Note: Descriptions are shown in the official language in which they were submitted.
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
GENE EXPRESSION AND POLYMORPHISMS
ASSOCIATED WITH LUNG CANCER
GOVERNMENT RIGHTS
S [001] This invention was supported, at least in part, by NIEi grants RO1
CAS8SS4, RO1
CA78797, and RO1 GM62694. The Federal Government has certain rights in this
invention.
PRIORITY CLAIM
[002] This application claims priority to US Provisional Patent Application
60/SI4,673,
filed October 27, 2003, which is incorporated herein by reference, in its
entirety.
BACKGROUND
[003] Lung cancer is the leading cause of mortality from cancer in both men
and women in
developed countries. There is evidence that although incidence is almost
always associated '
with environmental factors such as smoking or occupational exposure to
carcinogens,
susceptibility has a genetic component, with early onset lung cancer following
Mendelian
1 S inheritance. Moreover, susceptibility is largely intrinsic to the lung
itself, as shown by
classical experiments involving lung explants from sensitive and resistant
mice.
[004] Accordingly, it is desirable to have methods to provide additional
information about the
genetic profile of an individual. This information is useful in the context of
cancer, including
lung cancer, to identify individuals who are at risk for developing the
disease so as to provide
preventive care or prophylaxis. It is also useful for determining methods of
treatment that are
optimized for an individual's particular cancer profile.
SUMMARY OF THE INVENTION
[005] This invention relates to diagnosis and treatment of cancer. In
particular, it relates to
cancers that involve the expression of the Lung Adenoma Susceptibility-1 Gene
(Lasl) gene
2S and/or its product, the Lasl protein. Lasl is believed to be an inhibitor
of cellular
proliferation by influencing cell cycle. The Lasl is reported herein by
Applicants as a gene
1
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
that is associated with the pulmonary adenoma susceptibility 1 (Pasl)
chromosomal locus
that has been described in species such as mice and humans.
[006] Human groups exist that have an above average probability of being
diagnosed with
and/or of developing particular cancers (i.e., high-risk groups) and are
appropriate candidates
for evaluation of Lasl expression, and/or therapeutic or prophylactic use of
Lasl. Such
human groups may be at high risk because of exposure to particular
environmental materials
or circumstances (e.g., smoking or exposure to tobacco smoke, occupational
exposure to
carcinogens such as urethane and other agents), because of familial
susceptibility to certain
cancers (e.g., genetic inheritance of genes causing increased susceptibility),
as a result of the
presence of mutant forms of Lasl or decreased levels of expression of I~irsten
rat sarcoma
oncogene 2 ("Kras2"), for other reasons, or for combinations of causes and
reasons.
[007] In some embodiments, the invention provides methods for characterizing
the etiology
of a cancer in an individual by testing at least one cancer cell from the
individual for at least
one of a reduction in the level of expression of Lasl as compared to normal
cells, and one or
more mutations in the at least one cancer cell's genomic Lasl gene. The levels
of Lasl
expression in normal cells may be determined from non-cancer cells in the
individual, or
based on standaxd levels of Last expression in normal cells of other
individuals.
[008] According to one embodiment, the at least one cancer cell is tested for
the presence of
a mutation at codon 60 of the Lasl gene which encodes a mutant Lasl protein.
[009] According to other embodiments, the at least one cancer cell is tested
for the level of
Lasl gene expression. The level of Las 1 expression may be tested by measuring
mRNA
transcribed from the Lasl gene. The level of Las 1 expression may be tested by
measuring
the amount of Las1 protein in the cell. The level of Lasl expression may be
tested using an
antibody to Lasl protein.
2
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[010] According to one embodiment, the presence of a mutation at codon 60 of
the Lasl
gene is tested by analyzing the coding sequence of the Lasl gene.
[011] According to one embodiment, the presence of a mutation at codon 60 of
the Lasl
gene is tested by using an antibody that detects the mutant Lasl protein.
[012] According to some embodiments, the methods also comprise testing the at
least one
cancer cell from the individual for at least one of a reduction in the level
of expression, or one
or more mutations of one or more of the genes in the Pas-1 locus, which
include Kras2,
i
Lrmp, Bcatl, AK016641 and AI~015530. In one embodiment, the methods comprise
testing
the at least one cancer cell from the individual for at least one of a
reduction in the level of
expression of Kras2 as compared to non-cancer cells from the individual, and
one or more
mutations in the at least one cancer cell's genomic Kras2 gene. The level of
Pasl gene
expression may be tested by measuring mRNA transcribed from one or more of the
Pasl
genes. The level of Pasl expression may be tested by measuring the amount of
one or more
of the Pas 1 gene products in the cell. The Ievel of expression of one or more
of the Pas 1 gene
products may be tested using an antibody to one or more of such gene products.
The levels of
expression one or more of the Pasl genes in normal cells may be determined
from non-cancer
cells in the individual, or based on standard levels of expression of one or
more of the Pasl
genes in normal cells of other individuals.
[013] In soma embodiments, the invention provides methods for identifying an
individual
who is at risk of developing cancer by testing at least one cell from the
individual for at least
one of a reduction in the level of expression of Lasl as compared to normal
cells, and one or
more mutations in the at least one cell's genomic Las 1 gene.
[014] According to one .embodiment, the at least one cell is tested for the
presence of a
mutation at codon 60 of the Lasl gene which encodes a mutant Lasl protein.
3
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[015] According to other embodiments, the at least one cell is tested for the
level of Lasl
gene expression. The level of Las 1 expression may be tested by measuring mRNA
transcribed from the Las 1 gene. The level of Las 1 expression may be tested
by measuring
the amount of Lasl protein in the cell. The level of Lasl expression may be
tested using an
antibody to Lasl protein.
[016] According to one embodiment, the presence of a mutation at codon 60 of
the Lasl
gene is tested by analyzing the coding sequence of the Lasl gene.
[017] According to one embodiment, the presence of a mutation at codon 60 of
the Lasl
gene is tested by using an antibody that detects the mutant Lasl protein.
[018] According to some embodiments, the methods also comprise testing the at
least one
cell from the individual for at least one of a reduction in the level of
expression, or one or
more mutations of one or more of the genes in the Pas-1 locus, which include
Kras2, Lrmp,
Bcatl, AK016641 and AK015530. In one embodiment, the methods comprise testing
the at
least one cell from the individual for at least one of a reduction in the
level of expression of
Kras2 as compared to normal cells, and one or more mutations in the at least
one cell's
genomic Kras2 gene. The level of Pasl gene expression may be tested by
measuring rnRNA
transcribed from one or more of the Pas1 genes. The level of Pas1 expression
may be tested
by measuring the amount of one or more of the Pasl gene products in the cell.
The level of
expression of one or more of the Pas1 gene products may be tested using an
antibody to one
or more of such gene products. The levels of expression one or more of the
Pasl genes in
normal cells may be determined from other cells in the individual, or based on
standard levels
of expression of one or more of the Pasl genes in normal cells of other
individuals.
[019] In some embodiments the invention also provides methods for treating an
individual
identified as having a mutant Lasl gene or reduced expression of Lasl protein
by
administering to the individual an agent that restores Lasl protein function.
The individual
4
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
may have an adenocarcinoma, such as an adenocarcinoma of the lung. According
to some
embodiments, the agent is a Las1 protein. The Lasl protein may be administered
in a fashion
such that it is specifically targeted to cancer tissue in the individual.
According to other
embodiments, the agent is a polynucleotide encoding a Lasl protein, wherein
the
polynucleotide is in operable connection with a promoter that directs its
expression. In some
embodiments, the treatment is prophylactic.
[020J The genes at the Pas-1 locus, include the Lasl, Lrmp, Bcatl, AK016641
and
AK015530, and I~ras2 genes or ORFs (Figs. 10-19). Sequences for mRNAs encoding
Lrmp,
A1c015530, and Ak016641 can be found with the National Center for
Biotechnology
Information GenBank (GT: 6678713, 12853911 and 12855487, respectively). The
sequence
for Bcatl can be found in Benvenisty, N. et. al. (1992) Genes Dev., 6, 2513-
2523. The
sequence for the Kras2 ORF is found in application for US patent, 20030133910.
The
sequences for Lasl reported in this paper have been deposited in the GenBank
database
(accession nos. AY423542 for mouse and AY423543 for human. The sequences for
these
molecules are herby incorporated by reference, in their entirety.
[021] In some embodiments this invention relates to methods for the treatment
of lung
cancer, therapeutically to prevent or decrease the proliferation of cancer
cells, or
prophylactically to prevent formation of lung cancer. Such methods comprise
increasing
levels of non-mutant Las 1 protein, or a functional fragment thereof, in such
cells.
[022] In one embodiment, the invention provides a method for therapeutic or
prophylactic
treatment of a cancer in an individual by administering to the individual one
or more agents
comprising Lasl protein, or a functional fragment thereof, that inhibits
proliferation of cancer
cells. A Lasl protein, or a functional fragment thereof, may be administered
in a fashion
such that it is specifically targeted to cancer tissue. According to this
embodiment,
s
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
introduction or transfer of a Lasl protein, or a functional fragment thereof,
is achieved by any
of a variety of methods known in the art to introduce proteins to or into
cells.
[023] In another embodiment, the invention provides a method for therapeutic
or
prophylactic treatment of a cancer in an individual by administering to the
individual one or
S more agents comprising a polynucleotide encoding a Lasl protein, or a
functional fragment
thereof, wherein the polynucleotide is in operable connection with a promoter
that directs its
expression.
[024] In one embodiment, the polynucleotide is administered in a fashion such
that it is
specifically targeted to cancer tissue, and is in an amount sufficient to
achieve expression of
Lasl protein, or a functional fragment thereof, that inhibits proliferation of
cancer cells.
According to this embodiment, introduction or transfer of a polynucleotide,
such as a DNA
molecule or molecules, specifically a DNA molecule encoding one or more Lasl
protein, or a
functional fragment thereof, into a cell is achieved by any of a variety of
methods known in
the art to introduce polynucleotides into cells.
[025] In yet another embodiment, the invention provides a method for treating
an individual
identified as having a disease associated with reduced expression or mutation
of Lasl gene by
administering to the individual at least one compound that restores the
individual's Lasl
proteins ability to influence cell cycle and inhibit cancer cell
proliferation.
[026] The compositions that are used according to the methods of this
invention may be
administered prior to, concurrent with, or after administration of other
cancer therapeutic or
prophylactic treatments. In some embodiments, the agent or agents are
administered to an
individual identified as having a cancer associated with mutant Lasl genes or
reduced
expression of Lasl. In other embodiments, the agent or agents are administered
to an
individual having an adenocarciiloma, in particular, an adenocarcinoma of the
lung.
6
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[027] Additional features and advantages of the invention will be set forth in
part in the
description which follows, and in part will be obvious from the description,
or may be
learned by practice of the invention. The features and advantages of the
invention will be
realized and attained by means of the elements and combinations particularly
pointed out in
the appended claims.
[028] It is to be understood that both the foregoing general description and
the following
detailed description are exemplary and explanatory only and are not
restrictive of the
invention, as claimed.
[029] The accompanying figures, which are incorporated in and constitute a
part of this
specification, and together with the description, serve to explain the
principles of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[030] Fig. 1 shows the amino acid sequence for Las1 protein from human.
[031] Fig. 2 shows the nucleotide sequence which encodes the human Lasl
protein.
[032] Fig. 3. shows the amino acid sequence for the mouse Lasl protein.
[033] Fig. 4 shows the nucleotide sequence which encodes the mouse Lasl
protein.
[034] Fig. 5. Characterizations of the Pas1 locus. ~. Substitution mapping of
Pasl QTL
for mouse lung tumor susceptibility with the use of a set of congenic strains.
The open boxes
represent a chromosome fragment from the donor strain (A/J), and the solid
boxes represent a
chromosome fragment from the recipient strains (C57BL/6J). Eight
microsatellite markers
were used to alleleotype the 26.1 cM region containing the Pasl locus. AB is a
congenic
strain in which the entire chromosomal region between markers D6MIT54 and
D6MIT373
has been substituted into the recipient C57BL6J strain from the donor A/J
strain. Congenic
substrains 1 through 8 carry various donor (A/J) fragments as indicated. BB is
the control
congenic strain in which no substitution was found in the entire region.
