Note: Descriptions are shown in the official language in which they were submitted.
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
USE OF GPCR54 LIGANDS FOR THE TREATMENT OF INFERTILITY
BACKGROUND
Field of the Invention
The present invention is generally directed to the treatment of
reproductive disorders. More specifically, the invention involves the
treatment of
such disorders by administering compositions comprising Kiss-1-derived
peptides.
Background of the Related Art
In 1998, the American Society for Reproductive Medicine estimated-
that there were 6.1 million couples with infertility problems in the United
States.
Numerous advances have been made in the area of assisted reproductive
technologies
(ART) in efforts to overcome infertility problems in these individuals by the
use of
high technology procedures to combine sperm and eggs. Most couples go through
extensive infertility evaluation and treatment before being considered for ART
therapies. ART includes in vitro fertilization techniques alone typically in
combination with various hormonal and/or surgical interventions.
Treatment of infertility will often require ovulation induction (OI)
and/or controlled ovarian hyperstimulation (COH). OI involves causing a single
follicle to pass through the cycle through to ovulation as a single oocyte
whereas
COH is directed at harvesting multiple oocytes for use in various in vitro ART
procedures (e.g., for in vitro fertilization). Both of these procedures rely
on the use of
two primary hormones which control ovary follicle development and ovulation in
women, namely: follicle-stimulating hormone (FSH) and luteinizing hormone
(LH).
Women with normal ovarian function ovulate sometime during the
middle of each menstrual cycle. In each menstrual cycle, many follicles are
recruited
for the maturation of the oocytes. At the beginning of the approximately 28-
day
menstrual cycle the follicles are in the primordial form, i.e., an oocyte
surrounded by
a single layer of cells. As follicular growth and maturation is activated by
FSH,
multiple layers of granulosa cells form around the initial single layer
of~cells, a
process that continues through to midcycle. These granulosa cells are
responsible for
nourishing the oocyte and for the production and release of estrogen. FSH,
produced
by the pituitary induces aromatase activity in the granulosa cells thereby
increasing
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
the production of estrogen. Thus, concurrent with the maturation of a follicle
there is
an increase in estrogen production in the early part of the 2~-day menstrual
cycle.
The follicle also contains receptors for the second pituitary gonadotropin,
LH. As the
follicle continues to grow and mature by mid-cycle (approx, day 14), a space
(antrum)
develops inside the granulosa cells. At mid-cycle a surge of LH production
acts on
LH receptors to cause the follicle to rupture and release the oocyte which
travels
down the fallopian tube and, which may subsequently be fertilized.
The normal ovulating woman recruits approx. 300 immature oocytes
for each menstrual cycle. During a normal cycle, all but one follicle will
regress
(atresia), and a single dominant follicle will emerge and go on to release an
oocyte. In
vitro fertilization (1VF) of human oocytes, which is now a commonly used
treatment
for female and male subfertility, is based on retrieval of mature human
oocytes
followed by fertilization of the mature oocytes with spermatozoa. The
recruitment of
human mature oocytes is accomplished by hormone treatment regimens. For
example, standard IVF treatment protocols include a long phase of hormone
stimulation of the female patient, e.g. 30 days. This protocol is initiated by
suppressing the patient's own FSH and LH by gonadotropin releasing hormone
GnRH
or an analog of GnRH, and is followed by injections of exogenous
gonadotropins, e.g.
FSH and/or LH, in order to ensure development of multiple preovulatory
follicles. At
an appropriate stage of follicular growth, multiple oocytes are harvested by
aspiration
immediately before ovulation. The aspirated oocyte is subsequently fertilized
in vitro
and cultured, typically for three days before transfer of the resulting embryo
into the
uterus at the 4-~ cell stage.
In women who do not ovulate naturally, an initial aim of intervention
is to induce ovulation of at least one oocyte. Several medicaments axe
available and
in use for artificially triggering and sustaining the development of
follicles. These
medicaments include clomiphene citrate (Clomid~, Serophene~) or Letrozole
(Femera~), or alternatively, in the event that the patient is non-responsive
to
clomiphene, then injectable hormones, such as human menopausal gonadotropin
(hMG) (Repronex~, Pergonal~, Humegon~), FSH (Gonal-F~, Follistirn~,
Bravelle~), human chorionic gonadotropin (hCG; .Profasi~, Pregnyl~, Novarel~,
Ovudrel~) to trigger the release of the ovum administered either alone or in
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
combination with a GnRH antagonist such as Lupron~, Synarel~, Antigon~, or
Cetrotide~ to prevent the natural LH surge from occurring.
Clomiphene citrate is often the first drug used in fertility treatments as
it is relatively inexpensive and is available in pill form and 60% to 80% of
women
treated with this medicament will ovulate. Clomiphene acts as an anti-estrogen
on the
central nervous system and causes an increase in the pulse frequency and
concentration of FSH released by the pituitary and also causing stimulation of
LH
burst thereby giving a moderate gonadotropin stimulus to the ovary. Clomiphene
is
administered over a period of five days early in the cycle at typical doses
that start at
50 mg/day and may be increased in later cycles up to 200 mg.
However, clomiphene administration has significant side effects. For
example, there is a well-characterized possibility of multiple pregnancy.
Further, it
has been suggested that prolonged use of clomiphene may increase the risk of
ovarian
cancer. In addition, while clomiphene causes an increase in the rate of
ovulation, the
rate of pregnancy in clomiphene-stimulated women is surprisingly low. A
variety of
reasons have been suggested for this discrepancy between the rate of ovulation
and
the rate of pregnancy. Clomiphene appears to have an anti-estrogerlic effect
on the
endometrium and seems to cause a decrease in the uterine lining. Secondly, the
anti-
estrogenic effect of clomiphene on the cervix is to decrease the amount of
mucus
produced from the cervix. Further, clomiphene administration appears to cause
a
decrease in uterine blood flow, impairs placental protein 14 production and
may have
detrimental effects on the oocyte. (see Tarlatziz & Grimbais, Hum. Reprod.,
13:9
2356-2358, 1998; Out et al., Hum. Reprod., 13:9 2358-2361, 1998; Dickey et
al.,
Hum. Reprod., 13:9 2361-2365, 1998). Finally, as clomiphene is an artificial
chemical rather than a "natural" ovarian stimulant derived from a naturally
occurring
protein or other molecule, there are concerns that the side effects of such
chemical
intervention (hot flushes, mood swings, sleeplessness, dizziness, visual
impairment)
are too wide and varied for this intervention to be considered a safe
stimulant.
Indeed, it has been suggested that it is "highly unlikely that clomiphene
citrate would
be allowed to enter the market if registration were sought nowadays." (see Out
et al.,
Hum. Reprod., 13:9 2358-2361, 1998).
Thus, there axe clear problems with the use of clomiphene-induced
ovarian stimulation. Hormonal stimulation also has its drawbacks including
risk of
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
ovarian hyper stimulation syndrome (OHSS), weight gain, bloating, nausea,
vomiting,
the time involved with the monitoring process, and the unknown long-term
cancer
risks. Thus, there remains a need for new and effective methods for OI and/or
COH.
SiIMMARY OF THE INVENTION
The present invention is directed to methods and compositions that for
the ovarian stimulation and for replacing or augmenting existing methods for
fertility
treatment. In particular embodiments, the present invention contemplates
methods for
stimulating ovulation in an mammal comprising administering to the mammal a
first
composition comprising a Kiss-1 derived protein. In more particular
embodiments,
the Kiss-1 derived protein is a mature Kiss-1 protein comprising the sequence
of SEQ
>D N0:2. In other aspects, the method involves use of a Kiss-1 derived protein
that is
a peptide derived from a mature Kiss-1 protein. Preferably, the Kiss-1 derived
protein
is a Kiss-1 derived peptide that is able to activate a GPCR54 receptor. 1n
specific
embodiments, the Kiss-1 derived protein is a peptide that comprises an amino
acid
sequence of SEQ ID N0:7.
As described throughout the specification, numerous Kiss-1 peptides
are encompassed herein. In specific preferred embodiments, the Kiss-1 derived
protein is a peptide having the sequence of having the sequence of SEQ ID
N0:3, an
analog of a peptide of SEQ ID N0:3, a fragment of SEQ ID NO:3, or an analog of
a
fragment of SEQ ID N0:3. Variant, mutants, homologs and analogs are
contemplated. In pecific embodiments, the analog of SEQ ID N0:3 is a peptide
that
is a conservative variant of SEQ E? N0:3.
The Kiss-1 related peptide compositions of the present invention may
be used in a combination with other compositions. For example, the method of
stimulating ovulation may further comprise administering a second composition
that
stimulates ovulation. Compositions that stimulate ovulation are generally
known to
those of skill in the art and include hormonal and a chemical stimulants of
ovulation.
In exemplary embodiments, the chemical stimulant of ovulation is clomiphene
citrate
or Letrazole. Other agents that are analogs or variants of clomiphene citrate
or
Letrazole, or act through similar mechanisms of action also may be used in the
methods described herein. The hormonal stimulant of ovulation may be any
hormone
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
used for such a purpose. Exemplary such hormones include gonadotropin hormones
selected from the group consisting of human menopausal gonadotropin (hMG),
follicle stimulating hormone (FSH), luteinizing hormone (LH), and human
chorionic
gonadotropin (hCG). In additional embodiments, the gonadotropin hormones may
be
combined with administration of a composition comprising GnRH antagonist. In
particularly preferred embodiments, the gonadotropin is FSH.
The methods of the invention employing administration of FSH also
may be further combined with administration of a non-FSH gonadotropin hormone.
In particular embodiments, the non-FSH hormone is LH. The FSH and the LH may
be administered in equal amounts, or may be administered in non-equal amounts.
The
FSH may be administered concurrently or separately.
In certain exemplary embodiments, the FSH is administered at a
dosage range of from about 5 to 450 IU/day. In other embodiments, the FSH is
administered at a dosage range of from about 5 to 75 IUlday. In specific
aspects, the
hormones may be administered through any route of administration employed for
hormone treatment. More particularly, the gonadotropin hormone is administered
by
injection. The methods of the invention preferably involve treatment of a
human.
A further aspect of the present invention encompasses a method of
stimulating FSH production in a mammal comprising administering to the mammal
a
composition comprising a Kiss-1 derived protein. The Kiss-1 derived 'protein
may be
any protein that is derived from the mature Kiss-1 protein comprising the
sequence of
SEQ ID NO:2. The protein may be a peptide derived from a mature Kiss-1
protein.
Preferably, the method involves use of a Kiss-1 derived peptide that is able
to activate
a G-protein coupled receptor 54. More particularly, the Kiss-1 derived protein
is a
peptide that comprises an amino acid sequence of SEQ ID N0:7. The Kiss-1
derived
protein is preferably a peptide having the sequence of SEQ >D N0:3, an analog
of a
peptide of SEQ ID N0:3, a fragment of SEQ >I7 N0:3, or an analog of a fragment
of
SEQ ll~ NO:3. In specific embodiments, the analog of SEQ 117 N0:3 is a peptide
that
is a conservative variant of SEQ 117 NO:3. The method may further comprise
administering a second composition that stimulates FSH production in the
mammal.
The second composition that stimulates FSH production comprises an anti-
estrogenic
compound, e.g., anti-estrogenic compound is selected from the group consisting
of
clomiphene and letrazole.
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
Also described herein is a method of stimulating LH production in a
mammal comprising administering to the mammal a composition comprising a Kiss-
1
derived protein.
The methods of the present invention also encompass methods for the
therapeutic intervention of infertility in a mammal comprising suppressing
endogenous gonadotropins production in the mammal, administering to the mammal
a
composition Kiss-1 related peptide in an amount effect to stimulate ovarian
follicle
growth in the mammal; and inducing ovulation in the mammal to produce an ovum.
The infertility treatment methods may further comprise. administering a
gonadotropin
preparation to stimulate ovarian follicle growth. Such a gonadotropin
preparation
may comprise urinary or recombinant FSH or HMG, with or without recombinant
LH.
In particular embodiments, the gonadotropin preparation comprises recombinant
FSH.
In specific embodiments, the induction of ovulation comprises administering to
the
mammal a composition comprising HCG, native LHRH, LHRH agonists or
recombinant LH. In more specific embodiments, the suppression of endogenous w
gonadotropin production in the mammal comprises administering a GnRH
antagonist.
In preferred embodiments, the Kiss-1 derived peptide is administered
in combination with an anti-estrogenic agent in a combined amount effective to
stimulate FSH production in the mammal. In other aspects of the invention, the
methods described herein may be used in a mammal that is non-responsive to
standard gonadotropin stimulation of normal ovulation. In specific
embodiments, the
infertility disorder is hypogonadotropic hypogonadism. Other methods involve
treatment of the infertility disorder polycystic ovary syndrome.
The infertility treatment methods described herein further comprise
intrauterine insemination of the ovum by sperm injection. In other
embodiments, the
methods further comprise harvesting oocytes 12 days after the initial
stimulation of
the ovarian follicle production. In more specific embodiments the methods
further
comprise fertilizing the harvested oocytes in vitYO, and culturing the
harvested,
fertilized oocytes to the 4-8 cell stage. In preferred embodiments, the
methods further
comprise transferring the 4-8 cell stage fertilized oocytes to the uterus of a
mammal.
In specific embodiments, the fertilized oocytes are transferred to the uterus
of the
same mammal from which the oocytes were harvested. However, in other
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
embodiments, the fertilized oocytes are transferred to the uterus of a
different
mammal from which the oocytes were harvested.
The methods of the invention also alleviate one or more of the
symptoms hypogonadotropic hypogonadism in a subject by administering to the
individual a therapeutically effective amount of a Kiss-1 derived peptide. In
such
embodiments, the subject is a male subject. The subject suffering from
hypogonadotropic hypogonadism may be a female subject.
The invention further contemplates a composition comprising a Kiss-1
derived protein for use in the treating of infertility. In yet further
embodiments, the
invention provides a kit for the treatment of infertility, wherein the kit
comprises a
first composition comprising a Kiss-1 derived protein in a pharmaceutically
acceptable formulation, and a second composition for the treatment of
infertility.
