Note: Descriptions are shown in the official language in which they were submitted.
CA 02547331 2006-05-24
WO 2004/048937 PCT/US2003/038186
ELECTRO-OPTICAL NUCLEIC ACID-BASED
SENSOR ARRAY AND METHOD FOR DETECTING
ANALYTES
GOVERNMENT SUPPORT
[001] The invention described herein was supported in part with U.S.
Government funding under Defense Advance Research Projects Agency Contrabt No.
DAAK60-97-I~-9502, Office of Naval Research Grant No. N00014-95-1-1340, .and
National Institutes of Health Grant DC00228. The U.S. government has certain
rights
in this invention.
CROSS-REFERENCE TO RELATED APPLICATIONS
[002] This application claims the benefit of the U.S. Provisional Patent
Application Serial No. 60/428,869, filed November 25, 2002, and a co-pending
U.S.
Patent Application Serial No. 10/303,548 filed November 25, 2002.
FIELD OF THE INVENTION
[003] The present invention generally relates to compositions and systems
useful
in monitoring of chemical hazards, air quality, and medical conditions, and
detecting
explosives, mines, and hazardous chemicals. The invention provides nucleic
acid-
based sensors and methods for detecting analytes. More particularly, the
invention
relates'to nucleic acid-based optical sensors, sensor arrays, sensing systems
and
sensing methods for sensing and detection of unaiown analytes in vapor phase
by
way of real-time feedback and control of sampling conditions including remote
controlled systems and methods of malting such sensors and sensor arrays.
BACKGROUND OF THE INVENTION
[004] The serious threat of explosive, chemical and/or biological attaclts
pose a
particular challenge for national security in the current "post September
11th, 2001"
era. A method that could detect a wide range of compounds, and that could also
be
automated and remotely controlled and that could be used in field conditions
CA 02547331 2006-05-24
WO 2004/048937 -2- PCT/US2003/038186
including airport, seaport, or other screening systems, would be particularly
desirable.
For example, currently only about 2% of all the containers are screened by any
means
that come through the seaports to the United States, because there are no
suitable
reliable, fast, easy ayd relatively cheap screening methods available. For
national
security, it is imperative to develop screening methods that could detect, for
example,
explosives and toxic chemicals that may be transported into the United States.
Detection methods for identifying trace amounts of volatile compounds from,
for
example, explosives or chemical warfare agents, would be one possible way to
approach such novel screening methods for national security purposes.
[005] Moreover, there are a number of other current and potential uses for
detection and identification of volatile compounds. For example, different
chemical
analyses have been used to detect the presence or absence of a known target
chemical
in clinical diagnoses, to identify unknown compounds and mixtures in basic
research
and drug discovery, and to document the identity and purity of known
compounds,
e.g., in testing and quality control in drug manufacturing processes. In
addition to
laboratory analyses, chemical detection is also important outside of the
laboratory.
Examples include bedside diagnoses, and environmental monitoring for hazardous
materials. The "field" applications, including detection of explosives and
chemical
warfare agents, require small, portable, reliable, easy-to-use, inexpensive
devices.
[006] There are number of methods currently available for chemical analysis,
each appropriate for a particular application and each having its own
strengths and
weaknesses. Examples include the various forms of chromatography, including
gas
chromatography (GC), high performance liquid chromatography (HPLC), and . . .
spectroscopy, including mass spectroscopy (MS), ion mobility spectroscopy
(IMS),
Raman spectroscopy and infrared spectroscopy, as well as other chemical,
immunological, and gravimetric methods. Also, combinations of different
methods
can provide a powerful means of identifying unknown compounds, e.g., GC/MS
which is used extensively in analytical chemistry laboratories.
[007] A common feature of these analytical methods is that the chemical sample
needs to be prepared,prior.to analysis. Liquid and solid samples are usually
dissolved
into an appropriate solvent. For analysis of vapor-phase chemicals, a
preconcentration step is often required to increase the quantity of material
for
analysis.
CA 02547331 2006-05-24
WO 2004/048937 -3- PCT/US2003/038186
[008] Preconcentration of vapor-phase chemicals involves passing a large~~
volume of air over an adsorbent Tenax or solid phase microextraction (SPME)
trap.
The sample is removed from the trap using a small amount of liquid solvent or
is
thermally desorbed directly into the input of a GC for analysis (Zhang, Z.,
Yang, M.
J., and Pawliszyn, J. (1994) Anal. Chem., 66:844A- 853A).
[009] Preconcentration followed by GC or GC/MS has been used to detect and
quantify volatile chemicals in a variety of studies with relevance to health
care and
domestic security, for example, detection of contaminants in water
(Lambropoulou,
D. A. and Albanis, T. A. (2001) J. Chromatogr., 922:243-255;. Cancho, B.,
Ventura,
F., and Galceran, M. T. (2002) J. Chromatogr., 943:1-13) and soils (Cam, D.
and
Gagni, S. (2001) J. Chromatogr. Sci., 39:481- 486), detection of toxic
substances in
blood. (Bouche, M. P., Lambert, W. E., Bocxlaer, J. F. V., Piette, M. H., and
Leenheer, A. P. D. (2001) J. Anal. Toxicol., 26:35-42;Musshoff, F., Junker,
H., and
Madea, B. (2002) J. Chromatogr. Sci., 40:29-34), detection of drugs in
postmortem
tissue (Mosaddegh, M. H., Richardson, R., Stoddart, R. W., and McClure, J.
(2001)
Aml. Clin. Biochem., 38:541-547), detection of organic compounds in normal
breath
(Grote, C. and Pawliszyn, J. (1997) Anal. Chem., 69:587-596) and in the breath
of
lung cancer patients (Phillips, M., Gleeson, K., Hughes, J. M. B., Greenberg,
J.,
Cataneo, R. N., Baker, L.; and McVay, W. P. (1999) Lancet, 353:1930-1933),
characterization of explosive signatures (Jencins, T. F., Leggett, D. C.,
Miyares, P. H.,
Walsh, M. E., Ranney, T. A., Cragin, J. H., and George, V.(2001) Talanta,
54:501-513), and detecting Sarin in air and water (Schneider, J. F., Boparai,
A. S., and
Reed, L. L. (2001) J. Chromatogr. Sci., 39:420-424). Fer rapid detection of
volatile
compounds, it would be advantageous to avoid specific sample preparation
steps.
This would be especially desirable in applications where detection is
performed in '
field conditions, outside a laboratory.
[O10] Volatile chemical analyses using these methods require optimizations for
each analysis problem. For example, the GC column, GC detector, trap coatings,
and
flow rates all need to be optimized for particular volatiles of interest. In
addition,
preconcentration can take considerable time to collect sufficient material in
the trap.
The time required depends on the sorbent coating on the trap (different Tenax
coatings have different affinities for different chemical compounds) and on
the
original concentration of sample in the air. Such analytical methods are
therefore
generally inappropriate for rapid analyses, such as security screening, real-
time
CA 02547331 2006-05-24
WO 2004/048937 -4- PCT/US2003/038186
environmental monitoring, or bedside diagnoses. Therefore, it would be
advantageous to develop a detection system that is capable of rapidly
analyzing a
wide array of different~compounds in varying concentrations.
[Ol 1] For air sampling, aii alternative to preconcentration consists of
systems
containing dedicated sensors that are responsive to particular compounds of
interest.
Common examples include home detectors for carbon monoxide, propane, and
natural
gas. Although sensors are available that are broadly responsive, e.g., sensors
that
respond to many volatile organic compounds, these devices do not identify the
vapor
detected. While a system containing a dedicated selective sensor can respond
rapidly
to its cognate analyte and may not require preconcentration, the ability to
detect and
identify multiple volatile compounds would require a separate sensor selective
for
each compound of interest. Further, such methods preclude detection of future
compounds of interest. Therefore, it would be desirable to develop a system
that is
capable of sensing as well as identifying a wide range of compounds.
[012] For detecting, discriminating, and identifying volatile compounds in the
air, one of the most highly developed chemical detection devices is arguably
the
olfactory system of terrestrial animals. Olfactory abilities include high
sensitivity
(Passe, D. H. and Walker, J. C. (1985) Neurosci. Biobehav. Rev., 9:431-467),
the
ability to detect and discriminate many different compounds (e.g.,Youngentob,
S. L.,
Markert, L. M., Mozell, M. M., and Hornung, D. E. (1990) Physiol. Behav.,
47:1053-1059; Slotnick, B. M., Kufera, A., and Silberberg, A. M. (1991)
Physiol.
Behav., 50:555-561; Lu, X.-C. M., Slotnick, B. M., and Silberberg, A. M.
(1993)
Physiol: Behav., 53:795-804), and the ability to ir.:~ke fine odorant
discriminations
(e.g., individual recognition in rodents -Yamazaki, K., Singer, A., and
Beauchamp, G.
K. (1998-1999) Genetica, 104:235-240). Numerous mechanisms influence these
capabilities at points in the process even before odorant molecules interact
with
receptor proteins. Sniffing behavior, nasal aerodynamics, mucus solvation, and
odorant clearing all likely play a role in olfactory abilities (Christensen,
T. A. and
White, J. (2000). Representation of olfactory information in the brain. In
Finger,
T.E., Silver, W. L., and Restrepo, D., editors, Neurobiology of Taste and
Smell, pages
201-232. John Wiley& Sons, New Yorlc). Once odorants reach the olfactory
receptor
proteins in the nasal mucosa, the system does not devote one receptor protein
to each
individual odorous ligand. Rather, even single compounds interact with many
broadly-responsive receptor proteins, producing widespread spatiotemporal
patterns
CA 02547331 2006-05-24
WO 2004/048937 -5- PCT/US2003/038186
of activity in the olfactory sensory neuron population- in other words,
activity in
many sensor elements that evolve over time (MacKay-Sim, A., Shaman, P., and
Moulton, D. G. (1982) J. Neurophysio~l., 48:584-596; Kent, P. F. and Mozell,
M. M.
(1992) J Neurophysiol, 68:1804-1819). These patterns of activity are then
interpreted
by parallel processing elements in the olfactory areas of the brain, producing
widespread activation in the neuronal populations at each level of the
olfactory
pathway (for reviews, see Kauer, J. S. (1987). Coding in the olfactory system.
In
Finger, T. E. and Silver, W. L., editors, Neurobiology of Taste and Smell,
pages
205-231. Jolm Wiley & Sons, Inc, New York; Kauer, J. S. (1991). Trends
Neu~'osci~
14:79-85;Christensen, T. A. and White, J. (2000). Representation of olfactory
information in the brain. In Finger, T.E., Silver, W. L., and Restrepo, D.,
editors,
Neurobiology of Taste and Smell, pages 201-232. John Wiley& Sons, New York).
[013] The properties of the olfactory system suggest that engineered devices
based on olfactory mechanisms may have advantages for detecting and
identifying
volatile compounds. Such a device, called an "artificial nose" or "electronic
nose,"
was first described iy the early 1980's (Persaud, K. and Dodd, G. (1982).
Nature,
299:352-355), and a number of systems have been reported since then (see,,
e.g.,
Grate, J. W., Rose-Pehrsson, S. L., Venezky, D. L., Klusty, M., and Wohltjen,
H.
(1993) Anal. Chem., 65:1868-1881; Freund, M. S. and Lewis, N. S. (1995).
Proc.Nat.
Acad. Sci. USA, 92:2652-2656; White, J., Kauer, J. S., Dickinson, T. A., and
Walt, D.
R. (1996) Anal. Chem., 68:2191-2202).
[014] All of these devices incorporate the two main features that define an
electronic nose: i) an array of broadly-responsive sensors and 2) a pattern
recognition
method for processing sensor output. Like in the olfactory system, odorants
interact
with multiple sensors, producing a pattern of activation across the array.
Commercial
and research electronic noses use a variety of technologies for chemical
sensing
including conducting polymers, surface acoustic wave devices, solid-state
devices,
and optical interrogation. Pattern recognition methods generally involve
statistical
methods or computational neural networks (for reviews, see Gardner, J. W. and
Bartlett, P. N., editors (1992). Sensors and sensory systems for an electronic
nose.
Kluwer Academic Publishers, Dordrecht, The Netherlands; Gardner, J. W. and
Bartlett, P. N. (1994). Sensors and Actuators B, 18-19:211-220; Gardner, J. W.
and
Hires, E. L. (1997). Pattern analysis techniques. In Kress-Rogers, E., editor,
Handbook of Biosensors and Electronic Noses: Medicine, Food, and the
CA 02547331 2006-05-24
WO 2004/048937 _(_ PCT/US2003/038186
Environment, pages 633-652. CRC Press, BocaRaton, FL;Dickinson, T. A., White,
J.,
Kauer, J. S., and Walt, D. R. (1998). Trends Biotechmol., 16:250-258).
[015] Potential and actual uses of commercial electronic noses include
food/beverage analysis, environmental monitoring, and medical diagnosis (Ping,
W.,
Yi, T., Haibao, X., and Farong, S. (1997) Biosens. Bioelectron., 12:1031-1036;
Dickinson, T. A., White, J., Kauer, J. S., and Walt, D. R. (1998) Trends
Bioteclmol.,
16:250-258; Aathithan, S., Plant, J. C., Chaudry, A. N., and French, G. L.
(2001) J.
Clin. Microbiol., 39:2590-2593).
[Ol 6] Vapor phase chemical detection systems based on arrays of
broadly-responsive sensors offer a number of potential advantages over
traditional
analytical devices. An electronic nose directly samples the air, so no sample
preparation is necessary. The time required for detection is limited only by
the time
required for the chemical sensors to respond and for the pattern recognition '
calculation, which is fast using modern computer technology. With
rapidly-responding sensors, rapid detection of volatiles is therefore
possible. In
addition, while traditional analytical instruments tend to be large and
require
considerable power, sensor array devices have the potential for being small
and
portable. Although handheld IMS devices are available, they are currently
tuned to
specific, restricted tasks, such as use of the Iontrack Instruments
VaporTracer2 for
explosives or drugs, and therefore lack the broad-band nature of an electronic
nose.
[017] Sensor array devices would also have a number of advantages over
systems using mono-specific sensors. First, truly "mono-specific" sensors are
difficult (if not impossible) to produce; broadly-responsive sensors can be
readily
made. Second, even if mono-specificity could be achieved, detection of several
compounds would require development of a separate sensor for each compound of
interest. Conversely, a relatively small array of broadly-responsive sensors
is
theoretically capable of discriminating a large number of different compounds
(Alkasab, T. K., White, J., and Kauer, J. S. (2002) Chem. Senses, 27:261-275).
Third,
a device containing sensors specific for a finite number of compounds is
incapable of
detecting any others outside its defined target set. A device containing
broadly-responsive sensors would have the potential for detecting and
discriminating
compounds of future interest.
[Ol 8] It would be advantageous to develop sensors capable of detecting and
correctly identifying a large range of analytes, e.g., volatile chemicals.
Such sensors
CA 02547331 2006-05-24
WO 2004/048937 -~- PCT/US2003/038186
would be particularly useful in domestic security applications, such as
detecting
explosives and chemical warfare agents. '
SUMMARY OF THE INVENTION
[019] We have, surprisingly, discovered that nucleic acids with attached
fluorophores and dried onto a substrate react with volatile chemical compounds
or
analytes in ambient air and can therefore be used as sensors to detect
analytes in 'the
air that react thereto. This is distinctly different from other nucleic acid-
based sensing
materials that work only when both the analytes and nucleic acid materials are
present
in aqueous solution.
[020] The term "analyte" as refereed to throughout the specification refers to
any
molecule or compound. A "volatile analyte" refers to a molecule or compound in
gaseous or vapor phase, that is present, for example, in the headspace of a
liquid, in
ambient air, in a breath sample, in a gas, or as a contaminant in any of the
foregoing.
Analytes further include solid-phase compounds that are small enough to remain
suspended in air, e.g., dust, molecules and compounds-present on the surfaces
of
particles present in gaseous or vapor phase, such as virus envelope proteins
or
bacterial cell surface or spore surface molecules, macromolecules that are
cast off
from other sources such as DNA, RNA, and proteins.
[021 ] Accordingly, the present invention provides a nucleic acid-based
chemical
sensor, sensing system and sensing and identification method which provide for
a
nucleic acid-based multi-sensor, cross-reactive, sensor array having a rapid
response
time, a rapid sampling time, dynamic modulation of sampling and detection
parameters, intelligent feedback control of analyte sampling conditions, smart
mode
sampling, smart detection through application of sophisticated analyte
detection
algorithms, high throughput screening of sensors, and high sensitivity,
discrimination,
and detection capability for a variety of target analytes.
[022] The invention further provides a nucleic acid-fluorphore-based analyte
sensing system which can transmit identifying information on various odors or
smells,
e.g., vapor or gaseous analytes, remotely, for example, over the Internet, or
via a
wireless communication system.
CA 02547331 2006-05-24
WO 2004/048937 -8- PCT/US2003/038186
[023] In one embodiment, the present invention provides a method for detecting
and/or identifying an analyte, e.g., a volatile analyte, in an air sample
comprising the
steps of:
a) contacting said air sample with a nucleic acid-based sensor array
comprising a substrate and a nucleic acid labeled with (attached to)
a fluorophore dispersed on the substrate, said nucleic acid labeled
with a fluorophore providing a characteristic optical response when
subjected to excitation light energy in the presence of the analyte;
and
b) detecting the presence or absence of the analyte.
c) identifying the analyte found in the air sample.
[024] The substrate can be fabricated of different materials, including, for
example, papers, fiberglass, sills, and fabrics made of synthetic materials.
[025] In one preferred embodiment, the nucleic acid/fluorophore is dispersed
on
a plurality of internal and external surfaces within the substrate.
[026] In one embodiment, contacting is accomplished by drawing an air sample
suspected to contaiy the analyte into a sample chamber and exposing the array
to the
air sample. In a preferred embodiment, the air sample is drawn through the
chamber
for no more than five seconds.
[027] The detecting may be accomplished by illuminating said sensor with
excitation light energy and measuring an optical response produced by the
sensor due
to the presence of said volatile compound with a detector means. Detector
means
include, for example, a variety of photodeteciars such as photomultiplier
tubes
(PMTs), charge-coupled display device (CCD) detectors, photovoltaic devices,
phototransistors, and photodiodes. In a preferred embodiment, filtered
photodiode
detectors are used.
[028] In all embodiments, the analyte can be identified by employing a pattern-
matching algorithm and comparing the optical response of the nucleic acid-
based
sensor array with the characteristic optical response.
[029] In specific embodiments, the analyte can be identified by measuring the
spatio-temporal response patterns of the optical response and recognizing the
patterns
through a method selected from template matching, neural networks, delay line
neural
networks, or statistical analysis. The air sample may be suspected of
containing
CA 02547331 2006-05-24
WO 2004/048937 -9- PCT/US2003/038186
analytes from a variety of substances, including explosive materials or
chemical
weapons agents.
[030] The present invention further provides a sensing system for detecting
and
identifying an analyte in an ambient air sample. The system includes: a) a
nucleic. .
acid-based sensor array comprising a plurality of nucleic acids; b) a
fluorophore
"' "' attached to the nucleic acids; c) a plurality of substrates wherein the
nucleic acids with
fluorophore are attached to; d) a substrate support; e) an excitation light
source array
including a plurality of light. sources optically coupled to the sensor
elements; f) a
detector array comprising a plurality of detectors optically coupled to said
sensot
elements; g) a sample chamber for housing the sensor elements, the light
source array,
and the detector array; h) a sampling means attached to the chamber for
drawing the
ambient air into the chamber for contact with the sensor array for a
controlled
exposure time; i) a controller means in electrical communication with the
light
sources, the detectors, and the sampling means, the controller means
electrically
coordinating and switching the sampling means with the light sources and the
detectors for sampling the ambient air, measuring optical responses of the
array
sensors to the ambient air sample, and detecting the volatile compound; and j)
an
analyte identification algorithm for comparing the measured sensor optical
responses
to characteristic optical responses of the sensors to target analytes and
identifying the
analyte in the ambient air sample. '
[031] The elements of the analyte sensing system may be used together in a
hand-held device, a device attached to another object, e.g., a shipping
container, or
used in conjunction with another screening device such as an x-ray screening
machine. Alternatively, separate elements of the system, e.g., elements a)-i),
can be
used as one or more sensing units, while the analyte identification algorithm
resides
on a computer at a remote or separate location. ~ne or more sensing units can
be
connected with the computer via a wired or wireless network.
