Note: Descriptions are shown in the official language in which they were submitted.
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
MODULATION OF CYTOKININ ACTIVITY IN PLANTS
Field of the Invention:
This invention relates generally to the field of plant molecular biology. More
specifically, this invention relates to methods and reagents for the
temporally- or
spatially -regulated expression of genes that affect metabolically effective
levels of
cytokinins in plants, including seeds and the maternal tissue from which such
seeds
arise, including female inflorescences, ovaries, female florets, aleurone,
pedicel,
and pedicel-forming regions.
Background of the Invention:
Cytokinins are phytohormones involved in numerous physiological
processes in plants. Plants respond to environmental stresses in part by
modifying
the relative balance of active and inactive cytokinins. For instance, during
times of
abiotic stress (which include, but are not limited to, conditions of drought,
density,
cold, salinity, and/or soil compaction), increased cytokinin oxidase activity
shifts the
balance in favor of inactive cytokinins, leading to decreased plant
productivity.
(Jones and Setter, In CSSA Special Publication No. 29, pp. 25-42. American
Society of Agronomy, Madison, WI. (1999)) Conversely, targeted manipulation of
the cytokinin balance in favor of active cytokinins could result in increased
productivity, even under abiotic stress, through mechanisms such as increased
cell
division, induction of stomatal opening, inhibited senescence of organs,
and/or
suppression of apical dominance. (Morris, R.O. 1997. In Cellular and Molecular
Biology of Plant Seed Development, pp. 117-148. Kluwer Academic Publishers.
(1997)) In maize subject to unfavorable environmental conditions, cytokinins
have
been shown to decrease resulting in reduced seed size, increased tip kernel
abortion and decreased seed set. (Cheikh and Jones, Plant Physiol. 106:45-51
(1994); Dietrich et al., Plant Physiol Biochem 33:327-336 (1995)). Therefore,
these
studies show that under stress conditions one approach to improving seed set
and
seed size would be to maintain the active cytokinin pool above a critical
threshold
level.
-1-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
The first naturally occurring cytokinin was purified in 1963 (Letham, D.S.,
Life
Sci. 8:569-573 (1963)) from immature kernels of Zea mays and identified as 6-
(4-
hydroxy-3-methylbut-trans-2-enylamino) purine, more commonly known today as
zeatin. In the main all naturally occurring cytokinins appear to be purine
derivatives
with a branched 5-carbon N6 substitutent. (See: McGaw, B.A., In: Plant
Hormones
and their Role in Plant Growth and Development, ed. P.J. Davies, Martinus
Nijhoff
Publ., Boston, 1987, Chap B3, Pgs. 76-93).
While some 25 different naturally
occurring cytokinins have been identified, those regarded as particularly
active are
N6 (A2-isopentenyl) adenosine (iP), zeatin (Z), diHZ, benzyladenine (BAP) and
their
9-ribosyl (and in the case of Z and diHZ, their O-glucosyl) derivatives.
However,
such activity is markedly reduced in the 7- and 9-glucosyl and 9-alanyl
conjugates.
These latter compounds may be reflective of deactivation or control
mechanisms.
The metabolism of cytokinins in plants is complex. Multi-step biochemical
pathways are known for the biosynthesis and degradation of cytokinins. At
least
two major routes of cytokinin biosynthesis are recognized. The first involves
transfer RNA (tRNA) as an intermediate. The second involves de novo (direct)
biosynthesis. In the first case, tRNAs are known to contain a variety of
hypermodified bases (among them are certain cytokinins). These modifications
are
known to occur at the tRNA polymer level as a post-transcriptional
modification.
The branched 5-carbon N6 substituent is derived from mevalonic acid
pyrophosphate, which undergoes decarboxylation, dehydration, and isomerization
to yield A2-isopentenyl pyrophosphate (iPP). The latter condenses with the
relevant
adenosine residue in the tRNA. Further modifications are then possible.
Ultimately
the tRNAs are hydrolyzed to their component bases, thereby forming a pool of
available free cytokinins.
Alternately, enzymes have been discovered that catalyze the formation of
cytokinins de novo, i. e., without a tRNA intermediate. The ipt gene utilized
in the
practice of this invention is one such gene. The formation of free cytokinins
is
presumed to begin with [9R5'P] iP. This compound is rapidly and
stereospecifically
hydroxylated to give the zeatin derivatives from which any number of further
metabolic events may ensue. Such events include but are not limited to (1)
conjugation, incorporating ribosides, ribotides, glucosides, and amino acids;
(2)
-2-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
hydrolysis; (3) reduction; and (4) oxidation. While each enzyme in these
pathways
is a candidate as an effector of cytokinin levels, enzymes associated with
rate-
limiting steps have particular utility in the practice of this invention.
One such enzyme is isopentenyl transferase (ipt). An isolated gene
encoding ipt was described by van Larebeke et al., (Nature 252:169-170(1974);
see also Barry et al., Proc. Nat'l. Acad. Sci. (USA) 81:4776-4780 (1984) and
Strabala et al., Mol. Gen. Gen. 216(2-3):388-394 (1989)). Isolation of ipt
genes in
Arabidopsis has also been reported. (Takei et al., J Biol Chem. 276(28):26405-
26410 (2001); Kakimoto et al., Plant Cell Physiol. 42(7):677-685 (2001) and WO
2002/072818; Sun et al., Plant Physiol 131:167-176 (2003)) The invention
comprises appropriately modulated expression of ipt genes from any source,
including other species, such as maize.
Based on the demonstrable effects of cytokinins in hundreds of experiments
across multiple plant species, a transgenic approach to augment active
cytokinins in
maize could improve its productivity under normal and/or abiotic stress
conditions.
However, simply increasing the pool of active cytokinins does not
automatically lead
to enhanced plant growth. In fact, elevating cytokinin levels has been shown
to
generate detrimental effects on plant phenotype.
For example, Smigocki et al. (Proc. Nat'l. Acad. Sci. (USA) 85:5131-
5135(1988)), employing the ipt gene from A. tumefaciens operably linked to
either
the 35S or NOS promoter, showed a generalized effect on shoot organogenesis
and zeatin levels. It was noted that the activity of the promoter controls the
degree
of morphogenic response observed, and unregulated production of cytokinins can
result in unwanted pleiotropic effects. With the constructs identified above,
undesirable effects included complete inhibition of root formation in tobacco,
and
stunted cucumber plantlets that did not survive. (Smigocki at al. (supra);
Klee et al.,
Annual Rev. Plant Physiol. 38:467-486 (1987))
Attempts followed to express the ipt gene in a more controlled fashion.
Medford at al. (The Plant Cell 1:403-413(1989)) reported placing the
Agrobacterium
ipt gene under the control of a heat-inducible promoter and expressing same in
transgenic rooted tobacco plants. Levels of cytokinin rose dramatically
following
heat treatment, and effects observed in transgenics included significant
reductions
in height, xylem content, and leaf size. In both tobacco and Arabidopsis,
-3-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
transgenics displayed slower root growth, disorderly root development, and
increased axillary bud growth relative to wild-type plants. In addition, the
experimental constructs were not satisfactory because the plants exhibited
phenotypes associated with excess cytokinin levels, including reduced height,
leaf
area, and stem width, even in the absence of thermal induction. Further,
certain
changes were observed in both wild-type and transgenic plants and could be
attributed to the heat induction per se.
Schmulling, T. et al. (FEBS Letters 249(2):401-406(1989)) transformed
tobacco with the Agrobacterium ipt gene under control of the Drosophila hsp70
promoter, which provides a very low level of expression at normal temperatures
and a rapid increase in expression after heat shock. Most heat-shocked
transgenic
calli were greener, had higher cytokinin concentrations, and grew at a more
rapid
rate than control calli. Plants regenerated from the heat-shocked transgenic
calli
were described as "fairly normal" and cytokinin levels in these plants did not
differ
from those measured in wild-type plants. Plants regenerated from uninduced
transgenic calli did not differ from controls in either plant phenotype or
cytokinin
content. A second experiment created callus tissue transgenic for the ipt gene
driven by its native promoter. In shoots regenerated from these calli, high
cytokinin
levels inhibited root formation. These shoots, grafted onto wild-type tobacco
stems,
displayed tiny leaves and a stunted, highly-branched growth habit. Thus,
transformation either resulted in negative phenotypic changes or had no
impact.
In PCT Patent Application Publication No. W091/01323, 7 February 1991,
and U.S. Patents 5,177,307, and 4,943,674, tomato plants transformed with the
ipt
gene linked to fruit-specific promoters (2AII, Z130 and Z70) exhibited
modified
ripening characteristics. Fruits were described as roughened at immature
stages,
and as mottled, blotchy, and patchy during ripening. See also U.S. Patent
6,329,570, which discloses transformation of cotton with ipt and a seed-tissue-
preferred promoter to modify boll set and fiber quality.
In PCT Patent Application Publication No. W093/07272, the ipt gene was
fused to the chalcone synthase (chs) promoter from Antirrhinum majus and
expressed in potato. Phenotypic alterations of transformants included
increased
tuber yield, plant height and leaf size, thickened stems and delayed leaf
senescence. Wang et al. (Australian J of Plant Phys 24(5):661-672 and 673-683,
-4-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
1997) reported increased cytokinin levels in leaf laminae and upper stems of
tobacco transformed with ipt driven by a chs promoter, as well as release of
axillary
buds, inhibition of root development, retardation of leaf senescence,
elevation of
chlorophyll levels, delay in onset of flowering, retardation of flower
development,
growth of leafy shoots from the primary root, change in leaf shape, enlarged
leaf
midribs, enlarged veins, thicker stems, greater node number, and increased
transpiration rates. Expression of chalcone synthase genes is complex and
regulated by a variety of factors, including light, fungal elicitors,
wounding, and
microbial pathogens. In addition, chs expression may be tissue-preferred,
occurring in pigmented flowers and roots, and developmentally specific,
occurring
during early germination. (Ito et al., Mol. Gen. Gen. 255:28-37 (1997);
Shimizu et
al., Plant Molecular Biology 39(4)785-95 (1999))
Additional ipt gene/promoter constructions have been reported.
Smigocki et al., in WO 94/24848 and U.S. Patents 5,496,732 and 5,792,934,
disclosed a gene construct capable of conferring enhanced insect resistance
comprising a wound-inducible promoter fused to an ipt gene. The study was
focused on insect resistance and did not report changes in plant morphology.
Houck et al., in U. S. Patents 4,943,674 and 5,177,307, disclosed several
promoters (2AII, Z130 and Z70) coupled with genes encoding enzymes in the
cytokinin metabolic pathway, in particular ipt for expression of such enzymes
in
tomato fruit.
Amasino at al., in PCT Patent Application Publication W096/29858
disclosed two senescence-specific promoters, including SAG12, operably linked
to
an ipt gene to inhibit leaf senescence in tobacco. Transformants developed
normally, with enhanced biomass and flower and seed production, perhaps owing
to the extended developmental period created by the delay in senescence. See
also: U.S. Patents 5,689,042 and 6,359,197; Gan, S. et al., (Science 270:1986-
1988 (1995)). Jordi et al., Plant, Cell and Environment 23(3):279-289 (2000),
studied the physiological effects of the SAG12:ipt construct in tobacco. While
older
leaves benefited by retaining chlorophyll, Rubisco, and protein,
remobilization of
nutrients from older leaves to younger leaves may have been reduced, leading
to
limited photosynthesis in the upper leaves and restricting potential increases
in
biomass of these plants, particularly under stress conditions.
-5-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Roeckel, P. et al., (Transgenic Res. 6(2):133-141 (1997)) transformed
canola and tobacco with an ipt gene under the control of the developmentally-
regulated, seed-specific 2S albumin promoter from Agrobacterium. While ipt
mRNA was found only in seeds, and cytokinin levels were evaluated only in
seeds,
effects of the construct were not limited to seeds: tobacco had reduced roots;
canola plants were "surprisingly" (p. 139) taller and had more branches and
more
seed-bearing structures. However, yield was not affected, nor was leaf type,
leaf
number, days to first flower, or days to bolting, in either species.
Transformation of tobacco with ipt linked to a copper-inducible, root-specific
promoter provided, in 28 of 31 cases, a controlled system for evaluating
effects of
increased cytokinin production. Morphological changes upon induction included
release of apical dominance, increases in total plant leaf number, and delay
of leaf
senescence. (McKenzie et al., Plant Physiol. 116:969-977 (1998)) Several
transgenic lines, however, exhibited uncontrolled cytokinin expression and a
radically different, undesirable phenotype, lacking root development and
elongation
of stems.
Ivic et al. (Plant Cell Reports 20:770-773 (2001)) reported that expression of
ipt in transgenic sugarbeet resulted in severe inhibition of root development,
along
with undesirable changes in leaf and shoot morphology. Transformed plantlets
formed roots slowly or not at all and had a very low survival rate when
transferred to
soil.
Sa et al. (Transgenic Research 11(3):269-278, 2002) reported that
transformation of tobacco with ipt from Agrobacterium under the control of a
TA29
promoter, which specifically expresses in anthers, resulted in perturbation in
the
development of anthers and pollen. About 80% of the TO transgenic plants
exhibited
a significant decrease in the rate of pollen germination, and up to 20% of the
TO
transgenic plants were male-sterile. In addition, abnormal styles and stamens
were
found in the transgenic plants.
Such negative effects resulting from directed expression of transgenic IPT
were noted in PCT Publication WO 00/52169: "These approaches also produce
undesirable side-effects in the plant and, even in cases where ipt or ro1C is
expressed under the control of tissue-specific promoters, these side-effects
are
-6-
CA 02521497 2012-07-10
observed in other tissues, presumably because the cytokinin is transported
readily
between cells and tissues of the plant." (emphasis added)
Thus, there still exists a need for nucleic acid constructs and methods useful
in controlling and directing temporally- and spatially- regulated expression
of
cytokinin metabolic genes in plants, including plant seed and those maternal
tissues in which seed development takes place, or in modulating plant sensing
of
and/or response to cytokinins, in order to improve plant vigor and yield
without
such detrimental effects as reduced root development or aberrant shoot
morphology. This invention provides several such useful nucleic acid
constructs
and methods to modulate cytokinin activity in plants, including effective
levels of
cytokinin in plant seeds, developing plant seeds, and related maternal
reproductive
tissues. Further, the need exists for constructs and methods which can provide
said improvements in plant vigor and yield under favorable or unfavorable
growing
conditions. This invention provides tools and reagents that allow the skilled
artisan,
by the application of, inter alia, transgenic methodologies, to so influence
the level
of cytokinin activity, including the metabolic flux in respect to the
cytokinin
metabolic pathway in seed. Thi irifluencE may be either anabolic or catabolic,
by
which is meant the influence may act to increase the biosynthesis of cytokinin
and/or decrease the degradation. A combination of both approaches is also
contemplated by this invention. Further combinations may include targeted
modulation of expression of isolated polynucleotides encoding polypeptides
involved in cytokinin recognition and cellular response to provide enhanced
cytokinin activity as defined herein.
An aspect of the invention is to provide a method for producing a transgenic
plant with increased plant vigor without detrimental effects of reduced root
development
or aberrant shoot morphology and capable of the regulated expression of a
cytokinin-
modulating gene in developing seed or related female reproductive tissue,
comprising
(i) transforming a plant host cell with a genetic construct capable of
temporally- or
spatially-regulated expression of a cytokinin modulating gene in developing
seed or
related female reproductive tissue, wherein the genetic construct comprises a
promoter
that initiates expression of the cytokinin modulating gene in developing plant
seeds or
7
CA 02521497 2012-07-10
related female reproductive tissue prior to or during the lag phase of seed
development
and the cytokinin modulating gene comprises the genetic code for isopentenyl
transferase in sense or antisense orientation; and (ii) regenerating a
transgenic plant,
wherein the transgenic plant exhibits increased plant vigor without
detrimental effects
of reduced root development or aberrant shoot morphology compared to a
corresponding plant that is not transformed with the genetic construct.
In the method described above, the step of transforming can be carried out by
electroporation, PEG poration, particle bombardment, silicon fiber delivery,
microinjection, or Agrobacterium-mediated transformation. The step of
transforming can
be carried out by particle bombardment. The step of transforming can be
carried out by
Agrobacterium-mediated transformation.
In the method described above, the promoter can be zag2.1, zap, tbl, eepl,
eep2, F3.7, thxH, Zm40, ESR, PCNA2, lec1, ZmCkxl-2, ZmCkx2, ZmCkx3, ZmCkx4, or
ZmCkx5. The promoter can be zag2.1, maize zap, maize tbl, maize PCNA2 or maize
kn1.
In the method described above the preferential expression can occur from about
14 days prior to about 25 days after pollination. The preferential expression
can occur
from about 0 days to about 6 days after pollination. The preferential
expression can
occur from about 0 days to about 12 days after pollination. The preferential
expression
can occur from about 4 days to about 21 days after pollination.
In the method described above, said promoter can drive expression in
meristematic regions of female reproductive tissue.
In the method described above, said enhanced vigor can be expressed in the
presence or absence of abiotic stress. The enhanced vigor can be expressed in
the
presence of drought stress.
In the method described above, said construct can further comprise one or more
promoters or enhancer elements of a highly-expressed gene. The enhancer
element
can comprise the 35S enhancer of cauliflower mosaic virus. The 35S enhancer
can
comprise SEQ ID NO: 4. The construct can comprise (1) the zag2.1 promoter
operably
linked to a polynucleotide encoding isopentenyl transferase (ipt) and (2) the
cauliflower
7a
CA 02521497 2012-07-10
mosaic virus 35S enhancer. The construct can comprise (1) SEQ ID NO: 3
operably
linked to the coding region of SEQ ID NO: 1 and (2) SEQ ID NO: 4.
In the method described above, the increased vigor can comprise increased
plant biomass. The increased vigor can comprise increased plant height. The
increased
vigor can comprise increased leaf greenness.
In any of the methods described above, the plant can be maize. When the plant
is maize, the increased vigor can be measured as increased ear length. The
plant can
be soybean.
Another aspect of the invention is to provide a transgenic plant cell from a
transgenic plant comprising a genetic construct stably integrated into the
genome
thereof, said construct comprising a promoter operably linked to a cytokinin-
modulating
gene, wherein said promoter directs temporal or spatial expression in
developing seed
or related female reproductive tissues of said plant prior to or during the
lag phase of
seed development and the cytokinin-modulating gene comprises the genetic code
for
isopentenyl transferase in sense or antisense orientation, and wherein said
transgenic
plant exhibits increased plant vigor without detrimental effects of reduced
root
development or aberrant shoot morphology compared to a corresponding plant
that has
not been transformed with said construct.
In the plant cell described above, the promoter can be zag2.1, zap, tbl, eepl,
eep2, F3.7, thxH, Zm40, ESR, PCNA2, lec1, ZmCkxl-2, ZmCkx2, ZmCkx3, ZmCkx4, or
ZmCkx5. The promoter can be zag2.1, maize zap, maize tbl, maize PCNA2, or
maize
kn1.
In the plant cell described above, the cell is a transgenic seed cell
comprising the
expression cassette.
In the plant cell described above, the enhanced vigor in said plant can be
expressed in the presence or absence of abiotic stress. The enhanced vigor in
said
plant can be expressed in the presence of drought stress.
In the plant cell described above, the construct can comprise the zag2.1
promoter operably linked to a polynucleotide encoding isopentenyl transferase.
The
construct can comprise the eepl promoter operably linked to a polynucleotide
encoding
7b
CA 02521497 2012-07-10
isopentenyl transferase. The construct can comprise the eep2 promoter operably
linked
to a polynucleotide encoding isopentenyl transferase. The construct can
comprise the
zap promoter operably linked to a polynucleotide encoding isopentenyl
transferase. The
construct can comprise the tb1 promoter operably linked to a polynucleotide
encoding
isopentenyl transferase. The construct can comprise the ckxl-2 promoter
operably
linked to a polynucleotide encoding isopentenyl transferase. The construct can
comprise the F3.7 promoter operably linked to a polynucleotide encoding
isopentenyl
transferase. The construct can comprise one or more promoters or enhancer
elements
of a highly-expressed gene. The enhancer element can comprise the 35S enhancer
of
cauliflower mosaic virus. The 35S enhancer can comprise SEQ ID NO: 4. The
construct can comprise (1) the zag2.1 promoter operably linked to a
polynucleotide
encoding isopentenyl transferase (ipt) and (2) the cauliflower mosaic virus
35S
enhancer. The construct can comprise (1) SEQ ID NO: 3 operably linked to the
coding
region of SEQ ID NO: 1 and (2) SEQ ID NO: 4.
In the transgenic plant cell described above, the promoter can drive
expression
in meristematic regions of female reproductive tissue.
In the transgenic plant cell described above, the increased vigor in said
plant can
comprise increased plant biomass. The increased vigor in said plant can
comprise
increased plant height. The increased vigor in said plant can comprise
increased leaf
greenness.
In any of the transgenic plant cells described above, the plant can be maize.
If
the plant is maize, the increased vigor can be measured as increased ear
length. The
plant can be soybean.
Another aspect of the invention is to provide a method of developing a plant
utilizing the plant cell described above, as a source of genetic material in a
breeding
program. The method can further comprise one or more of recurrent selection,
mass
selection, bulk selection, backcross, pedigree, development of a synthetic, or
open
pollination.
Another aspect of the invention is to provide an isolated recombinant DNA
comprising a genetic construct comprising a promoter directing temporal or
spatial gene
expression in developing plant seed or related female reproductive tissue
prior to or
7c
CA 02521497 2012-07-10
during the lag phase of seed development operably linked to a cytokinin
modulating
gene, wherein the cytokinin modulating gene comprises the genetic code for
isopentenyl
transferase in sense or antisense orientation, and wherein a plant transformed
with said
isolated recombinant DNA expresses increased vigor without detrimental effects
of
reduced root development or aberrant shoot morphology.
Another aspect of the invention is to provide a host cell having stably
introduced
therein the genetic construct described above.
Summary of the Invention
Certain embodiments of the present invention provide plants, particularly
transgenic maize, which have enhanced cytokinin activity, relative to an
otherwise
isogenic plant, without corresponding detrimental effects. Said enhancement
relative to an otherwise isogenic plant may occur under favorable
environmental
conditions, unfavorable environmental conditions, or both. Enhanced cytokinin
activity may encompass levels of cytokinins in the seed, the developing seed,
and
the maternal tissues associated with seed development. Alternatively or
additionally, enhanced cytokinin activity may result from improved perception
of,
7d
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
and response to, cytokinins by said plant. Enhanced cytokinin activity may act
as a
metabolic buffer to ameliorate the effects of transient stresses, particularly
during
the lag phase of seed development, to thus improve corn stress tolerance and
yield
stability. Enhanced cytokinin activity may also be manifested in improved
plant
vigor and/or increased seed yield. Such embodiments comprise a nucleic acid
construct stably integrated into the genome thereof, said construct capable of
the
temporally- or spatially-regulated modulation of cytokinin levels.
Certain embodiments of the present invention provide transgenic plant lines
with heritable phenotypes which are useful in breeding programs designed to
produce commercial products with improved performance, which may include plant
vigor, improved seed size, decreased tip kernel abortion and/or increased seed
set
during favorable or unfavorable environmental conditions. Such commercial
products are further embodiments of the invention.
Some embodiments of the invention provide a fertile transgenic plant
comprising a nucleic acid construct stably integrated into the genome thereof,
said
construct capable of effecting modulation of cytokinin activity in said plant.
Certain embodiments of the invention provide an isolated recombinant DNA
molecule comprising a promoter directing temporally- or spatially-regulated
expression of an operably-linked cytokinin-modulating gene and optionally
comprising one or more enhancer elements from a highly-expressed gene.
In some embodiments the invention provides a method for improving stress
tolerance and yield stability in plants, comprising stably introducing into
plant cells a
nucleic acid construct capable of effecting modulation of cytokinin activity,
and from
said cells, regenerating said plants with improved stress tolerance and yield
stability. Said construct may result in preferential expression of cytokinin
modulating genes during the lag phase of plant seed development.
Embodiments also provide a method for producing fertile, transgenic plants
capable of the regulated expression of a cytokinin modulating gene in
developing
seeds, comprising introducing into plant host cells a nucleic acid construct
capable
of preferential temporal and/or spatial expression of a cytokinin-modulating
gene in
developing seed and the maternal tissues associated with seed development,
under conditions sufficient for the stable integration of the construct into
the
-8-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
genome of said cells, and regenerating and recovering said fertile transgenic
plants.
Further embodiments of the invention provide a method for producing fertile,
transgenic plants with enhanced vigor, comprising introducing into plant host
cells a
nucleic acid construct capable of effecting modulation of cytokinin activity,
under
conditions sufficient for the stable integration of said construct into the
genome of
said cells, and regenerating and recovering said fertile transgenic plants.
In accordance with these aspects of the invention, there are provided
isolated nucleic acid molecules encoding cytokinin metabolic enzymes,
including
mRNAs, cDNAs, genomic DNAs and biologically useful variants, analogs or
derivatives thereof, including fragments of the variants, analogs and
derivatives.
Other embodiments of the invention are naturally occurring allelic variants of
the
nucleic acid molecules in the sequences provided which encode cytokinin
metabolic
enzymes. Also provided are polypeptides that comprise cytokinin metabolic
enzymes
as well as biologically or diagnostically useful fragments thereof, as well as
variants,
derivatives and analogs of the foregoing and fragments thereof. For example,
specifically provided are cytokinin metabolic polypeptides, particularly ipt
(for
example, SEQ ID NOS: 1 and 2) and cytokinin oxidase (for example, SEQ ID NOS:
26-37) , that may be employed for modulation of cytokinin levels in seed and
related
female reproductive tissues, particularly meristematic regions of female
reproductive
tissues.
Certain embodiments of the invention provide methods for producing the
polypeptides of interest, comprising culturing host cells having expressibly
incorporated therein a polynucleotide under conditions for the temporal and/or
spatial
expression of cytokinin metabolic enzymes in seed and related female
reproductive
tissues, and then optionally recovering the expressed polypeptide.
Also provided in certain embodiments are probes that hybridize to cytokinin
metabolic enzyme polynucleotide sequences useful as molecular markers in
breeding
programs.
Other embodiments of the invention provide products, compositions,
processes and methods that utilize the aforementioned polypeptides and
polynucleotides for research, biological and agricultural purposes.
-9-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Other embodiments of the invention provide inhibitors to such polypeptides,
useful for modulating the activity and/or expression of the polypeptides. In
particular, there are provided antibodies against such polypeptides.
In certain embodiments of this aspect of the invention there are provided
antibodies against the cytokinin catabolic enzymes. The antibodies may be
selective
for the entire class of the cytokinin catabolic enzymes, irrespective of
species of
origin, as well as species-specific antibodies.
Yet other embodiments provide cytokinin enzyme antagonists and agonists.
Among preferred antagonists are those which bind to cytokinin catabolic
enzymes
(e.g., to cytokinin oxidase) so as to inhibit the binding of binding
molecules, or to
destabilize the complex formed between the cytokinin catabolic enzyme and the
binding molecule, to prevent further biological activity arising from the
cytokinin
catabolic enzyme. Among preferred agonists are molecules that bind to or
interact
with cytokinin biosynthetic enzymes so as to stimulate one or more effects of
a
particular cytokinin biosynthetic enzyme or which enhance expression of the
enzyme
and which also preferably result in a modulation of cytokinin accumulation.
Effective constructs result in cytokinin modulation within meristematic
tissues, particularly those within female reproductive tissues, providing the
observed improvement in vigor. The invention encompasses the particular
constructs described herein, and other such constructs which may provide
expression of cytokinin-modulating genes to result in improved plant vigor
without
significant detrimental effects. In any case, and without being limited to any
particular theory, the modulation of cytokinin activity in the female
reproductive
tissues of said plant, to result in enhanced plant vigor without significant
detrimental effects, is claimed.
Expression of isolated DNA sequences in a plant host is dependent upon the
presence of operably linked regulatory elements that are functional within the
plant
host. Choice of the regulatory sequences will determine when and where within
the
organism the isolated DNA sequence is expressed. Where continuous expression
is desired in all or nearly all cells of a plant throughout development,
constitutive
promoters are utilized. In contrast, where gene expression in response to a
stimulus is desired, inducible promoters are the regulatory element of choice.
Where expression in particular tissues or organs is desired, sometimes at
specific
-10-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
stages of development, tissue-preferred promoters and/or terminators are used.
That is, these regulatory elements can drive expression in specific tissues or
organs, at specific stages. Additional regulatory sequences upstream and/or
downstream from the core sequences can be included in expression cassettes of
transformation vectors to bring about varying levels of expression of isolated
nucleotide sequences in a transgenic plant.
Seed development involves embryogenesis and maturation events as well
as physiological adaptation processes that occur within the seed to insure
progeny
survival. Developing plant seeds accumulate and store carbohydrate, lipid, and
protein that are subsequently used during germination. Generally, the
expression
patterns of seed proteins are highly regulated. This regulation includes
spatial and
temporal regulation during seed development. A variety of proteins accumulate
and decay during embryogenesis and seed development and provide an excellent
system for investigating different aspects of gene regulation as well as for
providing
regulatory sequences for use in genetic manipulation of plants.
As the field of plant bioengineering develops, and more genes become
accessible, a greater need exists for transforming with multiple genes. These
multiple exogenous genes typically need to be controlled by separate
regulatory
sequences. Some genes should be regulated constitutively, whereas other genes
should be expressed at certain developmental stages or locations in the
transgenic
organism. Accordingly, a variety of regulatory sequences having diverse
effects
are needed.
Another reason diverse regulatory sequences are needed is that undesirable
biochemical interactions may result from using the same regulatory sequence to
control more than one gene. For example, transformation with multiple copies
of a
regulatory element may cause homologous recombination between two or more
expression systems, formation of hairpin loops resulting from two copies of
the
same promoter or enhancer in opposite orientation in close proximity,
competition
between identical expression systems for binding to common promoter-specific
regulatory factors, and inappropriate expression levels of an exogenous gene
due
to trans effects of a second promoter or enhancer.
-11-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
In view of these considerations, a goal in this field has been the detection
and characterization of new regulatory sequences for transgenic control of DNA
constructs.
Isolation and characterization of seed-preferred promoters and terminators
that can serve as regulatory elements for expression of isolated nucleotide
sequences of interest in a seed-preferred manner are needed for improving seed
traits in plants. In particular, early kernel development is a stage critical
in drought-
induced ear tip abortion. Maintaining an active pool of plant cytokinins has
been
proven critical in sustaining kernel growth and development under transient
drought
stress. In addition, genes that contribute to stress responses in general,
such as
those involved in ABA responses, and also genes that maintain cell expansion
and
division, play essential roles in reproductive development under stress. Early
stage
endosperm has emerged as an important target tissue for transgene expression
as
it surrounds and nurtures developing embryos. EEP1 and EEP2 promoters
address the need for directing transgene expression in the early endosperm
tissue.
Other objects, features, advantages and aspects of the present invention will
become apparent to those of skill from the following description. It should be
understood, however, that the following description and the specific examples,
while
indicating preferred embodiments of the invention, are given by way of
illustration
only. Various changes and modifications within the spirit and scope of the
disclosed
invention will become readily apparent to those skilled in the art from
reading the
following description and from reading the other parts of the present
disclosure.
Brief Description of the Drawings
Figure 1A-Embryo: This Figure shows that embryo-preferred overexpression
of ipt increases embryo cytokinin levels, particularly ZR and Z9G (range of 2
to 8-
fold difference). In contrast, Z levels are unchanged and IPAR is not
detectable at
either developmental stage. Abbreviations: Z=zeatin, ZR (or [9R]Z)=zeatin
riboside, Z9G (or [9G]Z)=zeatin-9-glucoside, IPA or
[9R]iP=isopentenyladenosine,
IPAR (or [9R-5'P]iP)=isopentenyladenosine-5'-monophosphate, and DAP=Days
After Pollination.
-12-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Figure 113-Endosperm: This Figure shows that embryo-preferred ipt
overexpression altered endosperm cytokinin levels but less than those in the
embryo (range of only 10 to 30% difference). Abbreviations used as in Figure
1A.
Figure 2 presents ear growth rate data for D2F1 hemizygous plants under non-
stress conditions.
Figure 3 presents grain yield, kernel number, kernel dry mass, and ear length
data for D3F1 hemizygous plants under non-stress conditions.
Figure 4 presents plant height data for D4F3 homozygous plants under non-
stress conditions.
Figure 5 presents yield data for D4F3 homozygous plants under non-stress
conditions.
Figure 6 provides yield component data for D4F3 homozygous plants under
non-stress conditions.
Figure 7 provides plant height data for drought-stressed D4F3 plants.
Figure 8 provides leaf greenness data for drought-stressed D4F3 plants.
Figure 9 provides yield data for drought-stressed D4F3 plants.
Figure 10 shows increased plant biomass for event TCI5850.
-13-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Sequence Listing Description
1 Agro ipt (pnt)
2 Agro ipt (ppt)
3 zag2.1
4 CaMV35s enhancer
ZmMADS = ZAP
6 promoter ckxl -2
7 eepl
8 end2
9 led
F3.7 promoter
11 GSP1 primer for eepl
12 GSP 2 primer for eepl
13 Primer for eepl
14 Primer for eepl
Clontech AP1 primer
16 Clontech AP2 primer
17 tbl promoter
18 eep2 promoter
19 trxl or thxH promoter (thioredoxin H)
Zm40 promoter
21 GSP I primer for eep2
22 GSP2 primer for eep2
23 mLIP15
24 ESR promoter
PCNA2 promoter
26 ZmCkx2 pnt
27 ZmCkx2 ppt
28 ZmCkx3 pnt
29 ZmCkx3 ppt
ZmCkx4 pnt
31 ZmCkx4 ppt
32 ZmCkx5 pnt
33 ZmCkx5 ppt
34 ZmCkx2 promoter
ZmCkx3 promoter
36 ZmCkx4 promoter
37 ZmCkx5 promoter
38 Primer for ipt gene isolation
39 Primer for ipt gene isolation
-14-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Glossary:
The following illustrative explanations are provided to facilitate
understanding
of certain terms used frequently herein, particularly in the Examples. The
explanations are provided as a convenience and not to limit the invention.
CYTOKININ ACTIVITY, as used herein, encompasses levels of active
cytokinins within a plant, as well as the plant's perception of and response
to
cytokinins. Thus, cytokinin biosynthetic enzymes and cytokinin degrading
enzymes
are examples of enzymes capable of modulating cytokinin activity. "Cytokinin-
modulating genes" comprises polynucleotides encoding such enzymes as well as
polynucleotides encoding proteins involved in cytokinin perception and plant
response, including transcription factors associated with the cytokinin
response. The
"active cytokinin pool" refers to the accumulation of active cytokinins at any
one time
within a cell or plant part or entire plant, as appropriate. Stabilizing the
active
cytokinin pool may involve down-regulation of cytokinin degradation or
conjugation, or
up-regulation of cytokinin biosynthesis.
CYTOKININ METABOLIC ENZYME-BINDING MOLECULE, as used herein,
refers to molecules or ions which bind or interact specifically with cytokinin
metabolic
enzyme polypeptides or polynucleotides of the present invention, including,
for
example enzyme substrates, cell membrane components and classical receptors.
Binding between polypeptides of the invention and such molecules, including
binding
or interaction molecules, may be exclusive to polypeptides of the invention,
or it may
be highly specific for polypeptides of the invention, or it may be highly
specific to a
group of proteins that includes polypeptides of the invention, or it may be
specific to
several groups of proteins at least one of which includes a polypeptide of the
invention. Binding molecules also include antibodies and antibody-derived
reagents
that bind specifically to polypeptides of the invention.
CYTOKININ RESPONSIVE COMPONENT, as used herein, generally means
a cellular constituent that binds to or otherwise interacts with a cytokinin
resulting in
the transmission of an intra- or inter- cellular signal and eliciting one or
more cellular
responses to the presence or absence or fluctuation in the levels of
cytokinins.
DEVELOPING PLANT SEEDS, as used herein, generally means the maternal
plant tissues which after pollination are capable of giving rise to a plant
seed. This
-15-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
maternal plant tissue includes such tissue as female florets, ovaries,
aleurone,
pedicel, and pedicel-forming region.
DETRIMENTAL effects, as generally understood and as used herein, are
those which are obviously harmful or damaging. Significant detrimental
effects, in the
context of this application, refer to phenotypic changes which would
contribute to a
net negative effect on plant productivity or vigor.
GENE SILENCING refers to posttranscriptional interference with gene
expression. Techniques such as antisense, co-suppression, and RNA interference
(RNAi), for example, have been shown to be effective in gene silencing. (For
reviews, see Arndt and Rank, Genome 40(6):785-797, 1997; Turner and Schuch,
Journal of Chemical Technology and Biotechnology 75(10):869-882, 2000; Klink
and
Wolniak, Journal of Plant Growth Regulation 19(4):371-384, 2000)
GENETIC ELEMENT, as used herein, generally means a polynucleotide
comprising a region that encodes a polypeptide, or a polynucleotide region
that
regulates replication, transcription or translation or other processes
important to
expression of the polypeptide in a host cell, or a polynucleotide comprising
both a
region that encodes a polypeptide and a region operably linked thereto that
regulates
expression. Genetic elements may be comprised within a vector that replicates
as an
episomal element; that is, as a molecule physically independent of the host
cell
genome. They may be comprised within plasmids. Genetic elements also may be
comprised within a host cell genome; not in their natural state but, rather,
following
manipulation such as isolation, cloning and introduction into a host cell in
the form of
purified DNA or in a vector, among others.
GERMPLASM, as used herein, means a set of genetic entities, which may
be used in a breeding program to develop new plant varieties.
HIGH CYTOKININ TRANSGENIC, as used herein, means an entity, which,
as a result of recombinant genetic manipulation, produces seed with a
heritable
increase in cytokinin and/or decrease in auxin.
HOST CELL, as used herein, is a cell which has been transformed or
transfected, or is capable of transformation or transfection by an exogenous
polynucleotide sequence. "Exogenous polynucleotide sequence" is defined to
mean a sequence not naturally in the cell, or which is naturally present in
the cell
-16-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
but at a different genetic locus, in different copy number, or under direction
of a
different regulatory element.
IDENTITY and SIMILARITY, as used herein, and as known in the art, are
relationships between two polypeptide sequences or two polynucleotide
sequences,
as determined by comparing the sequences. In the art, identity also means the
degree of sequence relatedness between two polypeptide or two polynucleotide
sequences as determined by the match between two strings of such sequences.
Both identity and similarity can be readily calculated (Computational
Molecular
Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988;
Biocomputing:
Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York,
1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin,
H.G.,
eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology,
von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov,
M. and Devereux, J., eds., M Stockton Press, New York, 1991). Methods
commonly employed to determine identity or similarity between two sequences
include, but are not limited to those disclosed in Carillo, H., and Lipman,
D., SIAM
J. Applied Math., 448:1073 (1988). Preferred methods to determine identity are
designed to give the largest match between the two sequences tested. Methods
to
determine identity and similarity are codified in computer programs. Typical
computer program methods to determine identity and similarity between two
sequences include: GCG program package (Accelrys, Inc., San Diego, CA;
Devereux, J., et aL, Nucleic Acids Research 12(1):387 (1984)), BLASTP, BLASTN,
FASTA and TFASTA (Atschul, S.F. et al., J. Mol. Biol. 215:403 (1990)).
ISOLATED, as used herein, means altered "by the hand of man" from its
natural state; i.e., that, if it occurs in nature, it has been changed or
removed from its
original environment, or both. For example, a naturally-occurring
polynucleotide or a
polypeptide naturally present in a living organism in its natural state is not
"isolated,"
but the same polynucleotide or polypeptide separated from the coexisting
materials of
its natural state is "isolated", as the term is employed herein. For example,
with
respect to polynucleotides, the term isolated means that it is separated from
the
chromosome and cell in which it naturally occurs. As part of or following
isolation,
such polynucleotides can be joined to other polynucleotides, such as DNAs, for
mutagenesis, to form fusion proteins, and for propagation or expression in a
host, for
-17-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
instance. The isolated polynucleotides, alone or joined to other
polynucleotides such
as vectors, can be introduced into host cells, in culture or in whole
organisms.
Introduced into host cells in culture or in whole organisms, such DNAs still
would be
isolated, as the term is used herein, because they would not be in their
naturally-
occurring form or environment. Similarly, the polynucleotides and polypeptides
may
occur in a composition, such as media formulations or solutions for
introduction into
cells, or compositions or solutions for chemical or enzymatic reactions, which
are not
naturally occurring compositions, and, therein such polynucleotides or
polypeptides
remain isolated within the meaning of that term as it is employed herein.
LIGATION, as used herein, refers to the process of forming phosphodiester
bonds between two or more polynucleotides, which most often are double
stranded
DNAs. Techniques for ligation are well known to the art and protocols for
ligation are
described in standard laboratory manuals and references, such as, for
instance,
Sambrook at a1., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989) and
Maniatis at al., pg. 146, as cited below.
LOW-LEVEL CONSTITUTIVE EXPRESSION refers to gene expression in
essentially all tissues of a plant and at most or all stages of development,
at a level
less than that of a gene driven by the CaMV35S promoter. Low-level
constitutive
expression of a polynucleotide may result from operable linkage to a promoter
that
normally drives such expression, such as F3.7 (SECS ID NO: 10) or from a
combination of a promoter operably linked to a gene the combination of which
is
further in proximity to an enhancer element, such as the CaMV35s enhancer.
(See,
for example, Mol. Gen. Gen. 261:635-643 (1999)) Promoters driving expression
preferentially in meristematic tissues, such as zag2.1 (SECS ID NO: 3), may
also
provide a low level of constitutive expression.
OLIGONUCLEOTIDE(S), as used herein, refers to short polynucleotides.
Often the term refers to single-stranded deoxyribonucleotides, but it can
refer as well
to single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-
stranded
DNAs, among others. Oligonucleotides, such as single-stranded DNA probe
oligonucleotides, often are synthesized by chemical methods, such as those
implemented on automated oligonucleotide synthesizers. However,
oligonucleotides
can be made by a variety of other methods, including in vitro recombinant DNA-
-18-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
mediated techniques and expression of DNAs in cells and organisms. Initially,
chemically-synthesized DNAs typically are obtained without a 5' phosphate. The
5'
ends of such oligonucleotides are not substrates for phosphodiester bond
formation
by ligation reactions that employ DNA ligases typically used to form
recombinant DNA
molecules. Where ligation of such oligonucleotides is desired, a phosphate can
be
added by standard techniques, such as those that employ a kinase and ATP. The
3'
end of a chemically-synthesized oligonucleotide generally has a free hydroxyl
group
and, in the presence of a ligase, such as T4 DNA ligase, readily will form a
phosphodiester bond with a 5' phosphate of another polynucleotide, such as
another
oligonucleotide. As is well known, this reaction can be prevented selectively,
where
desired, by removing the 5' phosphates of the other polynucleotide(s) prior to
ligation.
