Note: Descriptions are shown in the official language in which they were submitted.
CA 02525148 1999-11-02
TRANSG~NIC A.ND CLONED'MAMMALS
~ ~ ~ ~ . . ~ . Background oJthe Invendoa ., . . ~ '
The ability to modify animal ~genomes through'transgenic technology has
. - opened new avenues for medical application. By-targeting~the expression of
biomedical .proteins to the mammary gland of large farce arrimais, low-cost
production of high f uantities of valuable, therapeutic proteins is now
possible.
fl Houdeliine (1995) Reprod. Nutr. Dev. 35:509-617; Maga et al. (1295)
' ~ BiolTechnology,-13:1452-1457;,Echelard (1996) Curr.Op.Biotechnol. 7:536-
540;
. Young et. al. ( 1997) BioPharm. 10:34-38. although the total sales for the
top
fifteen biopharmaceuticals in 1996 were ~7.S~billion, expectations are that
this
. number will continue to rise in the future, Med. Ad News 16:30.~ Transgenic
,
~5. ~, technology, is applicable and attractive.for proteins that, whether
duc~to~high unit
dosagc.requirements, frequency of administration, or large patient
populations,
are needed in high volume,~and also to complex proteitis~that are~difficult to
. ~ ~- ~ produce in.commercially viable quantities using traditional cell
culture methods. '
;In addition, the production of human pharmaceuticals in the milk'of
transgenic
2o farm animals solves' many of the problems 'associated with microbial
bioreactors;
e.g., lack of post-translational~modifications,.impiopei folding, high
purification
costs, or animate cell bioreactors, e.g., high capital costs; expensive
culture media,
low yields. ~ ~ . ~ . ' ~ . , . .
. . Dairy.goats are ideal for transgenic production of therapeutic recombinant
25 ' proteins. Their average milk output'is 600-800 liters per lactation.
.With herds of
-1-
CA 02525148 1999-11-02
a manageable size arid at concentrations of approximately 1-5 grains/liter.
reproducibly achieved with various animal models; yields of transgenic pmtein
to
obtain 1-300 kg of purified product per year are achievable. Gordon et al.
(1987)
BiolTechnology 5:1183-1187; Meade et al. (1990) BiolTechnology 8:443-446;
Ebert et al: (1991) BiolTechnology 9:835-838;.Simons et al. (1987) Nature
328:530-532; Wright et al. :(1991) BiolTechnology 9:801-834; Velander et al: .
, _.
(1992) Proc Natl Acad Sci USA 89:12003-120007; Hansson et al. (1994) JBiol
Chem. 269:5358-5363; Hiurwitz et al. (1994) TransgenicReS. 3:365-375. This
represents the low to middle range-of the high volume protein category and
quantities that would be required for the majority of biopharmaceuticals
cuwently
under development. Moreover, the goat generation: interval, i.e., gestation,
growth to sexual maturity and gestation, is l8 months as compared to almost
three years for cows: This period permits expansion of the production herds .
within the time frame neaied for the regulatory approval of the transgenically-
produced therapeutic proteins. Finally, the much lower incidence of scrapie in
goats (only 7 cases ever reported in the U.S:) relative to sheep, which have
identical reproductive performance, and lower lactation output, makes goats
better candidates for the production of therapeutic proteins.
Currently, there are very few reliable methods of producing transgenic
goats. One such method is pronuclear microinjection. .Using pronuclear
microinjection'methods; transgene integration into the genetic makeup occurs
iri
1-3% of all the microinjected embryos. Ebert et al: (1993) Theriogenology,
39:121-135.
In 1981, it was reported that mouse embryonic stem cells~can be isolated,
propagated in vivo, genetically modified and, ultimately,~can contribute to
the
germline of a host embryo. Evans et al. (1981 ) Nature 292:154-156; Martin
(1981) Proc Natl Acad Sci USA 78:7634-7638; Bradley et al. (1984) Nature
309:255-256. Since then, marine embryonic stem cells have been extensively
exploited in developmental and genetic studies to modify, e.g., delete,
replace,
mutate, single targeted genes. Mansour et al. (1988) Nature 336:348-352;
-2-
CA 02525148 1999-11-02
McMahon et al. (1990) Cell 62:1073-1085; recently reviewed
in: Bronson et al. (1994) J. Biol. Chem. 269:27155-27158;
Rossant, et al. (1995) Nat. Med. 6:592-594. Although
extensive studies in the mouse have clearly indicated the
utility of these elegant and powerful techniques, successful
application of embryonic cell technology has been
conclusively reported only in the mouse.
A need exists, however, for methods for obtaining
cloned and transgenic animals such as goats.
Summary of the Invention
The present invention is based, at least in part,
on the discovery that cloned and transgenic mammals, e.g.,
cloned and transgenic goats, can be produced by introduction
of a somatic cell chromosomal genome into a functionally
enucleated oocyte with simultaneous activation. The
functionally enucleated oocyte can be activated or
nonactivated. In one embodiment, a nonactivated
functionally enucleated oocyte (e.g., a caprine oocyte at
metaphase II stage) is fused (e.g., by electrofusion) with a
donor somatic cell (e.g., a caprine somatic cell) and
simultaneously activated with fusion. In another
embodiment, an activated functionally enucleated oocyte
(e. g., a naturally matured caprine oocyte at telophase
stage) is fused (e. g.; by electrofusion) with a donor
somatic cell (e.g., a caprine somatic cell) and
simultaneously activated with fusion.
The use somatic cell lines, e.g., recombinant
primary somatic cell lines, for nuclear transfer of
transgenic nuclei dramatically increases the efficiency of
production of transgenic animals, e.g., up to 100, if the
animals are made by the methods described herein. It also
- 3 -
CA 02525148 1999-11-02
50409-13D(S)
solves the initial mosaicism problem as each cell in the
developing embryo contains the transgene. In addition, using
nuclear transfer from transgenic cell lines to generate
transgenic animals, e.g., transgenic goats, permits an
accelerated scale up of a specific transgenic line. For
example, a herd can be scaled up in one breeding season.
Thus, in one aspect the present invention provides
a method of producing a cloned transgenic non-human mammal
comprising: (a) introducing a nucleus from a non-human
mammalian somatic cell into a functionally enucleated oocyte
that has been pretreated with ethanol, said functionally
enucleated oocyte being from the same species as said somatic
cell and being in the metaphase II stage of meiotic cell
division, and said nucleus from said somatic cell comprising
at least one recombinant nucleic acid sequence under the
control of at least one promoter sequence, to form a
reconstructed embryo; and (b) allowing the reconstructed
embryo from step (a) to develop into a mammal, thereby
providing the transgenic non-human mammal.
In another aspect the present invention provides a
method of making a transgenic non-human mammal comprising:
(a) fusing a non-human mammalian somatic cell capable of
expressing a transgenic protein with a functionally
enucleated oocyte that has been pretreated with ethanol, said
functionally enucleated oocyte being from the same species as
said somatic cell and being in the metaphase II stage of
meiotic division, and the nucleus from said somatic cell
containing at least one recombinant nucleic acid sequence to
obtain a reconstructed embryo; (b) activating the
reconstructed embryo from step (a); (c) transferring the
activated reconstructed embryo from step (b) into a female
non-human mammalian recipient; and (d) allowing the
transferred reconstructed embryo from step (c) to develop
- 3a -
CA 02525148 1999-11-02
50409-13D(S)
into a mammal, thereby providing the transgenic non-human
mammal.
In another aspect the present invention provides a
method of making a transgenic non-human mammal comprising:
(a) fusing a non-human mammalian somatic cell capable of
expressing a transgenic protein with a functionally
enucleated oocyte, said functionally enucleated oocyte being
from the same species as the somatic cell and being in the
metaphase II stage of meiotic division, and the nucleus from
said somatic cell containing at least one recombinant nucleic
acid sequence to obtain a reconstructed embryo; (b)
activating the reconstructed embryo from step (a); (c)
maintaining the activated reconstructed embryo from step (b)
in culture until the embryo is in the 2- to 8-cell stage of
embryogenesis; (d) transferring the 2- to 8-cell stage
reconstructed embryo from step (c) into a female non-human
mammalian recipient; (e) allowing the transferred
reconstructed embryo from step (d) to develop into a mammal
thereby providing the transgenic non-human mammal.
In another aspect the present invention provides a
method of producing a transgenic non-human mammal comprising:
(a) introducing a nucleus from a non-human mammalian somatic
cell into a functionally enucleated oocyte, said functionally
enucleated oocyte being from the same species as said somatic
cell and being in the metaphase II stage of meiotic cell
division, and said nucleus from said somatic cell comprising
at least one recombinant nucleic acid sequence under the
control of at least one promoter sequence, to form a
reconstructed embryo; (b) transferring said reconstructed
embryo to a non-human mammalian recipient when said
reconstructed embryo is in the 2- to 8-cell stage of
embryogenesis; and (c) allowing said reconstructed embryo to
- 3b -
CA 02525148 1999-11-02
50409-13D(S)
develop into a mammal, thereby providing the transgenic non-
human mammal.
The generation of transgenic animals, e.g.,
transgenic goats, by nuclear transfer with somatic cells has
the additional benefit of allowing genetic
- 3c -
CA 02525148 1999-11-02
manipulations that are not feasible with traditional microinjection
approaches.
For example, nuclear.transfer with somatic cells allov~rs the introduction of
specific mutations, or even the targeting of foreign genes directed to
specific sites
in the genome solving the problem of integration position effect. Homologous
recombination in the donor somatic cells can "knock-out" or replace the
endogenous protein, e.g., a endogenous goat pmtein, to lower purification
costs _,
of hetemlogous proteins expressed in.milk and help to precisely adjust the
animal
bioreactors.
In general, the invention features a method of providing a cloned non-
human mammal, e.g:, a cloned. goat. The methods below are described for goats,
but can be applied for any non-human mammal. The method includes:
introducing a caprine genome from a caprine somatic cell into a caprine
oocyte,
preferably a naturally matured telophase oocyte, to form a reconstructed
embryo;
~ 5 and allowing the reconstructed embryo to develop into a goat, e.g:, by
introducing
the necoristructed embryo into a recipient doe, thereby providing a goat. .
In one embodiment, the nucleus of the caprine somatic cell is introduced
into the caprine oocyte; e.g., by direct nuclear injection or by fusion, e.g.,
electrofusion, of the somatic cell with the oocyte:
2o In preferred embodiment, the goat develops from the reconstructed
embryo. In another embodiment, the goat is a descendant of a goat v~rhich
developed from the reconstructed embryo.
In a preferned embodiment:. the somatic cell is non-quiescent (e.g., the cell
is activated), e.g., the somatic cell is in G, stage. In another preferred
2~ embodiment, the somatic cell is quiescent (e.g., the cell is arrested),
e.g., the
somatic cell is in Ga stage. In a preferred embodimetit, the somatic cell is
an
embryonic somatic cell, e:g., the somatic cell is an embryonic fibroblast. The
somatic cell can be any of a fibroblast (e.g, a primary fibroblast), a muscle
cell
(e.g., a myocyte), a cumulus cell,,a neural cell or a mammary cell.
.4-
CA 02525148 1999-11-02
In a preferred embodiment,, the oocyte is a functionally enucleated oocyte,
e.g., an enucleated oocyte. In a preferred embodiment, the oocyte is in
metaphase
II; the oocyte is in.telophase; the oocyte is obtained using an in vivo
protocol; the
oocyte is. obtained using an in vivo.protocol to obtain an oocyte which is in
a
desired stage of the cell cycle; e.g., metaphase II or telophase; the oocyte
is
activated prior to or simultaneously with, the introduction of the genome. In
another preferred embodiment; the oocyte and somatic cell are synchronized,
e.g.,
both the oocyte and somatic cell are activated or both the oocyte and somatic
cell
are arrested:'
to In a prefen;ed embodiment, the method further includes mating the goat
which develops from the reconstructed embryo with a second goat. A second
goat can be a normal goat, a second goat which develops from a reconstructed
embryo or is descended,from a goat which developed from a reconstructed
embryo or a second goat developed from a reconstructed embryo, or descended
~ 5 from a goat which developed-from a reconstructed embryo, which was formed
.
from genetic material from the same animal; an animal of the same genotype, or
same cell line, which supplied the genetic material for the first goat. In a
piefeired embodiment, a first transgenic goat which develops. from the
reconstructed embryo can be mated with a second transgenic goat which
20 developed from a reconstructed embryo and which contains'a different
transgene
that the first transgenic goat.
In a preferred embodiment, the goat is a male goat. In other preferred
embodiments, the goat is a female goat. A female goat can be induced to
lactate
and milk can be obtained from the goat.
25 In a preferred embodiment: a product, e.g., a protein, e.g:, a recombinant
protein, e.g:, a human protein, is recovered from the goat; a product; e.g., a
protein, e.g., a human protein, is recovered from the milk, urine, hair,
blood, skin
or meat of the goat.
-5-
CA 02525148 1999-11-02
In another aspect, the invention features a method of providing a
transgeriic non-human mammal, e.g:, a transgenic goat. The methods below are
described for goats, but .can.be applied for any non-human mammal: The method
includes: introducing a genetically engineered caprine genome of a caprine
somatic cell into a caprine oocyte, preferably a naturally matured telophase
oocyte, to form a reconstructed embryo; and.allowing the reconstructed embryo
~,
to develop into a goat, e.g:, by introducing the reconstructed embryo into a
recipient doe, thereby providing a transgenic goat:
In one embodiment, the nucleus of the genetically engineered caprine
somatic cell is introduced into the caprine oocyte, e.g., by direct nuclear
injection
or by fusion, e.g.; electrofusion, of the somatic cell with the oocyte.
In preferred embodiment, the goat develops from the reconstructed
embryo. In another embodiment, the goat is a descendant of a goat which
developed from the reconstructed embryo.
~5 In a preferred embodiment: the somatic cell is non-quiescent (e.g., the
cell
is activated), e.g., the somatic cell is in G, stage: In another preferred
embodiment, the somatic cell is quiescent (e.g., the cell is arrested); e.g.,
the
somatic cell is in Go stage. In a preferred embodiment, the somatic cell is an
embryonic somatic cell, e.g., the somatic cell is an embryonic fibroblast. A
somatic cell can be any of a fibroblast (e.g., a primary fibroblast)a muscle
cell
(e.g:, a myocyte), a cumulus cell, a neural cell or a mammary cell.
In a preferred embodiment, a transgenic sequence has been introduced
into the somatic cell; the somatic cell is from a cell line; e: g:, a primary
cell line;
the somatic cell is from a cell line and a transgenic sequence has been
inserted
into the cell. I
In a preferred embodiment, the oocyte is a functionally enucleated oocyte,
e.g., an enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase B; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
using an in vivo protocol to obtain an oocyte which is in a desired stage of
the cell
-6-
CA 02525148 1999-11-02
cycle, e.g., metaphase II or telophase; the oocyte is activated prior to or
simultaneously with the: introduction of the genetically engineered genome. In
another preferred embodiment, the oocyte and somatic celLare synchronized,
e.g.,
both the oocyte and the somatic cell are activated or both the oocyte and
somatic
cell are arrested.
In a preferred embodiment, the method further includes mating the ..
transgenic goat which develops from the reconstructed embryo with a s~ond
goat. The second goat can be a normal goat, a second goat which develops from
a reconstructed embryo or is descended from a goat which developed from a
t 0 reconstructed embryo or a second goat developed from a reconstructed
embryo,
or descended from a goat which developed from a reconstructed embryo, which
was formed from genetic material from the .same animal, an animal of the same
genotype, or same cell line, which supplied the genetic material for the first
goat.
In a preferred embodiment, a first transgenic goat which develops from the
~5 reconstructed embryo can be mated with a second transgenic goat which .
developed from a reconstructed embryo and which contains a different transgene
than the first transgenic goat.
In a preferred embodiment, the goat is a male goat. In other preferred
embodiments the goat is a female goat. A female goat can be induced to lactate
20 and milk can be obtained from the goat.
In a preferred embodiment: a product; e.g., a protein, e.g., a recombinant .
protein, e.g., a human protein, is recovered from the goat; a product, e.g., a
protein, e.g., a human protein, is recovered from the milk, urine, hair,
blood, skin
or meat of the goat.
25 In a preferred embodiment, the caprine genome of the somatic cell
includes a transgenic sequence. The transgenic sequence can be any of
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a
knockout, knockin or other event which disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
30 promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
_7_
CA 02525148 1999-11-02
promoter. The transgenic sequence can encode any product of interest such as
a.
protein, polypeptide or peptide. A protein can be any of a hormone, an
immunoglobulin, a plasma protein, and an enzyme. The transgenic sequence can
encode any protein whose expression in the transgenic goat is desired
including,
but not limited to, any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogenin, extracellular superoxide dismutase, fibrogen, glucocerebrosidase,
glutamate decarboxylase, human serum albumin; myelin basic protein,
proinsulin,
soluble CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin,
erythrpoietin,
tissue plasminogen activator, human growth factor; antithrombin III, insulin,
t0 prolactin, and al-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes. a human
protein.
In a preferred embodiment, the caprine genome includes a heterologous
transgenic sequence under the control of a proirioter, e.g., a caprine
promoter.
~ 5 The promoter can be a tissue-specific promoter. The tissue specific
promoter can
be any of milk-specific promoters; blood=specific promoters; muscle-specific
promoters; neural-specific promoters; skin-specific promoters; hair-specific
promoters; and urine-specific promoters. The milk-specific promoter can be any
of~. a casein promoter, a beta lactoglobulin promoter, a whey acid protein
20 promoter and a lactalbumin promoter.
In another aspect, the invention features a method of making or producing
a non-human mammal, e.g., a goat; e.g., a cloned or transgenic goat. The
methods
below are described for goats, but can be applied for any non-human marrimal.
25 The method includes fusing, e.g., by electrofusion, a caprine somatic cell,
e.g., a
caprine somatic cell capable of expressing a transgenic protein, with an
eriucleated caprine oocyte, preferably a naturally matured telophase oocyte,
to
obtain a reconstructed embryo; activating the reconstructed embryo;
transferring
the embryo into a recipient doe; and allowing the embryo to develop into a
goat.
CA 02525148 1999-11-02
In a preferred embodiment, the goat develops from the reconstructed
embryo. In another embodiment, the goat is a descendant of a goat which
developed from the reconstructed embryo.
In a preferred embodiment, the somatic,cell is an embryonic somatic cell.
A somatic cell can be any of a fibroblast (e.g., a primary fibroblast), a
muscle
cell (e.g., a myocyte), a cumulus cell, a neural cell or a mammary cell. In a
..
preferred embodiment, the somatic cell is a non-quiescent cell (e.g., the cell
is
activated), e.g., the somatic cell is in G, stage, e.g., in G, prior to START.
In
another preferred embodiment, the somatic cell is a quiescent cell (e.g., the
cell is
arrested), e.g., the somatic cell is in Go stage. .
In a preferred embodiment, the oocyte is in metaphase II. Alternatively,
the oocyte is in telophase. In either embodiment, the oocyte is activated
prior to
or simultaneously with the introduction of the genome. In a preferred
embodiment, the oocyte is obtained using an'in vivo protocol; the oocyte is
obtained using an in vivo protocol to obtain an oocyte which is in a desired
stage
of the cell cycle, e.g., metaphase II or telophase. In a preferred embodiment,
the
oocyte and somatic cell are synchronized, e.g., both the oocyte and somatic
cell
are activated or both the oocyte and somatic.cell are arrested.
In a preferred embodiment: a transgenic sequence has been introduced
2o into the somatic cell; the somatic cell is from a cell line, e.g., a
primary cell line;
the somatic cell is from a cell line and a transgenic sequence has been
inserted
into the cell.
In a preferred embodiment, the method further includes mating the goat
which develops from the reconstructed embryo with a second goat. A second
goat can be a normal goat, a second goat which develops from a reconstructed
embryo or is descended from a goat which developed from a reconstructed
embryo or a second goat developed from a reconstructed .embryo, or is
descended
from a goat which developed from a reconstructed embryo, which was formed
from genetic material from the same animal, an animal of the same genotype, or
same cell line, which supplied the genetic material for the first goat. In a
-9-
CA 02525148 1999-11-02
preferred embodiment, a first transgenic goat which develops from the
reconstructed embryo can be mated with a second transgenic goat which
developed from a reconstructed embryo and which contains a different transgene
than the first transgenic goat.
In a preferred embodiment, the goat is a male goat. In other preferred
embodiments, the goat is a female goat. A female goat can be induced to
lactate
and milk can be obtained from the goat.
1n a preferred embodiment: a product, e.g., a protein, e.g., a recombinant
protein, e.g., a human protein, is recovered from the goat; a product, e.g., a
protein, e.g., a human protein, is recovered from the milk, urine, hair,
blood, skin
or meat of the goat.
In a preferred embodiment, the caprine genome of the somatic cell
includes a transgenic sequence. The transgenic sequence can be any of
integrated into the genome; a heterologous transgene; e.g., a human transgene;
a
knockout; knockin or other event which disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g.; a
caprine
promoter. The transgenic sequence can encode any product of interest such as a
protein; a polypeptide, or a peptide. A protein can be any of a hormone, an
immunoglobulin, a plasma protein, and an enzyme.. The transgenic sequence can
encode any protein whose expression in the transgenic goat is desired
including,
but not limited to any of a-I proteinase inhbitor, alkaline phosphotase,
angiogenin, extracellular superoxide dismutase, fibrogen, glucocerebrosidase,
glutamate decarboxylase, human serum albumin, myelin basic protein,
proinsulin,
soluble CD4, Iactoferrin, lactoglobuliii, lysozyme, lactoalbumin,
erythrpoietin,
tissue plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin, and a 1-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
-10.