[032] In another preferred embodiment the identification algorithm reports a
detection event when the sensor responses are different from blank air and
identifies
the analyte present using a pattern-match algorithm.
[033] In one preferred embodiment, the system comprises one or more remote
sensing units of the analyte sensing system with nucleic acid-fluorophore
sensor
arrays wirelessly comiected to each others and the unit with the analyte
identification
CA 02547331 2006-05-24
WO 2004/048937 -10- PCT/US2003/038186
algorithm, so that the information about the analytes is transferred to a
remote
location.
[034] Therefore, in one embodiment, the invention provides a sensor array
system for remote characterization of a gaseous or vapor sample, comprising:
a) a plurality of sensors, wherein at least one sensor comprises nucleic
acid/fluorophore combination comprising a plurality of nucleic acids attached
to a
fluorophore, wherein the plurality of sensors provide a detectable signal when
contacted by an analyte; b) a measuring apparatus, in communication with
plurality of
sensors capable of measuring the detectable signal; c) a transmitting device,
in
communication with the measuring apparatus for transmitting information
corresponding to the detectable signal to a remote location via the Internet,
fiber optic
cable, and/or an air-wave frequency; and a computer comprising a resident
algorithm
capable of characterizing the analyte.
[035] The invention further provides a method of selecting nucleic acids
capable
of responding to a vapor phase analyte, said method comprising: a) contacting
the
nucleic acid labeled with a fluorophore with an analyte in vapor phase; and b)
measuring. the emission proflile of the fluorophore in the presence and
absence of the
target analyte, wherein a difference in the emission profile indicates that
the nucleic
acid is responsive to the analyte in vapor phase.
BRIEF DESCRIPTION OF THE FIGURES
[036] This invention is pointed out with particularity in the appended claims.
Other features and benefits of the present invention can be more clearly
understood
with reference to the specification and the accompanying drawings in which:
[037] Figures lA and 1B show an example of a hand-held configuration of the
Electo-Optical Vapor Interrogation Device (EVID). Fig. lA shows a schematic
view
of the EVID sensor chamber, air flow path (30) (thick arrows), signal pathways
(solid
arrows), and computer control lines (dashed arrows) (8). The 3-way valve for
switching between odorous and clean air is implemented as a pair of servo
controlled
valves (10). In Figure lA and 1B the following parts are shown: panel of light
emitting diode light sources (12) and excitation filters (28); the panel of
photodiode
detectors (26) and emission filters; (14); sniffpump (4); control and feedback
control
(double arrow in two directions) (16); computer (18); 16 channel integrating
amplifiers and 20 bit A/D/ converters (20); inhale path (22) clean air from
the source
CA 02547331 2006-05-24
WO 2004/048937 -11- PCT/US2003/038186
(24). Figure 1B outlines a top view of the same system with LEDs (12);
emission
filter (14) excitation filter (28); and photodiodes (26). '
[038.] Figures 2A and 2B show temporal responses of sensor made from YO-
PRO and pBluescriptSK DNA. Fig. 2A shows a sensor made from YO- PRO, then
rinsed in 70% ethanol for 5 min. Fig 2B shows a sensor made from YO-PRO and
Sng total pBlueScriptSI~ DNA. Analyte dilutions as fractions of saturated
vapor
were: Water, 10-x; methanol (MeOH), 10-x; triethylamine, 10-2; and propionic
acid,
10-x. Each trace represents the mean of 10 presentations; error bars indicate
+/- 1 S.D.
For experiments with DNA-based analyte sensors, similar methods were used for
each
type of sensor. Briefly, DNA in solution was diluted to the desired
concentration
(0.2-40 ng/~.l) in TE (lTris, 0.5 mM EDTA). 20 ~.1 of dilute DNA was mixed
with 1
~1 concentrated dye stock and incubated at room temperature for 5 minutes. Dye-
only
controls were made of 1 ~l dye stock in 20 ql TE. Sensors were made on a
substrate
of acid-washed l6xx silkscreen (lOmm x 12 mm). DNA/dye mixtures were pipetted
onto the substrate and allowed to dry for 25 minutes. Each sensor was rinsed
in 70%
ethanol for 5 minutes, allowed to dry, then attached to supports on glass
coverslips for
testing in the EVID (Fig. 2B).
[039] Figures 3A and 3B show temporal responses of sensors made from
different short sequences bf single-stranded DNA and OliGreen dye. Fig. 3A
shows
an oligomer DS003, which has the sequence
GATCCTTGCTACCCTCTCCTAGGAACGATGGGA (SEQ ID NO: 5). Figure 3B
shows an oligomer AJ001, which has the sequence
ACCAGGACCTGACTAAGCAGAT (SEQ ID NO: 4). See Fig. 2 for sensor
construction details and analyte dilutions. Each trace represents the mean of
10
replicates; error bars indicate +/- 1 S.D.
[040] Figures 4A and 4B show analyte concentration responses of two
oligonucleotides labeled with the fluorescent dye Cy3(tm) during synthesis
(using
Cy3(tm) phosphoramidite from Glen Research). Figure 4A shows LAPP1, which is
the sequence GAGTCTGTGGAGGAGGTAGTC (SEQ ID NO: 1). Figure 4B shows
LAPP2, which is the sequence CTTCTGTCTTGATGTTTGTCAACC (SEQ ID
N0.:2). The oligomers were stored in Tris-NaCI (10 mM Tris, 50 mM NaCI, pH 8)
at
225 ng/~1, then diluted to a concentration of 50 ng/~1 in distilled water just
before use.
See Fig. 2 for sensor construction details. Signal amplitudes are the
parameters
resulting from the exponential fit of the sensor temporal signals as described
below.
CA 02547331 2006-05-24
WO 2004/048937 _12- PCT/US2003/038186
Sensor signals and data processing. Each data point is the mean of 10
presentations;
error bars indicate +/- 1 S.D.
[041 ] Figure 5 shows an overview of steps for sensor library creation and
screening. The PCR template ~a) or primer extension template b) is amplified
with
two or one primer(s), respectively. Step 1: Synthesize random sequence
library; Step
2: Dilute library; Step 3: Put samples into 104 96-well plates; Step 4:
Amplify and
label the nucleic acids; Step 5: Create high-density sensor library using a
robotic
spotter; Step 6: Image sensor library with array scanner before and after
applying the
vapor phase analytes.
[042] Figure 6 shows an example of a strong propionic acid odor response in
tine
set of sensor spots. Data were collected using a ScanArray 4000 microarray
scanner.
The image on the left shows the background fluorescence of the sensor spots in
clean
air. The center image shows .the fluorescence levels in the same spots after
saturated
vapor propionic acid was injected into the test chamber. The image on the
right
shows the change in fluorescence when the image on the left was substracted
from the
image in the middle. Arrays of spots were applied to the coverslip in blocks
of 12X12
(12 replicates vertically and 12 different sequences horizontally); two
replicate blocks
(Rep 1 and Rep 2) were applied under three different ionic conditions: 50 mM
MgCl2,
50 mM NaCI, and water. One sensor sequence; TLAPP1 in water, showed a strong
increase in fluorescence, other sequences showed smaller changes in
fluorescence.
[043] Figures 7A and 7B show a diagrams of an exemplary chamber (32) for
delivering analytes to a sensor array when testing the nucleic acids for their
responsiveness to analytes in vapor phase. Figure 7A shows a ic~p me,w of the
chamber and Figure 7B shows a side view of the chamber. Solid black (34)
indicates
stainless steel, dancer grey (36) indicates 40 micron pore size stainless
steel filter.
The tube wherein the odor is injected in is a 21 gauge Teflon tubing and is
indicated
with a white tube (38). The analyte is injected into the tube and comes out
through
the filter (40) (darlc grey block). The interior chamber (42) contains the
coverslip
which is exposed to the analyte after the analyte is passed through the filter
(white
area inside the stainless steel walls of the chamber). The dimensions of
chamber
shown in this figure are appropriate for reading the glass coverslip with a
ScaWrray
4000.
CA 02547331 2006-05-24
WO 2004/048937 _13_ PCT/US2003/038186
[044] Figure 8 shows a block diagram of a sensor system of the present
invention wherein the analysis is performed in a remote location showing the
sensor
chamber (1) with nucleic acid arrays (~l) inside the chamber.
[045] ~ Figure 9 is a block diagram showing hardware components of one
embodiment of the system.
[046] Figure 10 is a schematic diagram of a sensor array module.
[047] Figure 11 is the sequence of oligomers with random internal sequence and
fixed ends.
[048] Figure 12 shows PCR reaction primers and double stranded product. ' The
asterisk represents Cy3(tm) labeling of the 5' dTTP nucleotide of the lower
primer.
DETAILED DESCRIPTION OF THE INVENTION
[049] The nucleic acid-based sensing method and sensing device design of the
present invention mimics and parallels the structure and operational
characteristics of
the mammalian olfactory system through the combination of electro-optical
hardware
component modules, microprocessor control and software sampling and detection
algorithms. The sample cavity design mimics the mammalian nasal cavity where
odors or smells (i.e. vapor analytes) are drawn into the sensing module
("sniffed" or
"inhaled") and their interaction with a plurality of sensing elements
("sensory
neurons") in a sensor array triggers an external event.
[050] Analyte applications include broad ranges of chemical classes such as
organics including, for example, alkanes, allcenes, alkynes, dimes, alicyclic
hydrocarbons, arenes, alcohols, ethers, hetcnes, aldehydes, carbonyls,
carbanions,
biogenic amines, thiols, polynuclear aromatics and derivatives of such
organics, e.g.,
halide derivatives, etc., biomolecules such as sugars, isoprenes and
isoprenoids, fatty
acids and derivatives, etc.
[051] Accordingly, commercial applications of the sensors, arrays and noses
include environmental toxicology and remediation, biomedicine, materials
quality
control, food and agricultural products monitoring, anaesthetic detection,
breath
alcohol analyzers, hazardous spill identification, explosives detection,
fugitive
emission identification, medical diagnostics, fish freshness, detection and
classification of bacteria and microorganisms both in vitro and in vivo for
biomedical
uses and medical diagnostic uses, monitoring heavy industrial manufacturing,
ambient
air monitoring, worker protection, emissions control, product quality testing,
leak
CA 02547331 2006-05-24
WO 2004/048937 -14- PCT/US2003/038186
detection and identification, oil/gas petrochemical applications, combustible
gas
detection, HZS monitoring, hazardous leak detection and identification,
emergency
response and law enforcement applications, illegal substance detection and
identification, arson investigation, enclosed space surveying, utility and
power
applications, emissions monitoring, transformer fault detection,
food/beverage/agriculture applications, freshness detection, fruit ripening
control,
fermentation process monitoring and control applications, flavor composition
and
identification, product quality and identification, refrigerant and fumigant
detection,
cosmetic/perfume/fragrance formulation, product quality testing, personal
identification, chemical/plastics/pharmaceutical applications, leak detection,
solvent
recovery effectiveness, perimeter monitoring, product quality testing,
hazardous waste
site applications, fugitive emission detection and identification, leak
detection and
identification, perimeter monitoring, transportation, hazardous spill
monitoring,
refueling operations, shipping container inspection, diesel/gasoline/aviation
fuel
identification, building/residential natural gas detection, formaldehyde
detection,
smoke detection, fire detection, automatic ventilation control applications
(cooking,
smoking, etc.), air intake monitoring, hospital/medical anesthesia &
sterilization gas
detection, infectious disease detection and breath applications, body fluids
analysis,
pharmaceutical applications, drug discovery, telesurgery, and the like.
[052] Biogenic~amines such as putrescine, cadaverine, and spermine are formed
and degraded as a result of normal metabolic activity in plants, animals and
microorganisms and can be identified in order to assess the freshness of
foodstuffs
such as meats (Veciananogues, J. Agr. Food Chem., 45:2036-2041, 1997),
cheeses,
alcoholic beverages, and other fermented foods. Additionally, aniline and o-
toluidine
have been reported to be biomarkers for subjects having lung cancer (Preti et
al., J.
Chromat. Biomed. Appl. 432:1-1 l, 1988), breath ammonia in diagnosis,
treatment
assessment, and follow-up in hepatic encephalopathy (Shimamoto et al.,
Hepatogastroenterology, 47(32):443-5, 2000), while dimethylamine and
trimethylamine have been reported to be the cause of the "fishy" uremic breath
odor
experienced by patients with renal failure. (Simenhoff, New England J. Med.,
297:132-135, 1977). Thus, in general biogenic amines and thiols are biomarkers
of
bacteria, disease states, food freshness, and other odor-based conditions.
Thus, the
nucleic acid-fluorophore based nose sensor elements and arrays discussed
herein can
be used to monitor the components in the headspace of urine, blood, sweat, and
saliva
CA 02547331 2006-05-24
WO 2004/048937 -15- PCT/US2003/038186
of human patients, as well as breath, to diagnose various states of health,
such as the
timing of estrus (Lane et al., J Dairy Sci 81(8):2145-50, 1998), and~diseases
as
discussed herein. In addition, the sensor elements can be used for food
quality
monitoring, such as fish freshness (which involves volatile amine signatures),
for
enviromnental and industrial applications (oil quality, water quality, air
quality and
"' "' contamination and lealc detection), for other biomedical applications,
for law
enforcement applications (breathalayzers), for confined space monitoring
(indoor air
quality, filter breakthrough, etc.) and for other applications delineated
above to add .
functionality and performance to sensor arrays through improvement in analyte
detection by use in arrays that combine sensor modalities. Accordingly, the
invention
provides physicians and patients with a method to monitor illness and disease
from
remote locations. It is envisioned that the systems of the invention will be
useful in
medical care personnel monitoring patients who are bed-ridden at home or whom
require continual monitoring of a particular disease state. Such remote
monitoring
ability eliminates the need for repeated trips to a doctors office or hospital
and can
provide physicians with real-time data regarding a patient's health and well-
being.
[053] In one embodiment, analyte interaction with the nucleic acid/fluorophore
-
based sensing elements produces emitted light energy at a detectable
characteristic
wavelength when the sensor elements are illuminated by excitation light energy
from
a filtered LED array. The multi-element nucleic acid-based sensor array of the
present invention thus mimics the sensory neurons of the olfactory system in
responding to the external triggering event, emitted light energy signaling
the
presence of an analyte, and detecting this triggering event by way of a
filtered .. .
photodiode array ("Detection"). The photodiode preamplifiers mimic an
olfactory
sensory neuron by converting the optical signal to an electrical voltage
signal '
("Transduction") which is amplified, manipulated and transported via
electrical
circuits ("Transmission") to an analog-digital ("A/D") converter and a
software
controlled microprocessor for data manipulation, analysis, feedback control,
detection
and identification ("Integration"). The Detection, Transduction, Transmission,
and
A/D features are replicated for each nucleic acid-based sensor element in the
array.
The sensor array of the present invention may be expanded or contracted
without limit
by adding or removing elements and channels according to the requisite analyte
detection, discrimination and identification needs of a specific sampling
application.
CA 02547331 2006-05-24
WO 2004/048937 -1(- PCT/US2003/038186
[054] Figs. lA and 1B provide an overview of the analyte sensing and detection
system of the present invention. Analytes from an odor source (2) are sniffed
i.e.
transported to the sensor array where the odors interact with the array of
nucleic
acid/fluorophore -based sensor elements using a "sniff pump" (4). Light energy
excitation of the sensor elements (6) in the presence of the odors produces a
detectable optical response signal due to changes in emitted light produced by
analyte
interaction with the nucleic acid/fluorophore compounds in the sensor
elements. The
spatio-temporal optical response of the nucleic acid-based array to the odor
is
detected, recorded, manipulated, and then matched to known target odors via
smart
analytical algorithms, resident at computer 1 ~, which apply, for example,
pattern
matching, neural network, neuronal network, or statistical analysis methods to
detect,
discriminate and identify the odor.
[055] The hardware and software components and configuration of the nucleic
acid/fluorophore-based sensor of the present invention provide for a compact,
portable, inexpensive, expandable, rapidly responding sensing device that can
modify
its detection strategy on the fly. The design and method provides for real-
time, on-
the-fly, modulation of: a) the output of light emitting diodes (LEDs), such as
wavelength, intensity, and frequency; b) the detection properties of
photodiodes, such
as wavelength, gain, and frequency; c) the sampling parameters, such as
frequency,
duration, number, velocity, and rise-fall dynamics; and d) sampling time
constant or
temporal filter settings, for dynamically responsive, smart feedback control
in
sampling, detection and identification of analytes.
[056] In addition to dynamic response modulation, the device and method
further provide for hardware and algorithm implementations which evaluate the
synchrony and noise characteristics across different sensors, especially those
of the
same composition being examined at different wavelengths. This provides a
powerful
tool for identifying and utilizing small response signals and rejecting noise.
[057] By providing for independently illuminated, detected, recorded, and
modulated sensing channels, levels of flexibility, expandability, portability,
efficiency, and economy are achieved that are difficult to realize with the
currently
existing odor detectors. In addition, the use of small, inexpensive, flexibly
programmable, computational microcomputer platforms and interchangeable
nucleic
acid/fluorophore -based sensors and sensor array modules provide for extreme
flexibility and tailoring of sensor performance and capabilities to real world
sensing
CA 02547331 2006-05-24
WO 2004/048937 17 PCT/US2003/038186
applications, such as wirelessly comlected sensing units. One or more of such
units
can be placed, for example, in a tunnel through which objects can be directed
and
screened for odors or analytes. Applications of such wireless systems
comprising the
nucleic acid-fluorophore sensor arrays of the present invention include, but
are not
limited to screening for mail, screening for trucl~s or ship containers, cars,
luggage
"' "' and other such subject for odors and/or analytes.
[058] An example of a wireless system useful according to the present
invention
is described in detail in, for example, U.S. Patent No. 6,631,333,
incorporated herein
by reference in its entirety. '
[,059] ~ Nucleic acids useful according to the present invention include
single and
double-stranded RNA and single and double-stranded DNA and cDNA. Nucleic acid,
oligoriucleotide, and similar terms used herein also include nucleic acid
analogs, i.e.
analogs having other than a phosphodiester baclcbone. For example, the so-
called
peptide nucleic acids, which are known in the art and have peptide bonds
instead of
phosphodiester bonds in the backbone are considered within the scope of the
present
invention (Nielsen et al. Science 254, 1497 (1991)). Alternatively, modified
bases
can be used in the nucleic acid sequence.
[060] Examples of such modified bases are listed below on Table 1:
Table 1: Examples of Modified Bases
Code Modified base
ac4c 4-acetylcytidine chm5u 5
(carboxyhydroxymethyl)uridine
cm 2'-O-methylcytidine cm5u 5-carbamoyhnethyluridine
cmnm Ss2u 5-carboxymethylaminomethyl-2-thiouridine
cmnm Su 5-carboxymethylaminomethyluridine
d dihydrouridine
fm 2'-O-methylpseudouridine
gal q beta,D-galactosylqueuosine
gm 2'-O-methylguanosine i-inosine
i6a. N6-isopentenyladenosine
m 1 a 1-methyladenosine
m 1 am 2'-O-methyl-1-methyladenosine
m 1 f 1-methylpseudouridine
CA 02547331 2006-05-24
WO 2004/048937 -1 g- PCT/US2003/038186
m l g 1-methylguanosine
m l i 1-methylinosine
m22g 2,2-dimethylguanosine
m22gm N2,N2,3'-trimethylguanosine
m2a . 2-methyladenosine
m2g 2-methylguanosine
m3c 3-methylcytidine
m5c 5-methylcytidine
m6a N6-methyladenosine
m7g 7-methylguanosine
mam5s2u 5-methylaminomethyl-2-thiouridine
mam5u 5-methylaminomethyluridine
man q beta,D-mannosylqueuosine
mcmSs2u 5-methoxycarbonylinethyl-2-thiouridine
mcm5u 5-methoxycarbonylmethyluridine
mo5u 5-methoxyuridine
ms2i6a 2-methylthio-N6-isopentenyladenosine
ms2t6a N-((9-beta-D-ribofuranosyl-2-methylthiopurin-6-
yl)carbamoyl) threonine
mt6a N-((9-beta-D-ribofuranosylpurine-6-yl)N-methyl-
carbamoyl) threonine
my uridine-5-oxoacetic acid methylester
o5u uridine-5-oxyacetic acid(v)
osyw wybutoxosine
p pseudouridine
q queuosine
s2c 2-thiocytidine
s2t 5-methyl-2-thiouridine
s2u 2-thiouridine
s4u 4-thiouridine
t 5-methyluridine
t6a N-((9-beta-D-ribofuranosylpurine-6-
CA 02547331 2006-05-24
WO 2004/048937 -19- PCT/US2003/038186
yl)carbamoyl)threonine
tm 2'-O-methyl-5-methyluridine '
um 2'-O-methyluridine x 3-(3-amino-3-
carboxypropyl)uridine, (acp 3 )U
yw wybutosine
[061 ] The length of the nucleic acid sequences can vary between about 1 base
of
single stranded DNA up to about 3 thousand bases of double stranded DNA.
