CA 02571917 2007-O1-08
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME t DE 2
NOTE: Pour les tomes additionels, veillez contacter 1e Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
hJOTE: For additional volumes please contact the Canadian Patent O~ce.
CA 02571917 2007-O1-08
CORYIVEBACTERIFIMGLUTAMfCUMGENES ENCODING METABOLIC
PATHWAY PROTEINS
This application is a divisional application derived from Patent Application
Serial No. 2,402,186 which is a National Phase application derived from PCT
Application IB2000/02035 filed December 22, 2000 and entitled "Corynebacterium
Glutamicum Genes Encoding Metabolic Pathway Proteins"
Background of the Invention
Certain products and by-products of naturally-occurring metabolic processes in
cells have utility in a wide array of industries, including the food, feed,
cosmetics, and
pharmaceutical industries. These molecules, collectively termed 'fme
chemicals',
include organic acids, both proteinogenic and non-proteinogenic amino acids,
nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates,
aromatic
compounds, vitamins and cofactors, and enzymes. Their production is most
conveniently performed through large-scale culture of bacteria developed to
produce
and secrete large quantities of a particular desired molecule. One
particularly useful
organism for this purpose is Corynebacterium glutamicum, a gram positive,
nonpathogenic bacterium. Through strain selection, a number of mutant strains
have
been developed which produce an array of desirable compounds. However,
selection of
strains improved for the production of a particular molecule is a time-
consuming and
difficult process.
Summary of the Invention
The invention provides novel bacterial nucleic acid molecules which have a
variety of uses. These uses include the identification of microorganisms which
can be
CA 02571917 2007-O1-08
WO 01166573 PCT/IB00/02035
used to produce fine chemicals (e.g., amino acids, such as, for example,
lysine and
methionine), the modulation of fme chemical production in C. glutamicum or
related
bacteria, the typing or identification of C. glutamicum or related bacteria,
as reference
points for mapping the C. glutamicum genome, and as markers for
transformation.
These novel nucleic acid molecules encode proteins, referred to herein as
metabolic
pathway (MP) proteins.
C. glutamicum is a gram positive, aerobic bacterium which is commonly used in
industry for the large-scale production of a variety of fine chemicals, and
also for the
degradation of hydrocarbons (such as in petroleum spills) and for the
oxidation of
terpenoids. The MP nucleic acid molecules of the invention, therefore, can be
used to
identify microorganisms which can be used to produce fine chemicals, e.g., by
fermentation processes. Modulation of the expression of the MP nucleic acids
of the
invention, or modification of the sequence of the MP nucleic acid molecules of
the
invention, can be used to modulate the production of one or more fine
chemicals from a
I5 microorganism (e.g., to improve the yield or production of one or more fine
chemicals
from a Corynebacterium or Brevibacterium species). In a preferred embodiment,
the
MP genes of the invention are combined with one or more genes involved in the
same or
different metabolic pathway to modulate the production of one or more fine
chemicals
from a microorganism.
The MP nucleic acids of the invention may also be used to identify an organism
as being Corynebacterium glutamicum or a close relative thereof, or to
identify the
presence of C. glutamicum or a relative thereof in a mixed population of
microorganisms. The invention provides the nucleic acid sequences of a number
of C.
glutamicum genes; by probing the extracted genomic DNA of a culture of a
unique or
mixed population of microorganisms under stringent conditions with a probe
spanning a
region of a C. glutamicum gene which is unique to this organism, one can
ascertain
whether this organism is present. Although Corynebacterium glutamicum itself
is
nonpathogenic, it is related to species pathogenic in humans, such as
Corynebacterium
diphtheniae (the causative agent of diphtheria); the detection of such
organisms is of
significant clinical relevance.
The MP nucleic acid molecules of the invention may also serve as reference
points for mapping of the C: glutamicum genome, or of genomes of related
organisms.
2
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
Similarly, these molecules, or variants or portions thereof, may serve as
markers for
genetically engineered Corynebacterium or Brevibacterium species.
The MP proteins encoded by the novel nucleic acid molecules of the invention
are capable of, for example, performing an enzymatic step involved in the
metabolism of
certain fine chemicals, including amino acids, e.g., lysine and methionine,
vitamins,
cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose. Given the
availability
of cloning vectors for use in Corynebacterium glutamicum, such as those
disclosed in
Sinskey et al., U.S. Patent No. 4,649,119, and techniques for genetic
manipulation of C.
glutamicum and the related Brevibacterium species (e.g., lactofermentum)
(Yoshihama
et al, J. Bacteriol. 162: 591-597 (1985); Katsumata et al., J. Bacteriol. 159:
306-311
(1984); and Santamaria et al., .I. Gen. Microbiol. 130: 2237-2246 (1984)), the
nucleic
acid molecules of the invention may be utilized in the genetic engineering of
this
organism to make it a better or more efficient producer of one or more fine
chemicals.
This improved production or efficiency of production of a fine chemical may be
due to a direct effect of manipulation of a gene of the invention, or it may
be due to an
indirect effect of such manipulation. Specifically, alterations in C.
glutamicum
metabolic pathways for amino acids, e.g., lysine and methionine, vitamins,
cofactors,
nucleotides, and trehalose may have a direct impact on the overall production
of one or
more of these desired compounds from this organism. For example, optimizing
the
activity of a lysine or a methionine biosynthetic pathway protein or
decreasing the
activity of a lysine or methionine degradative pathway protein may result in
an increase
in the yield or efficiency of production of lysine or methionine from such an
engineered
organism. Alterations in the proteins involved in these metabolic pathways may
also
have an indirect impact on the production or efficiency of production of a
desired fine
chemical. For example, a reaction which is in competition for an intermediate
necessary
for the production of a desired molecule may be eliminated, or a pathway
necessary for
the production of a particular intermediate for a desired compound may be
optimized.
Further, modulations in the biosynthesis or degradation of, for example, an
amino acid,
e.g., lysine or methionine, a vitamin, or a nucleotide may increase the
overall ability of
the microorganism to rapidly grow and divide, thus increasing the number
and/or
production capacities of the microorganism in culture and thereby increasing
the
possible yield of the desired fine chemical.
3
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
The nucleic acid and protein molecules of the invention, alone or in
combination
with one or more nucleic acid and protein molecules of the same or different
metabolic
pathway, may be utilized to directly improve the production or efficiency of
production
of one or more desired fine chemicals from Corynebacterium glutamicum (e.g.,
methionine or lysine). Using recombinant genetic techniques well known in the
art, one
or more of the biosynthetic or degradative enzymes of the invention for amino
acids,
e.g., lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides,
nucleosides,
or trehalose may be manipulated such that its function is modulated. For
example, a
biosynthetic enzyme may be improved in efficiency, or its allosteric control
region
destroyed such that feedback inhibition of production of the compound is
prevented.
Similarly, a degradative enzyme may be deleted or modified by substitution,
deletion, or
addition such that its degradative activity is lessened for the desired
compound without
impairing the viability of the cell. In each case, the overall yield or rate
of production of
the desired fine chemical may be increased.
It is also possible that such alterations in the protein and nucleotide
molecules of
the invention may improve the production of other fine chemicals besides the
amino
acids, e.g., lysine and methionine, vitamins, cofactors, nutraceuticals,
nucleotides,
nucleosides, and trehalose through indirect mechanisms. Metabolism of any one
compound is necessarily intertwined with other biosynthetic and degradative
pathways
within the cell, and necessary cofactors, intermediates, or substrates in one
pathway are
likely supplied or limited by another such pathway., Therefore, by modulating
the
activity of one or more of the proteins of the invention, the production or
efficiency of
activity of another fine chemical biosynthetic or degradative pathway may be
impacted.
For example, amino acids serve as the structural units of all proteins, yet
may be present
intracellularly in levels which are limiting for protein synthesis; therefore,
by increasing
the efficiency of production or the yields of one or more amino acids within
the cell,
proteins, such as biosynthetic or degradative proteins, may be more readily
synthesized.
Likewise, an alteration in a metabolic pathway enzyme such that a particular
side
reaction becomes more or less favored may result in the over- or under-
production of
one or more compounds which are utilized as intermediates or substrates for
the
production of a desired fine chemical.
This invention provides novel nucleic acid molecules which encode proteins,
referred to herein as metabolic pathway ("MP's proteins, which are capable of,
for
4
CA 02571917 2007-O1-08
example, performing an enzymatic step involved in the metabolism of molecules
important for the normal functioning of cells, such as amino acids, e.g.,
lysine and
methionine, vitamins, cofactors, nucleotides and nucleosides, or trehalose.
Nucleic acid
molecules encoding an MP protein are referred to herein as MP nucleic acid
molecules.
S In a preferred embodiment, an MP protein, alone or in combination with one
or more
proteins of the same or different metabolic pathway, performs an enzymatic
step related
to the metabolism of one or more of the following: amino acids, e.g., lysine
and
methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and
trehalose.
Examples of such proteins include those encoded by the genes set forth in
Table 1.
Accordingly, one aspect of the invention pertains to isolated nucleic acid
molecules (e.g., cDNAs, DNAs, or RNAs) comprising a nucleotide sequence
encoding
an MP protein or biologically active portions thereof, as well as nucleic acid
fragments
suitable as primers or hybridization probes for the detection or amplification
of MP-
encoding nucleic acid (e.g., DNA or mRNA). In particularly preferred
embodiments,
the isolated nucleic acid molecule comprises one of the nucleotide sequences
set forth as
the odd-numbered SEQ ID NO in the Sequence Listing (e.g., SEQ ID NO:1, SEQ ID
N0:3, or SEQ ID NO:S), or the coding region or a complement thereof of one of
these
nucleotide sequences. In other particularly preferred embodiments, the
isolated nucleic
acid molecule of the invention comprises a nucleotide sequence which
hybridizes to or
is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%,
preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or
70%%,
more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%; 93%,
94%,. and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7%
or
more homologous to a nucleotide sequence set forth as an odd-numbered SEQ ID
NO in
the Sequence Listing (e.g., SEQ ID NO:1, SEQ ID N0:3, or SEQ ID NO:S), or a
portion
thereof. In other preferred embodiments, the isolated nucleic acid molecule
encodes one
of the amino acid sequences set forth as an even-numbered SEQ ID NO in the
Sequence
Listing (e.g., SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6). The preferred MP
proteins of the present invention also preferably possess at least one of the
MP activities
described herein.
5
CA 02571917 2007-O1-08
According to one aspect, the present invention provides an isolated nucleic
acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:1 or a
full complement thereof.
According to a further aspect of the present invention there is provided an
isolated nucleic acid molecule which encodes a naturally occurring allelic
variant
of a polypeptide comprising the amino acid sequence set forth in SEQ ID N0:2,
wherein the allelic variant has an O-acetylhomoserine sulfhydrylase activity,
or a
full complement thereof.
According to another aspect of the present invention there is provided an
isolated nucleic acid molecule comprising a nucleotide sequence which is at
least
SO% identical to the entire nucleotide sequence set forth in SEQ ID NO:1,
wherein
said nucleic acid molecule encodes a polypeptide having an O-acetylhomoserine
sulfhydrylase activity, or a full complement thereof.
According to a still further aspect of the present invention there is provided
1 S an isolated nucleic acid molecule comprising a fragment of at least 20
contiguous
nucleotides of the nucleotide sequence set forth in SEQ ID NO:1, wherein said
fragment encodes a polypeptide having an O-acetylhomoserine sulfhydrylase
activity, or a full complement thereof.
According to another aspect of the present invention there is provided an
isolated polypeptide comprising the amino acid sequence set forth in
SEQ ID N0:2.
According to a further aspect of the present invention there is provided an
isolated nucleic acid molecule which encodes a polypeptide comprising the
amino
acid sequence set forth in SEQ ID N0:2 or a full complement thereof.
According to yet another aspect of the present invention there is provided
an isolated polypeptide comprising a naturally occurring allelic variant of a
polypeptide comprising the amino acid sequence of SEQ ID N0:2, wherein said
polypeptide has an O-acetylhomoserine sulfhydrylase activity.
5a
CA 02571917 2007-O1-08
According to still a furthere aspect of the present invention there is
provided an isolated polypeptide which is encoded by a nucleic acid molecule
comprising a nucleotide sequence which is at least 50% identical to the entire
nucleotide sequence set forth in SEQ ID NO:1, wherein said polypeptide has an
O-
acetylhomoserine sulfhydrylase activity.
According to a further aspect of the present invention there is provided an
isolated polypeptide encoded by a nucleic acid molecule comprising the
nucleotide
sequence set forth in SEQ ID NO:1.
According to another aspect of the present invention there is provided an
isolated polypeptide comprising an amino acid sequence which is at least 60%
identical to the entire amino acid sequence set forth in SEQ ID N0:2, wherein
said
polypeptide has an O-acetylhomoserine sulfhydrylase activity.
According to a still further aspect of the present invention there is provided
an isolated polypeptide comprising a fragment of the amino acid sequence set
forth
in SEQ ID N0:2, wherein said fragment has an O-acetylhomoserine sulfhydrylase
activity.
According to another aspect of the present invention there is provided n
isolated nucleic acid molecule which encodes a polypeptide comprising an
amino acid sequence which is at least 60% identical to the entire amino acid
sequence set forth in SEQ ID N0:2, wherein said polypeptide has an O-
acetylhomoserine sulfllydrylase activity, or a full complement thereof.
According to a further aspect of the present invention there is provided an
isolated nucleic acid molecule comprising a fragment of at least 20 contiguous
nucleotides of the nucleotide sequence of SEQ ID NO: l, wherein said nucleic
acid
molecule is a primer, a probe or an antisense molecule.
According to yet another aspect of the present invention there is provided a
host cell comprising a nucleic acid molecule comprising the nucleotide
sequence
set forth in SEQ ID NO:1, wherein the nucleic acid molecule is disrupted.
According to a still further aspect of the present invention there is provided
a host cell comprising a nucleic acid molecule comprising the nucleotide
sequence set forth in SEQ ID NO:I, wherein the nucleic acid molecule
Sb
CA 02571917 2007-O1-08
comprises one or more nucleic acid modifications as compared to the sequence
set forth in SEQ ID NO:1.
According to a further aspect of the present invention there is provided a
host cell comprising a nucleic acid molecule comprising the nucleotide
sequence
set forth in SEQ ID NO:1, wherein the regulatory region of the nucleic acid
molecule is modified relative to the wild-type regulatory region of the
molecule.
In another embodiment, the isolated nucleic acid molecule encodes a
protein or portion thereof wherein the protein or portion thereof includes an
amino
acid sequence
Sc
CA 02571917 2007-O1-08
WO 01166573 PCT/IB00/02035
which is sufficiently homologous to an amino acid sequence of the invention
(e.g., a
sequence having an even-numbered SEQ ID NO in the Sequence Listing, such as
SEQ
ID N0:2, SEQ ID N0:4, or SEQ ID N0:6), e.g., sufficiently homologous to an
amino
acid sequence of the invention such that the protein or portion thereof
maintains an MP
activity. Preferably, the protein or portion thereof encoded by the nucleic
acid molecule
maintains the ability to perform an enzymatic reaction in a amino acid, e.g.,
lysine or
methionine, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or
trehalose
metabolic pathway. In one embodiment, the protein encoded by the nucleic acid
molecule is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%,
or
60%,.preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or
70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%,
79%, or 80%, 81%, $2%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%,, or 91%,
92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%,
99%,
99.7% or more homologous to an amino acid sequence of the invention (e.g., an
entire
amino acid sequence selected from those having an even-numbered SEQ ID NO in
the
Sequence Listing, such as SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6). In
another
preferred embodiment, the protein is a full length C. glutamicum protein which
is
substantially homologous to an entire amino acid sequence of the invention
(encoded by
an open reading frame shown in the corresponding odd-numbered SEQ ID NO in the
Sequence Listing (e.g., SEQ ID NO:1, SEQ ID N0:3, or SEQ ID NO:S).
In another preferred embodiment, the isolated nucleic acid molecule is derived
from C. glutamicum and encodes a protein (e.g., an MP fusion protein) which
includes a
biologically active domain which is at least about 50% or more homologous to
one of
the amino acid sequences of the invention (e.g., a sequence of one of the even-
numbered
SEQ ID NOs in the Sequence Listing, such as SEQ ID N0:2, SEQ ID N0:4, or SEQ
ID
N0:6) and is able to catalyze a reaction in a metabolic pathway for an amino
acid, e.g.,
lysine or methionine, vitamin, cofactor, nutraceutical, nucleotide,
nucleoside, or
trehalose, or one or more of the activities set forth in Table 1, and which
also includes
heterologous nucleic acid sequences encoding a heterologous polypeptide or
regulatory
regions.
In another embodiment, the isolated nucleic acid molecule is at least 15
nucleotides in length and hybridizes under stringent conditions to a nucleic
acid
molecule comprising a nucleotide sequence of the invention (e.g., a sequence
of an odd-
6
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
numbered SEQ ID NO in the Sequence Listing, such as SEQ ID NO:1, SEQ ID N0:3,
or SEQ ID NO:S). Preferably, the isolated nucleic acid molecule corresponds to
a
naturally-occurnng nucleic acid molecule. More preferably, the isolated
nucleic acid
encodes a naturally-occurring C, glutamicum MP protein, or a biologically
active
portion thereof.
Another aspect of the invention pertains to vectors, e.g., recombinant
expression
vectors, containing the nucleic acid molecules of the invention, alone or in
combination
with one or more nucleic acid molecules involved in the same or different
pathway, and
host cells into which such vectors have been introduced. In one embodiment,
such a
host cell is used to produce an MP protein by culturing the host cell in a
suitable
medium. The MP protein can be then isolated from the medium or the host cell.
Yet another aspect of the invention pertains to a genetically altered
microorganism in which one or more MP genes, alone or in combination with one
or
more genes involved in the same or different metabolic pathway, have been
introduced
or altered. In one embodiment, the genome of the microorganism has been
altered by
introduction of a nucleic acid molecule of the invention encoding one or more
wild-type
or mutated MP sequences as transgenes alone or in combination with one or more
nucleic acid molecules involved in the same or different metabolic pathway. In
another
embodiment, one or more endogenous MP genes within the genome of the
microorganism have been altered, e.g., functionally disrupted, by homologous
recombination with one or more altered MP genes. In another embodiment, one or
more
endogenous or introduced MP genes, alone or in combination with one or more
genes of
the same or different metabolic pathway in a microorganism have been altered
by one or
more point mutations, deletions, or inversions, but still encode functional MP
proteins.
In still another embodiment, one or more of the regulatory regions (e.g., a
promoter,
repressor, or inducer) of one or more MP genes in a microorganism, alone or in
combination with one or more MP genes or in combination with one or more genes
of
the same or different metabolic pathway, has been altered (e.g., by deletion,
truncation,
inversion, or point mutation) such that the expression of one or more MP genes
is
modulated. In a preferred embodiment, the microorganism belongs to the genus
Corynebacterium or Brevibacterium, with Corynebacterium glutarnicum being
particularly preferred. In a preferred embodiment, the microorganism is also
utilized for
the production of a desired compound, such as an amino acid, with lysine and
7
CA 02571917 2007-O1-08
w0 01/66573 PCT/IB00/02035
methionine being particularly preferred. In a particularly preferred
embodiment, the MP
gene is the metZ gene (SEQ ID NO:1), metC gene (SEQ ID N0:3), or the RXA00657
gene (SEQ ID NO:S), alone or in combination with one or more MP genes of the
invention or in combination with one or more genes involved in methionine
and/or
lysine metabolism.
In another aspect, the invention provides a method of identifying the presence
or
activity of Cornyebacterium diphtheriae in a subject. This method includes
detection of
one or more of the nucleic acid or amino acid sequences of the invention
(e.g., the
sequences set forth in Table l and in the Sequence Listing as SEQ ID NOs 1
through
122) in a subject, thereby detecting the presence or activity of
Corynebacterium
diphtheriae in the subject.
Still another aspect of the invention pertains to an isolated MP protein or
portion,
e.g., biologically active portion, thereof. In a preferred embodiment, the
isolated MP
protein or portion thereof, alone or in combination with one or more MP
proteins of the
invention or in combination with one or more proteins of the same or different
metabolic
pathway, can catalyze an enzymatic reaction involved in one or more pathways
for the
metabolism of an amino acid, e.g., lysine or methioriine, a vitamin, a
cofactor, a
nutraceutical, a nucleotide, a nucleoside, or trehalose. In another preferred
embodiment,
the isolated MP protein or portion thereof, is sufficiently homologous to an
amino acid
sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO: in
the
Sequence Listing, such as SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6) such that
the
protein or portion thereof maintains the ability to catalyze an enzymatic
reaction
involved in one or more pathways for the metabolism of an amino acid, a
vitamin, a
cofactor, a nutraceutical, a nucleotide, a nucleoside, or trehalose.
The invention also provides an isolated preparation of an MP protein. In
preferred embodiments, the MP protein comprises an amino acid sequence of the
invention (e.g., a sequence of an even-numbered SEQ ID NO: of the Sequence
Listing
such as SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6). In another preferred
embodiment, the invention pertains to an isolated full length protein which is
substantially homologous to an entire amino acid sequence of the invention
(e.g., a
sequence of an even-numbered SEQ ID NO of the Sequence Listing such as SEQ ID
N0:2, SEQ ID N0:4, or SEQ ID N0:6) (encoded by an open reading frame set forth
in
a corresponding odd-numbered SEQ ID NO: of the Sequence Listing such as SEQ ID
8
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
NO: l, SEQ ID N0:3, or SEQ ID N0:5). In yet another embodiment, the protein is
at
least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%,
preferably
at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more
preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%,
81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%,
and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more
homologous to an entire amino acid sequence of the invention (e.g., a sequence
of an
even-numbered SEQ ID NO: of the Sequence Listing such as SEQ ID N0:2, SEQ ID
N0:4, or SEQ ID N0:6). In other embodiments, the isolated MP protein comprises
an
amino acid sequence which is at least about 50% or more homologous to one of
the
amino acid sequences of the invention (e.g., a sequence of an even-numbered
SEQ ID
NO: of the Sequence Listing such as SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6)
and is able to catalyze an enzymatic reaction in an amino acid, vitamin,
cofactor,
nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway either
alone or in
combination one or more MP proteins of the invention or any protein of the
same or
different metabolic pathway, or has one or more of the activities set forth in
Table 1.
Alternatively, the isolated MP protein can comprise an amino acid sequence
which is encoded by a nucleotide sequence which hybridizes, e.g., hybridizes
under
stringent conditions, or is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%,
57%,
58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, or 70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%,
76%,
77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%,
or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%,
98%,
99%, 99.7% or more homologous to a nucleotide sequence of one of the even-
numbered
SEQ ID NOs set forth in the Sequence Listing. It is also preferred that the
preferred
forms of MP proteins also have one or more of the MP bioactivities described
herein.
The MP polypeptide, or a biologically active portion thereof, can be
operatively
linked to a non-MP polypeptide to form a fusion protein. In preferred
embodiments, this
fusion protein has an activity which differs from that of the MP protein
alone. In other
preferred embodiments, this fusion protein, when introduced into a C.
glutamicum
pathway for the metabolism of an amino acid, vitamin, cofactor, nutraceutical,
results in
increased yields and/or efficiency of production of a desired fine chemical
from C.
glutamicum. In particularly preferred embodiments, integration of this fusion
protein
9
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
into an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside,
or trehalose
metabolic pathway of a host cell modulates production of a desired compound
from the
cell.
In another aspect, the invention provides methods for screening molecules
which
modulate the activity of an MP protein, either by interacting with the protein
itself or a
substrate or binding partner of the MP protein, or by modulating the
transcription or
translation of an MP nucleic acid molecule of the invention.
Another aspect of the invention pertains to a method for producing a fine
chemical. This method involves the culturing of a cell containing one or more
vectors
directing the expression of one or more MP nucleic acid molecules of the
either alone or
in combination one or more MP nucleic acid molecules of the invention or any
nucleic
acid molecule of the same or different metabolic pathway, such that a fine
chemical is
produced. In a preferred embodiment, this method further includes the step of
obtaining
a cell containing such a vector, in which a cell is transfected with a vector
directing the
expression of an MP nucleic acid. In another preferred embodiment, this method
further
includes the step of recovering the fine chemical from the culture. In a
particularly
preferred embodiment, the cell is from the genus Corynebacterium or
Brevibacterium,
or is selected from those strains set forth in Table 3. In another preferred
embodiment,
the MP genes is the metZ gene (SEQ ID NO:1), metC gene (SEQ ID N0:3), or the
gene
designated as RXA00657 (SEQ ID NO:S) (see Table 1 ), alone or in combination
with
one or more MP nucleic acid molecules of the invention or with one or more
genes
involved in methionine and/or lysine metabolism. In yet another preferred
embodiment,
the fine chemical is an amino acid, e.g., L-lysine and L-methionine.
Another aspect of the invention pertains to methods for modulating production
of
a molecule from a microorganism. Such methods include contacting the cell with
an
agent which modulates MP protein activity or MP nucleic acid expression such
that a
cell associated activity is altered relative to this same activity in the
absence of the
agent. In a preferred embodiment, the cell is modulated for one or more C.
glutarnicum
amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or
trehalose
metabolic pathways, such that the yields or rate of production of a desired
fine chemical
by this microorganism is improved. The agent which modulates MP protein
activity can
be an agent which stimulates MP protein activity or MP nucleic acid
expression.
Examples of agents which stimulate MP protein activity or MP nucleic acid
expression
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
include small molecules, active MP proteins, and nucleic acids encoding MP
proteins
that have been introduced into the cell. Examples of agents which inhibit MP
activity or
expression include small molecules and antisense MP nucleic acid molecules-
Another aspect of the invention pertains to methods for modulating yields of a
desired compound from a cell, involving the introduction of a wild-type or
mutant MP
gene into a cell, either alone or in combination one or more MP nucleic acid
molecules
of the invention or any nucleic acid molecule of the same or different
metabolic
pathway, either maintained on a separate plasmid or integrated into the genome
of the
host cell. If integrated into the genome, such integration can be random, or
it can take
place by homologous recombination such that the native gene is replaced by the
introduced copy, causing the production of the desired compound from the cell
to be
modulated. In a preferred embodiment, said yields are increased. In another
preferred
embodiment, said chemical is a fine chemical. In a particularly preferred
embodiment,
said fine chemical is an amino acid. In especially preferred embodiments, said
amino
1 S acid are L-lysine and L-methionine. In another preferred embodiment, said
gene is the
metZ gene (SEQ ID NO:1), metC gene (SEQ ID N0:3), or the RXA00657 gene (SEQ
ID NO:S), alone or in combination with one or more MP nucleic acid molecules
of the
invention or with one or more genes involved in methionine and/or lysine
metabolism.
Detailed Description of the Invention
The present invention provides MP nucleic acid and protein molecules which are
involved in the metabolism of certain fine chemicals in Corynebacterium
glutamicum,
including amino acids, e.g., lysine and methionine, vitamins, cofactors,
nutraceuticals,
nucleotides, nucleosides, and trehalose. The molecules of the invention may be
utilized
in the modulation of production of fine chemicals from microorganisms, such as
C.
glutamicum, either directly (e.g., where modulation of the activity of a
lysine or
methionine biosynthesis protein has a direct impact on the production or
efFciency of
production of lysine or methionine from that organism), or may have an
indirect impact
which nonetheless results in an increase of yield or e~ciency of production of
the
desired compound (e.g., where modulation of the activity of a nucleotide
biosynthesis
protein has an impact on the production of an organic acid or a fatty acid
from the
bacterium, perhaps due to improved growth or an increased supply of necessary
co-
factors, energy compounds, or precursor molecules). The MP molecules may be
utilized
11
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
alone or in combination with other MP molecules of the invention, or in
combination
with other molecules involved in the same or a different metabolic pathway
(e.g., lysine
or methione metabolism). In a preferred embodiment, the MP molecules are the
metZ
(SEQ ID NO:1), metC (SEQ ID N0:3), or RXA00657 (SEQ ID NO:S) nucleic acid
molecules and the proteins encoded by these nucleic acid molecules (SEQ ID
N0:2,
SEQ ID N0.:4 and SEQ ID N0.:6, respectively). Aspects of the invention are
further
explicated below.
I. Fine Chemicals
The term 'fine chemical' is art-recognized and includes molecules produced by
an organism which have applications in various industries, such. as, but not
limited to,
the pharmaceutical, agriculture, and cosmetics industries. Such compounds
include
organic acids, such as tartaric acid, itaconic acid, and diaminopimelic acid,
both
proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases,
nucleosides, and nucleotides (as described e.g. in Kuninaka, A. (1996)
Nucleotides and '
related compounds, p. 561-612, in Biotechnology vol. 6, Rehm et al., eds. VCH:
Weinheim, and references contained therein), lipids, both saturated and
unsaturated fatty
acids (e.g., arachidonic acid), diols (e.g., propane diol, and butane diol),
carbohydrates
(e.g., hyaluronic acid and trehalose), aromatic compounds (e.g., aromatic
amines,
vanillin, and indigo), vitamins and cofactors (as described in Ullmann's
Encyclopedia of
Industrial Chemistry, vol. A27, "Vitamins", p. 443-613 (1996) VCH: Weinheim
and
references therein; and Ong, A.S., Niki, E. & Packer, L. (1995) 'Nutrition,
Lipids,
Health, and Disease" Proceedings of the UNESCO/Confederation of Scientific and
Technological Associations in Malaysia, and the Society for Free Radical
Research -
Asia, held Sept. 1-3, 1994 at Penang, Malaysia, AOCS Press, (1995)), enzymes,
polyketides (Cane et al. (1998) Science 282: 63-68), and all other chemicals
described in
Gutcho (1983) Chemicals by Fermentation, Noyes Data Corporation, ISBN:
0818805086 and references therein. The metabolism and uses of certain of these
fine
chemicals are further explicated below.
A. Amino Acid Metabolism and Uses
Amino acids comprise the basic structural units of all proteins, and as such
are
essential for normal cellular functioning in all organisms. The term "amino
acid" is art-
12
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
recognized. The proteinogenic amino acids, of which there are 20 species,
serve as
structural units for proteins, in which they are linked by peptide bonds,
while the
nonproteinogenic amino acids (hundreds of which are known) are not normally
found in
proteins (see Ulinann's Encyclopedia of Industrial Chemistry, vol. A2, p. 57-
97 VCH:
Weinheim (1985)). Amino acids may be in the D- or L- optical configuration,
though L-
amino acids are generally the only type found in naturally-occurring proteins.
Biosynthetic and degradative pathways of each of the 20 proteinogenic amino
acids
have been well characterized in both prokaryotic and eukaryotic cells (see,
for example,
Stryer, L. Biochemistry, 3'd edition, pages 578-590 (1988)). The 'essential'
amino acids
(histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine,
tryptophan,
and valine), so named because they are generally a nutritional requirement due
to the
complexity of their biosyntheses, are readily converted by simple biosynthetic
pathways
to the remaining 11 'nonessential' amino acids (alanine, arginine, asparagine,
aspartate,
cysteine, glutamate, glutamine, glycine, proline, serine, and tyrosine).
Higher animals
do retain the ability to synthesize some of these amino acids, but the
essential amino
acids must be supplied from the diet in order for normal protein synthesis to
occur.
Aside from their function in protein biosynthesis, these amino acids are
interesting chemicals in their own right, and many have been found to have
various
applications in the food, feed, chemical, cosmetics, agriculture, and
pharmaceutical
industries. Lysine is an important amino acid in the nutrition not only of
humans, but
also of monogastric animals such as poultry and swine. Glutamate is most
commonly
used as a flavor additive (mono-sodium glutamate, MSG) and is widely used
throughout
the food industry, as are aspartate, phenylalanine, glycine, and cysteine.
Glycine, L-
methionine and tryptophan are all utilized in the pharmaceutical industry.
Glutamine,
valine, leucine, isoleucine, histidine, arginine, proline, serine and alanine
are of use in
both the pharmaceutical and cosmetics industries. Threonine, tryptophan, and
D! L-
methionine are common feed additives. (Leuchtenberger, W. (1996) Amino aids -
technical production and use, p. 466-502 in Rehm et al. (eds.) Biotechnology
vol. 6,
chapter 14a, VCH: Weinheim). Additionally, these amino acids have been found
to be
useful as precursors for the synthesis of synthetic amino acids and proteins,
such as N-
acetylcysteine, S-carboxymethyl-L-cysteine, (S)-5-hydroxytryptophan, and
others
described in Ulmann's Encyclopedia of Industrial Chemistry, vol. A2, p. 57-97,
VCH:
Weinheim, 1985.
13
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
The biosynthesis of these natural amino acids in organisms capable of
producing
them, such as bacteria, has been well characterized (for review of bacterial
amino acid
biosynthesis and regulation thereof, see Umbarger, H.E.(1978) Ann. Rev.
Biochem. 47:
533-606). Glutamate is synthesized by the reductive amination of a-
ketoglutarate, an
intermediate in the citric acid cycle. Glutamine, proline, and arginine are
each
subsequently produced from glutamate. The biosynthesis of serine is a three-
step
process beginning with 3-phosphoglycerate (an intermediate in glycolysis), and
resulting
in this amino acid after oxidation, transamination, and hydrolysis steps. Both
cysteine
and glycine are produced from serine; the former by the condensation of
homocysteine
with serine, and the latter by the transferal of the side-chain ~-carbon atom
to
tetr~hydrofolate, in a reaction catalyzed by serine transhydroxymethylase.
Phenylalanine and tyrosine are synthesized from the glycolytic and pentose
phosphate
pathway precursors erythrose 4-phosphate and phosphoenolpyruvate in a 9-step
biosynthetic pathway that differ only at the final two steps after synthesis
of prephenate.
Tryptophan is also produced from these two initial molecules, but its
synthesis'is an 11-
step pathway. Tyrosine may also be synthesized from phenylalanine, in a
reaction
catalyzed by phenylalanine hydroxylase. Alanine, valine, and leucine are all
biosynthetic products of pyruvate, the final product of glycolysis. Aspartate
is formed
from oxaloacetate, an intermediate of the citric acid cycle. Asparagine,
methionine,
threonine, and lysine are each produced by the conversion of aspartate.
Isoleucine is
formed from threonine.
The biosynthetic pathways leading to methionine have been studied in diverse
organisms. The first step, acylation of homoserine, is common to all of the
organisms,
even though the source of the transferred acyl groups is different.
Escherichia coli and
the related species use succinyl-CoA (Michaeli, S. and Ron, E. Z. (1981) Mol.
Gen.
Genet. 182, 349-354), while Saccharomyces cerevisiae (Langin, T., et al.
(1986) Gene
49, 283-293), Brevibacterium flavum (Miyajima, R. and Shiio, I. (1973) J.
Biochem. 73,
1061-1068; Ozaki, H. and Shiio, I. (1982) J. Biochem. 91,1163-1171), C.
glutamicum
(Park, S.-D., et al. (1998) Mol. Cells 8, 286-294), and Zeptospira meyeri
(Belfaiza, J. et
al. (1998) 180, 250-255; Bourhy, P., et al. (1997) J. Bacteriol. 179, 4396-
4398) use
acetyl-CoA as the acyl donor. Formation of homocysteine from acylhomoserine
can
occur in two different ways. E. coli uses the transsulfuration pathway which
is
catalyzed by cystathionine ~y-synthase (the product of metB) and cystathionine
~i-lyase
14
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
(the product of metC). S. cerevisiae (Cherest, H. and Surdin-Kerjan, Y. (1992)
Genetics
130, 51-58), B. flavum (Ozaki, H. and Shiio, I. (1982) J. Biochem. 91, 1163-
1171),
Pseudomonas aeruginosa (Foglino, M., et al. (1995) Microbiology 141, 431-439),
and
L. meyeri (Belfaiza, J., et al. (1998) J. Bacteriol. 180, 250-255) utilize the
direct
sulfhydrylation pathway which is catalyzed by acylhomoserine sulfhydrylase.
Unlike
closely related B. flavum which uses only the direct sulfhydrylation pathway,
enzyme
activities of the transsulfuration pathway have been detected in the extracts
of the C.
glutamicum cells and the pathway has been proposed to be the route for
methionine
biosynthesis in the organism (Hwang, B-J., et al. (1999) Mol. Cells 9, 300-
308; Kase, H.
and Nakayama, K. (1974) Agr. Biol. Chem. 38, 2021-2030; Park, S.-D., et al.