CA 02525148 1999-11-02
In a preferred embodiment, the caprine genome comprises a heterologous
transgenic sequence under the control of a promoter, e.g., a caprine promoter.
The
promoter can be a tissue-specific promoter. The tissue specific promoter can
be
any of milk-specific promoters; blood-specific promoters; muscle-specific
promoters; neural-specific promoters; skin-specific promoters; hair-specific
promoters; and urine-specific promoters. The milk-specific promoter can be any
..
of a casein promoter, a beta lactoglobulin promoter, a whey acid protein
promoter and a lactalbumin promoter.
The invention also includes a non-human animal made by any of the
methods described herein. The methods described for goats can be applied for
any non-human mammal. Accordingly, in another aspect, the invention features
a cloned goat, or descendant thereof, obtained by introducing a caprine genome
of
a caprine somatic cell into a caprine oocyte, preferably a naturally matured
~ 5 telophase oocyte, to a obtain reconstructed embryo and allowing the
reconstructed embryo to develop into a goat.
In a preferred embodiment, the caprine genome can be from an embryonic
somatic cell. A somatic cell can be any of fibroblast (e.g., a primary
fibroblast),
a muscle cell (e.g., a myocyte), a cumulus cell or a mammary cell. In a
prefen;ed
embodiment; the somatic cell is a non-quiescent cell (e.g. the cell is
activated),
e.g., the somatic cell is in G, stage, e.g., in G, prior to START. In another
preferred embodiment, the somatic cell is a quiescent cell (e.g., the cell is
arrested), e.g., the somatic cell is in Go stage.
In a prefenred embodiment, the caprine oocyte can be a functionally
enucleated oocyte, e.g., an enucleated oocyte.
In a'preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
using an in vivo protocol to obtain an oocyte which is in a desired stage of
the cell
cycle, e.g., metaphase II or telophase; the oocyte is activated prior to or
3o simultaneously with the introduction of the genome. In a preferred
embodiment,
-11-
CA 02525148 1999-11-02
the oocyte and somatic cell are synchronized, e.g.; both the oocyte and
somatic
cell are activated or both the oocyte and somatic cell are arrested.
In a preferred embodiment, the caprine genome can be introduced by
fusing, e.g., by electrofusion, of a somatic cell with the functionally
enucleated
oocyte.
In another aspect, the invention features one, or more, e:g., a population
having at least one male and one female, cloned goat, each cell of which has
its
chromosomal genome derived from a caprine somatic cell, wherein said caprine
somatic cell is from a goat other than cloned goat.
In a preferred embodiment, the chromosomal genome can be from an
embryonic somatic cell. A somatic cell can be any of a fibroblast (e.g., a
primary fibroblast), a muscle cell (e.g., a myocyte), a neural cell, a cumulus
cell
or a mammary cell. In a preferred embodiment, the somatic cell is a non-
15 quiescent cell (e.g., the cell is activated), e.g., the somatic cell is in
G, stage, e.g.,
in G, prior to START. In another preferred embodiment, the somatic cell is a
quiescent cell (e.g., the cell is arrested), e.g., the somatic cell is in Go
stage.
In another aspect, the invention features a transgenic goat, or descendant
thereof, obtained by introducing a caprine genome of a genetically engineered
caprine somatic cell into a caprine oocyte, preferably a naturally matured
telophase oocyte, to obtain a reconstructed embryo and allowing the
reconstructed embryo to develop into a goat.
In a preferred embodiment, the c~prine genome can be from an embryonic
somatic cell. In another preferred embodiment, the caprine genome can be from
a
caprine fibroblast, e.g., an embryonic fibroblast.
In a preferred embodiment, the, caprine oocyte can be a functionally
enucleated oocyte; e.g., an enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
-f 2-
CA 02525148 1999-11-02
using an in vivo protocol to obtain an oocyte which is in a desired stage of
the cell
cycle, e.g., metaphase II or telophase; the oocyte is activated prior to or
simultaneously with the introduction of the genome. In a preferred embodiment,
the oocyte and the somatic cell are synchronized, e.g., both the oocyte and
the
somatic cell are activated or both the oocyte and the somatic cell are
arrested.
In a preferred embodiment, the caprine genotne can be introduced by
fusing, e.g., by electrofusion, of a somatic cell with the functionally
enucleated
oocyte.
In a preferred embodiment, the caprine genome of the somatic cell
includes a transgenic sequence. The transgenic sequence can be any of .
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a
knockout, knockin or other event which disrupts the cxpression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
~5 promoter. The transgenic sequence can encode a protein which can be any of
a
hormone; an immunoglobulin, a plasma protein; an enzyme, and a peptide. The
transgenic sequence can encode any product of interest such as a protein, a
polypeptide or a peptide. A pmtein which can be any pmtein whose expression
in the transgenic goat is desired including, but not limited to any of a-1
proteinase inhibitor, alkaline phosphotase, angiogenin, extracellular
superoxide
dismutase, fibrogen, glucocerebrosidase, glutamate decarboxylase, human serum
albumin, myelin basic protein, proinsulin, soluble CD4; lactoferrin,
lactoglobuliri;
lysozyme, lactoalbumin, erythrpoietin, tissue plasminogen activator, human
growth factor, antithrombin III, insulin, prolactin, and al-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
In a preferred embodiment; the caprine genome comprises a heterologous
transgenic sequence under the control of a promoter, e.g., a caprine promoter.
The
promoter can be a tissue-specific promoter. The tissue specific promoter can
be
any of-. milk-specific promoters; blood-specific promoters; muscle-specific
-13-
CA 02525148 1999-11-02
promoters; neural-specific promoters; skin-specific promoters; hair-specific
promoters; and urine-specific promoters. The milk-specific promoter can be any
of a casein promoter, a beta lactoglobulin promoter, a whey acid protein
promoter and a lactalbumin promoter.
In another aspect, the invention features a transgenic goat, each cell of ..
which has its chromosomal genome derived from a genetically engineered
caprine somatic cell, wherein said caprine somatic cell is from a goat other
than
said transgenic goat.
In a preferred embodiment, the chromosomal genome can be from an
embryonic somatic cell. In another preferred embodiment, the chromosomal
genome can be from a caprine fibcoblast, e.g., an embryonic fibroblast.
In a preferred embodiment, the chromosomal genome of the somatic cell
includes a transgenic sequence. The transgenic sequence can be any of
integrated into the genoriie; a heterologous transgene, e.g., a human
transgene; a
knockout; knockin or other event which disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode any product of interest such as a
protein, a polypeptide and a peptide. A protein can be any of a hormone, an
immunoglobulin, a plasma protein, an enzyme, and a peptide: The tcarisgenic
sequence can encode any protein whose expression in the transgenic goat is
desired including, but not limited to any of a-1 proteinase inhibitor,
alkaline .
phosphotase, angiogenin, extracellular superoxide dismutase, fibmgen,
glucocerebrosidase, glutamate decarboxylase, human serum albumin, myelin
basic protein, proinsulin, soluble CD4, Iactoferrin, lactoglobulin, Iysozyme,
Iactoalbumin, erythrpoietin, tissue plasminogen activator, human growth
factor,
antithrombin III, insulin, prolactin, and al-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
-14-
CA 02525148 1999-11-02
In a preferred embodiment, the chromosomal genome comprises a
heterologous transgenic sequence under the control of a promoter, e.g., a
caprine
promoter. The promoter can be a tissue-specific promoter. The tissue specific
promoter can be'any of-. milk-specific promoters; blood-specific promoters;
muscle-specific promoters; neural-specific promoters; skin-specific promoters;-
hair-specific promoters; and urine-specific promoters. The milk-specific
promoter can be any of a casein promoter, a beta lactoglobulin promoter, a
whey
acid protein promoter and a lactalbumin promoter.
In another aspect, the invention features a goat made by mating a goat
which developed from a reconstructed embryo (made as described herein) with a
second goat.
In a preferred embodiment: the second goat developed from a
reconstructed embryo or is descended from a goat which developed from a '
reconstructed embryo; the second goat developed from a reconstructed embryo,
or is descended from a goat which developed from a reconstructed embryo, which
was formed from genetic material from the same animal, an animal of the same
genotype, or same cell line, which supplied the genetic material for the first
goat.
In a preferred embodiment, a first transgenic goat which develops from the
reconstructed embryo can be mated with a second transgenic goat which
developed from a reconstructed embryo and which contains a different transgene
than the first transgenic goat.
In another aspect, the invention features a plurality of transgenic goats
obtained by mating a goat which developed from a reconstructed embryo with a
second goat.
In a preferred embodiment: the second goat developed from a
reconstructed embryo or is descended from a goat which developed from a
reconstructed embryo; the second goat developed from a reconstructed embryo,
or is descended from a goat which developed from a reconstructed embryo, which
-15-
CA 02525148 1999-11-02
was formed from genetic material from the same animal, an animal of the same
genotype, or same cell line, which supplied the genetic riiaterial for the
first goat.
In a preferred embodiment, a first goat which developed from a reconstructed
embryo can be mated with a second goat which developed from a reconstructed
embryo and which contains a different transgene than the first goat:
In yet another aspect, the invention.features a method of providing a
transgenic goat which is homozygous for a transgenic sequence. The method
includes providing a somatic cell which is heterozygous for a transgenic
sequence; allowing somatic recombination to occur so as to produce a somatic
cell which is homozygous for the transgenic sequence; introducing the genome
from the somatic cell which is homozygous for the transgenic sequence into a
caprine oocyte, preferably a naturally matured telophase oocyte, to form a
reconstructed embryo; and allowing the reconstructed embryo to develop into a
. goat, e.g., by introducing the reconstructed embryo into a recipient doe,
thereby
providing a transgenic goat which is homozygous for a transgeriic sequence.
In another aspect, the invention features a transgenic goat which is
homozygous for a transgenic sequence.
2o In a preferred embodiment, the tr3nsgenic goat was made by introducing
the genome from the somatic cell which is homozygous for the transgenic
sequence into a caprine oocyte, preferably a naturally matured telophase
oocyte,
to form a reconstructed embryo; and allowing the reconstructed embryo to
develop into a goat.
In another aspect, the invention features a method of making a cloned
non-human mammal, e.g.; a goat, cow, pig, horse, sheep, llama, camel. The
method includes providing an activated oocyte, e.g., an oocyte in telophase
stage,
preferably a naturally matured telophase oocyte; functionally enucleating the
oocyte; introducing the chromosomal genome of a somatic cell into the
-16-
CA 02525148 1999-11-02
functionally enucleated oocyte to obtain a reconstructed embryo; and allowing
the reconstructed embryo to develop ,e.g., by introducing the reconstructed
embryo into a recipient doe, thereby making a cloned mammal.
In a preferred embodiment, the mammal, e.g., a goat, develops from the
. reconstructed embryo. In another embodiment, the mammal, e.g., a goat, is a
descendant of a mammal, e.g., a goat which developed from the reconstructed
embryo:
In a preferred embodiment, the somatic cell is an embryonic somatic cell.
In a preferred embodiment the somatic cell is a fibroblast, e.g., an embryonic
fibroblast. In a preferred embodiment, the somatic cell is a non-quiescent
cell
(e.g., the cell is activated), e.g., the.somatic cell is in G, stage, e.g:, in
G, prior to
START. In another preferred embodiment, the somatic cell is a quiescent cell
(e.g:, the cell is arrested), e.g., the somatic cell is in Go stage.
In a preferred embodiment, the oocyte is activated prior to or
simultaneously with the introduction of the genome. In a preferred embodiment,
the oocyte is obtained using an in vivo protocol, e.g., the oocyte is obtained
using
an in vivo protocol to obtain an oocyte which is in a desired stage of the
cell
cycle, e.g., metaphase II or telophase. In a preferred embodiment, the oocyte
and
somatic cell are synchronized, e.g., both the oocyte and somatic cell are
activated
or both the oocyte and somatic cell are arrested.
In a preferred embodiment, the chromosomal genome of the somatic cell .
is introduced into the oocyte by fusion, e.g., electrofusion, or by direct
injection
of the nucleus into the oocyte, e.g., microinjection.
In another aspect, the invention features a cloned non-human mammal,
e.g., a goat; cow, pig, horse, sheep, llama, camel, obtained by functionally
enucleating an activated oocyte, e.g., an oocyte in telophase, and introducing
the
chromosomal genome of a somatic cell into the enucleated oocyte, preferably a
naturally matured telophase oocyte, to form a reconstructed embryo; and
allowing
-17-
CA 02525148 1999-11-02
the reconstructed embryo to develop, e.g., by introducing the reconstructed
embryo into a recipient mammal.
In a preferred embodiment, the oocyte is obtained using an in vivo
protocol, e.g., the oocyte is obtained using an tn vivo protocol to obtain an
oocyte
which is in a desired stage of the cell cycle, e.g., telophase.
In another aspect, the invention features a reconstructed non-human
mammalian embryo, e.g., a goat, cow, pig, horse, sheep, llama, camel embryo,
obtained by functionally enucleating an activated oocyte, e.g., an oocyte in
telophase, preferably a naturally matured telophase oocyte, and introducing
the
chromosomal genome of a somatic cell into the enucleated oocyte.
In a preferred embodiment, the oocyte is obtained using an in vii
protocol; the oocyte is obtained using an in vivo protocol to obtain an oocyte
which is in a desired stage of the cell cycle, e.g., telophase
,~ 5
In yet another aspect, the invention features a method of making a
transgenic non human mammal, e.g.; a goat, cow, pig, horse, sheep, llama,
camel.
The method includes providing an activated oocyte, e.g., an oocyte in
telophase
stage, preferably a naturally matured telophase oocyte; functionally
enucleating
20 the oocyte; introducing the chromosomal genome of a genetically engineered
somatic cell into the functionally enucleated oocyte to obtain a reconstructed
embryo; and allowing the reconstructed embryo to develop, e.g.; by introducing
the reconstructed embryo into a recipient female, such that a transgenic
mammal
is obtained.
25 In a preferred embodiment, the mammal develops from the reconshucted
embryo. In another embodiment, the mammal is a descendant of a mammal
which developed from the reconstructed embryo.
In a preferred embodiment, the somatic cell is an embryonic somatic cell.
In another preferred embodiment, the somatic cell is a fibroblast, e.g., an
30 embryonic fibroblast. In a preferred embodiment, the somatic cell is a non-
-18-
CA 02525148 1999-11-02
quiescent cell (e.g., the cell is activated), e:g., the somatic cell is in G,
stage, e.g.,
in G, prior to START. 1n another preferred embodiment, the somatic cell is a
quiescent cell (e.g., the cell is arrested), e.g., the somatic cell is in.Go
stage.
In a preferred embodiment, the oocyte is activated prior to or
simultaneously with the introduction of the genome. In a preferred embodiment,
the oocyte is obtained using an in vivo protocol, e.g., the oocyte is obtained
using ..
an in vivo protocol to obtain an oocyte which is in a desired stage of the
cell
cycle, e.g., telophase. In a preferred embodiment, the oocyte and somatic cell
are
synchronized, e.g., both the oocyte and somatic cell are activated or both the
oocyte and somatic cell are arrested. In a preferred embodiment, the
chroriiosomal genome of the somatic cell is introduced into the ooeyte by
fusion,
e.g., electrofusion, or by direct injection of the nucleus into the oocyte,
e.g.,
microinjection.
In a preferred embodiment, the nucleus of the somatic cell comprises a
transgenic sequence. The transgenic sequence can be any of integrated into the
genome; a heterologous transgene, e.g., a human transgene; a knockout,
knocltin
or other event which disrupts the expression of a caprine gene; a sequence
which
encodes a protein, e.g., a human protein; a hetcrologous promoter, a
heterologous
sequence under the control of a promoter, e.g., a caprine promoter.. The
transgenic sequence can encode any product.of interest such as a protein, a
polypeptide and a peptide. A protein can be any of a hormone, an
immunoglobulin, a plasma protein, and an enzyme. The transgenic sequence can
encode any protein whose expression in the transgenic mammal is desired
including, but not limited to any of a-1 pmteinase inhibitor, alkaline
phosphotase; angiogenin, extracellular superoxide dismutase; fibrogen;
glucocerebrosidase, glutarriate decarboxylase, human serum albumin, myelin
basic protein, proinsulin, soluble CD4, lactoferrin, lactoglobulin, lyso2yme,
lactoalbumin, erythrpoietin, tissue plasminogen activator, human growth
factor,
antithrombin III, insulin, prolactin, and al-antitrypsin.
-19-
CA 02525148 1999-11-02
In a preferred embodiment, the transgenic sequence encodes a human
protein.
In a preferred embodiment, the chromosomal genome comprises a
heterologous transgenic sequence under the control of a promoter, e.g., a
: mammalian-specific promoter, e.g.; a caprine promoter. The promoter can be a
tissue-specific promoter. The tissue specific promoter can be any of milk- .
..
specific promoters; blood-specific promoters; muscle-specific promoters;
neural-
specific promoters; skin-specific prorrioters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be any of a casein
promoter,
a beta lactoglobulin promoter, a whey acid protein promoter and a lactalbumin
promoter.
In another aspect, the invention features a transgenic non-human mammal,
e.g:; a goat, cow, pig, horse, sheep; llama, camel, made by functionally
enucleating an activated oocyte, e.g., an oocyte .in telophase, preferably a
naturally matured telophase oocyte, and introducing the chromosomal genome of
a genetically engineered somatic cell into the enucleated oocyte tci form a
reconstructed embryo and allowing the reconstructed embryo to develop, e.g.,
by
introducing the reconstructed embryo into a recipient mammal.
In a preferred embodiment, the oocyte is obtained using an in vivo
protocol, e.g., the oocyte is obtained using an in vivo protocol to obtain an
oocyte
which is in a desired stage of the cell cycle, e.g., telophase.
In another aspect; the invention features a reconstructed non-human
mammalian embryo, e.g., a goat, cow; pig, horse, sheep, Llama, camel embryo,
obtained by functionally enucleating an activated oocyte; e.g., an oocyte in
telophase, preferably a naturally matured telophase oocyte, and introducing
the
chromosomal genome of a genetically engineered somatic cell into the enuckated
oocyte.
-20-
CA 02525148 1999-11-02
In a preferred embodiment, the oocyte is obtained using an ir: vivo
protocol, e.g., the oocyte is obtained using an iii vivo protocol to obtain an
oocyte
which is in a desired stage of the cell cycle, e.g.; telophase.
In yet another aspect, the invention features a method of making a cloned
non-human mammal, e.g., a goat, cow, pig, horse, sheep, llama, camel. The
method includes providing an oocyte, preferably a naturally matured telophase
oocyte; functionally enucleating the oocyte; introducing the chromosomal
genome of a somatic cell into the functionally enucleated oocyte to obtain a
i 0 reconstructed embryo, wherein the oocyte is activated prior to or
simultaneously
with the introduction of the chromosomal genome; introducing the reconstructed
embryo into a recipient mammal; and allowing the reconstructed embryo to
develop, thereby making a cloned mammal.
In a preferred embodiment, the mammal develops from the reconstructed
embryo. In another embodiment, the mammal is a descendant of a mammal
which developed from the reconshucted embryo.
In a preferred erribodiment, the somatic cell is an embryonic cell. In
another preferred embodiment, the somatic cell is a fibroblast, e.g:, an
embryonic
fibroblast. In a preferred embodiment, the somatic cell is a non-quiescent
cell
(e.g., the cell is activated), e.g., the somatic cell is in G, stage, e.g., in
G, prior to
START. In another preferred embodiment, the somatic cell is a quiescent cell
(e.g., the cell is arrested), e.g., the somatic cell is in Go stage. In
another preferred .
embodiment, the oocyte is an enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol, e.g., the oocyte
is
obtained using an in vivo protocol to obtain an oocyte which is in a desired
stage
of the cell cycle, e.g., telophase. In a preferred embodiment, the oocyte and
somatic cell are synchronized, e.g.; both the oocyte and somatic cell are
activated
or both the oocyte and somatic cell are arrested.
-21-
CA 02525148 1999-11-02
In a preferred embodiment, the chromosomal genome of the somatic cell
is introduced into the oocyte by fusion, e.g., electrofusion, or by direct
injection
of the nucleus into the oocyte, e.g., microinjection.
In another aspect, the invention features a cloned non-human mammal,
e.g., a goat, cow, pig, horse, sheep, llama, camel, made by functionally ..
enucleating a mammalian oocyte, preferably a naturally matured telophase
oocyte, and activating the oocyte prior to or simultaneously with the
introduction
of the chromosomal genome of a somatic cell into the enucleated oocyte.
In yet another aspect, the invention features a reconstructed non-human
mammalian embryo, e.g., a goat; cow, pig, horse, sheep, llama, camel embryo,
obtained by functionally enucleating a mammalian oocyte; preferably a
naturally
matured telophase oocyte, and activating the oocyte prior to and/or
simultaneously with the introduction of the chromosomal genome of a somatic
cell into the enucleated oocyte.
