession No. T07613, 98% identity, 3e °~~), a protein encoded by
one of
nine cDNAs induced by short-term water stress and thought to be
responsible for acquired resistance to chilling in a chilling-sensitive
variety of
rice (Takahashi efi al., 1994). Among the proteins encoded by these cDNAs,
which were found to be differentially expressed following water stress,
expression of the WS1724 protein remained relatively fixed. A BLAST
analysis comparing the nucleotide sequence of OsLIP5 against TMRI's
GENECHIP~ Rice Genome Array sequence database identified probeset
OS000070 r at (e=4e'S) as the closest match. Gene expression
experiments indicated that this gene is down-regulated by the herbicide BL2.
Os006819-2510 was also found to interact with Oryza sativa putative
myosin (OsPN23878). A BLAST analysis of the amino acid sequence of
OsPN23878 indicated that this prey protein is the rice putative myosin
(GENBANK~ Accession No. AAL31066.1, 99% identity, e=0.0).
'OsPN23878 is also similar to Myosin VIII, ZMM3 - maize (fragment) from Z.
mays (GENBANK~ Accession No. A59311, 89% identity, e=0.0). Myosins
are discussed in Example I. Based on current knowledge of plant myosins,
the myosin VIII prey protein OsPN23878 can be a cytoskeletal component
that participates in events relating to cytokinesis.
The prey protein OsPN23878 also interacts with hypothetical protein
003118-3674, which is similar to Lycopersicon esculentum Calmodulin
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
164
(Os003118-3674; see Table 25). Os003118-3674 is a 148-amino acid
protein with two EF-hand calcium-binding domains (amino acids 22 to 34
and 93 to 105). In agreement with the observation that Os003118-3674
includes EF-hand calcium-binding domains, a BLAST analysis of the
Genpept database indicated that this protein shares 72% identity with A.
thaliana putative calmodulin (GENBANK~ Accession ~No. NP_1764705,
e'57), although the top hit in this search is A. thaliana putative
serine/threonine kinase (GENBANK~ Accession No. NP_172695.1, 76%
identity, 7e-6°). Therefore, the possibility that this calmodulin-like
protein
possesses kinase activity is worth consideration.
A BLAST analysis comparing the nucleotide sequence of OsPN23878
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS002190_I at (e X65) as the closest match. Our gene
expression experiments indicate that this gene is not specifically induced
under a range of given conditions.
Additionally, Os006819-2510 was found to interact with OsRAB16B
(OsRAB16B), a 164-amino acid protein that has a possible cleavage site
between amino acids 51 and 52, although it does not appear to have a
cleavable signal peptide. Analysis of its amino acid sequence predicted
(2.6e-$~) this protein to be a member of a group of plant proteins called
dehydrins, which are induced in plants by water stress (see Close et al.,
1989; Robertson & Chandler, 1992; Dure et al., 1989). Dehydrins include
the basic, glycine-rich RAB (responsive to abscisic acid) proteins. In
agreement with this notion, the analysis indicated that OsRAB16B is a basic,
glycine-rich protein. A BLAST analysis against the public database revealed
that OsRAB16B is the rice DEHYDRIN RAB 16B (GENBANK~ Accession
No. ~ P22911, 100% identity, 4e 9~). The cDNA encoding this protein was
isolated by (Yamaguchi-Shinozaki et al., 1990) as one of four rice RAB
genes that are differentially expressed in rice tissues. In agreement with the
notion that OsRAB16B is a rice RAB protein, a BLAST analysis against
Myriad's proprietary database indicated that OsRAB16B shares 57% identity
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
165
with OsRAB25. While expression data for OsRAB16B are not available, the
rice RAB16B promoter contains two abscisic acid (ABA)-responsive
elements required for ABA induction (Ono et al., 1996). Among other rice
RAB proteins, the RAB16A gene has been linked to salt stress (Saijo et al.,
2001 ), and the activity of the RAB16A promoter is also induced by ABA and
by osmotic stresses in various tissues of vegetative and floral organs (Ono et
aL, supra). Another rice RAB protein, RAB21, is induced in rice embryos,
leaves, roots and callus-derived suspension cells treated with NaCI and/or
ABA (Mundy & Chua, 1988). Based on these data, it is likely that the
OsRAB16B prey protein has a role in the stress response.
Os006819-2510 was found to interact with protein PN23226
(OsPN23226).
A BLAST analysis against the public database indicated that
OsPN23226 is similar to putative glucan synthase (GENBANK~ Accession
No. NP 563743.1, 78% identity, e=0.0) and to callose synthase 1 catalytic
subunit (GENBANK~ Accession No. NP 563743.1, 78% identity, e=0.0)
from A. tfiaiiana. Callose synthase (CaIS) from higher plants is a
multisubunit membrane-associated enzyme involved in callose synthesis
(reviewed in Hong et aL, 2001). Callose is a linear 1,3-(3-glucan with some
1,6- branches and differs from cellulose, the major component of the plant
cell wall. Callose is synthesized on the forming cell plate and several other
locations in the plant, and its deposition at the cell plate precedes the
synthesis of cellulose. Callose synthesis can also be induced by wounding,
pathogen infection, and physiological stress. The activity of callose synthase
is highly regulated during plant development and can be affected by various
biotic and abiotic factors. CaIS, like cellulose synthase, is a large
transmembrane protein. Ifs structure includes a large hydrophilic loop that is
relatively conserved among the CaIS isoforms, a less conserved, long N-
terminal segment, and a short C-terminal segment, all located on the
cytoplasmic side. The central loop is thought to act as a receptacle to hold
other proteins that are essential for CaIS catalytic activity (see below); the
N-
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
I66
terminal segment can contain subdomains for interaction with proteins that
regulate 1,3-f3-glucan synfihase activity.
The cDNA encoding the callose synthase (CaIS1 ) catalytic subunit
from Arabidopsis was identified by Hong et al., supra), who demonstrated
that higher plants encode multiple forms of CaIS enzymes and that the
Arabidopsis CaIS1 is a cell plate-specific isoform. In addition, these authors
used yeast two-hybrid and in vitro experiments to show that CaIS1 interacts
with two other cell plate-specific proteins, phragmoplastin and a UDP-
glucose transferase, and suggest that it can form a large complex with these
and other proteins to facilitate callose deposition on the cell plate.
Moreover,
the plasma membrane CaIS is strictly Ca2+-dependent, and Ca2+ plays a key
role in cell plate formation and can activate the cell plate-specific CaIS1.
The prey protein OsPN23226 is likely a rice callose synthase homolog that
can function similarly to the Arabidopsis CaIS1 catalytic subunit.
In addition to the cell plate, callose is synthesized ,in a variety of
specialized tissues and in response to mechanical and physiological
stresses. Multiple CaIS isozymes are thought to be required in higher plants
to catalyze callose synthesis in different locations and in response to
different physiological and developmental signals (Hong ef al., supra).
Os006819-2510 was also found to interact with protein PN23485,
which is similar to Hordeum vulgare coproporphyrinogen III oxidase,
chloroplast precursor (OsPN23485). A BLAST analysis of the amino acid
sequence of OsPN23485 determined that this protein is similar to barley (H.
vulgare) Coproporphyrinogen III Oxidase, Chloroplast Precursor (coprogen
oxidase) (GENBANK~ Accession No. Q42840, 89.3% identity, a ~s9).
Coproporphyrinogen III oxidase (CPO) catalyzes a step in the pathway from
5-amino-levulinate to protoporphyrin IX, a common reaction in the
biosynthesis of heme in animals and chlorophyll in photosynthetic
organisms. The N-terminal sequences of plant CPOs are characteristic of
plastid transit peptides. CPO is exclusively located in the stroma of
plastids,
and in vitro transcribed and translated CPO is imported into the stroma of
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
167
pea plastids and truncated by a stromal endopeptidase (reviewed by
Ishikawa et al., 2001 ). Plant cDNA sequences encoding CPO were obtained
from soybean, tobacco and barley (Kruse et al., 1995). They found that the
plant coprogen oxidase mRNA was expressed to different extents in various
tissues, with maximum amounts in developing cells and drastically
decreased amounts in completely differentiated cells, suggesting differing
requirements for tetrapyrroles in different organs. Based on these results,
these authors propose that enzymes involved in tetrapyrrole (porphyrin)
synthesis are regulated developmentally rather than by light, and that
regulation of these enzymes guarantees a constant flux of metabolic
intermediates and help avoid photodynamic damage by accumulating
porphyrins. Inhibition of the pathway for chlorophyll synthesis causes lesion
formation such as that found in the pale green and lesion-formation
phenotype of lint plants. Ishikawa et al., supra found that a deficiency of
coproporphyrinogen III oxidase causes lesion formation in these Arabidopsis
mutants. Furthermore, based on the observation that transgenic tobacco
plants with reduced CPO activity accumulate photosensitizing tetrapyrrole
intermediates and exhibit antioxidative responses and necrotic leaf lesions,
these authors suggest that CPO inhibition causes lesion formation leading to
induction of a set of defense responses that resemble the HR observed after
pathogen attack. These lesions are the equivalent of diseases known as
porphyries in humans. If accumulated, coproporphyrin(ogen), as a
photosensitizer, induces damage through generation of reactive oxidative
species, which play a key role in the initiation of cell death and lesion
formation both in the HR and in certain lesion mimic mutants. They suggest
that in lint mutants, the generation of an oxidative burst triggered by
coproporphyrin accumulation leads to cell death.
Os006819-2510 was found to interact with protein PN29037
(OsPN29037). A BLAST analysis of the amino acid sequence of
OsPN29037 indicated that this prey protein is similar to Gamma
Hydroxybutyrate Dehydrogenase from A. thaliana (GENBANK~ Accession
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
168
No. AAK94781.1, 80.7%, identity, a ~~'). This enzyme oxidizes gamma-
hydroxybutyrate. As a minor brain metabolite directly or indirectly involved
in
scavenging oxygen-derived free radicals in animals, gamma-hydroxybutyrate
demonstrates similarities with melatonin (Cash, 1996).
Summary
Thus, the senescence-associated protein Os006819-2510 interacts
with several proteins that have possible roles in cell cycle processes. One of
these is OsPN23878, a protein annotated in the public domain as the rice
putative myosin. Myosins are cytoskeletal proteins that function as
molecular motors in ATP-dependent interactions with actin filaments in
various cellular events. Based on the similarity of the prey protein to a
class
VIII myosin and on the reported role of plant myosin VIII in maturation of the
cell plate and in organization of the actin cytoskeleton at cytokinesis, we
speculate that the myosin OsPN23878 is a cytoskeletal component that
participates in events occurring at cytokinesis in rice. The association of
the
myosin OsPN23878 with senescence-associated protein can be a step in
cell-cycle-dependent events involving cytoskeleton organization and
senescence. Specific expression of the gene encoding OsPN23878 in
panicle (our gene expression experiments) is consistent with an interaction
between this protein and Os006819-2510, and with a role for the latter in
flower senescence, as suggested for the gene encoding the daylily homolog
of this protein (Panavas et al., 1999). Localization of senescence-associated
protein to the ER suggests that some of the events in which OsPN23878
functions could be associated with plasmodesmata function.
Note that the myosin protein OsPN23878 also interacts with a novel
calmodulin-kinase-like protein Os003118-3674 (see Table 25), and that the
latter interacts with a myosin heavy chain (OsAAK98715) found to interact
with rice cyclin OsCYCOS2 and presumed to be involved in cytoskeleton
organization during mitotic events. The interactions of myosins with a
calcium-binding calmodulin-like protein are consistent with published
evidence of regulation of myosin function by calcium (Yokota et al., 1999,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
169
reviewed in Reddy, 2001 ). The possibility that Os003118-3674 possesses
kinase activity raises the probability that these interactions propagate a
cell-
cycle-related signaling event. The calmodulin-like protein Os003118-3674
thus provides a link between the senescence-associated protein and
interacting partners of this Example and the cell cycle network.
Another interactor with a possible role in cell cycle regulation is the
rice histone deacetylase OsAAK01712. This enzyme includes a
transmembrane domain and is involved in regulation of core histones
acetylation. The acetylation/deacetylation of histones, the main protein
component of chromatin, is connected to replication during the cell cycle in
plants, as is in other eukaryotes (Jasencakova et al., 2001 ). Thus, the
Os006819-2510-OsAAK01712 interaction likely participates in mitotic events
involving chromatin organization.
Another novel interactor found for senescence-associated protein is
OsPN23485, similar to coproporphyrinogen III oxidase, chloroplast
precursor, an enzyme of the pathway leading to the biosynthesis of
chlorophyll in plants. The observation that the lesion formation in the lint
mutant Arabidopsis plants is the result of loss-of-function of CPO (Ishikawa
et al., 2001 ) links the gene encoding CPO to regulation of cell death
pathways. Moreover, plant CPO enzymes are regulated developmentally
and by light (reviewed by Ishikawa et al., supra). Based on these reports,
the interaction of rice CPO (OsPN23485) with senescence-associated
protein can participate in regulation of programmed cell death in a
development-dependent manner in rice.
The senescence-associated protein Os006819-2510, which is
presumed to be a transmembrane protein based on analysis of its amino
acid sequence, interacts with the rice calreticulin OsCRTC which, like other
plant calreticulins, is likely an ER transmembrane protein. The presence of
two endoplasmic reticulum retention motifs in Os006819-2510 and of an
endoplasmic reticulum targeting sequence in OsCRTC suggests that both
proteins are localized in~~~the ER. This notion is in agreement with the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
170
possibility of an interaction between Os006819-2510 and OsCRTC in plants.
Os006819-2510 can participate in events controlled by OsCRTC within the
endoplasmic reticulum. This interaction is consistent with the suggested role
of plant CRT in anther maturation and dehiscence, which was proposed by
Nelson et al., 1997 based on the observation that maximum expression of
the Arabidopsis CRT in the anthers coincides with anther degeneration.
Moreover, Denecke et al., 1995 reported detection of another plant CRT
homolog in the nuclear envelope, in the ER, and in mitotic cells in
association with the spindle apparatus and the phragmoplast. Given the
interaction of senescence-associated protein with proteins having roles in
mitosis, it is possible that the rice CRT of this Example functions in mitotic
events. However, Nelson et al., supra, indicate possible additional roles for
plant CRT in developmental processes, including a chaperone function that
can be reconciled with CRT localization in the developing endosperm, a site
characterized by high protein synthesis rates, and in secreting nectaries,
'which are associated with heavy traffic of secretory proteins through the ER.
Note that OsCRTC also interacts with the rice soluble starch synthase
homolog OsSSS. Soluble starch synthase enzymes have been isolated
from plant endosperm cells (Cao et al., 2000). These data suggest that the
rice CRT homolog of this Example can also be found in this tissue, where it
is conceivable that it interacts with the soluble starch synthase OsSSS in a
chaperone role to promote proper folding of this profiein during protein
synthesis.
To further corroborate the notion that the rice senescence-associated
protein Os006819-2510 is a membrane-associated protein, a novel
interactor identified for this protein is a putative callose synthase
catalytic
subunit (OsPN23226), another transmembrane enzyme involved in glucan
synthesis. Plasma membrane proteins participate in a variety of interactions
with the cell wall, including synthesis and assembly of cell wall polymers
(Biochemistry and Molecular Bioloay of Plants, Buchanan, Gruissem and
Jones (eds.), John Wiley& Sons, New York, NY 2002, p. 13). The prey
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
171
protein OsPN23226 likely functions as its Arabidopsis homolog, a plasma
membrane enzyme that utilizes UDP-glucose as substrate to synthesize
callose for deposition in the cell wall. The interactions of senescence-
associated protein with the rice putative callose synthase OsPN23226 and
with the calreticulin OsCRTC, and the interaction between OsCRTC and the
soluble starch synthase OsSSS all involve membrane-associated proteins.
While there is no evidence that such interactions occur at the same time,
they can be associated with the traffic that sorts, distributes and targets
membrane proteins and other molecules between compartments of the
endomembrane system (Biochemistry and Molecular Biology of Plants,
Buchanan, Gruissem and Jones (eds.), John Wiley& Sons, New York, NY
2002, p. 14) during the different stages of the cell cycle/development and in
response to different physiological and developmental signals. Moreover, the
interactions identified in this Example link the senescence-associated bait
protein to glucan synthesis, a process that is vital to the plant normal
growth.
For example, the formation of a functional callose synthase 1 catalytic
subunit (CalS1) complex is vital to cell plate formation. Functional
characterization of the various components of the CaIS1 complex and CaIS-
associated proteins has been proposed as a means to reveal how the
activity of this enzyme is regulated during cell plate formation and to
clarify
callose synthesis and deposition in plants (Hong et al., Plant Cell 13(4): 755-
768, 2001 ). The interaction identified here between senescence-associated
protein and the novel putative callose synthase catalytic subunit
(OsPN23226) provides new insight into this process in rice.
Other interactors identified for senescence-associated protein link this
protein to the plant stress response. OsRABI6B is a member of the RAB
family of proteins known to be induced by water stress and treatment with
the plant hormone abscisic acid. ABA levels increase during seed
development in many plant species, stimulating production of seed storage
proteins and preventing premature germination; ABA is also induced by
water stress and is thought to regulate stomatal transpiration (Raven, Eivert
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
172
and Eichhorn, p. 684). Based on functional homology with other RAB
proteins and on the presence of the ABA-responsive elements in the
OsRAB16B promoter, we presume that OsRAB16B has a rote in the
response to abiotic stress in rice and that its function can be regulated by
Ca2~. Another interactor correlated with stress is low temperature-induced
protein 5 (OsLIPS), which in yeast is involved in lipoic acid metabolism.
Lipoic acid in animals has been shown to help minimize the effects of
systemic stress (Kelly, 1999) and to provide animal cells with significant
protection against the cytotoxic effects of repin, a sesquiterpene lactone
isolated from Russian knapweed (nobles et al., 1997). The high similarity
(98%) of the rice LIPS-like protein to rice WS1724, a protein encoded by a
gene induced by water stress and linked to resisfiance to chilling in rice,
points to similar roles for the OsLIPS prey protein. Gene expression
experiments indicate that the gene encoding OsLIP5 is down-regulated upon
treatment with the herbicide BL2. This finding suggests a role for OsLIPS in
the response to abiotic stress. While the specific function of the
interactions
between Os006819-2510 and the prey proteins OsRAB16B and OsLIPS is
not obvious, these interactions can participate in biological processes
related
to flower senescence and response to water stress and chilling.
In addition, the rice calreticulin OsCRTC discussed above can also
have a role in the stress response. This hypothesis is based on functional
homology with the tobacco CRT protein studied by Denecke et al., 1995 and
found to participate in protein-protein interactions in a stress-dependent
fashion.
In summary, among the interactors identified for the rice senescence-
associated protein Os006819-2510 are several membrane-associated
proteins, which supports the notion that the rice Os006819-2510 is a
transmembrane protein. Among the interactors identified are proteins
involved in cell cycle processes/mitosis and proteins with functions in the
plant stress response. Some are newly characterized rice proteins. The
interactions identified for rice senescence-associated protein with proteins
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
173
involved in cell cycle/development and in resistance to stress suggests an
overlapping of roles for the bait protein. Indeed, Os006819-2510 can
constitute a link between stress tolerance and processes for cell division in
nce.
Example 111
OsSGT1 is a 367-amino acid protein that includes a tetratricopeptide
repeat domain, two variable regions, the CS motif present in metazoan
CHORD and SGT1 proteins, and the SGS motif. In yeast, Sgt1 is required
for cell-cycle signaling. In yeast, SGT1 associates with the kinetochore
complex and the SCF-type E3 ubiquitin ligase by interacting with SlCP1.
COP9 signalosome interacts with SCF E3 ubiquitin ligases. By its
interaction with SCF complexes, SGT1 exerts its essential activity in
degrading of SIC1 and CLN1. Thus, one possible role of SGT1 could be to
target proteins for degradation by the 26S proteasome via specific SCF
complexes or the SGT1 complex can participate in the modification of
protein activity or can have a dual role for activation and degradation of the
target via ubiquitylation. A. thaliana has two SGT1 homologs. At
nonpermissive temperatures AtSGT1 a and AtSGT1 b can complement G1
and G2 arrest in temperature sensitive sgt1 yeast mutants. However,
SGT1 b interacts with RAR1 which is required for RPP5 regulated disease
resistance to downy mildew. In this scenario, target proteins involved in
disease resistance can be targeted for protein degradation by the SGT1
pathway. Barley encodes a SGT1 homolog that also interacts with barley
RAR1, which is implicated in disease resistance in barley to downy mildew.
.(Austin et al., 2002; Azevedo et al., 2002). A BLAST analysis comparing the
nucleotide sequence of OsSGT1 against TMRI's GENECHIP~ Rice
Genome Array sequence database identified probeset OS016424.1 (98%)
as the closest match. Gene expression experiments indicated that this gene
is up-regulated by the blast infection.
The rice SGT1 protein shares 74 and 75% amino acid sequence
similarity with two Ara6idopsis thaliana SGT1 homologs and 45% amino acid
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
I74
sequence similarity with Saccharomyces cerevisiae SGT1. In yeast, SGT1
is required for cell-cycle progression at the G1/S-phase and G2/M-phase
transitions. In A. thaliana, SGT1 b interacts with Rar1 and mediates disease
resistance. Thus, in plants, SGT1 likely controls processes that are
fundamental to disease resistance and development. The rice OsSGT1
protein was chosen as a bait for these interaction studies based on its
potential relevance to disease resistance and development. One bait
fragment encoding amino acid 200-368 of OsSGT1 was used in the yeast
two-hybrid screen, as described above.
Results
The OsSGT1 was found to interact with ten rice proteins. Three
interactors have been previously described, namely OsSGT1, a Ras
GTPase (gi~730510), and elicitor responsive protein (gi~11358958). The
remaining seven interactors are novel proteins with identifiable protein
domains, or are similar to other proteins. These are an L-aspartase-like
protein, an RNA binding domain protein, an auxin induced-like protein, an
archain delta COP-like protein, a fibrillin-like protein, a HSP70-like
protein,
and a proline rich protein. The elicitor responsive protein was also used as a
bait and interacted with 12 novel proteins with identifiable protein domains,
with similarity to known proteins or that are unidentifiable by sequence
similarity. These were an NAD(P) binding domain protein, a gamma
adaptin-like protein, a pectinesterase-like protein, a receptor like kinase
protein kinase like protein, a pyruvate orthophosphate dikinase like protein,
an Isp-4 like protein, a xanthine dehydrogenase like protein, a ubiquitin
specific protease like protein and 4 unknown proteins.
The interacting proteins of this Example are listed in Tables 6-8,
followed by detailed information on each protein and a discussion of the
significance of the interactions. The nucleotide and amino acid sequences
of the proteins of the Example are provided in SEQ ID NOs: 31-70 and 143-
150. Based on the biological function of SGT1, it is possible that the
interacting proteins are also involved in cell cycle/mitotic processes and/or
in
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
175
the plant resistance to stress. Likewise, the interactors with the elicitor
responsive protein can also be involved in plant resistance to stress.
Proteins that participate in cell cycle regulation in rice can be targets for
genetic manipulation or for compounds that modify their level or activity,
thereby modulating the plant cell cycle. The identification of genes encoding
these proteins can allow genetic manipulation of crops or application of
compounds to effect agronomically desirable changes in plant development
or growth. Likewise, genes that are involved in conferring plants resistance
to stress have important commercial applications, as they could be used to
facilitate the generation and yield of stress-resistant crops.
Table 6
Interacting Proteins Identified for Os006819-2510 (Hypothetical Protein
006819-2510, Similar to Hemerocallis Senescence-Related Protein 5).
The names of the clones of the proteins used as baits and found as preys
are given. Nucleotidelprotein sequence accession numbers for the proteins
of the Example (or related proteins) are shown in parentheses under the
protein name. The bait and prey coordinates (Coord) are the amino acids
encoded by the bait fragments) used in the search and by the interacting
prey clone(s), respectively. The source is the library from which each prey
clone was retrieved.
Gene Name Protein Name Bait Prey Coord
(GENBANK~ Accession No.) Coord (source)
BAIT PROTEIN
PN20285 OsSGT1 (gi~6581058)
(SEQ ID NO
144)
INTERACTORS
PN24060 L-aspartase-like protein-like200-368 176-315
(SEQ ID NO (output
: 32) trait)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
176
PN20696* Elicitor responsive protein200-368 54-144
(OsERP) (gi~11358958) (input trait)
(SEQ ID NO
146)
PN23914 RNA binding domain protein200-368 1-263 x 3
(SEQ ID NO (output trait)
: 34)
PN23221# Proline rich protein 200-368 182-366 x
2
(SEQ ID NO (output trait)
: 36)
207-344
(input trait)
134-254
(output trait)
PN20285 OsSGT1 (gi~6581058) 200-368 9-227
(SEQ ID NO (output trait)
:
144)
PN24061 Auxin induced protein-like200-368 34-236
(SEQ ID NO (output trait)
: 38)
PN24063 RAS GTPase (gi~730510) 200-368 63-202
(SEQ ID NO (output trait)
:
148)
PN23949 HSP70-like 200-368 244-418
(SEQ ID NO (outpu trait)
: 40)
PN28982 Archain delta COP-like
(SEQ ID NO
: 42)
PN29042 Fibrillin-like
(SEQ ID NO
: 44)
* Additional interactions identified for elicitor responsive protein are shown
in
Table 7
# Additional interactions identified for PN23221 are shown in Table 8
Table 7
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
177
Gene Name Protein Name Bait Coord Prey Coord
(GENBANK~ (source)
Accession No.)
BAIT PROTEIN
PN20696 Elicitor responsive
(OsERP) protein (gi~11358958)
(SEQ ID NO
146)
INTERACTORS
PN29984 Novel Protein 50-145 1-38
(SEQ ID NO : PN29984 5-41
46)
(input trait)
PN30844 Novel protein 50-145 1-64
(SEQ ID NO : PN30844 (input trait)
48)
PN30868 NAD(P) binding 50-145 167-336
(SEQ ID NO : domain protein (input trait)
50)
PN24292 Gamma adaptin-like23-120 737-918
(SEQ ID NO : (output)
52)
PN29983 Novel protein 50-145 1-131
(SEQ ID NO : PN29983 (input trait)
54)
PN30845 Pectinesterase-like50-145 1-64
(SEQ ID NO : (input trait)
56)
PN31085 Receptor-like protein23-120 378-553
(SEQ ID NO : kinase-like (output trait)
58)
PN20674 Pyruvate 50-145 64-263
(SEQ ID NO : orthophosphate 71-298
60)
dikinase-like (input trait)
PN30870 Isp-4 like 50-145 1-446
(SEQ ID NO : (input trait)
62)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
178
PN29997 Xanthine 23-120 737/918
(SEQ ID NO : dehydrogenase-like (output trait)
64)
PN30843 Ubiquitin specific50-145 164-221
(SEQ ID NO : protease-like (input trait)
66)
PN30857 Novel protein 50-145 1-148
(SEQ ID NO : PN30857 (input trait)
68)
Table 8
Gene Name Protein Name Bait Coord Prey Coord
(GENBANK~ (source)
Accession No.)
PREY PROTEIN
PN23221 Proline rich protein
(SEQ 1D NO:
36)
BAIT PROTEIN
PN20621 Shaggy kinase 120-435 175-311
(SEQ ID NO: (gi~13677093) (output trait)
150)
PN20115 Ring zinc finger 5-140 84-302
protein
(SEQ ID NO: 191-324
70)
(output trait)
Yeast Two-grid using OsSGT1 as Bait
The bait fragment encoding amino acid 200-368 of OsSGT1 was
found to interact with L-aspartase-like protein PN24060. A BLAST analysis
of the amino acid sequence of PN24060 indicated that this prey protein has
36.5% similarity to A. thaliana L-aspartase (gig 18394135). The enzyme L-
aspartate ammonia-lyase (aspartase) catalyzes the reversible deamination
of the amino acid L-aspartic acid, using a carbanion mechanism to produce
fumaric acid and ammonium ion. While the catalytic activity of this enzyme
has been known for nearly 100 years, a number of recent studies have
revealed some interesting and unexpected new properties of this reasonably
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
179
well-characterized enzyme. The non-linear kinetics that are seen under
certain conditions have been shown to be caused by the presence of a
separate regulatory site. The substrate, aspartic acid, can also play the role
of an activator, binding at this site along with a required divalent metal
ion.
So if is possible that PN24060 catalyses a reaction that pertains to protein
modification and the modification can be important for disease resistance or
cell cycling.
The bait fragment encoding amino acid 200-368 of OsSGT1 was also
found to interact with elicitor responsive protein, PN20696. A BLAST
analysis of the amino acid sequence of the prey clone PN20696 indicated
that this protein is the rice elicitor responsive protein (gi~11358958;
OsERP).
OsERP is a 144-amino acid protein that, according to GENBANK~, is
expressed by rice culture cells in the presence of the rice blast fungal
elicitor.
Thus, OsERP can have a role in disease responses in rice.
OsERP was also used as bait and found to interact with 12 other
proteins (see Table 7). These prey are described in this Example below.
An A. thaliana homologue to OsERP was identified by BLAST.
At1 g63220 shares 75% amino acid similarity with OsERP. To see if
Arabidopsis homologues of OsERP have roles in disease resistance,
Arabidopsis thaliana with T-DNA insertions in At1g63220 (line
SAIL 320_D02) was identified from a random insertion seed library. DNA
regions surrounding the insertions were sequenced and revealed that the T-
DNAs were located within exon 5 of At1g63220. Plants were backcrossed
and plants homozygous for the T-DNA insertion were identified by PCR.
Homozygous mutants and wild type plants were challenged with
Pseudomonas syringae pv. maculicola ES4326 and plants were assayed for
amount of P. syringae bacteria accumulation 3 days post inoculation
(Glazebrook et al., 1996) These experiments were repeated twice on at
least six plants. Data are reported as means and standard deviations of the
log of colony forming units per leaf cm2. By three days after inoculation, the
mutant plants accumulated more than 10 times as much bacteria as wild
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
18~
type plants (wt = 3.94 log cfu/leaf disk std. 0.57, at1g63220 = 5.34 std.
0.63). Hence, At1 g63220 contributes to disease resistance in A. thaliana. It
is possible that the At1 g63220 mutation inhibits defense responses that are
dependent upon SGT1 interactions.
In addition, the bait fragment encoding amino acid 200-368 of
OsSGT1 was found to interact with RNA-binding domain protein, PN23914.
PN23914 is a 164-amino acid protein. A BLAST analysis of the amino acid
sequence of this prey shows it has 35.9% sequence identity to tFZR1 from
Oncorhynchus mykiss (gi~2982698). TFZR1 is an orphan nuclear receptor
family member, tFZR1, which has a FTZ-F1 box. The amino acid sequences
of the zinc finger domain and the FTZ-F1 box has 92.8% and 100% identity,
respectively, with those of zebrafish FTZ-F1. On the other hand, the overall
homology between tFZR1 and zebrafish FTZ-F1 is low (33.0%). The results
indicate that tFZR1 is a new member of fushitarazu factor 1 (FTZ-F1 )
subfamily. It is possible that PN23914 shares functionality through the zing
finger domain.
In addition, bait fragment encoding amino acid 200-368 of OsSGTI
was found to interact with proline rich protein, PN23221. A BLAST analysis
of the amino acid sequence of PN23221 indicated that this prey protein is
40.3% similar to a rice repetitive proline rich protein (gi~18478606). Proline
rich proteins can mediate interaction among proteins (Zhao et al., 2001 ).
Note that proline rich protein PN23221 also interacts with shaggy kinase
PN20621 and ring zinc finger protein-like PN20115 (see Table 28). Thus,
the proline rich protein PN23221 can serve to bring these proteins together
with OsSGT1.
The bait fragment encoding amino acid 200-368 of OsSGTI was also
found to interact with OsSGT1. In other words, OsSGT1 interacts with itself.
Although the bait for OsSGT1 included amino acids 200-368, the prey
included amino acids 9-227. Although OsSGTI can be a self regulator
through aggregation, these bait and prey domains can reflect natural protein
folding of a single native OsSGT1 protein. .
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
181
Additionally, the bait fragment encoding amino acid 200-368 of
OsSGT1 was found to interact with an auxin-induced protein like protein,
PN24061. A BLAST analysis against the public database indicated that
PN24061 is 63.5% similar to a rice putative IAA1 profiein (gi~17154533).
Indole acetic acid is a plant growth hormone and is classified as an auxin.
IAA is associated with a variety of physiological processes, including apical
dominance, tropisms, shoot elongation, induction of cambial cell division and
root initiation. Thus, genes that are induced by IAA likely produce proteins
that are responding developmental changes. This associated goes hand in
hand with regulation of cell division by interaction with SGT1.
The bait fragment encoding amino acid 200-368 of OsSGT1 was also
found to interact with Ras GTPase, PN24063. A BLAST analysis of the
amino acid sequence of PN24063 determined that this protein is ras-related
GTP binding protein possessing GTPase activity (gi~730510). This protein
has four conserved regions involved in GTP binding and hydrolysis which
are characteristic in the ras and ras-related small GTP-binding protein
genes. In addition, two consecutive cysteine residues near the carboxyi-
terminal end required for membrane anchoring are also present. This protein
synthesized in Escherichia coli possessed GTPase activity (i.e., hydrolysis of
GTP to GDP; Kidou et al., 1993). Ras GTPases are likely involved in
signaling processes for development. ORFX from tomato that is expressed
early in floral development, controls carpet cell number, and has a sequence
suggesting structural similarity to the human oncogene c-H-ras p21 (fw2.2: a
quantitative trait locus key to the evolution of tomato fruit size. (Frary et
al.,
2000). The Rho family of GTPases are also involved in control of cell
morphology, and are also thought to mediate signals from cell membrane
receptors (Winge et al., 1997).
An A. thaliana homologue to PN24063 was identified by BLAST.
At1 g02130 shares 90% amino acid similarity with PN24063. To see if
Arabidopsis homologues of PN24063 have roles in disease resistance
Arabidopsis thaliana with T-DNA insertions in At1g02130 (line
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
182
SAIL~680_D03) was identified from a random insertion seed library. DNA
regions surrounding the insertions were sequenced and revealed that the T-
DNAs were located within the promoter of At1g02130. Plants were
backcrossed and plants homozygous for the T-DNA insertion were identified
by PCR. Homozygous mutants and wild type plants were challenged with
Pseudomonas syringae pv. maculicola ES4326 and plants were assayed for
amount of P. syringae bacteria accumulation 3 days post inoculation
(Glazebrook et al., supra). These experiments were repeated twice on at
least six plants. Data are reported as means and standard deviations of the
log of colony forming units per leaf cm2. By three days after inoculation, the
mutant plants accumulated more than 10 times as much bacteria as wild
type plants (wt = 3.93 log cfu/leaf disk std. 0.57, at1g02130 = 5.22 std.
0.9).
Hence, At1g02130 contributes to disease resistance in A. thaliana. It is
possible that the At1 g02130 mutation inhibits defense responses that are
dependent upon SGT1 interactions.
The bait fragment encoding amino acid 200-368 of OsSGT1 was
found to interact with Archain delta COP, PN28982. A BLAST analysis of the
amino acid sequence of PN28982 indicated that this prey protein is 92%
similar to rice archain delta COP (gi~2506139). Cytosolic coat proteins that
bind reversibly to membranes have a central function in membrane transport
within the secretory pathway. One well-studied example is COPI or
coatomer, a heptameric protein complex that is recruited to membranes by
the GTP-binding protein Arf1. Assembly into an electron-dense coat then
helps in budding off membrane to be transported between the endoplasmic
reticulum (ER) and Golgi apparatus. Activated Arf1 brings coatomer to
membranes. However, once associated with membranes, An'1 and
coatomer have different residence times: coatomer remains on membranes
after Arf1-GTP has been hydrolysed and dissociated. Rapid membrane
binding and dissociation of coatomer and Arf1 occur stochastically, even
without vesicle budding. This continuous activity of coatomer and Arf1
generates kinetically stable membrane domains that are connected to the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
1~3
formation of COPI-containing transport intermediates. This rote for
Arf1lcoatomer might provide a model for investigating the behaviour of other
coat protein systems within cells. (Presley et al., 2002). It is possible that
this delta COP interacts with the OsSGT1 and a Ras GTPase to coordinate
membrane transport for proteolytically processed proteins.
An A. thaliana homologue to PN28982 was identified by BLAST.
At5g05010 shares 77°l° amino acid similarity with PN28982.
To see if
Arabidopsis homologues of PN28982 have roles in disease resistance
Arabidopsis thaliana with T-DNA insertions in Af5g05010 (line
SAIL 84 C10) was identified from a random insertion seed library. DNA
regions surrounding the insertions were sequenced and revealed that the T-
DNAs were located within the promoter of At5g05010. Plants were
backcrossed and plants homozygous for the T-DNA insertion were identified
by PCR. Homozygous mutants and wild type plants were challenged with
Pseudomonas syringae pv. maculicola ES4326 and plants were assayed for
amount of P. syringae bacteria accumulation 3 days post inoculation
(Glazebrook et al., supra). These experiments were repeated twice on at
least six plants. Data are reported as means and standard deviations of the
log of colony forming units per leaf cm2. By three days after inoculation, the
mutant plants accumulated more than 10 times as much bacteria as wild
type plants (wt = 3.93 log cfu/leaf disk std. 0.57, at5g05010= 5.24 std.
0.52).
Hence, At5g05010 contributes to disease resistance in A, thaliana. It is
possible that the At5g05010 mutation inhibits defense responses that are
dependent upon SGT1 interactions.
The bait fragment encoding amino acid 200-368 of OsSGTI was
found to interact with fibrillin-like protein, PN29042. A BLAST analysis of
the
amino acid sequence of OsPN29037 indicated that this prey protein is 75%
similar to the potato fibrillin homolog CDSP34 precursor from chloroplasts
(gi~7489242). Plastid lipid-associated proteins, also termed fibrillin/CDSP34
proteins, are known to accumulate in fibrillar-type chromoplasts such as
those of ripening pepper fruit, and in leaf chioroplasts from Solanaceae
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
184
plants under abiotic stress conditions. Further, substantially increased
levels
of fibrillin/ CDSP34 proteins are shown in various dicotyledonous and
monocotyledonous plants in response to water deficit. (Langenkamper et al.,
2001 ) In water-stressed tomato plants, similar increases in the CDSP 34-
related transcript amount were noticed in wild-type and ABA-deficient flacca
mutant, but protein accumulation was observed only in wild-type, suggesting
a posttranscriptional role of ABA in CDSP 34 synthesis regulation.
Substantial increases in CDSP 34 transcript and protein abundances were
also observed in potato plants subjected to high illumination. The CDSP 34
protein is proposed to play a structural role in stabilizing stromal lamellae
thylakoids upon osmotic or oxidative stress. (Gillet et al., 1998).
A BLAST analysis comparing the nucleotide sequence of PN29042
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS011738 (100%) as the closest match. Gene
expression experiments indicated that this gene is up-regulated by ABA
treatment.
An A. thaliana homologue to PN29042 was identified by BLAST.
At4g22240 shares 79% amino acid similarity with PN29042. To see if
Arabidopsis homologues of PN29042 have roles in disease resistance
Arabidopsis thaliana with T-DNA insertions in At4g22240 (line
SAIL 691 B11) was identified from a random insertion seed library. DNA
regions surrounding the insertions were sequenced and revealed that the T-
DNAs were located within exon 1 of At4g22240. Plants were backcrossed
and plants homozygous for the T-DNA insertion were identified by PCR.
Homozygous mutants and wild type plants were challenged with
Pseudomonas syringae pv. maculicola ES4326 and plants were assayed for
amount of P. syringae bacteria accumulation 3 days post inoculation
(Glazebrook et al., supra). These experiments were repeated twice on at
least six plants. Data are reported as~ means and standard deviations of the
log of colony forming units per leaf cm2. By three days after inoculation, the
mutant plants accumulated more than 10 times as much bacteria as wild
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
185
type plants (wt = 3.93 log cfu/leaf disk std. 0.57, at4g22240= 5.21 std.