Preferably about 18-24 base pair oligonucleotides are used.
[062] Nucleic acids useful according to the present invention can be
synthesized
using methods well known to one skilled in the art. For example, a solid-phase
phosphotriester approach can be used as described in Sproat et al. (Solid-
phase
synthesis of oligodeoxyribonucleotides by the phosphotriester method, in
Oligonucleotide Synthesis - A practical approach (Gait,M.J., Ed.), IRL Press,
Oxford
pp. 83-115, 1984). The concept of the solid-phase phosphotriester approach has
four
basic aspects: the oligonucleotide is synthesized while attached covalently to
a solid
support, excess soluble protected nucleotides and coupling reagent can drive a
reaction near to completion, the reaction is carried out in a single reaction
vessel to
diminish mechanical losses due to solid support manipulation, allowing
synthesis with
minute quantities of starting materials, and the heterogeneous reactions are
standardized. All these procedures are easily automated and several
commercially
available oligonucleotide synthesizers are known to one skilled in the art.
The most
used chemical route for solid-phase oligonucleotide synthesis is the phosphite
triester
method as modified by Beaucage and Caruthers (Beaucage,S.L., and
Caruthers,M.H.
(1981) Deoxynucleoside phosphoramidites- A new class of key intermediates for
deoxypolynucleotide synthesis, Tetrahedron Lett. 22,1859-1862).
[063] Alternatively, nucleic acids can be isolated from libraries comprising
nucleic acid fragments in the form of, for example, plasmids, cosmids, yeast
artificial
chromosomes, and bacterial artificial chromosomes. The nucleic acids can also
be
isolated from any other source such as viruses, and procaryotic or eucaryotic
cells.
Nucleic acid isolation methods are routine and protocols can be found, for
example
from Molecular Cloning: A Laboratory Manual, 3rd Ed., Sambroolc and Russel,
Cold
Spring Harbor Laboratory Press, 2001.
CA 02547331 2006-05-24
WO 2004/048937 -20- PCT/US2003/038186
[064] After isolation, the isolated nucleic acids can be further modified, for
example, by restriction enzyme digestion. Isolated nucleic acids can also be
amplified
using PCR and either random or specific primer sequences. Such primer
sequences
can also be labeled with a fluorophore during the oligonucleotide synthesis.
[065] In one embodiment, the nucleic acids useful in the present invention are
similar to aptamers which can be selected from existing aptamers or from
random
sequence libraries. Aptamers are defined as single-stranded or double-stranded
nucleic acids which are capable of binding proteins or other small molecules
with
high specificity in aqueous solution. In the present invention, the nucleic
acid-based
sensors differ from aptamers in two important respects: 1) the nucleic acids
sensors
are dried onto a substrate and interact directly with compounds in the air,
and 2) the
nucleic acid 'sequences are selected for their capacity to react, in
combination with a
fluorophore, to broad ranges of volatile. compounds. Generally, aptamers are
selected
from a large number of non-interacting.oligonucleotides and they originate
from in
vitro selection experiments termed "SELEX" for systematic evolution of ligands
by
exponential enrichment, that, starting from random sequence libraries,
optimize the
nucleic acids for high-affinity binding to given ligands (C. Tuerk and L.
Gold,
Science 249, 505 (1990); A. D. Ellington and J. W. Szostak, Nature 346, 818
(1990)).
Reviews on in vitro selection and aptamers, see, e.g., G. F. Joyce, Curr.
Opin. Struct.
Biol. 4, 331 (1994); L. Gold, B. Polisky, O. C. Uhlenbeck, M. Yarus, Annu.
Rev.
Biochem. 64, 763 (1995); J. R. Lorsch and J. W. Szostak, Acc. Chem. Res. 29,
103
(1996); T. Pan, Curr. Opin. Chem. Biol. 1, 17 (1997); Y. Li and R. R. Breaker,
Curr.
Opin. Struct. Biol. 9, 31.5 (1999); IVI. Famulok, Curr. Opin. Struct. Biol. 9,
324 (1999).
[066] The length and nucleic acid sequence can be easily modified and thereby
the repertoire of possible sensors is almost infinite raging from preferably
about 1 to
about 3000 bases. The preferred lengths of the sensing nucleic acid sequences
vary
from about 10 to about 2000 bases, from about 10 to about 1000 bases, from
about 10
to about 500, from about 15 to about 400 bases, from about 15 to about 300
bases,
from about 15 to about 200 bases, from about 15 to about 100 bases, from about
15 to
about 30, 40, 50, 60, 70, 80, or 90 bases. In a preferred embodiment, the
nucleic acids
are about 15-24 bases long.
[067] To test the responsiveness of the nucleic acid to an analyte, the
isolated or
synthesized nucleic acids are labeled with a fluorophore. As used herein the
term
CA 02547331 2006-05-24
WO 2004/048937 -21- PCT/US2003/038186
"fluorophore" will be understood to refer to both fluorophores, phosphors and
~~
luminophores, and to chromophores that absorb but do not emit photons.
[068] Fluorophores provide the means for transducing the interaction of the
analytes with the sensor. For example, fluorophores useful according to the
present
invention include, but are not limited to OLIGREEN (Molecular Probes, Inc.,
Eugene,
"" "' OR), and other fluorescent dyes listed in the following Table 2.
Table 2: Examples
of Fluorophores
and Their Excitation
and Emission wave-lenghts.
Fluorescent Dye Excitation, Emission, nm
nm
5-FAM 494 518
AlexaTM 488 495 520
AlexaTM 532 531 554
AlexaTM 546 555 570
AlexaTM 555 555 565
I
AlexaTM 568 ~ 579 604
AlexaTM 594 590 615
AlexaTM 647 649 ' 666
AlexaTM 647 649 666
AlexaTM 660 ~~ 663 ' 690
AlexaTM 660 663 690
Allophycocyanin (APC)650 660
Allophycocyanin (APC)650 660
I I
BODIPY RO 564/570 564 ' 570
BODIPY Q TMR ! 542 ' 574
' BODIPYO 530/550 ' 530 550
BODIPY~ 558/568 ' 558 ' 568
:n
BODIPY~ 630-650 ... _.. .. ........
630 ! 650
BODIPY~ 630-650 630 650
i
Calcein ' 494 ! 517
Calcium CrimsonTM ! 590 ' 615
Calcium GreenTM 506 533
CA 02547331 2006-05-24
WO 2004/048937 -22- PCT/US2003/038186
Calcium OrangeTM ' 549 576
C-Phycocyanin , 620 648
Cy2TM 489 506
Cy3.5TM 581 596
Cy3TM 5'S~ 570
Cy5.5 675 694
Cy5.5 675 694
CySTM 649 670
CySTM .649 670
m~~
DiD DiIC(5) 644 665
I I
, ~..
DiD DiIC(5) 644 ~ 665
N
dsRed 558 ' S83
Ethidium Bromide 518 605
FAM 488 508
FITC 494 518
FluorXTM 494 519
GFP , 488 558
GFP Red Shifted 488 507
(rsGFP)
JOE 522 555
JOE-514 514 549
Magnesium 506 ~ ~ 531
GreenTM
Magnesium 550 575
OrangeTM
Nile Red 549 599
Oregon GreenTM 496 524
488
Oregon GreenTM 503 522
CA 02547331 2006-05-24
WO 2004/048937 -23- PCT/US2003/038186
500 . ,.
PBXL-1 545 ~ ~ 666
i
PBXL-3 614 662
Phycoerythrin, R & 565 575
B
Pyronin Y 555 ~i i 580
Red Reflect 633 633
.:.'._.. "~""
Red Reflect 633 633 '
Rhodamine 110 496 ~ 520
I
~odamine' 123 ... 507 529
Rhodamine B 555 580
Rhodamine GreenTM 502 527
Rhodamine 542 565
Phalloidin
A
Rhodamine RedTM 570 590
RiboGreenTM 500 525
ROX ' S 80 605
R-phycocyanin 6181 -~ , 642
R-Phycoerythrin (R- ' 565 575
PE)
~ FI
, 497'~~ 520
SYBR Green
Sypro Ruby 450 ~~ ~ 610
TAMRA 555~~~ 575
I I
Thiadicarbocyanine ! 651 i 671
Thiadicarbocyanine ' 651 671
TO-PROTM-1 514 533
TO-PROTM-3 642 660
TO-PROTM-3 642 660
YO-PROTM-1 491 509
CA 02547331 2006-05-24
WO 2004/048937 _24_ PCT/US2003/038186
y0-PROTM=3 612 631
YOYOTM-3 , 612 631
[069] Preferred dyes useful according to the present invention include
OLIGREEN or YO-PRO dye (Molecular Probes, Inc., Eugene, OR).
[070] In addition to labeling each oligonucleotide with a single type of
fluorophore, fluorophore/quencher systems can also be used. Typically, these
systems incorporate a fluorophore (e.g., fluorescein) and a quencher (e.g.,
DABCYL)
at the ends of an oligomer sequence that forms a hairpin structure (see, e.g.,
Tyagi, S.
and Kramer, F. R. (1996) Nature Biotech., 14:303-308; Hamaguchi, N.,
Ellington, A.,
and Stantoii, M. (2001) Anal. Biochem., 294:126-131). In this conformation,
the
DABCYL quenches the fluorescein fluorescence through fluorescence resonance
energy transfer (FRET). Upon binding of the oligomer sequence to its target
ligand,
the conformation of the oligomer changes, separating the fluorophore and
quencher.
This separation decreases the FRET between the fluorophore and quencher,
causing a
change in fluorescence at the fluorophore emission wavelength.
[071 ] These energy transfer pairs for fluorophore/quencher systems where both
the donor and acceptor are covalently bound to the same nucleic acid are known
to
one skilled in the art.. Such energy transfer pairs have been used to detect
changes in
oligonucleotide conformation, such as in Tyagi et al. (EP 0 745 690 A2 (1996))
and
Pitner et al. (U.S. Pat. No. 5,691,145 (1997)). They 'also have been used to
detect
cleavage of the oligonucleotide at a point between the donor and acceptor
dyes, such
as in Han et al. (U.S. Pat. No. 5,763,181 (1998)), Nadeau et al. (U.S. Pat.
No.
5,846,726 (1998)), and Wang et al. (ANTIVIRAL CHEMISTRY &
CHEMOTHERAPY 8, 303 (1997)). Energy transfer pairs covalently bound to
oligonucleotides have also been used to provide a shift in the ultimate
emission
wavelength upon excitation of the donor dye, such as by Ju (U.S. Pat. No.
5,804,386
(1998)).
[072] Other fluorophore/quencher systems have been described in the art and
such systems can be used according to the present invention. For example, the
combination of a non-covalently bound nucleic acid stain with a covalently
attached
fluorophore on a single-stranded oligonucleotide hybridization probe has been
used to
detect specific DNA target sequences by monitoring the fluorescence of either
the
CA 02547331 2006-05-24
WO 2004/048937 -25- PCT/US2003/038186
nucleic acid stain or the covalent label, such as described in Lee and Fuerst
(PCT Int.
Appl. WO 99 28,500). Also, US Pat. No. 6,333,327 discloses
fluorophore/quencher
systems for decreasing background fluorescence during amplification assays and
in
ligation assays, and for detecting hybridization. .
[073] The nucleic acid can be labeled with the fluorophore at the 3' region,
5'
region of the nucleic acid, or internally. Additionally, the flurophore can be
applied
dye.
[074] Nucleic acids in the nucleic acid-based sensors of the present invention
are
labeled using techniques known to one skilled in the art. Such methods
include; for
example, mixing the nucleic acids with a dye, end-labeling the nucleic acids
during
oligonucleotide synthesis, or labeling the nucleic acids during a PCR
reaction.
According to the present invention, any method to attach the fluorophore to
the
nucleic acid can be used.
[075] Preferred examples of applying or using dyes to label nucleic acids
include
direct application of dyes, such as for example OLIGREEN and TOTO family of
cyanine diner dyes (Molecular Probes, Inc.), onto the nucleic acids to produce
a
labeled nucleic acid.
[076] Nucleic acids can also be labeled during their synthesis. Reagents are
readily available (e.g., Glen Research, Sterling, VA) for adding fluorescent
dye
molecules to the 3' and 5' ends, as well as labeled dT for inserting the dye
molecule
within the nucleic acid sequence. Use of direct, labeling allows control over
the
precise amount and location of the fluorophore within the nucleic acid
sequence.
Also, a fluorophore may be added at different locations or multiple
fluorophore~ at
several locations in the nucleic acid sequence which allows development of
even
greater variety of sensors.
[077] The sequence and/or structure of the nucleic acid used to construct a
sensor effects the response profile of the sensor. Iy preparing the nucleic
acid-based
sensors, the effect of sequence (and, hence, structure) on the response
properties of
nucleic acid-based sensors is tested. For each sequence tested, the folding
structures)
and melting temperatures) are estimated to determine the effect of a specific
DNA
structure on the analyte responses.
[078] The amount of nucleic acids used in producing the nucleic acid-based
sensor effects the response of the sensor to an analyte. For example, effects
of DNA
quantity were seen in preliminary experiments on the nucleic acid based
sensors (Fig.
CA 02547331 2006-05-24
WO 2004/048937 -26- PCT/US2003/038186
11). Therefore, for each sensor configuration, a range of nucleic acid and dye
concentrations (for applied dyes) are tested for the amount that produces the
desired
result, i.e. a clearly noticeable response to a test analyte.
[079] ~ It is desirable to apply the nucleic acid/fluorophore solution to the
substrate as evenly as possible. For example, an inkjet application system can
be
used. With this system, a piezo-electric incjet ejects 50n1 droplets of
solution, which
are applied to the substrate in precise locations using an XYZ positioning
system.
The inkjet system can be used to apply nucleic acid/fluorophore solutions to
the
sensor substrates.
[080] The substrate used to make the sensor can be fabricated of different
materials, such as, for example, papers, fiberglass, fabrics made of synthetic
materials. However, for the purpose of screening/testing nucleic
acid/fluorophore
combinations for their responsiveness to test analytes, a glass substrate can
be used.
The nucleic acid/fluorophore combination should then be tested on the
substrate that
is intended to be used in the sensor to ensure responsiveness will not be
effected.
[081] Long-term stability of the nucleic acid/fluorophore -based sensor
responses is important for their use in the present invention. Fluorescent
dyes can
photobleach upon repeated exposure to excitation light, and different dyes
photobleach at different rates. The present invention is designed to minimize
photobleaching (by limiting light exposure to brief 1 msec pulses), and the
analyte
recognition algorithms are resistant to changes in signal amplitude. Reducing
any
possible photobleaching, however, will increase the life expectancy of the
sensor.
[082] Dried nucleic acids are stable for loilg periods c~f time which makes it
an
ideal sensor material. However, it is possible that the nucleic acid used in
the analyte
sensors degrades over time thereby altering analyte response. The degradation
is
lilcely to be minimal and can be easily tested. Analyte responses over
'repeated sniffs
are compared to the data from, for example the photobleaching tests described
above.
Any signal decrease that cannot be accounted for by photobleaching will
suggest a
nucleic acid degradation effect. If evidence of nucleic acid degradation is
found,
nucleotide modifications that reduce nuclease degradation can be used to
reduce
degradation as described, e.g., for applications to aptamers (see Jayasena, S.
D.
(1999). Clin.Chem., 45:1628-1650).
[083] The present invention also provides a system for identifying and
selecting
nucleic acid-fluorophore combinations for their capacity to respond to odors
and/or
CA 02547331 2006-05-24
WO 2004/048937 _2~_ PCT/US2003/038186
vapor phase analytes. The method includes exposing the nucleic acids-
fluorophore
complexes to an analyte in a vapor phase and comparing the emission of light
from
the complex before addition to the analyte and during or after exposure to the
analyte,
wherein difference in the emitted light from the fluorophore between the
before and
during or after exposure to the analyte indicates that the nucleic acid-
fluorophore is
capable of responding to the analyte.
[084] For example, a plurality of different nucleic acid-fluorophore complexes
can be applied onto a substrate, such as a glass coverslip, the substrate is
then placed
in the array scanner and scanned to produce the "before" image. While the
chamber is
still in the scanner, an analyte in vapor phase is injected into it using, for
example a
syringe. For example, a syringe can be used to withdraw some of the headspace
vapor. from a container containing a sample analyte. The amount of.analyte can
vary
depending on the size of the chamber and can be as little as about 0.25-0.5 ml
or
about 1, 2, 3, 5, 10, 15 or up to 100 ml. In the preferred embodiment, about
0.5-2.5
ml of vapor analyte is added to the test chamber.
[085] The exposure time may be varied from about 1 second to up to 5, 10, 15,
20, 25, 30, 40 and 50 seconds and further up to several minutes, for example,
1, 2, 3,
4, 5 and up to 10 minutes. Most preferably, the exposure time varies between
about
25 seconds to about 3 minutes. After injection of the test analyte odor to the
chamber
with the substrate, the chamber is scanned again to get the "after" image. If
there is a
difference between the before and after images, in any of the particular
coordinates
with a nucleic acid-fluorophore complex, the complex is considered reactive to
that
particular test analyte in vapor ph ase: The difference between the before and
after
image may be any detectable difference in the intensity of emission light
between the
before and after image. Figure 6 shows an example of a screen for nucleic
acids in a
microarray form, wherein difference of light emission pattern can clearly be
appreciated.
[086] The exposure time and test analyte vapor amount may vary because the
goal of using the chamber and scamler is to find any and all nucleic acid-
fluorophore
spots that respond to the test analytes at all. The main motivations for the
times and
volumes is to make sure all spots are covered by the analyte vapor. In one
embodiment, a 2 ml chamber is used and about volumes of 2 - 10 ml of vapor
analyte
can be injected into the chamber. With high concentration vapor (i.e.,
saturated
CA 02547331 2006-05-24
WO 2004/048937 -2$- PCT/US2003/038186
vapor), smaller volumes may be sufficient. With low concentrations, higher
volumes
are needed to make sure the air in the chamber is sufficiently exchanged.
[087] The gas or vapor phase analyte is preferably injected into the chamber
relatively slowly. For example, for the about 2 ml chamber, the injection
speed is
most preferably about 0.5 - 1 ml/sec.
[088] The present invention further provides nucleic acid/fluorophore -based
array sensor element compositions disposed on substrates which may be either
inert or
active during analyte sampling and detection. While inert supports are
typically used
in conventional sensing devices, the present invention provides for active dye
support
materials that enhance sensor responses to specific analytes by their unique
chemical;
physical, adsorption, or optical characteristics. Different substrate support
materials
may be employed within a single array where specific support materials are
matched
to specific fluorophores, fluoxophore compounds and nucleic acid/fluorophore
mixtures to produce enhanced sensor responses to specific volatile analytes or
odors.
[089] Fibrous substrate supports, which enhance sensor response signals for a
variety of fluorophores and nucleic acid/fluorophore mixtures are preferred
substrate
materials.
[090] An additional advantageous feature of the present invention is in
providing
for removable or interchangeable nucleic acid/fluorophore -based arrays, array
substrates, or substrate supports to facilitate changing sensor arrays to
match specific
analyte sampling and detection requirements. In one embodiment, multiple
layers of
array substrates may be employed for diversification and enhancement of sensor
detection capabilities for identifying both broad and specific classes of
analytes.