OPERABLY LINKED, as used herein, includes reference to a functional
linkage between a promoter and a second sequence, wherein the promoter
sequence initiates and mediates transcription of the DNA corresponding to the
second sequence. Generally, operably linked means that the nucleic acid
sequences being linked are contiguous and, where necessary to join two protein
coding regions, contiguous and in the same reading frame.
PLANT, as used herein, includes reference to whole plants, plant parts or
organs (e.g., leaves, stems, roots, etc.), plant cells, seeds and progeny of
same.
Plant cell, as used herein, further includes, without limitation, cells
obtained from or
found in: seeds, suspension cultures, embryos, meristematic regions, callus
tissue,
leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.
Plant
cells can also be understood to include modified cells, such as protoplasts,
obtained from the aforementioned tissues. The class of plants which can be
used
in the methods of the invention is generally as broad as the class of higher
plants
amenable to transformation techniques, including both monocotyledonous and
dicotyledonous plants, including, for example, maize, soybean, and canola.
PLASMIDS, as used herein, generally are designated herein by a lower case p
preceded and/or followed by capital letters and/or numbers, in accordance with
standard naming conventions that are familiar to those of skill in the art.
Starting
plasmids disclosed herein are either commercially available, publicly
available, or can
be constructed from available plasmids by routine application of well-known,
published procedures. Many plasmids and other cloning and expression vectors
that
-19-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
can be used in accordance with the present invention are well known and
readily
available to those of skill in the art. Moreover, those of skill readily may
construct any
number of other plasmids suitable for use in the invention. The properties,
construction and use of such plasmids, as well as other vectors, in the
present
invention will be readily apparent from the present disclosure to those of
skill.
POLYNUCLEOTIDE(S), as used herein, generally refers to any
polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or
DNA or modified RNA or DNA. Thus, for instance, polynucleotides as used herein
refers to, among others, single-and double-stranded DNA, DNA that is a mixture
of
single- and double-stranded regions or single-, double- and triple-stranded
regions,
single- and double-stranded RNA, and RNA that is a mixture of single- and
double-
stranded regions, hybrid molecules comprising DNA and RNA that may be single-
stranded or, more typically, double-stranded, or triple-stranded, or a mixture
of single-
and double-stranded regions. In addition, polynucleotide as used herein refers
to
triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands
in such regions may be from the same molecule or from different molecules. The
regions may include all of one or more of the molecules, but more typically
involve
only a region of some of the molecules. One of the molecules of a triple-
helical
region often is an oligonucleotide. As used herein, the term polynucleotide
includes
DNAs or RNAs as described above that contain one or more modified bases. Thus,
DNAs or RNAs with backbones modified for stability or for other reasons are
"polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs
comprising unusual bases, such as inosine, or modified bases, such as
tritylated
bases, to name just two examples, are polynucleotides as the term is used
herein. It
will be appreciated that a great variety of modifications have been made to
DNA and
RNA that serve many useful purposes known to those of skill in the art. The
term
polynucleotide as it is employed herein embraces such chemically-,
enzymatically- or
metabolically-modified forms of polynucleotides, as well as the chemical forms
of
DNA and RNA characteristic of viruses and cells, including inter a/ia, simple
and
complex cells.
POLYPEPTIDES, as used herein, includes all polypeptides as described
below. The basic structure of polypeptides is well known and has been
described in
innumerable textbooks and other publications in the art. In this context, the
term is
-20-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
used herein to refer to any peptide or protein comprising two or more amino
acids
joined to each other in a linear chain by peptide bonds. As used herein, the
term
refers to both short chains, which also commonly are referred to in the art as
peptides, oligopeptides and oligomers, for example, and to longer chains,
which
generally are referred to in the art as proteins, of which there are many
types. It will
be appreciated that polypeptides often contain amino acids other than the 20
amino
acids commonly referred to as the 20 naturally-occurring amino acids, and that
many
amino acids, including the terminal amino acids, may be modified in a given
polypeptide, not only by natural processes, such as processing and other post-
translational modifications, but also by chemical modification techniques
which are
well known to the art. Even the common modifications that occur naturally in
polypeptides are too numerous to list exhaustively here, but they are well
described in
basic texts and in more detailed monographs, as well as in a voluminous
research
literature, and they are well known to those of skill in the art. Among the
known
modifications which may be present in polypeptides of the present invention
are, to
name an illustrative few, acetylation, acylation, ADP-ribosylation, amidation,
covalent
attachment of flavin, covalent attachment of a heme moiety, covalent
attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid
derivative,
covalent attachment of phosphatidylinositol, cross-linking, cyclization,
disulfide bond
formation, demethylation, formation of covalent cross-links, formation of
cystine,
formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation,
GPI
anchor formation, hydroxylation, iodination, methylation, myristoylation,
oxidation,
proteolytic processing, phosphorylation, prenylation, racemization,
selenoylation,
sulfation, transfer-RNA mediated addition of amino acids to proteins such as
arginylation, and ubiquitination. Such modifications are well known to those
of skill
and have been described in great detail in the scientific literature. Several
particularly
common modifications, glycosylation, lipid attachment, sulfation, gamma-
carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation,
for
instance, are described in most basic texts, such as, for instance PROTEINS -
STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H.
Freeman and Company, New York (1993). Many detailed reviews are available on
this subject, such as, for example, those provided by Wold, F.,
Posttranslational
Protein Modifications: Perspectives and Prospects, pgs. 1-12 in
-21-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C.
Johnson, Ed., Academic Press, New York (1983); Seifter et al., Meth. Enzymol.
182:626-646 (1990) and Rattan et al., Protein Synthesis: Posttranslational
Modifications and Aging, Ann. N.Y. Acad. Sci. 663:48-62 (1992). It will be
appreciated, as is well known and as noted above, that polypeptides are not
always
entirely linear. For instance, polypeptides may be branched as a result of
ubiquitination, and they may be circular, with or without branching, generally
as a
result of posttranslation events, including natural processing events and
events
brought about by human manipulation which do not occur naturally. Circular,
branched and branched circular polypeptides may be synthesized by non-
translation
natural process and by entirely synthetic methods, as well. Modifications can
occur
anywhere in a polypeptide, including the peptide backbone,' the amino acid
side-
chains and the amino or carboxyl termini. In fact, blockage of the amino or
carboxyl
group in a polypeptide, or both, by a covalent modification, is common in
naturally
occurring and synthetic polypeptides and such modifications may be present in
polypeptides of the present invention, as well. For instance, the amino
terminal
residue of polypeptides made in E. coli or other cells, prior to proteolytic
processing,
almost invariably will be N-formylmethionine. During post-translational
modification
of the peptide, a methionine residue at the NH2-terminus may be deleted.
Accordingly, this invention contemplates the use of both the methionine-
containing
and the methionine-less amino terminal variants of the protein of the
invention.
The modifications that occur in a polypeptide often will be a function of how
it is
made. For polypeptides. made by expressing a cloned gene in a host, for
instance,
the nature and extent of the modifications in large part will be determined by
the host
cell post-translational modification capacity and the modification signals
present in the
polypeptide amino acid sequence. For instance, as is well known, glycosylation
often
does not occur in bacterial hosts such as, for example, E. coll. Accordingly,
when
glycosylation is desired, a polypeptide should be expressed in a glycosylating
host,
generally a eukaryotic cell. Similar considerations apply to other
modifications. It will
be appreciated that the same type of modification may be present in the same
or
varying degree at several sites in a given polypeptide. Also, a given
polypeptide may
contain many types of modifications. In general, as used herein, the term
polypeptide
-22-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
encompasses all such modifications, particularly those that are present in
polypeptides synthesized by expressing a polynucleotide in a host cell.
PROMOTER, as used herein, includes reference to a region of DNA
upstream from the start of transcription and involved in recognition and
binding of
RNA polymerase and other proteins to initiate transcription. A "plant
promoter" is a
promoter capable of initiating transcription in plant cells. Exemplary plant
promoters include, but are not limited to, those that are obtained from
plants, plant
viruses, and bacteria which comprise genes expressed in plant cells, such as
Agrobacterium or Rhizobium. Examples of promoters under developmental control
include promoters that preferentially initiate transcription in certain
tissues, such as
leaves, roots, or seeds or spatially in regions such as endosperm, embryo, or
meristematic regions. Such promoters are referred to as "tissue-preferred".
Promoters that initiate transcription only in certain tissue are referred to
as "tissue-
specific". A temporally regulated promoter drives expression at particular
times,
such as between 0-25 days after pollination. A "cell-type-preferred" promoter
primarily drives expression in certain cell types in one or more organs, for
example,
vascular cells in roots or leaves. An "inducible" promoter is a promoter that
is
under environmental control and may be inducible or de-repressible. Examples
of
environmental conditions that may effect transcription by inducible promoters
include anaerobic conditions or the presence of light. Tissue-specific, tissue-
preferred, cell-type-specific, and inducible promoters constitute the class of
"non-
constitutive" promoters. A "constitutive" promoter is a promoter that is
active under
most environmental conditions and in all or nearly all tissues, at all or
nearly all
stages of development.
RECOMBINANT EXPRESSION CASSETTE, as used herein, refers to a
nucleic acid construct, generated recombinantly or synthetically, with a
series of
specified genetic elements that permit transcription of a particular nucleic
acid in a
host cell. The recombinant expression cassette can be incorporated into a
plasmid,
chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment.
Typically, the recombinant expression cassette portion of an expression vector
includes, among other sequences, a nucleic acid to be transcribed, and a
promoter,
and may optionally comprise additional elements, such as an enhancer.
-23-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
RELATED FEMALE REPRODUCTIVE TISSUE, as used herein, includes
maternal plant tissues, such as female florets, ovaries, aleurone, pedicel,
and
pedicel-forming region, either pre-pollination or upon pollination. Pre-
pollination
seed tissues can also be referred to as "grain initials" or "seed initials".
TRANSFORMATION, as used herein, is the process by which a cell is
"transformed" by exogenous DNA when such exogenous DNA has been introduced
inside the cell membrane. Exogenous DNA may or may not be integrated
(covalently linked) into chromosomal DNA making up the genome of the cell. In
prokaryotes and yeasts, for example, the exogenous DNA may be maintained on
an episomal element, such as a plasmid. With respect to higher eukaryotic
cells, a
stably transformed or transfected cell is one in which the exogenous DNA has
become integrated into the chromosome so that it is inherited by daughter
cells
through chromosome replication. This stability is demonstrated by the ability
of the
eukaryotic cell to establish cell lines or clones comprised of a population of
daughter cells containing the exogenous DNA.
VARIANT(S) of polynucleotides or polypeptides, as the term is used herein,
are polynucleotides or polypeptides that differ from a reference
polynucleotide or
polypeptide, respectively. Variants in this sense are described below and
elsewhere
in the present disclosure in greater detail. With reference to
polynucleotides,
generally, differences are limited such that the nucleotide sequences of the
reference
and the variant are closely similar overall and, in many regions, identical.
As noted
below, changes in the nucleotide sequence of the variant may be silent; that
is, they
may not alter the amino acids encoded by the polynucleotide. Where alterations
are
limited to silent changes of this type, a variant will encode a polypeptide
with the
same amino acid sequence as the reference. In other cases, as noted below,
changes in the nucleotide sequence of the variant may alter the amino acid
sequence
of a polypeptide encoded by the reference polynucleotide. Such nucleotide
changes
may result in one or more amino acid substitutions, additions, deletions,
fusions and
truncations in the polypeptide encoded by the reference sequence, as discussed
below. With reference to variant polypeptides generally, differences are
limited so
that the sequences of the reference and the variant are closely similar
overall and, in
many regions, identical. A variant and reference polypeptide may differ in
amino acid
-24-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
sequence by one or more substitutions, additions, deletions, fusions and
truncations,
which may be present in any combination.
VIGOR of a plant, as used herein, refers to the relative health, productivity,
and rate of growth of the plant and/or of certain plant parts, and may be
reflected in
various developmental attributes, including, but not limited to, concentration
of
chlorophyll, photosynthetic rate, total biomass, root biomass, grain quality,
and/or
grain yield. In Zea mays in particular, vigor may also be reflected in ear
growth rate,
ear size, and/or expansiveness of silk exsertion. Vigor may be determined with
reference to different genotypes under similar environmental conditions, or
with
reference to the same or different genotypes under different environmental
conditions.
YIELD STABILITY, as known in the art and as used herein, refers to
consistent yield performance of a given genotype across environments,
including
environments of stress.
Detailed Description of the Invention:
This invention relates, in part, to nucleic acid constructs useful for
modulation
of cytokinin activity in plants, including the temporal and/or spatial
expression of
cytokinin genes in seed and related female reproductive tissue, and to
associated
polynucleotides and polypeptides; variants and derivatives of these
polynucleotides
and polypeptides; processes for making these polynucleotides and these
polypeptides, and their variants and derivatives; agonists and antagonists of
the
polypeptides; products comprising these polynucleotides and polypeptides, and
their
variants and derivatives; and uses of these polynucleotides, polypeptides,
variants,
derivatives, agonists and antagonists, and uses of the products comprising
same. In
particular, in these and in other regards, the invention relates to
polynucleotides and
polypeptides of the cytokinin metabolic pathway, including the enzymes ipt and
cytokinin oxidase and genes encoding same, and their use singly or in
combination
with each other and/or in combinations with various other isolated
polynucleotides
and polypeptides affecting cytokinin activity. Targeted modulation of
expression to
improve plant vigor and seed yield is described.
As mentioned above, the invention provides the reagents necessary for the
development of transgenic plants characterized by enhanced cytokinin activity.
As
-25-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
used herein, the phrase "cytokinin activity" is a relative one and refers to
the
cytokinin activity in a control plant without the cytokinin-affecting
transgene as
compared to a plant with such a functioning transgene. The relative levels may
also be measured employing only the transgenic plant but measured in the
presence and absence of expression of the subject transgene. Accordingly, any
structural gene, the regulated expression of which has the effect of enhancing
cytokinin activity in plants, particularly seeds, is useful for the practice
of this
invention. Genes that direct the expression of proteins that act to increase
the
biosynthesis of cytokinin (e.g., ipt or tzs) or genes encoding cytokinin
degrading
enzymes, the expression of which is inhibited, may be used in the_practice of
this
invention. However, the use of other genes is also contemplated by this
invention.
In addition to genes that affect the absolute levels of cytokinin, genes that
affect the
ratio of cytokinin to auxin are also useful. Auxin-lowering genes such as iaa-
1 and
gene-5 may also be employed in the practice of this invention. Additionally or
alternatively, targeted modulation of expression of isolated polynucleotides
encoding polypeptides involved in cytokinin recognition and cellular reponse
may
provide enhanced cytokinin activity as defined herein. Combinations of these
approaches, comprising changes in expression of one or more cytokinin-
modulating genes, are also contemplated.
As mentioned above, the present invention relates to novel constructions of
cytokinin metabolic polypeptides and polynucleotides encoding same, among
other
things, as described in greater detail below. The polypeptides particularly
useful for
the practice of this invention include, but are not limited to, ipt and
cytokinin oxidase.
The nucleic acids, and fragments thereof, encoding the above-mentioned enzymes
are useful to generate enzyme-producing transgenics. For example, a single
gene or
gene fragment (or combinations of several genes) may be incorporated into an
appropriate expression cassette (using for example the globulin-1 [glbl]
promoter for
embryo-preferred expression, or the 27kd gamma zein promoter for endosperm-
preferred expression in seed) and transformed into corn along with an
appropriate
selectable marker (such as the BAR and PAT genes). Certain embodiments
comprise
a promoter driving expression in female reproductive meristematic tissue
operably
linked to a poynucleotide encoding a cytokinin biosynthetic enzyme. Examples
of
-26-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
promoters useful in such an embodiment include zag2.1, Zap (also known as
ZmMADS), tbl, and PCNA2, as shown in SEQ ID NOS: 3, 5,17, and 25.
In certain situations it may be preferable to silence or down-regulate certain
genes, such as the cytokinin oxidase. Relevant literature describing the
application of
homology-dependent gene silencing include: Jorgensen, Trends Biotechnol. 8
(12):340-344 (1990); Revell, Proc. Nat'l. Acad. Sci. (USA) 91:3490-3496
(1994);
Finnegan et al., Bio/Technology 12: 883-888 (1994); Neuhuber et aL, Mol. Gen.
Genet. 244:230-241 (1994); Revell at al. (1994) Proc. Natl. Acad. Sci. USA
91:3490-3496; Jorgensen at al. (1996) Plant Mol. Biol. 31:957-973; Johansen
and
Carrington (2001) Plant Physiol. 126:930-938; Broin at al. (2002) Plant Cell
14:1417-1432; Stoutjesdijk at al. (2002) Plant Physiol. 129:1723-1731; Yu at
a!.
(2003) Phytochgmistry 63:753-763; and U.S. Patent Nos. 5,034,323, 5,283,184,
and 5,942,657. Alternatively, another approach to gene silencing can be with
the use
of antisense technology (Rothstein et al. in Plant Mol. Cell. Biol. 6:221-246
(1989);
Liu et al. (2002) Plant Physiol. 129:1732-1743 and U.S. Patent Nos. 5,759,829
and
5,942,657. Methods and constructs for down-regulating expression of cytokinin
oxidase are described in co-pending US provisional patent application,
Cytokinin
Oxidase-Like Sequences and Methods of Use, filed, April 2, 2004 (published as
2006/0021082).
Certain embodiments may comprise both increased cytokinin biosynthesis and
reduced cytokinin degradation to result in improved cytokinin activity.
Polynucleotides
In accordance with one aspect of the present invention, there are provided the
isolated polynucleotides of SEQ ID NOS: 26, 28, 30, and 32, which encode the
cytokinin metabolic enzyme maize cytokinin oxidase, having the deduced amino
acid
sequences shown herein as SEQ ID NOS: 27, 29, 31, and 33, as disclosed in co-
pending provisional application, Cytokinin Oxidase-Like Sequences and Methods
of Use,
filed, April 2, 2004 (published as 2006/0021082); as well as maize cytokinin
oxidase of SEQ
ID NO:38, encoding SEQ ID NO: 39, as disclosed in U.S. Patent 6,229,066 and
WO99/06571. Use of the isolated polynucleotide encoding ipt (isopentenyl
transferase), as provided at Molecular and General Genetics 216:388-394 (1989)
and
provided herein as SEQ ID NO: 1, and its deduced amino acid sequence SEQ ID
NO:
2, is also contemplated by this invention, as is use of other cytokinin
biosynthetic
-27-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
genes (e.g., ipt) isolated from other organisms, such as Arabidopsis or maize,
for
example.
In accordance with one aspect of the present invention, there are provided the
isolated Agrobacterium tumefaciens polynucleotide encoding isopentenyl
transferase,
SEQ ID NO: 1, and its deduced amino acid sequence, SEQ ID NO: 2 (Strabala, et
al., Mol. Gen. Genet. 216, 388-394 (1989); GenBank Accession X14410); maize
Zag2.1 promoter, SEQ ID NO: 3 (GenBank X80206) ; CaMV 35s enhancer, SEQ ID
NO: 4; maize Zap promoter, SEQ ID NO: 5 (also known as ZmMADS; US patent
application 10/387,937; WO 03/078590); maize ckxl-2 promoter, SEQ ID NO: 6 (US
patent publication 2002-0152500 Al; WO 02/0078438); maize eepl promoter, SEQ
ID NO: 7 (US provisional patent application 60/460,718); maize end2 promoter,
SEQ
ID NO: 8 (U.S. Patent 6,528,704 and U.S. patent applications 10/310,191);
maize
lecl promoter, SEQ ID NO: 9 (U.S. Patent Application 09/718,754); maize F3.7
promoter, SEQ ID NO: 10 (Baszczynski et al., Maydica 42:189-201 (1997); maize
tbl promoter; SEQ ID NO: 17(Hubbarda et al., Genetics 162: 1927-1935,
December 2002); maize eep2 promoter, SEQ ID NO: 18; maize thioredoxinH
promoter, SEQ ID NO: 19, US provisional Patent Application 60/514,123); maize
Zm40 promoter, SEQ ID NO: 20 (U.S. Patent 6,403,862 and WO 01/2178); maize
mLIP15 promoter, SEQ ID NO: 23 (U.S. patent 6,479,734); maize ESR promoter,
SEQ ID NO: 24 (U.S. application 10/786,679, filed February 25, 2004); maize
PCNA2
promoter, SEQ ID NO: 25 (U.S. application 10/388,359 filed March 13, 2003);
maize
cytokinin oxidases and promoters, SEQ ID NOS: 26-37 (co-pending provisional
application, Cytokinin Oxidase-Like Sequences and Methods of Use,
filed, April 2, 2004 (published as 2006/0021082).
The maize gene ZAG2 was isolated based on homology to the Arabidopsis
AGAMOUS gene, which directs floral development. (Schmidt et al., Plant Cell
5(7):729-737, 1993) ZAG2 is normally expressed primarily in developing female
florets. The ZAG2 coding sequence and approximately 2.1 kb of 5' sequence were
deposited in GenBank as accession no. X80206 in September 1995. A portion of
the ZAG2 5' region is included herein as SEQ ID NO: 3 and referred to as the
ZAG2.1 promoter.
Using the information provided herein, such as the polynucleotide sequences
set out below, a polynucleotide of the present invention encoding cytokinin
metabolic
-28-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
enzyme polypeptides may be obtained using standard cloning and screening
procedures. To obtain the polynucleotide encoding the protein using the DNA
sequences given below, oligonucleotide primers can be synthesized that are
complementary to the known polynucleotide sequence. These primers can then be
used in PCR to amplify the polynucleotide from template derived from mRNA or
genomic DNA isolated from the desired source material. The resulting amplified
products can then be cloned into commercially available cloning vectors, such
as the
TA series of vectors from InVitrogen. By sequencing the individual clones thus
identified with sequencing primers designed from the original sequence, it is
then
possible to extend the sequence in both directions to determine the full gene
sequence. Such sequencing is performed using denatured double stranded DNA
prepared from a plasmid clone. Suitable techniques are described by Maniatis,
T.,
Fritsch, E.F. and Sambrook, J. in MOLECULAR CLONING, A Laboratory Manual
(2nd edition 1989 Cold Spring Harbor Laboratory. See Sequencing Denatured
Double-Stranded DNA Templates 13.70.
Isolation of ipt gene:
The isopentenyl transferases (ipts) of the present invention may be obtained
from
sources including, but not limited to, Zea mays, Agrobacterium, Psuedomonas
savastano, Rhodococcus and Erwinia. The complete sequence of an ipt gene is
provided in Strabala,T.J., et al., Isolation and characterization of an ipt
gene from the
Ti plasmid Bo542, Mol. Gen. Genet. 216, 388-94 (1989). A copy of such gene can
be
prepared synthetically employing DNA synthesis protocols well known to those
skilled
in the art of gene synthesis. Alternatively, a copy of the gene may be
isolated directly
from an organism harboring an ipt gene, for example by PCR cloning as
described in
WO 00163401.
Polynucleotides of the present invention may be in the form of RNA, such as
mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA
obtained by cloning or produced by chemical synthetic techniques or by a
combination thereof. The DNA may be double-stranded or single-stranded. Single-
stranded DNA may be the coding strand, also known as the sense strand, or it
may
be the non-coding strand, also referred to as the antisense strand.
-29-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The coding sequence that encodes the polypeptide may be identical to the
coding sequence of the polynucleotides shown below. It also may be a
polynucleotide with a different sequence, which, as a result of the redundancy
(degeneracy) of the genetic code, encodes the polypeptides shown below. As
discussed more fully below, these alternative coding sequences are an
important
source of sequences for codon optimization.
Polynucleotides of the present invention which encode the polypeptides listed
below may include, but are not limited to, the coding sequence for the mature
polypeptide, by itself; the coding sequence for the mature polypeptide and
additional
coding sequences, such as those encoding a leader or secretory sequence, such
as
a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature
polypeptide, with or without the aforementioned additional coding sequences,
together with additional, non-coding sequences, including for example, but not
limited
to, non-coding 5' and 3' sequences, such as the transcribed, non-translated
sequences that play a role in transcription (including termination signals,
for
example), ribosome binding, mRNA stability elements, and additional coding
sequences which encode additional amino acids, such as those which provide
additional functionalities.
The DNA may also comprise promoter regions that function to direct the
transcription of the DNA encoding heterologous cytokinin-modulating enzymes of
this
invention. Heterologous is defined as a sequence that is not naturally
occurring with
the promoter sequence. While the nucleotide sequence is heterologous to the
promoter sequence, it may be homologous (native) or heterologous (foreign) to
the
plant host.
Furthermore, the polypeptide may be fused to a marker sequence, such as a
peptide, which facilitates purification of the fused polypeptide. In certain
embodiments of this aspect of the invention, the marker sequence is a hexa-
histidine
peptide, such as the tag provided in the pQE vector (Qiagen, Inc.) and the pET
series
of vectors (Novagen), among others, many of which are commercially available.
As
described in Gentz et al., Proc. Nat'l. Acad. Sci., (USA) 86:821-824 (1989),
for
instance, hexa-histidine provides for convenient purification of the fusion
protein. The
HA tag may also be used to create fusion proteins and corresponds to an
epitope
-30-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
derived of influenza hemagglutinin protein, which has been described by Wilson
et al.,
Cell 37:767 (1984), for instance.
In accordance with the foregoing, the term "polynucleotide encoding a
polypeptide" as used herein encompasses polynucleotides which include a
sequence
encoding a polypeptide of the present invention, particularly cytokinin
modulating
enzymes having the amino acid sequences set out below. The term encompasses
polynucleotides that include a single continuous region or discontinuous
regions
encoding the polypeptide (for example, interrupted by integrated phage or
insertion
sequence or editing) together with additional regions that also may contain
coding
and/or non-coding-sequences.
The present invention further relates to variants of the present
polynucleotides
that encode for fragments, analogs and derivatives of the polypeptides having
the
deduced amino acid sequence below. A variant of the polynucleotide may be a
naturally occurring variant such as a naturally occurring allelic variant, or
it may be a
variant that is not known to occur naturally. Such non-naturally-occurring
variants of
the polynucleotide may be made by mutagenesis techniques, including those
applied
to polynucleotides, cells or organisms.
Among variants in this regard are variants that differ from the aforementioned
polynucleotides by nucleotide substitutions, deletions or additions. The
substitutions
may involve one or more nucleotides. The variants may be altered in coding or
non-
coding regions or both. Alterations in the coding regions may produce
conservative
or non-conservative amino acid substitutions, deletions or additions.
Among the embodiments of the invention in this regard are polynucleotides
encoding polypeptides having the amino acid sequences set out below; variants,
analogs, derivatives and fragments thereof.
Further in this regard are polynucleotides encoding cytokinin biosynthetic
enzyme variants, analogs, derivatives and fragments, and variants, analogs and
derivatives of the fragments, which have the amino acid sequences below in
which
several, a few, 1 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are
substituted,
deleted or added, in any combination. Among these are polynucleotides
comprising
silent substitutions, additions and deletions, which do not alter the
properties and
activities of the cytokinin biosynthetic enzymes; conservative substitutions;
and
-31-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
polynucleotides encoding polypeptides having the amino acid sequence below,
without substitutions.
Further embodiments of the invention comprise polynucleotides that are
greater than 79%, at least 80%, or at least 85% identical to a polynucleotide
encoding
a polypeptide having an amino acid sequence set out below, and polynucleotides
that
are complementary to such polynucleotides. Certain embodiments, moreover, are
polynucleotides which encode polypeptides which retain substantially the same,
or
even exhibit a increase in, biological function or activity as compared to
that of the
mature polypeptide encoded by the polynucleotides set out below.
The present invention further relates to polynucleotides that hybridize to the
herein above-described sequences. In this regard, the present invention
especially
relates to polynucleotides which hybridize under stringent conditions to the
herein
above-described polynucleotides. As herein used, the term "stringent
conditions"
means hybridization will occur only if there is at least 80% identity between
the
sequences.
The terms "stringent conditions" or "stringent hybridization conditions"
include reference to conditions under which a probe will hybridize to its
target
sequence, to a detectably greater degree than to other sequences (e.g., at
least 2-
fold over background). Stringent conditions are sequence-dependent and will be
different in different circumstances. By controlling the stringency of the
hybridization and/or washing conditions, target sequences can be identified
which
are 100% complementary to the probe (homologous probing). Alternatively,
stringency conditions can be adjusted to allow some mismatching in sequences
so
that lower degrees of similarity are detected (heterologous probing).
Generally, a
probe is less than about 1000 nucleotides in length, often less than 500
nucleotides
in length.
Typically, stringent conditions will be those in which the salt concentration
is
less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion
concentration (or
other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C for
short
probes (e.g., 10 to 50 nucleotides) and at least about 60 C for long probes
(e.g.,
greater than 50 nucleotides). Stringent conditions may also be achieved with
the
addition of destabilizing agents such as formamide. Exemplary low stringency
conditions include hybridization with a buffer solution of 30 to 35%
formamide, 1 M
-32-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
NaCl, 1 % SDS (sodium dodecyl sulfate) at 37 C, and a wash in 1 X to 2X SSC
(20X
SSC = 3.0 M NaCI/0.3 M trisodium citrate) at 50 to 55 C. Exemplary moderate
stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl,
1%
SDS at 37 C, and a wash in 0.5X to 1X SSC at 55 to 60 C. Exemplary high
stringency conditions include hybridization in 50% formamide, I M NaCl, 1% SDS
at 37 C, and a wash in 0.1X SSC at 60 to 65 C.
Specificity is typically the function of post-hybridization washes, the
critical
factors being the ionic strength and temperature of the final wash solution.
For
DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and
Wahl, Anal. Biochem., 138:267-284 (1984): Tm = 81.5 C + 16.6 (log M) + 0.41
(%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations,
%GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form
is the percentage of formamide in the hybridization solution, and L is the
length of
the hybrid in base pairs. The Tm is the temperature (under defined ionic
strength
and pH) at which 50% of a complementary target sequence hybridizes to a
perfectly matched probe. Tm is reduced by about 1 C for each I % of
mismatching;
thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to
sequences of the desired identity. For example, if sequences with >90%
identity
are sought, the Tm can be decreased 10 C. Generally, stringent conditions are
selected to be about 5 C lower than the thermal melting point (Tm) for the
specific
sequence and its complement at a defined ionic strength and pH. However,
severely stringent conditions can utilize a hybridization and/or wash at 1, 2,
3, or 4
C lower than the thermal melting point (Tm); moderately stringent conditions
can
utilize a hybridization and/or wash at 6, 7, 8, 9, or 10 C lower than the
thermal
melting point (Tm); low stringency conditions can utilize a hybridization
and/or wash
at 11, 12, 13, 14, 15, or 20 C lower than the thermal melting point (Tm).
Using the
equation, hybridization and wash compositions, and desired Tm, those of
ordinary
skill will understand that variations in the stringency of hybridization
and/or wash
solutions are inherently described. If the desired degree of mismatching
results in a
Tm of less than 45 C (aqueous solution) or 32 C (formamide solution) it is
preferred to increase the SSC concentration so that a higher temperature can
be
used. Hybridization and/or wash conditions can be applied for at least 10, 30,
60,
90, 120, or 240 minutes. An extensive guide to the hybridization of nucleic
acids is
-33-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology--
Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of
principles of
hybridization and the strategy of nucleic acid probe assays", Elsevier, New
York
(1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et
al.,
Eds., Greene Publishing and Wiley-Interscience, New York (1995).
As discussed additionally herein regarding polynucleotide assays of the
invention, for instance, polynucleotides of the invention as discussed above,
may be
used as a hybridization probe for RNA, cDNA and genomic DNA to isolate full-
length
cDNAs and genomic clones encoding cytokinin biosynthetic enzymes and to
isolate
cDNA and genomic clones of other genes that have a high sequence similarity to
the
genes. Such probes generally will comprise between about 15 and 50 bases.
The polynucleotides and polypeptides of the present invention may be
employed as research reagents and materials for discovery of transgenic plants
with
modulated cytokinin activity. The polynucleotides of the invention that are
oligonucleotides derived from the sequences below may be used as PCR primers
in the process herein described to determine whether or not the genes
identified
herein in whole or in part are transcribed in cytokinin accumulating tissue.
The polynucleotides may encode a polypeptide which is the mature protein
plus additional amino or carboxyl-terminal amino acids, or amino acids
interior to the
mature polypeptide (when the mature form has more than one polypeptide chain,
for
instance). Such sequences may play a role in processing of a protein from
precursor
to a mature form, may allow protein transport, may lengthen or shorten protein
half-
life or may facilitate manipulation of a protein for assay or production,
among other
things. As generally is the case in vivo, the additional amino acids may be
processed
away from the mature protein by cellular enzymes.
A precursor protein, having the mature form of the polypeptide fused to one or
more prosequences, may be an inactive form of the polypeptide. When
prosequences are removed, such inactive precursors generally are activated.
Some
or all of the prosequences may be removed before activation. Generally, such
precursors are called proproteins.
In sum, a polynucleotide of the present invention may encode a mature
protein, a mature protein plus a leader sequence (which may be referred to as
a
preprotein), a precursor of a mature protein having one or more prosequences
which
-34-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
are not the leader sequences of a preprotein, or a preproprotein, which is a
precursor
to a proprotein, having a leader sequence and one or more prosequences, which
generally are removed during processing steps that produce active and mature
forms
of the polypeptide.
Polypeptides
The present invention further relates to polypeptides that have the deduced
amino acid sequences below. The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In
certain
embodiments it is a recombinant polypeptide.
The invention also relates to fragments, analogs and derivatives of these
polypeptides. The terms "fragment," "derivative" and "analog", when referring
to the
polypeptides, mean a polypeptide which retains at least 90% of, at least 95%
of, or
essentially the same biological function or activity as such polypeptide.
Thus, an
analog includes a proprotein that can be activated by cleavage of the
proprotein
portion to produce an active mature polypeptide. Among the embodiments of the
invention in this regard are polypeptides having the amino acid sequence of
cytokinin
modulating enzymes set out below, variants, analogs, derivatives and fragments
thereof, and variants, analogs and derivatives of the fragments.
The fragment, derivative or analog of the polypeptides below may be (i) one in
which one or more of the amino acid residues are substituted with a conserved
or
non-conserved amino acid residue (preferably a conserved amino acid residue)
and
such substituted amino acid residue may or may not be one encoded by the
genetic
code, or (ii) one in which one or more of the amino acid residues includes a
substituent group, or (iii) one in which the mature polypeptide is fused with
another
compound, such as a compound to increase the half-life of the polypeptide (for
example, polyethylene glycol), or (iv) one in which the additional amino acids
are
fused to the mature polypeptide, such as a leader or secretory sequence or a
sequence which is employed for purification of the mature polypeptide or a
proprotein
sequence. Such fragments, derivatives and analogs are deemed to be obtained by
those of ordinary skill in the art, from the teachings herein.
Among preferred variants are those that vary from a reference by conservative
amino acid substitutions. Such substitutions are those that substitute a given
amino
-35-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
acid in a polypeptide by another amino acid of like characteristics. Typically
seen as
conservative substitutions are the replacements, one for another, among the
aliphatic
amino acids Ala, Val, Leu and Ile; interchange of the hydroxyl residues Ser
and Thr,
exchange of the acidic residues Asp and Glu, substitution between the amide
residues Asn and Gln, exchange of the basic residues Lys and Arg; and
replacements among the aromatic residues Phe, Tyr.
Further particularly preferred in this regard are variants, analogs,
derivatives
and fragments, and variants, analogs and derivatives of the fragments, having
the
amino acid sequences below, in which several, a few, I to 10, 1 to 5, 1 to 3,
2, 1 or no
amino acid residues are substituted, deleted or added, in any combination.
Especially preferred among these are silent substitutions, additions and
deletions,
which do not alter the properties and activities of the cytokinin biosynthetic
enzymes.
Also especially preferred in this regard are conservative substitutions. Most
highly
preferred are polypeptides having the amino acid sequences below without
substitutions.
The polypeptides and polynucleotides of the present invention are preferably
provided in an isolated form, and may be purified to homogeneity.
Vectors, Host Cells, Expression
The present invention also relates to vectors comprising the polynucleotides
of
the present invention, host cells that incorporate the vectors of the
invention, and the
production of polypeptides of the invention by recombinant techniques.
Vectors
In accordance with this aspect of the invention the vector may be, for
example,
a plasmid vector, a single or double-stranded phage vector, a single or double-
stranded RNA or DNA viral vector. Such vectors may be introduced into cells as
polynucleotides, preferably DNA, by well known techniques for introducing DNA
and
RNA into cells. The vectors, in the case of phage and viral vectors, also may
be and
preferably are introduced into cells as packaged or encapsidated virus by well
known
techniques for infection and transduction. Viral vectors may be replication
competent
or replication defective. In the latter case, viral propagation generally will
occur only
in complementing host cells.
Preferred among vectors, in certain respects, are those for expression of
polynucleotides and polypeptides of the present invention. Generally, such
vectors
-36-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
comprise cis-acting control regions effective for expression in a host,
operably linked
to the polynucleotide to be expressed. Appropriate trans-acting factors are
supplied
by the host, supplied by a complementing vector or supplied by the vector
itself upon
introduction into the host.
In certain preferred embodiments in this regard, the vectors provide for
preferred expression. Such preferred expression may be inducible expression or
temporally limited or restricted to predominantly certain types of cells or
any
combination of the above. Particularly preferred among inducible vectors are
vectors
that can be induced for expression by environmental factors that are easy to
manipulate, such as temperature and nutrient additives. A variety of vectors
suitable
to this aspect of the invention, including constitutive and inducible
expression vectors
for use in prokaryotic and eukaryotic hosts, are well known and employed
routinely by
those of skill in the art. Such vectors include, among others, chromosomal,
episomal
and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from
bacteriophage, from transposons, from yeast episomes, from insertion elements,
from
yeast chromosomal elements, from viruses such as baculoviruses, papova
viruses,
such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies
viruses and retroviruses, and vectors derived from combinations thereof, such
as
those derived from plasmid and bacteriophage genetic elements, such as cosmids
and phagemids and binaries used for Agrobacteriur7-mediated transformations.
All
may be used for expression in accordance with this aspect of the present
invention.
The following vectors, which are commercially available, are provided by way
of example. Among vectors preferred for use in bacteria are pQE70, pQE60 and
pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript
vectors,
pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and ptrc99a,
pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred
eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from
Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Useful
plant binary vectors include BIN19 and its derivatives available from
Clontech. These
vectors are listed solely by way of illustration of the many commercially
available and
well-known vectors that are available to those of skill in the art for use in
accordance
with this aspect of the present invention. It will be appreciated that any
other plasmid
or vector suitable for, for example, introduction, maintenance, propagation or
-37-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
expression of a polynucleotide or polypeptide of the invention in a host may
be used
in this aspect of the invention, several of which are disclosed in more detail
below.
In general, expression constructs will contain sites for transcription
initiation
and termination, and, in the transcribed region, a ribosome-binding site for
translation.
The coding portion of the mature transcripts expressed by the constructs will
include
a translation-initiating AUG at the beginning and a termination codon
appropriately
positioned at the end of the polypeptide to be translated.
In addition, the constructs may contain control regions that regulate as well
as
engender expression. Generally, in accordance with many commonly practiced
procedures, such regions will operate by controlling transcription, such as
transcription factors, repressor binding sites and termination signals, among
others.
For secretion of the translated protein into the lumen of the endoplasmic
reticulum,
into the periplasmic space or into the extracellular environment, appropriate
secretion
signals may be incorporated into the expressed polypeptide. These signals may
be
endogenous to the polypeptide or they may be heterologous signals.
Transcription of the DNA encoding the polypeptides of the present invention by
higher eukaryotes may be increased by inserting an enhancer sequence into the
vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300
bp
that act to increase transcriptional activity of a promoter in a given host
cell-type.
Examples of enhancers include the SV40 enhancer, which is located on the late
side
of the replication origin at bp 100 to 270, the cytomegalovirus early promoter
enhancer, the polyoma enhancer on the late side of the replication origin, and
adenovirus enhancers. Additional enhancers useful in the invention to increase
transcription of the introduced DNA segment, include, inter alia, viral
enhancers like
those within the 35S promoter, as shown by Odell et aL, Plant Mol. Biol.
10:263-72
(1988), and an enhancer from an opine gene as described by Fromm et al., Plant
Cell
1:977 (1989). The enhancer may affect the tissue-specificity and/or temporal
specificity of expression of sequences included in the vector. For example, a
construct may comprise the CaMV 35s enhancer (SEQ ID NO: 4) in a "head to
head"
orientation with respect to the zag2.1 promoter (SEQ ID NO: 3) driving ipt
(SEQ ID
NO: 1).
Termination regions also facilitate effective expression by ending
transcription
at appropriate points. Useful terminators for practicing this invention
include, but are
-38-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
not limited to, pinll (See An et al., Plant Cell 1(1):115-122 (1989)), glb1
(See
Genbank Accession #L22345), gz (See gzw64a terminator, Genbank Accession
#578780), and the nos terminator from Agrobacterium.
Among known eukaryotic promoters suitable for generalized expression are
the CMV immediate early promoter, the HSV thymidine kinase promoter, the early
and late SV40 promoters, the promoters of retroviral LTRs, such as those of
the Rous
sarcoma virus ("RSV"), metallothionein promoters, such as the mouse
metallothionein-I promoter and various plant promoters, such as globulin-1.
When
available, the native promoters of the cytokinin modulating enzyme genes may
be
used. Representatives of prokaryotic promoters include the phage lambda PL
promoter, the E. coli lac, trp and tac promoters to name just a few of the
well-known
promoters.