Preferably, the second composition for the treatment of infertility comprises
an FSH
preparation in a pharmaceutically acceptable formulation. In specific
embodiments,
the FSH preparation is selected from the group consisting of a urinary FSH
preparation and a recombinant FSH. Preferably, the FSH is human FSH. In
specific
embodiments, the FSH is present in a unit dose of between about 5 lU FSH and
about
75 IU FSH. The kits also may further comprise a third composition comprising
LH in
a pharmaceutically acceptable formulation. More particularly, the LH is
present in a
unit dose of between about 75 IU LH and about 150 IU LH.
Other features and advantages of the invention will become apparent
from the following detailed description. It should be understood, however,
that the
detailed description and the specific examples, while indicating preferred
embodiments of the invention, are given by way of illustration only, because
various
changes and modifications within the spirit and scope of the invention will
become
apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE FIGURES
The following drawings form part of the present specification and are
included to further illustrate aspects of the present invention. The invention
may be
better understood by reference to the drawings in combination with the
detailed
description of the specific embodiments presented herein.
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
Figures 1 A-P shows a comparison of the in vivo effects of GnRH and
Kiss1 on the release of LH (Figures lA-H) and FSH (Figures lI-P) over a 45
minute
time period. Figure lA and 1B shows the effect of vehicle alone on LH release.
Figure 1C and 1D shows the effect of 90ng/kg GnRH-I administration on LH
release.
Figure lE and 1F shows the effect of 9~glkg GnRH-I administration on LH
release.
Figure 1G and 1H shows the effect of 4~.g/kg Kiss-I administration on LH
release.
Figure l I and 1 J shows the effect of vehicle alone on FSH release. Figure 1
K and 1 L
shows the effect of 90ng/kg GnRH-I administration on FSH release. Figure 1M
and
1N shows the effect of 9~.g/kg GnRH-I administration on FSH release.. Figure
10 and
1P shows the effect of 4~.g/kg Kiss-I administration on~FSH release.
Figure 2A-2B. Effects of Kiss-1 by i.v. injection on plasma LH
(Figure 2A) and FSH (Figure 2B) levels, and prevention of these effects by
pretreatment of GnRH antagonist, Antide, in estrogen-treated ovariectomized
rats.
Exclusive letters indicate statistical difference at P<0.05 determined by one-
way
1 S ANOVA followed by Fisher's Least Significant Difference (Fisher's LSD)
analysis as
a post-hoc test.
Figure 3A-3B. Effects of Kiss-1 by i.c.v. injection on plasma LH
(Figure 3A) and FSH (Figure 3B) levels in estrogen-treated ovariectomized
rats.
Exclusive letters indicate statistical difference at P<0.05 determined by one-
.way
ANOVA followed by Fisher's LSD as a post-hoc test.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
Infertility has been treated through a variety of mechanisms, most of
which rely on stimulating or augmenting the effects of FSH andlor LH. Prior to
the
present invention, the first course of intervention in combating infertility
has been to
employ anti-estrogen compounds such as clomiphene or letrazole. However, it
has
been discovered that these agents have undesirable side effects. Thus there
remains a
need for effective additional treatments for infertility. The present
invention provides
novel methods and compositions for the stimulation of endogenous gonadotropin
production. More particularly, the methods and compositions of the present
invention
produce a stimulation of FSH and/or LH production and/or release. This
stimulation
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
is advantageous in that it can be exploited in the treatment of various
fertility
disorders.
The present invention describes methods of treating infertility by
administering compositions comprising Kiss-1-peptide related proteins. Methods
and
compositions for achieving this beneficial outcome are described in further
detail
herein below.
KISS-1 PROTEIN AND ITS RECEPTOR
The present invention is directed to methods of treating a variety of
infertility disorders by administering Kiss-1 related proteins. In preferred
aspects of
the invention it has been found that Kiss-1 and peptides derived therefrom may
be
used to regulate the hypothalamic-pituitary-gonadal (H-P-G) axis and to
modulate the
production and circulating concentration of various hormones, including
luteinizing
releasing hormone (LHRH) (also known as GnRH), FSH, LH, as well as gonadal
steroids such as estrogen and testosterone. In specific examples, it has been
demonstrated that a Kiss-1 protein derived agonist of GPCR54, stimulates the
production and release of FSH and/or LH. For example, it has been shown by the
inventors that a single administration of the 10 amino acid RFamide of SEQ ID
N0:3
was sufficient to drive LH and FSH production similar to GnRH. This finding
importantly reveals that the level of induction of FSH production is in a
therapeutically relevant range. As the H-P-G axis is involved in various
aspects of the
reproductive system, including but not limited to, timing of puberty,
maintenance of
fertility and in the time of onset of menopause, the stimulants of the
invention may be
used in the treatment of a wide variety of fertility disorders. The following
section is
directed to a description of Kiss-1 protein and compounds that may be derived
therefrom that may be useful in the treatment of infertility.
G protein-coupled receptors (GPCRs) are a large family of membrane
receptors. Hundreds of genes that belong to this family have been identified
but in
many instances their ligands and functions remain unelucidated. GPCR54 is one
such
orphan GPCR that was originally cloned from rat brain and found to be widely
expressed in the rat central nervous system, including the hypothalamus,
midbrain,
pons, medulla, hippocampus, and amygdale. The gene encoding human GPCR54 is
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
present in a bacterial artificial chromosome mapped to chromosome 2 (GenBank
accession number AC023583). Recently, it has been shown that a placental
tissue
extract contains active peptides derived from metastasis suppressor gene KISS-
1
(SEQ ID N0:1; see also GenBank accession no. NM_002256 and SwissProt
accession no. Q15726) that are agonists of GPCR54 (Kotani et al., J. Biol.
Chem.,
276(37):34631-34636, 2001). The peptides (termed kisspeptins) described in
Kotani
were 54-, 14-, and 13- amino acids in length (SEQ ID NO: 4, SEQ ID NO:S and
SEQ
ID N0:6, respectively) and contained a RF-amide at the C-terminus. These
peptides
are derived from the full-length Kiss-1 protein (SEQ ID NO:2). The present
invention
for the first time describes that compositions comprising Kiss-1 and
kisspeptins may
be used in the treatment of infertility and for the augmentation of
gonadotropin
(especially FSH and/or LH) production and/or release.
As used herein the term "Kiss-1 derived protein" is intended to
encompass any protein that is derived from the sequence of SEQ ID N0:2, is a
fragment of SEQ ID N0:2, or an analog or conservative variant of a protein of
SEQ
ID N0:2 that has any agonist effect on a GPCR54 receptor. or a variant of a
GPCR54
receptor. In the present invention a Kiss-1 derived peptide having the
sequence of
~~NWNSFGLRF (SEQ ID N0:3) is a particularly preferred kisspeptin that may be
used in the treatment of infertility. However, it should be understood that
any variant,
analog or fragment of SEQ ID N0:2 may be used in the methods of the present
invention. Indeed, it has been found that RFamide peptides derived from Kiss-1
protein as short as 5 amino acids in length possess activity as agonists of
GPCR54.
Thus, it is contemplated that sequences such as FGLRF (SEQ ID NO:7); SFGLRF
(SEQ ID N0:8); NSFGLRF (SEQ ZD N0:9); WNSFGLRF (SEQ ID N0:10);
NWNSFGLRF (SEQ IZ? NO:11 ) or variants or analogs thereof that possess
receptor
agonist activity will be useful in the present invention.
Other specific kisspeptins that may be useful herein include but are not
limited to a fragment of Kiss-1 having amino acids 93-121 of SEQ ID NO:1,
wherein
the C-terminus of the fragment is RFamide derived from the RF at positions 120-
121
of SEQ ID NO:1; a fragment of Kiss-1 having amino acids 106-121 of SEQ ID
NO:1,
wherein the C-terminus of the fragment is RFamide derived from the RF at
positions
120-121 of SEQ ID NO:1, wherein the C-terminus of the fragment is RFamide
derived from the RF at positions 120-121 of SEQ ID NO:1, a fragment of Kiss-1
to
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
having amino acids 108-121 of SEQ ID NO:1, wherein the C-terminus of the
fragment is RFamide derived from the RF at positions 120-121 of SEQ 1D NO:1, a
fragment of Kiss-1 having amino acids 68-121 of SEQ ID NO:1, wherein the C- .
terminus of the fragment is RFamide derived from the RF at positions 120-121
of
SEQ ID N0:1; a fragment of Kiss-1 having amino acids 94-121 of SEQ ID NO:1,
wherein the C-terminus of the fragment is RFamide derived from the RF at
positions
120-121 of SEQ ID NO:1; a fragment of Kiss-1 having amino acids 107-121 of SEQ
ID NO:1, wherein the C-terminus of the fragment is RFamide derived from the RF
at
positions 120-121 of SEQ ID NO:l; a fragment of Kiss-1 having amino acids 109-
121
of SEQ ID NO:1, wherein the C-terminus of the fragment is RFamide derived from
the RF at positions 120-121 of SEQ ~ NO:l; a fragment of Kiss-1 having amino
acids 112-121 of SEQ ID NO:1, wherein the C-terminus of the fragment is
RFamide
derived from the RF at positions 120-121 of SEQ ID NO:1; and a fragment of
Kiss-1
having.amino acids 114-121 of SEQ ID NO:1, wherein the C-terminus of the
fragment is RFamide derived from the RF at positions 120-12i of SEQ ID NO:1.
In preferred embodiments, the peptide may comprise amino acids 110-
121 of SEQ ID NO:1; amino acids 109-121 of SEQ ID NO:1, 108-12I of SEQ ID
NO:1; 107-121 of SEQ ID NO:1; 106-121 of SEQ U~ NO:1; 105.-121 of SEQ ID
NO:l; 104-121 of SEQ ~ NO:1; 103-121 of SEQ ID NO:1; 102-121 of SEQ 117
NO:1; 101-121 of SEQ ID NO:1; 100-121 of SEQ ID NO:1; 99-121 of SEQ ID NO:1;
98-121 of SEQ ID NO:1; 97-121 of SEQ ID NO:1; 96-121 of SEQ ID NO:1; 95-121
of SEQ ID N0:1; 94-121 of SEQ ID NO:1; 93-121 of SEQ ID NO:1; 92-121 of SEQ
ID NO:1; 91-121 of SEQ ID NO:1; 90-121 of SEQ ID NO:1; 89-121 of SEQ ID
NO:1; 88-121 of SEQ ID NO:1; 87-121 of SEQ ID NO:l; 86-121 of SEQ 117 NO:1;
85-121 of SEQ ID NO:1; 84-121 of SEQ ID NO:1; 83-121 of SEQ ID NO:l; 82-121
of SEQ ID NO:1; 81-121 of SEQ ID NO:1; 80-121 of SEQ ID N0:1; 79-121, of SEQ
ID NO:1; 78-121 of SEQ ID NO:1; 77-121 of SEQ ID NO:1; 76-121 of SEQ ID
NO:1; 75-121 of SEQ ID NO:1; 74-121 of SEQ ID NO:l; 73-121 of SEQ 117.N0:1; .
72-121 of SEQ II7 NO:1; 71-121 of SEQ ID NO:1; 70-121 of SEQ ID NO:1; 69-121
of SEQ ID NO:l; 68-121 of SEQ ID NO:1; 67-121 of SEQ ID N0:1; 66-121 of SEQ
ID NO:1; 65-121 of SEQ B7 NO:1; 64-121 of SEQ ID NO:1; 63-121 of SEQ ID
NO:1; 62-121 of SEQ ll7 N0:1; 61-121 of SEQ ID N0:1; 60-121 of SEQ ID NO:1;
59-121 of SEQ ID NO:1; 58-121 of SEQ ID NO:l; 57-121 of SEQ ID NO:1; 56-121
11
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
of SEQ ID NO:l; 55-121 of SEQ ID NO:l; 54-121 of SEQ ID NO:1; 53-121 of SEQ
ID NO:l; 52-121 of SEQ ID NO:1; 51-121 of SEQ ID NO:1; 50-121 of SEQ ID
NO:1; 49-121 of SEQ ID NO:1; 48-121 of SEQ ll~ NO:1; 47-121 of SEQ ID NO:1;
46-121 of SEQ ID NO:1; 45-121 of SEQ ID NO:1; 44-121 of SEQ ID NO:1; 43-121
of SEQ ID NO:1; 42-121 of SEQ ID NO:l; 41-121 of SEQ ID NO:1; 40-121 of SEQ
ID NO:1; 39-121 of SEQ ID NO:1; 38-121 of SEQ ID N0:1; 37-121 of SEQ ID
NO:1; 36-121 of SEQ ID NO:1; 35-121 of SEQ ID NO:1; 34-121 of SEQ )I~ NO:1;
33-121 of SEQ ID NO:1; 32-121 of SEQ ID NO:1; 31-121 of SEQ ID NO:1; 30-121
of SEQ ID NO:1; 29-121 of SEQ ID NO:1; 28-121 of SEQ ID NO:1; 27-121 of SEQ
D7 NO:1; 26-121 of SEQ ID NO:l; 25-121 of SEQ ID NO:1; 24-121 of SEQ ID
NO:1; 23-121 of SEQ ID N0:1; 22-121 of SEQ ID NO:1; 21-121 of SEQ ID NO:1;
20-121 of SEQ ID N0:1; 19-121 of SEQ ID NO:1; 18-121 of SEQ ID NO:1; 17-121
of SEQ ID NO:l; 16-121 of SEQ ID NO:1; 15-121 of SEQ ID NO:1; 14-121 of SEQ
ID NO:1; 13-121 of SEQ ID NO:1; 12-121 of SEQ ID NO:1; 11-121 of SEQ ID
NO:1; 10-121 of SEQ ID NO:1; 9-121 of SEQ ID N0:1; 8-121 of SEQ ID NO:1; 7-
121 of SEQ ID NO:1; 6-121 of SEQ ID N0:1; 5-121 of SEQ ID NO:1; 4-121 of SEQ
ID NO:1; 3-121 of SEQ ID NO:1; 2-121 of SEQ ID NO:1; and 1-121 of SEQ ID
NO:l.