0.43).
Hence, At4g22240 contributes to disease resistance in A. thaliana. It is
possible that the At4g22240 mutation inhibits defense responses that are
dependent upon SGT1 interactions.
Additionally, the bait fragment encoding amino acid 200-368 of
OsSGT1 was found to interact with HSP70-like protein, PN23949. A BLAST
analysis of the amino acid sequence of OsPN3949 indicated that this prey
protein is 71 % similar to the cucumber 70K heat shock protein found in
chloroplasts (gi~7441856). Heat shock proteins (reviewed in Bierkens ef al.,
2000) are stress proteins that function as intracellular chaperones to
facilitate protein folding/unfolding and assembly/disassembly. They are
selectively expressed in plant cells in response to a range of stimuli,
including heat and a variety of chemicals. As regulators, HSP proteins are
thus part of the plant protective stress response. A BLAST analysis
comparing the nucleotide sequence of PN23949 against TMRI's
GENECHIP~ Rice Genome Array sequence database identified probeset
OS015016 (97%) as the closest match. Gene expression experiments
indicated that this gene is down-regulated by herbicide and JA treatment.
Yeast Two-Hybrid Using OsERP (PN20696) as Bait
Next, one of the proteins found to interact with OsSGT1, namely the
elicitor responsive protein PN20696 (gi~11358958; OsERP), was used as a
bait. As shown in Table 27, the rice elicitor responsive protein PN20696
(gi~11358958; OsERP) was found to interact with a receptor-like protein
kinase like protein, PN31085. A BLAST analysis of the amino acid
sequence of OsPN31085 indicated that this prey protein is 48% similar to a
rice receptor like protein kinase (gi~7434420). The receptor protein kinases
include a large group of proteins and most contain a cytoplasmic protein
kinase catalytic domain, a transmembrane region, and and/or an
extracellular domain consisting of leucine-rich repeats, which are thought to
interact with other macromolecules. Cell to cell communication is likely
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
1~6
mediated by receptor kinases which have important roles in plant
morphogenesis.
OsERP was also found to interact with pyruvate orthophosphate
dikinase, PN20674. A BLAST analysis of the amino acid sequence of
PN20674 indicates that this prey protein is 97% similar to rice pyruvate
orthophosphate dikinase (gi~743444). Pyruvate orthophosphate dikinase
(PPDK) is known for its role in C4 photosynthesis but has no established
function in C3 plants. Abscisic acid, PEG and submergence were found to
markedly induce a protein of about 97 kDa, identified by microsequencing as
PPDK, in rice roots (C3). One rice PPDK is ABA-induced protein from roots.
Western blot analysis showed a PPDK induction in roots of rice seedlings
during gradual drying, cold, high salt and mannitol treatment, indicating a
water deficit response. PPDK was also induced in the roots and sheath of
submerged rice seedlings, and in etiolated rice seedlings exposed to an
oxygen-free N2 atmosphere, which indicated a low-oxygen stress response.
None of the stress treatments induced PPDK protein accumulation in the
lamina of green rice seedlings. Ppdk transcripts were found to accumulate in
roots of submerged seedlings, concomitant with the induction of alcohol
dehydrogenase 1. Low-oxygen stress triggered an increase in PPDK activity
in roots and etiolated rice seedlings, accompanied by increases in
phosphoenolpyruvate carboxylase and malate dehydrogenase activities. The
results indicate that cytosolic PPDK is involved in a metabolic response to
water deficit and low-oxygen stress in rice, an anoxia-tolerant species
(Moons et al., 1998).
Additionally, OsERP was found to interact with gamma adaptin,
PN24292.
A BLAST analysis of the amino acid sequence of PN24292 indicated that
this prey protein is 97% similar to the Arabidopsis gamma adaptin
(gi~5091510). Eukaryotic vesicular transport requires the recognition of
membranes through specific protein complexes. The heterotetrameric
adaptor protein complexes 1, 2, and 3 (AP1/2/3) are composed of two large,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
187
one small, and one medium adaptin subunit. Large subunits of AP112/3 are
homologous and two subunits of the heptameric coatomer I (COPI) complex
belong to this gene family. In addition, all small subunits and the
aminoterminal domain of the medium subunits of the heterotetramers are
homologous to each other; this also holds for two corresponding subunits of
the COPI complex. AP1/2l3 and a substructure (heterotetrameric, F-COPI
subcomplex) of the heptameric COPI have a common ancestral complex
(called pre-F-COPI). Since all large and all small/medium subunits share
sequence similarity, the ancestor of this complex is inferred to have been a
heterodimer composed of one large and one small subunit. (Schledzewski et
al., 1999). An archain delta COP interacts with OsSGT1 which interacts with
the Gamma adaptin bait ERP.
OsERP was also found to interact with xanthine dehydrogenase,
PN29997. A BLAST analysis of the amino acid sequence of PN29997
indicated that this prey protein is 66°lo similar to the Arabidopsis
xanthine
dehydrogenase (gi~15236216). Xanthine dehydrogenase is the enzyme
responsible for xanthine degradation. Xanthine dehydrogenase is involved
in purine catabolism and stress reactions. A BLAST analysis comparing the
nucleotide sequence of PN29997 ~ against TMRI's GENECHIP~ Rice
Genome Array sequence database identified probeset OS013724 (100%) as
the closest match. Gene expression experiments indicated that this gene is
expressed in seeds.
OsERP was also found to interact with ubiquitin specific protease,
PN30843. A BLAST analysis of the amino acid sequence of PN30843
indicated that this prey protein is 40°!° similar to an
Arabidopsis ubiquitin
specific protease (gi~11993486). The ubiquitin/26S proteasome pathway is a
major route for selectively degrading cytoplasmic and nuclear proteins in
eukaryotes. In this pathway, chains of ubiquitins become attached to short-
lived proteins, signaling recognition and breakdown of the modified protein
by the 26S proteasome. During or following target degradation, the attached
multi-ubiquitin chains are released and subsequently disassembled by
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
188
ubiquitin-specific proteases (UBPs) to regenerate free ubiquitin monomers
for re-use. T-DNA insertion mutations in an Arabidopsis ubiquitin protease
cause an embryonic lethal phenotype, with the homozygous embryos
arresting at the globular stage. The arrested seeds have substantially
increased levels of multi-ubiquitin chains, indicative of a defect in
ubiquitin
recycling. Thus, there is essential role for the ubiquitin/26S proteasome
pathway in general and for AtUBP14 in particular during early plant
development (Doelling et al., Plant J. 27(5): 393-405, 2001 ). SGT1 also
interacts with components of the ubiquitin/26S proteasome pathway and the
ERP that interacts with this ubiquitin specific protease interacts with OsSGT.
This protease can be have roles in disease resistance as well as
development.
OsERP was also found to interact with pectinesterase, PN30845. A
BLAST analysis of the amino acid sequence of PN30845 indicated that this
prey protein is 71% similar to a rice pectinesterase (gi~15528783).
Pectinesterases catalyse the esterification of cell wall polygalacturonans. In
dicot plants, these ubiquitous cell wall enzymes are involved in important
developmental processes including cellular adhesion and stem elongation.
A BLAST analysis comparing the nucleotide sequence of PN30845 against
TMRI's GENECHIP~ Rice Genome Array sequence database identified
probeset OS007057 (99%) as the closest match. Gene expression
experiments indicated that this gene is up-regulated as a result of JA
treatment, high saline growth conditions and herbicide treatment.
OsERP was also found to interact with several proteins, namely
PN30870, PN29984, PN30844, PN29983, PN30868 and PN30857. A
BLAST analysis of the amino acid sequence of PN30870, PN29984,
PN30844, PN29983, PN30868 and PN30857 indicates that these prey
proteins have no sufficient homology to any other characterized proteins.
However, based on association with the rice elicitor responsive protein
PN20696, these proteins can have roles in disease resistance or cell cycling.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
189
A BLAST analysis comparing the nucleotide sequence of PN30857
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS008661.1 (99%) as the closest match. Gene
expression experiments indicated that this gene is up-regulated as a result of
blast infection.
An A. thaliana homologue to PN29983 was identified by BLAST.
At2g36950 shares 52% amino acid similarity with PN29983. To see if
Arabidopsis homologues of PN29983 have roles in disease resistance,
Arabidopsis thaliana with T-DNA insertions in At2g36950 (line
SAIL 779_E11 ) was identified from a random insertion seed library. DNA
regions surrounding the insertions were sequenced and revealed that the T-
DNAs were located within exon 3 of At2g36950. Plants were backcrossed
and plants homozygous for the T-DNA insertion were identified by PCR.
Homozygous mutants and wild type plants were challenged with
Pseudomonas syringae pv. maculicola ES4326 and plants were assayed for
amount of P. syringae bacteria accumulation 3 days post inoculation
(Glazebrook et al., supra). These experiments were repeated twice on at
least six plants. Data are reported as means and standard deviations of the
log of colony forming units per leaf cm2. By three days after inoculation, the
mutant plants accumulated more than 10 times as much bacteria as wild
type plants (wt = 3.94 log cfu/leaf disk std. 0.57, at2g36950 = 5.95 std.
0.72).
Hence, At2g36950 contributes to disease resistance in A. thaliana. It is
possible that the At2g36950 mutation inhibits defense responses that are
dependent upon ERP/SGT1 interactions.
It should be noted that the all of the following bait proteins, namely
OsSGT, ring zinc finger, PN20115, and shaggy kinase, PN20621, identified
proline rich protein, PN23221, as their prey. OsSGT and PN23221 have
been described earlier in this Example.
A BLAST analysis of the amino acid sequence of ring zinc finger
PN20115 indicated that this bait protein is 65% similar to A. thaliana ring
zinc
finger protein At1g63170. The RING domain is a conserved zinc finger motif,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
190
which serves as a protein-protein interaction interface. This protein can
interact with other proteins to control developmental or stress tolerance
processes. A BLAST analysis comparing the nucleotide sequence of
PN20115 against TMRI's GENECHIP~ Rice Genome Array sequence
database identified probeset OS015830 (90%) as the closest match. Gene
expression experiments indicated that this gene is up-regulated as a result of
conditions of drought.
A BLAST analysis of the amino acid sequence of shaggy kinase
PN20621 indicated , that this bait protein is the rice shaggy kinase
(gi~131677093). GSK3/SHAGGY is a highly conserved serine/threonine
kinase implicated in many signaling pathways in eukaryotes. Many
GSK3/SHAGGY-like kinases have been identified in plants. The Arabidopsis
BRASSINOSTEROID-INSENSITIVE 2 (BIN2) gene encodes a
GSK3/SHAGGY-like kinase. Gain-of-function mutations within its coding
sequence or its overexpression inhibit brassinosteroid (BR) signaling,
resulting in plants that resemble BR-deficient and BR-response mutants. In
contrast, reduced BIN2 expression via cosuppression partially rescues a
weak BR-signaling mutation. Thus, BIN2 acts as a negative regulator to
control steroid signaling in plants (Li and Nam, Scienee 295(5558): 1299
1301, 2002).
Summary
As one of the major human staples, rice has been a target of genetic
engineering for higher yields_ and resistance to diseases, pests, and
environmental stresses of various kinds. The proteins identified in the
present Example have presumed roles in cell cycle processes and/or the
stress response. Knowledge of the proteins and molecular interactions
associated with cell cycle processes and stress response in rice could lead
to important applications in agriculture. Modulation of these interactions can
be exploited to effect changes in plant development or growth that would
result in increased crop yield and tolerance to environmental stress
conditions.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
191
Plant disease response often mimics certain normal developmental
processes. ror example, plants responses to tungal gibberellic acid and
fusicoccin toxin are similar to responses to plant-produced gibberellin and
auxin, respectively (Hedden and Kamiya, Annual Rev. Plant Physiol. Plant
Mol. Biol. 48: 431, 1977; Baunsgaard et al., Plant J. 13: 661, 1998). The
same can be said for abiotic stress responses and certain stages of plant
development. Leaf cells undergoing dehydration stress express some of the
same genes that embryonic cells express during development or seed
desiccation (Medina et al., Plant Physiol. 125: 1655, 2001 ). Since systematic
regulation of gene expression drives developmental processes and stress
responses (Chen et aL, Plant Cell 74: 559, 2002) it is likely that there is a
broader overlapping set of genes and their cognate proteins involved in such
responses. This Example describes one such overlapping set of genes.
The results described in this Example are useful for predicting gene
function in rice or other plants. For example, rice has a homolog (OsSGT1;
gb~AAF18438) to the barley SGT1 and A. thaliana SGT1 b proteins that
participate in pathogen defense through interactions with resistance gene
and ubiquitinylation protein degradation pathways. OsSGT1 is inducible by
blast infection and likely participates in pathogen defense. OsSGT1
interacted with several undefined and known proteins, including one whose
transcript is induced upon treatment with a rice blast fungal elicitor
(gb~AF090698). The elicitor-responsive protein (OsERP) interacted with
ofiher undefined proteins and an ubiquitin protease-related protein, which
implicates OsERP in SGT1 mediated protein degradation. These rice
proteins, as well as other plant homologs, are suspected to have associated
roles in disease resistance.
A. thaliana proteins homologous to OsERP (PN20696), Ras GTPase
(PN24063), Archain delta COP-like (28982), fibrillin-like (PN29042) and to
one of the undefined proteins that interacted with OsERP (PN29983) have
also been identified. A.thaliana homozygous for insertion mutations in the
cognate genes were challenged with Pseudomonas syringae. By three days
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
192
after inoculation, the mutant plants accumulated more than 10 times as
many bacteria as wild type plants. Hence, these Arabidopsis homologs
contribute to disease resistance in A. thaliana. It is possible that these
mutations inhibit defense responses that are dependent upon SGT1
interactions. Based upon homology and the interaction map, the rice
homologs from which are associated the Arabidopsis genes can also
involved in disease resistance and other processes utilizing SGT1 as a
factor. These results demonstrate that the combined datasets can be used
to predict gene functions that can be verified using phenotypes of mutants.
Example IV
This Example describes the identification and characterization of rice
proteins that interact at the cell wall in response to biotic stress. As has
been described above, an automated, high-throughput yeast two-hybrid
assay technology was used to identify proteins interacting with rice
chitinase,
class III, and with ceilufose synthase catalytic subunit. The sequences
encoding the protein fragments used in the search were then compared by
BLAST analysis against proprietary and public databases to determine the
sequences of the full-length genes. The proteins found appear to be
localized or targeted to the cell wall and to participate in the plant
pathogen-
induced defense response. The identification and characterization of
proteins participating in pathways and biochemical reactions associated with
defense against pathogens in rice can allow the development of genetically
modified crops with enhanced or reduced disease resistance.
Chitinases are glycohydrolases that degrade chitin, a structural
component of insects and plant pathogens such as nematodes, fungi, and
bacteria. These enzymes are involved in multiple biological functions that
include defense against chitin-containing pathogens, with class III chitinases
having a substrate specificity for bacterial cell walls (Brunner et al., Plant
J.
14(2): 225-34, 1998). Chitinase was chosen as a bait for these interaction
studies based on its relevance to TMRI's plant health programs. The high
potential for specific enzyme-substrate interactions makes these proteins
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
193
suitable for two-hybrid assays. The identification of rice genes encoding
proteins involved in the plant response to pathogens are important to
agriculture, as their discovery can allow genetic manipulation of crops to
obtain plants with enhanced or reduced disease resistance.
The second bait used in this Example, namely cellulose synthase
catalytic subunit, is part of a membrane-bound enzyme complex involved in
the synthesis of cellulose, an essential component of the cell wall of higher
plants whose production is central to morphogenesis and many other
biological processes in plants (reviewed in Perrin R.M., Curr. Biol. 11(6):
8213-8216, 2001 ).
This example provides newly characterized rice proteins interacting
with a rice chitinase, class III (OsCHIB1), and with rice cellulose synthase
catalytic subunit, RSW1-like (OsCS). An automated, high-throughput yeast
two-hybrid assay technology (provided by Myriad Genetics Inc., Salt Lake
City, UT) was used to search for protein interactions with the chitinase and
cellulose synthase bait proteins.
Results
Chitinase, class III, was found to interact with rice catalase A, an
antioxidant enzyme that is part of the plant's detoxification mechanism
against molecules induced in response to environmental stresses. A second
interactor, cellulose synthase catalytic subunit, is an enzyme involved in
cellulose biosynthesis and is the second bait protein of this Example. The
search also identified four novel rice proteins interacting with chitinase: a
protein similar to plant ABC transporter proteins, which play an important
role in defense responses by eliminating toxins from tissues; a peptidase
similar to Arabidopsis thaliana glutamyl aminopeptidase, whose proteolitic
activity can be associated with activation of signaling molecules during the
response of the plant to pathogens; a protein similar to a putative ATPase
from A. thaliana, and one unknown protein, similar to a putative protein from
A. thaliana.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
194
The cellulose synthase catalytic subunit bait clone was found to
interact with itself and with twelve proteins. These include three known rice
proteins: the DNAJ homologue, a type of molecule known to participate in
the plant protective stress response as a regulator of heat shock proteins,
and two proteins that function as membrane-spanning pumps: the product
of the salT gene, which is induced by salt and stress, and the channel
protein aquaporin. Nine interactors are novel proteins: a DNA-damage
inducible-like protein with a putative role in the plant defense mechanism
against nucleic acid damage; a putative BAG protein which presumably
participates in the plant stress response by regulating heat shock proteins; a
protein similar to the riboflavin precursor 6,7-dimethyl-8-ribityllumazine
synthase precursor from A. thaliana and possibly involved in biosynthesis of
riboflavin during oxidative stress; a protein similar to soybean calcium-
dependent protein kinase and one similar to A. thaliana putative zinc finger
protein, with likely roles as mediators of molecular signaling or
transcription
following damage to the cell wall; and four proteins of unknown function.
The interacting proteins of the Example are fisted in Table 9 and
Table 10 below, followed by detailed information on each protein and a
discussion of the significance of the interactions. A diagram of the
interactions is provided in Figure 2. The nucleotide and amino acid
sequences of the proteins of the Example are provided in SEQ ID NOs: 71-
96 and 151-162.
Some of the proteins identified represent rice proteins previously
uncharacterized. These proteins appear to participate in the plant defense
mechanism against pathogens. Based on their presumed biological function
and on their ability to specifically interact with the chitinase and cellulose
synthase bait proteins, the interacting proteins can be localized or targeted
to the cell wall, where they are involved in biochemical reactions and gene
induction associated with local or systemic defense against pathogens.
Table 9
(nteractina Proteins Identified for OsCHIB1 (Chitinase, Class 1(I).
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
195
The names of the clones of the proteins used as baits and found as preys
are given. Nucleotide/protein sequence accession numbers for the proteins
of the Example (or related proteins) are shown in parentheses under the
protein name. The bait and prey coordinates (Coord) are the amino acids
encoded by the bait fragments) used in the search and by the interacting
prey clone(s), respectively. The source is the library from which each prey
clone was retrieved.
Gene Name Protein Name Bait Prey Coord
(GENBANK~ Accession Coord (Source)
No.)
BAIT PROTEIN
OsCHIB1 O. sativa Chitinase,
Class III
PN19651 (AF296279; AAG02504)
(SEQ ID NO: 152)
INTERACTORS
OsCATA O. sativa Catalase 10-200 332-433
A
PN20899 Isozyme (input trait)
(SEQ ID NO: 154)(D29966; BAA06232)
OsCS* O. sativa Cellulose 10-200 411-489
PN19707 Synthase Catalytic (input trait)
Subunit,
(SEQ ID NO: 156)RSW1-Like
(AF030052; AAC39333)
OsPN22823 Novel Protein PN22823,10-200 25-106
(SEQ ID NO: 72) Similar to ABC Transporter (input trait)
Proteins
(T02187, AB043999.1,
NP~171753; e=0)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
196
OsPN22154 Novel Protein PN22154, 10-200 390-562
(SEQ ID NO: 74) Similar to A. thaliana (input trait)
,
Glutamyl Aminopeptidase
(AL035525; e=0)
OsPN29041 Novel Protein PN29041, 10-200 2x 5-108
(SEQ ID NO: 76) Fragment, Similar to (input trait)
A.
thaliana Putative ATPase
(AAG52137; e-~~)
OsPN22020 Novel Protein PN22020, 10-200 3x 76-170
(FL_R01 P005 Fragment, Similar to 128-170
C09. A.
g.1a.Sp6a) thaliana Putative Protein (input trait)
(SEQ ID NO: 78) (NP_197783; 3e 3a.)
" The cellulose synthase catalytic subunit was also used as a bait; its
interactions are shown in Table 10.
Table 10
InteractindProteins Identified for OsCS
Cellulose Synthase Catalytic Subunit, RSW1-Like)
Gene Name Protein Name Bait Prey Coord
(GENBANK~ Accession No.) Coord (Source)
BAIT PROTEIN
OsCS O. sativa Cellulose Synthase
PN19707 Catalytic Subunit, RSW1-Like
(SEQ ID NO: (AF030052; AAC39333)
156)
INTERACTORS
OsCS O. sativa Cellulose Synthase316-583 316-582
PN19707 Catalytic Subunit,~ RSW1-Like (input
trait)
(SEQ ID NO: (AF030052; AAC39333)
156)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
197
OsAAB53810 O. sativa salT Gene Product 316-583 6-145
PN29086 (AF001395; AAB53810.1 ) (output trait)
(SEQ ID NO:
158)
OsPIP2A O. sativa Aquaporin 316-583 123-290
PN29098 (AF062393) (output trait)
(SEQ ID NO:
160)
OsPN22825 Novel Protein PN22825, Fragment316-583 5-129
(SEQ ID NO: (input trait)
80)
OsPN29076 Novel Protein PN29076, Fragment316-583 1-187
(SEQ ID NO: 43-388
82) 122-304
(output trait)
OsPN29077 Novel Protein PN29077, Fragment,316-583 4x 1-242
(SEQ ID NO: Similar to A. thaliana DNA-Damage (output trait)
84) Inducible Protein DD11-Like
(BAB02792; 5e-9)
OsPN29084 Novel Protein PN29084, Fragment,316-583 3x 1-253
(SEQ iD NO: Similar to Soybean (Glycine (output trait)
max)
86) Calcium-Dependent Protein
Kinase
(A43713, 2e 79)
OsPN29113 O. sativa DNAJ Homologue 316-583 1-92
(SEQ ID NO: (BAB70509.1 ) ~ (output trait)
162)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
198
OsPN29115 Novel Protein PN29115, Fragment,316-583 1-188
(SEQ ID NO: Similar to A. thaliana 6,7-Dimethyl- (output trait)
88) 8-Ribityllumazine Synthase
Precursor
(AAK93590, 6e 3')
OsPN29116 Novel Protein PN29116, Fragment316-583 1-169
(SEQ ID NO: (output trait)
90)
OsPN29117 Novel Protein PN29117 316-583 -7-151
(FL-R01~P07 (output trait)
8 N 11.fasta.c
ontig1 )*
(SEQ ID NO:
92)
OsPN29118 Novel Protein PN29118, Fragment316-583 1-136
(SEQ ID NO: (output trait)
94)
OsPN29119 Novel Protein PN29119, Fragment316-583 -53, to 155
(FL-R01_P08 (output trait)
4-P01.g.1
a.S
p6a)
(SEQ ID NO:
96)
* OsPN29117 also interacts with heat shock protein hsp70 (OsHSP70,
PN20775): three prey clones of OsPN29117 (one encoding amino acids 11-
160, two encoding amino acids 29-160) from the output trait library
interacted with a clone (amino acids 138-360) of OsHSP70 used as bait.
Yeast Two-Hybrid Usina OsCHIB1 (Chitinase, Class III as Bait
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
199
The rice class III chitinase (GENBANK~ Accession No. AF296279) is
a 286-amino acid protein. Chitinases are glycohydrolases that degrade
chitin. Chitin is a structural component ,of insects, nematodes, fungi, and
bacteria. Chitinases are one of the several kinds of pathogenesis-related
(PR) proteins induced in higher plants in response to infection by pathogens
(reviewed in Stintzi et al., Biochimie. 75(8): 687-706, 1993). While
chitinases
perform multiple biological functions, the class lil chitinases' substrate
specificity for bacterial cell walls suggests a main role for these enzymes as
defense proteins (Brunner et al., supra). The enzyme directly attacks the
pathogen by degrading the fungal or bacterial cell wall.
The bait fragment used in this search encodes amino acids 10 to 200
of OsCHIB1 (Chitinase, Class III). This region of the protein includes the
active site of the enzyme (amino acids 127 to 135). There is no match for
the gene encoding OsCHIB1 on TMRI's GENECHIP~ Rice Genome Array.
OsCHIBI (Chitinase, Class ill) was found to interact with OsCATA
(PN20899; O. sativa Catalase A Isozyme (D29966; BAA06232)). Catalase A
(GENBANK~ Accession No. D29966) is the product of the rice CatA gene,
which was identified by Higo and Higo, Plant Mol. Biol. 30(3): 505-521, 1996
as the homologue of the Cat-3 gene from Indian corn (Zea mays;
GENBANK~ Accession No. L05934). Both rice CatA and Z. mays Cat-3
genes belong to the monocot-specific group, one of three groups into which
plant catalase genes have been classified based on their molecular
evolution from a common ancestor (Guan and Scandalios, J. Mol. Evol.
42(5): 570-579, 1996). Rice catalase A contains 491 amino acids with two
catalytic sites in position H65 and N138, and a heme binding-site in position
Y348. The heme group is a cofactor for catalases' enzymatic activity. Higo
and Higo, supra, showed that the CatA gene is expressed at high levels in
seeds during early development and also in young seedlings, and that this
gene is induced by the herbicide paraquat, but not or only slightly by
abscisic
acid (ABA), wounding, salicylic acid, and hydrogen peroxide.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
200
Catalases are stress-induced enzymes found in almost all aerobic
organisms. They are part of the enzymatic detoxification mechanism against
active oxygen species (AOS) in plant cells. AOS are induced in response to
environmental stress and act as signaling molecules to activate multiple
defense responses through induction of PR genes and of other signaling
molecules (e.g., salicylic acid, SA), leading to increased stress tolerance
(Lamb and Dixon, Ann. Rev. Plant Biol. 48 (1): 251, 1997). AOS, however,
can also damage proteins, membrane lipids, DNA and other cellular
components of the plant. The balance between these two diverging effects
depends on the tight control of cellular levels of AOS, which is achieved
through a diverse battery of oxidant scavengers. Among these antioxidant
molecules, catalases protect plant cells from the toxic effects of the AOS
precursor hydrogen peroxide generated in the oxidative burst by converting it
to dioxygen and water (reviewed in Dat et al., Redox Rep. 6(1): 37-42,
2001 ).
OsGHIBI (Chitinase, Class III) was found to interact with O. Sativa
Cellulose Synthase Catalytic Subunit, RSW1-Like (OsCS; PN19707). The
prey clone found in our search, retrieved from the input trait library,
encodes
amino acids 411 to 489 of rice cellulose synthase catalytic subunit. This
region of the 583-amino acid protein is C-terminal to the transmembrane
domains and is predicted by amino acid sequence analysis to be on the
cytoplasmic side of the plasma membrane.
Cellulose synthase is a membrane-bound enzyme complex
comprising multiple isoforms. Cellulose synthase catalytic subunit
(GENBANIC~ Accession No. AF030052) is involved in the synthesis of
cellulose, a polysaccharide that is an essential component of the cell wall of
higher plants. Cellulose imparts mechanical properties to plants which
determine plant growth and cell shape, and its production impacts many
aspects of plant biology. Most plants synthesize cellulose at the plasma
membrane through the activity of cellulose synthase. As part of a structure
called the rosette, the enzyme extends nascent cellulose chains by adding a
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
201
sugar nucleotide precursor, and these chains then assemble into microfibrils
that align in the same direction on the surface of the plasma membrane.
This process seems to depend on a precise organization and orientation of
the rosette (Perrin, R.M., Curr. Biol. 11 (6): 8213-6, 2001 ). A mutation in
the
A. thaliana rsw1 gene that causes cellulose disassembly results in altered
root morphogenesis (Baskin et al., Aust. J. Plant Physiol. 19(4): 427-437,
1992), indicating that proper cellulose synthesis is critical to plant
development and morphology. Arioli et al., Science 279(5351 ): 717-720,
1998 showed that the rsw1 gene in A, thaliana encodes a catalytic subunit of
cellulose synthase. However, genetic and biochemical evidence now
supports the concept that a family of genes encode the catalytic subunit of
cellulose synthase in higher plants, with various members showing tissue-
specific expression or being differentially expressed in response to various
conditions. These topics are reviewed in Perrin, R.M., supra. These authors
indicate that the presence of many genes for the cellulose synthase catalytic
subunit in plants suggests that multiple isoforms of cellulose synthase can
be needed in the same cell for the formation of functional multimeric
complexes, most likely dimers. In addition, many other polypeptides have
been detected within the rosette whose identities have not been determined.
Interaction studies aimed at identifying the proteins interacting with
synthase
can help elucidate the organization of the cellulose synthase rosette
machinery and address some of the questions that still remain about the
biosynthesis of cellulose. There is no match for the gene encoding OsCS on
TMRI's GENECHIP~ Rice Genome Array.
Cellulose synthase catalytic subunit was also used as a bait protein.
Its interactors are shown in Table 30 and discussed in later in this Example.
OsCHIB1 (Chitinase, Class Ill) was found to interact with Protein
PN22823, which is similar to ABC Transporter Proteins (OsPN22823).
Protein PN22823 is a 1239-amirio acid protein that includes fen predicted
transmembrane domains (amino acids 45 to 61, 154 to 170, 174 to 190, 253
to 269, 295 to 311, 671 to 687, 715 to 731, 794 to 810, 818 to 834, and 933
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
202
to 949) and two ATP/GTP-binding site motifs A (P-loops) (amino acids 383
to 390 and 1031 to 1038). A BLAST analysis against the Genpept database
indicated that PN22823 shares 55% identity with Japanese goldthread
(Coptis japonica) CjMDR1 (GENBANK~ Accession No. AB043999.1; e=0.0).
CjMDRI is a multidrug resistance gene expressed in the rhizome, where
alkaloids are highly accumulated compared to other organs (Yazaki~ et al., J.
Exp. Bot. 52(357): 877-9, 2001 ). Other proteins highly similar to PN22823
include A. thaliana putative ABC transporter (GENBANK~ Accession No.
T02187; e=0) and putative P-glycoprotein (GENBANK~ Accession No.
NP_171753; e=0). These types of proteins contain ATP-binding cassettes
(ABC) and belong to a family that includes P-glycoprotein (P-gp) and
multidrug resistance-associated protein 2 (MRP2) (reviewed by Fardel et al.,
Toxicology 167(1): 37-46, 2001 ). ABC proteins are membrane-spanning
proteins that transport a wide variety of compounds across biological
membranes, including phospholipids, ions, peptides, steroids,
polysaccharides, amino acids, organic anions, drugs and other xenobiotics.
In mammals, ABC transporters participate in the biliary elimination of
exogenous compounds and xenobiotics, and their expression can be up
regulated by these toxins. The large number of ABC transporter protein
family members identified in A. thaliana (129 according to Sanchez
Fernandez et al., J. Biol. Chem. 276(32): 30231-30244, 2001 ), suggests an
important role for these proteins in plants. In agreement with this notion,
ABC transporters were among the immediate early genes found to be up-
regulated in a tropical japonica rice cultivar (Oryza sativa cv. Drev~r) in
response to jasmonic acid, benzothiadiazole, and/or blast infection (Xiong et
al., Mol. Plant Microbe Interact. 14(5): 685-692, 2001 ). This suggests that
ABC proteins play a role in defense against toxins in plants as they do in
mammals. Most of the ABC transporters characterized in plants to date have
been localized in the vacuolar membrane and are considered to be involved
in the intracellular sequestration of cytotoxins (reviewed in Leslie et al.,
Toxicology 167(1): 3-23, 2001). Furthermore, plant ABC transporters appear
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
203
to have a role equivalent to that of the mammalian ABC transporter in
multidrug resistance, as shown in a study in which an ABC transporter
protein was up-regulated in a Nicotiana plumbaginifolia cell culture following
treatment with a close analog of the antifungal diterpene sclareol (Jasinski
et
al., Plant Cell 13(5): 1095-107, 2001 ). MRP homologues isolated from A.
thaliana (AtMRPs) are implicated in providing herbicide resistance to plants
(Rea et al., Annu. Rev. Plant Physiol. Plant Mol. Biol. 49: 727-760, 1998).
There is also evidence that ABC transporter proteins act as hormone
transporters as they do in mammals. Specifically, a mutation in one of the
ABC transporters in A. thaliana, AtMRPS, results in decreased root growth
and increased lateral root formation possibly due to the inability of the
mutant AtMRP5 to act as an auxin conjugate transporter Gaedeke et al.,
EM80 J. 20(8): 1875-1887, 2001 ).
A BLAST analysis comparing the nucleotide sequence of Novel
Protein PN22823 against TMRI's GENECHIP~ Rice Genome Array
sequence database identified probeset OS ORF012127 at (~ X45
expectation value) as the closest match. Gene expression experiments
indicated that this gene is induced by the fungal pathogen M. grisea.
OsCHIB1 (Chitinase, Class III) was found to interact with protein
PN22154, which is similar to A. thaliana Glutamyl Aminopeptidase
(OsPN22154). OsPN22154 is a 173-amino acid protein fragment that is
65% identical to a protein from A. thaliana (GENBANK~ Accession No.
AL035525) described as a homologue of mouse aminopeptidase
(GENBANK~ Accession No.U35646). The cDNA sequence of the A.
thaliana aminopeptidase-like protein and th'e rice genome sequence (as a
template) were used to generate a rice DNA sequence coding for a protein
of 874 amino acids, which is 54.7 % identical to the A. thaliana
aminopeptidase-like protein. Indeed, domain analysis of the novel rice
protein detected a peptidase M1 domain (amino acids 17 to 402), and a zinc-
binding domain (amino acids 311 to 320), suggesting that this protein is a
metallo-aminopeptidase. It is unclear whether this protein is encoded by an
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
204
orthologue or an analogue of the A, thaliana aminopeptidase-like gene. A
BLAST analysis comparing the nucleotide sequence of Novel Protein
PN22154 against TMRI's GENECHIP~ Rice Genome Array sequence
database identified probeset OS 004263_at (4e $3 expectation value) as the
closest match. Gene expression experiments indicated that this gene is
expressed in panicle.
OsCHIB1 (Chitinase, Class III) was found to interact with protein
PN29041 (OsPN29041 ). A BLAST analysis indicated that this protein
fragment is similar to putative ATPase from A. thaliana (GENBANK~
Accession No. AAG52137; a ~7). ATPases can be localized to the plasma
membrane which is adjacent to the cell wall. There is no match for this gene
on TMRI's GENECHIP~ Rice Genome Array, and thus no gene expression
data that would allow prediction of its function during stress or infection.
It is
possible that this protein can have no role in pathogen invasion. However, it
is part of the chitinase multiprotein complex identified in this Example
through the yeast two-hybrid interactions, which we suggest exists at the cell
wall interfiace. One hypothesis is that the ATPase-like protein can reside in
the plasma membrane and participate in cell wall synthesis. Further
interaction data can help elucidate the biological significance of its
participation in the chitinase multiprotein complex.
OsCHIB1 (Chitinase, Class III) was found to interact with protein
PN22020 (OsPN22020). Protein PN22020 is a 175-amino acid protein
fragment that shares 55% identity with A. thaliana putative protein
(GENBANK~ Accession No. NP_197783; 3e 34). Analysis of the amino acid
sequence identified a C2 domain (amino acids 5 to 90, e=0.037), as found in
protein kinase C isozymes, which suggests that PN22020 can participate in
signaling pathways similar to those modulated by protein kinase C. Perhaps
its interaction with chitin represents a signaling event that occurs in
response
to pathogen or toxin exposure. However, this domain has been detected in
other kinases and nonkinase proteins (Pouting and Parker, Protein Sci. 5(1):
162-166, 1996). Identification of the full amino acid sequence of novel
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
205
protein PN22020 can make it possible to determine the class of C2 domain-
containing proteins to which it belongs.
A BLAST analysis comparing the nucleotide sequence of Novel
Protein PN22020 against TMRI's GENECHIP~ Rice Genome Array
sequence database identified probeset OS008182_r at (e X02 expectation
value) as the closest match. Gene expression experiments indicated that
this gene is constitutively expressed in leaves, stems, roots, seeds, panicle
and pollen.
Yeast Two-Hybrid Usina OsCS as Bait
A second bait, namely O. sativa Cellulose Synthase Catalytic Subunit,
RSW1-Like (OsCS; PN19707; GENBANK~ Accession No. AF030052), was
also used. This protein is described earlier in this Example because it was
found to interact with the bait protein O. sativa Chitinase, Class III
(OsCHIBI; PN19651). The bait fragment used in the search encodes amino
acids 316 to 583 of OsCS.
OsCS was found to interact with O. sativa Cellulose Synthase
Catalytic Subunit, RSW1-like (OsCS). In other words, OsCS was found to
interact with itself. The prey clone was retrieved from the input trait
library,
and encoded almost the same amino acids as the bait clone (the prey clone
encoded amino acids 316 to 582). The self-interaction supports the concept
of cellulose synthase acting as a dimer, as has been suggested (see Perrin,
R.M., Curr. Biol. 11 (6): 8213-8216, 2001 )).
OsCS was also found to interact with O. sativa salT Gene Product
(OsAAB53810). A BLAST analysis of the 145-amino acid protein
OsAAB53810 amino acid sequence indicated that this protein is the rice salT
Gene Product (AAB53810.1; 100% identity; 3e $°). This protein is
encoded
by a cDNA clone, salT, which was isolated from rice roots subjected to
salinity stress, as reported by Claes et al. (Plant Cell 2(1): 19-27, 1990).
These authors showed that the salT mRNA is specifically expressed in
sheaths and roots from mature plants and seedlings in response to salt
stress and drought. Expression data reported previously by Garcia et al.,
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
206
Plants 207(2): 172-80, 1998 indicate that expression of salT in each region
of the plant is dependent on the metabolic activity of the cells as well as on
whether or not they are responding to stress. These authors also found that
the salT gene is induced by gibberellic acid and abscisic acid and suggest
that induction by these growth regulators occurs through independent and
possibly antagonistic pathways. Analysis of the OsAAB53810 protein
sequence predicted a jacalin-like !actin domain (amino acids 14 to 145, 2.3e
32). ~acalin interacts with carbohydrates in . a highly specific manner
(Sankaranarayanan ef al., Nat. Sfrucf. Biol. 3(7): 596-603, 1996).
OsCS was also found to interact with Aquaporin (OsPIP2a).
Aquaporin (GENBANK~ Accession No. AF062393) is a 290-amino acid
protein that includes six predicted transmembrane domains (amino acids 48
to 64, 83 to 99, 131 to 147, 175 to 191, 207 to 223, and 254 to 270) and a
Major Intrinsic Protein (MIP) family signature (amino acids 34 to 271 ), as
determined by amino acid sequence analysis. The prey clone retrieved from
the output trait library encodes amino acids 123 to. 290 of OsPIP2a, a region
that includes the four most C-terminal predicted transmembrane domains
and part of the MIP family signature. Aquaporin is thought to be a plasma
membrane intrinsic protein (Malz and Sauter, Plant Mol. Biol. 40(6): 985-995,
1999). Such proteins facilitate movement of small molecules, often times
functioning as water channels. This is why OsPIP2a is also called
aquaporin. Malz and Sauter identified OsPIP2a along with OsPIPIa and
report that these two proteins possess several hallmark motifs and
homologies that justify their assignment to their respective PIP subfamilies.