With respect to plants, examples of seed-preferred promoters include
promoters of seed storage proteins which express these proteins in seeds in a
highly regulated manner (Thompson, et al.; BioEssays;. 10:108 (1989)), such
as,
for dicotyledonous plants, a bean (i-phaseolin promoter, a napin promoter, a P-
conglycinin promoter, and a soybean lectin promoter. For monocotyledonous
plants, promoters useful in the practice of the invention include, but are not
limited
to, a maize 15 kD zein promoter, a 22 kD zein promoter, a 27Kd y-zein promoter
(such as gzw64A promoter, see Genbank Accession #S78780), a waxy promoter,
a shrunken-1 promoter, a globulin I promoter (See Genbank Accession # L22344),
an Itp2 promoter (Kalla, et al., Plant Journal 6:849-860 (1994); U.S. Patent
5,525,716), ciml promoter (see U.S. Patent 6,225,529) maize endl and end2
promoters (See U.S. patent 6,528,704 and application 10/310,191, filed
December
4, 2002); nucl promoter (U.S. patent 6,407,315); Zm40 promoter (U.S. patent
6,403,862); eepl (SEQ ID NO: 7) and eep2 (SEQ ID NO: 18); lecl (U.S. patent
application 09/718,754); thioredoxinH promoter (U.S. provisional patent
application
60/514,123); mlipl5 promoter (U.S. patent 6,479,734); PCNA2 promoter, SEQ ID
NO: 25; and the shrunken-2 promoter. (Shaw et al., Plant Phys 98:1214-1216,
1992; Zhong Chen et al., PNAS USA 100:3525-3530, 2003) However, other
promoters useful in the practice of the invention are known to those of skill
in the
art such as nucellain promoter ( See C. Linnestad, et al., Nucellain, A Barley
Homolog of the Dicot Vacuolar - Processing Proteasem Is Localized in Nucellar
-39-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Cell Walls, Plant Physiol. 118:1169-80 (1998), kn1 promoter (See S. Hake and
N.
On, The Role of knottedl in Meristem Functions, B8: INTERACTIONS AND
INTERSECTIONS IN PLANT PATHWAYS, COEUR D'ALENE, IDAHO, KEYSTONE SYMPOSIA,
February 8-14, 1999, at 27.), and F3.7 promoter (Baszczynski et al., Maydica
42:189-201 (1997); SEQ ID NO: 10). Spatially acting promoters such as glbl, an
embryo-preferred promoter; or gamma zein, an endosperm-preferred promoter; or
a promoter active in the embryo-surrounding region (see U.S. Patent
Application
10/786,679, filed February 25, 2004), or BETL1 (See G. Hueros, et al., Plant
Physiology 121:1143-1152 (1999) and Plant Cell 7:747-57 (June 1995)), are
particularly useful, including promoters preferentially active in female
reproductive
tissues, and those active in meristematic tissues, particularly in
meristematic
female reproductive tissues.
The use of temporally-acting promoters is also contemplated by this
invention. Promoters that act from 0-25 days after pollination (DAP) are
preferred,
as are those acting from 4-21, 4-12, or 8-12 DAP. In this regard, promoters
such
as ciml and Itp2 are preferred. Promoters that act from -14 to 0 days after
pollination can also be used, such as SAG12 (See WO 96/29858, Richard M.
Amasino, published 3 Oct. 1996) and ZAGI or ZAG2 (See R.J. Schmidt, et al.,
Identification and Molecular Characterization of ZAG1, the Maize Homolog of
the
Arabidopsis Floral Homeotic Gene AGAMOUS, Plant-Cell 5(7): 729-37 (July 1993).
See also SEQ ID NO: 3).
Useful promoters include maize zag2.1 (SEQ ID NO: 3), Zap (SEQ ID NO: 5,
also known as ZmMADS; US patent application 10/387,937; WO 03/078590); maize
tb1 promoter (SEQ ID NO: 17; see also Hubbarda et al., Genetics 162:1927-1935,
2002).
Examples of suitable promoters for generalized expression in plants are the
promoter for the small subunit of ribulose- 1,5-bis-phosphate carboxylase,
promoters
from tumor-inducing plasmids of Agrobacterium tumefaciens, such as the
nopaline
synthase and octopine synthase promoters, and viral promoters such as the
cauliflower mosaic virus (CaMV) 19S and 35S promoters or the figwort mosaic
virus
35S promoter.
It will be understood that numerous promoters not mentioned are suitable for
use in this aspect of the invention, are well known and readily may be
employed by
-40-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
those of skill in the manner illustrated by the discussion and the examples
herein. For
example, this invention contemplates using, when appropriate, the native
cytokinin
biosynthetic enzyme promoters to drive the expression of the enzyme in a
recombinant environment.
Vectors for propagation and expression generally will include selectable
markers. Such markers also may be suitable for amplification or the vectors
may
contain additional markers for this purpose. In this regard, the expression
vectors
preferably contain one or more selectable marker genes to provide a phenotypic
trait
for selection of transformed host cells. Preferred markers include
dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture, and tetracycline
or
ampicillin resistance genes for culturing E. coli and other prokaryotes.
Kanamycin
and herbicide resistance genes (PAT and BAR) are generally useful in plant
systems.
Selectable marker genes, in physical proximity to the introduced DNA segment,
are used to allow transformed cells to be recovered by either positive genetic
selection or screening. The selectable marker genes. also allow for
maintaining
selection pressure on a transgenic plant population, to ensure that the
introduced
DNA segment, and its controlling promoters and enhancers, are retained by the
transgenic plant.
Many of the commonly used positive selectable marker genes for plant
transformation have been isolated from bacteria and code for enzymes that
metabolically detoxify a selective chemical agent which may be an antibiotic
or a
herbicide. Other positive selection marker genes encode an altered target
which is
insensitive to the inhibitor.
An example of a selection marker gene for plant transformation is the BAR or
PAT gene, which is used with the selecting agent bialaphos. Spencer et al., J.
Theor.
Appl'd Genetics 79:625-631 (1990). Another useful selection marker gene is the
neomycin phosphotransferase II (nptll) gene, isolated from Tn5, which confers
resistance to kanamycin when placed under the control of plant regulatory
signals.
Fraley et al., Proc. Nat'l Acad. Sci. (USA) 80:4803 (1983). The hygromycin
phosphotransferase gene, which confers resistance to the antibiotic
hygromycin, is a
further example of a useful selectable marker. Vanden Elzen et al., Plant Mol.
Biol.
5:299 (1985). Additional positive selectable marker genes of bacterial origin
that
confer resistance to antibiotics include gentamicin acetyl transferase,
streptomycin
-41-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
phosphotransferase, aminoglycoside-3'-adenyl transferase and the bleomycin
resistance determinant. Hayford et al., Plant Physiol. 86:1216 (1988); Jones
et al.,
Mol. Gen. Genet. 210:86 (1987); Svab et al., Plant Mol. Biol. 14:197 (1990);
Hille et
al., Plant Mol. Biol. 7:171 (1986).
Other positive selectable marker genes for plant transformation are not of
bacterial origin. These genes include mouse dihydrofolate reductase, plant
5-enolpyruvylshikimate-3-phosphate synthase and plant acetolactate synthase.
Eichholtz et al., Somatic Cell Mol. Genet. 13:67 (1987); Shah et al., Science
233:478
(1986); Charest et al., Plant Cell Rep. 8:643 (1990).
Another class of useful marker genes for plant transformation with the DNA
sequence requires screening of presumptively transformed plant cells rather
than
direct genetic selection of transformed cells for resistance to a toxic
substance such
as an antibiotic. These genes are particularly useful to quantitate or
visualize the
spatial pattern of expression of the DNA sequence in specific tissues and are
frequently referred to as reporter genes because they can be fused to a gene
or gene
regulatory sequence for the investigation of gene expression. Commonly used
genes
for screening presumptively transformed cells include (3-glucuronidase (GUS),
1 -
galactosidase, luciferase, and chloramphenicol acetyltransferase. Jefferson,
Plant
Mol. Biol. Rep. 5:387 (1987); Teeri et al., EMBO J. 8:343 (1989); Koncz et
al., Proc.
Nat'l Acad. Sci. (USA) 84:131 (1987); De Block et al., EMBO J. 3:1681 (1984).
Another approach to the identification of relatively rare transformation
events has
been use of a gene that encodes a dominant constitutive regulator of the Zea
mays
anthocyanin pigmentation pathway(Ludwig et al., Science 247:449 (1990)).
The appropriate DNA sequence may be inserted into the vector by any of a
variety of well-known and routine techniques. In general, a DNA sequence for
expression is joined to an expression vector by cleaving the DNA sequence and
the
expression vector with one or more restriction endonucleases and then joining
the
restriction fragments together using T4 DNA ligase. The sequence may be
inserted
in a forward or reverse orientation. Procedures for restriction and ligation
that can be
used to this end are well known and routine to those of skill. Suitable
procedures in
this regard, and for constructing expression vectors using alternative
techniques,
which also are well known and routine to those of skill, are set forth in
great detail in
-42-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989).
A polynucleotide of the invention, encoding the heterologous structural
sequence of a polypeptide of the invention, generally will be inserted into
the vector
using standard techniques so that it is operably linked to the promoter for
expression.
The polynucleotide will be positioned so that the transcription start site is
located
appropriately 5' to a ribosome binding site. The ribosome-binding site will be
5' to the
AUG that initiates translation of the polypeptide to be expressed. Generally,
there will
be no other open reading frames that begin with an initiation codon, usually
AUG, and
lie between the ribosome binding site and the initiation codon. Also,
generally, there
will be a translation stop codon at the end of the polypeptide and there will
be a
polyadenylation signal in constructs for use in eukaryotic hosts.
Transcription
termination signals appropriately disposed at the 3' end of the transcribed
region may
also be included in the polynucleotide construct.
The vector containing the appropriate DNA sequence as described elsewhere
herein, as well as an appropriate promoter, and other appropriate control
sequences,
may be introduced into an appropriate host using a variety of well-known
techniques
suitable to expression therein of a desired polypeptide. The present invention
also
relates to host cells containing the above-described constructs. The host cell
can be
a higher eukaryotic cell, such as a plant cell, or a lower eukaryotic cell,
such as a
yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial
cell.
Introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-dextran mediated transfection, microinjection,
cationic
lipid-mediated transfection, electroporation, transduction, scrape loading,
ballistic
introduction, infection or other methods. Such methods are described in many
standard laboratory manuals, such as Davis et al., BASIC METHODS IN
MOLECULAR BIOLOGY, (1986) and Sambrook et al., MOLECULAR CLONING: A
LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y. (1989).
Representative examples of appropriate hosts include bacterial cells,
such as streptococci, staphylococci, E. coli, streptomyces and Salmonella
typhimurium cells; fungal cells, such as yeast cells and Aspergillus cells;
insect cells
such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS
-43-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
and Bowes melanoma cells; and plant cells. The plant cells may be derived from
a
broad range of plant types, particularly monocots such as the species of the
Family
Graminiae including Sorghum bicolor and Zea mays, as well as dicots such as
soybean (Glycine max) and canola (Brassica napus, Brassica rapa ssp.).
Preferably, plants include maize, soybean, sunflower, safflower, canola,
wheat,
barley, rye, alfalfa, and sorghum; however, the isolated nucleic acid and
proteins of
the present invention can be used in species from the genera: Ananas,
Antirrhinum,
Arabidopsis, Arachis, Asparagus, Atropa, Avena, Brassica, Bromus, Browaalia,
Camellia, Capsicum, Ciahorium, Citrus, Cocos, Cofea, Cucumis, Cucurbita,
Datura, Daucus, Digitalis, Ficus, Fragaria, Geranium, Glycine, Gossypium,
Helianthus, Heterocallis, Hordeum, Hyoscyamus, Ipomoea, Juglans, Lactuca,
Linum, Lolium, Lotus, Lycopersicon, Majorana, Mangifera, Manihot, Medicago,
Musa, Nemesis, Nicotiana, Olea, Onobrychis, Oryza, Panieum, Pelargonium,
Pennisetum, Persea, Petunia, Phaseolus, Pisum, Psidium, Ranunculus,
Raphanus, Rosa, Salpiglossis, Secale, Senecio, Solanum, Sinapis, Sorghum,
Theobroma, Triticum, Trifolium, Trigonella, Vigna, Vitis, and Zea.
The promoter regions of the invention may be isolated from any plant,
including, but not limited to, maize (corn; Zea mays), canola (Brassica napus,
Brassica rape ssp.), alfalfa (Medicago saliva), rice (Oryza saliva), rye
(Secale
cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus
annuus), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana
tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton
(Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot
esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Ananas
comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia
sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica),
guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea),
oats,
barley, vegetables, ornamentals, and conifers. Preferably, plants include
maize,
soybean, sunflower, safflower, canola, wheat, barley, rye, alfalfa, and
sorghum.
-44-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Hosts for a great variety of expression constructs are well known, and those
of
skill will be enabled by the present disclosure readily to select a host for
expressing a
polypeptide in accordance with this aspect of the present invention.
The engineered host cells can be cultured in conventional nutrient media,
which may be modified as appropriate for, inter alia, activating promoters,
selecting
transformants or amplifying genes. Culture conditions, such as temperature, pH
and
the like, previously used with the host cell selected for expression generally
will be
suitable for expression of polypeptides of the present invention as will be
apparent to
those of skill in the art.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or
other cells under the control of appropriate promoters. Cell-free translation
systems
can also be employed to produce such proteins using RNAs derived from the DNA
constructs of the present invention.
Following transformation of a suitable host strain and growth of the host
strain
to an appropriate cell density, where the selected promoter is inducible it is
induced
by appropriate means (e.g., temperature shift or exposure to chemical inducer)
and
cells are cultured for an additional period.
Cells typically then are harvested by centrifugation, disrupted by physical or
chemical means, and the resulting crude extract retained for further
purification.
Microbial cells employed in expression of proteins can be disrupted by any
convenient method, including freeze-thaw cycling, sonication, mechanical
disruption,
or use of cell lysing agents; such methods are well know to those skilled in
the art.
Plant Transformation Methods:
Isolated nucleic acid acids of the present invention can be introduced into
plants according to techniques known in the art. Generally, recombinant
expression cassettes as described above and suitable for transformation of
plant
cells are prepared. Techniques for transforming a wide variety of higher plant
species are well known and described in the technical, scientific, and patent
literature. See, for example, Weising et al., Ann. Rev. Genet. 22: 421-477
(1988).
For example, the DNA construct may be introduced directly into the genomic DNA
of the plant cell using techniques such as electroporation, PEG poration,
particle
bombardment, silicon fiber delivery, or microinjection of plant cell
protoplasts or
embryogenic callus. Alternatively, the DNA constructs may be combined with
-45-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
suitable T-DNA flanking regions and introduced into a conventional
Agrobacterium
tumefaciens host vector. The virulence functions of the Agrobacterium
tumefaciens
host will direct the insertion of the construct and adjacent marker into the
plant cell
DNA when the cell is infected by the bacteria. See, U.S. Patent No. 5,591,616.
The introduction of DNA constructs using polyethylene glycol precipitation is
described in Paszkowski et al., Embo J. 3: 2717-2722 (1984). Electroporation
techniques are described in Fromm et al., Proc. NatI. Acad. Sci (USA) 82: 5824
(1985). Ballistic transformation techniques are described in Klein et al.,
Nature 327:
70-73 (1987) and by Tomes, D. et al., IN: Plant Cell, Tissue and Organ
Culture:
Fundamental Methods, Eds. O.L. Gamborg and G.C. Phillips, Chapter 8, pgs. 197-
213 (1995). (See also Tomes et al., U.S. Patents 5,886,244; 6,258,999;
6,570,067;
5,879,918)
Agrobacterium tumefaciens-meditated transformation techniques are well
described in the scientific literature. See, for example Horsch et al.,
Science 233:
496-498 (1984), and Fraley et al., Proc. Natl. Acad. Sci(USA) 80: 4803 (1983).
Although Agrobacterium is useful primarily in dicots, certain monocots can be
transformed by Agrobacteriurn. For instance, Agrobacterium transformation of
maize is described in U.S. Patent No. 5,550,318.
Other methods of transfection or transformation include (1) Agrobacterium
rhizogenes-mediated transformation (see, e.g., Lichtenstein and Fuller In:
Genetic
Engineering, vol. 6, PWJ Rigby, Ed., London, Academic Press, 1987; and
Lichtenstein, C. P., and Draper, J,. In: DNA Cloning, Vol. II, D. M. Glover,
Ed.,
Oxford, IRI Press, 1985),Application PCT/US87/02512 (WO 88/02405 published
Apr. 7, 1988) describes the use of A.rhizogenes strain A4 and its Ri plasmid
along
with A. tumefaciens vectors pARC8 or pARC16 (2) liposome-mediated DNA uptake
(see, e.g., Freeman et al., Plant Cell Physiol. 25: 1353, 1984), (3) the
vortexing
method (see, e.g., Kindle, Proc. Nat'l. Acad. Sci.(USA) 87: 1228, (1990).
DNA can also be introduced into plants by direct DNA transfer into pollen as
described by Zhou et al., Methods in Enzymology, 101:433 (1983); D. Hess,
Intern.
Rev. Cytol., 107:367 (1987); Luo et al., Plant Mol. Biol. Reporter,
6:165(1988).
Expression of polypeptide coding genes can be obtained by injection of the DNA
into reproductive organs of a plant as described by Pena et al., Nature
325:274
(1987). DNA can also be injected directly into the cells of immature embryos
and
-46-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
the rehydration of desiccated embryos as described by Neuhaus et al., Theor.
Appl.
Genet., 75:30 (1987); and Benbrook et al., in Proceedings Bio Expo. 1986,
Butterworth, Stoneham, Mass., pp. 27-54 (1986). A variety of plant viruses
that can
be employed as vectors are known in the art and include cauliflower mosaic
virus
(CaMV), geminivirus, brome mosaic virus, and tobacco mosaic virus.
Regeneration of Transformed Plants
Transformed plant cells that are derived by any of the above transformation
techniques can be cultured to regenerate a whole plant that possesses the
transformed genotype. Such regeneration techniques often rely on manipulation
of
certain phytohormones in a tissue culture growth medium, typically relying on
a
biocide and/or herbicide marker that has been introduced together with a
polynucleotide of the present invention. For transformation and regeneration
of
maize see, for example, U.S. Patent 5,736,369.
Plants cells transformed with a plant expression vector can be regenerated,
e.g., from single cells, callus tissue or leaf discs according to standard
plant tissue
culture techniques. It is well known in the art that various cells, tissues,
and organs
from almost any plant can be successfully cultured to regenerate an entire
plant.
Plant regeneration from cultured protoplasts is described in Evans et al.,
Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, Macmillilan
Publishing Company, New York, pp. 124-176 (1983); and Binding, Regeneration of
Plants, Plant Protoplasts, CRC Press, Boca Raton, pp. 21-73 (1985).
The regeneration of plants containing the foreign gene introduced by
Agrobacterium from leaf explants can be achieved as described by Horsch et
al.,
Science, 227:1229-1231 (1985). In this procedure, transformants are grown in
the
presence of a selection agent and in a medium that induces the regeneration of
shoots in the plant species being transformed as described by Fraley et al.,
Proc.
Nat'l. Acad. Sci. (U.S.A)., 80:4803 (1983). This procedure typically produces
shoots
within two to four weeks and these transformant shoots are then transferred to
an
appropriate root-inducing medium containing the selective agent and an
antibiotic
to prevent bacterial growth. Transgenic plants of the present invention may be
fertile or sterile.
-47-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Regeneration can also be obtained from plant callus, explants, organs, or
parts thereof. Such regeneration techniques are described generally in Klee et
a1.,
Ann. Rev. of Plant Phys. 38: 467-486 (1987). The regeneration of plants from
either single plant protoplasts or various explants is well known in the art.
See, for
example, Methods for Plant Molecular Biology, A. Weissbach and H. Weissbach,
eds., Academic Press, Inc., San Diego, Calif: (1988). This regeneration and
growth
process includes the steps of selection of transformant cells and shoots,
rooting the
transformant shoots and growth of the plantlets in soil. For maize cell
culture and
regeneration see generally, The Maize Handbook, Freeling and Walbot, Eds.,
Springer, New York (1994); Corn and Corn Improvement, 3rd edition, Sprague and
Dudley Eds., American Society of Agronomy, Madison, Wisconsin (1988).
One of skill will recognize that after the recombinant expression cassette is
stably incorporated in transgenic plants and confirmed to be operable, it can
be
introduced into other plants by sexual crossing. Any of a number of standard
breeding techniques can be used, depending upon the species to be crossed.
In vegetatively propagated crops, mature transgenic plants can be
propagated by the taking of cuttings or by tissue culture techniques to
produce
multiple identical plants. Selection of desirable transgenics is made and new
varieties are obtained and propagated vegetatively for commercial use. In seed-
propagated crops, mature transgenic plants can be self-crossed to produce a
homozygous inbred plant. The inbred plant produces seed containing the newly
introduced heterologous nucleic acid. These seeds can be grown to produce
plants
that would produce the selected phenotype. Mature transgenic plants can also
be
crossed with other appropriate plants, generally another inbred or hybrid,
including,
for example, an isogenic untransformed inbred.
Parts obtained from the regenerated plant, such as flowers, seeds, leaves,
branches, fruit, and the like are included in the invention, provided that
these parts
comprise cells comprising the isolated nucleic acid of the present invention.
Progeny and variants, and mutants of the regenerated plants are also included
within the scope of the invention, provided that these plants comprise the
introduced nucleic acid sequences.
Transgenic plants expressing the selectable marker can be screened for
transmission of the nucleic acid of the present invention by, for example,
standard
-48-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
immunoblot and DNA detection techniques. Transgenic lines are also typically
evaluated on levels of expression of the heterologous nucleic acid. Expression
at
the RNA level can be determined initially to identify and quantitate
expression-
positive plants. Standard techniques for RNA analysis can be employed and
include PCR amplification assays using oligonucleotide primers designed to
amplify
only the heterologous RNA templates and solution hybridization assays using
heterologous nucleic acid-specific probes. The RNA-positive plants can then be
analyzed for protein expression by Western immunoblot analysis using the
specifically reactive antibodies of the present invention. In addition, in
situ
hybridization and immunocytochemistry according to standard protocols can be
done using heterologous nucleic acid specific polynucleotide probes and
antibodies, respectively, to localize sites of expression within transgenic
tissue.
Generally, a number of transgenic lines are usually screened for the
incorporated
nucleic acid to identify and select plants with the most appropriate
expression
profiles.
Some embodiments comprise a transgenic plant that is homozygous for the
added heterologous nucleic acid; i.e., a transgenic plant that contains two
added
nucleic acid sequences, one gene at the same locus on each chromosome of a
chromosome pair. A homozygous transgenic plant can be obtained by sexually
mating (selfing) a heterozygous (aka hemizygous) transgenic plant that
contains a
single added heterologous nucleic acid, germinating some of the seed produced
and analyzing the resulting plants produced for altered expression of a
polynucleotide of the present invention relative 'to a control plant (i.e.,
native, non-
transgenic). Back-crossing to a parental plant and out-crossing with a non-
transgenic plant, or with a plant transgenic for the same or another trait or
traits, are
also contemplated.
It is also expected that the transformed plants will be used in traditional
breeding programs, including TOPCROSS pollination systems as disclosed in US
5,706,603 and US 5,704,160.
Polynucleotide Assays
This invention is also related to the use of the cytokinin biosynthetic enzyme
polynucleotides in markers to assist in a breeding program, as described for
example
-49-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
in PCT publication US89/00709. The DNA may be used directly for detection or
may
be amplified enzymatically by using PCR (Saiki et al., Nature 324:163-166
(1986))
prior to analysis. RNA or cDNA may also be used in the same ways. As an
example, PCR primers complementary to the nucleic acid encoding the cytokinin
biosynthetic enzymes can be used to identify and analyze cytokinin
biosynthetic
enzyme presence and expression. Using PCR, characterization of the gene
present
in a particular tissue or plant variety may be made by an analysis of the
genotype of
the tissue or variety. For example, deletions and insertions can be detected
by a
change in size of the amplified product in comparison to the genotype of a
reference
sequence. Point mutations can be identified by hybridizing amplified DNA to
radiolabeled cytokinin biosynthetic enzyme RNA or alternatively, radiolabeled
cytokinin biosynthetic enzyme antisense DNA sequences. Perfectly matched
sequences can be distinguished from mismatched duplexes by RNase A digestion
or
by differences in melting temperatures.
Sequence differences between a reference gene and genes having mutations
also may be revealed by direct DNA sequencing. In addition, cloned DNA
segments
may be employed as probes to detect specific DNA segments. The sensitivity of
such methods can be greatly enhanced by appropriate use of PCR or another
amplification method. For example, a sequencing primer is used with double-
stranded PCR product or a single-stranded template molecule generated by a
modified PCR. The sequence determination is performed by conventional
procedures with radiolabeled nucleotide or by automatic sequencing procedures
with
fluorescent tags.
Genetic typing of various varieties of plants based on DNA sequence
differences may be achieved by detection of alteration in electrophoretic
mobility of
DNA fragments in gels, with or without denaturing agents. Small sequence
deletions
and insertions can be visualized by high resolution gel electrophoresis. DNA
fragments of different sequences may be distinguished on denaturing formamide
gradient gels in which the mobilities of different DNA fragments are retarded
in the gel
at different positions according to their specific melting or partial melting
temperatures
(see, e.g., Myers et al., Science, 230:1242 (1985)).
-50-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Sequence changes at specific locations also may be revealed by nuclease
protection assays, such as RNase and S1 protection or the chemical cleavage
method (e.g., Cotton et al., Proc. Nat'l. Acad. Sci., (USA), 85:4397-4401
(1985)).
Thus, the detection of a specific DNA sequence may be achieved by methods
such as hybridization, RNase protection, chemical cleavage, direct DNA
sequencing
or the use of restriction enzymes, (e.g., restriction fragment length
polymorphisms
("RFLP")) and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA sequencing,
mutations also can be detected by in situ analysis.
A mutation may be ascertained, for example, by a DNA sequencing assay.
Samples are processed by methods known in the art to capture the RNA. First
strand
cDNA is synthesized from the RNA samples by adding an oligonucleotide primer
consisting of sequences that hybridize to a region on the mRNA. Reverse
transcriptase and deoxynucleotides are added to allow synthesis of the first
strand
cDNA. Primer sequences are synthesized based on the DNA sequences of the
cytokinin modulating enzymes of the invention. The primer sequence is
generally
comprised of at least 15 consecutive bases, and may contain at least 30 or
even 50
consecutive bases.
Cells carrying mutations or polymorphisms in the gene of the present invention
may also be detected at the DNA level by a variety of techniques. The DNA may
be
used directly for detection or may be amplified enzymatically by using PCR
(Saiki et
al., Nature, 324:163-166 (1986)) prior to analysis. RT-PCR can also be used to
detect mutations. It is particularly preferred to use RT-PCR in conjunction
with
automated detection systems, such as, for example, GeneScan. RNA or cDNA may
also be used for the same purpose, PCR or RT-PCR. As an example, PCR primers
complementary to the nucleic acid encoding cytokinin biosynthetic enzymes can
be
used to identify and analyze mutations. Examples of representative primers are
shown below. For example, deletions and insertions can be detected by a change
in
size of the amplified product in comparison to the normal genotype. Point
mutations
can be identified by hybridizing amplified DNA to radiolabeled RNA, or
alternatively,
radiolabeled antisense DNA sequences. While perfectly matched sequences can be
distinguished from mismatched duplexes by RNase A digestion or by differences
in
melting temperatures, preferably point mutations are identified by sequence
analysis.
-51-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Primers used for detection of mutations or polymorphisms in the ipt gene:
5'GCGTCCAATGCTGTCCTCAACTA 3'
5'GCTCTCCTCGTCTGCTAACTCGT3'
The above primers may be used for amplifying cytokinin biosynthetic enzyme
cDNA or genomic clones isolated from a sample derived from an individual
plant.
The invention also provides the primers above with 1, 2, 3 or 4 nucleotides
removed
from the 5' and/or the 3' end. The primers may be used to amplify the gene
isolated
from the individual such that the gene may then be subject to various
techniques for
elucidation of the DNA sequence. In this way, mutations in the DNA sequence
may
be identified.
Polypeptide Assays
The present invention also relates to diagnostic assays such as quantitative
and diagnostic assays for detecting levels of cytokinin biosynthetic enzymes
in cells
and tissues, including determination of normal and abnormal levels. Thus, for
instance, a diagnostic assay in accordance with the invention for detecting
expression
of cytokinin biosynthetic enzymes compared to normal control tissue samples
may be
used to detect unacceptable levels of expression. Assay techniques that can be
used
to determine levels of polypeptides of the present invention in a sample
derived from
a plant source are well-known to those of skill in the art. Such assay methods
include
radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA
assays. Among these, ELISAs frequently are preferred. An ELISA assay initially
comprises preparing an antibody specific to the polypeptide, preferably a
monoclonal
antibody. In addition, a reporter antibody generally is prepared which binds
to the
monoclonal antibody. The reporter antibody is attached to a detectable reagent
such
as a radioactive, fluorescent or enzymatic reagent, in this example
horseradish
peroxidase enzyme.
To carry out an ELISA, a sample is removed from a host and incubated on a
solid support, e.g., a polystyrene dish, which binds the proteins in the
sample. Any
free protein binding sites on the dish are then covered by incubating with a
non-
specific protein such as bovine serum albumin. Next, the monoclonal antibody
is
incubated in the dish, during which time the monoclonal antibodies attach to
any
cytokinin biosynthetic enzymes attached to the polystyrene dish. Unbound
monoclonal antibody is washed out with buffer. The reporter antibody linked to
-52-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
horseradish peroxidase is placed in the dish, resulting in binding of the
reporter
antibody to any monoclonal antibody bound to cytokinin biosynthetic enzyme.
Unattached reporter antibody is then washed out. Reagents for peroxidase
activity,
including a colorimetric substrate, are then added to the dish. Immobilized
peroxidase, linked to cytokinin biosynthetic enzyme through the primary and
secondary antibodies, produces a colored reaction product. The amount of color
developed in a given time period indicates the amount of cytokinin
biosynthetic
enzyme present in the sample. Quantitative results typically are obtained by
reference to a standard curve.
A competition assay may be employed wherein antibodies specific to cytokinin
biosynthetic enzymes are attached to a solid support, and labeled enzyme
derived
from the host ispassed over the solid support. The amount of label detected
attached
to the solid support can be correlated to a quantity of cytokinin biosynthetic
enzyme in
the sample.
Antibodies
The polypeptides, their fragments or other derivatives, or analogs thereof, or
cells expressing them can be used as immunogens to produce antibodies thereto.
These antibodies can be, for example, polyclonal or monoclonal antibodies. The
present invention also includes chimeric, single chain, and humanized
antibodies, as
well as Fab fragments, or the product of an Fab expression library. Various
procedures known in the art may be used for the production of such antibodies
and
fragments.
Antibodies generated against the polypeptides corresponding to a sequence of
the present invention can be obtained by direct injection of the polypeptides
into an
animal, or by administering the polypeptides to an animal, preferably a
nonhuman.
The antibody so obtained will then bind the polypeptides itself. In this
manner, even a
sequence encoding only a fragment of the polypeptide can be used to generate
antibodies binding the whole native polypeptide. Such antibodies can then be
used
to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique that provides
antibodies produced by continuous cell line cultures can be used. Examples
include
the hybridoma technique (Kohler, G. and Milstein, C., Nature 256:495-497
(1975)),
the trioma technique, the human B-cell hybridoma technique (Kozbor et al.,
-53-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Immunology Today 4:72 (1983)) and the EBV-hybridoma technique to produce
human monoclonal antibodies (Cole et al., pg. 77-96 in MONOCLONAL
ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc. (1985)).
Hybridoma cell lines secreting the monoclonal antibody are another aspect
of this invention.
Techniques described for the production of single-chain antibodies (U.S.
Patent No. 4,946,778) can be adapted to produce single-chain antibodies to
immunogenic polypeptide products of this invention. Also, transgenic mice, or
other
organisms such as other mammals, may be used to express humanized antibodies
to
immunogenic polypeptide products of this invention.
The above-described antibodies may be employed to isolate or identify clones
expressing the polypeptide or to purify the polypeptide of the present
invention by
attachment of the antibody to a solid support for isolation and/or
purification by affinity
chromatography.
Polypeptide derivatives include antigenically or immunologically equivalent
derivatives that form a particular aspect of this invention.
The term 'antigenically equivalent derivative' as used herein encompasses a
polypeptide or its equivalent which will be specifically recognized by certain
antibodies which, when raised to the protein or polypeptide according to the
present invention, interfere with the immediate physical interaction between
the
antibody and its cognate antigen.
The term "immunologically equivalent derivative" as used herein
encompasses a peptide or its equivalent which, when used in a suitable
formulation to raise antibodies in a vertebrate, results in antibodies which
act to
interfere with the immediate physical interaction between the antibody and its
cognate antigen.
The polypeptide, such as an antigenically or immunologically equivalent
derivative or a fusion protein thereof, is used as an antigen to immunize a
mouse
or other animal, such as a rat, guinea pig, goat, rabbit, sheep, bovine or
chicken.
The fusion protein may provide stability to the polypeptide. The antigen may
be
associated, for example by conjugation, with an immunogenic carrier protein,
for
example bovine serum albumin (BSA) or keyhole limpet haemocyanin (KLH).
Alternatively a multiple antigenic peptide comprising multiple copies of the
protein
-54-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
or polypeptide, or an antigenically or immunologically equivalent polypeptide
thereof, may be sufficiently antigenic to improve immunogenicity so as to
obviate
the use of a carrier.
Alternatively, phage display technology could be utilized to select antibody
genes with binding activities towards the polypeptide either from repertoires
of PCR
amplified v-genes of lymphocytes from humans screened for possessing anti-Fbp
or from naive libraries (McCafferty, J. et al., (1990), Nature 348:552-554;
Marks, J.
et al., (1992) Biotechnology 10:779-783). The affinity of these antibodies can
also
be improved by chain shuffling (Clackson, T. et al., (1991) Nature 352:624-
628).
The antibody should be screened again for high affinity to the polypeptide
and/or fusion protein.
As mentioned above, a fragment of the final antibody may be prepared.
The antibody may be either intact antibody of Mr approximately 150,000 or a
derivative of it, for example a Fab fragment or a Fv fragment as described in
Sierra,
A and Pluckthun, A., Science 240:1038-1040 (1988). If two antigen binding
domains are present, each domain may be directed against a different epitope -
termed 'bispecific' antibodies.
The antibody of the invention, as mentioned above, may be prepared by
conventional means, for example by established monoclonal antibody technology
(Kohler, G. and Milstein, C., Nature, 256:495-497 (1975)) or using recombinant
means e.g. combinatorial libraries, for example as described in Huse, W.D. et
al.,
Science 246:1275-1281 (1989).
Preferably the antibody is prepared by expression of a DNA polymer
encoding said antibody in an appropriate expression system such as described
above for the expression of polypeptides of the invention. The choice of
vector for
the expression system will be determined in part by the host, which may be a
prokaryotic cell, such as E. colt (preferably strain B) or Streptomyces sp. or
a
eukaryotic cell, such as a mouse C127, mouse myeloma, human HeLa, Chinese
hamster ovary, filamentous or unicellular fungi or insect cell. The host may
also be
a transgenic animal or a transgenic plant for example as described in Hiatt,
A. et
a/., Nature 340:76-78 (1989). Suitable vectors include plasmids,
bacteriophages,
cosmids and recombinant viruses, derived from, for example, baculoviruses and
vaccinia.
-55-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The Fab fragment may also be prepared from its parent monoclonal
antibody by enzyme treatment, for example using papain to cleave the Fab
portion
from the Fc portion.
Cytokinin Biosynthetic Enzyme Binding Molecules and Assays
This invention also provides a method for identification of molecules, such as
binding molecules, that bind the cytokinin biosynthetic enzymes. Genes
encoding
proteins that bind the enzymes, such as binding proteins, can be identified by
numerous methods known to those of skill in the art, for example, ligand
panning and
FACS sorting. Such methods are described in many laboratory manuals such as,
for
instance, Coligan et al., Current Protocols in Immunology 1(2): Chapter 5
(1991).
For instance, expression cloning may be employed for this purpose. To this
end, polyadenylated RNA is prepared from a cell expressing the cytokinin
biosynthetic enzymes, a cDNA library is created from this RNA, the library is
divided
into pools, and the pools are transfected individually into cells that are not
expressing
the enzyme. The transfected cells then are exposed to labeled enzyme. The
enzyme can be labeled by a variety of well-known techniques, including
standard
methods of radio-iodination or inclusion of a recognition site for a site-
specific protein
kinase. Following exposure, the cells are fixed and binding of enzyme is
determined.
These procedures conveniently are carried out on glass slides.
Pools are identified of cDNA that produced cytokinin biosynthetic enzyme-
binding cells. Sub-pools are prepared from these positives, transfected into
host cells
and screened as described above. Using an iterative sub-pooling and re-
screening
process, one or more single clones that encode the putative binding molecule
can be
isolated.
Alternatively, a labeled ligand can be photoaffinity linked to a cell extract,
such
as a membrane or a membrane extract, prepared from cells that express a
molecule
that it binds, such as a binding molecule. Cross-linked material is resolved
by
polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray film. The
labeled
complex containing the ligand-binding can be excised, resolved into peptide
fragments, and subjected to protein microsequencing. The amino acid sequence
obtained from microsequencing can be used to design unique or degenerate
oligonucleotide probes to screen cDNA libraries to identify genes encoding the
putative binding molecule.
-56-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Polypeptides of the invention also can be used to assess cytokinin
biosynthetic
enzyme binding capacity of cytokinin biosynthetic enzyme binding molecules,
such as
binding molecules, in cells or in cell-free preparations.
Polypeptides of the invention may also be used to assess the binding of small
molecule substrates and ligands in, for example, cells, cell-free
preparations,
chemical libraries, and natural product mixtures. These substrates and ligands
may
be natural substrates and ligands or may be structural or functional mimetics.
Anti-cytokinin biosynthetic enzyme antibodies represent a useful class of
binding molecules contemplated by this invention.
Antagonists and Agonists - Assays and Molecules
The invention also provides a method of screening compounds to identify
those that enhance or block the action of cytokinin biosynthetic enzymes on
cells,
such as interaction with substrate molecules. An antagonist is a compound that
decreases the natural biological functions of the enzymes. A particular enzyme
to be
targeted in this regard is cytokinin oxidase.
Potential antagonists include small organic molecules, peptides, polypeptides
and antibodies that bind to cytokinin oxidase and thereby inhibit or
extinguish its
activity. Potential antagonists also may be small organic molecules, a
peptide, a
polypeptide such as a closely related protein or antibody, that binds the same
sites on
a binding molecule, such as a cytokinin oxidase binding molecule, without
inducing
cytokinin metabolic enzyme-induced activities, thereby preventing the action
of the
enzyme by excluding the enzyme from binding.
Potential antagonists include a small molecule that binds to and occupies the
binding site of the polypeptide thereby preventing binding to cellular binding
molecules, such as binding molecules, such that normal biological activity is
prevented. Examples of small molecules include but are not limited to small
organic
molecules, peptides or peptide-like molecules.
Other potential antagonists include molecules that affect the expression of
the
gene encoding cytokinin biosynthetic enzymes (e.g. transactivation
inhibitors). Other
potential antagonists include antisense molecules. Antisense technology can be
used to control gene expression through antisense DNA or RNA or through double-
or triple-helix formation. Antisense techniques are discussed, for example, in
-
Okano, J. Neurochem. 56: 560 (1991); OLIGODEOXYNUCLEOTIDES AS
-57-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raton, FL
(1988). Triple helix formation is discussed in, for instance Lee et al.,
Nucleic Acids
Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al.,
Science 251:1360 (1991). The methods are based on binding of a polynucleotide
to
a complementary DNA or RNA. For example, the 5' coding portion of a
polynucleotide that encodes the mature polypeptide of the present invention
may be
used to design an antisense RNA oligonucleotide of from about 10 to 40 base
pairs in
length. A DNA oligonucleotide is designed to be complementary to a region of
the
gene involved in transcription, thereby preventing transcription and the
production of
cytokinin biosynthetic enzymes. The antisense RNA oligonucleotide hybridizes
to the
mRNA in vivo and blocks translation of the mRNA molecule into cytokinin
biosynthetic
enzymes. The oligonucleotides described above can also be delivered to cells
such
that the antisense RNA or DNA may be expressed in vivo to inhibit production
of
cytokinin biosynthetic enzymes.
The DNAs of this invention may also be employed to co-suppress or silence
the cytokinin metabolic enzyme genes; for example, as described in PCT Patent
Application Publication WO 98/36083.
The antagonists may be employed for instance to increase the levels of
cytokinin and/or decrease the available auxin in plant cells.
Alternatively, this invention provides methods for screening for agonists,
those
molecules that act to increase the natural biological function of enzymes.
Targets in
this regard include enzymes such ipt, f3-glucosidase, and iaa-1.
Potential agonists include small organic molecules, peptides, polypeptides and
antibodies that bind to a biosynthetic enzyme and thereby stimulate or
increase its
activity. Potential agonists also may be small organic molecules, a peptide, a
polypeptide such as a closely related protein or antibody that binds to sites
on a
binding molecule, such as a ipt binding molecule and promotes cytokinin
metabolic
enzyme-induced activities, thereby enhancing the action of the enzyme.
Potential agonists include small molecules that bind to and occupy the
allosteric sites of the enzyme thereby promoting binding to cellular binding
molecules,
such as substrates, such that normal biological activity is enhanced. Examples
of
small molecules include but are not limited to small organic molecules,
peptides or
peptide-like molecules.
-58-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
Other potential agonists include molecules that affect the expression of the
gene encoding cytokinin biosynthetic enzymes (e.g. transactivatiors).
"Stacking" of Constructs and Traits
In certain embodiments the nucleic acid sequences of the present invention
can be used in combination ("stacked") with other polynucleotide sequences of
interest in order to create plants with a desired phenotype. The
polynucleotides of
the present invention may be stacked with any gene or combination of genes,
and
the combinations generated can include multiple copies of any one or more of
the
polynucleotides of interest. The desired combination may affect one or more
traits;
that is, certain combinations may be created for modulation of gene expression
affecting cytokinin activity. For example, up-regulation of cytokinin
synthesis may
be combined with down-regulation of cytokinin oxidase expression. Other
combinations may be designed to produce plants with a variety of desired
traits,
including but not limited to traits desirable for animal feed such as high oil
genes
(e.g., U.S. Patent No. 6,232,529); balanced amino acids (e.g. hordothionins
(U.S.