1998)
Mol. Cells 8, 286-294).
Although some genes involved in methionine biosynthesis in C. glutamicum
have been isolated, information on the biosynthesis of methionine in C.
glutamicum is
still very limited. No genes other than metA and metB have been isolated from
the
organism. To understand the biosynthetic pathways leading to methioriine in C.
glutamicum, we have isolated and characterized the metC gene (SEQ ID N0:3) and
the
metZ (also called meth gene (SEQ ID NO:1) of C. glutamicum (see Table 1).
Amino acids in excess of the protein synthesis needs of the cell cannot be
stored,
and are instead degraded to provide intermediates for the major metabolic
pathways of
the cell (for review see Stryer, L. Biochemistry 3'd ed. Ch. 21 "Amino Acid
Degradation
and the Urea Cycle" p. 495-516 (1988)). Although the cell is able to convert
unwanted
amino acids into useful metabolic intermediates, amino acid production is
costly in
terms of energy, precursor molecules, and the enzymes necessary to synthesize
them.
Thus it is not surprising that amino acid biosynthesis is regulated by
feedback inhibition,
in which the presence of a particular amino acid serves to slow or entirely
stop its own
production (for overview of feedback mechanisms in amino acid biosynthetic
pathways,
see Stryer, L. Biochemistry, 3'd ed. Ch. 24: "Biosynthesis of Amino Acids and
Heme" p.
575-600 (1988)). Thus, the output of any particular amino acid is limited by
the amount
of that amino acid present in the cell.
B. Vitamin, Cofactor, and ~Vutraceutical Metabolism and Uses
Vitamins, cofactors, and nutraceuticals comprise another group of molecules
which the higher animals have lost the ability to synthesize and so must
ingest, although
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
they are readily synthesized by other organisms, such as bacteria. These
molecules are
either bioactive substances themselves, or are precursors of biologically
active
substances which may serve as electron carriers or intermediates in a variety
of
metabolic pathways. Aside from their nutritive value, these compounds also
have
significant industrial value as coloring agents, antioxidants, and catalysts
or other
processing aids. (For an overview of the structure, activity, and industrial
applications
of these compounds, see, for example, Ullinan's Encyclopedia of Industrial
Chemistry,
"Vitamins" vol. A27, p. 443-613, VCH: Weinheim, 1996.) The term "vitamin" is
art-
recognized, and includes nutrients which are required by an organism for
normal
functioning, but which that organism cannot synthesize by itself. The group of
vitamins
may encompass cofactors and nutraceutical compounds. The language "cofactor"
includes nonproteinaceous compounds required for a normal enzymatic activity
to
occur. Such compounds may be organic or inorganic; the cofactor molecules of
the
invention are preferably organic. The term "nutraceutical" includes dietary
supplements
having health benefits in plants and animals, particularly humans. Examples of
such
molecules are vitamins, antioxidants, and also certain lipids (e.g.,
polyunsaturated fatty
acids).
The biosynthesis of these molecules in organisms capable of producing them,
such as bacteria, has been largely characterized (Ullinan's Encyclopedia of
Industrial
Chemistry, "Vitamins" vol. A27, p. 443-613, VCH: Weinheim, 1996; Michal, G.
(1999)
Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John
Wiley
& Sons; Ong, A.S., Niki, E. & Packer, L. (1995) "Nutrition, Lipids, Health,
and
Disease" Proceedings of the UNESCO/Confederation of Scientific and
Technological
Associations in Malaysia, and the Society for Free Radical Research - Asia,
held Sept.
1-3, 1994 at Penang, Malaysia, AOCS Press: Champaign, IL X, 374 S).
Thiamin (vitamin B 1) is produced by the chemical coupling of pyrimidine and
thiazole moieties. Riboflavin (vitamin B2) is synthesized from guanosine-5'-
triphosphate
(GTP) and ribose-5'-phosphate. Riboflavin, in turn, is utilized for the
synthesis of flavin
mononucleotide (FMI~ and flavin adenine dinucleotide (FAD). The family of
compounds collectively termed 'vitamin B6' (e.g., pyridoxine, pyridoxamine,
pyridoxa-
5'-phosphate, and the commercially used pyridoxin hydrochloride) are all
derivatives of
the common structural unit, 5-hydroxy-6-methylpyridine. Pantothenate
(pantothenic
acid, (R)-(+~N-(2,4-dihydroxy-3,3-dimethyl-1-oxobutyl)-~-alanine) can be
produced
16
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
either by chemical synthesis or by fermentation. The final steps in
pantothenate
biosynthesis consist of the ATP-driven condensation of (3-alanine and pantoic
acid. The
enzymes responsible for the biosynthesis steps for the conversion to pantoic
acid, to ~-
alanine and for the condensation to panthotenic acid are known. The
metabolically
active form of pantothenate is Coenzyme A, for which the biosynthesis proceeds
in 5
enzymatic steps. Pantothenate, pyridoxal-5'-phosphate, cysteine and ATP are
the
precursors of Coenzyme A. These enzymes not only catalyze the formation of
panthothante, but also the production of (R)-pantoic acid, (R)-pantolacton,
(R)-
panthenol (provitamin BS), pantetheine (and its derivatives) and coenzyme A.
Biotin biosynthesis from the precursor molecule pimeloyl-CoA in
microorganisms has been studied in detail and several of the genes involved
have been
identified. Many of the corresponding proteins have been found to also be
involved in
Fe-cluster synthesis and are members of the nifs class of proteins. Lipoic
acid is
derived from octanoic acid, and serves as a coenzyme in energy metabolism,
where it
becomes part.of the pyruvate dehydrogenase complex and the a-ketoglutarate
dehydrogenase complex. The folates are a group of substances which are all
derivatives
of folic acid, which is turn is derived from L-glutamic acid, p-amino-benzoic
acid and 6-
methylpterin. The biosynthesis of folic acid and its derivatives, starting
from the
metabolism intermediates guanosine-5'-triphosphate (GTP), L-glutamic acid and
p-
amino-benzoic acid has been studied in detail in certain microorganisms.
Corrinoids (such as the cobalamines and particularly vitamin B12) and
porphyrines belong to a group of chemicals characterized by a tetrapyrole ring
system.
The biosynthesis of vitamin B12 is sufficiently complex that it has not yet
been
completely characterized, but many of the enzymes and substrates involved are
now
known. Nicotinic acid (nicotinate), and nicotinamide are pyridine derivatives
which are
also termed 'niacin'. Niacin is the precursor of the important coenzymes NAD
(nicotinamide adenine dinucleotide} and NADP (nicotinamide adenine
dinucleotide
phosphate) and their reduced forms.
The large-scale production of these compounds has largely relied on cell-free
chemical syntheses, though some of these chemicals have also been produced by
large-
scale culture of microorganisms, such as riboflavin, Vitamin B6, pantothenate,
and
biotin. Only Vitamin B1z is produced solely by fermentation, due to the
complexity of
17
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
its synthesis. In vitro methodologies require significant inputs of materials
and time,
often at great cost.
C. Purme, Pyrimidine, Nucleoside and Nucleotide Metabolism and Uses
Purine and pyrimidine metabolism genes and their corresponding proteins are
important targets for the therapy of tumor diseases and viral infections. The
language
"purine" or "pyrimidine" includes the nitrogenous bases which are constituents
of
nucleic acids, co-enzymes, and nucleotides. The term "nucleotide" includes the
basic
structural units of nucleic acid molecules, which are comprised of a
nitrogenous base, a
pentose sugar (in the case of RNA, the sugar is ribose; in the case of DNA,
the sugar is
D-deoxyribose), and phosphoric acid. The language "nucleoside" includes
molecules
which serve as precursors to nucleotides, but which are lacking the phosphoric
acid
moiety that nucleotides possess. By inhibiting the biosynthesis of these
molecules, or
their mobilization to form nucleic acid molecules, it is possible to inhibit
RNA and DNA
synthesis; by inhibiting this activity in a fashion targeted to cancerous
cells, the ability
of tumor cells to divide and replicate may be inhibited. Additionally, there
are
nucleotides which do not form nucleic acid molecules, but rather serve as
energy stores
(i.e., AMP) or as coenzymes (i.e., FAD and NAD).
Several publications have described the use of these chemicals for these
medical
indications, by influencing purine and/or pyrimidine metabolism (e.g.
Christopherson,
R.I. and Lyons, S.D. (1990) "Potent inhibitors of de novo pyrimidine and
purine
biosynthesis as chemotherapeutic agents." Med. Res. Reviews 10: 505-548).
Studies of
enzymes involved in purine and pyrimidine metabolism have been focused on the
development of new drugs which can be used, for example, as immunosuppressants
or
anti-proliferants (Smith, J.L., (1995) "Enzymes in nucleotide synthesis."
Curr. Opin.
Struct. Biol. 5: 752-757; (1995) Biochem Soc. Transact. 23: 877-902). However,
purine
and pyrimidine bases, nucleosides and nucleotides have other utilities: as
intermediates
in the biosynthesis of several fine chemicals (e.g., thiamine, S-adenosyl-
methionine,
folates, or riboflavin), as energy Garners for the cell (e.g., ATP or GTP),
and for
chemicals themselves, commonly used as flavor enhancers (e.g., lMP or GMP) or
for
several medicinal applications (see, for example, Kuninaka, A. (1996)
Nucleotides and
Related Compounds in Biotechnology vol. 6, Rehm et al., eds. VCH: Weinheim, p.
561-
612). Also, enzymes involved in purine, pyrimidine, nucleoside, or nucleotide
18
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
metabolism are increasingly serving as targets against which chemicals for
crop
protection, including fungicides, herbicides and insecticides, are developed.
The metabolism of these compounds in bacteria has been characterized (for
reviews see, for example, Zalkin, H. and Dixon, J.E. (1992) "de novo purine
nucleotide
biosynthesis", in: Progress in Nucleic Acid Research and Molecular Biology,
vol. 42,
Academic Press:, p. 259-287; and Michal, G. (1999) "Nucleotides and
Nucleosides",
Chapter 8 in: Biochemical Pathways: An Atlas of Biochemistry and Molecular
Biology,
Wiley: New York). Purine metabolism has been the subject of intensive
research, and is
essential to the normal functioning of the cell. Impaired purine metabolism in
higher
animals can cause severe disease, such as gout. Purine nucleotides are
synthesized from
ribose-5-phosphate, in a series of steps through the intermediate compound
inosine-5'-
phosphate (IMP), resulting in the production of guanosine-5'-monophosphate
(GMP) or
adenosine-5'-monophosphate (AMP), from which the triphosphate forms utilized
as
nucleotides are readily formed. These compounds are also utilized'as energy
stores, so
their degradation provides energy for many different biochemical processes in
the cell.
Pyrimidine biosynthesis proceeds by the formation of uridine-5'-monophosphate
(UMP)
from ribose-5-phosphate. UMP, in turn, is converted to cytidine-5'-
triphosphate (CTP).
The deoxy- forms of all of these nucleotides are produced in a one step
reduction
reaction from the diphosphate ribose form of the nucleotide to the diphosphate
deoxyribose form of the nucleotide. Upon phosphorylation, these molecules are
able to
participate in DNA synthesis.
D. Trehalose Metabolism and Uses
Trehalose consists of two glucose molecules, bound in a, a-1,1 linkage. It is
commonly used in the food industry as a sweetener, an additive for dried or
frozen
foods, and in beverages. However, it also has applications in the
pharmaceutical,
cosmetics and biotechnology industries (see, for example, Nishimoto et al.,
(1998) U.S.
Patent No. 5,759,610; Singer, M.A. and Lindquist, S. (1998) Trends Biotech.
16: 460-
467; Paiva, C.L.A. and Panek, A.D. (1996) Biotech. Ann. Rev. 2: 293-314; and
Shiosaka, M. (1997) J. Japan 172: 97-102). Trehalose is produced by enzymes
from
many microorganisms and is naturally released into the surrounding medium,
from
which it can be collected using methods known in the art.
19
CA 02571917 2007-O1-08
WO 01/66573 PCTlIB00/02035
II. Elements and Methods of the Invention
The present invention is based, at least in part, on the discovery of novel
molecules, referred to herein as MP nucleic acid and protein molecules (see
Table 1 ),
which play a role in or function in one or more cellular metabolic pathways.
In one
embodiment, the MP molecules catalyze an enzymatic reaction involving one or
more
amino acid, e.g., lysine or methionine, vitamin, cofactor, nutraceutical,
nucleotide,
nucleoside, or trehalose metabolic pathways. In a preferred embodiment, the
activity of
one or more MP molecules of the present invention, alone or in combination
with
molecules involved in the same or different metabolic pathway (e.g.,
methionine or
lysine metabolism), in one or more C. glutamicum metabolic pathways for amino
acids,
vitamins, cofactors, nutraceuticals, nucleotides, nucleosides or trehalose has
an impact
on the production of a desired fine chemical by this organism. In a
particularly
preferred embodiment, the MP molecules of the invention are modulated in
activity,
such that the C. glutamicum metabolic pathways in which the MP proteins of the
invention are involved are modulated in efficiency or output, which either
directly or
indirectly modulates the production or efficiency of production of a desired
fine
chemical by C. glutamicum. In a preferred embodiment, the fine chemical is an
amino
acid, e.g., lysine or methionine. In another preferred embodiment, the MP
molecules are
metZ, metY, and/or 12XA00657 (see Table 1).
The language, "MP protein" or "MP polypeptide" includes proteins which play a
role in, e.g., catalyze an enzymatic reaction, in one or more amino acid,
vitamin,
cofactor, nutraceutical, nucleotide, nucleoside or trehalose metabolic
pathways.
Examples'of MP proteins include those encoded by the MP genes set forth in
Table 1
and by the odd-numbered SEQ ID NOs. The terms "MP gene" or "MP nucleic acid
sequence" include nucleic acid sequences encoding an MP protein, which consist
of a
coding region and also corresponding untranslated 5' and 3' sequence regions.
Examples of MP genes include those set forth in Table 1. The terms
"production" or
"productivity" are art-recognized and include the concentration of the
fermentation
product (for example, the desired fine chemical) formed within a given time
and a given
fermentation volume (e.g., kg product per hour per liter). The term
"efficiency of
production" includes the time required for a particular level of production to
be achieved
(for example, how long it takes for the cell to attain a particular rate of
output of a fme
chemical). The term "yield" or "productlcarbon yield" is art-recognized and
includes
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
the efficiency of the conversion of the carbon source into the product (i.e.,
fine
chemical). This is generally written as, for example, kg product per kg carbon
source.
By increasing the yield or production of the compound, the quantity of
recovered
molecules, or of useful recovered molecules of that compound in a given amount
of
S culture over a given amount of time is increased. The terms "biosynthesis"
or a
"biosynthetic pathway" are art-recognized and include the synthesis of a
compound,
preferably an organic compound, by a cell from intermediate compounds in what
may
be a multistep and highly regulated process. The terms "degradation" or a
"degradation
pathway" are art-recognized and include the breakdown of a compound,
preferably an
organic compound, by a cell to degradation products (generally speaking,
smaller or less
complex molecules) in what may be a multistep and highly regulated process.
The
language "metabolism" is art-recognized and includes the totality of the
biochemical
reactions that take place in an organism. The metabolism of a particular
compound,
then, (e.g., the metabolism of an amino acid such as glycine) comprises the
overall
biosynthetic, modification, and degradation pathways in the cell related to
this
compound.
The MP molecules of the present invention may be combined with one or more
MP molecules of the invention or one or more molecules of the same or
different
metabolic pathway to increase the yield of a desired fine chemical. In a
preferred
embodiment, the frne chemical is an amino acid, e.g., lysine or methionine.
Alternatively, or in addition, a byproduct which is not desired may be reduced
by
combination or disruption of MP molecules or other metabolic molecules (e.g.,
molecules involved in lysine or methionine metabolism). MP molecules combined
with
other molecules of the same or a different metabolic pathway may be altered in
their
nucleotide sequence and in the corresponding amino acid sequence to alter
their activity
under physiological conditions, which leads to an increase in productivity
and/or yield
of a desired fine chemical. In a fiirther embodiment, an MP molecule in its
original or in
its above-described altered form may be combined with other molecules of the
same or a
different metabolic pathway which are altered in their nucleotide sequence in
such a way
that their activity is altered under physiological conditions which leads to
an increase in
productivity and/or yield of a desired fine chemical, e.g., an amino acid such
as
methionine or lysine.
21
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
In another embodiment, the MP molecules of the invention, alone or in
combination with one or more molecules of the same or different metabolic
pathway,
are capable of modulating the production of a desired molecule, such as a fine
chemical,
in a microorganism such as G glutamicum. Using recombinant genetic techniques,
one
or more of the biosynthetic or degradative enzymes of the invention for amino
acids,
e.g., lysine or methionine, vitamins, cofactors, nutraceuticals, nucleotides,
nucleosides,
or trehalose may be manipulated such that its function is modulated. For
example, a
biosynthetic enzyme may be improved in efficiency, or its allosteric control
region
destroyed such that feedback inhibition of production of the compound is
prevented.
Similarly, a degradative enzyme may be deleted or modified by substitution,
deletion, or
addition such that its degradative activity is lessened for the desired
compound without
impairing the viability of the cell. In each case, the overall yield or rate
of production of
one of these desired fine chemicals may be increased.
It is also possible that such alterations in the protein and nucleotide
molecules of
the invention may improve the production of other fine chemicals besides the
amino
acids, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and
trehalose.
Metabolism of any one compound is necessarily intertwined with other
biosynthetic and
degradative pathways within the cell, and necessary cofactors, intermediates,
or
substrates in one pathway are likely supplied or limited by another such
pathway.
Therefore, by modulating the activity of one or more of the proteins of the
invention, the
production or efficiency of activity of another fine chemical biosynthetic or
degradative
pathway may be impacted. For example, amino acids serve as the structural
units of all
proteins, yet may be present intracellularly in levels which are limiting for
protein
synthesis; therefore, by increasing the efficiency of production or the yields
of one or
more amino acids within the cell, proteins, such as biosynthetic or
degradative proteins,
may be more readily synthesized. Likewise, an alteration in a metabolic
pathway
enzyme such that a particular side reaction becomes more or less favored may
result in
the over- or under-production of one or more compounds which are utilized as
intermediates or substrates for the production of a desired fine chemical.
The isolated nucleic acid sequences of the invention are contained within the
genome of a Corynebacterium gdutamicum strain available through the American
Type
Culture Collection, given designation ATCC 13032. The nucleotide sequence of
the
isolated C. glutamicum MP DNAs and the predicted amino acid sequences of the
C.
22
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
glutamicum MP proteins are shown in the Sequence Listing as odd-numbered SEQ
ID
NOs and even-numbered SEQ ID NOs, respectively. Computational analyses were
performed which classified and/or identified these nucleotide sequences as
sequences
which encode metabolic pathway proteins, e.g., proteins involved in the
methionine or
lysine metabolic pathways.
The present invention also pertains to proteins which have an amino acid
sequence which is substantially homologous to an amino acid sequence of the
invention
(e.g., the sequence of an even-numbered SEQ ID NO of the Sequence Listing). As
used
herein, a protein which has an amino acid sequence which is substantially
homologous
to a selected amino acid sequence is least about SO% homologous to the
selected amino
acid sequence, e.g., the entire selected amino acid sequence. A protein which
has an
amino acid sequence which is substantially homologous to a selected amino acid
sequence can also be least about 50%, 51%, S2%, S3%, S4%, SS%, S6%, S7%, 58%,
S9%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 6S%, 66%, 67%, 68%,
1S 69%, or 70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%,
77%,
78%, 79%, or 80%, 81%, 82%, 83%, 84%, 8S%, 86%, 87%, 88%, 89%, or 90%, or
91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%,
98%,
99%, 99.7% or more homologous to the selected amino acid sequence.
An MP protein of the invention, or a biologically active portion or fragment
thereof, alone or in combination with one or more proteins of the same or
different
metabolic pathway, can catalyze an enzymatic reaction in one or more amino
acid,
vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose
metabolic
pathways, or have one or more of the activities set forth in Table 1 (e.g.,
metabolism of
methionine or lysine biosynthesis).
2S
Various aspects of the invention are described in further detail in the
following
subsections: .
A. Isolated Nucleic Acid Molecules
One aspect of the invention pertains to isolated nucleic acid molecules that
encode MP polypeptides or biologically active portions thereof, as well as
nucleic acid
fragments sufficient for use as hybridization probes or primers for the
identification or
amplification of MP-encoding nucleic acid (e.g., MP DNA). As used herein, the
term
23
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
"nucleic acid molecule" is intended to include DNA molecules (e.g., cDNA or
genomic
DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated
using nucleotide analogs. This term also encompasses untranslated sequence
located at
both the 3' and 5' ends of the coding region of the gene: at least about 100
nucleotides
of sequence upstream from the 5' end of the coding region and at least about
20
nucleotides of sequence downstream from the 3'end of the coding region of the
gene.
The nucleic acid molecule can be single-stranded or double-stranded, but
preferably is
double-stranded DNA. An "isolated" nucleic acid molecule is one which is
separated
from other nucleic acid molecules which are present in the natural source of
the nucleic
acid. Preferably, an "isolated" nucleic acid is free of sequences which
naturally flank
the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic
acid) in the
genomic DNA of the organism from which the nucleic acid is derived. For
example, in
various embodiments, the isolated MP nucleic acid molecule can contain less
than about
5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which
naturally flank
the nucleic acid molecule in genomic DNA of the cell from which the nucleic
acid is
derived (e.g, a C. glutamicum cell). Moreover, an "isolated" nucleic acid
molecule, such
as a DNA molecule, can be substantially free of other cellular material, or
culture
medium when produced by recombinant techniques, or chemical precursors or
other
chemicals when chemically synthesized.
A nucleic acid molecule of the present invention, e.g., a nucleic acid
molecule
having a nucleotide sequence of an odd-numbered SEQ ID NO of the Sequence
Listing,
or a portion thereof, can be isolated using standard molecular biology
techniques and the
sequence information provided herein. For example, a C. glutamicum MP DNA can
be
isolated from a G glutamicum library using all or portion of one of the odd-
numbered
SEQ ID NO sequences of the Sequence Listing as a hybridization probe and
standard
hybridization techniques (e.g., as described in Sambrook, J., Fritsh, E. F.,
and Maniatis,
T. Molecular Cloning: A Laboratory Manual. 2nd, ed , Cold Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY,
1989).
Moreover, a nucleic acid molecule encompassing all or a portion of one of the
nucleic
acid sequences of the invention (e.g., an odd-numbered SEQ ID NO:) can be
isolated by
the polymerase chain reaction using oligonucleotide primers designed based
upon this
sequence (e.g., a nucleic acid molecule encompassing all or a portion of one
of the
nucleic acid sequences of the invention (e.g., an odd-numbered SEQ ID NO of
the
24
CA 02571917 2007-O1-08
WO 01/66573 PCTIIB00/02035
Sequence Listing) can be isolated by the polymerase chain reaction using
oligonucleotide primers designed based upon this same sequence). For example,
mRNA
can be isolated from normal endothelial cells (e.g., by the guanidinium-
thiocyanate
extraction procedure of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and
DNA
can be prepared using reverse transcriptase (e.g., Moloney MLV reverse
transcriptase,
available from GibcoBRL, Bethesda, MD; or AMV reverse transcriptase, available
from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide
primers
for polymerase chain reaction amplification can be designed based upon one of
the
nucleotide sequences shown in the Sequence Listing. A nucleic acid of the
invention
can be amplified using cDNA or, alternatively, genomic DNA, as a template and
appropriate oligonucleotide primers according to standard PCR amplification
techniques. The nucleic acid so amplified can be cloned into an appropriate
vector and
characterized by DNA sequence analysis. Furthermore, oligonucleotides
corresponding
to an MP nucleotide sequence can be prepared by standard synthetic techniques,
e.g.,
using an automated DNA synthesizer.
In a preferred embodiment, an isolated nucleic acid molecule of the invention
comprises one of the nucleotide sequences shown in the Sequence Listing. The
nucleic
acid sequences of the invention, as set forth in the Sequence Listing,
correspond to the
Corynebacterium glutamicum MP DNAs of the invention. This DNA comprises
sequences encoding MP proteins (i.e., the "coding region", indicated in each
odd-
numbered SEQ ID NO: sequence in the Sequence Listing), as well as 5'
untranslated
sequences and 3' untranslated sequences, also indicated in each odd-numbered
SEQ ID
NO: in the Sequence Listing. Alternatively, the nucleic acid molecule can
comprise
only the coding region of any of the nucleic acid sequences of the Sequence
Listing.
For the purposes of this application, it will be understood that some of the
MP
nucleic acid and amino acid sequences set forth in the Sequence Listing have
an
identifying RXA, RXN, RXS, or RXC number having the designation "RXA", "RXN",
"RXS", or "RXC" followed by 5 digits (i. e., RXA,, RXN, RXS, or RXC). Each of
the
nucleic acid sequences comprises up to three parts: a 5' upstream region, a
coding
region, and a downstream region. Each of these three regions is identified by
the same
RXA, RXN, RXS, or RXC designation to eliminate confusion. The recitation "one
of
the odd-numbered sequences of the Sequence Listing", then, refers to any of
the nucleic
acid sequences in the Sequence Listing, which may also be distinguished by
their
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
differing RXA, RXN, RXS, or RXC designations. The coding region of each of
these
sequences is translated into a corresponding amino acid sequence, which is
also set forth
in the Sequence Listing, as an even-numbered SEQ ID NO: immediately following
the
corresponding nucleic acid sequence . For example, the coding region for
RXA00115 is
set forth in SEQ ID N0:69, while the amino acid sequence which it encodes is
set forth
as SEQ ID N0:70. The sequences of the nucleic acid molecules of the invention
are
identified by the same RXA, RXN, RXS, or RXC designations as the amino acid
molecules which they encode, such that they can be readily correlated. For
example, the
amino acid sequences designated RXA00115, RXN00403, and RXS03158 are
translations of the coding regions of the nucleotide sequences of nucleic acid
molecules
RXA00115, RXN00403, and RXS03158, respectively. The correspondence between the
RXA, RXN, RXS, and RXC nucleotide and amino acid sequences of the invention
and
their assigned SEQ ID NOs is set forth in Table 1.
Several of the genes of the invention are "F-designated genes". An F-
designated
gene includes those genes set forth in Table 1 which have an 'F' in front of
the RXA,
RXN, RXS, or RXC designation. For example, SEQ ID N0:77, designated, as
indicated
on Table 1, as "F RXA,00254", is an F-designated gene.
Also listed on Table 1 are the metZ (or meth and metC genes (designated as
SEQ ID NO:1 and SEQ ID N0:3, respectively. The corresponding amino acid
sequence
encoded by the metZ and metC genes are designated as SEQ ID N0:2 and SEQ ID
NO:S, respectively.
In one embodiment, the nucleic acid molecules of the present invention are not
intended to include those compiled in Table 2.
In another preferred embodiment, an isolated nucleic acid molecule of the
invention comprises a nucleic acid molecule which is a complement of one of
the
nucleotide sequences of the invention (e.g., a sequence of an odd-numbered SEQ
ID
NO: of the Sequence Listing), or a portion thereof. A nucleic acid molecule
which is
complementary to one of the nucleotide sequences of the invention is one which
is
su~ciently complementary to one of the nucleotide sequences shown in the
Sequence
Listing (e.g., the sequence of an odd-numbered SEQ ID NO:) such that it can
hybridize
to one of the nucleotide sequences of the invention, thereby forming a stable
duplex.
In still another preferred embodiment, an isolated nucleic acid molecule of
the
invention comprises a nucleotide sequence which is at least about 50%, 51%,
52%, 53%,
26
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%,
64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 71%,
72%,
73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at
least
about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to a nucleotide
sequence
of the invention (e.g., a sequence of an odd-numbered SEQ ID NO: of the
Sequence
Listing), or a portion thereof. Ranges and identity values intermediate to the
above-
recited ranges, (e.g., 70-90% identical or 80-95% identical) are also intended
to be
encompassed by the present invention. For example, ranges of identity values
using a
combination of any of the above values recited as upper and/or lower limits
are intended
to be included. . In an additional preferred embodiment, an isolated nucleic
acid
molecule of the invention comprises a nucleotide sequence which hybridizes,
e.g.,
hybridizes under stringent conditions, to one of the nucleotide sequences of
the
invention, or a portion thereof.
Moreover, the nucleic acid molecule of the invention can comprise only a
portion of the coding region of the sequence of one of the odd-numbered SEQ ID
NOs
of the Sequence Listing, for example a fragment which can be used as a probe
or primer
or a fragment encoding a biologically active portion of an MP protein. The
nucleotide
sequences determined from the cloning of the MP genes from C. glutamicum
allows for
the generation of probes and primers designed for use in identifying and/or
cloning MP
homologues in other cell types and organisms, as well as MP homologues from
other
Coryn'ebacteria or related species. The pxobe/primer typically comprises
substantially
purified oligonucleotide. The oligonucleotide typically comprises a region of
nucleotide
sequence that hybridizes under stringent conditions to at least about 12,
preferably about
25, more preferably about 40, 50 or 75 consecutive nucleotides of a sense
strand of one
of the nucleotide sequences of the invention (e.g., a sequence of one of the
odd-
numbered SEQ ID NOs of the Sequence Listing), an anti-sense sequence of one of
these
sequences, or naturally occurring mutants thereof. Primers based on a
nucleotide
sequence of the invention can be used in PCR reactions to clone MP homologues.
Probes based on the MP nucleotide sequences can be used to detect transcripts
or
genomic sequences encoding the same or homologous proteins. In preferred
embodiments, the probe fizrther comprises a label group attached thereto, e.g.
the label
group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme
co-
27
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
factor. Such probes can be used as a part of a diagnostic test kit for
identifying cells
which misexpress an MP protein, such as by measuring a level of an MP-encoding
nucleic acid in a sample of cells from a subject e.g., detecting MP ml'ZNA
levels or
determining whether a genomic MP gene has been mutated or deleted.
In one embodiment, the nucleic acid molecule of the invention encodes a
protein
or portion thereof which includes an amino acid sequence which is sufficiently
homologous to an amino acid sequence of the invention (e.g., a sequence of an
even-
numbered SEQ ID NO of the Sequence Listing) such that the protein or portion
thereof
maintains the ability to catalyze an enzymatic reaction in an amino acid,
vitamin,
cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic
pathway. As used
herein, the language "sufficiently homologous" refers to proteins or portions
thereof
which have amino acid sequences which include a minimum number of identical or
.
equivalent (e.g., an amino acid residue which has a similar side chain as an
amino acid
residue in a sequence of one of the even-numbered SEQ ID NOs of the Sequence
Listing) amino acid residues to an amino acid sequence of the invention such
that the
protein or portion thereof is able to catalyze an enzymatic reaction in a C.
glutamicum
amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside or
trehalose
metabolic pathway. Protein members of such metabolic pathways, as described
herein,
function to catalyze the biosynthesis or degradation of one or more of amino
acids,
vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, or trehalose.
Examples of
such activities are also described herein. Thus, "the function of an MP
protein"
contributes to the overall functioning of one or more such metabolic pathway
and
. contributes, either directly or indirectly, to the yield, production, and/or
efficiency of
production of one or more fine chemicals. Examples of MP protein activities
are set
forth in Table 1.
In another embodiment, the protein is at least about 50%, 51 %, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 71%, 72%,
73%,
?4%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, $5%, 86%, 87%,
88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least
about
95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to an entire amino acid
sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO: of
the
Sequence Listing).
28
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
Portions of proteins encoded by the MP nucleic acid molecules of the invention
are preferably biologically active portions of one of the MP proteins. As used
herein,
the term "biologically active portion of an MP protein" is intended to include
a portion,
e.g., a domainlmotif, of an MP protein that catalyzes an enzymatic reaction in
one or
more C. glutamicum amino acid, vitamin, cofactor, nutraceutical, nucleotide,
nucleoside,
or trehalose metabolic pathways, or has an activity as set forth in Table 1.
To determine
whether an MP protein or a~biologically active portion thereof can catalyze an
enzymatic
reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide,
nucleoside, or
trehalose metabolic pathway, an assay of enzymatic activity may be performed.
Such
assay methods are well known to those of ordinary skill in the art, as
detailed in
Example 8 of the Exemplification.
Additional nucleic acid fragments encoding biologically active portions of an
MP protein can be prepared by isolating a portion of one of the amino acid
sequences of
the invention (e.g., a sequence of an even-numbered SEQ ID NO: of the Sequence
Listing), expressing the encoded portion of the MP protein or peptide (e.g.,
by
recombinant expression in vitro) and assessing the activity of the encoded
portion of the
MP protein or peptide.
The invention further encompasses nucleic acid molecules that differ from one
of
the nucleotide sequences of the invention (e.g., a sequence of an odd-numbered
SEQ ID
NO: of the Sequence Listing) (and portions thereof) due to degeneracy of the
genetic
code and thus encode the same MP protein as that encoded:by the nucleotide
sequences
of the invention. In another embodiment, an isolated nucleic acid molecule of
the
invention has a nucleotide sequence encoding a protein having an amino acid
sequence
shown in the Sequence Listing (e.g., an even-numbered SEQ ID NO:). In a still
further
embodiment, the nucleic acid molecule of the invention encodes a full length
C.
glutamicum protein which is substantially homologous to an amino acid sequence
of the
invention (encoded by an open reading frame shown in an odd-numbered SEQ ID
NO:
of the Sequence Listing).
It will be understood by one of ordinary skill in the art that in one
embodiment
the sequences of the invention are not meant to include the sequences of the
prior art,
such as those Genbank sequences set forth in Table 2, which was available
prior to the
present invention. In one embodiment, the invention includes nucleotide and
amino acid
sequences having a percent identity to a nucleotide or amino acid sequence of
the
29
CA 02571917 2007-O1-08
WO 01!66573 PCT/IB00/02035
invention which is greater than that of a sequence of the prior art (e.g., a
Genbank
sequence (or the protein encoded by such a sequence) set forth in Table 2).
For
example, the invention includes a nucleotide sequence which is greater than
and/or at
least 45% identical to the nucleotide sequence designated RXA00657 SEQ ID N0:5
One of ordinary skill in the art would be able to calculate the lower
threshold of percent
identity for any given sequence of the invention by examining the GAP-
calculated
percent identity scores set forth in Table 4 for each of the three top hits
for the given
sequence, and by subtracting the highest GAP-calculated percent identity from
100
percent. One of ordinary skill in the art will also appreciate that nucleic
acid and amino
acid sequences having percent identities greater than the lower threshold so
calculated
(e.g., at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or
60%,
preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%,
more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%,
94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or
more identical) are also encompassed by the invention.
In addition to the C. glutamicum MP nucleotide sequences set forth in the
Sequence Listing as odd-numbered SEQ ID NOs, it will be appreciated by one of
ordinary skill in the art that DNA sequence polymorphisms that lead to changes
in the
amino acid sequences of MP proteins may exist within a population (e.g., the
C.
glutamicum population). Such genetic polymorphism in the MP gene may exist
among
individuals within a population due to natural variation. As used herein, the
terms
"gene" and "recombinant gene" refer to nucleic acid molecules comprising an
open
reading frame encoding an MP protein, preferably a C. glutamicum MP protein.
Such
natural variations can typically result in 1-5% variance in the nucleotide
sequence of the
MP gene. Any and all such nucleotide variations and resulting amino acid
polymorphisms in MP that are the result of natural variation and that do not
alter the
functional activity of MP proteins are intended to be within the scope of the
invention.
Nucleic acid molecules corresponding to natural variants and non-C. glutamicum
homologues of the C. glutamicum MP DNA of the invention can be isolated based
on
their homology to the C. glutamicum MP nucleic acid disclosed herein using the
C.
glutamicum DNA, or a portion thereof, as a hybridization probe according to
standard
hybridization techniques under stringent hybridization conditions.