In another aspect, the invention features a method of making a transgenic
non-human mammal, e.g., a goat, cow, pig, horse, sheep; llama, camel. The
method 'includes providing an oocyte, preferably a naturally matured telophase
oocyte; functionally enucleating the oocyte; introducing the chromosomal
genome of a genetically eilgineered somatic cell into the functionally
enucleated
oocyte to obtain a reconstructed embryo, wherein the oocyte is, activated
prior to
or simultaneously with the introduction of the chromosomal genome; and
allowing the reconstructed embryo to develop, e.g., by introducing the
reconstructed embryo into a recipient mammal, such that a transgenic mammal is
obtained.
In a preferred embodiment, the mammal develops from the reconstructed
embryo. In another embodiment, the mammal is a descendant of a mammal
which developed from the reconstructed embryo.
-22-
CA 02525148 1999-11-02
In a preferred embodiment, the somatic cell is as embryonic somatic cell:
In another preferred embodiment, the somatic cell is a fibroblast, e.g., an
embryonic fibroblast. In a preferred embodiment, the somatic cell is a non-
quiescent cell (e.g., the cell is activated), e.g., the somatic cell is in G,
stage, e.g.,
. in G, prior to STAiZT. In another preferred. embodiment, the somatic cell is
a
quiescent cell (e.g., the cell is arrested), e.g.,,the somatic cell is in Go
stage. In
another preferred embodiment, the oocyte is an enucleated oocyte
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
1o using an in vii protocol to obtain an oocyte which is in-a desired stage of
the cell
cycle, e.g., metaphase II or telophase; the oocyte is activated prior to or
simultaneously with the introduction of the genome. In a preferred embodiment,
the oocyte and somatic cell are synchronized, e.g., both the oocyte and the
somatic cell are activated or both the oocyte and somatic cell are arrested.
In a preferred embodiment, the chromosomal genome of the somatic cell
is introduced into the oocyte by fusion, e.g., electmfusion, or by direct
injection
of the nucleus into the oocyte, e.g., microinjection.
In a preferred embodiment, the nucleus of the somatic cell comprises a
transgenic sequence. The transgenic sequence can be any of integrated into the
2o genome; a heterologous tcansgene, e.g., a human transgene; a knockout,
knockin
or other event which disrupts the expression of a caprine gene; a sequence
which
encodes a protein, e.g., a human protein; a heterologous promoter; a
heterologous
sequence under the control of a promoter, e.g., a tissue-specific promoter.
The
transgenic sequence can encode any product of interest such as a protein, a
polypeptide and a peptide. A protein can be any of a hormone, an
immunoglobulin, a plasma protein, and an enzyme. The transgenic sequence can
encode a protein whose expression in the transgenic mammal is desired
including, but not limited to any of a-1 proteinase inhibitor, alkaline ..
phosphotase, angiogenin, extracellular superoxide dismutase, fibmgen,
glucocerebrosidase, glutamate decarboxylase, human serum albumin, myelin
~3~
CA 02525148 1999-11-02
basic protein, proinsulin, soluble CD4, lactofetrin, lactoglobulin, lysozyme,
lactoalbumin, erythrpoietin, tissue plasminogen activator, human growth
factor,
antithrombin III, insulin, proiactin, and al-antitrypsin.
In a prefeaed embodiment, the transgenic sequence encodes a human
protein. .
In a prefer ed embodiment; the chromosomal genome comprises a
heterologous transgenic sequence under the control of a promoter, e.g., a
mammalian-specific promoter; e.g., a. caprine promoter. The promoter can be a
tissue-specific promoter. The tissue specific promoter can be any of milk-
1 o specific promoters; blood-specific promoters; muscle-specific .promoters;
neural-
specific promoters; skin-specific promoters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be any of a casein
promoter,
a beta lactoglobulin promoter, a whey acid protein promoter and a lactalbumin
promoter.
In another aspect, the invention features a transgenic non-human mammal,
e.g., a goat, cow, pig, horse, sheep, Llama, camel; made by functionally
enucleating a mammalian oocyte, preferably a naturally matured telophase
oocyte; and activating the oocyte prior to or simultaneously with the
introduction
2o of the chromosomal genome of a genetically engineered somatic cell into the
enucleated oocyte.
In yet another aspect, the invention features a reconstructed non-human
mammalian embryo, e.g., a goat, cow, pig, horse, sheep, llama, camel embryo,
obtained by functionally enucleating a mammalian oocyte, preferably a
naturally
matured telophase oocyte, and activating the oocyte prior to or simultan~usly
with the introduction of the chromosomal genome of a genetically engineered
somatic cell into the enucleated oocyte.
-24-
CA 02525148 1999-11-02
The invention also includes a product, e:g., a protein, e.g:; a heterologous
protein, described herein obtained from a non-human mammal, e:g., a cloned or
trarisgenic mammal, e.g., a clone or transgenic goat, described herein.
In a preferred embodiment; product is milk or a protein secreted into milk.
In another aspect, the invention features a method of providing a protein, .
e.g., a human protein. The method includes; providing a non-human marntrial,
e.g., a iransgenic mammal, e.g., a transgenic goat, described herein; and
recovering the product from the mammal, or from a product, e.g., milk, of the
mammal.
In another aspect, the invention features a method of providing a
heterologous polypeptide. The methods includes introducing a caprine genome,
e.g., by introducing a nucleus; of a genetically engineered caprine somatic
cell
into a caprine oocyte, preferably a naturally matured telophase oocyre, to
form a
reconstructed embryo; allowing the reconstructed embryo to develop into a
goat,
e.g., by introducing the reconstructed embryo into a recipient doe; and
recovering
the polypeptide from the goat or a descendant thereof.
In a preferred embodiment, the nucleus of the caprine somatic cell is
introduced into the caprine oocyte, e.g., by direct nuclear injection or by
fusion,
e.g., electrofusion, of the somatic cell with the oocyte.
In a preferred embodiment: the somatic cell is a non-quiescent cell (e.g.,
the cell is activated), e.g., the somatic cell is in G, stage, e.g., in G,
prior to
START. In another preferred embodiment, the somatic cell is a quiescent cell
(e.g., the cell is arrested), e.g:, the somatic cell is in Go stage. In a
preferred
embodiment, the somatic cell is an embryonic somatic cell, e.g., an embryonic
fibroblast. The somatic~cell can be a fibroblast (e.g., a primary fibroblast),
a
muscle cell (e.g., a myocyte), a neural cell, a cumulus cell or a mammary
cell.
In a preferred embodiment, a transgenic sequence has been introduced
into the somatic cell; the somatic cell is from a cell line, e.g., a primary
cell line;
CA 02525148 1999-11-02
the somatic cell is from a cell line and a transgenic sequence has been
inserted
into the cell.
In a preferred embodiment, the oocyte is a functionally enucleated oocyte,
e.g:, an enucleated oocyte.
5 In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained -.
using an in vivo protocol to obtain an oocyte which is in a desired stage of
the cell
cycle, e:g., metaphase II or telophase; the oocyte is activated prior to or
simultaneously with the introduction of the genome. In a preferred embodiment,
1 o the oocyte and the somatic cell are synchronized, e.g., both the oocyte
and the
somatic cell are activated or both the oocyte and the somatic cell are
arrested.
In a preferred embodiment, the caprine genome of the somatic cell
includes a transgenic sequence. The transgenic sequence can be any of
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a .
15 knockout, knockin or other event which disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode any product of interest including
a protein, a polypeptide and a peptide. A protein can be any of a hormone, an
2o immunoglobulin, a plasma protein, and an enzyme. The transgenic sequence
can
encode any protein whose expression in the transgenic goat is desired
including,
but not limited to any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogenin, extracellular superoxide dismutase, fibrogen, glucocerebrosidase,
glutamate decarboxylase, human serum albumin, myelin basic protein,
proinsulin,
25 soluble CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin,
erythrpoietin,
tissue plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin, and a 1-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
CA 02525148 1999-11-02
In a preferred eiribodiment, the caprine genome comprises a heterologous
transgenic sequence under the control of a promoter, e.g., a caprine promoter.
The
promoter can be a tissue-specific promoter. The tissue specific promoter can
be
any of.- milk-specific promoters; blood-specific promoters; muscle-specific
promoters; neural-specific promoters; skin-specific promoters; hair-specific
promoters; and, urine-specific promoters. The milk-specific promoter can be
any .-
of ~a casein promoter, a beta lactoglobulin promoter, a whey acid protein
promoter and a lactalbumin promoter.
In another aspect, the invention features a method of making a
heterologous polypeptide. The method includes fusing a genetically engineered
caprine somatic cell which comprises a transgepe encoding a hetemlogous
polypeptide and a milk-specific promoter, with an enucleated caprine oocyte,
preferably a naturally matured telophase oocyte; to obtain a reconstructed
embryo; and allowing the reconstructed embryo to develop into a transgenic
goat,
e.g., by introducing the reconstructed embryo into a recipient doe.
In a preferred embodiment, the transgene is operatively linked to the milk-
specific promoter, The milk-specific promoter can be any of a casein promoter,
a beta lactoglobulin promoter, a whey acid protein promoter and a lactalbumin
. promoter.
In a preferred embodiment, the nucleus of the caprine somatic cell is
introduced into the caprine oocyte, e.g., by direct nuclear injection or by
fusion,
e.g., electrofusion, of the somatic cell with the oocyte.
In a preferred embodiment, the somatic cell is an embryonic somatic cell.
In another preferred embodiment, the somatic cell is a fibroblast; e.g., an
embryonic fibroblast.
In a preferred embodiment; the oocyte is a functionally enucleated oocyte,
e.g., an enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
-27-
CA 02525148 1999-11-02
using an in vivo protocol to obtain an. oocyte which is in a desired stage of
the cell
cycle, e.g., metaphase II or telophase; the oocyte is activated prior to or
simultaneously with the introduction of the genome. In a preferred embodiment,
theoocyte and the somatic cell are synchronized, e.g., both the oocyte and the
somatic cell are activated or both the oocyte and the somatic cell are
arrested.
In a preferred embodiment, the caprine genome of the somatic cell ..
includes a transgenic sequence. The transgenic sequence can be any of
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a
knockout, knockin or other event which disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode any product of interest such as a
protein, a polypeptide or a peptide. A protein can be any of a hormone, an
immunoglobulin, a plasma .protein, an enzyme. The transgenic sequence can
encode a protein whose expression in the transgenic goat is desired including,
but
not limited to any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogenin,
extracellular superoxide dismutase, fibrogen, glucocerebrosidase, glutamate
decarboxylase, human serum albumin, myelin basic protein, proinsulin, soluble
CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin, erythrpoietin, tissue
plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin,
and al-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
In a preferred embodiment, the heterologous polypeptide is purified from
the milk of the transgenic goat.
In a preferred embodiment; the method can also include milking the
transgenic goat.
In another aspect, the invention features a method of providing a
3o heterologous polypeptide. The method includes obtaining a goat made by
_28_
CA 02525148 1999-11-02
introducing a caprine genome of a genetically engineered caprine somatic cell
into a caprine oocyte, preferably a naturally matured telophase oocyte, to
form a
reconstructed embryo; and allowing the reconstructed embryo to develop into a
goat, e.g., by introducing the reconstructed embryo into a recipient doe; and
recovering the polypeptide from the goat, e.g., from the milk of the goat, or
a
descendantthereof.
In a preferred embodiment, the caprine genome of the somatic cell
includes a transgenic sequence. The transgenic sequence can be any of
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a
knockout, knockin or other event which disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
promoter, a. heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode any product of interest such as.
a
protein, a polypeptide and a peptide. A protein can be any of a hormone, an
immunoglobulin, a plasma protein, and an enzyme. The transgenic sequence can
encode any protein whose expression in the transgenic goat is desit~ed
including,
but not limited to any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogen'in, extracellular superoxide dismutase, fibrogen; glucocerebrosidase,
glutamate decarboxylase, human serum albumin, myelin basic protein,
proinsulin,
soluble CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin, erydupoietin,
tissue plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin, and al-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
In a preferred embodiment, the heterologous polypeptide is purified from
the milk of the transgenic goat.
In another aspect, the invention features method of making a
reconstructed caprine embryo. The method includes introducing a caprine
CA 02525148 1999-11-02
genome from a caprine somatic cell into a caprine oocyte, preferably a
naturally
matured telophase oocyte, thereby forming a reconstructed embryo.
In a preferred embodiment: the somatic cell is a non-quiescent cell (e.g.,
the cell is activated), e.g., the somatic cell is in G, stage. .In another
preferred
embodiment; the somatic cell is a quiescent cell (e.g., the cell is arrested),
e.g.,
the somatic cell is in Go stage. In a preferred embodiment, the somatic cell
is an --
embryonic somatic cell, e.g., an embryonic fibroblast. The somatic cell can be
a
fibroblast (e.g., a primary fibroblast), a muscle cell (e.g., a myocyte), a
neural
cell, a cumulus cell or a mammary cell.
In a preferred embodiment: the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
using an in vivo protocol to obtain an oocyte which is in a desired stage of
the cell
cycle, e.g., metaphase II or telophase; the oocyte is enucleated. In a
preferred
erribodiment; the oocyte and the somatic cell are synchronized, e.g., both the
oocyte and the somatic cell are activated or both the oocyte and the somatic
cell
are arrested.
In yet another aspect, the invention features a reconstructed capririe
embryo obtained by introducing a caprine genome from a caprine somatic cell
into a caprine oocyte, preferably a naturally matured telophase oocyte..
In another aspect, the invention features a method of making a
reconstructed transgenic caprine embryo. The method includes introducing a
caprine genome, e.g., by introducing a nucleus, of a genetically engineered
caprine somatic cell into a caprine oocyte, preferably a naturally matured
telophase oocyte, thereby forming a transgenic reconstructed embryo.
In a preferred embodiment the somatic cell is a non-quiescent cell (i.e.,
the cell is activated), e.g., the somatic cell is in G, stage. In another
preferred
embodiment, the somatic cell is a quiescent cell (i.e., the cell is arrested),
e.g., the
somatic cell is in Go stage. In a preferred embodiment, the somatic cell is an
-30-
CA 02525148 1999-11-02
embryonic somatic cell, e.g:, an ennbryonic fibroblast: The somatic cell can
be a
fbroblast (e.g., a primary fibroblast), a muscle cell (e.g., a myocyte), a
neural
cell, a cumulus cell or a mammary cell.
In a preferred embodiment: the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
using an in vivo protocol to obtain an oocyte which is in a desired stage of
the cell ..
cycle, e:g., metaphase II or telophase; the oocyte is enucleated. In a
preferred
embodiment, the oocyte and the somatic cell are synchronized, e.g:, both the
oocyte and the somatic cell are activated or both the oocyte and somatic cell
are
arrested.
In another aspect, the invention features a reconstnrcted ttansgenic caprine
embryo obtained by introducing a caprine genome, e.g., by introducing a
nucleus,
of a genetically engineered caprine somatic cell into a caprine oocyte,
preferably
a naturally matured telophase oocyte.
In another aspect, the invention features a method of providing a herd of
goats. The method includes making a first goat by introducing a caprine
genome,
e.g., by introducing the nucleus, from a caprine somatic cell into a caprine
oocyte,
preferably,a naturally matured telophase oocyte, to form a reconstructed
embryo
and allowing the reconstructed embryo to develop into the first goat; making a
second goat by intmducing a caprine genome, e.g., by introducing the nucleus,
from a caprine somatic cell into a caprine oocyte, preferably a naturally
matured
telophase oocyte, to form a reconstructed embryo and allowing the
reconstructed
embryo to develop into the second goat; whereby the genome of the first and
second goats are from the genetic material of the same animal, same genotype
or
same cell Line; thereby providing a herd of goats.
In a preferred embodiment, the first goat, or descendant thereof, is mated
with the second goat or a descendant thereof.
-31-
CA 02525148 1999-11-02
In another aspect, the invention features a herd of goats obtained by
making a first goat by introducing a caprine genome, e.g., by introducing the
nucleus, from a caprine. somatic cell into a caprine oocyte, preferably a
naturally
matured telophase oocyte, to form a reconstructed embryo and.allowing the
reconstructed embryo to develop into the first goat; making a second goat by
introducing a caprine genome, e.g.; by introducing the nucleus; from a
capririe
somatic cell into a caprine oocyte to form a reconstructed embryo and allowing
the reconstructed embryo to develop into the second goat; whereby the genome
of
the first and second goats are from the genetic material of the same animal,
same
genotype or same cell line.
In a preferred embodiment, the herd of goats is obtained by arty of the
methods described herein.
In another aspect, the invention features, an embryonic or fetal caprine
somatic cell,
In a preferred embodiment, the cell is a purified embryonic or fetal
caprine, somatic cell.
In a prefen~ed embodiment,, the cell is in a preparation of embryonic or
fetal caprine somatic cells.
In a preferred embodiment; the cell can be used to derive an embryonic or
fetal caprine somatic cell line.
In a preferred embodiment, the cell includes a transgene, e.g., a transgene
encoding a polypeptide. The transgene can be: integrated-into the genome of
the
somatic cell; a heterologous transgene, e.g., a hetemlogous transgene which
includes a human sequence; a knockout, knockin or other event which disrupts
the expression of a caprine gene; a sequence which encodes .a protein, e.g., a
human protein; a hetemlogous promoter; a heterologous sequence under the
control of a promoter, e.g., a caprine promoter. The transgenic sequence can
encode a product of interest such as a protein, polypeptide or peptide.
-32-
CA 02525148 1999-11-02
In a preferred embodiment; the transgene encodes any of a hormone, an
immunoglobulin, a plasma protein, and an enzyme: The transgene can encode,
e.g:, any of a-1 proteinase inhibitor, alkaline phosphotase; angiogenin,
extracellular superoxide dismutase, fibrogen, glucocerebrosidase, glutamate
decarboxylase, human serum albumin; myelin basic protein, proinsulin, soluble
CD4; lactofernn, lactoglobulin, lysozyme, lactoalbumin, erythrpoietin, tissue
plasminogen activator, human.growth factor, antithrombin III, insulin;
prolactin,
and a 1-antitrypsin.
In a preferred embodiment, the transgene is under the control of a
promoter, e.g., a heterologous or a caprine promoter. The promotercan be a
tissue=specific promoter. The tissue specific promoter can be any of a milk-
sp~ific promoter; a blood-specific promoter; a muscle-specific promoter, a
neural-specific promoter; a skin-specific promoter; a hair specific promoter,
and,
. a urine-specific promoter. The milk-specific promoter can be, e.g., any of a
~i-
casein promoter, a (3-lactoglobin promoter, a whey acid protein promoter; and
a
lactalbumin promoter.
In' a preferred embodiment, the somatic cell is a fibroblast. The fibroblast
can be a primary fibroblast or a primary derived fibroblast.
In a preferred embodiment, the cell is obtained from a goat, e.g., an
embryonic goat, derived from a germ cell obtained from a transgenic mammal.
The germ cell can be sperm from a transgenic goat.
In a preferred embodiment, the cell is a genetically engineered embryonic
or fetal caprine somatic cell, e.g., a puzified genetically engineered
embryonic or
fetal caprine somatic cell. .
In a preferred embodiment, the cell is part of a preparation of genetically
engineered embryonic or fetal caprine somatic cells. In another preferred
embodiment, the cell is used to derive a genetically engineered embryonic or
fetal
caprine somatic cell line.
In a preferred embodiment, the genetically engineered cell includes a
nucleic acid, e.g., a nucleic acid encoding a polypeptide, which has been
-33-
CA 02525148 1999-11-02
introduced into the cell. The nucleic acid can be: integrated into the genome
of
the somatic cell; a heterologous nucleic acid, e.g., a heterologous nucleic
acid
which includes a human sequence; a knockout, knockin or other event which
disrupts the expression of a caprine gene; a sequence which encodes a protein,
e.g., a human protein; a heterologous promoter; a heterologous sequence under
the control of a promoter, e.g., a caprine promoter. The nucleic acid sequence
can
encode any product of interest such as a protein, polypeptide or peptide.
In a preferred embodiment, the nucleic acid encodes any of a hormone,
an immunoglobulin, a plasma protein, and an enzyme. The nucleic acid can
encode, e.g., any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogenin,
extracellular superoxide dismutase, fibrogen, glucocerebrosidase, glutamate
decarboxylase, human serum albumin, myelin basic protein, proinsulin, soluble
CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin, erythrpoietin, tissue
plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin,
and a l -antitrypsin.
In a preferred embodiment, the nucleic acid is under the control of a
promoteI, e.g., a caprine or heterologous promoter. The promoter can be a
tissue
specific promoter. The tissue specific promoter can be any of a milk-specific
promoter; a blood-specific promoter; a muscle-specific promoter, a neural-
specific promoter; a skin-specific promoter; a hair specific promoter, and, a
urine-
specific promoter. The milk-specific promoter can be, e.g:, any of a ~i-casein
promoter; a ~i-Iactoglobin promoter; a whey acid protein promoter; and a
lactalbumin promoter.
In a preferred embodiment, the somatic cell is a fibroblast: The fibroblast
can be a primary fibroblast or a primary derived fibroblast.
In a preferred embodiment, the cell is obtained from a goat, e:g., an
embryonic goat, derived from a germ cell obtained from a transgenic goat. The
germ cell can be sperm or an oocyte from a transgenic goat.
In a preferred embodiment, the cell is used as a source of genetic material
for nuclear transfer.