[091] One skilled in the art would recognize that it is generally preferred to
position sensor substrates at the appropriate viewing angle and distance from
light
emitting diode excitation light sources and photodiode detectors so as to
provide for
optimum sensor signal generation and detection. In one preferred embodiment, a
separate substrate holder may be provided for positioning and securing array
substrates. In an alternative preferred embodiment, the sample chamber housing
may
be configured for proper positioning and securing array substrate.
[092] As will be appreciated by those in the art, the number of possible
substrate
materials is very large. Possible substrate materials include, but are not
limited to,
sills, glass and modified or functionalized glass, plastics (including
acrylics,
polystyrene and copolymers of styrene and other materials, polypropylene,
CA 02547331 2006-05-24
WO 2004/048937 -29- PCT/US2003/038186
polyethylene, polybutylene, polyurethanes, teflons, etc.), polysaccharides,
nylon or
nitrocellulose, resins, silica or silica-based materials including silicon and
modified
silicon, carbon, metals, inorganic glasses, plastics, and a variety of other
polymers.
[093] ~ In preferred embodiments, optically transparent substrates are
employed to
permit placement of the substrate between LED light sources and photodiode
"" "' detectors as shown in Fig. 10. In alternative embodiments, where the
LEDs and
photodiodes are placed on the same side of the substrate, optically opaque or
optically
absorbing, reflective, and scattering materials may be employed.
[094] Where conventional flat, planar, curved or non-planar solid sensor '
substrates are used, these substrates are generally self supporting and
substrate
supports are not required but may be optionally employed.
[095] While conventional flat, planar, or curved non-planar solid sensor
substrates may be employed, increased sensor surface area can arise from
depositing
dyes on highly convoluted surfaces that include fine fibrous hairs of
different
materials, particulates, porous substrates, or films and substrates suspended
within the
sampling stream. With the innovative substrates of the present invention,
these
preferred substrate embodiments provide enhanced contact and interaction
between
sample target analytes and sensor elements, increased optical response signal
per unit
of sensor geometrical surface area, and increased optical response signal per
unit of
sensor volume.
[096] In preferred embodiments, highly permeable, high surface area, textured,
fibrous or particulate substrates which have substantial open porosity for
unimpeded
transport of vapors and fluids are desired. In preferred embodiments, single
~or muiti~
ply layers of papers, felts, laid, or woven fibrous materials or fabrics are
employed.
In alternative embodiments, loosely packed individual fibrous or particulate
materials
may be employed.
[097] In a most preferred embodiment, fibrous substrate materials are employed
for signal enhancement. Important considerations in selecting fibrous
substrates are
substrate permeability to vapors, high accessible surface area per unit
volume,
response signal enhancement for specific analytes, how the substrate interacts
with the
sample flow to provide open access of its external and internal surfaces to
analytes for
interaction with the sensing material. While particularly useful fiber
substrates are
porous, lightweight paper or tissue products, for example KimwipeTM (Kimberly-
Clarlc Corp., Roswell, GA), lens papers, facial tissues, and products made
from
CA 02547331 2006-05-24
WO 2004/048937 -30- PCT/US2003/038186
cotton, rayon, glass, and nitrocellulose fibers, other fibrous materials
employing
natural or synthetic fibers such as felt, batting, textiles, woven fabrics,
yarns, threads,
string, rope, papers, and.laminates or composites of such materials would be
equally
suitable as long as they possess the requisite fluid permeability, surface
area, surface
area to voluW a ratio, and open porosity for free transport of vapor and fluid
analytes.
[098] Particularly useful inorganic fibers and fibrous material compositions
are
natural and synthetic fibers made from glass, ceramic, metal, quartz, silica,
silicon,
silicate, silicide, silicon carbide, silicon nitride, alumina, aluminate,
aluminide,
carbon, graphite, boron, borate, boride, and boron nitride. Particularly
useful natural
or synthetic fibers and fibrous material compositions are polymer fibers made
from
aromatic polyamides, nylons, polyarylonitrile, polyesters, olefins, acrylics,
cellulose,
acetates, anidex, aramids, azlon, alatoesters, lyocell, spandex, melamines,
modacrylic,
nitrite, polybenzinidazole, polyproplylene, rayons, lyorell; sarans, vinyon,
triacetate,
vinyl, rayon, carbon pitch, epoxies, silicones, sot gels, polyphenylene-
benzobis-
ozazole, polyphenylene sulfides, polytetrafluoroethylene, teflon, and low
density or
high density polyethylene. In one preferred embodiment, fiber materials that
are
highly absorbent and have good dye retention characteristics, for example the
cellulosic fiber known as Lyorell, may be employed.
[099] In alternative embodiments, fibers may be coated with either chemical
sizing, polymer, ceramic or metallic materials. Chemical sizing such as
modified
polyvinyl acetates, organosilanes, coupling agents, anti-static agents and
lubricants
may be employed as appropriate.
[0100] With respect to signal enhancing sensor substrat~J rsope~-ties of the
present
invention, one skilled in the art would generally recognize and understand the
intended meaning of the term "textured" referring to material surfaces which
typically
have a distribution of surface topographical features, such as high points
(peaks) and
low points (valleys), ranging from about 100 nm to about 1000 ~.m RMS. The
tern
"high permeability" generally refers to materials and material structures with
a high
open porosity that provide essentially free, unimpeded access and convective
or
diffusive transport to low viscosity fluids, the term "high surface area"
generally
referring to materials that have a surface area of at least 1 Mz/g and
typically refers to
surface areas ranging between 2 to 500 MZ/g. The term "high surface area to
volume"
generally refers to materials having a surface area to volume ratio of at
least 1M2/cm3,
CA 02547331 2006-05-24
WO 2004/048937 -31- PCT/US2003/038186
and typically refers to surface area to volume rations ranging between 2 to
1000
1M2/cm3. The terms "porous" or "porosity" generally referring to materials
having a
distribution of pore sizes ranging from l001n11 to 1000 Vim, and the term
"high open
porosity" generally referring to materials whose pore distributions
substantially
comprise open pores.
"' "' [O1 O1 ] In alternative embodiments, the sensor substrates of the
present invention
may be chemically or physically modified to enhance surface area, absorption,
adhesion, hydrophobicity, hydrophilicity, repulsion, discrimination or
specificity. In
some embodiments, the substrate may be chemically altered to provide chemical
functionality for interaction with analytes, such as providing for enhanced
affinity,
enhanced repulsion, or steric impediments to analyte adsorption.
[0102], In a preferred embodiment, the sensors are made on a substrate of acid-
washed silkscreen, preferably l6xx and sized about 10 mm x 12 mm. The nucleic
acid/fluorophore mixture is pipetted onto a silkscreen, preferably about 5-50
~1 of
nucleic acid/fluorophore mixture is used, and allowed to air dry for about 10-
60
minutes, preferably about 20-30 minutes, most preferably about 25 minutes.
Each
sensor is rinsed in 70% ethanol for about 5 minutes, allowed to air dry, then
attached
to supports on, for example, glass coverslips.
[0103] The nucleic acid/fluorophore -based sensor and sensing system of the
present invention provides for a rapidly responding, relatively inexpensive,
dynamically configurable, intelligent, portable sampling device.
[0104] One preferred detection devise useful with the nucleic acid-
fluorophore.
sensors of the present system is described in detail in the issued U.S. Patent
No.
6,649,416, which is herein incorporated by reference in its entirety.
[0105] The device delivers analytes (odors) in a controlled, pulsatile manner
(sniff) to nucleic acid/fluorophore -based sensor array and detector array
system that
generates signals, for example, analog electrical signals. The number of
sensors,
detectors, and sampling time points can be made larger or smaller depending on
the
classes of analytes that are being targeted for detection. Analog signals, for
example,
are amplified and filtered by a pre-amplifier/amplifier module and digitized
by an
analog/digital conversion module for storage in a computer memory module. All
attributes of the sensing process, including odor delivery, sampling,
analysis,
detection and identification are under programmable software control via a
computer.
CA 02547331 2006-05-24
WO 2004/048937 -32- PCT/US2003/038186
[0106] The sensing device housing the nucleic acid/fluorophore based array is
easily trained to recognize specific analytes. Training consists of delivering
a known
set of analytes, for example DNT and other nitroaromatic compounds for
detection of
explosives, to the device, one analyte at a time, and storing matrices of
values that are
spatio-temporal signatures of each analyte in memory. When an unknown analyte
is
to be sampled after training, it is delivered to the device and a matrix of
values
acquired from the unknown is compared to matrix templates for the variety of
analytes stored in memory during the training phase. The best match between
the .
unknown and the library of stored matrices is then determined using a number
of
different algorithms. In one embodiment, the algorithm looks for the best
match after
calculating the sum of the squared differences between each point in the
stored and
unknown matrices. In a prefeiTed embodiment, the rising phase of each sensor
signal
is fit by an exponential function containing two parameters describing the
signal
amplitude and rate of change. A matrix of these parameters is then used to
represent
the sensor array response, and matches are calculated as above using sum of
squared
differences.
[0107] The sensing system provides output results in a variety formats
including,
but not limited to screen displays, plots, printouts, database files, and
recorded or
synthesized voice messages.
[Ol 08] The sensing device of the present invention comprises a sampling
chamber
housing an analyte delivery system and a mufti-channel array comprising light
emitting diodes (LEDs) focused through an array of excitation filters onto
individual
sensor eleme:~ts of a sensor array. An array of photodiodes, filtered with an
array of
emission filters, detects emitted light energy produced by illuminating the
sensor
elements with LED excitation light during interaction with analytes that are
drawn
into the sample chamber by the analyte delivery system. The ambient
temperature,
humidity, and particulate levels in the sample chamber may be controlled for
improved reproducibility in sampling under a variety of environmental
conditions.
[0109] The sensing device generally provides the basic function comprising
analyte delivery and control (i.e. manipulation of spatial and temporal
distributions;
control over temperature, humidity, and duty cycle), detection by a sensor
array and
transduction of sensor signals into a manipulatable format, analysis of
transduction
output events, and dynamic feedback control over analyte delivery, detection
and
CA 02547331 2006-05-24
WO 2004/048937 -33- PCT/US2003/038186
analysis for intelligent sampling and detection and optimization of nucleic
acid/fluorophore -based sensor sensitivity and analyte discrimination.
[Ol 10,] Fig. 9 provides a schematic block diagram showing the general modular
design acid configuration of the preferred nucleic acid/fluorophore based
sensor array
and sensing system components. A detailed schematic of an exemplary sensor
array
'" "' configuration showing LEDs, excitation filters, sensor elements,
(nucleic
acid/fluorophore) sensor array substrates, emission filters, and photodiodes
is
provided in Fig. 1B.
[0l 11 ] In a preferred embodiment, the analyte delivery system provides
feedback
control over sample temperature, humidity, flow-rate, and the rise and fall
times.,
duration, and frequency of analyte delivery.
[Ol 12], Generally, the sensing chamber includes: a) a means for controlling
temperature, humidity, air flowrate, rise and fall times and frequency of the
applied
vapor pulses; b) a means for controlling the surface properties of the sensing
and non-
sensing areas of the chamber (liquid, mucus, or gel lining) in order to impart
chromatographic surfaces to the sensing area and/or humidify, dehumidify, or
distribute the analyte to the sensory surface, or to optimize response of the
sensing
chemistry; c) a means for aerodynamic control over chamber shape which may
either
be held constant for the duration of analyte delivery or modulated by feedback
control
during analyte delivery; and d) a means for active, dynamic feedback control
over
shape, duration, air flowrate, temporal envelope, and frequency of analyte
sampling
(sniffing). Such feedback may be derived from examining the spatio-temporal
respor_se patterns from the sensor array produced by prior analyte sampling.
[0113] The sensing chamber can be optimized for its aerodynamic properties by
placing the detectors in cavities of various shapes. In one embodiment, the
sensors '
may be placed at a bend in the flow path. In an alternative embodiment; the
sensors
may be located on the side of the straight flow path.
[Ol 14] The present invention provides the sensing elements that are composed
of
nucleic acid/fluorophore mixtures applied to removable sensor substrates. In
one
embodiment, thin films of nucleic acid/fluorophore mixture are deposited on a
flat
sills, plastic or glass substrate. In preferred embodiments, a nucleic
acid/fluorophore
mixture is deposited directly onto fibrous support made from silk, natural or
synthetic
cellulose, polymers, glasses, ceramics, metallic, or other materials using an
ink jet
printer. The use of fibrous dye substrates dramatically increases the
magnitude of the
CA 02547331 2006-05-24
WO 2004/048937 -34- PCT/US2003/038186
response signals, which improves analyte detection and discrimination of the
device.
In an alternative embodiment, thin nucleic acid/fluorophore films can be
suspended
freely across a perforated removable solid support which is placed in the
center of the
air flow stream, thereby exposing both sides of the nucleic acid sensor to
volatile
compound analyte.
[Ol 15] The sensing device according to the present invention uses
interchangeable, removable sensors or sensor elements comprising a support
wherein
nucleic acid/fluorophore complexes are attached. Easily removable sensors
facilitate
rapidly changing sensing sites for improving the sensitivity and optimizing
discrimination for specific analytes in a variety of sampling applications.
This feature
further provides for rapid screening of different nucleic acid/fluorophore
mixtures for
evaluating new nucleic acid sequences and or structures or different
fluorophores for
use in sensors and also for evaluating analytical detection algorithms.
[Ol 16] The size, thickness and surface area of sensor element sites may be
modified to optimize sensitivity and discrimination and to efficiently couple
sensor
elements to light sources and detectors. Generally, a larger sensor geometric
area and
a close matching of the sensor element geometric area with photodetector area
will
provide better sensitivity.
[Ol 17] The cross-reactive sensor array of the present invention may comprise
either narrow or broadly responsive sensor elements. The number of sensor
array
elements can be configured for specific sampling application requirements.
Specific
sensors for defined analytical tasks can be chosen from among the many
possible
sensing element sites present in the array. Sensor and aiTay confguraiio:r~~
ma;~ be
modified through the addition of LED-sensor-photodiode-filter channels
depending
on the requirements of a particular analyte discrimination task.
[0118] In one preferred embodiment, multiple sensor arrays and array
substrates
may be deployed in the sampling chamber. Such multiple arrays may comprise a
series of hierarchically organized sensor arrays such that the first
interaction and
sampling of the analyte is with a Broadly responsive sensor array and,
subsequently,
the analyte sample is automatically diverted for additional sniffs, on the
basis of
analytical information fed back from the computer, to specific second order
arrays
designed to detect and identify the specific type of analyte. Thus, a
plurality of
sensing arrays may be arranged hierarchically so that ever finer
discriminations can
talee place successively along the pathway. Additionally, the longevity of
sensors can
CA 02547331 2006-05-24
WO 2004/048937 -3~- PCT/US2003/038186
be extended by redundant arrays that are protected from exposure until needed,
by
delivery of analytes as short pulses, and by reducing light exposure~by
rapidly pulsing
LEDs. To further reduce light exposure, low light excitation levels can be
used if
high sensitivity photodetectors such as avalanche photodiodes are employed.
Rapid
short pulsing of analytes prevents sensing surfaces from saturating, thereby
improving
"'' "' sensor recovery following analyte exposure.
[Ol 19] For enhanced, smart mode operation, the number of array sensors used
in
sampling or detecting an analyte may be modified, in real-time during either
actual
sampling or post-sampling data analysis using "on-the-fly" intelligent
feedback '
control. ~By way of example, if a specific sensor is unresponsive to a
particular
analyte sample, the corresponding sensing channel may be automatically removed
from consideration by a smart sampling or analysis algorithm which provides
feedback control to the microcontroller. In addition, the weighting of
individual
sensors in the analysis and detection algorithm may be adjusted based on the
signal
contribution of individual sensors. Given that individual sensors have
different
breadths and peaks of response, sensor weighting will vary for different
analytes.
[0120] In one preferred embodiment a 16 or 32 channel sensor array is
employed.
For example, it is anticipated that an optimized array of thirty-two sensor
elements
should have the capability of detecting and discriminating at least 1000
different
analyte types. Because the nucleic acid/fluorophore -based sensor materials
employed provide almost infinite diversity in their variety and therefore
their analyte
detection capability and can be selected to have appropriately broad spectra
of
response, different optimized sensor arrays can be selectee~ for particular
analyte
detection tasks.
[0121] Typically, epi-illuminating optics are employed in conventional '
fluorescence sensing systems. Epi-illuminating optics require relatively
complex
dichroic mirror arrangements for each channel where a different excitation and
emission wavelength is used. Thus, in the epi-illumination format an
excitation filter,
a dichroic mirror, and an emission filter are required for each wavelength.
The
sensing system of the present invention employs a trans-illumination
configuration
where only excitation and emission filters are needed. Since the epi-
illumination
mode typically requires critical optical component alignment and is sensitive
to
vibration and movement, the trans-illumination mode of the present invention
is
CA 02547331 2006-05-24
WO 2004/048937 -3(- PCT/US2003/038186
advantageous for robust, compact, portable sensing devices for field sampling
of
ambient environments.
[0122] A schematic diagram of the optical detection system of the present
invention is provided in the block diagram of Fig. 9. Fig. 1 B provides a
cross-
sectional view of the sampling chamber that schematically shows the
configuration
and relative orientation of individual LED-photodiodes-optical filters-sensor
sets
within the sampling chamber housing. For simplicity; the cross-sectional view
in Fig.
1B shows only two sensing chamiels, comprising two LED-photodiode-filter-
sensor
channel pairings. Fig. lA shows a view of a sixteen sensor array
configuration. It is
important to note that the partial array configurations shown in Figs. lA and
1B are '
merely used to demonstrate, by way of example, the relative orientation and
positioning of the sensors, filters, photodiodes and LEDs in the sampling
chamber and
are not intended to indicate any limitation in the size of sensor arrays that
may be
employed in the present invention. The actual sensing device of the present
invention
may employ larger or smaller arrays and any number of sensing channels with
corresponding LED-photodiode-filter-sensor sets. For example, in one preferred
embodiment, 32 LED-photodiode-optical filters-sensor channel sets are
employed.
The number of sensor array channels may be increased or decreased depending on
specific sampling applications and analyte discrimination requirements.
[0123] An example of the configuration and relative orientation of LEDs,
photodiodes, excitation filters and emission filters, sensors and sensor array
substrate
is shown schematically in Fig. 10. While an eight sensor-LED-photodiode-filter
module is shown in Fig: 10 by way of example, larger and smaller modules and
arrays
may be constructed based on specific sampling and detection needs. For
example, in
one embodiment, a 32 element sensor array may be assembled from four modules
aligned side-by-side with eight sensors in each module. As shown in Fig. 10, a
plurality of LEDs are mounted on black plastic support by drilling two columns
of
four 3 mm holes in a 2 x 4 array configuration. The LEDs are press fit into
the
mounting holes and may be readily removed for replacement. A photodiode
support
with the same dimensions is used for mounting a plurality of eight photodiodes
in a 2
x 4 array configuration. Both the LED and photodiode arrays are mounted in
columns
with pair row spacing of about 6mm center to center and interpair spacings of
8mm
center to center. Column spacing for both the LED array and photodiode array
is
1 Smm center to center.
CA 02547331 2006-05-24
WO 2004/048937 -3~- PCT/US2003/038186
[0124] As shown in Fig. 10, 12.5 rinn diameter excitation filters are mounted
on
an approximately 30mm x 30mm x 6mm excitation filter support formed by
drilling
four 12.5 mm holes in a black plastic support plate to accommodate the filters
in a
2x2 array configuration. Other filter assembly configurations, containing a
larger.or
smaller filter array with larger or smaller filters may be employed in other
embodiments. A similar emission filter support with the same dimensions as the
excitation filter support is fabricated for mounting four emission filters.
The emission
filters and excitation filters are mounted to their respective supports with
conventional set screws. The resulting excitation filter support assembly is
attached
directly to the front face of the LED support assembly and the emission filter
support
assembly is attached directly to the front face of the photodiode support
assembly
with conventional mounting screws.