Expression of
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
Pasl candidate genes in mouse lungs. Total RNAs were isolated from A/J and
C57BL/6J
normal lung tissues. Expression levels of five candidate genes were tested
using RT-PCR
and Northern blot analysis. For each autoradiograph, Upper panel, individual
candidate
genes; lower panel, b-actin control. For each candidate gene, the left panel,
expression level
in C57BL6J lungs; the right panel, expression level in A/J lungs. Note: Bcatl,
Lrmp,
AK015530, AI~016641 are RT-PCR. Kras2 is Northern blot analysis.
,(,G~Functional
polymorphisms of Pasl candidate genes. 1. Sequence analysis of the Lasl gene
revealed a
functional polymorphism at codon 60 between lung tumor
susceptible/intermediate (A/J,
SWR/J, BALB/cJ, 129/J, CBA/J, and SM/J) (top) and resistant strains (C57BL/6J,
DBA/2J,
SJL/J, C3H/HeJ, AI~R/J, and Mus. Spretus) (bottom). An amino acid alignment of
the
codon 52-72 of Lasl is shown, with the asparagine to serine alteration at
codon 60 (boxed).
2. Sequence variations of Ak016641 between A/J and C57BL/6J. AI~016641
contains 2
functional polymorphisms at codon 218 (Arg to His), codon 258 (Gly to Glu) and
an
alternative splicing transcript without exon 5 only found in A/J strain. 3.
AK015530 had a
polymorphism at codon 28 resulting a change of Asp to Gly. 4. Lrmp contains 5
functional
polymorphisms including codon 31 (Asp to Gly), codon 56 (Gly to Asp), codon 58
(Phe to
Leu), codon 438 (Arg to Gly), and codon 537 (Pro to Leu).
[035] Fig. 6. Cluster alignment of mouse rat human and Ciona intestinalis Lasl
protein
sequences. The sequences of mouse, rat, human, and Ciona intestinalis Lasl axe
presented.
Identical residues are shaded in black. Residues identical in at least two
species are shaded in
black. In mouse protein, the codon 60 ("x") encodes an Asparagine (AAT) in A/J
mice and a
Serine (AGT) in C57BL/6J mice. The human protein sequence (67% identities and
81%
positives) is based on predicted human Lasl cDNA sequence. Searching NCBI
protein
database using mouse protein sequence revealed a rat homologous protein,
encoded by NCBI
predicted gene LOC297720 (84% identities and 92% positives). The mouse Lasl
protein is
s
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
also homologous to a Ciona intestinalis protein axonemal p83.9 (GI: 20086393,
33%
identities and 52% positives).
[036] Fig. 7. Characterization of the Lasl gene as a candidate Pasl gene. ~
Colony
formation assay. Inhibition of colony formation by transfected Lasl in LM1
cell line (a) and
MC14 cell line (b). LMl and MC14 cells of the same passage were transfected
under
identical conditions with 4 g of purified plasmid DNA of Lasl-A/J-pcDNA3.1,
Lasl-
C57BL/6J-pcDNA3.1, or pcDNA3.1 vector alone. 1.5 x 106 cells were seeded into
each of
the four (10-cm) dishes, and incubated in proper medium plus 6418 (50 _g/ml)
for 14 days.
The cells were then fixed and stained and colonies with more than 1 mm
diameter were
counted and the proportions against empty vector (~ SE) were plotted.
Asterisks indicate
P<0.05 compared to vector-transfected cells. ~ Athymic mouse tumorigenicity
assays of
Lasl transfected tumor cells. (a) RT-PCR of unique sequences carried by the
transfected
Lasl clones. A/J: LM1 cells transfected with Las1-A/J-pcDNA3.1 clone.
C57BL/6J: LM1
cells transfected with Lasl-C57BL/6J-pcDNA3.l clone. (b) Measurement of the
tumor size.
(c), (d), Inhibition of nude mouse tumor development (left side, Lasl-A/J-
pcDNA3.1
transfected cells; right side, Lasl-C57BL/6J-pcDNA3.1 transfected cells). ~C
Expression of
Lasl in mouse tissues and mouse cell lines. (a) Northern blot analysis was
used to determine
the expression of Lasl in A/J and C57BL/6J lungs. (b), (c), Total RNA was
prepared from
different mouse tissues and cell lines. RT-PCR analysis was used to determine
the
expression of Lasl in mouse multiple organ (b) and cell lines (c). - actin was
used as an
internal control. ~ Subcellular localization of Lasl. Myc-tagged Lasl plasmids
were
transfected into NIH/3T3 and COS7 cells and visualized by immunofluorescent
staining
using rhodamine (red). Nuclei were stained with DAPI (blue). AIJ, Lasl-A/J-
pcDNA3.1
transfected cells; C57BL/6J, Las1-C57BL/6J-pcDNA3.1 transfected cells, vector,
pcDNA3.1
vector transfected cell, control, untransfected negative control cells.
9
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[037] Fig. 8. Kras2 allelic effects on chemically induced lung tumorigenesis.
(A) Allelic
effects on tumor multiplicity. In A/J (open bars) or C57BL/6J (solid bars)
hybrid mouse
groups, the remaining A/J or C57BL/6J Kras2 allele in Kras2+/- mice has no
significant
differential effect on lung tumor multiplicity 3.82- (A/J Kras2+/- mice/A/J
Kras2+/+ mice) vs
4.88- (C57BL/6J Kras2+/- mice/C57BL/6J Kras2+/+ mice) fold (urethane treated
group);
4.76- vs 5.10-fold (MNU treated group) between the two Kras2 alleles. (B)
Allelic effects on
tumor volume. In A/J or C57BL/6J hybrid groups, the remaining A/J or C57BL/6J
Kras2
allele in Kras2+/- mice have a significant differential effect on lung tumor
progression 31.73-
(A/J Kras2+/- mice/A/J I~ras2+/+ mice) vs 8.04- (C57BL/6J Kras2+/-
mice/C57BL/6J
I~ras2+/+ mice) fold (urethane treated group); 56.85- vs 14.47- fold (*
p<0.001) between the
two Kras2 alleles. (G~ Activated I~ras2 protein in mouse lung tumors from
(A/J~K-ras+/-)
F1, and (C57BL/6J~K-ras+/-) Fl mice. I~-Ras2 activity in large and small
tumors from
Kras2+/+ and Kras2+/- mice was presented that corresponds to A/J and C57BL/6J
alleles. b,
and s, correspond to large (> 4 mm in diameter) and small tumors (1< 4 mm in
diameter),
respectively. Note: half the amount of lysate was used in the pull-downs from
A/J tumors
(lanes 1-4) compared to C57BL/6J tumors (lanes 5-8).
[038] Fig. 9 shows all genes found in the narrowed Pasl QTL region encompassed
by
markers D60SU6 and D60SU12.
[039] Fig. 10 shows the nucleotide sequence for human LRMP.
[040] Fig. l l shows the nucleotide sequence for mouse LRMP.
[041] Fig. 12 shows the human BCATl cDNA sequence.
[042] Fig.13 shows the mouse BCAT1 cDNA sequence.
[043] Fig. 14 shows the human I~ras2 isoform a cDNA sequence.
[044] Fig. 15 shows the human Kras2 isoform b cDNA sequence.
[045] Fig. 16 shows the mouse Kras2 isoform a cDNA sequence.
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[046] Fig. 17 shows the mouse Kras2 isoform b cDNA sequence.
[047] Fig.18 shows the mouse Ak016641 cDNA sequence.
[048] Fig. 19 shows the mouse Ak015530 cDNA sequence.
DETAILED DESCRIPTION OF THE INVENTION
[049] The present invention will now be described with occasional reference to
the specific
embodiments of the invention. This invention may, however, be embodied in
different forms
and should not be construed as limited to the embodiments set forth herein.
Rather, these
embodiments are provided so that this disclosure will be thorough and
complete, and will
fully convey the scope of the invention to those skilled in the art.
[050] Unless otherwise defined, all technical and scientific terms used herein
have the same
meaning as commonly understood by one of ordinary skill in the art to that
this invention
belongs. The terminology used in the description of the invention herein is
for describing
particular embodiments only and is not intended to be limiting of the
invention. As used in
the description of the invention and the appended claims, the singular forms
"a," "an," and
"the" are intended to include the plural forms as well, unless the context
clearly indicates
otherwise. All publications, patent applications, patents, and other
references mentioned
herein are incorporated by reference in their entirety.
[051] Unless otherwise indicated, all numbers expressing quantities of
ingredients,
properties such as molecular weight, reaction conditions, and so forth as used
in the
specification and claims are to be understood as being modified in all
instances by the term
"about." Accordingly, unless otherwise indicated, the numerical properties set
forth in the
following specification and claims are approximations that may vary depending
on the
desired properties sought to be obtained in embodiments of the present
invention.
Notwithstanding that the numerical ranges and parameters setting forth the
broad scope of the
invention are approximations, the numerical values set forth in the specific
examples are
m
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
reported as precisely as possible. Any numerical values, however, inherently
contain certain
errors necessarily resulting from error found in their respective
measurements.
[052] The disclosure of all patents, patent applications (and any patents that
issue thereon,
as well as any corresponding published foreign patent applications), GenBank
and other
accession numbers and associated data, and publications mentioned throughout
this
description are hereby incorporated by reference herein, including US Patent
Application No:
20030133910 of You, et. al., filed August 23, 2002, entitled Wild-type gas as
a cancer
thet~apeutic agent. It is expressly not admitted, however, that any of the
documents
incorporated by reference herein teach or disclose the present invention.
[053] The present invention may be understood more readily by reference to the
following
detailed description of the embodiments of the invention and the Examples
included herein.
However, before the present methods and compositions are disclosed and
described, it is to
be understood that this invention is not limited to specific methods, specific
nucleic acids,
specific polypeptides, specific cell types, specific host cells or specific
conditions, etc., as
such may, of course, vary, and the numerous modifications and variations
therein will be
apparent to those skilled in the art. It is also to be understood that the
terminology used
herein is for the purpose of describing specific embodiments only and is not
intended to be
limiting.
[054] "cDNA" means a DNA prepaxed using messenger RNA (mRNA) as template. In
contrast to genomic DNA and DNA polymerized from a genomic, non- or partially-
processed
RNA template, cDNA contains coding sequences of the corresponding protein in
the absence
of introns and other non-translated nucleic acids.
[055] "Gene" refers broadly to any region or segment of DNA associated with a
biological
molecule or function. Thus, genes include coding sequence, and may further
include
regulatory regions or segments required for their expression. Genes may also
include non-
12
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
expressed DNA segments that, for example, from recognition sequences for other
proteins.
Genes can be obtained from a variety of sources, including cloning from a
source of interest,
or synthesizing from known or predicted sequence information, and may include
sequences
encoding desired parameters.
[024] "Isolated," when used herein in the context of a nucleic acid or
protein, denotes that
the nucleic acid or protein is essentially free of other cellular components
with which it is
associated in the natural state. It is preferably in a homogeneous state
although it can be in
either dry form or an aqueous solution. Purity and homogeneity are typically
determined
using analytical chemistry techniques such as polyacrylamide gel
electrophoresis or high
performance liquid chromatography. A protein that is the predominant molecular
species
present in a preparation is substantially purified. An isolated gene is
separated from open
reading frames that flank the gene and encode a protein other than the gene of
interest.
[056] "Malignant" or "cancerous" or "cancer" refers to the properties of cells
or tissue that
distinguish them from benign or normal cells. Malignant, cancerous, and cancer
cells invade,
grow and destroy adjacent tissue, metastasize, and usually grow more rapidly
than benign
cells.