Patent Nos. 5,990,389; 5,885,801; 5,885,802; and 5,703,409); barley high
lysine
(Williamson et al. (1987) Eur. J. Biochem. 165:99-106; and WO 98/20122); and
high methionine proteins (Pedersen et al. (1986) J. Biol. Chem. 261:6279;
Kirihara
et at. (1988) Gene 71:359; and Musumura et al. (1989) Plant Mol. Biol. 12:
123));
increased digestibility (e.g., modified storage proteins (U.S. Application
Serial No.
10/053,410, filed November 7, 2001); and thioredoxins (U.S. Application Serial
No.
10/005,429, filed December 3, 2001)).
The polynucleotides of the present invention can also
be stacked with traits desirable for insect, disease or herbicide resistance
(e.g.,
Bacillus thuringiensis toxic proteins (U.S. Patent Nos. 5,366,892; 5,747,450;
5,737,514; 5723,756; 5,593,881; Geiser et al (1986) Gene 48:109); lectins (Van
Damme et at. (1994) Plant Mol. Biol. 24:825); fumonisin detoxification genes
(U.S.
Patent No. 5,792,931); avirulence and disease resistance genes (Jones et al.
(1994) Science 266:789; Martin et at. (1993) Science 262:1432; Mindrinos et
at.
(1994) Cell 78:1089); acetolactate synthase (ALS) mutants that lead to
herbicide
resistance such as the S4 and/or Hra mutations; inhibitors of glutamine
synthase
such as phosphinothricin or basta (e.g., bar gene); and glyphosate resistance
-59-
CA 02521497 2009-08-12
WO 2004/090143 PCTIUS2004/010064
(EPSPS gene)); and traits desirable for processing or process products such as
high oil (e.g., U.S. Patent No. 6,232,529 ); modified oils (e.g., fatty acid
desaturase
genes (U.S. Patent No. 5,952,544; WO 94/11516)); modified starches (e.g., ADPG
pyrophosphorylases (AGPase), starch syntheses (SS), starch branching enzymes
(SBE) and starch debranching enzymes (SDBE)); and polymers or bioplastics
(e.g.,
U.S. patent No. 5.602,321; beta-ketothiolase, polyhydroxybutyrate synthase,
and
acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacteriol. 170:5837-5847)
facilitate expression of polyhydroxyalkanoates (PHAs)), the disclosures of
which
are herein incorporated by reference. One could also combine the
polynucleotides
of the present invention with polynucleotides affecting agronomic traits such
as
male sterility (e.g., see U.S. Patent No. 5.583,210), stalk strength,
flowering time, or
transformation technology traits such as cell cycle regulation or gene
targeting (e.g.
WO 99/61619; WO 00/17364; WO 99/25821).
These stacked combinations can be created by any method, including but
not limited to cross breeding plants by any conventional or TopCross
methodology,
or genetic transformation. If the traits are stacked by genetically
transforming the
plants, the polynucleotide sequences of interest can be combined at any time
and
in any order. For example, a transgenic plant comprising one or more desired
traits
can be used as the target to introduce further traits by subsequent
transformation.
The traits can be introduced simultaneously in a co-transformation protocol
with the
polynucleotides of interest provided by any combination of transformation
cassettes. For example, if two sequences will be introduced, the two sequences
can be contained in separate transformation cassettes (trans) or contained on
the
same transformation cassette (cis). Expression of the sequences of interest
can be
driven by the same promoter or by different promoters. In certain cases, it
may be
desirable to introduce a transformation cassette that will suppress the
expression of
a polynucleotide of interest. This may be accompanied by any combination of
other
suppression cassettes or overexpression cassettes to generate the desired
combination of traits in the plant.
Use in Breeding Methods
The transformed plants of the invention may be used in a plant breeding
program. The goal of plant breeding is to combine, in a single variety or
hybrid,
-60-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
various desirable traits. For field crops, these traits may include, for
example,
resistance to diseases and insects, tolerance to heat and drought, reduced
time to
crop maturity, greater yield, and better agronomic quality. With mechanical
harvesting of many crops, uniformity of plant characteristics such as
germination
and stand establishment, growth rate, maturity, and plant and ear height, is
desirable. Traditional plant breeding is an important tool in developing new
and
improved commercial crops. This invention encompasses methods for producing a
maize plant by crossing a first parent maize plant with a second parent maize
plant
wherein one or both of the parent maize plants is a transformed plant
displaying
enhanced vigor, as described herein.
Plant breeding techniques known in the art and used in a maize plant
breeding program include, but are not limited to, recurrent selection, bulk
selection,
mass selection, backcrossing, pedigree breeding, open pollination breeding,
restriction fragment length polymorphism enhanced selection, genetic marker
enhanced selection, doubled haploids, and transformation. Often combinations
of
these techniques are used.
The development of maize hybrids in a maize plant breeding program
requires, in general, the development of homozygous inbred lines, the crossing
of
these lines, and the evaluation of the crosses. There are many analytical
methods
available to evaluate the result of a cross. The oldest and most traditional
method
of analysis is the observation of phenotypic traits. Alternatively, the
genotype of a
plant can be examined.
A genetic trait which has been engineered into a particular maize plant using
transformation techniques, could be moved into another line using traditional
breeding techniques that are well known in the plant breeding arts. For
example, a
backcrossing approach is commonly used to move a transgene from a transformed
maize plant to an elite inbred line, and the resulting progeny would then
comprise
the transgene(s). Also, if an inbred line was used for the transformation then
the
transgenic plants could be crossed to a different inbred in order to produce a
transgenic hybrid maize plant. As used herein, "crossing" can refer to a
simple X by
Y cross, or the process of backcrossing, depending on the context.
The development of a maize hybrid in a maize plant breeding program
involves three steps: (1) the selection of plants from various germplasm pools
for
-61-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
initial breeding crosses; (2) the selfing of the selected plants from the
breeding
crosses for several generations to produce a series of inbred lines, which,
while
different from each other, breed true and are highly uniform; and (3) crossing
the
selected inbred lines with different inbred lines to produce the hybrids.
During the
inbreeding process in maize, the vigor of the lines decreases. Vigor is
restored
when two different inbred lines are crossed to produce the hybrid. An
important
consequence of the homozygosity and homogeneity of the inbred lines is that
the
hybrid created by crossing a defined pair of inbreds will always be the same.
Once
the inbreds that give a superior hybrid have been identified, the hybrid seed
can be
reproduced indefinitely as long as the homogeneity of the inbred parents is
maintained.
Transgenic plants of the present invention may be used to produce a single
cross hybrid, a three-way hybrid or a double cross hybrid. A single cross
hybrid is
produced when two inbred lines are crossed to produce the F1 progeny. A double
cross hybrid is produced from four inbred lines crossed in pairs (A x B and C
x D)
and then the two F1 hybrids are crossed again (A x B) x (C x D). A three-way
cross
hybrid is produced from three inbred lines where two of the inbred lines are
crossed
(A x B) and then the resulting F1 hybrid is crossed with the third inbred (A x
B) x C.
Much of the hybrid vigor and uniformity exhibited by F1 hybrids is lost in the
next
generation (F2). Consequently, seed produced by hybrids is consumed rather
than
planted.
In accordance with the invention, nucleotide sequences are provided that allow
initiation of transcription in seed. The sequences of the invention comprise
transcriptional initiation regions associated with seed formation and seed
tissues.
Thus, the compositions of the present invention comprise novel nucleotide
sequences
for regulatory sequences.
A method for expressing an isolated nucleotide sequence in a plant using the
transcriptional initiation sequences disclosed herein is provided. Suitable
techniques
are described by Maniatis, T., Fritsch, E.F. and Sambrook, J. in MOLECULAR
CLONING, A Laboratory Manual (2nd edition 1989 Cold Spring Harbor Laboratory).
The method comprises transforming a plant cell with a transformation vector
that
comprises an isolated nucleotide sequence operably linked to the promoter of
the
present invention and regenerating a stably transformed plant from the
transformed
-62-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
plant cell. In this manner, the promoter is useful for controlling the
expression of
endogenous as well as exogenous products in a seed-preferred manner.
Under the transcriptional initiation regulation of the seed-preferred promoter
region will be a sequence of interest, which will provide for modification of
the
phenotype of the seed. Such modification includes modulating the production of
an
endogenous product, as to amount, relative distribution, or the like, or
production of
an exogenous expression product to provide for a novel function or product in
the
seed.
By "seed-preferred" is intended favored expression in the seed, including at
least one of embryo, kernel, pericarp, endosperm, nucellus, aleurone, pedicel,
and
the like.
By "regulatory element" is intended sequences responsible for tissue-preferred
and temporally-preferred expression of the associated coding sequence,
including
promoters, terminators, enhancers, introns, and the like.
By "promoter" is intended a regulatory region of DNA usually comprising a
TATA box capable of directing RNA polymerase II to initiate RNA synthesis at
the
appropriate transcription initiation site for a particular coding sequence. A
promoter
can additionally comprise other recognition sequences generally positioned
upstream
or 5' to the TATA box, referred to as upstream promoter elements, which
influence
the transcription initiation rate. It is recognized that having identified the
nucleotide
sequences for the promoter region disclosed herein, it is within the state of
the art to
isolate and identify further regulatory elements in the 5' untranslated region
upstream
from the particular promoter region identified herein. Thus the promoter
region
disclosed herein is generally further defined by comprising upstream
regulatory
elements such as those responsible for tissue-preferred and temporally-
preferred
expression of the coding sequence, enhancers, and the like. In the same
manner,
the promoter elements that enable expression in the desired tissue such as the
seed
can be identified, isolated, and used with other core promoters to confirm
seed-
preferred expression.
The isolated promoter sequences of the present invention can be modified to
provide for a range of expression levels of the isolated nucleotide sequence.
Less
than the entire promoter region can be utilized and the ability to drive seed-
preferred
expression retained. However, it is recognized that expression levels of mRNA
can
-63-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
be decreased with deletions of portions of the promoter sequence. Thus, the
promoter can be modified to be a weak or strong promoter. Generally, by "weak
promoter" is intended a promoter that drives expression of a coding sequence
at a
low level. By "low level" is intended levels of about 1/10,000 transcripts to
about
1/100,000 transcripts to about 1/500,000 transcripts. Conversely, a strong
promoter
drives expression of a coding sequence at a high level, or at about 1/10
transcripts to
about 1/100 transcripts to about 1/1,000 transcripts. Generally, at least
about 20
nucleotides of an isolated promoter sequence will be used to drive expression
of a
nucleotide sequence.
It is recognized that to increase transcription levels, enhancers can be
utilized
in combination with the promoter regions of the invention. Enhancers are
nucleotide
sequences that act to increase the expression of a promoter region. Enhancers
are
known in the art and include the SV40 enhancer region, the 35S enhancer
element,
and the like.
A promoter of the present invention can be isolated from the 5' untranslated
region flanking the transcription initiation site of its respective coding
sequence.
Likewise, the terminator can be isolated from the 3' untranslated region
flanking the
stop codon of its respective coding sequence.
The term "isolated" refers to material, such as a nucleic acid or protein,
which
is: (1) substantially or essentially free from components which normally
accompany or
interact with the material as found in its naturally occurring environment or
(2) if the
material is in its natural environment, the material has been altered by
deliberate
human intervention to a composition and/or placed at a locus in a cell other
than the
locus native to the material. Methods for isolation of promoter regions are
well known
in the art. A sequence for the promoter region eepl is set forth in SEQ ID NO:
7. A
sequence for the promoter region eep2 is set forth in SEQ ID NO: 18.
The eepl promoter set forth in SEQ ID NO: 7 is 960 nucleotides in length
A putative CAAT motif is found 308 bp upstream of the start of translation and
a
putative TATA motif is found 139 bp upstream form the start of translation.
The
promoter was isolated from EST sequences found in maize tissue libraries of 4
and 6
DAP embryo sacs, as well as 5 and 7 DAP whole kernels. The eepl promoter can
address expression problems by providing expression in seed tissues during
early
stages of seed development.
-64-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The eep2 promoter set forth in SEQ ID NO: 18 is 1027 nucleotides in length.
The
promoter was isolated from an EST sequence found in maize tissue libraries of
4 DAP
(days after pollination) embryo sacs and is highly specific for early kernel
and endosperm
expression, as determined by EST distribution among libraries and by Lynx MPSS
profiling.
The promoter regions of the invention may be isolated from any plant,
including, but not limited to, maize (corn; Zea mays), canola (Brassica napus,
Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye
(Secale
cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus
annuus), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana
tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton
(Gossypium hirsutum), sweet potato (lpomoea batatus), cassava (Manihot
esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Ananas
comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia
sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica),
guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea),
oats,
barley, vegetables, ornamentals, and conifers. Preferably, plants include
maize,
soybean, sunflower, safflower, canola, wheat, barley, rye, alfalfa, and
sorghum.
Promoter sequences from other plants may be isolated according to well-
known techniques based on their sequence homology to the promoter sequences
set
forth herein. In these techniques, all or part of the known promoter sequence
is used
as a probe which selectively hybridizes to other sequences present in a
population of
cloned genomic DNA fragments (i.e. genomic libraries) from a chosen organism.
Methods that are readily available in the art for the hybridization of nucleic
acid
sequences may be used to obtain sequences which correspond to the promoter of
the present invention.
The entire promoter sequence or portions thereof can be used as a probe
capable of specifically hybridizing to corresponding promoter sequences. To
achieve specific hybridization under a variety of conditions, such probes
include
sequences that are unique and are preferably at least about 10 nucleotides in
length, and most preferably at least about 20 nucleotides in length. Such
probes
can be used to amplify corresponding promoter sequences from a chosen organism
by the well-known process of polymerase chain reaction (PCR). This technique
-65-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
can be used to isolate additional promoter sequences from a desired organism
or
as a diagnostic assay to determine the presence of the promoter sequence in an
organism. Examples include hybridization screening of plated DNA libraries
(either
plaques or colonies; see e.g. Innis et al. (1990) PCR Protocols, A Guide to
Methods
and Applications, eds., Academic Press).
In general, sequences that correspond to the promoter sequence of the
present invention and hybridize to the promoter sequence disclosed herein will
be at
least 50% homologous, 55% homologous, 60% homologous, 65% homologous, 70%
homologous, 75% homologous, 80% homologous, 85% homologous, 90%
homologous, 95% homologous and even 98% homologous or more with the
disclosed sequence.
The following terms are used to describe the sequence relationships between
two or more nucleic acids or polynucleotides: (a) "reference sequence", (b)
"comparison window", (c) "percentage of sequence identity", and (d)
"substantial
identity".
(a) As used herein, "reference sequence" is a defined sequence used as a
basis for sequence comparison. A reference sequence may be a subset or the
entirety of a specified sequence; for example, a segment of a full-length
promoter
sequence, or the complete promoter sequence.
(b) As used herein, "comparison window" makes reference to a contiguous
and specified segment of a polynucleotide sequence, wherein the polynucleotide
sequence may be compared to a reference sequence and wherein the portion of
the
polynucleotide sequence in the comparison window may comprise additions or
deletions (i.e., gaps) compared to the reference sequence (which does not
comprise
additions or deletions) for optimal alignment of the two sequences. Generally,
the
comparison window is at least 20 contiguous nucleotides in length and
optionally can
be 30, 40, 50, 100, or more contiguous nucleotides in length. Those of skill
in the art
understand that to avoid a high similarity to a reference sequence due to
inclusion of
gaps in the polynucleotide sequence a gap penalty is typically introduced and
is
subtracted from the number of matches.
(c) As used herein, "percentage of sequence identity" means the value
determined by comparing two optimally aligned sequences over a comparison
window, wherein the portion of the polynucleotide sequence in the comparison
-66-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
window may comprise additions or deletions (i.e., gaps) as compared to the
reference
sequence (which does not comprise additions or deletions) for optimal
alignment of
the two sequences. The percentage is calculated by determining the number of
positions at which the identical nucleic acid base occurs in both sequences to
yield
the number of matched positions, dividing the number of matched positions by
the
total number of positions in the window of comparison and multiplying the
result by
100 to yield the percentage of sequence identity.
(d) The term "substantial identity" of polynucleotide sequences means that
a polynucleotide comprises a sequence that has at least 70% sequence identity,
preferably at least 80%, more preferably at least 90% and most preferably at
least
95%, compared to a reference sequence using one of the alignment programs
described using standard parameters.
Methods of aligning sequences for comparison are well known in the art.
Gene comparisons can be determined by conducting BLAST ( Basic Local
Alignment Search Tool; Altschul, S. F., et al., (1993) J. Mot. Biol. 215:403-
410; see
also www.ncbi.nlm.nih.gov/BLAST/) searches under default parameters for
identity
to sequences contained in the BLAST "GENEMBL" database. A sequence can be
analyzed for identity to all publicly available DNA sequences contained in the
GENEMBL database using the BLASTN algorithm under the default parameters.
Identity to the sequence of the present invention would mean a polynucleotide
sequence having at least 65% sequence identity, more preferably at least 70%
sequence identity, more preferably at least 75% sequence identity, more
preferably
at least 80% identity, more preferably at least 85% sequence identity, more
preferably at least 90% sequence identity and most preferably at least 95%
sequence identity wherein the percent sequence identity is based on the entire
promoter region.
For purposes of defining the present invention, GAP (Global Alignment
Program) is used. GAP uses the algorithm of Needleman and Wunsch (J. Mol.
Biol. 48:443-453, 1970) to find the alignment of two complete sequences that
maximizes the number of matches and minimizes the number of gaps. GAP
considers all possible alignments and gap positions and creates the alignment
with
the largest number of matched bases and the fewest gaps. It allows for the
provision of a gap creation penalty and a gap extension penalty in units of
matched
-67-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
bases. GAP must make a profit of gap creation penalty number of matches for
each gap it inserts. If a gap extension penalty greater than zero is chosen,
GAP
must, in addition, make a profit for each gap inserted of the length of the
gap times
the gap extension penalty. Default gap creation penalty values and gap
extension
penalty values in Version 10 of the Wisconsin Package (Accelrys, Inc., San
Diego, CA) for protein sequences are 8 and 2, respectively. For nucleotide
sequences the default gap creation penalty is 50 while the default gap
extension
penalty is 3. The gap creation and gap extension penalties can be expressed as
an integer selected from the group of integers consisting of from 0 to 200.
Thus, for
example, the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5,
6, 7,
8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.
GAP presents one member of the family of best alignments. There may be
many members of this family, but no other member has a better quality. GAP
displays four figures of merit for alignments: Quality, Ratio, Identity, and
Similarity.
The Quality is the metric maximized in order to align the sequences. Ratio is
the
quality divided by the number of bases in the shorter segment. Percent
Identity is
the percent of the symbols that actually match. Percent Similarity is the
percent of
the symbols that are similar. Symbols that are across from gaps are ignored. A
similarity is scored when the scoring matrix value for a pair of symbols is
greater
than or equal to 0.50, the similarity threshold. The scoring matrix used in
Version
10 of the Wisconsin Package (Accelrys, Inc., San Diego, CA) is BLOSUM62 (see
Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
Sequence fragments with high percent identity to the sequences of the
present invention also refer to those fragments of a particular promoter
sequence
disclosed herein that operate to promote the seed-preferred expression of an
operably-linked isolated nucleotide sequence. These fragments will comprise at
least about 20 contiguous nucleotides, preferably at least about 50 contiguous
nucleotides, more preferably at least about 75 contiguous nucleotides, even
more
preferably at least about 100 contiguous nucleotides of the particular
promoter
nucleotide sequence disclosed herein. The nucleotides of such fragments will
usually comprise the TATA recognition sequence of the particular promoter
sequence. Such fragments can be obtained by use of restriction enzymes to
cleave the naturally occurring promoter sequences disclosed herein; by
-68-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
synthesizing a nucleotide sequence from the naturally-occurring DNA sequence;
or
through the use of PCR technology. See particularly, Mullis et al. (1987)
Methods
Enzymol. 155:335-350, and Erlich, ed. (1989) PCR Technology (Stockton Press,
New York). Again, variants of these fragments, such as those resulting from
site-
directed mutagenesis, are encompassed by the compositions of the present
invention.
Nucleotide sequences comprising at least about 20 contiguous sequences of
the sequence set forth in SEQ ID NO:10 are encompassed. These sequences can
be isolated by hybridization, PCR, and the like. Such sequences encompass
fragments capable of driving seed-preferred expression, fragments useful as
probes
to identify similar sequences, as well as elements responsible for temporal or
tissue
specificity.
Biologically active variants of the promoter sequence are also encompassed
by the compositions of the present invention. A regulatory "variant" is a
modified form
of a promoter wherein one or more bases have been modified, removed or added.
For example, a routine way to remove part of a DNA sequence is to use an
exonuclease in combination with DNA amplification to produce unidirectional
nested
deletions of double-stranded DNA clones. A commercial kit for this purpose is
sold
under the trade name Exo-Size TM (New England Biolabs, Beverly, Mass.).
Briefly,
this procedure entails incubating exonuclease III with DNA to progressively
remove
nucleotides in the 3' to 5' direction at 5' overhangs, blunt ends or nicks in
the DNA
template. However, exonuclease III is unable to remove nucleotides at 3', 4-
base
overhangs. Timed digests of a clone with this enzyme produce unidirectional
nested
deletions.
One example of a regulatory sequence variant is a promoter formed by
causing one or more deletions in a larger promoter. The 5' portion of a
promoter up
to the TATA box near the transcription start site can be deleted without
abolishing
promoter activity, as described by Zhu et al., The Plant Cell 7: 1681-89
(1995).
Such variants should retain promoter activity, particularly the ability to
drive
expression in seed or seed tissues. Biologically active variants include, for
example, the native regulatory sequences of the invention having one or more
nucleotide substitutions, deletions or insertions. Activity can be measured by
Northern blot analysis, reporter activity measurements when using
transcriptional
-69-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
fusions, and the like. See, for example, Sambrook et al. (1989) Molecular
Cloning:
A Laboratory Manual (2nd ed. Cold Spring Harbor Laboratory, Cold Spring
Harbor,
N.Y.).
The nucleotide sequences for the seed-preferred promoter disclosed in the
present invention, as well as variants and fragments thereof, are useful in
the genetic
manipulation of any plant when operably linked with an isolated nucleotide
sequence
whose expression is to be controlled to achieve a desired phenotypic response.
By
"operably linked" is intended that the transcription or translation of the
isolated
nucleotide sequence is under the influence of the regulatory sequence. In this
manner, a nucleotide sequence for the promoter of the invention may be
provided in
an expression cassette along with an isolated nucleotide sequence for
expression in
the plant of interest, more particularly in the seed of the plant. Such an
expression
cassette is provided with a plurality of restriction sites for insertion of
the nucleotide
sequence to be under the transcriptional control of the promoter.
The genes of interest expressed under the direction of the promoter of the
invention can be used for varying the phenotype of seeds. This can be achieved
by
increasing expression of endogenous or exogenous products in seeds.
Alternatively,
results can be achieved by providing for a reduction of expression of one or
more
endogenous products, particularly enzymes or cofactors in the seed. These
modifications result in a change in phenotype of the transformed seed. It is
recognized that the promoter may be used with its native coding sequence to
increase or decrease expression, resulting in a change in phenotype in the
transformed seed.
General categories of genes of interest for the purposes of the present
invention include for example, those genes involved in information, such as
Zinc
fingers; those involved in communication, such as kinases; and those involved
in
housekeeping, such as heat shock proteins. More specific categories of
transgenes
include genes encoding important traits for agronomics, insect resistance,
disease
resistance, herbicide resistance, and grain characteristics. Still other
categories of
transgenes include genes for inducing expression of exogenous products such as
enzymes, cofactors, and hormones from plants and other eukaryotes as well as
prokaryotic organisms. It is recognized that any gene of interest, including
the native
-70-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
coding sequence, can be operably linked to the regulatory elements of the
invention
and expressed in the seed.
Modifications that affect grain traits include increasing the content of oleic
acid, or altering levels of saturated and unsaturated fatty acids. Likewise,
increasing the levels of lysine and sulfur-containing amino acids may be
desired as
well as the modification of starch type and content in the seed. Hordothionin
protein modifications are described in WO 9416078 filed April 10, 1997; WO
9638562 filed March 26, 1997; WO 9638563 filed March 26, 1997 and U.S. Pat.
No. 5,703,409 issued December 30, 1997.
Another example is lysine and/or sulfur-rich seed
protein encoded by the soybean 2S albumin described in WO 9735023 filed March
20, 1996, and the chymotrypsin inhibitor from barley, Williamson et a!. (1987)
Eur.
J. Biochem. 165:99-106
Derivatives of the following genes can be made by site-directed mutagenesis
to increase the level of preselected amino acids in the encoded polypeptide.
For
example, the gene encoding the barley high lysine polypeptide (BHL), is
derived
from barley chymotrypsin inhibitor, WO 9820133 filed November 1, 1996 .
Other proteins include
methionine-rich plant proteins such as from sunflower seed, Lilley et al.
(1989)
Proceedings of the World Congress on Vegetable Protein Utilization in Human
Foods and Animal Feedstuffs; Applewhite, H. (ed.); American Oil Chemists Soc.,
Champaign, IL :497-502; corn, Pedersen et al.
(1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359;
and rice, Musumura et al. (1989) Plant Mol. Biol.
12:123. Other important genes encode glucans,
Floury 2, growth factors, seed storage factors and transcription factors.
Agronomic traits in seeds can be improved by altering expression of genes
that: affect the response of seed growth and development during environmental
stress, Cheikh-N et a! (1994) Plant Physiol. 106(1):45-51) and genes
controlling
carbohydrate metabolism to reduce kernel abortion in maize, Zinselmeier et al.
(1995) Plant Physiol. 107(2):385-391. These include, for example, genes
encoding
cytokinin biosynthesis enzymes, such as isopentenyl transferase; genes
encoding
cytokinin catabolic enzymes, such as cytokinin oxidase; genes encoding
-71-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
polypeptides involved in regulation of the cell cycle, such as CyclinD or
cdc25;
genes encoding cytokinin receptors or sensors, such as CRE1, CKII, and CKI2,
histidine phospho-transmitters, or cytokinin response regulators.
Insect resistance genes may encode resistance to pests that have great
yield drag such as rootworm, cutworm, European Corn Borer, and the like. Such
genes include, for example: Bacillus thuringiensis endotoxin genes, U.S. Pat.
Nos.
5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; Geiser et al. (1986)
Gene
48:109; lectins, Van Damme et al. (1994) Plant Mol. Biol. 24:825; and the
like.
Genes encoding disease resistance traits include: detoxification genes, such
as against fumonosin (WO 9606175 filed June 7, 1995); avirulence (avr) and
disease resistance (R) genes, Jones et al. (1994) Science 266:789; Martin et
al.
(1993) Science 262:1432; Mindrinos et al. (1994) Cell 78:1089; and the like.
Commercial traits can also be encoded on a gene(s) which could alter or
increase for example, starch for the production of paper, textiles and
ethanol, or
provide expression of proteins with other commercial uses. Another important
commercial use of transformed plants is the production of polymers and
bioplastics
such as described in U.S. Patent No. 5,602,321 issued February 11, 1997. Genes
such as B-Ketothiolase, PHBase (polyhydroxyburyrate synthase) and acetoacetyl-
CoA reductase (see Schubert et al. (1988) J. Bacteriol 170(12):5837-5847)
facilitate
expression of polyhyroxyalkanoates (PHAs).
Exogenous products include plant enzymes and products as well as those
from other sources including prokaryotes and other eukaryotes. Such products
include enzymes, cofactors, hormones, and the like. The level of seed
proteins,
particularly modified seed proteins having improved amino acid distribution to
improve the nutrient value of the seed can be increased. This is achieved by
the
expression of such proteins having enhanced amino acid content.
The nucleotide sequence operably linked to the regulatory elements
disclosed herein can be an antisense sequence for a targeted gene. By
"antisense
DNA nucleotide sequence" is intended a sequence that is in inverse orientation
to
the 5'-to-3' normal orientation of that nucleotide sequence. When delivered
into a
plant cell, expression of the antisense DNA sequence prevents normal
expression
of the DNA nucleotide sequence for the targeted gene. The antisense nucleotide
sequence encodes an RNA transcript that is complementary to and capable of
-72-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
hybridizing with the endogenous messenger RNA (mRNA) produced by
transcription of the DNA nucleotide sequence for the targeted gene. In this
case,
production of the native protein encoded by the targeted gene is inhibited to
achieve a desired phenotypic response. Thus the regulatory sequences disclosed
herein can be operably linked to antisense DNA sequences to reduce or inhibit
expression of a native protein in the plant seed.
The expression cassette will also include, at the 3' terminus of the isolated
nucleotide sequence of interest, a transcriptional and translational
termination
region functional in plants. The termination region can be native with the
promoter
nucleotide sequence of the present invention, can be native with the DNA
sequence of interest, or can be derived from another source.
Other convenient termination regions are available from the Ti-plasmid of A.
tumefaciens, such as the octopine synthase and nopaline synthase termination
regions. See also: Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144;
Proudfoot (1991) Cell 64:671-674; Sanfacon at al. (1991) Genes Dev. 5:141-149;
Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-
158; Ballas at al. 1989) Nucleic Acids Res. 17:7891-7903; Joshi at al. (1987)
Nucleic Acid Res. 15:9627-9639.
The expression cassettes can additionally contain 5' leader sequences.
Such leader sequences can act to enhance translation. Translation leaders are
known in the art and include: picornavirus leaders, for example: EMCV leader
(Encephalomyocarditis 5' noncoding region), Elroy-Stein et al. (1989) Proc.
Nat.
Acad. Sci. USA 86:6126-6130; potyvirus leaders, for example, TEV leader
(Tobacco Etch Virus), Allison et al. (1986); MDMV leader (Maize Dwarf Mosaic
Virus), Virology 154:9-20; human immunoglobulin heavy-chain binding protein
(BiP), Macejak et al. (1991) Nature 353:90-94; untranslated leader from the
coat
protein mRNA of alfalfa mosaic virus (AMV RNA 4), Jobling et al. (1987) Nature
325:622-625); tobacco mosaic virus leader (TMV), Gallie et al. (1989)
Molecular
Biology of RNA, pages 237-256; and maize chlorotic mottle virus leader (MCMV)
Lommel et al. (1991) Virology 81:382-385. See also Della-Cioppa et al. (1987)
Plant Physiology 84:965-968. The cassette can also contain sequences that
enhance translation and/or mRNA stability such as introns.
-73-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
In those instances where it is desirable to have the expressed product of the
isolated nucleotide sequence directed to a particular organelle, particularly
the plastid,
amyloplast, or to the endoplasmic reticulum, or secreted at the cell's surface
or
extracellularly, the expression cassette can further comprise a coding
sequence for a
transit peptide. Such transit peptides are well known in the art and include,
but are
not limited to: the transit peptide for the acyl carrier protein, the small
subunit of
RUBISCO, plant EPSP synthase, and the like.
In preparing the expression cassette, the various DNA fragments can be
manipulated, so as to provide for the DNA sequences in the proper orientation
and,
as appropriate, in the proper reading frame. Toward this end, adapters or
linkers
can be employed to join the DNA fragments or other manipulations can be
involved
to provide for convenient restriction sites, removal of superfluous DNA,
removal of
restriction sites, or the like. For this purpose, in vitro mutagenesis, primer
repair,
restriction digests, annealing, and resubstitutions such as transitions and
transversions, can be involved.
As noted herein, the present invention provides vectors capable of
expressing genes of interest under the control of the regulatory elements. In
general, the vectors should be functional in plant cells. At times, it may be
preferable to have vectors that are functional in E. coli (e.g., production of
protein
for raising antibodies, DNA sequence analysis, construction of inserts,
obtaining
quantities of nucleic acids). Vectors and procedures for cloning and
expression in
E. coli are discussed in Sambrook et al. (supra).
The transformation vector, comprising the promoter of the present invention
operably linked to an isolated nucleotide sequence in an expression cassette,
can
also contain at least one additional nucleotide sequence for a gene to be co-
transformed into the organism. Alternatively, the additional sequence(s) can
be
provided on another transformation vector.
Vectors that are functional in plants can be binary plasmids derived from
Agrobacterium. Such vectors are capable of transforming plant cells. These
vectors contain left and right border sequences that are required for
integration into
the host (plant) chromosome. At minimum, between these border sequences is the
gene to be expressed under control of the regulatory elements of the present
invention. In one embodiment, a selectable marker and a reporter gene are also
-74-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
included. For ease of obtaining sufficient quantities of vector, a bacterial
origin that
allows replication in E. coli can be used.
Reporter genes can be included in the transformation vectors. Examples of
suitable reporter genes known in the art can be found in, for example:
Jefferson et
a/. (1991) in Plant Molecular Biology Manual, ed. Gelvin et al. (Kluwer
Academic
Publishers), pp. 1-33; DeWet et al. (1987) Mol. Cell. Biol. 7:725-737; Goff et
al.
(1990) EMBO J. 9:2517-2522; Kain at a/. (1995) BioTechniques 19:650-655; and
Chiu et al. (1996) Current Biology 6:325-330.
Selectable marker genes for selection of transformed cells or tissues can be
included in the transformation vectors. These can include genes that confer
antibiotic resistance or resistance to herbicides. Examples of suitable
selectable
marker genes include, but are not limited to: genes encoding resistance to
chloramphenicol, Herrera Estrella et'al. (1983) EMBO J. 2:987-992;
methotrexate,
Herrera Estrella et al. (1983) Nature 303:209-213; Meijer at al. (1991) Plant
Mol.
Biol. 16:807-820; hygromycin, Waldron at al. (1985) Plant M l. Biol. 5:103-
108;
Zhijian et al. (1995) Plant Science 108:219-227; streptomycin, Jones et al.
(1987)
Mol. Gen. Genet. 210:86-91; spectinomycin, Bretagne-Sagnard at al. (1996)
Transgenic Res. 5:131-137; bleomycin, Hille et al. (1990) Plant Mol. Biol.
7:171-
176; sulfonamide, Guerineau et al. (1990) Plant Mol. Biol. 15:127-136;
bromoxynil,
Stalker et al. (1988) Science 242:419-423; glyphosate, Shaw at al. (1986)
Science
233:478-481; phosphinothricin, DeBlock et al. (1987) EMBO J. 6:2513-2518.
Other genes that could serve utility in the recovery of transgenic events but
might not be required in the final product would include, but are not limited
to: GUS
(1i-glucoronidase), Jefferson (1987) Plant Mol. Biol. Rep. 5:387); GFP (green
florescence protein), Chalfie et al. (1994) Science 263:802; luciferase, Teed
et al.
(1989) EMBO J. 8:343; and the maize genes encoding for anthocyanin production,
Ludwig at al. (1990) Science 247:449.
The transformation vector comprising the particular regulatory sequences of
the present invention, operably linked to an isolated nucleotide sequence of
interest
in an expression cassette, can be used to transform any plant. In this manner,
genetically modified plants, plant cells, plant tissue, seed, and the like can
be
obtained. Transformation protocols can vary depending on the type of plant or
plant cell, i.e., monocot or dicot, targeted for transformation. Suitable
methods of
-75-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
transforming plant cells include microinjection, Crossway et al. (1986)
Biotechniques 4:320-334; electroporation, Riggs et al. (1986) Proc. Natl.
Acad. Sci.
USA 83:5602-5606; Agrobacterium-mediated transformation, see for example,
Townsend et al. U.S. Patent 5,563,055; direct gene transfer, Paszkowski at al.
(1984) EMBO J. 3:2717-2722; and ballistic particle acceleration, see for
example,
Sanford et al. U.S. Patent 4,945,050; Tomes et al. (1995) in Plant Cell,
Tissue, and
Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag,
Berlin); and McCabe et al. (1988) Biotechnology 6:923-926. Also see Weissinger
et al. (1988) Annual Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate
Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol.
87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean);
Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc.
Natl.
Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988) Biotechnology 6:559-
563
(maize); Klein et al. (1988) Plant Physiol. 91:440-444 (maize); Fromm et al.
(1990)
Biotechnology 8:833-839; Hooydaas-Van Slogteren at al. (1984) Nature (London)
311:763-764; Bytebier at al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349
(Liliaceae); De Wet at al. (1985) in The Experimental Manipulation of Ovule
Tissues, ed. G. P. Chapman et al. (Longman, New York), pp. 197-209 (pollen);
Kaeppler at al. (1990) Plant Cell Reports 9:415-418; and Kaeppler et al.
(1992)
Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D.Halluin at
al.
(1992) Plant Cell 4:1495-1505 (electroporation); Li at al. (1993) Plant Cell
Reports
12:250-255 and Christou et al. (1995) Annals of Botany 75:407-413 (rice);
Osjoda
et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium
tumefaciens); all of which are herein incorporated by reference.
The cells that have been transformed can be grown into plants in
accordance with conventional ways. See, for example, McCormick at al. (1986)
Plant Cell Reports 5:81-84. These plants can then be grown and pollinated with
the same transformed strain or different strains, and resulting plants having
seed-
preferred expression of the desired phenotypic characteristic can then be
identified.
Two or more generations can be grown to ensure that seed-preferred expression
of
the desired phenotypic characteristic is stably maintained and inherited.
-76-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
EXAMPLES
The present invention is further described by the following examples. The
examples are provided solely to illustrate the invention by reference to
specific
embodiments. These exemplifications, while illustrating certain specific
aspects of
the invention, do not portray the limitations or circumscribe the scope of the
disclosed
invention. It will be obvious that certain changes and modifications may be
practiced
within the scope of the appended claims.
Certain terms used herein are explained in the foregoing glossary.
All examples were carried out using standard techniques, which are well
known and routine to those of skill in the art, except where otherwise
described in
detail. Routine molecular biology techniques of the following examples can be
carried
out as described in standard laboratory manuals, such as Sambrook et al.,
MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989).
All parts or amounts set out in the following examples are by weight, unless
otherwise specified.
Unless otherwise stated, size separation of fragments in the examples below
was carried out using standard techniques of agarose and polyacrylamide gel
electrophoresis ("PAGE") in Sambrook et a1., MOLECULAR CLONING: A
LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y. (1989) and numerous other references such as, for
instance, by
Goeddel et al., Nucleic Acids Res. 8:4057 (1980).
Unless described otherwise, ligations were accomplished using standard
buffers, incubation temperatures and times, approximately equimolar amounts of
the
DNA fragments to be ligated and approximately 10 units of T4 DNA ligase
("ligase")
per 0.5 microgram of DNA.
Example 1: Construction of vectors system for temporal and spatial seed
preferred
expression of cytokinin biosynthetic enzymes
Construction of PHP 11466 and PHP 11467 and their cointegrates (PHP11551 and
PHPI 1552, respectively). PPH 11466 and PHP 11467 were employed in particle
gun
transformation protocols even though they have the right and left border for
the tDNA.
-77-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The versions designated PHP11551 and PHP11552 were used in Agro-mediated
transformation protocols.
The ipt coding sequence was obtained as a 732 bp BamHI/Hpal fragment and
inserted into a GLB1 expression cassette (BamHI/Hpal, 4.9 kb) to give
PHP11310.
The maize GLB1 promoter (Genbank Accession # L22344 L22295) and terminator
(Genbank Accession # L22345 L22295) in PHP3303 comprise the GLB1 expression
cassette. The pGLB1:ipt:GLB1 3' cassette was moved as two pieces
(Hindlll/BamHl
1401 bp and BamHl/EcoRl 1618 bp) into a T-DNA vector digested with EcoRl +
Hindlll (6.33 kb) to give PHP11363. Finally, a selectable marker gene
(pUBI:UBIINTRON1:maize-optimized PAT:35S 3') was added as a 2.84 kb Hindlll
fragment into Hind IIl-digested PHP1 1363 (9.35 kb). In PHPI 1466, the two
genes are
in opposite orientation relative to each other. In PHP11467, the two genes are
oriented in the same direction. After triparental mating the cointegrate of
PHP11466/PHP10523 was designated PHP11551. Likewise, the cointegrate of
PHP11467/PHP10523 was designated PHP11552.
Construction of PHP11404 and PHP11550
PHP 11404 was used with the biolistics-mediated transformation protocol. The
plasmid has all the features of the Agro version. The plasmid that was
actually used
with the Agro-mediated transformation protocols was is PHP11550.
Using the plasmid PHP9063 (pUBI:UBIINTRON1:ipt:pinll 3'), an Ncol restriction
site
was created at the start codon of ipt using site-directed mutagenesis
(specifically, the
MORPHTM Kit of 5 Prime 4 3 Prime, Inc.). The resulting plasmid was designated
PHP11362. The ipt coding sequence was then moved as a 724 bp Ncol/Hpal
fragment into PHP8001 (BamHl-cut, treated with Klenow to fill in the overhang
to a
blunt then cut with Ncol, 4.9 kb) to give PHP11401. PHP8001 contains the GZ-
W64A
promoter and terminator from the 27 KD zein gene of Z. mays (Genbank Accession
#
S78780). PHP11401 was digested with Pacl + Kpnl and a 1.35 kb fragment
inserted
into PHP11287 (Pacl/Kpnl-digested, 10.87 kb) to give PHP11404. PHP11287 is a T-
DNA vector that already carries the above-described pUBI:UBIINTRON1:maize-
optimized PAT:35S 3' selectable marker. After triparental mating the
cointegrate of
PHP11404/PHP10523 was designated PHP11550.
-78-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Construction of PHP12975
The CIMI promoter is described in U.S. Patent Application 09/377,648, filed
August
19, 1999. Site-directed mutagenesis was used to create an Ncol site at the
CIM1
translational start (PHP12699). The promoter was cut out as a 1.69 kb
Sacl/Ncol
fragment and ligated to the ipt coding sequence and pinll terminator from
PHP11362
to form PHP12800. The CIM1:ipt:pinll transcriptional unit was then moved as a
2.8 kb
BstEll fragment into BstEll-digested PHP12515 (9.5 kb), a binary vector
already
carrying the UBI:UBIINTRONI:MO-PAT:35S selectable marker between the border
sequences. The resulting plasmid was designated PHP12866. Triparental mating
into A. tumefaciens LBA4404 (PHP10523) gave the cointegrate plasmid PHP12975.