A particularly preferred peptide of the present invention is a peptide
having the sequence of SEQ ID N0:3. However, it is also contemplated that
conservative substitution of amino acid residues of this peptide also may be
produced
that nonetheless retain the three-dimensional conformation structure of the
peptide of
SEQ ID N0:3 and/or retain the functional activity of the peptide of SEQ ID
NO:3 as
an agonist of a GPCR54 receptor andlor stimulant of FSH and/or LH production.
The
term "conservative substitution" as used herein denotes the replacement of an
amino
acid residue by another, biologically similar residue with respect to
hydrophobicity,
hydrophilicity, cationic charge, anionic charge, shape, polarity,
conforrilational
tendency, and the like. Examples of conservative substitutions include the
substitution of one hydrophobic residue such as isoleucine, valine, leucine,
alanine,
cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine or
methionine for another, or the substitution of one polar residue for another,
such as
the substitution of arginine for lysine, glutamic acid for aspartic acid, or
glutamine for
asparagine, and the like. Neutral hydrophilic amino acids which can be
substituted
12
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
for one another include asparagine, glutamine, serine and threonine. The term
"conservative substitution" also includes the use of a substituted or modified
amino
acid in place of an unsubstituted parent amino acid provided that antibodies
raised to
the substituted polypeptide also immunoreact with the unsubstituted
polypeptide. By
"substituted" or "modified" the present invention includes those amino acids
that have
been altered or modified from naturally occurring amino acid.
As such, it should be understood that in the context of the present
invention, a conservative substitution is recognized in the art as a
substitution of one
amino acid for another amino acid that has similar properties. Exemplary
conservative substitutions are set out in e.g., Alternatively, conservative
amino acids
can be grouped as described iri Lehninger, [Biochemistry, Second Edition;
Worth
Publishers, Inc. NY:NY (1975), pp.71-77]. Those of skill in the art are aware
of
numerous tables that indicate specific conservative substitutions. One
exemplary
such table is provided below:
Table of Exemplary
Conservative
Substitutions
Original Exemplary Substitution
Residue
Ala (A) Val, Leu, Ile
Arg (R) Lys, Gln, Asn
Asn (I~ Gln, His, Lys, Arg
Asp (D) Glu
Cys (C) Ser
Gln (~) Asn
Glu (E) Asp
His (H) Asn, Gln, Lys, Arg
Ile (I) Leu, Val, Met, Ala,
Phe,
Leu (L) Ile, Val, Met, Ala,
Phe
Lys (K) Arg, Gln, Asn
Met (M) Leu, Phe,. Ile
Phe (F) Leu, Val, Ile, Ala
13
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
Pro (P) Gly
Ser (S) T~'
Thr (T) Ser
Trp (W) TY1'
Tyr (Y) Trp, Phe, Thr, Ser
Val (V) Ile, Leu, Met, Phe, Ala
Any conservative variant of YNWNSFGLRF.(SEQ ID N0:3) is
contemplated to be a useful peptide of the present invention as long as such a
variant
retains its property of being an agonist of a GPCR54 and/or the ability to
stimulate
FSH .andlor LH production. Such activities may be readily assessed as
described
herein below.
Other novel peptides include mutants of any of the sequences
discussed herein above that has similar conformational tendencies. The
similarity of
conformational tendencies of amino acids can be obtained by comparing their
Ramachandran plots, as shown in the following table:
Table: Similarity of amino acids in terms of conformational tendencies
OriginalHi chlvmilar Medial lar Lowl dues
ALA GLU si residues simi residues similar PRO
ARG GLN HIS TYR MET resi GLY
LEU SER ASN ASP
PHE CYS THR TRP
LYS ILE
VAL
ARG LYSHISGLN PHEGLULEUTYRTRPALACYSMETTHRSERVALILEASNASPPRO GLY
ASN HISASPPHE TYRSERGLNARGCYSALAGLULEULYSMETTRPTHRILEVALPRO GLY
ASP ASNHISARG ALAPHESERGLUGLNLYSTYRLEUCYSMETTHRTRPVALILEPRO GLY
CYS TRPGLNMET HISTYRPHEARGLEUGLUVALLYSILEALAASNTHRSERASPPRO GLY
GLN PHEHISARG GLULYSCYSLEUMETTYRTRPVALILEALATHRASNSERASPPRO GLY
GLU GLNARGLYS LEUPHEALATYRHISTRPTHRVALCYSMETILESERASNASPPRO GLY
GLY ALASERASP GLUASNLYSTHRARGPHELEUHISTYRGLNCYSMETTRPVALILE PRO
HIS PHEGLNARG TYRCYSLYSLEUASNMETGLUTRPALATHRILEVALSERASPPRO GLY
ILE VALMETTRP LEUGLNPHEGLUTYRLYSTHRHISARGCYSALAASNSERASPPRO GLY
LEU LYSARGPHE GLNGLUHISILETYRMETTRPVALALATHRCYSASNSERASPPRO GLY
LYS ARGLEUGLN GLUPHETYRHISALAMETTHRILETRPCYSVALASNSERASPPRO GLY
MET TRPVALGLN CYSILEPHELEUHISARGTYRLYSGLUTHRALAASNSERASPPRO GLY
PHE HISGLNTYR ARGLEULYSTRPMETGLUCYSVALASNILEALATHRSERASPPRO GLY
PRO ILEVALMET TRPLEUGLNCYSARGTHRGLULYSALAHIS.PHETYRASNSERASP GLY
SER ALAASNARG HISGLUTYRPHEGLNTHRLEULYSASPCYSMETTRPVALILEPRO GLY
THR VALLEUTYR GLUARGLYSGLNILEHISPHEMETTRPALACYSSERASNASPPRO GLY
TRP METCYSGLN ILEPHEARGVALTYRLEUGLUHISLYSTHRALAASNSERASPPRO GLY
TYR PHEHISGLN LYSARGCYSLEUGLUTRPASNMETALATHRILEVALSERASPPRO GLY
VAL ILEMETTRP GLNPHELEUTHRGLUCYSARGTYRLYSHISALASERASNASPPRO GLY
In addition to the basic amino acid structure of the peptides, it is
contemplated that the Kiss-1 derived proteinslpeptides may be modified to
enhance
their uptake, circulation, and/or other modifications to render the peptides
more
14
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
therapeutically effective. For example, it has been discovered herein that
kisspeptins
and Kiss-1 derived proteins have a beneficial effect on stimulating fertility
related
hormones by acting on sites within the central nervous system, and likely
within the
blood brain barrier. Therefore, any modification that allows the
targeting/uptake of
the peptides/protein to a site within the H-P-G axis will be useful.
For example, it may be desirable to prevent the degradation of the
peptides in order to prolong the effects thereof. This may be achieved through
the use
of non-hydrolyzable peptide bonds, which are known in the art, along with
procedures
for synthesis of peptides containing such bonds. Non-hydrolyzable bonds
include --
[CHZNH]-- reduced amide peptide bonds, --[COCH2 ]-- ketomethylene peptide
bonds,
--[CH(CN)NH]-- (cyanomethylene)amino peptide bonds, --[CH2 CH(OH)]--
hydroxyethylene peptide bonds, --[CH20]-- peptide bonds, and --[CHI S]--
thiomethylene peptide bonds (see e.g., U.S. Patent 6,172,043), and peptoids.
Peptoids
are N-substituted glycines that can be used to optimize uptake of a drug agent
of
interest. Peptoids have been used to create cationic lipid-like compounds
(Murphy et
al., Proc. Natl. Acad. Sci. 95:1 S 17, 1998) and can be synthesized using
standard
methods (e.g., Zuckennann et al. J. Am. Chem. Soc. 114:10646, 1.992;
Zuckermann et
al. Int. J. Peptide Protein Res. 40:497, 1992). Combinations of cationic
lipids and
peptoids, liptoids, can also be used to optimize uptake of the subject
compositions
(Hunag et al. Chemistry and Biology. 5:345, 1998). Liptoids can be synthesized
by
elaborating peptoids and coupling the amino terminal submonomer to a lipid via
its
amino group (Hunag et al. Chemistry and Biology, 5:345, 1998). Those of skill
in the
art are referred to e.g., U.S. Patent Publication No. 20030187188
(incorporated herein
by reference), which describes the synthesis of peptoid substituted compounds.
Methods of making peptoid containing serine protease inhibitors are described
in U.S.
Patent No. 6,548,638; U.S. Patent Publication No. 20030176642 (incorporated
herein
by reference).
Kiss-1 derived proteins useful in the invention can be linear, or maybe
circular or cyclized by natural or synthetic means. For example, disulfide
bonds
between cysteine residues may cyclize a peptide sequence. Bifunctional
reagents can
be used to provide a linkage between two or more amino acids of a peptide.
Other
methods for cyclization of peptides, such as those described by Anwer et al.
(Int. 3
is
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
Pep. Protein Res. 36:392-399, 1990) and Rivera--Baeza et al. (Neuropeptides
30:327-
333, 1996) are also known in the art.
Rational drug design may be used to produce structural analogs of the
presently known biologically active Kiss-1 derived polypeptides. By creating
such
analogs, it is possible to fashion Kiss-1 derived proteins which are more
active or
stable than the natural molecules which have different susceptibility to
alteration or
which may affect the function of various other molecules. In one approach, one
would generate a three-dimensional structure for Kiss-1 derived protein of
interest or
a fragment thereof e.g., this can be accomplished by x-ray crystallography,
computer
modeling or by a combination of both approaches. An alternative approach,
"alanine
scan," involves the random replacement of residues throughout molecule with
alanine,
and the resulting affect on function determined.
Multiple sequence alignment of Kiss-1 and 'its sequence analogs such
as those from different species or those of related ligand family provide
further
guidance of rational substitutions. The residues in the Kiss-1 sequence may be
substituted by the corresponding residues from the related sequence from a
different
species or related ligand family.
It also is possible to isolate a Kiss-1-specific antibody, selected by a
functional assay, and then solve its crystal structure. In principle, this
approach yields
a pharmacore upon which subsequent drug design can be based. It is possible to
bypass protein crystallography altogether by generating anti-idiotypic
antibodies to a
functional, pharmacologically active antibody. As a mirror image of a mirror
image,
the binding site of anti-idiotype would be expected to be an analog of the
original
antigen. The anti-idiotype could then be used to identify and isolate peptides
from
banks of chemically- or biologically-produced peptides. Selected peptides
would then
serve as the pharmacore. Anti-idiotypes may be generated by producing
antibodies
specific for Kiss-1 and then using such an antibody as the antigen.
Thus, one may design drugs which have improved Kiss-1 derived
protein activity or which act as stimulators, agonists, of Kiss-1 protein or
the GPCR54
receptor. By virtue of the availability of cloned Kiss-1 sequences, sufficient
amounts,
of various Kiss-1 derived proteins can be produced to perform crystallographic
16
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
studies. In addition, knowledge of the polypeptide sequences permits computer
employed predictions of structure-function relationships.
Furthermore, nonpeptide analogs of Kiss-1 derived proteins which
provide a stabilized structure or lessened biodegradation, are also
contemplated.
Peptide mimetic analogs can be prepared based on a Kiss-1 derived protein by
replacing one or more amino acid residues of the protein of interest by
nonpeptide
moieties. Preferably, the nonpeptide moieties permit the peptide to retain its
natural
confirmation, or stabilize a preferred, e.g., bioactive, confirmation. One
example of -
methods for preparation of nonpeptide mimetic analogs from peptides is
described in
Nachman et al., Regul. Pept. 57:359-370 (1995). Peptide as used herein
embraces all
. . of the foregoing.
The Kiss-1 derived proteins used in the therapeutic methods of the
present invention may be modified in order to improve their therapeutic
efficacy.
Such modification of therapeutic compounds may be used to decrease toxicity,
increase circulatory time, or modify biodistribution. For example, the
toxicity of
potentially important therapeutic compounds can be decreased significantly by
combination with a variety of drug earner vehicles that modify
biodistribution. An
elegant example is the recently approved Wyeth-Ayerst chemotherapeutic
MylotargTM, which is composed of the potent cytotoxic agent calicheamicin
linked to
an antibody that is targeted to CD33 (found on the surface of certain leukemic
cells).
This antibody-drug conjugate had a dramatically improved therapeutic index
versus
the free drug. The Kiss-1 derived proteins have their therapeutic effect on
the H-P-G
axis by acting on the pituitary in order to stimulate FSH production and/or
release. As
such, any modification that allows the peptide to be taken up and have an
effect along
the H-P-G axis will be useful.
A strategy for improving drug viability is the utilization of water-
soluble polymers. Various water-soluble polymers have been shown to modify
biodistribution, improve the mode of cellular uptake, change the permeability
through
physiological barriers, and modify the rate of clearance from the body.
(Greenwald et
al., Crit Rev Therap Drug Carrier Syst. 2000;17:101-161; Kopecek et al., J
Controlled
Release., 74:147-15~, 2001). To achieve either a targeting or sustained-
release effect,
water-soluble polymers have been synthesized that contain drug moieties as
terminal
groups, as part of the backbone, or as pendent groups on the polymer chain.
17
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
Polyethylene glycol (PEG), has been widely used as a drug Garner,
given its high degree of biocompatibility and ease of modification. Harris et
al., Clin
Pharmacokinet. 2001;40(7):539-51 Attachment to various drugs, proteins, and
liposomes has been shown to improve residence time and decrease toxicity. .
(Greenwald et al., Crit Rev Therap Drug Carner Syst. 2000;17:101-161; Zalipsky
et
al., Bioconjug Chem. 1997;8:111-118). PEG can be coupled to active agents
through
the hydroxyl groups at the ends of the chain and via other chemical methods;
however, PEG itself is limited to at most two active agents per molecule. In a
different approach, copolymers of PEG and amino acids were explored as novel
biomaterials which would retain the .biocompatibility properties of PEG, but
which
would have the added advantage of numerous attachment points per molecule
(providing greater drug loading), and which could be synthetically designed to
suit a
variety of applications (Nathan et al.,.Macromolecules. 1992;25:4476-4484;
Nathan et
al., . Bioconj Chem. 1993;4:54-62).