[025] "Naturally-occurring" and "wild-type," are used herein to describe
something that can
be found in nature as distinct from being artificially produced by man. For
example, a
polypeptide or polynucleotide sequence that is present in an organism
(including viruses) that
can be isolated from a source in nature and that has not been intentionally
modified by man in
the laboratory is naturally-occurnng. In particular, "wild-type" is used
herein to refer to the
naturally-occurring or native forms of proteins and their encoding nucleic
acid sequences that
lack mutations or polymorphisms that alter their function. Therefore, in the
context of this
application, 'wild-type' includes naturally occurring variant forms of Lasl
and Kras2 genes,
13
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
either representing splice variants or genetic variants between individuals,
which may require
different probes for selective detection.
[057] "Normal cell" means a non-cancerous or non-malignant cell.
[026] "Nucleic acid" and "polynucleotide" refer to deoxyribonucleotides or
ribonucleotides, nucleotides, oligonucleotides, polynucleotide polymers and
fragments
thereof in either single- or double-stranded form. A nucleic acid may be of
natural or
synthetic origin, double-stranded or single-stranded, and separate from or
combined with
carbohydrate, lipids, protein, other nucleic acids, or other materials, and
may perform a
particular activity such as transformation or form a useful composition such
as a peptide
nucleic acid (PNA). Unless specifically limited, the term encompasses nucleic
acids
containing known analogues of natural nucleotides that have similar binding
properties as the
reference nucleic acid and may be metabolized in a manner similar to naturally-
occurnng
nucleotides. Unless otherwise indicated, a particular nucleic acid sequence
also implicitly
encompasses conservatively modified variants thereof (e.g. degenerate colon
substitutions)
and complementary sequences and as well as the sequence explicitly indicated.
Specifically,
degenerate colon substitutions may be achieved by generating sequences in
which the third
position of one or more selected (or all) colons is substituted with mixed-
base and/or
deoxyinosine residues (Batzer et al. (1991) Nucleic Acid Res. 19: 5081;
~htsuka et al. (1985)
J. Biol. Chem. 260: 2605-2608; Cassol et al. (1992); Rossolini et al. (1994)
Mol. Cell. Probes
8: 91-98). The term nucleic acid is used interchangeably with gene, cDNA, and
mRNA
encoded by a gene.
[058] "Proliferation" means growth and reproduction, i.e., division of cells.
An important
aspect of this invention is that the Lasl and Kras2 genes that are expressed
in cells are
believed to inhibit or suppress cell proliferation associated with cancer or
malignancy.
"Inhibition" and "suppression," as used with reference to cell proliferation
are terms well
14
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
known to those skilled in the art, and refer to slowing or stopping of cell
division such that
cells do not increase in number. The magnitude of such slowing of cell growth
can be
variable. Herein, any alteration of the growth of cells that comprise
cancerous or
precancerous cells or tissue falls within the scope of this application.
[027] "Sample" refers to an isolated sample of material, such as material
obtained from an
organism, containing nucleic acid molecules. A sample may comprise a bodily
fluid; a cell;
an extract from a cell, chromosome, organelle, or membrane isolated from a
cell; genomic
DNA, RNA, or cDNA in solution or bound to a substrate; or a biological tissue
or biopsy
thereof. A sample may be obtained from any bodily fluid (blood, urine, saliva,
phlegm,
gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
[028] "Stringent hybridization conditions" and "stringent hybridization wash
conditions" in
the context of nucleic acid hybridization experiments such as Southern and
northern
hybridizations are sequence dependent, and are different under different
environmental
parameters. Nucleic acids having longer sequences hybridize specifically at
higher
temperatures. An extensive guide to the hybridization of nucleic acids is
found in Tijssen
(1993) Laboratory Techniques in Biochemistry and Molecular Biology-
Hybridization with
Nucleic Acid Frobes part I chapter 2 "Overview of principles of hybridization
and the
strategy of nucleic acid probe assays," Elsevier, N.Y. Generally, highly
stringent
hybridization and wash conditions are selected to be 5 °C. lower than
the thermal melting
point (Tin) for the specific sequence at a defined ionic strength and pH.
Typically, under
"stringent conditions" a probe will hybridize to its target subsequence, but
to no other
sequences. The Tm is the temperature (under defined ionic strength and pH) at
which 50% of
the target sequence hybridizes to a perfectly matched probe. Very stringent
conditions are
selected to be equal to the Tn., for a particular probe. An example of
stringent hybridization
conditions for hybridization of complementary nucleic acids that have more
than 100
is
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
complementary residues on a filter in a Southern or northern blot is 50%
formamide with 1
mg of heparin at 42 °C, with the hybridization being carried out
overnight. An example of
highly stringent wash conditions is 0.15 M NaCl at 72 °C for 15
minutes. An example of
stringent wash conditions is a 0.2x SSC wash at 65 °C for 15 minutes
(see, Sambrook, infra.,
for a description of SSC buffer). Often, a high stringency wash is preceded by
a low
stringency wash to remove background probe signal. An example medium
stringency wash
for a duplex of, e.g., more than 100 nucleotides, is lx SSC at 45 °C
for 15 minutes. An
example low stringency wash for a duplex of, e.g., more than 100 nucleotides,
is 4-6x SSC at
40 °C for 15 minutes. For short probes (e.g., 10 to 50 nucleotides),
stringent conditions
typically involve salt concentrations of less than 1.0 M Na ion, typically
0.01 to 1.0 M Na
ion concentration (or other salts) at pH 7.0 to ~.3, and the temperature is
typically at least 30
°C. Stringent conditions can also be achieved with the addition of
destabilizing agents such as
formamide. In general, a signal to noise ratio of 2x (or higher) than that
observed for an
unrelated probe in the particular hybridization assay indicates detection of a
specific
hybridization. Nucleic acids that do not hybridize to each other under
stringent conditions are
still substantially similar if the polypeptides that they encode are
substantially similar. This
occurs, e.g., when a copy of a nucleic acid is created using the maximum codon
degeneracy
permitted by the genetic coda.
[029] "Target polynucleotide," as used herein, refers to a nucleic acid to
which a
polynucleotide probe can hybridize by base pairing and that comprises all or a
fragment of a
gene that encodes Lasl, I~ras2 or another other Pas1 gene product. In some
instances, the
sequences of target and probes may be 100% complementary (no mismatches) when
aligned.
In other instances, there may be up to a 10% mismatch. Target polynucleotides
represent a
subset of all of the polynucleotides in a sample that encode the expression
products of all
transcribed and expressed genes in the cell or tissue from which the
polynucleotide sample is
16
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
prepared. The gene products of target polynucleotides are Lasl or Kras2, or
other Pasl gene
products, or fragments thereof.
[030] "Target Region" means a stretch of consecutive nucleotides comprising
all or a
portion of a target sequence such as a gene or an oligonucleotide encoding
Lasl, Kras2 or
another Pasl gene product. Target regions may be 15, 16, 17, 18 19, 20, 21,
22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45,46, 47, 48, 49, 50,
51, 52, 53, 54, 55, 5,6, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69,
70, 71, 72, 73, 74, 75,
76, 77, 78, 79,80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, 100,
200 or more polynucleotides in length. In some embodiments, target regions are
70
nucleotides in length, and lack secondary structure. Target regions may be
identified using
computer software programs such as OLIGO 4.06 software (National Biosciences,
Plymouth
MN), LASERGENE software (DNASTAR, Madison Wis.), MACDNASIS (Hitachi Software
Engineering Co., San Francisco, Calif.) and the like.
[031] Methods For Characterizing The Etiology Of A Cancer and For Identifying
An
Individual Who Is At Risk Of Developing Cancer
[059] Based on the observations of Applicants, it is believed that certain
cancer cells in
individuals with cancer, such as adenocarcinoma of the lung, have Lasl
proteins with one or
more mutations, such as a single nucleotide polymorphism at codon 60. It is
likewise
believed that some individuals with cancer, such as adenocarcinoma of the
lung, may also
have reduced levels of Kras2 expression as compared to normal tissue. It is
believed that
individuals may be at risk for developing certain cancers, such as
adenocarcinoma of the
lung, if the genomic Lasl gene in such individuals' cells encode Lasl proteins
with one or
more mutations, such as a single nucleotide polymorphism at codon 60.
[060] Polynucleotides encoding the human and mouse Lasl protein are shown in
Fig. 2 and
Fig. 4; Figs. 10-19 show various of the mouse and human sequences for other
genes or
m
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
cDNAs at the Pasl locus. Polynucleotides comprising all or a portion of these
sequences, or
having sequences which are the complement thereof, are useful tools for
designing
hybridization probes for screening tissue samples for Lasl and other Pasl gene
mutations,
particularly tissues from patients at risk for, known to have, or suspected of
having lung
S cancer, and for preparing primers useful for isolating and identifying cDNA
clones and
genomic clones encoding the Lasl and other Pasl genes and allelic forms
thereof. Such
hybridization techniques are known to those of skill in the art.
[061] In some embodiments of the invention, tissue samples are obtained from
cancerous
tissue or tissue that is believed to be or may become cancerous. In some
embodiments,
normal tissue is also obtained. According to such embodiments, a comparison
may be made
between the genetic profiles of the actual or suspected cancer cells and
normal cells.
[062] Polynucleotide primers
[063] Primers can be used to obtain Lasl and other Pasl polynucleotides from
cDNA
libraries, for screening tissue samples, or for diagnostic purposes. The
primers may be used
according to polymerase chain reaction (PCR) technologies to amplify
transcripts of the
genes which encode the Lasl and other Pasl gene products, or portions of such
transcripts.
Primers may comprise 15, 16, 17, 18 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 5,6, 57, 58,
59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,
78, 79,80, 81, 82, 83,
84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 or more
nucleotides, and
have a G+C content of 40% or greater. Such oligonucleotides can be at least
98%, 99% or
more complementary with a portion of the DNA strand, i.e., the sense strand,
which encodes
the respective Las1 or other Pasl gene or a portion of its corresponding
antisense strand.
Primers that have 100% complementarity with the antisense strand of a double-
stranded DNA
1s
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
molecule which encodes a Lasl or other Pasl gene product have a sequence which
is
identical to a sequence contained within the sense strand.
[064] Isolated allele specific primers can be used for diagnosis of an
individual having or at
risk of developing cancer, particularly lung cancer, more particularly
adenocarcinoma of the
lung. Allele specific primers for Lasl or other Pasl genes are produced based
upon
identification of regions within the Las 1 or other Pas 1 gene encoding one or
more
polymorphisms, or SNPS, such as the polymorphism identified at Lasl codon 60.
In some
embodiments, the primers of the invention axe designed to hybridize to the
upstream and
downstream (e.g., flanking) sequences of target regions of the Lasl or other
Pasl gene so as
to bracket the locus of such one or more SNPs.
[065] The primers of the invention embrace oligonucleotides of sufficient
length and
appropriate sequence so as to provide specific initiation of polymerization on
a significant
number of nucleic acids flanking the polyrnorphic locus. Conditions conducive
to synthesis
include the presence of nucleoside triphosphates and an agent for
polymerization, such as
DNA polymerise, and a suitable temperature and pH. In some embodiments,
primers are
single stranded for maximum efficiency in amplification. Primer length is
determined based
on many factors, including temperature, buffer, and nucleotide composition.
[066] Primers are typically sufficiently complementary to hybridize with their
respective
strands under conditions which allow the agent for polymerization to perform.
In other
words, the primers should have sufficient complementarity with the 5' and 3'
sequences
flanking the target sequence, for example, the Lasl coding sequence, to
hybridize therewith
and permit amplification of one or more polymorphic locus, such as the SNP at
codon 60.
[067] The oligonucleotide primers of the invention may be prepared using any
suitable
method, such as conventional phosphotriester and phosphodiester methods or
automated
embodiments thereof. In one such automated embodiment, diethylphosphoramidites
are used
19
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
as starting materials and may be synthesized as described by Beaucage, et al.
(Tetrahedron
Letters, 22:1859-1862, 1981). One method for synthesizing oligonucleotides on
a modified
solid support is described in U.S. Pat. No. 4,458,066.