[0125] A plurality of nucleic acid~based sensor elements are applied either
directly to a transparent sensor array substrate, for example a glass
coverslip, as
coatings or droplets. Alternatively, where porous or fibrous sensing elements
are
employed, these may be attached, for example, taped, glued, or clamped, to a
transparent sensor array substrate, or suspended over openings or perforations
in an
array support which may be either transparent or opaque. Removable,
interchangeable sensor army substrates, or array support substrates, can be
mounted
flush with the front face of the emission filter support using a substrate
support
holder. The substrate support holder is formed by attaching, for example by
gluing, a
shaped, preferably U-shaped substrate support frame and a shaped substrate
support
facing to the fron; fact of the emission filter support. The sensor array
substrates, or
array support substrates, are, for example mounted in a slot or channel formed
by the
substrate support frame, support facing and front face of the filter support.
The
substrate support assembly provides for rapid removal and replacement of the
interchangeable array substrates. or array support substrates.
[0126] The sensor array may comprise either a single sensor array module, as
shown in Fig. 10, or a plurality of sensor modules aligned edge-to-edge to
form a
mufti-module array containing a large number of sensor elements. The bottom
edge
of both the LED-excitation filter module support assembly and the photodiode-
emission filter-sensor module support assembly are secured to a chamber
support
plate with conventional mounting screws. In this configuration, the excitation
filter
side of the LED assembly faces the sensor array side of the photodiode
assembly.
CA 02547331 2006-05-24
WO 2004/048937 -3~- PCT/US2003/038186
The LED and photodiode modules, or plurality of modules, are preferably
aligned
parallel to one another with spacing between the two modules adjusted to
optimize
illumination of the sensor array elements by the LED array. In one preferred
embodiment shown in Fig. 10; this spacing is approximately 5 mm. In one
preferred
embodiment, a 32 sensor array is formed by mounting four eight sensor modules
to
the chamber support plate. Other configurations using larger or smaller sensor
modules and a fewer or greater number of modules may be employed to
accommodate smaller or larger arrays by adjusting the size of the LED,
photodiode,
filter and sensor supports and chamber support plate and adjusting the spacing
between opposing LED and photodiode modules to optimize illumination of sensor
array elements by the LED array.
[0127] Commercially available, optical bandpass excitation filters for LED
light
sources and emission filters for photodiode detectors were obtained from
Andover
Corp. (Salem, NH) and Coherent Inc. (Santa Clara, CA). While these filters are
available in'/a to 1 %2 inch sizes, '/2 inch filters were used in the
preferred embodiment.
By way of example, Fig. 10 shows schematically the relative orientation,
configuration and spacing of excitation and emission filters for an embodiment
which
employs 32 sensors and sensing channels. For simplicity, Fig. 10 shows only
one of
four eight-sensor modules employed in a 32 channel sensor array. In this
embodiment, with four sensor modules, 16 excitation filters are arranged in a
2x 8
array with a center to center distance of 15 mm. With this embodiment, each
emission filter covers a pair of two adjacent photodiodes having a 6 mm center
to
center spacing. In this particular embodiment, the 32 sensor elements in the
array
were aligned with the center of the LED-photodiode pair sight line. Other
embodiments are envisioned where each sensor chaimel has its own individual
excitation and emission filter or where more than two sensor channels share
each
excitation and emission filter. For example, for YO-PRO and Oligreen dyes, an
excitation filter of 450 nm with a 40 nm bandwidth, and emission filters with
550 nm
with a 70 nm bandwidth can be used (Coherent Inc., Santa Clara, CA). Dyes such
as
BOBO-3 and Cy3(tm) require longer wave lengths which one slcilled in the art
is
capable of selecting.
[0128] Illumination of sensor elements with excitation light energy may be
accomplished with any appropriate light source. Thus, filtered light emitting
diodes
(LEDs), solid-state lasers, or incandescent light sources of the appropriate
CA 02547331 2006-05-24
WO 2004/048937 -39- PCT/US2003/038186
wavelengths for the dye indicators being used may be employed. In a preferred
embodiment, each LED light is passed through an excitation filter matched to a
speczfic sensor element dye excitation wavelength. Where excitation filters
are
employed, broad-band ("white") LEDs with appropriate, wavelength filters may
be .
used.
"' "' [0129] Unlike other sensors, by providing individually filtered sensing
channels,
the present invention enables simultaneous sampling at multiple excitation
wavelengths and multiple emission wavelengths with different sensor elements.
The.
present invention uniquely provides for individual control over the amplitude,
'
duration, and duty cycle of illumination for each sensing channel in the
array. Control
over noise is exerted by feedback. Control over response to ambient light and
optimization of signal detection, including reduction of fluorescent dye
bleaching, is
accomplished by switching and modulating LED output and coordinate amplifier
detection at various frequencies, ranging from kilohertz to megahertz. Control
over
ambient light interference may be achieved by phase locked LED flashing and
photodiode detection.
[0130] In the present invention, nucleic acid-based sensor elements are
illuminated directly by focused, light emitting diodes (LEDs) of the correct
wavelength for each sensor dye material. Other advantages achieved from using
LED
excitation light sources are low power requirements, cooler operating
temperatures,
and high light output over small area. Additionally, by employing LED light
sources
for each sensor channel, each LED chamlel can be rapidly and independently
switched electrically without use of a mechanical shutier. The LED chamlels
can be
individually modulated electrically at high rates by feedback from the
microcontroller. In addition, the LED channels can be individually filtered
for '
presenting different excitation wavelengths in parallel, thereby avoiding
serially and
mechanically switching filters during array measurements.
[Ol 31 ] Examples of LEDs useful according to the present invention for the
nucleic acid.based sensors include, but are not limited to Hosfelt #25-365,
Ultra
Bright Blue LED, rated at about 466 mn. Other LEDs useful according to the
present
invention can be selected according to wavelengths appropriate for each and
every
fluorescent molecule that can be attached to the nucleic acids as shown in the
Table
above.
CA 02547331 2006-05-24
WO 2004/048937 -4Q- PCT/US2003/038186
[0132] The LED's are turned on and off under computer control. Since these
devices can respond at high speeds, up to megahertz frequencies, they are
typically
flashed at kilohertz frequencies in order to reduce bleaching. Such switching
speeds
cannot be achieved using mechanical shutters. The rapid switching capacities
of
LED's are utilized to flash them on and off in order to reduce sensor
bleaching during
data acquisition, thereby reducing total light exposure by shortened duty
cycle during
sample sniffs. LEDs are rapidly flickered so that light is only on during the
time
when data are being taken and then turned off between data points and between
trials.
[0133] While a variety of photodetectors such as photomultiplier tubes (PMTS),
charge-coupled display device (CCD) detectors, photovoltaic devices,
phototransistors, and photodiodes may be used for detecting sensor response
signals,
in a preferred embodiment, filtered photodiode. detectors are employed. In
another
preferred embodiment, highly sensitive. avalanche photodiodes may be employed.
Photodiode detectors have distinct advantages compared to conventional CCD
camera
detectors since they enable independent control and modulation of individual
channel
optical filtering, current/voltage conversion, signal amplification, and
temporal
filtering. Othenspecific advantages are low power consumption, relatively
simple
electronic circuitry, high sensitivity, configurability, multiple array
formats (e.g.
circular, square, or linear arrays), fast high frequency response at megahertz
frequencies, low noise, wide dynamic range, and use with low frequency
circuits.
[0134] In the nucleic acid-based sensing device of the present invention, an
array
of filtered photodiodes is employed where each filtered photodiode is either
aligned
with one filtered LED or, alternatively,,~,~oups of filtered photodiodes may
be
illuminated by a single filtered LED. The individual photodiodes are each
aligned
with an individual sensor element site with an optical emission f lter that is
appropriate for the specific dye employed by the individual sensor. Different
emission filters may be used for each photodiode or, alternatively, one
emission filter
may be shared by multiple photodiodes. Photodiode signal noise is controlled
by
feedback. Additionally, feedback control is exerted over the signal sampling
duration
and time course. Differential signal inputs may be employed with a separate
control
sensor and individual sampling sensors. In one preferred embodiment, highly
sensitive avalanche photodiodes may be used to permit lower required LED
intensity
for sensor excitation thereby reducing sensor photobleaching.
CA 02547331 2006-05-24
WO 2004/048937 -41- PCT/US2003/038186
[0135] In one embodiment commercially available EG&G VTP 1232 photodiodes
(EG&G, Inc, Gaithersburg, MD) and 12.5 mm emission filters (Andover Corp.,
Salem, NH and Coherent Inc., Santa G~lara, CA) were used. In a preferred
embodiment, large area photodiodes (Hamamatsu part no. 52387-66R) are used.
Specific emission filters used in conjunction with the photodiode detectors
are
"' "' discussed above.
[0136] While sensors may share the same LED, photodiode and
excitation/emission filters, in alternative embodiments, separate LED,
photodiode,
sensor, and excitation/emission filters may be employed for each of sensor
element
and sensing channel. In one embodiment, individual sensor elements and sensing
channels may employ different sensing materials, different excitation
wavelengths,
and/or different emission wavelengths simultaneously. One skilled in the art
may
increase or decrease both the size of the sensor array and number of sensing
channels,
following the teachings disclosed herein.
[0137] In one embodiment, all LEDs are powered by a single constant voltage
circuit. The changes in fluorescence as a result of the odor interacting with
the
sensing material is detected by a photodiode and current to voltage (I/V)
converter
originally designed by Warner Instruments (Hamden, CT) and now commercially
available from Red Shirt hnaging Inc. (Fairfield, CT). There is one I/V
converter and
amplifier/ftlter for each detector channel. The unique feature of this
converter/amplifier configuration is that when the LEDs are activated prior to
sample
delivery, the background fluorescence signal produced by the sensor elements
may be
offset by resetting the amplifiers to a baseline value so that a full range of
high gain
amplification may be used to observe small changes in the signals generated by
analytes during sampling. In addition, the amplifier board~has the option for
software
control to be exerted over the gain and the filter time constants for all the
chamiels. .
Photodiode output is digitized using a 12 bit A/D converter. In a preferred
embodiment, each LED is powered independently by its own constant current
circuitry. The output current of each photodiode is converted to voltage and
digitized
to 20 bits using an integrating preamp/AD converter IC manufactured by Burr-
Brown
(DDC112). The DDC112's provide separate gain control for each sensor channel.
Circuitry containing two programmable logic devices (PLD; Xilinx part no.
XC95108-15PC84C) generates the high speed timing control signals for the 16
DDC112 chips.
CA 02547331 2006-05-24
WO 2004/048937 -4~- PCT/US2003/038186
[0138] Thus, in addition to being able to manipulate the onset and duration of
the
illumination and of the sniff as described above, the time constants and gain
of the
amplifiers can also be controlled in real time during data acquisition. These
hardware
features offer distinct advantages for optimizing the response of the sensing
device for
detection, discrimination and identification of analytes or odors of interest.
[0139] Generally, the nucleic acid/fluorophore -based sensing system of the
present invention analyzes spatial-temporal patterns of data output from
nucleic acid-
based sensor arrays in order to characterize and identify the delivered sample
or its
analyte components. Useable information from the sensing array is obtained
from the
pattern of sensor response activity generated by all sensor elements over time
and is '
evaluated using statistical measures such as information theory. Pattern
recognition
algorithms including template comparison, neural networks, principal
components
analysis, etc. may be implemented either in conventional digital CPUs, in
neuronal
network simulator chips, or in analogue neuronal network computers.
Additionally,
algorithms based on biologically based neuronal connections from the olfactory
system and other neuronal circuits in the brain may be employed.
[0140] The analytical circuits of the present sensing device provide the
requisite
hardware support for the detection, discrimination and identification
capability of the
sensing system.
[0141] The present invention uses temporal control over stimulus presentation
and
the examination of the resulting changes in sensor output over time. Unlike
other
designs, with the present invention analyte presentation to the sensing sites
is carried
out by negative pressure 'sniffing', rather than by positive pressure pulsing
which
requires samples to be enclosed in confined containers. Additionally, the
present
invention uses sniffing parameters that can be electronically modulated by
feedback
from via computer control and flow rate, sniff duration, and temporal profile
can be
adjusted and modulated for specific sampling enviromnents and target analytes
to
detect ambient odors drawn into the sensing chamber. Sampling modulations can
be
carried out in real time so that subsequent sniffs can be modified by the
preceding
ones. With the smart sampling mode capability of the present invention, a
computer
turns the sniff on and off and can modulate and control sniff parameters
during
sampling.
CA 02547331 2006-05-24
WO 2004/048937 -43- PCT/US2003/038186
[0142] Target samples of known analytes (odors), either pure compounds or
complex mixtures, are required for training the sensing device and identifying
unknown analytes in sampled fluids.
[0143] ~ For all training runs, initially a clean air test sniff is first
taken by initiating
the automated sampling sequence which provides for turning on the LEDs, taking
"" ", digitized data from the photodiodes, measuring background fluorescence
and storing
this in memory, turning on the sniff pump, turning off the pump, terminating
data
acquisition, and turning off the LEDs. The device is then trained for target
analytes
by placing the target analyte sample container into position and initiating
the '
automated sampling sequence. The sequence of sampling and data acquisition
events
for target analytes is the same as for the air baseline sample. This training
sequence is
repeated for each target analyte of interest and response data are stored in
the
microcontroller computer RAM memory module.
[0144] After analyte presentation and data acquisition using a device, such as
a
device described in the U.S. Patent No. 6,649,416, evaluation circuits and
algorithms
characterize the spatio-temporal response data of the array either via pattern
recognition algorithms, template matching, a neural network, statistical
analysis, or
other analytical methods known to be useful for data analysis from multiple
points.
Results may be displayed'on screen, spoken by voice synthesis, or plotted as a
three-
dimensional response surface of fluorescence changes from each sensor at each
time
point during sampling. If sensing device is on robotic vehicle, results are
processed
for feedback control and decision is made to stay on course or execute' an
appropriate
maneuver.
[0145] Optionally, where multiple samples or complex mixtures containing
multiple analytes are being sampled, with data sampling and acquisition
modifications
based on intelligent feedback via smart algoritlnns. Thus, real-time, on-the-
fly
feedback can dynamically modulate either LED, photodiode, or sniffing hardware
settings, or alternatively, analyte sampling parameters such as, sample
duration, rise
time, relaxation time, delay from previous sniff, amplifier gain and time
constants
may be modified. These modifications may be imposed on the next data
acquisition
within the same sampling trial until detection and identification of the
analyte occurs.
[0146] The software program explicitly controls the pre-bleaching phase, the
duration for which the LED's illuminate the sensors, the onset of data
acquisition, the
application of the analyte, the duration of analyte presentation, the
cessation of
CA 02547331 2006-05-24
WO 2004/048937 -44- PCT/US2003/038186
analyte application, the duration of the integration time for each data point,
the
number of time points, and the interval between time points. All of these
parameters
can be modulated either by direct operator intervention or, alternatively, by
programming the microprocessor with smart algorithms that modify the sampling,
data acquisition, or analysis steps through real-time feedback control.
[0147] The data are filtered, smoothed, statistically evaluated, compared with
libraries of stored templates for odor identification, and/or operated on by
any of the
algorithms discussed below. The data are typically stored in memory as an
array of
numbers representing the temporal changes in fluorescence in each sensing
channel.
Detection Methods and Algorithms
A. Evaluation of Synchrony, Response Signals and
Noise Characteristics
[0148] To improve the detection and discrimination capability of the sensor of
the
present invention, additional algorithms may be employed to evaluate
"synchrony" of
response data across different sensor elements to identify small response
signals and
reject noise. Evaluation of "synchrony" refers to analyzing how signals coming
from
identical sensors are similar in the context of when they occur during the
sniff cycle.
The field that encompasses analytical algorithms is very large and many
analytical
approaches are available. Due to the features of the present invention, such
as the use
of multiple detector channels with different wavelengths, use of single or
multi-pulsed
analyte presentation, and the ability to acquire data from sensor elements in
parallel
rather than serially, the design~of the present invention enables
consideration' of a
number of alternative algoritluns beyond those that are conventionally used in
artificial noses. Additionally, in preferred embodiments algorithms which are
based
on biological circuits may be employed (see J. White, et al., Biol. Cybern.
78:245-
251(1998); J. White, et al., Anal. Chem. 68(13):2191-2202 (1996), which
publications
are incorporated herein by reference in their entirety). The device of the
present
invention may employ synchronously occurring signals in some embodiments since
sensor response data are acquired simultaneously in parallel.
CA 02547331 2006-05-24
WO 2004/048937 _45_ PCT/US2003/038186
Detection Algorithms
[0149] The degree to which the response matrix of a test substance corresponds
to
one of the target analyte library matrices stored during the sensor training
phase can
be evaluated in a number of ways.
[0150] In one preferred embodiment, the rising phase of each sensor signal is
fit
by an exponential function containing two parameters describing the signal
amplitude
and rate of change. A matrix of these parameters is then used to represent the
sensor
array response. Matches are determined from the sum of the squared differences
between each parameter in the test matrix and the training matrix. The
smallest 'sum
is. used to identify the best target analyte match.
[0151 ] In an alternative preferred embodiment, a supervised, for example back
propagation, neural network approach may be employed. Examples of these
methods
are provided in J. White, et al. "Rapid Analyte Recognition In A Device Based
On
Optical Sensors And The Olfactory System", Anal. Chem. 68(13):2191-2202 (1996)
and S. R. Johnson, et al., "Identification Of Multiple Analytes Using An
Optical
Sensor Array And Pattern Recognition Neural Networks", Anal. Chem. 69(22):4641-
4648(1997).
[0152] In another preferred embodiment, analytical circuits based on the
olfactory
system may be employed ~s disclosed by J. White, et al., "An Olfactory
Neuronal
Network For Vapor Recognition In An Artificial Nose", Biol. Cybern. 78:245-
251 ( 1998).
[0153] In another preferred embodiment, unsupervised neural networks may be
used. Principle component analysis and multidimensional scaling are, in
effect,
unsupervised statistical methods for reducing dimensionality. Generally,
unsupervised neural networks organize high dimensional input data into lower
dimensional representations. For example, assuming one embodiment of the
present
device with 32 sensors and 20 time points, a total of 640 data points may be
collected.
In this embodiment, each analyte presentation can thus be thought of as a
point in
640-dimension space, which, while difficult to visualize, may be
mathematically .
manipulated. By averaging across sensors and time, the data dimensionality may
be
reduced, but typically data dimensionality above about four dimensions is
rather
difficult to visualize.
[0154] Self organizing maps (SOMs) are unsupervised neural networks that
reduce data dimensionality. Such SOM methods are attractive for representing
CA 02547331 2006-05-24
WO 2004/048937 _4(_ PCT/US2003/038186
artificial olfactory system data because they give a visualization of "odor
space". In.
other. words, a map of relationships among various analytes can be produced
during
training; then during testing, the location of a test analyte on the 'map'
indicates the
relationship of the analyte with respect to this 'space'. Thus, SOMs may help
to
visualize relationships among analytes, rather than simply indicating the
similarity of
an unknown analyte to a target. Examples of SOM approaches which may be
particularly useful for analyte detection, discrimination and identification
are
disclosed by T. I~ohonen. et al., "SOM-PAID: The Self Organizing Map Program
Package", Report A31, Helsinki University of Technology, Laboratory of
Computer
and Information Science, Espoo, Finland (1996) and T. Kohonen, Self Organizing
'
Maps, Series in Information Sciences, Vol. 30, 2nd ed., Springer-Verlag,
Heidelberg
(1997), which publications are incorporated herein by this reference.
Sampling and Detection Parameter Modulation
[0155] Upon evaluation of the response matrices generated by the standards
used
for training, modifications in sniffing parameters, gain settings, andlor
filter settings
may be made for actual sampling of ambient fluids. In a standard operating
mode,
these modifications may be made through interventions of an operator who
manually
changes sampling and data acquisition parameters through the programmable
microcontroller or by keyboard entry. In alternative smart operating modes
described
in subsequent sections, these modifications may be made automatically, on-the-
fly by
smart sampling and detection algoritluns that direct microcontroller
operations.
[0156] Whether and how much such modification improve sensing performance
may be evaluated by examining sensor responses after feedback and determining,
by
some pre-determined or analytically-derived criterion, whether current sample
data
are better or worse than data obtained on a previous run. Modifications may
also
consist of differentially weighting the influence of sensors, so that those
sensors that
give the best signals have a greater impact in the recognition algorithms.
This can be
done in a number of ways, such as eliminating sensors that give little or no
signal so
as to reduce noise, normalizing the remaining signals to some standard value
in order
to use the maximum range available, or changing the analyte sampling and
stimulus
acquisition paradigm to optimize sniff sampling parameters.