They report that OsPIP2a and OsPIPIa display similar, but not identical,
expression patterns in rice, both being expressed at higher levels in
seedlings than in adult plants, and that expression in the primary root is
regulated by light. Furthermore, their study indicates that gibberellic acid
also regulates the expression of these OsPIP transcripts in internodes of
deepwater rice plants induced to grow rapidly by submergence, although
expression did not correlate with growth. In A. thaliana, difFerent PIP
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
207
proteins are expressed in response to different agonists and conditions, e.g.,
salt stress induces tonoplast intrinsic protein (SITIP), as reported by Pih et
al., Mol. Cells 9(~I): 84-90, 1999. These authors suggest that PIP proteins
can be responsible for osmoregulation in plants under high osmotic stress
such as a high salt condition.
OsCS was also found to interact with protein PN22825 (OsPN22825).
OsPN22825 is a 229-amino acid protein fragment for which the complete
sequence is not known. A BLAST analysis against the public and Myriad's
proprietary databases indicated that OsPN22825 is similar to two unknown
proteins from A. thaliana (GENBANK~ Accession No. NP 188565, 67%
identity, 3e-$2; and GENBANK~ Accession No. AB025624, 37% identity, 3e-
$2). There is no match for the gene encoding OsPN22825 on TMRI's
GENECHIP~ Rice Genome Array, and thus no gene expression data that
would allow prediction of its function during stress or infection.
OsCS was also found to interact with protein PN29076 (OsPN29076).
OsPN29076 is a 389-amino acid protein fragment for which the complete
sequence is not known. Analysis of the available amino acid sequence
identified a cytochrome c family heme-binding site (amino acids 142 to 147).
A BLAST analysis revealed no proteins with high similarity to OsPN29076,
the best hit being an A. thaliana unknown protein (GENBANK~ Accession
No. AAF24616, 34% identity, 3e 46). Three prey clones encoding amino
acids 1 to 187, 42 to 389, and 121 to 304 of OsPN29076 were retrieved from
the output trait library. The clones share an overlapping region which spans
amino acids 121 to 187 of OsPN29076 and which includes the cytochrome c
family heme-binding site. There is no match for the gene encoding
OsPN29076 on TMRI's GENECHIP~ Rice Genome Array, and thus no gene
expression data that would allow prediction of its function during stress or
infection. The lack of information about OsPN29076 makes it difficult to
determine its function. Identification of the complete amino acid sequence
for OsPN29076 can contribute to clarifying the function of this protein and
the biological significance of the OsCS-OsPN29076 interaction.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
208
OsCS was also found to interact with protein PN29077, which is
similar to A. thaliana DNA-Damage Inducible Protein DD11-Like
(OsPN29077). OsPN29077 is 243-amino acid protein fragment for which the
complete sequence is not known. A BLAST analysis indicated that
OsPN29077 shares 73% identity with A. fhaliana DNA-damage inducible
protein DD11-like (GENBANK~ Accession No. BAB02792; 5e 94). DD11 is
thought to be a cell-cycle checkpoint protein in yeast and its expression is
induced by a variety of DNA-damaging agents. Such proteins arrest cells at
certain stages and regulate the transcriptional response to DNA damage
(Zhu and Xiao, Nucleic Acids Res. 26(23): 5402-5408, 1998). DD11 has
been reported to interact with ubiquitin (Bertolaet et al., Nat. Struct. 8iol.
8(5): 417-422, 2001 ), an observation that supports the use of the yeast two-
hybrid approach to study such proteins.
A BLAST analysis comparing the nucleotide sequence of OsPN29077
against TMRI's GENECHIP° Rice Genome Array sequence database
identified probeset OS016688.1~at (e-$3 expectation value) as the closest
match. Gene expression experiments indicated that this gene is not
specifically expressed in several different tissue types and is not
specifically
induced by a broad range of plant stresses, herbicides, and applied
hormones.
OsCS was also found to interact with protein PN29084, which is
similar to G. max calcium-dependent protein kinase (OsPN29084).
OsPN29084 is a 284-amino acid protein fragment for which the complete
sequence is not known. Analysis of the available amino acid sequence
identified four EF-hand calcium-binding domains (amino acids 110 to 122,
146 to 158, 182 to 194, and 216 to 228). In agreement with the presence of
these domains, a BLAST analysis indicated that OsPN29084 is highly similar
to many calcium-dependent protein kinases including soybean (G. max)
calcium-dependent protein kinase (GENBANK~ Accession No. A43713,
81 °l° identity, 2e 79). This soybean protein also includes four
EF-hand
calcium-binding domains and requires calcium but not calmodulin or
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
209
phospholipids for activity (Harper et al., Science 252(5008): 951-954, 1991).
Calcium can function as a second messenger through stimulation of such
calcium-dependent protein kinases.
A BLAST analysis comparing the nucleotide sequence of OsPN29084 .
against TMRI's GENEGHIP~ Rice Genome Array sequence database
identified probeset OS004083.1 at (e $3 expectation value) as the closest
match. Gene expression experiments indicated that this gene is not
specifically expressed in several different tissue types and is not
specifically
induced by a broad range of plant stresses, herbicides, and applied
hormones.
OsCS was also found to interact with O. sativa DNAJ homologue
(OsPN29113). OsPN29113 is a 92-amino acid protein whose sequence
includes an ATP/GTP-binding site motif A (P-loop, amino acids 43 to 50). A
BLAST analysis of the available amino acid sequence indicated that
OsPN29113 is the rice DNAJ homologue (GENBANK~ Accession No.
BAB70509.1; 100% idenfiity; 5e-39). In eukaryotic cells, DnaJ-like proteins
regulate the chaperone (protein folding) function of Hsp70 heat-shock
proteins through direct interaction of different Hsp70 and DnaJ-like protein
pairs (Gyr et aL, Trends Biochem. Sci. 19(4): 176-181, 1994). Heat shock
proteins (reviewed in Bierkens, J.G., Toxicology 153(1-3): 61-72, 2000) are
stress proteins that function as intracellular chaperones to facilitate
protein
folding/unfolding and assembly/disassembly. They are selectively
expressed in plant cells in response to a range of stimuli, including heat and
a variety of chemicals. As regulators of heat shock proteins, DnaJ-like
proteins are thus part of the plant protective stress response.
A BLAST analysis comparing the nucleotide sequence of OsPN29113
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS002926 at (e X24 expectation value) as the closest
match. Gene expression experiments indicated that this gene is not
specifically expressed in several different tissue types and is not
specifically
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
210
induced by a broad range of plant stresses, herbicides, and applied
hormones.
OsCS was also found to interact with protein PN29115, which is
similar to A. thaliana 6,7-dimethyl-8-ribityllumazine synthase precursor
(OsPN29115). OsPN29115 is a 188-amino acid protein fragment for which
the complete sequence is not known. The available sequence includes an
ATP/GTP-binding site motif A (P-loop, amino acids 94 to 101 ) and a 6,7-
dimethyl-8-ribityllumazine synthase family signature (amino acids 42 to 186),
as determined by analysis of the available amino acid sequence. The
presence of the latter domain is in agreement with the results of a BLAST
analysis indicating that OsPN29115 shares 50% identity with A. thaliana
putative 6,7-dimethyl-8-ribityllumazine synthase precursor (GENBANK~
Accession No. AAK93590, 6e 3'). The cofactor riboflavin is synthesized from
the precursor 6,7-dimethyl-8-ribityllumazine (Nielsen et al., J. Biol. Chem.
261(8): 3661-3669, 1986). Flavins are involved in numerous biological
processes (reviewed by Massey, V., Biochem. Soc. Trans. 28(4): 283-296,
2000). For example, they participate in electron transfer reactions and
thereby contribute to oxidative stress through their ability to produce
superoxide, but at the same time flavins participate in the reduction of
hydroperoxides, the products of oxygen-derived radical reactions. Flavins
also contribute to soil detoxification and are finked to light-induced DNA
repair in plants. The chemical versatility of flavoproteins is controlled by
specific interactions with the proteins with which they are bound.
A BLAST analysis comparing the nucleotide sequence of OsPN29115
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS015577_at (e 4~ expectation value) as the closest
match. Gene expression experiments indicated that this gene is not
specifically expressed in several different tissue types and is not
specifically
induced by a broad range of plant stresses, herbicides, and applied
hormones.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
211
OsCS was also found to interact with protein PN29116 (OsPN29116).
OsPN29116 is a 170-amino acid protein fragment for which the complete
sequence is not known. Analysis of the available amino acid sequence
identified a WD40 domain (amino acids 82 to 118), which is reported to
participate in protein-protein interactions (Ajuh et al., J. Biol. Chem.
276(45):
42370-42381, 2001 ). A BLAST analysis indicated that OsPN29116 shares
identity with two unknown proteins from A. thaliana (GENBANK~ Accession
No. T45879, 67% identity, e-64; and GENBANK~ Accession No. NP 181253,
69% identity, a 5$). The lack of information about OsPN29116 makes it
difficult to determine its function. Identification of the complete amino acid
sequence for ~OsPN29116 can clarify the function of this protein and the
biological relevance of the OsCSC-OsPN29116 interaction.
A BLAST analysis comparing the nucleotide sequence of OsPN29116
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS016500_r at (e'2 expectation value) as the closest
match. The expectation value is too low for this probeset to be a reliable
indicator of the gene expression of OsPN29116.
OsCS was also found to interact with protein PN29117 (OsPN29117).
OsPN29117 is a 237-amino acid protein that includes a ubiquitin domain
(amino acids 12 to 84). Analysis of the amino acid sequence identified a
BAG domain (amino acids 106 to 187, 2.1e ~~), which is known to bind and
regulate Hsp70/Hsc70 molecular chaperones (Briknarova et al., Nat. Struct.
Biol. 8(4): 349-352, 2001 ). The BAG family of cochaperones functionally
regulates signal-transducing proteins and transcription factors important for
cell stress responses, apoptosis, proliferation, cell migration and hormone
action (Briknarova et al., supra; Antoku et al., Biochem. Biophys. Res.
Commun. 286(5): 1003-1010, 2001 ). A BLAST analysis indicated that
OsPN29117 shares identity with an A. thaliana unknown protein
(GENBANK~ Accession No. AAC14405, 44% identity, 4e 52). In agreement
with the notion that OsPN29117 is a member of the BAG family of proteins, it
was also found to interact with hsp70 (OsHSP70) (see note * under Table
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
212
30). Heat shock proteins (discussed above) are stress proteins which
function as ATP-dependent intracellular chaperones and which are
selectively expressed in plant cells in response to a range of stimuli,
including heat and a variety of chemicals. As a regulator of heat shock
proteins, the BAG protein OsPN29117 can thus be part of the plant
protective stress response.
The prey clone retrieved in the search encodes amino acids 1 to 151
of OsPN29117, a region that includes the ubiquitin domain. Note that the
prey clone includes a small portion (-7 to 0) of the 5' untranslated region,
and
thus its coordinates are shown in Table 2 as amino acids -7 to 151. A
BLAST analysis comparing the nucleotide sequence of OsPN29117 against
TMRI's GENECHIP~ Rice Genome Array sequence database identified
probeset OS017803-at (e-'3 expectation value) as the closest match. Gene
expression experiments indicated that this gene is not specifically expressed
in several different tissue types and is not specifically induced by a broad
range of plant stresses, herbicides, and applied hormones.
OsCS was also found to interact with protein PN29118 (OsPN29118).
OsPN29118 is a 136-amino acid protein fragment for which the complete
sequence is not known. A BLAST analysis indicated that OsPN29118 has
only weak similarity to proteins in the public domain and in Myriad's
proprietary database, the best hit being an A. thaliana putative zinc finger
protein SHI-like (GENBANK~ Accession No. NP~201436, 42% identity, 5e
15). The protein with the next highest identity is an A. thaliana hypothetical
protein (GENBANK~ Accession No. T04595, 38% identity, 9e ~5). Discovery
of the complete amino acid sequence for OsPN29118 can contribute to
clarifying the function of this protein and the biological relevance of the
OsCSC-OsPN29118 interaction.
A BLAST analysis comparing the nucleotide sequence of OsPN29118
against TMRI's GENECHIP° Rice Genome Array sequence database
identified probeset OS004996.1 at (e 3$ expectation value) as the closest
match. Gene expression experiments indicated that this gene is not
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
213
specifically expressed in several different tissue types and is not
specifically
induced by a broad range of plant stresses, herbicides, and applied
hormones.
OsCS was also found to interact with protein PN29119 (OsPN29119).
OsPN29119 is a 327-amino acid protein fragment for which the complete
sequence is not known. A BLAST analysis indicated that OsPN29119
shares 38% identity with an A. thaliana unknown protein, T17H3.9
(GENBANK~ Accession No. AAD45997, 7e 54). Discovery of the complete
amino acid sequence for OsPN29119 can contribute to clarifying the function
of this protein and the biological relevance of the OsCSC-OsPN29119
interaction. One prey clone encoding amino acids 1 to 155 of OsPN29119
was retrieved from the output trait library. This prey clone includes a
portion
of the 5' untranslated region and thus its coordinates are shown in Table 2
as amino acids -53 to 155. A BLAST analysis comparing the nucleotide
sequence of OsPN29119 against TMRI's GENECHIP~ Rice Genome Array
sequence database identified probeset OS014829.1 at (e ~3~ expectation
value) as the closest match. Gene expression experiments indicated that
this gene is not specifically expressed in several different tissue types and
is
not specifically induced by a broad range of plant stresses, herbicides, and
applied hormones.
Summary
Proteins that Interact with OsCHIB1 (Chitinase Class III).
The yeast two-hybrid assay designed to search for proteins
interacting with the chitinase bait proteins led to the isolation of proteins
that
appear to be associated with the plant defense response to pathogens.
Resistance to disease occurs on several levels that include local and
nonspecific systemic responses. The hypersensitive response (HR) in
plants is a mechanism of local resistance to pathogenic microbes
characterized by a rapid and localized tissue collapse and cell death at the
infection site, resulting in immobilization of the intruding pathogen. This
process is triggered by pathogen elicitors and orchestrated by an oxidative
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
214
burst, which occurs rapidly after the attack (Lamb and Dixon, Ann. Rev.
Plant Biol. 48(1 ): 251, 1997). The accumulation of active oxygen species
(AOS) is a central theme during plant responses to both biotic and abiotic
stresses. AOS are generated at the onset of the HR and might be
instrumental in killing host tissue during the initial stages of infection.
AOS
also act as signaling molecules that induce expression of PR genes and
production of other signaling molecules which participate in the signal
cascade that leads- to PR gene induction. The triggering of defense genes
can extend to the uninfected tissues and the whole plant, leading to local
resistance (LR) and systemic acquired resistance (SAR; reviewed in
Martinez et aL, Plant Physiol. 122(3): 757-766, 2000). As a result of SAR,
other portions of the plant are provided with long-lasting protection against
the same and unrelated pathogens.
Hydrogen peroxide from the oxidative burst plays an important role in
the localized HR not only by driving the cross-linking of cell wall structural
proteins, but also by triggering cell death in challenged cells and as a
diffusibl'e signal for the induction in adjacent cells of genes encoding
cellular
protectants such as glutathione S-transferase and glutathione peroxidase,
and for the production of salicylic acid (SA). SA is thought to act as a
signaling molecule in LR and SAR through generation of SA radicals, a likely
by-product of the interaction of SA with catalases and peroxidases, as
reported by Martinez et al. (supra). These authors showed that recognition
of a bacterial pathogen by cotton triggers the oxidative burst that precedes
the production of SA in cells undergoing the HR, and that hydrogen peroxide
is required for local and systemic accumulation of SA, thus acting as the
initiating signal for LR and SAR. The involvement of catalase in SA-
mediated induction of SAR in plants was previously demonstrated by Chen
et al., Science 262(5141 ): 1883-1886, 1993 who showed that binding of
catalase to SA results in inhibition of catalase activity, and that consequent
accumulation of hydrogen peroxide induces expression of defense-related
genes associated with SAR.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
215
in this study, chitinase was found to interact with catalase A. Given
the established role of chitinase as a defense protein, this interaction is
consistent with the presence of the stress-induced catalase during pathogen
attack and suggests that both enzymes can be located at the cell wall, where
they participate in PR gene induction. The significance of the chitinase-
catalase interaction as part of the defense response against microbes finds
further support in the observation that fungal catalase has a role in
protecting necrotrophic fungi from the deleterious effects of AOS during
colonization of a host expressing the HR (Mayer et al., Phytochemistry 58(1):
33-41, 2001 ). These organisms were shown to secrete catalase, among
other enzymes, to remove or inactivate AOS from the host.
In addition, the cell wall can play a role in defense against bacterial
and fungal pathogens by receiving information from the surface of the
pathogen from molecules called elicitors, and by transmitting this information
to the plasma membrane of plant cells, resulting in gene-activated processes
that lead to resistance. One type of biochemical reaction induced by elicitors
and associated with the hypersensitive response is the synthesis and
accumulation of phytoalexins, antimicrobial compounds produced in the
plant after fungal or bacterial infection (reviewed in Hammerschmidt, R.,
Ann. Rev. Phytopathol. 37: 285-306, 1999). One of the proteins found to
interact with chitinase is an ABC transporter. ABC transporters are known to
sequester cytotoxins, metabolites and other molecules from plant tissues. It
is thus likely that the ABC transporter found to interact with chitinase
resides
at the cell wall, where it participates in the transport of toxins. Though the
function of phytoalexins in the plant defense response has not been
thoroughly elucidated (Hammerschmidt, R., supra), it is tempting to
speculate that the ABC transporter can be involved in the elimination of
these toxins from the plant cells during the plant pathogen-induced defense
response. Furthermore, gene expression experiments indicated that the
gene encoding the ABC transporter protein is induced by the fungal
pathogen M. grisea. These results are consistent with the putative role of
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
216
this protein in the defense response induced by pathogenic fungi and
bacteria in rice.
Chitinase was also found to interact with novel protein PN22154
similar to A. thaliana glutamyl aminopeptidase. While the specific function of
this prey protein has not been determined, it is well known that proteolytic
activity is a common component of plant defense mechanisms against
pathogens. These mechanisms include both chitinases and proteases.
Peptidase activity has been associated with regulation of signaling.
Carboxypeptidases, for instance, hydrolytically remove the pyroglutamyl
group from peptide hormones, thereby activating these signaling molecules.
A carboxypeptidase regulates Brassinosteroid-insensitive 1 (BR11 ) signaling
in A. thaliana by proteolytic processing of a protein (Li et al., Proc. Natl.
Acad. Sci. USA 98(10): 5916-5921, 2001). ' Based on its ability to interact
with chitinase and on the well-established role of the latter in PR defense,
chitinase and novel protein PN22154 can interact as components of a
complex with chitinolytic and proteolytic activities targeted against plant
invaders, and that the rice glutamy( aminopeptidase-like protein can have a
role in activating signaling molecules at the cell wall that are involved in
the
plant defense response.
A fourth interactor found for chitinase is cellulose synthase catalytic
subunit. This enzyme acts as a complex at the plasma membrane where it
participates in cell wall synthesis, and its regulation can allow the plant to
respond with morphological changes to physical insult produced by
pathogen attack. This interaction can be significant to maintaining the
balance of the metabolism of cell wall components during the defense
response. It is possible that either chitinase resides at the cell wall where
it
interacts with cellulose synthase immediately following pathogen attack, or
chitinase is targeted to this site and interacts with synthase after PR gene
induction.
Aside from novel proteins PN22020 and PN29041, the rice proteins
found to interact with chitinase appear to be localized at or recruited to the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
217
cell wall where they parfiicipate in the plant defense response to pathogen
attack. Two of the interactors, an ABC transporter and a glutamyl
aminopeptidase-like protein, are newly characterized proteins in rice.
As a whole, all of these proteins can interact as a multicomponent
complex at the cell wall interface in the plant cell, and all can have roles
in
controlling AOS levels, inducing PR genes, and synthesizing and
maintaining the integrity of the cell wall to protect the plant against the
effects of pathogen invasion.
Proteins that interact with Cellulose Synthase Catalytic Subunit (OsCS)
The interactions involving OsCS expand the stress-response protein
network identified for the chitinase bait protein. OsCS interacts with several
proteins that appear to participate in the plant response to pathogen-induced
stress at the cell wall. Published evidence links some of these proteins to
the plant response to various stresses. These include aquaporin (OsPIP2a)
and salt-stress induced protein (OsAAB53810), two molecules that, although
they can not have a direct role in disease resistance, can function as
membrane-spanning pumps in the protein complex at the cell wall to
regulate turgor pressure or transmit solutes. Moreover, the presence of the
jacalin-like lectin domain in OsAAB53810 is of particular interest in the
context of its interaction with an enzyme that synthesizes carbohydrate
chains. Given the carbohydrate-binding property of jacalin
(Sankaranarayanan et al., Nat. Struct. Biol. 3(7): 596-603, 1996),
OsAAB53810 can specifically bind nascent cellulose chains as they are
produced by OsCS, thus playing an active role in OsCS-dependent events
relating to cell wall metabolism. The fact that OsAAB53810 is induced by
salt and stress supports a role for this protein in such physiological events.
Another interactor, the rice DNAJ homologue OsPN29113, likely
participates in the plant protective stress response by regulating the
chaperone function of heat shock proteins, which are induced by various
forms of stress. It is possible that the interaction of the DNAJ protein with
cellulose synthase is part of the plant response to chemicals produced by
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
21~
pathogens or generated in cells undergoing the HR, and that such response
is associated with injury to the cell wall that has occurred in response to
the
stress.
Among the novel proteins found to interact with OsCS, OsPN29077 is
similar to A. thaliana DNA-damage inducible protein DD11-like. Based on the
expression of yeast DD11 in response to DNA damage and on sequence
homology, we speculate that OsPN29077 performs the same function as
DD11 and that the OsCS-OsPN29077 interaction is associated with the plant
defense mechanism against DNA damage. Likewise, we attribute the BAG-
like protein OsPN29117 a putative role in the plant protective stress
response as a regulator of heat shock proteins. In agreement with this role,
OsPN29117 also interacts with hsp70, which our gene expression
experiments indicate is expressed constitutively and is down-regulated by
jasmonic acid (see chart in Appendix 1 ), a component of plant defense
response pathways. Since OsPN29077 and OsPN29117 interact with the
cellulose synthase catalytic subunit, and the latter interacts with the
pathogen-induced defense protein chitinase, these interactors can be a part
of the same complex at the cell wall where they participate in the response
to pathogen attack.
The novel protein OsPN29115 is similar to the riboflavin precursor
6,7-dimethyl-8-ribityllumazine synthase precursor from A. thaliana. Among
the roles reported for riboflavin is its association with the redox reactions
occurring as a result of oxidative stress (Massey, V., Biochem. Soc. Trans.
28(4): 283-96, 2000). Based on this evidence and on sequence homology
for the identified interactor, the OsCS-OsPN29115 interaction can link the
plant response to stress and toxins produced by pathogens with structural
changes requiring OsCS activity.
Additional novel proteins interacting with OsCS include a protein
similar to soybean calcium-dependent protein kinase (OsPN29084) and a
protein similar to A. thaliana putative zinc finger protein (OsPN29118). The
similarities of these interactors to protein kinases and zinc finger proteins
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
219
suggest that they function as mediators of molecular signaling and
transcription, respectively. Their interactions with OsCS can represent
signaling or transcriptional events occurring after disruption following
damage to the cell wall by pathogens, and these prey proteins can move
from the cell wall to other parts of the cell to mediate such events. The
OsCS-OsPN29084 interaction likely represents a step in the transduction of
an extracellular signal that results in a physiological response, while the
OsCS-OsPN29118 interaction can be associated with transcriptional
regulation also in response to an extracellular signal. This signal can be in
the form of an insult to the plant produced by pathogen attack.
For the remaining proteins found to interact with OsCS-OsPN22825,
OsPN29076, OsPN29116, and OsPN29119--based on their association with
cellulose synthase and chitinase, these prey proteins can also be important
factors for pathogen defense, cell wall integrity, or for holding together
protein complexes.
Thus, the results presented in this Example show that proteins
interacting with the cellulose synthase catalytic subunit are also part of the
chitinase multiprotein complex localized at the cell wall interface.
Example V
Janssens and Goris teach that type 2A serine/threonine protein
phosphatases (PP2A) are important regulators of signal transduction, which
they affect by dephosphorylation of other proteins (Janssens and Goris,
Biochem J. 353(Pt 3): 417-439, 2001 ). Members of the protein phosphatase
2A (PP2A) family of serine/threonine phosphatases contain a well-conserved
catalytic subunit, the activity of which is highly regulated (Janssens and
Goris, supra). There are multiple PP2A isoforms in plants and other
organisms, and they appear to be differentially expressed in various tissues
and at different stages of development (Arino et al., Plant Mol. Biol. 21 (3):
475-485, 1993). Harris et al. cites a number of reports describing the
association of PP2A subunits with a variety of cellular proteins in addition
to
regulatory subunits, suggesting that PP2As function as regulators of various
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
220
signaling pathways associated with protein synthesis, cell cycle and
apoptosis (Harris et al., Plant Physiol. 121 (2): 609-617, 1999). PP2A
enzymes have been implicated as mediators of a number of plant growth
and developmental processes.
In addition, PP2A enzymes play a role in pathogen invasion. In
animals, a variety of viral proteins target specific PP2A enzymes to
deregulate chosen cellular pathways in the host and promote viral progeny
(Sontag, E., Cell Signal 13(1 ): 7-16, 2001; Garcia et al., Microbes Infect.
2(4): 401-407, 2000). PP2A enzymes interact with many cellular and viral
proteins, and these protein-protein interactions are critical to modulation of
PP2A signaling (Sontag, supra). The proteins interacting with PP2A (e.g.,
PP2A) can, for example, target PP2A to different subcellular compartments,
or affect PP2A enzyme activity. Moreover, PP2A enzymes play a role in
plants in their response to viral infection (Dunigan and Madlener, Virology
207(2): 460-466, 1995). Indeed, serine/threonine protein phosphatase is
required for tobacco mosaic virus-mediated programmed cell death (Dunigan
and Madlener, supra).
OsPP2A-2 (GENBANK~ Accession No. AF134552) is a 308-amino
acid subunit of a family of protein phosphatases that contains a
serine/threonine protein phosphatase signature (amino acids 112 to 117).
As described above, a yeast two-hybrid approach was taken to
dissect PP2A-mediated signaling events. The bait fragments used in this
search and found to have interactors encode amino acids 1 to 308. and
150-308 of OsPP2A-2.
The second bait used in this Example, OsCAA90866, is a protein
encoded by a complete cDNA sequence that is only known to be inducible
by chilling in rice. OsCAA90866 was chosen as a bait for these interaction
studies based on its relevance to abiotic stress. Investigation into the
interactions involving OsCAA90866 will provide insight into the function of
this poorly defined protein. The identification of rice genes involved in
modulating the response of the plant to an environmental challenge, thus
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
221
conferring it a selective advantage, would facilitate the generation and yield
of crops resistant to abiotic stress.
Results
OsPP2A-2 was found to interact with rice putative proline-rich protein,
which is possibly a transcriptional regulator, and with the seed storage
protein glutelin. The search also identified five novel rice proteins
interacting
with OsPP2A-2: a putative PP2A regulatory subunit protein also similar to
rice chilling-inducible protein CAA90866 (the second bait protein of this
Example); an enzyme similar to phosphoribosylanthranilate transferase that
is likely involved in the plant response to pathogen infection; a disulfide
isomerase, with a putative role in protein folding; a voltage-dependent ion
channel protein; and a DnaJ-like protein with a putative role in the pathogen-
induced defense response.
The second bait protein of this Example, chilling-inducible protein
CAA90866 was found to interact with itself and with six proteins. One of
these is the same putative PP2A regulatory subunit protein (similar to the
bait protein itself) found to interact with the bait OsPP2A-2 of described in
this Example. This interaction links the two networks of proteins identified
in
thi Example (i.e., links proteins associated with biotic and abiotic stress to
phosphatases). The other interactors identified in this search include a 14-3-
3-like protein that is induced under various abiotic stress conditions; a
pyrrolidone carboxyl peptidase-like protein with a putative role in activating
signaling peptides involved in the plant's response to cold stress; a novel
protein containing an inositol phosphate domain likely involved in regulation
of signaling events associated with cold tolerance; a novel rice homolog of
wheat initiation factor (iso)4f p82 subunit with a putative role in RNA decay
pathways associated with stress conditions; and a novel protein similar to
plants 2-dehydro-3-deoxyphosphooctonate aldolase.
The interacting proteins of the Example are listed in Table 11 and
Table 12 below, followed by detailed information on each protein and a
discussion of the significance of the interactions. A diagram of the
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
222
interactions is provided in Figure 3. The nucleotide and amino acid
sequences of the proteins of the Example are provided in SEQ ID NOs: 97-
112 and 163-174.
Some of the proteins identified represent rice proteins previously
uncharacterized. Based on their presumed biological function and on their
ability to specifically interact with the bait proteins OsPP2A-2 or
OsCAA90866, we speculate that the proteins interacting with OsPP2A-2
represent a network involved in the rice defense response to biotic stress,
and those interacting with OsCAA90866 are associated with the abiotic
stress response. Importantly, the interactions identified suggest that
phosphatases play a role in the regulation of both biotic and abiotic stress
response in rice.
Table 11
Interacting Proteins Identified for OsPP2A-2
(Serine/Threonine Protein Phosphatase PP2A-2).
The names of the clones of the proteins used as baits and found as preys
are given. Nucleotide/protein sequence accession numbers for the proteins
of the Example (or related proteins) are shown in parentheses under the
protein name. The bait and prey coordinates (Coord) are the amino acids
encoded by the bait fragments) used in the search and by the interacting
prey clone(s), respectively. The source is the library from which each prey
clone was retrieved.
Gene Name Protein Name Bait Coord Prey
(GENBANK~ Accession Coord
No.) (Source)
BAIT
PROTEIN
OsPP2A-2 O. sativa Serine/Threonine
PN20254 (AF134552- Protein Phosphatase
PP2A-
OS002763) 2, Catalytic Subunit
(SEQ ID NO: 164) (AF134552, AAD22116)
INTERACTORS
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
223
OsAAK63900 O, sativa Putative Proline-1-308 122-224
PN23266 Rich Protein AAK63900 (input
(SEQ ID NO: 166) (AC084884)
trait)
OsORF020300-2233.2 Hypothetical Protein 1-308 93-387
PN21639 (2233(2)-OS- ORF020300-2233.2, 118-388
ORF020300 novel Putative PP2A Regulatory (input
(SEQ ID NO: 98) Subunit, Similar to trait)
OsCAA90866
(AAD39930; 5e 92)
(CAA90866; 5e 5s)
OsPN23268 Novel Protein 23268, 1-308 2x 12-
PN23268 novel Similar to 200
(SEQ ID NO: 100) Phosphoribosylanthranilate (input
Transferase, Chloroplast trait)
Precursor, Fragment
(AAB02913.1; 5e 95)
OsCAA33838 O. sativa Glutelin 150-308 5-155
PN24775 CAA33838 (output
(SEQ ID NO: 168) (X15833)
trait)
OsPN26645 Novel Protein PN26645, 1-308 24-164
(Contig3412.fasta.ContigPutative Protein Disulfide (input
1 ) (novel) Isomerase-Related Protein trait)
(SEQ ID NO: 102) Precursor
(BAB09470.1; a 2$)
OsPN24162 Novel Protein PN24162, 150-308 28-164
(Contig3453.fasta.ContigPorin-like, Voltage- (output
1 ) (novel) Dependent Anion Channel trait)
(SEQ ID NO: 104) Protein (NP_201551;
3e $6)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
224
Os011994-D16 PN20618 Hypothetical Protein 150-308 99-368
(FL_R01_P028_D160S0 011994-D16, Similar (output
to Z.
11994) (novel ) mays DnaJ protein trait)
(SEQ ID NO: 106) (T01643; e=0)
Table 12
Interacting Proteins identified for OsCAA90866
(O. sativa Chilling-Inducible Protein CAA90866~
The names of the clones of the proteins used as baits and found as preys
are given. Nucleotide/protein sequence accession numbers for the proteins
of the Example (or related proteins) are shown in parentheses under the
protein name. The bait and prey coordinates (Coord) are the amino acids
encoded by the bait fragments) used in the search and by the interacting
prey clone(s), respectively. The source is the library from which each prey
clone was retrieved.
Gene Name Protein Name Bait Prey Coord
(GENBANK~ Coord (Source)
Accession No.)
BAIT PROTEIN
OsCAA90866 O. sativa Chilling-
PN20311 Inducible Protein
(984756 OS015052)\ CAA90866
(SEQ iD NO: 170) (Z54153, CAA90866)
INTERACTORS
OsCAA90866 O. sativa Chilling- 100-250 1-126
PN20311 Inducible Protein (output trait)
(SEQ ID NO: 170) CAA90866
(Z54153, CAA90866)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
225
Os008938-3209 O. sativa Putative 100-250 4x 53-259
14-3-3
PN20215 (3209- Protein (input trait)
OS208938) (AAK38492)
(SEQ ID NO: 172)
OsAAG46136 O. sativa Putative 100-250 2x 92-222
PN23186 Pyrrolidone Carboxyl (input trait)
(SEQ ID NO: 174) Peptidase
(AAG46136)
OsORF020300-223 Hypothetical Protein100-250 3x 1-206
PN21639 ORF020300-2233.2, 3x 1-190
(SEQ ID NO: 98) Putative PP2A (output trait)
Regulatory Subunit,
Similar to OsCAA90866
(AAD39930; 5e'92)
(CAA90866, 5e 5s)
OsPN23045 Novel Protein PN23045100-250 2x 240-287
(SEQ ID NO: 108) (input trait)
OsPN23225 Novel Protein PN23225,100-250 639-792
(SEQ ID NO: 110) Similar to Tritticum (input trait)
aestivum Initiation
Factor (iso)4f p82
Subunit
(AAA74724; e=0)
OsPN29883 Novel Protein PN29883,100-250 58-175
(SEQ lD NO: 112) Fragment (output trait)
Two Hybrid Usinct OsPP2A as a Bait
The bait fragment encoding amino acids 1 to 308 of O. sativa
Serine/Threonine Protein Phosphatase PP2A-2, Catalytic Subunit (OsPP2A-
2) was found to interact with O. sativa (rice) putative proline-rich protein,
which is possibly a transcriptional regulator. The bait fragment (i.e., as 1-
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
226
308 of OsPP2A-2) includes the serine/threonine protein phosphatase
signature of OsPP2A-2. One prey clone encoding amino acids 122 to 224 of
OsAAK63900 was retrieved from the input trait library. Somewhat
surprisingly, this prey clone does not code for the HLH domain of
OsAAK63900.
O. sativa Putative Proline-Rich Protein AAK63900 (OsAAK63900)
(GENBANK~ Accession No. AG084884) is a 224-amino acid protein that
includes a putative transmembrane spanning region (amino acids 7 to 23). It
also contains a gntR family signature (amino acids 10 to 34) common to a
group of DNA-binding transcriptional regulation proteins in bacteria (see
Buck and Guest, Biochem. J. 260: 737-747, 1989; Haydon and Guest,
FEMS Microbiol. Lett. 79: 291-296, 1991; and Reizer et al., Mol. Microbiol. 5:
1081-1089, 1991. This signature includes a helix loop helix (HLH) protein
dimerization domain (amino acids 5 to 20) that is often found in transcription
factors (see Murre et al., Cell 56: 777-783, 1989; Garrel and Gampuzano,
BioEssays 13: 493-498, 1991, Kato and Dang, FASEB J. 6: 3065-3072,
1992; Krause et al., Cell 63: 907-919, 1990; and Riechmann et al., Nucl.
Acids Res. 22: 749-755, 1994). However, no DNA-binding motif is
detectable.
Note that analysis of the amino acid sequence of OsAAK63900 also
detected an Ole a I family signature (amino acids 30 to 162) including six
conserved cysteines that are involved in disulfide bonds. This signature is a
conserved region found in a group of plant pollen proteins of unknown
function which tend to be secreted and consist of about 145 amino acids
(and thus are shorter than OsAAK63900). The first of the Ole a I family of
proteins to be discovered was Ole a I (IUIS nomenclature), a constitutive
protein in the olive tree Olea europaea pollen and a major allergen (Villalba
et al., Eur. J. Biochem. 216(3): 863-869, 1993).
The bait fragment encoding amino acids 1 to 308 of OsPP2A-2 (which
includes the serine/threonine protein phosphatase signature of OsPP2A-2)
was also found to interact with O. sativa OsORF020300-2233.2, a novel
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
227
418-amino acid protein which has a putative PP2A regulatory subunit, similar
to OsCAA90866. Two prey clones encoding amino acids 93 to 387 and 118
to 388 of ORF020300-233 were retrieved from the input trait library, which
indicates that OsORF020300-223 interacts with OsPP2A-2 through a region
within amino acids 118 to 387. OsORF020300-223 includes a possible
cleavage site between amino acids 50 and 51, although it appears to have
no N-terminal signal peptide. OsORF020300-223 is similar to A. thaliana
PP2A regulatory subunit (GENBANK~ Accession No. AAD39930.1;
44.5°l°
amino acid sequence identity; 5e g' expectation value). OsORF020300-223
is also similar to rice chilling-inducible protein CAA90866 (GENBANK~
Accession No. CAA90866, ~68°l° sequence identity; 9e'~$
expectation value),
a protein related to chilling tolerance in rice, with which OsORF020300-223
also interacts. CAA90866 was also used as a bait protein, and the
interactions identified for it are discussed later in this Example.
A BLAST analysis comparing the nucleotide sequence of
OsORF020300-223 against TMRI's GENECHIP~ Rice Genome Array
sequence database (http://tmri.org/gene_exp_web/) identified probeset
OS015607_ at (e'35 expectation value) as the closest match. Gene
expression experiments indicated that this gene is induced by the fungal
pathogen M. grisea.
The bait fragment encoding amino acids 1 to 308 of OsPP2A-2 (which
includes the serine/threonine protein phosphatase signature of OsPP2A-2)
was also found to interact with a novel protein (23268), an enzyme similar to
phosphoribosylanthranilate transferase that is likely involved in the plant
response to pathogen infection. The novel protein, which was named
OsPN23268, is similar to anthranilate phosphoribosyltransferase, a
ch(oroplast precursor. Two prey clones encoding amino acids 12 to 200 of
novel protein OsPN23268 were retrieved from the input trait library.
OsPN23268 is a novel 320-amino acid protein with a possible
cleavage site between amino acids 43 and 44, although there does not
appear to be an N-terminal peptide sequence. Analysis of the Os23268
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
228
protein sequence detected two domains originally defined in E. coli
thymidine phosphorylase (Walter et al., J. Biol. Chem. 265(23): 14016-22,
1990): the glycosyl transferase family, helical bundle domain (amino acids 1
to 61 ) and a glycosyl transferase family, aib domain (amino acids 66 to 303).
The latter contains a beta-sheet that is splayed open to accommodate a
putative phosphate-binding site (Walter et al., J. Biol. Chem. 265(23): 14016-
14022, 1990). Two prey clones of OsPN23268 retrieved from the input trait
library and found to interact with OsPP2A-2 included sequence encoding
amino acids 12 to 200 of novel protein OsPN23268. This sequence of
OsPN23268 includes the glycosyl transferase family helical bundle domain
and part of the aib domain.
The glycosyl transferase family includes thymidine phosphorylase and
anthranilate phosphoribosyltransferase enzymes. In mammalian cells,
thymidine phosphorylase is identical to the angiogenic factor, platelet-
derived endothelial cell growth factor (Morita et aL, Curr. Pharm. Biotechnol.