Accordingly, in
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
another embodiment, an isolated nucleic acid molecule of the invention is at
least 15
nucleotides in length and hybridizes under stringent conditions to the nucleic
acid
molecule comprising a nucleotide sequence of an odd-numbered SEQ m NO: of the
Sequence Listing. In other embodiments, the nucleic acid is at least 30,
50,100, 250 or
more nucleotides in length. As used herein, the term "hybridizes under
stringent
conditions" is intended to describe conditions for hybridization and washing
under
which nucleotide sequences at least 60% homologous to each other typically
remain
hybridized to each other. Preferably, the conditions are such that sequences
at least
about 65%, more preferably at least about 70%, and even more preferably at
least about
75% or more homologous to each other typically remain hybridized to each
other. Such
stringent conditions are known to one of ordinary skill in the art and can be
found in
current Protocols in Molecular Biology, John Wiley 8t Sons, N.Y. (1989), 6.3.1-
6.3.6.
A preferred, non-limiting example of stringent hybridization conditions are
hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C,
followed by
one or more washes in 0.2 X SSC, 0.1% SDS at SO-65°C. Preferably, an
isolated
nucleic acid molecule of the invention that hybridizes under stringent
conditions to a
nucleotide sequence of the invention corresponds to a naturally-occurnng
nucleic acid
molecule. As used herein, a "naturally-occurnng" nucleic acid molecule refers
to an
RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g.,
encodes a natural protein). In one embodiment, the nucleic acid encodes a
natural C
glutamicum MP protein.
In addition to naturally-occurring variants of the MP sequence that may exist
in
the population, one of ordinary skill in the art will further appreciate that
changes can be
introduced by mutation into a nucleotide sequence of the invention, thereby
leading to
changes in the amino acid sequence of the encoded MP protein, without altering
the
functional ability of the MP protein. For example, nucleotide substitutions
leading to
amino acid substitutions at "non-essential" amino acid residues can be made in
a
nucleotide sequence of the invention. A "non-essential" amino acid residue is
a residue
that can be altered from the wild-type sequence of one of the MP proteins
(e.g., an even-
numbered SEQ ID NO: of the Sequence Listing) without altering the activity of
said MP
protein, whereas an "essential" amino acid residue is required for MP protein
activity.
Other amino acid residues, however, (e.g., those that are not conserved or
only semi-
31
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
conserved in the domain having MP activity) may not be essential for activity
and thus
are likely to be amenable to alteration without altering MP activity.
Accordingly, another aspect of the invention pertains to nucleic acid
molecules
encoding MP proteins that contain changes in amino acid residues that are not
essential
for MP activity. Such MP proteins differ in amino acid sequence from a
sequence of an
even-numbered SEQ ID NO: of the Sequence Listing yet retain at least one of
the MP
activities described herein. In one embodiment, the isolated nucleic acid
molecule
comprises a nucleotide sequence encoding a protein, wherein the protein
comprises an
amino acid sequence at least about 50% homologous to an amino acid sequence of
the
invention and is capable of catalyzing an enzymatic reaction in an amino acid,
vitamin,
cofactor, nutraceutical, nucleotide, nucleoside; or trehalose metabolic
pathway, or has
one or more activities set forth in Table 1. Preferably, the protein encoded
by the nucleic
acid molecule is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%,
59%,
or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%,
or
70%%, more preferably at least about 7I%, 72%, 73%, 74%, 75%, 76%, 77%, 78%,
79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%,
92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%,
99%,
99.7% homologous to one of the amino acid sequences of the invention.
To determine the percent homology of two amino acid sequences (e.g., one of
the amino acid sequences of the invention and a mutant form thereof) or of two
nucleic
acids, the sequences are aligned for optimal comparison purposes (e.g., gaps
can be
introduced in the sequence of one protein or nucleic acid for optimal
alignment with the
other protein or nucleic acid). The amino acid residues or nucleotides at
corresponding
amino acid positions or nucleotide positions are then compared. When a
position in one
sequence (e.g., one of the amino acid sequences of the invention) is occupied
by the
same amino acid residue or nucleotide as the corresponding position in the
other
sequence (e.g., a mutant form of the amino acid sequence), then the molecules
are
homologous at that position (i. e., as used herein amino acid or nucleic acid
"homology"
is equivalent to amino acid or nucleic acid "identity"). The percent homology
between
the two sequences is a function of the number of identical positions shared by
the
sequences (i. e., % homology = # of identical positions/total # of positions x
100).
An isolated nucleic acid molecule encoding an MP protein homologous to a
protein sequence of the invention (e.g., a sequence of an even-numbered SEQ ID
NO: of
32
CA 02571917 2007-O1-08
WO 01!66573 PCTlIB00/02035
the Sequence Listing) can be created by introducing one or more nucleotide
substitutions, additions or deletions into a nucleotide sequence of the
invention such that
one or more amino acid substitutions, additions or deletions are introduced
into the
encoded protein. Mutations can be introduced into one of the nucleotide
sequences of
the invention by standard techniques, such as site-directed mutagenesis and
PCR-
mediated mutagenesis. Preferably, conservative amino acid substitutions are
made at
one or more predicted non-essential amino acid residues. A "conservative amino
acid
substitution" is one in which the amino acid residue is replaced with an amino
acid
residue having a similar side chain. Families of amino acid residues having
similar side
chains have been defined in the art. These families include amino acids with
basic side
chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic
acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine,
serine,
threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine,
leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched
side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains (e.g.,
tyrosine,
phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino
acid residue
in an MP protein is preferably replaced with another amino acid residue from
the same
side chain family. Alternatively, in another embodiment, mutations can be
introduced
randomly along all or part of an MP coding sequence, such as by saturation
mutagenesis, and the resultant mutants can be screened for an MP activity
described
herein to identify mutants that retain MP activity. Following mutagenesis of
the
nucleotide sequence of one of the odd-numbered SEQ ID NOs of the Sequence
Listing,
the encoded protein can be expressed recombinantly and the activity of the
protein can
be determined using, for example, assays described herein (see Example 8 of
the
Exemplification).
In addition to the nucleic acid molecules encoding MP proteins described
above,
another aspect of the invention pertains to isolated nucleic acid molecules
which are
antisense thereto. An "antisense" nucleic acid comprises a nucleotide sequence
which is
complementary to a "sense" nucleic acid encoding a protein, e.g.,
complementary to the
coding strand of a double-stranded DNA molecule or complementary to an mRNA
sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense
nucleic
acid. The antisense nucleic acid can be complementary to an entire MP coding
strand,
or to only a portion thereof. In one embodiment, an antisense nucleic acid
molecule is
33
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
antisense to a "coding region" of the coding strand of a nucleotide sequence
encoding an
MP protein. The term "coding region" refers to the region of the nucleotide
sequence
comprising codons which are translated into amino acid residues (e.g., the
entire coding.
region of SEQ ID NO.:1 (met. comprises nucleotides 363 to 1673). In another
embodiment, the antisense nucleic acid molecule is antisense to a "noncoding
region" of
the coding strand of a nucleotide sequence encoding MP. The term "noncoding
region"
refers to 5' and 3' sequences which flank the coding region that are not
translated into
amino acids (i.e., also referred to as 5' and 3' untranslated regions).
Given the coding strand sequences encoding MP disclosed herein (e.g., the
sequences set forth as odd-numbered SEQ ID NOs in the Sequence Listing),
antisense
nucleic acids of the invention can be designed according to the rules of
Watson and
Crick base pairing. The antisense nucleic acid molecule can be complementary
to the
entire coding region of MP mRNA, but more preferably is an oligonucleotide
which is
antisense to only a portion of the coding or noncoding region of MP mRNA. For
example, the antisense oligonucleotide can be complementary to the region
surrounding
the translation start site of MP mRNA. An antisense oligonucleotide can be,
for
example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
An
antisense nucleic acid of the invention can be constructed using chemical
synthesis and
enzymatic ligation reactions using procedures known in the art. For example,
an
antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically
synthesized
using naturally occurring nucleotides or variously modified nucleotides
designed to
increase the biological stability of the molecules or to increase the physical
stability of
the duplex formed between the antisense and sense nucleic acids, e.g.,
phosphorothioate
derivatives and acridine substituted nucleotides can be used.. Examples of
modified
nucleotides which can be used to generate the antisense nucleic acid include 5-
fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xanthine, 4-
acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-
thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-
galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, l-
methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-
methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-
methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-
methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio N6-
isopentenyladenine,
34
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
uracil-S-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-
thiocytosine, S-
methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, S-methyluracil, uracil-S-
oxyacetic acid
methylester, uracil-S-oxyacetic acid (v), S-methyl-2-thiouracil, 3-(3-amino-3-
N-2-
carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the
antisense
S nucleic acid can be produced biologically using an expression vector into
which a
nucleic acid has been subcloned in an antisense orientation (i.e., RNA
transcribed from
the inserted nucleic acid will be of an antisense orientation to a target
nucleic acid of
interest, described further in the following subsection).
The antisense nucleic acid molecules of the invention are typically
administered
to a cell or generated in situ such that they hybridize with or bind to
cellular mRNA
and/or genomic DNA encoding an MP protein to thereby inhibit expression of the
protein, e.g., by inhibiting transcription and/or translation. The
hybridization can be by
conventional nucleotide complementarity to.form a stable duplex, or, for
example, in the
case of an antisense nucleic acid molecule which binds to DNA duplexes,
through
1 S specific interactions in the major groove of the double helix. The
antisense molecule can
be modified such that it specifically binds to a receptor or an antigen
expressed on a
selected cell surface, e.g., by linking the antisense nucleic acid molecule to
a peptide or
an antibody which binds to a cell surface receptor or antigen. The antisense
nucleic acid
molecule can also be delivered to cells using the vectors described herein. To
achieve
sufficient intracellular concentrations of the antisense molecules, vector
constructs in
which the antisense nucleic acid molecule is placed under the control of a
strong
prokaryotic, viral, or eukaryotic promoter are preferred.
In yet another embodiment, the antisense nucleic acid molecule of the
invention
is an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule
forms
2S specific double-stranded hybrids with complementary RNA in which, contrary
to the
usual (3-units, the strands run parallel to each other (Gaultier et al. (198
Nucleic Acids.
Res. 15:6625-6641). The antisense nucleic acid molecule can also comprise a 2'-
0-
methylribonucleotide (moue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a
chimeric RNA-DNA analogue (moue et al. (1987) FEBS Lett. 215:327-330).
In still another embodiment, an antisense nucleic acid of the invention is a
ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity
which are
capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which
they
have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes
CA 02571917 2007-O1-08
(described in Haselhoffand Gerlach (1988) Nature 334:585-591)) can be used to
catalytically cleave MP mRNA transcripts to thereby inhibit translation of MP
mRNA.
A ribozyme having specificity for an MP-encoding nucleic acid can be designed
based
upon the nucleotide sequence of an MP DNA disclosed herein (i.e., SEQ ID NO:1
(metZ). For example, a derivative of a Tetrahymena L-19 IVS RNA can be
constructed
in which the nucleotide sequence of the active site is complementary to the
nucleotide
sequence to be cleaved in an MP-encoding mRNA. See, e.g., Cech et al. U.S.
Patent
No. 4,987,071 and Cech et al. U.S. Patent No. 5,116,742. Alternatively, MP
mRNA can
be used to select a catalytic RNA having a specific ribonuclease activity from
a pool of
RNA molecules. See, e.g., Bartel, D. and Szostak, J.W. (1993) Science 261:1411-
1418.
Alternatively, MP gene expression can be inhibited by targeting nucleotide
sequences complementary to the regulatory region of an MP nucleotide sequence
(e.g.,
an MP promoter and/or enhancers) to form triple helical structures that
prevent
transcription of an MP gene in target cells. See generally, Helene, C. (1991)
Anticancer
Drug Des. 6(6):569-84; Helene, C. et al. (1992) Ann. N Y. Acad. Sci. 660:27-
36; and
Maker, L.J. (1992) Bioassays 14(12):807-15.
Another aspect of the invention pertains to combinations of genes involved in
methionine and/or lysine metabolism and the use of to combinations of genes
involved
in methionine and/or lysine metabolism in the methods of the invention.
Preferred
combinations are the combination of metZ with metC, metB (encoding
Cystathionine-
Synthase), metA (encoding homoserine-O-acetyltransferase), metE (encoding
Methionine Synthase), metes (encoding Methionine Synthase), hom (encoding
homoserine dehydrogenase), asd (encoding aspartatesemialdehyd dehydrogenase),
IysC
/ask (encoding aspartokinase) and rxa00657 (herein designated as SEQ ID
NO.:S),
dapA, (gene encoding DIHYDRODIPICOLINATE SYNTHASE), dapB (gene encoding
DIHYDRODIPICOLINATE REDUCTASE), dapC (gene encoding 2,3,4,5-
tetrahydropyridine-2-carboxylate N-succinyltransferase), dapDlargD (gene
encoding
acetylornithine transaminase), dapE (gene encoding succinyldiaminopimelate
desuccinylase), dapF (gene encoding diaminopimelate epimerase), lysA (gene
encoding
diaminopimelate decarboxylase), ddh (gene encoding diaminopimelate
dehydrogenase),
lysE (gene encoding for the lysine exporter), IysC, lysR, lysG (gene encoding
for
the exporter regulator), hsk (gene encoding homoserine kinase) as well as
genes
involved in anaplerotic reaction such as ppc (gene encoding
phosphoenolpyruvate
carboxylase),
36
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
ppcK (gene encoding phosphoenolpyruvate carboxykinase), pycA (gene encoding
pyruvate carboxylase), accD, accA, accB, accC (genes encoding for subunits of
acetyl-
CoA-carboxylase), as well as genes of the pentose-phosphate pathway, gpdh
genes
encoding glucose-6-phophate-dehydrogenase, opcA, pgdh (gene encoding 6-
phosphogluconate-dehydrogenase), to (gene encoding transaldolase), tk (gene
encoding
gene encoding transketolase), pgl (gene encoding 6-PHOSPHOGLUCONO-
LACTONASE), ripe (gene encoding RIBULOSE-PHOSPHATE 3-EPIMERASE)
rpe (gene encoding RIBOSE 5-PHOSPHATE EPIMERASE)
or combinations of the above-mentioned genes of the pentose-phosphate-
pathways, or
other MP genes of the invention.
The genes may be altered in their nucleotide sequence and in the corresponding
amino acid sequence resulting in derivatives in such a way that their activity
is altered
under physiological conditions which leads to an increase in productivity
and/or yield of
a desired fine chemical, e.g., an amino acid such as methionine or lysine. One
class of
such alterations or derivatives is well known for the nucleotide sequence of
the ask gene
encoding aspartokinase. These alterations lead to removal of feed back
inhibition by the
amino acids lysine and threonine and subsequently to lysine overproduction. In
a
preferred embodiment the metZ gene or altered forms of the metZ gene are used
in a
Corynebacterium strain in combination with ask, hom, metA and metes or
derivatives of
these genes. In another preferred embodiment metZ or altered forms of the metZ
gene
are used in a Corynebacterium strain in combination with asl~ hom, metA and
metE or
derivatives of these genes. In a more preferred embodiment, the gene
combinations metZ
or altered forms of the metZ gene are combined with ash hom, metA and metes or
derivatives of these genes, or metZ is combined with asl~ hom, metA and metE
or
derivatives of these genes in a Corynebacterium strain and sulfur sources such
as
sulfates, thiosulfates, sulfites and also more reduced sulfur sources such as
H2S and
sulfides and derivatives are used in the growth medium. Also, sulfur sources
such as
methyl mercaptan, methanesulfonic acid, thioglycolates, thiocyanates,
thiourea, sulfur
containing amino acids such as cysteine and other sulfur containing compounds
can be
used. Another aspect of the invention pertains to the use of the above
mentioned gene
combinations in a Corynebacterium strain which is, before or after
introduction of the
genes, mutagenized by radiation or by mutagenic chemicals well-known to one of
ordinary skill in the art and selected for resistance against high
concentrations of the fine
37
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
chemical of interest, e.g. lysine or methionine or analogues of the desired
fine chemical
such as the methionine analogues ethionine, methyl methionine, or others. In
another
embodiment, the gene combinations mentioned above can be expressed in a
Corynebacterium strain having particular gene disruptions. Preferred are gene
disruptions that encode proteins that favor carbon flux to undesired
metabolites. Where
methionine is the desired fme chemical the formation of lysine may be
unfavorable. In
such a case the combination of the above mentioned genes should proceed in a
Corynebacterium strain bearing a gene disruption of the IysA gene (encoding
diaminopimelate decarboxylase) or the ddh gene (encoding the meso-
diaminopimelate
dehydrogenase catalysing the conversion of tetrahydropicolinate to meso-
diaominopimelate). In a preferred embodiment, a favorable combination of the
above-
mentioned genes are all altered in such a way that their gene products are not
feed back
inhibited by end products or metabolites of the biosynthetic pathway leading
to the
desired fine chemical. In the case that the desired fine chemical is
methionine, the gene
combinations may be expressed in a strain previously treated with mutagenic
agents or
radiation and selected for the above-mentioned resistance. Additionally, the
strain
should be grown in a growth medium containing one or more of the above
mentioned
sulfur sources.
In another embodiment of the invention, a gene was identified from the genome
of Corynebacterium glutamicum as a gene coding for a hypothetical
transcriptional
regulatory protein. This gene is described as RXA00657. The nucleotide
sequence of
RXA00657 corresponds to SEQ ID NO:S. The amino acid sequence of RXA00657
corresponds to SEQ ID N0:6. It was found that when the RXA00657 gene, as well
as
upstream and downstream regulatory regions described in the examples, was
cloned into
a vector capable of replicating in Corynebacterium glutamicum and transformed
and
expressed in a lysine producing strain such as ATCC 13286, that this strain
produced
more lysine compared to the strain transformed with the same plasmid lacking
the
aforementioned nucleotide fragment RXA00657. In addition to the observation
that the
lysine titer was increased in the mentioned strain, the selectivity determined
by the
molar amount of lysine produced compared to the molar amount of sucrose
consumed
was increased (see Example 14). Overexpression of RXA00657 in combination with
the
overexpression of other genes either directly involved in the lysine specific
pathway
38
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
such as IysC, dapA, dapB, dapC, dapD, dapF, ddh, lysE, lysG, and lysR results
in an
increase in the production of lysine compared to 1ZXA00657 alone.
B. Recombinant Expression Vectors and Host Cells
Another. aspect of the invention pertains to vectors, preferably expression
vectors, containing a nucleic acid encoding an MP protein (or a portion
thereof) or
combinations of genes wherein at least one gene encodes for an MP protein. As
used
herein, the term "vector" refers to a nucleic acid molecule capable of
transporting
another nucleic acid to which it has been linked. One type of vector is a
"plasmid",
which refers to a circular double stranded DNA loop into which additional DNA
segments can be ligated. Another type of vector is a viral vector, wherein
additional
DNA segments can be ligated into the viral genome. Certain vectors are capable
of
autonomous replication in a host cell into which they are introduced (e.g.,
bacterial
vectors having a bacterial origin of replication and episomal mammalian
vectors). Other
vectors (e.g:, non-episomal mammalian vectors) are integrated into the genome
of a host
cell upon introduction into the host cell, and thereby are replicated along
with the host
genome. Moreover, certain vectors are capable of directing the expression of
genes to
which they are operatively linked. Such vectors are referred to herein as
"expression
vectors". In general, expression vectors of utility in recombinant DNA
techniques are
often in the form of plasmids. In the present specification, "plasmid" and
"vector" can
be used interchangeably as the plasmid is the most commonly used form of
vector.
However, the invention is intended to include such other forms of expression
vectors,
such as viral vectors (e.g., replication defective retroviruses, adenoviruses
and adeno-
associated viruses), which serve equivalent functions.
The recombinant expression vectors of the invention comprise a nucleic acid of
the invention in a form suitable for expression of the nucleic acid in a host
cell, which
means that the recombinant expression vectors include one or more regulatory
sequences, selected on the basis of the host cells to be used for expression,
which is
operatively linked to the nucleic acid sequence to be expressed. Within a
recombinant
expression vector, "operably linked" is intended to mean that the nucleotide
sequence of
interest is linked to the regulatory sequences) in a manner which allows for
expression
of the nucleotide sequence (e.g., in an in vitro transcription/translation
system or in a
host cell when the vector is introduced into the host cell). The term
"regulatory
39
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
sequence" is intended to include promoters, repressor binding sites, activator
binding
sites, enhancers and other expression control elements (e.g., terminators,
polyadenylation signals, or other elements of mRNA secondary structure). Such
regulatory sequences are described, for example, in Goeddel; Gene Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Regulatory sequences include those which direct constitutive expression of a
nucleotide
sequence in many types of host cell and those which direct expression of the
nucleotide
sequence only in certain host cells. Preferred regulatory sequences are, for
example,
promoters such as cos-, tac-, trp-, tet-, trp-tet-, lpp-, lac-, lpp-lac-,
lacI9-, T7-, T5-, T3-,
gal-, trc-, ara-, SP6-, amy, SP02, ~,-PR- or ~, PL, which are used preferably
in bacteria.
Additional regulatory sequences are, for example, promoters from yeasts and
fungi, such
as ADC1, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH, promoters from plants
such as CaMV/3SS, SSU, OCS, lib4, usp, STLS I, B33, nos or ubiquitin- or
phaseolin-
promoters. It is also possible to use artificial promoters. It will be
appreciated by one of
ordinary skill in the art that the design of the expression vector can depend
on such
factors as the choice of the host cell to be transformed, the level of
expression of protein
desired, etc. The expression vectors of the invention can be introduced into
host cells to
thereby produce proteins or peptides, including fusion proteins or peptides,
encoded by
nucleic acids as described herein (e.g., MP proteins, mutant forms of MP
proteins,
fusion proteins, etc.).
The recombinant expression vectors of the invention can be designed for
expression of MP proteins in prokaryotic or eukaryotic cells. For example, MP
genes
can be expressed in bacterial cells such as C. glutamicum, insect cells (using
baculovirus
expression vectors), yeast and other fungal cells (see Romanos, M.A. et al.
(1992)
"Foreign gene expression in yeast: a review", Yeast 8: 423-488; van den
Hondel,
C.A.M.J.J. et al. (1991) "Heterologous gene expression in filamentous fungi"
in: More
Gene Manipulations in Fungi, J.W. Bennet & L.L. Lasure, eds., p. 396-428:
Academic
Press: San Diego; and van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene
transfer
systems and vector development for filamentous fungi, in: Applied Molecular
Genetics
of Fungi, Peberdy, J.F. et al., eds., p. 1-28, Cambridge University Press:
Cambridge),
algae and multicellular plant cells (see Schmidt, R. and Willmitzer, L. (1988)
High
efficiency Agrobacterium fume, f 'aciens mediated transformation of
Arabidopsis
thaliana leaf and cotyledon explants" Plant Cell Rep.: 583-586), or mammalian
cells.
CA 02571917 2007-O1-08
WO 01/665?3 PCT/IB00/02035
Suitable host cells are discussed further in Goeddel, Gene Expression
Technology:
Methods in Enrymology 185, Academic Press, San Diego, CA (1990).
Alternatively, the
recombinant expression vector can be transcribed and translated in vitro, for
example
using T7 promoter regulatory sequences and T7 polymerase.
S Expression of proteins in prokaryotes is most often carried out with vectors
containing constitutive or inducible promoters directing the expression of
either fusion
or non-fusion proteins. Fusion vectors add a number of amino acids to a
protein encoded
therein, usually to the amino terminus of the recombinant protein but also to
the C-
terminus or fused within suitable regions in the proteins. Such fusion vectors
typically
serve three purposes: 1) to increase expression of recombinant protein; 2) to
increase the
solubility of the recombinant protein; and 3) to aid in the purification of
the recombinant
protein by acting as a ligand in affinity purification. Often, in fusion
expression vectors;
a proteolytic cleavage site is introduced at the junction of the fusion moiety
and the
recombinant protein to enable separation of the recombinant protein from the
fusion
moiety subsequent to purification of the fusion protein:. Such enzymes; and
their
cognate recognition sequences, include Factor Xa, thrombin and enterokinase.
Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith,
D.B. and Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs,
Beverly;
MA) and pRITS (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase
(GST), maltose E binding protein, or protein A, respectively, to the target
recombinant
protein. In one embodiment, the coding sequence of the MP protein is cloned
into a
pGEX expression vector to create a vector encoding a fusion protein
comprising, from
the N-terminus to the C-terminus, GST-thrombin cleavage site-X protein. The
fusion
protein can be purified by affinity chromatography using glutathione-agarose
resin.
Recombinant MP protein unfused to GST can be recovered by cleavage of the
fusion
protein with thrombin.
Examples of suitable inducible non-fusion E. coli expression vectors include
pTrc (Amann et al., (1988) Gene 69:301-315) pLG338, pACYC184, pBR322, pUCl8,
pUCl9, pKC30, pRep4, pHSI, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-
III113-B1, ~,gtl l, pBdCl, and pET l 1d (Studier et al., Gene Expression
Technology:
Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89;
and
Pouwels et al., eds. (1985) Cloning Vectors. Elsevier: New York IBSN 0 444
904018).
Target gene expression from the pTrc vector relies on host RNA polymerase
41
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
transcription from a hybrid trp-lac fusion promoter. Target gene expression
from the
pET 11d vector relies on transcription from a T7 gnl0-lac fusion promoter
mediated by
a coexpressed viral RNA polymerase ('f7 gnl). This viral polymerase is
supplied by
host strains BL21(DE3) or HMS 174(DE3) from a resident ~, prophage harboring a
T7
gnl gene under the transcriptional control of the lacUV 5 promoter. For
transformation
of other varieties of bacteria, appropriate vectors may be selected. For
example, the
plasmids pIJ101, pIJ364, pIJ702 and pIJ361 are known to be useful in
transforming
Streptomyces, while plasmids pUB110, pC194, or pBD214 are suited for
transformation
of Bacillus species. Several plasmids of use in the transfer of genetic
information into
Corynebacterium include pHM1519, pBLI, pSA77, or pAJ667 (Pouwels et al., eds.
(1985) Cloning Vectors. Elsevier: New York IBSN 0 444 904018).
' One strategy to maximize recombinant protein expression is to express the
protein in a host bacteria with an impaired capacity to proteolytically cleave
the
recombinant protein (Gottesman, S., Gene Expression Technology: Methods in
Enzymolog~ 185, Academic Press, San Diego, California (1990) 119-128). Another
strategy is to alter the nucleic acid sequence of the nucleic acid to be
inserted into an
expression vector so that the individual codons for each amino acid are those
preferentially utilized in the bacterium chosen for expression, such as C.
glutamicum
(Wads et al. (I992) Nucleic Acids Res. 20:2111-2118). Such alteration of
nucleic acid
sequences of the invention can be carried out by standard DNA synthesis
techniques.
In another embodiment, the MP protein expression vector is a yeast expression
vector. Examples of vectors for expression in yeast S. cerevisiae include
pYepSecl
(Baldari, et al., (1987) Embo J. 6:229-234), , 2 ~., pAG-l, Yep6, Yepl3,
pEMBLYe23,
pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al.,
(1987)
Gene 54:113-123), and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors
and
methods for the construction of vectors appropriate for use in other fungi,
such as the
filamentous fungi, include those detailed in: van den Hondel, C.A.M.J.J. &
Punt, P.J.
(1991) "Gene transfer systems and vector development for filamentous fungi,
in:
Applied Molecular Genetics of Fungi, J.F. Peberdy, et al., eds., p. 1-28,
Cambridge
University Press: Cambridge, and Pouwels et al., eds. (1985) Cloning Vectors.
Elsevier:
New York (IBSN 0 444 904018).
Alternatively, the MP proteins of the invention can be expressed in insect
cells
using baculovirus expression vectors. Baculovirus vectors available for
expression of
42
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series
(Smith et al.
(1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and Summers
(1989)
Virology 170:31-39).
In another embodiment, the MP proteins of the invention may be expressed in
unicellular plant cells (such as algae) or in plant cells from higher plants
(e.g., the
spermatophytes, such as crop plants). Examples of plant expression vectors
include
those detailed in: Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992)
"New
plant binary vectors with selectable markers located proximal to the left
border", Plant
Mol. Biol. 20: 1195-1197; and Bevan, M.W. (1984) "Binary Agrobacterium vectors
for
plant transformation", Nucl. Acid. Res. 12: 8711-8721, and include pLGV23,
pGHlac+,
pBINl9, pAK2004, andpDH51 (Pouwels et al:, eds. (1985) Cloning Vectors.
Elsevier:
New York IBSN 0 444 904018).
. In yet another embodiment, a nucleic acid of the invention is expressed in
mammalian cells using a mammalian expression vector. Examples of mammalian
expression vectors include pCDM8 (Seed, B. (1987) Nature 329:840) and pMT2PC
(Kaufman et al. (1987) EMBO J. 6:187-195). When used in mammalian cells, the
expression vector's control functions are often provided by viral regulatory
elements.
For example, commonly used promoters are derived from polyoma, Adenovirus 2,
cytomegalovirus and Simian Virus 40. For other suitable expression systems for
both
prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, J.,
Fritsh, E. F.,
and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring
Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY,
1989.
In another embodiment, the recombinant mammalian expression vector is
capable of directing expression of the nucleic acid preferentially in a
particular cell type
(e.g., tissue-specific regulatory elements are used to express the nucleic
acid). Tissue-
specific regulatory elements are known in the art. Non-limiting examples of
suitable
tissue-specific promoters include the albumin promoter (liver-specific;
Pinkert et al.
(1987) Genes Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton
(1988)
Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto
and
Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins (Banerji et al. (1983)
Cell
33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific
promoters
(e.g., the neurofilament promoter; Byrne and Ruddle (1989) PNAS 86:5473-5477),
43
CA 02571917 2007-O1-08
WO 01/66573 PCT/IBOO102035
pancreas-specific promoters (Edlund et al. (1985) Science 230:912-916), and
mammary
gland-specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316
and
European Application Publication No. 264,166). Developmentally-regulated
promoters
are also encompassed, for example the murine hox promoters (Kessel and Gruss
(1990)
Science 249:374-379) and the a-fetoprotein promoter (Campes and Tilghman
(1989)
Genes Dev. 3:537-546).
The invention further provides a recombinant expression vector comprising a
DNA molecule of the invention cloned into the expression vector in an
antisense
orientation. That is, the DNA molecule is operatively linked to a regulatory
sequence in
a manner which allows for expression (by transcription of the DNA molecule) of
an
RNA molecule which is antisense to MP mRNA. Regulatory sequences operatively
linked to a nucleic acid cloned in the antisense orientation can be chosen
which direct
the continuous expression of the antisense RNA molecule in a variety of cell
types, for
instance viral promoters and/or enhancers, or regulatory sequences can be
chosen which
1 S direct constitutive, tissue specific or cell type specific expression of
antisense RNA.
The antisense expression vector can be in the form of a recombinant plasmid,
phagemid
or attenuated virus in which antisense nucleic acids are produced under the
control of a
high efficiency regulatory region, the activity of which can be determined by
the cell
type into which the vector is introduced. For a discussion of the regulation
of gene
expression using antisense genes see Weintraub, H. et al., Antisense RNA as a
molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1)
1986.
Another aspect of the invention pertains to host cells into which a
recombinant
expression vector of the invention has been introduced. The terms "host cell"
and
"recombinant host cell" are used interchangeably herein. It is understood that
such
terms refer not only to the particular subject cell but to the progeny or
potential progeny
of such a cell. Because certain modifications may occur in succeeding
generations due
to either mutation or environmental influences, such progeny may not, in fact,
be
identical to the parent cell, but are still included within the scope of the
term as used
herein.
A host cell can be any prokaryotic or eukaryotic cell. For example, an MP
protein can be expressed in bacterial cells such as C glutamicum, insect
cells, yeast or
mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
Other
suitable host cells are known to those of ordinary skill in the art.
Microorganisms
44
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
related to Corynebacterium glutamicum which may be conveniently used as host
cells
for the nucleic acid and protein molecules of the invention are set forth in
Table 3.
Vector DNA can be introduced into prokaryotic or eukaryotic cells via
conventional transformation or transfection techniques. As used herein, the
terms
"transformation" and "transfection", "conjugation" and "transduction" are
intended to
refer to a variety of art-recognized techniques for introducing foreign
nucleic acid (e.g.,
linear DNA or RNA (e.g., a linearized vector or a gene construct alone without
a vector)
or nucleic acid in the form of a vector (e.g., a plasmid, phage, phasmid,
phagemid,
transposon or other DNA) into a host cell, including calcium phosphate or
calcium
chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection,
natural
competence, chemical-mediated transfer, or electroporation. Suitable methods
for
transforming or transfecting host cells can be found in Sambrook, et al.
(Molecular
Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold
Spring
Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and other laboratory
manuals.
For stable transfection of mammalian cells, it is known that, depending upon
the
expression vector and transfection technique used, only a small fraction of
cells may
integrate the foreign DNA into their genome. In order to identify and select
these
integrants, a gene that encodes a selectable marker (e.g., resistance to
antibiotics) is
generally introduced into the host cells along with the gene of interest.
Preferred
selectable markers include those which confer resistance to drugs, such as
6418,
hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be
introduced into a host cell on the same vector as that encoding an MP protein
or can be
introduced on a separate vector. Cells stably transfected with the introduced
nucleic
acid can be identified by drug selection (e.g., cells that have incorporated
the selectable
marker gene will survive, while the other cells die).
To create a homologous recombinant microorganism, a vector is prepared which
contains at least a portion of an MP gene into which a deletion, addition or
substitution
has been introduced to thereby alter, e.g., functionally disrupt, the MP gene.
Preferably,
this MP gene is a Corynebacteriurn glutamicum MP gene, but it can be a
homologue
from a related bacterium or even from a mammalian, yeast, or insect source. In
a
preferred embodiment, the vector is designed such that, upon homologous
recombination, the endogenous MP gene is functionally disrupted (i.e., no
longer
encodes a functional protein; also referred to as a "knock out" vector).
Alternatively,
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
the vector can be designed such that, upon homologous recombination, the
endogenous
MP gene is mutated or otherwise altered but still encodes functional protein
(e.g., the
upstream regulatory region can be altered to thereby alter the expression of
the
endogenous MP protein). In the homologous recombination vector, the altered
portion
of the MP gene is flanked at its 5' and 3' ends by additional nucleic acid of
the MP gene
to allow for homologous recombination to occur between the exogenous MP gene
carned by the vector and an endogenous MP gene in a microorganism. The
additional
flanking MP nucleic acid is of sufficient length for successful homologous
recombination with the endogenous gene. Typically, several kilobases of
flanking DNA
~ (both at the 5'~ and 3' ends) are included in the vector (see e.g., Thomas,
K.R., and
Capecchi, M.R. (198'n Cell 51: 503 for a description of homologous
recombination
vectors). The vector is introduced into a microorganism (e.g., by
electroporation) and
cells in which the introduced MP gene has homologously recombined with the
endogenous MP gene are selected, using art-known techniques.
In another embodiment, recombinant microorganisms can be produced which
contain selected systems which allow for regulated expression of the
introduced gene.
For example, inclusion of an MP gene on a vector placing it under control of
the lac
operon permits expression of the MP gene only in the presence of IPTG. Such
regulatory systems are well known in the art.
In another embodiment, an endogenous MP gene in a host cell is disrupted
(e.g.,
by homologous recombination or other genetic means known in the art) such that
expression of its protein product does not occur. In another embodiment, an
endogenous
or introduced MP gene in a host cell has been altered by one or more point
mutations,
deletions, or inversions, but still encodes a functional MP protein. In still
another
embodiment, one or more of the regulatory regions (e.g., a promoter,
repressor, or
inducer) of an MP gene in a microorganism has been altered (e.g., by deletion,
truncation, inversion, or point mutation) such that the expression of the MP
gene is
modulated. One of ordinary skill in the art will appreciate that host cells
containing
more than one of the described MP gene and protein modifications may be
readily
produced using the methods of the invention, and are meant to be included in
the present
invention.
A host cell of the invention, such as a prokaryotic or eukaryotic host cell in
culture, can be used to produce (i. e., express) an MP protein. Accordingly,
the invention
46
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
further provides methods for producing MP proteins using the host cells of the
invention. In one embodiment, the method comprises culturing the host cell of
invention (into which a recombinant expression vector encoding an MP protein
has been
introduced, or into which genome has been introduced a gene encoding a wild-
type or
altered MP protein) in a suitable medium until MP protein is produced. In
another
embodiment, the method further comprises isolating MP proteins from the medium
or
the host cell.