CA 02547331 2006-05-24
WO 2004/048937 -47- PCT/US2003/038186
"Smart Mode" Operation .
[0157] One example of an embodiment of the smart mode sampling capability of
the present invention is where the number and duration of analyte samples
taken
during a sample session are controlled~by way of real-time feedback and
control loops
for improving detection, discrimination and identification of analytes. In
other
"' "' embodiments, alternative smart mode parameters and device sampling
configurations
may be manually or automatically selected during training and sampling via
device
menu options. Smart mode sampling configurations may be used alone or in a
variety
of combinations and permutations. In one anticipated embodiment, an automated
training algorithm may be employed to optimize parameter selection and
sampling
configuration in order to provide the best detection and discrimination
capability for
specific analytes of interest. Specific examples of alternative smart mode
sampling
options and parameter configurations are described below.
Sampling Parameters
Sniff Parameters - Sniff Duration
[0158] For sensors that respond slowly to a particular analyte, increasing the
sniff
duration leads to increased signal amplitude and hence improved detection
accuracy.
Sniff Parameters - Number of Sniffs.
[0159] In the simplest implementation, signals across multiple sniffs may be
averaged to improve signal-to-noise. However, different sensors exhibit
different
long-teen responses to multiple sniffs (providing either increasing signal,
decreasing
signal, or constant signal over a series of sniffs). Monitoring these changes
over
sniffs (rather than simply averaging the signals) could provide additional
information
for analyte discrimination.
Sniff Parameters - Sniff Dynamics (Rise Time, Fall Time).
[0160] The rate and extent of sample chamber valves opening and closing may be
controlled to modify sampling (sniff) dynamics.
[0l 61 ] Changing the sniff dynamics may enhance differences in the rising and
falling phases of the sensor response.
CA 02547331 2006-05-24
WO 2004/048937 -48- PCT/US2003/038186
Sniff Parameters - Sniff Velocity.
[0162] In one anticipated embodiment, a digital-to-analog line may be used to
control a~ transistor that changes the voltage supplied to the sniff fan and
thereby alter
fan velocity. Changing sniff velocity, in conjunction with changes in sniff
duration,
can provide optimized exposure of the sensors to particular analytes.
Sniff Parameters - Exhalation Velocity.
[0163] As with changing sniff velocity, a change in exhalation velocity in an
embodiment with two fans would alter the rate at which analyte is purged from
the.
sensors. In,a system with a single fan, the velocity of that fan between
sniffs can be
similarly altered. The dynamic sensor response may then be monitored in
subsequent
sniffs for improved analyte discrimination.
LED Intensity.
[0164] While higher LED intensity leads to more rapid photo-bleaching and
sensor degradation, it also tends to yield larger sensor response signals
during analyte
exposure. In one smart mode embodiment, normal sampling would be made at lower
LED intensity and, where small response signals are present, LED intensity may
be
increased incrementally until reliable response signals are produced for
analyte
detection. This smart mode would tend to extend sensor lifetime by operating
at
minimum LED intensity to reduce photobleaching.
LED Wavelength.
[0165] The excitation wavelength of the LED may be modulated. LEDs are
commercially available that produce three separate wavelengths. The wavelength
of
conventional LEDs may be modulated by changing applied voltage and flicker
frequency. The capability for changing LED wavelength may permit the device to
optimally excite the sensors and to change that excitation over sniffs to
improve
discrimination.
Amplifier Gain Settings.
[0166] Under typical sampling conditions, the highest gain settings are
employed.
Under such a condition, some analytes produce sensor signals that saturate the
CA 02547331 2006-05-24
WO 2004/048937 -49- PCT/US2003/038186
amplifier. By providing for adjustment of gain settings during smart mode
sampling,
if an amplifier channel saturates, an additional sniff at a lower gain~setting
would
provide more accurate time course anc~ amplitude information.
Amplifier Temporal Filter Settings.
"'' "' [0167] In embodiments incorporating amplifiers containing integral
temporal
filters, changing the filter settings may be used to improve the signal-to-
noise
characteristics of the individual sensor channels. Data acquisition and A/D
conversion are closely correlated with LED pulse timing. However, some
detection
enhancement may be achieved by modifying the timing of data acquisition during
an
LED pulse for improved signal discrimination for specific analytes; modulation
of
this parameter may therefore improve detection and identification of certain
analytes.
Gain and Temporal Filter Settings for Individual Channels.
[0168] While one current embodiment of the amplifier electronics allow
manipulation of gain and filter settings globally (i.e. gain and filter
changes apply to
all channels simultaneously), in alternative sensor embodiments, individual
sensor
channels may also be manipulated for smart mode sampling and detection.
[0169] Smart mode training and sampling procedures using these and other
parameter variations are discussed in greater detail below.
Smart Mode Training
[0170] Smart mode training can,be divided ~nto two sections: first, the
parameters
defining the "primary" sniff are determined, followed by a determination of
parameters for any "secondary" sniffs) that may be necessary. The constraints
for the
two sets of parameters are different: The primary sniffs are applied at
regular intervals
over long periods of time and should have minimum zmpact on sensor lifetime
since
they expose the sensors to as little light as possible to reduce
photobleaching and to as
little analyte as possible to prolong sensor lifetime and shorten recovery
time.
Secondary sniffs are intended to generate signals that produce better
discrimination.
Photobleaching and Bleach Runs
[0171] Exposing a fluorescent sensor to prolonged excitation light produces
photobleaching, decreasing the fluorescent output of the sensor. This
fluorescence
CA 02547331 2006-05-24
WO 2004/048937 '~0- PCT/US2003/038186
recovers over time after the excitation light is turned off. In embodiments
where
sensors are exposed to prolonged excitation light during acquisition of
response data
at variable intervals, there appears to be more variability in sensor
response.
Preferably, response data are acquired at regular 15 second intervals. Sensor
bleach
runs establish this regular interval before data are actually acquired. The
bleach runs
are repeated until the signals from the sensors stabilize. In preferred
embodiments
using short excitation light exposures (1 - 5 ms), variability across sniffs
due to
photobleaching is greatly reduced.
[0172] In embodiments using longer excitation light exposure, bleach runs are
acquired either with or without sniffing a blank air sample. The response
matrices
from these runs are compared to the previous run by calculating the sum of
squares
(SS) difference for all data points. For the first run, the comparison is to a
matrix of
zeroes. If the SS difference is stable, where successive SS differences change
little,
training target sampling is initiated. If the SS difference is unstable, a 15
second
inter-run delay time is used and then the bleach run is repeated. While the
operator
may evaluate the SS difference stability visually, this process may be
automated by
setting a criterion which provides for minimum changes in successive SS
differences;
when that criterion is reached, the program continues and training target
sampling is
initiated.
Smart Nose Testing
[0173] Smart Nose testing a single analyte can occur in two stages. First, a
primary sniff is taken and, if the primary sniff produces a good match to a
target, that
match is reported. Secondly, if the primary sniff does not produce a good
match, one
or more secondary sniff(s), if defined by training, are taken. If a match
criterion is not
reached, the matching difficulty is noted and the closest match reported. If
the quality
criterion is reached, the match is reported.
[0174] The photodiodes useful according to the present invention are generally
more sensitive than and have larger dynamic range than individual pixels of .
conventional CCD camera detectors. The detection surface area of individual
sensor
photodiodes in the present device is larger than individual pixel areas of
conventional
CCD camera detectors. Additionally, due to the surface area of the LEDs and
photodiodes employed in the present invention, larger sensor element areas may
be
employed and sampling is conducted over a larger geometric surface area of
CA 02547331 2006-05-24
WO 2004/048937 _51 _ PCT/US2003/038186
individual the sensor elements. Furthermore, the high porosity high surface
area
sensor substrates of the present invention, further enhance sensor response
signals due
to a substantial increase in sensor surface area to volume ratios and the
volumetric
sampling of sensor response signals generated within a three-dimensional
substrate-
sensor volume.
"" "' [0175] The enhanced sensitivity of the present sensors may be further
augmented
by utilizing multiple layers of sensing material 'suspended' in the air
stream,
employing larger surface area sensor elements and larger surface area
photodiodes,
and/or using replicates of multiple identical detectors in the sensor array
from which
signals are combined electronically. Replicates of different sensing materials
may be
incorporated into different sensor channels. Using replicates provides
advantages not
only with respect to the duplication of data to verify measurement
reproducibility, but
also with regard to reducing non-correlated noise from electronic components
such as
amplifiers.
[0176] The invention further provides a method of selecting a nucleic acid
capable of responding to a vapor phase analyte, said method comprising: a)
contacting
the nucleic acid labeled with a fluorophore with an analyte in vapor phase;
arid b)
measuring the emission proflile of the fluorophore in the presence and absence
of the
target analyte, wherein a difference in the emission profile indicates that
the nucleic
acid is responsive to the analyte in vapor phase.
[0177] The nucleic acids according to the method can be prepared by any method
known to one skilled in the art including, but not limited to oligonucleotide
synthesis
using method described earlier, polymerase chain reaction (PCR) using any DNA
as a
template, or isolating nucleic acids from any source, including but not
limited to
eukaryotic and prokarytotic cells, nucleic acid libraries in bacteria,
cosmids, yeast
artificial chromosomes and such.
[0178] Nucleic acids may be labeled using any fluorescent label and method
known to one skilled in the art. In one embodiment, the nucleic acids are
labeled with
Cy3(tm) label. A set of nucleic acid oligomers are designed, wherein the
internal
sequence is a random sequence and the N- and C-terminal ends have an
essentially
same sequence or an anchor sequence. An example of a random oligo nucleotide
with
random 20-mer sequence in between is T(15)CCN(20) AAACATTGCGAAGAAA
(SEQ ID NO: 6). Such random primers with fixed anchor ends can then be used to
create a library by amplifying nucleic acids isolated from any source, such as
bacterial
CA 02547331 2006-05-24
WO 2004/048937 -52- PCT/US2003/038186
DNA. Once the random sequences are amplified, they can be cloned into a
library,
for example a plasmid library, using methods known to one skilled in the art.
Such
libraries can then be amplified using, for example, PCR with a forward primer
haveing a sequence T(15)CC in combination with a Cy3(tm) labeled reverse
primer
T*TTGTAACGCTTCTTT (SEQ ID NO: 7).
[0179] In accordance with the present invention, if the nucleic acid is
internally
labeled, any position is acceptable. For example, the label can be located in
or near
the 5'-end, or in or near the 3.' end. Additionally, applied dye such as YO-
PRO and
Oligreen can also be used.
[0180] Once the nucleic acid is labeled it is purifted. Purification may be
performed using any method known to one skilled in the art. In the example
outlined
above, oligo dT spin columns (available, for example from Amersham Biosciences
Corp., Piscataway, NJ).
[0181] The microarray slides useful according to the present invention can be
'.produced using a variety of surface substrates and methods of depositing
nucleic acids
on the surfaces. For example, glass coverslips containing spots containing
thousands
of different nucleic acid-fluorophore sequences, for example, Cy3-labeled DNA
sequences, can be prepared using a robotic microarray spotter and let dry. The
glass
coverslips can then be put to a chamber, for example a chamber shown in the
Figure
7, and analyzed before exposure to a vapor phase analyte and during or after
exposure
to the vapor phase analyte.
[0182] The comparison of the before and during and/or after images can be done
electronically by subtracting the before image from the during and or after
ln'iabe (for
example, Figure 6). Difference in the intensity of the fluorophore emission
patterns in
the images indicate that the nucleic acid is responsive to the vapor phase
analyte. The
difference in the emission pattern may be increase or decrease of the
intensity of the
emission between the before and during and/or after image. The decrease of at
least
about 2%, 5%, 10-15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or
more and up to 100% is considered as indicative of a nucleic acid capable of
responding to the odor. The increase in the during and/or after image of at
least about
1%, 3%, 5%, 10%, 20%, 30%, 40%, 50%, or more including but not limited to 51-
100%, 200%, 300%, and 1000%, compared to the before image is considered an
increase indicating that the nucleic acid is responsive to the analyte in
vapor phase.
CA 02547331 2006-05-24
WO 2004/048937 -53- PCT/US2003/038186
[0183] The sensor responses may be varied by the use of salts or other
chemicals
present in the buffer of the nucleic acids, before they are deposited'on the
substrate, or
different substrates or other during the preparation of the sensors.
[0184] ~ Examples of salts include but are not limited to 50 mM MgCl2, 50 mM
SrCl2, .50 mM CoCl2, 50 mM CsCl, 50 mM ZnS04, 50 mM UOz (N03 )Z, 50 mM
"' "' CaCIZ, 50 mM BaCI, 50 mM CrK(S04 )Z, 50 mM A1C13, 50 mM NaCl + 10 mM
Tris+
50 ~M MgCl2, 50 mM NaCI + 10 mM Tris+ 50 ~.M SrCla, mM NaCI + 10 mM Tris+
50 ~,M CoCl2, 50 mM NaCI + 10 mM Tris+ 50 ~M CsCI, 50 mM NaCI + 10 mM
Tris+ 50 wM ZnS04, 50 mM NaCI + 10 mM Tris+ 50 ~,M U02 (N03)2, 50 mM NaCI
+,10 mM Tris+ 50 ~M CaCl2, 50 mM NaCl + 10 mM Tris+ 50 ~M BaCI, 50 mM
NaCI + 10 mM Tris+ 50 ~M CrK(S04)Z, 50 mM NaCI + 10 mM Tris+ 50 ~M A1C13.
[0185] Examples of canons useful according to the methods of the present
invention in testing the optimal conditions for nucleic acid-fluorophores for
their
responses to vapor phase analytes include, but are not limited to: Ag - based
on papers
that suggest silver increases Cy3(tm) fluorescence in microarray; Re - based
on paper
that Rhenium causes superconducting-like resistance in DNA; transition metals,
also
want to test different oxidation states of the transition metals (Cr, Co, and
Zn already
tested); Alkali metals, LI, Rb, and Fr (Na, K, and Cs already tested);
Alkaline Earth
Metals, Be (Mg, Ca, Sr, Ba already tested); Lanthanide and Actinide Series,
use those
which are not poisonous or radioactive, (U02 already used); Groups 3a - 6a:
use those
which have ionic forms soluble in water (Al already used)
[0186] The following are anions useful according to the present invention in
testing the nucleic acids for their responses to ailalytes in vapor phase: Cl,
NO3, and
SO4.
[Ol 87] Substrates as listed elsewhere in the application, such as different
plastics
and surface modified substrates, such as silanized substrates, can modify the
response
of the nucleic acid to a vapor phase analyte and should be taken into
consideration
when testing the nucleic acids and later when constructing the actual sensing
array
useful in detecting vapor phase analytes according to the present invention.
EXAMPLE 1
[Ol 88] The portable EVID and a schematic overview of the EVID's sensing
chamber, sensors, optical components, sniff mechanism, and computer control
lines
are shown in Fig. 1. The EVID uses an array of sensors that change their
fluorescence
CA 02547331 2006-05-24
WO 2004/048937 _54_ PCT/US2003/038186
intensity upon exposure to brief pulses of airborne analytes (e.g.,
"odorants"). The
EVID in its present form contains 16 sensors that can be illuminated and
observed at
16 different excitation and emission wavelengths. The sensors are placed along
a
narrow chamber through which ambient air is drawn (see below). The optical
elements for illuminating and monitoring the sensors are positioned along the
sides of
the chamber (Fig. 1B). Excitation light is produced by LEDs providing
wavelengths
appropriate for the sensors being used (e.g., 460nm and 530nm).
[0189] Dye-labeled DNA can act as an analyte sensor. As an initial test of
whether DNA stained with a fluorescent dye responds to analytes, sensors were
constructed from a standard 2.9kb pBlueScriptSK plasmid mixed with YO-PRO dye
'
(Molecular Probes, Inc.) and dried onto a substrate material (see method
details
below). Sensors made from YO-PRO alone and rinsed for 5 min in 70% ethanol
showed no analyte responses,(Fig. 2A). A sensor made by mixing a small
quantity of
plasmid with YO-PRO, however, produced'a large and rapid decrease in
fluorescence
upon exposure to propionic acid, and smaller changes to water, methanol, and
trietliylamine (Fig. 2B).
[0190] Tests with double-stranded DNA showed no sequence effects. To begin
testing whether different sequences of double-stranded DNA per se can produce
sensors of different analyte response profiles, two oligonucleotide oligomers
were
synthesized that were composed of solely GC or AT and were designed to form
hairpin structures. Although differing significantly in primary sequence, the
two
sensors made from these hairpins had similar analyte response profiles. The
hairpin
sensor responses were also qualitativ:;ly similar to the sensors made from
pBluescriptSI~ DNA.
[0191] Analyte dilutions as fractions of saturated vapor were: Water, 10-I;
methanol (MeOH), 10-~; triethylamine, 10-2; and propionic acid, 10-x. Each
trace
represents the mean of 10 presentations; error bars indicate +/- 1 S.D. For
experiments with DNA-based analyte sensors, similar methods were used for each
type of sensor. Briefly, DNA in solution was diluted to the desired
concentration
(0.2-40 ng/~1) in TE .(10 mM Tris, 0.5 mM EDTA). 20 ~.1 of dilute DNA was
mixed
with 1 ~.1 concentrated dye stock and incubated at room temperature for 5
minutes.
Dye-only controls were made of 1 ~1 dye stock in 20 ql TE. Sensors were made
on a
substrate of acid-washed l6xx silkscreen (1 Omm x 12 mm). DNA/dye mixtures
were
pipetted onto the substrate and allowed to dry for 2~ minutes. Each sensor was
rinsed
CA 02547331 2006-05-24
WO 2004/048937 -~$- PCT/US2003/038186
in 70% ethanol for 5 minutes, allowed'to dry, then attached to supports on
glass
coverslips for testing in the EVID. '
[0192] Single-stranded DNA sequences can show differential analyte responses.
As a further test of whether differences in DNA sequence can produce sensors
with
different response profiles, sensors made from single-stranded DNA stained
with the
fluorescent dye OliGreen (Molecular Probes, II1C.) were tested. A sensor made
from
the OliGreen dye alone showed a decrease in fluorescence upon exposure to
propionic
acid, but little change with other analytes (not shown). This response was not
eliminated with longer rinse times of 10 and 15 min. Sensors made from Oligo
t1T
and oligomer DS003 showed enhanced signals to propionic acid and the other
analytes tested (DS003 shown in Fig. 3A). The response profiles of these two
sensors
were similar to each other, and were also similar to the responses of the
double-
stranded DNA sensors made with YO-PRO (Fig. 2B).
[0193] A sensor made with the AJ001 primer sequence, however, had a markedly
different analyte response profile (Fig. 3B). This sensor showed an increase
in
fluorescence in response to propionic acid and methanol, with relatively
little change
to the other analytes tested. While other DNA-based sensors showed responses
to
propionic acid, none showed as strong a methanol signal as this AJ001 sensor.
[0194] With applied dies such as OliGreen, there is little control over how
the
dye interacts with the DNA sequence. In order to define the dye-nucleotide ,
interaction explicitly, we tested oligonucleotides with the fluorescent dye
Cy3(tm)
covalently attached to the 5' end during synthesis. Sensors made from Cy3(tm)-
labeled sequences can show distinctly different analyte response profiles. The
LAPP1
sensor (Fig. 4A) showed good sensitivity to propionic acid and triethylamine
(detection limits at dilutions of about 10-3), and less sensitivity to
methanol, DNT and
DMMP (detection limits at dilutions of about 2 x 10-2). In contrast, the LAPP2
sensor
(Fig. 4B) showed good sensitivity to triethylamine (detection limit at
dilutions of
about 10-3), less sensitivity to DMMP (detection limit at dilutions of about 2
x 10-~)~,
and no response to propionic acid, methanol, or DNT, even at high
concentration.(10-~
dilution).
[0195] It is important to emphasize that certain DNA-based sensors, such as
LAPP1 shown here, respond to DNT. Besides the nitroaromatic sensing polymer
developed by Dr. Timothy Swager (MIT), no other fluorescent sensor types that
we
have tested respond to DNT. Additionally, LAPPl responds to DNT at dilutions
CA 02547331 2006-05-24
WO 2004/048937 -56- PCT/US2003/038186
down to 2 x 10-2, or approximately 6 ppb, indicating that these sensors are
capable of
detecting low vapor-phase concentrations of some analytes.