Construction of PHP12425
Plasmid PHP11404 (described above) was used as a starting plasmid to replace
the
GZ-W64A promoter with the LTP2 promoter from H. vulgare. PHP11404 DNA was
digested with Notl and Kpnl (9.46 kb fragment) and separately with Ncol plus
Kpnl
(1.24 kb fragment). These two fragments were mixed with a 1.52 kb Notl/Ncol
fragment from PHP8219 containing the LTP2 promoter and ligated. The resulting
plasmid product was designated PHP12333. Triparental mating of this plasmid
into
A. tumefaciens LBA4404 (PHP10523) gave the cointegrate plasmid PHP12425.
Triparental mating and selectable marker 35s:bar:pinll:
All vectors were constructed using standard molecular biology techniques. The
T-
DNA region for transformation consists of the T-DNA border sequences flanking
a
reporter gene and a selectable marker. The reporter is inserted proximal to
the
right T-DNA border and consists of the 2.0 kb Pstl fragment of the maize
ubiquitin
promoter Ubi-1 (Christensen et al., 1992) with flanking 5' Hindlll and 3'
BamHl
restriction sites. The ubiquitin promoter was ligated to the 5' BamHl site of
a beta-
glucuronidase (GUS) reporter gene (Jefferson et al., 1986), containing the
second
intron from potato ST-LSI (Vancanneyt et al., 1990). The potato proteinase II
(pinll) terminator (bases 2 to 310 from An et al., Plant Cell 1(1):115-122
(1989))
was blunt-end ligated downstream of the GUS coding sequence. On the 3' end of
the terminator is a Notl restriction site.
-79-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The selectable marker consists of an enhanced cauliflower mosaic virus 35S
promoter (bases -421 to -90 and -421 to +2 from Gardner, R.C., et al., Nucl.
Acids
Res. 9:2871-88 (1981).)) with a flanking 5' Notl site and 3' Pstl site. A
Pstl/Sall
fragment containing the 79 bp tobacco mosaic virus leader (Gallie, D.R., at
al.,
Nucl. Acids Res. 15:3257-73 (1987).)) is inserted downstream of the promoter
followed by a Sall/BamHI fragment containing the first intron of maize alcohol
dehydrogenase ADH1-S (Dennis et al., 1984). The BAR coding sequence
(Thompson, C.J., et al., Embo J. 6:2519-23 (1987).)) was cloned into the BamHI
site, with the pinll terminator ligated downstream. The pinll signal is
flanked by a 3'
Sacl site.
The T-DNA of PHP8904 was integrated into the super binary plasmid pSB1
(Ishida et al. 1996) by homologous recombination between the two plasmids. E.
soli
strain HB101 containing PHP8904 was mated with Agrobacterium strain LBA4404
harboring pSB1 to create the cointegrate plasmid in Agrobacterium designated
LBA4404(PHP10525) (by the method Ditta, G., et al., Proc. NatI. Acad. Sci. USA
77:7347-51 (1980).) LBA4404(PHP10525) was selected for by Agrobacterium
resistance to spectinomycin and verified as a recombinant by a Sall
restriction
digest of the plasmid.
Example 2: Transformation of Maize
Biolistics:
The inventive polynucleotides contained within a vector are transformed into
embryogenic maize callus by particle bombardment, generally as described by
Tomes, D. et al., IN: Plant Cell, Tissue and Organ Culture: Fundamental
Methods,
Eds. O.L. Gamborg and G.C. Phillips, Chapter 8, pgs. 197-213 (1995) and is
briefly
outlined below. Transgenic maize plants are produced by bombardment of
embryogenically responsive immature embryos with tungsten particles associated
with DNA plasmids. The plasmids consist of a selectable and an unselected
structural gene.
-80-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Preparation of Particles:
Fifteen mg of tungsten particles (General Electric), 0.5 to 1.8 , preferably
I to 1.8 p,
and most preferably 1 , are added to 2 ml of concentrated nitric acid. This
suspension was sonicated at 0 C for 20 minutes (Branson Sonifier Model 450,
40%
output, constant duty cycle). Tungsten particles are pelleted by
centrifugation at
10000 rpm (Biofuge) for one minute, and the supernatant is removed. Two
milliliters
of sterile distilled water are added to the pellet, and brief sonication is
used to
resuspend the particles. The suspension is pelleted, one milliliter of
absolute ethanol
is added to the pellet, and brief sonication is used to resuspend the
particles.
Rinsing, pelleting, and resuspending of the particles is performed two more
times with
sterile distilled water, and finally the particles are resuspended in two
milliliters of
sterile distilled water. The particles are subdivided into 250-ml aliquots and
stored
frozen.
Preparation of Particle-Plasmid DNA Association:
The stock of tungsten particles are sonicated briefly in a water bath
sonicator
(Branson Sonifier Model 450, 20% output, constant duty cycle) and 50 ml is
transferred to a microfuge tube. All the vectors were cis: that is the
selectable
marker and the gene of interest were on the same plasmid. These vectors were
then
transformed either singly or in combination.
Plasmid DNA was added to the particles for a final DNA amount of 0.1 to 10 tg
in 10 L total volume, and briefly sonicated. Preferably, 10 .ig (1 .ig/ L in
TE buffer)
total DNA is used to mix DNA and particles for bombardment. Specifically, 1.0
g of
PHP 11404, 11466, and/or 11467 (1 g/ L), where any cytokinin biosynthetic
enzyme
, polynucleotide can replace ipt were used per bombardment. Fifty microliters
(50 L)
of sterile aqueous 2.5 M CaCl2 are added, and the mixture is briefly sonicated
and
vortexed. Twenty microliters (20 L) of sterile aqueous 0.1 M spermidine are
added
and the mixture is briefly sonicated and vortexed. The mixture is incubated at
room
temperature for 20 minutes with intermittent brief sonication. The particle
suspension
is centrifuged, and the supernatant is removed. Two hundred fifty microliters
(250 L)
of absolute ethanol are added to the pellet, followed by brief sonication. The
suspension is pelleted, the supernatant is removed, and 60 ml of absolute
ethanol are
-81-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
added. The suspension is sonicated briefly before loading the particle-DNA
agglomeration onto macrocarriers.
Preparation of Tissue
Immature embryos of maize variety High Type II are the target for particle
bombardment-mediated transformation. This genotype is the F1 of two purebred
genetic lines, parents A and B, derived from the cross of two know maize
inbreds,
A188 and B73. Both parents are selected for high competence of somatic
embryogenesis, according to Armstrong at aL, Maize Genetics Coop. News 65:92
(1991).
Ears from F1 plants are selfed or sibbed, and embryos are aseptically
dissected
from developing caryopses when the scutellum first becomes opaque. This stage
occurs about 9-13 days post-pollination, and most generally about 10 days post-
pollination, depending on growth conditions. The embryos are about 0.75 to 1.5
millimeters long. Ears are surface sterilized with 20-50% Clorox for 30
minutes,
followed by three rinses with sterile distilled water.
Immature embryos are cultured with the scutellum oriented upward, on
embryogenic induction medium comprised of N6 basal salts, Eriksson vitamins,
0.5 mg/I thiamine HCI, 30 gm/I 'sucrose, 2.88 gm/I L-proline, 1 mg/I
2,4-dichlorophenoxyacetic acid, 2 gm/I Gelrite, and 8.5 mg/I AgN03. Chu at
al., Sci.
Sin. 18:659 (1975); Eriksson, Physiol. Plant 18:976 (1965). The medium is
sterilized
by autoclaving at 121 C for 15 minutes and dispensed into 100 X 25 mm Petri
dishes.
AgN 3 is filter-sterilized and added to the medium after autoclaving. The
tissues are
cultured in complete darkness at 28 C. After about 3 to 7 days, most usually
about 4
days, the scutellum of the embryo swells to about double its original size and
the
protuberances at the coleorhizal surface of the scutellum indicate the
inception of
embryogenic tissue. Up to 100% of the embryos display this response, but most
commonly, the embryogenic response frequency is about 80%.
When the embryogenic response is observed, the embryos are transferred to a
medium comprised of induction medium modified to contain 120 gm/I sucrose. The
embryos are oriented with the coleorhizal pole, the embryogenically responsive
tissue, upwards from the culture medium. Ten embryos per Petri dish are
located in
the center of a Petri dish in an area about 2 cm in diameter. The embryos are
-s2,
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
maintained on this medium for 3-16 hour, preferably 4 hours, in complete
darkness at
28 C just prior to bombardment with particles associated with plasmid DNAs
containing the selectable and unselectable marker genes.
To effect particle bombardment of embryos, the particle-DNA agglomerates are
accelerated using a DuPont PDS-1000 particle acceleration device. The particle-
DNA agglomeration is briefly sonicated and 10 ml are deposited on
macrocarriers
and the ethanol is allowed to evaporate. The macrocarrier is accelerated onto
a
stainless-steel stopping screen by the rupture of a polymer diaphragm (rupture
disk).
Rupture is effected by pressurized helium. The velocity of particle-DNA
acceleration
is determined based on the rupture disk breaking pressure. Rupture disk
pressures
of 200 to 1800 psi are used, with 650 to 1100 psi being preferred, and about
900 psi
being most highly preferred. Multiple disks are used to effect a range of
rupture
pressures.
The shelf containing the plate with embryos is placed 5.1 cm below the bottom
of the macrocarrier platform (shelf #3). To effect particle bombardment of
cultured
immature embryos, a rupture disk and a macrocarrier with dried particle-DNA
agglomerates are installed in the device. The He pressure delivered to the
device is
adjusted to 200 psi above the rupture disk breaking pressure. A Petri dish
with the
target embryos is placed into the vacuum chamber and located in the projected
path
of accelerated particles. A vacuum is created in the chamber, preferably about
28 in
Hg. After operation of the device, the vacuum is released and the Petri dish
is
removed.
Bombarded embryos remain on the osmotically-adjusted medium during
bombardment, and 1 to 4 days subsequently. The embryos are transferred to
selection medium comprised of N6 basal salts, Eriksson vitamins, 0.5 mg/1
thiamine
HCI, 30 gm/I sucrose, 1 mg/I 2,4-dichlorophenoxyacetic acid, 2 gm/I Gelrite,
0.85 mg/I
Ag NO3 and 3 mg/I bialaphos (Herbiace, Meiji). Bialaphos is added filter-
sterilized.
The embryos are subcultured to fresh selection medium at 10 to 14 day
intervals.
After about 7 weeks, embryogenic tissue, putatively transformed for both
selectable
and unselected marker genes, proliferates from about 7% of the bombarded
embryos. Putative transgenic tissue is rescued, and that tissue derived from
individual embryos is considered to be an event and is propagated
independently on
-83-
CA 02521497 2009-08-12
WO 2004/090143 PCT/US2004/010064
selection medium. Two cycles of clonal propagation are achieved by visual
selection
for the smallest contiguous fragments of organized embryogenic tissue.
A sample of tissue from each event is processed to recover DNA. The DNA is
restricted with a restriction endonuclease and probed with primer sequences
designed to amplify DNA sequences overlapping the cytokinin biosynthetic
enzymes
and non- cytokinin biosynthetic enzyme portion of the plasmid. Embryogenic
tissue
with amplifiable sequence is advanced to plant regeneration.
For regeneration of transgenic plants, embryogenic tissue is subcultured to a
medium comprising MS salts and vitamins (Murashige & Skoog, Physiol. Plant 15:
473 (1962)), 100 mg/I myo-inositol, 60 gm/I sucrose, 3 gm/I Gelrite, 0.5 mg/I
zeatin,
I mg/I indole-3-acetic acid, 26.4 ng/I cis-trans-abscissic acid, and 3 mg/I
bialaphos in
100 X 25 mm Petri dishes, and is incubated in darkness at 28 C until the
development of well-formed, matured somatic embryos can be seen. This requires
about 14 days. Well-formed somatic embryos are opaque and cream-colored, and
are comprised of an identifiable scutellum and coleoptile. The embryos are
individually subcultured to a germination medium comprising MS salts and
vitamins,
100 mg/I myo-inositol, 40 gm/I sucrose and 1.5 gm/I Gelrite in 100 X 25 mm
Petri
dishes and incubated under a 16 hour light:8 hour dark photoperiod and 40
meinsteinsm 2sec'1 from cool-white fluorescent tubes. After about 7 days, the
somatic
embryos have germinated and produced a well-defined shoot and root. The
individual plants are subcultured to germination medium in 125 X 25 mm glass
tubes
to allow further plant development. The plants are maintained under a 16 hour
Iight:8
hour dark photoperiod and 40 meinsteinsm 2sec 1 from cool-white fluorescent
tubes.
After about 7 days, the plants are well-established and are transplanted to
horticultural soil, hardened off, and potted into commercial greenhouse soil
mixture
and grown to sexual maturity in a greenhouse. An elite inbred line is used as
a male
to pollinate regenerated transgenic plants.
Agrobacterium-mediated:
When Agrobacterium-mediated transformation is used, the method of
Zhao is employed as in PCT patent publication W098/32326.
Briefly, immature embryos are isolated from
maize and the embryos contacted with a suspension of Agrobacterium (step 1:
the
-84-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
infection step). In this step the immature embryos are preferably immersed in
an
Agrobacterium suspension for the initiation of inoculation. The embryos are co-
cultured for a time with the Agrobacterium (step 2: the co-cultivation step).
Preferably the immature embryos are cultured on solid medium following the
infection step. Following this co-cultivation period an optional "resting"
step is
contemplated. In this resting step, the embryos are incubated in the presence
of at
least one antibiotic known to inhibit the growth of Agrobacterium without the
addition of a selective agent for plant transformants (step 3: resting step).
Preferably the immature embryos are cultured on solid medium with antibiotic,
but
without a selecting agent, for elimination of Agrobacterium and for a resting
phase
for the infected cells. Next, inoculated embryos are cultured on medium
containing
a selective agent and growing transformed callus is recovered (step 4: the
selection
step). Preferably, the immature embryos are cultured on solid medium with a
selective agent resulting in the selective growth of transformed cells. The
callus is
then regenerated into plants (step 5: the regeneration step) and preferably
calli
grown on selective medium are cultured on solid medium to regenerate the
plants.
Example 3: Identification of High Cytokinin Transgenic Corn Lines
The resulting transformants are screened for elevated levels of cytokinin
using a combination of direct measurements and in vivo correlates.
Vivipary Experiments (glbl:ipt constructs):
Because it is appreciated that seed dormancy is controlled by the ratio of
ABA:cytokinin, an elevated cytokinin level in the seed could induce a
viviparous
phenotype.
Glbl::ipt transformants were initiated using GS3 embryos and either
Agrobacterium- (inventive polynucleotides 11551 and 11552) or biolistic-
(inventive
polynucleotides 11466 and 11467) mediated transformation. Plantlets were
regenerated 2-3 months later and these plantlets (TO's) were transferred to
the
greenhouse after an additional 2-3 months. At anthesis, TO's were crossed with
HG11 and vivipary was detected in the developing T1 seed approximately 30 days
later. Developing T1 seed that exhibited the viviparous phenotype was rescued
by
replanting without seed drying. Viable plants were analyzed by PCR and leaf-
-85-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
painting to determine if the ipt gene and the selectable marker (PAT gene)
were
present. T1 plants flowered and ears were selfed to create T2 seed. Those
plants
carrying the ipt gene (PCR- and leaf paint-positive) produced seed that were
segregating 3:1 for the gene, whereas the plants that were PCR- and leaf paint-
negative did not segregate.
Cytokinin determinations:
t 19 and 23 days after pollination (DAP), ten seeds were harvested from each
of four replications per event (11551 and 11552). Seeds were then separated
into
embryo and endosperm and frozen in liquid nitrogen. At each sampling date,
embryo
tissue from the four replications was pooled and cytokinin levels were
determined.
Endosperm tissue was processed in an similar manner. The results are presented
in
Figure 1.
glb1::ipt Seed Propagation:
n order to propagate the viviparous seed, half of the remaining plants within
each event were harvested at 25 DAP. Ears were placed in dryer boxes and
ambient
air (22 to 25 C) was blown across them for three days to slowly dry the seed.
Dryer
boxes containing the transgenic ears were then transferred to a growth chamber
and
seeds were dried to -12% moisture by blowing 35C air across them for 3 to 5
days.
Individual ears were then shelled and the seeds stored at 10C and 50%RH.
Phenotype determination:
To determine the proportion of seed exhibiting vivipary, ears from the
remaining half of the plants were harvested at approximately 45 DAP and seed
scored for degree of vivipary. The four classes of vivipary were defined as:
Class 1: No apparent swelling of coleoptile.
Class 2: Visible swelling of coleoptile, but no elongation.
Class 3: Visible swelling of coleoptile with elongation past the scutellum,
but no
rupture of pericarp.
Class 4: Visible swelling of coleoptile with elongation past the scutellum and
rupture of pericarp.
-86-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The results are shown below in Table 1.
TABLE 1
Vivipary Characterization at 45
DAP
-ai
Oc CL
o N
LLI Cl] d J `~ U C~ CS U F=
11551 751412 + + + 4 4 7 4 19
751415 + + + 0 169 34 2 205
751416 + + + 99 28 18 59 204
751417 + + + 167 55 39 18 279
751420 + + + 2 193 47 0 242
751422 + + + 0 141 93 11 245
Sum 272 590 233 ;94 ,1194
11551 751425 + + + 50 57 85 4 196
751426 + + + 0 75 64 12 151
751429 + + + 66 40 19 4 129
751432 + + + 41 16 14 4 75
.Sea 157 180 182 24 551
11551 751433 - -
751434 - - - 438 0 0 0 438
751435 - - - 405 0 0 0 405
751436 375 ^ 0 0 375
Stun 41)4 0 0 0 . 400
11551 761437 + + + 14 50 78 19 161
751438 - + + 52 37 128 10 227
751439 + + + 126 92 101 9 330
751443 + + + 70 84 89 4 247
Sum 264 763 343E 42 965
11551 751441 - - - 375 0 0 0 375
751442 + -
751444 343 0 0 0 343
Sum 369 n 0 0 359
11551 751445 + 158 76 38 9 281
751446 - + -I- 4 12G79 3 212
751450 + + + 101 63 44 '14 242
751451 + + + 101 33 48 1 183
Bann 364 .318 2459. 27 911
11552 752902 + + 16 53 62 4 135
752906 + + + 35 74 24 4 137
752910 + + + 9 132 14 0 155
752911 + + + 2 148 39 3 192
752912 + + + 0 40 27 2 69
752913 + + + 49 36 36 8 129
752914 + + + 75 47 12 21 155
752919 + + 25 72 80 16 193
Sum 211 602 294 58 1165
11551 752924 4- + + 109 57 98 16 280
752930 + + + 6 27 22 10 65
752936 + + + 53 60 47 3 163
752937 -+- 4- + 53 36 70 10 '169
752939 + + + 58 48 68 6 180
752940 + + 0 1 0 0
Sure 279 229 305 45 657
The results of the phenotypic evaluation demonstrated that the presence of the
ipt gene
resulted in a greater occurrence of vivipary (Classes 2 through 4), relative
to the plants
without the gene.
-87-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Increased Seed Dry Unit Mass (qz:ipt constructs):
Because kernel mass is a function of the number of endosperm cells and
amyloplasts, and cytokinins have been implicated in increasing endosperm cell
number and in the differentiation of amyloplasts from proplastids, seeds
exhibiting an
increased level of cytokinin should yield a corresponding increase in seed dry
unit
mass.
Gz::ipt transformants were initiated using GS3 embryos and
Agrobacterium-mediated transformation (inventive polynucleotide 11550).
Plantlets
were regenerated in 2-3 months in 1997 and these plantlets (TO's) were
transferred
to the greenhouse after an additional 2-3 months. At anthesis, TO's were
crossed
with HG11 and at maturity the ears were harvested, shelled and the seed used
for
additional seed propagation (both backcrossing to HG11 and self-pollinating).
T2
seed (both BC2 generation and selfs) was then planted. The T2 plants were
analyzed by using PCR and leaf painting to determine if the ipt gene and the
selectable marker (PAT gene) were present, respectively. Subsets of these
plants
were self-pollinated for cytokinin determinations, or allowed to open
pollinate for
phenotype determinations (yield and yield components).
Cytokinin Determinations:
Samples can be collected and analyzed as follows. At 10, 16 and 22 DAP, 50 to
100
seeds can be collected from two replications per event (each replication was
composed of two subsamples) and the pedicel removed. For the 10 DAP samples,
the remaining seed tissue can be placed directly into liquid nitrogen (tissue
defined as
"seed," composed primarily of pericarp, aleurone, endosperm and nucellus). In
contrast, at 16 and 22 DAP, the embryo can be first dissected from the
remaining
seed tissue (tissue defined as "seed minus embryo," and composed primarily of
pericarp, aleurone and endosperm) and then both tissues placed directly into
liquid
nitrogen.
Phenotype Determination:
To determine the effect of the gz::ipt construct on seed mass, individual
plants are
hand harvested at physiological maturity (visible black layer), the seed
shelled and
oven dried to a constant mass (104 C, minimum of 3 days). Yield (g plant) and
the
-88-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
components of yield (ears per plant, seeds per ear and wt per seed) are
determined
on primary and secondary ears.
Increased Frequency Of Seed Set And Increased Number Of Seeds
(Itp2:ipt constructs):
Because yield is a combination of both frequency of seed set and number of
seeds per ear, seeds exhibiting an increased level of cytokinin in the early
stages of
seed set and formation should have ears with a corresponding increase in seed
set
and numbers.
Ltp2::ipt transformants were initiated using GS3 embryos and
Agrobacterium-mediated transformation (12425). Plantlets were regenerated in 2-
3
months in 1998 and these plantlets (TO's) were transferred to the greenhouse
after
an additional 2-3 months. At anthesis, TO's were crossed with HG11 and at
maturity the ears were harvested, shelled and the seed used for additional
seed
propagation (both backcrossing to HG11 and self-pollinating). The number of
seeds per TO event, and the number of events which set seed were compared to a
number of other transgenic events with promoter:gene combinations other than
ltp2:ipt. These are shown in Table 2.
Table 2. Seed set average of TO events of Itp2:ipt gene compared to other
genes
in TO plants grown under identical green house conditions in 1998 in Johnston,
IA.
Inventive gene number %TO w/seed average #
polynucleotide description TO's seeds
12425 Itp2:ipt 35 82.9 198
12384 lignin 92 22.8 145
12417 carbohydrate 40 55.0 156
12427 maturity 35 45.7 69
12428 lignin 29 75.9 174
12723 lignin 35 62.9 184
12724 lignin 35 45.7 161
-89-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Compared to % seed set and average # seeds per TO plant, Itp2:ipt, had both
the
highest % of TO plants which set seed and the highest numerical average # of
seeds
compared to six other transgenic combinations in TO plants grown at the same
time
and under the same greenhouse conditions. These results indicate that
expression
of cytokinin in the aleurone layer of early seed development may increase
yield by
increasing both the percentage of plants that set seed, and the number of
seeds set
per ear.
Subsequent generations will be grown at different field locations to determine
their
seed set and seed number characteristics and seed yield compared to non-
transgenic controls of the same genetic background. Cytokinin levels will also
be
measured on transgenic and non-transgenic kernels of similar genetic
background.
Cytokinin determinations:
Samples can be collected and analyzed as follows. At 2, 6 and 22 DAP, 50 to
100 seeds can be collected from two replications per event (each replication
composed of two subsamples) and the pedicel removed. For the 2, 6, and 22 DAP
samples, the remaining seed tissue can be placed directly into liquid nitrogen
(tissue
defined as "seed," composed primarily of pericarp, aleurone, endosperm and
nucellus).
EXAMPLE NO. 4 - Isolation of ipt and isolation of ckxl-2
Briefly, PCR primers preferably containing convenient restriction
endonuclease sites are constructed. Two useful primers are shown below:
SEQ ID NO: 38 (Upper primer with Barn HI site)
5'caucaucaucauggatccaccaatggatctacgtctaattttcggtccaac 3'
SEQ ID NO: 39 (Lower primer with Hpal site)
5'cuacuacuacuagttaactcacattcgaaatggtggtccttc 3'
-90-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The introduced restriction sites are bolded. The portion of the primer that
binds to the template extends from nucleotides 22 and 19 to the 3' terminus,
respectively. A BamHl site "ggatcc"(bolded) and a Kozak consensus sequence
were introduced before the start codon and a Hpal site "gttaac" (also bolded)
was
introduced after the stop. Following is a schematic showing how the primers
attach
to the published sequence.
BamHI
5'caucaucaucauggatccaccaatggatctacgtctaattttcggtccaac
aatggatctacgtctaattttcggtccaacttgcacaggaaaga
catcgactgcgatagctcttgcccagcagactggcctcccagtcctctcgctcgatcgcgtccaatg
ctgtcctcaactatcaaccggaagcgggcgaccaacagtggaagaactgaaaggaacgactcgtctg
taccttgatgatcgccctttggtaaagggtatcattaca9ccaagcaagctcatgaacggctcattg
cggaggtgcacaatcacgaggccaaaggcgggcttattcttgagggaggatctatctcgttgctcag
gtgcatggcgcaaagtcgttattggaacgcggattttcgttggcatattattcgcaacgagttagca
gacgaggagagcttcatgagcgtggccaagaccagagttaagcagatgttacgcccctctgcaggtc
tttctattatccaagagttggttcaactttggagggagcctcggctgaggcccatactggaagggat
cgatggatatcgatatgccctgctatttgctacccagaaccagatcacgcccgatatgctattgcag
ctcgacgcagatatggagaataaattgattcacggtatcgctcaggagtttctaatccatgcgcgtc
gacaggaacagaaattccctttggtgggcgcgacagctgtcgaagcgtttgaaggaccaccatttcg
aatgtga
3' cctggtggtaaagcttacact
cattgaucaucaucauc
HpaI
The Agrobacterium tumefaciens strain carrying the tumor-inducing plasmid
pTi Bo542 was obtained (See Guyon, P., et al., Agropine in null-type crown
gall
tumors: Evidence for generality of the opine concept, Proceedings of the
National
Academy of Sciences (U.S.) 77(5): 2693-97 (1980); Chilton, W.S., et al.
Absolute
stereochemistry of leucinopine, a crown gall opine, Phytochemistry (Oxford)
24(2):
221-24 (1985); Strabala, T.J., et al., Isolation and characterization of an
ipt gene
from the Ti plasmid Bo542, Molecular & General Genetics 216: 388-94 (1989))
and
live bacteria were used for the PCR template. Standard PCR conditions were
used. An example of such conditions follows: Volume per reaction of 100 L,
with
0.5 L of 10 ng/ L target plasmid, 0.05 Unit/ L Taq Polymerase, 0.5 gM each of
primers, 0.8 mM dNTP's IX Buffer in a thin walled tube. Mix reagents, keep on
ice.
-91-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Add target plasmid to tube and then add the 100 L of reaction mix to each
tube.
Pre-incubate in a thermocycler at 95 C for 3 minutes. Then cycle five times
at 95
C for 35 seconds, 55 C for 1 minute, and 72 C for 1 minute. Follow with 30
cycles at 95 C for 35 seconds, 65 C for 1 minute, and 72 C for 1 minute.
Finalize reaction by dwelling for 10 minutes at 72 C and allowing to soak at
6 C.
PCR product was then cloned into DH5a cells using a kit made by Life
Technologies according to manufacturer's instructions. DNA was extracted from
putative transformants, cut with BamHl and Hpal, and run on gel to confirm
transformation. This insert was then gel purified and transformed into a
convenient
expression vector, such as 7921 vector DNA containing a Ubi promoter and pinil
terminator.
A preferred DNA sequence is provided in Molecular and General Genetics
216:388-394 (1989). It contains an open reading frame encoding a protein of
239 amino
acid residues, with a deduced molecular weight of about 26.3kDa (Calculated as
the
.15 number of amino acid residues X 110).
Isolation of maize cytokinin oxidase gene, c ox 1-2
Another preferred DNA sequence is set out below as SEQ. I.D. NO: 1. It
contains
an open reading frame encoding a protein of about 535 amino acid residues, SEQ
ID
NO.:2, with a deduced molecular weight of about 58.9kDa (Calculated as the
number of
amino acid residues X 110). A copy of cytokinin oxidase can be prepared
synthetically
employing DNA synthesis protocols well known to those skilled in the art of
gene
synthesis. Alternatively, a copy of the gene may be isolated directly from a
cytokinin
oxidase harboring organism by PCR cloning. A maize cytokinin oxidase gene
(ckxl) was
cloned by Roy Morris of the University of Missouri and the sequence deposited
in
Genbank. (Morris et al., 1999. Isolation of a gene encoding a glycosylated
cytokinin
oxidase from maize. Biochem. Biophys. Res. Commun. 255(2):328-333. See also
Houba-Herin et al., 1999. Cytokinin oxidase from Zea mays: purification, cDNA
cloning and expression in moss protoplasts. Plant J. (6):615-626.) PCR primers
preferably containing convenient restriction endoonuclease sites are
constructed: Two
useful primers are shown below:
5' CATGCCATGGCGGTGGTTTATTACCTGCT 3' (with Ncol site at 5' end)
-92-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
5' CGGGATCCTCATCATCAGTTGAAGATGTCCT 3' (with BamHI site at 3' end)
These primers were designed against the sequence of ckxl and reverse
transcriptase PCR (RT-PCR) was utilized to isolate cytokinin oxidase genes
from
several different tissues of developing maize kernels. DNA fragments were
amplified from the following tissues: 10 DAP, 13 DAP, 18 DAP, and 20 DAP
endosperms; as well as 10 DAP, 18 DAP, and 20 DAP embryos, where DAP is
days after pollination. Fragments from all tissues migrated to 1.6 Kb in the
gel,
which is equal to that of the published sequence. We selected one of the
fragments (from 18 DAP embryos) and sequenced the DNA. This fragment is
referred to herein as Cytoxl-2 and its full-length sequence is set out below
in SEQ
ID NO.: 1. At the amino acid level, there is a 98% homology between the ckxl
gene and cytoxl -2, therefore, one of skill in the art would recognize that
cytoxl -2 is
a cytokinin oxidase gene from maize.
Example 5. Expression of transgenes in monocots
A plasmid vector is constructed comprising the Zag2.1 promoter (SEQ ID
NO: 3) or Zap promoter (SEQ ID NO: 5, also known as ZmMADS) or tbl promoter
(SEQ ID NO: 17) operably linked to a an isolated polynucleotide encoding ipt
(SEQ
ID NO: 1). This construct can then be introduced into maize cells by the
following
procedure.
Immature maize embryos are dissected from developing caryopses derived
from crosses of maize lines. The embryos are isolated 10 to 11 days after
pollination when they are 1.0 to 1.5 mm long. The embryos are then placed with
the axis-side facing down and in contact with agarose-solidified N6 medium
(Chu et
al. (1975) Sci. Sin. Peking 18:659-668). The embryos are kept in the dark at
27 C.
Friable embryogenic callus, consisting of undifferentiated masses of cells
with
somatic proembryoids and embryoids borne on suspensor structures, proliferates
from the scutellum of these immature embryos. The embryogenic callus isolated
from the primary explant can be cultured on N6 medium and sub-cultured on this
medium every 2 to 3 weeks.
-93-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The plasmid p35S/Ac (Hoechst Ag, Frankfurt, Germany) or equivalent may be
used in transformation experiments in order to provide for a selectable
marker.
This plasmid contains the Pat gene (see European Patent Publication 0 242 236)
which encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT
confers resistance to herbicidal glutamine synthetase inhibitors such as
phosphinothricin. The pat gene in p35S/Ac is under the control of the 35S
promoter from Cauliflower Mosaic Virus (Odell et al. (1985) Nature 313:810-
812)
and comprises the 3' region of the nopaline synthase gene from the T-DNA of
the
Ti plasmid of Agrobacterium tumefaciens.
The particle bombardment method (Klein et al. (1987) Nature 327:70-73) may
be used to transfer genes to the callus culture cells. According to this
method, gold
particles (1 pm in diameter) are coated with DNA using the following
technique.
Ten pg of plasmid DNAs are added to 50 pL of a suspension of gold particles
(60 mg per mL). Calcium chloride (50, pL of a 2.5 M solution) and spermidine
free
base (20 pL of a 1.0 M solution) are added to the particles. The suspension is
vortexed during the addition of these solutions. After 10 minutes, the tubes
are
briefly centrifuged (5 sec at 15,000 rpm) and the supernatant removed. The
particles are resuspended in 200 pL of absolute ethanol, centrifuged again and
the
supernatant removed. The ethanol rinse is performed again and the particles
resuspended in a final volume of 30 pL of ethanol. An aliquot (5 pL) of the
DNA-
coated gold particles can be placed in the center of a Kapton flying disc (Bio-
Rad
Labs). The particles are then accelerated into the corn tissue with a
Biolistic
PDS-1000/He (Bio-Rad Instruments, Hercules CA), using a helium pressure of
1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0 cm.
For bombardment, the embryogenic tissue is placed on filter paper over
agarose-solidified N6 medium. The tissue is arranged as a thin lawn and covers
a
circular area of about 5 cm in diameter. The petri dish containing the tissue
can be
placed in the chamber of the PDS-1000/He approximately 8 cm from the stopping
screen. The air in the chamber is then evacuated to a vacuum of 28 inches of
Hg.
The macrocarrier is accelerated with a helium shock wave using a rupture
membrane that bursts when the He pressure in the shock tube reaches 1000 psi.
Seven days after bombardment the tissue can be transferred to N6 medium
that contains gluphosinate (2 mg per liter) and lacks casein or proline. The
tissue
-94-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
continues to grow slowly on this medium. After an additional 2 weeks the
tissue
can be transferred to fresh N6 medium containing gluphosinate. After 6 weeks,
areas of about 1 cm in diameter of actively growing callus can be identified
on
some of the plates containing the glufosinate-supplemented medium. These calli
may continue to grow when sub-cultured on the selective medium.
Plants can be regenerated from the transgenic callus by first transferring
clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D.
After
two weeks the tissue can be transferred to regeneration medium (Fromm at al.
(1990) Bio/Technology 8:833-839).
Example 6. Expression of transgenes in dicots
Soybean embryos.are bombarded with a plasmid comprising the Zag2.1
promoter operably linked to a heterologous nucleotide sequence encoding ipt,
as
follows. To induce somatic embryos, cotyledons of 3-5 mm in length are
dissected
from surface-sterilized, immature seeds of the soybean cultivar A2872, then
cultured in the light or dark at 26 C on an appropriate agar medium for six to
ten
weeks. Somatic embryos producing secondary embryos are then excised and
placed into a suitable liquid medium. After repeated selection for clusters of
somatic embryos that multiply as early, globular-staged embryos, the
suspensions
are maintained as described below.
Soybean embryogenic suspension cultures can be maintained in 35 ml liquid
media on a rotary shaker, 150 rpm, at 26 C with fluorescent lights on a 16:8
hour
day/night schedule. Cultures are sub-cultured every two weeks by inoculating
approximately 35 mg of tissue into 35 ml of liquid medium.
Soybean embryogenic suspension cultures may then be transformed by the
method of particle gun bombardment (Klein et al. (1987) Nature (London)
327:70-73, U.S. Patent No. 4,945,050). A DuPont Biolistic PDS1000/HE
instrument.
(helium retrofit) can be used for these transformations.
A selectable marker gene that can be used to facilitate soybean
transformation is a transgene composed of the 35S promoter from Cauliflower
Mosaic Virus (Odell at al. (1985) Nature 313:810-812), the hygromycin
phosphotransferase gene from plasmid pJR225 (from E. coli; Gritz et al. (1983)
Gene 25:179-188), and the 3' region of the nopaline synthase gene from the T-
DNA
-95-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
of the Ti plasmid of Agrobacterium tumefaciens. The expression cassette of
interest, comprising the Zag2.1 promoter and a heterologous polynucleotide
encoding ipt, can be isolated as a restriction fragment. This fragment can
then be
inserted into a unique restriction site of the vector carrying the marker
gene.
To 50 l of a 60 mg/mI 1 m gold particle suspension is added (in order): 5 l
DNA (1 p.g/ l), 20 l spermidine (0.1 M), and 50 l CaCI2 (2.5 M). The
particle
preparation is then agitated for three minutes, spun in a microfuge for 10
seconds
and the supernatant removed. The DNA-coated particles are then washed once in
400 pi 70% ethanol and resuspended in 40 pi of anhydrous ethanol. The
DNA/particle suspension can be sonicated three times for one second each. Five
microliters of the DNA-coated gold particles are then loaded on each macro
carrier
disk.
Approximately 300-400 mg of a two-week-old suspension culture is placed in
an empty 60x15 mm petri dish and the residual liquid removed from the tissue
with
a pipette. For each transformation experiment, approximately 5-10 plates of
tissue
are normally bombarded. Membrane rupture pressure is set at 1100 psi, and the
chamber is evacuated to a vacuum of 28 inches mercury. The tissue is placed
approximately 3.5 inches away from the retaining screen and bombarded three
times. Following bombardment, the tissue can be divided in half and placed
back
into liquid and cultured as described above.
Five to seven days post bombardment, the liquid media may be exchanged
with fresh media, and eleven to twelve days post-bombardment with fresh media
containing 50 mg/ml hygromycin. This selective media can be refreshed weekly.
Seven to eight weeks post-bombardment, green, transformed tissue may be
observed growing from untransformed, necrotic embryogenic clusters. Isolated
green tissue is removed and inoculated into individual flasks to generate new,
clonally propagated, transformed embryogenic suspension cultures. Each new
line
may be treated as an independent transformation event. These suspensions can
then be subcultured and maintained as clusters of immature embryos or
regenerated into whole plants by maturation and germination of individual
somatic
embryos.
-96-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Example 7. Analysis of ear growth rate of T1 (D2F1 hemizygous) plants under
non-
stress conditions.
Transformation of maize with the zag2.1::ipt construct was performed as
described in Example 5. Regenerated plants were pollinated with one of the
parent genotypes to create D2F1 seed (D2 referring to two doses of a parent;
also
known as T1 seed). Of 17 original transformants, nine were selected for
advancement based on favorable genetic complexity (i.e., single- to low-copy
number as determined by Southern blot analysis), intactness of the plant
transcriptional unit (as determined by Southern blot analysis), and adequate
seed
numbers.
The D2F1 seed was planted in a replicated, well-watered field trial in
Johnston, Iowa. Dry mass of unpollinated ears was measured at initial silk
emergence and seven days later. Ear growth rate (EGR) was calculated as the
difference in dry mass divided by the number of days. As shown in Figure 2,
four of
the nine events tested showed an increase in ear growth rate, relative to
transgene-
negative sibs planted as controls. Presence of the ipt transcript in
developing ears
representing all nine events was confirmed via RT-PCR.
However, space constraints in the field prohibited direct comparisons of
transgene-positive and transgene-negative plants of the same event and same
genotype. Instead, control plants in this example were grown from a bulked
sample
of segregating T1 seed. Control plots were thinned to standard density; also,
transgene-positive plants, identified via leaf painting with herbicide, were
rogued.
As a result of the bulking across events and genotypes, and the variation in
field
conditions for transgenic vs. control plants, the differences in EGR between
transgenic and control plants were muted and the results were inconclusive.
Therefore, all nine events were carried forward for yield analysis the
following year.
Ear growth rate differences are expected for the transgenic events and can
be properly evaluated with direct comparisons in which genetic background and
field growing conditions are held constant.
-97-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Example 8. Analysis of yield of T2 (D3F1 hemizygous) plants under non-stress
conditions.
T2 seed representing the nine selected events (derived from pollination of T1
plants with a recurrent parent) was planted in an unreplicated, well-watered
field
trial in Johnston, Iowa. Presence of the ipt transcript in developing ears was
confirmed via Northern blot analysis. Transgene-negative sibs of each event
were
planted as controls and a pair-wise analysis of each event was conducted (a
difference analysis) as well as an event average analysis. All subject plants
were
detasseled and pollinated by a mixed non-transgenic male parent.
Yield was determined by collecting primary ears. Grain was bulked by event
and by the presence or absence of the transgene; grain was then oven-dried and
measured for total dry mass. Results are shown in Figure 3. Grain yield of
seven
of the nine events was greater than that of controls. Kernel number, ear
length, and
kernel mass were also measured; results for transgenics exceeded those for non-
transgenic sibs in five out of nine events for ear length; and in five out of
nine
events for both kernel number and dry matter per kernel.
Example 9. Analysis of D4F3 homozygous plants for yield and plant height.
Next-generation progeny of the nine selected events were evaluated in a
replicated, well-watered field trial in Johnston, Iowa, in 2002. Transgene-
negative
sibs were planted as controls. All subject plants were detasseled; a mix of
non-
transgenic plants served as the pollen source.
Plant heights were measured at V10 and V12. (For growth stages, see How
a Corn Plant Develops, Iowa State University of Science and Technology
Cooperative Extension Service Special Report No. 48, Reprinted June 1993.)
Five
of the nine events showed a statistically significant increase in plant
height, as
shown in Figure 4.
Yield was determined by collecting all grain-bearing ears. Grain was bulked
as appropriate, oven-dried, and measured for total dry mass. As shown in
Figure 5,
three of the nine events showed a statistically significant increase in yield,
including
two of the events also showing increased plant height. Ear number, kernel
number,
and kernel mass were also measured, as shown in Figure 6.
-98-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Example 10. Analysis of yield, plant height, leaf greenness, biomass, and
transgene expression of D4F3 plants under drought stress.
Homozygous progeny of the nine events were evaluated under drought
conditions in a replicated field trial at Woodland, California, in 2002.
Supplemental
irrigation was withheld to target a stress during anthesis sufficient to
decrease yield
40% to 50%. To do this, water was withheld begininning at 920 GDUs (growing
degree units) post planting and resumed at 1860 GDUs. All subject plants were
detasseled and pollinated by a mixed non-transgenic male parent. Presence of
the
ipt transcript was determined by Northern blot analysis of developing stem,
leaf,
and tassel.
Leaf greenness was measured approximately one week prior to flowering
with a Minolta SPAD chlorophyll meter. Plant height was measured at the same
time. Five of the nine events showed a statistically significant increase in
plant
height, as shown in Figure 7. Four of these five, and one additional event,
showed
increased leaf greenness, as shown in Figure 8.
Yield was determined by collecting all grain-bearing ears. Grain was bulked
as appropriate, oven-dried, and measured for total dry mass. Kernel number,
ear
number, and kernel mass were also measured. Three of the nine events gave
improved yield results, as shown in Figure 9; all three of these events had
also
displayed increased plant height and leaf greenness. The increase in plant
biomass for one of these events is shown in Figure 10. In addition, in all
events
tested, the transgene positive plants showed an increase in steady-state
levels of
ipt transcripts in various vegetative and reproductive tissues relative to
that in
transgene negative plants.
Example 11. Analysis of transgene effect on yield of in non-stress conditions
Several constructs were tested for their impact upon yield in a preliminary
screen at
one location with supplemental irrigation as required. All constructs were
evaluated
as multiple events, dose 2 elite parent, and tested for per se yield with two
reps per
event. Only transgene-positive plants were harvested and then all events were
compared against each other for their yield advantage. The results are shown
in
Table 2, where the different constructs are ranked by yield, highest at the
top and
lowest yielding at the bottom. The second column records the raw yield,
whereas
-99-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
the third column records the difference between that entry and the mean of all
of
the constructs.