[068] Lasl-designed primers may be used in RT-PCR to quantify the amount of
Lasl
mRNA in the test tissues and cells. Examples of such primers include, but are
not limited to:
[069] 5'- GACCAAAGCCGAGCGACTGCGGC;
[070] 3'-TCGAAGAAGTAGTTCTGTGGC
[071] Alternatively, Lasl-designed primers may be used to analyze tissue
sections from
individuals by an RT in situ-PCR hybridization protocol as described Nuovo et
al (1994) in
Am J. Pathol., 144, 659-666, which is specifically incorporated herein by
reference.
[072] Polynucleotide Probes
[073] Polynucleotide probes are useful for detecting transcripts of the genes
which encode
the Lasl and Kras2 proteins and other Pasl gene products. Such polynucleotide
probes may
comprise 15, 16, 17, 18 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45,46, 47, 48, 49, 50, 51, 52, 53, 54, 55,
5,6, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,80, 81,
82, 83, 84, 85, 86,
87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, Or 200 or more
nucleotides.
Polynucleotide probes have a sequence which is 90%, 91%, 92%, 93%, 94%, 95%,
96%,
97%, 98%, 99% or more complementary with a contiguous sequence contained
within the
sense strand or antisense strand of a double stranded DNA molecule which
encodes the Lasl
or Kras2 protein (i.e., the target region of the Lasl or Kras2 gene).
Polynucleotide probes
bind to the sense strand or antisense under stringent conditions, and in some
instances under
highly stringent conditions. The polynucleotide probes may be used in Northern
assays to
detect transcripts of Lasl homologous genes and in Southern assays to detect
Lasl
homologous genes. At least some of said polynucleotide probes comprise a
polynucleotide
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
sequence that is complementary to a target region of a Lasl or I~ras2 gene or
one or more
other Pasl genes.
[074] The polynucleotide probes may be genomic DNA or cDNA or mRNA, or any RNA-
like or DNA-like material, such as peptide nucleic acids, branched DNAs and
the like. The
polynucleotide probes may be sense or antisense polynucleotide probes. Where
target
polynucleotides are double stranded, the probes may be either sense or
antisense strands.
Where the target polynucleotides are single stranded, the nucleotide probes
may be
complementary single strands.
[075] The polynucleotide probes may be prepared by a variety of synthetic or
enzymatic
schemes that are well known in the art. The polynucleotide probes can be
synthesized, in
whole or in part, using chemical methods well known in the art Caruthers et
al. (1980)
Nucleic Acids Res. Symp. Ser. 215-233). Alternatively, the probes can be
generated, in
whole or in part, enzymatically.
[076] Nucleotide analogues can be incorporated into the polynucleotide probes
by methods
well known in the art. The incorporated nucleotide analogues should serve to
base pair with
target polynucleotides. For example, certain guanine nucleotides can be
substituted with
hypoxanthine, which base pairs with cytosine residues. However, these base
pairs are less
stable than those between guanine and cytosine. Alternatively, adenine
nucleotides can be
substituted with 2,6-diaminopurine that can form stronger base pairs than
those between
adenine and thymidine. Additionally, the polynucleotide probes can include
nucleotides that
have been derivatized chemically or enzymatically. Typical chemical
modifications include
derivatization with acyl, alkyl, aryl or amino groups.
[077] The polynucleotide probes may be labeled with one or more labeling
moieties to
allow for detection of hybridized probeltarget polynucleotide complexes. The
labeling
moieties can include compositions that can be detected by spectroscopic,
photochemical,
21
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
biochemical, bioelectronic, immunochemical, electrical, optical or chemical
means. The
labeling moieties include radioisotopes, such as p3z, pas or 535,
chemiluminescent compounds,
labeled binding proteins, heavy metal atoms, spectroscopic markers, such as
fluorescent
markers and dyes, magnetic labels, linked enzymes, mass spectrometry tags,
spin labels,
electron transfer donors and acceptors, and the like.
[078] The polynucleotide probes can be immobilized on a substrate. Preferred
substrates are
any suitable rigid or semi-rigid support, including membranes, filters, chips,
slides, wafers,
fibers, magnetic or nonmagnetic beads, gels, tubing, plates, polymers,
microparticles and
capillaries. The substrate can have a variety of surface forms, such as wells,
trenches, pins,
channels and pores, to which the polynucleotide probes are bound. Preferably,
the substrates
are optically transparent.
[079] Tar eg t Polynucleotides
[080] In order to conduct sample analysis, a sample containing polynucleotides
that will be
assessed for the presence of target polynucleotides, that is, Lasl or I~ras2
genes, or Lasl
genes containing one or more SNPS, are obtained. The samples can be any sample
containing target polynucleotides and obtained from any bodily fluid (blood,
urine, saliva,
phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue
preparations. In some
embodiments, ~ samples comprise cancer cells, other cells, or cell extracts
from an individual
or is at risk of developing, has or may have cancer, such as adenocarcinomas
of the lung.
[081] Any nucleic acid specimen, in purified or nonpurified form, can be
utilized as the
starting nucleic acid or acids, provided it contains, or is suspected of
containing, the specific
nucleic acid sequence containing the polymorphic locus. Thus, the process may
employ, for
example, DNA or RNA, including messenger RNA, wherein DNA or RNA may be single
stranded or double stranded. In the event that RNA is to be used as a
template, enzymes,
and/or conditions optimal for reverse transcribing the template to DNA would
be utilized. In
22
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
addition, a DNA-RNA hybrid which contains one strand of each may be utilized.
A mixture
of nucleic acids may also be employed, or the nucleic acids produced in a
previous
amplification reaction herein, using the same or different primers may be so
utilized. The
specific nucleic acid sequence to be amplified, i.e., the polymorphic locus,
may be a fraction
S of a larger molecule or can be present initially as a discrete molecule, so
that the specific
sequence constitutes the entire nucleic acid. It is not necessary that the
sequence to be
amplified be present initially in a pure form; it may be a minor fraction of a
complex mixture,
such as contained in whole human DNA.
[082] DNA utilized herein may be extracted using one of a variety of
techniques such as
that described by Maniatis, et al. (Molecular Cloning: A Laboratory Manual,
Cold Spring
Harbor, N.Y., pp 280, 281, 1982). If the extracted sample is impure, it may be
treated before
amplification with an amount of a reagent effective to open the cells, or
animal cell
membranes of the sample, and to expose and/or separate the strands) of the
nucleic acid(s).
This lysing and nucleic acid denaturing step to expose and separate the
strands will allow
amplification to occur much more readily. Additional methods of purification
of nucleic
acids are described in Tijssen (1993) Laboratory Techniques in Biochemistry
and Molecular
Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic
Acid
Preparation, Elsevier, New York N.Y. In one case, total RNA is isolated using
the TRIZOL
reagent (Life Technologies, Gaithersburg Md.), and mRNA is isolated using
oligo d(T)
column chromatography or glass beads. Alternatively, when polynucleotide
samples are
derived from an mRNA, the polynucleotides can be a cDNA reverse transcribed
from an
mRNA, an RNA transcribed from that cDNA, a DNA amplified from that cDNA, an
RNA
transcribed from the amplified DNA, and the like. When the polynucleotide is
derived from
DNA, the polynucleotide can be DNA amplified from DNA or RNA reverse
transcribed from
DNA.
23
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[083] Suitable methods for measuring the relative amounts of the target
polynucleotide
transcripts in samples of polynucleotides are Northern blots, RT-PCR, or real-
time PCR, or
RNase protection assays. Fore ease in measuring the transcripts for target
polynucleotides, it
is preferred that arrays as described above be used.
S [084] The target polynucleotides may be labeled with one or more labeling
moieties to
allow for detection of hybridized probe/target polynucleotide complexes. The
labeling
moieties can include compositions that can be detected by spectroscopic,
photochemical,
biochemical, bioelectronic, immunochemical, electrical, optical or chemical
means. The
labeling moieties include radioisotopes, such as P32, Pss or 535,
chemiluminescent compounds,
labeled binding proteins, heavy metal atoms, spectroscopic markers, such as
fluorescent
markers and dyes, magnetic labels, linked enzymes, mass spectrometry tags,
spin labels,
electron transfer donors and acceptors, and the like.
[085] Genetic Analysis
[086] In one type of analysis, DNA isolated from the target tissue sample is
analyzed by
polymerise chain reaction (PCR). Regions of the Lasl ORF, or surrounding
areas, are
chosen and PCR primers are made that hybridize with the genomic DNA in the
region. Such
primers can be made to any known sequence within the Lasl gene or to regions
surrounding
the Lasl gene where the genomic sequence is known. One such set of regions
surrounding
the Las1 gene that can be used are polymorphic microsatellite markers, whose
sequences and
locations throughout the human, and some animal genomes, are known in the art.
The
primers are used in a PCR reaction to amplify the region of the genome that
contains the Las1
gene. A single PCR reaction may be used to amplify the entire genomic region
containing
the Lasl gene. Alternatively, multiple PCR reactions, each amplifying a
different region of
the Lasl gene may be used. Preferably, PCR reactions are used such that the
entire coding
24
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
region of the Lasl gene is amplified. In addition, genomic regions within
introns and
surrounding the Lasl gene may also be amplified.
[087] The amplified product may be detected by analyzing via a Southern
blotting technique
or similarly, using dot blot analysis. Suitable solid supports useful in
Southern blotting
techniques are membranes, beads, microtiter plates, etc. The use of non-
radioactive probes or
labels is facilitated by the high level of the amplified signal.
Alternatively, probes used to
detect the amplified products can be directly or indirectly detestably
labeled. A detectable
label is one that can be detected by physiochemical means, such as with a
radioisotope, a
fluorescent compound, a bioluminescent compound, a chemiluminescent compound,
by color
absorbance, a metal chelator or an enzyme. Those of ordinary skill in the art
will know of
other suitable labels for binding to the probe, or will be able to ascertain
such, using routine
experimentation.
[088] Analysis of the size of a particular PCR product from the tumor or
cancer cell genome
as compared to the size of the same PCR product using DNA from a control cell
(i.e., one
known to have Lasl genes), can detect insertions or deletions of DNA in that
area of the
genome. It is well known in the art, that if there is an insertion of DNA in
the area of a
genome between the regions where two PCR primers are used to amplify the
genome, the
resulting PCR product is larger in size compared to the size of the same PCR
product
obtained using DNA from a genome where no insertion has occurred. Likewise, a
deletion of
DNA in the genome between two PCR primers results in a PCR product that is
smaller in size
compared to a control PCR product obtained using DNA from a genome not
containing a
deletion. Such analyses detect relatively large changes (e.g., minimum of 10%
change) in
size of a PCR product as compared to the product from a Lasl genome. Normally,
size
determination of PCR products is performed by comparing the relative sizes of
two or more
PCR products. For example, the size of a PCR product from a genome where a
Lasl
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
mutation is suspected is compared to the size of the same PCR product from a
genome where
Lasl mutations are known not to be present. Relative sizes are easily compared
using
migration of PCR products in an electric field, as occurs in gel
electrophoresis. Agarose gel
electrophoresis is often used for this purpose.
(089] Another method for analyzing PCR products is through determination of
the
nucleotide sequence of all or part of the PCR product. This method of analysis
detects
changes in relative size of PCR products that are less than 10%. This method
also detects
changes in the DNA sequence that do not result in relative size changes. For
example,
determination of the sequence and comparison of the sequence of the same PCR
product
obtained from amplification of DNA from two different cells can detect single
or multiple
nucleotide base changes, substitutions of regions of DNA, and the like.
Methods for DNA
sequence determination and for DNA sequence determination of PCR products are
well
known in the art of molecular biology. The chain termination method of
sequencing is often
used. DNA sequencing is often performed by automated sequencing machines.
[090] In another type of analysis, RNA, preferably mRNA isolated from the
tumor or cancer
cells is used as a template to make DNA in a reverse transcription reaction.
The reverse
transcribed DNA is then used as a template in PCR reactions using PCR primers
with
sequences known to be within the mRNA of the Lasl gene. Various mRNA primers
can be
chosen, as described above in order to amplify the entire length of the mRNA
sequence of the
Lasl gene. This can be done using a single PCR reaction, or multiple PCR
reactions as
described above. Analysis of the PCR products is then performed much as
already described.