EXAMPLE 2
[0196] LAPP1: 5' GAG TCT GTG GAG GAG GTA GTC 3' (SEQ ID NO: 1)
[0197] LAPP2: 5' CTT CTG TCT TGA TGT TTG TCA ACC 3' (SEQ ID NO: 2)
[0198] LAPPAS: 5' TTT GGC TTT CTG GAA ATG GGC 3' (SEQ ID NO: 3)
[0199] LAJ001: 5' ACC AGG ACC TGA CTA AGC AGA T 3' (SEQ ID NO: 4)
[0200] Oligomers LAPP1, LAPP2, LAPPAS, and LAJ001 were synthesized and
labeled at the 5' end with the fluorescent dye Cy3(tm) during synthesis (using
Cy3(tm) phosphoramidite from Glen Research). The oligomers were stored in Tris-
NaCI (10 mM Tris, 50 mM NaCI, pH 8) at 225 .ng/ul, then diluted to a
concentration
of 50 ng/ul in distilled waterjust before use. Sensors were constructed by
applying
20u1 of dilute oligomer solution to 1 Omm x Il2mm pieces of acid-washed l6xx
silkscreen. Sensors were allowed to. dry for at least 30min at room
temperature, then
attached to supports for testing.
[0201 ] All sensors were mounted in the device and tested simultaneously. All
were illuminated with excitation light at 540 nm (30mn bandwidth).- Sensors
made
with LAPP1, LAPPAS, and LAJ001 were observed at 600 nm (10 nm bandwidth) and
LAPP2 was observed at 610 nm (10 nm bandwidth). Vapors from propionic acid,
triethylamine, methanol, DNT, and DMMP (dimethyl methylphosphonate, an
organophosphate compound that is a sirnulant for Sarin) were presented to the
device
using an air dilution olfactometer at the indicated dilutions. For the graphs
in the
figure, each point in each curve represents the mean sensor response to ten 2
sec sniffs
taken at 30 sec intervals; error bars indicate +/- one standard deviation.
Signal
amplitudes for the odorants are represented as multiples of the signal
amplitude of
background air (indicated by horizontal dashed line).
[0202] In the initial tests, the oligomer sequences LAPP 1 and LAPP2 showed a
distinctly different response profiles to this small test set of odorants. The
LAPPl
sensor showed good sensitivity to propionic acid and triethylamine (detection
limits at
dilutions of about 0.001), and less sensitivity to methanol, DNT and DMMP
(detection limits at dilutions of about 0.02). In contrast, the LAPP2 sensor
showed
good sensitivity to triethylamine (detection limit at dilutions of about
0.001), less
sensitivity to DMMP (detection limit at dilutions of about 0.02), and almost
no
CA 02547331 2006-05-24
WO 2004/048937 _5~_ PCT/US2003/038186
response to propionic acid, methanol, or DNT, even at high concentration (0.1
dilution). Sensors made with LAPPAS and LAJ001 sequences sho~cwed responses
S111111ar to LAPP2, but with smaller amplitudes. These data show that sensors
that
differ only in nucleotide sequence can ~exllibit different odorant response
profiles.
LAPP1 responds to DNT at dilutions down to 0.02, or approximately 6 ppb,
"' "' indicating that these sensors are capable of detecting low vapor-phase
concentrations.
EXAMPLE 3
[0203] The dye-labeled DNA-based sensors described above can be selected'
using the system described herein. The strategy for finding different DNA
sequences
that respond to different analytes takes advantage of modern high-throughput
methods
and equipment for examining large numbers of DNA interactions rapidly. An
overview of the approach is shown in Fig. 5 and is detailed in the following
sections.
[0204] Prior to a large-scale sensor screen, details of the steps shown in
Fig. 5 are
established through a series of pilot experiments. The appropriate sequence
length is
determined, the actual sensor template is designed, and the necessary
amplification
and labeling conditions are established for generating large numbers of random
DNA
sequences for use as sensors using the methods described elsewhere in the
specification. The amount by which the full sequence library needs to be
diluted for
effective screening is also be determined by testing different dilutions.
[0205] Determine sensor length. The single-stranded sensors investigated in
our
preliminary studies ranged from 18 to 23 bases in length. The minimum sensor
length
necessary for differential analyte responses, however, is unknown.
[0206] The sensor screen will be most effective if the final sensor library
represents a significant portion of the original sequence library. The number
of
different sequences in the original. library goes up as 4"°~bases~ so a
sequence length of
20 bases would yield an original library of approx. 102 sequences, far greater
than
can be screened.
[0207] To determine a minimum effective sensor sequence length, LAPP1 and
LAPP2 sequences labeled with Cy3(tm) are used as described. Sections of the
two
sequences are swapped, beginning with a swap point at the mid-point of the two
sequences. A change in the analyte profile of either original sequence
indicates that
an effective sensor sequence is longer than the swap point.
CA 02547331 2006-05-24
WO 2004/048937 -5$- PCT/US2003/038186
[020] The swap point is moved closer or farther away from the 5' end (where
the
dye is attached) as necessary until there is no change in the analyte response
profile.
That point defines the minimum sensor length.
[0209] Design sensor template. Once the minimum sensor length is determined,
the sensor template is designed. At least two possible amplification
strategies are
used: polymerase chain reaction (PCR) and primer extension (step 4 in Fig. 5).
For
PCR amplification, the template will consist of a random sensor sequence
(length
determined above) flanked by two anchor sequences. Alternatively, primer
extension
can be used for amplification, where the template will consist of a random
sensor
portion followed by a single anchor portion (see top of Fig. 5 for schematic
representations of templates). In each of these templates, the anchor portion
is
complementary to the primer sequences) to be. used for the amplification (one
primer
for primer extension, two primers for PCR). Each anchor/primer pair will be
short in
order to have as little effect as possible .on the sensor responses, yet must
be long
enough to have a sufficiently high melting temperature for the amplification
process
An anchor/primer sequence of 13 bases will be investigated initially, which
has an
estimated melting temperature of 47° C.
[0210] Tests are conducted on both template types to determine the effects of
flanking primer portions on analyte responses. Sequences containing known
sensor
regions (such as LAPPl and LAPP2, shown in Fig. 4) flanked by one or two
primer
sequences will be synthesized along with attched dye label. The analyte
responses of
these sensors will be tested using the methods described elsewhere. Comparison
of
the analyte responses will determine whether PCR or primer extension will be
used in
the amplification (step 4) and hence will determine final template design.
[0211 ] Determine labeling procedure. Because any post-amplification
procedures
for attaching dye to the sensor sequences must be repeated about 10,000 times,
the
dye to the primer sequence is preferably, but not necessarily, attached so
that it will be
incorporated during amplification. In order to place the dye molecule as close
as
possible to the sensor portion of the sequence, the primer is labeled at the
3' end by
incorporating an amino-allyl modified dC or dT (Glen Research) during
synthesis. N-
hydroxysuccinimide functionalized Cy3(tm) (Amersham Biosciences) attaches the
dye to the amino-allyl linker. After the dye reaction, a gel filtration
purification step
removes the unincorporated dye. The dye-labeled primer is then ready to use in
the
amplification step 4.
CA 02547331 2006-05-24
WO 2004/048937 -59- PCT/US2003/038186
[0212] Determine amplification conditions. As mentioned above, PCR or primer
extension is used to amplify samples of the sequence library (step 4 of Fig.
5),
depending on the outcome of the analyte.tests described above.
[0213] ~ Optimal buffer conditions, reagent concentrations, and thermal
cycling
conditions are determined through tests with sensor templates containing a
known
sensor sequence and using the dye labeled primers described above.
Amplification is
monitored by spotting the amplified sensor sequence onto glass slides and
testing for
analyte responses using a microarray scanner.
[0214] Determine optimal dilution. The robotic spotter used to spot the sensor
library onto a microscope slide can apply approximately 10,000 sensor spots.
In order
to screen the largest possible number of sensor sequences, it is desirable for
each spot
to contain multiple different sensor sequences. Too many non-responsive sensor
sequences in a spot, however, may obscure the signals from a single responsive
sensor.
[0215] To estimate the number of non-responsive sequences that could obscure a
responsive sequence, tests are conducted with the known sensor sequences LAPP1
and LAPP2. As shown in Fig. 4, LAPP1 responds to propionic acid whereas LAPP2
does not - propionic acid thus discriminates these two sensor sequences. Spots
with
varying integer ratios of die-labeled LAPP1 and LAPP2 will be applied to
microscope slides and exposed to propionic acid under the conditions that is
used to
screen the entire sensor library. The lowest LAPP 1:LAPP2 ratio that still
shows a
propionic acid signal discriminable from LAPP2 alone provides an estimate of
the
number of sensor sequences per spot. This number of sensors per spot will then
be set
by the dilution in step 2 and the sample volume used in step 3 (Fig. 5).
[0216] Create a large-scale random library of different~oligonucleotide-based
sensors. The steps outlined in Fig. 5 and detailed above are followed to
generate and
amplify a sensor library, which is spotted onto microscope coverslips for
screening
with analytes.
[0217] A random sequence library is synthesized using the sensor template
described above (step 1 of Fig. 5). The sequence library is diluted so that 1
~,1
samples contain at least one, and possibly multiple, different sequences (step
2). The
1 ~,l samples are put into 96-well plates (step 3).
[0218] Primer, bases, polymerase enzyme, and buffer are then added to each
well.
Four plates at a time (384 samples) are amplified using a PCT-225 PCR Tetrad
CA 02547331 2006-05-24
WO 2004/048937 _(0. PCT/US2003/038186
thermal cycler (step 4). It is estimated that four plates can be amplified in
a day, so
amplification of the full 10,000 sample sensor library will require 26 days. A
BioRobotics MicroGrid II microarray spotter is then used to produce sensor
slides
containing 10,000 spots of the~amplified sequences (step 5). Multiple
replicates of the
spotted slides are generated, most of which are stored for future screenings.
[0219] The sensor library generated using the methods described above are
screened with a set of explosive-related compounds and CWA simulants. Sensor
spots showing responses to these compounds are further diluted, amplified, and
spotted onto slides for additional testing with the analytes to locate the
unique sensor
sequences. The sequences are then determined using standard DNA sequencing '
methods.
[0220] A Packard BioChip Technologies ScanArray 4000 array scarmer is used to
scan a sensor slide while exposing it to analytes of interest. This requires
the
construction of a sealed slide holder so that analytes can be applied to the
spots during
scanning. One exemplary design is shown on Figure 7. Examples of the analytes
that
can be used in the screening are shown in Tables 3-5. .
[0221 ] Spots showing a change in fluorescence with analyte exposure are
examined further. The amplified samples that produced the spots are further
diluted
to produce sub-samples containing individual sequences. These sub-samples are
amplified again using the same amplification protocols developed above and
spotted
onto slides. The spots on these slides therefore contain individual sensor
sequences.
These slides are tested with analytes in the array scanner to identify
individual sensor
sequences for the odors of interest. The sequences in the sub-samples that
produced
the responsive sensors are determined using standard DNA sequencing methods.
The
final appropriate sequences are then synthesized, labeled, and tested directly
in the
EVID.
[0222] For each of the sensors identified in the sensor library screen
described
above, concentration-response functions are determined for each of the
explosives,
related compounds, and chemical agents listed in Table 3, 4 and 5. Using these
data
for individual sensors, an optimized sensor array is constructed and the lower
detection limit for each of the compounds determined. These detection limits
are
compared to the reported sensitivities of commercially available devices, to
toxicological data for the chemical agents, and, where data are available, to
the
behavioral thresholds of trained dogs.
CA 02547331 2006-05-24
WO 2004/048937 -(1- PCT/US2003/038186
Table 3: Example Explosives
Target Related compou Function Reference
ends
C-4 ~ Dimethyl , Taggant
dinitrobutane
Dioctyl SebacatePlasticizer
2-ethyl-1-hexanolSolvent
Toluene Solvent Ron Ray, CD~I,
pers. comm.
RDX , Cyclohexanone Solvent Jenkins and
O~eilly (1974)
TNT DNT Synthetic precursor
Dinitrobenzene Contaminant
(DNB)
Table 4: Example Chemical Warfare Agents/Blister Agents
Target Related compoundsFunction Reference
Mustard (H) Dibutyl sulfideSimulant ~ Pal et al. (1993)
2-Chloroethyl Jaeger et al.
(1999)
phenyl sulfide Simulant
Table 5: Example Chemical Warfare Agents/Nerve Agents
Target Related compounds Function Reference
Sarin (GB) Diisopropyl Simulant Pal et al.
(1993)
methylphosphonate
(DIMP)
CA 02547331 2006-05-24
WO 2004/048937 -62- PCT/US2003/038186
Dimethyl Synthetic
methylphosphonate precursor
(DMMP)
Isopropyl Degradation
methylphosphonate product
(IMPA)
Triethyl phosphiteSimulant
Soman (GD) Triethyl phosphateSimulant
VX Tributyl phosphateSimulant
DMMP .
Simulant Pal et al.
(1993)
* From http://www.dean.usma.edu/chem/Faculty/fountain/Fountainurcrsrch.htm
[0223] An air-dilution olfactometer, based on standard olfactometry concepts
and
modeled after a system used in dog studies (Hartell et al., 1998), is used to
deliver
controlled dilutions of analytes to the EVID. In the present configuration,
filtered
compressed air is fed to a bank of mass-flow controllers (Teledyne Hastings
Instruments) to set flow rates through four air or analyte channels. Eight
channels can
also be used. One channel sets the background (diluent) air flow from 1 L/min
to 10
L/min. The other three channels feed the air (flow rates from 10 ml/min to 10
L/min)
through gas-washing bottles and other custom glassware containing analyte
samples.
Downstream of the analyte vessels, the analyte stream in each channel is
controlled by
electric valves (I~IP Inc.), directing flow to exhaust or to a manifold
bringing all
channels back together. The manifold is connect to a glass analyte port, into
which
the snout of the EVID is placed for sampling. Analyte dilutions are determined
by the
relative flow rates through the diluent air channel and the analyte channel.
Total flow
rate is typically 10 L/min.
[0224] Sensors are characterized by their responses to the analytes over a
range of
concentrations. To collect concentration-response data for each analyte, a
concentration series is delivered to the EVID using the olfactometer described
above.
CA 02547331 2006-05-24
WO 2004/048937 _(3_ PCT/US2003/038186
An ascending series of concentrations are presented and ten sniffs at each
concentration taken, with 30 sec between sniffs. Each concentration series
starts with
a dilution of 5 x 10-4 of saturated vapor concentration and ascend, in steps
that
approximately double the concentration, to a dilution of 10-1 (i.e., 5x10'4,
10-3, 2x103,
5x10-3, 10-2, 2x10-2, SxlO-3, 10-1). Data from the.device is logged to a
separate
computer for analysis and display.
[0225] The detection limit for each sensor is determined by comparing the
amplitude of the signal to that of clean air. The lowest concentration of an
analyte
that elicits a signal that is significantly different from the clean air
signal is the
detection limit of the sensor for that simulant. Detection limits for all the
sensors
available for all the analytes are determined in this way.
[0226]~ An optimized array of sensors, each with a low detection limit for one
or
more analytes, is selected. The detection limits of this array for each
compound are
determined using random presentations of the analytes at the dilutions listed
above.
Performance of the array is evaluated using signal detection theory and ROC
curves.
To evaluate the detection limits of the EVID determined in these studies, the
values
are compared to CWA toxicological data and to the sensitivities of other
detection
devices, including trained dogs.
EXAMPLE 4
[0227] Preparation and testing of nucleic acids for their responsiveness to
analytes
in vapor phase.
[0228] DNA-Cy3(tm) Sensor Library. A set of DNA oligomers with random
internal sequence and fixed ends (see Fig. 11) have been prepared by the Tufts
University DNA/Protein Core Facility. Random nucleotide incorporation was used
to
generate the random portion of the oligomer. This random set provides DNA
templates for amplification and labeling to produce a DNA-Cy3(tm) library for
screening as described below.
[0229] Two methods are possible for initial amplification of the sensor
library:
[0230] PCR. Polymerase chain reaction can be used to initially amplify the
library sequences. The random oligomer library with determined primer and
anchor
sequences can be serially diluted, with the last dilution being no greater
than 1:10,
until it is calculated that each well in a microtitre plate contains, on
average, one
CA 02547331 2006-05-24
WO 2004/048937 -6~- PCT/US2003/038186
molecule of DNA. The DNA molecules) in each well is then be amplified and
labeled by PCR through the reaction described below.
[0231 ] Bacteria A preliminary library has been constructed by putting the
random sequences of DNA (Fig. 11 ) into plasmids using one of the commercially
available single copy cloning lcits (TOPO TA or Zero Blunt TOPO PCR) from
Invitrogen. Plasmids were transformed into E. coli and colonies selected for
expression of antibiotic resistance genes carried on the plasmid. The
selection of
bacteria with a drug resistant single copy plasmid allows one and only one DNA
sensor sequence to be expressed in each colony. Colonies can be picked and
grown in
96-well plates. After growth, a small portion of the bacteria can be lysed and
the
sensor sequence amplified and Cy3(tm) labeled in the wells using the primers
as
described below. ~ ~ .
[0232] DNA Labeling Procedure. DNA can be fluorescently labeled using a
variety of mechanisms and dyes. We have chosen Cy3(tm) to facilitate the use
of
existing microarray technology in our experiments. Importantly, our
preliminary
studies show that 5' labeled single-stranded DNA-Cy3(tm) sensors respond
robustly
to odors. One method of 5' Cy3(tm) labeling of DNA uses a 5' capping reaction
involving phosphoramidite chemistry during oligomer synthesis (reagents
available
from Glen Research).
[0233] Although phosphoramidite chemistry provides a convenient method for
attaching Cy3(tm) to DNA, it~can only be used in synthesis reactions. This
does not
allow for attaching Cy3(tm) during amplification of the DNA sensor sequences.
We
have instead chosen to use a Cy3(tm) labeled primer in the PCR reaction to
allow
labeling at a defined location (Fig. 12). Cy3(tm)-labeled primer produced by
first
synthesizing an oligomer with a modified thymidine, Amino-modifier C2dT (Glen
Research), at the 3' end. C2dT was selected as an attachment site for Cy3(tm)
because its short 2-carbon linking group gives the greatest possibility for
electrochemical interactions between the DNA and Cy3(tm) attached to the two-
carbon linker. Cy3(tm)-NHS ester (Amersham) was attached via an amide bond to
the C2dT, using the NHS ester as a leaving group in the reaction (Amersham
protocols were followed for this reaction). The primer was 3' labeled so that
the
final DNA-Cy3(tm) product is 5' labeled after removing all but the labeled
base of the
primer sequence using the restriction eyzyme BsrDl. Results using Cy3(tm)
linlced to
CA 02547331 2006-05-24
WO 2004/048937 -65- PCT/US2003/038186
defined oligomers via a 5' C2dT show the effectiveness of this method in
creating
DNA-Cy3(tm) odor sensors.
[0234] In other PCR studies, Taq polymerase has been used to add Cy3(tm)-
linked nucleotides to a growing strand' of DNA without interrupting the growth
of the
strand. Our method is similar, except that the label is located in the primer
at the
"' "' begimling of the growing strand instead of interspersed as Taq randomly
adds labeled
nucleotides. To remove unlabeled primer, which could exist if the reaction to
attach
Cy3(tm) to the primer is incomplete, Cy3(tm)-labeled primer was purified by
reverse
phase high-pressure liquid chromatography (RP-HPLC). Preliminary results using
this purification technique were successful and will be optimized.
[0235] Using the computer program Oligo no likely primer secondary structures
or dimers were predicted, but PCR conditions need to be optimized for maximal
amplification. Specific factors to optimize are MgCl2 concentration, annealing
temperature, and primer concentration. Optimization of the PCR is carried out
with
known sequences prior to preparation of the random library, but preliminary
data has
shown that a Cy3(tm) labeled PCR product of the appropriate size can be
produced
using our labeled primer. PCR products will be analyzed using 19%
polyacrylamide
gel electrophoresis. DNA bands will be examined using SBYR to show single-
stranded DNA bands, and'the Cy3(tm) fluorescent tag itself to show labeled
bands.