Those of skill in the art are aware of PEGylation techniques for the
effective modification of drugs. For example, drug delivery polymers that
consists of
alternating polymers of PEG and tri-functional monomers such as lysine and
cysteine
have been used by VectraMed (Plainsboro, NJ) or Shearwater (NJ). The PEG
chains
(typically 2000 daltons or less) are linked to the a- and e-amino groups of
lysine
through stable urethane linkages. Such copolymers retain the desirable
properties of
PEG, while providing reactive pendent groups (the carboxylic acid groups of
lysine)
at strictly controlled and predetermined intervals along the polymer chain.
The
reactive pendent groups can be used for derivatization, cross-linking, or
conjugation
with other molecules. These polymers are useful in producing stable, long-
circulating
pro-drugs by varying the molecular weight of the polymer, the molecular weight
of
the PEG segments, and the cleavable linkage between the drug and the polymer.
The
molecular weight of the PEG segments affects the spacing of the drug/linking
group
complex and the amount of drug per molecular weight of conjugate (smaller PEG
segments provides greater drug loading). In general, increasing the overall
molecular
weight of the block co-polymer conjugate will increase the circulatory half
life of the
conjugate. Nevertheless, the conjugate must either be readily degradable or
have a
molecular weight below the threshold-limiting glomular filtration (e.g., less
than 45
is
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
kDa). Thus, PEgylated Kiss-1 derived peptides of the invention should
preferably be
in the range of between 20kDa and 35 kDa in molecular weight.
The effective modification of drugs is not limited to the PEGylation
techniques. Glycosylation of the molecule, fusion to another molecule, such as
antibodies or human serum albumin or the combinations are examples of other
modifications that may be used to facilitate a more effective or efficient
drug delivery.
In addition, to the polymer backbone being important in maintaining
circulatory half life, and biodistribution, linkers may be used to maintain
the
therapeutic agent in a pro-drug form until released from the backbone polymer
by a
specific trigger, typically enzyme activity in the targeted tissue. For
example, this
type of tissue activated drug delivery is particularly useful where delivery
to a specific
site of biodistribution is required and the therapeutic agent is released at
or near the
site of pathology. Linking group libraries for use in activated drug delivery
are
known to those of skill in the art and may be based on enzyme kinetics,
prevalence of
1 S active enzyme, and cleavage specificity of the selected disease-specific
enzymes (see
e.g., technologies of established by VectraMed, Plainsboro, NJ). Such linkers
may be
used in modifying the Kiss-1 derived proteins described herein for therapeutic
delivery.
METHODS OF MAKING KISS-1 DERIVED PEPTIDES
The present invention provides proteins and peptides for use iri
medicaments for the treatment of infertility. Such proteins or peptides may be
produced by conventional automated peptide synthesis methods or by recombinant
expression. General principles for designing and making proteins are.well
known to
those of skill in the art.
A. Automated Solid-Phase Peptide Synthesis
The peptides or indeed even the full length Kiss-l~~of the invention can
be synthesized in solution or on a solid support in accordance with
conventional
techniques. Various automatic synthesizers are commercially available and can
be
used in accordance with known protocols. See, for example, Stewart and Young,
Solid Phase Peptide Synthesis, 2d. ed., Pierce Chemical Co., (1984);Tam et
al., J. Arn.
Chem. Soc., 105:6442, (1983); Mernfield, Science, 232: 341-347, (1986); and
Barany
19
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
and Merrifield, The Peptides, Gross and Meienhofer, eds, Academic Press, New
York, 1-2~4, (1979), each incorporated herein by reference. The novel Kiss-1
derived
proteins of the invention can be readily synthesized and then screened in
GPCR54
receptor binding/activity assays.
For example, the peptides may be synthesized by solid-phase
technology employing an exemplary peptide synthesizer such as a Model 433A
from
Applied Biosystems Inc. The purity of any given peptide substrate, generated
through
automated peptide synthesis or through recombinant methods may be determined
using reverse phase HPLC analysis. Chemical authenticity of each peptide may
be
established by any method well known to those of skill in the art. In
preferred
embodiments, the authenticity may be established by mass spectrometry.
Additionally, the peptides may be quantitated using amino acid analysis in
which
microwave hydrolyses are conducted. Such analyses may use a microwave oven
such
as the CEM Corporation's MDS 2000 microwave oven. The peptide (approximately
2 ~.g protein) is contacted with e.g., 6 N HCl (Pierce Constant Boiling e.g.,
about 4
ml) with approximately 0.5% (volume to volume) phenol (Mallinckrodt). Prior to
the
hydrolysis, the samples are alternately evacuated and flushed with Na. The
protein
hydrolysis is conducted using a two-stage process. During the first stage, the
peptides
are subjected to a reaction temperature of about 100°C and held that
temperature for 1
minute. Immediately after this step, the temperature is increased to 1
SO°C and held at
that temperature for about 25 minutes. After cooling, the samples are dried
and amino
acid from the hydrolysed peptides samples are derivatized using 6-
aminoquinolyl-N-
hydroxysuccinimidyl carbamate to yield stable ureas that fluoresce at 395 nm
(Waters
AccQ Tag Chemistry Package). The samples may be analyzed by reverse phase
HPLC and quantification may be achieved using an enhanced integrator.
B. Recombinant Protein Production.
As an alternative to automated peptide synthesis, recombinant DNA
technology may be employed wherein a nucleotide sequence which encodes a
peptide
of the invention is inserted into an expression vector, transformed or
transfected into
an appropriate host cell and cultivated under conditions suitable for
expression as
described herein below. Recombinant methods are especially preferred for
producing
longer polypeptides that comprise peptide sequences of the invention.
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
A variety of expression vectorlhost systems may be utilized to contain
and express the peptide or protein coding sequence. These include but are not
limited
to microorganisms such as bacteria transformed with recombinant bacteriophage,
plasmid or cosmid DNA expression vectors; yeast transformed with yeast
expression
vectors;'insect cell systems infected with virus expression vectors (e.g.,
baculovirus);
plant cell systems transfected with virus expression vectors (e.g.,
cauliflower mosaic
virus, CaMV; tobacco mosaic virus, TMV) or transformed with bacterial
expression
vectors (e.g., Ti or pBR322 plasmid); or animal cell systems. Mammalian cells
that
axe useful in recombinant protein productions include but are not limited to
VERO
cells, HeLa cells, Chinese hamster ovary (CHO) cell lines, COS cells (such as
COS-
7), W138, BHK, HepG2, 3T3, RIN, MDCK, A549, PC12, K562 and 293 cells.
Exemplary protocols for the recombinant expression of the peptide substrates
or
fusion polypeptides in bacteria, yeast and other invertebrates are known to
those of
skill in the art and a briefly described herein below.
Expression vectors for use in prokaryotic hosts generally comprise one
or more phenotypic selectable marker genes. Such genes generally encode, e.g.,
a
protein that confers antibiotic resistance or that supplies an auxotrophic
requirement.
A wide variety of such vectors axe readily available from commercial sources.
Examples include pSPORT vectors, pGEM vectors (Promega), pPROEX vectors
(LTI, Bethesda, MD), Bluescript vectors (Stratagene), pET vectors (Novageri)
and
pQE vectors (Qiagen). The DNA sequence encoding the given peptide substrate or
fusion polypeptide is amplified by PCR and cloned into such a vector, for
example,
pGEX-3X (Pharmacia, Piscataway, NJ) designed to produce a fusion protein
comprising glutathione-S-transferase (GST), encoded by the vector, and a
protein
encoded by a DNA fragment inserted into the vector's cloning site. The primers
for
the PCR may be generated to include for example, an appropriate cleavage site.
Treatment of the recombinant fusion protein with thrombin or factor Xa
(Pharmacia,
Piscataway, NJ) is expected to cleave the fusion protein, releasing the
substrate or
substrate containing polypeptide from the GST portion. The pGEX-3X/Kiss-1
peptide construct is transformed into E. coli XL-1 Blue cells (Stratagene, La
Jolla
CA), and individual transformants were isolated and grown. Plasmid DNA from
individual transformants is purified and partially sequenced using an
automated
sequencer to confirm the presence of the desired peptide or polypeptide
encoding
21
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
nucleic acid insert in the proper orientation. If the GST/Kiss-1 derived
protein fusion
protein is produced in bacteria as a soluble protein, it may be purified using
the GST
Purification Module (Pharmacia Biotech).
Alternatively, the DNA sequence encoding the predicted substrate
containing fusion polypeptide may be cloned into a plasmid containing a
desired
promoter and, optionally, a leader sequence (see, e.g., Better et al.,
Science,
240:1041-43, 1988). The sequence of this construct may be confirmed by
automated
sequencing. The plasmid is then transformed into E. coli using standard
procedures
employing CaClz incubation and heat shock treatment of the bacteria (Sambrook
et
al., supra). The transformed bacteria are grown in LB medium supplemented with
carbenicillin, and production of the expressed protein is induced by growth in
a
suitable medium. If present, the leader sequence will effect secretion of the
mature
Kiss-1 peptide or fusion protein and be cleaved during secretion.
The secreted recombinant protein is purified from the bacterial culture
media by the method described herein throughout. Similar systems for the
recombinant protein in yeast host cells are readily commercially available,
e.g., the
Pichia Expression System (Tnvitrogen, San Diego, CA), following the
manufacturer's
instructions. Another alternative recombinant production may be achieved using
an
insect system. Insect systems for protein expression are well known to those
of skill in
the art. In one such system, Autographs californica nuclear polyhedrosis virus
(AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda
cells
or in Trichoplusia larvae. The Kiss-1 coding sequence is cloned into a
nonessential
region of the virus, such as the polyhedrin gene, and placed under control of
the
polyhedrin promoter. Successful insertion of Kiss-1 will render the polyhedrin
gene
inactive and produce recombinant virus lacking coat protein coat. The
recombinant
viruses are then used to infect S. frugiperda cells or Trichoplusia larvae in
which the
Kiss-1 is expressed (Smith et al., J Virol 46: 584, 1983; Engelhard EK et al.,
Proc Nat
Acad Sci 91: 3224-7, 1994).
Mammalian host systems for the expression of recombinant proteins
also are well known to those of skill in the art. Host cell strains may be
chosen for a
particular ability to process the expressed protein or produce certain post-
translation
modifications that will be useful in providing protein activity. Such
modifications of
the polypeptide include, but are not limited to, acetylation, carboxylation,
22
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
glycosylation, phosphorylation, lipidation and acylation. Post-translational
processing
which cleaves a "prepro" form of the protein may also be important for correct
insertion, folding and/or function. Different host cells such as CHO, HeLa,
MDCK.,
293, WI38, and the like have specific cellular machinery and characteristic
mechanisms for such post-translational activities and may be chosen to ensure
the
correct modification and processing of the introduced, foreign protein.
It is preferable that the transformed cells are used for long-term, high-
yield protein production and as such stable expression is desirable. Once such
cells
are transformed with vectors that contain selectable markers along with the
desired
expression cassette, the cells may be allowed to grow for 1-2 days in an
enriched
media before they are switched to selective media. The 'selectable marker is
designed
to confer resistance to selection and its presence allows growth and recovery
of cells
which successfully express the introduced sequences. Resistant clumps of
stably
transformed cells can be proliferated using tissue culture techniques
appropriate to the
cell.
A number of selection systems may be used to recoventhe cells that
have been transformed for recombinant protein production. Such selection
systems
include, but are not limited to, HSV thymidine kinase, hypoxanthine-guanine
phosphoribosyltransferase and adenine phosphoribosyltransferase genes, in tk-,
hgprt-
or aprt- cells, respectively. Also, anti-metabolite resistance can be used as
the basis of
selection for dhfr, which confers resistance to methotrexate; gpt, which
confers
resistance to mycophenolic acid; neo, which confers resistance to the
aminoglycoside
6418; als which confers resistance to chlorsulfuron; and hygro, which confers
resistance to hygromycin. Additional selectable genes that may be useful
include
trpB, which allows cells to utilize indole in place of tryptophan, or hisD,
which allows
cells to utilize histinol in place of histidine. Markers that give a visual
indication for
identification of transformants include anthocyanins, b-glucuronidase and its
substrate, GUS, and luciferase and its substrate, luciferin.
C. Expression Constructs for Recombinant Protein Production
In the recombinant production of the Kiss-1 derived proteins of the
invention, it would be necessary to employ vectors comprising polynucleotide
molecules for encoding the Kiss-1 derived proteins. Methods of preparing such
23
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
vectors as well as producing host cells transformed with such vectors are well
known
to those skill in the art. The polynucleotide molecules used in such an
endeavor may
be joined to a vector, which generally includes a selectable marker and an
origin of
replication, for propagation in a host. These elements of the expression
constructs are
well known to those of skill in the art. Generally, the expression vectors
include
DNA encoding the given protein being operably linked to suitable
transcriptional or
translational regulatory sequences, such as those derived from a mammalian,
microbial, viral, or insect gene. Examples of regulatory sequences include
transcriptional promoters, operators, or enhancers, mRNA ribosomal binding
sites,
and appropriate sequences which control transcription and translation.
The terms "expression vector," "expression construct " or "expression
cassette " are used interchangeably throughout this specification and are
meant to
include any type of genetic construct containing a nucleic acid coding.for a
gene
product in which part or all of the nucleic acid encoding sequence is capable
of being
transcribed.
The choice of a suitable expression vector for expression of the
peptides or polypeptides of the invention will of course depend upon the
specific host
cell to be used, and is within the skill of the ordinary artisan. Methods for
the
construction of mammalian expression vectors are disclosed, for example, in
Okayama and Berg (Mol. Cell. Biol. 3:280 (1983)); Cosman et al. (Mol. Immunol.
23:935 (1986)); Cosman et al. (Nature 312:768 (1984)); EP-A-0367566; and WO
91/18982.
The expression construct rnay further comprise a selectable marker that
allows for the detection of the expression of a peptide or polypeptide.