2(3): 257-267, 2001; Browns and Bicknell, Biochem. J. 334(Pt 1 ): 1-8, 1998),
and it also controls the effectiveness of the chemotherapeutic drug
capecitabine by converting it to its active form (Ackland and Peters, Drug
Resist. Updat. 2(4): 205-214, 1999). As its name indicates, novel protein
23268 is similar to A. thaliana phosphoribosylanthranilate transferase
(GENBANK~ Accession No. AAB02913.1; 56.6% identity; 5e 95), an enzyme
with a role in the tryptophan biosynthetic pathway which is also found in
bacteria (Edwards et aL, J. Mol. BioL 203(2): 523-524, 1988). In A. thaliana,
this tryptophan biosynthetic enzyme is synthesized as a higher-molecular-
weight precursor and then imported into chloroplasts to be processed into its
mature form (Zhao and Last, J. Biol. Chem. 270(11): 6081-6087, 1995). The
A. thaliana anthranilate phosphoribosyltransferase is also similar to
DESCA11 (GENBANK~ Accession No. B1534445; e-~7), one of the genes
identified in Chenopodium amaranticolor (a plant with broad-spectrum virus
resistance) which are induced during the hypersensitive response (HR)
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
229
response of the plant subsequent to infection with tobacco mosaic virus and
tobacco rattle tobravirus (Cooper, B., Plant J. 26(3): 339-349, 2001 ).
A BLAST analysis comparing the nucleotide sequence of OsPN23268
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS015603_ s_ at (3e 4~ expectation value) as the closest
match. Our gene expression experiments indicate that this gene is induced
by the fungal pathogen M. grisea.
The bait fragment of OsPP2A-2 containing amino acids 150 to 308
was also found to interact with the seed storage protein glutelin CAA33838
(OsCAA33838). Glutelin CAA33838 is the major seed storage protein in rice.
Its cDNA sequence was identified by Wen et al., Nucleic Acids Res. 17(22):
9490, 1989, and the accumulation of the protein in rice endosperm occurs
between five and seven days after flowering (Udaka et al.,' J. Nutr. Sci.
Vitaminol. (Tokyo) 46(2): 84-90, 2000). One prey clone encoding amino
acids 5 to 155 of OsCAA33838 was retrieved from the output trait library.
OsCAA33838 (GENBANK~ Accession No. X15833) is a 499-amino acid
protein that includes a cfeavable signal peptide (amino acids 1 to 24), as
determined by analysis of the amino acid sequence. The analysis identified
an 11 S plant seed storage protein domain (amino acids 1 to 469; 1 a 243).
The 11 S plant seed storage proteins tend to be glycosylated proteins that
form hexameric structures. They are composed of two peptides linked by
disulfide bonds and are also members of the cupin superfamily of proteins by
virtue of their two beta-barrel domains. The analysis also detected this
domain but localized it to a narrower region (amino acids 302 to 324). In
addition, a 7S seed storage protein, C-terminal domain (amino acids 319 to
478; 602e °4), was identified which is also found in members of the
cumin
superfamily. in agreement with the evidence that OsCAA33838 is a
glycosylated protein, an N-glycosylation site (amino acids 491 to 494) was
identified.
A BLAST analysis comparing the nucleotide sequence of
OsCAA33838 against TMRI's GENECHIP~ Rice Genome Array sequence
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
230
database identified probeset OS000688.1 _ at (e=0 expectation value) as
the closest match. Our gene expression experiments indicate that this gene
is not specifically expressed in several different tissue types and is not
specifically induced by a broad range of plant stresses, herbicides and
applied hormones.
The bait fragment of OsPP2A-2 was also found to interact with novel
protein PN26645, a putative protein disulfide isomerase-related protein
precursor (also called OsPN26645). The bait fragment used in this search
encodes amino acids 1 to 308 of OsPP2A-2, which includes the
serine/threonine protein phosphatase signature of OsPP2A-2. One prey
clone encoding amino acids 24 to 164 of OsPN26645 was retrieved from the
input trait library. OsPN26645 is a 311-amino acid protein that includes a
cleavable signal peptide (amino acids 1 to 17) and a predicted
transmembrane domain (amino acids 210 to 226), as determined by analysis
of the amino acid sequence. A BLAST analysis against the Genpept
database revealed that OsPN26645 is similar to an A. thaliana protein
(GENBANK~ Accession No. BAB09470.1; 32.8°!° identity; a 28) that
is similar
to the rat protein disulfide isomerase-related protein precursor (GENBANK~
Accession No.: gi5668777, 46% identity, 1 a 63). As its name indicates,
disulfide isomerase catalyzes the formation of disulfide bonds. This enzyme
can therefore be important for proper protein folding. in mamimals, disulfide
isomerase in the lumen of the endoplasmic reticulum creates disulfide bonds
in secretory and cell-surface proteins, and microsomes deficient in this
enzyme are unable to conduct cotranslational formation of disulphide bonds
(Bulledi and Freedman, Nature 335(6191): 649-651, 1988). Although the
activity of this enzyme is not as well characterized in plants, it is likely
that it
serves in a similar capacity.
A BLAST analysis comparing the nucleotide sequence of OsPN26645
against TMRI's GENECHIP° Rice Genome Array sequence database
identified probeset OS002485.1 _ at (e X05 expectation value) as the closest
match. Gene expression experiments indicated that this gene is not
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
231
specifically expressed in several different tissue types and is not
specifically
induced by a broad range of plant stresses, herbicides and applied
hormones.
The bait fragment of OsPP2A-2 was also found to interact with novel
protein PN24162 (OsPN24162), a porin-like, voltage-dependent anion
channel protein. The bait fragment used in this search encodes amino acids
150 to 308 of OsPP2A-2. One prey clone encoding amino acids 28 to 164 of
OsPN24162 was retrieved from the output trait library. BLAST analysis of
the OsPN24162 amino acid sequence indicated that this protein is most
similar to a porin-like protein from A, thaliana (GENBANK~ Accession No.
NP 201551; 53% amino acid sequence identity; 3e $6). OsPN24162 is also
similar to a rice mitochondria) voltage-dependent anion channel
(GENBANK~ Accession No. Y18104; 44% identity; 2e 6'), a 274-amino acid
protein encoded by a cDNA found to belong to a small multigene family in
the rice genome (Roosens et al., Biochim. Biophys. Acta 1463(2): 470-476,
2000). Expression of this gene was found to be regulated in function of the
plantlets maturation and organs, and not responsive to osmotic stress
(Roosens et al., supra). Mitochondria) voltage-dependent ion channels are
also called mitochondriai porins by analogy with the proteins forming pores
in the outer membrane of Gram-neaative bacteria.
A BLAST analysis comparing the nucleotide sequence of OsPN24162
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS007036.1 _ at (e 65 expectation value) as the closest
match. Our gene expression experiments indicate that this gene is not
specifically expressed in several different tissue types and is not
specifically
induced by a broad range of plant stresses, herbicides and applied
hormones.
The bait fragment of OsPP2A-2 was also found to interact with search
a DnaJ-like protein with a putative role in the pathogen-induced defense
response. The bait fragment used in this search encodes amino acids 150
to 308 of OsPP2A-2. One prey clone encoding amino acids 99 to 368 of
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
232
Os011994-D16 was retrieved from the output trait library. This new protein
was named 011994-D16 or, because it was identified from O. sativa,
Os011994-D16.
BLAST analysis of the Os011994-D16 amino acid sequence indicated
that this protein is similar to maize (Zea mays) DnaJ protein homolog ZMDJ1
(GENBANK~ Accession No. T01643; 84% identity; e=0). In eukaryotic cells,
DnaJ-like proteins regulate the chaperone (protein folding) function of Hsp70
heat-shock proteins through direct interaction of different Hsp70 and DnaJ-
tike protein 'pairs (Cyr et al., Trends Biochem. Sci. 19(4): 176-181, 1994).
Heat shock proteins (reviewed in Bierkens et al., Toxicology 153(1-3): 61-72,
2000) are stress proteins which function as intracellular chaperones to
facilitate protein folding and assembly and which are selectively expressed in
plant cells in response to a range of stimuli, including heat and a variety of
chemicals. As regulators of heat shock proteins, DnaJ-like proteins are thus
part of the plant protective stress response.
A BLAST analysis comparing the nucleotide sequence of Os011994-
D16 against TMR1's GENEGHIP~ Rice Genome Array sequence database
identified probeset OS009139.1 at (e = 0 expectation value) as the closest
match. Gene expression experiments indicated that expression of this gene
is repressed by the plant hormone jasmonic acid.
Yeast Two-Hybrid Using O. saliva Chillinglnducible Protein CAA90866
~OsCAA90866) as Bait
The bait protein, namely O. sativa chilling-inducible protein CAA90866
(OsCAA90866), is a 379-amino acid protein encoded by a complete cDNA
sequence related to chilling tolerance in rice. BLAST analysis indicated that
OsCAA90866 is similar to the same PP2A regulatory subunit from A.
thaliana (GENBANK~ Accession No. AAD39930; 35% amino acid sequence
identity; a 5' expectation value) that was found similar to OsORF020300-223,
interactor for the bait protein PP2A-2 (see Example III, page). A BLAST
analysis comparing the nucleotide sequence of the chilling-inducible protein
against TMRI's GENECHIP~ Rice Genome Array sequence database
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
233
identified probeset OS015052_at (4e 7$ expectation value) as the closest
match. Gene expression experiments indicated that this gene is induced by
cold stress.
As described in Table 32, a bait clone encoding amino acids 100 to
250 of O, sativa Chilling-(nducible Protein CAA90866 (OsCAA90866) was
found to interact with a prey clone encoding amino acids 1 to 126 of the
same protein retrieved from the output trait library.
In addition, the bait clone encoding amino acids 100 to 250 of O.
sativa Chilling-Inducible Protein CAA90866 (OsCAA90866) was found to
interact with Os008938-3209. Four prey clones encoding amino acids 53
259 of Os008938-3209 were retrieved from the input trait library. Os008938-
3209 is a 260-amino acid protein that includes a 14-3-3 protein signature 1
(amino acids 48-60) and a 14-3-3 protein signature 2 (amino acids 220 to
260), which suggests that Os008938-3209 is a member of the 14-3-3 family.
BLAST analysis indicated that the amino, acid sequence of Os008938-3209
shares 100% identity with that of rice putative 14-3-3 protein (GENBANK~
Accession No. AAK38492, ge-~45). The 14-3-3 proteins interact with
regulators of cellular signaling, cell cycle regulation, and apoptosis. They
are thought to act as molecular scaffolds or chaperones and to regulate the
cytoplasmic and nuclear localization of proteins with which they interact by
regulating their nuclear import/export Zilliacus et aL, Mol. Endocrinol.
15(4):
501-511, 2001); reviewed by Muslin et al., Cell Signal 12(11-12): 703-709,
2000. Since 14-3-3 proteins participate in protein complexes within the
nucleus (Imhof and Wolffe, Biochemistry 38(40): 13085-13093, 1999;
Zilliacus et al., supra), cytoplasm (De Lille et al., Plant Physiol. 126(1):
35-
38, 2001 ), mitochondria (De Lille et al., supra) and chloroplast (Sehnke et
al., Plant Physiol. 122(1): 235-242, 2000), additional information would be
necessary to determine where Os008938-3209 resides within the cell.
Cellular localization of this prey protein could lead to a better
interpretation of
the significance of its interaction with chilling-inducible protein CAA90866.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
234
A BLAST analysis comparing the nucleotide sequence of the
Os008938-3209 protein against TMRI's GENECHIP~ Rice Genome Array
sequence database identified probeset OS008938 s at (e 6~ expectation
value) as the closest match. Gene expression experiments indicated that
this gene is induced by salicylic acid, ABA, BAP, BL2, and 2,4D, during cold
stress, and under drought conditions.
In addition, the bait clone encoding amino acids 100 to 250 of O.
sativa Chilling-Inducible Protein CAA90866 (OsCAA90866) was found to
interact with OsAAG46136, a pyrrolidone carboxyl peptidase from O. sativa.
Two prey clones encoding amino acids 92-222 of OsAAG46136 were
retrieved from the input trait library. These clones include the pyroglutamyl
peptidase I motif of OsAAG46136.
OsAAG46136 is a 222-amino acid protein that contains a
pyroglutamyl peptidase I motif (amino acids 11 to 221 ). This motif is found
in
the N-terminal regions of peptide hormones (including thyrotropin-releasing
hormone and luteinizing hormone releasing hormone), and it confers
protease resistance to the protein (Odagaki et al., Structure Fold Des. 7(4):
399-411, 1999). BLAST analysis indicated that the amino acid sequence of
OsAAG46136 shares 100% identity with that of rice putative pyrrolidone
carboxyl peptidase (GENBANK~ Accession No. AAG46136; 4e ~2s).
OsAAG46136 is also similar to two unknown proteins from A. thaliana
(GENBANK~ Accession Nos. NP-176063, 8e °$° and AAK25976.1, a
°'6,
both not described in the literature. The similarity of OsAAG46136 to
pyrrolidone carboxyl peptidase gives some suggestion as to the function of
this poorly defined rice protein. Pyrrolidone carboxyl peptidase (Pcps) is an
enzyme that removes an N-terminal pyroglutamyl group from some proteins.
It is present in many species (reviewed by Awade et al., Proteins 20(1 ): 34-
51, 1994) and is a valuable tool for bacterial diagnosis (most of the
literature
describing this protein addresses bacterial homologs). The active site of the
Pseudomonas fluorescens Pcps has been characterized and the nature of
This site (Cys-144 and His-166 are necessary for activity) suggests that it
can
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
235
represent a new class of thiol aminopeptidases (Le Saux et al., J. Bacferiol.
178(11): 3308-3313, 1996). Peptidases in this protein family are necessary
for processing and activation of important bioactive peptides including
amyloid precursor protein (APP), strongly implicated in Alzheimer's disease
(Lefterov et al., FASEB J. 14(12): 1837-1847, 2000). Furthermore, this
enzyme deaminates and thus inactivates the glycopeptide anticancer agent
bleomycin (Schwartz et al., Proc. NatL Acad. Sci. USA 96(8): 4680-4685,
1999).
A BLAST analysis comparing the nucleotide sequence of
OsAAG46136 against TMRI's GENECHIP~ Rice Genome Array sequence
database identified probeset OS013894's at (e $ expectation value) as the
closest match. The expectation value is too low for this probeset to be a
reliable indicator of the gene expression of OsAAG46136.
The bait clone encoding amino acids 100 to 250 of O. sativa Chilling-
Inducible Protein CAA90866 (OsCAA90866) was also found to interact viiith
protein ORF020300-2233.2 (OsORF020300-223), having a putative PP2A
regulatory subunit and being similar to OsCAA90866 (see description in
Example III). Three prey clones encoding amino acids 1 to 206 and three
prey clones encoding amino acids 1-190 of OsORF020300-223 were
retrieved from the output trait library.
Additionally, the bait clone encoding amino acids 100 to 250 of O.
sativa Chilling-Inducible Protein CAA90866 (OsCAA90866) was found to
interact with protein PN23045 (OsPN23045). Two prey clones encoding
amino acids 240 to 287 of OsPN23045 were retrieved from the input trait
library.
OsPN23045 is a 287-amino acid protein that includes an inositol P
domain (amino acids 233 to 272). This domain was identified in bovine
inositol polyphosphate 1-phosphatase protein, which is involved in signal
transduction (see York et al., Biochemistry 33(45): 13164-13171, 1994).
Mikami et al. showed that phosphatidylinositol-4-phosphate 5-kinase
(AtPIP5K11 ) is induced by water stress and abscisic acid (ABA) in A.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
236
thaliana, suggesting a link between phosphoinositide signaling cascades
with water-stress responses in plants (Mikami et al., Plant J. 15(4): 563-568,
1998). Xiong et al. reported that FRY1, a mutant gene in A. thaliana
encoding an inositol polyphosphate 1-phosphatase, is a negative regulator
of ABA and stress signaling in this plant (Xiong et al., Genes Dev. 15(15):
1971-1984, 2001 ), providing evidence that phosphoinositols mediate ABA
and stress signal transduction in plants.
A BLAST analysis comparing the nucleotide sequence of OsPN23045
against TMRi's GENECHIP~ Rice Genome Array sequence database
identified probeset OS006742.1 at (e = 0 expectation value) as the closest
match. Gene expression experiments indicated fihat this gene is specifically
expressed in leaf and stem.
The bait clone encoding amino acids 100 to 250 of O. sativa Chilling-
Inducible Protein CAA90866 (OsCAA90866) was also found to interact with
protein PN23225, which is a novel 792-amino acid protein similar to T.
aestivum initiation factor (iso)4f p82 subunit (p82) (GENBANK~ Accession
No. AAA74724; 69.6% amino acid sequence identity; e=0). One prey clone
encoding amino acids 639 to 792 of OsPN23225 was retrieved from the
input trait library. The wheat protein contains possible motifs for ATP
binding, metal binding, and phosphorylation (Allen et al., J. Biol. Chem.
267(32): 23232-23236, 1992). OsPN23225 contains an MIF4G domain
(amino acids 207 to 434) named after Middle domain of eukaryotic initiation
factor 4G (eIF4G), and an MA3 domain (amino acids 627 to 739) also found
in eIF proteins (Ponting, C.P., Trends Biochem. Sci. 25(9): 423-426, 2000).
These domains are found in molecules that participate in mRNA decay
pathways. Although the function of the bait chilling-inducible protein
CAA90866 is not well defined, it appears to be a nuclear protein and its
interaction with the eIF-like protein OsPN23225 supports the notion that
CAA90866 participates in the rice transcriptional machinery. The
identification of the OsPN23225 prey protein likely represents the discovery
of a novel rice eIF.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
237
A BLAST analysis comparing the nucleotide sequence of OsPN23225
against TMRI's GENECHIP~ Rice Genome Array sequence database
identified probeset OS003249_ at (e ~' expectation value) as the closest
match. The expectation value is too low for this probeset to be a reliable
indicator of the gene expression of OsPN23225.
The bait clone encoding amino acids 100 to 250 of O. sativa Chilling-
Inducible Protein CAA90866 (OsCAA90866) was also found to interact with
OsPN29883, a 340-amino acid fragment that is similar to A. thaliana putative
2-dehydro-3-deoxyphosphooctonate aldolase (GENBANK~ Accession No.
NP_178068; 3e X42 expectation value) and pea (Pisum sativum) 2-dehydro-3-
deoxyphosphooctonate aldolase (KdoBP synthase) (GENBANK~ Accession
No. 050044; 3e ~4z expectation value). One prey clone encoding amino
acids 58 to 175 of OsPN29883' was retrieved from the output trait library.
KdoBP synthase in pea catalyzes the biosynthesis of Kdo-8-P, a component
of lipopolysaccharide of plant cell walls, with high structural and functional
similarities to enterobacterial KdoBP synthase (Brabetz et al., Plants 212(1):
136-143, 2000).
Summary
The interactors identified for the OsPP2A-2 bait protein (i.e., proteins
that bind to OsPP2A-2) comprise a network that is speculated to be
associated with the plant defense response to pathogens. Among the five
novel rice proteins identified as interactors for OsPP2A-2, Os23268 is similar
to the A. thaliana tryptophan biosynthetic enzyme anthranilate
phosphoribosyltransferase. This enzyme is encoded by a gene that is
similar to the DESCA11 gene involved in resistance to virus infection
(Cooper, B., Plant J. 26(3): 339-49, 2001 ). While the role of tryptophan in
disease resistance is unknown, tryptophan is used in the biosynthesis of
indol-3-acetic acid, a plant hormone and signaling molecule. Tryptophan
can thus have a role in modulation of gene expression in plants. Moreover,
the glycosyl transferase function in Os23268 can be associated with disease
resistance signaling pathways or with phytoalexin cellular distribution.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
238
Phytoalexins are low-molecular-weight antimicrobial compounds that
accumulate in plants as a result of infection or stress, and the rapidity of
their
accumulation is associated with resistance in plants to diseases caused by
fungi and bacteria. Taken altogether, these data suggest that anthranilate
phosphoribosyltransferases plays a role in the plant response to pathogen
infection. Moreover, gene expression experiments confirmed that this gene
is induced by the fungal pathogen M. grisea. Thus, the anthranilate
phosphoribosyltransferase-like novel protein Os23268 is believed to be
involved in the signaling and regulation pathways that mediate the response
of rice to biotic stress.
Novel protein Os011994-D16, similar to DnaJ protein, is another
interactor for OsPP2A-2 with a likely role in the pathogen-induced defense
response. DnaJ-like proteins are known to be regulators of heat shock
proteins and are thus part of the plant protective stress response. Gene
expression experiments support this notion, indicating that the gene
encoding the DnaJ-like protein of this Example is repressed by jasmonic
acid, a component of signaling networks that provide the specificity of plant
pathogen-induced defense responses (reviewed in Nurnberger and Scheel,
Trends Plant Sci. 6(8): 372-379, 2001 ).
OsPP2A-2 was also found to interact with the novel protein
OsORF020300-2233.2, which is similar to A. thaliana PP2A regulatory
subunit and to rice chilling inducible protein CAA90866 (OsCAA90866) (the
second bait protein of this Example). The similarity of OsORF020300-223 to
PP2A regulatory subunit validates its interaction with the PP2A-2 catalytic
subunit, this interaction being consistent with the subunit composition of
PP2A enzymes (Awotunde et al., Biochim Biophys Acta 1480(1-2): 65-76,
2000). The OsORF020300-223-OsPP2A-2 interaction suggests that
OsORF020300-223 participates in signaling events that involve OsPP2A-2
enzymatic activity, and the similarity of OsORF020300-223 to rice chilling-
inducible protein OsCAA90866 suggests that cold tolerance can involve one
of these signaling events.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
239
OsPP2A-2 was also found to interact with rice putative proline-rich
protein OsAAK63900. Though it has no known DNA-binding motif, there are
indications that OsAAK63900 can play a role as a transcriptional regulator.
It has an HLH domain common to transcription factors, although this domain
mediates protein dimerization only. It also has a gntR family signature
common to bacterial DNA-binding transcriptional regulators, although the
function of this domain is not known. The existence of the Ole a I suggests
that OsPP2-2 can dephosphorylate OsAAK69300, thus regulating its
function as a pollen protein, although the lack of data on the Ole a I
signature function makes this possibility more difficult to argue. Evidence
also exists that PP2A proteins regulate the DNA-binding activity of
transcription factors in plants Vazquez-Tello et al., Mol. Gen. Genet. 257(2):
157-166, 1998) and mammalian cells (Wadzinski et al., Mol. Cell Bioi. 13(5):
2822-2834, 1993). Therefore, it is most likely that the OsPP2A-2-
OsAAK63900 interaction occurs in the nucleus and that if plays a role in
' regulating transcriptional events in rice.
Other proteins found to interact with OsPP2A-2 include a disulfide
isomerase with a putative role in protein folding (novel protein OsPN26645),
a voltage-dependent ion channel protein (novel protein OsPN24162) and the
seed storage protein glutelin (OsCAA33838). The biological significance of
these interactions is unclear. Analysis of the amino acid sequence of glutelin
identified several protein kinase C and casein kinase II phosphorylation
sites. It is possible that the phosphorylation state of glutelin determines
ifs
function or stability, and its interaction with OsPP2A-2 can occur during
dephosphorylation of glutelin. Alternatively, this interaction can result in
localization of OsPP2A-2 and thereby affect events downstream of OsPP2A-
2-dependent dephosphorylation. Given the presence of a disulfide bond
between the two peptide chains of typical plant seed storage proteins, it is
interesting that OsPP2A-2 also interacts with a putative protein disulfide
isomerase (OsPN26645). Perhaps OsPP2A-2 interacts with other enzymes
to create a co-translational modification complex. Additional yeast-two-
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
240
hybrid data can clarify the purpose of these interactions. However, given the
association of PP2A with other proteins involved in biotic stress responses,
the aforementioned associations could also be involved in biotic stress
responses.
The chilling-inducible protein CAA90866 was found to interact with
itself and with six proteins. These proteins are speculated to interact as
components of a network of proteins relevant to the rice response to cold
stress. This hypothesis finds support in gene expression experiments, which
confirmed that the gene encoding the chilling-inducible protein is induced by
cold. One of the interactors is the putative 14-3-3 protein Os008938-3209.
The relationship to chilling tolerance of the bait protein OsCAA90866
suggests that its interaction with Os008938-3209 can be associated with
cold tolerance. Gene expression experiments showed that this protein is
induced under a broad range of stress conditions. Its activation probably
allows its interaction with a number of stress proteins. Given the function of
14-3-3 proteins as molecular chaperones, Os008938-3209 can act as a
molecular glue for these interactions to preserve protein complex stability in
membranes, or it can coordinate interactions involving transcription factors
associated with stress genes. Subcellular localization of Os008938-3209
can further clarify the significance of its interaction with OsCAA90866.
Another interactor for OsCAA90866 is a pyrrolidone carboxyl
peptidase-like protein (OsAAG46136). The putative pyrrolidone carboxyl
peptidase function of OsAAG46136 suggests that it participates in
processing and/or activation of substrate proteins, and these proteins can be
important to the plant response to chilling. Peptidase activity has been
associated with regulation of signaling. Carboxypeptidases, for instance,
hydrolytically remove the pyroglutamyl group from peptide hormones,
thereby activating these signaling molecules. A carboxypeptidase regulates
Brassinosteroid-insensitive 1 (BR11 ) signaling in A, thaliana by proteolytic
processing of a protein (Li et al., Proc. Natl. Acad. Sci. USA 98(10): 5916-
5921, 2001 ). Based on its ability to interact wifih chilling-inducible
protein
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
241
and on the role of the latter in chilling tolerance, it is speculated that the
carboxypeptidase-like protein OsAAG46136 can have a role in activating
signaling molecules/hormonal peptides that are involved in the plant
response to cold stress.
The interactions of OsCAA90866 with OsPN23045, a protein with a
putative inositol phosphate function, and with OsPN23225, a rice homolog of
wheat initiation factor (iso)4f p82 subunit, provide further insight into the
function of the bait protein. Phosphoinositols are known to mediate ABA and
stress signal transduction in plants (Mikami et al., Plant J. 15(4): 563-568,
1998; Xiong et al., Genes Dev. 15(15): 1971-1984, 2001 ). The putative
inositol phosphatase protein OsPN23045 can function in a similar way and
its interaction with the chilling-inducible protein can be associated with
regulation of cell signaling events that relate to cold tolerance. The prey
protein OsPN23225 likely represents a novel rice eIF. The eIF proteins have
a role in RNA processing pathways (Ponting C.P., Trends Biochem. Sci.
25(9): 423-426, 2000) and stress is typically associated with an abundance
of RNA transcripts. Based on this information and on the relationship that
CAA90866 has to chilling tolerance, the OsCA90866- PN23225 interaction is
speculated to control translationai events related to cold stress.
Finally, OsCAA90866 interacts with and is similar to the same
putative PP2A regulatory subunit protein OsORF020300-223 found to
interact with the bait protein OsPP2A-2. This interaction provides a link
between the two networks of this Example and suggests the involvement of
OsPP2A-2 in both biotic and abiotic stress response pathways (see diagram
in Appendix 1 ). Based on the observed interactions and on sequence
similarities among the proteins involved in these interactions, OsPP2A-2
appears to regulate both biotic and abiotic stress response pathways. Thus,
the two pathways, though independent, are speculated to be linked through
protein phosphatases, and that these enzymes likely mediate the plant's
sfiress response by dephosphorylation of the proteins participating in these
pathways. In this scenario, it is possible that the self interaction observed
for
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
242
OsCAA90866 participates in the creation of multicomponent phosphatase
complexes. Furthermore, the interaction of OsCA90866 with the aldolase-
like protein OsPN29883 suggests that the aldolase needs to be
dephosphorylated for activation/inactivation, and that this novel protein can
have roles during stress responses based upon the other interactions and
the gene expression patterns of the chilling-inducible protein.
Moreover, OsORF020300-223 the A. thaliana regulatory A subunit of
protein phosphatase 2A (PP2A-A) has been implicated in the regulation of
auxin transport in A. thaliana (Garbers et al., EMBO J. 15(9): 2115-2124,
1996). The phytohormone auxin controls processes such as cell elongation,
root hair development and roof branching. Since OsORF020300-223 is also
similar to and interacts with chilling-inducible protein CAA90866, it is
possible that the latter can be involved in auxin transport.
References
The references listed below as well as ail references cited in the
specification are incorporated herein by reference to the extent that they
supplement, explain, provide a background for or teach methodology,
techniques and/or compositions employed herein.
Aasland et al. (1995) Trends Biochem. Sci. 20: 56-59.
Abdel-Ghany et al. (2000) DNA Cell Biol. 19: 567-578.
Abler et al. (1993) Plant MoL Biol. 22: 1031-1038.
Ach & Gruissem (1997) Proc. Natl. Acad. Sci. USA 91: 5863-5867.
Ackiand & Peters, (1999) Drug Resist. Update 2: 205-214.
Agrawal S (ed.) (1993) Methods in Molecular Bioloay, volume 20, Humana
Press, Totowa, New Jersey, United States of America.
Agueli et al. (2001 ) Biochem. J. 360: 413-419.
Aihara et al. (2000) J. Neurochem. 74: 2622-2625.
Ajuh et al. (2001 ) J. Biol. Chem. 276: 42370-42381.
Allen et al. (1992) J. Biol. Chem. 267: 23232-23236.
Allison et al. (1986) Virology 154:9-20.
Altschul et al. (1990) J. MoL Biol. 215:403.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
243
Altschul et al. (1997) Nucl. Acids Res. 25: 3389.
An et al. (1985) EMBO J. 4: 277.
Antoku et al. (2001 ) Biochem. Biophys. Res. Commun. 286: 1003-1010.
Aoyama & Chua (1997) Plant J 11:605-612.
Apte et al. (1995) FEBS Lett. 363: 304-306.
Arino et al. (1993) Plant Mol. Biol. 21: 475-485.
Arioli et al. (1998) Science 279: 717-720.
Auch & Reth (1990) Nucl. Acids Res. 18: 6743.
Austin et ai. (2002) Science 295: 2077-2080.
Ausubel et al. (1988) Current Protocols in Molecular Bioloay, John Wiley &
Sons, New York, New York, United States of America.
Awade et al. (1994) Proteins 20: 34-51.
Awotunde et al. (2000) Biochim Biophys Acta 1480: 65-76.
Azevedo et al. (2002) Science 295: 2073-2076.
Aznar & Lacal (2001 ) Prog. Nucleic Acid Res. MoL Biol. 67: 193-234.
Baluska et al. (2001 ) Plant Physiol. 126: 39-46.
Bartel & Fields (eds.), (1997) The Yeast Two-Hybrid System, Oxford Press.
Bartlett et al. (1982) in Methods in Chloro~last Molecular Bioloay, (Edelman
et al., eds.) Elsevier Biomedical Press, New York, New York, United
States of America, pp. 1081-1091.
Baskin et al. (1992) Aust. J. Plant Physiol. 19: 427-437.
Batzer et al. (1991 ) Nucleic Acid Res. 19:5081.
Baunsgaard et al. (1998) Plant J. 13: 661.
Beerli et al. (1998) Proc Natl Acad Sci U S A 95:14628-14633.
Bergeron et al. (1994) Trends Biochem. Sci. 19: 124-128.
Bertolaet et al. (2001 ) Nat. Struct. Biol. 8: 417-422.
Bevan (1984) Nucl. Acids Res. 12:8711.
Bevan et al. (1983) Nature 304:184-187.
Bezzi et al. (2001 ) Nat. Neurosci. 4: 702-710.
Biedenkapp et al. (1988) Nature 335: 835-837.
Bierkens et al. (2000) Toxicology 153: 61-72.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
244
Bihn et al. (1997) Plant J. 12: 1439-1445.
Binet et al. (1991 ) Plant Mol Biol 17:395-407.
Bischoff et al. (1994) Proc. Natl. Acad. Sci, USA 91: 2587-2591.
Bisikirska et al. (1997) Z. Naturforsch 52: 180-186.
Blochinger & Diggelmann (1984) Mol Cell Bio14:2929-2931.
Bolhuis et al. (1998) J. Biol. Chem. 273: 21217-21224.
Borisjuk et al. (1998) Planta 206: 504-14.
Bornemann et al. (1996) Biochemistry 35: 9907-9916.
Bourouis & Jarry (1983) EMBO J 2:1099-1104.
Brabetz et al. (2000) Planta 212: 136-143.
Bradweli et al. (1994) Genies Dev. 8: 1664-1677.
Braun (2001 ) Plant Physiol. 125:1611-1619.
Briknarova et al. (2001 ) Nat. Struct. Biol. 8: 349-352.
Browns & Bicknell (1998) Biochem. J. 334: 1-8.
Bruggemann et al. (1996) Plant J 10:755-760.
Brummelkamp et al. (2002) Science 296: 550-3.
Brunner et al.. (1998) Plant J. 14: 225-34.
Buchanan et al. (eds.), (2002) Biochemistr rLand Molecular Bioloay of Plants,
John Wiley & Sons, New York, New York, United States of America.
Buck & Guest (1989) Biochem. J. 260: 737-747.
Bulledi & Freedman (1988) Nature 335: 649-651.
Burglin et al. (1997) Nucl. Acids Res. 25: 4173-4180.
Bursch (2001 ) Cell Death Differ. 8: 569-81.
Busch et al. (1990) Trends Genet. 6: 36-40.
Byrne et al. (1987) Plant Cell Tissue Org Culture 8: 3.
Caddick et al., (1998) Nat Biotechnol 16:177-180.
Callebaut & Mornon (1997) FEBS Lett. 400: 25-30.
Callis et al. (1987) Genes Dev. 1: 1183.
Callis et al., (1990) J Biol Chem 265:12486-12493.
Cao et al. (2000) Arch Biochem Biophys. 373: 135-46.
Casas et al., (1993) Proc Natl Acad Sci U S A 90:11212-6.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
245
Cash (1996) Med Hypotheses 47: 455-459.
Chan et al. (1998) Biochim. Biophys. Acta 1442: 1-19.
Chee et al. (1989) Plant Physiol. 91:1212.
Chen et al. (1993) Science 262: 1883-1886.
Chen et al. (2002) Plant Cell 14: 559-574.
Chibbar et al., (1993) Plant Cell Rep 12:506-509.
Choi et al. (1995) Mol Gen, Genet. 246:266.
Christensen et al., (1989) Plant Mol Biol 12:619-632.
Christou et al. (1988) Plant PhysioL 87:671.
Christou et al. (1989) Proc. Natl. Acad. Sci. USA 86:7500.
Christou et al., (1991 ) BiolTechnology 9: 957-962.
Chuang & Meyerowitz, (2000) Proc Natl Acad Sci U S A 97:4985-90.
Chung et al. (1994) Plant Mol. Biol. 26: 657-665.
Claes et al. (1990) Plant Ce112: 19-27.
Ciose et al. (1989) Plant Mol. Biol. 13: 95-108.
Comai et al., (1988) J Biol Chem 263:15104-15109.
Conceicao et al. (1994) Plant 5:493.
Corpet et al. (1988) Nucl. Acids Res. 16:10881.
Creighton, (1984) Proteins, WH Freeman & Co., New York, New York,
United States of America.
Crossway et al. (1986) BiolTechniques 4:320.
Cruz et al. (1998) P. R. Health Sci. J. 17: 323-326.
Cyr et al. (1994) Trends Biochem. Sci. 19: 176-181.
Dasgupta et al. (1993) Gene 133: 301.
Dasso (2000) Cell 104: 321-324.
Dat et al. (2001 ) Redox Rep. 6: 37-42.
Datta et al. (1990) BiolTechnology 8: 736.
Davies et al. (1996) EMBO J. 15:4330-4343.
De Biock et al. (1989) Plant Physiol. 91:694.
de Framond, (1991 ) FEBS Lett 290:103-6.
Delta-Cioppa et al. (1987) Plant Physiol. 84:965.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
246
De Lille et al. (2001 ) Plant Physiol. 126: 35-38. ,
Denecke et al. (1995) Plant Cell7: 391-406.
Doelling et al. (2001 ) Plant J. 27: 393-405.
Dong et al., (1996) Mol Breeding 2:267-276.
Doonan et al. (1997) Curr. Opin. Cell. Biol. 9: 824-830.
Dunigan & Madlener (1995) Virology 207: 460-466.
Dure et al. (1989) Plant Mol. Biol. 12: 475-486.
Dwyer et al. (1996) Biochim Biophys Acta 1289: 231-237.
Ecker (1995) Science 268: 667-675.
Ecker & Davis, (1986) Proc Natl Acad Sci USA 83:5372-5376.
Edwards et al. (1988) J. Mol. Biol. 203: 523-524.
Elbashir bet al., (2001 ) EMBO J 20:6877-88.
Eige et ai. (2001 ) Plant J. 26: 561-571.
Ellenberger (1994) Curr. Opin. Struct. Biol. 4: 12-21.
Ellis et al. (1987) EMBO J., 6:3203.
Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA. 86:6126.
EP 0 120 516
EP0138341
EP 0 292 435
EP 0 295 959
EP 0 301 749
EP 0 332 104
E P 0 332 581
EP 0 342 926
EP 0 392 225
EP 1 116 793
Everett et al. (1987) BiolTechnology 5:1201.
Fardel et al. (2001 ) Toxicology 167: 37-46.
Feys et al. (2001 ) EMBO J. 20: 5400-5411.
Fire et al. (1998) Nature 391: 806-811.
Firek et al., (1993) Plant Mol Bio122:129-142.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
247
Frary et al. (2000) Science 289: 85-88.
Freier et al., (1986) Proc Natl Acad Sci USA 83:9373-9377.
Fromental-Ramain et al. (1996) Development 122: 461-472.
Fromm et al. (1986) Nature 319: 791.
Fromm et al. (1990) BiolTechnology 8: 833.
Fromme et al. (2001 ) Biochim. Biophys Acta 1507: 5-31.
Fujiyama et al. (2001 ) J. Comp. Neurol. 435: 379-387.
Gaedeke et al. (2001 ) EMBO J. 20: 1875-1887.
Gallie et al. (1987) Nucl. Acids Res. 15:3257.
Gallie et al. (1989) Plant Cell 1:301.
Gallois et al. (1997) Plant J. 11: 1325-1331.
Garbers et al. (1996) EMBO J. 15: 2115-2124.
Garcia efi al. (1998) Plants 207: 172-80.
Garcia et al. (2000) Microbes Infect. 2: 401-407.
Carrel & Campuzano (1991 ) BioEssays 13: 493-498.
Gehring (1992) Trends Biochem. Sci. 17: 277-280.
Gehring & Hiromi (1986) Ann. Rev. Genet. 20: 147-173.
Gillet et al. (1998) Plant J. 16: 257-262.
Glazebrook et al. (9996) Genetics 143: 973-982.
Godwin et al. (1998) Proc. Natl. Acad. Sci. USA 95: 13042-13047.
Goeddel, (1990) Methods in En~mologY, Volume 185, Academic Press,
San Diego, California, United States of America.
Goff (2001 ) Plant J. 26: 339-349.
Goff et al. (2002) Science 296: 92-100.
Gocal et al. (2001 ) Plant Physiol. 125: 1788-1801.
Cordon Kamm et al. (1990) Plant Ce112:603.
Greco et al. (1997) Mol. Gen. Genet. 253: 615-623.
Green, (2000) Trends Biochem Sci 25:59-63.
Green et al., (1986) Ann Rev Biochem 55:569-597.
Gritz et al. (1983) Gene 25:179.
Grotewold et al. (1991 ) Proc. Natl. Acad. Sci. USA 88: 4587-4591.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
24~
Groves, et al. (1999) Curr. Opin. Struct. Biol. 9: 383-389.
Gruber et al. (1993) Vectors for Plant Transformation, in Methods in Plant
Molecular Bioloay, Glich et al. eds, pp. 89-119, CRC Press.
Guan & Scandalios (1996) J. Mol. Evol. 42: 570-579.
Guo et al. (2000) EMBO J. 19: 6891-6899.
Gyuris et al. (1993) Cell 1993, 75: 791-803.
Hake et al. (1995) Philos Trans. R Soc. Lond. B Biol. Sci. 350: 45-51.
Hammerschmidt (1999) Ann. Rev. Phytopathol. 37: 285-306.
Hannig et al. (1995) Bioessays 17: 915-919.
Haraven et al. (1996) Cell 84: 735-44.
Harlow & Lane, (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, United States of
America.
Harper efi al. (1991 ) Science 252: 951-954.