In one type of analysis, the presence of absence of a PCR product, or a change
in its size as
compared to controls is indicative of large changes, such as large insertions
or deletions
within the Lasl genome regions. Again, such analysis is commonly performed
using gel
26
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
electrophoresis of the PCR products. In another type of analysis, the DNA
sequence of the
PCR products is determined, using methods well known in the art.
[091] According to one embodiment, a Lasl mutating polymorphism may be
detected using
the reverse dot blot hybridization technique (RDB) (see for example, Bray, et
al., Blood,
84(12):4361, 1994, incorporated herein by reference). Briefly, allele-specific
oligonucleotides are fixed to a solid support (e.g., a filter). Typically, an
amino group is
added to the terminus of the allele-specific oligonucleotides for covalent
attachment to the
support. Labeled (e.g., biotinylated) oligonucleotides flanking the
polymorphic sequence in
genomic are used to amplify genomic DNA by PCR, for example, and these PCR
products
are denatured into single stranded DNA and hybridized to the filters
containing the allele-
specific oligonucleotides s.
[092] Other methods, well known in the art, can also be used to assay for
presence of Las1
genes, transcripts, or changes in either as compared to wild type Lasl. Some
of these
methods include Southern blotting, Northern blotting, RNase protection assays,
S1 nuclease
assays and the like.
[093] Methods of Cancer Detection by measuring protein levels
(094] In another embodiment, the invention provides for the diagnosis of an
individual
having or at risk of developing cancer, such as adenocarcinoma of the lung,
using an antibody
or other agent which detects a mutating polymorphism, such as a mutation in
the Lasl
protein. In some embodiments, mutations in other Pasl genes may be detected
using
antibodies. Antibodies may be used either to detect levels of gene products of
Lasl or one or
more of the other Pasl genes, or to detect mutant forms of the gene products.
[095] Monoclonal antibodies useful for immunophenotyping are suited for use,
for example,
in immunoassays in which they can be utilized in liquid phase or bound to a
solid phase
carrier. In addition, the monoclonal antibodies in these immunoassays can be
detectably
2~
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
labeled in various ways. Examples of types of immunoassays which can utilize
monoclonal
antibodies of the invention are competitive and non-competitive immunoassays
in either a
direct or indirect format. Examples of such immunoassays are the
radioimmunoassay (RIA)
and the sandwich (immunometric) assay. Detection of the platelet antigens
using monoclonal
antibodies can be done utilizing immunoassays which are run in either the
forward, reverse,
or simultaneous modes, including immunohistochemical assays on physiological
samples
(e.g., blood). Those of skill in the art will know, or can readily discern,
other immunoassay
formats without undue experimentation.
[096] The term "immunometric assay" or "sandwich immunoassay", includes
simultaneous
sandwich, forward sandwich and reverse sandwich immunoassays. These terms are
well
understood by those skilled in the art. Those of skill will also appreciate
that antibodies as
described herein will be useful in other variations and forms of assays which
are presently
known or which may be developed in the future. These are intended to be
included within the
scope of the present invention.
[097] Monoclonal antibodies can be bound to many different Garners and used to
detect the
presence and phenotype of Lasl or other Pasl gene products. Examples of well-
known
carriers include glass, polystyrene, polypropylene, polyethylene, dextran,
nylon, amylases,
natural and modified celluloses, polyacrylamides, agaroses and magnetite. The
nature of the
carrier can be either soluble or insoluble for purposes of the invention.
Those skilled in the
art will know of other suitable Garners for binding monoclonal antibodies, or
will be able to
ascertain such using routine experimentation.
[098] In performing the assays it may be desirable to include certain
"blockers" in the
incubation medium (usually added with the labeled soluble antibody). The
"Mockers" are
added to assure that non-specific proteins, proteases, or anti-heterophilic
immunoglobulins to
anti-Pl immunoglobulins present in the experimental sample do not cross-link
or destroy the
2s
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
antibodies on the solid phase support, or the radiolabeled indicator antibody,
to yield false
positive or false negative results. The selection of "blockers" therefore may
add substantially
to the specificity of the assays described in the present invention.
[099] It has been found that a number of nonrelevant (i.e., nonspecific)
antibodies of the
S same class or subclass (isotype) as those used in the assays (e.g., IgGl,
IgG2a, IgM, etc.) can
be used as "blockers". The concentration of the "blockers" (normally 1-100
µg/ll) may be
important, in order to maintain the proper sensitivity yet inhibit any
unwanted interference by
mutually occurring cross reactive proteins in the specimen.
[0100] Methods for Treating~Individuals who have or at Risk of Develops Cancer
[0101] Various embodiments of the invention provides methods for preventing
the formation
of cancer or treating cancer in individuals in need of such treatment. As
described herein,
individuals may be identified as having cancer, such as adenocarcinoma of the
lung, wherein
at least one causative factor in their disease is the presence of a mutation
in the Lasl gene, or
in the Lasl gene and one or more of the other Pasl genes. Other individuals
may be
identified as being at risk for developing a cancer, such as adenocarcinoma of
the lung,
wherein at least one indicator of such risk is the presence of a mutation in
the Lasl gene, or in
the Lasl gene and one or more of the other Pasl genes. Such individuals are in
need of
treatment to prevent or stop proliferation of cancer cells. The methods of
treatment described
herein involve, in some embodiments, elevating the levels of Lasl protein in
the individual.
[0102] In some embodiments the level Lasl protein is elevated by administering
to an
individual in need of treatment a Lasl protein, or a pharmaceutical
composition containing a
Lasl protein. In other embodiments the level Lasl protein is elevated by
administering to an
individual in need of treatment a polynucleotide encoding a Lasl protein, or a
pharmaceutical
composition containing a polynucleotide encoding a Lasl protein.
[0103] Lasl Protein
29
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[0104] The present invention identifies a novel tumor suppressor protein, Lung
Adenoma
Susceptibility-l, referred to herein as Lasl or Lasl protein, the human
sequence for which is
shown in Fig. 1, and the mouse sequence for which is shown in Fig. 3.
Polynucleotide
sequences for the mouse and human Lasl open reading frames are shown in Figs.
2 and 4.
Alignment of amino acid sequences for Lasl in human, mouse, rat, and sea
squirt are shown
in Fig. 6.
[0105] The Lasl protein, and functional fragments thereof (collectively, "Lasl
proteins)"),
may be produced by conventional peptide synthesizers. The Lasl proteins may
also be
produced using cell-free translation systems and RNA molecules derived from
DNA
constructs that encode the Lasl proteins. Lasl proteins may also be made by
transfecting
host cells with expression vectors that comprise a DNA sequence that encodes
the respective
Lasl protein or and then inducing expression of the protein in the host cells.
For recombinant
production, recombinant constructs comprising a sequence which encodes the
Lasl protein
are introduced into host cells by conventional methods such as calcium
phosphate
transfection, DEAE-dextran mediated transfection, transvection,
microinjection, cationic
lipid-mediated transfection, electroporation, transduction, scrape lading,
ballistic introduction
or infection.
[0106] The Las1 protein may be expressed in suitable host cells, such as for
example,
mammalian cells, yeast, bacteria, or other cells under the control of
appropriate promoters
using conventional techniques. Following transformation of the suitable host
strain and
growth of the host strain to an appropriate cell density, the cells axe
harvested by
centrifugation, disrupted by physical or chemical means, and the resulting
crude extract
retained for further purification of the Lasl protein.
[0107] Conventional procedures for isolating recombinant proteins from
transformed host
cells, such as isolation by initial extraction from cell pellets or from cell
culture medium,
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
followed by salting-out, and one or more chromatography steps, including
aqueous ion
exchange chromatography, size exclusion chromatography steps, and high
performance
liquid chromatography (HPLC), and affinity chromatography may be used to
isolate
recombinant Las 1 protein.
[0108] Inhibiting Lung Cancer Cell Proliferation with Lasl Protein
[0109] The present invention provides methods for inhibiting or suppressing
growth of cells
by introduce Las1 proteins into cells of an individual who has developed or is
at risk of
developing cancer. Such individuals include those who have or may develop
adenocarcinomas of the lung. There are a variety of methods known in the art
for introducing
proteins into cells. According to one method, proteins are coupled or fused to
short peptides
that direct entry of the Lasl protein into cells. One such group of peptides
are called protein
transduction domains. Another method for introduction proteins into cells uses
lipid carriers.
For example, proteins that are associated with liposomes are able to enter
cells when the
liposornes enter or fuse with the cell membranes.
[0110] Such methods include, but are not limited to, "protein transduction" or
"protein
therapy" as described in publications by Nagahara et al. (Nagahara, et al.,
1998, Nat Med,
4:1449-52.) and in publications from the laboratory of Dowdy (Nagahara, et
al., 1998, Nat
Med, 4:1449-52.; Schwarze, et al., 1999, Science, 285:1569-72.; Vocero-Akbani,
et al., 2000,
Methods Enzymol, 322:508-21; Ho, et al., 2001, Cancer Res, 61:474-7.; Vocero-
Akbani, et
al., 2001, Methods Enzymol, 332:36-49; Snyder and Dowdy, 2001, Curr Opin Mol
Ther,
3:147-52.; Becker-Hapak, et al., 2001, Methods, 24:247-56.), publications
which are
incorporated herein by reference.
[0111] In one embodiment, an eleven amino acid sequence, the "protein
transduction
domain" (PTD), from the human immunodeficiency virus TAT protein (Green and
Loewenstein, 1988, Cell, 55:1179-88.; Frankel and Pabo, 1988, Cell, 55:1189-
93.) is fused to
31
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
the Lasl protein. The purified protein is then put in contact with the surface
of cells and the
cells take up the Lasl protein which functions to inhibit or suppress growth
of that cell. In
the case where it is desired to introduce the Lasl protein containing the
fused PTD into cells
comprising a tumor in a human or animal, the protein is administered to the
human by a
variety of methods. The Lasl protein may be administered by injection (e.g.,
intravenously)
or by inhalation in an aerosol.
[0112] Las 1 proteins that contain the fused PTD are preferably made by fusing
the DNA
sequence encoding the Las 1 gene with the DNA sequence encoding the PTD. The
resulting
Lasl -PTD fusion gene may be incorporated into a vector, for example a plasmid
or viral
vector, that facilitates introduction of the fusion gene into a organism and
expression of the
gene at high levels in the organism such that large amounts of the fusion
protein are made
therein. One such organism in which the vector containing the fusion gene can
be expressed
is a bacterium, preferably Escherichia coli. Other organisms are also commonly
used by
those skilled in the art. After the fusion protein is expressed at a high
level in any of these
orga~.usms, the fusion protein is purified from the organism using protein
purification
techniques well known to those skilled in the art.
[0113] Lasl Polynucleotides
[0114] The present invention provides isolated polynucleotides which encode a
Last protein.
The Lasl-encoding polynucleotides may be single-stranded or double stranded.
Such
polynucleotides may be DNA or RNA molecules In one embodiment the isolated
polynucleotide comprises all or a portion of the Las 1 sequence shown in Fig.
2 or Fig. 4. The
Lasl polynucleotides are useful in one embodiment for preparing Lasl proteins.
[0115] The present invention also encompasses isolated polynucleotides whose
sequence is
the complement of the Lasl gene sequence, shown in Figs. 2 and 3, and
polynucleotides that
32
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
hybridize under stringent conditions, in some embodiments under highly
stringent conditions,
to the open reading frame sequence of the Lasl gene sequence, or the
complement thereof.
[0116] Polynucleotides comprising sequences encoding a Lasl protein may be
synthesized in
whole or in part using chemical methods. Polynucleotides which encode a Lasl
protein,
particularly alleles of the genes which encode a Lasl protein, may be obtained
by screening a
genomic library or cDNA library with a probe comprising sequences identical or
complementary to the sequences shown in Figs. 2 or 3, or with antibodies
immunospecific for
a Lasl protein, to identify clones containing such polynucleotide.
Alternatively,
polynucleotides encoding Lasl proteins may be made using polymerase chain
reaction (PCR)
technology and primers that bind specifically to sequences which are known to
encode a Lasl
protein.