Usually the
inclusion of a drug selection marker aids in cloning and in the selection of
transformants, for example,meomycin, puromycin, hygromycin, DHFR, zeocin and
histidinol. Alternatively, enzymes such as herpes simplex virus thymidine
kinase (tk)
(eukaryotic), b-galactosidase, luciferase, or chloramphenicol
acetyltransferase (CAT)
(prokaryotic) may be employed. Immunologic markers also can be employed. For
example, epitope tags such as the FLAG system (IBI, New Haven, CT), HA and the
6xHis system (Qiagen, Chatsworth, CA) may be employed. Additionally,
glutathione
S-transferase (GST) system (Pharmacia, Piscataway, NJ), or the maltose binding
' protein system (NEB, Beverley, MA) also may be used. The selectable marker
24
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
employed is not believed to be important, so long as it is capable of being
expressed
simultaneously with the nucleic acid encoding a gene product. Further examples
of
selectable markers are well known to one of skill in the art.
Expression requires that appropriate signals be provided in the vectors,
such as enhancers/promoters from both viral and mammalian sources that may be
used to drive expression of the nucleic acids of interest in host cells.
Usually, the
nucleic acid being expressed is under transcriptional control of a promoter. A
"promoter" refers to a DNA sequence recognized by the synthetic machinery of
the
cell, or introduced synthetic machinery, required to initiate the specific
transcription
of a gene. Nucleotide sequences are operably linked when the regulatory
sequence
functionally relates to the DNA encoding the peptide substrate. or the fusion
polypeptide. Thus, a promoter nucleotide sequence is operably linked to a
given
DNA sequence if the promoter nucleotide sequence directs the transcription of
the
sequence. Similarly, the phrase "under transcriptional control" means that the
promoter is in the correct location and orientation in relation to the nucleic
acid to
control RNA polymerase initiation and expression of the gene. Any promoter
that
will drive the expression of the nucleic acid may be used. The particular
promoter
employed to control the expression of a nucleic acid sequence of interest is
not
believed to be important, so long as it is capable of directing the expression
of the
nucleic acid in the targeted cell. Thus, where a human cell is targeted, it is
preferable
to position the nucleic acid coding region adjacent to and under the control
of a
promoter that is capable of being expressed in a human cell. Generally
speaking, such
a promoter might include either a human or viral promoter. Common promoters
include, e.g., the human cytomegalovirus (CMV) immediate early gene promoter,
the
SV40 early promoter, the Rous sarcoma virus long terminal repeat, [3-actin,
rat insulin
promoter, the phosphoglycerol kinase promoter and glyceraldehyde-3-phosphate
dehydrogenase promoter, all of which are promoters well known and readily
available
to those of skill in the art, can be used to obtain high-level expression of
the coding .
sequence of interest. The use of other viral or mammalian cellular or
bacterial phage
promoters which are well-known in the art to achieve expression of a coding
sequence
of interest is contemplated as well, provided that the levels of expression
are sufficient
for a given purpose. By employing a promoter With well-known properties, the
level
2s
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
and pattern of expression of the protein of interest following transfection or
transformation can be optimized. Inducible promoters also may be used.
Another regulatory element that is used in protein expression is an
enhancer. . These are genetic elements that increase transcription from a
promoter
located at a distant position on the same molecule of DNA. Where an expression
construct employs a cDNA insert, one will typically desire to include a
polyadenylation signal sequence to effect proper polyadenylation of the gene
transcript. Any polyadenylation signal sequence recognized by cells of the
selected
transgenic animal species is suitable for the practice of the invention, such
as human
, or bovine growth hormone and SV40 polyadenylation signals.
Also contemplated as an element of the expression cassette is a
terminator. These elements can serve to enhance message levels and to minimize
read
through from the cassette into other sequences. The termination region which
is
employed primarily will be one selected for convenience; since termination
regions
for the applications such as those contemplated by the present invention
appear to be
relatively interchangeable. The termination region rnay be native with the
transcriptional initiation, may be native to the DNA sequence of interest, or
rnay be
derived for another source.
D. Site-Specific Mutagenesis
2p Site-specific mutagenesis is another technique useful in the preparation
of individual Kiss-1 derived proteins used in the methods of the invention.
This
technique employs specific mutagenesis of the underlying DNA (that encodes the
amino acid sequence that is targeted for modification). The technique further
provides a ready ability to prepare and test sequence variants, incorporating
one or
more of the foregoing considerations, by introducing one or more nucleotide
sequence
changes into the DNA. Site-specific mutagenesis allows the production of
mutants
through the use of specific oligonucleotide sequences that encode the DNA
sequence
of the desired mutation, as well as a sufficient number of adjacent
nucleotides, to
provide a primer sequence of sufficient size and sequence complexity to form a
stable
duplex on both sides of the deletion junction being traversed. Typically, a
primer of
about 17 to 25 nucleotides~in length is preferred, with about S to 10 residues
on both
sides of the junction of the sequence being altered.
26
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
The technique typically employs a bacteriophage vector that exists in
both a single stranded and double stranded form. Typical vectors useful in
site-
directed mutagenesis include vectors such as the M 13 phage. These phage
vectors are
commercially available and their use is generally well known to those skilled
in the .
art. Double stranded plasmids also are routinely employed in.site directed
mutagenesis, which eliminates the step of transferring the gene of interest
from a
phage to a plasmid.
In general, site-directed mutagenesis is performed by first obtaining a.
single-stranded vector, or melting of two strands of a double stranded vector
which
includes within its sequence a DNA sequence encoding the desired protein. An
oligonucleotide primer bearing the desired mutated sequence is synthetically
prepared. This primer is then annealed with the single-stranded DNA
preparation,
taking into account the degree of mismatch when.selecting hybridization
(annealing)
conditions, and subjected to DNA polymerizing enzymes such as E. coli
polymerase I
1 S Klenow fragment, in order to complete the synthesis of the mutation-
bearing strand.
Thus, a heteroduplex is formed wherein one strand encodes the original non-
mutated
sequence and the second strand bears the desired mutation. This heteroduplex
vector
is then used to transform appropriate cells, such as E. coli cells, and clones
are
selected that include recombinant vectors bearing the mutated sequence
arrangement.
Of course, the above-described approach for site-directed mutagenesis
is not the only method of generating potentially useful mutant peptide species
and as
such is not meant to be limiting. The present invention also contemplates
other
methods of achieving mutagenesis such as for example, treating the recombinant
vectors carrying the gene of interest mutagenic agents, such as hydroxylamine;
to
obtain sequence variants. Other examples of generating potentially useful
mutant
peptides include yeast or phage display methods.
E. Protein Purification
It will be desirable to purify the peptides of the present invention.
Protein purification techniques are well known to those of skill in the art.
These
techniques involve, at one level, the crude fractionation of the cellular
milieu to
polypeptide~ and non-polypeptide fractions. Having separated the peptides or
polypeptides of the invention from other proteins, the polypeptides or
peptides of
27
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
interest may be further purified using chromatographic and electrophoretic
techniques
to achieve partial or complete purification (or purification to homogeneity).
Analytical methods particularly suited to the preparation of a pure peptide
are ion-
exchange chromatography, exclusion chromatography; polyacrylamide gel
electrophoresis; isoelectric focusing. A particularly efficient method of
purifying
peptides is fast protein liquid chromatography (FPLC) or even high performance
liquid chromatography (HPLC).
Certain aspects of the present invention concern the purification, and in
particular embodiments, the substantial purification, of an encoded
polypeptide,
protein or peptide. The term "purified polypeptide, protein or peptide" as
used herein,
is intended to refer to a composition, isolated from other components, wherein
the
polypeptide, protein or peptide is purified to any degree relative to its
naturally-
obtainable state. A purified polypeptide, protein or peptide therefore also
refers to a
polypeptide, protein or peptide, free from the environment in which it may
naturally
occur.
Generally, "purified" will refer to a polypeptide, protein or peptide
composition that has been subjected to fractionation to remove various other
components, and which composition substantially retains its expressed
biological
activity. Where the term "substantially purified" is used, this designation
will refer to
a composition in which the polypeptide, protein or peptide forms the major
component of the composition, such as constituting about SO%, about 60%, about
70%, about 80%, about 90%, about 95% or more of the proteins in the
composition.
Various techniques suitable for use in protein purification will be well
known to those of skill in the art. These include, for example, precipitation
with
ammonium sulphate, PEG, antibodies and the like or by heat denaturation,
followed
by centrifugation; chromatography steps such as ion exchange, gel filtration,
reverse
phase, hydroxylapatite and affinity chromatography; isoelectric focusing; gel
electrophoresis; and combinations of such and other techniques. As is
generally
known in the art, it is believed that the order of conducting the various
purification
steps may be changed, or that certain steps may be omitted,. and still result
in a
suitable method for the preparation of a substantially purified polypeptide,
protein or
peptide.
2s
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
METHODS OF DETERMINING GPCR54 RECEPTOR AGON1ST ACTIVITY OF
llISSPEPTINS
As indicated herein above, the Kiss-1 derived proteins of used herein
are agonists of the GPCR54 receptor. This receptor is known to those of skill
in the
art and is encoded by the sequence set~forth in e.g., GenBank accession no.
AY0229541 (incorporated herein by reference). Methods of transfecting cells
e.g.
mammalian cells, with expression constructs that encode such a receptor
expressed on
the surface of the cell are well known in the art. (See, for example, U.S.
Pat. Nos.
5,053,337; 5,155,218; 5,360,735; 5,472,866; 5,476,782; 5,516,653; 5,545,549;
5,556,753; 5,595,880; 5,602,024; 5,639,652; 5,652,113; 5,661,024; 5,766,879;
5,786,155; and 5,786,157, the disclosures ofwhich are hereby incorporated by
reference in their entireties into this application.)
Cells produced by such transfection may readily be used to test the
Kiss-1 derived peptides described herein for binding activity to the orphan
GFCR54
receptor, and to serve as agonists of this receptor. (See, for example, U.S.
Pat. Nos.
5,053,337; 5,155,218; 5,360,735; 5,472,866; 5,476,782; 5,516,653; 5,545,549;
5,556,753; 5,595,880; 5,602,024; 5,639,652; 5,652,113; 5,661,024; 5,766,879;
5,786,155; and 5,786,157, the disclosures of which are hereby incorporated by
reference in their entireties into this application.)
The term "agonist" is used throughout this application to indicate any
Kiss-1 derived protein, peptide or peptide mimetic of a Kiss-1 derived protein
compound which increases the activity of any of the GPCR54 receptor of the
subject
invention. Preferably, such an agent also stimulates the production andlor
release of
FSH andlor LH. Preferably, such a stimulation of release of orie or other of
these
hormones is comparable to a GnRH-stimulated release of one or other of these
hormones. The peptides also may be useful in stimulating GnRH release.
Typically, the receptor binding activity is determined by preparing a
cell or a membrane preparation of a cell transfected with, and expressing a
GPCR54
receptor, or obtaining a cell or a membrane preparation fiom a cell known to
express
said receptor, with the Kiss-1 derived protein to be tested under conditions
permitting
receptor-ligand binding. Exemplary such conditions are provided in e.g.,
Kotani et
al., (J. Biol. Chem. 276(37):34661-34636, 2001). Following assays such as the
29
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
receptor binding assays described in Kotani et al. will readily allow the
determination
of the receptor binding activity of the Kiss-1 derived protein being tested.
Typically,
such an activity may be compared to the binding of the kisspeptins known to
bind the
receptor.
Ligand Binding Assays
The binding properties of the Kiss-1 derived proteins may be tested
using labeled ligand binding assays. For example, cells expressing the orphan
receptor of this invention may be used to test the Kiss-1 proteins of for
activity, for
example, by labeled ligand binding assays. For example, the labeled
kisspeptins such
as those of SEQ ID N0:4, 5 or 6 may be labeled contacted with either membrane
preparations or intact cells expressing the receptor in multi-well microtiter
plates,
together with unlabeled test Kiss-1 proteins to be tested, and binding buffer.
Binding
reaction mixtures are incubated for times and temperatures determined to be
optimal
in separate equilibrium binding assays. Exemplary such assays are given in
Kotani et
al. The reaction is stopped by filtration through GFIB filters, using a cell
harvester, or
by directly measuring the bound ligand. If the ligand was labeled with a
radioactive
isoto a such as 3H 14C 1251 3sS yap s3p etc. the bound li and ma be detected b
P > > > > > a ~ g Y Y
using liquid scintillation counting, scintillation proximity, or any other
method of
detection for radioactive isotopes. If the ligand was labeled with a
fluorescent
compound, the bound labeled ligand may be measured by methods such as, but not
restricted to, fluorescence intensity, time resolved fluorescence,
fluorescence
polarization, fluorescence transfer, or fluorescence correlation spectroscopy.
In this
manner agonist Kiss-1 derived proteins that bind to the orphan receptor may be
identified as they inhibit the binding of the labeled ligand to the membrane
protein or
intact cells expressing the said receptor. Non-specific binding is defined as
the
amount of labeled ligand remaining after incubation of membrane protein in the
presence of a high concentration (e.g., 100-1000 x KD) of unlabeled ligand.
In equilibrium saturation binding assays membrane preparations or
intact cells transfected with the orphan receptor are incubated in the
presence of
increasing concentrations of the labeled compound to determine the binding
affinity
of the labeled ligand. The binding affinities of unlabeled compounds may be
determined in equilibrium competition binding assays, using a fixed
concentration of
labeled compound in the presence of varying concentrations of the displacing
ligands.
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
For example, the Kiss-1 derived proteins of the present invention also may be
competitive inhibitors of the kisspeptins of SEQ 117 NO 4, 5 or 6 or other
naturally
occurnng ligand of GPCR54 receptor for GPCR54 receptor binding. To measure the
relative binding affinities of selected Kiss-1 derived proteins, an ELISA-type
approach may be employed. For example, to examine binding affinity for GPCR54
receptor, serial dilutions of competing kisspeptin of SEQ ID NO: 4, 5, or 6
and a
subsaturating concentration of the candidate Kiss-1 derived peptide tagged
with the
myc epitope is added to microtitre plates coated with GPCR54, and incubated
until
equilibrium is established. The plates are then washed to remove unbound
proteins.
Peptides that remain bound to the receptor-coated plates are detected using an
anti-
myc antibody conjugated to a readily detectable label e.g., horseradish
peroxidase.