C. Isolated MP Proteins
Another aspect of the invention pertains to isolated MP proteins, and
biologically
active portions thereof. An "isolated" or "purified" protein or biologically
active portion
thereof is substantially free of cellular material when produced by
recombinant DNA
techniques, or chemical precursors or other chemicals when chemically
synthesized.
The language "substantially free of cellular material" includes preparations
of MP
protein in which the protein is separated from cellular components of the
cells in which
it is naturally or recombinantly produced. In one embodiment, the language
"substantially free of cellular material" includes preparations of MP protein
having less
than about 30% (by dry weight) of non-MP protein (also referred to herein as a
"contaminating protein"), more preferably less than about 20% of non-MP
protein, still
more preferably less than about 10% of non-MP protein, and most preferably
less than
about 5% non-MP protein. When the MP protein or biologically active portion
thereof
is recombinantly produced, it is also preferably substantially free of culture
medium, i. e.,
culture medium represents less than about 20%, more preferably less than about
10%,
and most preferably less than about 5% of the volume of the protein
preparation. The
language "substantially free of chemical precursors or other chemicals"
includes
preparations of MP protein in which the protein is separated from chemical
precursors or
other chemicals which are involved in the synthesis of the protein. In one
embodiment,
the language "substantially free of chemical precursors or other chemicals"
includes
preparations of MP protein having less than about 30% (by dry weight) of
chemical
precursors or non-MP chemicals, more preferably less than about 20% chemical
precursors or non-MP chemicals, still more preferably less than about 10%
chemical
precursors or non-MP chemicals, and most preferably less than about 5%
chemical
precursors or non-MP chemicals. In preferred embodiments, isolated proteins or
47
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
biologically active portions thereof lack contaminating proteins from the same
organism
from which the MP protein is derived. Typically, such proteins are produced by
recombinant expression of, for example, a C. glutamicum MP protein in a
microorganism such as C. glutamicum.
An isolated MP protein or a portion thereof of the invention can catalyze an
enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical,
nucleotide,
nucleoside, or trehalose metabolic pathway, or has one or more of the
activities set forth
in Table 1. In preferred embodiments, the protein or portion thereof comprises
an amino
acid sequence which is sufficiently homologous to an amino acid sequence of
the
invention (e.g., a sequence of an even-numbered SEQ ID NO: of the Sequence
Listing)
such that the protein or portion thereof maintains the ability to catalyze an
enzymatic
reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide,
nucleoside, or
trehalose metabolic pathway. The portion of the protein is preferably a
biologically
active portion as described herein. In another preferred embodiment, an MP
protein of
the invention has an amino acid sequence set forth as an even-numbered SEQ ID
NO: of
the Sequence Listing. In yet another preferred embodiment, the MP protein has
an
amino acid sequence which is encoded by a nucleotide sequence which
hybridizes, e.g.,
hybridizes under stringent conditions, to a nucleotide sequence of the
invention (e.g., a
sequence of an odd-numbered SEQ ID NO: of the Sequence Listing). In still
another
preferred embodiment, the MP protein has an amino acid sequence which is
encoded by
a nucleotide sequence that is at least about SO%, S1%, 52%, 53%, 54%, 55%,
56%,
57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%,
67%, 68%, 69%, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or
90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%,
97%,
98%, 99%, 99.7% or more homologous to one of the nucleic acid sequences of the
invention, or a portion thereof. Ranges and identity values intermediate to
the above-
recited values, (e.g., 70-90% identical or 80-95% identical) are also intended
to be
encompassed by the present invention. For example, ranges of identity values
using a
3.0 combination of any of the above values recited as upper and/or lower
limits are intended
to be included. The preferred MP proteins of the present invention also
preferably
possess at least one of the MP activities described herein. For example, a
preferred MP
protein of the present invention includes an amino acid sequence encoded by a
48
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
nucleotide sequence which hybridizes, e.g., hybridizes under stringent
conditions, to a
nucleotide. sequence of the invention, and which can catalyze an enzymatic
reaction in
an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or
trehalose
metabolic pathway, or which has one or more of the activities set forth in
Table 1.
In other embodiments, the MP protein is substantially homologous to an amino
acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID
NO: of
the Sequence Listing) and retains the functional activity of the protein of
one of the
amino acid sequences of the invention yet differs in amino acid sequence due
to natural
variation or mutagenesis, as described in detail in subsection I above.
Accordingly, in
another embodiment, the MP protein is a protein which comprises an amino acid
sequence which is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%,
59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%,
69%, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or
91%, 92%, 93%, 94%, and even'more preferably at least about 95%, 96%, 97%,
98%,
99%, 99.7% or more homologous to an entire amino acid sequence of the
invention and
which has at least one of the MP activities described herein. Ranges and
identity values
intermediate to the above-recited values, (e.g., 70-90% identical or 80-95%
identical)
are also intended to be encompassed by the present invention. For example,
ranges of
identity values using a combination of any of the above values recited as
upper and/or
lower limits are intended to be included. In another embodiment, the invention
pertains
to a full length C. glutamicum protein which is substantially homologous to an
entire
amino acid sequence of the invention.
Biologically active portions of an MP protein include peptides comprising
amino
acid sequences derived from the amino acid sequence of an MP protein, e.g., an
amino
acid sequence of an even-numbered SEQ ID NO: of the Sequence Listing or the
amino
acid sequence of a protein homologous to an MP protein, which include fewer
amino
acids than a full length MP protein or the full length protein which is
homologous to an
MP protein, and exhibit at least one activity of an MP protein. Typically,
biologically
active portions (peptides, e.g., peptides which are, for example, 5, 10, 15,
20, 30, 35, 36,
37, 38, 39, 40, 50, 100 or more amino acids in length) comprise a domain or
motif with
at least one activity of an MP protein. Moreover, other biologically active
portions, in
which other regions of the protein are deleted, can be prepared by recombinant
49
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00102035
techniques and evaluated for one or more of the activities described herein.
Preferably,
the biologically active portions of an MP protein include one or more selected
domains/motifs or portions thereof having biological activity.
MP proteins are preferably produced by recombinant DNA techniques. For
example, a nucleic acid molecule encoding the protein is cloned into an
expression
vector (as described above), the expression vector is introduced into a host
cell (as
described above) and the MP protein is expressed in the host cell. The MP
protein can
then be isolated from the cells by an appropriate purification scheme using
standard
protein purification techniques. Alternative to recombinant expression, an MP
protein,
polypeptide, or peptide can be synthesized chemically using standard peptide
synthesis
techniques. Moreover, native MP protein can be isolated from cells (e.g.,
endothelial
cells), for example using an anti=MP antibody, which can be produced by
standard
techniques utilizing an MP protein or fragment thereof of this invention.
The invention also provides MP chimeric or fusion proteins. As used herein, an
MP "chimeric protein" or "fusion protein" comprises an MP polypeptide
operatively
linked to a non-MP polypeptide. An "MP polypeptide" refers to a polypeptide
having an
amino acid sequence corresponding to MP, whereas a "non-MP polypeptide" refers
to a
polypeptide having an amino acid sequence corresponding to a protein which is
not
substantially homologous to the MP protein, e.g., a protein which is different
from the
MP protein and which is derived from the same or a different organism. Within
the
fusion protein, the term "operatively linked" is intended to indicate that the
MP
polypeptide and the non-MP polypeptide are fused in-frame to each other. The
non-MP
polypeptide can be fused to the N-terminus or C-terminus of the MP
polypeptide. For
example, in one embodiment the fusion protein is a GST-MP fusion protein in
which the
MP sequences are fused to the C-terminus of the GST sequences. Such fusion
proteins
can facilitate the purification of recombinant MP proteins. In another
embodiment, the
fusion protein is an MP protein containing a heterologous signal sequence at
its N-
terminus. In certain host cells (e.g., mammalian host cells), expression
and/or secretion
of an MP protein can be increased through use of a heterologous signal
sequence.
Preferably, an MP chimeric or fusion protein of the invention is produced by
standard recombinant DNA techniques. For example, DNA fragments coding for the
different polypeptide sequences are ligated together 'in-frame in accordance
with
conventional techniques, for example by employing blunt-ended or stagger-ended
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
termini for ligation, restriction enzyme digestion to provide for appropriate
termini,
filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to
avoid
undesirable joining, and enzymatic ligation. In another embodiment, the fusion
gene
can be synthesized by conventional techniques including automated DNA
synthesizers.
Alternatively, PCR amplification of gene fragments can be carried out using
anchor
primers which give rise to complementary overhangs between two consecutive
gene
fragments which can subsequently be annealed and reamplified to generate a
chimeric
gene sequence (see, for example, Current Protocols in Molecular Biology, eds.
Ausubel
et al. John Wiley & Sons: 1992). Moreover, many expression vectors are
commercially
available that already encode a fusion moiety (e.g., a GST polypeptide). An MP-
encoding nucleic acid can be cloned into such an expression vector such that
the fusion
moiety is linked in-frame to the MP protein.
Homologues of the MP protein can be generated by mutagenesis, e.g., discrete
point mutation or truncation of the MP protein. As used herein, the term
"homologue"
refers to a variant form of the MP protein which acts as an agonist or
antagonist of the
activity of the MP protein. An agonist of the MP protein can retain
substantially the
same, or a subset, of the biological activities of the MP protein. An
antagonist of the
MP protein can inhibit one or more of the activities of the naturally occurnng
form of
the MP protein, by, for example, competitively binding to a downstream or
upstream
member of the MP cascade which includes the MP protein. Thus, the C.
glutamicum
MP protein and homologues thereof of the present invention may modulate the
activity
of one or more metabolic pathways in which MP proteins play a role in this
microorganism.
In an alternative embodiment, homologues of the MP protein can be identified
by screening combinatorial libraries of mutants, e.g., truncation mutants, of
the MP
protein for MP protein agonist or antagonist activity. In one embodiment, a
variegated
library of MP variants is generated by combinatorial mutagenesis at the
nucleic acid
level and is encoded by a variegated gene library. A variegated library of MP
variants
can be produced by, for example, enzymatically ligating a mixture of synthetic
oligonucleotides into gene sequences such that a degenerate set of potential
MP
sequences is expressible as individual polypeptides, or alternatively, as a
set of larger
fusion proteins (e.g., for phage display) containing the set of MP sequences
therein.
There are a variety of methods which can be used to produce libraries of
potential MP
51
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
homologues from a degenerate oligonucleotide sequence. Chemical synthesis of a
degenerate gene sequence can be performed in an automatic DNA synthesizer, and
the
synthetic gene then ligated into an appropriate expression vector. Use of a
degenerate
set of genes allows for the provision, in one mixture, of all of the sequences
encoding
the desired set of potential MP sequences. Methods for synthesizing degenerate
oligonucleotides are known in the art (see, e.g., Narang, S.A. (1983)
Tetrahedron 39:3;
Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984)
Science
198:1056; Ike et al. (1983) Nucleic Acid Res. 11:477.
In addition, libraries of fragments of the MP protein coding can be used to
generate a.variegated population of MP fragments for screening and subsequent
selection of homologues of an MP protein. In one embodiment, a library of
coding
sequence fragments can be generated by treating a double stranded PCR fragment
of an
MP coding sequence with a nuclease under conditions wherein nicking occurs
only
about once per molecule, denaturing the double stranded DNA, renaturing the
DNA to
form double stranded DNA which can include sense/antisense pairs from
different
nicked products, removing single stranded portions from reformed duplexes by
treatment with S 1 nuclease, and Iigating the resulting fragment Library into
an expression
vector. By this method, an expression library can be derived which encodes N-
terminal,
C-terminal and internal fragments of various sizes of the MP protein.
Several techniques are known in the art for screening gene products of
combinatorial libraries made by point mutations or truncation, and for
screening cDNA
libraries for gene products having a selected property. Such techniques are
adaptable for
rapid screening of the gene libraries generated by the combinatorial
mutagenesis of MP
homologues. The most widely used techniques, which are amenable to high
through-put
analysis, for screening Large gene libraries typically include cloning the
gene library into
replicable expression vectors, transforming appropriate cells with the
resulting library of
vectors, and expressing the combinatorial genes under conditions in which
detection of a
desired activity facilitates isolation of the vector encoding the gene whose
product was
detected. Recursive ensemble mutagenesis (REM), a new technique which enhances
the
frequency of functional mutants in the libraries, can be used in combination
with the
screening assays to identify MP homologues (Arkin and Yourvan (1992) PNAS
89:7811-7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331).
52
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
In another embodiment, cell based assays can be exploited to analyze a
variegated MP library, using methods well known in the art.
D. Uses and Methods of the Invention
The nucleic acid molecules, proteins, protein homologues, fusion proteins,
primers, vectors, and host cells described herein can be used in one or more
of the
following methods: identification of C. glutarnicum and related organisms;
mapping of
genomes of organisms related to C. glutamicum; identification and localization
of C.
glutamicum sequences of interest; evolutionary studies; determination of MP
protein
regions required for function; modulation of an MP protein activity;
modulation of the
activity of an MP pathway; and modulation of cellular production of a desired
compound, such as a fine chemical.
The MP nucleic acid molecules of the invention have a variety of uses. First,
they may be used to identify an organism as being Corynebacterium glutarnicum
or a
close relative thereof. Also, they may be used to identify the presence of C.
glutamicum
or a relative thereof in a mixed population of microorganisms. The invention
provides
the nucleic acid sequences of a number of C. glutamicum genes; by probing the
extracted genomic DNA of a culture of a unique or mixed population of
microorganisms
under stringent conditions with a probe spanning a region of a C. glutamicum
gene
which is unique to this organism, one can ascertain whether this organism is
present.
Although Corynebacterium glutamicum itself is not pathogenic to humans, it is
related
to species which are human pathogens, such as Corynebacterium diphtheriae.
Corynebacterium diphtheriae is the causative agent of diphtheria, a rapidly
developing,
acute, febrile infection which involves both local and systemic pathology. In
this
disease, a local lesion develops in the upper respiratory tract and involves
necrotic injury
to epithelial cells; the bacilli secrete toxin which is disseminated through
this lesion to
distal susceptible tissues of the body. Degenerative changes brought about by
the
inhibition of protein synthesis in these tissues, which include heart, muscle,
peripheral
nerves, adrenals, kidneys, liver and spleen, result in the systemic pathology
of the
disease. Diphtheria continues to have high incidence in many parts of the
world,
including Africa, Asia, Eastern Europe and the independent states of the
former Soviet
Union. An ongoing epidemic of diphtheria in the latter two regions has
resulted in at
least 5,000 deaths since 1990.
53
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
In one embodiment, the invention provides a method of identifying the presence
or activity of Cornyebacterium diphtheriae in a subject. This method includes
detection
of one or more of the nucleic acid or amino acid sequences of the invention
(e.g., the
sequences set forth as odd-numbered or even-numbered SEQ ID NOs, respectively,
in
the Sequence Listing) in a subject, thereby detecting the presence or activity
of
Corynebacterium diphtheriae in the subject. C. glutamicum and C. diphtheriae
are
related bacteria, and many of the nucleic acid and protein molecules in C.
glutamicum
are homologous to C. diphtheriae nucleic acid and protein molecules, and can
therefore
be used to detect C. diphtheriae in a subject.
The nucleic acid and protein molecules of the invention may also serve as
markers for specific regions of the genome. This has utility not only in the
mapping of
the genome, but also for functional studies of C. glutamicum proteins. For
example, to
identify the region of the genome to which a particular C. glutamicum DNA-
binding
protein binds, the C. glutamicum genome could be digested, and the fragments
incubated
with the DNA-binding protein. Those which bind the protein may be additionally
probed
with the nucleic acid molecules of the invention, preferably with readily
detectable
labels; binding of such a nucleic acid molecule to the genome fragment enables
the
localization of the fragment to the genome map of C. glutamicum, and, when
performed
multiple times with different enzymes, facilitates a rapid determination of
the nucleic
acid sequence to which the protein binds. Further, the nucleic acid molecules
of the
invention may be sufficiently homologous to the sequences of related species
such that
these nucleic acid molecules may serve as markers for the construction of a
genomic
map in related bacteria, such as Brevibacterium lactofermentum.
The MP nucleic acid molecules of the invention are also useful for
evolutionary
and.protein structural studies. The metabolic processes in which the molecules
of the
invention participate are utilized by a wide variety of prokaryotic and
eukaryotic cells;
by comparing the sequences of the nucleic acid molecules of the present
invention to
those encoding similar enzymes from other organisms, the evolutionary
relatedness of
the organisms can be assessed. Similarly, such a comparison permits an
assessment of
which regions of the sequence are conserved and which are not, which may aid
in
determining those regions of the protein which are essential for the
functioning of the
enzyme. This type of determination is of value for protein engineering studies
and may
54
CA 02571917 2007-O1-08
WO 01/66573 PCTlIB00/02035
give an indication of what the protein can tolerate in terms of mutagenesis
without
losing function.
'n Manipulation of the MP nucleic acid molecules of the invention may result
in the
production of MP proteins having functional differences from the wild-type MP
proteins. These proteins may be improved in efficiency or activity, may be
present in
greater numbers in the cell than is usual, or may be decreased in efficiency
or activity.
The invention also provides methods for screening molecules which modulate
the activity of an MP protein, either by interacting with the protein itself
or a substrate or
binding partner of the MP protein, or by modulating the transcription or
translation of an
MP nucleic acid molecule of the invention. In such methods, a microorganism
expressing one or more MP proteins of the invention is contacted with one or
more test
compounds, and the effect of each test compound on the activity or level of
expression
of the MP protein is assessed.
When the desired fine chemical to be isolated from large-scale fermentative
culture of C. glutamicum is an amino acid, a vitamin, a cofactor, a
nutraceutical, a
nucleotide, a nucleoside, or trehalose, modulation of the activity or
efficiency of activity
of one or more of the proteins of the invention by recombinant genetic
mechanisms may
directly impact the production of one of these fine chemicals. For example, in
the case
of an enzyme in a biosynthetic pathway for a desired amino acid, improvement
in
efficiency or activity of the enzyme (including the presence of multiple
copies of the
gene) should lead to an increased production or efficiency of production of
that desired
amino acid. In the case of an enzyme in a biosynthetic pathway for an amino
acid whose
synthesis is in competition with the synthesis of a desired amino acid, any
decrease in
the efficiency or activity of this enzyme (including deletion of the gene)
should result in
an increase in production or efficiency of production of the desired amino
acid, due to
decreased competition for intermediate compounds and/or energy. In the case of
an
enzyme in a degradation pathway for a desired amino acid, any decrease in
efficiency or
activity of the enzyme should result in a greater yield or efficiency of
production of the
desired product due to a decrease in its degradation. Lastly, mutagenesis of
an enzyme
involved in the biosynthesis of a desired amino acid such that this enzyme is
no longer is
capable of feedback inhibition should result in increased yields or e~ciency
of
production of the desired amino acid. The same should apply to the
biosynthetic and
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
degradadve enzymes of the invention involved in the metabolism of vitamins,
cofactors,
nutraceuticals, nucleotides, nucleosides and trehalose.
Similarly, when the desired fine chemical is not one of the aforementioned
compounds, the modulation of activity of one of the proteins of the invention
may still
impact the yield and/or efficiency of production of the compound from large-
scale
culture of C. glutamicum. The metabolic pathways of any organism are closely
interconnected; the intermediate used by one pathway is often supplied by a
different
pathway. Enzyme expression and function may be regulated based on the cellular
levels
of a compound from a different metabolic process, and the cellular levels of
molecules
necessary for basic growth, such as amino acids and nucleotides, may
critically affect
the viability of the microorganism in large-scale culture. Thus, modulation of
an amino
acid biosynthesis enzyme, for example, such that it is no longer responsive to
feedback
inhibition or such that it is improved in efficiency or turnover may result in
increased
cellular levels of one or more amino acids. In turn, this increased pool of
amino acids
provides not only an increased supply of molecules necessary for protein
synthesis, but .-
also of molecules which are utilized as intermediates and precursors in a
number of
other biosynthetic pathways. If a particular amino acid had been limiting in
the cell, its
increased production might increase the ability of the cell to perform
numerous other
metabolic reactions, as well as enabling the cell to more efficiently produce
proteins of
all kinds, possibly increasing the overall growth rate or survival ability of
the cell in
large scale culture. Increased viability improves the number of cells capable
of
producing the desired fine chemical in fermentative culture, thereby
increasing the yield
of this compound. Similar processes are possible by the modulation of activity
of a
degradative enzyme of the invention such that the enzyme no longer catalyzes,
or
catalyzes less efficiently, the degradation of a cellular compound which is
important for
the biosynthesis of a desired compound, or which will enable the cell to grow
and
reproduce more efficiently in large-scale culture. It should be emphasized
that
optimizing the degradative activity or decreasing the biosynthetic activity of
certain
molecules of the invention may also have a beneficial effect on the production
of certain
fine chemicals from C. glutamicum. For example, by decreasing the efficiency
of
activity of a biosynthetic enzyme in a pathway which competes with the
biosynthetic
pathway of a desired compound for one or more intermediates, more of those
intermediates should be available for conversion to the desired product. A
similar
56
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
situation may call for the improvement of degradative ability or efficiency of
one or
moze proteins of the invention.
This aforementioned list of mutagenesis strategies for MP proteins to result
in
increased yields of a desired compound is not meant to be limiting; variations
on these
mutagenesis strategies will be readily apparent to one of ordinary skill in
the art. By
these mechanisms, the nucleic acid and protein molecules of the invention may
be
utilized to generate C glutamicum or related strains of bacteria expressing
mutated MP
nucleic acid and protein molecules such that the yield, production, andlor
efficiency of
production of a desired compound is improved. This desired compound may be any
natural product of C. glutamicum, which includes the final products of
biosynthesis
pathways and intermediates of naturally-occurring metabolic pathways, as well
as
molecules which do not naturally occur in the metabolism of C. glutamicum, but
which
are produced by a C. glutamicum strain of the invention. Preferred compounds
to be
produced by Corynebacterium glutamicum strains are the amino acids L-lysine
and L
methionine.
In one embodiment, the metC gene encoding cystathionine (3-lyase, the third
enzyme in the methionine biosynthetic pathway, was isolated from
Corynebacterium
glutamicum. The translational product of the gene showed no significant
homology with
that of metC gene from other organisms. Introduction of the plasmid containing
the
metC gene into C. glutamicum resulted in a 5-fold increase in the activity of
cystathionine ~i-lyase. The protein product, now designated MetC
(corresponding to
SEQ ID N0:4), which encodes a protein product of 35,574 Daltons and consists
of 325
amino acids, is identical to the previously reported aecD gene (Rossol, I. and
Puhler, A.
(1992) J. Bacteriology 174, 2968-2977) except the existence of two different
amino
acids. Like aecD gene, when present in multiple copies, metC gene conferred
resistance
to S ((3-aminoethyl)-cysteine which is a toxic lysine analog. However, genetic
and
biochemical evidences suggest that the natural activity of metC gene product
is to
mediate methionine biosynthesis in C. glutamicum. Mutant strains of metC were
constructed and the strains showed methionine prototrophy. The mutant strains
completely lost their ability to show resistance to S (7-aminoethyl)-cysteine.
These
results show that, in addition to the transsulfuration, which is another
biosynthetic
pathway, the direct sulfhydrylation pathway is functional in C. glutamicum as
a parallel
biosynthetic route for methionine.
57
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
in yet another embodiment, it is also shown that the additional
sulfliydrylation
pathway is catalyzed by O-acetylhomoserine sulfhydrylase. The presence of the
pathway is demonstrated by the isolation of the corresponding metZ (or meth
gene and
enzyme (corresponding to SEQ ID NO:1 and SEQ ID N0:2, respectively). Among the
eukaryotes, fungi and yeast species have been reported to have both the
transsulfuration
and direct sulfhydrylation pathway. Thus far, no prokaryotic organism which
possesses
both pathways has been found. Unlike E. coli which only possesses single
biosynthetic
route for lysine, C glutamicum possesses two parallel biosynthetic pathways
for the
amino acid. The biosynthetic pathway for methionine in C. glutamicum is
analogous to
that of lysine in that aspect.
The gene metZ is located in the upstream region of metA, which is the gene
encoding the enzyme catalysing the first step of methionine biosynthesis
(Park, S.-D., et
al. ( 1998) Mol. Cells 8, 286-294). Regions upstream and downstream of metA
were
sequenced to identify other met genes. It appears that metZ and metA form an
operon.
Expression of the genes encoding MetA and MetZ leads to overproduction of the
corresponding polypeptides.
Surprisingly, metZ clones can complement methionine auxotrophic Escherichia
coli metB mutant strains. This shows that the protein product of metZ
catalyzes a step
that can bypass the step catalyzed by the protein product of metB.
MetZ was also disrupted and the mutant strain showed methionine prototrophy.
Corynebacterium glutamicum metB and metZdouble mutants were also constructed.
The
double mutant is auxotrophic for methionine. Thus, metZ encodes a protein
catalysing the
reaction from O-Acetyl-Homoserine to Homocysteine, which is one step in the
sulfhydrylation pathway of methionine biosynthesis. Corynebacterium glutamicum
contains both the transsulfuration and the sulfhydrylation pathway of
methionine
biosynthesis.
Introduction of metZ into C. glutamicum resulted in the expression of a 47,000
Dalton protein. Combined introduction of metZ and metA in C. glutamicum
resulted in the
appearance of metA and metZ proteins as shown by gel electrophoresis. If the
Corynebacterium strain is a lysine overproducer, introduction of a plasmid
containing
metZ and metA resulted in a lower lysine titer but accumulation of
homocysteine and
methionine is detected.
58
CA 02571917 2007-O1-08
WO 01166573 PCT/IB00I02035
In another embodiment metZ and metA were introduced into Corynebacterium
glutamicum strains together with the hom gene, encoding the homoserine
dehydrogenase,
catalysing the conversion from aspartate semialdehyde to homoserine. Different
hom
genes from different organisms were chosen for this experiment. The
Corynebacterium
glutamicum hom gene can be used as well as hom genes from other procaryotes
like
Escherichia coli or Bacillus subtilis or the hom gene of eukaryotes such as
Saccharomyces
cerevisiae, Shizosaccharomyces pombe, Ashbya gossypii or algae, higher plants
or
animals. It may be that the hom gene is insensitive against feed back
inhibition mediated
by any metabolites that occur in the biosynthetic routes of the amino acids of
the aspartate
family, like aspatrate, lysine, threonine or methionine. Such metabolites are
for example
aspartate, lysine, methionine, threonine, aspartyl-phosphate, aspartate
semialdehyd,
homoserine, cystathionine, homocysteine or any other metabolite that occurs in
this
biosynthetic routes. In addition to the metabolites, the homoserine
dehydrogenase may be
insensitive against inhibition by analogues of all those metabolites or even
against other
compounds involved in this metabolism as there are other amino acids like
cysteine or
cofactors like vitamin B 12 and all of its derivatives and S-
adenosylmethionine and its
metabolites and derivatives and analogues. The insensitivity of the homoserine
dehydrogenase against all these, a part of these or only one of these
compounds may either
be its natural attitude or it may be the result from one or more mutations
that resulted from
classical mutation and selection using chemicals or irradiation or other
mutagens. The
mutations could also be introduced into the hom gene using gene technology,
for example
the introduction of site specific point mutations or by any method
aforementioned for the
MP or MP encoding DNA-sequences.
When a hom gene was combined with the metZ and metA genes and introduced
into a Corynebacterium glutamicum strain that is a lysine overproducer, lysine
accumulation was reduced and homocysteine and methionine accumulation was
enhanced.
A further enhancement of homocysteine and methionine concentrations can be
achieved,
if a lysine overproducing Corynebacterium glutamicum strain is used and a
disruption of
the ddh gene or the IysA gene was introduced prior to the transformation with
DNA
containing a hom gene and metZ and metA in combination. The overproduction of
homocysteine and methionine was possible using different sulfur sources.
Sulfates,
thiosulfates, sulfites and also more reduced sulfur sources like H2S and
sulfides and
derivatives could be used. Also, organic sulfur sources like methyl mercaptan,
59
CA 02571917 2007-O1-08
thioglycolates, thiocyanates, thiourea, sulfur containing amino acids like
cysteine and
other sulfur containing compounds can be used to achieve homocysteine and
methionine
overproduction.
In another embodiment, the metC gene was introduced into a Corynebacterium
glufanucum strain using aforementioned methods. The metC gene can be
transformed into
the strain in combination with other genes like metB, metA and metA. The hom
gene can
also be added. When the hom gene, the met C, metA and metB genes were combined
on a
vector and introduced into a Co~ynebacterium glutamicum strain, homocysteine
and
methionine overproduction was achieved. 'The overproduction of homocysteine
and
methionine was possible using different sulfur sources. Sulfates,
thiosulfates, sulfites and
also more reduced sulfi~r sources like H2S and sulfides and derivatives could
be used.
Also, organic sulfur sources like methyl mercaptan, thioglycolates,
thiocyanates, thiourea,
sulfur containing amino acids like~cysteine and other sulfur containing
compounds can be
used to achieve homocysteine and methionine overproduction.
'
This invention is further illustrated by the following examples which should
not
be construed as limiting.
CA 02571917 2007-O1-08
WO 01/66573 PCTlB00/02035
Exemplification
Example 1: Preparation of total genomic DNA of Corynebacteriu»: glutamicum
ATCC13032
A culture of Corynebacterium glutamicum (ATCC 13032) was grown overnight
at 30°C with vigorous shaking in BHI medium (Difco). The cells were
harvested by
centrifugation, the supernatant was discarded and the cells were resuspended
in 5 ml
buffer-I (S% of the original volume of the culture - all indicated volumes
have been
calculated for 100 ml of culture volume). Composition of buffer-I: 140.34 g/1
sucrose,
2.46 g/1 MgSO, x 7H20, 10 m1/1 KHZPO, solution (100 g/1, adjusted to pH 6.?
with
KOH), 50 mill M12 concentrate (10 g/1 (NH4)ZSO,,1 g/1 NaCI, 2 g/1 MgS04 x
7H20,
0_2 g/1 CaCl2, 0.5 gll yeast extract (Difco), 10 m1/1 trace-elements-mix (200
mg/1 FeSO,
x HxO,10 mg/1 ZnSO, x 7 H20, 3 mg/1 MnCl2 x 4 HZO, 30 mg/1 H,BO, 20 mg/1 CoClz
x
6 HZO, 1 mg/1 NiCIZ x 6 H20, 3 mg/1 Na~MoO, x 2 HZO, 500 mg/1 complexing agent
(EDTA or critic acid), 100 m1/1 vitamins-mix (0.2 mg/1 biotin, 0.2 mg/1 folic
acid, 20
mg/1 p-amino benzoic acid, 20 mg/1 riboflavin, 40 mg/1 ca-panthothenate, 140
mg/I
nicotinic acid, 40 mgll pyridoxole hydrochloride, 200 mg/1 myo-inositol).
Lysozyme
was added to the suspension to a final concentration of 2.5 mg/ml. After an
approximately 4 h incubation at 37°C, the cell wall was degraded and
the resulting
protoplasts are harvested by centrifugation. The pellet was washed once with S
ml
buffer-I and once with 5 ml TE-buffer ( 10 mM Tris-HCI,1 mM EDTA, pH 8). The
pellet was resuspended in 4 ml TE-buffer and 0.5 ml SDS solution (10%) and 0.5
ml
NaCI solution (5 M) are added. After adding of proteinase K to a final
concentration of
200 ~,g/ml, the suspension is incubated for ca.l8 h at 37°C. The DNA
was purified by
extraction with phenol, phenol-chloroform-isoamylalcohol and chloroform-
isoamylalcohol using standard procedures. Then, the DNA was precipitated by
adding
1/50 volume of 3 M sodium acetate and 2 volumes of ethanol, followed by a 30
min
incubation at -20°C and a 30 min centrifugation at 12,000 rpm in a high
speed centrifuge
using a SS34 rotor (Sorvall). The DNA was dissolved in 1 ml TE-buffer
containing 20
p,g/ml lZNaseA and dialysed at 4°C against 1000 ml TE-buffer fox at
least 3 hours.
61
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
During this time, the buffer was exchanged 3 times. To aliquots of 0.4 ml of
the
dialysed DNA solution, 0.4 ml of 2 M LiCI and 0.8 ml of ethanol are added.
After a 30
min incubation at -20°C, the DNA was collected by centrifugation
(13,000 rpm, Biofuge
Fresco, Heraeus, Hanau, Germany). The DNA pellet was dissolved in TE-buffer.
DNA
prepared by this procedure could be used for all purposes, including southern
blotting or
construction of genomic libraries.
Example Z: Construction of genomic libraries in Escfierichia coli of
Corynebacterium
glutamicum ATCC13032.
Using DNA prepared as described in Example 1, cosmid and plasmid libraries
were
constructed according to known and well established methods (see e.g.,
Sambrook, J. et al.
(1989) "Molecular Cloning : A Laboratory Manual", Cold Spring Harbor
Laboratory Press,
or Ausubel, F.M. et al. (1994) "Current Protocols in Molecular Biology", John
Wiley &
Sons.)
' ' Any plasmid or cosmid could be used. Of particular use were the plasmids
pBR322
(Sutcliffe, J.G. (1979) Proc. Natl. Acacl Sci. SSA, 75:3737-3741); pACYC177
(Change &
Cohen (1978) J. Bacteriol 134:1141-1156), plasmids of the pBS series (pBSSK+,
pBSSK- a
others; Stratagene, LaJolla, USA), or cosmids as SuperCosl (Stratagene,
LaJolla, USA) or
Lorist6 (Gibson, T.J., Rosenthal A. and Waterson, R.H. (1987) Gene 53:283-286.
Gene libr~
specifically for use in C. glutamicum may be constructed using plasmid pSLl09
(Lee, H.-S.
A. J. Sinskey (1994) J. Microbiol. Biotechnol. 4: 256-263).
For the isolation of metC clones, E. coli JE6839 cells were transformed with
the
library DNA and plated onto the M9 minimal medium containing ampicillin and
appropriate supplements. The plates were incubated at 37°C for 5 days.
Colonies were
isolated and screened for the plasmid content. The complete nucleotide
sequence of the
isolated metC gene was determined by methods well-known to one of ordinary
skill in
the art.
Example 3: DNA Sequencing and Computational Functional Analysis
Genomic libraries as described in Example 2 were used for DNA sequencing
according to standard methods, in particular by the chain termination method
using
ABI377 sequencing machines (see e.g., Fleischman, R.D. et al. (1995) "Whole-
genome
Random Sequencing and Assembly of Haemophilus Influenzae Rd., Science, 269:496-
62
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
512). Sequencing primers with the following nucleotide sequences were used: 5'-
GGAAACAGTATGACCATG-3' (SEQ ID N0:123) or 5'-GTAAAACGACGGCCAGT-
3'(SEQ ID N0.:124).
Example 4: In vivo Mntagenesis
In vivo mutagenesis of Corynebacterium glutamicum can be performed by passage
o
plasmid (or other vector) DNA through E. coli or other microorganisms (e.g.
Bacillus spp. o
yeasts such as Saccharomyces cerevisiae) which are impaired in their
capabilities to maintai
the integrity of their genetic information. Typical mutator strains have
mutations in the gent
for the DNA repair system (e.g., mutHLS, mutD, mutT, etc.; for reference, see
Rupp, W.D.
(1996) DNA repair mechanisms, in: Escherichia coli and Salmonella, p. 2277-
2294, ASM:
Washington.) Such strains are well known to those of ordinary skill in the
art. The use of s~
strains is illustrated, for example, in Greener, A. and Callahan, M. (1994)
Strategies 7: 32-3'
Example S: DNA Transfer Between Escherichia coli and Corynebacterium
glutamicum
Several Corynebacterium and Brevibacterium species contain endogenous
plasmids (as e.g., pHMI S 19 or pBLl) which replicate autonomously (for review
see, e.g.,
Martin, J.F. et al. (1987) Biotechnology, 5:137-146). Shuttle vectors for
Escherichia coli
and Corynebacterium glutamicum can be readily constructed by using standard
vectors for
E. coli (Sambrook, J. et al. (1989), "Molecular Cloning: A Laboratory Manual",
Cold
Spring Harbor Laboratory Press or Ausubel, F.M. et al. (1994) "Current
Protocols in
Molecular Biology", John Wiley & Sons) to which a origin or replication for
and a
suitable marker from Corynebacterium glutamicum is added. Such origins of
replication
are preferably taken from endogenous plasmids isolated from Corynebacterium
and
Brevibacterium species. Of particular use as transformation markers for these
species are
genes for kanamycin resistance (such as those derived from the Tn5 or Tn903
transposons) or chloramphenicol (Winnacker, E.L. (1987) "From Genes to Clones
Introduction to Gene Technology, VCH, Weinheim). There are numerous examples
in the
literature of the construction of a wide variety of shuttle vectors which
replicate in both E.
coli and C glutamicum, and which can be used for several purposes, including
gene over-
expression (for reference, see e.g., Yoshihama, M. et al. (1985) J. Bacteriol.