_3
CA 02525148 1999-11-02
In another aspect, the invention features an embryonic or fetal caprine
somatic cell, a preparation of cells, or an embryonic or fetal caprine somatic
cell
line, e.g., as described herein, in a container, e.g., an airtight or liquid
tight
container.
In another aspect, the invention features an embryonic or fetal caprine ..
somatic cell, a preparation of cells, or an embryonic or fetal caprine somatic
cell
line, e.g., as ,described herein, which is frozen, e.g., is cryopreserved.
1o In another.aspect, the invention features a kit. The kit includes a
container
of the cell or cells described.herein. In a preferred embodiment, the kit
further
includes instructions for use in preparing a transgenic animal.
In a preferred embodiment, the kit further includes a recipient oocyte, e.g.,
an enucleated oocyte.
In another aspect, the invention features a method for providing a
component for the production of a cloned or transgenic goat. The method
includes obtaining a frozen sample of the cell or cells, e.g., those described
herein, and thawing the sample.
2o
In another asp~t, the invention features, a method of preparing an
embryonic or fetal caprine somatic cell line. The method includes obtaining a
somatic cell from an embryonic or fetal goat; and, culturing the cell, e.g.,
in a
suitable medium, such that a somatic cell line is obtained.
In a preferred embodiment, the cell line is a genetically engineered cell
line, e.g., the cell comprises a transgene. The transgene can be: integrated
into
the somatic cell genome; a heterologous transgene, e.g., a heterologous
transgene
which includes a human sequence; a knockout, knockin or other event which
disrupts the expression of a caprine gene; a sequence which encodes a protein,
3o e.g., a human protein; a heterologous promoter; a heteroiogous sequence
under
CA 02525148 1999-11-02
the control of a promoter, e.g., a caprine promoter. The transgenic sequence
can
encode any product of interest such as a protein, polypeptide or peptide.
In a preferred embodiment, the transgene encodes any of a, hormone, an
immunoglobulin, a plasma protein, and an enzyme. The transgene can encode
any protein; e.g., any of a-1 proteinase inhibitor, alkaline phosphotase;
angiogenin, extracellular superoxide dismutase, fibrogen, .glucocerebrosidase,
..
glutamate decarboxylase; human serum albumin, myelin basic protein,
proinsulin;
soluble CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin,
erythrpoietin,
tissue plasminogen activator, human growth factor, antithrombin III, insulin,
90 prolactin, and al-antitrypsin.
In a preferred embodiment, the transgene is under the control of a
promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-
specific promoter. The tissue specific promoter can be any of a milk-specific
promoter; a blood-specific promoter; a muscle-specific promoter, a neural-
specific promoter; a skin=specific promoter, a hair specific promoter; and, a
urine-
specific promoter. The milk-specific promoter can be, e.g., any of a ~-casein
promoter, a (3-lactoglobin promoter; a whey acid protein promoter, and a
lactalbumin promoter.
In a preferred embodiment, the genetically engineered cell includes a
2o nucleic acid, e.g., a nucleic acid encoding a polypeptide, which has been
introduced into the cell. The nucleic acid can be: integrated into the genome
of
the somatic cell; a heterologous nucleic acid, e.g., a heterologous nucleic
acid
which includes a human sequence; a knockout, knockin or other event which
disrupts the expression of a caprine gene; a sequence which encodes a protein,
e.g:, a huriian protein; a heterologous promoter; a heterologous sequence
under
the control of a promoter, e.g., a caprine promoter. The nucleic acid sequence
can
encode any product of interest such as a protein, polypeptide or peptide.
In a preferred embodiment, the nucleic acid can encode any of a
hormone, an immunoglobulin, a plasma protein, and an enzyme. The nucleic
3o acid can encode, e.g.; any of a-1 proteinase inhibitor, alkaline
phosphotase,
_3g_
CA 02525148 1999-11-02
angiogenin, extracellular superoxide dismutase, fibrogen; glucocerebrosidase,
glutamate decarboxylase, human serum albumin, myelin basic protein,
proinsulin,
soluble CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin,
eryth~poietin,
tissue plasminogen activator, human growth factor, antithrombin III, insulin;
5, prolactin, and al-antitrypsin.
In a preferred embodiment, the nucleic,acid is under the control of a
promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-
specific promoter: The tissue specific promoter can be any of a milk-specific
promoter; a blood-specific promoter; a muscle-specific promoter; a neural-
specific promoter, a skin-specific promoter; a hair specific promoter; and, a
urine-
specific promoter. The milk-specific promoter can be, e.g., any of a ~-casein
promoter; a /3-lactoglobin promoter; a whey acid protein promoter; and a
lactalbumin promoter.
In a preferred embodiment, the somatic cell is a fibroblast. The fibmblast can
1 s be a primary fibroblast or a primary derived fibroblast.
In a preferred embodiment, the cell is obtained from a goat, e.g., an
embryonic or fetal goat, derived from a germ cell obtained from a transgenic
goat. The germ cell can be or an oocyte from a transgenic goat.
In a preferred embodiment, the cell is used as a source of genetic material
20 for nuclear transfer.
In another aspect, the invention features, a method of preparing an
embryonic or fetal caprine somatic cell line. The method includes inseminating
a
female recipient with the semen from a goat; obtaining a transgenic. embryo
from
25 the recipient; obtaining a somatic cell from the embryo; and, culturing the
cell in
a suitable medium, such that a somatic cell line is obtained.
In a preferred embodiment, the semen is from a transgenic goat.
In a preferred embodiment, the cell line is a genetically engineered cell
line, e.g., the cell comprises a transgene. The transgene can be: integrated
into
30 the somatic cell genome; a heterologous transgene, e.g., a heterologous
transgene
CA 02525148 1999-11-02
which includes a human sequence; a knockout, knockimor other event which
disrupts the expression of a caprine gene; a sequence which encodes a.
protein,
e.g., a human protein; a heterologous promoter; a heterologous sequence under
the control of a promoter, e.g., a caprine promoter. The transgenic sequence
can
encode any product of interest such as a protein, polypeptide or peptide.
In a preferred embodiment, the transgene encodes any of a hormone, an ..
immunoglobulin, a plasma protein, and an enzyme. The transgene can encode
any protein, e.g., any of a-1; proteinase inhibitor, alkaline phosphotase,
angiogenin, extracellular superoxide dismutase, fibrogen, glucocerebrosidase,
glutamate decarboxylase, human serum albumin, myelin basic protein,
proinsuliri,
soluble CD4, lactoferrin,.lactoglobulin, lysozyme, lactoalbumin,
erythrpoietin,
tissue plasminogen activator, human growth factor, antithrori~bin III;
insulin,
prolactin, and al-antitrypsin.
In a prefewed embodiment, the transgene is under the control of a
promoter, e;g., a caprine or heterologous promoter. The promoter can be a
tissue-
specific promoter. The tissue specific promoter can be any of a milk-specific
promoter, a blood-specific promoter, a muscle-specific promoter; a neural-
specific promoter; a skin-specific promoter; a hair specific prornoter; and, a
urine-
specific promoter. The milk-specific promoter can be, e.g., any of a (3-casein
promoter, a ~-lacfoglobin promoter; a whey acid protein promoter, and a
lactalbumin promoter.
In a prefeaed embodiment, the genetically engineered cell includes a
nucleic acid, e.g., a nucleic acid encoding a polypeptide, which has been
introduced into the cell. The nucleic acid can be: integrated into the genome
of
the somatic cell; a heterologous nucleic acid, e:g., a heterologous nucleic
acid
which includes a human sequence; a knockout, knockin or other event which
disrupts the expression of a caprine gene; a sequence which encodes a protein,
e.g., a human protein; a heterologous promoter, a heterologous sequence under
the control of a promoter, e.g., a caprine promoter. The nucleic acid sequence
can
encode any product of interest such as a protein, polypeptide or peptide.
-38=
I CA 02525148 1999-11-02
In a preferred embodiment, the nucleic acid can encodes any of a
hormone, an immunoglobulin, a plasma protein, and an enzyme: The nucleic
acid can encode, e.g., any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogenin,. extracellular superoxide dismutase, fibrogen, glucocerebrosidase;
glutamate decarboxylase, human serum albumin, myelin basic protein,
proinsulin;
soluble CD4, lactofeirin, lactoglobulin, lysozyme, lactoalbumin,
erythrpoietin, ..
tissue, plasminogen activator, .human growth factor, antithrombin III,
insulin,
prolactin, and al-antitrypsin.
In a preferred embodiment, the nucleic acid is under the control of a
promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-
specific promoter. The tissue specific promoter can be any of a milk-specific
promoter, a blood-specific promoter, a muscle-specific promoter, a neural-
specific promoter; a skin-specific promoter, a hair specific promoter, and, a
urine-
specific promoter. The milk-specific promoter can be, e.g., any of a ~-casein
promoter; a ~i-lactoglobin promoter, a whey acid protein promoter; and a .
lactalbumin promoter.
In a preferred embodiment, the somatic cell is a fibroblast. The fibroblast
can be a primary fibroblast or a primary derived fibroblast.
In a preferred embodiment, the cell is used as a source of$enetic material
for nuclear transfer.
The present invention is also based, in part, on the discovery that a
reconstructed embryo which is transferred into a recipient mammal at the two
to
four cell stage of embryogeriesis can develop into a cloned mammal. The
mammal can be an embryo, a fetus, or a post natal mammal, e.g., an adult
mammal.
Accordingly, in one aspect, the invention features a method of producing
a non-human mammal, e.g., a cloned mammal, e.g., a goat, cow, pig, horse,
sheep, llama, camel. The method includes maintaining a mammalian
- reconstructed embryo, e.g.; a reconstructed embryo wherein, the genome is
-39-
CA 02525148 1999-11-02
derived from a somatic cell, in culture until the embryo is in the 2 to 8 cell
stage,
transferring the embryo, at the 2 to'8 cell stage into a recipient mammal, and
allowing the reconstructed embryo to develop into a mammal, to thereby produce
a mammal.
5 In a preferred embodiment, the mammal develops from the reconstructed
embryo. In another embodiment, the mammal is a descendant of a mammal
which developed from the reconstructed embryo.
In a preferred embodiment, the reconstructed embryo is maintained in
culture until the embryo is in the 2 to 8, the 2 to 6, the 2 to 4 cell stage
of
embryogenesis.
In a preferred embodiment, the genome of the reconstructed embryo is
derived from: a somatic cell, e.g., a fibroblast or epithelial cell; a
genetically
engineered somatic cell, e.g., a somatic cell comprising a transgenic
sequence.
In a preferred embodiment, the method further includes mating the
mammal which develops from the reconstructed embryo with: a second mammal;
a second mammal which develops from a reconstructed embryo or is descended
from a mammal which developed from a reconstructed embryo; or a second
mammal developed from a reconstructed embryo, or descended from a mammal
which developed from a reconstructed embryo, which was formed from genetic
material from the same animal, an animal of the same genotype, or same cell
line,
which supplied the genetic material for the fast riiammal. In a preferred
embodiment, a first transgenic mammal which develops from the reconstructed
embryo can be mated with a second transgenic mammal which developed from a
reconstructed embryo and which contains a different transgene that the first
~ transgenic mammal.
In a preferred embodiment, the mammal is a male mammal. In other
preferred embodiments, the mammal is a female mammal. A fem8le mammal
can be induced to lactate and milk can be obtained from the mammal.
In a preferred embodiment: a product, e.g., a protein, e.g., a recombinant
protein, e.g., a human protein, is recovered from the mammal; a product, e.g.,
a
-40-
t
CA 02525148 1999-11-02
protein, e.g., a human protein, is recovered from the milk; urine, hair,
blood, skin
or meat of the mammal.
In a preferred embodiment, the mammal is: embryonic; fetal; or,
postnatal, e.g.; adult.
In a preferred embodiment, -the genome. of the reconstructed embryo is
derived from a genetically engineered somatic cell, e.g., a transgenic cell or
a cell ..
which a nucleic acid has been introduced.
In another aspect, the invention features a rriethod of producing a non-
t0 human mammal, e.g., a transgenic mammal, e.g., a goat, cow, pig, horse,
sheep,
llama, camel. The method includes maintaining a mammalian reconstructed
embryo (e.g., a reconstructed embryo wherein its genome is derived from a
genetically engineered somatic cell) in culture until the embryo is in the 2
to 8
cell stage, transferring the embryo at the 2 to 8 cell stage into a recipient
mammal; and allowing the reconstructed embryo to develop into a mammal, to
thereby produce a transgenic mammal.
In a preferred embodiment, the mammal develops from the r~onstructed
embryo. In another embodiment, the mammal is a descendant of a mammal
which developed from the reconstructed embryo.
In a preferred embodiment, the reconstructed embryo is maintained in
culture until the embryo is in the 2 to 8, the 2 to 6, the ~ to 4 cell stage
of
embryogenesis.
In a preferred embodiment, the method further includes mating the
mammal which develops from the reconstructed embryo with: a second mammal;
a second mammal which develops from a reconstructed embryo or is descended
from a mammal which developed from a reconstructed embryo; or a second
mammal developed from a reconstructed embryo, or descended from a mammal
which developed from a reconstructed embryo, which was formed from,genetic
material from the same animal, an animal of the same genotype, ~r same cell
line,
which supplied the genetic material for the first mammal. In a preferred
-41-
CA 02525148 1999-11-02
embodiment, a first transgenic mammal which develops from the reconstructed
embryo can be mated with a second transgenic mammal which developed from a ,
reconstructed embryo and which contains a different transgene that the first
transgenic mammal.
In a preferred embodiment, the mammal, is a male mammal. In othei
preferred embodiments, the mammal is a female mammal. A female mammal
can be induced to lactate and milk can be obtained from the mammal.
In a preferred embodiment: a product, e.g., a protein, e.g., a recombinant
protein, e.g., a human protein, is recovered from the mammal; a product, e.g.,
a
protein, e.g., a human protein, i~ recovered from the milk; urine, hair,
blood, skin
or meat of the mammal.
In a preferred embodiment, the genome of the genetically engineered
somatic cell includes a transgenic sequence. The transgenic sequence can be
any
of a heterologous transgene, e.g:; a human transgene; a knockout, knockin or.
other event which disrupts the expression of a mammalian gene; a sequence
which encodes a protein; e.g., a human protein; a heterologous promoter; s
heterologous sequence under the control of a promoter, e.g., a caprine
promoter.
The transgenic sequence can encode any product of interest such as a protein,
polypeptide or peptide.
2o In a preferred embodiment, the transgenic sequence encodes any of a
hormone, an immunoglobulin, a plasma protein, and an enzyme. The transgenic
sequence can encode any protein whose expression in the transge~nic mammal is
desired, e.g., any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogenin,
extracellular supeTOxide dismutase, fibrogen, glucocerebrosidase; glutamate
decarboxylase, human serum albumin; myelin basic protein, proinsulin, soluble
CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin, erythrpoietin, tissue
plasminogen activator; human growth factor, antithrombin III, insulin,
prolactin,
and al-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
3o protein.
-~2-
CA 02525148 1999-11-02
In a preferred embodiment, the transgenic sequence is under the control of
a promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-specific promoter. The tissue specific promoter can be any of milk-
specific promoters; blood-specific promoters; muscle-specific promoters;
neural-
specific promoters; skin-specific promoters;,hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be, e.g., anyof-. a casein
..
promoter, a beta lactoglobulin promoter, a whey acid protein promoter and a
lactalbumin promoter.
In a preferred embodiment, a.nucleic acid can be introduced into the
genome of the genetically engineered somatic cell. The nucleic acid can be any
of a heterologous transgene, e.g., a human transgene; a knockout, knockin or
other event, which disrupts the expression of a mammalian gene; a sequence
which encodes a protein, e.g., a human protein; a heterologous promoter; a
heterologous sequence under the control of a promoter, e.g., a caprine or
heterologous promoter. The nucleic acid sequence can encode any product of
interest such as a protein, polypeptide or peptide. - .
In a prefeaed embodiment, the nucleic acid encodes any of a hormone,
an immunoglobulin, a plasma protein, and an enzyme. The nucleic acid sequence
can encode any protein whose expression in the transgenic mammal is desired,
e.g., any of a-1 proteinase inhibitor, alkaline phosphotase, angiogenin,
extracellular supemxide dismutase, fibrogen, glucocerebrosidase, glutamate
decarboxylase, human serum albumin, myelin basic protein, proinsulin, soluble
CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin, eryt>upoietin, tissue
plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin,
and ocl-antitrypsin.
In a preferred embodiment, the nucleic acid sequence encodes a human
protein.
In a preferred embodiment, the nucleic acid sequence is under the control
of a promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-specific promoter: The tissue specific promoter can be any ofi milk
CA 02525148 1999-11-02
specific promoters; blood-specific promoters; muscle-specific promoters;
neural-
specific promoters-, skin-specific promoters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be; e.g., any of 'a casein
promoter, a beta lactoglobulin promoter, a whey acid protein promoter and a
7actalbumin promoter.
In another aspect, the invention features a method of producing a cloned
goat. The method includes maintaining a caprine reconstructed embryo (e.g., a
reconstructed embryo wherein its genome is derived from a caprine somatic
cell)
in culture until the embryo is in the 2 to 8 cell stage, transferring the
embryo at
the 2 to 8 cell stage into a recipient goat, and allowing the reconstructed
embryo
to develop into a goat, to thereby produce a goat.
In a preferred embodiment, the goat is: embryonic; fetal; or, postnatal,
e.g.; adult.
In a prefen~ed embodiment, the goat develops from the reconshucted
embryo. In another embodiment, the goat is a descendant of a goat which
developed from the reconstructed embryo.
In a preferred embodiment, the reconstructed embryo is maintained in
culture until the embryo is in the 2 to 8, the 2 to 6, the 2 to 4 cell stage
of
embryogenesis.
In a preferred embodiment, the genome of the reconstructed embryo is
derived from: a caprine somatic cell, e.g., a fibmblast or epithelial cell; a
genetically engineered caprine somatic cell, e.g., the genome of the caprine .
somatic cell comprises a transgenic sequence or a nucleic acid has been
introduced into the genome of the somatic cell.
In a preferred embodiment, the method further includes mating the goat
which develops from the reconstructed embryo with: a second goat; a secobd
goat
which develops from a reconstructed embryo or is descended from a goat which
developed from a reconstructed embryo; or a second goat developed from a
3o reconstructed embryo, or descended from a goat which developed from a
CA 02525148 1999-11-02
reconstructed embryo, which was formed from genetic material from the same
animal, an animal of the same genotype, or same cell line, which supplied the
genetic material for the first goat. In a preferred embodiment, a first
transgenic
goat which develops from the reconstructed embryo can be mated with a second
transgenic goat which developed from a reconstructed embryo and which
contains a different transgene that the first transgenic goat.
In a preferred embodiment, the goat is a male goat. In other preferred
embodiments, the goat is a female goat. A female goat can be induced to
lactate
and milk can be obtained from the goat.
In a preferred embodiment: a product, e.g., a pmtein, e.g., a recombinant
protein, e.g., a human protein, is recovered from the goat; a product, e.g., a
pmtein; e.g., a human protein, is recovered from the milk, urine, hair, blood,
skin
or meat of the goat.
In another aspect, the invention features a method of producing a
transgenic goat. The method includes maintaining a caprine reconstructed
embryo (e.g., a reconstructed embryo wherein its genome is derived from a
genetically engineered somatic cell) in culture until the embryo is in the 2
to 8
cell stage, transferring the embryo at the 2 to 8 cell stage into a recipient
goat, and
allowing the reconstructed embryo to develop into a goat, to thereby produce a
transgenic goat.
In a prefen-ed embodiment, the goat is: embryonic; fetal; or, postnatal,
e.g., adult.
In a prefen~ed embodiment, the goat develops from the reconstructed
embryo. In another embodiment, the goat is a descendant of a goat which
developed from the reconstructed embryo.
In a preferred embodiment, the reconstructed embryo is maintained in
culture until the embryo is in the 2 to 8, the 2 to 6, the 2_to 4 cell stage
of
embryogenesis.
-45-
CA 02525148 1999-11-02
In a preferred embodiment, the genome of the reconstructed embryo is
derived from a somatic cell, e.g., a fibroblast or epithelial cell.
In a preferred embodiment, the method further includes mating the goat
which develops from the reconstructed. embryo with: a second goat; a second
goat
which develops from a reconstructed embryo or is descended from a goat which
developed from a reconstructed embryo; or a second goat developed from a
reconstructed embryo, or descended from a goat which developed from a
reconstructed embryo, which was formed from genetic material from the same
animal, an animal of the same genotype, or same cell line, which supplied the
genetic material for the first goat. In a preferred embodiment, a first
transgenic
goat which develops from the reconstructed embryo can be mated with a second
trarisgenic goat which developed from a reconstructed embryo and which
contains a different transgene that the first transgenic goat.
In a preferred embodiment, the goat is a male goat. In other preferred
embodiments, the goat is a female goat. A female goat can be induced to
lactate
and milk can be obtained from the goat.
In a preferred embodiment:.a product, e.g., a protein, e.g., a recombinant
protein, e.g., a human protein, is recovered from the goat; a product, e.g., a
protein, e.g., a human protein, is recovered from the milk, urine, hair,
blood, skin
or meat of the goat.