Binding affinities (ECSO) can be calculated as the concentration of competing
Kiss-1
derived protein that results in half maximal binding. These values can be
compared
with those obtained from analysis of kisspeptin of SEQ ID NO: 4, 5, or 6 to
determine
the relative binding affinity for the receptor of the tested Kiss=1 derived
protein.
Functional Assays
The Kiss-1 derived proteins may be tested to determine whether the
test proteins increase any signaling activity associated with the GPCR54
receptor,
thereby determining whether the-Kiss-1 derived protein is a GPCR54 receptor
agonist.
The signaling response may be a second messenger response of the GPCR54 and
may
include e.g., chloride channel activation, change~in intracellular calcium
levels,
release of inositol phosphate, activation of MAP kinase, change in cAMP
levels,
release of arachidonic acid or other second messenger response typically
associated
with a GPCR54.
As an alternative to ligand binding assays, cells expressing the
GPCR54 receptor DNA may be used to screen for ligands to the receptor using
functional assays. It is well known to those in the art that the over-
expression of a G-
protein coupled receptor can result in the constitutive activation of
intracellular
signaling pathways. In the same manner, over-expression of the orphan receptor
in
any cell line as described above, can result in the activation of the
functional
responses described below, and any of the assays herein described can be used
to
31
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
screen for the activity of the Kiss-1 derived proteins as both agonist ligands
of the
GPCR54 orphan receptor. Agonists thus identified will be useful in the
therapeutic
methods of the invention.
As indicated above, a wide spectrum of assays can be employed to
screen for the presence of GPCR receptor ligands. These assays range from
traditional measurements of total inositol phosphate accumulation, cAMP
levels,
intracellular calcium mobilization, and potassium currents, for example; to
systems
measuring these same second messengers but which have been modified or adapted
to
be of higher throughput, more generic and more sensitive; to cell based assays
reporting more general cellular events resulting from receptor activation such
as
metabolic changes, differentiation, cell division/proliferation. Exemplary
such assays
are described in detail in U.S. Patent Application Publication No.
US2003/0022839
A1 specifically at paragraphs 0100 through 0135. This document is specifically
incorporated in its entirety as teaching methods of determining the receptor
bind and
functional activity of the Kiss-1 derived proteins of the present invention.
Any
protein or peptide made as described herein may be tested in an assay such as
those
described in U.S. Patent Application Publication No. US200310022839 to
determine
whether such a protein or peptide retains its receptor agonist activity. As
long as the
generated protein or peptide retains an activity in any one or more of such
exemplary
assays (e.g., elevation of cystolic calcium, or phosphorylation of ERK in
transfected
CHO cells), it may be used in the present invention.
METHODS OF TREATING INFERTILITY
As described herein throughout it has been discovered that Kiss-1
~25 derived proteins can be used to enhance, stimulate, promote or otherwise
increase the
release of FSH and/oi LH. As such, any Kiss-1 peptide/protein that has an
activity
that is similar to the activity of a peptide of SEQ ID NO:3 may be used in the
treatment of infertility disorders. The infertility disorders that may be
treated herein
include any disorder that may benefit from an increase in the amount of FSH
signal,
LH signal or both. Preferably, the increase in FSH production produced by the
treatment methods of the invention results in an appreciable increase in
the~blood
levels of FSH. In preferred embodiments, the methods produce a greater than 2-
fold.
increase in blood levels of FSH, however, any increase in FSH is likely to be
32
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
beneficial. It is contemplated that the peptide/protein-based compositions of
the
present invention may be used in any and all protocol in which an agent such
as
Clomiphene is presently be used in the treatment of a fertility disorder. As
such, the
protein/peptide-based therapeutics of the present invention may be used in the
treatment of anovulatory females in the induction of ovulation and pregnancy
in
anovulatory infertile patients in whom the cause of infertility is functional
and not due
to primary ovarian failure or individuals suffering from hypogonadotropic
hypogonadism. In men these peptides may be useful in the induction of
spermatogenesis in males having primary and secondary hypogonadotropic
hypogonadism. The peptides also may be useful in the treatment of
endometriosis.
The protocols for the administration of the Kiss-1 derived proteins may
be similar to the protocols for the administration of other stimulants of
gonadotropin
release. As a general guideline, protocols developed for the administration of
clomiphene may form a'starting point for the administration of the peptides of
the
invention as both clomiphene and the Kiss-1 related peptides are both used to
stimulate gonadotropin production. Thus, for example to stimulate ovulation,
the
Kiss-1 derived protein-based compositions (e.g., a peptide of amino acid
sequence of
SEQ ID N0:3) may be prescribed for five days each cycle, typically as a single
daily
dose on each specified day. However; the dosage may be increased or decreased
by
your physician based on the patient's individual response. In a typical
treatment, like
clomiphene, it may be necessary to perform a Kiss-1 protein load test
determine
whether the patient will be responsive to the Kiss-1 derived protein.
Clomiphene load
tests are well known to those of skill in the art (See e.g., U.S. Patent No.
U.S. Patent
No. 5,091,170). Such tests can be modified by replacing the clomiphene with
the
Kiss-1 derived protein being used as the stimulant.
In a typical protocol for the ovulation stimulation, the Kiss-1 derived
protein may be initially administered beginning on cycle day 3 and taken daily
until
cycle day 7. At cycle day 9 or 10, the LH and FSH levels of the patient are
monitored. If the LH level is two to three times higher than the FSH level;
the Kiss-1
derived protein may not be effective. On cycle day 12, the urine of the
patient is
tested daily for LH surge, i.e., the signal that ovulation will occur in 24-36
hours.
Ovulation predictor kits (LH predictor) may be used for this test. If a surge
has not
occurred by cycle day 16, an ultrasound may be performed to check for
follicular
33
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
development and measure the thickness of the uterine lining. After LH surge
ovulation should occur with two days.
If pregnancy does not result, a further cycle of Kiss-1 derived protein
therapeutic is begun. In such a subsequent cycle, at the onset of menstrual
flow,
before day three, a pelvic examination and or ultrasound check may be
performed.
In alternative embodiments, where the above protocol is unsuccessful
in producing a pregnancy, intrauterine insemination may be used to improve
possibility of conception. Such intrauterine insemination may be combined with
one
or more of clomiphene, letrozole, HMG/insemination or Gonal-F/Follistim
injections
and intrauterine insemination. In intrauterine insemination, a baseline
ultrasound is
performed on or before cycle day 3: Beginning at day 3 the Kiss-1 derived
protein
therapy is initiated and continued to cycle day 7. In combined therapies, the
patient
may be treated With the Kiss-1 derived protein, in combination with clomiphene
(or
letrozole)/FSH or HMG/ and intrauterine insemination. In such protocols, an
injection of 150 units of FSH or HMG (e.g., Bravelle/Gonal-F or Repronex) may
be
administered on day 8 or 9. On cycle 9 or 10 LH and FSH are determined.
If the patient does not have an LH surge by the 16th cycle day, an
ultrasound should be performed to check for follicular development and measure
the
thickness of the uterine lining. In the event that it is determined that the
follicle is
larger than 19 mm and endometrium is thicker than 7 mm an hCG injection may be
administered to trigger release of egg(s).
ADDITIONAL COMPOUNDS/COMPOSITIONS TO BE ADMINISTERED WITH KISS-1
PROTEIN
As discussed above, the protocols for the administration of the Kiss-1
derived proteins may be combined with other agents to produce e.g., ovulation
stimulation. ~ Thus, while the Kiss-1 derived proteins are contemplated to be
sufficient
to produce an increase in FSH release, a surge in LH or both of these effects,
which
may thus be used in improve stimulation of ovulation and overcome infertility,
it is
contemplated that the Kiss-1 derived proteins also may be administered in
combined
therapies with other treatments for infertility. Such additional treatments
include
administration of other stimulators of gonadotropin release e.g., clomiphene
and
34
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
letroZOle, as well 'as various gonadotropins to increase ovulation induction
andlor
follicle maturation.
To achieve the appropriate therapeutic outcome in the combination
therapies contemplated herein, i.e., to achieve an increase in ovulation
induction,
produce an increase in FSH production, produce an LH surge, produce an
increase in
the number of ovulatable oocytes in the mammal that is being treated and the
like, one
would generally administer to the subject the Kiss-1 derived protein
composition in an
amount effective to produce the desired therapeutic outcome. In addition,
additional
exogenous FSH may also be provided in a course of daily administrations
lasting
between 7 to 12 days. FSH compositions are described in further detail below.
FSH is a pituitary glycoprotein hormone that is composed of two
subunits. The a-subunit is common to FSH as well as the other glycoproteins,
LH,
hCG and TSH, the (3-subunit confers FSH specificity. The field of infertility
treatment is advanced and there are presently numerous FSH preparations that
are
commercially available and may be used in the methods of the invention. Such
commercial preparations include urinary-derived FSH compositions and
recombinant
FSH compositions. These compositions include, e.g., PergonalTM (Serono
Laboratories Inc., Randolph, MA; protocols and compositions for typical
administration described in e.g., PDRTM, 52nd Edn. 1998, pages 2773-2775),
FertinexTM (Serono Laboratories Inc., Randolph, MA protocols and compositions
for
typical administration described in e.g., PDRTM, 52nd Edn. 1998, pages 2771-
2773),
RepronexTM (Ferring Pharmaceutical Inc., Tarrytown, NJ; protocols and
compositions
for typical administration described in PDRTM, 57th Edn. 2003, pages 1325-
1327),
(Fernng Pharmaceutical Inc., Tarrytown, NJ; described in e.g., PDRTM, 57th
Edn.
2003, pages 1325-1327), HumegonTM (Organon, West Orange, NJ; protocols and
compositions for typical administration described in e.g., PDRTM, 52nd Edn.
1998,
pages 1949-1951), Gonal-F ((PDRTM, 57th Edn. 2003, pages 3124-3128),
FollistimTM.
These are merely exemplary commercial FSH preparations and those of skill in
the art
will understand that it may be possible to produce other such FSH preparations
for use
~ in the methods and compositions of the present invention. To the extent that
the
preceding compositions provide exemplary guidance as to formulations and
dosages
of FSH that may be used, they are discussed in further detail below. However,
it
should be understood that such doses and formulations may readily be modified
and
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
still be useful in the context of the present invention as long as the FSH
dosages and
formulations when administered in combination with Kiss-1 derived proteins
produce
a therapeutically effective LH surge and/or an increase in the number of
ovulatable
oocytes in vivo as compared to the number of oocytes produced in the absence
of such
administration.
In addition to these commercially available compositions, those of skill
in the art may chose to purify FSH from natural source, e.g., urine of post-
menopausal
women, using techniques well known to those of skill in the art (See e.g.,
U.S. Patent
No. 5,767,067).
Alternatively, those of skill in the art may choose to produce
recombinant FSH using techniques well known to those of skill in the art. It
is
particularly contemplated that long-lasting FSH agonists would be useful in
the
methods of the invention. For example, it is known that hCG has a longer half
life
than FSH. Both of these gonadotropins share a common a-subunit, with the
specific
activity being conferred by the (3-subunit. It has previously been
demonstrated that
the a-subunit of one gonadotropin may be used with the ~3-subunit of another
and still
yield a physiologically active chimeric gonadotropin. Further it has been
demonstrated that the increased biopotency of hCG as compared to LH was due to
the
carboxy-terminal peptide of the (3-subunit of hCG (Matzuk et al.',
Endocrinology
126:376-383, 1990). Long lasting agonists of FSH may be generated which
contain a
caxboxy-terminal peptide extension of hCG ~i-subunit at the carboxy terminus
of the
FSH b subunit. (LaPolt et al., Endocrinology, 131:6, 2514-2520, 1992). Such
chimeric molecules have been shown to possess a markedly increased circulating
half
life and potency as compared to wild-type FSH (Fares et al., Proc. Nat'1 Acad.
Sci.,
89:4304-4308, 1992). Longer half life can also be achieved by extra
glycosylations
or PEGylations as described elsewhere in the present application.
The FSH may be administered through any route. normally employed
for the administration of gonadotropin hormones. Most preferably the
administration
is either via intramuscular or subcutaneous injection. Throughout the
treatment
protocols, the patient is monitored for signs of adverse reaction including
for signs of
OHSS.
In addition to FSH, other gonadoiropin hormones will be used in the
methods of the present invention and packaged in the kits described herein.
Such
hormones include hCG. This is commercially available as NovarelTM (Fernng
36
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
Pharmaceutical Inc., Tarrytown, NJ), described in the Physician's Desk
Reference (see
e.g., PDRTM, 57th Edn. 2003, pages 1324-1325) and is a gonadotropin produced
by the
human placenta and obtained from the urine of pregnant women. Another
commercial preparation of hCG is PregnylTM (Organon, West Orange, NJ). The
S properties, indications and protocols for the use of this hormone are
discussed in
detail in the Physician's Desk Reference. (see e.g., PDRTM, 57th Edn. 2003,
pages
2401 ). Both of these preparations are for intramuscular administration.
Typically,
this hormone is administered in a dosage of between about 5000 Units and 10
000
Units to induce ovulation.
Yet another hormone that may be used and packaged herein is GnRH.
There are numerous commercial sources of this hormone. GnRH and analogs
thereof
are commercially available as CetrotideTM (Serono; see PDRTM, 57th Edn. 2003,
pages
3119-3121); EligardTM (Sanofi-Synthelabo, PDRTM, 57th Edn: 2003, page 2994);
LupronTM (PDRTM, 57th Edn. 2003, page 3185); and ZoladexTM (AstraZeneca PDRTM,
57th Edn. 2003, page 695). These agents are used to suppress LHlFSH production
in
women and are therefore used to delay ovulation. Typical doses of these agents
vary
from about 0.25 mg to about 3 mg. Ovarian stimulation therapy with FSH is
typically
initiated on the 2"d or 3ra day of the menstrual cycle. The GnRH or analogs
thereof
axe administered either once daily (lower dose, e.g., 0.25 mg), or as a single
dose
(e.g., 3 mg) during the early to mid follicular phase. GnRH is administered up
until
the day of hCG administration. When ultrasound analyses reveal that the
follicles are
of an adequate size, hCG is administered to induce ovulation and final
maturation of
the oocyte.