Harris et al. (1999) Plant Physiol. 121: 609-617.
Hartwig (1995) Protein Profile 2: 703-800.
Hassan et al. (1995) Biochem. Biophys. Res. Commun. 211: 54-49.
Hatzfeld (1999) Int. Rev. Cytol. 186: 179-224.
Hayashi et al. (2001 ) J. Biol. Chem. 276: 43400-43406.
Haydon & Guest (1991) FEMS Microbiol. Lett. 79: 291-296.
Hedden & Kamiya (1977) Annual Rev. Plant Physiol. Plant Mol. Biol. 48:
431.
Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA, 89:10915.
Hiei et al. (1994) Plant J. 6:271.
Hiei et al., (1997) Plant Mol Biol 35:205-18.
Higgins et al. (1988) Gene 73:237.
Higgins et al. (1989) CABIOS 5:151.
Higo & Higo (1996) Plant Mol. Biol. 30: 505-521.
Hinchee et al. (1988) BiolTechnology 6:915.
Hoekema (1985) in The Binary Plant Vector System, Offset-drukkerij Kanters
B.V.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
249
Hoik et al, (1996) Planf Mol. Biol. 31: 1153-1161.
Hong et al. (2001 ) Plant Cell 13: 755-768.
Huang et al. (1992) CABIOS 8:155.
Huang et al. (1996) Plant Mol. Biol. 33:125.
Huber et al. (1997) Ce1190: 871-882.
Hudspeth & Grula, (1989) Plant Molec Biol 12:579-589.
Hurst (1995) Protein Prof. 2: 105-168.
Imhof & Wolffe (1999) Biochemistry 38: 13085-13093.
Ishikawa et al. (2001 ) Plant J, 27: 89-99.
Janssens & Goris (2001 ) Biochem J. 353: 417-439.
Jasencakova et ai. (2001 ) Chromosoma 110: 83-92.
Jasinski et al. (2001 ) Plant Cell 13: 1095-107.
Jia et al. (2000) Plant Sci. 155:115-122.
Jin & Martin (1999) Plant Mol. Biol. 4: 577-585.
Jobling & Gehrke (1987) Nature 325:622.
John et al. (2001 ) Protoplasma 216: 119-142.
Johnson et al. (1997) J. Biol. Chem. 272: 7106-7113.
Jorgensen et al., (1996) Plant Mol Biol 31:957-973.
Josefsson et al. (1987) J. Biol. Chem. 262:12196.
Kagedal et al. (2001 ) Biochem J. 359: 335-343.
Kaitna et al. (2000) Curr. Biol. 10:1172-1181.
Kang et al. (1995) Plant Mol. Biol. 29:1-10.
Kang et al. (1997) Mol. Cells 7: 45-51.
Kao et al. (2000) Biochem. Biophys. Res. Commun. 267: 201-207.
Karlin & Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264.
Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873.
Kato & Dang (1992) FASEB J. 6: 3065-3072.
Kawalleck et al. (1992) Proc. Natl. Acad. Sci. USA 89:4713-7.
Keegan et al., (1986) Science 231:699-704.
Kehres et al. (1998) Microb. Comp. Genomics 3: 151-169.
Kelly (1999) Altern. Med. Rev. 4: 249-265.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
250
Kempin et al., (1997) Nature 389:802-803.
Kerstetter et al. (1997) Development 124: 3045-3054.
Kidou et al. (1993) FEBS Left. 332: 282-286.
Kim et al. (200'1 ) Planf Physiol. 127: 1243-1255.
Kitade et al. (1999) Nucl. Acids Symp. Ser 42: 25-26.
Klein et al. (1988) BiolTechnology 6:559.
Kline et al. (1987) Nafure 327:70.
Knauf et al. (1983) Analysis of Host Range Expression by Agrobacterium, in
Molecular Genetics of the Bacteria-Plant Interaction, Puhler, . (ed.),
Springer-Verlag.
Kobe et al. (1994) Trends Biochem. Sci. 19: 415-421.
Kong & Steinbiss (1998) Arch Virol 143:1791-1799.
Koonin (1993) J. Mol. Biol. 229: 1165-1174.
Korfhage et al. (1994) Plant Cell 6: 695-708.
'Kossman & Lloyd (2000) Crit. Rev. Biochem. Mol. Biol. 35: 141-196.
Kostyal et al. (1998) Clin. Exp. Immunol. 112: 355-362.
Kosugi & Ohashi (2002) Plant Physiol. 128: 833-843.
Koziel et al. (1993) Biotechnology 11:194.
Krause et al. (1990) Cell 63: 907-919.
Kruse et al. (1995) Planta 196: 796-803.
Kyozuka et al. (2000) Plant Cell Physiol. 41:710-718.
Kyte & Doolittle, (1982) J Mol Biol 157:105-132.
Lacombe et al. (2001 ) Science 292: 1486-1487.
Lamb & Dixon (1997) Ann. Rev. Plant Biol. 48: 251.
Landolt (1986,) Biosystematic Investigation on the Family of Duckweeds: The
family of Lemnaceae - A Monograph Study, Geobatanischen Institut
ETH, Stiftung Rubel, Zurich.
Landschulz et al. (1988) Science 240: 1759-1764.
Langenkamper et al. (2001 ) J. Exp. Bot. 52: 1545-1554.
Laursen et al. (1994) Planf Mol. Biol. 24:51.
Lebel et al., (1998) Plant J 16:223-233.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
251
Lechner et al. (1996) Biochim Biophys Acta 1296: 181-188.
Lee et al. (1994) Plant Mol. Biol. 26:1981.
Lefterov et al. (2000) FASEB J. 14: 1837-1847.
- Lenny et al. (1997) Mol. Biol. Rep. 24: 157-168.
Le Saux et al. (1996) J. Bacteriol. 178: 3308-3313.
Leslie et al. (2001 ) Toxicology 167: 3-23.
Levine et al., (1994) Cell79: 583-593.
Li & Komatsu (2000) Eur: J. Biochem. 267: 737-745.
Li & Nam (2002) Science 295: 1299-1301.
Li et al. (2001 )Proc. Natl. Acad. Sci. USA 98: 5916-5921.
Lim et al. (1999) Plant Physiol. 120: 1193-1204.
Lim et al. (2000) Plant Mol. Biol. 44: 513-527.
Lincoln et al. (1994) Plant Cell6: 1859-1876.
Lindholm et al. (2000) Mech. Dev. 93: 169-173.
Lindsey et al. (1993) Transgen. Res. 2: 3347.
Liu et al. (1992) Antiviral Res. 19: 247-265.
Liu et al., (1999) Genome Res 9:859-867.
Logemann et al., (1989) Plant Cell 1:151-158.
Lommel et al. (1991 ) Virology 181:382.
Lopez-Dee et al. (1999) Dev. Genet. 25: 237-244.
Lorz et al. (1985) Mol. Gen. Genet. 199: 178.
Ma et al. (1988) Nature 334: 631.
Macejak & Sarnow, (1991 ) Nature 353:90-94.
Magyar et al. (2000) FEBS Left. 486: 79-87.
Maki et al. (1993) Methods in Plant Molecular Biology, Glich et al. eds, pp.
67-88, CRC Press.
Malz & Sauter (1999) Plant Mol. Biol. 40: 985-995.
Manjunath et al. (1997) Planf Mol. Biol. 33:97.
Mann & Affolter (1998) Curr. Opin. Genet. Dev. 8: 423-429.
Mannervick (1999) Bioessays 21: 267-270.
Martinez et al. (1989) J. Mol. Biol. 208:551.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
252
Martinez et al. (2000) Plant PhysioL 122: 757-766.
Massey (2000) Biochem. Soc. Trans. 28: 283-296.
Mayer et al. (2001 ) Phytochemistry 58: 33-41.
Mayo, (1987) The Theory of Plant Breeding, Second Edition, Clarendon
Press, New York, New York, United States of America.
McBride et al. (1994) Proc. Natl. Acad. Sci. USA 91: 7301.
McBride et al. (1990) Plant Mol. Biol. 14: 266.
McCabe et al. (1988) BiolTechnology 6:923.
McElroy et al., (1990) Plant Ce112:163-71.
McEwen, et al. (2001 ) Mol. Biol. Cell. 12: 2776-89.
McLeod (1986) Bioessays 6: 208-212.
Medina et al. (2001 ) Plant Physiol. 125: 1655.
Merkie et al. (1994) Plant J. 6: 555-565.
Messing & Vierra (1982) Gene 19:259.
Miao & Lam, (1995) Plant J 7:359-365.
Michalak et al. (1992) Biochem. J. 285: 681-692.
Michalak et al. (1998) Biochem. Cell. Biol. 76: 779-785.
Michelis et al. (2000) Plant Mol. Biol. 44: 487-498.
Mikami et al. (1998) Plant J. 15: 563-568.
Moon et al. (1999) Plant Physiol. 120: 1193-1204.
Moons et al. (1998) Plant J. 15: 89-98.
Morita et al. (2001 ) Curr. Pharm. Biotechnol. 2: 257-267.
Muehlbauer et al, (1999) Plant Physiol. 119: 651-62.
Mukumoto et al., (1993) Plant Mol Bio123: 995-1003.
Muller et ai. (1995) Nafure 374: 727-730.
Mundy & Chua (1988) EMBO J. 7: 2279-2286.
Munro & Pelham (1987) Cell48: 899-907.
Munster et al. (2001 ) Gene 262:1-130.
Murre et al. (1989) Cell 56: 777-783.
Muslin & Xing (2000) Cell Signal 12: 703-709.
Myers & Miller (1988) CABIOS 4:11.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
253
Nagamara-Inoue et al. (2001) Int. Rev. Immunol. 20: 83-105.
Nakamura et al. (1996) Plant Mol. Biol. 30: 381-385.
Needleman & Wunsch (1970) J. MoL BioL 48:443.
Negrotto et al., (2000) Plant Cell Reports 19:798-803.
Nelson et al. (1997) Plant Physiol. 114: 29-37.
Nepveu (2001 ) Gene 270: 1-15.
Ng & Yanofsky (2001 ) Nat. Rev. Genet. 2: 186-195.
Nielsen et al. (1986) J. Biol. Chem. 261: 3661-3669.
Norris et al., (1993) Plant Mol Biol 21:895-906.
Nurnberger & Scheel (2001 ) Trends Plant Sci. 6: 372-379.
O'Connell et al. (2001 ) J. Biol. Chem. 276: 43065-43073.
Odagaki et al. (1999) Structure Fold Des. 7: 399-411.
Ohtsuka et al., (1985) J. Biol. Chem. 260:2605-2608.
Oliveira et al. (2001 ) Braz. J. Med. Biol. Res. 34: 567-575.
Ono et al. (1996) Plant PhysioL 112: 483-491.
Ono et al. (2001 ) Proc. Natl. Acad. Sci. USA 98: 759-764.
Oppenheimer et al. (1991 ) Cell 67: 483-493.
Orzaez & Granell (1997) FEBS Lett. 404: 275-278.
O'Shea et al. (1989) Science 243: 538-542.
Pacciotti et al. (1985) BiolTechnology 3:241.
Panavas et al. (1999) Plant Mol. Biol. 40: 237-248.
Park et al. (1985) J. Plant Biol., 38:365.
Park et al. (1998) EMBO J. 17: 859-867.
Pascual et al. (2000) J. Mol. Biol. 304: 723-729.
Paszkowski et al. (1984) EMBO J. 3:2717.
PCT International Publication No. WO 93!05163
PCT International Publication No. WO 93/07278
PCT International Publication WO 93/21335
PCT International Publication WO 94/00977
PCT International Publication No. WO 94/20627
PCT International Publication No. WO 95/16783
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
254
PCT International Publication WO 95/19431
PCT International Publication WO 96/06166
PCT International Publication WO 98/54311
PCT International Publication WO 99/32619
PCT International Publication WO 99/53050
PCT International Publication WO 99/61631
PCT International Publication No. WO 00/07210
PCT International Publication No. WO 00/760067
PCT International Publication No. WO 01/07618
Pearson & Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444.
Pearson et al. (1994) Meth. Mol. Biol. 24:307.
Peifer et al. (1990) Cell 63:1167-76.
Peifer et al. (1994) Cell 76:789-791.
Pelham (1990) Trends Biochem. Sci. 15: 483-486.
Perrin (2001 ) Curr. Biol. 11: 8213-8216.
Persson et al. (2001 ) Plant Physiol. 126: 1092-1104.
Phillips et al. (1988) in Corn and Corn Improvement, 3rd ed, Sprague et al.
eds., Amer. Soc of Agronomy.
Picard et ai., (1988) Cell54: 1073-1080.
Pih et al. (1999) Mol. Cells 9: 84-90.
Ponting (2000) Trends Biochem. Sci. 25: 423-426.
Ponting & Parker (1996) Protein Sci. 5: 162-166.
Postma-Haarsma et al. (2002) Plant Mol Biol 48: 423-41.
Potrykus (1985) Trends Biotech. 7:269.
Potuschak & Doerner (2001 ) Curr. Opin. Plant Biol. 4: 501-506.
Powell et al., (1989) Proc. Natl. Acad. Sci. USA 86:6949-6952.
Presley et al. (2002) Nature 417: 187-193.
Purugganan et al. (1995) Genetics 140: 345-356.
Ratajczak (2000) Biochim Biophys Acta 1465: 17-36.
Raven et al. (1999) Biology of Plants, Freeman/Worth.
Rea et al. (1998) Annu. Rev. Plant Physiol. Plant Mol. Biol. 49: 727-760.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
255
Reddy (2001 ) Int. Rev. Cytol. 204: 97-178.
Redei & Koncz, (1992) in Methods in Arabidopsis Research (Koncz C, Chua
N-H & Schell J, eds.) World Scientific Press, River Edge, New Jersey,
United States of America, pp. 16-82.
Reed et al., (2001 ) In Vitro Cell Dev Biol-Plant 37:127-132.
Reichelt et al. (1999) Plant J. 19: 555-567.
Reiser et al. (1995) Cel183:735.
Reizer et al. (1991) Mol. Microbiol. 5: 1081-1089.
Riechmann et al. (1994) Nucl. Acids Res. 22: 749-755.
Riechmann & Meyerowitz (1997) Biol. Chem. 378: 1079-1101.
Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602.
Ritz et al. (2001 ) J. Biol. Chem. 276: 22273-22277.
Robertson & Chandler (1992) Plant Mol. Biol. 19: 1031-1044.
Robins et al. (1998) J. Med. Chem. 41: 3857-3864.
Robles et al. (1997) J. Neurosci. Res. 47: 90-97.
Rogers et al., (1985) Proc. Natl. Acad. Sci. USA 82:6512-6516.
Rogers et al. (2001 ) J. Biol. Chem. 276: 30994-30922.
Rohrmeier & Lehfe, (1993) Plant Mol Biol 22:783-792.
Roosens et al. (2000) Biochim. Biophys. Acta 1463: 470-476.
Rossolini et al., (1994) Mol Cell Probes 8:91-98.
Roth et al., (1991) Plant Cel13:317-325.
Rothstein et al. (1987) Gene 53:153.
Ruberti et al. (1991 ) EMBO J. 10: 1787-1791.
Sabelli et al. (1999) Mol. Gen. Genet. 261: 820-830.
Saijo et al. (2001 ) Plant Cell Physiol. 42: 1228-1233.
Salvucci & Ogren (1996) Phosynthesis Res. 47: (1) 1-11.
Salvucci et ai. (2001 ) Plant Physiol. 127: 1053-1064.
Sanchez-Fernandez et al. (2001) J. Biol. Chem. 276: 30231-30244.
Sanderfoot et al. (1999) Plant Physiol. 121: 929-938.
Sanford et al. (1987) Particulate Sci. Tech. 5:27.
Sankaranarayanan et al. (1996) Nat. Struct. Biol. 3: 596-603.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
256
Saraste et al. (1990) Trends Biochem. Sci. 15: 430-434.
Sato et al. (1997) J. Biol. Chem. 272:24530-5.
Sauter et al. (1995) Plant J. 7: 623-632.
Savidge et al. (1995) Plant Cell7: 721-33.
Sazer & Dasso (2000) J. Cell Sci. 113: 1111-1118.
ScharFmann et al., (1991 ) Proc Natl Acad Sci U S A 88:4626-4630.
Schledzewski et al. (1999) J. Mol. Evol. 48: 770-778.
Schmidhauser & Helinski (1985) J. Bacteriol. 164:446.
Schneeberger et al. (1998) Development 125: 2857-2865.
Schocher et al., (1986) BiolTechnology 4:1093-1096.
Schofield (1987) Trends Neurosci. 10: 3-6.
Schultz et al. (1998) Plant Cell 10: 837-47.
Schwab et al. (2001 ) Phytochemistry 56: 407-415.
Schwartz et al. (1999) Proc. Natl. Acad. Sci. USA 96: 4680-4685.
Sehnke et al. (2000) Plant Physiol. 122: 235-242.
Sganga et al. (1992) Proc. Natl. Acad. Sci. USA 89: 6328-6332.
Shalev et al. (2001 ) J. Biol. Chem. 276: 34948-34957.
Shank et al. (2001 ) Plant Physiol. 126: 267-277.
Shcherban et al. (1995) Proc. Natl. Acad. Sci. USA 92: 9245-9249.
Sheridan et al. (1996) Genetics 142:1009.
Shibuya et al. (2000) J. Exp. Bot. 51: 2067-2073.
Shimamoto et al. (1989) Nature 338:274.
Shinshi et al., (1990) Plant Mol Biol 14:357-368.
Silverstone et al., (1998) Plant Cell 10:155-169.
Singh, (1986) Breeding for Resistance to Diseases and Insect Pests,
Springer-Verlag, New York, New York, United States of America.
Singh et al. (1998) J. Plant. PhysioL 153: 316-323.
Sinha et al. (1993) Genes Dev. 7: 787-795.
Sjodahl et al. (1995) Planta 197:264.
Skuzeski et al. (1990) Plant Mol. Biol., 15: 65.
Smilie (1979) Trends Biochem. Sci. 4: 151-155.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
257
Smith et al., (2000) Nature 407:319-320.
Smith & Waterman (1981 ) Adv. Appl. Math. 2: 482.
Smith et al. (1997) Ann. Rev. Plant Biol. 48: 67.
Solocombe et al. (1994) Plant Physiol. 104:1167.
Sontag (2001 ) Cell Signal 13: 7-16.
Spencer et al. (1990) Theor. Appl. Genet. 79:625.
Staub et al. (1992) Plant Cel14:39.
Staub et al. (1993) EMBO J. 12:601.
Stintzi et al. (1993) Biochimie. 75: 687-706.
Sukhapinda et al. (1987) Plant Mol. Biol. 8:209.
Sulo & Martin (1993) J. Biol. Chem. 268: 17634-17639.
Sung et al. (2001 ) Mol. Cells 11: 352-359.
Suss et al. (1993) Proc. NatL Acad. Sci. USA 90: 5514-5518.
Svab et al. (1990) Proc. Natl. Acad. Sci. USA 87:8526.
Takahashi et al. (1994) Plant Mol. Biol. 26: 339-352.
Takamori et al. (2000) Nature 407: 189-194.
Tanaka et al. (1997) Plant Mol. Biol. 35: 981-986.
Tapon & Hall (1997) Curr. Opin. Cell. Biol. 9: 86-92.
Taylor et al., (1993) Plant Cell Rep 12:491-495.
Theissen et al. (2000) Plant Mol. Biol. 42: 115-149.
Thompson et al. (1987) EMBO J. 6:2519.
Tomes et al. (1995) Plant Cell, Tissue and Organ Culture: Fundamental
Methods, Springer-Verlag.
Triezenberg et al., (1988) Genes Dev 2:718-729.
Trimarchi & Lees (2002) Nat. Rev. Mol. Cell. Biol. 3: 11-20.
Tsutsumi et al. (1994) Gene 141: 215-220.
Turner et al., (1987) Cold Spring Harb Symp Quant Biol L11:123-133.
Udaka et al. (2000) J. Nutr. Sci. Vitaminol. (Tokyo) 46: 84-90.
Uknes et al., (1992) Plant Cel14:645-656.
Umeda et al. (1999) Mol. Gen. Genet. 262: 230-238.
Unger et al., (1989) Plant Mol Biol 13:411-418.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
258
Urao et al. (1996) Plant Mol. Biol. 32:571.
U.S. Patent Application No. 20010049831
U.S. Patent No. 4,554,101
U.S. Patent No. 4,940,935
U.S. Patent No. 4,945,050
U.S. Patent No. 4,987,071
U.S. Patent No. 5,036,006
U.S. Patent No. 5,100,792
U.S. Patent No. 5,188,642
U.S. Patent No. 5,270,163
U.S. Patent No. 5,350,689
U.S: Patent No. 5,451,513
U.S. Patent No. 5,466,785
U.S. Patent No. 5,491,288
U.S. Patent No. 5,501,967
U.S. Patent No. 5,523,311
U.S. Patent No. 5,545,817
U.S. Patent No. 5,545,818
U.S. Patent No. 5,591,616
U.S. Patent No. 5,614,395
U.S. Patent No. 5,639,949
U.S. Patent No. 5,767,378
U.S. Patent No. 5,929,226
U.S. Patent No. 5,990,386
U.S. Patent No. 5,994,629
U.S. Patent No. 6,087,175
U.S. Patent No. 6,369,298
Van Breusegem et al. (1994) Plants 193: 57-66.
Van den Broeck et al., (1985) Nature 313:358-363.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
259
van der Krol et al., (1991 ) In Antisense nucleic acids and proteins (Joseph M
& van der Krol A, eds.) Marcel Dekker Inc, New York, New York,
United States of America, pp. 125-141.
van Hemert et al. (2001 ) Bioessays 23: 936-946.
van Hille et al. (1993) Biochem Biophys Res. Commun. 197: 15-21.
Vasil et al. (1989) Mol. Microbiol. 3:371.
Vasil et al., (1992) BiolTechnology 10:667-674.
Vasil et al. (1993) Biotechnology 11:1553.
Vazquez-Tello et al. (1998) Mol. Gen. Genet. 257: 157-166.
Villalba et al. (1993) Eur. J. Biochem. 216: 863-869.
Vollbrecht et al. (1991 ) Nature 350: 241-243.
Vos et al. (2000) Plant Cell 12: 979-990.
Wadzinski et al. (1993) Mol. Cell Biol. 13: 2822-2834.
Walter et al. (1990) J. Biol. Chem. 265: 14016-22.
Warner et al., (1993) Plant J 3:191-201.
Wasmann et al., (1986) Mol Gen Genet 205:446-453.
Watanabe et al. (1994) J. Biol. Chem. 269: 7744-7749.
Waterhouse et al., (1998) Proc Natl Acad Sci U S A 95:13959-13964.
Weeks et al. (1993) Plant Physiol. 102: 1077.
Weissinger et al. (1988) Ann. Rev. Genet. 22: 421.
Welsh, (1981 ) Fundamentals of Plant Genetics and Breeding, John Wiley ~
Sons, New York, New York, United States of America.
Wen et al. (1989) NucL Aeids Res. 17: 9490.
White et al. (1990) Nucl. Acids Res. 18:1062.
Williams et al., (1993) J Clin Invest 92:503-508.
Williams-Carrier et al. (1997) Development 124: 3737-3745.
Winge et al. (1997) Plant Mol. Biol. 35: 483-495.
Wolf & Borchardt (1991 ) J. Med. Chem. 34: 1521-1530.
Wood, (1983) Crop Breeding, American Society of Agronomy, Madison,
Wisconsin, United States of America.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
260
Wricke & Weber, (1986) Quantitative Genetics and Selection Plant Breeding,
Walter de Gruyter and Co., Berlin, Germany.
Wu et al. (1995) MoL Cell. BioL 15: 2536-2546.
Xia et al. (1996) Plant J. 10: 761-769.
Xiong et al. (2001a) Genes Dev. 15: 1971-1984.
Xiong et al. (2001 b) Mol. Plant Microbe Inferact. 14: 685-692.
Xu et al., (1993) Plant Mol Biol 22:573-588.
Yamaguchi-Shinozaki et al. (1990) Plant Mol. Biol. 14: 29-39.
Yao et al. (2001 ) Proc. Natl. Acad. Sci. USA 98: 1306-1311.
Yazaki et al. (2001 ) J. Exp. Bot. 52: 877-9.
Yokota et al. (1999a) Plant Physiol. 119: 231-240.
Yokota et al. (1999b) Plant Physiol. 121: 525-534.
York et al. (1994) Biochemistry 33: 13164-13171.
Yucel (2000) J. Cell. Biol. 150: 1-11.
Zhang et al. (1998) EMBO J. 17: 6404-6411.
Zhao & Last, (1995) J. Biol. Chem. 270: 6081-6087.
Zhao et al., (2000) Plant Mol Bio144:789-98.
Zhao et al. (2001 ) EMBO J. 20: 2315-2325.
thong et al. (1996) Mol. Gen. Genet. 251:196.
Zhu & Xiao (1998) Nucl. Acids Res. 26: 5402-5408.
Zhu et al., (1999) Proc Natl Acad Sci U S A 96:8768-8773.
Zhu et al. (2001 ) Plant Physiol. Biochem. 39: 221-242.
Zilliacus et al. (2001 ) Mol. Endocrinol. 15: 501-511.
Zollman, et al. (1994) Proc. Natl. Acad. Sci. USA 91: 10717-21.
Those skilled in the art will recognize, or be able to ascertain, using
no more than routine experimentation, numerous equivalents to the specific
embodiments described specifically herein. Such equivalents are intended
to be encompassed in the scope of the following claims.
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
SEQUENCE
LISTING
<110> Syngenta Participations, AG
Cooper,
Bret
<120> STRESS-RELATED THEREFOR
POLYPEPTIDES
AND
USES
<130> 1392-10-20
PCT
10<150> US
60/436,564
<151> 2002-12-26
<160> 174
'15<170> PatentIn version 3.2
<210> 1
<211> 1383
<212> DNA
20<213> Oryza
sativa
<220>
<221> CDS
25<222> (1)..(1383)
<400> 1
get tttcggactgttggtgetaaaatcactcaggaaactggtgat 48
tcc
Ala PheArgThrValGlyAlaLysIleThrGlnGluThrGlyAsp
Ser
301 5 10 15
ttc gttagcgatgcagagggtgacccagacaaaccaactgatggt 96
ttt
Phe ValSerAspAlaGluGlyAspProAspLysProThrAspGly
Phe
20 25 30
35
ttt tctattgatgaggetataggcgcattgcatgaaggaaagttt 144
tcc
Phe SerIleAspG1uAlaIleGlyAlaLeuHisGluGlyLysPhe
Ser
35 40 45
40gtt getgtagatgatgaaagcggtgataatgaaggggatcttgtc 192
att
Val AlaValAspAspGluSerGlyAspAsnGluGlyAspLeuVal
Ile
50 55 60
atg getacgctggcagacccagaatctattgcattcatgatcagg 240
gca
45Met AlaThrLeuAlaAspProGluSerIleAlaPheMetIleArg
Ala
65 70 75 80
aat tctgggatcatctcagtgggcatgaaggaagaggacttaaca 288
ggt
Asn SerGlyIleIleSerValGlyMetLysGluGluAspLeuThr
Gly
50 85 90 95
aga atgattcctatgatgtctccaattgcagaaattgaggatatt 336
ttg
Arg MetIleProMetMet~SerProIleAlaGluIleGluAspIle
Leu
100 105 110
55
tca getgettccacagtaacagtggatgccagagtgggcatatca 384
get
Ser AlaAlaSerThrValThrValAspAlaArgValGlyIleSer
Ala
115 120 125
60acc gtctcggetgcagatagggcaaaaacgatttttactctagcc 432
ggc
Thr ValSerAlaAlaAspArgAlaLysThrIlePheThrLeuAla
Gly
130 135 140
tcc gattctaagccaactgacctcagaagaccaggccatatattc 480
cct
65Ser AspSerLysProThrAspLeuArgArgProGlyHisIlePhe
Pro
145 150 155 160
cct aaataccgaaacggtggtgtgctaaaaagagetggacatact 528
cta
1
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Pro LeuLysTyrArgAsnGlyGlyValLeuLysArgAlaGlyHisThr
165 170 175
gag gcatccgtcgatcttgtcgcgttggetggcttgcgccctgtgtct 576
Glu AlaSerValAspLeuValAlaLeuAlaGlyLeuArgProValSer
180 18 5 l90
gtc ctgtcaaccgtcatcaacccagtggatggttcaatggcaggaatg 624
Val LeuSerThrValIleAsnProValAspGlySerMetAlaGlyMet
195 200 205
cca gtgctgaaacagatggetttggagcatgatatcccaattgtttca 672
Pro ValLeuLysGlnMetAlaLeuGluHisAspIleProIleValSer
210 215 220
atc getgatctcatccggtatagaaggaagagggagaagctggtggaa 720
Ile AlaAspLeuIleArgTyrArgArgLysArgGluLysLeuValGlu
225 230 235 240
20ctg attgetgtatctcgtttgccgacgaaatggggccttttccgaget 768
Leu IleAlaValSerArgLeuProThrLysTrpGlyLeuPheArgAla
245 250 255
tac tgctaccaatccaagcttgatggaaccgagcacattgetgttgca 816
25Tyr CysTyrGlnSerLysLeuAspGlyThrGluHisIleAlaValAla
260 265 270
aag ggcgacatcggcgacggcgaggacgtcttggtgagggtccattcc 864
Lys GlyAspIleGlyAspGlyGluAspValLeuValArgValHisSer
30 275 280 285
gag tgcctgaccggcgacatcctcggctecgcccgctgcgactgcggc 912
Glu CysLeuThrGlyAspIleLeuGlySerAlaArgCysAspCysGly
290 295 300'
35
aac cagctggacctggcgatgcagctcatcgacaaggccggccgcggc 960
Asn GlnLeuAspLeuAlaMetGlnLeuIleAspLysAlaGlyArgGly
305 310 315 320
40gtc ctcgtctacctccgcggccacgagggccgcggcatcggcctcggc 1008
Val LeuValTyrLeuArgGlyHisGluGlyArgGlyIleGlyLeuGly
325 330 335
cag aagctccgcgcctacaacctccaggacgacggccacgacaccgtc 1056
45Gln LysLeuArgAlaTyrAsnLeuGlnAspAspGlyHisAspThrVal
340 345 350
cag gccaacgtcgagctcggcctcgccgtcgactcccgcgagtacggc 1104
Gln AlaAsnValGluLeuGlyLeuAlaValAspSerArgGluTyrGly
50 355 360 365
atc ggc gcc cag att ctg cgg gac atg ggg gtg cgc acg atg cgg ctg 1152
Ile Gly Ala Gln Ile Leu Arg Asp Met Gly Val Arg Thr Met Arg Leu
370 375 380
atg acg aac aac ccg gca aag ttc gtc ggg ctc aag ggc tac ggg ctc 1200
Met Thr Asn Asn Pro Ala Lys Phe Val Gly Leu Lys Gly Tyr Gly Leu
385 390 395 400
gcc gtc gtc ggc agg gtt ccg gtg atc tec ccc atc acc aag gag aac 1248
Ala Val Val Gly Arg Val Pro Val Ile Ser Pro Ile Thr Lys Glu Asn
405 410 415
cag agg tac ctc gag acg aag cgc acc aag atg ggc cat gtc tac ggc 1296
Gln Arg Tyr Leu Glu Thr Lys Arg Thr Lys Met Gly His Val Tyr Gly
420 425 430
tcc gac ctc ccc ggc aac gtc ccg gag gaa ttc ctc aac ccg gac gac 1344
2
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Ser Asp Leu Pro Gly Asn Val Pro Glu Glu Phe Leu Asn Pro Asp Asp
435 440 445
atc gcc gga gac caa gac gaa gac gac acc cac aac tga 1383
Ile Ala Gly Asp Gln Asp Glu Asp Asp Thr His Asn
450 455 460
<210> 2
<211> 460
<212> PRT
<213> Oryza sativa
<400> 2
Ala Ser Phe Arg Thr Val Gly Ala Lys Ile Thr Gln Glu Thr Gly Asp
1 5 10 15
Phe Phe Val Ser Asp Ala Glu Gly Asp Pro Asp Lys Pro Thr Asp Gly
20 25 30
Phe Ser Ser Ile Asp Glu Ala Ile Gly Ala Leu His Glu Gly Lys Phe
35 40 45
Val Ile Ala Val Asp Asp Glu Ser Gly Asp Asn Glu Gly Asp Leu Val v
50 55 60
Met Ala Ala Thr Leu Ala Asp Pro Glu Ser Ile Ala Phe Met Ile Arg
65 70 75 80
Asn Gly Ser Gly Ile Ile Ser Val Gly Met Lys Glu Glu Asp Leu Thr
85 90 g5
Arg Leu Met Ile Pro Met Met Ser Pro Ile Ala Glu Ile Glu Asp Ile
100 105 110
Ser Ala Ala Ala Ser Thr Val Thr Val Asp Ala~Arg Val Gly Ile Ser
115 120 125
Thr Gly Val Ser Ala Ala Asp Arg Ala Lys Thr Ile Phe Thr Leu Ala
' 130 135 140
Ser Pro Asp Ser Lys Pro Thr Asp Leu Arg Arg Pro Gly His Ile Phe
145 150 155 160
Pro Leu Lys Tyr Arg Asn Gly Gly Val Leu Lys Arg Ala Gly His Thr
165 l70 175
Glu Ala Ser Val Asp Leu Val Ala Leu Ala Gly Leu Arg Pro Val Ser
180 185 190
Val Leu Ser Thr Val Ile Asn Pro Val Asp Gly Ser Met Ala Gly Met
195 200 205
Pro Val Leu Lys Gln Met Ala Leu Glu His Asp Ile Pro Ile Val Ser
3
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
210 215 220
Ile Ala Asp Leu Ile Arg Tyr Arg Arg Lys Arg Glu Lys Leu Val Glu
225 230 235 240
Leu Ile Ala Val Ser Arg Leu Pro Thr Lys Trp Gly Leu Phe Arg Ala
245 250 255
Tyr Cys Tyr Gln Ser Lys Leu Asp Gly Thr Glu His Ile Ala Val Ala
260 265 270
Lys Gly Asp Ile Gly Asp Gly Glu Asp Val Leu Val Arg Val His Ser
275 280 285
Glu Cys Leu Thr Gly Asp Ile Leu Gly Ser Ala Arg Cys Asp Cys Gly
290 295 300
Asn Gln Leu Asp Leu Ala Met Gln Leu Ile Asp Lys Ala Gly Arg Gly
305 310 3l5 320
Val Leu, Val Tyr Leu Arg Gly His Glu Gly Arg Gly Ile Gly Leu Gly
325 330 335
Gln Lys Leu Arg Ala Tyr Asn Leu Gln Asp Asp Gly His Asp Thr Val
340 345 350
Gln Ala Asn Val Glu Leu Gly Leu Ala Val Asp Ser Arg Glu Tyr Gly
355 360 365
Ile Gly Ala Gln Ile Leu Arg Asp Met Gly Val Arg Thr Met Arg Leu
370 375 380
Met Thr Asn Asn Pro Ala Lys Phe Val Gly Leu Lys Gly Tyr Gly Leu
385 390 395 400
Ala Val Val Gly Arg Val Pro Val Ile Ser Pro Ile Thr Lys Glu Asn
405 410 415
Gln Arg Tyr Leu Glu Thr Lys Arg Thr Lys Met Gly His Val Tyr Gly
420 425 430
Ser Asp Leu Pro Gly Asn Val Pro Glu Glu Phe Leu Asn Pro Asp Asp
435 440 445
Ile Ala Gly Asp Gln Asp Glu Asp Asp Thr His Asn
450 455 460
<210> 3
<211> 267
<212> DNA
<213> Oryza sativa
4
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
<220>
<221> CDS
<222> (1)..(267)
<400> 3