In a preferred embodiment, the genome of the genetically engineered
somatic cell includes a transgenic sequence. The trans~enic sequence can be
any
of a hetcrologous transgene, e.g., a human transgene; a knockout, knockin or
other event which disrupts the expression of a mammalian gene; a sequence
which encodes a protein, e.g., a human protein; a heterologous promoter; a
heterologous sequence under the control of a promoter, e.g., a caprine or
heterologons promoter. The transgenic sequence can encode any product of
interest such as a protein, polypeptide or peptide: .
In a preferred embodiment, the transgenic sequence encodes any of a
3o hormone, an immunoglobulin, a plasma protein, and an enzyme. The transgenic
CA 02525148 1999-11-02
sequence can encode any protein whose expression in the transgenic mammal is
desired, e.g., any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogenin,
extracellular superoxide dismutase, fibrogen, glucocerebrosidase, glutamate
decarboxylase, human serum albumin, myelin basic protein, proinsulin, soluble
CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin, erythrpoietin, tissue
plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin,
and a 1-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
In a preferred embodiment, the transgenic sequence is under the control of
a promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-specific promoter. The tissue specific promoter can be any of milk-
specific promoters; blood-specifc promoters; muscle-specific promoters; neural-
specific promoters; skin-specific promoters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be, e.g., any of a casein
promoter, a beta lactoglobulin promoter, a whey acid protein promoter and a
lactalbumin promoter.
In a preferred embodiment, a nucleic acid has been introduced into the
genome of the genetically engineered somatic cell. The nucleic acid sequence
can be any of a heterologous transgene, e.g., a human transgene; a knockout,
knockin or other event which disrupts the expression of a mammalian gene; a
sequence which encodes a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
or heterologous promoter. The transgenic sequence can encode any product of
interest such as a protein, polypeptide or peptide.
In a preferred embodiment, the nucleic acid encodes any of~. a hormone,
an immunoglobulin, a plasma protein, arid an enzyme. The nucleic acid sequence
can encode any protein whose expression in the transgenic mammal is desired,
e.g., any of-. a-1 proteinase inhibitor, alkaline phosphotase, angiogenin,
extracellular superoxide dismutase, fibrogen, glucocerebrosidase, glutamate
-47-
CA 02525148 1999-11-02
decarboxylase, human serum albumin, myelin basic protein; proinsulin, soluble
CL14, lactoferrin, lactoglobulin, lysozyme, lactoalbumin, erythrpoietin,
tissue
plasminogen activator, human growth factor, antithrombin.III, insulin,
prolactin,
and a l -antitrypsin.
In a preferred embodiment, the nucleic .acid sequence encodes a human
protein. ..
In a preferred embodiment, the nucleic acid sequence is under the control
of a promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-specific promoter. The tissue specific promoter can be any of milk-
specific promoters; blood-specific promoters; muscle-specific promoters;
neural-
specific promoters; skin-specific promoters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be, e.g., any of a casein
promoter, a beta lactoglobulin promoter, a whey acid protein promoter and a
lactalbumin promoter.
In another aspect, the invention features a kit. The kit includes a
reconstructed embryo which is in the 2 to 8 cell stage. In a preferred
embodiment, the kit further includes instructions for producing a mammal,
e.g.,
an embryonic, fetal or postnatal mammal.
In another aspect, the invention features a kit which includes a later stage
embryo, e.g., an embryo after the 8 cell stage, or a fetus, obtained, e.g., by
the
methods described heroin.
As used herein, the term "functional enucleation" refers to a process of
rendering the endogenous genome of a cell; e.g., an oocyte, incapable of
functioning, e.g., replicating and/or synthesizing DNA. Such an oocyte is
referred to herein as a "functionally enucleated oocyte".
-48-
CA 02525148 1999-11-02
The terms protein, polypeptide and peptide are used interchangeably
herein.
As used herein, the term "transgenic sequence" refers to a nucleic acid
sequence (e.g., encoding one or more human proteins), which is inserted by
artifice into a cell. The transgenic sequence, also referred to herein as a ..
tTansgene, becomes part of the genome of an animal which develops in whole or
in part from that cell. In embodiments of the invention, the transgenic
sequence
is integrated into the chromosomal genome. If the transgenic sequence is
integrated into the genome it.results, merely by virtue of its insertion, in a
change
in the nucleic acid sequence of the genome into which it is inserted. A
transgenic
sequence can be partly or entirely species-heterologous, i.e., the transgenic
sequence, or a portion thereof, can be from a species which is different from
the
cell into which it is introduced. A transgenic sequence can be partly or
entirely
i5 species-homologous, i.e., the transgenic sequence, or a portion thereof,
cart be
from the same species as is the cell into which it is introduced. If a
transgenic
sequence is homologous (in the sequence sense or in the species-homologous
sense) to an endogenous gene of the cell into which it is introduced, then the
transgenic sequence, preferably, has one or more of the following
characteristics:
it is designed for insertion, or is inserted, into the cell's genome in such a
way as
to alter the sequence of the genome of the cell into which it is inserted
(e.g., it is
inserted at a location which differs from that of the endogenous gene or its
insertion results in a change in the sequence of the endogenous endogenous
gene); it includes a mutation, e.g., a mutation which results in misexpression
of
the transgenic sequence; by virtue of its insertion, it can result in
misexpression
of the gene into which it is inserted, e.g., the insertion can result in a
knockout of
the gene into which it is inserted. A transgenic sequence can include one or
more
transcriptional regulatory sequences and any other nucleic acid sequences,
such
as introns, that may be necessary for a desired level or pattern of expression
of a
selected nucleic acid, all operably linked to the selected nucleic acid. The
_49_
CA 02525148 1999-11-02
transgenic sequence can include an enhancer sequence and or sequences which
allow for secretion.
The terms "reconstructed embryo", "reconstituted embryo", "nuclear
transfer unit" and "nuclear transfer embryo" are used interchangeably herein.
As used herein, the term "normal goat" refers to a goat which did not
develop from a reconstructed embryo.
- A "naturally derived oocyte" is one which is allowed to reach a selected
stage; e.g.; metaphase II or more preferably telophase, by culturing under
natural
conditions, e.g., in vivo. The term "natural,conditions" means the absence of
treatment of the oocyte with exogenously added chemicals, e.g., ethanol, to
affect
the stage of meiosis. In prefer ed embodiments, a naturally matured
preparation
can include metaphase II, telophase or both stages. The inventors have
discovered that naturally matured oocytes are preferable to those which have
been
chemically induced.
Other features and advantages of the invention will be apparent from the
following description and from the claims.
Detailed Description of the Invention
Sources of Somatic Genomes:
Somatic Cells
Somatic cells can supply the genome for producing a reconstructed
embryo in the methods described herein. The term "somatic cell", as used
herein,
refers to a differentiated cell. The cell can be a somatic cell or a cell that
is
committed to a somatic cell lineage. Alternatively, any of the methods and
-50-
CA 02525148 1999-11-02
animals described herein can utilize a diploid stem cell that gives rise to a
germ
cell in order to supply the genome for producing a reconstructed embryo.
The somatic cell can be from an animal or from a cell culture. If taken
from an animal, the animal can be at any stage of development, e.g.; an
embryo, a
5. feius or an adult. Embryonic cells are preferred. Embryonic cells can
include
embryonic stem cells as well as embryonic cells committed to a somatic cell -
lineage. -Such cells can be obtained from the endoderm, mesoderra or ectoderm
of the embryo. Preferably; the embryonic cells are committed to somatic cell
lineage. Embryonic cells committed to a somatic cell lineage refer to cells
1o isolated.on or after day 10 of embryogenesis. However, cells can be
obtained
prior to day ten of embryogenesis. If a cell line is used as a source of a
chromosomal genome, primary cells are preferred. The term "primary cell line"
as used herein includes primary cell lines as well as primary-derived cell
lines.
Suitable somatic cells include fibroblasts (e.g., primary fibroblasts, e.g.,
15 embryonic primary fibroblasts), muscle cells (e.g., myocytes), cumulus
cells,
neural cells; and mammary cells. Other suitable cells include hepatocytes and
pancreatic islets. Preferably, the somatic cell is an embryonic somatic cell,
e.g., a
cell isolated on or after day 10 of embryogenesis: The genome of the somatic
cells can be the naturally occurring genome, e.g:, for the production of
cloned
20 . mammals; or the.genorae can be genetically altered to comprise a
transgenic
sequence, e.g., for the production of transgenic cloned mammals.
Somatic cells can be obtained by, for example, dissociation of tissue, e.g.,
by mechanical (e.g., chopping, mincing) or enzymatic means (e.g.,
trypsinization)
to obtain a cell suspension and then by culturing the cells until a confluent
25 monolayer is obtained. The somatic cells can then be harvested and prepared
for
cryopreservation, or maintained as a stock culture. The isolation of caprine
somatic cells, e.g., fibroblasts, is described herein.
The somatic cell can be 'a quiescent or non-quiescent somatic cell. "Non-
quiescent", as used herein, refers to a cell in mitotic cell cycle. The
mitotic cell
3o cycle has four distinct phases, G" S, G~ and M. The beginning event in the
cell
-51-
CA 02525148 1999-11-02
cycle, called START; takes place during the G, phase. "START" as used herein
refers to early G, stage of the cell cycle prior to the commitment of a cell
to
proceeding through the cell cycle. For example, 1, 2, 3, 4, 5, 6, 7, 8; 9,10
up to
11 hours after a cell enters the G, stage, the cell is considered prior to
START.
The decision as to whether the cell will undergo. another cell cycle is made
at
START. Once the cell has passed through START, it passes through the
remainder of the G, phase (i.e., the pre-DNA synthesis stage). The S phase is
the
DNA synthesis stage, which is followed by the Gt phase, the stage between
synthesis and mitosis. .Mitosis takes place during the M phase. If at START,
the
cell does not undergo another cell cycle, the cell becomes quiescent. In
addition,
a cell can be induced to exit the cell cycle and become quiescent. A
"quiescent"
cell, also referred to as a cell in Go phase, refers to a cell which is not in
any of the
four phases of the cell cycle. Preferably; the somatic cell is a cell in the
Gophase
or the G, phase of the mitotic cell cycle.
t5 Using donor somatic cells at certain phases of the cell cycle, e.g., Go or
G,
phase, can allow for synchronization between the oocyte and the genome of the
somatic cell. For example, reconstruction of an oocyte in metaphase II by
introduction of a nucleus of a somatic cell in Go or G,, e.g., by simultaneous
activation and fusion, can mimic the events occurring during fertilization. By
2o way of another example, an oocyte, in telophase II fused, e.g., by
simultaneous
activation and fusion, with the genome of a somatic cell in G, prior to START,
provides a synchronization of cell cycle between the oocyte and donor nuclei.
Methods of detenriining which phase of the cell cycle a cell is in are
known. For example, as described below in the Examples, various markets are
25 present at different stages of the cell .cycle. Such markers can include
cyclins D
1, 2, 3 and proliferating cell nuclear antigen (PCNA) for G,, and BrDu to
detect
DNA synthetic activity.: In addition, cells can be induced to enter the Go
stage by
culturing the cells on serum-deprived rnediuni. Alternatively, cells in Ga
stage
can be induced to enter the cell cycle, i.e., at G, stage, by serum
activation.
-52-
CA 02525148 1999-11-02
Thedonor cells can be obtained from a mammal, e.g., an, embryonic,. fetal
or adult mammal, or from a culture system, e:g., a synchronous culture system.
For example, the donor cell can be selected from a culture system which
contains .
. at .least a majority of donor cells (e.g., 50%, 55%, 60%, 65%, 70%, 75%,
80%,
, '85%, 90% or more) in a specific stage of the mitotic.cell .cycle.
' Sources of Geneticalh~ Engineered Somatic Cells: .
. , . . . Transgenic-Mammals .
Methods for generating son-human. tiansgenic mammals which can be~
i0 used as'a source of somatic cells in the invention are known in the art.
Such
methods cari involve introducing D,NA constructs into the germ line of s
mammal
to make a transgenic mammal. For example, one or several copies of the
construct maybe incorporated intoahe geriome of~a mammalian embryo by ' _ . .
. standard transgenic techniques. ' . . _ . .
' . ~ ~ .Although goats are a preferred source of genetically engineered
somatic . '
cells, other non-human mammals can be used: Prefen-ed non-human mammals
are'ruminants, e,g., cows, sheep, camels-or goats. .Goats of Swiss origin,
e.g., the
Alpine, Saanen and Toggenburg bleed goats, an useful in the methods descn'bal
. ~ .
herein. Additional examples of preferred non-human animals include oxen,
2o horses, llamas, and pigs. The mammal used as the source of genetically
engineered cells will' depend on the transgenic mammal to be obtained by the
methods of the invention as,. by way of example, a goat genome should be .
introduced, into a goat functionally enucleated oocyte. ' v '
. preferably, the somatic cells for use in the invention are obtained from a
25, transgenic goat. Methods of producing transgenic goats are knows in the
art. For
example, a transgene~can be introduced into the gennline of a goat by
microinjection.as described, for example; in Eberi et al. (1994)
Biof!'echnology
12:699 . . .
Other transgerlic non-human animals to be used as a source of genetically
30 . engineered somatic cells can be produced by introducing a txansgene into
the
-
CA 02525148 1999-11-02
germline of the nvn-human animal. Embryonal target cells at various
developmental stages can be used to introduce transgenes. Different methods
are
used depending on the stage of development of the embryonal target cell. The
specific lines) of any animal used to practice this invention are selected for
general good health, good embryo yields, good pronuclear visibility in the
embryo, and good reproductive fitness. In addition, the haplotype is a
significant
factor.
Transfected CeII Lines
Genetically engineered somatic cells for use in the invention can be
obtained from a cell line into which a nucleic acid of interest, e.g., a
nucleic acid
which encodes a protein, has been introduced.
A construct can be introduced into a cell via conventional transformation
or transfection techniques. As'used heroin, the terms "transfection" and
"transfomlation" include a variety of techniques for introducing a transgenic
sequence into a host cell, including calciuiu phosphate or calcium chloride co-
precipitation, DEAF-dextrane-mediated transfection, lipofection, or
electroporation. In addition, biological vectors; e.g., viral vectors can be
used as
described below: Suitable methods for transforming or tiansf~ting host cells
can
be found in Sambrook et al., Molecular Cloning: A Laboratory Manuel, 2nd ed.,
Cold Spring Harbor Laboratory, (Cold Spring Harbor Laboratory Press, Cold
Spring ITarbor, NY,1989), and other suitable laboratory manuals.
Two useful approaches are electroporation and lipofection. Brief
examples of each are described below.
The DNA construct can be stably. introduced into a donor somatic cell line
by electmporation using the following protocol: somatic cells, e.g.,
fibroblasts,
e.g., embryonic fibroblasts, are resuspended in PBS at about 4 x 106,
cells/ml.
Fifty micorgrams of Iinearized DNA is added to the 4.5 ml cell suspension, and
the suspension is placed in a 4.4 cm electrode gap cuvette (Biorad).
Electroporation is performed using a Biorad Gene Pulser electroporator with a
CA 02525148 1999-11-02
330 voltpulse at 25 mA,1000 microFarad and.infinite resistance. If the DNA
construct contains a Neomyocin resistance gene for selection, neomyocin
resistant clones are selected following incubation with 350 microgram/m1 of
6418 (GibcoBlu.,) for I S days.
The,DNA construct can be stably introduced into a donor somatic cell line
by lipofection using a protocol such as the following: about 2 x 105 cells are
plated into a 3.5 cmiameter well and transfected with 2 micrograms of
linearized
DNA using LipfectAMINET"" (GibcoBRL). Forty-eight hours after transfection,
the cells are split 1:1000 and 1:5000 and, if the DNA construct contains a
neomyosin resistance gene for selection, 6418 is added to a final
concentration of
0.35 mg/ml. Neomyocin resistant clones are isolated and.expanded for
cyropreservation as well as nuclear transfer.
Tissue-Specific ExQression of Proteins
It is often desirable to express a protein, e.g:, a heterologous profein, in a
specific tissue or fluid, e.g., the milk, of a traasgenic animal: The
hetemlogous
- protein can be recovered from the tissue or fluid in which it is expressed.
For
example; it is often desirable to express. the heterologous protein in miik.
Methods for producing a heterologous protein under the control of a milk
specific
promoter are described below. In addition, other tissue-specific promoters, as
well as, other regulatory elements, e.g., signal sequences and sequence which
enhance secretion of non-secreted proteins, are described below.
Milk Specific Promoters
Useful transcriptional promoters are those promoters that are
preferentially activated in mammary epithelial cells, including promoters that
control the genes encoding milk proteins such as caseins, beta lactoglobulin
(Clark et al., (1989) Bio/Technology 7: 487-492), whey acid protein (cordon et
al. (1987) Bio/Technology 5: 1183-1187), and lactalbumin iSoulier et al.,
(1992)
-55-
CA 02525148 1999-11-02
FEBS Letts. 297:13 . Casein promoters may be derived from the alpha, beta,
gamma or kappa casein genes of any mammalian species; a preferred promoter is
derived from the goat beta casein gene (DiTullio, (1992) Bio/Technology 10:74=
77). Milk-specific protein promoter or the promoters that are specifically
5 activated in mammary tissue can be derived from cDNA or genomic sequences.
Preferably, they are genomic in origin.
DNA sequence information is available for the mammary gland specific
genes listed above; in at least one, and often in several organisms. See,
e.g.,
Richards et al., J. Biol. Chem. 256, 526-532 (1981) (a-lactalbumin rat);
Campbell
et al., Nucleic Acids Res. 12, 8685-8697 (1984) (rat WAP); Jones et al., J.
Biol.
Chem. 260, 7042-7050 (1985) (rat /3-casein); Yu-Lee & Rosen, J. Biol. Chem.
258, 10794-10804 (1983) (rat Y-casein); Hall, Biochem. J. 242, 735-742 (1987)
oc-lactalbumin human); Stewart, Nucleic Acids Res. 12, 389 (1984) (bovine asl
and x casein cDNAs); Gorodetsky et al., Gene 66, 87-96 ( 1988) (bovine (3
15 casein); Alexander et al., Eur. J. Biochem. 178; 395-401 (1988) (bovine x
casein);
Brignon et al., FEBS Lett. 188, 48-55 (1977) (bovine aS2 casein); Jamieson et
al.; Gene 61, 85-90 (1987), Ivanov et al., Biol. Chem. Hoppe-Seyler 369, 425-
429
(1988), Alexander et al., Nucleic Acids Res. 17, 6739 (1989) (bovine (3
lactoglobulin); Vilotte et al., Biochimie 69, 609-620 (1987) (bovine a-
lactalbumin). The structure and function of the various milk pmtein genes are
reviewed by Mercier & Vilotte, J. Dairy Sci. 76, 3079-3098 (1993)
(incorporated
by reference in its entirety for all purposes). If additional flanking
sequence are
useful in optimizing expression of the heterologous protein, such sequences
can
be cloned using the existing sequences as probes. Mammary-gland specific
25 regulatory sequences from different organisms can be obtained by screening
libraries from such organisms using known cognate nucleotide sequences, or
antibodies to cognate proteins as probes.
Signal Seguences
-56-
CA 02525148 1999-11-02
Useful signal sequences are milk-specific signal sequences or other signal
sequences which result in the secretion of eukaryotic or prokaryotic proteins.
Preferably, the signal sequence is selected from-milk-specific signal
sequences,
i.e., it is from a gene which encodes a product secreted into milk. Most
preferably, the milk-specific signal sequence is related to the milk-specific
promoter used in the construct, which are described below. The size of the
signal ..
sequence is not critical. All that is required is that the sequence be of a
sufficient
size to effect secretion of the desired recombinant protein, e.g., in the
mammary
tissue. For example, signal sequences from genes coding for caseins, e.g.,
alpha,
beta, gamma or kappa caseins, beta lactoglobulin, wheyacid protein, and
lactalbumin can be used. A preferred signal sequence is the goat (i-casein
signal
sequence.
Signal sequences from other secreted proteins, e.g.; proteins secreted by
kidney cells, pancreatic cells or liver cells, can also be used. Preferably,
the
signal sequence results in the secretion of proteins into, for example, urine
or
blood.
Amino-Terminal Re~tions of Secreted Proteins
A non=secreted protein can also be modified in such a manner that it is
2o secreted such as by inclusion in the protein to be secreted ofall or part
of the
coding sequence of a protein which is normally secreted. Preferably the entire
sequence of the protein which is normally secreted is not included in the
sequence
of the protein but rather only a sufficient portion of the amino terminal end
of the
protein which is normally secreted to result in secretion of the protein. For
example, a protein which is not normally secreted is fused (usually at its
amino
terminal end) to an amino terminal portion of a protein which is normally
secreted.
In one aspect, the protein which is normally secreted is a protein which is
normally secreted in milk. Such proteins include proteins secreted by mammary
, epithelial cells, milk proteins such as caseins, beta lactoglobulin, whey
acid
-57-
CA 02525148 1999-11-02
protein , and lactalbumin. . Casein proteins include alpha, beta, gamma or
kappa
casein genes of any mammalian species. A preferred protein is beta casein;
e.g.,
. goat beta casein. The sequences' which encode the secreted protein can be
derived from either cDNA or genomic sequences: Preferably, they are genoinic
in origin, and include one or more introns.
Other Tissue-Specific Promoters
Other tissue-specific promoters which provide expression in a particular
tissue can be used. Tissue specific promoters are promoters which are
expressed
more strongly in a particular tissue than in others. Tissue specific promoters
are
often expressed essentially exclusively in the specific tissue.