In the other embodiments in which there are multiple therapeutic
agents that are co-administered, the co-administered agents may be
administered
concurrently with one another or may be administered separately after
appropriate
time intervals. For example, clomiphene may be administered at the same time
as the
Kiss-1 derived protein-based compositions. Commercial preparations of
clomiphene
are known to those of skill in the art and include e.g., ClomidTM and
SeropheneTM. In
other embodiments, the Kiss-1 derived protein may be coadministered with a
GnRH
antagonist. Such GnRH antagonists, e.g., Lupron~, Synarel~, Antigon~, or
Cetrotide~ and protocols for their administration in fertility treatment are
well known
to those of skill in the art and are readily commercially available.
37
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
PATIENT SELECTION AND MONITORING
The patients that receive the treatments of the invention are female
patients between the age range of 20 to 45 year. Patient selection for the
methods of
the present invention may employ the same parameters as described in the PDRTM
entries for use of FSH based therapies described above. For example, prior to
treatment the patient is subjected to a thorough gynecologic examination arid
endocrinologic evaluation, including an assessment of pelvic anatomy. .
Primary .
ovarian failure should be excluded by determining the basal serum gonadotropin
levels and it should be ensured that the patient is not pregnant.
Throughout the treatment regimens of the present invention, the patient
should be assessed prior to, during, and after, the therapy to monitor for the
signs of
DHSS. The symptoms of DHSS include but are not limited to abdominal pain,
abdominal distention, gastrointestinal symptoms including nausea, diarrhea,
severe
ovarian enlargement, weight gain, dyspnea amd oliguria. Clinically, the
symptom
manifests in hypovolemia, hemoconcentration, electrolytic imbalance, ascites,
hemoperitoneum, pleural effusions, hydrothorax acute pulmonary distress and
thromboembolism. In the event that symptoms of DHSS occur during the
administration of the FSH-based therapy or any other agent being
administeredfor
stimulation of follicular maturation, the administration should~cease and the
subject
should be placed under medical supervision to determine
whether~hospitalization or
other intervention is necessary. Other symptoms that may be used to monitor
the
FSH-based therapy include changes in vaginal cytology, appearance and volume
of
vaginal mucous, Spinnbarkeit and ferning of cervical mucus. These latter
symptoms
are indicative of the estrogenic effect of the therapy, and should be
monitored because
administration FSH will stimulate estrogen production. Preferably these
estrogenic
effects should be monitored in conjunction with more direct determinations of
follicle
development such as, e.g:, determination of serum estradiol and
ultrasonigraphy.
The clinical manifestations of ovulation, other than pregnancy, may be
obtained either through,a direct or an indirect measure of progesterone
production.
Such indicia include: a rise in basal body temperature, increase in serum
progesterone, menstruation following a shift in body temperature. In
conjunction .
with the above indicators of progesterone production, sonographic
visualization of the
ovaries may be used to assist in determining if ovulation has occurred. Such
38
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
monographic monitoring may include evaluating fluid in the cul-de sac, ovarian
stigmata and the presence of collapsed follicles. Sonographic determinations
also will
assist in determining whether the ovaries are enlarged in DHSS.
PHARMACEUTICAL COMPOSITIONS
Pharmaceutical compositions for administration according to the
present invention can comprise at least one Kiss-1 derived protein (e.g., a
peptide of
SEQ ID N0:3, a variant or analog thereof or any other Kiss-1 derived protein
that
stimulates FSH production and/or release). The pharmaceutical compositions
also
may include another stimulant of FSH production, e.g., clomiphene and/or at
least one
gonadotropin.hormone, preferably FSH. Each of these preparation is preferably
provided in a pharmaceutically acceptable form optionally combined with a
pharmaceutically acceptable Garner. These compositions can be administered by
any
means that achieve their intended purposes. Individualized amounts and
regimens for
the administration of the compositions for the stimulation of follicle
maturation using
the methods of the present invention can be determined readily by those with
ordinary
skill in the art using the guidance provided by the Physician's Desk Reference
for the
use of such compositions in treating anovulatory disorders and for their use
in assisted
reproduction technologies. As discussed above, those of skill in the art could
initially
employ amounts and regimens of FSH, clomiphene and the like currently being
used
in such medical contexts. To this effect, those skilled in the art are
specifically
referred to each of the entries in the Physician's Desk Reference discussed
above and
those entries are incorporated herein by reference in their entireties for
teaching
methods and compositions for the administration of agents such as SeropheneTM,
ClomidTM, FertinexTM, Gonal FTM, BravelleTM and the like discussed herein
above.
Each of those entries in the Physician's Desk Reference provide exemplary
guidance
as to types of formulations, routes of administration and treatment regimens
that may
be used in administering FSH. Any of the protocols, formulations, routes of
administration and the like described therein can readily be modified for use
in the
present invention.
. Compositions within the scope of this invention include all
compositions comprising at least one Kiss-1 derived protein according to the
present
invention in an amount effective to achieve its intended purpose of
stimulating,
increasing or otherwise inducing ovulation. Preferably such induction is
preceded by
39
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
an increase in FSH production and/or an increase in LH surge as compared to
these
parameters in the absence of administration of these pharmaceutical proteins.
.In some
instances, it is contemplated that the number of ovulatable oocytes in the
animal are
increased as a result of administration of these peptides, either when
administered
alone or more preferably, when administered in combination with a low dose of
FSH.
The active agents used in the methods of the present invention may be
administered
by any means normally employed for such administration. Most preferably, the
Kiss-
1 derived protein compositions used in the present invention are administered
orally.
It is understood that the suitable dose of a composition according to the
present invention will depend upon the age, health and weight of the
recipient, kind of
concurrent treatment, if any, frequency of treatment, and the nature of the
effect
desired. However, the most preferred dosage can be tailored to the.individual
subject,
as is understood and determinable by one of skill in the art, without undue
experimentation. This typically involves adjustment of a standard dose, e.g.,
1 S reduction of the dose if the patient has a low body weight. Therapy should
be halted
in the event that symptoms of DHSS are observed.
As discussed above, the total dose required for each treatment may be
administered in multiple doses or in a single dose. The compositions may be
administered alone or in conjunction with other therapeutics directed to the
disease or
directed to other symptoms thereof.
The compositions of the invention should be formulated into suitable
pharmaceutical compositions, i.e., in a form appropriate for in vivo
applications in a
the therapeutic intervention of infertility disorders. Generally, this will
entail
preparing compositions that are essentially free of pyrogens, as well as other
impurities that could be harmful to humans or animals, preferably for oral
administration. The FSH formulations may be formulated akin to the currently
available FSH preparations discussed herein throughout. The peptidelprotein
formulations may be formulated similarly to any other small protein
composition.
Preferably, these forrriulations are for oral administration, however, other
routes of
administration are contemplated (e.g. injection, intrathecal administration
and the
like). ~'he results of the FSH stimulating properties of Kisspeptin lead to a
conclusion
that a main site of Kisspeptin action is likely in the central nervous system.
Such a
site of action may be within the blood brain barrier (BBB). As such, it is
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
contemplated that formulations and routes of administration that facilitate
the
peptide/protein compositions to readily traverse the traverse BBB will be
particularly
useful. Receptor-mediated uptake across the BBB may be especially useful.
One will generally desire to employ appropriate salts and buffers to
render the compositions stable and allow for uptake of the compositions at the
target
site. Generally the hormone compositions of the invention are provided in
lyophilized
form to be reconstituted prior to administration and the Kiss-1 derived
protein
compositions are likely formulated into tablet form. Buffers and solutions for
the
reconstitution of the hormones may be provided along with the pharmaceutical
formulation to produce aqueous compositions of the present invention for
administration. Such aqueous compositions will comprise an effective amount of
each of the therapeutic agents being used, dissolved or dispersed in a
pharmaceutically acceptable carrier or aqueous medium. Such compositions also
are
referred to as inocula. The phrase "pharmaceutically or pharmacologically
acceptable'' refer to molecular entities and compositions that do not produce
adverse,
allergic, or other untoward reactions when administered to an animal or a
human. As
used herein, "pharmaceutically acceptable Garner" includes any and alI
solvents,
dispersion media, coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents and the like. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except insofar as
any
conventional media or agent is incompatible with the therapeutic compositions,
its use
in therapeutic compositions is contemplated. Supplementary active ingredients
also
can be incorporated into the compositions.
The active compositions of the present invention include classic
pharmaceutical preparations of FSH, which have been discussed herein as well
as
those known to those of skill in the art. Methods of formulating proteins and
peptides
for therapeutic administration also are known to those of skill in~the art.
Administration of these compositions according to the present invention will
be via
any common route so long as the target tissue is available via that route.
Most
commonly, these compositions are formulated for oral administration. However,
other conventional routes of administration, e.g., by subcutaneous,
intravenous,
intradermal, intramusclar, intramammary, intraperitoneal, intrathecal,
intraocular,
retrobulbar, intrapulmonary (e.g., term release), aerosol, sublingual, nasal,
anal,
41
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
vaginal, or transdermal delivery, or by surgical implantation at a particular
site also
may be used particularly when oral administration is problematic. The
treatment may
consist of a single dose or a plurality of doses over a period of time.
The active compounds may be prepared for administration as solutions
of free base or pharmacologically acceptable salts in water suitably mixed
with a
surfactant, such as hydroxypropylcellulose. Dispersions also can be prepared
in
glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under
ordinary conditions of storage and use, these preparations contain a
preservative to
prevent the growth of microorganisms.
The pharmaceutical forms suitable for injectable use include sterile
aqueous solutions or dispersions arid sterile powders for the extemporaneous
preparation of sterile injectable solutions or dispersions. In all cases the
form must be
sterile and must be fluid to the extent that easy syririgability exists. It
must be stable
under the conditions of manufacture and storage and must be preserved against
the
contaminating action of microorganisms, such as bacteria and fungi. The
carrier can
be a solvent or dispersion medium containing, for example, water, ethanol,
polyol (for
example, glycerol, propylene glycol, and liquid polyethylene glycol, and the
like),
suitable mixtures thereof, and vegetable oils. The proper fluidity can be
maintained,
for example, by the use of a coating, such as lecithin, by the maintenance of
the
required particle size in the case of dispersion and by the use of
surfactants. The
prevention of the action of microorganisms can be brought about by various
antibacterial and antifungal agents, for example, parabens, chlorobutanol,
phenol,
sorbic acid, thimerosal, and the like. In many cases, it will be preferable to
include
isotonic agents, for example, sugars or sodium chloride. Prolongedabsorption
of the
injectable compositions can be brought about by the use in the compositions of
agents
delaying absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the active
compounds in the required amount in the appropriate solvent with various of
the other
ingredients enumerated above; as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the various sterilized
active
ingredients into a sterile vehicle which contains the basic dispersion medium
and the
required other ingredients from those enumerated above. In the case of sterile
powders for the preparation of sterile injectable solutions, the preferred
methods of
42
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
preparation are vacuum-drying and freeze-drying techniques which yield a
powder of
the active ingredient plus any additional desired ingredient from a previously
sterile-
filtered solution thereof.
As used herein, "pharmaceutically acceptable carrier" includes any and
S all solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic
and absorption delaying agents and the like. The use of such media and agents
for
pharmaceutical active substances is~well known in the art. Except insofar as
any
conventional media or agent is incompatible with the active ingredient, its
use in. the
therapeutic compositions is contemplated. Supplementary active ingredients
also can
be incorporated into the compositions.
The compositions of the present invention may be formulated in a
neutral or salt form. Pharmaceutically-acceptable salts include the acid
addition salts
(formed with the free amino groups of the protein) and which are formed with
inorganic acids such as, for example, hydrochloric or phosphoric acids, or
such
organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts
formed with the
free carboxyl groups also can be derived from inorganic bases such as, for
example,
sodium, potassium, ammonium, calcium, or ferric hydroxides; and such organic
bases
as isopropylamine, trimethylamine, histidine, procaine and the like.
Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically
effective. The formulations are easily administered in a variety of dosage
forms such
as injectable solutions, drug release capsules and the like. For parenteral
administration in an aqueous solution, for example, the solution should be
suitably
buffered if necessary and the liquid diluent first rendered isotonic with
sufficient
saline or glucose. These particular aqueous solutions are especially suitable
for
intravenous, intramuscular, subcutaneous and intraperitoneal administration.
"Unit dose" is defined as a discrete amount of a therapeutic
composition dispersed in a suitable carrier. Parenteral administration of the
therapeutic compounds may be carried out with an initial bolus followed by
continuous infusion to maintain therapeutic circulating levels of drug
product. Those
of ordinary skill in the art will readily optimize effective dosages and
administration I
43
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
regimens as determined by good medical practice and the clinical condition of
the
individual patient.
The frequency of dosing will depend on the pharmacokinetic
parameters of the agents and the routes of administration. The optimal
pharmaceutical formulation will be determined by one of skill in the art
depending on
the route of administration and the desired dosage. See for example
Remington's
Pharmaceutical Sciences, 18th Ed: (1990, Mack Publ. Co, Easton PA 18042),
incorporated herein by reference. Such formulations may influence the physical
state,
stability; rate of in vivo release and rate of in vivo clearance of the
administered
agents. Depending on the route of administration, a suitable dose may be
calculated
according to body weight, body surface areas or organ size. Further refinement
of the
calculations necessary to determine the appropriate treatment dose is
routinely made
by those of ordinary skill in the art without undue experimentation,
especially in light
of the dosage information and assays disclosed herein as well as the
pharmacokinetic
data observed in animals or human clinical trials. .
Appropriate dosages may be ascertained through the use of established
assays for determining blood levels in conjunction with relevant dose response
data.
The final dosage regimen will be determined by the attending physician,
considering
factors which modify the action of drugs, e.g., the drug's specific activity,
severity of
the damage and the responsiveness of the patient, the age, condition, body
weight, sex
and diet of the patient, the severity of any infection, time of administration
and other
clinical factors. As studies are conducted, further information will emerge
regarding
appropriate dosage levels and duration of treatment for specific diseases and
.
conditions.