gga acaaaccctggcttcagagttggagagatcaggctctccaacagg 4g
Gly ThrAsnProGlyPheArgValGlyGluIleArgLeuSerAsnArg
1 5 10 15
gat atttatttcggcacattattggggaacacaccagagggttcaggg 96
Asp IleTyrPheGlyThrLeuLeuGlyAsnThrProGluGlySerGly
20 25 30
agg tatgtctggtcagatggttgcacttacgatggtgagtggaggaga 144
Arg TyrValTrpSerAspGlyCysThrTyrAspGlyGluTrpArgArg
35 40 45
ggg atgaggcatgggcaaggaaagacaatgtggccatctggagccacc 192
Gly MetArgHisGlyGlnGlyLysThrMetTrpProSerGlyAlaThr
50 55 60
tac gagggtgagtactctggtggctacatttatggtgaaggcacatat 240
Tyr GluGlyGluTyrSerGlyGlyTyrIleTyrGlyGluGlyThrTyr
65 70 75 80
acc gggtctgacaacatcgtctacaag 267
Thr GlySerAspAsnIleValTyrLys
85
<210> 4
<211> 89
<212> PRT
<213> Oryza sativa
<400> 4
Gly Thr Asn Pro Gly Phe Arg Val Gly Glu Ile Arg Leu Ser Asn Arg
1 5 10 15
r
Asp Ile Tyr Phe Gly Thr Leu Leu Gly Asn Thr Pro Glu Gly Ser Gly
20 25 30
Arg Tyr Val Trp Ser Asp Gly Cys Thr Tyr Asp Gly Glu Trp Arg Arg
35 40 45
Gly Met Arg His Gly Gln Gly Lys Thr Met Trp Pro Ser Gly Ala Thr
50 55 60
Tyr Glu Gly Glu Tyr Ser Gly Gly Tyr Ile Tyr Gly Glu Gly Thr Tyr
70 75 8p
Thr Gly Ser Asp Asn Ile Val Tyr Lys
60 s5
<210> 5
<211> 1227
65 <212> DNA
<213> Oryza sativa
5
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
<220>
<22 1> CDS
<22 2> (1)..(1227)
<40 0> 5
cca cgcgtccggagaagcggccgctttttttttttgttttcccctccg 48
Pro ArgValArgArgSerGlyArgPhePhePheLeuPheSerProPro
1 5 10 15
10act ccgactccgatcgatctccaccccgaatccctcctcctcaccgcc 96
Thr ProThrProIleAspLeuHisProGluSerLeuLeuLeuThrAla
20 25 30 '
ggc gagcttccggetgcggcggagatggccacacgttattggatcgtg 144
15Gly GluLeuProAlaAlaAlaGluMetAlaThrArgTyrTrpIleVal
35 40 45
tct cttcccgtgcagactcctggctccaccgccaattctctctgggcg 192
Ser LeuProValGlnThrProGlySerThrAlaAsnSerLeuTrpAla
20 50 55 60
cgc ctccaggactccatctcgcgccactccttcgacacgccgctctac 240
Arg LeuGlnAspSerIleSerArgHisSerPheAspThrProLeuTyr
65 70 75 80
25
cgg tttaacgtccccgatctccgcgtcggcacgctcgactccctcctc 288
Arg PheAsnValProAspLeuArgValGlyThrLeuAspSerLeuLeu
85 90 95
30gcc ctcagcgacgatctcgtcaagtccaacgtcttcatcgagggggtc 336
Ala LeuSerAspAspLeuValLysSerAsnValPheIleGluGlyVal
100 105 110
tcg cacaagatccggaggcagatcgaggagctagagcgcgccgggggt 384
35Ser HisLysIleArgArgGlnIleGluGluLeuGluArgAlaGlyGly
115 120 l25
gtc gagagtggggetctcaccgttgacggcgtccccgtcgacacctac 432
Val GluSerGlyAlaLeuThrValAspGlyValProValAspThrTyr
40 130 135 140
ctc accaggtttgtgtgggatgagggcaaatacccaacgatgtcaccg 480
Leu ThrArgPheValTrpAspGluGlyLysTyrProThrMet~SerPro
145 150 l55 160
45
ctc aaggagattgccggcagcatccaatcacaggtctccaagattgaa 528
Leu LysGluIleAlaGlySerIleGlnSerGlnValSerLysIleGlu
165 170 175
50gat gacatgaaggttcgaggagcggaatacaataatgtaaggagccag 576
Asp AspMetLysValArgGlyAlaGluTyrAsnAsnValArgSerGln
180 185 190
ctt aatgcgatcaacagaaagcaaaccggaagcttagcagttcgtgat 624
55Leu AsnAlaIleAsnArgLysGlnThrGlySerLeuAlaValArgAsp
195 200 205
ctt tccaatctggtaaaaccagaggatatggtcacatcagaacatcta 672
Leu SerAsnLeuValLysProGluAspMetValThrSerGluHisLeu
60 210 215 220
gtg acactccttgcagttgttcctcagtactctcaaaaggattggttg 720
Val ThrLeuLeuAlaValValProGlnTyrSerGlnLysAspTrpLeu
225 230 235 240
65
tca agctatgagtcccttgacacatttgtggtaccgagatcgtctaaa 768
Ser SerTyrGluSerLeuAspThrPheValValProArgSerSerLys
245 250 255
6
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
aaa ctt tat gag gac aat gag tat get ctc tac acg gta aca ttg ttt 816
Lys Leu Tyr Glu Asp Asn Glu Tyr Ala Leu Tyr Thr Val Thr Leu Phe
260 265 270
get aag gtt gtt gac aac ttt aag gtc cgt gca cgt gaa aaa ggt ttc 864
Ala Lys Val Val Asp Asn Phe Lys Val Arg Ala Arg Glu Lys Gly Phe
275 280 285
10cag gttcgcgattttgagtatagttctgaagcacaggaaagtaggaag 9l2
Gln ValArgAspPheGluTyrSerSerGluAlaGlnGluSerArgLys
290 295 300
gaa gagctggaaaagctaatgcaagaccaggaagcaatgagggcatca 960
15Glu GluLeuGluLysLeuMetGlnAspGlnGluAlaMetArgAlaSer
305 310 315 320
ctt ctgcaatggtgctatgccagctacagtgaggtattcagttcctgg 1008
Leu LeuGlnTrpCysTyrAlaSerTyrSerGluValPheSerSerTrp
20 325 330 335
atg cacttctgtctggtgcgtgtctttgtagagagcattcttagatat 1056
Met HisPheCysLeuValArgValPheValGluSerIleLeuArgTyr
340 345 350
25
ggt cttcccccatcattcctgtctgetgttctagcaccttctcaaaag 1104
Gly LeuProProSerPheLeuSerAlaValLeuAlaProSerGlnLys
355 360 365
30ggt gaaaagaaagtaaggagcatcctgaggaactctgtgggcaatgtc 1152
Gly GluLysLysValArgSerIleLeuArgAsnSerValGlyAsnVal
370 375 380
cat agtatttattggaaatctgaagacgatgttggtgtagetggtctg 1200
35His SerIleTyrTrpLysSerGluAspAspValGlyValAlaGlyLeu
385 390 395 400
gga ggcaaggcagtgtttttggagtaa 1227
Gly GlyLysAlaValPheLeuGlu
40 405
<210> 6
<211> 408
45 <212> PRT
<213> Oryza sativa
<400> 6
50 Pro Arg Val Arg Arg Ser Gly Arg Phe Phe Phe Leu Phe Ser Pro Pro
1 5 10 15
Thr Pro Thr Pro'Ile Asp Leu His Pro Glu Ser Leu Leu Leu Thr Ala
55 20 25 30
Gly Glu Leu Pro Ala Ala Ala Glu Met Ala Thr Arg Tyr Trp Ile Val
35 40 45
65
Ser Leu Pro Val Gln Thr Pro Gly Ser Thr Ala Asn Ser Leu Trp Ala
50 55 60
Arg Leu Gln Asp Ser Ile Ser Arg His Ser Phe Asp Thr Pro Leu Tyr
70 75 8p
7
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Arg Phe Asn Val Pro Asp Leu Arg Val Gly Thr Leu Asp Ser Leu Leu
85 90 95
Ala Leu Ser Asp Asp Leu Val Lys Ser Asn Val Phe Ile Glu Gly Val
100 105 110
Ser His Lys Ile Arg Arg Gln Ile Glu Glu Leu Glu Arg Ala Gly Gly
115 l20 125
Val Glu Ser Gly Ala Leu Thr Val Asp Gly Val Pro Val Asp Thr Tyr
130 135 140
Leu Thr Arg Phe Val Trp Asp Glu Gly Lys Tyr Pro Thr Met Ser Pro
145 150 155 160
Leu Lys Glu Tle Ala Gly Ser Ile Gln Ser Gln Val Ser Lys Ile Glu
165 170 175
Asp Asp Met Lys Val Arg Gly Ala Glu Tyr Asn Asn Val Arg Ser Gln
180 185 190
Leu Asn Ala Ile Asn Arg Lys Gln Thr Gly Ser Leu Ala Val Arg Asp
195 200 205
Leu Ser Asn Leu Val Lys Pro Glu Asp Met Val Thr Ser Glu His Leu
210 215 220
Val Thr Leu Leu Ala Val Val Pro Gln Tyr Ser Gln Lys Asp Trp Leu
225 230 235 240
Ser Ser Tyr Glu Ser Leu Asp Thr Phe Val Val Pro Arg Ser Ser Lys
245 250 255
Lys Leu Tyr Glu Asp Asn Glu Tyr Ala Leu Tyr Thr Val Thr Leu Phe
260 265 270
Ala Lys Val Val Asp Asn Phe Lys Val Arg Ala Arg Glu Lys Gly Phe
275 280 285
i
Gln Val Arg Asp Phe Glu Tyr Ser Ser Glu Ala Gln Glu Ser Arg Lys
290 295 300
Glu Glu Leu Glu Lys Leu Met Gln Asp Gln Glu Ala Met Arg Ala Ser
305 310 315 320
Leu Leu Gln Trp Cys Tyr Ala Ser Tyr Ser Glu Val Phe Ser Ser Trp
325 330 335
Met His Phe Cys Leu Val Arg Val Phe Val Glu Ser Ile Leu Arg Tyr
340 345 350
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Gly Leu Pro Pro Ser Phe Leu Ser Ala Val Leu Ala Pro Ser Gln Lys
355 360 365
Gly Glu Lys Lys Val Arg Ser Ile Leu Arg Asn Ser Val Gly Asn Val
370 375 380
His Ser Ile Tyr Trp Lys Ser Glu Asp Asp Val Gly Val Ala Gly Leu
385 390 395 400
Gly Gly Lys Ala Val Phe Leu Glu
405
<z2o> 7
<21l> 1512
<212> DNA
<213> Oryza sativa
<220>
25<221> CDS
<222> (1)..(1512)
<400> 7
aag tatgetgagcgtgggcttcgttctcttgetgttgcaagacaggaa 48
30Lys TyrAlaGluArgGlyLeuArgSerLeuAlaValAlaArgGlnGlu
1 5 10 15
gta cctgagaagtcgaaggagtctgetggtggaccatggcaattcgtt 96
Val ProGluLysSerLysGluSerAlaGlyGlyProTrpGlnPheVal
35 20 25 30
ggt ctgctgcccctgtttgatcccccgaggcacgacagtgetgaaact 144
Gly LeuLeuProLeuPheAspProProArgHisAspSerAlaGluThr
35 40 45
40
atc cggaaggetctccatcttggtgttaatgttaagatgatcactggt 192
Ile ArgLysAlaLeuHisLeuGlyValAsnValLysMetIleThrGly
50 55 60
45gac cagcttgetattggtaaggagactggtaggaggcttggaatgggt 240
Asp GlnLeuAlaIleGlyLysGluThrGlyArgArgLeuGlyMetGly
65 70 75 80
aca aacatgtatccttcatccgcattgctcggacaaaacaaggacget 288
50Thr AsnMetTyrProSerSerAlaLeuLeuGlyGlnAsnLysAspAla
85 90 95
tca cttgaggcacttcccgtggatgagctcattgagaaggetgatggt 336
Ser LeuGluAlaLeuProValAspGluLeuIleGluLysAlaAspGly
55 ioo io5 110
ttt gccggagtcttccctgagcacaaatatgagatcgtgaagaggttg 384
Phe AlaGlyValPheProGluHisLysTyrGluIleValLysArgLeu
115 120 125
60
caa gagaagaagcacatcgtcggtatgaccggagatggtgtcaatgat 432
Gln GluLysLysHisIleValGlyMetThrGlyAspGlyValAsnAsp
130 135 140
65gcc cctgetcttaagaaggccgacattggtattgetgttgetgatgca 480
Ala ProAlaLeuLysLysAlaAspIleGlyIleAlaValAlaAspAla
145 150 155 160
9
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
ata gat get gca aga agt get tcc gac att gtg ctc act gag cca ggt 528
Ile Asp Ala Ala Arg Ser Ala Ser Asp Ile Val Leu Thr Glu Pro Gly
165 l70 175
ctt agt gtc att atc agc get gtc ctc act agc aga tgc atc ttc cag 576
Leu Ser Val Ile Ile Ser Ala Val Leu Thr Ser Arg Cys Ile Phe Gln
180 185 190
agg atg aag aac tat acc att tat gca gtt tcc atc acc atc cgt ata 624
Arg Met Lys Asn Tyr Thr Ile Tyr Ala Val Ser Ile Thr Ile Arg Ile
195 200 205
gtg ctt gga ttt ttg ctt att get ctg atc tgg aaa tac gac ttc tca 672
Val Leu Gly Phe Leu Leu Ile Ala Leu Ile Trp Lys Tyr Asp Phe Ser
210 215 220
ccc ttc atg gtc ctt atc att gcc atc ctg aat gac ggt act atc atg 720
Pro Phe Met Val Leu Ile Ile Ala Ile Leu Asn Asp Gly Thr Ile Met
225 230 235 240
acg atc tcg aag gac aga gtt aag cct tct ccc ttg cca gac agc tgg 768
Thr Ile Ser Lys Asp Arg Val Lys Pro Ser Pro Leu Pro Asp Ser Trp
245 250 255
25aag ctgaaggaaatcttcgetaccggtattgtgcttggaagctacctt 816
Lys LeuLysGluIlePheAlaThrGlyIleValLeuGlySerTyrLeu '
260 265 270
get ctgatgaccgttattttcttctgggccatgcacaagacagacttt 864
30Ala LeuMetThrValIlePhePheTrpAlaMetHisLysThrAspPhe
275 280 285
ttc acggacaaattcggtgtcagatcaatcaggaacagtgaacatgag 912
Phe ThrAspLysPheGlyValArgSerIleArgAsnSerGluHisGlu
35 290 295 300
atg atgtctgcactgtacctccaagtcagtattgtgagtcaggccctc 960
Met MetSerAlaLeuTyrLeuGlnValSerIleValSerGlnAlaLeu
305 310 315 320
40
atc ttcgtcacccgttctcgcagctggtccttcatcgaacgccctggt 1008
Ile PheValThrArgSerArgSerTrpSerPheIleGluArgProGly
325 330 335
45ctt ctcttggtcactgcattcatgcttgcacaactggttgcgacattc 1056
Leu LeuLeuValThrAlaPheMetLeuAlaGlnLeuValAlaThrPhe
340 345 350
ctc getgtctatgccaactggggctttgccaggatcaagggcattggc 1104
50Leu AlaValTyrAlaAsnTrpGlyPheAlaArgIleLysGlyIleGly
355 360 365
tgg ggctgggetggcgttatctggctttacagcattgtgttctacttc 1152
Trp GlyTrpAlaGlyValIleTrpLeuTyrSerIleValPheTyrPhe
55 370 375 380
cct ctt gac atc ttc aag ttc ttc atc cgc ttt gtg ctg agt gga agg 1200
Pro Leu Asp Ile Phe Lys Phe Phe Ile Arg Phe Val Leu Ser Gly Arg
385 390 395 400
gcc tgg gac aac ctc ctt gag aac aag att gca ttc acc acc aag aag 1248
Ala Trp Asp Asn Leu Leu Glu Asn Lys Ile Ala Phe Thr Thr Lys Lys
405 410 415
gat tac ggt agg gag gag agg gag gca caa tgg gcc acc gca caa aga 1296
Asp Tyr Gly Arg Glu Glu Arg Glu Ala Gln Trp Ala Thr Ala Gln Arg
420 425 430
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
aca ctt ggccttcagccaccggaggtcgcctccaacacgctcttc 1344
cac
Thr Leu GlyLeuGlnProProGluValAlaSerAsnThrLeuPhe
His
435 440 445
aac gac agcagctaccgcgagctctctgagatcgetgagcaagcc 1392
aag
Asn Asp SerSerTyrArgGluLeuSerGluTleAlaGluGlnAla
Lys
450 455 460
aag aga getgagatcgcgaggctgagagagctgaacactctcaag 1440
cga
Lys Arg AlaGluIleAlaArgLeuArgGluLeuAsnThrLeuLys
Arg
465 470 475 480
ggc cac gaatcggtggtgaagctgaaggggctggacatcgacacg 1488
gtc
Gly His GluSerValValLysLeuLysGlyLeuAspIleAspThr
Val
485 490 495
atc cag aactacacagtgtga 1512
cag
Ile Gln AsnTyrThrVal
Gln
500
<210> 8
<211> 503
<212> PRT
<213> Oryzasativa
<400> 8
Lys Tyr GluArgGlyLeuArgSerLeuAlaValAlaArgGlnGlu
Ala
1 5 10 15
Val Pro Glu Lys Ser Lys Glu Ser Ala G1y Gly Pro Trp Gln Phe Val
20 25 30
40
Gly Leu Leu Pro Leu Phe Asp Pro Pro Arg His Asp Ser Ala Glu Thr
35 ~ 40 45
Ile Arg Lys Ala Leu His Leu Gly Val Asn Val Lys Met Ile Thr Gly
50 55 60
Asp Gln Leu Ala Ile Gly Lys Glu Thr Gly Arg Arg Leu Gly Met Gly
65 70 75 80
Thr Asn Met Tyr Pro Ser Ser Ala Leu Leu Gly Gln Asn Lys Asp Ala
85 90 95
60
Ser Leu Glu Ala Leu Pro Val Asp Glu Leu Ile Glu Lys Ala Asp Gly
100 105 110
Phe Ala Gly Val Phe Pro Glu His Lys Tyr Glu Ile Val Lys Arg Leu
115 120 125
Gln Glu Lys Lys His Ile Val Gly Met Thr Gly Asp Gly Val Asn Asp
130 135 140
Ala Pro Ala Leu Lys Lys Ala Asp Ile Gly Ile Ala Val Ala Asp Ala
145 150 155 160
11
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Ile Asp Ala Ala Arg Ser Ala Ser Asp Ile Val Leu Thr Glu Pro Gly
165 170 175
Leu Ser Val Ile Ile Ser Ala Val Leu Thr Ser Arg Cys Ile Phe Gln
180 185 190
Arg Met Lys Asn Tyr Thr Ile Tyr Ala Val Ser Ile Thr Ile Arg Ile
195 200 205
Val Leu Gly Phe Leu Leu Ile Ala Leu Ile Trp Lys Tyr Asp Phe Ser
210 215 220
Pro Phe Met Val Leu Ile Ile Ala Ile Leu Asn Asp Gly Thr Ile Met
225 230 235 240
Thr Ile Ser Lys Asp Arg Val Lys Pro Ser Pro Leu Pro Asp Ser Trp
245 250 255
Lys Leu Lys Glu Ile Phe Ala Thr Gly Ile Val Leu Gly Ser Tyr Leu
260 265 270
Ala Leu Met Thr Val Ile Phe Phe Trp Ala Met His Lys Thr Asp Phe
275 280 285
Phe Thr Asp Lys Phe Gly Val Arg Ser Ile Arg Asn Ser Glu His Glu
290 295 300
Met Met Ser Ala Leu Tyr Leu Gln Val Ser Ile Val Ser Gln Ala Leu
305 310 315 320
Ile Phe Val Thr Arg Ser Arg Ser Trp Ser Phe Ile Glu Arg Pro Gly
325 330 335
Leu Leu Leu Val Thr Ala Phe Met Leu Ala Gln Leu Val Ala Thr Phe
340 345 350
Leu Ala Val Tyr Ala Asn Trp Gly Phe Ala Arg Ile Lys Gly Ile Gly
355 360 365
Trp Gly Trp Ala Gly Val Ile Trp Leu Tyr Ser Ile Val Phe Tyr Phe
370 375 380
Pro Leu Asp Ile Phe Lys Phe Phe Ile Arg Phe Val Leu Ser Gly Arg
385 390 395 400
Ala Trp Asp Asn Leu Leu Glu Asn Lys Ile Ala Phe Thr Thr Lys Lys
405 410 415
Asp Tyr Gly Arg Glu Glu Arg Glu Ala Gln Trp Ala Thr Ala Gln Arg
420 425 430
12
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Thr Leu His Gly Leu Gln Pro Pro Glu Val Ala Ser Asn Thr Leu Phe
435 440 445
Asn Asp Lys Ser Ser Tyr Arg Glu Leu Ser Glu Ile Ala Glu Gln Ala
450 455 460
Lys Arg Arg Ala Glu Ile Ala Arg Leu Arg Glu Leu Asn Thr Leu Lys
465 470 475 480
Gly His Val Glu Ser Val Val Lys Leu Lys Gly Leu Asp Ile Asp Thr
485 ~ 490 495
Ile Gln Gln Asn Tyr Thr Val
500
25
<210> 9
<21l> 612
<212> DNA
<213> Oryza sativa
<220>
<22 1> CDS
<22 2> (1)..(612)
<40 0> 9
atg gccatggccacgcaagcctccgccgccaagtgccacctcctcgcc 48
Met AlaMetAlaThrGlnAlaSerAlaAlaLysCysHisLeuLeuAla
1 5 10 15
gcc tgggcaccggcgaagccgcgctcatccaccctctccatgcccacc 96
Ala TrpAlaProAlaLysProArgSerSerThrLeuSerMetProThr
20 25 30
tcg agggcacccacctccctcagagcggcggcggaggatcagcccgcc 144
Ser ArgAlaProThrSerLeuArgAlaAlaAlaGluAspGlnProAla
35 40 45
gcg gcggcgacggaggagaagaagccagcccccgcggggttcgtgccg 192
Ala AlaAlaThrGluGluLysLysProAlaProAlaGlyPheValPro
50 55 60
ccg cagctggaccccaacacgccgtccccgatcttcggcgggagcacg 240
Pro GlnLeuAspProAsnThrProSerProIlePheGlyGlySerThr
65 70 75 80
ggg ggactcctccggaaggcgcaggtggaggagttctacgtcatcaca 288
Gly GlyLeuLeuArgLysAlaGlnValGluGluPheTyrValIleThr
85 90 95
tgg acgtcgcccaaggagcaggtgttcgagatgcccacgggcggcgcc 336
Trp ThrSerProLysGluGlnValPheGluMetProThrGlyGlyAla
100 105 110
gcc atcatgcgcgagggccccaacctgctgaagctggccaggaaggag 384
Ala IleMetArgGluGlyProAsnLeuLeuLysLeuAlaArgLysGlu
115 120 125
cag tgcctggccctgggcaccaggctccgctccaagtacaagatcaac 432
Gln CysLeuAlaLeuGlyThrArgLeuArgSerLysTyrLysIleAsn
130 135 140
tac cagttctaccgcgtcttccccaatggcgaggtgcagtacctccac 480
13
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Tyr Gln Phe Tyr Arg Val Phe Pro Asn Gly Glu Val Gln Tyr Leu His
145 150 155 160
ccc aag gac ggc gtc tac ccg gag aag gtc aac gcc ggc agg cag ggc 528
Pro Lys Asp Gly Val Tyr Pro Glu Lys Val Asn Ala Gly Arg Gln Gly
165 170 175
gtc ggc cag aac ttc cgc agc atc ggc aag aac gtc agc ccc atc gag 576
Val Gly Gln Asn Phe Arg Ser Ile Gly Lys Asn Val Ser Pro Ile Glu
180 185 190
gtc aag ttc acc ggc aag aac gtc ttc gac atc tag 612
Val Lys Phe Thr Gly Lys Asn Val Phe Asp Ile
195 200
<2l0> 10
<211> 203
<212> PRT
<213> Oryza sativa
<400> 10
Met Ala Met Ala Thr Gln Ala Ser Ala Ala Lys Cys His Leu Leu Ala
l 5 10 15
Ala Trp Ala Pro Ala Lys Pro Arg Ser Ser Thr Leu Ser Met Pro Thr
20 25 30
Ser Arg Ala Pro Thr Ser Leu Arg Ala Ala Ala Glu Asp Gln Pro Ala
40 45
Ala Ala Ala Thr Glu Glu Lys Lys Pro Ala Pro Ala Gly Phe Val Pro
50 55 60
Pro Gln Leu Asp Pro Asn Thr Pro Ser Pro Ile Phe Gly Gly Ser Thr
65 70 75 80
Gly Gly Leu Leu Arg Lys Ala Gln Val Glu Glu Phe Tyr Val Ile Thr
85 90 95
55
Trp Thr Ser Pro Lys Glu Gln Val Phe Glu Met Pro Thr Gly Gly Ala
100 105 110
Ala Ile Met Arg Glu Gly Pro Asn Leu Leu Lys Leu Ala Arg Lys Glu
115 120 125
Gln Cys Leu Ala Leu Gly Thr Arg Leu Arg Ser Lys Tyr Lys Ile Asn
130 135 140
Tyr Gln Phe Tyr Arg Val Phe Pro Asn Gly Glu Val Gln Tyr Leu His
145 150 155 160
Pro Lys Asp Gly Val Tyr Pro Glu Lys Val Asn Ala Gly Arg Gln Gly
165 170 175
Val Gly Gln Asn Phe Arg Ser Ile Gly Lys Asn Val Ser Pro Ile Glu
14
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
180 185 190
Val Lys Phe Thr Gly Lys Asn Val Phe Asp Ile
195 200
<2l0> 1l
<2l1> 901
<212> DNA
<213> Oryza sativa
<220>
<221> CDS
<222> (1)..(900)
<400> 11
gcg gtgttcctg ctc tcg 48
cca gca ctc
ggg cgg cgc
gcg ccg cgc
cga
Ala Pro ValPheLeu Leu Ser
Gly Ala Leu
Ala Arg Arg
Arg Pro Arg
1 5 ZO l5
ccg cggggcgtcgcctgcgcccttcgccgg ccctccaagtacaag 96
agg
Pro ArgGly AlaCysAlaLeu ArgArgProSerLysTyrLys
Val Arg
20 25 30
aat aaaatccagaatgaggaggttgtagtagaggatgatattggcggt 144
Asn LysIleGlnAsnGluGluValValValGluAspAspIleGlyGly
35 40 45
ggt ggtgaagacgatgacgacgcgctggaagcactttttaagcagttg 192
Gly GlyGluAspAspAspAspAlaLeuGluAlaLeuPheLysGlnLeu
50 55 60
gaa gaagatctcaagaatgatgatttgtctgttgaggatgatgacgat 240
Glu GluAspLeuLysAsnAspAspLeuSerValGluAspAspAspAsp
65 70 75 80
gga atttcagaagaagatatggcaagatttgagcaggagttggcagag 288
Gly IleSerGluGluAspMetAlaArgPheGluGlnGluLeuAlaGlu
85 90 95
gca atcggggatattgetgatgetgatgaatctggagagggttcgtca 336
Ala IleGlyAspIleAlaAspAlaAspGluSerGlyGluGlySerSer
100 105 110
tta ggctctgaggettatgggaatgatgaaaaaacggatgaaatcaaa 384
Leu GlySerGluAlaTyrGlyAsnAspGluLysThrAspGluIleLys
115 120 125
cgg ccagagctgaaaaactggcaacttaagaggctggetcgtgetctc 432
Arg ProGluLeuLysAsnTrpGlnLeuLysArgLeuAlaArgAlaLeu
130 135 140
aaa ataggtcgccgtaaaactagtataaagaatcttgcaggggaacta 480
Lys IleGlyArgArgLysThrSerIleLysAsnLeuAlaGlyGluLeu
145 150 155 160
ggc ctggataggactttggtcattgaattgctccgaaatccacctcca 528
Gly LeuAspArgThrLeuValIleGluLeuLeuArgAsnProProPro
165 170 175
aaa cttctattcatgtctgattctttgcctgat gacccttctaaa 576
gaa
Lys LeuLeuPheMetSerAspSerLeuProAsp AspProSerLys
Glu
180 185 190
cct gaaatcaaggaaatagag tctccagta gataacgetgat 624
ccc gtt
Pro GluIleLysGluIleGlu SerProVal AspAsnAla
Pro Val Asp
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
195 200 205
gtc actgaaaccaagccacagacggaacttcctgttcatgtcatgtgc 672
Val ThrGluThrLysProGlnThrGluLeuProValHisValMetCys
210 215 220
gca gaatggtcttcacagaaaagattaaaaaaggtgcaactggagaca 720
Ala GluTrpSerSerGlnLysArgLeuLysLysValGlnLeuGluThr
225 230 235 240
tta gaaagagtctactcccgaaccaaacgccctacaaatacaatgatc 768
Leu GluArgValTyrSerArgThrLysArgProThrAsnThrMetIle
245 250 255
agc agcatagttcaagtgacaagccttccacggaagaccattgttaag 816
Ser SerIleValGlnValThrSerLeuProArgLysThrIleValLys
260 265 270
tgg tttgaggatagaagggaacaggatggggtacctgaccatcgagtt 864
Trp PheGluAspArgArgGluGlnAspGlyValProAspHisArgVal
275 280 285
gca ttcaagagatccctatctgagaccatagetagtt 901
~
Ala PheLysArgSerLeuSerGluThrIleAlaSer
290 295 300
<210> 12
<211> 300
<212> PRT
<213> Oryza
sativa
<40 0> 12
Ala ProGlyAlaArgValPheLeuAlaArgProLeuLeuArgArgSer
1 5 10 15
Pro Arg Gly Val Ala Cys Ala Leu Arg Arg Arg Pro Ser Lys Tyr Lys
20 25 30
50
Asn Lys Ile Gln Asn Glu Glu Val Val Val Glu Asp Asp Ile Gly Gly
35 40 45
Gly Gly Glu Asp Asp Asp Asp Ala Leu Glu Ala Leu Phe Lys Gln Leu
55 60
Glu Glu Asp Leu Lys Asn Asp Asp Leu Ser Val Glu Asp Asp Asp Asp
65 70 75 80
Gly Ile Ser Glu Glu Asp Met Ala Arg Phe Glu Gln Glu Leu Ala Glu
85 90 95
Ala Ile Gly Asp Ile Ala Asp Ala Asp Glu Ser Gly Glu Gly Ser Ser
100 105 110
Leu Gly Ser Glu Ala Tyr Gly Asn Asp Glu Lys Thr Asp Glu Ile Lys
115 120 125
Arg Pro Glu Leu Lys Asn Trp Gln Leu Lys Arg Leu Ala Arg Ala Leu
130 135 140
16
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Lys Ile Gly Arg Arg Lys Thr Ser Ile Lys Asn Leu Ala Gly Glu Leu
145 150 155 160
Gly Leu Asp Arg Thr Leu Val Ile Glu Leu Leu Arg Asn Pro Pro Pro
165 170 175
Lys Leu Leu Phe Met Ser Asp Ser Leu Pro Asp Glu Asp Pro Ser Lys
180 185 190
Pro Glu Ile Lys Glu Ile Glu Pro Ser Pro Val Val Asp Asn Ala Asp
195 200 205
Val Thr Glu Thr Lys Pro Gln Thr Glu Leu Pro Val His Val Met' Cys
210 215 220
Ala Glu Trp Ser Ser Gln Lys Arg Leu Lys Lys Val Gln Leu Glu Thr
225 230 235 240
Leu Glu Arg Val Tyr Ser Arg Thr Lys Arg Pro Thr Asn Thr Met Ile
245 250 255
Ser Ser Ile Val Gln Val Thr Ser Leu Pro Arg Lys Thr Ile Val Lys
260 265 270
Trp Phe Glu Asp Arg Arg Glu Gln Asp Gly Val Pro Asp His Arg Val
275 280 285
Ala Phe Lys Arg Ser Leu Ser Glu Thr Ile Ala Ser
290 295 300
<210> 13
<211> 799
<212> DNA
<213> Oryza sativa
<220>
<221>
CDS
<222> (1)..(798)
<400>
13
gcc cgccgcccctccaccttcctcaacgccgtcgcgctcggcaac 48
cca
Ala ArgArgProSerThrPheLeuAsnAlaValAlaLeuGlyAsn
Pro
1 5 10 15
gtc gcgggcaagtcggccgtgctgaacagcctcatcggccacccc 96
ggg
Val AlaGlyLysSerAlaValLeuAsnSerLeuIleGlyHisPro
Gly
20 25 30
gtg ccgacgggggagaacggggcgacgagggcgccaattgtggtg 144
ctg
Val ProThrGlyGluAsnGlyAlaThrArgAlaProIleValVal
Leu
35 40 45
gac cagagggacccgggcctcagcagcaagtccatcgtgctgcaa 192
ctg
Asp GlnArgAspProGlyLeuSerSerLysSerIleValLeuGln
Leu
50 55 60
17
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
atc gacagcaagtcgcagcgggtgtccgcaagttcgctgcggcattcg 240
Ile AspSerLysSerGlnArgValSerAlaSerSerLeuArgHisSer
65 70 75 80
ctg caggacaggctcagcaagggggcgtccagcggatccagtaggggc 288
Leu GlnAspArgLeuSerLysGlyAlaSerSerGlySerSerArgGly
85 90 95
10cgt gtagaggggatcaatctcaagctgcggacgagtacagetccccca 336
Arg ValGluGlyIleAsnLeuLysLeuArgThrSerThrAlaProPro
100 105 110
cta aagctggttgatttacctgggatagaccagcgagetgttgacgat 384
15Leu LysLeuValAspLeuProGlyIleAspGlnArgAlaValAspAsp
115 120 125
cca atgattaatgaatatgetgggcacaatgatgcaatactgctagtt 432
Pro MetIleAsnGluTyrAlaGlyHisAsnAspAlaIleLeuLeuVal
20 130 135 140
gtg atacctgcaatgcaagcagetgatgttgcgtcatctcgagetctt 480
Val IleProAlaMetGlnAlaAlaAspValAlaSerSerArgAlaLeu
145 150 155 160
25
agg ctggccaaggatattgatgcagatggcaccagaactgtaggtgtg 528
Arg LeuAlaLysAspIleAspAlaAspGlyThrArgThrValGlyVal
165 170 175
30 ata agt aaa gtt gat caa gca gaa gga gat gca aaa act ata get tgt 576
Ile Ser Lys Val Asp Gln Ala Glu Gly Asp Ala Lys Thr Ile Ala Cys
180 185 190
gtt cag gcc ctt ctg ttg aat aag ggc cca aaa aac ctt cca gat atc 624
35 Val Gln Ala Leu Leu Leu Asn Lys Gly Pro Lys Asn Leu Pro Asp Ile
195 200 205
gag tgg gtt get ctg ata gga caa tca gtt gca att gcg tca get caa 672
Glu Trp Val Ala Leu Ile Gly Gln Ser Val Ala Ile Ala Ser Ala Gln
40 210 2l5 220
gca gca ggt tct gaa aac tca cta gaa aca gca tgg aat get gaa get 720
Ala Ala Gly Ser Glu Asn Ser Leu Glu Thr Ala Trp Asn Ala Glu Ala
225 230 235 240
gaa acc ctc aga tcc atc tta act gga get cca.aaa agt aaa cta ggt 768
Glu Thr Leu Arg Ser Ile Leu Thr Gly Ala Pro Lys Ser Lys Leu Gly
245 250 255
aga ata get ctg gtt gac acc att get aag c 7gg
Arg Ile Ala Leu Val Asp Thr Ile Ala Lys
260 265
<210> 14
<211> 266
<212> PRT
<213> Oryza sativa
<400> 14
Ala Pro Arg Arg Pro Ser Thr Phe Leu Asn Ala Val Ala Leu Gly Asn
1 5 10 15
Val Gly Ala Gly Lys Ser Ala Val Leu Asn Ser Leu Ile Gly His Pro
20 25 30
18
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Val Leu Pro Thr Gly Glu Asn Gly Ala Thr Arg Ala Pro Ile Val Val
35 40 45
Asp Leu Gln Arg Asp Pro Gly Leu Ser Ser Lys Ser Ile Val Leu Gln
50 55 60
Ile Asp Ser Lys Ser Gln Arg Val Ser Ala Ser Ser Leu Arg His Ser
65 70 75 80
Leu Gln Asp Arg Leu Ser Lys Gly Ala Ser Ser Gly Ser Ser Arg Gly
85 90 95
Arg Val Glu Gly Ile Asn Leu Lys Leu Arg Thr Ser Thr Ala Pro Pro
100 105 110
Leu Lys Leu Val Asp Leu Pro Gly Ile Asp Gln Arg Ala Val Asp Asp
115 120 125
Pro Met Ile Asn Glu Tyr Ala Gly His Asn Asp Ala Ile Leu Leu Val
130 135 140
Val Ile Pro Ala Met Gln Ala Ala Asp Val Ala Ser Ser Arg Ala Leu
145 150 155 160
Arg Leu Ala Lys Asp Ile Asp Ala Asp Gly Thr Arg Thr Val Gly Val
165 170 175
Ile Ser Lys Val Asp Gln Ala Glu Gly Asp Ala Lys Thr Ile Ala Cys
180 185 190
Val Gln Ala Leu Leu Leu Asn Lys Gly Pro Lys Asn Leu Pro Asp Ile
195 200 205
Glu Trp Val Ala Leu Ile Gly Gln Ser Val Ala Ile Ala Ser Ala Gln
210 215 220
Ala Ala Gly Ser Glu Asn Ser Leu Glu Thr Ala Trp Asn Ala Glu Ala
225 230 235 240
Glu Thr Leu Arg Ser Ile Leu Thr Gly Ala Pro Lys Ser Lys Leu Gly
245 250 255
Arg I1e Ala Leu Val Asp Thr Ile Ala Lys
260 265
<210> 15
<211> 1429
<212> DNA
<213> Oryza sativa
<220>
19
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
<221> CDS
<22 2> (1)..(1428)
<40 0> 15
atg ggggcccttttgagctcccccaacagcaagaaccagccatgggag 48
Met GlyAlaLeuLeuSerSerProAsnSerLysAsnGlnProTrpGlu
l 5 10 15
cat ggtgaagettcaaaggcagattcctccaagaagctgcggatgtcg 96
10His GlyGluAlaSerLysAlaAspSerSerLysLysLeuArgMetSer
20 25 30
gcg ccgcctctgtccggtggctacgaccaccccgggctgatcccgggg 7.44
Ala ProProLeuSerGlyGlyTyrAspHisProGlyLeuIleProGly
35 40 45
ctc ccggatgagatctcgctgcagatcctcgcaaggatgccccggatg 192
Leu ProAspGluIleSerLeuGlnIleLeuAlaArgMetProArgMet
50 55 60
ggt tatctgaatgcaaagatggtttcgaggagctggaaggetgcgatc 240
Gly TyrLeuAsnAlaLysMetValSerArgSerTrpLysA1aAlaIle
65 70 75 80
25act ggcgtggagctgtaccgggtgaggaaggagctgggtgtgagtgag 288
Thr GlyValGluLeuTyrArgValArgLysGluLeuGlyValSerGlu
85 90 95
gaa tggctgtacatgcttaccaagtcagatgatgggaagctagtgtgg 336
30Glu TrpLeuTyrMetLeuThrLysSerAspAspGlyLysLeuValTrp
100 105 110
aat gcattcgatccggtttgtggccaatggcagaggctgccactgatg 384
Asn AlaPheAspProValCysGlyGlnTrpGlnArgLeuProLeuMet
35 l15 l20 125
ccg gggatcagccatggaggagaatgcaagaggggcatccctgggttg 432
Pro GlyIleSerHisGlyGlyGluCysLysArgGlyIleProGlyLeu
130 135 140
40
tgg ttaggggatttgttgagcgccggcatcagggtctctgatgttatt 480
Trp LeuGlyAspLeuLeuSerAlaGlyIleArgValSerAspValIle
145 150 155 160
45aga ggctggcttggccaaagggattcattggataggcttccgttctgc 528
Arg GlyTrpLeuGlyGlnArgAspSerLeuAspArgLeuProPheCys
165 170 175
ggt tgtgcaattgggacagtcaacgggtgcatctatgttttaggtgga 576
50Gly CysAlaIleGlyThrValAsnGlyCysIleTyrValLeuGlyGly
180 185 190
ttc tctagaggctcggcgatgaaatgtgtatggaggtatgatcctttt 624
Phe SerArgGlySerAlaMetLysCysValTrpArgTyrAspProPhe
55 195 200 205
gtc aatgcgtggcaggaggttagctcgatgagcaccgggcgcgcattc 672
Val AsnAlaTrpGlnGluValSerSerMetSerThrGlyArgAlaPhe
210 215 220
60
tgc aaggetagcctgctgaacaacaagctgtatgttgttggtggtgtc 720
Cys LysAlaSerLeuLeuAsnAsnLysLeuTyrValValGlyGlyVal
225 230 235 240
65agc aaaggcaagaacgggttagetc,cgctccaatccgccgaggtgttt 768
Ser LysGlyLysAsnGlyLeuAlaProLeuGlnSerAlaGluValPhe
245 250 255
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