Table 2
PHP Bu/acr Construct minus mean S.E. P value
of other constructs bu/acr
PHP19698 138.0 13.05 5.81 0.0248
PHP19020 137.4 12.54 5.54 0.0236
PHP19874 135.8 10.87 5.06 0.0318
PHP15418 132.0 9.00 1.85 <.0001
PHP16036 131.2 6.23 4.86 0.2006
PHP19304 129.4 4.42 4.17 0.2895
PHP19369 128.6 3.57 4.17 0.3925
PHP19512 126.4 1.30 4.17 0.7543
PHP19513 126.0 0.85 4.22 0.8399
PHP19815 124.3 -0.89 4.35 0.8375
PHP19380 124.1 -1.07 4.17 0.7977
PHP16889 124.0 -1.18 7.79 0.8794
PHP17897 123.3 -1.87 5.67 0.7416
PHP16037 122.9 -2.34 4.97 0.6378
PHP19699 122.7 -2.58 4.32 0.5497
PHP18070 122.1 -3.11 4.97 0.5315
PHP16176 121.7 -3.52 5.22 0.5011
PHP16178 121.5 -3.74 6.08 0.5385
PHP16172 120.8 -4.45 5.58 0.4258
PHP19523 120.5 -4.82 4.20 0.2478
PHP19814 120.3 -5.04 4.37 Ø2504
PHP19368 118.4 -6.92 4.17 0.0968
PHP19514 118.1 -7.31 4.20 0.0812
PHP19822 117.4 -8.23 4.91 0.0936
1 J
It can be seen that four constructs at the top of the table were significantly
higher yielding than any of the other constructs tested. Similarly, three
constructs
exhibited a significantly lower yield than any of the other constructs in this
test. The
remainder was not sufficiently distinguished from each other and it can be
assumed
that their transgene does not create an impact obviously different from just
the
background genotype. In this test, there were four IPT constructs that were
driven
in expression by either Zag2.1 or Zap and this group represent the four
highest
yielding constructs in this test: PHP19698 Zap::IPT, PHP19020 Zag:IPT with
-100-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Ubi:BAR , PHP19874 Zag::IPT with 35s BAR (head-to-head) , and PHP15418 the
original Zag::IPT construct with 35s BAR (head-to-tail). While the rest of
these
constructs were tested with 10 events per construct, in fact the re-make of
PHP15418 contained over 90 events. These results clearly show the impact of
coupling the IPT gene with a promoter/regulatory sequence with expression
focused around female meristems.
Example 12. Analysis of zaq2:ipt expression in soybean
Soybean embryogenic suspension cultures were transformed by the method
of particle gun bombardment using procedures known in the art (Klein et al.
(1987)
Nature (London) 327:70-73; U. S. Patent No. 4,945,050; Hazel, et al. (1998)
Plant
Cell. Rep. 17:765-772; Samoylov, et al. (1998) In Vitro Cell Dev. Biol.-Plant
34:8-13).
In particle gun bombardment procedures it is possible to use purified 1)
entire
plasmid DNA or, 2) DNA fragments containing only the recombinant DNA
expression cassette(s) of interest. In this example, the recombinant DNA
fragments
were isolated from the entire plasmid before being used for bombardment. For
every eight bombardments of soybean tissue, 30 pl of solution were prepared
with
3 mg of 0.6 pm gold particles and up tolOO picograms (pg) of DNA fragment per
base pair of DNA fragment.
The soybean transformation experiments were carried out using two
recombinant DNA fragments. The recombinant DNA fragment used to express the
IPT gene was on a separate recombinant DNA fragment from the selectable marker
gene providing resistance to sulfonylurea herbicides. Both recombinant DNA
fragments were co-precipitated onto gold particles.
Stock tissue for these transformation experiments was obtained by initiation
from soybean immature seeds. Secondary embryos were excised from explants
after 6 to 8 weeks on culture initiation medium. The initiation medium was an
agar-solidifed modified MS (Murashige and Skoog (1962) Physiol. Plant.
15:473-497) medium supplemented with vitamins, 2,4-D and glucose. Secondary
embryos were placed in flasks in liquid culture maintenance medium and
maintained for 7-9 days on a gyratory shaker at 26 +/- 2 C under -80 ,pEm-2s-1
light intensity. The culture maintenance medium was a modified MS medium
-101-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
supplemented with vitamins, 2,4-D, sucrose and asparagine. Prior to
bombardment, clumps of tissue were removed from the flasks and moved to an
empty 60 X 15 mm petri dish for bombardment. Tissue was dried by blotting on
Whatman #2 filter paper. Approximately 100-200 mg of tissue corresponding to
10-
20 clumps (1-5 mm in size each) were used per plate of bombarded tissue.
After bombardment, tissue from each bombarded plate was divided and placed
into
two flasks of liquid culture maintenance medium per plate of bombarded tissue.
Seven days post bombardment, the liquid medium in each flask was replaced with
fresh culture maintenance medium supplemented with 100 ng/ml selective agent
(selection medium). For selection of transformed soybean cells the selective
agent
used was a sulfonylurea (SU) compound with the chemical name,
2-chloro-N-((4-methoxy-6 methy-1,3,5-triazine-2-yl)aminocarbonyl)
benzenesulfonamide (common names: DPX-W4189 and chlorsulfuron).
Chlorsulfuron is the active ingredient in the DuPont sulfonylurea herbicide,
GLEAN . The selection medium containing SU was replaced every week for 6-8
weeks. After the 6-8 week selection period, islands of green, transformed
tissue
were observed growing from untransformed, necrotic embryogenic clusters. These
putative transgenic events were isolated and kept in media with SU at 100
ng/ml for
another 2-6 weeks with media changes every 1-2 weeks to generate new, clonally
propagated, transformed embryogenic suspension cultures. Embryos spent a total
of around 8-12 weeks in SU. Suspension cultures were subcultured and
maintained as clusters of immature embryos and also regenerated into whole
plants by maturation and germination of individual somatic embryos.
In the greenhouse, 1400 T1 plants derived from 42 zag2:ipt::ALS transgenic
events were grown at a high density (1400 plants in a space designed for 480).
Eighteen plants of variety `Jack' grown in the same environment were used as
controls. Plants were grown to maturity and visually selected for unusual pod
clusters, or increased pod load. Eighty three (83) zag2:ipt::ALS plants, and
18 Jack
plants were measured for the number of pods per plant, number of seed per
plant,
and seed weight (converted to 100-seed weight). Data were subject to ANOVA
using the PROC GLM procedure in SAS, and means separation were completed
using the PROC MEANS function of SAS.
-102-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
The null hypothesis tested was to determine if zag2:ipt::ALS plants visually
selected for unusual pod clustering or apparent increased pod load were
significantly different from the untransformed control (Jack). Plants from 34
events
were selected, and the pod number data across all events selected was
significantly different (p=0.05) between the ipt plants and Jack. Across all
events,
the selected zag2:ipt::ALS plants averaged 32.1 pods, which was significantly
more
(LSD = 5.2 pods) compared to the 25.4 pods that Jack averaged.
Five events were identified that were significantly different than Jack at the
0.05 level, and at least 2 plants from each event were measured. When the pod
data for these events was subject to ANOVA, the zag2:ipt::ALS plants were
statistically different from the Jack plants. The plants from the 5 selected
events
had an average of 42.3 pods, which was statistically greater (LSD = 5.9 pods)
of
the control.
Seed number was counted from all threshed plants of the two events with
the highest average pod number (AFS 3579.7.1 and AFS 3586.1.2). The
Zag2:ipt::ALS plants averaged 73.6 seed per plant, which was significantly
more
(LSD = 11.7 seed) than average seed per plant of Jack (44.7 seed) (Table 5).
The
events were not statistically different from each other.
Seed of each individual zag2:ipt::ALS plant and individual Jack plants were
weighed to determine if seed size was affected by the increased pod load. The
10-
seed weight of individual plants from AFS 3579.7.1 and AFS 3586.1.2 was 16.6
grams, which was not statistically different (LSD = 1.1 gram) from the 100
seed
weight of the control Jack plants (16.2 grams).
The data examined suggest that the zag2:ipt::ALS construct potentially may
influence pod number and seed per plant. In addition, seed size for the
zag2:ipt::ALS plants measured was not statistically different from the non-
transformed Jack control. A high level of variability existed in the
greenhouse
environment; however, these preliminary data suggest that the zag2:ipt::ALS
construct may increase pod retention and seed per plant without a statistical
difference in seed size.
-103-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Example 13 - Isolation of eepl Promoter Sequences
The procedure for promoter isolation is described in the User Manual for the
Universal Genome Walker kit sold by Clontech Laboratories, Inc., Palo Alto,
California. Genomic DNA was prepared by grinding 10-day-old Zea mays seedling
leaves in liquid nitrogen, and the DNA prepared using the DNeasy Plant Kit
(Qiagen, Valencia, California). The DNA was then used exactly as described in
the
Genome Walker User Manual (Clontech PT3042-1 version PR68687). Briefly, the
DNA was digested separately with restriction enzymes Dral, EcoRV, Pvull, Scal,
and Stul, all blunt-end cutters. In addition to the blunt enzymes suggested by
Clontech, three other blunt enzymes, EcoICRI, Xmnl, and Sspl were also used in
separate digestions. The DNA was extracted with phenol, then chloroform, then
ethanol precipitated. The Genome Walker adapters were ligated onto the ends of
the restricted DNA, to create a "Genome Walker Library."
For isolation of specific promoter regions, two nonoverlapping gene-specific
primers (26-30 bp in length) were designed complementary to the 5' end of the
maize genes identified from sequence databases. The primers were designed to
amplify the region upstream of the coding sequence, i.e. the 5' untranslated
region
and promoter of the chosen gene. The sequences of the primers are given below.
The first round of PCR was performed on each Genome Walker library with
Clontech primer API (SEQ ID NO: 15) and the gene-specific primer (gsp)i with
the
sequence shown in SEQ ID NO: 11.
PCR was performed in a model iCycler thermal cycler from Bio-Rad
(Hercules, California) using reagents supplied with the Genome Walker kit. The
following cycle parameters were used: 7 cycles of 94 C for 2 seconds, then 68
C
for 3 minutes, followed by 32 cycles of 94 C for 2 seconds and 67 C for 3
minutes.
Finally, the samples were held at 67 C for 4 minutes and then at 4 C until
further
analysis.
As described in the User Manual, the DNA from the first round of PCR was
then diluted and used as a template in a second round of PCR using the
Clontech
AP2 primer (SEQ ID NO: 16) and gene-specific primer (gsp)2 with the sequence
shown in SEQ ID NO:12.
The cycle parameters for the second round were: 5 cycles of 94 C for 4
seconds, then 70 C for 3 minutes, followed by 20 cycles of 94 C for 4 seconds,
then
- 104 -
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
68 C for 3 minutes . Finally, the samples were held at 67 C for 4 minutes and
then
held at 4 C. Approximately 10 ml of each reaction were run on 0.8% agarose
gel,
and bands (usually 500bp or larger) were excised, purified with the Qiaquick
Gel
Extraction Kit (Qiagen, Valencia, California) and cloned into the TA vector
pGEMTeasy (Promega, Madison, Wisconsin). Clones were sequenced for
verification.
The band produced from the Xmnl Genome Walker library contained 1.5kb of
sequence upstream of the gene specific primer in SEQ ID NO:12. The eepl
promoter region was obtained using primers SEQ ID NOS: 13 and 14, created from
this sequence to amplify l kb of genomic DNA from maize line A63. These
primers
added a Hindlll site at the 5' end, an Ncol at the start of translation, and
an EcoRV
site just upstream of the Ncol site. These were added to aid in future vector
construction. The PCR reaction was performed in a Bio-Rad iCycler (Hercules,
CA)
thermal cycler using PCR supermix High fidelity (Cat# 10790020, Invitrogen,
Carlsbad, California). The following cycle parameters were used: 94 C for 2
seconds,
followed by 30 cycles of 94 C for 20 seconds, 55 C for 30 seconds, and 68 C
for I
minute. Finally, the samples were held at 67 C for 4 minutes and then at 4 C
until
further analysis. The PCR products were then cloned into the pGEM-T Easy
vector
(Promega Corp. Madison, WI). Clones were sequenced for verification.
Example 14 - Isolation of eep2 Promoter Sequences
The procedure for promoter isolation is described in the User Manual for the
Universal Genome Walker kit sold by Clontech Laboratories, Inc., Palo Alto,
California. Genomic DNA was prepared by grinding leaves from Zea mays B73
plants at V6 stage in liquid nitrogen, and the DNA prepared using the PureGene
DNA isolation Kit (Gentra Systems, Minneapolis, Minnesota). The DNA was then
used exactly as described in the Genome Walker User Manual (Clontech PT3042-1
version PR68687). Briefly, the DNA was digested separately with restriction
enzymes Dra I, which generates blunt-ends. The DNA was extracted with phenol,
then chloroform, followed by ethanol precipitation. The Genome Walker adapters
were ligated onto the ends of the restricted DNA, to create a "Genome Walker
Library."
-105-
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
For isolation of specific promoter regions, two non-overlapping gene-specific
primers (27 bp each in length) were designed complementary to the 5' end of
the
maize EST identified from sequence databases. The primers were designed to
amplify the region upstream of the coding sequence, i.e. the 5' untranslated
region
and promoter of the chosen gene. The sequences of the primers are given below.
The first round of PCR was performed on the Genome Walker library with
Clontech
primer AP1 (Sequence ID NO: 15) and the gene-specific primer 1 (GSP1) with the
sequence AAACACCTTCGGATATTGCTCCCTTTT (SEQ ID NO: 21).
PCR was performed in a PTC-200 DNA Engine thermal cycler from MJ
Research Inc. (Waltham, Massachusetts) using reagents supplied with the Genome
Walker kit. The following cycle parameters were used: 7 cycles of 94 C for 10
seconds, then 72 C for 3 minutes, followed by 32 cycles of 94 C for 10 seconds
and 67 C for 3 minutes. Finally, the samples were held at 67 C for 7 minutes
and
then at 8 C until further analysis.
As described in the User Manual, the DNA from the first round of PCR was
then diluted and used as a template in a second round of PCR using the
Clontech
AP2 primer (SEQ ID NO: 16) and gene-specific primer 2 (GSP2) with the sequence
TCTCGCATTTGCAGAAACGAACAACGT (SEQ ID NO: 22).
The cycle parameters for the second round were: 5 cycles of 94 C for 10
seconds, then 72 C for 3 minutes, followed by 20 cycles of 94 C for 10
seconds, then
67 C for 3 minutes. Finally, the samples were held at 67 C for 7 minutes and
then
held at 8 C. Approximately 10 pL of each reaction were run on 1.0% agarose
gel,
and PCR products 500bp or larger were excised, purified with the Qiaquick Gel
Extraction Kit (Qiagen, Valencia, California). The band produced from the Dra
I
Genome Walker library contained 1.0 kb of sequence upstream of the GSP2
primer,
and it was cloned into the TA cloning vector pCR2.1 (Invitrogen, Carlsbad,
California).
Clones were sequenced for verification. The eep2 promoter region was obtained
by
PCR from the plasmid using primers corresponding to a 1027 bp region from
downstream of AP2 primer and upstream of the ATG start codon. Clones were
sequenced for verification.
The EST distribution for eep2 is as follows:
- 106 -
= CA 02521497 2009-08-12
WO 2004/090143 PCT/1JS2004/010064
o p0083.cldeu53r B73 "Kernel" "" "7 DAP whole kernels"'
o p0124.cdbmg47r B73 "Kernel, Embryo" "" "6 day embryo sac, Screened
1"
o p0062.cymab46r B73 "Kernels, Endosperm" "" "coenocytic (4 DAP)
embryo sacs,"
o p0106.cjlps68r B73 "Kernel', lit, 115 DAP whole kernels, screened 1"
o p0l24.cdbmg2lr B73 "Kernel, Embryo" I'll 116 day embryo sac, Screened
1"
o pOlOO.cbaab57r B73 "Kernel, Embryo, Endosperm" "" "coenocytic (4
DAP) embryo sacs, screened 1 (original lib
P0062)"
o pOlOO.cbaacl9r B73 "Kernel, Embryo, Endosperm" "" "coenocytic (4
DAP) embryo sacs, screened 1 (original lib
P0062)"
o p0062.cymal89r B73 "Kernels, Endosperm" "" "coenocytic (4 DAP)
embryo sacs,"
o p0062.cymai74f B73 "Kernels, Endospermll I'll "coenocytic (4 DAP)
embryo sacs,"
Here is the Lynx data for this gene in PPM:
Name PPM Title
1
Cen6lm 10261 B73 endos erm, 6 DAP embryo sac
Cdk8lm 457 Corn whole kernels, embryo and endosperm, 8DAP
Cpdl-ctr 395 Corn pedicels control
C d1-dr 375 Corn p edicels drought-stressed
CenBlm 312 Corn endosperm 8 DAP
B73, 5 DAP pericarp
Cper5lm 8
Cebho4lm 5 Corn embryos AskcO, 15 DAP
Cenl2lm 2 Corn endosperm 12 DAP
These data are very consistent with limiting this gene's expression to the
developing
seed.
All publications and patent applications mentioned in the specification are
indicative of the level of those skilled in the art to which this invention
pertains.
Although the foregoing invention has been described in some detail by way
of illustration and example for purposes of clarity of understanding, it will
be obvious
- 107 -
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
that certain changes and modifications can be practiced within the scope of
the
appended claims.
-108-
CA 02521497 2006-05-17
SEQUENCE LISTING
<110> Pioneer Hi-Bred International, Inc.
<120> Modulation of Cytokinin Activity in Plants
<130> 31539-2201
<140> CA 2,521,497
<141> 2004-04-02
<150> US 60/460,718
<151> 2003-04-04
<160> 39
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 1919
<212> DNA
<213> Agrobacterium tumefaciens
<220>
<221> CDS
<222> (690) ... (1411)
<223> ipt
<400> 1
ggatcccgtt acaagtattg cacgttttgt aaattgcata ttaatgcaat ctggatgttt 60
aataacgaat gtaatggcgt agaaatatgt attttattgt atttatcttt cactatgttg 120
aagtttgcaa taatatgcta atgtaaaatt aaaaaattat gtactgccgc atttgttcaa 180
atggcgccgt tatttcaaaa atatctttga ttttgttacg aggacaacga ctgcaggaag 240
taaataaaag acgctgttgt taagaaattg ctatcatatg tgcccagcta tagggccatt 300
taagttcaat tgtgaaatag ccgcccttat tttgacgtct catcaaatca aatattaaaa 360
aatatctcac tctgtcgcca gcaatgatgt aataaccgca gaaaagtgag agtaaatcgc 420
ggaaaaacgt cgccgagtgg catgaatagc ggcctccgta ttgctgattt agtcagcttt 480
atttgactta agggtgccct cgttagtgac aaattgcttt caaggagaca gccatgcccc 540
acactttgtt gaaaaacaag ttgccttttg ggaagaacct aaagccactt gctcttcaag 600
gaggaatatc gaggaagaga atataacagc ctctggtaca gacttctctt gtgcaaaaat 660
caatttgtat tcaacatatc gcaagaccg atg gat cta cgt cta att ttc ggt 713
Met Asp Leu Arg Leu Ile Phe Gly
1 5
cca act tgc aca gga aag aca tcg act gcg ata get ctt gcc cag cag 761
Pro Thr Cys Thr Gly Lys Thr Ser Thr Ala Ile Ala Leu Ala Gln Gln
15 20
act ggc ctc cca gtc ctc tcg ctc gat cgc gtc caa tgc tgt cct caa 809
Thr Gly Leu Pro Val Leu Ser Leu Asp Arg Val Gln Cys Cys Pro Gln
25 30 35 40
cta tca acc gga agc ggg cga cca aca gtg gaa gaa ctg aaa gga acg 857
Leu Ser Thr Gly Ser Gly Arg Pro Thr Val Glu Glu Leu Lys Gly Thr
45 50 55
1
6090811.1
31539-2201
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
act cgt ctg tac ctt gat gat cgc cct ttg gta aag ggt atc att aca 905
Thr Arg Leu Tyr Leu Asp Asp Arg Pro Leu Val Lys Gly Ile Ile Thr
60 65 70
gcc aag caa get cat gaa cgg ctc att gcg gag gtg cac aat cac gag 953
Ala Lys Gln Ala His Glu Arg Leu Ile Ala Glu Val His Asn His Glu
75 80 85
gcc aaa ggc ggg ctt att ctt gag gga gga tct atc tcg ttg ctc agg 1001
Ala Lys Gly Gly Leu Ile Leu Glu Gly Gly Ser Ile Ser Leu Leu Arg
90 95 100
tgc atg gcg caa agt cgt tat tgg aac gcg gat ttt cgt tgg cat att 1049
Cys Met Ala Gln Ser Arg Tyr Trp Asn Ala Asp Phe Arg Trp His Ile
105 110 115 120
att cgc aac gag tta gca gac gag gag agc ttc atg agc gtg gcc aag 1097
Ile Arg Asn Glu Leu Ala Asp Glu Glu Ser Phe Met Ser Val Ala Lys
125 130 135
acc aga gtt aag cag atg tta cgc ccc tct gca ggt ctt tct att atc 1145
Thr Arg Val Lys Gln Met Leu Arg Pro Ser Ala Gly Leu Ser Ile Ile
140 145 150
caa gag ttg gtt caa ctt tgg agg gag cct cgg ctg agg ccc ata ctg 1193
Gin Glu Leu Val Gln Leu Trp Arg Glu Pro Arg Leu Arg Pro Ile Leu
155 160 165
gaa ggg atc gat gga tat cga tat gcc ctg cta ttt get acc cag aac 1241
Glu Gly Ile Asp G1y Tyr Arg Tyr Ala Leu Leu Phe Ala Thr Gln Asn
170 175 180
cag ate acg ccc gat atg cta ttg cag ctc gac gca gat atg gag aat 1289
Gln Ile Thr Pro Asp Met Leu Leu Gln Leu Asp Ala Asp Met Glu Asn
185 190 195 200
aaa ttg att cac ggt ate get cag gag ttt eta atc cat gcg egt cga 1337
Lys Leu Ile His Gly Ile Ala Gln Glu Phe Leu Ile His Ala Arg Arg
205 210 215
cag gaa cag aaa ttc cct ttg gtg ggc geg aca get gtc gaa geg ttt 1385
Gln Glu Gln Lys Phe Pro Leu Val Gly Ala Thr Ala Val Glu Ala Phe
220 225 230
gaa gga cca cca ttt cga atg tga to gattgcacca gttttgtttc 1431
Glu Gly Pro Pro Phe Arg Met
235
agacttgtcg ctatttgaat aagatgttcg ttctttgttg tgttggtgtg ttgtgataga 1491
ggcaagtggt ttgaaacttg tttttactgg tttattttca gtctcttgga cgatgtttta 1551
caaatataat attgtgaaaa ttgtggtttt atattcgtag aacgaaataa atggtaagta 1611
tagccgttat caaaatttag caaaaattgt taaaggttct tttatgcggt gaggttgtcg 1671
aettttcatc attgtegcgt aaggagttac ggatatccat aactgtaaaa acgccgcaga 1731
atttacgggt ggtgcattta gtttgccgtt caacatgatt ttggcaatag ttggtaacca 1791
agcactagcc aaccgttcga taatcactta atcgatggaa ccgttcagct ttcettcgtg 1851
aggctgctct tgatgatgag ctgccgtcta gtttttataa cgccgggtta cgcattatag 1911
acaagctt 1919
<210> 2
<211> 239
<212> PRT
2
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
<213> Agrobacterium tumefaciens
<400> 2
Met Asp Leu Arg Leu Ile Phe Gly Pro Thr Cys Thr Gly Lys Thr Ser
1 5 10 15
Thr Ala Ile Ala Leu Ala Gln Gln Thr Gly Leu Pro Val Leu Ser Leu
20 25 30
Asp Arg Val Gln Cys Cys Pro Gln Leu Ser Thr Gly Ser Gly Arg Pro
35 40 45
Thr Val Glu Glu Leu Lys Gly Thr Thr Arg Leu Tyr Leu Asp Asp Arg
50 55 60
Pro Leu Val Lys Gly Ile Ile Thr Ala Lys Gin Ala His Glu Arg Leu
65 70 75 80
Ile Ala Glu Val His Asn His Giu Ala Lys Gly Gly Leu Ile Leu Glu
85 90 95
Gly Gly Ser Ile Ser Leu Leu Arg Cys Met Ala Gln Ser Arg Tyr Trp
100 105 110
Asn Ala Asp Phe Arg Trp His Ile Ile Arg Asn Glu Leu Ala Asp Glu
115 120 125
Glu Ser Phe Met Ser Val Ala Lys Thr Arg Val Lys Gln Met Leu Arg
130 135 140
Pro Ser Ala Gly Leu Ser Ile Ile Gln Glu Leu Val Gln Leu Trp Arg
145 150 155 160
Glu Pro Arg Leu Arg Pro Ile Leu Glu Gly Ile Asp Gly Tyr Arg Tyr
165 170 175
Ala Leu Leu Phe Ala Thr Gln Asn Gln Ile Thr Pro Asp Met Leu Leu
180 185 190
Gln Leu Asp Ala Asp Met Glu Asn Lys Leu Ile His Gly Ile Ala Gln
195 200 205
Glu Phe Leu Ile His Ala Arg Arg Gln Glu Gin Lys Phe Pro Leu Val
210 215 220
Gly Ala Thr Ala Val Glu Ala Phe Glu Gly Pro Pro Phe Arg Met
225 230 235
<210> 3
<211> 2085
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1) ... (2085)
<223> zag2.1
<400> 3
agcttcgtgt gttccttcga tcggtcacag tttgattcct gctcaccaca tatttttgcc 60
gcgtgggagg gaggccacga ctggtggcag aacagcgaga ggcagactac ccttacagcc 120
ttaataactc ttatatcttc tactataaca tcaaaataag acgtagtgtg gtggatatgt 180
tgtctctaat ttagcagcag gtcttgagtt tgattcacaa ttcttgcaga tttatttttt 240
gagccataac agggatgagg gcaaaatagg aaatgaacga catgttaccc ttaccgcctt 300
aataagtagt agagatatcc agtttatacg taattattat tatataaaat gcactgcaca 360
tatattacta ttaccagttt tcttggacat gcacagcaga aaacacgcac acgcagagag 420
gaaaaggaga ggccataaac caaaaggctt taagaatata tgtaaagata tgtctaaatg 480
gctatatctg gttaagcaag ataacagggc tctggtcatc agtagtagtg gccttttgcc 540
cttgcccctc atctctctca cacctctctt ttctcagcct tgcttccgat cgatggatcc 600
catcccactg ccatagtgcc atcctttctt tcccttgcgc gcattgccta gccggccggc 660
cggcctgcta ttaaaccact ttacccccct tctcgttcac gctcgacgca gctccctttt 720
ccttgcttgc ttattgcaag tctctgcaag aacctgctag agaggaacaa ggtagaatag 780
tatcgctttt tccatctaga ggttatctct ttttacatga aaaatttcag ccgtattttc 840
gttctccata tatcagtcct gcgataatat aaatacgcgc gtcttgtgtg atccggcata 900
tgtatagttc ctactaactg atcgagatcg ctctcgtttg tactttctcc ctttgaggaa 960
3
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
agagttcccc tttttctgtg cttcaaattc ttgtaaggaa aaccatgcct gcctgccagc 1020
ttcttctgct acttggatga tgattcttat ttgcttactt gatttccgtt tttttttctt 1080
gctttctata tgtatgtatc tgggctgtct tcccctgcgt ctcgttacta cgtactaagc 1140
tttggaaggt ttcaactctt tgtatacgat gaggtttctg cccctagtag cagatccgcg 1200
cacgactaga tgtttgagga aaagaaaagg gcaagacgct atatatatat gcagcacgca 1260
gtcgcacata tatccagttt tccaatctgc ctcttgcttt atgataattc aacttgcgct 1320
gattatattc ttggctacct agctagaaat gtctaattaa actttgtttg ctagctagat 1380
tttgttgctt cttttcgcat ctgatctttt tatctcttct gagtgctccg caaagccttc 1440
cagtgttgaa gaagctgctg gaagaagaga tgagctttct cttgaaggaa aaagagatga 1500
tcattgccgg tttgttgttg tttcgtgttt ttttagcttc ttgtccccca tttatattcg 1560
cgcctaatga acgagcccgt agatcttgtg ttcttgtggc tggttttgtt ggatctcgat 1620
ctcggttacg tttacatgag tcttgctgcc taacatacat ctgtgttctt tttctaggct 1680
gcgagaaact taactgatcg agtctgtctg gcaggcatcg atctatccag tcgtcagttc 1740
gtcacatccg ctttttcgta tatatcatct tcagattttg tccatctgtc aaatcatgga 1800
aaatctgtcg tctttccttg tattctcttc tgttattcct gctgcctccg gcggaccaat 1860
tcttgaatcg acccgtgttc ctattccctt ttgttagaca gcccaaatcg cttgctcgat 1920
cgtagtgtac tgtactactg cggctagcta gatcttccaa gctagctata gttcgccggt 1980
ccctttgatc tgcttcacag aacatatata acacttgaac tcttttacgc ttatgagaaa 2040
acttgctgct tgctgctttc agctggtatc gtcgccagcg gatcc 2085
<210> 4
<211> 344
<212> DNA
<213> Cauliflower mosaic virus
<220>
<221> enhancer
<222> (1)...(344)
<223> CaMV35s
<400> 4
tctagaaatc cgtcaacatg gtggagcacg acactctcgt ctactccaag aatatcaaag 60
atacagtctc agaagaccaa agggctattg agacttttca acaaagggta atatcgggaa 120
acctcctcgg attccattgc ccagctatct gtcacttcat caaaaggaca gtagaaaagg 180
aaggtggcac ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt caagatgcct 240
ctgccgacag tggtcccaaa gatggacccc cacccacgag gagcatcgtg gaaaaagaag 300
acgttccaac cacgtcttca aagcaagtgg attgatgtga tgct 344
<210> 5
<211> 2198
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(2198)
<223> ZmMADS
<400> 5
cctttttctt tttctccaca acatgaacct tactagaaca ctgccccact taaaagaatg 60
agggtagaac tcttgaatct tagggatttg aactccttgc agtacctcat aacaagggtg 120
ttacatgtcc ttcttctgct gttgctgctt gagcaggata tagagagatg accgacaccg 180
ggttgatctt gggacaacct tcttctcatc ttttcttcgt tgttttcttt tctattctca 240
ctaccttttt ctttctcttt gttcttccca ctggaggatt ctatcaaaaa gtattaccat 300
catacagagg aggaacccga agactatgaa ccatgtacaa cagtcttcaa cccaagaatc 360
accaagcatt gtgatcttag gggcgaggga gtggaaaatg gagttgcttg tgatttggca 420
gagggaattt tatcaggagt gttttgcttt gagtggaatg ggaactgagg gagttgttgg 480
gggggggggg tttataggcg agtgggagtg ctcgggtgcg gagtgtggtg atggaacagg 540
tgacatgagg tagcaggtcg atggaggggg gctgttgccg gcgatgatgg cggcggtggg 600
tgcgctgcaa aggagggcgt ggggcggtgg tagtgcgcat ggaggcgggc acgcgtgcgg 660
ggggcacaag tgagtggtgg ggtcgatgac cctgatgttt gtggtctctg gttccaagaa 720
tctttgtctc tctttatgat aataacttct tttgtcgtcc ttttctgttt actttgactc 780
4
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
aggggcagtg ctttgattct cacggtcggt ccttttgact gagtgactgg acattttttt 840
tctgtagcat tgtacaacat gtactttgtg caagctacaa ggccacattt tttgaagcat 900
agattctttc ccccaaacaa tttatacaaa tatgcaaggc tacacttctt gtatttctat 960
aacattgtac attcatgaca gaagcccaaa agcttgtaaa ttttgtgcag gtttaattca 1020
tgtaaagttc ccttgtagag tcatgacaac atcttactat aaaattattc taaaaaaacc 1080
acacatgacc cccatgttat ttggtgacaa tacagaaacc acacatctag tgatgatata 1140
acactgtaca gaagccacaa attataatat ataaaacact atacaaagta tccaaataaa 1200
gcctaatagg tatggagggt aacctgaatc tttcctaata ataatgaata atctacaata 1260
atgatttgtt tggacaaaca gaattaaacg gtattgagtg ggctaaaatt ccttgttatt 1320
caaaaccctc aatcacagtt tctccgaagg aaaaagaaac aggggaggac actcaggctg 1380
ttcacaatag gtatttcata tcgctctttc caacaatgcc acatcatcaa aagtgttatg 1440
aaactaaaaa tgaaataata cttctcaatg caaactttca ttttcataga ttaatatact 1500
aattaaatga tgcaactaaa taaccaatag atgttagtaa aatatggtaa gattaaacaa 1560
accactatca atggacattt cacatagttt ccaagacttt gaaaacgggt tgacatgatt 1620
tcatccacat caaactaatt ttatctctga aacccattca ttttaaatga tatggcataa 1680
cgtccaaaat gctgacgtga cataccatta aatgtgcatg aaactcccat aaaactttta 1740
ttgataatag cctcacagac atccggtcct acacccgtgt ggacccatca gccagacgcc 1800
ctgcagcaaa cgcgacgttt gacttgccat ctcgctccct tatgcccgac cgaccctgga 1860
aggctggact ggaactggaa caagcaaaat ggaaaaaacc atatctcacc actgaaccgc 1920
acccttccgg cccacgccag gctcgaccaa tccctgcccc gcgcgccctg acgagcgcat 1980
cactcgaacg ccggcctcgc taggcccatc cttctggccc gcaataacga tccccgtcat 2040
gatccgacgg tctagctgcc tccacgccgc tccaaaaccc ccgcgtccaa tcaaaacacg 2100
acagcgggac gagcgaaacc accgtggttt cgccaaaccg ctttccttcc catctaaaac 2160
cgccccctcc CttCCtCttC tcctagctct cttgcctg 2198
<210> 6
<211> 1470
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(1470)
<223> ckxl-2
<400> 6
gagctcgccc ttgcatgctt gagtcatatc ttggaaaaaa aaactgtaac ttaaagtatg 60
atctatatat ggattatttg gatgggatgt cattttcgta tcaccaacca aaattacagt 120
ttggtcgtgc gtagaaattc tacctactag ctgaaacaac ggctgctatg tataactact 180
ggtactggaa agaatattag tcattgactc aaaattagaa tgcatgtgta agtcatgcgt 240
gctaatttgt tctatcagca ttcggcgaat tccgaagtcc gtacgtgttg ttcgtggagg 300
agaggaaaac atcagaaatg acaaaactag acggcgtgtg cttctacact gaattcatca 360
acatttgttt tacttttact agagaatggc atcagatgga aaaccgctga aaaaacaaga 420
aaacaattgg accccaaata tgtacagacg ctagctatag CCagCCaCac tgaagttgac 480
atgcggcaac tagctaacca ccttctctga aacactaaca tttgtacctt ggtcgtgtaa 540
gtgtagttag taacgtatgt tgacgcgact taccgaacaa aaatataatt gtcccaatca 600
agctagggac gattgtttgt ttccaaaatg ttgccatttg cttaatcaat cctatattga 660
ttcatggctg ttaaggtgag ataaagcgac aagaaatctc tctctatata tatatataag 720
atcccgaagg ctagcgacat ttttgatagc aaaatatgag aagttggcag gttctggtag 780
caaatcaaat aatatggcca gaataatcgt ggctagcttg attaaacctt cagcttggtg 840
tattttggaa gtcgaccaac cagctgggcc ggggctcgtc gtagtaccaa aattacagcc 900
tgcttccttc gtcgtcctgt acgtaatgca gtacagctgt ctgtctagta gagacgattt 960
tgagcaggca cacacattaa gtgataacat aaaagacggc ttcattttat ttcataacca 1020