[0117] Inhibiting Lung Cancer Cell Proliferation with Las1 polynucleotides
[0118] In one aspect, the present method comprises introduction of Lasl
encoding
polynucleotides, preferably contained within a vector, into cancer cells so
that the cells
achieve increased levels of Lasl expression. Herein, such introduction or
transfer of a DNA
molecule or molecules, specifically a DNA molecule encoding one or more Lasl
encoding
polynucleotide, into a cell refers to any of a variety of methods known in the
art to achieve
transfer of DNA molecules into cells. Whatever methodology is used to
administer the Lasl
genes to humans or animal, such methodologies comprise variations that result
in the Lasl
genes being introduced exclusively into normal and not being introduced into
tumor cells.
For example, techniques are known in the art that result in recombinant
viruses specifically
infecting certain cell types within a human or animal. For viruses, such
"targeting" can be
accomplished through manipulation of cellular receptors for the recombinant
viruses and/or
manipulation of viral ligands that recognize and bind to cellular receptors
for the viruses.
Such methodologies, as used to introduce Las 1 genes into cancer cells in
animals or humans,
33
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
are within the purview of the present application. Targets on cancer cells
include, but are not
limited to, proteins such as carcino embryonic antigen, and other markers that
are
differentially expressed on cancer cells but not in corresponding normal
cells. Specific
ligands for such targets include, but are not limited to, known ligands,
antibodies.
[0119] In one embodiment, polynucleotides encoding the Lasl protein or a
functional
equivalent thereof are introduced into such cells to permit expression or
overexpression of the
Las1 protein. Viral or plasmid vectors may be used to deliver the
polynucleotide to the cells.
Levels of Lasl may be increased in cancer cells by introducing a DNA fragment
comprising
an Lasl polynucleotide and a promoter into the cell and expressing the Lasl
protein.
Preferably, the promoter, which is operably linked to the Lasl polynucleotide
is a tissue
specific promoter. The DNA fragment may be incorporated into a viral vector or
into a
liposome which, preferably, further comprises a molecule which targets the
liposome to the
cancer cell.
[0120] In one embodiment, polynucleotides encoding the Lasl protein or a
functional
equivalent or fragment thereof is introduced into cancer cells to permit
expression or
overexpression of the Lasl protein. In one embodiment, Lasl delivery is
specifically
selective for cancer cells and is achieved using a targeting carrier that is
selective for cancer
cells and does not direct delivery to normal cells.
[0121] In order to introduce the polynucleotide sequences encoding Lasl
activity into cells,
the protein coding region of the polynucleotide sequences is normally attached
to sequences
that facilitate its transcription into mRNA as well as translation of the mRNA
into Lasl. A
strategy common in the art for doing this is to clone the polynucleotide
sequence encoding
the Lasl protein into a vector which contains sequences facilitating
expression of a protein
coding sequence cloned therein.
34
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[0122] Expression vectors normally contain sequences that facilitate gene
expression. An
expression vehicle can comprise a transcriptional unit comprising an assembly
of a protein
encoding sequence and elements that regulate transcription and translation.
Transcriptional
regulatory elements generally include those elements that initiate
transcription. Types of
such elements include promoters and enhancers. Promoters may be constitutive,
inducible or
tissue specific. Transcriptional regulatory elements also include those that
terminate
transcription or provide the signal for processing of the 3' end of an RNA
(signals for
polyadenylation). Translational regulatory sequences are normally part of the
protein
encoding sequences and include translational start codons and translational
termination
codons. There may be additional sequences that are part of the protein
encoding region, such
as those sequences that direct a protein to the cellular membrane, a signal
sequence for
example.
[0123] The Lasl-encoding polynucleotides that are introduced into cells are,
in some
embodiments, expressed at a high level (i.e., the introduced polynucleotide
sequence
1 S produces a high quantity of Las 1 protein within the cells) after
introduction into the cells.
Techniques for causing a high-level of expression of polynucleotide sequences
introduced
into cells are well known in the art. Such techniques frequently involve, but
are not limited
to, increasing the transcription of the polynucleotide sequence, once it has
been introduced
into cells. Such techniques frequently involve the use of transcriptional
promoters that cause
transcription of the introduced polynucleotide sequences to be initiated at a
high rate. A
variety of such promoters exist and are well known in the art. Frequently,
such promoters axe
derived from viruses. Such promoters can result in efficient transcription of
polynucleotide
sequences in a variety of cell types. Such promoters can be constitutive
(e.g., CMV
enhancerlpromoter from human cytomegalovirus) or inducible (e.g., MMTV
enhancer/promoter from mouse mammary tumor virus). A variety of constitutive
and
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
inducible promoters and enhancers are known in the art. Other promoters that
result in
transcription of polynucleotide sequences in specific cell types, so-called
"tissue-specific
promoters," can also be used. A variety of promoters that are expressed in
specific tissues
exist and are known in the art. For example, promoters whose expression is
specific to
neural, liver, epithelial and other cells exist and are well known in the art.
Methods for
making such DNA molecules (i.e., recombinant DNA methods) are well known to
those
skilled in the art.
[0124] Vectors for introducing Lasl polynucleotides into target cells
[0125] In the art, vectors refer to nucleic acid molecules capable of
mediating introduction of
another nucleic acid or polynucleotide sequence to which it has been linked
into a cell. One
type of preferred vector is an episome, i.e., a nucleic acid capable of
extrachromosomal
replication. Other types of vectors become part of the genome of the cell into
which they are
introduced. Vectors capable of directing the expression of inserted DNA
sequences are
referred to as "expression vectors" and may include plasmids, viruses, or
other types of
molecules known in the art.
[0126] Typically, vectors contain one or more restriction endonuclease
recognition sites
which permit insertion of the Lasl polynucleotide sequence. The vector may
further
comprise a marker gene, such as for example, a dominant antibiotic resistance
gene, which
encode compounds that serve to identify and separate transformed cells from
non
transformed cells.
[0127] One type of vector used in the present invention is selected from viral
vectors. Viral
vectors are recombinant viruses which are generally based on various viral
families
comprising poxviruses, herpesviruses, adenoviruses, parvoviruses and
retroviruses. Such
recombinant viruses generally comprise an exogenous polynucleotide sequence
(herein, a
36
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
Lasl gene) under control of a promoter which is able to cause expression of
the exogenous
polynucleotide sequence in vector-infected host cells.
[0128] One type of viral vector is a defective adenovirus which has the
exogenous
polynucleotide sequence inserted into its genome. The term "defective
adenovirus" refers to
an adenovirus incapable of autonomously replicating in the target cell.
Generally, the
genome of the defective adenovirus lacks the sequences necessary for the
replication of the
virus in the infected cell. Such sequences are partially or, preferably,
completely removed
from the genome. To be able to infect target cells, the defective virus
contains sufficient
sequences from the original genome to permit encapsulation of the viral
particles during in
vitro preparation of the construct. Other sequences that the virus contains
are any such
sequences that are said to be genetically required "in cis."
[0129] It is desirable that the adenovirus is of a serotype which is not
pathogenic for man.
Such serotypes include type 2 and 5 adenoviruses (Ad 2 or Ad 5). In the case
of the Ad 5
adenoviruses, the sequences necessary for the replication are the ElA and E1B
regions.
Methods for preparing adenovirus vectors are described in U.S. Patent No.
5,932,210, which
issued in August, 1999 to Gregory et al., U.S Patent No. 5,985,846 which
issued in
November, 1999 to Kochanek et al, and U.S. Patent No. 6,033,908 which issued
in March,
2000, to Bout et al.
[0130] It is also desirable that the virus vector is an immunologically inert
adenovirus. As
used herein the term "irmnunologically inert" means the viral vector does not
encode viral
proteins that activate cellular and humoral host immune responses. Methods for
preparing
irilrilunOlogiCally inert adenoviruses are described in Parks et al., Proc
Natl Aead Sci USA
1996; 93(24) 13565-70; Leiber, A. et al., J. Virol. 1996; 70(12) 8944-60;
Hardy s., et al, J.
Trirol. 1997, 71(3): 1842-9; and Morsy et al, Proc. Natl. Acad. Sci. USA 1998.
95: 7866-71,
all of which are specifically incorporated herein by reference. Such methods
involve Cre-
37
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
loxP recombination. In vitro, Cre-loxP recombination is particularly adaptable
to preparation
of recombinant adenovirus and offers a method for removing unwanted viral
nucleotide
sequences. Replication deficient recombinant adenovirus lacks the E1 coding
sequences
necessary for viral replication. This function is provided by 293 cells, a
human embryonic
kidney cell line transformed by adenovirus type. First generation adenoviruses
are generated
by co-transfecting 293 cells with a helper virus and a shuttle plasmid
containing the foreign
gene of interest. This results in the packaging of virus that replicates both
the foreign gene
and numerous viral proteins. More recently, 293 cells expressing Cre
recombinase, and
helper virus containing essential viral sequences and with a packaging signal
flanked by loxP
sites, have been developed (See Parks et al.) In this system, the helper virus
supplies all of
the necessary signals for replication and packaging in traps, but is not
packaged due to
excision of essential sequences flanked by loxP. When 293-Cre cells are co-
transfected with
this helper virus, and a shuttle plasmid (pRP1001) containing the packaging
signal, nonsense
"filler DNA", and the foreign gene, only an adenovirus containing filler DNA
and the foreign
gene is packaged (LoxAv). This results in a viral recombinant that retains the
ability to infect
target cells and synthesize the foreign gene, but does not produce viral
proteins.
[0131] Another type of viral vector is a defective retrovirus which has the
exogenous
polynucleotide sequence inserted into its genome. Such recombinant
retroviruses are well
known in the art. Recombinant retroviruses for use in the present invention
are preferably
free of contaminating helper virus. Helper viruses are viruses that are not
replication
defective and sometimes arise during the packaging of the recombinant
retrovirus.
[0132] Non-defective or replication competent viral vectors can also be used.
Such vectors
retain sequences necessary for replication of the virus. Other types of
vectors are plasmid
vectors.
38
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[0133] After Lasl-encoding polynucleotides are introduced into cells,
techniques may be
used to determine the cells into which the polynucleotide sequences have been
introduced
and/or the specific cells that are expressing the introduced polynucleotide
sequences. A
variety of techniques to examine the presence of polynucleotide sequences
and/or expression
of polynucleotide sequences exist and are well known in the art. Some such
techniques
include Southern blotting, Northern blotting, polymerase chain reaction (PCR),
Western
blotting, RNase protection, radioiodide uptake assays, and others.
[0134] Also encompassed by the present invention, are single stranded
polynucleotides,
hereinafter referred to as antisense polynucleotides, having sequences which
are
complementary to the DNA and RNA sequences which encode the Lasl protein. The
term
complementary as used herein refers to the natural binding of the
polynucleotides under
permissive salt and temperature conditions by base pairing.
[0135] Administration of proteins and polynucleotides
[0136] Doses may be selected, depending on their dosage form, patient's age,
sex and
severity of disease, and other conditions, as appropriate, but the amount of
the active
ingredient may be generally about 0.0001 to 100 mg/kg a day. A unit dosage
form may
contain about 0.001 to 1000 mg of the active ingredient. The compositions may
be
administered using any mode that is medically acceptable, meaning any mode
that produces
effective levels of the active protein without causing clinically unacceptable
adverse effects.
Such modes of administration include parenteral routes (e.g., intravenous,
infra-arterial,
subcutaneous, intramuscular, mucosal or infusion), but may also include oral,
rectal, topical,
nasal or intradermal routes. Another route of introduction, of special use for
treatment of
patients with pulmonary fibrosis, is the respiratory route by inhalation into
the lungs. Other
delivery systems can include time-release, delayed release or sustained
release delivery
systems. Such systems can avoid repeated administrations, increasing
convenience to the
39
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
patient and the physician. Many types of release delivery systems are
available and known to
those of ordinary skill in the art. The pharmaceutical compositions of the
present invention
may also be administered by the respiratory route. The formulations
administered by the
respiratory route are generally oral aerosol formulations. Such formulations
can be
S administered via the respiratory route in a variety of ways.