162:591-597,
63
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00l02035
Martin J.F. et al. (1987) Biotechnology, 5:137-146 and Eikmanns, B.J. et al.
(1991) Gene,
102:93-98).
Using standard methods, it is possible to clone a gene of interest into one of
the
shuttle vectors described above and to introduce such a hybrid vectors into
strains of
Corynebacterium glutamicum. Transformation of C, glutamicum can be achieved by
protoplast transformation (Kastsumata, R. et al. (1984) J. Bacteriol. 159306-
311),
electroporation (Liebl, E. et al. (1989) FEMS Microbiol. Letters, 53:399-303)
and in cases
where special vectors are used, also by conjugation (as described e.g: in
Schafer, A et al.
(1990) J. Bacteriol. 1?2:1663-1666). It is also possible to transfer the
shuttle vectors for
C. glutamicum to E. coli by preparing plasmid DNA from C. glutamicum (using
standard
methods well-known in the art) and transforming it into E. coli. This
transformation step
can be performed using standard methods, but it is advantageous to use an Mcr-
deficient
E. coli strain, such as NM522 (Gough & Murray (1983) J. Mol. Biol. 166:1-19).
Genes may be overexpressed in G glutamicum strains using plasmids which
comprise pCGI (U.S. Patent No. 4,617,267) or fragments thereof, and optionally
the
gene for kanamycin resistance from TN903 (Grindley, N.D. and Joyce, C.M.
(1980)
Proc. Natl. Acad. Sci. USA 7.7(12): 7176-7180). In addition, genes may be
overexpressed in C. glutamicum strains using plasmid pSL109 (Lee, H.-S. and A.
J.
Sinskey (1994)J. Microbiol. Biotechnol. 4: 256-263).
Aside from the use of replicative plasmids, gene overexpression can also be
achieved by integration into the genome. Genomic integration in C. glutamicum
or other
Corynebacterium or Brevibacterium species may be accomplished by well-known
methods, such as homologous recombination with genomic region(s), restriction
endonuclease mediated integration (REMI) (see, e.g., DE Patent 19823834), or
through
the use of transposons. It is also possible to modulate the activity of a gene
of interest by
modifying the regulatory regions (e.g:, a promoter, a repressor, and/or an
enhancer) by
sequence modification, insertion, or deletion using site-directed methods
(such as
homologous recombination) or methods based on random events (such as
transposon
mutagenesis or REMI). Nucleic acid sequences which function as transcriptional
terminators may also be inserted 3' to the coding region of one or more genes
of the
invention; such terminators are well-known in the art and are described, for
example, in
Winnacker, E.L. (198?) From Genes to Clones-Introduction to Gene Technology.
VCH:
Weinheim.
64
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
Example 6: Assessment of the Expression of the Mutant Protein
Observations of the activity of a mutated protein in a transformed host cell
rely on
the fact that the mutant protein is expressed in a similar fashion and in a
similar quantity
to that of the wild-type protein. A useful method to ascertain the level of
transcription of
the mutant gene (an indicator of the amount of mRNA available for translation
to the gene
product) is to perform a Northern blot (for reference see, for example,
Ausubel et al.
(1988) Current Protocols in Molecular Biology, Wiley: New York), in which a
primer
designed to bind to the gene of interest is labeled with a detectable tag
(usually radioactive
or chemiluminescent), such that when the total RNA of a culture of the
organism is
extracted, run on gel, transferred to a stable matrix and incubated with this
probe, the
binding and quantity of binding of the probe indicates the presence and also
the quantity
of mRNA for this gene. This information is evidence of the degree of
transcription of the
mutant gene. Total cellular RNA can be prepared from Corynebacterium
glutamicum by
several methods, all well-known in the art, such as that described in Bormann,
E.R. et al.
(1992) Mol. Microbiol. 6: 317-326.
To assess the presence or relative quantity of protein translated from this
mRNA,
standard techniques, such as SDS-acrylamide gel electrophoresis, were
employed. The
overproduction of metC and metZ in combination with metA in Corynebacterium
glutamicum was demonstrated by this method. Western blot may also be employed
(see,
for example, Ausubel et al. (1988) Current Protocols in Molecular Biology,
Wiley: New
York). In this process, total cellular proteins are extracted, separated by
gel
electrophoresis, transferred to a matrix such as nitrocellulose, and incubated
with a probe,
such as an antibody, which specifically binds to the desired protein. This
probe is
generally tagged with a chemiluminescent or colorimetric label which may be
readily
detected. The presence and quantity of label observed indicates the presence
and quantity
of the desired mutant protein present in the cell.
Example 7: Growth of Escherichia coli and Genetically Modified Corynebacterium
glutamicum - Media and Culture Conditions
E. coli strains are routinely grown in MB and LB broth, respectively
(Follettie, M.
T., et al. (1993) J. Bacteriol. 175, 4096-4103). Minimal media for E. coli is
M9 and
modified MCGC (Yoshihama, M., et al. (1985) J. Bacteriol.162, 591-507).
Glucose was
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
added to a final concentration of 1 %. Antibiotics were added in the following
amounts
(micrograms per milliliter): ampicillin, 50; kanamycin, 25; nalidixic acid,
25. Amino
acids, vitamins, and other supplements were added in the following amounts:
methionine,
9.3 mM; arginine, 9.3 mM; histidine, 9.3 mM; thiamine, 0.05 mM. E. coli cells
were
routinely grown at 37°C, respectively.
Genetically modified Corynebacteria are cultured in synthetic or natural
growth
media. A number of different growth media for Corynebacteria are both well-
known and
readily available (Lieb et al. (1989) Appl. Microbiol. Biotechnol., 32:205-
210; von der
Osten et al. (1998) Biotechnology Letters, 11:11-16; Patent DE 4,120,867;
Liebl (1992)
"The Genus Corynebacterium, in: The Procaryotes, Volume II, Balows, A. et al.,
eds.
Springer-Verlag). These media consist of one or more carbon sources, nitrogen
sources,
inorganic salts, vitamins and trace elements. Preferred carbon sources are
sugars, such as
mono-, di-, or polysaccharides. For example, glucose, fructose, mannose,
galactose,
ribose, sorbose, ribulose, lactose, maltose, sucrose, raffmose, starch or
cellulose serve as
very good carbon sources. It is also possible to supply sugar to the media via
complex
compounds such as molasses or other by-products from sugar refinement. It can
also be
advantageous to supply mixtures of different carbon sources. Other possible
carbon
sources are alcohols and organic acids, such as methanol, ethanol, acetic acid
or lactic
acid. Nitrogen sources are usually organic or inorganic nitrogen compounds, or
materials
which contain these compounds. Exemplary nitrogen sources include ammonia gas
or
ammonia salts, such as NIi4Cl or (NH4),504, NH~OH, nitrates, urea, amino acids
or
complex nitrogen sources like corn steep liquor, soy bean flour, soy bean
protein, yeast
extract, meat extract and others.
The overproduction of sulfur containing amino acids like homvcysteine and
methionine was made possible using different sulfur sources. Sulfates,
thiosulfates,
sulfites and also more reduced sulfur sources like H2S and sulfides and
derivatives can be
used. Also, organic sulfur sources like methyl mercaptan, thioglycolates,
thiocyanates,
thiourea, sulfur containing amino acids like cysteine and other sulfur
containing
compounds can be used to achieve homocysteine and methionine overproduction
Inorganic salt compounds which may be included in the media include the
chloride-, phosphorous- or sulfate- salts of calcium, magnesium, sodium,
cobalt,
molybdenum, potassium, manganese, zinc, copper and iron. Chelating compounds
can be
added to the medium to keep the metal ions in solution. Particularly useful
chelating
66
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
compounds include dihydroxyphenols, like catechol or protocatechuate, or
organic acids,
such as citric acid. It is typical for the media to also contain other growth
factors, such as
vitamins or growth promoters, examples of which include biotin, riboflavin,
thiamin, folic
acid, nicotinic acid, pantothenate and pyridoxin. Growth factors and salts
frequently
originate from complex media components such as yeast extract, molasses, corn
steep
liquor and others. The exact composition of the media compounds depends
strongly on
the immediate experiment and is individually decided for each specific case.
Information
about media optimization is available in the textbook "Applied Microbiol.
Physiology, A
Practical Approach (eds. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) pp. 53-
73, ISBN 0
19 963577 3). It is also possible to select growth media from commercial
suppliers, like
standard 1 (Merck) or BHI (grain heart infusion, DIFCO) or others.
All medium components are sterilized, either by heat (20 minutes at 1.5 bar
and
121 °C) or by sterile filtration. The components can either be
sterilized together or, if
necessary, separately. All media components can be present at the beginning of
growth,
1 S or they can optionally be added continuously or batchwise.
Culture conditions are defined separately for each experiment. The temperature
should be in a range between 15°C and 45°C. The temperature can
be kept constant or can
be altered during the experiment. The pH of the medium should be in the range
of 5 to
8.5, preferably around 7.0, and can be maintained by the addition of buffers
to the media.
An exemplary buffer for this purpose is a potassium phosphate buffer.
Synthetic buffers
such as MOPS, HEPES, ACES and others can alternatively or simultaneously be
used. It
is also possible to maintain a constant culture pH through the addition of
NaOH or
NII40H during growth. If complex medium components such as yeast extract are
utilized,
the necessity for additional buffers may be reduced, due to the fact that many
complex
compounds have high buffer capacities. If a fermentor is utilized for
culturing the micro-
organisms, the pH can also be controlled using gaseous ammonia.
The incubation time is usually in a range from several hours to several days.
This
time is selected in order to permit the maximal amount of product to
accumulate in the
broth. The disclosed growth experiments can be carried out in a variety of
vessels, such as
microtiter plates, glass tubes, glass flasks or glass or metal fermentors of
different sizes.
For screening a large number of clones, the microorganisms should be cultured
in
microtiter plates, glass tubes or shake flasks, either with or without
baffles. Preferably
100 ml shake flasks are used, filled with 10% (by volume) of the required
growth
67
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
medium. The flasks should be shaken on a rotary shaker (amplitude 25 mm) using
a
speed-range of 100 - 300 rpm. Evaporation losses can be diminished by the
maintenance
of a humid atmosphere; alternatively, a mathematical correction for
evaporation losses
should be performed.
If genetically modified clones are tested, an unmodified control clone or a
control
clone containing the basic plasmid without any insert should also be tested.
The medium
is inoculated to an OD6~ of O.5 -1.5 using cells grown on agar plates, such as
CM plates
(10 g/1 glucose, 2,5 g/1 NaCI, 2 g/1 urea, 10 g/1 polypeptone, 5 g/1 yeast
extract, 5 g/1 meat
extract, 22 g/1 NaCI, 2 g/1 urea, 10 g/1 polypeptone, 5 g/1 yeast extract, 5
g/1 meat extract,
22 g/1 agar, pH 6.8 with 2M NaOH) that had been incubated at 30°C.
Inoculation of the
media is accomplished by either introduction of a saline suspension of C.
glutamicum cells
from CM plates or addition of a liquid preculture of this bacterium.
Example 8 -Ih vitro Analysis of the Function of Mutant Proteins
The determination of activities and kinetic parameters of enzymes is well
established in the art. Experiments to determine the activity of any given
altered
enzyme must be tailored to the specific activity of the wild-type enzyme,
which is well
within the ability of one of ordinary skill in the art. Overviews about
enzymes in
general, as well as specific details concerning structure, kinetics,
principles, methods,
applications and examples for the determination of many enzyme activities may
be
found, for example, in the following references: Dixon, M., and Webb, E.C.,
(1979)
Enzymes. Longmans: London; Fersht, (1985) Enzyme Structure and Mechanism.
Freeman: New York; Walsh, (1979) Enzymatic Reaction Mechanisms. Freeman: San
Francisco; Price, N.C., Stevens, L. (1982) Fundamentals of Enzymology. Oxford
Univ.
Press: Oxford; Boyer, P.D., ed. (1983) The Enzymes, 3'd ed. Academic Press:
New
York; Bisswanger, H., (1994) Enzymkinetik, 2"d ed. VCH: Weinheim (ISBN
3527300325); Bergmeyer, H.U., Bergmeyer, J., Graf3l, M., eds. (1983-1986)
Methods of
Enzymatic Analysis, 3'~ ed., vol. I-XII, Verlag Chemie: Weinheim; and
Ullmann's
Encyclopedia of Industrial Chemistry (1987) vol. A9, "Enzymes". VCH: Weinheim,
p.
352-363.
Cell extracts from Corynebacterium glutamicum were prepared as described
previously (Park, S.-D., et al. (1998) Mol. Cells 8, 286-294). Cystathionine
(3-lyase was
assayed as follows. The assay mixture contained 100 mM Tris-HCl (pH8.5), 0.1
mM
68
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
NADH, 1 mM L-cystathionine, 5 units of L-lactate dehydrogenase, and
appropriate
amounts of crude extract. Optical changes were monitored at 340 nm. Assay for
S (~-
aminoethyl)-cysteine (AEC) resistance was carried out as described in Rossol,
I. and
Puhler, A. (1992) ,I. Bacteriol. 174, 2968-77. The results of cystathionin (3-
lyase assays
from extracts of different Corynebacterium glutamicum strains as well as
results of
AEC resistance assays of the same strain are summarized in Table 5, below.
69
CA 02571917 2007-O1-08
WO 01/66573 PCT/1800/02035
Table 5. Expression of cystathionine ø-lyase a
Activity Growth
Strains Properties' on
' Resistance
b
(nmol min' MM to AEC
mg
)
C. glutamicum AS019E12- 146 + +
C. glutamicum AS019E12/pMTlEmpty 145 + +
vector
C. glutamicmn AS019E121pSL173metC clone797 + ++
C. glutamicum I-ILfl57tnetC 19 + -
mutant
C. glutamicum HL459 metC mutants23 + -
E. coli JE6839 metC mutant21 - ND a
S ' The enryme was induced by growth to the stationary phase on the minimal
medium containing 1%
glucose. Cells were harvested, disrupted, and assayed for the activity as
described in the Materials
and Methods.
6 MCGC minimal media was used. Growth was monitored on plates.
' Cells were grown on plates containing 40 mM S-(ø-aminoethyl)-cysteine (AEC)
for 5 days.
d The mutants were generated in this study.
'Not determined
The ability of the metC clones to express cystathionine ø-lyase was tested by
enzymatic assay. Crude extracts prepared from the C. glutamicum AS019E12 cells
harboring plasmid pSL173 were assayed. Cells harboring the plasmid showed
approximately a 5-fold increase in the activity of cystathionine ø-lyase
compared to
those harboring the empty vector pMTI (Table 5), apparently due to the gene-
dose
effect. SDS-PAGE analysis of crude extracts revealed a putative cystathionine
ø-lyase
band with approximate Mr of 41,000. Intensity of each putative cystathionine ø-
lyase
band agreed with the complementation and enzymatic assay data (Table 5). As
described
above, a region of metC appeared to be nearly identical to the previously
reported aecD.
Since the aecD gene was isolated on the basis of its ability to confer
resistance to S (ø-
aminoethyl)-cysteine (AEC), a toxic lysine analogue, we tested the protein
product of
metC for the presence of the activity. As shown in Table 5, cells
overexpressing
cystathionine ø-lyase showed increased resistance to AEC. The strain carrying
a
mutation in metC gene (see below) completely lost its ability to show a
resistant
phenotype to AEC.
Assay for O-acetylhmoserine sulphydrylase was performed as follows (Belfaiza,
J.,
et al. (1998) J. Bacteriol. 180, 250-255; Ravanel, S., M. Droux, and R. Douce
(1995)
Arch Biochem. Biophys. 316, 572-584; Foglino, M. (1995) Microbiology 141, 431-
439).
Assay mixhue of 0.1 ml contained 20 mM MOPS-NaOH (pH7.5),10 mM O
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
acetylhomoserine, 2 mM Na2S in 50 mM NaOH, and an appropriate amount of
enzyme.
Immediately after the addition of Na2S which was added last, the reaction
mixture was
overlayed with 50 u1 of mineral oil. After 30 minute incubation at
30°C, the reaction
was stopped by boiling the mixture for 3 minutes. Homocysteine produced in the
reaction was quantified as previously described (Yamagata, S. (1987) Method
Enzymol.
143, 478-483.). Reaction mixture of 0.1 ml was taken and mixed with 0.1 ml of
H20,
0.6 ml of saturated NaCI, 0.1 ml of 1.5 M NaZC03 containing 67 mM KCN, and 0.1
ml
of 2% nitroprusside. After 1 minute incubation at room temperature, optical
density was
measured at 520 nm. Corynebacterium cells harboring additional copies of the
metZ
gene, e.g., a plasmid containing the metZ gene, exhibited significantly higher
metZ
enzyme activities than the same type of Corynebacterium cells without
additional copies
of the metZ gene.
The activity of proteins which bind to DNA can be measured by several well-
established methods, such as DNA band-shift assays (also called gel
retardation assays).
The effect of such proteins on the expression of other molecules can be
measured using
reporter gene assays (such as that described in Kolmar, H. et al. (1995) EMBO
J. 14:
3895-3904 and references cited therein). Reporter gene test systems are well
known and
established for applications in both pro- and eukaryotic cells, using enzymes
such as
beta-galactosidase, green fluorescent protein, and several others.
The determination of activity of membrane-transport proteins can be performed
according to techniques such as those described in Gennis, R.B. (1989) "Pores,
Channels and Transporters", in Biomembranes, Molecular Structure and Function,
Springer: Heidelberg, p. 85-137; 199-234; and 270-322.
Example 9: Analysis of Impact of Mutant Protein on the Production of the
Desired
Product
The effect of the genetic modification in C. glutamicum on production of a
desired compound (such as an amino acid) can be assessed by growing the
modified
microorganism under suitable conditions (such as those described above) and
analyzing
the medium and/or the cellular component for increased production of the
desired
product (i.e., an amino acid). Such analysis techniques are well known to one
of
ordinary skill in the art, and include spectroscopy, thin layer
chromatography, staining
methods of various kinds, enzymatic and microbiological methods, and
analytical
71
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
chromatography such as high performance liquid chromatography (see, for
example,
Ullman, Encyclopedia of Industrial Chemistry, vol. A2, p. 89-90 and p. 443-
613, VCH:
Weinheirn (1985); Fallon, A. et al., (1987) "Applications of HPLC in
Biochemistry" in:
Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17; Rehm et
al.
(1993) Biotechnology, vol. 3, Chapter III: "Product recovery and
purification", page
469-714, VCH: Weinheim; Better, P.A. et al. (1988) Bioseparations: downstream
processing for biotechnology, John Wiley and Sons; Kennedy, J.F. and Cabral,
J.M.S.
(1992) Recovery processes for biological materials, John Wiley and Sons;
Shaeiwitz,
J.A. and Henry, J.D. (1988) Biochemical separations, in: Ulmann's Encyclopedia
of
Industrial Chemistry, vol. B3, Chapter 11, page 1-27, VCH: Weinheim; and
Dechow,
F.J. (1989) Separation and purification techniques in biotechnology, Noyes
Publications.)
In addition to the measurement of the final product of fermentation, it is
also
possible to analyze other components of the metabolic pathways utilized for
the
production of the desired compound, such as intermediates and side-
products,'to
determine the overall efficiency of production of the compound. Analysis
methods
include measurements of nutrient levels in the medium (e.g., sugars,
hydrocarbons,
nitrogen sources, phosphate, and other ions), measurements of biomass
composition and
growth, analysis of the production of common metabolites of biosynthetic
pathways, and
measurement of gasses produced during fermentation. Standard methods for these
measurements are outlined in Applied Microbial Physiology, A Practical
Approach,
P.M. Rhodes and P.F. Stanbury, eds., IRL Press, p. 103-129; 131-163; and 165-
192
(ISBN: 0199635773) and references cited therein.
Example 10: Purification of the Desired Product from C. glutamicum Culture
Recovery of the desired product from the C. glutamicum cells or supernatant of
the above-described culture can be performed by various methods well known in
the art.
If the desired product is not secreted from the cells, the cells can be
harvested from the
culture by low-speed centrifugation, the cells can be lysed by standard
techniques, such
as mechanical force or sonication. The cellular debris is removed by
centrifugation, and
the supernatant fraction containing the soluble proteins is retained for
further
purification of the desired compound. If the product is secreted from the C.
glutamicum
72
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
cells, then the cells are removed from the culture by low-speed
centrifugation, and the
supernate fraction is retained for further purification.
The supernatant fraction from either purification method is subjected to
chromatography with a-suitable resin, in which the desired molecule is either
retained on
a chromatography resin while many of the impurities in the sample are not, or
where the
impurities are retained by the resin while the sample is not. Such
chromatography steps
may be repeated as necessary, using the same or different chromatography
resins. One
of ordinary skill in the art would be well-versed in the selection of
appropriate
chromatography resins and in their most efficacious application for a
particular molecule
to be purified. The purified product may be concentrated by filtration or
ultrafiltration,
and stored at a temperature at which the stability of the product is
maximized.
There are a wide array of purification methods known to the art and the
preceding method of purification is not meant to be limiting. Such
purification
techniques are described, for example, in Bailey, J.E. & Ollis, D.F.
Biochemical
Engineering Fundamentals, McGraw-Hill: New York (1986).
The identity and purity of the isolated compounds may be assessed by
techniques
standard in the art. These include high-performance liquid chromatography
(HPLC),
spectroscopic methods, staining methods, thin layer chromatography, NIRS,
enzymatic
assay, or microbiologically. Such analysis methods are reviewed in: Patek et
al. (1994)
Appl. Environ. Microbiol. 60: 133-140; Malakhova et al. (1996) Biotekhnologiya
11: 27-
32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's
Encyclopedia
of Industrial Chemistry, (1996) vol. A27, VCH: Weinheim, p. 89-90, p. 521-540,
p. 540-
547, p. 559-566, 575-581 and p. 581-587; Michal, G. (1999) Biochemical
Pathways: An
Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A.
et al.
(1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in
Biochemistry and Molecular Biology, vol. 17.
Example 11: Analysis of the Gene Sequences of the Invention
The comparison of sequences and determination of percent homology between
two sequences are art-known techniques, and can be accomplished using a
mathematical
algorithm, such as the algorithm of Karlin and Altschul (1990) Proc. Natl.
Acad. Sci.
USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad.
Sci. USA
90:5873-77. Such an algorithm is incorporated into the NBLAST and XBLAST
73
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
BLAST
nucleotide searches can be performed with the NBLAST program, score = 100,
wordlength = 12 to obtain nucleotide sequences homologous to MP nucleic acid
molecules of the invention. BLAST protein searches can be performed with the
S XBLAST program, score = S0, wordlength = 3 to obtain amino acid sequences
homologous to MP protein molecules of the invention. To obtain gapped
alignments for
comparison purposes, Gapped BLAST can be utilized as described in Altschul et
al.,
(1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped
BLAST programs, one of ordinary skill in the art will know how to optimize the
parameters of the program (e.g., XBLAST and NBLAST) for the specific sequence
being analyzed.
Another example of a mathematical algorithm utilized for the comparison of
sequences is the algorithm of Meyers and Miller ((1988) Comput. Appl. Biosci.
4: 11-
17). Such an algorithm is incorporated into the ALIGN program (version 2.0)
which is
1 S part of the GCG sequence alignment software package. When utilizing the
ALIGN
program for comparing amino acid sequences, a PAM 120 weight residue table, a
gap
length penalty of 12, and a gap penalty of 4 can be used. Additional
algorithms for
sequence analysis are known in the art, and include ADVANCE and ADAM.
described
in Torelli and Robotti (1994) Comput. Appl. Biosci. 10:3-S; and FASTA,
described in
Pearson and Lipman (1988) P.N.A.S. 85:2444-8.
The percent homology between two amino acid sequences can also be
accomplished using the GAP program in the GCG software package (available at
http://www.gcg.com), using either a Blosum 62 matrix or a PAM250 matrix, and a
gap
weight of 12, 10, 8, 6, or 4 and a length weight of 2, 3, or 4. The percent
homology
between two nucleic acid sequences can be accomplished using the GAP program
in the
GCG software package, using standard parameters, such as a gap weight of 50
and a
length weight of 3.
A comparative analysis of the gene sequences of the invention with those
present
in Genbank has been performed using techniques known in the art (see, e.g.,
Bexevanis
and Ouellette, eds. (1998) Bioinformatics: A Practical Guide to the Analysis
of Genes
and Proteins. John Wiley and Sons: New York). The gene sequences of the
invention
were compared to genes present in Genbank in a three-step process. In a first
step, a
BLASTN analysis (e.g., a local alignment analysis) was performed for each of
the
74
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
sequences of the invention against the nucleotide sequences present in
Genbank, and the
top 500 hits were retained for further analysis. A subsequent FASTA search
(e.g., a
combined local and global alignment analysis, in which limited regions of the
sequences
are aligned) was performed on these 500 hits. Each gene sequence of the
invention was
S subsequently globally aligned to each of the top three FASTA hits, using the
GAP
program in the GCG software package (using standard parameters). In order to
obtain
correct results, the length of the sequences extracted from Genbank were
adjusted to the
length of the query sequences by methods well-known in the art. The results of
this
analysis are set forth in Table 4. The resulting data is identical to that
which would have
been obtained had a GAP (global) analysis alone been performed on each of the
genes of
the invention in comparison with each of the references in Genbank, but
required
significantly reduced computational time as compared to such a database-wide
GAP
(global) analysis. Sequences of the invention for which no alignments above
the cutoff
values were obtained are indicated on Table 4 by the absence of alignment
information.
It will further be understood by one of ordinary skill in the art that the GAP
alignment
homology percentages set forth in Table 4 under the heading "% homology (GAP)"
are
listed in the European numerical format, wherein a ',' represents a decimal
point. For
example, a value of "40,345" in this column represents "40.345%".
Example 12: Construction and Operation of DNA Microarrays
The sequences of the invention may additionally be used in the construction
and .
application of DNA microarrays (the design, methodology, and uses of DNA
arrays are
well known in the art, and are described, for example, in Schena, M. et al.
(1995)
Science 270: 467-470; Wodicka, L. et al. (1997) Nature Biotechnology 15: 1359-
1367;
DeSaizieu, A. et al. (1998) Nature Biotechnology 16: 45-48; and DeRisi, J.L.
et al.
(1997) Science 278: 680-686).
DNA microarrays are solid or flexible supports consisting of nitrocellulose,
nylon, glass, silicone, or other materials. Nucleic acid molecules may be
attached to the
surface in an ordered manner. After appropriate labeling, other nucleic acids
or nucleic
acid mixtures can be hybridized to the immobilized nucleic acid molecules, and
the label
may be used to monitor and measure the individual signal intensities of the
hybridized
molecules at defined regions. This methodology allows the simultaneous
quantification
of the relative or absolute amount of all or selected nucleic acids in the
applied nucleic
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
acid sample or mixture. DNA microarrays, therefore, permit an analysis of the
expression of multiple (as many as 6800 or more) nucleic acids in parallel
(see, e.g.,
Schena, M. (1996) BioEssays 18(5): 427-431).
The sequences of the invention may be used to design oligonucleotide primers
which are able to amplify defined regions of one or more C. glutamicum genes
by a
nucleic acid amplification reaction such as the polymerise chain reaction. The
choice
and design of the 5' or 3' oligonucleotide primers or of appropriate linkers
allows the
covalent attachment of the resulting PCR products to the surface of a support
medium
described above (and also described, for example, Schena, M. et al. (1995)
Science 270:
467-470).
Nucleic acid microarrays may also be constructed by in situ oligonucleotide
synthesis as described by Wodicka, L. et al. (1997) Nature Biotechnology 15:
1359-
1367. By photolithographic methods, precisely defined regions of the matrix
are
exposed to light. Protective groups which are photolabile are thereby
activated and
1 S undergo nucleotide addition, whereas regions that are masked from light do
not undergo
any modification. Subsequent cycles of protection and light activation permit
the
synthesis of different oligonucleotides at defined positions. Small, defined
regions of
the genes of the invention may be synthesized on microarrays by solid phase
oligonucleotide synthesis.
The nucleic acid molecules of the invention present in a sample or mixture of
nucleotides may be hybridized to the microarrays. These nucleic acid molecules
can be
labeled according to standard methods. In brief, nucleic acid molecules (e.g.,
mRNA
molecules or DNA molecules) are labeled by the incorporation of isotopically
or
fluorescently labeled nucleotides, e.g., during reverse transcription or DNA
synthesis.
Hybridization of labeled nucleic acids to microarrays is described (e.g., in
Schena, M. et
al. (1995) supra; Wodicka, L. et al. (1997), supra; and DeSaizieu A. et al.
(1998),
supra). The detection and quantification of the hybridized molecule are
tailored to the
specific incorporated label. Radioactive labels can be detected, for example,
as
described in Schena, M. et al. (1995) supra) and fluorescent labels may be
detected, for
example, by the method of Shalon et al. (1996) Genome Research 6: 639-645).
The application of the sequences of the invention to DNA microarray
technology, as described above, permits comparative analyses of different
strains of C.
glutamicum or other Corynebacteria. For example, studies of inter-strain
variations
76
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
based on individual transcript profiles and the identification of genes that
are important
for specific and/or desired strain properties such as pathogenicity,
productivity and
stress tolerance are facilitated by nucleic acid array methodologies. Also,
comparisons
of the profile of expression of genes of the invention during the course of a
fermentation
i reaction are possible using nucleic acid array technology.
Example Z3: Analysis of the Dynamics of Cellular Protein Populations
(Proteomics)
The genes, compositions, and methods of the invention may be applied to study
the interactions and dynamics of populations of proteins, termed 'proteomics'.
Protein
populations of interest include, but are not limited to, the total protein
population of C.
glutamicum (e.g., in comparison with the protein populations of other
organisms), those
proteins which are active under specific environmental or metabolic conditions
(e.g.,
during fermentation, at high or low temperature, or at high or low pH), or
those proteins
which are active during specific phases of growth and development.
Protein populations can be analyzed by various well-known techniques, such as
gel electrophoresis. Cellular proteins may be obtained, for example, by lysis
or
extraction, and may be separated from one another using a variety of
electrophoretic
techniques. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-
PAGE)
separates proteins largely on the basis of their molecular weight. Isoelectric
focusing
polyacrylamide gel electrophoresis (IEF-PAGE) separates proteins by their
isoelectric
point (which reflects not only the amine acid sequence but also
posttranslational
modifications of the protein). Another, more preferred method of protein
analysis is the
consecutive combination of both IEF-PAGE and SDS-PAGE, known as 2-D-gel
electrophoresis (described, for example, in Hermann et al. (1998)
Electrophoresis 19:
3217-3221; Fountoulakis et al. (1998) Electrophoresis 19: 1193-1202; Langen et
al.
(1997) Elech~ophoresis 18: 1184-1192; Antehnann et al. (1997) Electrophoreses
18:
1451-1463). Other separation techniques may also be utilized for protein
separation,
such as capillary gel electrophoresis; such techniques are well known in the
art.
Proteins separated by these methodologies can be visualized by standard
techniques, such as by staining or labeling. Suitable stains are known in the
art, and
include Coomassie Brilliant Blue, silver stain, or fluorescent dyes such as
Sypro Ruby
(Molecular Probes). The inclusion of radioactively labeled amino acids or
other protein
77
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
precursors (e.g., 35S-methionine, 35S-cysteine, 14C-labelled amino acids,15N-
amino
acids, 15N03 or ~SNH4+ or 13C-labelled amino acids) in the medium of C.
glutamicum
permits the labeling of proteins from these cells prior to their separation.
Similarly,
fluorescent labels may be employed. These labeled proteins can be extracted,
isolated
and separated according to the previously described techniques.
Proteins visualized by these techniques can be fiu~ther analyzed by measuring
the
amount of dye or label used. The amount of a given protein can be determined
quantitatively using, for example, optical methods and can be compared to the
amount
of other proteins in the same gel or in other gels. Comparisons of proteins on
gels can
be made, for example, by optical comparison, by spectroscopy, by image
scanning and
analysis of gels, or through the use of photographic films and screens. Such
techniques
are well-known in the art.
To determine the identity of any given protein, direct sequencing or other
standard techniques may be employed. For example, N- and/or C-terminal amino
acid
sequencing (such as Edman degradation) may be used, as may mass spectrometry
(in
particular MALDI or ESI techniques (see, e.g., Langen et al. (1997)
Electrophoresis 18:
1184-1192)). The protein sequences provided herein can be used for the
identification
of C. glutamicum proteins by these techniques.
The information obtained by these methods can be used to compare patterns of
protein presence, activity, or modification between different samples from
various
biological conditions (e.g., different organisms, time points of fermentation,
media
conditions, or different biotopes, among others). Data obtained from such
experiments
alone, or in combination with other techniques, can be used for various
applications,
such as to compare the behavior of various organisms in a given (e.g.,
metabolic)
situation, to increase the productivity of strains which produce fine
chemicals or to
increase the efficiency of the production of fine chemicals.
Example 14: Cloning of Genes by Application of the Polymerase Chain Reaction
(PCR)
Genes can be amplified using specific oligonucleotides comprising either
nucleotide sequences homologous to sequences of Corynebacterium glutamicum or
other strains as well as recognition sites of restriction enzymes well known
in the art
(e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular
Cloning: A
78
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 1989). Theses oligonucleotides can
be used
to amplify specific DNA-fragments containing parts of the chromosome of
mentioned
strains using DNA-polymerises such as T. aquaticus DNA-polymerise, P. furiosus
DNA-polymerise, or P. woesei DNA-polymerise and dNTPs nucleotides in an
appropriate buffer solution as described by the manufacturer.
Gene fragments such as coding sequences from RXA00657 including
appropriate upstream and downstream regions not contained in the coding region
of the
mentioned gene can be amplified using the aforementioned technologies.
Furthermore,
these fragments can be purified from unincorporated oligonucleotides and
nucleotides.
DNA restriction enzymes can be used to produce protruding ends that can be
used to
ligate DNA fragments to vectors digested with complementary enzymes or
compatible
enzymes producing ends that can be used to ligate the DNA into the vectors
mentioned
in Sinskey et al., U.S. Patent No. 4,649,119, and techniques for genetic
manipulation of
C. glutamicum and the related Brevibacterium species (e.g., lactofermentum)
(Yoshihama et al, J. Bacteriol. 162: 591-597 (1985); Katsumata et al., J.
Bacteriol. 159:
306-311 (1984); and Santamaria et al., J. Gen. Microbiol. 130: 2237-2246
(1984).
Oligonucleotides used as primers for the amplification of upstream DNA
sequence, the
coding region sequence and the downstream region of RXA00657 were as follows:
TCGGGTATCCGCGCTACACTTAGA (SEQ ID N0:121);
GGAAACCGGGGCATCGAAACTTA (SEQ ID N0:122).
Corynebacterium glutamicum chromosoriial DNA with an amount of 200ng was
used as a template in a 100p1 reaction volume containing 2,5U Pfu Turbo-
PolymeraseTM
(StratageneTM), and 200p.M dNTP-nucleotides The PCR was performed on a PCR-
CyclerTM (Perkin Ehner 2400TM) using the following temperature/time protocol:
1 cycle: 94 °C: 2 min.;
20 cycle: 94°C : 1 min.;
52°C: 1 min, 72°C: 1.5 min.,
I cycle: 72 °C: 5 min.
Primers were removed from the resulting amplified DNA fragment and the
resulting fragment was cloned into the blunt EcoRV site of pBS KS
(StratageneTM). The
fragment was excised by digestion with the restriction enzymes BamHI/~~hoI and
ligated
79
CA 02571917 2007-O1-08
into a BamHI SaII digested vector pB (SEQ ID N0.:125). The resulting vector is
called
pB RXA00657.