aacgatatgg tcaacacaca cctatagcta ccaaatttgt acaactattt agtgcgaaaa 1080
ctatttcatt ctcaagaatt gatcgcttat atttattatt acaggttttt aaatgtataa 1140
atacgctata ttgcatggca aaagggggta ataattaggc aggactatat atataatagt 1200
tttttttcct ttaaattctt gggaggatgg taaagttggt aactaggcac cttgtgcgca 1260
tatttttctg tggtcaaaca gaataaaact agacgggatg cagaattttt ttttccttgg 1320
aaagcagctc atctctgtgt tcgagtacgt aattgaagaa gtatgtgatc gcactacacc 1380
tacacgtatg tgccgccgta tccgtcctat atatatacgg ggtgcaatca cctagttacc 1440
aaacactcac acataagggc ggatccatgg 1470
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
<210> 7
<211> 960
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(960)
<223> eepl
<400> 7
tcaaaccggt catcgtttgt atcatccact gcttgacttg ggaagaagtt aagaacttgg 60
taagacagct gtgagggtgt gacccaacta acccataaat acattttctc caattagtaa 120
attagttttt ttttcttggc ttgattgatg aatcattcaa gttggcatga taagattttg 180
ttcagttatt cgtgtgtctt atgtatgaaa agtgattgaa aaaaattatg gatagttttg 240
acttgctatg gatttaatta cacctaatcg cctccaatcc atatggattg gagggaacca 300
aacaagctct aaggttgata tccgcttcta tatatgctgc atgagcagtt tactgcttta 360
tttttctaca gatgggtcag tgatgaggat tggtgaatgc atcaggtcat tcaaataaat 420
ttttttaacg acagggttat gtaggtgatg acacaccata tattccctaa ctgcctgtct 480
agtgtctact aattactaac gggaaaattg cgtatgctca ttgacgtctc agctgtgcag 540
aagaatctcg gaacatttaa ttcacatata ttgatactac gtgctagctg gtgccatctt 600
cctagctgga tactacttat tgcatcaatt aatttctttt tttgttttct ttcaattgct 660
tccaaggtca aactgaatgc aaaccattac ttgttacaac ggtcctctcc atcctacgct 720
acgcctgatg tgatgtaatg taatcgaagc aagagcctta ttattgtata tttctgttcc 780
taccagggct tgcatggaaa actgccagcc tctcattata ttataaatat acgtatactg 840
atacacatac atgcacacca aaagtactca ggactgtcat ctctcagttg caattgcaaa 900
aaaaatacag agagagagag agagagagag agagatccct accctgcaaa gatatcgacc 960
<210> 8
<211> 1224
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(1224)
<223> end2
<400> 8
tactataggg cacgcgtggt cgacggcccg ggctggtaaa aagtaattga acccaaaata 60
tcatggtatg tttggtgaag acagtgatca gtgatttttt tatatctata tatatatcaa 120
agatacttga ttttctagaa ggttcttttt gttgttttcc cttatgtttt tacgcatgat 180
gcaattcttt ttgagaggtt tccgatgcat tgatgttatt gtattatctc ctatatatag 240
gtcgacgtac attatgtatt gcaataacca gttaactgga tccagcttcg cttagttttt 300
agtttttggc agaaaaaatg atcaatgttt cacaaaccaa atatttttat aacttttgat 360
gaaagaagat caccacggtc atatctaggg gtggtaacaa attgcgatct aaatgtttct 420
tcataaaaaa taaggcttct taataaattt tagttcaaaa taaatacgaa taaagtctga 480
ttctaatctg attcgatcct taaattttat aatgcaaaat ttagagctca ttaccacctc 540
tagtcatatg tctagtctga ggtatatcca aaaagccctt tctctaaatt ccacacccta 600
ctcagatgtt tgcaaataaa tactccgact ccaaaatgta ggtgaagtgc aactttctcc 660
attttatatc aacatttgtt attttttgtt taacatttca cactcaaaac taattaataa 720
aatacgtggt tgttgaacgt gcgcacatgt ctcccttaca ttatgttttt ttatttatgt 780
attattgttg ttttcctccg aacaacttgt caacatatca tcattggtct ttaatattta 840
tgaatatgga agcctagtta tttacacttg gctacacact agttgtagtt ttgccacttg 900
tctaacatgc aactctagta gttttgccac ttgcctggca cgcgactcta gtattgacac 960
ttgtatagca aataatgcca atacgacacc tggccttaca tgaaacatta tttttgacac 1020
ttgtatacca tgcaacatta ccattgacat ttgtccatac acattatatc aaatatattg 1080
agcgcatgtc acaaactcga tacaaagctg gatgaccctc cctcaccaca tctataaaaa 1140
cccgagcgct actgtaaatc actcacaaca caacacatat cttttagtaa cctttcaata 1200
ggcgtccccc aagaactagt aaac 1224
6
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
<210> 9
<211> 1433
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(1433)
<223> lecl
<400> 9
tcctaatctt caaataacca tctcaaaagt tttttaaaac atcttttgag gatatgtatc 60
ccatagccct agagcgctaa attgactact tttaatcgat taaaaggtat tagacatcct 120
tacaagtcct aagtatcaaa tcaccttcta tcggctatac acaactaacg gaagttatct 180
ctagtcacac taacttatgt cggtttccgc atggcagatc aaaattagct aacttttgtt 240
ggctaataag agcaattcca aaagaacgtg taaactaatc tcaaaacaga tattagttaa 300
gaatagtaat ttttcttact ccaacagttc cctcagtctt ccccaaaaaa ttaagcgttc 360
cgcatccaca gCCtCCtCtc ggtcgtattt tggtgtgttt catccctccc caatccattt 420
ctcaacgtat cagatcatcc accgcctacg acgactgtac agtttgcgtc acatatcaca 480
tttaaaggaa ctgttggagt acccatcata attcactctt aaaaaatttt agcctgctct 540
caataatcaa ttgggggggt aaaattttta acatcctttc ggatctaatc caacttatgg 600
aagttagcta gctctggtcg cgctaacttc tgtcgatcgc ctattagcta atactccatc 660
tgtcccatta tataaggtat aaccaactct gattcaaaga ccaaaaatat acttaattgt 720
gtctatacca cttcatcgat gtacgtatgc atagaaagag cacatcttat attgtggaac 780
aagaacaaaa atatggttac gccttatatt ataagacgta gaaatcaatg gtttacaata 840
gccaagaata gatgttttta tttatttcct atatagatgt ttttatttat ttcCtatatg 900
tttcacaata gccttatatt gtgccgaaaa tttaggcaca cgtgccacga acgtctgaaa 960
tgtcgttcgc gcgtattacc atgcactacg acgtacgtag gagtatgtac gttgaaccaa 1020
gcacacatat atctctgaca cagtacaatg atatactaca acaacaacag tactgcccaa 1080
ttcatccatt ttcacgttcC atcttccgcg tgtgacaact cgatcggcca cgcacgcaga 1140
cgacgacgga gcagtacttc acagaatcct ccgccactcg tcacaccaac aggcgcgcgc 1200
tggtgcgcat gcatcatgtg catgccatcg tccgtccctt ggcgtgcctc ggtagacggt 1260
agctagagta gtagcctgtg cttgctaccc ctggtcaaca catcgtagcc tcctatattt 1320
aacgtatcct cacacatcac aagaacgaca cacagaaacc agtagccact actccatcca 1380
ccacgagcga gcgagcgata accctagcta gcttcaggat ccagcgagag ccc 1433
<210> 10
<211> 820
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(820)
<223> F3.7 promoter
<400> 10
gagctcaagc cgcaacaaca aatttcggtg ctcccaagct tcataaaggc tatcttcggc 60
gtcgttggga tccatggtgg cacagaatcg agttgatgtt gtagctggcg gctagggttt 120
gaagtggaga agaggtccgg ctggtggcat cctatcgtct attgagggtt gggtccggtg 180
gcatcatact tgatgacaat tgaaagtaat tttaatcaac ttgtcatgag tagtgagtct 240
tttataaaaa ataagctgaa ataagcaccc tttgatgagc ttataggatt atcataatct 300
caaatgctaa attatataat tttattagat aagttgcttg tttgtttccc cactagctta 360
tttacattgg attatataat ctacataaat tataatctca aacaaaaagt ccttaatcag 420
agatcagcga ggtctcacga gtgagaaggc gagagcttgt ccaaacgagc attttcgggc 480
gtgtgaacac ccatttcagc aaagccgtcg ttgtccagtt cagcgaagcg cattctgcgg 540
ctttggcgtg acccattctg ctagctcagc actgagaata cgcgtccgct gcagcgttgg 600
cgtacaggcc ggactacatt agccaacgcg tatcggcagt ggcaaacctc ttcgcttcta 660
actccgctgg gccaccagct ttgaccgccg cctcccttcc cctccgctac tgctcctccc 720
caccccactc ccccgcagga gcggcggcgg cggcggcgag gtcgtacccc acatcggcga 780
gcggcggcgg caccgccgga ggcaaaggca agtctagaac 820
7
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
<210> 11
<211> 26
<212> DNA
<213> Zea mays
<400> 11
gtcagtggtg taaaagcact tctggt 26
<210> 12
<211> 26
<212> DNA
<213> Zea mays
<400> 12
tgcgccagaa gaagcagcag gaagat 26
<210> 13
<211> 26
<212> DNA
<213> Zea mays
<400> 13
aagcttaggg tacctcaaac cggtca 26
<210> 14
<211> 34
<212> DNA
<213> Zea mays
<400> 14
ccatggtcga tatctttgca gggtagggat ctct 34
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Clontech APl primer
<400> 15
gtaatacgac tcactatagg gc 22
<210> 16
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Clontech AP2 primer
<400> 16
actatagggc acgcgtggt 19
<210> 17
<211> 1679
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(1679)
8
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
<223> tbl promoter
<400> 17
gcggccgcct acctaataga tatgtatcac tctctcctca cttCggctat aaaagagagg 60
gatagagaaa catagaatgg gtttcgaaaa aaactctttg actctctaaa tagaaacaag 120
aggaaaggga agttagttgg tcattatctt tgttgatgcc tcaacatgta attttcttcg 180
ccattgtatt tctcaatcca ctatatacaa agaggttata gggtatatat tacacatctt 240
acggtccgaa cctatattta aattacccat gtattgatgc ctaggcggta tccagcaaca 300
gagtgtctct agcacgcatc tcttactcta tttatcaact ctcccccgaa tacatgtggt 360
tccttattgt cactggcgga tctacagggt gtcaccctgt agtccggtac cggcataaca 420
tattagcttt gtctatttca tgacttcaaa catgttgcaa caaccttcag atgcgttcag 480
tctatctata tacaagagga agaatacaag tgacaaatct aatttgtgaa tataagaatt 540
attatgctgg tttacataga ataccaaatt atagcacaca tttatcattc cttattgaat 600
ttctaaatgt atttcactga atttttcatg catttttaat ttggcatacc ttatagtaaa 660
attctataac Cgctactgot tattgtcatt atgCgacttg gaagacattt tctacctact 720
gaaagcggtc tgttttttgt gttgtcgaga gtgtgatggg taaccatagt taataatgca 780
ctgcatctat cactactcat acaggtccca tatgcctaat aatgttgtga agaccaactc 840
atctgaccac atctgtccct accatgcttg tacaccacac tacatacatc actcatcact 900
ggtccttcgt ttcggtaccc tcctcccaca atgttcaatg tatatactaa tagttctcaa 960
ataaattcct gtggatgtta caaaaaccca cggtctttgg tttcctgaag aagtatttca 1020
tggaggcgcg cacgtccatc gtactgcgtc ctgcagctat ggccgccccc atctggccaa 1080
taaatgtact aggtcacttg tagccaatag cgtttcaaca tgcacacagc ttttccccca 1140
atagtgcagg tccttgtatt ctcctccctc tccctcacCt caaatctcat ccacacgaac 1200
aggcggcacg gcagtattcc tccacagccc tcctctctat aagatggcac agccctctca 1260
ggtaggggcg agtgtCtcac tctcacatag taaaaaaaaa aaaaacgccc ccaaggttct 1320
taagcacaat tctctagcta tcttggtctc ctacacagcc tatgcacatg agcccatgcc 1380
tctcctctcc ttgcgcctgc atagagaggt ggtatgatca cctggaaagt ttttaactct 1440
CtctCtctct ctctctctct ctctctctta caagcctaga ccttatgcat ggtcggacgg 1500
acacatctga tcataggaca tatgagtagg ccacactcct CCtgccCCtc tctcgtagag 1560
atcaacacac actgctctta gtgccaggac ctagagaggg gagcgtggag agggcatcag 1620
ggggccttgg agtcccatca gtaaagcaca tgtttccttt ctgtgattcc tcaagcccc 1679
<210> 18
<211> 1027
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(1027)
<223> eep2 promoter
<400> 18
gtaaagttac aattatatat caaatgccag Ctactagtcg ggagaaaacc aactaagggg 60
atgtttgttt gggattgtaa tctgtccaga atatataatc caacaaattt tgaactaaca 120
ctcggttcaa aatttattag attatataat ccatacatat tacaatccca aacaaacacc 180
cctaattcta aatggtgaga gtaaaaagcg ctgtctaata acttttatca gctaatttgt 240
ttatcttgag ctgttaatta aaccattagt gaagtttttt tggggggtgg tcgaatagag 300
ctaatctaac tattagctca taggatcaag gccattggtt taatttcacc ccactatgac 360
tatgtcccag taactaaata ctatatttgt caccataaac tttggaagaa attagttgct 420
actagaaaga agatccaaac ctggaaaaaa ttagtttcta ctagaaagca gatcatgtct 480
gctacccaga cattgattta tactccagca tcaaccaacc ccgtacttgt tactacaaaa 540
ttggaagaaa ttagttgcta ctagaaagta gataatttct gccaccagat attgatttat 600
aacctagtat caatctctac tagccttgct tccgtcattt gttgctagat ataaatggtt 660
ttctttcaca tatgtgagtg tatatatatg aaccttgcag caaccattat attcggtagt 720
caaacaaagc cctacagaca tcgatctctg atctgagaaa aaaaatcctt atatggcgag 780
aattacaatg gaagcaagca aggctgtcct gctcttgatg gtgatcctag gaagtttgat 840
gattcccgca tactgtaagt gcacatcggg caaccatgcg catttgaatc aagttacata 900
ttatacagtt tcttactagt agtaaatata aattgttcgc ataatgtcaa caaccttaac 960
ttactgtaaa aacagtaact gaatgccctt attgcatgca gctcggaacc ttgttcgttt 1020
tctgccc 1027
9
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
<210> 19
<211> 723
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(723)
<223> trxl or thxH promoter (thioredoxin H)
<400> 19
gcccttacta tagggcacgc gtggtcgacg gcccgggctg gtactctctg gtactgagtt 60
agatttggtg aatgttaata catatatact tttaataaaa ttacttttta agacaaaatt 120
gatgcactgg cgttcattgg cggctgtgtt aacaaaaccg aagtggaagt agcccgttcc 180
actggaggtt ggcttaagtg cacatgcagt gaaaataacg ttccacttgc gattcattta 240
acacaactgt cagtataaat agtttttttt attggcggtt gatttaggtg aaccccaagc 300
gaaaatatat ttacacatgc ggttttttaa gccgtgCtca cctatttatt ttcagtgtgc 360
ttaactgaaa ctgtcggtat atatttttgc gtgccatcag tttagagcac ttatctactg 420
actttttttt tcaagtatcg tacggatttt gcaccacgtc gacgaccgtc gataacgagg 480
cacgccgatc tagagagctc gaagacctgg gaatggcaca ggggaccggc cggagcccgc 540
cggcgccatg caagctgcct cgatcgcggg cctcgaccta agtagcccgt ccctgtcgcg 600
cgccagtcgc tcgctgcgcc tataaaagcc gcccgcggct cgcgtaggct accagcgcaa 660
aactctgcca agggcttcgg atcccacacc gaggaaagga gaagagaggg tcggaatacc 720
atg 723
<210> 20
<211> 1626
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(1626)
<223> Zm40 or Mze40-2 promoter
<400> 20
aagcttagct agatcatttg taagaatgca acttgttcat atagcatggc tacagcctac 60
atcatctgaa atggacctgt ttataggata cctaagctca attcacccta tatctaaaac 120
ctacgaggcc taaacacacc cgtcctcaag aaaacgacca aaccaaacca aaccatgcgt 180
ccgtgtcatg gttttgtaga cacgtttacg tatcaattat actgttctga ttttttatat 240
tctcctaatt atttagagct aaatttattt ttatgatagc agagatctaa atatttttgt 300
tttgattttt tatatactaa aatcatctct acaatattag agattttaaa tgctcagaag 360
aattttactt gaattaaaac ctttactgat ttttaactaa aacggagacc aaaagaaatc 420
tatccaaggc tgcctctaag agccttcgtg tctcgttttc ttatttcaga cttcactcat 480
cttcttattt caggctccac tatataaggt ggtctctagt atctttccta tcacatatcc 540
tatttaaaac tttagtatat aaaacattat aattcataat ataaatCgat tattttacac 600
gatctcagcc taaaagcggt aatatgcacg ctctgagcat ggcccaagct ccacgttaac 660
cgttctgtca aaaaaaaaaa catctattct agaatggaaa acacacgatt ttagaagtta 720
ggactagttt ggcaactcaa ttttccaaat gattttcttt cttttaagag gatttaattt 780
attttttggt aaaataggaa tcactagaaa ctctattttt tcaagagaaa gtaagctatt 840
tttttagaaa aataaaaaat cccttaaaaa atattgttcg taaattagcc ctaagatgga 900
ctaaaaatct ggttttatag aatagggagg gatcgagcaa ccgccaaatc tacgcgccaa 960
aaaggtacct tttccgtgaa taaacacgac tgcggcgatc acgatctgat cgaactcgta 1020
gaataaaatg gagcagcgga atagtgtggg aggcacaagc acaggaggag ctgaaaccga 1080
accgaagtgg cgaacacgat ccccactccg gccggcaccc gagtgtgcga gacgtgtggg 1140
gctgatctga cgagcctgga agaagaagaa gaaaaaaaag tcctcacgct cctgcttggc 1200
tccatcgaca gctcactagc tgctaccgga tgctcgcgtc tctgatgcct ctcgattcat 1260
catccatcgt tggtggcggc ggcggggcgg caaaggttct gattccgcag cagccaagtg 1320
ctcctcctgc agacgaaaat gacggcagag gttggcgttg atccaggaga ctcatcagtt 1380
tagtttaata atgaatctgt agcaggcgct tcagtctctc atcggatgag cgagcagctt 1440
agcagagcag gtggtggtcc ctggctcgcc cccgtccatt ctttcccgcc cgtcctgccg 1500
tccactccgc cgcctattta tacccctcct cgcccaccct gccatcctca ccatcgcaat 1560
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
tcacaagcaa agcaatcaga gccaagcacc caccgtcctc ctttctttcc ttcgactcat 1620
caaagc 1626
<210> 21
<211> 27
<212> DNA
<213> Zea mays
<400> 21
aaacaccttc ggatattgct ccctttt 27
<210> 22
<211> 27
<212> DNA
<213> Zea mays
<400> 22
tctcgcattt gcagaaacga acaacgt 27
<210> 23
<211> 525
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(525)
<223> mLIP15
<400> 23
ctttcagcta agtccctgct ccctctcttt ttcttacatt caggtcctcg cagctcctct 60
cttttttctt gtttctttct ttcgatctgc gagccgtcca ggtccagtac tctCCtttcc 120
gtgaaggaac tcttgcagcc ggcccctctg gtttcctcga attcttgttc cccggtccct 180
cctcctgtcc ccgcgtagat ccgtccgtcc gaggagcaca ccgtccccac ccccatgttt 240
acccaccagt tCCtctgacg gCcgcCgtgC tccgatgaag ctgagcgtgc tccgtatccg 300
ccgCtcCCac tcCttctccg tcgccttcCt ctactggttC tacgtCttct catgaacgca 360
tcgcccctct ccacctgctg atccttcgcc atctctccat ctctctttct ctctgagata 420
gtCtttCgaa tCCatctcta gggctcttgt ttctccCCat cctcccccca ccccaccCCC 480
caccaaacac aagtcccctt gttcaatccg acaagacaag catcc 525
<210> 24
<211> 587
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(587)
<223> ESR promoter
<400> 24
gaattcgccc ttggtagatg tctagatgac ctattctact tttcctaaga ttttctctgt 60
atgagtaacc tgtcataatt taacttgtga gatcttgccg atataaaaaa aaaacgccag 120
tcatttatgg tacgggatta ataggttcca agaaccagcc acaatccatt tattagtttc 180
atataaatgt cataaatttt tactaaaatt ttctctgaat agtaacatgt cataactgaa 240
cttgtgagaa aaacgccagt tatttatggt acgggattaa taggttccaa aaaccagccg 300
taacctattt atattagggt actttaagct ggtgooctca gttttgttgg tgtcttcgtt 360
tttaaactta gttgtatttt ttttcttagt tctgtccttc tagtgttata gagcataagg 420
acaaaattga gcaaaaaatg actaaggata aaaatgagga tatcagaaag ggcagcagct 480
taaaaaacct tttatattag ttcaaaagga caccagtcta taaaaagtat actccaagca 540
catttgaatt tggatttgca ttgtcagtca ggccagtcaa ggggacc 587
11
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
16,.. .. ,. õ,õ ..... ... ....... _....
<210> 25
<211> 900
<212> DNA
<213> Zea mays
<220>
<221> promoter
<222> (1)...(900)
<223> PCNA2 promoter
<400> 25
atcgtaatcg gttttcaccg tataccgaac cgaaaaaacc gaataccaaa ctttatcaat 60
tcccaaattt gactattcga ttatgtgaac taattgtgtg atacaattaa attgttattc 120
acttatttgt atgtgatgta tgatgtatat ctaaatattt gtacctatat aatttttact 180
ttttaaaatt atatgtaatc tatcatgtaa acttgttgta tgtattgtct tgattataag 240
tttggtattc ggtttttacc gaaaaatcga agtaaaaaac cgaaaccgaa cttctcggtt 300
tttcattttc tagaaaaccg aacggtttct aatgtttgaa aaaccgaagt tttttaaaac 360
cgaaaaaccg aaccgaagtt tagaaaaaaa ccgaatgccc agccctaaaa attagtaccc 420
cataagaact aaaaaaagat aaaatgacta aaaattaatc agttgaaacc aaacctattt 480
tcccccacac ctcacggtat tgtttcgcat tccaagtttg aaacaCgact ggaaacaaaa 540
cccaaaacga ctggagggac cgagcttgtg ctgagcagca gagatggcgg gaaatgctgc 600
gtctcccgcc tcagtttcgg atgccccgcc ctttcccaaa ccggccaccg ccgccgcccg 660
tgtctcccca ccgacaggtg ggtccaatcc ttaaccacgg accagggccc ccacctgtca 720
ggtggacctt ccgaagcaag gatcggccag gcgggaaaac atttcgcggc aggtggcggt 780
tgcgccaaat ttctccctcc cttttccgtt cggcgtcccc aaacgcctcc ctattaatct 840
CCCCgCgttC CCCttCCCtC gcgc gccgc tCtCCCCtCC caaagctcgc CCCgCtCCCa 900
<210> 26
<211> 1560
<212> DNA
<213> Zea mays
<220>
<221> CDS
<222> (1)...(1560)
<400> 26
atg aag ccg cca tca ctg gtg cac tgc ttc aag ctg ctg gtc ctg ctg 48
Met Lys Pro Pro Ser Leu Val His Cys Phe Lys Leu Leu Val Leu Leu
1 5 10 15
gcg ctc gcc agg ctg acc atg cac gtc ccc gac gag gac atg cta tcg 96
Ala Leu Ala Arg Leu Thr Met His Val Pro Asp Glu Asp Met Leu Ser
20 25 30
ccc ctc ggc gcg ctg cgc ctc gac ggt cat ttc agc ttc cat gac gtc 144
Pro Leu Gly Ala Leu Arg Leu Asp Gly His Phe Ser Phe His Asp Val
35 40 45
tcc gcc atg gcg cgg gac ttc ggc aac cag tgc agc ttc ctg ccg gcc 192
Ser Ala Met Ala Arg Asp Phe Gly Asn Gln Cys Ser Phe Leu Pro Ala
50 55 60
gcc gtg ctc cac cca ggc tcg gtc tcc gat atc gcc gcc acc gtg agg 240
Ala Val Leu His Pro Gly Ser Val Ser Asp Ile Ala Ala Thr Val Arg
65 70 75 80
cac gtc ttc tcc ctg ggc gag ggc tcg ccg ctc acc gtc gcg gcg cgc 288
His Val Phe Ser Leu Gly Glu Gly Ser Pro Leu Thr Val Ala Ala Arg
85 90 95
12
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
ggg cat gga cac tcc ctc atg ggt cag tcc cag gcc gcc cag ggg atc 336
Gly His Gly His Ser Leu Met Gly Gln Ser Gln Ala Ala Gln Gly Ile
100 105 110
gtg gtc agg atg gag tcg ctc cgg ggc get agg ctc cag gtc cac gac 384
Val Val Arg Met Glu Ser Leu Arg Gly Ala Arg Leu Gln Val His Asp
115 120 125
ggc ttt gtc gat gcc ccc gga gga gag ctc tgg atc aat gtc ctg cgt 432
Gly Phe Val Asp Ala Pro Gly Gly Giu Leu Trp Ile Asn Val Leu Arg
130 135 140
gag acg ctg aag cac ggc ctg gca ccc aag tcg tgg acg gac tat ctc 480
Glu Thr Leu Lys His Gly Leu Ala Pro Lys Ser Trp Thr Asp Tyr Leu
145 150 155 160
cat ctc acg gtc ggt ggc acc ttg tct aat gcg ggg gtc agc ggc cag 528
His Leu Thr Val Gly Gly Thr Leu Ser Asn Ala Gly Val Ser Gly Gln
165 170 175
gcg ttc cgc cac gga ccg cag gtc agc aat gtc aat caa ctg gag att 576
Ala Phe Arg His Gly Pro Gln Val Ser Asn Val Asn Gln Leu Glu Ile
180 185 190
gtg aca gga agg gga gac gtc gtt acc tgc tca ccc gag gat aac tct 624
Val Thr Gly Arg Gly Asp Val Val Thr Cys Ser Pro Glu Asp Asn Ser
195 200 205
gat ctc ttc tat get get ctc ggc ggt ctt ggt cag ttc ggg atc ata 672
Asp Leu Phe Tyr Ala Ala Leu Gly Gly Leu Gly Gln Phe Gly Ile Ile
210 215 220
acc aga gca agg att gca ctt gag cct get cca gag atg gtg agg tgg 720
Thr Arg Ala Arg Ile Ala Leu Glu Pro Ala Pro Glu Met Val Arg Trp
225 230 235 240
ata aga gtt ctt tac tcg gat ttt gaa agc ttc acc gaa gac cag gag 768
Ile Arg Val Leu Tyr Ser Asp Phe Giu Ser Phe Thr Glu Asp Gln Glu
245 250 255
atg ttg atc atg gca gag aac tcc ttt gac tac att gaa ggt ttt gtc 816
Met Leu Ile Met Ala Glu Asn Ser Phe Asp Tyr Ile Glu Gly Phe Val
260 265 270
atc ata aac agg aca ggc atc ctc aac aac tgg agg gcg tcc ttc aag 864
Ile Ile Asn Arg Thr Gly Ile Leu Asn Asn Trp Arg Ala Ser Phe Lys
275 280 285
cca cag gac cca gtc caa gca agc cat ttc cag tca gat gga aga gtg 912
Pro Gln Asp Pro Val Gln Ala Ser His Phe Gln Ser Asp Gly Arg Val
290 295 300
cta tac tgc ctc gaa cta acc aag aac ttc aat agt ggc gac act gat 960
Leu Tyr Cys Leu Glu Leu Thr Lys Asn Phe Asn Ser Gly Asp Thr Asp
305 310 315 320
acc atg gaa cag gaa gtt get gta ctg cta tct cgg ctt aga ttc ata 1008
Thr Met Glu Gln Glu Val Ala Val Leu Leu Ser Arg Leu Arg Phe Ile
325 330 335
cag tct act cta ttc cac acc gat gtc acg tac ctg gag ttt ttg gac 1056
Gln Ser Thr Leu Phe His Thr Asp Val Thr Tyr Leu Glu Phe Leu Asp
13
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
... ................... .....
340 345 350
agg gtg cac acc tct gag ctg aag ctg agg gca caa agc ctc tgg gaa 1104
Arg Val His Thr Ser Glu Leu Lys Leu Arg Ala Gln Ser Leu Trp Glu
355 360 365
gtt cca cac cct tgg ttg aat ctt ctg ata ccg agg agc tca atc cgc 1152
Val Pro His Pro Trp Leu Asn Leu Leu Ile Pro Arg Ser Ser Ile Arg
370 375 380
aga ttt get acg gaa gtc ttt ggc agg atc ctg aaa gat agc aac aat 1200
Arg Phe Ala Thr Glu Val Phe Gly Arg Ile Leu Lys Asp Ser Asn Asn
385 390 395 400
ggt cct ata ttg ctt tat cca gtg aac aaa tca aag tgg gac aac aaa 1248
Gly Pro Ile Leu Leu Tyr Pro Val Asn Lys Ser Lys Trp Asp Asn Lys
405 410 415
acg tca gtg gtc ata cca gat gag gaa att ttc tac cta gtg gga ttc 1296
Thr Ser Val Val Ile Pro Asp Glu Glu Ile Phe Tyr Leu Val Gly Phe
420 425 430
ctt tct tca gca ccg tct ctc tca ggt cac ggc agc att gca cat gcg 1344
Leu Ser Ser Ala Pro Ser Leu Ser Gly His Gly Ser Ile Ala His Ala
435 440 445
atg agc ctg aac agc caa ata gta gag ttc tgt gaa gag get gat att 1392
Met Ser Leu Asn Ser Gln Ile Val Glu Phe Cys Glu Glu Ala Asp Ile
450 455 460
ggg atg aaa cag tat cta gca cac tac acc aca cag gag cag tgg aaa 1440
Gly Met Lys Gln Tyr Leu Ala His Tyr Thr Thr Gln Glu Gln Trp Lys
465 470 475 480
acc cac ttt gga gca agg tgg gag aca ttt gaa cgg agg aaa cac aga 1488
Thr His Phe Gly Ala Arg Trp Glu Thr Phe Glu Arg Arg Lys His Arg
485 490 495
tat gat ccc cta gcc atc cta gca cca gga cag aga ata ttc cca aag 1536
Tyr Asp Pro Leu Ala Ile Leu Ala Pro Gly Gln Arg Ile Phe Pro Lys
500 505 510
gcg tca ctc cca ttg tct ttg tga 1560
Ala Ser Leu Pro Leu Ser Leu
515
<210> 27
<211> 519
<212> PRT
<213> Zea mays
<400> 27
Met Lys Pro Pro Ser Leu Val His Cys Phe Lys Leu Leu Val Leu Leu
1 5 10 15
Ala Leu Ala Arg Leu Thr Met His Val Pro Asp Glu Asp Met Leu Ser
20 25 30
Pro Leu Gly Ala Leu Arg Leu Asp Gly His Phe Ser Phe His Asp Val
35 40 45
Ser Ala Met Ala Arg Asp Phe Gly Asn Gln Cys Ser Phe Leu Pro Ala
50 55 60
Ala Val Leu His Pro Gly Ser Val Ser Asp Ile Ala Ala Thr Val Arg
14
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
65 70 75 80
His Val Phe Ser Leu Gly Glu Gly Ser Pro Leu Thr Val Ala Ala Arg
85 90 95
Gly His Gly His Ser Leu Met Gly Gln Ser Gln Ala Ala Gln Gly Ile
100 105 110
Val Val Arg Met Glu Ser Leu Arg Gly Ala Arg Leu Gln Val His Asp
115 120 125
Gly Phe Val Asp Ala Pro Gly Gly Glu Leu Trp Ile Asn Val Leu Arg
130 135 140
Glu Thr Leu Lys His Gly Leu Ala Pro Lys Ser Trp Thr Asp Tyr Leu
145 150 155 160
His Leu Thr Val Gly Gly Thr Leu Ser Asn Ala Gly Val Ser Gly Gln
165 170 175
Ala Phe Arg His Gly Pro Gln Val Ser Asn Val Asn Gln Leu Glu Ile
180 185 190
Val Thr Gly Arg Gly Asp Val Val Thr Cys Ser Pro Glu Asp Asn Ser
195 200 205
Asp Leu Phe Tyr Ala Ala Leu Gly Gly Leu Gly Gln Phe Gly Ile Ile
210 215 220
Thr Arg Ala Arg Ile Ala Leu Glu Pro Ala Pro Glu Met Val Arg Trp
225 230 235 240
Ile Arg Val Leu Tyr Ser Asp Phe Glu Ser Phe Thr Glu Asp Gln Glu
245 250 255
Met Leu Ile Met Ala Glu Asn Ser Phe Asp Tyr Ile G1u Gly Phe Val
260 265 270
Ile Ile Asn Arg Thr Gly Ile Leu Asn Asn Trp Arg Ala Ser Phe Lys
275 280 285
Pro Gln Asp Pro Val Gln Ala Ser His Phe Gln Ser Asp Gly Arg Val
290 295 300
Leu Tyr Cys Leu Glu Leu Thr Lys Asn Phe Asn Ser Gly Asp Thr Asp
305 310 315 320
Thr Met Glu Gln Glu Val Ala Val Leu Leu Ser Arg Leu Arg Phe Ile
325 330 335
Gln Ser Thr Leu Phe His Thr Asp Val Thr Tyr Leu Glu Phe Leu Asp
340 345 350
Arg Val His Thr Ser Glu Leu Lys Leu Arg Ala Gln Ser Leu Trp Glu
355 360 365
Val Pro His Pro Trp Leu Asn Leu Leu Ile Pro Arg Ser Ser Ile Arg
370 375 380
Arg Phe Ala Thr Glu Val Phe Giy Arg Ile Leu Lys Asp Ser Asn Asn
385 390 395 400
Gly Pro Ile Leu Leu Tyr Pro Val Asn Lys Ser Lys Trp Asp Asn Lys
405 410 415
Thr Ser Val Val Ile Pro Asp Glu Glu Ile Phe Tyr Leu Val Gly Phe
420 425 430
Leu Ser Ser Ala Pro Ser Leu Ser Gly His Gly Ser Ile Ala His Ala
435 440 445
Met Ser Leu Asn Ser Gin Ile Val Glu Phe Cys Glu Glu Ala Asp Ile
450 455 460
Gly Met Lys Gln Tyr Leu Ala His Tyr Thr Thr Gln Glu Gln Trp Lys
465 470 475 480
Thr His Phe Gly Ala Arg Trp Glu Thr Phe Glu Arg Arg Lys His Arg
485 490 495
Tyr Asp Pro Leu Ala Ile Leu Ala Pro Gly Gln Arg Ile Phe Pro Lys
500 505 510
Ala Ser Leu Pro Leu Ser Leu
515
<210> 28
<211> 1617
<212> DNA
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
<213> Zea mays
<220>
<221> CDS
<222> (1)...(1617)
<400> 28
atg gca aga agg act cgt ttc gtg gcc atc gcc gcc ctc ctc aca agc 48
Met Ala Arg Arg Thr Arg Phe Val Ala Ile Ala Ala Leu Leu Thr Ser
1 5 10 15
ttc ctc aae gte gca gcc ggg cat tcC cgg cca ctg tcc ggt gcc ggc 96
Phe Leu Asn Val Ala Ala Gly His Ser Arg Pro Leu Ser Gly Ala Gly
20 25 30
ctc ccg ggc gat ctt ttc ggg ctg ggc atc gcg tcg agg atc cgc acg 144
Leu Pro Gly Asp Leu Phe Gly Leu Gly Ile Ala Ser Arg Ile Arg Thr
35 40 45
gac agc aac tcg acg gcg aag gcg gcg acg gac ttc ggc cag atg gtg 192
Asp Ser Asn Ser Thr Ala Lys Ala Ala Thr Asp Phe Gly Gln Met Val
50 55 60
agg gcc gcg ccg gag gcc gtg ttc cac ccc gcc acg ccg gcc gac atc 240
Arg Ala Ala Pro Glu Ala Val Phe His Pro Ala Thr Pro Ala Asp Ile
65 70 75 80
gcc gcg ctc gtc cgg ttc tcc gcc acg tcg gcg gcg ccg ttc ccc gtt 288
Ala Ala Leu Val Arg Phe Ser Ala Thr Ser Ala Ala Pro Phe Pro Val
85 90 95
gcg ccg cgc ggg cag ggc cac tcc tgg cgc ggc cag gcg ctc gcc ccg 336
Ala Pro Arg Gly Gln Gly His Ser Trp Arg Gly Gln Ala Leu Ala Pro
100 105 110
ggc ggc gtc gtc gtg gac atg ggc tcg ctg ggg cgc ggc ccc cgc atc 384
Gly Gly Val Val Val Asp Met Gly Ser Leu Gly Arg Gly Pro Arg Ile
115 120 125
aac gtg tcc gcc gtg gcc ggc gcg gag ccg ttc gtc gac gcc ggc ggg 432
Asn Val Ser Ala Val Ala Gly Ala Glu Pro Phe Val Asp Ala Gly Gly
130 135 140
gag cag ctg tgg gtc gac gtc ctc cgc gcc acg ctg cga cac ggc ctg 480
Glu Gln Leu Trp Val Asp Val Leu Arg Ala Thr Leu Arg His Gly Leu
145 150 155 160
gcg ccc cgc gtg tgg acc gac tac ctc cgg ctc acc gtc ggc ggc acg 528
Ala Pro Arg Val Trp Thr Asp Tyr Leu Arg Leu Thr Val Gly Gly Thr
165 170 175
ctc tcc aac gcg gga atc ggc ggg cag gcg ttc cga cac ggt ccg cag 576
Leu Ser Asn Ala Gly Ile Gly Gly Gln Ala Phe Arg His Gly Pro Gln
180 185 190
atc gcc aac gtg cat gaa ctc gac gtc gtc aca ggc aca ggt gag atg 624
Ile Ala Asn Val His Glu Leu Asp Val Val Thr Gly Thr Gly Glu Met
195 200 205
gtg aca tgc tcc atg gac gtg aac tcg gac ctg ttc atg gcg get cta 672
Val Thr Cys Ser Met Asp Val Asn Ser Asp Leu Phe Met Ala Ala Leu
210 215 220
16
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
ggc ggg tta ggc cag ttc ggg gtc ata acc aga gca cgg atc cgg ctt 720
Gly Gly Leu Gly Gln Phe Gly Val Ile Thr Arg Ala Arg Ile Arg Leu
225 230 235 240
gag ccg gcg ccc aag agg gtg cgc tgg gtt cga ctt gcc tac acc gac 768
Glu Pro Ala Pro Lys Arg Val Arg Trp Val Arg Leu Ala Tyr Thr Asp
245 250 255
gtc get act ttc acc aag gat cag gag ttt ctc ata tca aac cgg get 816
Val Ala Thr Phe Thr Lys Asp Gln Glu Phe Leu Ile Ser Asn Arg Ala
260 265 270
agc caa gtc ggg ttc gac tac gtc gaa ggc cag gtc cag ctc agc cgg 864
Ser Gln Val Gly Phe Asp Tyr Val Glu Gly Gln Val Gln Leu Ser Arg
275 280 285
tcc ttg gtc gaa ggc ccc aaa tca aca ccc ttc ttc tcc ggc gcc gat 912
Ser Leu Val Glu Gly Pro Lys Ser Thr Pro Phe Phe Ser Gly Ala Asp
290 295 300
gtt get agg ctt get gga ctc gcg tcc agg acc gga cct get gca atc 960
Val Ala Arg Leu Ala Gly Leu Ala Ser Arg Thr Gly Pro Ala Ala Ile
305 310 315 320
tac tac atc gaa ggc gcc atg tac tac acc aag gac acc gcc ata tct 1008
Tyr Tyr Ile Glu Gly Ala Met Tyr Tyr Thr Lys Asp Thr Ala Ile Ser
325 330 335
gtg gac aag aaa atg aag gca ctc ctg gat cag ctg agc ttc gag cca 1056
Val Asp Lys Lys Met Lys Ala Leu Leu Asp Gln Leu Ser Phe Glu Pro
340 345 350
ggg ttt gcg ttc acc aag gac gtg acg ttc gtg cag ttc ctc gat cgg 1104
Gly Phe Ala Phe Thr Lys Asp Val Thr Phe Val Gln Phe Leu Asp Arg
355 360 365
gtg cgc gag gag gag agg gtg ctc cgg tca gcc ggc gcg tgg gag gtg 1152
Val Arg Glu Glu Glu Arg Val Leu Arg Ser Ala Gly Ala Trp Glu Val
370 375 380
ccg cac cca tgg ctg aac ctc ttc gtc cca cgg tcg cgc atc ctc gac 1200
Pro His Pro Trp Leu Asn Leu Phe Val Pro Arg Ser Arg Ile Leu Asp
385 390 395 400
ttc gac gac gga gtg ttc aag get ctg ctc aag gac tcc aac cca get 1248
Phe Asp Asp Gly Val Phe Lys Ala Leu Leu Lys Asp Ser Asn Pro Ala
405 410 415
ggg atc atc ctc atg tac ccc atg aac aag gat agg tgg gac gac cgg 1296
Gly Ile Ile Leu Met Tyr Pro Met Asn Lys Asp Arg Trp Asp Asp Arg
420 425 430
atg aca gcg atg acc cca gcc acg gac gac gac gac atg ttc tat gcc 1344
Met Thr Ala Met Thr Pro Ala Thr Asp Asp Asp Asp Met Phe Tyr Ala
435 440 445
gtt agt ttc ctt tgg tca gca ctg tcc gca gac gac gtg ccc cag ctc 1392
Val Ser Phe Leu Trp Ser Ala Leu Ser Ala Asp Asp Val Pro Gln Leu
450 455 460
gag aga tgg aac aag gca gtg ctg gac ttc tgt gat cgg tca gga ata 1440
17
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Glu Arg Trp Asn Lys Ala Val Leu Asp Phe Cys Asp Arg Ser Gly Ile
465 470 475 480
gaa tgc aag cag tac ctg cca cac tac aca tct caa gac ggg tgg cga 1488
Glu Cys Lys Gln Tyr Leu Pro His Tyr Thr Ser Gln Asp Gly Trp Arg
485 490 495
cgg cat ttc ggg gcg aaa tgg agc agg atc get gag ctg aag gcc aga 1536
Arg His Phe Gly Ala Lys Trp Ser Arg Ile Ala Glu Leu Lys Ala Arg
500 505 510
tat gac cct cgg gca ttg ttg tcg ccg ggc cag agg att ttt ccg gtg 1584
Tyr Asp Pro Arg Ala Leu Leu Ser Pro Gly Gln Arg Ile Phe Pro Val
515 520 525
cca gta gag gca tct ggc att get tct gcc tga 1617
Pro Val Glu Ala Ser Gly Ile Ala Ser Ala
530 535
<210> 29
<211> 538
<212> PRT
<213> Zea mays
<400> 29
Met Ala Arg Arg Thr Arg Phe Val Ala Ile Ala Ala Leu Leu Thr Ser
1 5 10 15
Phe Leu Asn Val Ala Ala Gly His Ser Arg Pro Leu Ser Gly Ala Gly
20 25 30
Leu Pro Gly Asp Leu Phe Gly Leu Gly Ile Ala Ser Arg Ile Arg Thr
35 40 45
Asp Ser Asn Ser Thr Ala Lys Ala Ala Thr Asp Phe Gly Gln Met Val
50 55 60
Arg Ala Ala Pro Glu Ala Val Phe His Pro Ala Thr Pro Ala Asp Ile
65 70 75 80
Ala Ala Leu Val Arg Phe Ser Ala Thr Ser Ala Ala Pro Phe Pro Val
85 90 95
Ala Pro Arg Gly Gln Gly His Ser Trp Arg Gly Gln Ala Leu Ala Pro
100 105 110
Gly Gly Val Val Val Asp Met Gly Ser Leu Gly Arg Gly Pro Arg Ile
115 120 125
Asn Val Ser Ala Val Ala Gly Ala Glu Pro Phe Val Asp Ala Gly Gly
130 135 140
Glu Gln Leu Trp Val Asp Val Leu Arg Ala Thr Leu Arg His Gly Leu
145 150 155 160