[0137] In the event that a response in an individual is insufficient at the
initial doses applied,
higher doses (or effectively higher doses by a different, more localized
delivery route) may
be employed to the extent that patient tolerance permits. Multiple doses per
day are
contemplated to achieve appropriate systemic levels of peptides. The duration
of therapy with
the pharmaceutical compositions used in the methods of the present invention
will vary,
depending on the unique characteristics of the pharmaceutical composition and
the particular
therapeutic effect to be achieved, the severity of the disease being treated
and the condition
and potential idiosyncratic response of each patient. Ultimately the attending
physician will
decide on the appropriate duration of therapy with the pharmaceutical
composition used in
the method of the present invention.
[0138] Pharmaceutical compositions
[0139] Therapeutic proteins and polynucleotides may be administered to an
individual in
need of the same in a pharmaceutical composition. Suitable formulations for
delivery are
found in Remington's Pharmaceutical Sciences, 17th ed. (Mack Publishing Co.,
Philadelphia,
Pa., 1985). These pharmaceutical compositions are suitable for use in a
variety of drug
delivery systems (Larger, Science 249:1527-1533, 1990).
[0140] Las 1 and Kras2 proteins and polynucleotides in pharmaceutical
compositions are
suitable for single administration or in a series of inoculations. The
pharmaceutical
compositions are intended for parenteral, topical or oral administration.
Parenteral
administration may be by intravenous, subcutaneous, intradermal,
intraperitoneal or
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
intramuscular administration. Parenteral administration may be preferentially
directed to the
patient's liver such as by catheterization to hepatic arteries or into a bile
duct. For parenteral
administration, the compositions can include Lasl proteins and a suitable
sterile carrier such
as water, aqueous buffer, 0.4% saline solution, 0.3% glycine, hyaluronic acid
or emulsions of
nontoxic nonionic surfactants as is well known in the art. The compositions
may further
include substances to approximate physiological conditions such a buffering
agents and
wetting agents such as NaCI, KCI, CaCl2 sodium acetate and sodium lactate.
[0141] Solid compositions in conventional nontoxic solid carriers such as, for
example,
glucose, sucrose mannitol, sorbitol, lactose, starch, magnesium stearate,
cellulose or cellulose
derivatives, sodium carbonate and magnesium carbonate. For oral administration
of solid
compositions, the HCV-like particles preferably comprise 10% to 95%, and more
preferably
25% to 75% of the composition.
[0142] Therapeutic compositions may be administered as a single dose, but more
likely as a
series of dosages over a period of days, weeks or even months. Herein, an
effective
therapeutic dose is a dose that inhibits growth of a tumor, or causes tumor
regression.
EXAMPLES
[0143] Mouse model for Lung Cancer: Inbred mice models offer an effective
means of
identifying candidate lung cancer susceptibility loci. Inbred strains of mice
have different
susceptibilities to spontaneous and carcinogen-induced lung tumor formation.
The A/J strain
~ is the most susceptible to lung tumorigenesis whereas the C3H and C57BL/6
are among the
most resistant strains. Linkage study using (A/J ~ C3H/HeJ) F2 and (A/J ~
C57BL/6J) F2
mice has demonstrated that Pasl is the major lung tumor susceptibility locus
in mice that has
been mapped to the distal region of chromosome 6, and accounts for
approximately 50% of
the phenotypic variance. Here, Applicants provide the most definitive evidence
yet to
support the candidacy of both Lasl and Kras2 as the Pasl genes on mouse
chromosome 6.
41
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
This work represents the identification of candidates for the first major lung
cancer QTL in
either mouse models or humans since the initial mapping of Pasl QTL in 1993.
[0144] Materials and Methods for Construction of Cong~enic Strains Inbred A/J
and
C57BL/6J mice were purchased from the Jackson Laboratories (Bar Harbor, ME).
The basic
breeding scheme in the study was to put an approximately 26.1 cM fragment of
chromosome
6, encompassed by D6MIT54 and D6MIT373 markers from lung tumor susceptible A/J
strain
onto the genetic background of lung tumor resistant C57BL/6J mice. A/J mice
were initially
crossed to C57BL/6J mice. F1 progeny were backcrossed to C57BL/6J mice to
produce the
first backcross generation (N2). The N2 generation heterozygous for the
chromosome region
of interest was then backcrossed again to C57BL/6J mice to produce the N3
generation. This
process was repeated for a total of seven backcrosses. At N5 generation,
additional
microsatellite markers on chromosomes 9, 10, 17, and 19, including D9MIT75,
D9MIT355,
D9MIT35, D10MIT106, D10MIT2, D10MIT126, D17MIT246, D17MIT23, D17MIT50,
D19MIT36, D19MIT10, and D19MIT89, were screened to obtain the optimal breeders
which
harbor the least amount of the non-Pasl donor genome. At N8, 132 male
substrains
containing different chromosomal regions of interest were generated. These
individual
substrains were then each crossed to 3 C57BL/6J females to produce the N9
generation.
After selection, an average of 5-12 N9 congenic mice were generated from each
subcongenic
strain.
[0145] Genotyping Using Pol~rphic Markers For selecting mice on the basis of
their
geneotypes throughout the Pasl region on chromosome 6, the following markers
were used:
D6MIT54, D6MIT52, D6MIT59, D6MIT57, D6MC010, D6MC011, D6MIT15, and
D6MIT373. All of the mouse microsatellite primers were purchased from Research
Genetics,
Inc. (Huntsville, AL). The forward primer was end-labeled with 32P-ATP, and 30
cycles of
PCR were performed at 94°C for denaturation, 55°C for annealing
and 72°C for extension.
42
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
Eight percent denaturing polyacrylamide gels were used for resolution of the
radiolabeled
PCR products followed by autoradiography.
[0146] Lung Tumorigenesis in Congenic Mice Five-week-old N9 mice were given a
single
i.p. injection of urethane (1 mg/g body weight) in 0.2 ml PBS. All animals
were euthanized
by C02 asphyxiation 7.5 months after urethane initiation. A portion of lung
tumors and
normal tissue were removed and flash frozen in liquid nitrogen. The remaining
was fixed in
Tellyesniczky's solution and examined with the aid of a dissecting microscope
to count and
size the tumors. Tumor volumes were determined by measuring the three-
dimensional size of
each tumor and by using the average of the three measurements as the diameter.
The radius
(diameter/2) was determined, and the total tumor volume was calculated by:
Volume =
(4/3)pr3 (r-radius). Two-way ANOVA was used to determine the difference in
both the
number and the size of lung tumors between control and congenic groups.
[0147] Northern Blot Analysis and Semiguantative RT-PCR. Total RNAs were
prepared
from mouse lung tissues using TRIzoI reagent (Life Technologies). Poly(A)+
RNAs were
purified from the total RNAs with MicroPoly(A)Pure (Ambion). A 2-microgram
aliquot of
each Poly(A)+ RNA was separated on a 1 % agarose gel containing 2%
formaldehyde and
transferred to nylon membrane. The blots were hybridized with a random-primed
32P-
labelled cDNA probe in ExpressHybTM Hybridization Solution (Clontech) at 68
°C, washed
with O.1XSSC-0.1%SDS at 50-65 °C, and exposed for autoradiography at -
80 °C. For
semiquantative RT-PCR, first strand cDNAs were synthesized using Superscript 2
(Life
Technologies) with random primer and 1 mg of Poly(A)+ RNAs or 3-g of total
RNAs
described above. Primer sequences were 5'- GACCAAAGCCGAGCGACTGCGGC, 3'-
TCGAAGAAGTAGTTCTGTGGC for Las- l, 5'-TGACATCCGTAAAGACCTCTATGCC,
3, -AAG CAC TTG CGG TGCACG ATG GAG for b-actin. All reactions involved initial
denaturation at 94 °C for 3 min followed by 30-35 cycles at 94
°C for 30 sec, 55 °C for 30sec,
43
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
72 °C for 30 sec (for Lasl), and 21 cycles at 94 °C for 30 sec,
68 °C for 30sec, 72 °C for 30
sec (for = actin) on PTC- 100 Programmable Thermal Controller (MJ Research).
[0148] Colony Formation Assay and Athymic Mouse Tumorigenicity Assay. To
obtain the
entire sequence of cDNAs, Applicants performed Rapid Amplification of cDNA
Ends
(RACE) using MarathonTM cDNA Amplification Kit (Clontech). The entire Lasl
cDNAs
for both A/J and C57BL/6L were cloned into the pcDNA3.l(+) vector (Invitrogen)
with the
restriction sites of HindIII and EcoRI. Various mouse lung tumor cells were
used in this
experiment. LM1 is a metastatic cell line derived from A/J. MC4 and MC14 cells
were from
chemical-induced lung tumors in B6C3F1. These lines and NIH3T3 (mouse
fibroblast cell
line) were obtained from either American Type Cell Culture or University of
Colorado. For
colony formation assay, LM1 cells were seeded at 1.5 x 106 per 10 crn dish and
transiently
transfected with 4 ~.g of the constructed and empty vectors with Lipofectamine
(Invitrogen).
The transfected cells were cultured in the presence of lmg/ml 6418 for 2
weeks. The cells,
which survived, were fixed with 10% formalin and stained with 0.125% crystal
violet. The
colonies (! lmm) were counted. Applicants repeated at least 3 independent
experiments. For
athymic mouse tumorigenicity, female athymic BALB/c nude mice aged 4-6 weeks
were
purchased from Charles Rivers Laboratories. Applicants injected 10 million
cells
subcutaneously into each flank of nude mice. Four animals were used per
sample.
Applicants monitored the health of animals 3 times a week and measured the
size of tumors
weekly for 6 weeks. Tumor volume was calculated as length _ height - width _
0.5.
Applicants also confirmed the expression of Lasl for several tumors resected
from nude mice
by RT-PCR.
[0149] Tmmunocytochemistry. pcDNA3.1(+)/N-myc-tagged Lasl expression vectors
were
constructed from A/J allele and C57BL/6J allele individually to identify the
localization of
Lasl in cells. Transiently transfected NIH/3T3 cells with pcDNA3.1(+)/N-myc-
Las- 1 were
44
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
re-plated on multiwell chamber slides (Beckton Dickinson). Then the cells were
fixed with
4% paraformaldehyde in PBS and made permeable with 0.1%Triton X-100 in PBS for
3
minutes. Cells were covered with 3% BSA-containing blocking solution for 1 hr
at room
temperature. Then the cells were incubated with mouse anti-myc antibody
(Oncogene,
diluted 1:50 in blocking solution) for 1 hr at room temperature. Anti-myc
antibody was
stained with goat anti-mouse secondary antibody conjugated to rhodamine
(1:250) for 1 hr
and viewed with ECLIPSE E600 microscope (Nikon).
[0150] Sequence and Expression Analyses of Candidate Pasl Genes. There are 12
putative
genes detected by Exon Prediction software within ~0.5 Mb Pasl region (Table
l, shown in
Fig. 9). Among them, six genes, including Lrmp, Bcatl, Lasl (145.25Mb),
AK015530,
Kras2, and AI~016641, were confirmed to be expressed in lung tissues by RT-PCR
and
Northern blot analyses (data not shown). Consistent with Applicants' previous
study,
Northern blot analysis showed that Kras2 4B and AK015530 expression in A/J
mouse lung
was 36% and 58% higher than that from C57BL/6J strain, respectively (Fig. 5B).
AK016641 contained an elevated frequency of an alternative-splicing transcript
in A/J (Fig.
5B). No differential expression was found for Bcatl, Lrmp, and Lasl between
lung tissues of
A/J and C57BL/6J strains (Fig. 5B & Fig. 7C). Next, sequence analyses were
performed to
detect functional polymorphisms between susceptible and resistant strains. For
Lrmp, Bcatl,
Kras2, AK016641, and AI~015530, the entire open reading frames (ORFs) were
sequenced.