[0236] The anchor sequence is removed by using a restriction enzyme, BsrDl
(New England Biolabs) to cut the anchor sequence from the label.
[0237] Although there are sticky ends remaining after BsrDl digestion, the
melting of the complementary strands in the purification process is more than
adequate to separate the sticky ends. There is theoretically some loss in
library yield
due to random sequences which contain either the BsDl restriction site or the
primer
sequence. Loss due to a BsrDl restriction site in the random sequence is
calculated to
be 13 x 412 sequences. Loss due to random matching of the primer sequence is
calculated to be 45 exact matches for each primer in each orientation or 46
total
sequences lost. These losses combined represent less than 0.02% of the total
library.
[0238] Purification of PCR Product. For method optimization, oligo dT spin
columns (Amersham) are used to purify DNA. Polyacrylimide gel electrophoresis
is
used to analyze products. However, for a Iarge DNA library, these methods are
too
slow and labor intensive. Separating labeled single-stranded DNA (ssDNA) from
the
CA 02547331 2006-05-24
WO 2004/048937 _(6_ PCT/US2003/038186
complementary strand, primers, unused dNTPs, and reaction buffers is
accomplished
through washing after the desired ssDNA is bound to a substrate. Two possible
methods are as follows:
[0239] Micro-titre plates with solid phase oligo dT in the wells are availabe
from
Sequitur, Inc. Hot DNA from the PCR reaction is placed in the wells and as
cooling
occurs, the poly(A) tail of the labeled DNA anneals with the oligo dT in the
well. The
rest of the PCR reaction mixture is then washed away.
[0240] Using TdT, a biotin conjugated base is added to the 3' end of the
labeled
sequence. This is then bound to a strepavidin coated slide and the remaining
material
washed away. '
[0241] Microarray Slide Production. Coverslips containing spots of thousands
of different DNA-Cy3(tm) sequences are created using a robotic microarray
spotter.
Coverslips are then placed in a specially constructed chamber (Fig. 7).
[0242] Preliminary tests have been conducted using a prototype version of this
chamber. Spots of 12 different sequences labeled with Cy3(tm) during synthesis
were
spotted onto a coverslip using a spotting robot (BioRobotics MicroGrid II),
and the
coverslip placed in the prototype chamber. Odors were delivered to the chamber
in a
controlled manner using a syringe pump. The coverslip was imaged using a
microarray scanner (ScanArray 4000) before and after odor delivery.
[0243] Additional Results. The results outlined here indicate possible ways of
modifying sensor responses by altering the salt content of the DNA-Cy3(tm)
buffer
during sensor construction and by using different substrates for making the
sensors.
[0244] Effects of Different Salts. We have found that the salt content of the
DNA-Cy3(tm) solution used to malce the sensor can have an effect on sensor
responses, both in terms of amplitude and in odor response profile.
[0245] The following salts were tested: 50 mM MgCl2, 50 mM SrCl2, 50 mM
CoCl2, 50 mM CsCI, 50 mM ZnSO4, 50 mM UO2 (NO3 )Z, 50 mM CaCl2, 50 mM
BaCI, 50 mM GrI~(S04 )Z, 50 mM A1C13, 50 mM NaCI + 10 mM Tris+ 50 ~.M MgCl2,
50 mM NaCI + 10 mM Tris+ 50 ~M SrClz, mM NaCl + 10 mM Tris+ 50 ~M CoCl2,
50 mM NaCI +.10 mM Tris+ 50 ~M CsCI, 50 mM NaCl + 10 mM Tris+ 50 ~M
CA 02547331 2006-05-24
WO 2004/048937 -(7- PCT/US2003/038186
ZnS04, 50 mM NaCI + 10 mM Tris+ 50 ~M U02 (N03 )2, 50 mM NaCI + 10 mM
Tris+ 50 ~.M CaCl2, 50 mM NaCI + 10 mM Tris+ 50 ~,M BaCI, 50~mM NaCI + 10
mM Tris+ 50 ~M CrK(S04)2, 50 mM ~NaCl + 10 mM Tris+ 50 ~.M AlCl3. In addition
to these salt combinations, DNA-Cy3(tm) solutions tested contained 500~M
sodium
borate buffer.
"' "' [0246] In these experiments, the indicated salt was added to the DNA-
Cy3(tm)
solution that was then applied to the substrate and dried. 20 ~l of solution
was applied
to a piece of l Oxl2mm silkscreen. After drying, the actual concentration of
salt on
the sensor is unknown, but is estimated to be much higher. '
[0247] ~ The following anions are also useful in testing the nucleic acids for
their
responses to analytes in vapor phase: Cl (already used in our tests); N03
(already
used); SO4 (already used).
[0248] The references cited herein and throughout the specification are herein
incorporated by reference in their entirety. The examples above, are meant to
provide
guidance in malting and using the present invention, however, the invention is
meant
to cover all the equivalents of these preferred embodiments which one skilled
in the
art is capable of preparing based upon this disclosure.
References
Aathithan, S., Plant, J. C., Chaudry, A. N., and French, G. L. (2001).
Diagnosis of
bacteriuria by detection of volatile organic components in urine using an
automated headspace analyzer with multiple conducting polymer sensors. J.
Clifa. Mice°obiol., 39:2590-2593.
Alleasab, T. K., Bozza, T. C., Cleland, T. A., Dorries, K. M., Pearce, T. C.,
White, J.,
and Kauer, J. S. (1999). Characterizing complex ~ chemosensors: Information
theoretic analysis of olfactory systems. Ti°e~2ds Neur~sci., 22:102-
108.
Allcasab, T. K., White, J., and Kauer, J. S. (2002). A computational system
for
simulating and analyzing arrays of biological and artificial chemical sensors.
Chena. Senses, 27:261-275.
Bartlett, P. N. and Gardner, J. W. (1992). Odour sensors for an electronic
nose. In
Gardner, J. W. andBarlett, P. N., editors, Se32sois aTad Sensofy Systems for
an
Elects°onic Nose, pages 31-51. Kluwer Academic Publishers,
Dordrecht,
Netherlands.
Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H., and Toole, J. J.
(1992).
CA 02547331 2006-05-24
WO 2004/048937 -68- PCT/US2003/038186
Selection of single- stranded DNA molecules that bind and inhibit human
thrombin. Nature, 355:564-566.
Bouche, M. P., Lambert, W. E., Bocxlaer, J. F. V., Piette, M. H., and
Leenheer, A. P.
D. (2001 ). Quantitative determination of n-propane, ~iso-butane, and n-butane
by headspace GC-MS in intoxications byinhalation of lighter fluid. .I. Anal.
Toxicol., 26:35-42.
Buck, L. and Axel, R. (1991). A novel multigene family may encode odorant
receptors: A molecular basis forodor recognition. Cell, 65:175-187.
Cam,D. and Gagni, S. (2001). Determination of petroleum hydrocarbons in
contaminated soils using solid-phase microextraction with gas
chromatography-mass spectroscopy. J. Cl2f°onzatogr. Sci., 39:481- 486.
Cancho, B., Ventura, F., and Galceran, M. T. .(2002). Determination of
aldehydes in
drinking water usingpentafluorobenzylhydroxylamine derivatization and
solid-phase microextraction. J. Chf°omatog~., 943:1-13.
Ghen, S., Mahadevan, V., and Zieve, L. (1970). Volatile fatty acids in the
breath of
patients with cirrhosis oftheliver. J. Lab. Clin. Med., 75:622-627.
Christensen, T. A. and White, J. (2000). Representation of olfactory
information in
the brain. In Finger, T.E., Silver, W. L., and Restrepo, D., editors,
Neurobiology off' Taste ar7d Sinell, pages 201-232. John Wiley& Sons, New
York.
Dickinson, T. A., White, J.; I~auer, J. S., and Walt, D. R. (1998). Cuwent
trends in
'artificial-nose'teclmology. Ti°ends Bioteclznol., 16:250-258.
Ellington, A. D. ar~d Szostak, J. W. (1990). In vitYO selection of RNA
molecules that
bind specific ligands. Nature, 346:818-822.
Freund, M. S. and Lewis, N. S. (1995). A chemically diverse conducting
polymer-based "electronic nose". Pnoc.Nat. Acad. Sci. USA, 92:2652-2656.
Gardner, J. W. and Barlett, P. N. (1994). A brief history of electronic noses.
Sensors
andActuatoisB, 18-19:211-220.
Gardner, J. W. and Bartlett, P. N., editors (1992). Sensors and sensory
systems fof° ara
electronic nose, volume 0. Kluwer Academic Publishers ,Dordrecht, The
Netherlands.
Gardner, J. W. and Hines, E. L. (1997). Pattern analysis techniques. In Kress-
Rogers,
E., editor, Handbook ofBiosensoT s anal Elects°onic Noses: A~edicin.e,
Food, and
the Envii°~nnzefat, pages 633-652. CRC Press, BocaRaton, FL.
CA 02547331 2006-05-24
WO 2004/048937 -69- PCT/US2003/038186
Gelmont, D., Stein, R. A., and Mead, J. F. (1981). Isoprene - the main
hydrocarbon in
human breath. Biocl2em. Biophys. Res. Cornmun., 99:1456-1460.
George, V., Jencins, T., Leggett, D., ~ragin, J., Phelan, J., Oxley, J., and
Pennington,
J.~ (1999). Progress ondetermining the vapor signature of a buried landmine.
In
Proceedizzgs of the 13th Annual International Symposium on
"' "' AerospacelDefense Sezzsing, Simulatiorz, & Controls, pages 258-269.
George, V., Jerkins, T., Phelan, J., Leggett, D., Oxley, J., Webb, S.,
Miyares, P.,
Cragin, J., Smith, J., andBerry, T. (2000). Progress on determining the vapor
signature of a buried landmine. In Proceedings oftlzel4th Annual
Interrzdtional
Symposium on AerospacelDefense Sensing, Simulatiorz, ~z C0r2tr"Ols.
Grate, J. W., Rose-Pehrsson, S. L., Venezlcy, D. L., Klusty, M., and Wohltjen,
H.
(1993). Smart sensor system for trace organophosphorus and organosulfur
vapor detection employing a temperature-controlled arrayof surface acoustic
wave sensors, automated sample preconcentration, and pattern recognition.
Anal. Chenz., 65:1868-1881.
Grote, C. and Pawliszyn, J. (1997). Solid-phase microextraction for the
analysis of
human breath. Anal. Chem., 69:587-596.
Hamaguchi, N., Ellington, A., and Stanton, M. (2001): Aptamer beacons for the
direct
detction of proteins. Anal. Biochem., 294:126-131.
Hartell, M., Myers, L., Waggoner, L., Hallowell, S., and Petrousky, J. (1998).
Design
and testing of a quantitative vapor delivery system. In Proceedings of the 5th
International Symposium on the Arzalysis andDetectiorz of Explosives,
Washington, D.C.: Treasurey Department.
Jayasena, S. D. (1999). Aptamers: An emerging class of molecules that rival
antibodies in diagnostics. Clin.Chezzz., 45:1628-1650.
Jerkins, T. F., Leggett, D. C., Miyares, P. H., Walsh, M. E., Ranney, T. A.,
Cragin, J.
H., and George, V.(2001). Chemical signatures of TNT-filled land mines.
Talanta, 54:501-513.
Jerkins, T. F., Walsh, M. E., Miyares, P. H., I~opczynski, J. A., Ranney, T.
A.,
George, V., Pennington, J.C.,and T. E. Berry, J. (2000). Analysis of
explosives-related chemical signatures in soil samples collected near buried
land mines. ERDC TR-00-5, CRREL.
Jhaveri, S., Rajendran, M., and Ellington, A. D. (2000a). In vitro selection
of
signaling aptamers. Nature Biotech., 18:1293-1297.
CA 02547331 2006-05-24
WO 2004/048937 _7Q_ PCT/US2003/038186
Jhaveri, S. D., Kirby, R., Conrad, R., Maglott, E. J., Bowser, M., Kennedy, R.
T.,
Click, G., and Ellington, A. D. (2000b). Designed signaling aptamers that
transduce molecular recognition to changes influorescence intensity. J. Am.
Claem. Soc., .122:2469-'2473.
Kauer, J. S. (1987). Coding in the olfactory system. In Finger, T. E. and
Silver, W. L.,
editors, Neurobiology of Taste and Smell, pages 205-231. John Wiley ~ Sons,
Inc, New York.
Kauer, J. S. (1991). Contributions of topography and parallel processing to
odor
coding in the vertebrate olfactory pathway. Trends Neurosci, 14:79-85.
Kauer, J. S. and White, J. (2002). Representation of odor information in the
olfactory
system: from biology to an artificial nose. In Barth, F. G., Humphrey, J. A.
C.,
and Secomb, T. W., editors, Sef2sors andSensi~zg in Biology afzd Efzgineering.
Springer-Verlag, Berlin.
Kent, P. F. and Mozell, M. M. (1992). The recording of odorant-induced mucosal
activity patterns with avoltage-sensitive dye. JNeuroplZysiol, 68:1804-1819.
Kundu, S. K., Bruzek, J. A., Nair, R., and Judilla, A. M. (1993). Breath
acetone
analyzer: Diagnostic toolto monitor dietary fat loss. Clin. Claem., 39:87-92.
Lambropoulou, D. A. and Albanis, T. A. (2001). Optimization of headspace
solid-phase microextraction conditions for the determination of
organophosphorus insecticides in natural waters. J. Chi°on2atogr.,
922:243-255.
Leggett, D. C., Cragin, J. H., Jenkins, T. F., and Ranney, T. (2001). Release
of
explosive-related vapors fromland mines. ERDC TR-OI ~ 6, Ci~REL.
Lu, X.-C. M., Slotniclc, B. M., and Silberberg, A. M. (1993). Odor matching
and odor
memory in the rat.Playsiol. BelZav., 53:795-804.
MacKay-Sim, A., Shaman, P., and Moulton, D. G. (1982). Topographic coding of
olfactory quality: Odorant-specific patterns of epithelial responsivity in the
salamander. J NeuroplZysiol., 48:584-596.
Mendis, S., Sobotlca, P. A., and Euler, D. E. (1994). Pentane and isoprene in
expired
air from humans: Gas-chromatographic analysis of single breath. Clin. Chenz.,
40:1485-1488.
Mitchell, S., Ayesh, R., Barrett, T., and Smith, R. (1999). Trimethylamine and
Foetor
Hepaticus. Scand. .I. Gastroef2terol, 34:524-528.
Moore, D. (2001). Preparation and analysis of dna. In Ausubel, F. M., Brent,
R.,
CA 02547331 2006-05-24
WO 2004/048937 -71- PCT/US2003/038186
Kingston, R. E., Moore, D. D'., Seidman, J. G., Smith, J. A., and Struhl, K.,
editors, CuYI°ent PT~otocols in Molecular Biology, volume' T, chapter
2. John
Wiley & Sons, Inc.
Mosaddegh, M. H., Richardson, R:, Stoddart, R. W., and McClure, J. (2001).
Application of solid-phase micro-extraction technology to drug screening and
"' "' identification. Ann. Clin. Bioclaem., 38:541-547.
Musshoff, F., Junker, H., and Madea, B. (2002). Simple deternlination of 22
organophosphorous pesticides in human blood using headspace solid-phase
microextraction and gas chromatography with massspectrometric detectfon. J.
Clzron2atogr. Sci., 40:29-34.
Narasimhan, L. R., Goodman, W., and Patel, C. K. N. (2001). Correlation of
breath
ammonia with blood ureanitrogen and creatinine during hemodialysis. Proc.
Natl. Acad. Sci., 98:4617-4621.
Park,J., Groves, W. A., and Zellers, E. T. (1999). Vapor recognition with
small arrays
of polymer-coated microsensors. a comprehensive analysis. Anal. Chem.,
71:3877-3886.
Passe, D. H. and Walker, J. C. (1985). Odor psychophysics in vertebrates.
Neuy~osci.
Biobehav. Rev., 9:431-467.
Persaud, K. and Dodd, G. (1982). Analysis of discrimination mechanisms in the
mammalian olfactory system using a model nose. Nature, 299:352-355.
Phillips, M., Gleeson, K., Hughes, J. M. B., Greenberg, J., Cataneo, R. N.,
Baker, L.,
and McVay, W. P. (1999). Volatile organic compounds in breath as markers of
lung cancer: a cross-sectional study. Lancei, 353:1930-1933.
Ping, W., Yi, T., Haibao, X., and Farong, S. (1997). A novel method for
diabetes
diagnosis based on electronic nose. Biosens. Bioelecty°on., 12:1031-
1036.
Potyrailo, R. A., Conrad, R. C., Ellington, A. D., and Hieftje, G. M. (1998).
Adapting
selected nucleic acidligands (aptamers) to biosensors. Anal. ClZem.,
70:3419-3425.
Sassanfar, M. and Szostak, J. W. (1993). An RNA motif that binds ATP.
NatuT°e,
364:550-553.
Schneider, J. F., Boparai, A. S., and Reed, L: L. (2001). Screening for Sarin
in air and
water by solid-phase microextraction-gas chromatography-mass spectrometry.
J. Chf°onzatogr. Sci., 39:420-424.
Severin, E. J., Doleman, B. J., and Lewis, N. S. (2000). An investigation of
the
CA 02547331 2006-05-24
WO 2004/048937 -72- PCT/US2003/038186
concentration dependence andresponse to analyte mixtures of carbon
black/insulating organic polymer composite vapor detectors. Afaal.Chef~a.,
72:658-668. 1
Sidebotham, R. L. and Barori, J. H. (1990). Hypothesis: Helicobacte~ pylori,
urease,
.;
mucus, and gastric ulcer.Lancet, 335:193-195.
Slotnick, B. M., Kufera, A., and Silberberg, A. M. (1991). Olfactory learning
and
odor memory in the rat.Physiol. Behav.~ 50:555-561.
Tangerman, A., Meuwese-Arends, M. T., and Jansen, J. B. M. J. (1994). Cause
and
composition of foetor hepaticus. Laszcet, 343:483.
Tassopoulos, C. N., Barnett, D., and Fraser, T. R. (1969). Breath-acetone an'd
blood-sugar measurements indiabetes. LafZCet, 1(7609):1282-1286.
Tuerk, C, and Gold, L. (1990). Systematic. evolution of ligands by exponential
enrichment: RNA ligands tobacteriophage T4 DNA polymerase. Science,
249:505-510.
Tyagi, S. and Kramer, F. R. (1996). Molecular beacons: Probes that fluoresce
on
hybridization. Nature Biotech., 14:303-308.
White, J., Dickinson, T. A., Walt, D. R., and Kauer, J. S. (1998). An
olfactory
neuronal network for vaporrecognition in an artificial nose. Biol. Cyberfa.,
78:245-251.
White, J. and Kauer, J. S. (1999). Odor recognition in an artificial nose by
spatio-temporal processing usingan ,olfactory neuronal network.
Nem°oconaputing, 26-27:919-924.
White, J., Kauer, J. 5.,, Dickinson, T. A., and Walt, D. R. (1996). Rapid
analyte
recognition in a device basedon optical sensors and the olfactory system.
Anal.
Claem., 68:2191-2202.
Yarriazaki, K., Singer, A., and Beauchamp, G. K. (1998-1999). Origin,
functions and
chemistry of h-2 regulated odorants. Gefaetica, 104:235-240.
Yang,J. S. and Swager, T. M. (1998). Porous shape persistent fluorescent
polymer
films: An approach toTNT sensory materials. J. AnZ. Clzef~z. Soc.,
120:5321-5322.
Youngentob, S. L., Markert, L. M., Mozell, M. M., and Hornung, D. E. (1990). -
A
method for establishing afiveodor identification confusion matrix task in
rats.
P7aysiol. Be7zav., 47:1053-1059.
Zellers, E. T., Batterman, S. A., Han, M., and Patrash, S. J. (1995). Optimal
coating
CA 02547331 2006-05-24
WO 2004/048937 -73- PCT/US2003/038186
selection for the analysis of organic vapor' mixtures with polymer-coated
surface acoustic wave sensor arrays. Anal. Chem., 67:1092=1106.
Zhang, Z., Yang, M. J., and Pawliszyn, J. (1994). Solid-phase microextraction.
Anal.
Chena., 66:844A- 853A.