It will be appreciated that the pharmaceutical compositions and
treatment methods of the invention may be useful in fields of human medicine
and
veterinary medicine. Thus, the subject to be treated may be a mammal,
preferably
human or other animal. For veterinary purposes, subjects include for example,
farm .
animals including cows, sheep, pigs, horses and goats, companion animals such
as
dogs and cats,, exotic and/or zoo animals, laboratory animals including mice
rats,
rabbits, guinea pigs and hamsters; and poultry such as chickens, turkey ducks
and
geese.
44
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
The present invention also contemplated kits for use in the treatment of
fertility disorders. Such kits include at least a first composition comprising
the
proteins/peptides described above in a pharmaceutically acceptable carrier.
Another .
component may be an FSH in a pharmaceutically acceptable carrier. The kits may
additionally comprise solutions or buffers for effecting the delivery of the
first and
second compositions. The kits may further comprise additional compositions
which
contain further stimulators of FSH production/release e.g., additional other
Kiss-1
derived proteins, other stimulators, e.g., clomiphene and/or further hormones
such as
e.g., hCG, LH and the like. The kits may further comprise catheters, syringes
or other
delivering devices for the delivery of one or more of the compositions used in
the
methods of the invention. The kits may further comprise instructions
containing
administration protocols for the therapeutic regimens.
ExAMPLES
1 S The following examples) is included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of skill in
the art that
the techniques disclosed in the examples) that follows represent techniques
discovered by the inventor to function well in the practice of the invention,
and thus
can be considered to constitute preferred modes for its practice. However,
those of
skill in the art should, in light of the present disclosure, appreciate that
many changes
can be made in the specific embodiments which are disclosed and still obtain a
like or
similar result without departing from the spirit and scope of the invention.
Example 1 Exemplary Materials and Methods
Animals
All experiments were conducted in female Sprague-Dawley rats (180-
200 g) obtained from Charles River (MA), fed with standard laboratory chow and
water ad libitum, kept on 12h light-dark in temperature and humidity
controlled room.
Surgery
All surgeries were conducted under anesthesia with single injection
(i.p.) of a mixture ofketamine (100 mg/kg) and xylazine (15 mg/kg).
Implantation of intracerebroventricular cannula for i.c.v. experiment.
The head of anesthetized rats was placed in the stereotaxic instrument and
oriented
such that the bregma and lambda was horizontal. An incision was made along the
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
sagittal midline in an anterior-to-posterior direction. A hole, 1.5 mm in
diameter, was
drilled through the skull 0.9 mm posterior and 0.0 mm lateral to bregma. A 25
mm x .
22 gauge stainless steel cannula was lowered about 7 mm until cerebrospinal
fluid
could be aspirated from the 3rd ventricle via a 1 cc syringe connected to the
cannula
by a 5 cm section of Silastic tubing. After sealing the outer opening of the
cannula, it
was anchored to the skull with three stainless steel screws and dental acrylic
cement
then the incision was closed. Rats were allowed to recover for 14 days.
Ovariectomy and implantation of estrogen-containing capsule. To
remove daily variance of plasma estrogen levels due to variable estrous cycle,
both
ovaries were removed under anesthesia through incision at the animal's back.
Right
before closure of the incision, two estrogen-containing capsules
(O.Smg/coupsule,
Innovative Research of America, FL) were inserted subcutaneously at the middle
of
animal's back to maintain consistent basal physiological levels of plasma
estrogen.
Rats were allowed to recover for 7 days.
Jugular cannula insertion and tethering to automated blood sampler.
The right jugular vein of anesthetized rats was exposed through a neck
incision. A
retaining suture was tied to the exposed vein at rostral end to manipulate the
vein.
The caudal end of the vein was clamped with a small forceps to prevent
bleeding
while a cannula, a polyethene tubing (OD 1.Omm), was inserted in the middle of
the
vein through a 0.5 mm incision made with iris scissors. After the insertion of
the
cannula, a suture was tied around the vein at the caudal end to secure the
cannula
within the vein. The incision at the neck was closed with wound clips and the
outer
end of the cannula was attached to a tubing of an automated blood sampler
(Bioanalytical Systems Inc., IN) filled with heparin-containing (20 ItJ/ ml)
sterile
saline. The automated blood sampler consisting of a turning cage equipped with
a
food box and a water bottle, a balanced arm, a pumping system, a fraction
collector
and a controller was used to collect blood samples. A rat inserted of a
jugular cannula
was tethered to the balanced arm via a loosely-fitting plastic collar. The
cage rotates
to the counter direction of animal's movement to prevent twisting of the
jugular
cannula connected to a tubing of the sampler, as well as to allow the rat to
eat, drink
and move freely.during the course of the blood collection. Rats were allowed
to
recover for 24 hours.
46
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
Test Compounds
GnRH, a positive control, Antide, an antagonist of GnRH receptor, and
Kiss-1 (45-54; Tyr-Asn-Trp-Asn-Ser-Phe-Gly-Leu-Arg-Phe-NH2; SEQ ID N0:3)
was obtained from Sigma (MO), Serono (MA) and Peptide International (KY),
respectively. This 10-amino acid fragment of Kiss-1 was used merely because
previously it was reported that the fragment showed the most potent binding
affinity
to GPCR54 (Kotani et al., J Biol Chem 276:34631-34636). Any other Kisspeptin
that has receptor binding activity may be similarly used in the methods
described
herein.
Experimental Procedure .
All experiments were carried out around between 13h and 14h.
GPCR54 agonist, Kiss-1, dissolved in phosphate-buffered saline was injected
i.v. and
i.c.v. through jugular and intracerebroventricular cannula in a volume of 200
and 10
ul, each. Blood samples (100 ul) were removed before (-15 and 0 min) and.after
(15,
30, 45 min) injection with the automated blood sampler. Each blood sample was
replaced with an equivalent volume of the heparin--containing (20 ICT/ ml)
sterile
saline. Plasma was extracted and stored at -20 °C until determination
of LH and FSH
by enzyme-linked immunoassay and radioimmunoassay, respectively.
Data analysis
C hanges of plasma LH- and FSH concentration (ng/ml) after inj ection
were obtained as the area under the curve (AUC). It was first determined for
each
animal by calculating the sum of post-treatment hormonal levels at 1 S, 30 and
45 min
each of which was subtracted by basal levels (an average of pre-treatment
levels at -
15 and 0 min), then averaged as a group. Statistical differences among
treatment
groups were determined by one-way ANOVA followed by LSD as a post-hoc test.
An initial data set is shown in Figures lA-P. Further data are described in
Examples
2 and 3 below.
Example 2 Stimulation of the gonadotropic axis by i.v. injection of Kiss-1
This study aimed to determine the effects of peripheral treatment of
Kiss-1 on LH and FSH release. It also determined if the effects of Kiss-1 was
mediated by GnRH receptor in the pituitary, a well-established mechanism in
the
regulation of gonadotropins, by the pretreatment of GnRH receptor antagonist,
Amide, 15 min before the injection of 400 ug/kg of Kiss-1. These results were
47
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
summarized in Figure 2. There were dose-dependent increases by Kiss-1
treatment in
plasma LH and FSH levels with the exception of LH response at the highest
dose. A
blockade of GnRH receptor successfully prevented GnRH- and Kiss-1-induced
elevations of circulating gonadotropins levels. These results demonstrate that
stimulation of the gonadotropic axis by Kiss-1 is mediated by GnRH receptor in
the
pituitary.
Example 3 Stimulation of the gonadotropic axis by i.c.v. injection of Kiss-1
Based on the observation that GnRH antagonist prevents stimulatory
effects of Kiss-1 on LH and FSH release as shown in Example 2, it was
hypothesized
that Kiss-1 acts in the brain, where GnRH neurons locate, to stimulate their
neural
activity. To test this hypothesis, this study was aimed to determine if i.c:v.
injection
of Kiss-1 stimulates the gonadotropic axis. These results were summarized in
Figure
3. Kiss-1 dose-dependently stimulated LH release. Further, while the higher
dose of
Kiss-1 was not as effective as the lower dose, there was a significant
increase of FSH
levels after Kiss-1 injection. It is worthwhile to mention that i.c.v. doses
of Kiss-1 to
yield responses of LH and FSH in i.v. injection study were as low as 1/25 and
11100
of i.v. doses, respectively. These results demonstrate that main action site
of Kiss-1 in
enhancing LH and FSH release is in the brain and the regulatory mechanism
could
involve stimulation of GnRH neurons.
~ All of the compositions and/or methods disclosed and claimed herein
can be made and executed without undue experimentation in light of the present
disclosure. While the compositions and methods of this invention have been
described
in terms of preferred embodiments, it will be apparent to those of skill in
the art that
variations may be applied to the compositions and/or methods and in the steps
or in
the sequence of steps of the method described herein without departing from
the
concept, spirit and scope of the invention. More specifically, it will be
apparent that
certain agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or similar results
would be
achieved. All such similar substitutes and modifications apparent to those
skilled in
the art are deemed to be within the spirit, scope and concept of the invention
as
defined by the appended claims.
48
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
The references cited herein throughout, to the extent that they provide
exemplary procedural or other details supplementary to those set forth herein,
are all
specifically incorporated herein by reference.
49
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
SEQUENCE LISTING
<110>
Campbell
et al.
<120> OF GPCR54 THE TREATMENT
USE LIGANDS OF INFERTILTTY
FOR
<130>
30694/39949
<150> 60/564,576
US
<151>
2004-04-23
<160>
11
<170>
PatentIn
version
3.2
<210>
1
<211>
725
<212>
DNA
<213>
Homo
Sapiens
<400>
1
ctcttgagaccgggagcccagctgcccaccctctggacattcacccagccaggtggtctc 60
gtcacctcagaggctccgccagactcctgcccaggccaggactgaggcaagcctcaaggc 120
acttctaggacctgcctcttctcaccaagatgaactcactggtttcttggcagctactgc 180
ttttcctctgtgccacccactttggggagccattagaaaaggtggcctctgtggggaatt 240
ctagacccacaggccagcagctagaatccctgggcctcctggcccccggggagcagagcc 300
tgccgtgcaccgagaggaagccagctgctactgccaggctgagccgtcgggggacctcgc 360
tgtccccgccccccgagagctccgggagcccccagcagccgggcctgtccgccccccaca 420
gccgccagatccccgcaccccagggcgcggtgctggtgcagcgggagaaggacctgccga 480
actacaactggaac~ccttcggcctgcgcttcggcaagcgggaggcggcaccagggaacc 540
acggcagaagcgctgggcggggctggggcgcaggtgcggggcagtgaacttcagacccca 600
aaggagtcagagcatgcggggcgggggcggggggcggggacgtagggctaagggaggggg 660
cgctggagcttccaacccgaggcaataaaagaaatgttgcgtaactcaaaaaaaaaaaaa 720
aaaaa 725
<210> 2
<211> 145
<212> PRT
<213> Homo Sapiens
<400> 2
Met Asn Ser Leu Val Ser Trp Gln Leu Leu Leu Phe Leu Cys Ala Thr
1 5 10 15
His Phe Gly Glu Pro Leu Glu Lys Val Ala Ser Val Gly Asn Ser Arg
20 25 30
1/4
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
Pro Thr Gly Gln Gln Leu Glu Ser Leu Gly Leu Leu Ala Pro Gly Glu
35 40 45
Gln Ser Leu Pro Cys Thr Glu Arg Lys Pro Ala Ala Thr Ala Arg Leu
50 55 60
Ser Arg Arg Gly Thr Ser Leu Ser Pro Pro Pro Glu Ser Ser Gly Ser
65 70 75 80
Pro Gln Gln Pro Gly Leu Ser Ala Pro His Ser Arg Gln Ile Pro Ala
85 90 95
Pro Gln Gly Ala Val Leu Val Gln Arg Glu Lys Asp Leu Pro Asn Tyr
100 105 110
Asn Trp Asn Ser Phe Gly Leu Arg Phe Gly Lys Arg Glu Ala Ala Pro
115 120 125
Gly Asn His Gly Arg Ser Ala Gly Arg Gly Trp Gly Ala Gly Ala G1y
130 135 140
Gln
145
<210> 3
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 3
Tyr Asn Trp Asn Ser Phe Gly Leu Arg Phe
1 5 10
<210> 4
<211> 54
<212> PRT
<213> Homo Sapiens
<400> 4
Gly Thr Ser Leu Ser Pro Pro Pro Glu Ser Ser Gly Ser Pro Gln Gln
1 5 10 15
Pro Gly Leu Ser Ala Pro His Ser Arg Gln Ile Pro Ala Pro Gln Gly
20 25 30
Ala Val Leu Val Gln Arg Glu Lys Asp Leu Pro Asn Tyr Asn Trp Asn
35 40 45
Ser Phe Gly Leu Arg Phe
2/4
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
<210>
<211>
14
<212>
PRT
<213> Sapiens
Homo
<400>
5
Asp Leu Asn AsnTrp Ser Phe Gly Leu
Pro Tyr Asn Arg Phe
1 5 10
<210>
6
<211>
13
<212>
PRT
<213> Sapiens
Homo
<400>
6
Leu Pro Tyr TrpAsn Phe Gly Leu Arg
Asn Asn Ser Phe
1 5 10
<210>
7
<211>
5
<212>
PRT
<213> Sapiens
Homo
<400>
7
Phe Gly Arg
Leu Phe
1 5
<210>
8
<211>
6
<212>
PRT
<213> Sapiens
Homo
<400>
8
Ser Phe Leu Phe
Gly Arg
1 5
<210>
9
<211>
7
<212>
PRT
<213> Sapiens
Homo
<400>
9
Asn Ser Gly ArgPhe
Phe Leu
1 5
<210>
<211>
8
<212>
PRT
<213> Sapiens
Homo
<400>
10
Trp Asn Phe LeuArg
Ser Gly Phe
1 5
3/4
CA 02562676 2006-10-12
WO 2005/117939 PCT/US2005/013339
<210> 11
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 11
Asn Trp Asn Ser Phe Gly Leu Arg Phe
1 5
4/4