Tissue-specific promoters which can be used include: a neural-specific
promoter, e.g., nestin, Wnt 1, Pax-1, Engrailed-1, Engrailed-2, Sonic
hedgehog; a
liver-specific promoter, e.g., albumin, alpha-1 antirypsin; a muscle-specific
promoter, e.g., myogenin, actin, MyoD; myosin; an oocyte specific promoter,
e.g., ZP1, ZP2, ZP3; a testes-specific promoter, e.g., protamin, fertilin,
synaptonemal complex protein-1; a blood-specific promoter, e.g., globulin,
GATA-1, porphobilinogen deaminase; a lung-specific promoter, e.g., surfactant
protein C; a skin- or wool-specific promoter, e.g., keratia, elastin;
endothelium-
2o specific promoters, e.g., Tie-1, Tie-2; and a bone-specific promoter, e.g.,
BMP.
In addition, general promoters can be used for expression in several
tissues. Examples of general promoters include (i-actin, ROSA-21, PGK, FOS, c-
myc; Jun-A, and Jun-B.
DNA Constructs
A cassette which encodes a heterologous protein can be assembled as a
construct which includes a promoter for a specific tissue, e.g., for mammary
epithelial cells, e.g., a casein promoter, e.g., a goat beta casein promoter,
a milk-
specific signal sequence, e.g., a casein signal sequence, e.g., a (3-casein
signal
3o sequence, and a DNA encoding the heterologous protein.
-58-
CA 02525148 1999-11-02
The construct can also include a 3' untranslated region downstream of the
DNA sequence coding for the non-secreted protein. Such regions can stabilize
the RNA transcript of the expression system and thus increases the yield of
desired protein from the expression system. Among the 3' untranslated regions
useful in the constructs for use in the invention are sequences that provide a
poly
A signal. Such sequences may be derived, e.g., from the SV40 small t antigen,
..
the casein 3' untranslated region or other 3' untranslated sequences well
known in
the art. In one aspect, the 3' untranslated region is derived from a
milk.specific
protein. The length of the 3' untranslated region is not critical but the
stabilizing
effect of its poly A transcript appears important in stabilizing the RNA of
the
expression sequence.
Optionally, the construct can include a 5' untranslated region between the
promoter and the DNA.sequence encoding the signal sequence. Such
untranslated regions can be from the same control region 'from which promoter
is
taken or can be from a different gene, e.g., they may be derived from other
synthetic; semi-synthetic or natural sources. Again their specific length is
not
critical, however, they appear to be useful in improving the level of
expression.
The construct can also include about 10%, 20%, 30%, or more of the N-
tezzninal coding region of a gene preferentially expressed in mammary
epithelial
2o , cells. For example, the N-terminal coding region can correspond to the
promoter
used, e.g., a goat (i-casein N-terminal coding region.
The construct can be prepared using methods known .in the art. ' The
construct can be prepared as part of a larger plasmid. Such preparation allows
the
cloning and selection of the con ect constructions in an efficient manner. The
, construct can be located between convenient restriction sites on the plasmid
so
that they can be easily isolated from the remaining plasmid sequences for
incorporation into the desired mariimal.
Heterolo~ous Proteins
-59-
CA 02525148 1999-11-02
Transgenic sequences encoding heterologous proteins can be introduced
into the germline of anon-human mammal or can be transfected into a cell line
to
provide a source of genetically engineered somatic cells as described above.
The protein can be a complex or multitneric protein, e.g., a homo- or
heteromultimer, e.g., proteins which naturally occur as homo- or
heteromultimers, e.g., homo- or hetero- dimers, trimers or tetramers. The
protein
can be a protein which is processed by removal, e.g., cleavage, of N-terminus,
C-
terminus or internal fragments. Even complex proteins can be expressed in
active
form. Protein encoding sequences which can be introduced into the genome of
mammal, e.g., goats, include glycoproteins, neuropeptides, immunoglobulins,
enzymes, peptides and hormones. The protein may be a naturally occurring
protein or a recombinant protein, e.g., a fragment, fusion protein, e.g., an
immunoglogulin fusion protein, or mutien. It may be human or non-human in
origin. The heterologous protein may be a potential therapeutic or
~ 5 pharmaceutical agent such as, but not limited to: alpha-1 proteinase
inhibitor,
alpha-1 antitrypsine, alkaline phosphatase, angiogenin; antithrombin III, any
of
the blood clotting factors including Factor VIII, Factor IX, and Factor X
chitinase, erythropoietin, extracellular superoxide dismutase, fibrinogen,
glucocerebrosidase, glutamate decarboxylase, human growth factor, human serum
albumin, immunoglobulin, insulin, myelin basic protein, proinsulin, prolactin,
soluble CD4 or a component or complex thereof, lactoferrin, lactoglobulin,
lysozyme, lactalbumin, tissue plasminogen activator or a variant thereof.
Immunoglobulins are particularly preferred heterologous protiens.
Examples of immunoglobulins include IgA, IgG, IgE, IgM, chimeric antibodies,
humanized antibodies, recombinant antibodies, single chain antibodies and
antibody-protein fusions.
Nucleotide sequence information is available for several of the genes
encoding the heterologous proteins listed above, in at least one, and often in
several organisms. See e.g., Long et al. (1984) Biochem. 23(21):488-4837
(aplha-1 antitrypsin); Mitchell et al. (1986) Prot. Natl. Acad Sci USA 83:7182-
-60-
CA 02525148 1999-11-02
. : 7186 (alkaline phosphatase); Schneider et al. (1.988)'EMBO-J. 7(13):4151-
4156'
' ~(angiogenin); Bock.et ~aL.(1988) Biochem. 27(16):6171-6178 (antithrombin
IIn;
Olds et al: (1991) Br. J. Xaematol. 78(3):408-413 (antithrombiri.III); Lin et
al:
(1985) Proc.~Natl. r4cad. Sci. LISA'83(22):7580~7584 (erythropoeitin); U.S.
. 5 Patent No. 5,614,184 (erythropoietin);'Horowitz~et al. (1989) Genomies
4(1):87- _ ~ .
. . 96 (glueocerebrosidase); Kelly et al: (1982) Ann..Huin. Genet..56(3):255-
265
(glutamte, decarboxylase); U.S: Patent No. 5,70,7,828 (human serum .albumin);
.
' ~ ~ U.S. Patent No. 5,652,352~(humaa serum albumin); Lawn et al. (1981)
Nucleic ~ v
Acid Re$. 9(22):6103-.6114' (human serum albumin); Kamliolz.et al. (1,986)
Prot.
' ~ 10 Natl. rlcad. Sci. USA 83(13):4962-4966 (myelin i~asic.piotein); Hiraoka
et al. . '
(.1991)~Mol. Cell Endocrino~ 75(1):71-80 (prolaetin); U.S: Patent No:
5,571;896
(lactoferrin); Pennica et al. (1983) Nature 301 (5897):214-221 (iissue
plasminogcn activator); Sarafanov ~et al. (1995) Mol. BioL 29:161-165 ..
1s '
Oo cs ~ ~ . . . _ : . .
. Oocytes for use in the invention include oocytes in metaphase II stage of .
meiotic'cell division, e.g., oocytes .arrested in metaphase II, and telophase
stage of .
meiotic division, e.g., telophase 1 or telophase II. .Oocytes in metaphase II
20 , contain one polar body, whereas oocytes in telophase can.~be identified
based on
the presence of a protrusion of the plasma membrane. from the second polar
body '
. up to the formation of a second polar body. In addition, oocytes.in
metaphase II ~ ~ '
can be distinguished from oocytes in telophase II based on biochemical andlor
developmental distinctions. . For example, oocytes in metaphase I1~ can be in
an
25 aaested state, whereas oocytes in telophase nre in an activate$.state.
Preferably,
the oocyte is a ~captine oocyte.
Occytes can be obtained at various times during a goat's reproductive
cycle. For example, at given times during the reproductive cycle, a
significant
' percentage of the oocytes, e.g., about 55%, 60~/0, b5%, 70%, 75%, 80% or
more,
30 .- . are oocytes in telophase. 'these oocytes are naturally matured
oocytes.~ In ~ .
-61-
CA 02525148 1999-11-02
addition, oocytes at various stages of the cell cycle can be obtained and then
induced in vitro to enter a particular stage of meiosis. For example, oocytes
cultured on serum-starved medium become arrested in metaphase. In addition,
arrested oocytes can be induced to enter telophase by serum activation. Thus,
oocytes in telophase can be easily obtained for use,in the invention:
Oocytes can be matured in vitro before they are used to form a
reconstructed embryo. This process usually requires collecting immature
oocytes
from niammalian ovaries, e.g., a caprine ovary, and maturing the oocyte in a
medium prior to enucleation until the oocyte reaches the desired meiotic
stage,
e.g., metaphase or telophase.~ In addition, oocytes that have been matured in
vivo
can be used to form a reconstructed embryo.
Oocytes can be collected from a female mammal during superowlation.
Briefly, oocytes, e.g., caprine oocytes, can be recovered surgically by
flushing the
oocytes from the oviduct of the female donor. Methods of inducing
superovulation in goats and the collection of caprine oocytes is described
herein.
Preferably, the rrieiotic stage of the oocyte, e.g., metaphase II or telophase
II, correlates to the stage of the cell cycle of the donor somatic cell. The
correlation between the meiotic stage of the oocyte and the mitotic stage of
the
cell circle of the donor somatic cell is referred to herein as
"synchronization". For
example, reconstruction of an oocyte in metaphase II by introduction of a
nucleus
of a somatic cell in Go or G" e.g:, by simultaneous activation and fusion; can
mimic the events occurring during fertilization. By way of another example, an
oocyte in telophase fused, e.g., by simultaneous activation and fusion, with
the
genome of a somatic cell in G, prior to START, provides a synchronization
between the oocyte and the donor nuclei.
Functional Enucleation
The donor oocyte, e.g., caprine oocyte, should be functionally enucleated
such that the endogenous genome of the oocyte is incapable of functioning,
e.g.,
replicating or
-62-
CA 02525148 1999-11-02
synthesizing DNA. Methods of functionally enucleating an oocyte include:
removing the genome from the oocyte (i.e., enucleation), e.g., such.that the
oocyte is devoid of nuclear genome; inactivating DNA within the oocyte, e.g.,
by
irradiation (e.g., by X-ray irradiation, or Laser irradiation); chemical
inactivation,
or the like.
Enucleation
One method of rendering the genome of an oocyte incapable of
functioning is to remove the genome from the oocyte (i.e., enucleation). A
micropipette or needle can be inserted into the zone pellicuda in order to
remove
nuclear material from an oocyte. For example, metaphase II stage oocytes which
have one polar body can be enucleated with a micropipette by aspirating the
first
polar body and adjacent cytoplasm surrounding the polar body, e.g.,
approximately 20%, 30%, 40%, 30%, 60% of the cytoplasm, which presumably
contains the metaphase piste. Telphase stage oocytes which have two polar
bodies can be enucleated with a micropipette or needle by removing the second
polar.body and surrounding cytoplasm, e.g., approximately 5%;10%, 20%, 30%,
40%, 50%, 60% of cytoplasm: Specifically, oocytes in telophase stage can be
enucleated at any point from the presence of a protrusion in the plasma
membrane
from the second polar body up to the forn~ation of the second polar body.
Thus,
as used herein, oocytes which demonstrate a protrusion in the plasma membrane,
usually with a spindle abutted to it, up to extrusion of the second polar body
are
considered to be oocytes in telophase. Altemativtly, oocytes which have one
clear and distinct polar body with no evidence of protrusion are considered to
be
oocytes in metaphase. Methods of enucleating an oocyte, e:g., a caprine
oocyte,
are descn'bed in further detail in the Examples.
Irradiation
The oocyte can be functionally enucleated by inactivating the endogenous
DNA of the oocyte, using irradiation. Methods of using irradiation are known
in
-63-
CA 02525148 1999-11-02
the art and described, for example, in Bradshaw et al. (1995) Molecul. Reprod.
.
Dev. 41:503-512 .
Chemicallnactivation ~ '
The oocyte can be functionally enuclested by chemically inactivating the
endogenous DNA of the oocyte.. Methods of chemically inactivating the DNA.
are known in the art. For example,,chemical inactivation can be performed
using
the etopsoide-cycloheximide method as described in Fulkaj and Moore (1993)
Molecul. Reprod. Dev. 34:42.7-430. .
. . , . . .
Introduction of a Functional Chromosomal Genome into an'O
Methods descn'bed herein can include the introduction of a functional
chromosomal genome into an oocyte, e.g., a functionally enucleated oocyte,
e.g.,
' an enucleafed oocyte, to form a reconstructed embryo. The functional
chromosome] genome directs the development of a cloned or transgenic airimal '
. which'arises from the reconstructed embryo. Methods which result in the
transfer
of an essentially intact chromosomal genome to the oocyte can be used. '
Examples include fusion of a cell which contains the functional chromosomal
genome with the oocyte and nuclear injection, i.e., direct transfer of tlu
nucleus
' into the oocyte: . . .. _ . _ . .
Fusion
Fusion of the somatic cell with an oocyte can be performed by; for
~ example, electrofusion, viral fusion, biochemical reagent fusion (e.g., HA
protein), or chemical fusion (e.g., with polyethylene glycol (PEG) or
ethanol).
Fusion of the somatic cell with the oocyte.and activation can be
performed simultaneously. For example, the nucleus of the somatic cell can be
deposited within the zone pelliduca which contains the oocyte. The steps of
fusing the nucleus with the oocyte and activation can then be performed
-64-
CA 02525148 1999-11-02
simultaneously by; for example, applying ari_ electric field. Methods of
_ simultaneous fusion and activation of a somatic cell and an oocyte are
described ~ ~ .
herein. ~ ' . - . . ~. ~ ~ ~ ~ ,~ ~ '
~ Activation of a Recombinant Embryo . ~ ~ .
. . ~ Activation refers to the beginning of embryonic development, e:g:, ~ .
replication and DNA synthesis. Activation can be induced by, for eitample, .
electric shock (e.g., in electrofusion), the use of ionophores, ethanol
activation, or
the oocyte can be obtained during a stage.in which it is naturally activated,
e:g., ' .'
. an oocyte in telophase.. . . . y ;. . . .
Electrofusion
A reconstructed embryo can be activated using electric shock, i:e.,
electrofusion. 7fie use of electrofusion allows for the fusion of the somatic
cell
' y vith the oocyte and activation to be performed simultarteously.v
' . ~~'Chambers, such as the BTX 200 Embryomanipulation System, for
carrying out electrofusion are commercially available from, for example,
B'I'X, ~ , ' .
. San Diego: Methods for performing electrofusion. to fuse a somatic cell,
e:g., a
caprine somatic cell, and an oocyte, e.g., an enucleated oocyte, e.g., an
enucleated
caprine oocyte, are descn'bed herein: . . ~ . ~ ~ , ~ .
lononhores ~ ' . . '
In addition, the reconstructed embryo can be activated by ionophore
. activation. Using an ionophore, e.g., a calciuni:ionophore, the calcium
~ . concentration across the membrane of the reconstructed embryo is changed.
As
the free calcium concentration in the cell increases, there is a decrease in
phosphorylation of intracellular proteins and the oocyte is activated. ~ Such
. methods of activation are described, for example, in U.S. Patent Number '
5,496,720.
-65-
CA 02525148 1999-11-02
' Ethanol Activation . '
Prior to enucleation, an oocyte, e.g., an oocyte in metaphase II, can be
activated with ethanol according to the.ethanol-activation treatment as
desen'bed
in Presicce and Yang (1994) Mol. Repro~l Dev. 37:61-68, and Bordignon and
5' Smith' (1998) Mol. Reprod. rev: 49:29-36 .
' - . . ' 'Ooct-yes in Telovhase . .
' . . Oocytes in ~telophase are generally already activated. Thus, these
cells'
. often naturally exhibit a decrease in calcium concentration which prevents
fertilization and allows the embryo to~develop.
- Transfer of Reconstructed Embtyos ~ .
A reconstructed embryo-of the invention can be transferred, e.g., ~ '
. implanted, to a recipient doe and allowed to develop into a cloned or
transgenic
mammal,'e.g., a cloned or transgenic goat. For exanfple, the reconstructed
embryo can be transferired via the fimbria into the oviductal lumen of each
recipient doe as described below in the Examples. In addition, methods of
transferring an embryo to a recipient mammal are known in .the art and
descn'bed, ~ .
~ for example, in Ebert et al. (1994) BiolTechnology 12:699.
. The reconstructed embryo can be maintained in a culture until at least first
cleavage (2-cell stage) up to blastoeyst stage, preferably the embryos are- -
transferred at 2-cell or 4 cell-stage. Various culture media for embryo
development are known in the art. For example, the reconstructed embryo canbe
.25 ~ co-cultured with oviductal epithelial 'cell monolayer derived from the
type of
mammal to be provided by the invention. Methods of obtaining goat oviductal
epithelial cells (GOEC), maintaining the cells in a co-culture are descn'bed
in the
Examples below. . ..
3o Purification of Proteins from Milk
.ss-
CA 02525148 1999-11-02
The transgenic protein can be produced in milk at relatively high
concentrations and in large volumes, providing continuous high level output of
normally processed peptide that is easily harvested from a renewable resource.
There are several different methods known in the. art~for isolation of
proteins form
milk.
Milk proteins usually are isolated by a combination of processes. Raw ..
milk first is fractionated to remove fats, for example; by~skimrning,
centrifugation, sedimentation (H.E. Swaisgood, Developments in Dairy
Chemistry, I: Chemistry of Milk Protein, Applied Science Publishers, NY,1982),
acid precipitation (U.S. Patent No. 4,b44,056) or enzymatic coagulation with
rennin or chymotrypsin (Swaisgood, ibid.). Next, the major milk proteins may
be
fractionated into either a clear solution or .a bulk precipitate from which
the
specific protein of interest may be readily purified.
French Patent No. 2487642 describes the isolation of milk proteins from
skim milk or whey by membrane ultrafiltration in combination with exclusion
chromatography or ion exchange chromatography. Whey is first produced by
removing the casein by coagulation with rennet or lactic acid. U.S. Patent No.
4,485,040 descn'bes the isolation of an alpha-lactoglobulin-enriched product
in
the retentate from whey by two sequential ultrafiltration steps. U.S. Patent
No.
4,644,056 provides a method for purifying immunoglobulin from milk or
colostrum by acid precipitation at pH 4.0-5.5, and sequential cross-flow
filtration
first on a, merribrane with 0.1-1.2 micrometer pore size to clarify the
product
pool and. then on a membrane with a separation Iimit of 5 - 80 kd to
concentrate
it.
Similarly, U.S. Patent No. 4,897,465 teaches the concentration and
enrichment of a protein such as immunoglobuIin from blood serum, egg yolks or
whey by sequential ultrafiltration,on metallic oxide membranes with a pH
shift.
Filtration is carried out first at a pH below the isoelectric point (pn of the
selected
protein to remove bulk contaminants from the protein retentate, and next at a
pH
above the pI of the selected protein to retain impurities and pass the
selected
-67-
CA 02525148 1999-11-02
' protein to the permeate. A different filtration concentration method is
taught by
European Patent Tlo. EP 467 482 B ~1 in which defatted skim milk is reduced to
' pH 3-4, below the p1 of the milk pTOteins, to solubilize both'caseir~ and
whey .
proteins. ,Three successive rounds of ultrafiltration or diafiltration then
concentrate the proteins to form a retentate containing 15-20% solids of which
90% is protein. Altematively,.British Patent Application No. 2179947 discloses
. the isolation. of lactoferrin from whey by ultrafiltra'don to concentrate
the sample, ~ . ,
followed by weak canon exchange chromatography at approximately a neutral
pH. No measure of purity is reported. In PCT Publication Tlo. WO 95!22258, a
protein such as -lactofen in is recovered from milk that has been adjusted to
high . ' .
ionic strength by the addition.of concentraied'salt, followed by cation
exchange
. ~ chromatography. ~ . . , ~ ~ . v ~, , . : ~ . ~ . .
In all of these method's, milk or a fraction thereof is f~rs~t treated to
remove
fats, lipids, and other particulate matter that would foul filtration
membranes.or
. 15 r. .chromatography media. The initial fractions thus produced may consist
of casein, .
whey, or total milk protein, from which the piotein of interest is then
isolated.
' PCT Patent Publication No, WO. 94/19935 discloses a method of isolating'
a biologically, active protein from 'whole milk by stabilizing the solubility
of total
milk proteins with a positively charged_agent such as aTginine,,imida2ole or '
,
Bis-Tris. This treatment forms a clarified ~salution from which the protein
may be
isolated, e.g., by filtration through membranes that otherwise would becomC ~'
:' . ~ clogged by precipitated proteins.
U.S. Patent No. 6,268,487 discloses a method for isolating a soluble milk
component, such as a peptide, in its biologically active form ~-om whole milk
or a
, ~ milk fraction by tangential flow filtration. Unlike previous isolation
methods, ,
' , this eliminates the need for a first fractionation of whole milk to remove
fat and
.. .casein micelles, thereby sitrrplifying the process and avoiding losses of
recovery .
and bioactivity. This method may be used in combination with additional
purification steps to further remove contaminants and purify the~product,
e.g.,
' protein, of interest.
-68:
CA 02525148 1999-11-02
This invention is further illustrated by the following examples~which in no .
way shouid be construed as being further limiting.