Ala Pro Arg Val Trp Thr Asp Tyr Leu Arg Leu Thr Val Gly Gly Thr
165 170 175
Leu Ser Asn Ala Gly Ile Gly Gly Gin Ala Phe Arg His Gly Pro Gln
180 185 190
Ile Ala Asn Val His Glu Leu Asp Val Val Thr Gly Thr Gly Glu Met
195 200 205
Val Thr Cys Ser Met Asp Val Asn Ser Asp Leu Phe Met Ala Ala Leu
210 215 220
Gly Gly Leu Gly Gln Phe Gly Val Ile Thr Arg Ala Arg Ile Arg Leu
225 230 235 240
Glu Pro Ala Pro Lys Arg Val Arg Trp Val Arg Leu Ala Tyr Thr Asp
245 250 255
Val Ala Thr Phe Thr Lys Asp Gln Glu Phe Leu Ile Ser Asn Arg Ala
260 265 270
Ser Gln Val Gly Phe Asp Tyr Val Glu Gly Gln Val Gln Leu Ser Arg
275 280 285
18
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Ser Leu Val Glu Gly Pro Lys Ser Thr Pro Phe Phe Ser Gly Ala Asp
290 295 300
Val Ala Arg Leu Ala Gly Leu Ala Ser Arg Thr Gly Pro Ala Ala Ile
305 310 315 320
Tyr Tyr Ile Glu Gly Ala Met Tyr Tyr Thr Lys Asp Thr Ala Ile Ser
325 330 335
Val Asp Lys Lys Met Lys Ala Leu Leu Asp Gln Leu Ser Phe Glu Pro
340 345 350
Gly Phe Ala Phe Thr Lys Asp Val Thr Phe Val Gln Phe Leu Asp Arg
355 360 365
Val Arg Glu Glu Glu Arg Val Leu Arg Ser Ala Gly Ala Trp Glu Val
370 375 380
Pro His Pro Trp Leu Asn Leu Phe Val Pro Arg Ser Arg Ile Leu Asp
385 390 395 400
Phe Asp Asp Gly Val Phe Lys Ala Leu Leu Lys Asp Ser Asn Pro Ala
405 410 415
Gly Ile Ile Leu Met Tyr Pro Met Asn Lys Asp Arg Trp Asp Asp Arg
420 425 430
Met Thr Ala Met Thr Pro Ala Thr Asp Asp Asp Asp Met Phe Tyr Ala
435 440 445
Val Ser Phe Leu Trp Ser Ala Leu Ser Ala Asp Asp Val Pro Gin Leu
450 455 460
Glu Arg Trp Asn Lys Ala Val Leu Asp Phe Cys Asp Arg Ser Gly Ile
465 470 475 480
Glu Cys Lys Gln Tyr Leu Pro His Tyr Thr Ser Gln Asp Gly Trp Arg
485 490 495
Arg His Phe Gly Ala Lys Trp Ser Arg Ile Ala Glu Leu Lys Ala Arg
500 505 510
Tyr Asp Pro Arg Ala Leu Leu Ser Pro Gly Gln Arg Ile Phe Pro Val
515 520 525
Pro Val Glu Ala Ser Gly Ile Ala Ser Ala
530 535
<210> 30
<211> 1566
<212> DNA
<213> Zea mays
<220>
<221> CDS
<222> (1)...(1566)
<400> 30
atg atg ctc gcg tac atg gac cgc gcg acg gcg gcc gcc gag cca gag 48
Met Met Leu Ala Tyr Met Asp Arg Ala Thr Ala Ala Ala Glu Pro Glu
1 5 10 15
gac gcc ggc cgc gag ccc gcc acc atg gcg ggc ggg tgc gcg gcg gcg 96
Asp Ala Gly Arg Glu Pro Ala Thr Met Ala Gly Gly Cys Ala Ala Ala
20 25 30
gcg acg gat ttc ggc ggg ctg ggg agc gcc atg ccc gcg gcc gtg gtc 144
Ala Thr Asp Phe Gly Gly Leu Gly Ser Ala Met Pro Ala Ala Val Val
35 40 45
cgc ccg gcg agc gcg gac gac gtg gcc agc gcc atc cgc gcg gcg gcg 192
Arg Pro Ala Ser Ala Asp Asp Val Ala Ser Ala Ile Arg Ala Ala Ala
50 55 60
ctg acg ccg cac ctc acc gtg gcc gcc cgc ggg aac ggg cac tcg gtg 240
Leu Thr Pro His Leu Thr Val Ala Ala Arg Gly Asn Gly His Ser Val
19
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
65 70 75 80
gcc ggc cag gcc atg gcc gag ggc ggg ctg gtc ctc gac atg cgc tcg 288
Ala Gly Gln Ala Met Ala Glu Gly Gly Leu Val Leu Asp Met Arg Ser
85 90 95
ctc gcg gcg ccg tcc cgg cgc gcg cag atg cag ctc gtc gtg cag tgc 336
Leu Ala Ala Pro Ser Arg Arg Ala Gln Met Gln Leu Val Val Gln Cys
100 105 110
ccc gac ggc ggc ggc ggc cgc cgc tgc ttc gcc gac gtc ccc ggc ggc 384
Pro Asp Gly Gly Gly Gly Arg Arg Cys Phe Ala Asp Val Pro Gly Gly
115 120 125
gcg ctc tgg gag gag gtg ctc cac tgg gcc gtc gac aac cac ggg ctc 432
Ala Leu Trp Glu Glu Val Leu His Trp Ala Val Asp Asn His Gly Leu
130 135 140
gcc ccg gcg tcc tgg acg gac tac ctc cgc ctc acc gtg ggc ggc acg 480
Ala Pro Ala Ser Trp Thr Asp Tyr Leu Arg Leu Thr Val Gly Gly Thr
145 150 155 160
ctc tcc aat ggc ggc gtc agc ggc cag tcc ttc cgc tac ggg ccc cag 528
Leu Ser Asn Gly Gly Val Ser Gly Gln Ser Phe Arg Tyr Gly Pro Gln
165 170 175
gtg tcc aac gtg gcc gag ctc gag gtg gtc acc ggc gac ggc gag cgc 576
Val Ser Asn Val Ala Glu Leu Glu Val Val Thr Gly Asp Gly Glu Arg
180 185 190
cgc gtc tgc tcg ccc tcc tcc cac ccg gac ctc ttc ttc gcc gtg etc 624
Arg Val Cys Ser Pro Ser Ser His Pro Asp Leu Phe Phe Ala Val Leu
195 200 205
ggc ggg ctc ggc cag ttt ggc gtc atc acg cgc gcc cgc atc ccg ctc 672
Gly Gly Leu Gly Gln Phe Gly Val Ile Thr Arg Ala Arg Ile Pro Leu
210 215 220
cac agg gcg ccc aag gcg gtg cgg tgg acg cgc gtg gtg tac gcg agc 720
His Arg Ala Pro Lys Ala Val Arg Trp Thr Arg Val Val Tyr Ala Ser
225 230 235 240
atc gCg gaC taC acg gcg gac gcg gag tgg ctg gtg acg Cgg CCC CCC 768
Ile Ala Asp Tyr Thr Ala Asp Ala Glu Trp Leu Val Thr Arg Pro Pro
245 250 255
gac gcg gcg ttc gac tac gtg gag ggc ttc gcg ttc gtg aac agc gac 816
Asp Ala Ala Phe Asp Tyr Val Glu Gly Phe Ala Phe Val Asn Ser Asp
260 265 270
gac ccc gtg aac ggc tgg ccg tcc gtg ccc atc ccc ggc ggc gcc cgc 864
Asp Pro Val Asn Gly Trp Pro Ser Val Pro Ile Pro Gly Gly Ala Arg
275 280 285
ttC gac CCg tCC CtC CtC CCC gCC ggC gCC ggC CCC gtC CtC taC tgC 912
Phe Asp Pro Ser Leu Leu Pro Ala Gly Ala Gly Pro Val Leu Tyr Cys
290 295 300
ctg gag gtg gcc ctg tac cag tac gcg cac cgg ccc gac gac gac gac 960
Leu Glu Val Ala Leu Tyr Gln Tyr Ala His Arg Pro Asp Asp Asp Asp
305 310 315 320
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
gag gag gac cag gcg gcg gtg acc gtg agc cgg atg atg gcg ccg ctc 1008
Glu Glu Asp Gln Ala Ala Val Thr Val Ser Arg Met Met Ala Pro Leu
325 330 335
aag cac gtg cgg ggc ctg gag ttcgcg gcg gac gtc ggg tac gtg gac 1056
Lys His Val Arg Gly Leu Glu Phe Ala Ala Asp Val Gly Tyr Val Asp
340 345 350
ttc ctg tcc cgc gtg aac cgg gtg gag gag gag gcc cgg cgc aac ggc 1104
Phe Leu Ser Arg Val Asn Arg Val Glu Glu Glu Ala Arg Arg Asn Gly
355 360 365
agc tgg gac gcg ccg cac ccg tgg ctc aac ctc ttc gtc tcc gcg cgc 1152
Ser Trp Asp Ala Pro His Pro Trp Leu Asn Leu Phe Val Ser Ala Arg
370 375 380
gac atc gcc gac ttc gac cgc gcc gtc atc aag ggc atg ctc gcc gac 1200
Asp Ile Ala Asp Phe Asp Arg Ala Val Ile Lys Gly Met Leu Ala Asp
385 390 395 400
ggc atc gac ggg ccc atg ctc gtc tac cct atg cte aag agc aag tgg 1248
Gly Ile Asp Gly Pro Met Leu Val Tyr Pro Met Leu Lys Ser Lys Trp
405 410 415
gac ccc aac acg tcg gtg gcg ctg ccg gag ggc gag gtc ttc tac ctg 1296
Asp Pro Asn Thr Ser Val Ala Leu Pro Glu Gly Glu Val Phe Tyr Leu
420 425 430
gtg gcg ctg ctg cgg ttc tgc cgg agc ggc ggg ccg gcg gtg gac gag 1344
Val Ala Leu Leu Arg Phe Cys Arg Ser Gly Gly Pro Ala Val Asp Glu
435 440 445
ctg gtg gcg cag aac ggc gcc atc ctc cgc gcc tgc cgc gcc aac ggc 1392
Leu Val Ala Gln Asn Gly Ala Ile Leu Arg Ala Cys Arg Ala Asn Gly
450 455 460
tac gac tac aag gcc tac ttc ccg agc tac cgc ggc gag gcc gac tgg 1440
Tyr Asp Tyr Lys Ala Tyr Phe Pro Ser Tyr Arg Gly Glu Ala Asp Trp
465 470 475 480
gcg cgc cac ttc ggc gcc gcc agg tgg agg cgc ttc gtg gac cgc aag 1488
Ala Arg His Phe Gly Ala Ala Arg Trp Arg Arg Phe Val Asp Arg Lys
485 490 495
gcc cgg tac gac ccg ctg gcg atc ctc gcg.ccg ggc cag aag atc ttc 1536
Ala Arg Tyr Asp Pro Leu Ala Ile Leu Ala Pro Gly Gln Lys Ile Phe
500 505 510
cct cgg gtc ccg gcg tcc gtc gcc gtg tag 1566
Pro Arg Val Pro Ala Ser Val Ala Val
515 520
<210> 31
<211> 521
<212> PRT
<213> Zea mays
<400> 31
Met Met Leu Ala Tyr Met Asp Arg Ala Thr Ala Ala Ala Glu Pro Glu
1 5 10 15
Asp Ala Gly Arg Glu Pro Ala Thr Met Ala Gly Gly Cys Ala Ala Ala
21
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
20 25 30
Ala Thr Asp Phe Gly Gly Leu Gly Ser Ala Met Pro Ala Ala Val Val
35 A 40 45
Arg Pro Ala Ser Ala Asp Asp Val Ala Ser Ala Ile Arg Ala Ala Ala
50 55 60
Leu Thr Pro His Leu Thr Val Ala Ala Arg Gly Asn Gly His Ser Val
65 70 75 80
Ala Gly Gln Ala Met Ala Glu Gly Gly Leu Val Leu Asp Met Arg Ser
85 90 95
Leu Ala Ala Pro Ser Arg Arg Ala Gln Met Gln Leu Val Val Gln Cys
100 105 110
Pro Asp Gly Gly Gly Gly Arg Arg Cys Phe Ala Asp Val Pro Gly Gly
115 120 125
Ala Leu Trp Glu Glu Val Leu His Trp Ala Val Asp Asn His Gly Leu
130 135 140
Ala Pro Ala Ser Trp Thr Asp Tyr Leu Arg Leu Thr Val Gly Gly Thr
145 150 155 160
Leu Ser Asn Gly Gly Val Ser Gly Gln Ser Phe Arg Tyr Gly Pro Gln
165 170 175
Val Ser Asn Val Ala Glu Leu Glu Val Val Thr Gly Asp Gly Glu Arg
180 185 190
Arg Val Cys Ser Pro Ser Ser His Pro Asp Leu Phe Phe Ala Val Leu
195 200 205
Gly Gly Leu Gly Gln Phe Gly Val Ile Thr Arg Ala Arg Ile Pro Leu
210 215 220
His Arg Ala Pro Lys Ala Val Arg Trp Thr Arg Val Val Tyr Ala Ser
225 230 235 240
Ile Ala Asp Tyr Thr Ala Asp Ala Glu Trp Leu Val Thr Arg Pro Pro
245 250 255
Asp Ala Ala Phe Asp Tyr Val Glu Gly Phe Ala Phe Val Asn Ser Asp
260 265 270
Asp Pro Val Asn Gly Trp Pro Ser Val Pro Ile Pro Gly Gly Ala Arg
275 280 285
Phe Asp Pro Ser Leu Leu Pro Ala Gly Ala Gly Pro Val Leu Tyr Cys
290 295 300
Leu Glu Val Ala Leu Tyr Gln Tyr Ala His Arg Pro Asp Asp Asp Asp
305 310 315 320
Glu Glu Asp Gln Ala Ala Val Thr Val Ser Arg Met Met Ala Pro Leu
325 330 335
Lys His Val Arg Gly Leu Glu Phe Ala Ala Asp Val Gly Tyr Val Asp
340 345 350
Phe Leu Ser Arg Val Asn Arg Val Glu Glu Glu Ala Arg Arg Asn Gly
355 360 365
Ser Trp Asp Ala Pro His Pro Trp Leu Asn Leu Phe Val Ser Ala Arg
370 375 380
Asp Ile Ala Asp Phe Asp Arg Ala Val Ile Lys Gly Met Leu Ala Asp
385 390 395 400
Gly Ile Asp Gly Pro Met Leu Val Tyr Pro Met Leu Lys Ser Lys Trp
405 410 415
Asp Pro Asn Thr Ser Val Ala Leu Pro Glu Gly Glu Val Phe Tyr Leu
420 425 430
Val Ala Leu Leu Arg Phe Cys Arg Ser Gly Gly Pro Ala Val Asp Glu
435 440 445
Leu Val Ala Gln Asn Gly Ala Ile Leu Arg Ala Cys Arg Ala Asn Gly
450 455 460
Tyr Asp Tyr Lys Ala Tyr Phe Pro Ser Tyr Arg Gly Glu Ala Asp Trp
465 470 475 480
Ala Arg His Phe Gly Ala Ala Arg Trp Arg Arg Phe Val Asp Arg Lys
485 490 495
Ala Arg Tyr Asp Pro Leu Ala Ile Leu Ala Pro Gly Gln Lys Ile Phe
500 505 510
Pro Arg Val Pro Ala Ser Val Ala Val
22
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
515 520
<210> 32
<211> 1629
<212> DNA
<213> Zea mays
<220>
<221> CDS
<222> (1)...(1629)
<400> 32
atg gag gtt gcc atg gtc gtg agc gca aga gcc agc ctg ctg atc ctc 48
Met Glu Val Ala Met Val Val Ser Ala Arg Ala Ser Leu Leu Ile Leu
1 5 10 15
gtc ctc tcc ctc tgc tct ccg tac aaa ttc ata cag agc CCC atg gac 96
Val Leu Ser Leu Cys Ser Pro Tyr Lys Phe Ile Gln Ser Pro Met Asp
20 25 30
Ctg ggc ccC ctg aac ctg ctc ccC aCC aCC agc acc gcg gCc gcg tcC 144
Leu Gly Pro Leu Asn Leu Leu Pro Thr Thr Ser Thr Ala Ala Ala Ser
35 40 45
agc gac ttC ggc agg ata ctc ttc Cgc gCc ccg gcc gCg gtg Ctg agg 192
Ser Asp Phe Gly Arg Ile Leu Phe Arg Ala Pro Ala Ala Val Leu Arg
50 55 60
CCC cag tCg Ccg agg gac atc tCC atg ctg Ctc agc ttc ctc tcc ggc 240
Pro Gln Ser Pro Arg Asp Ile Ser Met Leu Leu Ser Phe Leu Ser Gly
65 70 75 80
tcg ccc tcg ctg agc agg gtc acg gtg gcg gcc agg ggg gca ggc Cac 288
Ser Pro Ser Leu Ser Arg Val Thr Val Ala Ala Arg Gly Ala Gly His
85 90 95
tCC atC cac ggg cag gcg cag gCc Ccg gac ggc att gtg gtg gag acg 336
Ser Ile His Gly Gln Ala Gln Ala Pro Asp Gly Ile Val Val Glu Thr
100 105 110
cgC tcc ttg Ccc ggc gag atg gag ttC Cac cac gtc cgc ggg gga ggc 384
Arg Ser Leu Pro Gly Glu Met Glu Phe His His Val Arg Gly Gly Gly
115 120 125
gaa ggg cgt gcc tcc tac gcC gac gtg ggc ggc ggg gtt ctg tgg atc 432
Glu Gly Arg Ala Ser Tyr Ala Asp Val Gly Gly Gly Val Leu Trp Ile
130 135 140
gag ctc ctg gag cgg agc Ctg aag ctt ggg Ctg get ccc agg tcc tgg 480
Glu Leu Leu Glu Arg Ser Leu Lys Leu Gly Leu Ala Pro Arg Ser Trp
145 150 155 160
acc gac taC ctC taC ctc act gtc ggc ggg acg ctg tcc aat gcc ggc 528
Thr Asp Tyr Leu Tyr Leu Thr Val Gly Gly Thr Leu Ser Asn Ala Gly
165 170 175
atc agc ggg cag acg ttc aag cac ggg cca cag atc agc aac gtc ctc 576
Ile Ser Gly Gln Thr Phe Lys His Gly Pro Gln Ile Ser Asn Val Leu
180 185 190
cag ctg gag gta gtc aca gga cga ggg gag att gtg gaa tgc tca ccc 624
23
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
Gln Leu Glu Val Val Thr Gly Arg Gly Glu Ile Val Glu Cys Ser Pro
195 200 205
agc aag gag gcc gac ctg ttc aat gcc gtc ctg gga ggc cta ggc cag 672
Ser Lys Glu Ala Asp Leu Phe Asn Ala Val Leu Gly Gly Leu Gly Gln
210 215 220
ttc ggc atc ata acc agg gcc agg atc ctg ctg cag gag get ccg gag 720
Phe Gly Ile Ile Thr Arg Ala Arg Ile Leu Leu Gin Glu Ala Pro Glu
225 230 235 240
aag gtg acg tgg gtg agg gcc ttc tac gac gac ttg ggc gcc ttc acc 768
Lys Val Thr Trp Val Arg Ala Phe Tyr Asp Asp Leu Gly Ala Phe Thr
245 250 255
agg gac cag gag ctg ctg gtg tcg att ccg gat tcg gtg gac tac gtg 816
Arg Asp Gln Glu Leu Leu Val Ser Ile Pro Asp Ser Val Asp Tyr Val
260 265 270
gaa ggg ttc atg gtc ctg aac gag cgg tcc ctc cac agc tcc tcc atc 864
Glu Gly Phe Met Val Leu Asn G1u Arg Ser Leu His Ser Ser Ser Ile
275 280 285
gcc ttc ccc gcg agc gtg gac ttc agc ccg gat ttc ggc acc agg agc 912
Ala Phe Pro Ala Ser Val Asp Phe Ser Pro Asp Phe Gly Thr Arg Ser
290 295 300
agc cct agg atc tac tac tgc gtc gag ttc gcg gtc cac cac cac cac 960
Ser Pro Arg Ile Tyr Tyr Cys Val Glu Phe Ala Val His His His His
305 310 315 320
ggt tac cag cag cag tct cag gcg gcc gtg gag gcc atc tcg agg cgg 1008
Gly Tyr Gln Gln Gln Ser Gln Ala Ala Val Glu Ala Ile Ser Arg Arg
325 330 335
atg agc cac atg gcg tcc cag ctg tac agc gtg gag gtg tcc tac ttg 1056
Met Ser His Met Ala Ser Gln Leu Tyr Ser Val Glu Val Ser Tyr Leu
340 345 350
gac ttc ctg aac cgg gtc agg atg gag gag gtg agc ctg cgg agc gcc 1104
Asp Phe Leu Asn Arg Val Arg Met Glu Glu Val Ser Leu Arg Ser Ala
355 360 365
ggg atg tgg gag gag gtg cac cac ccg tgg ctc aac atg ttc gtg ccc 1152
Gly Met Trp Glu Glu Val His His Pro Trp Leu Asn Met Phe Val Pro
370 375 380
aag gcc ggg gtc get ggc ttc agg gat ctg ctc atg gac aac gtc tcg 1200
Lys Ala Gly Val Ala Gly Phe Arg Asp Leu Leu Met Asp Asn Val Ser
385 390 395 400
ccg gat agc ttc cag ggc ctc atc ctc atc tac cca ctc ctc aga gac 1248
Pro Asp Ser Phe Gin Gly Leu Ile Leu Ile Tyr Pro Leu Leu Arg Asp
405 410 415
aag tgg gac acc aac acg tcg gtc gtg atc ccg gac tcc ggg ccc acc 1296
Lys Trp Asp Thr Asn Thr Ser Val Val Ile Pro Asp Ser Gly Pro Thr
420 425 430
gcg gac gac ccg gtg atg tac gtg gtc ggc atc ctc agg tcc gcg aac 1344
Ala Asp Asp Pro Val Met Tyr Val Val Gly Ile Leu Arg Ser Ala Asn
435 440 445
24
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
cct ggt cca gaa gaa gac ggt gac ggc tgc tcc cac cgc tgc ctg cac 1392
Pro Gly Pro Glu Glu Asp Gly Asp Gly Cys Ser His Arg Cys Leu His
450 455 460
gag ctc ctc cgc agc cac cgc cgg atc gcc gac gcc gcg gag gcg cgc 1440
Glu Leu Leu Arg Ser His Arg Arg Ile Ala Asp Ala Ala Glu Ala Arg
465 470 475 480
ctc ggc gcc aag cag tac ctg cct cac cac ccg acc ccg gcc cgc tgg 1488
Leu Gly Ala Lys Gln Tyr Leu Pro His His Pro Thr Pro Ala Arg Trp
485 490 495
cag cag cac ctg ggc cgg cgc tgg gag cgc ttc gcg gac cgc aag gcc 1536
Gln Gln His Leu Gly Arg Arg Trp Glu Arg Phe Ala Asp Arg Lys Ala
500 505 510
cgg ttc gac ccg ctg cgc atc ctg ggg ccc ggc cag ggc ata ttc cct 1584
Arg Phe Asp Pro Leu Arg Ile Leu Gly Pro Gly Gln Gly Ile Phe Pro
515 520 525
cgg acg gcc cag gat get gcc gcc get get gcg tac ggg agc tag 1629
Arg Thr Ala Gln Asp Ala Ala Ala Ala Ala Ala Tyr Gly Ser
530 535 540
<210> 33
<211> 542
<212> PRT
<213> Zea mays
<400> 33
Met Glu Val Ala Met Val Val Ser Ala Arg Ala Ser Leu Leu Ile Leu
1 5 10 15
Val Leu Ser Leu Cys Ser Pro Tyr Lys Phe Ile Gln Ser Pro Met Asp
20 25 30
Leu Gly Pro Leu Asn Leu Leu Pro Thr Thr Ser Thr Ala Ala Ala Ser
35 40 45
Ser Asp Phe Gly Arg Ile Leu Phe Arg Ala Pro Ala Ala Val Leu Arg
50 55 60
Pro Gln Ser Pro Arg Asp Ile Ser Met Leu Leu Ser Phe Leu Ser Gly
65 70 75 80
Ser Pro Ser Leu Ser Arg Val Thr Val Ala Ala Arg Gly Ala Gly His
85 90 95
Ser Ile His Gly Gln Ala Gln Ala Pro Asp Gly Ile Val Val Glu Thr
100 105 110
Arg Ser Leu Pro Gly Glu Met Glu Phe His His Val Arg Gly Gly Gly
115 120 125
Glu Gly Arg Ala Ser Tyr Ala Asp Val Gly Gly Gly Val Leu Trp Ile
130 135 140
Glu Leu Leu Glu Arg Ser Leu Lys Leu Gly Leu Ala Pro Arg Ser Trp
145 150 155 160
Thr Asp Tyr Leu Tyr Leu Thr Val Gly G1y Thr Leu Ser Asn Ala Gly
165 170 175
Ile Ser Gly Gln Thr Phe Lys His Gly Pro Gln Ile Ser Asn Val Leu
180 185 190
Gln Leu Glu Val Val Thr Gly Arg Gly Glu Ile Val Glu Cys Ser Pro
195 200 205
Ser Lys Glu Ala Asp Leu Phe Asn Ala Val Leu Gly Gly Leu Gly Gln
210 215 220
Phe Gly Ile Ile Thr Arg Ala Arg Ile Leu Leu Gln Glu Ala Pro Glu
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
225 230 235 240
Lys Val Thr Trp Val Arg Ala Phe Tyr Asp Asp Leu Gly Ala Phe Thr
245 250 255
Arg Asp Gln Glu Leu Leu Val Ser Ile Pro Asp Ser Val Asp Tyr Val
260 265 270
Glu Gly Phe Met Val Leu Asn Glu Arg Ser Leu His Ser Ser Ser Ile
275 280 285
Ala Phe Pro Ala Ser Val Asp Phe Ser Pro Asp Phe Gly Thr Arg Ser
290 295 300
Ser Pro Arg Ile Tyr Tyr Cys Val Glu Phe Ala Val His His His His
305 310 315 320
Gly Tyr Gln Gln Gln Ser Gln Ala Ala Val Glu Ala Ile Ser Arg Arg
325 330 335
Met Ser His Met Ala Ser Gln Leu Tyr Ser Val Glu Val Ser Tyr Leu
340 345 350
Asp Phe Leu Asn Arg Val Arg Met Glu Glu Val Ser Leu Arg Ser Ala
355 360 365
Gly Met Trp Glu Glu Val His His Pro Trp Leu Asn Met Phe Val Pro
370 375 380
Lys Ala Gly Val Ala Gly Phe Arg Asp Leu Leu Met Asp Asn Val Ser
385 390 395 400
Pro Asp Ser Phe Gln Gly Leu Ile Leu Ile Tyr Pro Leu Leu Arg Asp
405 410 415
Lys Trp Asp Thr Asn Thr Ser Val Val Ile Pro Asp Ser Gly Pro Thr
420 425 430
Ala Asp Asp Pro Val Met Tyr Val Val Gly Ile Leu Arg Ser Ala Asn
435 440 445
Pro Gly Pro Glu Glu Asp Gly Asp Gly Cys Ser His Arg Cys Leu His
450 455 460
Glu Leu Leu Arg Ser His Arg Arg Ile Ala Asp Ala Ala Glu Ala Arg
465 470 475 480
Leu Gly Ala Lys Gln Tyr Leu Pro His His Pro Thr Pro Ala Arg Trp
485 490 495
Gin Gln His Leu Gly Arg Arg Trp Glu Arg Phe Ala Asp Arg Lys Ala
500 505 510
Arg Phe Asp Pro Leu Arg Ile Leu Gly Pro Gly Gln Gly Ile Phe Pro
515 520 525
Arg Thr Ala Gln Asp Ala Ala Ala Ala Ala Ala Tyr Gly Ser
530 535 540
<210> 34
<211> 3003
<212> DNA
<213> Zea mays
<220>
<221> misc feature
<222> (0) _. (0)
<223> ZmCkx2 promoter
<400> 34
ctgccatcct catgcagatg agacggagag aagatgagaa aagtacaaga tcccagaagc 60
aagcagcagg atggggccat cccccccccc ccccactggg ccccacgggc cgaaagccac 120
cggcgaaaat gtccagaagg ccacgtgggg catgggtccc cggagtccac ttccgcgcga 180
tctcgaggcc gggccgcacc ggcaatcgct ctccggccac ctccctgctt cctcaggtcc 240
ggtctcccat agtccaatgc atgcatgcac gagcatcccc tcagaacgct ggcagtgagt 300
gtcttgctcg cacatcagct tggccagtca gtgcgagaac acagcagcaa caacaacaac 360
aacacctgtg cacaatggcg tctatcattg gtaccatctc aatcggctga cttgtctata 420
actactgtta acggaggtcc cttgtgcatc atgcagtttt agaagagcac ctcgatcgca 480
agcgcctcat tattatcatc attctcttaa actggtcaga aaactgacca tcagctaaag 540
tgatactgac atactgtatc tttgtagata attaaatgga gaaaaatctc cttctgttcc 600
26
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
gtctggccgt taaatgccga atccatgcat atataaatct gtacgtaggc tcaaagcaca 660
gtgtgcattt tggctttcca gctagcatac atacatgtga ctgctgacta tgaattgtgt 720
ggaccacatt ggcacaacgg tgcattgcaa cggacgggcg ccgtcaaggt caaacgcata 780
aaaggctgtc atttggcaac acaatgaatc agtgccgcca cgccatccgt ccacgatcca 840
ccgttcttgg tgtagtggtt ggtcccagcg cttgaaggcc aggccgaggc cgtgttctgg 900
aaggtggcct gtggtgagca ctaaacatgt gtgtgctttt gcctttccaa gccagagggc 960
cggtctctta atatacataa catacacacc actttttcat tttgttcatt attacggtct 1020
aatgcaaaca aagccatttg cagaatgtgc tacatagcag gtatgtttct ctttttttcc 1080
ctgtaaaatt tgtagactta tcacaagaat aagtttaacc attactagaa tagttcctca 1140
catgtttgtt taccatcggg gcgggaacag cttgccttgc aaaagCtgcg caagtattag 1200
gcccctctag atttttttaa tagtagtagt atatataata tataggtgtt actatttgag 1260
ttgttaggcc atctgcggca gattttctat gacatccctt atttcaaact ttattttgca 1320
aacagttgtc atatacccta ttttaggcga atcactgaag acaggtacgt tttggcacgg 1380
atgaggtgga gagtggacaa gaatctccgt tgtggagtct gcctaccagt accaggcaaa 1440
gtaatgcatg cgcgcggaca ggatggacgg tcgaagtgtc ctccctgcct ccaccccgac 1500
gacgacgcat gggctccgtc cccttCgctt gcttcctgct ccagctagct ccatcgccta 1560
gtgctccgct ccgccgcaca ggaacggaac ggaacggacc gaaccacttg gtcgcatccc 1620
gatggcttgc cgtctgccgg tgtccatcgt gtcggtttca cctctgcact agcataaatt 1680
ccttgacacc aacagcgagc gacatcatcg gctcagccct acaagtcacg agtgttctga 1740
ctgaccagct agcaatagca atcttctgct ctgcttgact tgctcggacg atccgccgct 1800
gcttggtttc ggctccatta ggctatcctc cgcgacgtcg tcgatctgga ctccattagg 1860
tccacacaga atcgacacga gcttggtgtg ccgcgtacgc atgtgtgcgt atgtatgcct 1920
cgtcttccac atgcaaacat acgcagagga aggggaaagg cggcagcaaa cgcgacggtc 1980
caagtcgtac cacagaagtg gtcgcgcatg tgtgcccaag ttgccatcac ccggatgcta 2040
ttagatttcc agaaactaac ttgtgaggac ccctggtgtc tgctagctgc tctccaactc 2100
CaaCCtgtca atcaattccc agacggacaa gctgagctca cagctcaagc tCaaCaaCga 2160
tggccggccg ggtcaccatg gaactgatcc tctacagtac aggcatggga aaatggagga 2220
ggagagcagg gcagtgaggc cacagaatca gaggctgatt agtgttggtg agctccaatc 2280
caacagcata tgaccagcga gcagaacata gggatgtcct gtgggcttgc ccagggacag 2340
acgcatgcaa gccatgtgac tgtccggaga gagagccggt gatactggaa Cagaggatcc 2400
gatcctgccc cccttctttt gcctctccct ctctcacaca cacagtctca cctatatgtg 2460
gctatgtcgt ctccattagg ctgttaacta gccaacacat gttcccccgt tgcttaagac 2520
agcagctaca aagcgagaac atcatgctct aaaaagaaac ttccgcaatg caccactagc 2580
acatgtctgc gcctcaattc gcaaccggca agcaagcaag ccggcaagca gacagtcgcc 2640
atacggtttt taccaaacag ctagcgccca cagctgacta gCtgaccacc gcaccaccca 2700
Cactcctcct cgcgagtcgc gaggcaagcc gcaagctcct atatagagag gccccctccc 2760
tcCCcctgca tgaacagcca ccgccttctt CaaCCCtcCt tccgtcttcc tcctctagtc 2820
ttacctcgtt gcacctcaag aaacttggcg cgcaaccagg aaaccccctc ttctctctct 2880
ctctctctct ctctctctgc cttctgattc CaagCtCCCC aactgcccag caccaacctg 2940
ccgaactccc ctcctttttg ttggtttgtc gaattataaa ttgagcccgg CCggctgact 3000
acc 3003
<210> 35
<211> 2001
<212> DNA
<213> Zea mays
<220>
<221> misc feature
<222> (0) ._. (0)
<223> Promoter for ZmCkx3
<221> misc feature
<222> (0) ._. (0)
<223> n = A, T, C, or G
<400> 35
ccggggtgtg acaggagcat tgaagcatgc atgctctgct cagcatataa ttaaagaaag 60
aagcatcaaa atgcactgga gcagttgacc aaaacttgca gctacgtcaa aatatatacg 120
agggctggca tcaaggtgtg Ctcagcccga gccccgtcag gtaacttggt cttttgtttt 180
ctggccttgc ggcttcatta aaggccgccg gccgcgagcg aggcaaaaca gtgaagggga 240
ggggaggtgc ccgccactaa cctctcggtc ggatatatta gtattcaagc agttgacaaa 300
27
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
tctgtgcgga tttgatttgg tctgaggaaa atatatatat atatatatat agcccctcgt 360
cgttcatgca ccctctcgca gcctgcaacc ttacaatatt gttcttgcat ccggttttat 420
ttatattttt attttttaaa aaaaaaatcc atagtcctgc cgtcttgaag gatatgtttt 480
tctttaccca tggacggcgg agtttaaatt tgcgctgacc cgactgctcg tgaacagaga 540
caagtatgac agatatcttt gagttccaaa ttttaaaaaa aaaatcaata aaaaatttaa 600
aacagaatgt tgaccaggaa aaaaaatatg aaggtgcttg cacacctgtc actccatgcc 660
ggacatcaac aaattaattg ttcaagtggt gggagtcagc tgcttccagt ttaccttcct 720
gcgccagcgg ttggtagaca ggattgttgc cacgtggacg aaatctcctg ccgccagctg 780
gttgatcacg gcaggcagtc acatgcttct tgccaagatt accgcgggtt gtaatcatct 840
gaaatatatt aacctgagca cgtgatagag taaaaaaatt ggtcgactaa gggggtgttt 900
ggtttctagg gactaatgtt tagtccctac attttattcc attttagttc taaaattacc 960
aaatatagaa actaaaactt tattttagtt tctatattag caatttatag actaaaaaag 1020
aataaaatga agggactaaa tattaatccc tagaaaccaa acacccccta actttaggta 1080
agttgtggca tgcattctct ggaacggcag ttctagagag cacttgagat gtcaacaggt 1140
gaagaattga agattggcca acacaggcgt tcaaggagat tcaaccaccc atccacatac 1200
cgcgcaaaca cttggggggc attcttgctg ctgccacatt tggaagaagc gcagcaatgt 1260
ggtgttcaga agaagcacag ctattttagc tcttgataac tatctttttt tttgcataga 1320
ttaatttatt tcttcgatat atactagctt gtaaaaaaat gttttncaga tatatgtata 1380
aaaatgtgta cctagtacct acgcatgtct tagttcaaca tacttgatag ctgtagtttt 1440
ctgaaaacct gttcaaatta acctttttcc taccctgatg gtgaatagag agaaaagctt 1500
tacctttgtc tgaataagaa aactaacaga aagcttacat tttggccact ctacctgccc 1560
gagtattttc taagcaagca aaggcgcatg aaaattttct cggaatccat gaccttttac 1620
gcgcantgnw aaayawwgwm mattgmtcmg accaatgatc attttgatac tctccacaag 1680
tcaacatctc aaaaaaacca caagatgggg cccatcaaca taagttcacg agtgtgcctt 1740
caggtacatt gttctttttt tttgttttgc taaagtcaat cagctgcaaa atattcagaa 1800
caatttcaat aacccgaaag gctgttgtgc ctccatttgt caacgtttgc gaggccaaat 1860
ggtacccccg ctataaatac catggaagtt cttggcctct aggacacaca agcgatctct 1920
cctcctatag tttctataac cccacaaagc gtccaggtcc cgtagtcacc tccgattgca 1980
ttgcgttgcc gcaagacaag c 2001
<210> 36
<211> 2448
<212> DNA
<213> Zea mays
<220>
<221> misc feature
<222> (0) _. (0)
<223> promoter for ZmCkx4
<400> 36
ctttatgttg tagccaagga aagtatactg ttaagatcag aatgaacCtt ataggagttg 60
tatgggcata aagccagcaa gtatagccaa aggtacacaa ggctaatata gtcaagttgt 120
tgatgtgtga gacgttcaag gaagtgaact attggaggag tcgaCtaaaa gtacgattaa 180
taaggtagac atgatggtaa aatctttgat ctagaattta agtggtatgg atgcgagggt 240
gagaatggca agcacaactt caaatatagg gtgatgctta tgcttggctg agccatttca 300
ttcatgagca taggaacatg agacatggtg ggatatggat acttgcacaa aaaaaggaat 360
taagtttatg atattcacct cccagtcagt ttgcatggta aaaaaattcc tatcaatttg 420
gttctcaact agggcctaaa attctcaaaa tatctgttgg ggaccattat cgtcgacgat 480
cctcagaatc tgttattacc aaattaaaag gtgtgtttca ggtactgtgc aaagcagcag 540
cgaagctatc cttcgtcaaa agtggctcaa tgaaccaggt ggagaagcta tggagcttcg 600
tctgcgtaga gcgtgccgga ggaggaagct ttggctctga atgcatcgac ttacgaagca 660
tgggagaaga agactcagaa ggcttgtcca gcgtgggaat aaaaaggaga aaatacaatt 720
ttgcccttgt gggatttgta aatcatgtgc aaggctcatg gatatgtttg taattttata 780
tgatatgttt gtaaatcatg gatatgtttt gtaaatcagg tggactagag gagagggagg 840
gtggacatag tgacttgcat cttgatcatg gtagagtggt catggtagag ggaaaggggt 900
aggtcaattc tggagtgcgg ccacggtggc ttgagtgtcg gccacggtag gggaaagggg 960
tagcccaatt ctagggccgg catcggagaa ggccgacatg tgcacgtcag gaggtagtgt 1020
tagaggtttg aacggaaaaa attgaacatg ttagtatgat gagttgtgta attgctggga 1080
attgtggata atttccactt aactacggcc ctgtttattt acccctagat tataaaatcc 1140
aacttaaaaa agttgagatg taaacaaaca acacatatta ttaggtggat tatgttatct 1200
agaaatctgg atgataataa tttataagtc ggttaatagg tgtttacata atcgataagc 1260
28
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
tggattatat aatcctggaa cacggctttc gcgagagcgt attaaaacag gattccgtga'1320
agcacactat ctgaggagct ccaccaaaag ctgaatctag cccgcactct tttttggagg 1380
attcaaattt ggtgtcactg gagcattcgg cattttgttt catggcgtga agctattttt 1440
actaattaca gaagctgttt caattagacc tttaaatgat ggctgagtat aaaaggaggc 1500
aattttttta tctcgccgat ggagccaggt cgcgtcgcgc cgcggccatg ctgcgctccc 1560
gacgcgatct agcggcgatg tgcacagtac agttttgcca tgccattggt taagcctgca 1620
tacaacacac cagcgtactg ccctgcacaa gatctcctcg gctcggcctc tcctgatgga 1680
acgttcagct tgaacagcgg agcgtggggg catcccgggg atgggcgccg cggccgagaa 1740
attttgcaac ctggcaaatc tgccctgtcg catactacca tccacctcca ggcgccaaga 1800
acgcctccga gtttcaggct tgcagctcag ctctgtgttg aattggaacg ggcggagttt 1860
ctgggttcca gacttccagt acaaggcgat caattggtag ggcgaattac ttgcaggccc 1920
agatgcatgg cccatctatc tggttctcta tcggttgctt ttacttgcac aatagtggca 1980
gacaaactac aagtcagatc cgatcctatc catccatcca tctcgcagcg cgatgcaaat 2040
atgcaatcgt ctgtggaact cgaaaaaaaa cagaggtccg gcctcgcacg aggttaaggg 2100
aaaaaaaacg aagcgtttgg aactttggtt ggcattcgca gcatgctgtg ctgccaccgt 2160
atgtttttat ttttgctttg tttgtcttct ttgagaaacg tgagggagcc gcgtgtccgc 2220
tcgttataaa acccccccgg cgacccaaac taccacgagc tcaagcctca agcctcaagc 2280
ctcaagcaag cagagcgccg tgacatcacg aaacaaacat atagagctag ctgctctgcc 2340
tctgcttcac caatcacctg cttggccgcg cggaggggag ggtttccccc tttgacacag 2400
ctgagctccc ctccatcagc agccagctcc tcgtcgcaaa gcaagaag 2448
<210> 37
<211> 2346
<212> DNA
<213> Zea mays
<220>
<221> misc feature
<222> (0) ._. (0)
<223> promoter for ZmCkxS
<400> 37
tacagatttg cgttcatcaa tggcagcgcg ggatctcatg aggtcactgg gttcttgcaa 60
gtggggagag aaagggagat ctacgaaaga cttgttagtg ggccaccttt tccctctttc 120
cccacaagga cgagatcgtg gattagagta ggaaagtgat tccgcattgg tctcaaatct 180
tggcgaaaga ttgcattgtg tactctccac cactcgaccg gcaacgaggc attttgttat 240
tgcacgatgc atcctttgca catgagctag gcttgtgcct ttgagtattc agttagcatt 300
gcaaccccat ttcaattcac atgcttgtct ttccaaggaa ctttctaagc cacctaacag 360
acattagggt ttatatcaga atcgagctca tggcgtactt tatgctgcac gaacaatggg 420
ttgggggcgt cgtttcttgc atgagagcat gcgcatcctg gtaaggattt cgccaaaaga 480
actttagtcc tctaccgact ttgtgtttgc gtgatctcgt gatttgaagc ctgtggtggt 540
gtgctgaggc agcatattgg aaggtatctc tgtgttgata tggcatccgt ccgtggacaa 600
atcgatacca catactgttc ttggattcta ttcttgggat tgctaaatga tctagataga 660
ttatattctc ttgttgcagc ccctattgct tcaatacgaa gaaaacccaa cgtttagaac 720
ttaataaaac catttgtgag cttagctgct taggcaattc atttttatgc atgacaaata 780
tataataata ttagctatac tattattgat gcaacctgtg ggagcgtata aaatggtact 840
tccccaattc taaattataa gacgttttga ctatatattc tacatacata tgtttaattt 900
tatatttaga taatcgctat gccttaatat atagtaaaaa gtagtatatc tagaaaagat 960
aaaacatctt ataatttaaa aatgggtaga gtattatatt agatatgaac agtgcttaga 1020
tgccaccaaa attttgccat gccatcctaa ggccagcaaa agtttgtgtc ttcttttgtt 1080
ttccaaacca ctagatgcca atatactatt tatcatcgat cgagatgtag gtcttagtta 1140
attgtgtcgg gtgcccttga gaaagaaaag aaaaaggtgg gattttgttt tcgcttagac 1200
gatgattgga tctcttggtc tctgaattcc atcccgaata aacaaatgaa gtaggtcctc 1260
agtcaccctt gccctgttag ctgcaagaga gctcatggtt tccagccaca caatcagtcc 1320
atggctcctt cttcttggcc taagtggtgg ccaatcattg tgggtgatcg agtcttgggc 1380
cctctgaaca gtattacaca acagtaatcc tgcaaaagat ttggtatatc tagattctag 1440
agtgagcgcc gtgttgtgcc cagctaggaa tgggttgtca agtgcaacag gaggaggacc 1500
caggatggtc aggtgtaata ggctctcatt aaaagactgt tcagatggat tagagcaacg 1560
acggggaagc cgggaaaaaa tggttggttc tgctttcctc tcgctccccg gccgggttca 1620
tatatgaatc tgagaacgat attttttgct tcatttttca tttgctatat atttaaactg 1680
tttttttgtg tgtgtgtgtg tgttcattga gctcaatact tgaggcttga tagggagagg 1740
agtgaggcag ctgatcacat ggacctccat ctgaggacag ttcctcttcc gaaacagaaa 1800
29
CA 02521497 2005-10-04
WO 2004/090143 PCT/US2004/010064
ggagagtgca gggaccagcg tggcctgtac agtattgtgt ttgccctttt cctttggcag 1860
ggacagagag cttcaggctt gtcctcttta tgtatgctgc tcgcctgctt cagagtcaga 1920,
gcttcccctt ctcacttctc agagagagag agagagaaga gagagagagg agagccctcc 1980
acagctcccc tgtcctgccc tcaggcattc tttgtcacag ggggcgaggg ctgaagatca 2040
tcacatggtg gccttttttg ggtctgtggc ctttggtctt ttagtgcttc ttccttttac 2100
ctcctcatga catgaacccc ctttttaaac ctccctcaaa atcaaatcac CctcCttCtc 2160
CtttaagagC Cctcaacccc ttCCCCtcat tttccttCat ccctcagcct ttgcacaaag 2220
ggcaagaata acgcagtatg atCatctgat catactcccg ccgccatCac aatcccacac 2280
gaacgtgaga Caaaggtaac agagacaaga agctagcagc tgcaggagat tgctcagccc 2340
atctcC 2346
<210> 38
<211> 51
<212> DNA
<213> Zea mays
<400> 38
caucaucauC auggatccac caatggatct acgtctaatt ttcggtccaa c 51
<210> 39
<211> 42
<212> DNA
<213> Zea mays
<400> 39
cuacuacuaC uagttaaCtC acattCgaaa tggtggtcct tC 42