Resulting recombinant vectors can be analyzed using standard techniques
described in e.g., Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular
Cloning: A
Laboratory Manual. 2nd, ed , Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 1989), and can be transferred into
C.
glutamicum using aforementioned techniques.
A Corynebacterium strain (ATCC 13286) was treated for a transformation as
described. Transformation of C. glutamicum can be achieved by protoplast
transformation
(Kastsumata, R. et al. (1984) J. Bacteriol. 159306-311), electroporation
(Liebl, E. et al.
(1989) FEMSMicrobiol. Letters, 53:399-303) and in cases where special vectors
are used,
also by conjugation (as described, e.g., in Schafer, A. et al. (1990) J.
Bacteriol. 172:1663-
1666). It is also possible to transfer the shuttle vectors for C. glutamicum
to E. coli by
preparing plasmid DNA from G glutamicum (using standard methods well-known in
the
art) and transforming it into E. coli. This transformation step can be
performed using
standard methods, but it is advantageous to use an Mcr-deficient E. coli
strain, such as
NM522 (Gough & Murray (1983) J. Mol. Biol. 166:1-19).
Transformation of a bacterial strain such as Corynebacterium glutamicum strain
(ATCC 13286) was performed with a plasmid pB containing the aforementioned DNA
regions of RXA00657 (SEQ ID N0.:6) and in another case with the vector p8 (SEQ
ID
NO.: ) carrying no additional insertion of nucleic acids.
The resulting strains were plated on and isolated from CM-Medium ( 10 g/1
TM
Glucose 2,5 g/1 NaCI, 2,0 g/1 Urea, 10 g/1 Bacto Peptone (DifcoBecton
Dicinson/Sparks USATM), 5 g/1 yeast extract (DifcoBecton Dicinson/Sparks
USATM),
5g/1 meat extract (DifcoBecton DicinsonlSparks USAT"~, 22g/1 Agar (DifcoBecton
Dickinson/Sparks USAT"~ and I5ltg/ml kanamycin sulfate (Serva, Germany) with a
adjusted with NaOH to pH of 6.8.
Strains isolated from the aforementioned agar medium were inoculated in 10 ml
in a 100m1 shake flask containing no baffles in liquid medium containing 100
g/1
sucrose 50g/1 (NH4)ZS04, 2,5 g/1 NaCI, 2,0 g/1 Urea,10 g/1 Bacto Peptone
(Difco/Becton Dickinson/Sparks USA), 5 g/1 yeast extract (DifcoBecton
Dickinson/Sparks USA), 5g/1 meat extract (DifcoBecton Dickinson/Sparks USA),
and
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
25g/1 CaC03 (Riedel de Haen, Germany) . Medium was a adjusted with NaOH to pH
of
6.8. .
Strains were incubated at 30°C for 48h. Supernatants of
incubations were
prepared by centrifugation 20'at 12,000 rpm in an Eppendorf''M
microcentrifuge. Liquid
supernatants were diluted and subjected to amino acid analysis (Standard
methods for
these measurements are outlined in Applied Microbial Physiology, A Practical _
Approach, P.M. Rhodes and P.F. Stanbury, eds., IRL Press, p. 103-129; 131-163;
and
165-192 (ISBN: 0199635773) and references cited therein).
The results are shown in Table 6, below.
Results: Table 6:
Strain ATCC Plasmid pB pB RXA00657
13286 contained
lysin produced 13.5 14.93
Selectivity 0.235 0.25
(mol lysine/
mol consumed
Saccharose)
Eq uivalents
Those of ordinary skill in the art will recognize, or will be able to
ascertain using
no more than routine experimentation, many equivalents to the specific
embodiments of
the invention described herein. Such equivalents are intended to be
encompassed by the
following claims.
81
CA 02571917 2007-O1-08
WO 01!66573 PCT/IB00/02035
m u
~
J
i
~Z TZ ~ Z
- v M
'-
U
~ U
v
_ j ~ '-
Z
~tL Zp cvU V
W
(O J ~ N L1J~ N N
!D ~ llJ C
J IL
Z
~
ZU ~ Q~ ~ ~ ~~ r
tn~.-'r~
UU Z ~ gN~ g Z
:J w_ wg ~
wwQ~
~ Q Z , tiJlL
~
Z
Nt >Z . mOp vU ~ - ~~U V
~~
n>Oa
_ OZ~ D~N". ~~ V~~m ~ pp !1lLtlZ
~ui W
ww >J' a ~
y~ ZZ U w?. U O
y N
ZZ p
~~ z- ~o- wwN c ?r z= gg~
z~HO o~HC Q
u!N Ol,u Q~ Uz toww z
uJotu Xxa-
1-~~ I-J QlIJZW Z DD m
~ 1-Z
r
ZD Z
v, go Qo >-um o 00 m0
~-~-oao g oum-
m'~zzaQ> _~ ,,,~m' 3~ ~~ aQgaov~
_ c9z ~ , UU
UUZ
uy
U u,i>.~[1J[jJ yr u!
_ w aQa V ~a g~ muW--mE-
=a~~ H~~
~-
~waaz'gZ ~Z JJO o ,0 ,um OoC~~aa
Z a m w
a.-
~
'~
~WZUtu JuJ aa~ Z ao ~_~ ~~~a~?.
'zzzoE- af- Q O
~'~ z_,
_,~
-. z w~ _ ., a f- y--
a O >- , ~>-a o
~n o~ 'n"~xo x oo ~~~
O o x
ogx=a~n~ ~
~
UO.c ~
mwZZ~nan. a ~w oaa'- c~ ~ZZ ~
w~ ~ ~ ~ muo p
~~a a
muU_ _U_ m ~ -
Q-.~~ Z Yh-h-~JQQ ~
zzJ _~J OauJN m '-aQ~
Ua
00 rOO I11uI0
c a0-~J~~O ZUO c 1-I-!-m ~ '-Q~~~
Z 10L20 ~ QQ"'~.iUUU~ cu'ni00Zu)ZQ
mm0
gQ ~~~ ~ ~ U~==o or.~j UtU11tU11QQ~J
t~LU~I~ pc~i U
=
t y
aQaa~~U ~l-U IL a'QN~~QQ N ~~~2,
O.U _
QOJJJQ
f~ fn !D O~ cD O~ ~
M c0 M O O ~
O~ a0 O
M h 00
01 ef
M -
t t
E" f0 W "' O D 0 s
O M M '
Y (O M N M
V ~ O~ O
u1
'
Z M Z M M V'M - h M
~(7 N V' ~ (fl
V' ~ 4
N ! M
a
M ~ aD M a00 r O M
V O~ O O n
V
N ~OV~'O V~'~(OD V Ot0 ~
O NN~~c~D
Z N Z ~ N ~I7M M tn
st M M 00 at 10
c0 V' N
~
M h M N DO ~ N 00
f~ I~ 1~ ~ tn ~ ~0
In N ID f0 t0
00 M tD h M O
M O O M
~ M
M
tD aD (O N M N 1~.
N O O V' O
O N 0 N
N 000
0000
C O C 000 O p 000
N N
'O 'O
O O
U U
c O~ c N
H. f~ p M N M 47 N M M
O~ N M M ~ r- e!
O In ~ st ~t1 ~
~ O t 0
O (
tC
I~
~
O
O
O
~
N
I ~ M 0 V O 7 ~ O
V ~O t0 V st N W M c0
N In ~ ~ O f~ M
O~ N O p~ cp
~ CO O M N
M OD M CD
t~ aD
N
O
N O O N N O O N ~
N O ~ O O O Oa O ~
N 00 N O O
~ 000 O 000000
~ 0000
OOOa000
a
~z
O 0O O ~ a V O f0O ~t f0
M N Q f0 N N OD O
O 0D tt N V
N f0
~
f0
0D
~~-e-ew- NN C C- NNN MMMM M V' V' V'
V V lnM~
>. ~ >. a
~
p a '~ p ~
a
r
n
G1 Z G7 Z
e-MOl~ 07 C UQ MInI~O.rMIn 1~O MInI~01
~ N M
~ f
O
O ~ a- ~ d N N M M ~ V'
Qe- - N M st tt 'Q'
- N M ~
~ M 7 N
O U
GPI
.I N J Zln
Z
82
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
m
0
z ~z z z z
~
J UJ ~
- C
U
t N
-
Z J m J V' J J
~
J
z az V >- r
U ~ =r =
=
~
~ U W ~ F llJ
0 f- -
-
~ IL J ~ ~ ~LO
J M
N
~
W W W
't z z
Z Z ~~~~~~ w
~z
w
V ~' N ~- w c!
~ N
01OOMOf~
Z ~ZZ O ~
l
1v
'
'~
'
?
W W- ~-w
~ p v
V
V
~
>'
m O WO p umwwwwWm~O O O
' m =
m tnln(n.
..~.
..r
~
d .
a W E.a.. . O O
~. -~ n. ~
1- ~
u1
l11
!L
u1
uJ
~
O
J Z Z
Z ~ZZ ~ ~ LL= = ~
IL =~
IL
Z
i
z zz z
z ~ ~z z z o~~g g
z ~~r~r
g ~~~~,a~,~,Q opo o ww
a ~Q z~Q' ~ ~ ~ ~
z ~~ z
~~~~~L w
w~ z ~aaQa'' o o a o
~ o ~ ~
~ ~
> mUU d ~
H - pc~(~C7c~ = z z
=
te
Z > ~ ~
=d' r ~
- j ~Qaa
J Q' O~'OOO~ILIIJILIII~
J
U
I_O = ~~r.
O ~~~~ZZZZZ
O ~
O >
a~~ma~
c ~~~OOO~O_O ~ M_~MHM_r~
O L
c J~pZ4~pZ c LU t~ii~(~iiHh=-h=- '~r:~.=~rOJ
f~'-' - t.~-
' HOU Q N N
~ a ~
~ ~
~
a
c U ~ N~~~NN~Nt ~ N U
- l /!
UI ~
U
ti c~i~QQ~aNQ~a ti OU==ZUUUUUW ~~ ~Nwa
n U~
d o
L: (n M
M
~
Iw 01
Z ~ M
N
N
N
M
~~
~
~
Z v
' N (O
N
v
s .~
I- ~ O ~ ONE N M M
I ) ~~M
O
Z ~" O 01 N O
Z D <O O O
M tn V
O re-at
N
V'
O
ll~hi~
NM
_ N
N
h t0
a0
aD
c0
O
N
~
O ~ O O
O
O
O
O
~
O
O
p
C O p O
U ~ U~ >0 ~
00
000
~
~
'
'
~
~
'
~'
C9 (7
U
U
C9
U
C
J
N
a o
o -a a
U C U
p ~j C d
h e- (p O M aO O
M tn O et
aD
O
Id
N
O
(O
O
h
~
O
O
V 07 h
y
M
tl~
01
c ~ tOU UUU ~ ~ _ N O M
~ z z
OMONlhOON
~~
~z
v~
~
a~~~ '~~a~ G a E ~a~~a~~~ ~ ~
~ E ~
a a
ap C1
UZ '~' '
, is
~~ lj 0 Z N
~
~
M
f ( O CA N U~ O>
p Ot 'd'nt
0 c ~.rnntD~a~O~O~f
0
aO ~ O
az .Q aZ
d ~ (O (MO V~ O M
~ ~ t~O e~
l~ (h0 M
O
M
In
h
0
M
1n
h
N
0
Ua h ap ~ O
h
h
h
a
CD
a0
a0
M
Z~
z'~
83
CA 02571917 2007-O1-08
WO 01/66573 PCT/1800/02035
w
z
a
o
z
z
z
z
z
z
Z
z
c~n
~
~
N
~
~
o
g
U
U
U
U
U
U
~
O
-
'
O
O
O
O
O
O
It~
x
O
O
O
O
O
O
~
z
x
x
x
x
x
x
~
u.
W
to
timi
w
tii
O
o
a
a
w
a
a
a
a
z Q U
Q
Q
Q
Q
Q
Q
p
a W
_ _ U
c'i ri
c~i O
C~
(7
C9
C9
C9
O
~
of ri H
of ~
a
~
~
~
~
~
~
~
W '.J~~"'~J~
~~~
'J'
l
~J
J'~
W _
11J.-WW _
_
v
,
~'-OrOrO~O~Or'
liJ
~N[n(n W ~N~'N 00
(n ~N~N~N~'Na
>
diwzz z a,UL awayaw~yi w
aw JOz
z_~uiuw u~v o~,owo~,ow~ z
o~,ow Z~
z~c~nci c~n'~~.~wg~~~~~~~~c~nz
O~UU LU Z
Q
Ur~~~?'~
~
~'~
0
~-w00 Oxm xu t
t
11
~xwxw=w=m>z~0
t~ii~~~~ tu'n~~p=~~
~
=J J ZO
J
~J(nfn J
(n~'J~'J~'JrJ~"JrJZZ~tn
o zro o o z
oxr=rxr~r=rxrwa~o
v o~ww w'~H~xwl-x-why-x-~i~OOaW ~ o
~ I
awoo o~w~~u~w~w~w~w~z ~ a
o
'~
~ v~~aa a~~~~~~~~~~~~aa u.
a u~
p U
~
~ r Z o
M
i
r~ st a
co W
n
C
te
.
r N N M Obl N ~ (OD
~
4~'7
~
Z M ~ N r~ z t~
N
In
e~-
d
s
~ ~ = ,
N N N
'N
~
N
N
o o ~ o
o o ~ ~ ~
~ o
o
o
~
~
~
~
~
( C C
7 7 7
m
a
p ~ o
a
p N ~ ~ ~ O
O ~ (~
N ~
c~ ~
t~
M
GO
CU
b
'd'
In
b
b
N M
M b ~ N
O N
N
~
N
N
M
N
O
(O
N
0
000 ooooaoo m 'FNo
s
O +r :o
O
oz C7 ~ z
~ O ~ ~
O N
~
O ~ ~ p
W ~
~ r
r
~W
a N a (O
fn
VD
~
U ~ ~ p O
D t~ M ~ W
' b N ~
- I~ e-
O
r-
c0
O
t~
O
O
O
~ 07 ~ ~
w O) ~
V) ~
r
r
~-
~ in z v~
z
~n
84
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
v N o
~;v ~. ~ p a
ad O v a
c a~
W
~.W ..
> U ~ ~ C 'r
~
H ~
,Q. N
~ ~"' Ar
.p
o "~ . af"p4
V ~~
v~,
.y" W ~ aU.~ .N b
a: d U
~" i~
~
N' c0 H cd p
a~ ~' O
C N
~', ~ ~ ~ .fly/
~
O. .~, ~ U Op
~ ~ N ~ ~O
ai 'C Cy~
s. ~ '
~"r
~
, ~ 'O O s,..,~
p C C y
4" cG
b ~
OD
d0 y .r,C.'
of .U O
L: .Y
G
bbDa~ Np F~.'~Q cC~O
O C
'U ~ ~ G V O
U ~ v >
AO
o N a ~ n~w
a ".~ o
a~ w ~ a ~7 .C
~ ~1 ~ b
M .Y
''"'
0o o a " a~ ...
d ~ o,
O ~ O .~ ~ s-
~"' ~ d ~ O_
A
~
a " G.'.
- U y~ U w .
d ,~, a ~ O N U
N ~
p~
~ p M tct
h .
o
- ;n p U Bc 0
~o '',:y ~~ V o_
~'
~oQW ~.a~ ~~~. a~ ~~~
~z
N t: Y ~ O ~ cC ~
wA fi
W U '" ~ ~-'y
h O ~ C
C~1 N
CG U W'
~
f ~ ~ b C ~ v
' p, D N ~ ~ W
M p
. ~. O
- a)
~
~; x
o ~ v .~ a
o '~
~
U
w .~ a~ p w ~
. ~ ~ O "
a U 4i ~.,
~ "' ~
~ ~ O ... O c .
r~ U ,' x~~ O ~.
aa~~~ ~~~ 3w a-.
V
xb~
w
b
p
>a .t" U N N
.
~
o ~ ~ w
~ ' a
'
~ . ~
'~ ~ ~ '~
a
> y ~ o~ ~ ~~ a~ ~ ~'o
id
y,.,'~ N N N
,..,..
~I '.af'' y ~'~" ~ a ~ ~
~ ~ ~
y N . , U c~
~ H
b ~~ ~ ~
~
o .~ o ~.. ~
~1~.t"r r ~U '~"~ ~ ~O ~p
~
.. U U ..
as o. o ~x . . a~ ,
>,
y ~ t, ~ bD ~ ON N is a U~
~ ~ 'CT
a, H A~ ~~ ~x x zb c~~d o
~
W
A
z ~ ~ ~ ~
b
d ~ ~ ~ ~ a ~ V ~ i w
p ~a a. o~o ~onoo
C7 " ~ ~ v ~~ w w ~ ~~ ~
p '
. b o ~s ~ eu
..
N o
z
N r~ O .-.~t~o0 et_~t_v~N h hO o_0
~ O M h ~ ~ ~ ON
VJ M Oi .~ ~' V M I~t~ N ~ VV h
h t'~1 M h '1 a0OM V' V1t'~l~ v1 v1'1
O h I~ O ~' 00 ~ NN N NN N O O OO cn
h 00 ~' cnM
00 00
00
h v1
v1 h
v1
h h h O O O O OO O OO O O O OO O
h h
~ ~r pq as pqorsvao0 oaas w w w
t7dd ~r ~ ~ d d dd d ad d d d ~~ d
v
ddd
d
d d
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
.,:
°' .
M
r' U
N
C ~U G. a
U O ~ U
0~1
Op v O ~~ ~ O U
N .~ Op 0.
~°~..° ~~ aoo
.°.'. cn co a
a
~ .. d O
O ..,
U o >, ~
U x .,
'~ o ..~ w .~ 'a ::
w, .mo ~'
° o ~ ~ o
'b ~ o cu v
r~. v
E-~ ~ o A v ~ '~ v
~p~r ~ °Y'W
°~
N ' ~ ~, ~ n
V ~.' ~ '~ t~ ~ 'a ~ ~
~ 00 ~ ',Z b4'C~ Ov
ice., ~ ~ ~ p~
d ~' Ix...U~ ~U~M
P~. 3 3 a: ~ U ~1 .°~ o'
0
o b
°~-~' ::
c o ~ o'
b~ tea. ~ , ° i ~ ~ ~ o 0
~" ~ Yz~. :~ ~ ~ ~h~ w
O N tti ~ O N' O d ~ O ~ .~ '~ N ~ ~ ~ U
i.W 1~ ~ ~ N ~ ~ ~ H ~ p' ,~ ~' ~ ~ '~ U
O c'~0 X ~ ~ b ~ .~ t~0 T ~ ~ ~ 4N ~ ~ ~ .o ~ ~ ~ awG ~ b .C .~
N ~ "fl ~ .~ N O ~V ~ ~ ~ p V V O.;D ~D O. ~ :D -G ~ N
% % ~' 'n y, 4. O '~ o' p ~ N ~ a..
f~, 'o ~3 b 0 ° °' ° ~ .~ ,~ 0 0 o A .~ ° °
~ ~ o _~ o 0
b o c~ o.~°'o~o~ 'o~o~~'~' ~.5.~ o ~~ o ~ ~ .~ o o c a°~
c~ Mo.A ~.o. .~~z o ~ ~ ~ wd~. o..~x Ac~w ~..~ ~a
~:.; cz" x
a a ~Qac~A_ i~ acid ~ oaxw d a
°' o ?, ° oo eau oo .c v~ ~ o ~ v~ o
C7 ~ n. -o ~ .~ ~ ~ ~ ~ ~ :~ :a ~ :d :.c c ~ a.
0
z
vo 0o n o, ~o ~o m .-. ao er c~~ et
f; ~ fn ~ .r7 c~1 01 O~ O_ ~_O ~ V1 l~ v1 O M 00
~D 0~0 0~0 .~-Wj 0N0 Ov O O ~ N Cn O ~D ~ ~D
C~ O O O O O O O O O O O O O O
86
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
an _~
~'
o
a
C ~ a~'J. ~ N U ~
p ~ O~
C (U0 _ ~
.~ ~
ct1
00
~
7. ~ ~ a, y o ~
~ ~ v
'
N C
O~p ~~ '
. ~
N~ ~ OpN '~O,
w V ~ ~ U ' J~ p
.C"' ~ O ~ M
. O M
2i a o w O ~ ,
o .. O U p ~n
~ ~ t~
;d
T fn ~ dp O .i. ~
3 cOu ~ ~
p. -~
, v
, o OJl ~ it N
O ~ O td
N
O r.
0' NC ~N N~~ ~ .-i
'V~ V
.N~ 1
p ~ V ~N _ _ 00
, ~ r' U U
. O ~
C N O~ n
N
~
I1 ~ ~ , , ~
G' V U N U ~O
C ~ ~~ M
C) 'i
n
~N'~0 ~~ 0~ U Va)~,~0
7c
c
~ ~ ~ o ~ ~ ~ w
v v M
~
~ o N O
, ~
V O p G V N ~ ,,O'",,
~ U M C ..O ~"
~ m .
Gr ~ C ~. .b 'O N
00 ~ M O ~ ..
~. v p)
b0 p j.," cCO c0 _
y 3 V b ~ N
~" O~ N ~ U ~".'
,"
r.' ~ _
N 'i7
~ ~
~1 Y ~~ H
~ ~ ~ ~' ~ 17
0 U ~ d ~
~O ~
~ d a~"~7 ~ y ~ U
C1 a a.. ~ ~
U 1. M . ~ ~
C C 'D '~ .~
p
a
~tO~ICL~~ bD~.D p~0 OUp,~bD
~ ~ O ~ ~
~
y C (~ O O ~ N
L' Y1 b 7. y O
~ . ~ V ~ ~
~ ~' y ~ ~
, c 'j d
~
!o ~ ~
.
..
O V ~ _. _~ .,.~,~
U , .4. N U ~ a-U
W N C/1 ~ G3.
a~
~. o c~ y a~
y a3~ ~ ~ (~
~ ~~~ W Ho
~~ a~
~ O a
O
p ~ w y ~ ~
G '.: "~ v
O x m U O 'n C p U
O. ~ a ' ' O O
~ ~ v ~ ~ ~
' a U
~
w ,u ~ ~ N ,
a~ . ~
~ m ,,,
~
y .. N ~ O :~ U N
tY a. .-d. ~ O (E O
r k.,'~ ~ s~ ~ O
w ~ 3 - E
o on
' w
, . .
0 .
.~
>
~, 3
;~
.o .~ '
p ~ ~n
ai
~
U U Y o tarN
~ ~; ...Uw
.5 .S
~"'
a~ a~ .~ ~ ~ w c.~
..: ~
m ,.~'
~ C
C N U O , ~ ~., c .b 00
O, ~n G. 0
N ."
~ f
V ~ '~ T ~ . ~ M
,SC .
~,
cNC 09 y 3 O b Ur-G N
U R
O
N cd . . a i< '~ C
ai ~ i by a~
'~ r ~ .~
'~ 'D ~
O
O
V . ~ 7 ~7 ;~ ~ a~
~ ~ ~
t ~
~
Ci fn y~-y O O ~ ,~ ~ "~,~~O~" OD
fn a. ~ T1 -. O O U
a.. y..,
(3,
~ Q. Q. O .~
CL O C
v
V '~ ( w ~ U ~ ~
p ~ C O b' O N .C~ .C
~ a~ v p U C ~
~ O 'm
.'.' ."
o . O ~ O t"' ~ ~ i.''b O
C. ' N ~ ~
~
' ~'~v~~ N~ ~a ~ ~~,~ ~ ~ x H
N~~~
y . . 'O
O ~
b ,. ~ d .~ ~ -C
.C~C ~ ~ ~ ~
.CU ~ r ~
~ X
C7 M . E a H P, a U ~ Z a. E-
~a V :.r ~s a~
b o
v o
b E''
o A
o
+r S
~ ''~ ~
m
0 0
o ~ ~ a p ~' ~'Q' b o
~ o ~
C7 ~ ~ ~ ~ ~ , ~ ~ ~ C o
c. a~ b o. ~u .
~
z
n
0 ~ ~ M M M ~ ~Od' 4lO
~ N N ~ ~ O O ~ N N m ~
p c c
a ~ 0 n ~ N n
:
a~ w w w 0 0 , '
c~~ '~ a a a a ~ a a ~ Q , Q A
a a
s7
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
a
a
N
; ~ ~ N o:
'
>; > ~ ,.., w
o~ wQ Q o
F ~ N N U ~ ~.L, i-:i-:p
w w O ~ d'
v ai of' ~~" ~ p ~ N ' ~ ~ ~
~ O O ~ N
,~, ' ~
' L1 d U ~ ~ '.~.t~C~ ~ ai
O U U C G a O O 1 +r v~
' ' M
N
M N O D ' ~ .~ ~ ( Q" ~ O
~i , O ~ M M O , ~
U M ~
V O ~ O O 0 ~ O~ T'-.a ~' ~ 'a~
l~ O U U 00 01 '
U O c
O f3.0~
O ~ m C ~ U d .b .~ z z p 'b
~ b p pOp~ ~
~ . .
'
~ ~7 .a w ci. ~ v U ~,:A f~ y o
. . a. -' N ~ ~
~ ~ '
~ a ~ ~ ~ ' ~
~
u ~ ~ ~ ~ '~ c G
~ ~ ~ ~ ~
.
5 ~ ~ y a~ oon ~ ~ ~ o
o o i i
i i
O . O ~ ' ~ ~ ~ ~ _
C d ~ ~
O ~ H ,~ ~ O O
O ~ ' 0 '
b '~
0
U N ~ ~ ~ . O
M ~ ~ fr
O L -!
.--nU
Y
U x ~ O ~ 0 0 LL O t. r
R X 0 0 n
y ~3 a:. 'h-. Q
-. .~ . . +, .
O a a ~ U ~ ~ t~. p c'~~ A.
'' a 7 ~ ~ .~ p O
,-~ . - ~ C O ~ C Y ~n ,.-~
~ ' N N ~ " a H y o
. N ~ . :
00 N j
00 ~
O N N p ' t d ~ w O U
00 by O C OD U '
M M ' b p
p
~
i
~ p O O -~ 4 G f. C ~.'
G F'" ~ G !'3 cW C
~ ~
t O 0 O . ~ b ~' ~ ~ ~ a
U ~ ~ '~ "
C ~ ~ '
N
U v U c ~ a 'b p O~ N U z
0 ' 1: Vp ~L' z
f3 ~
~ ~
Dp O O . . s ~ UM M M M
o b b . ., z m ~ A o o ~ Ca
p ~ ~ G . p ~ a~ o ~ ~ ~ o,
O O a. Q, (~ a> > 21 ~
~ ~ o o w w w
o. av
'." O
"'
~ N O ~ ~ p v ~ ~ U O O
~ ~ '~ N 0 w O O M N
' ~ C
~ p
C; P" P' C t". '~ . C O . ~ ~
~ W ~ ~ ~ b c 7 ~ U
. . t
, . v CL CL c C7 C~ ...,. . M r
a.. ~ O E ..., ,..,0 i i ~ ~ M . ".
. O O O ~, - ~ O O O O
U 'r ''% d ~
.p E
~ a. ~'N~..
y ~~ ~N ~~~ ~ ~ Y r ~~ M M ,._,
~~ N ~ ~ ' ' Ya
P, , ' U U d a a ~a ~
~ ~ N O~ PC PG
w N N
~
'~ N N y ai ~ C C O o0 0o z W
w O ,~ Y ~ O
a~ ~ ~,
O
~
U ~ ~ ~ ~ ~ ~
p p T O
~ ~
O t ~ t , . r N N to ~ ~ u1 V O
d N 0 ~ .n N aj ,.fl~ ~ l~ 00
~ N ~ ~ ~ N
F' ' O
" ~
'
.O ~ M I P. ~ O . 'n m , ~~ O
X M N t~. ~ ~ ~ ~ O~ p M M
b p O ip ca m
? N ~ ~ ~ '~
~ ~ oo op
O
4.r ~ fN..sN.. a.. '~ ,..,C r" ~ ,~ ~ 01 Op
a~ sU..pip pip ._ . i..H v~ '.'.'G~ Ov o G,
N ~ ca ~ ~ . ~ s ~ ~ ~ a, a
~, ' ca o o o. a. o,
' o ~ ~
,.., ,-.
x ~~o x~' x~' ~ ~ x:~xb.- x~~ x~ x..x~ ~..w..
~~ ~
U ~ V C
.~..f~/1 ~H
p
l~
~
~ p p
p O ~.~.
.l=
ui p a~ O
O ~ b4
0 '
op O p ~. b a~ c~
~ ..
b O U ~ ~ 'rd
z
~ ~ ~
o ~ ''
p
b w o ~ o ~ ~ ~
.~ ~ b b b
.
o ~ .~ .~ ~ x
a .~~ ~ ~ p ~ ~ ~
~, . ~ ~ p
G.b ~ ~ ~ ~ a b 'v C.
w o o n. ~ o o ~ ~ o o I?
~
C7 c5 x ~ H ~ ~ PO A' Ca w .~ ~ a. a
;x ~
.
v
z
c~
p
0
z
a
o
_
O 00 ~'' ~ ~ M d' O ~ ~ O~OO
~ V V l M M G~ ~ O M M M ~h
r 1 i ~ '
M M M
' ~!' .., .-r.~.--r .-. M ~t tt ~t ~ et V v1
"
v
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
a
Q Q a o~ o~ _
°' ~ o 0
H N N N ~ O~O o~0 ~ b N b N U U
~n~HEEN~tNO~cOC~
.O O 000 ~~'-'~'-' O L1_C
'Vb.~ O 0,.~~~~ ~ ~~,'sU..Q ~ O C
. . p~ O~ O~
U ~ O
N ~ ~ ~ ~ ~ ~ ~D ~ ~ ~ O
_ 'U ~i-~ i.~ M
O m C O N O N O V y
~~44:44: A~aU.~,.U, ~~~~~ ~~aU.~O
b j, ..D ~ O i3. D. 4 ~~ ~ ~' ~ H' 'v q ~ .-,
O M O M fn O O 'O ~ ~ ~ N d ~, Q~ ~ ~ ,O O d
'G .~ c ~ ~ 6 ~ ~ ;r ~ ;r o ~ ~ ~~a
O .~ .~ ~ b0 OUD by ~ ~ b ~ b ~
pp O A ~ ~ ~ ~ U M N N N pp G~ V fY0 V tYC ~ G 7 M
g.-, cn.-..~ ~ ~ d°' o ~ ~ ~'°w~w~ o ~ .~~°n
b G *' a~ a~ an ~ ~ ~ ~ ~~ ~t o ~ o ~ i N ~~ ov
o yd Q °'~ .~ ~., .o ~., c ~ ~e :x :x a. ~ ?? ~ a~ a U v o ~r =
V O ~ ~,'~ y"~ 'D N O O O -V O~ ~ O p O t0 01 w OV U
Q a a
Z ~ d' ~ ~ ~ w N w ' w ... a, a. o, .t'~.' ~'' c~
4~Z~Q °N oN od N ~ ~ c. v O.-. bo'v
N M O .-, C . tC cG cC :..: ~a:. i~ O .r C ~ a O
~ M A M Z c. o "~ o. "_' .-Q.' r''~ Y Y d o Q o Q o v o °'.
QA
[7 ~ ~ ~ b .=~ b .~ ~ M '~' ~ ~ ~ ~ O ~ ~ G A ~ A M
~~ ,...., O pp O pp .f, a.r ~ .,r ~ ~O h
_~ C~ Z" 00 s"' 00 U M " ~ .. y N N N N O ~ O t0
~ ~ ~_. d ~ ~ ~ ~ ~ ~ i~ of is ~ i,~,. ~ O O O ~ n N v~ y
j °' ~ ~ N co M ~ M ~ ~ i N y ~ ~ C7 ~ U .:. C) ~N, ~ ~ U
T N ~ ~ ate.. N . '~ . '~ ~ ~ ~ ~ x ,L
., . icf i-~ ~ ~ ~ N ~ iV ~ ic7 ~ iV at N
Y C. 4a . La . Y r
N H ~ H ~ a~ :: ~ ~ 0 ~ o ~ z o a~ ~ a~ ~ a~ ~ a~ ~ ~ w
w .n .n ..a .n °' ~ ~ ~ ,o~,, .~ ~ 'oo c 'co 0 on o ~ o o ~ o ~ ~a ~ y
,,oo, ~
a~ ~a o 0 0 0 ~ ~ ~ ~, o r, a M a M o w ~ ~, ~ a~ c ~ ~' ~ '~ o
fli W o A4 ca ~ ~ a4 ti. x' tz. ... O W o W o v1 0 ~ u. W w v1 w .., P. d w x
o
a~
x
°' = ~ C ~ ~o
a~ .~ ø. ~ a .
b
i o ~ ~ a w ~ o
a. a. ~ a 'd o
°Y' v ~ .n ~, °' °' ~ o
-d .,
b ~ ~ o :b
C~1 ,~ ~ r., 'U .Y ..1G 'j," U ~-' O
O ~ _.-. ~ ~ N cV O O rp
U U U R. ~' N ~ t~C U 7, '~~-. O
~t~. ~ m ~ p ~ O. t3. '~ '~ p ~ u.
O 'b N ~ i" Li ~ t~C ~"' ~r W
F~" o .~ ~~ ~ ~ .c ° ~ ~
p'~ ~~,o~c~o:~ i crab °
G7 ,.t'~- ~ ~"' ~ O v .Nn. O ~ ~~ y U E'
c~ A A ~ a, ~ a a ~ ~ a ~, a w ~
a
z
G1 U U
H H
O
z
xo
~~ N v0 O~ O .-. ~O h ~O t~ ~-~ l~ oo O~ O ~-~ N N ~t M
t~ l~ ~-~ ~~ ~ N N N O t~ t~ t~ oo ao 0o M M d
~ .-n .--n rr 00 00 00 l~ .-m--n .-r ..r N .-~ N N
V O O O O O O O O O O O O O O O O O O O
G7~w w w w w w w w w w w wwwwww w w
89
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
w a~
~ a '~
vm U ~ Y p ~ G O ~ r ~ h
a
vv
. .w ~ y Y V ~ Y
O ~
~ '.'C1~w P-s Y ' ~
p P
y ! 3. ~ N a y E., ~
M M 1 ~ .-
. .
-
~ ~ z ~o ~ ~
~ -
' N ~ ~ A
y v ~ a ~ ~ .~x
~ a~
. ~.
o ~ ~ T ~o
~
.
~
o ~ A ~ ~ ~ ~ ~ _ a~ .
( ~ ,err, ~ ~ e~
. O
c 4~,,~ b0 b0 y ~ .. J3 ~ ~ L. .,, w N
O ~ ~ ., p~ y ~ U
',~ ~
c. U 'ra'~ N i~ id .icecue.~ ~ v O V
~ O O O , . N ~ Cf
O .
O O A" U U U U U O ~ U
~ ~ a : w~ w w~ ~ Q
0
v 1 U w , _ ~, O C
U ~ O ~
..-.~
O ~ N ~ ca c~
~ ~ ~
A.
~O
O N i v m v t
O
C C ~ in n ~ ~ ~ ~ y ~
. N _ p O p R O ~ O a p,
~ M -
p O
C
~
R by ~ ~ a' ~ o
O O ~ G, v N ~ '~
.~ r..p, ~ ~
~n ' v
as
v ...~ -7 y ~ ~ ~ ~ p ~o a> ~
. ~ - N ~ ~
> ~ . . ~
~
a o o o ~ ~ ~ ~ ~ .~~. ~ x.
p po
. ~a0U U O O O O O ~~'C p Cz
N 00 yN
~~ ~ ~ ~~ .~. N>
~
a.:U~ N.~"C~~..),,.~"''V p O O O O N~ ~~p..NN'i
-
~ U U
~ ~ .O b V U U h [~ ~ ~ p4 U
H O r. f~ l~ " Y ~
l'
I~ ~r ~i ~i ~ w .~..n~ ~ \ U U y. ~
~ ~ ~ ~ ~ ~ ~ w ~ ~O y
.
~ ~ O y ~
O ~
z z~ z~ .
\ \ \ \ \
~~ ~ ~ o o o o o : : % o
~ ~
p o~ A Q a Q ~ a , ,
.