Examples ~ ~ . ~ . . . '
. , ~ Donor's and recipients used .in the following examples.were dairy goats
of
the Following breeds (mixed or not): Alpine, Saanen, and Toggenburg. All goats
weie maintained at the Genzyme Transgenics faun in Charlton; Massachusetts.
Collections and transfers were completed during the spring and early summer =
(off season). . ' ~ : . . . , . ~ . . _ . .
.Isolariori of Caprine Somatic Cells.
v . . ~ Capiine fetal fibrobtast cell lines used'as karyoplast donors were
derived
from six day 35-40 fetuses produced by~artificially inseminating non-
transgenic
t5 does with fresh~collected semen from a transgenic~antithromliin~I~I (ATIII)
founder buck. ~An ATIII cell line was chosen since'it provides a well ..
characterized genetic markei to the somatic ceia lines, and it targets high.
level
expression of a complex glycosylated protein (ATIII) in the milk of lactating
does. Three fetuses which were derived from the semen of the transgenie ATIII
20 . buck were surgically removed at day 40 post coitus and placed in
equ~'biated
Ca"/Mg"-free phosphate buffered saline (PBS): Cell suspensions; were prepared
by mincing and digesting fetal tissue in. 0.025% trypsin/0.5 mM EDTA at
37°C
for ten minutes. Cells were washed with equilbrated Medium,199T'!
(M199)(Gibco) + 10% Fetal Bovine Serum (FBS) supplemented with
25 nucleosides, 0.1 mM 2-mercaptoethanol, 2 mM L-glutamine, 1% .
penicillinlstreptomycin (10,000 LU. each/ml) (fetal cell medium), and cultured
in
25 cm', flasks. The cultures were re-fed 24~ hours later with equilibrated
fetal cell
-69-
CA 02525148 1999-11-02
medium. A confluent monolayer of primary fetal cells was harvested by:
trypsinization on day four by washing the monolayer twice with Ca'+/Mg"-free
PBS, followed by incubation with 0.025% trypsinl0.5 mM EDTA at 38°C for
7
minutes.
Cells potentially expressing ATIII were.then prepared for
cryopreservation, or maintained as stock cultures. .
Sexing and Genotyping ofDonor Cell Lines
Genomic DNA was isolated from fetal head tissue for ATIII donor
karyoplasts by digestion with proteinase K followed by precipitation with
isopropanol as described in Laird et al. ( 1991 ) Nucleic Acid Res. 19:4293,
and
analyzed by polymerase chain reaction (PCR) for the presence of human
Antithrombin III (ATIII) sequences as well as for sexing. The ATIII sequence
is
part of the BC6 construct (Goat Beta-Casein - human ATIII cDNA) used to
generate the ATIII transgenic line as described in Edmunds et al. (1998) Blood
91:4561-4571. The human ATIII sequencewas detected by amplification of a 367
by sequence with oligonucleotides GTCl 1 and GTC12 (see below). For sexing,
the ztX/zfY primer pair was used (see below) giving rise to a 445 by (z~X~447
by (zfy) doublet. Upon digestion with the restriction enzyme SacI (New England
Biolabs), the zfX band was cut into two small fragments (272 and 173 bp).
Males
were identified.by the presence of the uncut.447 by zfY band.
For the PCR reactions; approximately 250 ng of genomic DNA was
diluted in 50 ml of PCR buffer (20 mM Tris pH 8.3, 50 mM KCl and 1.5 mM
MgClz, 0.25 mM deoxynucleotide triphosphates, and each primer at a
concentration of 600 mM).with 2.5 units of Taq polymerase and processed using
the following temperature program:
1 cycle at 94°C 60 seconds
5 cycles at 94°C 30 seconds
58°C 45 seconds
-70-
CA 02525148 1999-11-02
74°C . 45 seconds .
30 cycles at 94°C 30 seconds
55°C 30 seconds
74°C - 30 seconds .
The following primer set was used to detect the human ATIII sequence:
GTC 11: CTCCATCAGTTGCTGGAGGGTGTCATTA (SEQ ID NO:1 )
GTC 12: GAAGGTTTATCTTTTGTCCTTGCTGCTCA (SEQ ID N0:2)
The following primer set was used for sexing:
~ 5 ztX: ATAATCACATGGAGAGCCACAAGC (SEQ ID N0:3)
zfY:. GCACTTCTTTGGTATCTGAGAAAG (SEQ ID N0:4)
Two of the fetuses were identified to be male and were both negative for
2o the ATIII sequence. Another fetus was ideptified as female and co~rmed
positive for the presence of the ATIII sequence.
Preparation of ATUI Expressing Donor Cells for Embryo Reconstitution .
A transgenic female line (CFF155-92-6) originating from a day 40 fetus
25 was identified by PCR analyses, as described above, and used for all
nuclear
transfer manipulations: Transgenic fetal fibroblast cells were maintained in
25
cm~ flasks with fetal cell medium, re-fed on day four following each passage,
and
harvested by trypsinization on day seven. From each passage, a new 25 cm=
flasks was seeded to maintain the stock culture. Briefly, fetal cells were
seeded in
3o 4-well plates with fetal cell medium and maintained in culture (5% CO= at
39°C).
_71_
CA 02525148 1999-11-02
1~ orty-eight hours later, the medium was replaced with fresh fetal cell
medium
containing 0.5% FBS. The culture was re-fed every 48-72 hours over the next
seven days with fresh fetal cell medium containing 0.5% FBS. On the seventh
day following, first addition of fetal cell medium (0.5% FBS), somatic cells
used
as karyoplast donors were harvested by trypsinization as previously described.
The cells were resuspended in equilibrated M 199~10% FBS supplemented with
ZmM L-glutamine, l% penicillin/streptomycin (10,000 LU. each/ml) one to three
hours prior to fusion to the enucleated oocytes.
10 Karyotyping of Cell Lirses
The clonal lines were further evaluated by karyotyping to determine gross
chromosomal abnormalities in the cell lines. Cells were induced to arrest at
metaphase by incubation vaith 0.02 pg/ml of Demecolcine (Sigma) for 12 hours.
After trypsinization, the resulting pellet was suspended in a hypotonic
solution of
15 75 mM KCl in water and incubated at 37°C for 20 minutes. Cells were
fixed for
5 minutes each time in 3 changes of ice-cold acetic acid-methanol (1:3)
solution
before drops of the cell suspension were placed in pre-washed microscopic
slides.
Following air-drying, chromosome preparations were stained with 3% Giemsa
stain (Sigma) in PBS for 10 minutes. The chromosome spreads were counted for
20 each cell line at I OOOx magnification under oil immersion.
Immunohistochemical Analysis
Antibodies specific for vimentin (Sigma) and pan-cytokeratin (Sigma)
were used to characterize and confirm the morphology of the cell lines. Cells
25 were plated in sterile gelatin coated cover slips to 75% confluency and
fixed in
2% paraformaldehyde with 0.05% saponin for 1 hour. Cells were incubated in
0.5% PVP in PBS (PB$/PVP) with primary antibodies for 2 hours at 37 °C,
rinsed with 3 changes of PBS/PVP at 10 minute intervals, and incubated for 1
hour in secondary antibodies conjugated with Cy3 and FITC respectively.
30 Alkaline phosphatase (Sigma) activity of the cells was also performed to
-72-
CA 02525148 1999-11-02
determine the piesence or absence of undifferentiated cells, The cover slips
were
rinsed and subsequently mounted on glass slides with 50% glycerol inPBS/PVP
with 10 pg/ml bisbenzimide (H-33342, Sigma) and-observed under fluorescent
microscopy.
Epithelial and fibroblast lines positive for vimentin and pan-cytokeratin,
respectively, and negative for alkaline phosphatase activity were generated
from ..
the ATIII primary cultures. In the cell cultures, two morphologically distinct
cell
types were observed. Larger "fibroblast-like" cells stained positive for
vimentin
. and smaller "epithelial-like" cells stained positive for pan-cytokeratin
which
coexisted in the primary cell cultures. The isolated fibroblast lines from
ATIII
showed a tendency to differentiate into epithelial-like cells when cultured
for 3
days after reaching confluency. Subsequent passages induced selection against
fibroblast cells giving rise to pure epithelial cells as confirmed by the lack
of
positive staining for vimentin. Senesces or possible cell cycle arrest was
first
observed at passage 28. These cells appear bigger in size (>30 pm) compared to
the normally growing cells (15-25 pm) and can be maintained in culture in the
absence of apparent mitotic activity for several months without loss of
viability.
Embryo reconstruction using nuclei frora the arrested cells produced morula
stage
embyos suggesting reacquistion of mitotic activity.
Donor Karyoplast Cell Cycle Synchronization and Characterization
Selected diploid transgenic female cell lines were propagated, passaged
sequencially and cyrobanked as future karyoplast stock. Donor karyoplasts for
nuclear transfer were seeded in 4 well plates arid cultured for up to 48 hours
in
DMEM + 10% FBS or when cells reached 70-80% confluency. Subsequently,
the cells were induced to exit growth phase and enter the quiescent stage (G~
by
senun deprivation for seven days using DMEM supplemented with 0.5% FBS to
synchronize the cells.. Following synchronization at G°, a group of
cells were
induced to re-enter the cell cycle by resuspending the cells in M199 + 10% FBS
up to three hours prior to karyoplast-cytoplast fusion to synchronize the
cells at
-73-
CA 02525148 1999-11-02
the early G, phase prior to START. . A second group of cells were also
released
from the quiescent state and cultured in M192 + 10% FBS for 12 or 36 hours to
synchronize cells at the S-phase. Cells were harvested by standard
trypsinisation
and resuspended in M199 + 10% FBS and electofused as karyoplasts donors
within 1 hour.
The metaphase spreads from the transgenic cell lines carrying the ATIII -
construct at passage 5 was 81 % diploid and this did not alter significantly
at
passage 15 where 78% of the spreads were diploid.
Cell cycle synchrony was determined by immunohistochemical analysis
using antibodies against cyclin D1, 2, 3 and PCNA (Oncogene Research
Products) for the absence of the protein complex to indicate quiescence
(G°) or
presence of the complex to indicate G, entry. Cells in the presumed S-phase of
the cell cycle were identified by the presence of DNA synthetic activity using
the
thymidine analog 5-bromo 2'-deoxyuridine-5'triphospate (BrDu, Sigma) and
streptavidiri-Biotin BrDu staining kit (Oncogene Research Products):
Immunofluorescence analysis of cells subjected to the synchronization
regimen demonstarted that following seven days of serum deprivation, 90% of
the cells were negative for G, stage cyclins D 1, 2"3 and PNCA, and were
therefore in G° arrest. Restoration of the serum content to 10% for
this line
induced reentry into the cell cycle with approximately 74% of the cells
reaching
early G, within 3 hours following serum addition based on positive staining
for
cyclins D 1, 2, 3 and PCNA. Serum restoration for 12 to 36 hours showed that
89% of the cells were positive for BrDu indicating DNA synthetic activity. In
this study, clonal lines generally responded differently to the serum
synchronization regimen. An indirect relationship was observed where the rate
of
cell synchronization decreases with the increase in passage numbers. Further,
as
passage number increased the population doubling times decreased, each clonal
cell line revealed a decreased sensitivity to serum synchronization of the
cell
cycle.
-74-
CA 02525148 1999-11-02
Superovulatiorr of Donor Goats and Oocyte Collection
Estrus was synchronized on day 0 by a 6 mg subcutaneous Norgestomet
ear implant (Synchro-mate B). A single injection of prostaglandin
(PGF2a)(Upjohn US) was administered on day 7: Starting on day 12, FSH
(Folltropin-V, Vetrepharm, St Laurent, Quebec, Canada) was administered twice
daily over four consecutive days. The ear implant was removed on day 14. -- ,
Twenty-four hours following implant removal, the donor animals were mated
several times to vasectomized males over a 48 hour interval. A single
injection of
GnRH (Rhone-Merieux US) was administered intramuscularly following the last
FSH injection. Oocytes were recovered surgically from donor animals by mid-
ventral laparotomy approximately 18 to 24 hours following the last mating, by
flushing the oviduct with Ca*"/Mg*' -free PBS prewarmed at 37°C:
Oocytes were
then recovered and cultured in equilibrated M199+10%FBS supplemented with
2mM L-glutamine, l% penicillin/streptomycin (10,000 LU. each/ml):
Oocyte Enucleation
In vivo matured oocytes were collected from donor goats. Oocytes with
attached cumulus cells or devoid of polar bodies were discarded. Cumulus-free
oocytes were divided into two groups: oocytes with only one polar body evident
(metaphase II stage) and the activated telophase II protocol (oocytes with one
polar body and evidence of an extruding second polar body). Oocytes in
telophase II were cultured in M 199 + .10% FBS for 2 to 4 hours. Oocytes that
had activated during this period, as evidenced by a first polar body and a
partially
extruded second polar body, were grouped as culture induced, calcium activated
teiophase II oocytes (Telophase II-Ca~~) and enucleated. Oocytes that had not
activated were incubated for 5 minutes in PBS containing 7% ethanol prior to
enucleation. Metaphase II stage oocytes (one polar body) were enucleated with
a
25-30 micron glass pipette by aspirating the first polar body and adjacent
cytoplasm surrounding the polar body (approximately 30% of the cytoplasm)
presumably containing metaphase plate.
_75_ .
CA 02525148 1999-11-02
As discussed above, telophase stage oocytes were prepared by two
procedures. Oocytes were intially incubated in phosphate buffered saline (PBS,
Cap+/Mg~* free) supplemented with 5% FBS for 15 minutes and cultured in M199
+ 10% FBS at 38°C for approximately three hours until the telophase
spindle
configuration or the extrusion of the second polar body was reached. All the
oocytes that responded to the sequential culture under differential
extracellular ..
calcium concentration treatment were seperated and grouped as Telophase II-
Cap+.
The other oocytes that did not respond were further incubated in 7% ethanol in
M199 + 10% FBS for S-7 minutes (Telophase II-ETOH) and cultured in M199 +
10%.FBS at 38°C for another 3 hours until the telophase II spindle
configuration
was reached. Thereafter, the oocytes were incubated in 30-SO pl drops of M 199
+
10% FBS conatining 5 ~g/rnl of cytochalasin-B for 10-15 minutes at
38°C.
Oocytes were enucleated with a 30 micron (OD) glass pipette by aspirating the
first polar body and approximately 30% of the adjacent cytoplasm containg the
metaphase II or about 10% of the cytoplasm containing the telophase II
spindle.
After enucleation the oocytes were immediately reconstructed.
Embryo Reconstruction
CFF155-92-6 somatic cells used as karyoplast donors were harvested on
day 7 by trypsinizing (0.025% trypsin/0.5 mM EDTA)(Sigma) for 7 minutes.
Single cells were resuspended in equilibrated M199+10% FBS supplemented
with 2mM L=glutamine, penicillin/streptomycin. The donor cell injection was
carried out in the same medium as for enucleation. Donor cells were graded
into
small, medium and large before selection for injection to enucleated
cytoplasts.
Small single cells (10-15 micron) were selected with a 20-30 micron diameter
glass pipette. The pipette was introduced through the same slit of the zona
made
during enucleation and donor cells were injected between the zona pellucida
and
the ooplasmic membrane. The reconstructed embryos were incubated in M199
30-60 minutes before fusion and activation.
_76_
CA 02525148 1999-11-02
Fusion and Activation
All reconstructed embryos (ethanol pretreatment or,not) were washed in
fusion buffer (0.3 M mannitol, 0.05 mM CaCh, 0.1 mM MgS04,1 mM K~HPO" .
0.1 mM glutathione, 0.1 mglml BSA in distilled water) for 2 minutes before
electrofusion. Fusion and activation were carried out at room temperature, in
a
chamber with two stainless steel electrodes 200 microns apart (B1'X 200 ..
Einbryomanipulation System, BTX-Genetronics, San Diego, CA) filled with
fusion buffer. Reconstructed embryos were placed with a pipette in groups of 3-
4
and manually aligned so the cytoplasmic membrane of the recipient oocytes and
donor CFF155-92-6 cells were parallel to the electrodes. Cell fusion and
activation were simultaneously induced 32-42 hours post GnRH injection with an
initial alignment/holding pulse of 5-l0 V AC for 7 seconds, followed by a
fusion
pulse- of 1.4 to I .8 KV/cm DC for 70 microseconds using an Electrocell
Manipulator and Enhancer 400 (BTX-Genetronics). Embryos were washed in
~5 fusion medium for 3 minutes, then they were transferred to M199 containing
5
ltg/ml cytochalasin-B (Sigma) and 10% FBS and incubated for 1 hour. Embryos
were .removed from M 199/cytochalasin-B medium and cocultured in 50
microliter drops of M 199 plus 10% FBS with goat oviductal epithelial cells
overlaid with paraffin oil. Embryo cultures were maintained in a humidified
39°C incubator with 5% CO~ for 48 hours before transfer of the
embryos to
recipient does.
Reconstructed embryos at 1 hour following simultaneous activation and
fusion with Go,G, and S-phase karyoplasts all showed nuclear envelope
breakdown (NEBD) and premature chromosome condensation (PCC) when the
~ cytoplasts were at the arrested metaphase II stage. Subsequent nuclear
envelope
fonnatioti was observed fo be at about 35% at 4 hour post activation. Oocytes
reconstructed at telophase II stage showed that an average of 22% of oocytes
observed at 1 hour post fusion of G°,G, and S-phase karyoplast
underwent NEBD
and PCC, whereas the remaining oocytes have intact nuclear lamina surrounding
the decondensing nucleus. No consistent nuclear morphology other than lack
flf,
-TT-
CA 02525148 1999-11-02
or the occurrence of NEBD and PCC was observed between the metaphase and
two telophase reconstruction protocols employed. Differences became evident
when cloned embryos were observed to have a higher incidence of advanced .
cleavage stages (8 to 32 .blastomeres) when embryos were reconstructed with S-
5 phase donor nuclei compared to when Goor G, stage karyoplasts were used (2
to 8
blastomeres) following culture in vitro for 36 to 48 hours. Fluorescent ..
microscopy analysis showed that the-nuclei of some of the rapidly dividing
embryos were fragmented. Other embryos developed to the 32 to 64 cell stage
within 3 days of culture before cleavage development was blocked. Analysis of
blastomere and nuclei numbers of these embryos showed the failure of
synchronous occurrence of cytokines and karyokinesis wherein blastomeres were
either devoid or their corresponding nuclei. or contained multiple nuclei. In
contrast, morphologically normal looking embryos showed synchronous
cytokinesis and karyokinesis.
Goat Oviductal Epithelial Cells (GOEC)lReconstructed Embryo Coculture
GOEC were derived from oviductal tissue collected during surgical
oviductal flushing performed on synchronized and superovulated does. Oviductal
tissue from a single doe was transfen:ed to a sterile 15 ml polypropylene
culture
20 tube containing 5 ml ofequilibrated M199, 10'/° FBS, 2 mM L-
glutamine,
penicillin/strepomycin. A single cell suspension was prepared by vortexing for
1
minute, followed by culture in a humidified S% C02 incubator at 38°C
for up to
one hour. The tube was vortexed a second time for one minute, then cultured an
additional five minutes to allow debris to settle. The top four millimeters
containing presumed single cells was transferred to a new 15 ml culture tube
and
centrifuged at 600x g for 7 minutes, at mom temperature. The supernatant was
removed, and the cell pellet resuspended in 8 ml of equilibrated GOEC medium.
The GOEC .were cultured in a 25 cmz flask, re-fed on day 3, and harvested by
trypsinization on day six, as previously described. Monolayers were prepared
weekly, from primary GOEC cultures, for each experiment. Cells were
-7&
CA 02525148 1999-11-02
resuspended in GOEC medium at Sx105/ml, and 50 microliter/well was seeded in
4-well plates ( 15mm). The medium was overlaid with 0.5 ml light paraffin oil,
and the plates were cultured in a humidified S% COZ incubator at 38°C.
The
cultures were re-fed on day two with 80% fresh equilibrated culture medium.
All
reconstructed embryos were'cocultured with the GOEC monolayers in vitro in
incubator at 39°C, 5% COZ before transfer to recipients of GTC farm:
All experimental replicates for ATIII yielded cleavage stage embryos that
were transferable on day 2 into synchronized recipients. Embryos using
fibroblasts and epithelial cell phenotype as donor karyoplasts showed cleavage
and development in culture. The percentage of cleavage development was'higher
in reconstructed couplets that used preactivated telophase Il stage cytoplasts
(45%) and telophase II-ethanol activated (56%) when compared to cytoplasts
used at metaphase II arrested (33%) using ATIII karyoplasts. There were no
differences observed in the cleavage rates of embryos that were reconstructed
~ 5 using donor karyoplasts in Go, G, or S-phase of the cell cycle although,
the
morphological quality of embryos was better when donor karyoplasts were in as
G° or.G, compared to S-phase. Embryos were generally between the ~ to
8 cell
stage with the majority of the embryos having 3=4 blastomeres at the time of
transfer. Normal cleavage development corresponded chronologically to
approximately 36 to 48 hours post fusion and activation. ll~Iorphologically
normal appearing embryos were selected at the 2 to 8 cell stage following
development in vitro for 36 to 48 hours.