For Lasl, additional 5' and 3' Rapid amplification cDNA ends (RACE) methods
were used
to obtain the entire ORF. The mouse Lasl sequence and its comparison with
those of rat and
human are shown in Fig. 6. As shown in Fig. SC, four transcripts including
AK016641,
AK015530, Lrmp, and Lasl showed functional polymorphisms between A/J and
C67BL/6J
strains. AI~016641 had 2 functional polymorphisms at codon 218 (Arg to His),
codon 258
(Gly to Glu) and an alternative splicing transcript without exon 5 only found
in A/J stra.in.
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
AKOl SS30 had a polymorphism at colon 28 resulting in a change of Asp to Gly.
Lrmp had S
functional polymorphisms including colon 31 (Asp to Gly), colon S6 (Gly to
Asp), colon S8
(Phe to Leu), colon 438 (Arg to Gly), and colon S37 (Pro to Leu). Lasl showed
one
functional polymorphism at colon 60 (Asn to Ser). Therefore, five genes
including
S AK016641, AKOlSS30, Lrmp, Lasl, and Kras2 contained either functional
polymorphisms
or differential expression between A/J and CS7BL/6J and were further
characterized as
candidates for Pasl gene(s),
[0151] Distribution Pattern and Cellular Localization of Lasl Lasl has a 2193
by ORF and
consists of 730 amino acids; estimated molecular weight is 84.8 Kd homologous
to axomonal
p83.9 (Ciona intestinalis) (Fig. 6). Northern blot showed that Lasl mRNA had a
size of
approximately 4 Kb and the same expression level between A/J and CS7BL/6J
(Fig. 7C-a).
RT-PCR data also revealed that no differential expression was detected in a
total of 12
different strains examined including 6 resistant (CS7BL/6J, DBA/2J, SJL/J,
C3H/HeJ,
AKR/J, M. sp~~etus), 4 intermediate (BALB/c, 129/J, CBA/J, SM/J) and 2
susceptible (A/J,
1S SWRIJ) strains (data not shown). In multiple organ expression panels, Lasl
expressed at
higher levels in lung, kidney, and testis in both A/J and CS7BL/6J strains
(Fig. 7C-b).
Moreover, in 16 mouse cell lines, LM2, SponS, CL-13H, CL20 showed relatively
high levels
of Lasl expression while some lines such as LM1, CMT64, PCC4 showed extremely
low
expression (Fig. 7C-c). There appears a close correlation between functional
polymorphism
of Las1 and lung tumor susceptibility in various mouse strains. Applicants
sequenced the
entire open reading frame of Lasl gene in 12 mouse strains including 6
resistant, 4
intermediate, and 2 susceptible strains. The 12 strains of mice fall into two
genotypes
according to their sequence alteration in 60th colon of Lasl gene. The
susceptible/intermediate groups including 6 strains (A/J, SWR/J, BALB/c,
129/J, CBA/J,
2S SM/J) have an AAT at colon 60 encoding an asparagine, while the six
resistant strains
46
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
including C57BL/6L, DBA/2J, SJL/J, C3H/HeJ, AI~R/J, and M. spretus have an AGT
at
codon 60 encoding a serine (data not shown). To assess the possible function
of the Lasl
gene, the cellular localization of the Lasl product in NIH3T3, COS7, and LMl
cells were
investigated by transient transfection N-terminus myc-tagged Las 1 vectors
derived from A/J
and C57BL/6J alleles into NIH/3T3 cells. Fig. 7D shows the cytoplasmic
distribution of the
Lasl gene product in NIH/3T3 cells. Similar results were obtained when
Applicants
transfected those plasmids into COS7 and LMl cells (data not shown). Looking
into
homology between mouse Lasl and other species, Lasl products revealed a high
degree of
conservation from Ciona intestinalis to human (Fig. 6). Lasl protein is 67%
identical and
81% positive to the derived human Lasl protein (similar to human hypothetical
protein
FLJ10921, 30.41Mb). Searching NCBI protein database using mouse protein
sequence
revealed a rat homologous protein, encoded by NCBI predicted gene LOC297720
(84%
identities and 92% positives). The mouse Lasl protein is also homologous to a
Ciojaa
intestinalis protein axonemal p83.9 (GI: 20086393, 33% identities and 52%
positives) (Fig.
6). Amoxonemes are highly organized microtubule based structure present in
diverse types
of cells that perform motile, sensory, and developmental functions in
organisms from protists
to humans. These functions are consistent with observed cellular distribution.
[0152] Effect of Lasl on the Growth of Mouse Lung Tumor Cells. To fiuther
evaluate the
effects of Pasl candidates on cell proliferation, Applicants carried out a
series of transfection
experiments to determine whether these candidates could promote or inhibit
growth of the
mouse lung tumor cell lines including LM1, MC7 and MC14 cells. Among the five
genes
(AK016641, AK015530, Lrmp, Lasl, and Kras2) tested, only Lasl showed
differential effect
on cell growth between the A/J allele and the C57BL/6J allele (data not shown
for genes with
negative results). As shown in Fig. 7A-a, transfection of Las1-A/J-pcDNA3.1
into LMl
cells produced ~90% colonies vs pcDNA3.1 control vector, while transfection of
Lasl-
47
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
C57BL/6J-pcDNA3.1 produced ~30% colonies vs pcDNA3.l control vector,
indicating that
Lasl-C57BL/6J-pcDNA3.1 significantly inhibited anchorage-dependent cell growth
(p<0.0001; Fig. 7A-a). Similar inhibitory effects were also observed in MC7
and MC14
cells (MC14, Fig. 7A-b; MC7, data not shown). Clearly, Lasl derived from
C57BL/6J allele
can suppress tumor cell growth i~a vitYO. Applicants also tested the ability
of the C57BL/6J
derived Lasl to inhibit tumor development of LM1 cells in nude mice. As shown
in Fig. 7B,
after 5 weeks of inoculation, large tumors developed in all four mice injected
with Last-A/J-
pcDNA3.l transfected cells, but only small tumors developed in the four mice
injected with
transformed LM1 cells carrying Lasl-C57BL/6/J-pcDNA3.1 (P<0.05) (Fig. 7B-b, c,
d).
Expression of Lasl was also confirmed in the resected tumors by RTPCR (Fig. 7B-
a). These
results indicate that the C57BL/6J derived Lasl can inhibit the tumorigenic
potential of the
LMl cells i~z vivo.
[0153] Lung Tumori~enesis on F1 Kras2 Heterozy,~ous Deficient Mice. Six-week-
old male
129/Sv-K-ras+/- (Kras2 "knockout"), A/J female, and C57BLl6J female mice were
paired to
develop breeding colonies for production of (A/J~l29/Sv-K-ras+/-) F1 and
(C57BL/6J~l29/Sv-K-ras+/-) F1 mice. Each F1 mouse was genotyped for the
presence of
the Kras2 targeted mutation and was randomized into groups according to the
Kras2
genotypes and carcinogen treatments. For groups treated with urethane, animals
were given a
single i.p. injection of urethane (1 mg/g body weight) in 0.2 ml
phosphatebuffered saline.
For MNU treatment groups, all animals were given a single i.p. injection of
MNU (50 mg/kg
body weight) in 0.2 ml phosphate-buffered saline (PBS). Eighteen to twenty
weeks after
treatment with carcinogens, animals from all eight groups were euthanized by
C02
asphyxiation. For each mouse, portions of the tumors plus some normal lung
were frozen in
liquid nitrogen. The remaining tissue and tumors were fixed in Tellyesniczky's
solution
overnight, followed by 70% ethanol treatment. The tumor number and size were
measured.
48
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
[0154] Kras2 Activit Assay-s. Mouse lung tumors from Kras2+/- of A/J or
C57BL/6J mice
were obtained from the lung tumor bioassays. These tumors were homogenized in
lysis
buffer- PBS (5 mM MgCl2, 1 mM DTT, 0.2 mM PMSF, 2pg/mL leupeptin, 5 p,g/mL
aprotinin, 1 mM benzamidine) and cleared by centrifugation. NP-40 was then
added to 1%
after centrifugation. Protein concentrations were determined by Bradford assay
(BioRad) and
equalized prior to incubation with 40 mg GST-RafRBD (Ras binding domain),
precoupled to
glutathione agarose. Half as much lysate was used in the pulldown from
C57BL/6J tumors.
After 2 h of mixing, beads were washed and bound proteins were eluted with SDS
sample
treatment buffer. Bound Kras2 protein was detected by western blot with a-
KRas2 F234
antibody (Santa Cruz Biotechnology).
[0155] Statistical Anal To compare the tumor multiplicity and load
genotype/genotype
(Kras2+/-/Kras2+/+) ratios between (A/J~129/Sv-K-ras+/-) Fl and
(C57BL/6J~l29/Sv-
Kras+/-) F1 strains, tumor numbers and loads were log-transformed and t-tests
applied using
the genotype-genotype differences of the log-transformed values. To facilitate
logtransformation, zero multiplicity values were assigned a value of 0.5 and
zero load values
were assigned a value of 0.001. This would produce conservative p-values.
[0156] Kras2 Alleles Contribute to Differential Lung Tumor Progression.
Although no
functional polymorphisms were detected in the coding sequence of the Kras2
gene between
A/J mice and C57BL/6J mice, Applicants further characterized its candidacy for
Pasl
because of previously observed allele-specific expression and mutation of
Kras2 in mouse
lung tumors from hybrid mice such as A/J _ C67BL/6J F1 or A/J _ C3H/HeJ Fl in
which as
much as 20-fold higher expression of Kras2 mRNA from the A/J allele was
observed (20). A
mouse lung tumor bioassay was conducted using heterozygous Kras2 deficient
mice (K-
ras+/-). The animals were paired to develop breeding colonies for production
of (A/J~K-
ras+/-) F1, and (C57BL/6J~K-ras+/-) Fl mice. Either wild type or heterozygous
Kras2
49
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
knockout and wild type mice v,~ere subjected to lung tumorigenesis assays
using two lung
carcinogens: urethane and methylnitrosourea (MNCJ~. Treatment of both (A/J~K-
ras+/-) Fl
and (C57BL/6J~K-ras+/-) F1 heterozygous deficient mice with urethane or MNU
produced
4-5 times more tumors/mouse than did treatment of wild type mice, indicating
no allelic
S difference was found in promoting lung tumor multiplicity as result of Kras2
heterozygous
deficiency (Fig. 8A). In contrast, the allelic effects on tumor load (or tumor
size) showed
significant differences: a nearly 50-fold increase in tumor volume was
observed in (A/J~K-
ras+/-) F1 heterozygous deficient mice when compaxed to wild type controls
while only ~8-
fold increase in tumor size was observed in (C57BL/6J~K-ras+/-) F1
heterozygous deficient
mice when compared to wild type control mice (Fig. 8B). These results indicate
that the
remaining A/J or C57BL/6J I~ras2 allele in K-ras+/- mice has a significant
differential effect
on lung tumor progression (Fig. 8B; p<0.001). Thus, the Kras2 allele derived
from A/J
mouse strains confers a significantly higher susceptibility to lung tumor
progression than
does the C57BL/6J I~ras2 allele.
[0157] The Activation State of I~ras2 in Lung Tumors from Kras2 Deficient
Mice. The
mechanism for the Kras2 alleles in lung tumor progression appears to be
related to the
observed differential mRNA expression of the activated Kras2 alleles in lung
tumors from the
A/J strain of mice. Interestingly, there was considerably higher active Kras2
protein
expressed in lung tumors from mice containing only A/J Kras2 allele compared
to mice with
only C57BL/6J I~ras2 allele as determined by an assay which utilized the Ras
binding domain
(RBD) of c-Raf to specifically recognize GTP-bound Kras2 (26; Fig. 8C). In
fact,
Applicants were unable to detect any active I~ras2 protein in lung tumors from
(C57BL/6J~K-ras+/-) Fl mice (Fig. 8C). This result was seen despite the use of
half the
amount of lysate in lung tumors from (A/J~K-ras+/-) F1 mice. Thus, mice
containing only
so
CA 02543965 2006-04-27
WO 2005/045062 PCT/US2004/035690
the C57BL/6J Kras2 allele expressed less activated Kras2 protein in a fashion
that associates
closely with its resistance to chemically induced lung tumorigenesis.
51