gac ccaagg acaggaatttgggtgggaggg gccctgacactctccgtc 816
Asp ProArg ThrGlyIleTrpValGlyGly AlaLeuThrLeuSerVal
260 265 270
tcg aaaggg ccaagctctaccagctgcctc ttggttgagctggtgaag 864
Ser LysGly ProSerSerThrSerCysLeu LeuValGluLeuValLys
275 280 285
ccc attgcg acaggaatgacctctttggga ggcaagctttatgttctt 912
Pro IleAla ThrGlyMetThrSerLeuGly GlyLysLeuTyrValLeu
290 295 300
caa agtctg tattccgggccattctttgtt gatgttggtggggagatc 960
Gln SerLeu TyrSerGlyProPhePheVal AspValGlyGlyGluIle
305 310 315 320
ttt gatccg gagacaaattcatgggcggaa atgcctgtaggaatgggc 1008
Phe AspPro GluThrAsnSerTrpAlaGlu MetProValGlyMetGly
325 330 335
gag ggctgg ccagcgaggcaggetggtacg aagttaagtgetgtcata 1056
Glu GlyTrp ProAlaArgGlnAlaGlyThr LysLeuSerAlaValIle
340 345 350
gat ggggac ttgtatgetttggagccatca acttcttttgatagaggt 1104
Asp GlyAsp LeuTyrAlaLeuGluProSer ThrSerPheAspArgGly
355 360 365
aag atcaag atttatgatcctcaggaggat gettggaaggttgccatt 1152
i 30 Lys IleLys IleTyrAspProGlnGluAsp AlaTrpLysVa1AlaIle
370 . 375 380
ggc caggta ccagtgggtgactttgcagag tcggaatgtccatactta 1200
Gly GlnVal ProValGlyAspPheAlaG1u SerGluCysProTyrLeu
385 390 395 400
ctt gcagga tttcttggcaagctcaatttg atcatcaaagatgtagat 1248
Leu AlaGly PheLeuGlyLysLeuAsnLeu IleIleLysAspValAsp
405 410 415
agc aagatc aatataatgcaaaccgatgtt ctgaagcctgtggagttg 1296
Ser LysIle AsnIleMetGlnThrAspVal LeuLysProValGluLeu
420 425 430
tca gcccct ggaaatggtccaacatgccaa aatcaacaacttttttca 1344
Ser AlaPro GlyAsnGlyProThrCysGln AsnGlnGlnLeuPheSer
435 440 445
gaa caggaa actaatttgtggaaagtcatc gtgtcgaaaaatcttgca 1392
Glu GlnGlu ThrAsnLeuTrpLysValIle ValSerLysAsnLeuAla
450 455 460
gcc getgaa ttagtcagttgtcaggtgctc aacatat 1429
Ala AlaGlu LeuValSerCysGlnValLeu AsnIle
465 470 475
<210>
16
<211>
476
<212>
PRT
<213> sativa
Oryza
<400>
16
Met GlyAla LeuLeuSerSerProAsnSer Lys GlnProTrpGlu
Asn
1 5 10 15
21
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
His Gly Glu Ala Ser Lys Ala Asp Ser Ser Lys Lys Leu Arg Met Ser
20 25 30
Ala Pro Pro Leu Ser Gly Gly Tyr Asp His Pro Gly Leu Ile Pro Gly
35 40 45
Leu Pro Asp Glu Ile Ser Leu Gln Ile Leu Ala Arg Met Pro Arg Met
50 55 60
Gly Tyr Leu Asn Ala Lys Met Val Ser Arg Ser Trp Lys Ala Ala Ile
65 70 75 g0
Thr Gly Val Glu Leu Tyr Arg Val Arg Lys Glu Leu Gly Val Ser Glu
85 90 95
Glu Trp Leu Tyr Met Leu Thr Lys Ser~Asp Asp Gly Lys Leu Val Trp
100 105 110
Asn Ala Phe Asp Pro Val Cys Gly Gln Trp Gln Arg Leu Pro Leu Met
115 120 125
Pro Gly Ile Ser His Gly Gly Glu Cys Lys Arg Gly Ile Pro Gly Leu
130 135 140
Trp Leu Gly Asp Leu Leu Ser Ala Gly Ile Arg Val Ser Asp Val Ile
145 150 155 160
Arg Gly Trp Leu Gly Gln Arg Asp Ser Leu Asp Arg Leu Pro Phe Cys
165 170 175
Gly Cys Ala Ile Gly Thr Val Asn Gly Cys Ile Tyr Val Leu Gly Gly
180 185 190
Phe Ser Arg Gly Ser Ala Met Lys Cys Val Trp Arg Tyr Asp Pro Phe
l95 200 205
Val Asn Ala Trp Gln Glu Val Ser Ser Met Ser Thr Gly Arg Ala Phe
210 2l5 220
Cys Lys Ala Ser Leu Leu Asn Asn Lys Leu Tyr Val Val Gly Gly Val
225 230 235 240
Ser Lys Gly Lys Asn Gly Leu Ala Pro Leu Gln Ser Ala Glu Val Phe
245 250 255
Asp Pro Arg Thr Gly Ile Trp Val Gly Gly Ala Leu Thr Leu Ser Val
260 265 270
Ser Lys Gly Pro Ser Ser Thr Ser Cys Leu Leu Val Glu Leu Val Lys
275 280 285
22
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Pro Ile Ala Thr Gly Met Thr Ser Leu Gly Gly Lys Leu Tyr Val Leu
290 295 300
Gln Ser Leu Tyr Ser Gly Pro Phe Phe Val Asp Val Gly Gly Glu Ile
305 310 315 320
Phe Asp Pro Glu Thr Asn Ser Trp Ala Glu Met Pro Val Gly Met Gly
325 330 335
Glu Gly Trp Pro Ala Arg Gln Ala Gly Thr Lys Leu Ser Ala Val Ile
340 345 350
20
Asp Gly Asp Leu Tyr Ala Leu Glu Pro Ser Thr Ser Phe Asp Arg Gly
355 360 365
Lys Ile Lys Ile Tyr Asp Pro Gln Glu Asp Ala Trp Lys Val Ala Ile
370 375 380
Gly Gln Val Pro Val Gly Asp Phe Ala Glu Ser Glu Cys Pro Tyr Leu
385 390 395 400
Leu Ala Gly Phe Leu Gly Lys Leu Asn Leu Ile Ile Lys Asp Val Asp
405 410 415
40
Ser Lys Ile Asn Ile Met Gln Thr Asp Val Leu Lys Pro Val Glu Leu
420 425 430
Ser Ala Pro Gly Asn Gly Pro Thr Cys Gln Asn Gln Gln Leu Phe Ser
435 440 445
Glu Gln Glu Thr Asn Leu Trp Lys Val Ile Val Ser Lys Asn Leu Ala
450 455 460
Ala Ala Glu Leu Val Ser Cys Gln Val Leu Asn Ile
465 470 475
<210> 17
<211> 1140
<212> DNA
<213> Oryza sativa
<z2o>
<221> CDS
<222> (1)..(1140)
<400> 17
tca tcc ttc ctt tgg ggt tat ctg gtg tca cca ata att ggt gga gca 48
Ser Ser Phe Leu Trp Gly Tyr Leu Val Ser Pro Ile Ile Gly Gly Ala
1 5 10 15
ctg gtc gac tac tat ggc gga aag cga gtt atg get tat ggc gtg get 96
Leu Val Asp Tyr Tyr Gly Gly Lys Arg Val Met Ala Tyr Gly Val Ala
20 25 30
cta tgg tcc ttg get aca ttc ctc tcc cct tgg gca get get cgc tct 144
23
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Leu Trp Ser Leu Ala Thr Phe Leu Ser Pro Trp Ala Ala Ala Arg Ser
35 40 45
ctc tggttgttcctctcaactagagttctg ctgggtatggcagaaggg 192
Leu TrpLeuPheLeuSerThrArgValLeu LeuGlyMetAlaGluGly
50 55 60
gtg gcactcccaagtatgaacaacatggtg ttgaggtggtttcctcgc 240
Val AlaLeuProSerMetAsnAsnMetVal LeuArgTrpPheProArg
1065 70 75 80
aca gagcgatcaagtgetgtcgggattgca atggetggttttcagctt 288
Thr GluArgSerSerAlaValGlyIleAla MetAlaGlyPheGlnLeu
85 90 95
ggc aataccattggtttacttctttcccct atcatcatgtcacgaget 336
Gly AsnThrIleGlyLeuLeuLeuSerPro IleIleMetSerArgAla
100 105 110
20gga atttttggaccatttgtgatatttgga ttatttggatttctatgg 384
Gly IlePheGlyProPheValIlePheGly LeuPheGlyPheLeuTrp
1l5 120 125
gtg ttggtgtggatatctgetatatcaggg actccaggtgaaaatgca 432
25Val LeuValTrpIleSerAlaIleSerGly ThrProGlyGluAsnAla
130 135 140
caa atatcagcacatgaactagattatata accaggggtcagaaattg 480
Gln IleSerAlaHisGluLeuAspTyrIle ThrArgGlyGlnLysLeu
30145 150 155 160
gta aaaactcaatctggaggtgaaagatta cgaaaggtccctcctttc 528
Val LysThrGlnSerGlyGlyGluArgLeu ArgLysValProProPhe
165 170 l75
35
agc aagctactctctaaatggccaacatgg getttaatttctgcaaat 576
Ser LysLeuLeuSerLysTrpProThrTrp AlaLeuIleSerAlaAsn
180 185 190
40get atgcatagttggggttattttgtcatt ctttcatggatgccagtg 624
Ala MetHisSerTrpGlyTyrPheValIle LeuSerTrpMetProVal
195 200 205
tat ttcaaaacaatatatcatgttaatctg agagaagetgcatggttt 672
45Tyr PheLysThrIleTyrHisValAsnLeu ArgGluAlaAlaTrpPhe
210 215 ' 220
agt gcactcccctgggtcatgatggcagtt ttaggctatgttgetggt 720
Ser AlaLeuProTrpValMetMetAlaVal LeuGlyTyrValAlaGly
50225 230 235 240
gtt gtatcagacaggcttatccaaaatggt acaagcatcactttgact 768
Val ValSerAspArgLeuIleGlnAsnGly ThrSerIleThrLeuThr
245 250 255
55
cgg aagataatgcagacaattggctttgtg ggtcctggtgtggetctt 816
Arg LysIleMetGlnThrIleGlyPheVal GlyProGlyValAlaLeu
260 265 270
60ctt ggactaaatgcagcaaagagtccagtc atcgettctgettggctt 864
Leu GlyLeuAsnAlaAlaLysSerProVal IleAlaSerAlaTrpLeu
275 280 285
act atcgetgtaggtttgaagtcctttggt cactcaggttttctagta 912
65Thr IleAlaValGlyLeuLysSerPheGly HisSerGlyPheLeuVal
290 295 300
aat cttcaggagattgetccacaatatget gtgctacatggaatg 960
gga
24
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Asn LeuGlnGluIleAlaProGlnTyrAlaGlyValLeuHisGlyMet
305 310 315 320
tca aatacagetggaacatttgetgccattttaggaactgttggagca 1008
Ser AsnThrAlaGlyThrPheAlaAlaIleLeuGlyThrValGlyAla
325 330 335
ggt ttctttgtcgatcggatgggttctttccgtggatttttaatatta 1056
Gly PhePheValAspArgMetGlySerPheArgGlyPheLeuIleLeu
340 345 350
aca tctcttctatacttcagtagcacactgttctgggatatatttget 1104
Thr SerLeuLeuTyrPheSerSerThrLeuPheTrpAspIlePheAla
355 360 365
act ggagagcgtgttgattttgatggcactggctag 1140
Thr GlyGluArgValAspPheAspGlyThrGly
370 375
<210> 18
<2l1> 379
<212> PRT
<213> Oryza sativa
<400> 18
Ser Ser Phe Leu Trp Gly Tyr Leu Val Ser Pro Ile Ile Gly Gly Ala
1 5 10 15
35
Leu Val Asp Tyr Tyr Gly Gly Lys Arg Val Met Ala Tyr Gly Val Ala
20 25 30
Leu Trp Ser Leu Ala Thr Phe Leu Ser Pro Trp Ala Ala Ala Arg Ser
40 45
Leu Trp Leu Phe Leu Ser Thr Arg Val Leu Leu Gly Met Ala Glu Gly
55 60
Val Ala Leu Pro Ser Met Asn Asn Met Val Leu Arg Trp Phe Pro Arg
45 65 70 75 80
Thr Glu Arg Ser Ser Ala Val Gly Ile Ala Met Ala Gly Phe Gln Leu
85 90 95
Gly Asn Thr Ile Gly Leu Leu Leu Ser Pro Ile Ile Met Ser Arg Ala
100 105 110
Gly Ile Phe Gly Pro Phe Val Ile Phe Gly Leu Phe Gly Phe Leu Trp
115 120 125
Val Leu Val Trp Ile Ser Ala Ile Ser Gly Thr Pro Gly Glu Asn Ala
130 135 140
Gln Ile Ser Ala His Glu Leu Asp Tyr Ile Thr Arg Gly Gln Lys Leu
145 150 155 160
Val Lys Thr Gln Ser Gly Gly Glu Arg Leu Arg Lys Val Pro Pro Phe
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
165 170 175
Ser Lys Leu Leu Ser Lys Trp Pro Thr Trp Ala Leu Ile Ser Ala Asn
180 185 190
Ala Met His Ser Trp Gly Tyr Phe Val Ile Leu Ser Trp Met Pro Val
195 200 205
Tyr Phe Lys Thr Ile Tyr His Val Asn Leu Arg Glu Ala Ala Trp Phe
210 215 220
Ser Ala Leu Pro Trp Val Met Met Ala Val Leu Gly Tyr Val Ala Gly
225 230 235 240
Val Val Ser Asp Arg Leu Ile Gln Asn Gly Thr Ser Ile Thr Leu Thr
245 250 255
Arg Lys Ile Met Gln Thr Ile Gly Phe Val Gly Pro Gly Val Ala Leu
260 265 270
Leu Gly Leu Asn Ala Ala Lys Ser Pro Val Tle Ala Ser Ala Trp Leu
275 280 285
Thr Ile Ala Val Gly Leu Lys Ser Phe Gly His Ser Gly Phe Leu Val
290 295 300
Asn Leu Gln Glu Ile Ala Pro Gln Tyr Ala Gly Val Leu His Gly Met
305 310 315 320
Ser Asn Thr Ala Gly Thr Phe Ala Ala Ile Leu Gly Thr Val Gly Ala
325 330 335
Gly Phe Phe Val Asp Arg Met Gly Ser Phe Arg Gly Phe Leu Ile Leu
340 345 350
Thr Ser Leu Leu Tyr Phe Ser Ser Thr Leu Phe Trp Asp Ile Phe Ala
355 360 365
Thr Gly Glu Arg Val Asp Phe Asp Gly Thr Gly
370 375
<210> 19
<211> 831
<212> DNA
<213> Oryza sativa
<220>
<221> CDS
<222> (1)..(831)
<400> 19
atg gcg ttc cgg ctg agc aac agc ctg ctc ggg atc ctg aac gcg gtg 48
Met Ala Phe Arg Leu Ser Asn Ser Leu Leu Gly Ile Leu Asn Ala Val
26
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
1 5 10 15
acg ttcctcctgtcggtgcccgtgctgggcggcggcatctggctg gcg 96
Thr PheLeuLeuSerValProValLeuGlyGlyGlyIleTrpLeu Ala
20 25 30
acg cgcgccgacggcacggagtgcgagcgctacttctcggcgccg gtg 144
Thr ArgAlaAspGlyThrGluCysGluArgTyrPheSerAlaPro Val
35 40 45
atc gcgttcggggtgttcctcctcctcgtctccctcgcgggcctc gtc 192
Ile AlaPheGlyValPheLeuLeuLeuValSerLeuAlaGlyLeu Val
50 55 60
15ggc gcctgctgccgcgtcaactgcctcctctggttctacctcgtc gcc 240
Gly AlaCysCysArgValAsnCysLeuLeuTrpPheTyrLeuVal Ala
65 70 75 80
atg ttcgtcctcatcgtcgtcctcttctgcttcaccgtcttcgcc ttc 288
20Met PheValLeuIleValValLeuPheCysPheThrValPheAla Phe
85 90 95
gtc gtcaccaacaagggcgccggcgaggccgtctccggcagaggg tac 336
Val ValThrAsnLysGlyAlaGlyGluAlaValSerGlyArgGly Tyr
25 100 105 110
aag gagtacaggctcggcgactactccaactggctgcagaagcgg atg 384
Lys GluTyrArgLeuGlyAspTyrSerAsnTrpLeuGlnLysArg Met
115 120 125
30
gag aacagcaagaactggaacaggatcaggagctgcctccaggac tcc 432
Glu AsnSerLysAsnTrpAsnArgIleArgSerCysLeuGlnAsp Ser
130 135 140
35aag gtctgcaagaaactgcaggacaagaactgggatcggacccag ttc 480
Lys ValCysLysLysLeuGlnAspLysAsnTrpAspArgThrGln Phe
145 150 155 160
ttc aaagccgacctctccccgctcgagtccggatgctgcaagcca ccc 528
40Phe LysAlaAspLeuSerProLeuGluSerGlyCysCysLysPro Pro
165 170 175
agc agctgcaacttcctctacgtcagcggcacgaactggacgaag gtg 576
5er SerCysAsnPheLeuTyrValSerGlyThrAsnTrpThrLys Val
45 180 185 190
ccc accaactcgtcggacccggactgcaacacgtgggtcgacgac ggc 624
Pro ThrAsnSerSerAspProAspCysAsnThrTrpValAspAsp Gly
195 200 205
50
acg cagctgtgctacaactgccagtcgtgcaaggccggcgcggtg gcg 672
Thr GlnLeuCysTyrAsnCysGlnSerCysLysAlaGlyAlaVal Ala
210 215 220
55acc ctgaagcgggactggaagcgcgtcgccgtcgtctgcatcgtc ttc 720
Thr LeuLysArgAspTrpLysArgValAlaValValCysIleVal Phe
225 230 235 240
ctc gtcttcatcgtcatcgtctactccctcggctgctgcgcgttc agg 768
60Leu ValPheIleValIleValTyrSerLeuGlyCysCysAlaPhe Arg
245 250 255
aac aaccggagggacaaccgcggcgcctatcgcggtgccgcgtgg aag 816
Asn AsnArgArgAspAsnArgGlyAlaTyrArgGlyAlaAlaTrp Lys
65 260 265 270
ggc ggatacgcctga 831
Gly GlyTyrAla
27
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
275
<210> 20
<211> 276
<212> PRT
<213> Oryza sativa
<400> 20
Met Ala Phe Arg Leu Ser Asn Ser Leu Leu Gly Ile Leu Asn Ala Val
1 5 10 15
Thr Phe Leu Leu Ser Val Pro Val Leu Gly Gly Gly Ile Trp Leu Ala
25 30
Thr Arg Ala Asp Gly Thr Glu Cys Glu Arg Tyr Phe Ser Ala Pro Val
20 35 40 45
Ile Ala Phe Gly Val Phe Leu Leu Leu Val Ser Leu Ala Gly Leu Val
50 55 60
Gly Ala Cys Cys Arg Val Asn Cys Leu Leu Trp Phe Tyr Leu Val Ala
65 70 75 80
Met Phe Val Leu Ile Val Val Leu Phe Cys Phe Thr Val Phe Ala Phe
85 90 95
Val Val Thr Asn Lys Gly Ala Gly Glu Ala Val Ser Gly Arg Gly Tyr
100 105 110
Lys Glu Tyr Arg Leu Gly Asp Tyr Ser Asn Trp Leu Gln Lys Arg Met
115 120 125
Glu Asn Ser Lys Asn Trp Asn Arg Ile Arg Ser Cys Leu Gln Asp Ser
130 135 140
Lys Val Cys Lys Lys Leu Gln Asp Lys Asn Trp Asp Arg Thr Gln Phe
145 150 155 160
Phe Lys Ala Asp Leu Ser Pro Leu Glu Ser Gly Cys Cys Lys Pro Pro
165 170 175
Ser Ser Cys Asn Phe Leu Tyr Val Ser Gly Thr Asn Trp Thr Lys Val
180 185 190
Pro Thr Asn Ser Ser Asp Pro Asp Cys Asn Thr Trp Val Asp Asp Gly
195 200 205
Thr Gln Leu Cys Tyr Asn Cys Gln Ser Cys Lys Ala Gly Ala Val A1a
210 215 220
Thr Leu Lys Arg Asp Trp Lys Arg Val Ala Val Val Cys Ile Val Phe
225 230 235 240
28
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Leu Val Phe Ile Val Ile Val Tyr Ser Leu Gly Cys Cys Ala Phe Arg
245 250 255
10
Asn Asn Arg Arg Asp Asn Arg Gly Ala Tyr Arg Gly Ala Ala Trp Lys
260 265 270
Gly Gly Tyr Ala
275
<210> 21
<211> 2727
<212> DNA
<213> Oryza sativa
<220>
<221> CDS
<222> (1)..(2727)
25<400> 21
ata aaaagacttcaccttctgctcacagtgaaggaatctgetatggat 48
Ile LysArgLeuHisLeuLeuLeuThrValLysGluSerAlaMetAsp
1 5 10 15
30gtt cctacaaacctggatgetagaaggcggatatcattctttgetaat 96
Val ProThrAsnLeuAspAlaArgArgArgIleSerPhePheAlaAsn
20 25 30
tct cttttcatggacatgccaagtgetccaaaagtccggcacatgttg 144
35Ser LeuPheMetAspMetProSerAlaProLysValArgHisMetLeu
35 40 45
ccc ttctctgtcttgactccttactacaaagaagatgtccttttctct 192
~
Pro PheSerValLeuThrProTyrTyrLysGluAspValLeuPheSer
40 50 55 60
tcc caagcattagaagaccagaatgaagatggggtttctattcttttt 240
Ser GlnAlaLeuGluAspGlnAsnGluAspGlyValSerIleLeuPhe
65 70 75 80
45
tac ttgcaaaaaatctatccagatgaatggaaacatttccttcaaagg 288
Tyr LeuGlnLysIleTyrProAspGluTrpLysHisPheLeuGlnArg
85 90 95
50gtg gattgcaatactgaagaggaactccgtgagacagagcagttggaa 336
Val AspCysAsnThrGluGluGluLeuArgGluThrGluGlnLeuGlu
100 105 110
gat gagcttcgcctttgggcatcatacaggggccaaactttgacgaga 384
55Asp GluLeuArgLeuTrpAlaSerTyrArgGlyGlnThrLeuThrArg
115 120 125
act gtcagagggatgatgtactacagacaagetttggtgcttcagget 432
Thr ValArgGlyMetMetTyrTyrArgGlnAlaLeuValLeuGlnAla
60 130 135 140
ttt cttgatatggetagagatgaagatcttagggaaggcttcagagca 480
Phe LeuAspMetAlaArgAspGluAspLeuArgGluGlyPheArgAla
145 150 155 160
65
get gacctcttaaatgatgaatcaccattactgactcaatgcaaaget 528
Ala AspLeuLeuAsnAspGluSerProLeuLeuThrGlnCysLysAla
165 170 175
29
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
ata get gac atg aag ttt aca tac gtt gta tca tgc caa caa tac ggt 576
Ile Ala Asp Met Lys Phe Thr Tyr Val Val Ser Cys Gln Gln Tyr Gly
180 185 190
atc cag aaa cgt tct ggt gat cac cgt gca caa gat att ctt aga ctg 624
Ile Gln Lys Arg Ser Gly Asp His Arg Ala Gln Asp Ile~Leu Arg Leu
195 200 205
atg aca act tat cca tca ctt cgg gtt gcc tat att gat gaa gtt gaa 672
Met Thr Thr Tyr Pro Ser Leu Arg Val Ala Tyr Ile Asp Glu Val Glu
210 215 220
gag ccaagcaaagacaggaacaagaagatagaaaaggtttactactca 720
ProSerLysAspArgAsnLysLysIleGluLysValTyrTyrSer
Glu
225 230 235 240
gcg ttggtgaaggcagetgtaaccaagcctgacgatcctggtcagaaa 768
Ala LeuValLysAlaAlaValThrLysProAspAspProGlyGlnLys
245 250 255
ctt gatcaggacatatacagaataaagctaccaggtaatgcaatgcta 816
Leu AspGlnAspIleTyrArgIleLysLeuProGlyAsnAlaMetLeu
260 265 270
ggt gaaggaaagccagaaaatcagaaccatgcgataatatttactcga 864
Gly GluGlyLysProGluAsnGlnAsnHisAlaIleIlePheThrArg
275 280 285
30ggt gaaggccttcaaactatagacatgaatcaggaacattacatggag 912
Gly G1uGlyLeuGlnThrIleAspMetAsnGlnGluHisTyrMetGlu
290 295 300
gag actttgaaaatgagaaatctgctgcaagagtttctgaagaaacat 960
35Glu ThrLeuLysMetArgAsnLeuLeuGlnGluPheLeuLysLysHis
305 310 315 320
gat ggtgtgaggtatccatcaatacttggtgtgagagagcacatattc 1008
Asp GlyValArgTyrProSerIleLeuGlyValArgGluHisIlePhe
40 325 330 335
act ggcagtgtttcttctcttgcgtggttcatgtcaaatcaagagaca 1056
Thr GlySerValSerSerLeuAlaTrpPheMetSerAsnGlnGluThr
340 345 350
45
agt tttgtcactattggacaacgggtacttgccaatcctttgagagtt 1104
Ser PheValThrIleGlyGlnArgValLeuAlaAsnProLeuArgVal
355 360 365
50cga tttcattatggacatcctgatatttttgatcgacttttccacctc 1152
Arg PheHisTyrGlyHisProAspIlePheAspArgLeuPheHisLeu
370 , 375 380
acg aggggtggtgtaagcaaagcatccaagattatcaatcttagtgag 1200
55Thr ArgGlyGlyValSerLysAlaSerLysIleIleAsnLeuSerGlu
385 390 395 400
gac atatttgetggattcaactcaacactgcgtgaaggaaatgttacg 1248
Asp IlePheAlaGlyPheAsnSerThrLeuArgGluGlyAsnValThr
60 405 410 415
cat cat gaa tac atg caa gtt ggc aag ggg aga gat gtg ggt ctc aat 1296
His His Glu Tyr Met Gln Val Gly Lys Gly Arg Asp Val Gly Leu Asn
420 425 430
caa atc tca cta ttt gag gca aaa ata get aat ggt aat gga gag cag 1344
Gln Ile Ser Leu Phe Glu Ala Lys Ile Ala Asn Gly Asn Gly Glu Gln
435 440 445
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
aca ctg agc cgt gac gtc tac cga ctt gga cat cgt ttt gat ttc ttc 1392
Thr Leu Ser Arg Asp Val Tyr Arg Leu Gly His Arg Phe Asp Phe Phe
450 455 460
aga atgttgtcctgctactacaccactattggtttttacttcagcact 1440
Arg MetLeuSerCysTyrTyrThrThrIleGlyPheTyrPheSerThr
465 470 475 480
10I atgacagtgtggacagtgtatgtattcctctatggacgtctctat 1488
atg
Met MetThrValTrpThrValTyrValPheLeuTyrGlyArgLeuTyr
485 490 495
ctt gtcctcagtggtcttgatgaagccttggetactggaaaaaggttt 1536
15Leu ValLeuSerGlyLeuAspGluAlaLeuAlaThrGlyLysArgPhe
500 505 510
ata cacaatgaacctctccaggttgetcttgettcacagtcttttgtg 1584
Ile HisAsnGluProLeuGlnValAlaLeuAlaSerGlnSerPheVal
20 515 520 525
cag cttgggtttttgatggcgttgcctatgatgatggaaattggtctg 1632
Gln LeuGlyPheLeuMetAlaLeuProMetMetMetGluIleGlyLeu
530 535 540
25
gag agaggatttagaaccgcattgagcgactttgtactgatgcagctg 1680
Glu ArgGlyPheArgThrAlaLeuSerAspPheValLeuMetGlnLeu
545 550 555 560
30cag ttagcatctgttttctttacattctctctcgggaccaaaactcac 1728
Gln LeuAlaSerValPhePheThrPheSerLeuGlyThrLysThrHis
565 570 575
tac tatggaacaacgctgctccatggaggagccgagtatagagetact 1776
35Tyr TyrGlyThrThrLeuLeuHisGlyGlyAlaGluTyrArgAlaThr
580 585 590
ggg cgtggatttgtggtgttccatgccaaatttgcggagaactatcga 1824
Gly ArgGlyPheValValPheHisAlaLysPheAlaGluAsnTyrArg
40 595 600 605
cta tactcacgcagccattttgtcaagggtatt,gagttgctgattttg 1872
Leu TyrSerArgSerHisPheValLysGlyIleGluLeuLeuIleLeu
610 615 620
45
cta attgtgtatgaaatctttgggcaatcatatcgaggagetatcgcg 1920
Leu IleValTyrGluIlePheGlyGlnSerTyrArgGlyAlaIleAla
625 630 635 640
50tac atcttcattacattttcgatgtggtttatggttgtaacctggctc 1968
Tyr IlePheIleThrPheSerMetTrpPheMetValValThrTrpLeu
645 650 655
ttt gcaccattcctatttaatccttctgggttcgagtggcagaagatt 2016
55Phe AlaProPheLeuPheAsnProSerGlyPheGluTrpGlnLysIle
660 665 670
gtg gatgattggactgattggaataagtggatcagcaaccgtggtggt 2064
Val AspAspTrpThrAspTrpAsnLysTrpIleSerAsnArgGlyGly
60 675 680 685
s
att ggtgtaccaccggagaaaagttgggagtcatggtgggagaaagag 2112
Ile GlyValProProGluLysSerTrpGluSerTrpTrpGluLysGlu
690 695 700
65
cag gagcctataaaatattctgggaagcgtggaattgttctcgaaata 2160
Gln GluProIleLysTyrSerGlyLysArgGlyIleValLeuGluIle
705 710 715 720
31
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
gtg cttgcattgcgcttctttatctaccaatatggtcttgtttatcac 2208
Val LeuAlaLeuArgPhePheIleTyrGlnTyrGlyLeuValTyrHis
725 730 735
ttg aacataaccaaacacacaaagagtgtcctggtctattgcctgtca 2256
Leu AsnIleThrLysHisThrLysSerValLeuValTyrCysLeuSer
740 745 750
10tgg gttgtcatctttgtaattctgcttgtgatgaagaccgtgtcagtt 2304
Trp ValValIlePheValIleLeuLeuValMetLysThrValSerVal
755 760 765
ggg aggcggaaattcagcgcggacttccaacttgtgttccggttgatt 2352
15Gly ArgArgLysPheSerAlaAspPheGlnLeuValPheArgLeuIle
770 775 780
aag gggttgatatttataacatttatctccatcattataatcttgata 2400
Lys GlyLeuIlePheIleThrPheIleSerIleIleIleIleLeuIle
20785 790 795 800
gca atccctcatatgacagtccaggacatctttgtttgcattcttgcc 2448
Ala IleProHisMetThrValGlnAspIlePheValCysIleLeuAla
805 810 815
25
ttc atgccaactggctggggtctgctgttggttgcgcaagetatcaag 2496
Phe MetProThrGlyTrpGlyLeuLeuLeuValAlaGlnAlaIleLys
820 825 830
30cca gtaattgtgcgcatcgggttgtggggatcgatcaaggcgcttgcg 2544
Pro ValIleValArgIleGlyLeuTrpGlySerIleLysAlaLeuAla
835 840 845
agg ggatatgagatcatcatggggctcctgctcttcaccccgatcgcg 2592
35Arg GlyTyrGluIleIleMetGlyLeuLeuLeuPheThrProIleAla
850 855 860
ttc ctcgettggttcccgtttgtatccgagttccagaccagaatgctc 2640
Phe LeuAlaTrpPheProPheValSerGluPheGlnThrArgMetLeu
40865 870 875 880
ttc aaccaggccttcagcagaggtctgcagatctcgcgaatccttggc 2688
Phe AsnGlnAlaPheSerArgGlyLeuGlnIleSerArgIleLeuGly
885 890 895
45
ggc cacaagaaagaccgagetacacggaacaaggagtag 2727
Gly HisLysLysAspArgAlaThrArgAsnLysGlu
90'0 905
<2io> zz
<211> 908
<212> PRT
<2l3> Oryza sativa
<400> 22
Ile Lys Arg Leu His Leu Leu Leu Thr Val Lys Glu Ser Ala Met Asp
1 5 10 15
65
Val Pro Thr Asn Leu Asp Ala Arg Arg Arg Ile Ser Phe Phe Ala Asn
20 25 30
Ser Leu Phe Met Asp Met Pro Ser Ala Pro Lys Val Arg His Met Leu
35 40 45
32
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Pro Phe Ser Val Leu Thr Pro Tyr Tyr Lys Glu Asp Val Leu Phe Ser
50 55 60
Ser Gln Ala Leu Glu Asp Gln Asn Glu Asp Gly Val Ser Ile Leu Phe
65 70 75 80
Tyr Leu Gln Lys Ile Tyr Pro Asp Glu Trp Lys His Phe Leu Gln Arg
85 90 95
Val Asp Cys Asn Thr Glu Glu Glu Leu Arg G1u Thr Glu Gln Leu Glu
loo l05 llo
Asp Glu Leu Arg Leu Trp Ala Ser Tyr Arg Gly Gln Thr Leu Thr Arg
l15 120 125
Thr Val Arg Gly Met Met Tyr Tyr Arg Gln Ala Leu Val Leu Gln Ala
130 135 140
Phe Leu Asp Met Ala Arg Asp Glu Asp Leu Arg Glu Gly Phe Arg Ala
145 150 155 160
Ala Asp Leu Leu Asn Asp Glu Ser Pro Leu Leu Thr Gln Cys Lys Ala
165 170 175
Ile Ala Asp Met Lys Phe Thr Tyr Val Val Ser Cys Gln Gln Tyr Gly
180 185 190
Ile Gln Lys Arg Ser Gly Asp His Arg Ala Gln Asp Ile Leu Arg Leu
195 200 205
Met Thr Thr Tyr Pro Ser Leu Arg Val Ala Tyr Ile Asp Glu Val Glu
210 215 220
Glu Pro Ser Lys Asp Arg Asn Lys Lys Ile Glu Lys Val Tyr Tyr Ser
225 230 235 240
Ala Leu Val Lys Ala Ala Val Thr Lys Pro Asp Asp Pro Gly Gln Lys
245 250 255
Leu Asp Gln Asp Ile Tyr Arg Ile Lys Leu Pro Gly Asn Ala Met Leu
260 265 270
Gly Glu Gly Lys Pro Glu Asn Gln Asn His Ala Tle Ile Phe Thr Arg
275 280 285
Gly Glu Gly Leu Gln Thr Ile Asp Met Asn Gln Glu His Tyr Met Glu
290 295 300
Glu Thr Leu Lys Met Arg Asn Leu Leu Gln Glu Phe Leu Lys Lys His
305 310 315 320
33
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Asp Gly Val Arg Tyr Pro Ser Ile Leu Gly Val Arg Glu His Ile Phe
325 330 335
Thr Gly Ser Val Ser Ser Leu Ala Trp Phe Met Ser Asn Gln Glu Thr
340 345 350
Ser Phe Val Thr Ile Gly Gln Arg Val Leu Ala Asn Pro Leu Arg Val
355 360 365
Arg Phe His Tyr Gly His Pro Asp Ile Phe Asp Arg Leu Phe His Leu
370 375 380
Tar Arg Gly Gly Val Ser Lys Ala Ser Lys Ile Ile Asn Leu Ser Glu
385 390 395 400
Asp Ile Phe Ala Gly Phe Asn Ser Thr Leu Arg Glu Gly Asn Val Thr
405 410 415
His His Glu Tyr Met Gln Val Gly Lys Gly Arg Asp Val Gly Leu Asn
420 425 430
Gln Ile Ser Leu Phe Glu Ala Lys Ile Ala Asn Gly Asn Gly Glu Gln
435 440 445
Thr Leu Ser Arg Asp Val Tyr Arg Leu Gly His Arg Phe Asp Phe Phe
450 455 460
Arg Met Leu Ser Cys Tyr Tyr Thr Thr Ile Gly Phe Tyr Phe Ser Thr
465 470 475 480
Met Met Thr Val Trp Thr Val Tyr Val Phe Leu Tyr Gly Arg Leu Tyr
485 490 495
Leu Val Leu Ser Gly Leu Asp Glu Ala Leu Ala Thr Gly Lys Arg Phe
500 505 510
Ile His Asn Glu Pro Leu Gln Val Ala Leu Ala Ser Gln Ser Phe Val
515 520 525
Gln Leu Gly Phe Leu Met Ala Leu Pro Met Met Met Glu Ile Gly Leu
530 535 540
Glu Arg Gly Phe Arg Thr Ala Leu Ser Asp Phe Val Leu Met Gln Leu
545 550 555 560
Gln Leu Ala Ser Val Phe Phe Thr Phe Ser Leu Gly Thr Lys Thr His
565 570 575
Tyr Tyr Gly Thr Thr Leu Leu His Gly Gly Ala Glu Tyr Arg Ala Thr
580 585 590
34
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Gly Arg Gly Phe Val Val Phe His Ala Lys Phe Ala Glu Asn Tyr Arg
595 600 605
Leu Tyr Ser Arg Ser His Phe Val Lys Gly Ile Glu Leu Leu Ile Leu
610 615 620
Leu Ile Val Tyr Glu Ile Phe Gly Gln Ser Tyr Arg Gly Ala Ile Ala
625 630 635 640
Tyr Ile Phe Ile Thr Phe Ser Met Trp Phe Met Val Val Thr Trp Leu
645 650 655
Phe Ala Pro Phe Leu Phe Asn Pro Ser Gly Phe Glu Trp Gln Lys Ile
660 665 670
Val Asp Asp Trp Thr Asp Trp Asn Lys Trp Ile Ser Asn Arg Gly Gly
675 680 685
Ile Gly Val Pro Pro Glu Lys Ser Trp Glu Ser Trp Trp Glu Lys Glu
690 695 700
Gln Glu Pro Ile Lys Tyr Ser Gly Lys Arg Gly Ile Val Leu Glu Ile
705 710 715 720
Val Leu Ala Leu Arg Phe Phe Ile Tyr Gln Tyr Gly Leu Val Tyr His
725 730 735
Leu Asn Ile Thr Lys His Thr Lys Ser Val Leu Val Tyr Cys Leu Ser
740 745 750
Trp Val Val Ile Phe Val Ile Leu Leu Val Met Lys Thr Val Ser Val
755 760 765
Gly Arg Arg Lys Phe Ser Ala Asp Phe Gln Leu Val Phe Arg Leu Ile
770 775 780
Lys Gly Leu Ile Phe Ile Thr Phe Ile Ser Ile Ile Ile Ile Leu Ile
785 790 795 800
Ala Ile Pro His Met Thr Val Gln Asp Ile Phe Val Cys Ile Leu Ala
805 810 815
Phe Met Pro Thr Gly Trp Gly Leu Leu Leu Val Ala Gln Ala Ile Lys
820 825 830
Pro Val Ile Val Arg Ile Gly Leu Trp Gly Ser Ile Lys Ala Leu Ala
835 840 845
Arg Gly Tyr Glu Ile Ile Met Gly Leu Leu Leu Phe Thr Pro Ile Ala
850 855 860
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Phe Leu Ala Trp Phe Pro Phe Val Ser Glu Phe Gln Thr Arg Met Leu
865 870 875 gg0
Phe Asn Gln Ala Phe Ser Arg Gly Leu Gln Ile Ser Arg Ile Leu Gly
885 890 gg5
Gly His Lys Lys Asp Arg Ala Thr Arg Asn Lys Glu
900 905
<210> 23
<211> 975
<212> DNA
<213> Oryza sativa
<z2o>
<221> CDS
<222> (1)..(975)
<400> 23
25cac gcgtccgggtccgggtcggtgcgggagcggttcgaggceatgatc 48
His AlaSerG1ySerGlySerValArgGluArgPheGluAlaMetIle
1 5 10 15
cgc cgcgtgcagggggaggtgtgcgcggcgctggaggaggccgacggg 96
30Arg ArgValGlnGlyGluValCysA1aAlaLeuGluGluAlaAspGly
20 25 30
agc ggcgcccggttcgtggaggacgtgtggtcgcgccccggcggcggc 144
Ser GlyAlaArgPheValGluAspValTrpSerArgProGlyGlyGly
35 35 40 45
ggg ggcatcagc'cgggtgctccaggacggccgcgtgttcgagaaggcc 192
Gly GlyIleSerArgVa1LeuGlnAspGlyArgValPheGluLysAla
50 55 60
40
ggg gtcaacgtctccgtcgtgtacggcgtcatgccccccgacgcgtac 240
Gly ValAsnValSerValValTyrGlyValMetProProAspAlaTyr
65 70 75 80
45cgc gccgccaagggggaggccggcaagaacggcgcggcggcagatggc 288
Arg AlaAlaLysGlyGluAlaGlyLysAsnGlyAlaAlaAlaAspGly
85 90 95
cec aaggetgggcecgtgcccttetttgecgetggcattagcteggtt 336
50Pro LysAlaGlyProValProPhePheAlaAlaGlyIleSerSerVal
100 105 110
ctt caccceaagaacccatttgetccaacattgcattttaactaccgc 384
Leu HisProLysAsnProPheAlaProThrLeuHisPheAsnTyrArg