Estrus Synchronization ofRecipient Does
Hormonal treatments were delayed by 1 day for recipients (as compared
to donors) to insure donor/recipient synchrony. Estrus was synchrnnized on day
1 by a 6 mg subcutaneous nor$estomet ear implant. A single injection of
prostaglandin was administered on day 8. Starting on day 14, a single
intramuscular treatment of PMSG (CaIBiochem US) was administered. The ear
implant was removed on day 1 S. Twenty-four hours following implant removal,
-79-
CA 02525148 1999-11-02
recipient does were mated several times to vasectomized males over three
consecutive days.
Embryo Transfer to Recipient Does
5 Reconstructed embryos were co-cultured with GOEC monolayers for
approximately 48 hours prior to transfer to synchronized recipients.
Immediately -
prior to transfer, reconstructed embryos were placed in equilibrated Ham's F-
12
medium + 10% FBS. Two to four reconstructed embryos were transferred via the
fimbria into the oviductal lumen of each recipient. Transfers were performed
in a
10 minimal volume of Hams's F-12 medium + 10% FBS using a sterile fire-
polished
glass micropipet.
The development of embryos reconstructed by nuclear transfer using
transgenic caprine fetal fibroblasts and in vivo derived oocytes is summarized
in
Table 1. There was a total of 14 rounds of collection and transfers, with 4
donors
15 set up for collection and 5-6 recipient does set up for transfer 48 hours
later. The
three different enucleation/activation protocols were employed: Metaphase II,
Telophase, and Metaphase II pretreated with Ethanol: Following fusion-
activation, reconstructed embryos were co-cultured with primary goat
epithelial
cells; at least until cleavage (2-cell stage) up to early 16-cell stage; with
most
20 embryos being transferred at chronologically correct 2- and 4-cell stages.
All
transfers were surgical and oviductal, in hormonally synchronized recipients
(due
to the season). Rates of development were slightly superior when using the
Telophase protocol and Ethanol protocol as compared to the Metaphase II
protocol. This is partly due to the fact that enucleation of the second polar
body
25 seems less traumatic for the oocytes, and partly due to what seems to be
higher
activation rate for oocytes pretreated with ethanol.
Table 1: Development of caprine embryos reconstructed by nuclear transfer of
transgenic fetal fibroblasts. Three enucleation/procedure were used: Metaphase
II
30 (first polar body enucleation), Telophase (second polar body enucleation),
-80-
CA 02525148 1999-11-02
Ethanol (preactivation of Metaphase II stage oocytes by 7% ethanol treatment
prior to enucleation). In all cases, concomitant fusion and activation was
used.
Enucleation oocytes Oocytes Embryos Embryos.
And Reconstructedlysed Cleaved Transferred
activation (%)~ (%)
rotocol
Metaphase
138 67 (48.5) 48 (35) 9'~
Telophase 92 38(41) 41(44). 38
Ethanol 55 23(42) '31(56) 27
Following embryo transfer, recipient does were examined by ultrasound,
as early as day 25. High pregnancy rates ranging from 55-78% for ATIII
recipient does were diagnosed. For all three enucleation/activation protocols,
it
was observed that high proportion of does (6S%) appeared, positive at day 30.
However, it must be noted that, in most cases, fetal heartbeats could not be
detected at such an early stage. Moreover, the positive ultrasound signal
detected v
at day 30 was not characteristic of normal embryo development and appeared
closer to vesicular development not associated with the formation of an embryo
proper. This kind of embryonic development is not typically observed in other
caprine embryo transfer programs (for example with microinjected embryos).
Biweekly, examination of these vesicular developments between day 25 and day
40 established that these pregnancies were abnormal and at day 40, most of the
fetuses were reabsorbed and normal ultrasound images were not apparent.
However, for 2 pregnancies, heartbeats were detected by day 40. In these
2 cases, ultrasound examination between day 25 and day 40, not only detected a
heartbeat, but also showed the development of recognizable embryonic
structures.
One of these pregnancies was established using the Metaphase II
enucleation/activation protocol, fusing the enucleated cytoplast to a
quiescent
karyoplast originating from a passage 6 culture of the CFF155-92-6 fibt~oblast
cell
line. In this instance, 4 four-cell stage reconstructed embryos were
transferred to
the oviduct of the recipient doe. The other pregnancy (twins) was obtained
from
embryos reconstructed according to the Telophase enucleation/activation
-81-
CA 02525148 1999-11-02
protocol, fusing an enucleated cytoplast derived from preactivated telophase
Ca"
oocytes and G, karyoplasts originating from a passage 5 culture of the CFF 155-
92-6 epithelial cell line. In this case, 3 reconshucted embryos ( 1 two-cell
stage
and 2 four-cell stage) were transferred to the oviduct of the recipient doe.
~ No pregnancies were observed with embryos generated by the Ethanol
enucleation/activation protocol. However, numbers are not large enough to ..
conclude on the relative efficacy of the 3 enucleation/activation protocols
used in
this study.
t0 Table 2: Induction of pregnancy and further development following transfer
of
caprine embryos reconstructed with transgenic fetal fibroblasts and activated
according to three protocols
Enucleation RecipientsWltrasoundResults Term
Activation (average (positive/total pregnancies
I( recip)
protocol of
embryos/
reci ) 30 da 90da s 50 da s
s
Metaphase
II 15(3.1) 9/15 1/15 1/15 1
Telo hase 19(2_.7) 11/19 1/14 1/14 1 (twins)
Ethanol r9(3) 5/9 0/9 0/9 0
I
Peri~iatal Care of Recipient Embryos
Does were monitored daily throughout pregnancy for outward signs of
health (e.g., appetite; alertness, appearance). Pregnancy was determined by
ultrasonograph 25-2$ days after the first day of standing estrus. Does were
ultrasounded biweekly till approximately day 75 and there after once a month
to
monitor and assess fetal viability. Additionally, recipient does had serum
samples drawn at approximately day 21 post standing estnts for senun
progesterone analysis. This was to determine if a functioning corpus luteum
was
present. and how this compared to the animal's reproductive status (i.e.,.
pregnancy). At approximately day 130, the pregnant does were vaccinated with
tetanus toxoid and Clostridium C&D. Selenium 8t vitamin E (Bo-Se) and
vitamins A, D, and B complex were given ir>tramuscularly or subcutaneously and
CA 02525148 1999-11-02
a dewormer was administered. The does were moved to a clean kidding stall on
approximately Day 143 and allowed to acclimate to this new environment prior
to
kidding. Observations'of the pregnant does were increased to monitor for signs
of pending parturition. After the beginning of regular contractions,ahe does
remained under periodic observation until birth occurred. If labor was not
progressive after approximately 15 minutes of strong contractions the fetal ..
position~was assessed by vaginal palpation. If the position appeared normal
then
the labor was allowed to proceed for an additional 5-30 minutes (depending on
the doe) before initiating an assisted vaginal birth. If indicated a cesarean
section
was performed. When indicated, parturition was induced with approximately 5-
10 mg of PGF2a (e.g. Lutalyse). This induction can occur approximately
between 145-155 days of gestation. Parturition generally occurs between 30 and
40.hours after the first injection. The monitoring process is the same as
described
above.
Once a kid was born, the animal was quickly towel dried and checked for
gross abnormalities and normal breathing. Kids were immediately removed from
the dam. Once the animal was determined to be in good health, the umbilicus
was dipped in 7% tincture of iodine. Within the first hour of birth, the kids
received their first feeding of heat-treated colostrum. At the time of birth,
kids
received injections of selenium & vitamin E (Bo-Se) and vitamins A, D, and B
complex to boost performance and health.
The first transgenic female goat offspring was produced by nuclear
transfer was born after 154 days of gestation following the induction of
parturition and cesarean delivery. The birth weight of the offspring was 2.35
kg
which is within the medium weight range of the alpine breed. The female twins
were born naturally with minimal assistance a month later with a gestation
length .
of 151 days. The birth weights of the twins were both 3.5 kg which are also
within the medium weight range for twins of this breed. All three kids
appearEd
normal and healthy and were phenotypically similar for coat color and
expressing
markings typical of the alpine breed. ~n addition, all threeoffspring were
sirnilar
-83-
CA 02525148 1999-11-02
in appearance to the transgenic founder buck. No distinguishable phenotypic
influence from the breed of the donor oocyte (Saanen, Toggenburg breed) or the
heterogeneous expression of the fetal genotype was observed.
Transgenic Cloned Goats .
In order to confirm that the three kids were transgenic for the BC6 --
construct comprising the goat beta casein promoter and the human ATIII gene
sequence, PCR amplification and southern analysis of the segment of the .
transgene were performed.
Shortly after birth, blood samples and ear skin biopsies were obtained
form the cloned female goats and the surrogate darns: The samples were
subjected to genomic DNA isolation. Laird et a1. (1991) Nucleic Acids Res.
19:4293. Each sample was first analyzed by PCR using AT III specific primers,
and then subjected to Southern blot analysis using the AT III cDNA (Edmunds et
al. (1998) Blood 91:4561-4571). For each sample, 5 pg of genomic DNA was
digested with EcoRI (New England Biolabs, Beverly, MA), electrophoresed in
0.7% agarose gels (SeaKem~, ME) and immobilized on nylon membranes
(MagnaGraph, MSI, Westbom, MA) by capillary transfer following standard
procedures. Laird et al. (1991) Nucleic Acids Res. 19:4293. Membranes were
probed with the 1.5 kb Xho I to Sal I AT III cDNA fragment labeled with a ''~P
dCTP using the Prime-Itch kit (Stratagene, La Jolla, CA). Hybridization was
executed at 65°C overnight. Church et al. (1984) Prot. Natl Acad. Sci.
USA.
81:199.1-1995. The blot was washed with 0.2 X SSC, 0.1 % SDS and exposed to
X-OMATTM AR film for 48 hours.
PCR analysis confuzned that all of the kids were transgenic for the BC6
construct comprising the goat beta casein promoter and the human ATIII gene
sequence. Southern blot analysis demonstrated the integrity of the BC6
transgene. Hybridization to s diagnostic 4.1 kb EcoRl fragment was detected
for
all three cloned animals, the cell Iines and a transgenic positive control,
but not
_g~
CA 02525148 1999-11-02
for the two recipient does. As expected, due to cross hybridization of the
ATIII
cDNA probe to the endogenous goat AT locus, a 14 kb band was detected in all
samples.
In addition, fluorescence in situ hybridization (FISH) was performed to
determine the integration site of the BC6,construct: For typing of the cloned
goats, whole blood was cultured for lymphocytes harvest. Ponce de Leon et al.
{I992) J. Hered 83:36-42. Fibroblast cells and lymphocytes were pretreated and
hybridized as previously described in van de Coiput et al. (1998) Histoehem
Cell
Biol. 110:431-437, and Klinger et al. (1992) Am. J. Human. Genet. 51:65-65. A
digoxygen labeled probe containing the entire.14.7 kb BC6 transgene was used
in
this pure. The TSA TM-Direct system (NEN T"' Life Science Products,
Boston,, MA) was used to amplify the signal: R-bands were visualized using
DAPI counterstain and identified as in Di Berardino et al. (1987) J. Hered.
78:225-230. A Zeiss Axioskop microscope mounted with a Hamamatsu Digital
Camera was used with Image-Pro ~ Plus software (Media Cybernetics, Silver
Spring, MD) to capture and process images.FISH analysis of blood cultures from
each transgenic kid with probes for the BC6 transgene showed that all three
carry
a chromosome 5 transgene integration identical to that found in the metaphase
2o plates derived from the CFF6 cell line. Moreover; analysis of at least 75
metaphase plates for each cloned offspring confirmed that they are not mosaic
for
the chromosome 5 transgenic integration.
As final confiimation that all three kids are derived from the transgenic
CFF6 cell line, PCR-RFLP analysis for the very polymorphic MHC class II DRB
gene was undertaken. Typing for the second exon of the caprine MHC class II
DRB gene was performed using PCR-RFLP Typing as descn'bed AmiUs et al.
(1996) Immunopathol: 56:255-260. Fifteen microliters of nested PCR product
was digested with 20 units of Rsal (New England Biolabs, Beverly, MA).
Following digestion, restriction fragments were separated at room temperature
in
-85-
CA 02525148 1999-11-02
a 4 to 20 % nondenaturing polycrylamide gel (1VIVPT"" precast gel, Stratagene,
La
Jolla, CA) in the presence of ethidium bromide.
As illustrated by the Rsal digests of the DRB gene second exon, the three
cloned offspring are identical to each other and identical to the CFF6 donor
cell
line; whereas the recipient does cant' different alleles:
Induction of Lactation and Transgene Expression of Proteins in Milk
In order to determine whether the targeted mammary gland specific
expression of human ATIII proteins were present in milk, the cloned transgenic
prepubertal clones were transiently induced to lactate. At two months of age,
the cloned offspring was subjected to a two week hormonal lactation-induction
protocol. Hormonal induction of lactation for the CFF6-1 female was performed
as described in Ryot et al. (1989) Indian J. Anim. Res. 10:49-51. The CFF6-1
kid
was hand-milked once daily to collect milk samples for AT III expression
analyses. All protein analysis methods were described in Edmunds et al. (1998)
Blood 91:4561-4571. Concentration of recombinant ATIII in the mills was
determined by a rapid reversephase HPLC method using a Hewlett Packard 1050
HPLC (Wilmington, DE) with detection at 214 nm. The ATIZI activity was
evaluated by measuring thrombin inhibition with a two-stage colorimetric
endpoint assay. Western blot analysis was performed with an atEnity purified
sheep anti-ATIII HRP conjugated polyclonal antt'body (SeroTec, Oxford, IJK).
Samples were boiled for 30 seconds in reducing- sample buffer prior to loading
onto,a 10-20 % gradient gel (Owl Scientific). Electrophoresis was operated at
164 volts (constant) until the dye front ran off the gel.
At the end of the treatment, small milk samples of 0:5 to 10 ml were
collected daily for 20 days. The small initial volumes of milk, 0.5 to l ml,
were
typical of the,amounts seen in prepubertal female goats hormonally induced to
lactate. The volumes increased to 1.0 ml per day by the time the feiriale was
dried
off, 25 days after the onset: The concentration and activity of ATIII in
several of
the samples was evaluated. As previously noted with does from this specific
BC6
CA 02525148 1999-11-02
transgenic cell line, high levels of the recflmbinant ATIII was detected by
Western blot analysis. Edmunds et al. (1998) Blood 91:4561-4571.' The .
concentration of recombinant ATIII in the milk of the cloned offspring was 5.8
grams per liter (20.SU/ml) at day 5, and 3.7 grams per liter (14.6 U/ml) by
day 9.
These were in line with levels recorded during the early part of a first
natural
lactation of does from this BC6 line (3.7 to 4.0 grams per liter). --
1o Discussion:
Healthy transgenic goats were obtained by nuclear transfer of somatic
cells to oocytes that were enucleated either in the an~ested Metaphase II or
the
activated Telophase II-stage. These studies show that serum-starved cells used
to
generate term pregnancies are likely at the Go/G, transition following
restoration
with 10% serum.
Immunofloresence screening revealed that after 7 days of serum
starvation, fetal somatic cells were negative for G, 'stage cyclins Dl, D2, D3
and
PCNA; whereas within 3 hours of 10% FBS serum-activation a majority (e.g:
approximately 70%) expressed these markers.
Reconstruction of an enucleated metaphase II an;ested oocyte with the
transferof a nucleus from a donor karyoplast synchronized at G° or G,
of the.cell
cycle following simultaneous fusion and activation mimic the chronological
events occurring during fertilization The successful development to term and
birth of a normal and healthy transgenic offspring following the simultaneous
fusion and activation protocol is in contrast with procedures employed in
other
studies that report the requirement for prolonged exposure of donor nuclei to
elevated cytoplasmic MPF activity to support chromatin remodeling and
reprogramming. See Campbell et al. (1996) Nature 380:64-66; Wilmut et al.
(1997) Nature 385:810-813; Schnieke et aI. (1997) Science 278:2130-2133;
Cibelli et al. (1998) Science 280:126-1258. This result challenges the
-s7-
CA 02525148 1999-11-02
contention that prolonged remodeling of the somatic nuclei in conditions of
elevated MPF activity prior to activation is important for embryonic and fetal
development to term. The results also demonstrate that a reconstructed embryo
may not have a requirement for prolonged exposure of the donor nucleus to MPF
nor are NEBD and PCC entirely requisite events. Rather chromatin remodeling
events involving NEBD and PCC are likely permissive effects of MPF activity
and, as such, may not be required for the acquisition of developmental
competence or totipotency. Instead, these events are likely to serve to
facilitate
the acquisition of synchronicity between the cytoplast and the karyoplast.
These
events may even be detrimental if normal diploidy is not maintained when the
donor nuclei are induced to undergo PCC with resultant chromosome dispersion
due to an aberrant spindle apparatus due in part to MPF activity. Therefore,
karyoplast and cytoplast synchronization with respect to cell cycle is
important,
first for maintenance of normal ploidy and, second for the proper induction of
genome reactivation and subsequent acquisition of developmental competence of
reconstructed erabryos.
Further support is provided in the second method where chromatin-intact
metaphase II arrested oocytes were activated to reduce MPF activity and induce
the oocyte to exit the M phase and enter the fast mitotic cleavage.
Approximately 3 hours post-activation, the oocytes were enucleated at
telophase
stage prior to flee onset of G, and fused and simultaneously activated with a
donor
karyoplast in G, prior to START of the cycle. In addition, the simultaneous
activation and fusion insured that tendencies of non=aged oocytes to revert
back
to an arrested state were circumvented. Using this paradigm, a normal and
healthy set of twin cloned transgenic kids were produced. This procedure
inherently provides a homogenous synchronization regimen for the cytoplast to
coincide closer with the donor nuclei in G, prior to START. Further
preactivation
of the oocyte induces a decline in cytoplasmic MPF activity, thus inhibiting
the
occurrence of NEBD and PCC. These results suggest that NEBD and PCC is
only facultative for the induction of cytoplast and karyoplast synchrony but
not
-
CA 02525148 1999-11-02
necessary for acquisition of proper genome reactivation and subsequent
development to term of the nuclear transfer embryo using somatic cell nuclei.
These- findings further suggest that differentiated cells at the Go or G,
stage
function similar to embryonic blastomeres with respect to their ability to
acquire
totipotency when used in combination with an arrested or an activated
recipient
cytoplast: The use of both metaphase II aaested and telophase II cytoplasts
provides dual options for cytoplast preparation in addition to providing an
opportunity for a longer time frame to prepare the cytoplast. The use of
Telophase II cytoplasts may have several practical and biological advantages.
The telophase approach facilitates efficient enucleation avoiding the
necessity for
chromatin staining and ultraviolet localization. Moreover, enucleation at
telophase enables removal of minimal cytoplasmic material and selection of a
synchronous group of activated donor cytoplasts. This procedure. also allows
for
the preparation of highly homogenous group of donor nuclei to be synchronized
with the cell cycle of the cytoplast. When used for embryo reconstruction,
these
populations showed a higher rate of embryonic development in vitro. Thus,
reconstructed embryos comprised of a synchronously activated cytoplast and
karyoplast are developmentally competent.
In addition to a successful transgenic founder production, nuclear'transfer
of somatic cells allows for the selection of the appropriate tcansgenic cell
line
before the generation of cloned transgenic embryos. This is particularly
important in the cases where several proteins are to be co-expressed by the
transgenic mammary gland. For example, in the transgenic production of
recombinant monoclonal antibodies in milk, heavy chain and light chain
transgenes ideally should be expressed in the same secretory cells of the
mammary epithelium at equivalent levels for the e~cient production of intact
antibodies. In addition, transgenes expressing each protein should be co-
integrated in the same locus to favor equivalent expression and avoid
segregation
of heavy chain and light chain transgenes during herd propagation..
-89-
CA 02525148 1999-11-02
The generation of transgenic'animals that have coiiipletely'identical
~ ~ genetic backgrounds also enhances the poss'bility of studying
the,expression and
secretion characteristics of recombinant proteins by the mammary gland.. For ~
-
example, the availability-of several .completely.identical transgenic females
' producing recombinant human ATID will help determine~the extent of variation
, ~ ' -
in the carbohydrate structure of this.profein, as it is produced by-the
mammary . ~ , : .
gland, Thus, it may be feasible to improve the. characteristics of the
recombinant
proteins produces iri the transgenic~animal system by varying environmental
factors. (e.g.,-nutrition) or to increase the milk volume yield
of.lactation~induction ' - .'
protocols~to diminish further the time necessary to ot~tain ~edequate amounts
of
' recombinant protein for pre-clinical or clinical programs. , ~ - . '
. . ~ . . The high-level expression of recombinant human ATIII detected in
the. -~ '
- . 15 - milk of the.CFF6=I cloned goat illustrates one of the~mos't important
aspects of
. ~ 'this technology. By combining nuclear transfer with lactation-induction
in-
. prepuberfal goats; it may be possible to characterize transgenic animals and
the , -
proteins they secrete in 8 to 9 months from the time of cell line transfaction
of
milk expression..'The amount of milk collected in ~n induced lactation.is not
only ' .
2.0 suffcient.to evaluate the recombinant protein yiead, but, when~mg per m1
expression levels are obtained, is adequate for more qualitative &nalyses '
w . ~ (glycosylation, preliininary_pharmaco-kinetics, biological and
pharmacological
. activities). The continued availability of the transfected donor cell
line~also
' insures that genetically identical animals can be quickly generated, to
rapidly ~ '
25 supply therapeutic proteins (with predictable characteristics) for clinical
trials.
Otherembodiments are within the following claims: .
_gp.