~ a .a ~.a.a -.a
~ , ~ ~ ~ ~~ x
~..
fl ~Pry~ y~ x ~N NN NN ~N NN N U '~MOC
y ~,. , ' 0 0 0 0 0
,. ~o ~o ~o ~o ~ ..: ' .:
do ~ o w
~ ~~~'
y >.w~o b .~oTw d'W e"~ar~~iWa"~>'~a~w ~,j
. C~ i U O Q ~ ~
-
L U a. .' . O ~, ~, ~ ~ ~, .~CV
U y~ ~ O\ 01 .~,>~ . b N
cH ~ ~ b b .~ N t, s. r..'..'+~.IN y
Y .n N ~ ~ ~ U >,
O~
'..a ~ ~b ' ~~ ~~"~~ ~~ ~~ 1~ ~bv U .~,
v ~ "o "' oD~
o
~r ~ ~. a. ~. ~
,
i1 a,
cC t ~ N U c
~' !
U
N ,.,( ~ N a c
~ O .. b4
U
N t t_t7 O C ~-~
.. H
N
W ' U O '~ H. U
~ U
O
~
~
U c L' y N ~ ~ N
V
b ~ ~ ~ .b . b ~
t b a~ f,'
C C
'c7~ U cU0 ~ U' ~ r fWn
.~
U ~ O ~ U + ~ , 'b
N ~ a. O TJ
~ ~ :D
~ ~ _ ~ " t0
~ . t~ a!
c~
O
O U ~ ~ O ~., ~ ?.>a>>
~ .~
U U y x . V N V .ti~ 4.
N . . N
" b , O
" ~ a~ . 'a.~ o, ' ,~ O
O
.n T3 v o a
O ~ ~ ~ ~ O
N O
O
~ >> ~ .rJ'N 7, ~ U y
.
U" 1 A V ~ a ~1 ~ A c7 E-~ M a
~ A a
a
p4 a ~ 1 .
U
a~ >
z
~
~ . 0
0
7 U >
C ~-. W .=.
0
z
x~
ao
M
Vi ~p O~ O ...~~' O l~ O M ~ 00 M N
O1
00
'~t~i'O O ~ 1D ~O t~ l~ h O O M
V1 ~ ~ ~ ~ v t0 N
V1
v ~D ~D O~ O~ v1 I~ l~ l t l O 1 t~ O~
00 t~ N N N N M ~
I~
N
o0 00 0o N N
N
C7~ w w w w w www w w w w w a ,- a
a
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
6
$~ ~ ~ ~°o ~~ o°°, wCj wC7 °~' d
_.-.vc o" o" ~[~
0 0~o .d ~ c~ ~ ~ Y N ~, ~ ~ c
60 ~: ~ O ' w 0 ~ O O~ O a..
v.c00 .y ;.a ~ .~G N C w O tip .t~ .OA.~.. .N .rte ~ O N
y O I' N ''' O 'S' y ~ N O~ O ~ a.. f. ar yy O C.'
Y i~. l~ O ~p0.. UI"-. U ~j ~ ~ .~" ~..' ~° U O cUG O c~ a-~. U
o ''~ °° o Ty ,-, °' g y°o ~,~ ° a ~ ~ a
ion a goo ~ ~ C+7 a
a
~ °' ~a ~. o°n o ~ o .o ~ ~ ": ~ .. a ~ a ~
.. ow
d~. pp'O ,n ~ ..p ~ O U ~ ~ ~ N ~ ~ v ~ ~ O v O Cv q c
.C N ~ N ~t ~ ~ ~ U N ~ Ov O "r ~ t~ p, P. p G V v "00..p N
o o ~ o .~ o .b ~ o
~ ~ m ~" O ~ ~ ~ N ~ ~ ~ ~ a) ~ cU0 cUC ~ G N ~ ',,~2
a~~'~yN~O~ at~ aR.~i ~~'~ O~ OU Nbp~''O-..'C
O. W '~ C ~, ~" .~ ~ p ~ A ~ ~ ~ ai O o 4'~.. ~ .~~. w ~ ~ N ~3
~ pp itt ~ ~ '~ ~ ~ bU C _~ pp O O ~c~ O
p p ~ a~ m ~ .~ .~ C w ~ ~ N '~ ~ ~ ~ 0 ,~ CO .~ v G ~N'' ~y
U 'm ~Y ~ b ~ ~ ~ ~ R '~ ~ l~ r,0, a cG ~O 'V (~ U Qi 4; Gl ~ ~
'O eR' O c~ ~ cW ~ ~ "" p ci .a ~ N
'° xC7 ~ ~~
O V ~ ~" U O ~ N ~ ~ y ~ N c00 N
v m G o ~ ~~ ~ ....
v _a~ ~ .~ ~ .~o W _ ~ >, ~ o ~ o U ,ap r_~ ~
NO°~Op~~~ ~~~iCb.OP.~~ ~h~'.'~U~hV'~U(~O
~ ar "rye a' p ~" O _~ ~ U ~ ~ ~ ~ ~ N ~ V ' .O M
w e°~ o ~ W '° V M " '~ °' ~ ~ H ~ a~ ~ i~ . ~ m . ~ o a
;°
a a ~ ~ ~ ~ °' ~ N ~ ~ Q ~ ~ ~ ~ x o. i ;r °o ~ ' °o ~ ~
~ ° v o
y Q o ~ io ~ v ~ .N ;° ~ ~ ~' °~,' ~ ° a ~. ~ x
c°a N x c°a N ~ o ~ U a .
y ~ O ~ ~ p~ p G 'd ~ O T ~00D ~ V p O ~ '~ cpC ~ CV ~ w N ~ ~ ~ p ~ U
P; w a. ~ ~ on ~ .a ~ ~ ~°~' U i O ~ .~° w U w w v) W ~n v~
pCi ~n O w o0 P;
U
N
C b O O
N
b0 O ~ ~ O
V't M V O
w~G~,w ~~~X~ ~N y
o ~ .~ ~ o on
W o ~ +°: Y . i . ~ ~ °. ~°c
m a. o. °~' > ~ '~ ,~ ~ °" w
-o '~ n. °' o v~
A w ~ F~~ a~.~
U" ~ a. ~
as
a
G5 ~ ~ v~
0
x~
0
d' V1 M 'd' OWD
r N N ~ O ~ h ~ ~ ~ O
pp ...v ~ I~ Ov
M_ ~_O ~_D ~_D V1 Y1
d V 00 l\ ~ a ra
C5 Q ~..~ .-N7 a
91
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
w ~ .~ ~ ~ o~'n ~ U
U ~ °' ce .-. w. o bn U ~ . v
'° [~ w °~,' ° °' w' o, o o °
a~ ~ p ~ ~ ° ~~ ~ o o ~' 'y °~ ~ ~ o a~ a a~ o
,.d O ~ ° v G V C D .~ ~ ~ .~ 'y
p v C .C ~ ~ O ~ N .. .~ ~O :: 0 4; O d
N ~ ~ ..D O 4~. ~: ~ _O .~ W 'c~ C ø' CS ø' CS t3. b
~~: a~ '~ ~ ~ ~N Op +~' ~"C., ~ N ~ ~ W ~ ~7 ~ W
as °°~v.~ ~.° ° off a °°.~a~~'
b ~ ~ o ~ ~ ~ ai A
,.c M a~ v ~ ~ ~ ~ ~. ~ ~ :; a4 .~ en . . °° Q on a o4 ~
~n.a a ~Q ~ ~ a .~~. o °.r' on Ti o ~ .~ vW o~, ~ o ~ o ~ o
'n 'b o, ~ ... > _°' A ° a ~ o o :-: '~ a. y a. y n.
a. &,~ ° c ~ ~ ~ N,J
'a _~ ~~ O v V OA W F,.. O O ~'' ~ 01 ~' M V ~~~... U ~ U y
~ ~'E"ow ~ ~ A. U~~vV.~~cN ~ ° a ° ~ °
°°>::~M bD~~Q' ..N~ ~ a0.. ~O.
V1 ~ N ~ fn
U O v ~ O~ V ~_ V ~ ~ i0 ~ ° ~ ~ ~ (] ° ~ O CL O d
T
.fl ~ N ~ v H Wit' ~ y ~ v f"' ~ ~ . ~ .~ Gy pp ; y .O ~ .O ~ .O
N H~ ~ ~~a~y~., ~ ~~ r~.,~ ~'G a0..'~M V ~' a"~'-. V 1.~. f~-n
v N 'rte'. N ~ ~ O O N r.a '~F' ~=, ~ ~ ~ ~ ,.~~. I_',~., .T.~.' ~ G ~ C
o ° ~ ° oo ~ .,: .~ U ~' ° ° oo ° ~ M ~ ~ ~
° o ~, ° o ~ C o
° ~ .~ o ~,,., ~- ~ ' U N - a ~ a
v ~ °' ~ ~ ~ v V 'code -°: .a ,~ ~ U ~ ° ~." a c~
Ov ~ ~ a ov
V ~ p M ~ . ~. ~ ~ ~ b0 N ~ ~ r-~ cC O ~ .~i .."! ~N V . (~O ~ . l~'O
t~ .b .~ tC _f3. " i:. U ~ '~~' y~y r-. N > .,,d, L: V ~ Q' ~ ~ ~ _N i0 Q'
..N~
a N ~c ~ ~ ~ ~ ~ 'd '~ ~; m~ ~ a ~ 'd ~ ~ W °' y ~ °' ~ ~
°' ~~
o ~..; ;~ Vy ~ ~, Gj ° o ~ ~ ~ ~ ~ ~ ~ ~ '~ ~ v~ rte. .. vi x~- ~.
it 7.: U ~ ~ 3 U .~. ~", ~r.. ~r~~ ~ F: ~ W N N .. .O. ~ C ~ V_1 ~ C .-~'.
~_, ~". y V1 O CS .b ~, N ,~ ~ (~ ~' :y c0 Vi M ~ ~, ~O
y ° a3 ~ ° t~ AO O O y ~ ~ av p y U N M '° ° N O
o0 O I~ O
rx x ~~x?~~U u.xx E"oUA~~.- ~Ub a~~-. :~~~:r,.-.
b
'V O
O ~ ~ O
FO. O
a~ ~ .'ra' 4a; ~ O
~ O of
G" . 0. ~ a
V ~ o ,~ ~ O. ~ ~d
~°~ ~~.. '.~ ~ ~. ~ ~ ~ O ~O (NO r°..
O .C ~ ~L V N ~ .~G .~
CL n
C ',.°"~ ~ N ~'
,~.., ,f"" N y.r t. .O V O O
n °° ~..a~, ~ 3 °~~' w ~ °~' ~ ~ "on .a
f~ a v' ~ °° '_" '~' ~ ° '' .~ ,~ n. on
y U °' ~ ~~ ~ ~, ~ ~ Wo
a~ ~n u: a. x
U' N m a a Q a; ~ ~ ~ ,.~ ~.° ~o
3
°' '' ~ a
z ~ ~° o
a C1 A ~ a ,~ U
U O
UU H t1. p, O
~z
o _
a%pOOM ~ VN'N ~NNth
h h ~ N ~ M ~_ ..N.,
92
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
' a
' on o o w o
.
b 'L~ U iC G ~ tNn n
G ~
.~,Y N~ ~~ W V~~ cOG3U
~ ~ ~ O ~ ",~ N ~i Ov
V ~H ~~., p
~ ~ ~'
U ca .,: ~ ~ a o' a .-n
on ~ ~ v a '~ N N
~..' s-, V ~ pv
7, ~ O :O ~ N y y N
~ .~ G ~ L1 pp m ~ C
. ~ .~ ~ cNV
~
:O~ ~~C; ~ .N ON~,bv N~
G
cV U C p ~ ~ ~ O ~ W
~ ~ CS ~ O
~ .~ ~ .~ y y tp
W . X y' ~ .-
a o w
oo, ~ " U . p oo
~ a ~o ~
~
(n ~ ~ a . p Op
.~ ' w H Ci a
O 00 4., x
'd:
pa'~Can~ o ~ ~~ ~ ~~ a~~ Q
ny p. ~~~
o
OON ~ ~v ~ G~ ~ p~ ptd-C ~
~
i ~ p 'd ~ . 00 .~y
~ c0 C .p ~ C M ~
~ Op N f3.
~ O ~ ~ ~U
V 'b Q H U ~p ~
- ~ R. ~ O ~ ~; O ~
~ ~
W ~ N G ~ Q. _~ .. y..,
N 'C a O M .~
l~ ~
bD bQ N O O a n F. N
~ V :v ~ O ~" d
6 rn .~' .c a w N
a ~ ~ o n ' ~ ~: a
P7 ' W. ~ ~ ~ x
~ ~ o
. id o V p U ~
O ~" '~ V . r. .~
~ '~ p C o . N
~~ o 0.,~
~ N ~
~ ..:
O~
~ U r..
" ~
~
p
' O- ~O n NN~ G4
" ( ~ ~ ~
~ C v
.
~~~
G~ e vwo .~ y~d~,~ -U
C ~v n.-, o y C7 GZ. it7
O ~ C. ~ N C N
' ~ p O a: ~
~ O~ ~
~
'
.'r.9v..OQ' cy, U~r""C p p d~,~
L O z
. .~
E. U U ~ o ~ ~ C~ x o ~
p ~ ~ U ~ o ~ ~ o
~ ' ~ ~
, . . .
a .-n , n
" - v ~ '~ ~
~ ~.
~, ~ . b ' o ~ ci
~ ' . ~ ~ ~
~ O ~
iCN.pax..N ~~,,~ ~~N ~'.- '~."v~NO
iO ~~~ 0 .~
~
p ~ a~ ~ (~ ~? n ~ V1
.p ~ ~ ~ p., ~
~ : ~ p
~''
v ~ ~ N ,'~., ~ ~ cv0 ~ v ~
~p U V' :fl ~ p ~ ~ ~ cpG
.x O C ~ ~
FI . of 3 , .~ .a ' _ N
~ ~ v y N p t. ~
V N ~ ~ ~
~p . '
a~ t0
H
y .~ L F: py G4~C~H .b~ e
N ~~ v ,. i N C~
~' ~ ~ ~ ~
~ ~ ~
..Y," C G
G7 ~ OD b0 ~ t ~ O k ~ O~
C" O ~m N N O ~ O
p ~ ~ ~ ~ p
Ol ttf
w ~ '~ ~ ~ Cn O ~ fn P~l
~ o. i'. ~ ao W U a~ U U
U ~C -- -~ C~ s ~s U
a~
N
H
'
_' W
N ~ a
p ~ ~ N
U H ~ o
~
p N
o ' ~ ~
v
ai a o Q,a .. o 0
~
tn ~ (~'c~ ~' U N G
.t1
tOd N ~ b , .~ '"'
~ V'
.~
.n-op o ~ ~ N. a.
~ ~ U
1
. f p. ' H W
-
~'.~H ' A' ' -c
V ..p ~
an
N ~ ~ p ~ ~ .~ ~ >,
-~
~
A ~, w, ~ p '~p ..O v p y
FT T a) p k 'O
~ N N
c~
m
y ~ ' d , O fn M
O
~ .~:'.~~ p, W N v r:
~
d .C ~ d N O ~L' Q
C7 CG ~ ~ i ~ E N t
~ C
U 1
E-' x n ~ - Cs. w a
v cx. w v
A
as ~,
~'
M
' o H ' Q ~ a
' ~ ~ r~
G7 ;a ~ v ~ ~ ~' W w b
~
G
~ z
0
~
Vj-~ M V1 ~Ol~00 O M ~ m M
N O h h h ~ ~ N
m
a .--m1 M t1M O~ ~ I~ ~ l M
~
V M c~1 et C1'V100 O O _
93
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
w o a. ~ ~ w ~ ~ ~ ~o v
," ~ ~ .U .V ~ .E' _ ~ O_~ t0 ~ n N U M Qv
C yr N C 001 t~,, ~ ~O .~ ~ n
'n V p N ~_'n ~~O O~O 0 O_~ ~ ~f~p ~ M ~N
c"a .s5 ~' ~ '~ ~ ~ o ~ a ~ ~ ~ ~ ~. ° c°~ o"_h ~ ~ v 'a v,
~ ~a°', ~ ~~ Q~.a ~~.o ~,a°c
Act ~ ~ .~a°~ o '~ '~ y Ga o ~ ~ .-. N a ~~, ~ ~ ~ so -~ o ~ o
~ U ~,., '~ .~ ~ o ~ U '~ :~ ~ L ~., ~. a. o ov .o a.
ca N W 4.. ~ .n .~y ,.~ c..r~.. o, ~ c
b
°' ~~ °o°, ° a.o ~..o a.b ~ ~r ~ o ° o
c. .~ ~ U ov U o ~o a. ~ o as ~, .: ~ :b v U ~ w
O L.DC .Cv.Cv øC pdUr~n~d~
~w.~ °'~ ~ ~~?~~CS ~' u~o a
~ a a°, ~ ~ o ~ ~ ~ .u o a ~~ ~ ~ ~ .o~' 'n ° ~ ~ a
° .D 'D N V O -O ~ % ~ V N 'd. ~ v) ~ ltt N
N .C V '.~ ~ M ~ O .Ti ~ .O Q ~ pn n ~ ~ ~ y ~ ?v p 4. C
!, V ~. ~ ~: ~ V ar ~ i. ~ ~v~
N ~ ~ d 0~0 V '~O '~'~ ~ .fl N
~-.w
a,U o S~ ~, .~,~; ~"U o ~.°x,~~ "ono ° ~,y
!°3 a~ ~~ ~ ~ p ~ ,°~n ~ 23 ,~ ~ o ~ ~ O E a, =: ~ or
~b~~.'~a -..~~~~'o~ %iv.~~isooubao.da. ~Te~n
i E o. ~ ai c .. '~'~ b.::o.i.v i.- ~~ ~ ~ N i c Q on
r~ a ~ o', ~ m O ~ 'b ~ Z -~ ~ r1 r; .C t-i V ~,, "", ~ ,° ~% o ~ ~,
y Li ~ ~~ O~ ~ N t3 U _
b ~ ~ NE' c°o'~ ~ ° a o c~a ~c,~~ ~ ~~o''~~ ~ wo'b W ~ b o,
a~ ° ~ ~ .n . U ~' A ~ ~' .~ o ~ Wo ~ 0 3 '~ ~ ~ .n N ~ ~ ~ °,
y 'U ~ U O ~r ~ ~., O ~V \D O U O ~ V ~ O ~ N n N n W ~~ a
O) ~ ~ oo O ~ ~ ~cd O ~ ~ ~ ~ ~.~ ~ ~ ~ O ~ O
x vU ~nN~ °~x ~'x~~c3 ~n.~x~x ~UWU a~.~~cn ao.~v~ en°
.o
o ~ ~ a
A
'~ ~ ~ ~ N ~ R
:, ~ ~ .~.° .a g
O .~0. LL O et! of .fl O M ~ 'O m
a N ~ Q' ~ .'fir U ~ ~ 'd ~~-~ ~' d
A ~ ~ p ~ r ~ ~ 'b ~ t~ . J
p ~ ~ ,~ t> aWy C O ..~ '~D b0
a~ o o ,d . p ~ ca a>
pq
W . V O m m ~ ~ ° p
a ab ~, ~~ a as
H ....~1.
a W ~ ~ g.
Ch
~e -.. ~ o~n ~°on
0
x d
p O
M n N (V
O
G~ O O
y ~ ~ ~r vwc ~o ~ b' d'
Ch ~ ~C 5C ~G ~C DC X i~ ?C
94
CA 02571917 2007-O1-08
WO O1/b6573 PCT/IB00/02035
on ~ °,° ~ ~ o o w ~ ..,:
c~ o a -d ~ ~: ' i o : a. ~°
'b~~ ~ , oo ,~~' > :: Oc
~s ~ ~ o o ~ ~~ ~ .c ~= o°~; ~
a. e°p ~ v '~ ~ a '~ .n '~ an a ~ c a
>, a~ ~ a ~ ~ a
a o ~: .~ ~ o .. G b ~ b ~,.~ v ~ ~ o a~ .a
eooo. N.N ~ E'°'a_ o ~ ~ o "~° ~
U
a"0.. ~ ~ ~ O ~ ~' a ~ O O. C .~ >p', ~ 'J O '~ ~ 'H N
O O _~ p ~ ~ ~ U ~ ~ b 4-. .~ ~ ~ 'a~:0. ~ ~ ~ ~ (n
c'~a N ~~ Q ~ ~ O V ' ~ p ~ v ~ N .s:. O a ' .a F,
a ~,.~N ~E~ H a ~ o:=,~a a ~ 8 ~~ '°d.ra ~ as
O~ v a~ ,", N
~ °""~ o on ~ ~.., '-' ~ e°'p'~. ~, a ~ ~ > a°_~, o E :~
cs
°' O' ~'' U ~'-' '~_ ~ ~ U o~ ~T~ ~ en~° ~va.a aH
p, ~ i-v y '~ N p '.' H y," C U ." a .,.U., ~ .Y'~ O b ~ p O O ~ O w
O P. ~O ~ .~ oo a~ r,.., ~~ ~ ~ O m ~ F., 'Ci N ~ 'C1 ~ ~ ~~, ~ '~ O
O" b0 O "C1 . ~ ~ ~ '~ O O
'O~D~ l_~ ar.a a~'' ~bCN"U.,U ~avO~~C~7 v W
a~.O~ObA.~~.,00 , a ~V r..l~OV~ U A~~"~~~U~M~O
Q ~' O~ V (~ ~f"'.' ~ 7~ G "'~pOp ~ O".~V' O ~ ~ N ~ ,.Vr ~; 00Q ~
.c '~ b ~ ~ '~ a-~ ~'~ U ~ °- '~ ~' ~y ~ V '-'on "~ U v >'
U -~ ~ ~ o a ~ ~ ~ ~ 'C "° ~ Q ~ ,~ " ~ ~ r M ~ 4.,
~~o ~~~p "_. ~;~.:;~,~r.a ~,w,~ ~ ~y ~ 0D~ iti ~ V ~ bp~".
O Z y-i N V ~ ~ ~ ~ H ' ~ ~, .D N N ~ O ~N ~.~. ~ ~ v iV 'm
m~.d ~,W'.~~~ ~ ~~ ~ a ;° ~ ~C4W ~ ~~ ~-~ ~C4 a~aopA'C~ v
a i o v _a~ ~ ~ " a ,-,
a~ C7 a 'n ø' a N °' '' ~ ~ >~ ~ ~ .~ a o ~ ~1 ~ ~ " a. O a~ ~ o
H OO~r~v~~ 'rUO~ d~ ~~aaOW.id'~ ~~N~~~O VNi.3a
V7 .C U cd ~ M wr ~ ~, '~ ~ +. .a C~ HU p ~ U V .,.~ ~ U 'C 'y
G4 E~ o'~o W ~ H a, H o ct7 ~ ~-~~ ~ i ~' W o 'C ~ ~ U W Gt. o ~ ~ U ~ ...07 ~
.,
+ p+,
w
Ca
Q ~v
° a
O N ~ N ~ ~ H
N
N ' ~ a ~ U by ~ N .j"r
t~C~~fnO OcaO TO
0 N
ctf fir' of
i~ _O .~7 '~ ~ .~ c~ y .~ O, k1
N N y f. ~ O
FZI O U c0 0. ld ~ 'r N
y ~ k_~ aC M a' ~ ~ CL
U" G. U A v~ ~ ,~ ,~ C7 ~n Pte, Q
d
z
C7 ° on a ~ ~ ~° A ~ $
6
~z
x~
0
f# 00 N t~ M et 01 CT V7 M ~ v7
n Ov O~ p ~ 0N0 O Y1 O h a~0
N ~n O v1 v~ b
X
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
o ' '
-G . ~ . i p '~ c,
..U. ~ ~ N a7 O ~ O V N ~ % ,~ ~ v w O
p ~ ~ V V1 ~,~,, ~O ~ CS ~ ..
p N ~ ~' V z ~-~ b ~ U '~~f ~ ~ ~ ~ ,1,~ V ~ ~d ~ ~1
y .D ~ ~ ~ cct O G ~~: V 4r '~ N O O O G ~ ~ p b ~
i o ~ av ° ~ o ~ o a "~ ~ v ~ '~ ~ ~ ~ ~ °' :: ~ v ...
a~ "~o~ 0~~..:~a~pQ'~,~ra~cM
F.' ~ ~ C ~ V .-V. ~ ~ W ~ 'r N ~ N ~ O et cV0
i ~ o .o o ~ " ~ N ~ ~ w ~ ~ c A. ~ a. U " ~; ~ ov
°., o~~~c°~~en.5e°'n.5~o
-c'E.v$ -~.°. ~ ~.~ ~; A ~ ~ ~ ~ ~ 'da 'da ~ o~
.n o a ~n ~' .~: o hi ° on u~ V a .d a~
o v~ b o ~ v V _o '~ o ~~ ~ ~ Z o0 ~ o- ~ sa. ?, a. a> CS ~ o
0
:a ~ ~ ° "- o ~ o t~~- N a .q '.~ U ~ c o a ~ w ~ ~ 4.'°,
N C O N a o5 '~ ° ~ a ~ ~ N N a m a . ~ b°D O b°8 O
M v~ o r
a~ ~ .y~' ~ ~ ~ ~ ~ 0 0 0 0 'o ca p, °~ p, ~ o. ar .: ~ °~' o
o goo NA ~'.c°w' Vdo ~'~ oo~.~a ~s°~-~"'N.c°-.v'~'V
O '~ ~ ~ ;? H o0 °' ~ L.~ O ~ °v p p >' ~' O >, >, p V ~ ~
o U
m ~~ ~ o ~~ oo ~~ oU 'H ~.. ~ o-°~a o.'~~n ~ ~
e, o: O .C r.. a. w ~ ~.. ,~, .,. a, ~ V a N V a N C v °~ d, ~
w .°f, ~ ° h p .~ ~ ~ .~T".' F ~j '~ ~ ~; VM ~ O ~ ~
01 T,~ N O ~ ,~~. ~ ~, V O _°. d O~ Q ~ Ov O G G ,.~, Y~1 O ,.~.,
1 Pi w Y" ~ ~ ~ ~p M A" N -~ ~ ~ ~~ ~~ O M ~~O h ~ ~ ~ l~ .L'. ~ ~ V V
O .. f, ~, ~ .-1 ~".a O ~ V
d Y'TC,~~F",.~~.-~~,a>~ 3~~ ~~'P'~t".at....~P.Nr~0.N,~~~ H
~-o ~ ~~o ~~ ~~ o
d ~Na~ ~~'' ~'n~ ~~~ v~ ~a a °'~
b ~ . a~ o fs, . ~$ a~ ,r ~ ~ o ~, o ~ G ~; .~ ~: V V
-o .sy2 ~e _ ~o ~ N ~ .~ a~ o . ~ o i.. as
v, v, o .~ .o a m ~ o~ wo ~ o
Q, G . ~ U_ Q ~ ~ O t~ . V cC v w O. n.. V H '~ N
~ ~1 .a aVa bp~p (~ C> O.i C. ~ ~ z ~~.r v ~ by ..~., ,"~ C> ~ i~ m dN' C%~
'V0 DO VI 'VG ~ W O ~ b0
c-
a~
a>
7,
v
c-
~d ~ ~ N
b
'C H
V 0.
H
a ~ .~ a ~ ~, a
b
O $ ° ~ x ° ~ ~ ~' ~ o
ao ~, ° a:o N ~~a~n?
° :a ~ g ~ '~ ~° ~i
~o . ~ .i.,
W ~ '° C7 w ;~ Q C7 '° Q
CJ
0
as W
Z x ~ 2 U Q °'
du ~ z ~c
Ch ~ a ~ ~ ° ~ ~'' p ~° ° ~ o
:° en on b '....° ~ a.
x b
d O
.., _
EQ o~ M ~ Ov N Ov n ~ ~ 01 t~ v~
N ~n ~O
O M d. ~O ~_~ M_ O ~ O~ N O~
H n 000 DD 00 0N0 ONO O~C O~O
x x x x x ~ x
96
CA 02571917 2007-O1-08
WO Oi/66573 PCT/IB00/02035
c
,..,
0
o,
'
'
> , >,
_
5 S .5 ~ S '~"a
., O\
" o . ~ C . . . c
V C
~ O O :
~OQ'~ ~ y U U U U U U ~
~ O O O O
,p O ~ ~ O
O O ~ O O O
O
O ~ U v ~ ~ ~ V a O
~ ~ ~ ~ p p p p p p ';
~ ~
.4: vN1 w ' ' ' ' ' '
O V ~G O U ( V V U U a
y '.~ OU
~ N
>
, U ~ ~ ~ ~
~
_ ~
N
~, ~ ~. ~ dp bIl b4 b0 OD b0 O
~ ~ H-~i ~ 4-i 4: 4-P 4.i ~
U ~~ ~ ~ ~ ~ ~ ~ ~ ~ U
~ ~ O O O O O O
O
N r. ~ O ' ~ ~ ~C~ ~ ~
N ~ ~ ' ~ ~
G
, ~ y.~ t, , y, y,
O cvY U N N U N a) N D
~ O W m ~ N W W O
~ U U ~ O
W ~ ~U ~ t NN c VN ~'~ ~v~ ~
O ~' CN N C~ ( y N
y N N
" O U O .O . .fl .C .a .a c
(C N N ~ N N ~ 0
. U ~ V! f/1 V1 N N O
1.'
6 c ~.o ~'o ~'o ~,o ~o ~o a
~-o a . v
'
" , ~ OU OU OU OU OU OU o
3U ~.~,~ U
~ ~" ~n U U U U U U U
an- ~ ~ ~ ~ ~ ~
'L~ ~ r' O O O O O O O
~ ~ U ~ ~ w ~ ~ ~ O
~ t ~
~ ~
"
N
N ' .. ~I ~r' ~.a ~r' ~.i ~ ~+
~ ~ . U U U U U U ~
~ U
U
( F. .
~b ~i.~H ~ ~ ~ w .,
~ ~ ~ ~ i
a~ on ~ a~ a~ a~ a~ a~ a~ a~
~ .~rs U a, ~ ~ ~ ~ ~ ~ c
~ .~ v~ r-. ....
~p v~ H
O U " (7 O TJ O O 'l O O
~ ~ N 'b n 'O 'L 7 'cJ
U ~ n n f n n
' n
~ v ' O~~ OcOV~O~~ ~ p Ot~V~~m
L ~ ~~ O~~ O~~
, iCy0~"t~
s '...1r'y ~ ~ (y, ..N.,~,'y,(y Q,
. . ,.U.. ~ ...~.,...N.,~ : ...~...,.N.,
. ~, ~ ~ ~ ~
O ~
n1 ' U Vl ~ " H H " "
U a V7 (A a v Vl
T' a v " 'I
- ~. v " . . " , . .
.~ ~ o . ~ ?, . , >. as
00 v .~ ov ~ ~, . ~
ov ~ ~,
~
a) ~ ~ ~ is at ic! is iO is
~ N cd ~ ~ id ~ ~
~ O O O O O O
-o ~ ~ i a
c~ o~ ~~ ~~ ~~
a~ ~~-.N N ~ ~ ca cd ~ ~ U
O m h h h h h h ~
'~ ~_ ~ ~ ~ ~ ~ ~
n ~ V V ~ ~ N
~ ~
it F." ~ ~ V ~ N V V V N
O N O d N ~; ~ N ~
N Q, ~ ~ N ~ N
' J ~
~ ~
tw ~ v A ~ ~ . c'"0 . . ~ ~
.L h O c~0 O ~ cue O 'Cy
~ ~ V O ~t O NV ~
4-~ d' ch N~
.C "
C/~ ~ .-. Pr Pr ~ (y, C1r C1r 13a
.O O ~ ~.' ~" ,~"~ '~ '~" ~". c
m O. ~ .-. .-~ " .-. C
.-.
U N
b
x
a~
z
~
U
z
~
O ~ N 'V' h
~"~ c w ~,' w w w w i
"'
.tea
x
A ~ ~
~F~~ ~ ~ ~ ~ ~
~ H
' "
~
sn Eo o
~ ~ ' c
~
~
W a, Ilk y ~ Y ~ Y V Y
(~ ~
~ O
~
p
y U ~ ~, ~,, O O O O O O O
J ~.~. ~ ~ ~
v
U d on w d a, a, r a, w r
~s
U ~
ca
w~ ~o
0
~ z
x o
_
N 0~0 h h h h h ~ ~D b
_ O~ O~ O O O O O O O
~D
~ G ~S ~G
C d ~C ~C ~C ~C ~C ~S ~C ~
97
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
b
~ ~N ~
C ~ p
dD h0 00 d0 00 00
.'~'a .~"a .'~'a' .~ N V ~ '-' G1 y
GO ~ p ~ p ~ p ~ ~ O ~ M ld O ~ O ~~:
U O U O U O U ~ U O U O ~ ~ U N ~ ~ j3,,
:o ~ .o ~ :.o ~ :.o ~ :.a w '~ '~ o N w .~ ~ 4°.~ ~ " ~ w
v O O O O v O v O o ~ ~o ~' N O '~ ' ~ ~ ~ ~ ø.
U ~~., V ~~ V ~~, V ~~., V ~~, V p ~ O ~ n .,N~ U ~ f1. V ~_~ A
a.~. ~ .,.~ ~ ~~ .U 'in ~ ~ ?, d "" ~ ~ U H
ou 4: ao a ; en 4.; ~0 4: on 4.: oW : '~ c~~o "~'. '.'~-.s ~ ~
E . ~ ~ .b ~: c ~ ~ ~.F. o
i ~ ~ N i ~ i ~ i ~ i ~ E c ° ° ° ~N'~'~~
.r ° .r a ~ .-. a .~ a .r a ~ v ~ w 3 '~:,
U N U ~ ~'' ~ U N U H U N U ,a ~ C,' v ,f1 ~ O ~." aU-n .~~"' N
y .G N ~ N. .O N .G N .O y -U N C. U N U
N VJ N N N Vl N N N VJ E~ N ~ V O y ~ N ~" ,y.,~. C ~ 'N :-r
'L" fr' r-r C"r C, Cr .~'.~ C L." C G C ~ '.~ Sir ~ ~ (~ O ~ U (O
~o ~.o ~,o ~o ~,o o ~~ ~ ~,~ ~.~ o, N ~ >
U U U U U ~ U
U ~ U ~ U ~ U ~ U ° U '~,° 'v a ~ ~ ~ ~ ~ ~ o .., ~ bn
~w° ~~° 84° ~w° ~w Ew° ~ o ","n.°
~.D~ a.,Uovo..°~' ~a
v ~ v. ~"'.or v ~'"r U O U
w ; o o .~. U ~ ..o '~ a a. ~ a
a~ ~ u, ~ a~ ~ a~ a~ a~ ~ a~ a~ '.:. ~ ~o a~ ~ o ,~ ~? ~ N a~7 a~
i~ N 1J NJ a> V7 w N 1.n V) fr N U O~ C ~ ~. U Lw
o.b o.a o.a...°.a..ow.~ow.~~'~o~ o~~° ~~, ~3 o a~
o X06, o ~~ o ~~ o ~a o ~o~. o ~~u~ vv~°.? ~'~ ° a ~ x~ n,~
r.. N C~ ~ OW"' [n p~ ~"' ~ ~ ~" ~ ~ r.. N ~ " . N M o O4 ~ -O ~'p ~,f~ 0 00 ~
CO
p, ~in v ~ 'm ~-~ f1" ~N .-n P, ~N d, ~N P, ~N O~ m ~, ~ ~ ~ N Q ~ A 'Ly
~s v. ~.. ~ ~ V-.
as O icf ~ O is ~ O iti ~ O is ~ O at ~ O ~ ~~ ' O iC N
~~ a ~ a~ ~~ ; ~~ i c~o~ ~ ~~ a' ;° °' ~ ~~r'"a ~ N "U
a> M '~ a~ C ~ a
a 'c~3~ ~dt~ c~ ~c~ ~t~ ~~~ ~'~ °' ~~ ~' ~ o
i.~, ~ U N ~ U N ~ v N ~ ~ N ~ U N ~ v N 4j .O O x N ~ ~ O N ~ O "D x 4.,
P4 a. E .-. A, ~ .-. a, ~ .-~ w ~ -. a, ~ .~ w ~ .. 'v~ ~ N a. U o a. w .p >
w~ ~ v~ ~
0
a a,
0
.5
N
O O O ~ ~ '~ O U
wwwa~',au""w~ ø' ,°
0
CI ~ ~ a ~ ~ ~ ~' ~ a.
w ~ ~ ~ ~ ~ ~ x
b ~ ~ ~ ~ ~ ~ ~ o 0
a v d ~ ~ ~ CL cV
y o 0 o O O O ~~ ,~ d _~
y O O O O O O
CJ a ~i. c~ w a~ w~ d C7 .a °~.' ri, .c
7,
k
a, y.