55 115 120 125
tat tttgagacagatgcaccgaaagatgetcctggtgcaccaaggcaa 432
Tyr PheGluThrAspAlaProLysAspAlaProGlyAlaProArgGln
130 135 140
60
tgg tggtttggaggtggtactgatttgactccttcatatatcattgaa 480
Trp TrpPheGlyGlyGlyThrAspLeuThrProSerTyrIleIleGlu
145 150 155 160
65gag gatgtgaagcattttcattctgttcaaaaacaagcgtgtgataag 528
Glu AspValLysHisPheHisSerValGlnLysGlnAlaCysAspLys
165 170 175
36
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
ttt gacccaagtttttacccgagattcaaaaaatggtgtgatgattat 576
Phe AspProSerPheTyrProArgPheLysLysTrpCysAspAspTyr
180 185 190
ttc tatattaagcaccgtaatgagcgtcgggggcttggtggaatattt 624
Phe TyrIleLysHisArgAsnGluArgArgGlyLeuGlyGlyIlePhe
195 200 205
ttt gatgatcttaatgactatgatcaagaaatgcttctcaactttget 672
10Phe AspAspLeuAsnAspTyrAspGlnGluMetLeuLeuAsnPheAla
210 215 220
aca gaatgtgcggattctgttgttcctgcatacataccaatcattgaa 720
Thr GluCysAlaAspSerValValProAlaTyrIleProIleIleGlu
15225 230 235 240
cgc cggaaggacactccatttactgaggaacacaaggcatggcaacaa 768
Arg ArgLysAspThrProPheThrGluGluHisLysAlaTrpGlnGln
245 250 255
20
ctg aggagaggtcgctatgtggagttcaaccttgtatatgatcgcggt 816
Leu ArgArgGlyArgTyrValGluPheAsnLeuValTyrAspArgGly
260 265 270
25acc acatttggcctcaagactggggggaggattgagagtattctggtt 864
Thr ThrPheGlyLeuLysThrGlyGlyArgIleGluSerIleLeuVal
275 280 285
tct cttccactgactgcacgatggcagtattatcatacacctgaagag 912
30Ser LeuProLeuThrAlaArgTrpGlnTyrTyrHisThrProGluGlu
290 295 300
gga actgaagaacggaaacttcttgacgcgtgcataaacccaaaggaa 960
Gly ThrGluGluArgLysLeuLeuAspAlaCysIleAsnProLysGlu
35305 310 315 320
tgg ctcgatctctga 975
Trp LeuAspLeu
<210> 24
<211> 324
<212> PRT
<213> Oryza sativa
<400> 24
His Ala Ser Gly Ser Gly Ser Val Arg Glu Arg Phe Glu Ala Met Ile
1 5 10 15
60
Arg Arg Val Gln Gly Glu Val Cys Ala Ala Leu Glu Glu Ala Asp Gly
20 25 30
Ser Gly Ala Arg Phe Val Glu Asp Val Trp Ser Arg Pro Gly Gly Gly
35 40 45
Gly Gly Ile Ser Arg Val Leu Gln Asp Gly Arg Val Phe Glu Lys Ala
50 55 60
Gly Val Asn Val Ser Val Val Tyr Gly Val Met Pro Pro Asp Ala Tyr
65 70 75 80
37
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Arg Ala Ala Lys Gly Glu Ala Gly Lys Asn Gly Ala Ala Ala Asp Gly
85 90 95
Pro Lys Ala Gly Pro Val Pro Phe Phe Ala Ala Gly Ile Ser Ser Val
100 105 110
Leu His Pro Lys Asn Pro Phe Ala Pro Thr Leu His Phe Asn Tyr Arg
115 120 125
Tyr Phe Glu Thr Asp Ala Pro Lys Asp Ala Pro Gly Ala Pro Arg Gln
130 135 140
Trp Trp Phe Gly Gly Gly Thr Asp Leu Thr Pro Ser Tyr Ile Ile Glu
145 150 l55 160
Glu Asp Val Lys His Phe His Ser Val Gln Lys Gln Ala Cys Asp Lys
165 170 175
Phe Asp Pro Ser Phe Tyr Pro Arg Phe Lys Lys Trp Cys Asp Asp Tyr
180 185 190
Phe Tyr Ile Lys His Arg Asn Glu Arg Arg Gly Leu Gly Gly Ile Phe
195 200 205
Phe Asp Asp Leu Asn Asp Tyr Asp Gln Glu Met Leu Leu Asn Phe Ala
210 215 220
Thr Glu Cys Ala Asp Ser Val Val Pro Ala Tyr Ile Pro Ile Tle Glu
225 230 235 240
Arg Arg Lys Asp Thr Pro Phe Thr Glu Glu His Lys Ala Trp Gln Gln
245 250 255
Leu Arg Arg Gly Arg Tyr Val Glu Phe Asn Leu Val Tyr Asp Arg Gly
260 265 270
Thr Thr Phe Gly Leu Lys Thr Gly Gly Arg Ile Glu Ser Ile Leu Val
275 280 285
Ser Leu Pro Leu Thr Ala Arg Trp Gln Tyr Tyr His Thr Pro Glu Glu
290 295 300
Gly Thr Glu Glu Arg Lys Leu Leu Asp Ala Cys Ile Asn Pro Lys Glu
305 310 315 320
Trp Leu Asp Leu
<210> 25
<211> 882
<212> DNA
<213> Oryza sativa
38
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
<220>
<221>
CDS
c222> (1)..(882)
c400>
25
atg gaggtggggttcctggggctgggcatcatggggaaggcaatggcg 48
Met GluValGlyPheLeuGlyLeuGlyIleMetGlyLysAlaMetAla
101 5 10 15
gcc aacctcctccgccacggcttccgcgtcaccgtctggaaccggact 96
Ala AsnLeuLeuArgHisGlyPheArgValThrValTrpAsnArgThr
20 25 30
ctc tccaagtgccaggagctcgtcgcgctgggcgccgccgtgggggag 144
Leu SerLysCysGlnGluLeuValAlaLeuGlyAlaAlaValGlyGlu
35 40 45
20acg ccggcggccgtcgtcgccaagtgcagatacaccatcgccatgctc 192
Thr ProAlaAlaValValAlaLysCysArgTyrThrIleAlaMetLeu
50 55 60
tcc gaccccagcgccgcgctatctgttgtattcgacaaggacggcgtg 240
25Ser AspProSerAlaAlaLeuSerValValPheAspLysAspGlyVal
65 70 75 80
ctc gagcagattggggaagggaagggttatgtggacatgtccactgtt 288
Leu GluGlnIleGlyGluGlyLysGlyTyrValAspMetSerThrVal
30 85 90 95
gat gccgccacttcttgcaagataagcgaggetataaaacaaaaaggt 336
Asp AlaAlaThrSerCysLysIleSerGluAlaIleLysGlnLysGly
100 105 110
35
ggg gettttgttgaagetccagtttcaggaagcaaaaagccagetgaa 384
Gly AlaPheValGluAlaProValSerGly5erLysLysProAlaGlu
115 120 125
40gat ggccaattggtcattcttgetgcaggggacaaggtattgtatgat 432
Asp GlyGlnLeuValIleLeuAlaAlaGlyAspLysValLeuTyrAsp
130 135 140
gat atggtccctgcatttgatgtacttgggaaaaagtcgttctttttg 480
45Asp MetValProAlaPheAspValLeuGlyLysLysSerPhePheLeu
145 150 155 160
gga gagattggaaatggagcaaagatgaaactggtggtcaacatgatc 528
Gly GluIleGlyAsnGlyAlaLysMetLysLeuValValAsnMetIle
50 165 170 175
atg ggaagtatgatgaatgetttgtctgagggactctctctggetgat 576
Met GlySerMetMetAsnAlaLeuSerGluGlyLeuSerLeuAlaAsp
180 185 190
55
aac agtggtttgagcccccagacacttcttgatgtcctggaccttggc 624
Asn SerGlyLeuSerProGlnThrLeuLeuAspValLeuAspLeuGly
195 200 205
60gcc atcgcgaatccaatgttcaagctgaaagggccctcgatgctgcaa 672
Ala IleAlaAsnProMetPheLysLeuLysGlyProSerMetLeuGln
210 215 220
ggc agctacaaccctgcatttcccctgaaacaccagcagaaggatatg 720
65Gly SerTyrAsnProAlaPheProLeuLysHisGlnGlnLysAspMet
225 230 235 240
agg ttggcacttgccctaggagacgagaacgetgtctccatgccagtg 768
39
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Arg Leu Ala Leu Ala Leu Gly Asp Glu Asn Ala Val Ser Met Pro Val
245 250 255
gca get get tcc aac gag gcg ttc aag aaa gca aga agc ttg gga cta 816
Ala Ala Ala Ser Asn Glu Ala Phe Lys Lys Ala Arg Ser Leu Gly Leu
260 265 270
ggg gac ctg gat ttc tca gcg gtt tac gag gta ctg aag ggc gca ggt 864
Gly Asp Leu Asp Phe Ser Ala Val Tyr Glu Val Leu Lys Gly Ala Gly
275 280 285
ggc tca ggc aag gcg tga
882
Gly Ser Gly Lys Ala
290
<2l0> 26
<211> 293
<2l2> PRT
<213> Oryza sativa
<400> 26
Met Glu Val Gly Phe Leu Gly Leu Gly Ile Met Gly Lys Ala Met Ala
1 5 10 15
Ala Asn Leu Leu Arg His Gly Phe Arg Val Thr Val Trp Asn Arg Thr
20 25 30
35
Leu Ser Lys Cys Gln Glu Leu Val Ala Leu Gly Ala Ala Val Gly Glu
40 45
Thr Pro Ala Ala Val Val Ala Lys Cys Arg Tyr Thr Ile Ala Met Leu
50 55 60
Ser Asp Pro Ser Ala Ala Leu Ser Val Val Phe Asp Lys Asp Gly Val
65 70 75 80
Leu Glu Gln Ile Gly Glu Gly Lys Gly Tyr Val Asp Met Ser Thr Va1
85 90 95
55
Asp Ala Ala Thr Ser Cys Lys Ile Ser Glu Ala Ile Lys Gln Lys Gly
100 105 110
Gly Ala Phe Val Glu Ala Pro Val Ser Gly Ser Lys Lys Pro Ala Glu
115 120 125
Asp Gly Gln Leu Val Ile Leu Ala Ala Gly Asp Lys Val Leu Tyr Asp
130 135 140
Asp Met Val Pro Ala Phe Asp Val Leu Gly Lys Lys Ser Phe Phe Leu
145 150 155 160
Gly Glu Ile Gly Asn Gly Ala Lys Met Lys Leu Val Val Asn Met Ile
l65 170 175
Met Gly Ser Met Met Asn Ala Leu Ser Glu Gly Leu Ser Leu Ala Asp
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
180 185 190
Asn Ser Gly Leu Ser Pro Gln Thr Leu Leu Asp Val Leu Asp Leu Gly
195 200 205
15
Ala Ile Ala Asn Pro Met Phe Lys Leu Lys Gly Pro Ser Met Leu Gln
210 215 220
Gly Ser Tyr Asn Pro Ala Phe Pro Leu Lys His Gln Gln Lys Asp Met
225 230 235 240
Arg Leu Ala Leu Ala Leu Gly Asp Glu Asn Ala Val Ser Met Pro Val
245 250 255
Ala Ala Ala Ser Asn Glu Ala Phe Lys Lys Ala Arg Ser Leu Gly Leu
260 265 270
Gly Asp Leu Asp Phe Ser Ala Val Tyr Glu Val Leu Lys Gly Ala Gly
275 280 285
Gly Ser Gly Lys A1a
290
<210> 27
<211> 1032
<212> DNA
35<213> Oryzasativa
<220>
<221> CDS
40<222> (1)..(1032)
<400> 27
get tct gaatcaacaacagccaacttagtggggcagatcacaacc 48
gag
Ala 5er GluSerThrThrAlaAsnLeuValGlyGlnIleThrThr
Glu
451 5 10 15
acc tgt gatgatatttctgtgaacagatcagcagaaaattcttca 96
aca
Thr Cys AspAspIleSerValAsnArgSerAlaGluAsnSerSer
Thr
20 25 30
50
cag aag attccattggatggagtatctgcacagtccattaagcca i44
aac
Gln Lys IleProLeuAspGlyValSerAlaGlnSerIleLysPro
Asn
40 45
55tct gca agtaggtctgaaccagtaggtcttggtggaggtttgcag 192
agt
Ser Ala SerArgSerGluProValGlyLeuGlyGlyGlyLeuGln
Ser
50 55 60
cct aag cggagcagaacagcaaagccacctgggagtagcagtgat 240
agg
60Pro Lys ArgSerArgThrAlaLysProProGlySerSerSerAsp
Arg
65 70 75 80
act ggc gtcgtcaattcctctcgcatcagcaatagccaaaatget 288
gaa
Thr Gly ValValAsnSerSerArgIleSerAsnSerGlnAsnAla
Glu
65 85 90 95
gtt tca ggccagcaggttctgcaagcccttgettctcaaaatact 336
atg
Val Ser GlyGlnGlnValLeuGlnAlaLeuAlaSerGlnAsnThr
Met
41
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
100 105 110
aat gtaaacagaagccatgttacggattctccacttccatccactact 384
Asn ValAsnArgSerHisValThrAspSerProLeuProSerThrThr
115 120 125
tct cagttttctggtggaatgcctccgagaagacagggtggtgaagga 432
Ser GlnPheSerGlyGlyMetProProArgArgGlnGlyGlyGluGly
l30 135 140
caa gttgattttggcagtatgatatccagtgtgctaaacaacccaget 480
Gln ValAspPheGlySerMetIleSerSerValLeuAsnAsnProAla
145 150 155 160
ttt ggcaatctgttgtccaatgtagcagagcaaacaggcatgggttcc 528
Phe GlyAsnLeuLeuSerAsnValAlaGluGlnThrGlyMetGlySer
165 170 175
gca ggtgatttgagaaacatggtggaagagtgtgcacagagccctgca 576
Ala GlyAspLeuArgAsnMetValGluGluCysAlaGlnSerProAla
180 185 190
ata atggatactatgagtaatttagtccaaaatgtggatgggtcagga 624
Ile MetAspThrMetSerAsnLeuValGlnAsnValAspGlySerGly
195 200 205
aga ggtcaaggtggcattgacttgtctagaatgatgcagcaaatgatg 672
Arg GlyGlnGlyGlyIleAspLeuSerArgMetMetGlnGlnMetMet
210 215 220
cct gttgtatcccaagttcttggtggagetggggetcgtcctgetggt 720
Pro ValValSerGlnValLeuGlyGlyAlaGlyAlaArgProAlaGly
225 230 235 240
aca aatagtggacaatccagattgcagcctcggcgcagtgacatgaga 768
Thr AsnSerGlyGlnSerArgLeuGlnProArgArgSerAspMetArg
245 250 255
gtg gatgatgettcagattatggaaattctcagattgatctacaccaa 816
Val AspAspAlaSerAspTyrGlyAsnSerGlnIleAspLeuHisGln
260 265 2'70
get cgtgaacacattgagcaacatgactcccccagggatatcttcggt 864
Ala ArgGluHisIleGluGlnHisAspSerProArgAspIlePheGly
275 280 285
gcg gtcctcgaaactgetgcacaggettatggtgaagatgagagtatt 912
Ala ValLeuGluThrAlaAlaGlnAlaTyrGlyGluAspGluSerIle
290 295 300
gag gacatgcttgaagagcttgtcagtgacccagaacttacagatgac 960
Glu AspMetLeuGluGluLeuValSerAspProGluLeuThrAspAsp
305 310 315 320
tac ctgaaacttctgctccaacaagttcgccagaggatacagtcggca 1008
Tyr LeuLysLeuLeuLeuGlnGlnValArgGlnArgIleGlnSerAla
325 330 335
tct caatccgggaaccagtcttga 1032
Ser GlnSerGlyAsnGlnSer
340
<210> 28
<211> 343
<212> PRT
<213> Oryza sativa
42
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
<400> 28
Ala Ser Glu Glu Ser Thr Thr Ala Asn Leu Val Gly Gln Ile Thr Thr
1 5 10 15
Thr Cys Thr Asp Asp Ile Ser Val Asn Arg Ser Ala Glu Asn Ser Ser
20 25 30
Gln Lys Asn Ile Pro Leu Asp Gly Val Ser Ala Gln Ser Ile Lys Pro
35 40 45
Ser Ala Ser Ser Arg Ser Glu Pro Val Gly Leu Gly Gly Gly Leu Gln
50 55 60
Pro Lys Arg Arg Ser Arg Thr Ala Lys Pro Pro Gly Ser Ser Ser Asp
65 70 75 80
Thr Gly Glu Val Val Asn Ser Ser Arg Ile Ser Asn Ser Gln Asn Ala
85 90 95
Val Ser Met Gly Gln Gln Val Leu Gln Ala Leu Ala Ser Gln Asn Thr
100 105 110
Asn Val Asn Arg Ser His Val Thr Asp Ser Pro Leu Pro Ser Thr Thr
115 120 125
Ser Gln Phe Ser Gly Gly Met Pro Pro Arg Arg Gln Gly Gly Glu Gly
130 135 140
Gln Val Asp Phe Gly Ser Met Ile Ser Ser Val Leu Asn Asn Pro Ala
145 150 155 160
Phe Gly Asn Leu Leu Ser Asn Val Ala Glu Gln Thr Gly Met Gly Ser
165 170 175
Ala Gly Asp Leu Arg Asn Met Val Glu Glu Cys Ala Gln Ser Pro Ala
180 185 190
Ile Met Asp Thr Met Ser Asn Leu Val Gln Asn Val Asp Gly Ser Gly
195 200 205
Arg Gly Gln Gly Gly Ile Asp Leu Ser Arg Met Met Gln Gln Met Met
210 215 220
Pro Val Val Ser Gln Val Leu Gly Gly Ala Gly Ala Arg Pro Ala Gly
225 230 235 240
Thr Asn Ser Gly Gln Ser Arg Leu Gln Pro Arg Arg Ser Asp Met Arg
245 250 255
Val Asp Asp Ala Ser Asp Tyr Gly Asn Ser Gln Ile Asp Leu His Gln
260 265 270
43
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Ala Arg Glu His Ile Glu Gln His Asp Ser Pro Arg Asp Ile Phe Gly
275 280 285
10
Ala Val Leu Glu Thr Ala Ala Gln Ala Tyr Gly Glu Asp Glu Ser Ile
290 295 300
Glu Asp Met Leu Glu Glu Leu Val Ser Asp Pro Glu Leu Thr Asp Asp
305 310 315 320
Tyr Leu Lys Leu Leu Leu Gln Gln Val Arg Gln Arg Ile Gln Ser Ala
325 330 335
Ser Gln Ser Gly Asn Gln Ser
340
<210> 29
<211> 447
<212> DNA
<213> Oryza sativa
<220>
30<221> CDS
<222> (1)..(447)
<400> 29
atg ggggggaaggagctgagcgaggagcaggtggcgtcgatgcgggag 48
35Met GlyGlyLysGluLeuSerGluGluGlnValAlaSerMetArgGlu
1 5 10 15
gcg ttctccctcttcgacaccgacggcgacggccggatcgcgccgtcg 96
Ala PheSerLeuPheAspThrAspGlyAspGlyArgIleAlaProSer
40 20 25 30
gag ctcggcgtcctgatgcgctccctcggcgggaaccccacccaggcg 144
Glu LeuGlyValLeuMetArgSerLeuGlyGlyAsnProThrGlnAla
35 40 45
45
cag ctccgcgacatcgccgcgcaggagaagctcaccgcgcccttcgac 192
Gln LeuArgAspIleAlaAlaGlnGluLysLeuThrAlaProPheAsp
50 55 60
50ttc ccgcgcttcctcgacctcatgcgcgcccacctccgccccgagccc 240
Phe ProArgPheLeuAspLeuMetArgAlaHisLeuArgProGluPro
65 70 75 80
ttc gaccgcccgctccgcgacgccttccgcgtcctcgacaaggacgcc 288
55Phe AspArgProLeuArgAspAlaPheArgValLeuAspLysAspAla
85 90 95
tcc ggcaccgtctccgtcgccgatctccgccacgtcctcacctccatc 336
Ser GlyThrValSerValAlaAspLeuArgHisValLeuThrSerIle
60 loo 105 110
ggc gagaagctcgagccccacgagttcgacgagtggatccgcgaggtc 384
Gly GluLysLeuGluProHisGluPheAspGluTrpIleArgGluVal
115 120 125
65
gac gtcgcccccgacggcaccatccgctacgacgacttcatccgccgc 432
Asp ValAlaProAspGlyThrIleArgTyrAspAspPheIleArgArg
130 135 140
44
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
atc gtc gcc aaa taa 447
Ile Val Ala Lys
145
<210> 30
<211> 148
<212> PRT
<213> Oryza sativa
<400> 30
Met Gly Gly Lys Glu Leu Ser Glu Glu Gln Val Ala Ser Met Arg Glu
l 5 10 15
Ala Phe Ser Leu Phe Asp Thr Asp Gly Asp Gly Arg Ile Ala Pro Ser
25 30
25
Glu Leu Gly Val Leu Met Arg Ser Leu Gly Gly Asn Pro Thr Gln Ala
35 40 45
Gln Leu Arg Asp Ile Ala Ala Gln Glu Lys Leu Thr Ala Pro Phe Asp
50 55 60
Phe Pro Arg Phe Leu Asp Leu Met Arg Ala His Leu Arg Pro Glu Pro
65 70 75 80
Phe Asp Arg Pro Leu Arg Asp Ala Phe Arg Val Leu Asp Lys Asp Ala
85 90 95
45
Ser Gly Thr Val Ser Val Ala Asp Leu Arg His Val Leu Thr Ser Ile
100 l05 110
Gly Glu Lys Leu Glu Pro His Glu Phe Asp Glu Trp Ile Arg Glu Val
115 120 125
Asp Val Ala Pro Asp Gly Thr Ile Arg Tyr Asp Asp Phe Ile Arg Arg
130 135 140
Ile Val Ala Lys
145
<210> 31
<2l1> 1692
<212> DNA
<213> Oryza sativa
<220>
<221> CDS
<222> (1)..(1692)
<400> 31
atg gcc tcc gcc gcc gtc atc ccg tcg tcc gcg ccc ggc gcc gcc gcc 48
Met Ala Ser Ala Ala Val Ile Pro Ser Ser Ala Pro Gly Ala Ala Ala
1 5 10 l5
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
gca ggt gcg gcc gcg gtt arr agc get ggg tgg gtg gtg gac gag cgg 96
Ala Gly Ala Ala Ala Val Xaa Ser Ala Gly Trp Val Val Asp Glu Arg
20 25 30
gac ggc ttc att tca tgg ctg cgc gga aag ttc gcg gcg gcc aac gcc 144
Asp Gly Phe Ile Ser Trp Leu Arg Gly Lys Phe Ala Ala Ala Asn Ala
35 40 45
atc atc gac ctg ctg ctg ctc cam cty cgs tcc gtc ggc gag ccc ggg 192
Ile Ile Asp Leu Leu Leu Leu Xaa Xaa Arg Ser Val Gly Glu Pro Gly
50 55 60
gag ttc gag cac gtc gcc gcc gcg gtg cag cag cgg cgc cac cac tgg 240
Glu Phe Glu His Val Ala Ala Ala Val Gln Gln Arg Arg His His Trp
65 ' 70 75 so
gcg ccc gtg atc cac atg cag cag ttc ttc ccc gtc ggc gac gtc gcg 288
Ala Pro Val Ile His Met Gln Gln Phe Phe Pro Val Gly Asp Val Ala
85 90 95
tac gcg ctc cag cag gcc ggg tkg cgc cgc cgc gcg ccg ccg cac cac 336
Tyr Ala Leu Gln Gln Ala Gly Xaa Arg Arg Arg Ala Pro Pro His His
100 105 110
25cag cagcagggccccggcgcctcgccgtccccgccgccccytcccccg 384
Gln GlnGlnGlyProGlyAlaSerProSerProProProXaaProPro
115 120 125
cgc ggccgcccctcgttctcggcgtcccactcgcaccatcgccacggt 432
30Arg GlyArgProSerPheSerAlaSerHisSerHisHisArgHisGly
130 135 140
ggt caccatcatcgctccgattcggtgcgcggcggcggcactggtgcg 480
Gly HisHisHisArgSerAspSerValArgGlyGlyGlyThrGlyAla
35145 150 155 160
acg getggatccgataaagatggacgtgaagttcataacaaggaagag 528
Thr AlaGlySerAspLysAspGlyArgGluValHisAsnLysGluGlu
165 170 175
40
aaa ggaatgaaggaagcagagaatgtggttgaagetaaaagctcacag 576
Lys GlyMetLysGluAlaGluAsnValValGluAlaLysSerSerGln
180 185 190
45ttg gagtctcttgtttctcatgaaggtgaaaaaactcctaggccgcaa 624
Leu GluSerLeuValSerHisGluGlyGluLysThrProArgProGln
195 200 205
get gttgetgaaggaagcagtaaagtggttccaactcctgtggagtat 672
50Ala ValAlaGluGlySerSerLysValValProThrProValGluTyr
210 215 220
acg gtcaatgacattattgatggcaagacggttaatgetgttgaaggg 720
Thr ValAsnAspIleIleAspGlyLysThrValAsnAlaValGluGly
55225 230 235 240
ctt aaggtttatgaagggttggtaaatgagaatgagaaaaacaagatt 768
Leu LysValTyrGluGlyLeuValAsnGluAsnGluLysAsnLysIle
245 250 255
60
ctc tctttacttaatgaaacaaaagettcttttcgtcgaggagggctt 816
Leu SerLeuLeuAsnGluThrLysAlaSerPheArgArgGlyGlyLeu
260 265 270
65gaa getgggcagactgtaataattggaaaaagaccaatgaagggtcat 864
Glu AlaGlyGlnThrValIleIleGlyLysArgProMetLysGlyHis
275 280 285
46
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
ggg agggaaattattcagctgggcattcctatcgttgaaggccctcct 9l2
Gly ArgGluIleIleGlnLeuGlyIleProIleValGluGlyProPro
290 295 300
5~ gaa gatgactatccaagagagacaaaagtggaggetgttcctggattg 960
Glu AspAspTyrProArgGluThrLysValGluAlaValProGlyLeu
305 310 315 320
ctg catgatctgtttgaccgcttgtgtcagaaggaaattataccaaca 1008
Leu HisAspLeuPheAspArgLeuCysGlnLysGluIleIleProThr
325 330 335
aaa ccagattattgtgttattgattactacaatgagggggattattct 1056
Lys ProAspTyrCysValIleAspTyrTyrAsnGluGlyAspTyrSer
340 345 350
cac cctcaccaatcccctccttggtatggtagacccttttgtacattc 1104
His ProHisGlnSerProProTrpTyrGlyArgProPheCysThrPhe
355 360 365
tgc ctgacagattgtgacatggtgttcggccgagttatttcaggagaa 1152
Cys LeuThrAspCysAspMetValPheGlyArgValIleSerGlyGlu
370 375 380
cga ggtgatcatagaggtcctctgaagctccttctctcgacagggtct 1200
Arg GlyAspHisArgGlyProLeuLysLeuLeuLeuSerThrGlySer
385 390 395 400
ctt ctggtgttgcatgggaagagtgetgatgttgetaagcgagetatt 1248
Leu LeuValLeuHisGlyLysSerAlaAspValAlaLysArgAlaIle
405 410 415
cct getgcatgtaagcagcggatcctactaagcttcgggaagtcttta 1296
Pro AlaAlaCysLysGlnArgIleLeuLeuSerPheGlyLysSerLeu '
420 425 430
tcg agaaaacaagtaccatctgaaagtgtttcacggtttactaccccg 1344
Ser ArgLysGlnValProSerGluSerValSerArgPheThrThrPro
435 440 445
ttg acaccacctcctatgccctggggtcctccaaggccggetaacatg 1392
Leu ThrProProProMetProTrpGlyProProArgProAlaAsnMet
450 455 460
gcg cgtcattcttcaagccctaaacactttggatatgccccaaacagt 1440
Ala ArgHisSerSerSerProLysHisPheGlyTyrAlaProAsnSer
465 470 475 480
ggc gtacttccagcgccggccattggagcgcatcacattcctccatca 1488
Gly ValLeuProAlaProAlaIleGlyAlaHisHisIleProProSer
485 490 495
gat ggaatgcagccactctttgtagcacctgetccagttgetgetgca 1536
Asp GlyMetGlnProLeuPheValAlaProAlaProValAlaAlaAla
500 505 510
gcc atgcctttcccatcacctgttcctttgccaaacttaaccaacagc 1584
Ala MetProPheProSerProValProLeuProAsnLeuThrAsnSer
515 520 525
ttg gatggcagaagctgctccaaggtctgctccacaacgactcccagt 1632
Leu AspGlyArgSerCysSerLysValCysSerThrThrThrProSer
530 535 540
tcc tggcacgggggtcttccttcctcctggatcgggtcacgcactgcc 1680
Ser TrpHisGlyGlyLeuProSerSerTrpIleGlySerArgThrAla
545 550 555 560
47
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
tca tca gat gat 1692
Ser Ser Asp Asp
<210> 32
<211> 564
<212> PRT
<2l3> Oryza sativa
<220>
<221> misc_feature
<222> (23) .(23)
<223> The 'Xaa' at location 23 stands for Arg, or Lys.
<220>
<221> misc_feature
<222> (56) .(56)
<223> The 'Xaa' at location 56 stands for Gln, or His.
<220>
<221> misc_feature
<222> (57) .(57)
<223> The 'Xaa' at location 57 stands for Leu.
<220>
<221> misc_feature
<222> (104)..(104)
<223> The 'Xaa' at location 104 stands for Trp, or Leu.
<220>
<221> misc_feature
<222> (126)..(126)
<223> The 'Xaa' at location 126 stands for Pro, or Leu.
<400> 32
Met Ala Ser Ala Ala Val Ile Pro Ser Ser Ala Pro Gly Ala Ala Ala
1 5 10 15
Ala Gly Ala Ala Ala Val Xaa Ser Ala Gly Trp Val Val Asp Glu Arg
20 25 30
Asp Gly Phe Ile Ser Trp Leu Arg Gly Lys Phe Ala Ala Ala Asn Ala
35 40 45
Ile Ile Asp Leu Leu Leu Leu Xaa Xaa Arg Ser Val Gly Glu Pro Gly
50 55 60
Glu Phe Glu His Val Ala Ala Ala Val Gln Gln Arg Arg His His Trp
65 70 75 80
Ala Pro Val Ile His Met Gln Gln Phe Phe Pro Val Gly Asp Val Ala
85 90 95
Tyr Ala Leu Gln Gln Ala Gly Xaa Arg Arg Arg Ala Pro Pro His His
100 105 110
Gln Gln Gln Gly Pro Gly Ala Ser Pro Ser Pro Pro Pro Xaa Pro Pro
115 120 125
48
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Arg Gly Arg Pro Ser Phe Ser Ala Ser His Ser His His Arg His Gly
130 135 140
Gly His His His Arg Ser Asp Ser Val Arg Gly Gly Gly Thr Gly Ala
l45 150 155 160
Thr Ala Gly Ser Asp Lys Asp Gly Arg Glu Val His Asn Lys Glu Glu
165 170 175
Lys Gly Met Lys Glu Ala Glu Asn Val Val Glu Ala Lys Ser Ser Gln
180 185 190
Leu Glu Ser Leu Val Ser His Glu Gly Glu Lys Thr Pro Arg Pro Gln
195 200 205
Ala Val Ala Glu Gly Ser Ser Lys Val Val Pro Thr Pro Val Glu Tyr
210 215 220
Thr Val Asn Asp Ile Ile Asp Gly Lys Thr Val Asn Ala Val Glu Gly
225 230 235 240
Leu Lys Val Tyr Glu Gly Leu Val Asn Glu Asn Glu Lys Asn Lys Ile
245 250 255
Leu Ser Leu Leu Asn Glu Thr Lys Ala Ser Phe Arg Arg Gly Gly Leu
260 265 270
Glu Ala Gly Gln Thr Val Ile Ile Gly Lys Arg Pro Met Lys Gly His
275 280 285
Gly Arg Glu Ile Ile Gln Leu Gly Ile Pro Ile Val Glu Gly Pro Pro
290 295 300
Glu Asp Asp Tyr Pro Arg Glu Thr Lys Val Glu Ala Val Pro Gly Leu
305 310 315 320
Leu His Asp Leu Phe Asp Arg Leu Cys Gln Lys Glu Ile Ile Pro Thr
325 330 ~ 335
Lys Pro Asp Tyr Cys Val Ile Asp Tyr Tyr Asn Glu Gly Asp Tyr Ser
340 345 350
His Pro His Gln Ser Pro Pro Trp Tyr Gly Arg Pro Phe Cys Thr Phe
355 360 365
Cys Leu Thr Asp Cys Asp Met Val Phe Gly Arg Val Ile Ser Gly Glu
370 375 380
Arg Gly Asp His Arg Gly Pro Leu Lys Leu Leu Leu Ser Thr Gly Ser
385 390 395 400
49
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Leu Leu Val Leu His Gly Lys Ser Ala Asp Val Ala Lys Arg Ala Ile
405 410 415
Pro Ala Ala Cys Lys Gln Arg Ile Leu Leu Ser Phe Gly Lys Ser Leu
420 425 430
Ser Arg Lys Gln Val Pro Ser Glu Ser Val Ser Arg Phe Thr Thr Pro
435 440 445
Leu Thr Pro Pro Pro Met Pro Trp Gly Pro Pro Arg Pro Ala Asn Met
450 455 460
Ala Arg His Ser Ser Ser Pro Lys His Phe Gly Tyr Ala Pro Asn Ser
465 470 475 480
Gly Val Leu Pro'Ala Pro Ala Ile Gly Ala His His Ile Pro Pro Ser
485 490 495
Asp Gly Met Gln Pro Leu Phe Val Ala Pro Ala Pro Val Ala Ala Ala
500 505 510
Ala Met Pro Phe Pro Ser Pro Val Pro Leu Pro Asn Leu Thr Asn Ser
515 520 525
Leu Asp Gly Arg Ser Cys Ser Lys Val Cys Ser Thr Thr Thr Pro Ser
530 535 540
Ser Trp His Gly Gly Leu Pro Ser Ser Trp Ile Gly Ser Arg Thr Ala
545 550 555 560
Ser Ser Asp Asp
<210> 33
<211> 858
<212> DNA
<213> Oryza sativa
<220>
<221> CDS
<222> (1)..(858)
<400> 33
atg gag ggc ggc ggc gag gtg ggc tgg tac gtg ctc ggc ccg aac cag 48
Met Glu Gly Gly Gly Glu Val Gly Trp Tyr Val Leu Gly Pro Asn Gln
1 5 10 15
gag cac gtc ggc ccc tac gcg ctc tcc gag ctg cga gaa cat ttt get 96
Glu His Val Gly Pro Tyr Ala Leu Ser Glu Leu Arg Glu His Phe Ala
20 25 30
aat ggg tac atc agt gag agc tca atg ctc tgg gca gaa ggg agg agt 144
Asn Gly Tyr Ile Ser Glu Ser Ser Met Leu Trp Ala Glu Gly Arg Ser
35 40 45
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
gaa tgg atg cca ttg tcg tcg att cct gac cta ctt gcg gtg gtc aca 192
Glu Trp Met Pro Leu Ser Ser Ile Pro Asp Leu Leu Ala Val Val Thr
50 55 60
aaa aaggatcaacctgatgaaggaattgaagatgatttcgataaattt 240
Lys LysAspGlnProAspGluGlyIleGluAspAspPheAspLysPhe
65 70 75 80
caa aaggaggttatagaagetgaggcagaggtggaagcctcgacagac 288
10Gln LysGluValIleGluAlaGluAlaGluValGluAlaSerThrAsp
85 90 95
aag getgcagataaogacataaaccaagaacatggggccgatgatcct 336
Lys AlaAlaAspAsnAspIleAsnGlnGluHisGlyAlaAspAspPro
100 105 110
gat gaccggccagcaaccccaccagatggcgaggacgaatttactgat 384
Asp AspArgProAlaThrProProAspGlyGluAspGluPheThrAsp
115 120 125
gat gatggtactgtttacaagtgggatcgtgtcctgagggcatgggtt 432
Asp AspGlyThrValTyrLysTrpAspArgValLeuArgAlaTrpVal
130 135 140
25cct caagatgacctagaaggcaaaaatgacaactatgaagttgaagac 480
Pro GlnAspAspLeuGluGlyLysAsnAspAsnTyrGluValGluAsp
145 150 155 160
atg acttttgcacatgaggaagaagttttccaagcaccagatattget 528
30Met ThrPheAlaHisGluGluGluValPheGlnAlaProAspIleAla
165 170 175
ggt tcaaccacattagaagaaaacaatgtttctgcggaaattgaaatc 576
Gly SerThrThrLeuGluGluAsnAsnValSerAlaGluIleGluIle
35 180 185 190
aaa gaa cca cca aag gta gaa aag aga gca cat aag aag cgg aag tct 624
Lys Glu Pro Pro Lys Val Glu Lys Arg Ala His Lys Lys Arg Lys Ser
195 200 205
tct gaa aag cca gcc gat aaa aag gaa get tac aaa cct cca gat agt 672 i
Ser Glu Lys Pro Ala Asp Lys Lys Glu Ala Tyr Lys Pro Pro Asp Ser
210 215 220
tgg gtt gat ctc aaa gtt aac aca cat gtc tac gtt act ggt ttg cct 720
Trp Val Asp Leu Lys Val Asn Thr His Val Tyr Val Thr Gly Leu Pro
225 230 235 240
gat gat gtc aca get gag gag att gtg gag gta ttt tcc aaa tgt gga 768
Asp Asp Val Thr Ala Glu Glu Ile Val Glu Val Phe Ser Lys Cys Gly
245 250 255
att ata aag gag gac cca gag aca aga aaa coc cga gta aaa atc tat 816
Ile Ile Lys Glu Asp Pro Glu Thr Arg Lys Pro Arg Val Lys Ile Tyr
260 265 270
act gac aga gaa aca ggc aga aag aaa ggt gat gcg cta gtg 858
Thr Asp Arg Glu Thr Gly Arg Lys Lys Gly Asp Ala Leu Val
275 280 285
<210> 34
<211> 286
<212> PRT
<213>Oryza sativa
<400> 34
51
CA 02507868 2005-05-27
WO 2004/061080 PCT/US2003/041098
Met Glu Gly Gly Gly Glu Val Gly Trp Tyr Val Leu Gly Pro Asn Gln
1 5 10 15
Glu His Val Gly Pro Tyr Ala Leu Ser Glu Leu Arg Glu His Phe Ala
20 25 30
Asn Gly Tyr Ile Ser Glu Ser Ser Met Leu Trp Ala Glu Gly Arg Ser
35 40 45
20
Glu Trp Met Pro Leu Ser Ser Ile Pro Asp Leu Leu Ala Val Val Thr
50 55 60
Lys Lys Asp Gln Pro Asp Glu Gly Ile Glu Asp Asp Phe Asp Lys Phe
65 70 75 80
Gln Lys Glu Val Ile Glu Ala Glu Ala Glu Val Glu Ala Ser Thr Asp
85 90 95
Lys Ala Ala Asp Asn Asp Ile Asn Gln Glu His Gly Ala Asp Asp Pro
100 105 110
Asp Asp Arg Pro Ala Thr Pro Pro Asp Gly Glu Asp Glu Phe Thr Asp
115 120 125
Asp Asp Gly Thr Val Tyr Lys Trp Asp Arg Val Leu Arg Ala Trp Val
130 135 140
Pro Gln Asp Asp Leu Glu Gly Lys Asn Asp Asn Tyr Glu Val Glu Asp
145 150 155 160
Met Thr Phe Ala His Glu Glu Glu Val Phe Gln Ala Pro Asp Ile Ala
165 170 175
Gly Ser Thr Thr Leu Glu Glu Asn Asn Val Ser Ala Glu Ile Glu Ile
180 185 190
Lys Glu Pro Pro Lys Val Glu Lys Arg Ala His Lys Lys Arg Lys Ser
195 200 205
Ser Glu Lys Pro Ala Asp Lys Lys Glu Ala Tyr Lys Pro Pro Asp Ser
210 215 220
Trp Val Asp Leu Lys Val Asn Thr His Val Tyr Val Thr Gly Leu Pro
225 230 235 240
Asp Asp Val Thr Ala Glu Glu Ile Val Glu Val Phe Ser Lys Cys Gly
245 250 255
Ile Ile Lys Glu Asp Pro Glu Thr Arg Lys Pro Arg Val Lys Ile Tyr
260 265 270
52
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 312
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 312
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