G7 ~ s~ o ,~ a.
0
z
xa
0
C~ ~V! M 'd' V1 \O l~ 00 M ~ 01 . .~ O
v! ~O ~O v0 v0 ~O v0 r, ..-y' t1 00
C7 M M M (~t M M V1 V1 ~O ~ V1
v O O O O O O M M ~n ~O ~D
a a Q. c. o~ o, o, o~ o, a, o. o,
x ~ ~t ~ x ~ x
98
CA 02571917 2007-O1-08
WO 01/66573 PCT/B00/02035
c ~ N ~ a
~ ~_e°uno ~ ~ ~ C5
O '~ c0 .~' ~~' .p N N ~
~U~
~. ~~ N ~ " N V U 01 l0 \b0
c0 O O ~, ~ N
°, ao~~a~~,~ ~ .cue ~ o ~ ~ ~~~.~.~ ~a a;~~;~b boo
W a.'Cy' d..~2~ ~' G l~r.~, CW r ~' l1v!?pMb 0ppv
U ~a~° °~'-'~O apW~athO.pON
;..~., '~ v o~ o ~ 'd o ~, ~ .~t . N ~ o d' " o, ~ ° ~°
>, ~ .c ~ o ~ .>; 8 ~ . M ~ c°e
N p U ~ ~ ~ ~ ° 3 ~ .-. p v O ~ H O
~ i;-;f.°t ~'~ l'~" ~ ~o ° ~ ~ U °:,x". oo c~~
'°v°o
a) U Ov tH, v U w C N U ~Cj w ccf N ° TJ ~ tn ti.. O
'r 'd b o~0 ° ~ ~ ~ O. ~ ec CL ~ ~ O w ovo ~ ~ y ..: ° v ~
° N
-0 cp'lt ~ ~ R w 'w U W U ~ .G > ~" f.' ~ ~ _O ~ ~ ° ~ O yr
,t~~ C b V ~ ~ m ~ ~ ~ ~ ~ v ~ ~° ~ '" " G4 N ~ _~ ~ p" o°o
U o~ ~ ° ~° cr:° °. ~ >~ Of7 P". " g ~ ~
° ... o p
a ~ E" N o v ~ °' ~ ~ ° ~ a .~ :o ~ o. 0'10 ,a: ~ :3 ~ 00 ~ ~ o
L N ~ '~, H -~,, y ~ U '~ .aY.~ ° V ~ v ~ p ° G ',:,
~1 U .O ~ ~ O ~ ° ..Z; ,~., i~ N ~n O 'v .~ t0
G ~ a G 'O ~'~ >-~-. V U N ~ ~ . ty, ~, .O H C1
i I '~' '4 ~ ~~ ° ?: ~1 z ~> ° et ~ G ~L ~ h ~, ~ y ° ~
~" ~ 0' a Z ~~ ~~o_, ~ i~~~.5,°~ ~a~Q.c~~" °U a,o v
b is v ',,., ° ~ ' O o_, ~ ~,., '-' a p.; ~ °..-~'' ° .
.~ N v . ~~ is w ° ~ ' fil
N 4i ~ ~", :'.O ~ ~ a ~ ° ~ ~ ' 're '~"' ~", v cC O. t°r~ T! ~ Y
" ~ °~. ~ G°7 U ~.Ur
e.~ Wea ,>, °~ ~~,.j °op.~ °N a, ~ ° ~ ~.o
° ~vi ° ~ o.~ a~a
~i ::. .:. o
o ~ ~ '~ :a .r' '.' U ~ " ° ~ p~ p .1~ ~ := ~ '~~' ' ~ ~w, +xU~ ~ O ~
.~U~ ~~ ''per'
O~.I fy. Nv~-. Or.~,b.v..,~,v~PU,Uvx O~pr bpV Pr ~~P, b0~ vP~ t~ OQ
'~ ~ hi .O
N N c~a ~~ WO ,~
O ~0 ~~ ,.~.. ,~" aU..
O ..f~'. N of ~ G.
e~ cpd b 'c~ c'nv ~ia O ~aW' o
o Ca ° o a~ .5 0 ° .n a >.
o v~ ~ wu ao ~ o °' ~ ~, .~ ~ .x
~ Q. a, ~ .'~ .d c~~o G. o a a '° ~ ',~
ii ~ ~ c~°a x ~~, r -bT ~'~:d.~ ~ ~ ~ a
v c w ~, ~ ~a ~ a>! ~ : : ..-. .~ ~ _6
C ~~ ~~ ~ ~H ~ tUV .s V ~~ U >, ~ V
~ C ~..' r' o ~ a~
as .~ ao o p ~ o o a~ Z o :5
0 0 ~ U a o ~ ~1 :~ °~.' ~ > ° ~ .o
~c~ ~w x ~~ x xx ~a~ ~x ~ M a w
N
A
o b
O
Q ~ '~ ~ °
'~ ,~ s a
0
b
O
0°~O _~1' v1 ~ d' ~ ~ t'~ ~ M
O ~ O O O O O ~ ..N.,
99
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
w
m
x
.n
°
a.
m
x
..
m '~ o. w
y ~, °
.~.~ G o '~ c~ p~ C N ~.m., p~" N ~ m
m ~ d ~ _~ w ai ~ ~ ~ o"o m w ~ ,.. 00
d ~ r.~ v ~ ° ~ N .b °~
d0 00 d' Ov O ~ (~ U tn 4. Cv , y TJ , N ~ ?v
a°~ a.v°~ N ~ b ~ ~ ~ N
m CS t~ m m G '~ M ~D
~D AO ~ ~ ~ i
~~,~-~~.7 c n'~~~ °' ~'~.-. .'Y~'~~ >,~ aup u'j ~U .~3 0
m ~ ~ ~ ~', ~ : C O .o
~~.° a.o m y°o .5 ~ ~~G °~o~o codQ
a r ~ ,o m ~ ~~ ~ ~ ~ ~ 00
o~_~~ a a~~~ .~ o a m '~~ wmGnc~a a:b
~o N °'~ °° .~ o a'
.n ~ .~u - °° °' '~, nmo ~ ~ a. ~ o aa~n o a. o ~ ~ ~ a
is
m m m m m v .n ~ v H v m m
rc~ N ~ t~ " .. ~$ ,o ~ ~ ~ o
~ G ~ k 01 ~' LU~, U ~ iv ~ ° m H ~ ° c~'V ~ w tU0
o t1 "O m m o, ."~~' y ~ m o c m . 6 C .~ ,# 0. m
w m ~ ~ C dD m N f. ,~ C 'in ~ ~ E ~ ADD ~ .d ~ m ~'3
'H ~ .~ ~ 'H G ~ w
° .~ ° o ~ ~° im. G 3 .-~,. W ~ ~ G,~ C ~ ~ .Wa ~
° p
m m ° m a .-. M d, m ° m ,. a ;, 'C .r
~ o ~ °~ o Q" °'m ~a ~~_a.m aoa, ~ a
~ '° m ~ r:~ a y _°° ,n C
~ ammo ~ a
~ ~ ~ _ o v~ r: ~; ~ c ,., N - U ' ~ ~" - .U V , .w a c
~ ° . ,ay ~ G ,,you, N Y ~~ ,mo m m as is _~ ~ ' pq °' ~m ~o
m aW a~ o a ~~ o r Q ~ ,~m~ ~ ~ ~m-, ~ m .a v m ~ ~ . c ° ~
do ~? m ~-, ~ ~ a ~ m a
cue, ~ °w ~ ~.~ ~ ~~ a. ~'~ ~°~ ~ ~~ cd'~
y -° o H ~."~ ~ a .~°'. a '> .d ~ a ~ .~ o :...~ '> ai '~ o ".~
omo.:.J ~
y ° U O ~,0,, OOp N ~ Q .,~..y ~ ~'.-~' ~ t0 i.., bA U ~ Lm. ~ CD V ~
° m ~ ~~ O.
Qi ~ ~ ~' .~ O ~ O,' W P, 0.7 '.ms's m ~ a'~3. O ~ v-, O Q7 b0 0 ~ v, U '~ ..-
~ ° ,.m...
m ,n
O
m
d, O
.a
m ~ ~ O
M pp
m ~ ~ °' a m
on ~ b
° '~ .a o
o a ° ~ ~ ~ o~oo x~
~, m
m y O m ~ N ~.,' ~ a' ~ ai
°_' U ~, .~ ~ i c ~ m
e1 ~o ~ ~ ,~ .~ .o ° ~ ~ ~o
Q m ~ o ~ ~ ~ '> p.
o .. ~ ~ ~a ~ N ~ ~ -~ '° ~ ~ 'v g
m c~. O ~ a. m ca ~ , ~ m
~ 5 '~ m ~ ~' :~ .~ ~- ebb ~ m
~i ~ ° ,~ T ° ° G 4~ 'vi ~1 P.
p
V' C7 A ~ Q 'v A '-~o E~-~ C7 ~ U ~~ a. ~."
c °
.. >
a b
x m
,.47., N
0. p,
a
A b
c~ ~ ~. ~ .~ .~ ~° w ~ ~
0
~z
m
a ,o
" .. N °v ,..
o ~°n v°~ ~ n oNO oNO oNO vM,
p v rwo 00 ,~ °wo ov ov °, ~o
v v .. ... .-.
U" ~f,' ?~ ~ ?~ t~ N N N N N N N
1~~
CA 02571917 2007-O1-08
WO 01/66573 PCT/1800/02035
TABLE 3. Corynebacterium and Brevibacterium Strains Which May be Used in
the Practice of the Invention
Genus species ATCC FEIiM-NIitRI.CEC_T~1G_IMB; NCTCIDSMZ-
ASS
Brevibacteriumammoniagenes21054
Brevibacteriumammoniagenes19350
Brevibacteriumammoniagenes19351
Brevibacteriumammoniagenes19352
Brevibacteriumammoniagenes19353
Brevibacteriumammoniagenes.19354
Brevibacteriumammoniagenes19355
Brevibacteriumammoniagenes19356
Brevibacteriumammoniagenes21055
Brevibacteriumammoniagenes21077
Brevibacteriumammoniagenes21553
Brevibacteriumammoniagenes21580
Brevibacteriumammoniagenes39101 .
Brevibacteriumbutanicum 21196
Brevibacteriumdivaricatum21792 P928
Brevibacteriumflavum 21474
Brevibacteriumflawm 21129
Brevibacteriumflawm 21518
Brevibacteriumflawm B11474
Brevibacteriumflavum B11472
Brevibacteriumflavum 21127
Brevibacteriumflavum 21128
Brevibacteriumflavum 21427
Brevibacteriumflavum 21475
Brevibacteriumflawm 21517
Brevibacteriumflawm 21528
Brevibacteriumflawm 21529
Brevibacteriumflavum B11477
Brevibacteriumflawm B11478
Brevibacteriumflawm 21127
Brevibacteriumflavum B11474
Brevibacteriumhealii 15527
Brevibacteriumketoglutamicum21004
Brevibacteriumketoglutamicum21089
Brevibacteriumketosoreductum21914
Brevibacteriumlactofermentum 7p
Brevibacteriumlactofermentum 74
Brevibacteriumlactofermentum 77
Brevibacteriutnlactofermentum21798
Brevibacteriumlactofermentum21799
Brevibacteritunlactofermentum21800
'
Brevibacteriumlactofermentum21801
Brevibacteriumlactofermentum B11470
~Brevibacteriumlactofermentum~ ~ 811471
~ ~
101
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
Genus species ~TCC FERM NR.RLCELTC13YIB'.. ' DSMZr
~ . ' N CBS: NCTC
Brevibacteriumlactofermentum2108 6
Brevibacteriumlactofermentum21420
Brevibacteriumlactofermentum21086
Brevibacteriumlactofermentum31269
Brevibacteriumlinens 9174
Brevibacteriumlinens 19391
Brevibacteriumlinens 8377
Brevibacteriumpaiaffmolyticum ~ 11160
Brevibacteriumspec. 717.73
Brevibacteriumspec. 717.73
Brevibacteriumspec. t4604
Brevibacteriumspec. 21860
Brevibacteriumspec. 21864
Brevibacteriumspec. 21865
Brevibacteriumspec. 21866
Brevibacteriumspec. 19240
Corynebacteriumacetoacidophilum21476
Corynebacteriumacetoacidophilum13870
Corynebacteriumacetoglutamicum 811473
Corynebacteriumacetoglutamicum B11475
Corynebacteriumacetogiutamicum15806
Corynebacteriumacetoglutamicum21491
Corynebacteriumacetoglutamicum31270
Corynebacteriurnacetophilum B3671
Corynebacteriurnammoniagenes6872 2399
Corynebacteriumammoniagenes15511
Corynebacteriumfujiokense21496
Coryn~acteriumglutamicum14067 . ,
Corynebacteriumglutamicum3913?
Corynebacteriumglutamicum21254
Corynebacteriumglutamicum21255
Corynebacteriumlutamicum 31830
g
Corynebacteriumlutamicum 13032
g
Corynebacteriumlutamicum 14305
g
Corynebacteriumlutamicum 15455
g
Corynebacteriumlutamicum 13058
g
Corynebacteriumlutamicum 13059 _
g
Corynebacteriumlutamicum 13060
g
Corynebacteriumlutamicum 21492
g
Corynebacteriumlutamicum 21513
g
Corynebacteriumlutamicum 21526
g
Corynebacteriumlutamicum 21543
g
Corynebacteriumlutamicum 13287
g
Corynebadenumlutamicum 21851
g
Coryaebacteriumlutamicum 21253
g
Corynebacteriumlutamicum 21514
g
~Corynebacteriumlutamicutn21516 '
, g
Corynebacteriumlutamicum 21299
g
102
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
Genns': ~ -. A,TCC F)4ltMKRRI,CE NCIMBCBS NCTCDSMZ
' . :
Cotynebacteriumglutamicum21300
Corynebacteriumglutamicum39684
Corynebacteriumglutamicum21488
Corynebacteriumglutamicum21649
Corynebacteriumglutamicum21650
Corynebacteriumglutamicum19223
Corynebacteriumglutamicum13869
Corynebacteriumglutamicum21157
Corynebacteriumglutamicum21158
Corynebacteriumglutamicum21159
Corynebacteriumglutamicum21355
Corynebacteriumglutamicum31808
Corynebacteriumglutamicum21674 .
Corynebacteriumglutamicum21562
Corynebacteriumglutamicum21563
Corynebacteriumglutamicum21564
Corynebacteriumglutamicum21565
Cotynebacteriumglutamicum21566
,
Corynebacteriumglutamicum21567
Coryuebacteriumglutamicum21568
Carynebacteriumglutamicum21569
Corynebacteriumglutamicum21570
Corynebacteriurnglutamicum21571
Corynebacteriumglutamicum21572
Corynebacteriumglutatnicum21573
Corynebacteriumglutamicum21579
Corynebacteriurnglutamicum19049
Corynebacteriumglutamicum19050 ,
Corynebacteriumglutamicum19051
Corynebacteriumglutamicum19052
Corynebacteriumglutamicum19053
Corynebacteriumglutamicum19054
Corynebacteriumglutamicum19055
Corynebacteriumglutamicum19056 .
Corynebaderiumglutamicum19057
Corynebacteriumlutamicum 19058
g lutamicum 19059
Corynebacterium
g
Corynebacteriumlutamicum 19060
g
Corynebacteriumlutamicum 19185
g
Corynebacteriumlutamicum 13286
g lutamicam 21 .
Corynebacterium S
g 15
Corynebacteriumlutatnicum21527
g lutattiicura21544
Coryuebacterium
g
Corynebacteriumlutamicum 21492
g lutamicum 88183
Corynebacterium.
g
Corynebaeteriumlutamicum B
g lutamicum - g
Corynebactetium 1
g g2
812416
~Corynebacteriumlutamicum 812417
~g 1
103
CA 02571917 2007-O1-08
Oenns ~_ species ATCC PERM NRifLEG"TNCnYIBCBS NCTC~DSMZther
. . . ,. C O . ~ _ ~
. : . " ~ ,
-; . ~ ~ _ - ~ w o
' ur
Corynebacteriumglutamicum~ ~ B12418
Corynebacteriumglutamicum B11476
Corynebacteriumglutamicum21608
Corynebacteriumlilium P973
Coryne acteriumnitrilophilus21419 11594
Corynebacteriumspec. P4445
Corynebacteriumspec. P4446
Corynebacterittmspec. 31088
Corynebacteriumspec. 31089
Corynebacteriumspec. 31090
Carynebacteriumspec. 31090
Corynebacteriumspec. 31090
Corynebacterittmspec. 15954 20145
Corynebacteritunspec. 21857' .
Corynebacteriumspec. 21862
Corynebacteriumspec. 21863
CorynebacteriumGlutamicum* ' AS019
CorynebacteriumGlutamicum** "' . AS019
' E12
CorynebacteriumGlutamicum*# HL457
CorynebacteriumGlutamicum**** I-IL,459
Corynebacteriumherculis
ATCC: American Type Culture Collection, Rockville, MD, USA
FERM: Fermentation Research Institute, Chiba, Japan
NRRL: ARS Culture Collection, Northern Regional Research Laboratory, Peoria,
IL, USA
CECT: Coleccion Espanola de Cultivos Tipo, Valencia, Spain
NCIMB: National Collection of Industrial and Marine Bacteria Ltd., Aberdeen,
UK
CBS: Centraalbureau voor Schimmelcultures, Baarn, NL
NCTC: National Collection of Type Cultures, London, UK
DSMZ: Deutsche Sammlung von Ml7QOOrganismen and Zellkulturen, Braunschweig,
Germany
For refotence soe Sugawara, H. et al. ( 1993) World directory of collections
of cultures of
microorganisms: Bacteria, fungi and yeasts (4'~ edn), World federation for
culture collections world
data center on microorganisms, Saimata, Japen. '
* Spontaneous rifampin-resistant mutant of C gJutamicum
ATCC13059°Yoshihama et a!., 1985
** Restriction-deficient variant of AS019 Follettie et aG, i993
* * * meJC-disrupted mutant of AS019E12 This study
**** matC-0isruptedmutantofAS0t9E12 This study
1114
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
n co r>
mm
m = m m
=
v- w 4 U o~ a~ ~ o~ m o>
m > o> ' ~
? cvi
~ ~ 4
U
> ? 0 po~ ~ ~ ~za d n~
~'
d d
, ~
0
G r N O ~ U N ~ ~ ~ 9 N N
G N O r N N ('
o N N
N
O
O
E ,~ co o~o~ n - u~ ~ ~ N m
W ~ W a~ r rn
m .-
r
t N 0 W O I~ (D N r N N
~ N 7 ~ ~O c0 I~
~ _
M
a O N N 07 n 10 10 O t0 O O
Q V' ~ O M N ~ V V ~
o V' c~ M c0 l0 t9
of OWE .t
O
v'
ao
vu
<t
7 7
M
E E '-'~ ~ ~ '
m
~
t
_ . E E Y m
_
U
~ m ~ ? o, o, m d
E
m
C ~ > O1Of O O .O 'O
> N E E m m ' E
Q m ? _ a~ _ ~ m v, m
.~ ~ ~o .~ g $ "'
E a~ E .
m
o ~ ~ m E c ~ a'> m v
E ~ m ao .
~
m m ~ o
~ ~ ~3 N ~
~ ~ ' ~
d m d 3 a -c . H m
~ ~ n m 3
a' o m m ~ o
a, a c o 0 o 0 0 0
3 ~ U ~ Y U O o m ~ Y E E
8 ~ U U E E
~ O V
~
O K~ J U p ~ ~..- U ~S Z 2
J a ~
L LWZ
D
N ~ L Z(
(J
~a ~
~ m U U
m m W m ~ U U
U U
v ~ ~ ci ~ z z
a a cn ~ n m
~ ~ ~= '"
ca Q 4 ~ cVw O' w w
'
m p _ f~ ~ N 01 Q d O
D n O. ~
"'
N O n ~ N m m N w w
c p N- p a I ar tn tn
U m u1 U
~ c
'm
E E Z Z _ ~ a.
S 7 ~ m o.
M~ U'
c y M M p
r W
w
N m (~ O (~ ~
d ~ ' ~ C
~ ~
m ~ i U y v. ~ ao lNtltNL
E . ~ , Fw-
c
~
v 0 0
aw~ ~ ~ Uw UUZJ ooov~ - v v
I
~ a ~ ~ I
I
N ~ m d m m ti O L N ai ai
ai ~ m w m w Z ~ U ~ U U
m rn ao d o.
~? .t O a~ m
L ~
$ m m 'aW om mo.o m Y v~mt~
c ~ N V U~ W Q = ~
~m f ~ G =
p, d
c0 O ~ m m ~ . m
7 7 ~ ~ E N C
7 ~ n = aG
~ ~
o L
N J, .r m Q V V
m m a O ~~ ~ ~ ~ m
m r p C
J ~
E N O
T
m
Oj 3 > O C C
j~V o 3 .n ~~vom ~E~~ E E
o n~ ~ ~o c
v
< U ~ c ~ .
U
m ~ o c o ~ = m ~ : r' r'
o T = a $ ~ ch
~
= U c ~ c a, ~ m ~ m m
a rL ~ Q m
~ ~ c m
~
~
~
~ m N ~ O N 10 ~ C d 'C E E
0. N m L m m U C o o
a1 O 'm W O I ~ t
E ~ E
H ~ 4'
a m
~ o
. m uJ U y
U a a NH% m rn~o' pn ov~
m ~~Ct~IH ~Ol~a
v
Q
dmy
d
- (M =
E
.
~
~ a a E v ~ ~ Y Y ~ t ~ Q
~ W ~ ~ ~ U ~I o' m ~
Q rn ' Q
~
a
=
o ~ m E o m m _ I r E ~ a cr3
~ a m tb ~ E U' U'
E m o- ~ o
~ ' m ~
E p
~
, E v ~ c m a E Q p ,~ H
o m ~ o E ~ " O O
E ,~ rn. ~ U c c c
~ a E ~ ' c ~ 0: ~
' Z
_ n m .r E c m- c r Q a
~ D Q c~ ~ m ~ ~ F~ a t1
n ' m ~ w _~ U
D ~ c 'a
cu a't C O L V V '~ m (C N
~ ,CQ E E N Q m l0
i5 E y O
N m W
m
m 7~0 7 ~m~pr_~a N~O O O
S N pM r-OM O O O
Z' O ~ ~ ~ ~
~ O O O
M
J m N N ~' M d O
z te N ~ N m ~ ~
' J ~ ~ ~
g
a w m tn I1 O o ~ w w ~ c~ 2 z
~ a o D c m E Z z ?
c o
w
a
a, a, N N n ~o n n o n n
o
_ _ N ~ ~ N M ~ h
m N M~ r '
N ~ ~ ~o O ~ W b m O O O
po N O M O
(p
O
a ~ ~ o U ~ N w Ii U U
u. u .- ~ ~
~ U U
m
a Q i p w a a 7 a a a a G
a Q a
~
Q
~ ~ ~ n o m o 0
~ '
(h M r n N V' N V O O
V 00 ~ aD V' V' r n a~
w O n ~
a0 4'
''
7 ~ th _ O O n
to ~1' 107 ~ W T ~
N t0 ~ m N (O
N N ~- ~ n '-
V l~
~ ~ n n n
N N m O a0 ~ ~ N ~ h h
o tp a0 t0 n ~
J n
tD
O ~ ~ N t0 ~ M 00 OD
N M
o
_ n O ,no U j < ~ U U
Q U ~
cn U
Q
U 4 U 1 1 Q
M ~ 1J
N
I -.~ ~ F- C~
a~ Ww a i- C z mmm
7
a
am
=
.o n w m as
I II I . I I ~ I I I I I
m I I I I I
I I I
mmmm m ~ mmmm m mmmm m mm m m
c~ c~ w c~ c~ c~ c~ c~ c~ t~ c~
c~ C~ c~ C~ c~
c~ c~ C~
c~
.r rn o
as W n
o,~~~ yr mn
n
105
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
m
0o a~ m m r' ~ ° h m m ~ ao co ° o °°r' a~ o~ ~'
o~ o~ o~ o> o~ ~ rn M w a~ o> V o~ o~ U o o~ o~ o~
U U °' ~ ~ ~ ~ U o ~ ~ 'a ~ j n1 5 ~ 11~ ~ Q ~ ~ ~ U
O O o. -,-,'-»O Z ~-~ Q~~O-~-,O tt_~ ~ Q Q O
n a ri ~ tm. ' c~ c~ t~ m oo ~:. th ao n ~ o tb ' ' rn
r O W ~- r r r M . N N N '- e- O r '- N r N (O N N r
V CO (O CD ~ t0 10 O ~ Q 01 OD h CD f0 Cp f~ 1~
M N N t~ r N ~D N t0 a7 N r N M O) CO m
N CO r tn r_ ~ r ~ (h M O 4~ f~ N (D ~ 1n M CO r
(D t0 t0 M O f0 M t0 1~ O ~ fD O ~O N V' (D f~ 1~ 00
M M M V ~ M M f0 O7 fp 10 V' fO M M CO t0 10 10 In st M M M
O O O ~ ~O Nm '- ~O O Q O H
7 ~ 7 ~ ~ 7 O C ~ 3 7 O p
~O' ~~~~~ ~ ~~~ (Cpe~ ~dC pE
$ a ~ a a c ~ .G O E ~ ~ a ~C G. ~ U O O!
H ~ ~' ~ ~ 'm c .8 d $ 3 w ~ ~ ?~ a~ ~°' ~~ E c°
'° ° v E~ °'EEEEE~ $E ' '°
a
7 ~ 7 7 W E C c 7 C = C G C c ~ 7J d N E
O '~ .d-. T ~.d.. m C N ,~0, O c ~ GI r N Y O >, N ~- . m 'a 'C. W
'° ~ .n ~°o E °w ~ E t m o m W m ~ m m o E ~ c c m
0 0 ~ a Q a a o ~ a -o n a a .o a a ~ Q a o m a
10 C yL' a m ~ ~ '~f O ~ ~ ~ ~ 7. >. ?. >. H .,05. ~ ~E ~ O O E
U ~O ~cn~W - o ~a .W~~~~a v~~ a~x x o
t0 .y.. a0 !O J
jp NE t~ h
~tNO tNOr~ 0.N OoN Cf4
r ~ r
_ d r ,O v v N d
E~°~ o~~.M-y~0.~~ cn.N-~p ~E y
n>_
p Z c c c c o '° c r p
~ O ~ ' m ~ d m d ~ m m a~ d v a $ v E a~ p O
.-pa ~~ ~E ~ ~~ ~. ~V' ~~ ~m rn ~ m vi -~ ~ ~ ~ °~
a Q, L y ~' ~ m. a~ y :_ ~ U % o m ~ ~ m Q ~ i° ~ ~ t Z Z ~
°°
N O~ 'O
c°_-°°c;d°' > o°'oom Uj E EETE ~__~ u~~' ao
U C9 ~m
c ;p C C C Q
m O ~ 'W ° m d C ~ V1 C C 0i C ~ 9 C ~ ~ 'yp ~ E Z Z ~
uJ w N a~ m m a~ -~ ~ m m d c d y y o ~ c m t U U _
L m a w rn t am oW .n or o~ o ay a o ~ Z 2 L
d W N L~ O d tC y ~ y ~ ~ ~ ~ m '~ $ ~ m U ~ D' ~ ~ O ~ ~ N x W W m m
a~ ~ ~ m ' °' ~, 3~ m - .~ o v ~ v d d a~ a~ °' '-' ~ ~a - $ E ~
E
'°~~°a$ O~EaEEo X~ E~3. EE~EQ~Em'" .~cm~~ to t~! Mc
.~$ 8 c._vo~ 5
'~ ~ ~ m ~ ~ v c t ~ 3 $ ' E U U V U O Q m ~ $ o_ ~ ~ m a r m
E $ m d o H ~ E ~ ~ 3, a a ~ ~ $ ~ ~ ~ 0'. ~''~ o w° m C m
° ~ t0 O L
p 07 O T N f~ h 1~ ~ ~ O ~ 'N V M ('j
~N 7 NU yM ~~(~'~1 O E ~ M W 0! MM gMm'OL H d;0_ ~0 7 1p~_ Efn
W E o~~~ Zx~_2.2 y o T Z N ~ x2 NT~~c,? m EU' c'o d,c'S_~p O O
~~11J0-j f=pf%1~E~Nf~6 ~' 'd ~~ NNNHW(O~.L..mO'' ~07~ h n'
t W . N ~ V O N O O ~ ~. O ~ O O O O O N ~ C O~ V O O ~
m -E a ~ °~ ~ c ~ ~ $ ~ o tn aW"n m o X ~ -7 7 7 7 ° O !0 T .-.
o u, m m Wo Z x ar
.C. d ~ U E ' ' fn N yI O ~ C ~' yV.. ' ' d C L N ~ O h 7 Z Z 01 p
7 7~~C oM~~20m.On.O.00an~ON~Vj~Y~.C~C C ~d
~ U m C E U O .,r Ln . 0I C ~ 'O .~0. d .7C L ~ L~ .~ ~ d N t L O ~ N E O h O
N C Z
IO d m '" N f0 N m 10 T T 10 d d O ° C a~. E O m V U N
~ °' ~ ~ ~° p p m $ a'~ m c m '° o m o ~ c 'm, d ~ $ d o
E a. o °°' ~ '° E w ~u ~ v 'n y ~ E Z
.oo'~'°~-°H~E~c~om.Em~E :c,~~WOOEm~mA W W o~o~E
W$'oa~°$o~~~°~=Z
m o m a .$ a a
~ H y, ~ c °~ ~ $ $ o~ n o~ o ° ~ r ,Q~. '° ~ ~o v o 0 0
0 0 $ $ ~ u. n o ro ~° L ° ~ o °' o °' o ~
O ~ N T O d ~ a .x0 ~U, ~ ~O, ~ ~ N O ~ . ~ % L 'd T T O T T N N C v ~ p ~ t
,E ~ O ~ O ~ WL
U.v w E °.m c c~tn~~H$DM~ ~D.v~~~~~~n.$ v mini am.da oix °x
30~
O N ~ O ~ ~ crO m
r- ~ N n ~- O
N ~ O ~ n ~ ~ I~ O e- O !N0 r O O r O ~ O~ N h o0 ~ O
m C7 ~ ° ~ rn ° U o ~ ago 00 ~° $ m ~ ao~ ~ u°. ~
U U U
Q . Q N ~ N N ~ Q N J K N t~ Q N J 7 Q < O Q
ao o ~c o ~ m r ~- a o r~ ~ cM~.
O O M~~~N N MM ~ ~~MmCOD ~M
? O M
c~nn ~'ncv~aa°°o c°~n ~chNV v~~~$cmo~ ~'~r' °'
r M M n m
r _ _ ~ N_ X Z N_ N_ U h
mmmm.N b mQ' mmu~'IOmMN OM ~ m O
N nVCJ NnNNO O ~~' NrrNO r _h O O
~ Q I-I-U" ~ IU- IU- ~ FU- m O °~ ° U U U
g -~ ~v,~~~~ m ~,~~, ~~~g~d (UQ ' O ca~5 ~ 'da'. .
H~
O C9 U
aaZ ~_ Q ~
~ ~~ ~~ ~~ ~~ m~ m~ m~ ~~ ~~ ml x~ _~ =I
m mm mmmmm m mm mmmmmmm mm m m m m
O t9 O (9 c9 c9 c9 (~ t9 c7 (~ C7 t9 c9 c9 c9 O C9 c9 c9 c9 c9 O t7
v
'ur~ o ~ r°p cMv
~n ao n
.r v v
r O O O
8
106
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
o m m m m
m m
m m m m m m w ao m r' ~ °' m m N m oy' ~
U CJ °> a> m m ~ ~ H j. °' ~ or ~ r > °'rn E= cv a ~
~
4 Q ~ Ii! Ii! 0 0 0 o m a U Q a o > > Q Q ,b U ° a? a,
0 o z z z z ~~ o ~ a~ ~a a ~~ ago
r r M m N N N Qr N lD aD ap (p O r f~ M ~ op y. m
f'7 O O r N N N N N N ch r r N N 41 O U N
(h N 4W n CO f~ f~ 1~ m In ~ 1~. 00 1() O 1~ f~ (D t0 M
r_ O N t0 m N N N N 1~'> N f9 m O tt d' m ~ Iff ~?
h N ~ ~ h N N N N r ~ N m O Q ~ Oo ~ 1f!. op [ _ t _ p~
N (~') V' h f~ a0 0D a0 OD OD O m c0 f0 N O V V (O N. et ~ t0
m m m c~1 M M M M (~1 ~d V' M m C~ fn r t9 fn M ('~7 V' (n M c0
7 ~ E E
_U _O N _U _U
E E ~ N ~ E N E
N YO
07 Q O ~ °~ ' ~ N ~ ° J 01
EE ~o-~E ~E'_U'UO_O ro
W v) W N N N W V N C N N C ~ ~ H H f0 N
C C C C C C L L E C = L t ~ ''-'
v a~ a~ v_ v m m ~ d ~ d a ~ E m m
Ln N~VW1 N W %'0~N.O11L17 ~,~~7 ~~~ ~N NlC
d n m a~ 8 $ o o '~ m N f
= c
E E ~ E E E ~ o N c2~ E m ~' N ~ !9 ~ ~ a c'T m
U U ~ 2 z i Z = S ~ j ~ p' U 2 U U a a !L Lu ~ m m U
ro m
m m
x ~,
m~'o No.mcnr~ $~ zZ
> ~ _ _ _ - cn - _
O O ~ O
X X ~ C7 (~ o ~ ~ ~ ~ ~ ~ ~ C7 U' ui 41
Z Z U - U tn m ~ oo ~ Q~ Z Z
Qccl~mu! v ~ UU
N N Z U U m ~ U1 ttl t11 y m E m O Z Z
m a~p~lzu ~~m~ ~oo''or °'a uiw and
c c v ~ (~ C7 C7 N a~ J > n a
J ~ I °~ a' Z E E
a a o 0 o a a a
o,N-r'ig~f~f~/7~y'°~-as ~~~° 8z~f~ ._
2 Z Z ~ m y O ~ci U ~ ~ Z Z v
~ .Q y ~ O $ U' C~ C9 ~ o 'a ~ a Z ~ r: ~ ~ m H
H a ~ a N °i of ~ o Z Z Z o v a ~ p p E E m
c E c E ~ o a a E U U U a i m 't J ~"~ m m m
Ol U 01 U ~O aOD 0~~0 Z x W W 111 ~ O E C dj ~ (~(j ~ v v N N E U
D ai D ~ ~ ,° ~ J 7 7 0 9 E - y ~ ~ o o cg a
°> > °> > c ~ ~ v UaJ IaL W ~ ~ o ° a ~ ~ ~ ~ ~ ~ ~ m c
$ '- d
'°N'°~m o~o~~o ~ ~ ~ ~'c °~~Evcmo m~°'Eo'cc
°'~ .n
m ~ C $ t-S QU Q~N N N N O9 O~ O ~~~ TII ~ n~ p.C C X~C NY
E ~ ~ b y o~ ~ ~ ~ a ~ ~ N N N ~ O t I~t1 ~ y -' c ~ ~ ~ E ~ c c V S 3_ E
~_ C U C ~ ~ E m E O Q L N N N ~ E U 2~ jj ~ ~ ~ ~ ,C N .C d ~ U ~ d
E '° ~E W '° Q m° E ~°n E ~ ° (7 U U
~'_ N m C7 'E m c "-' o -Q a E c c $
N N 07 m~ ~a~O~~~~~L7~L7UV ~m7 ~l0
ENE.°~n~.ovc~ca°or vdvdv°":~a~~zE:°.a~d~n~~~
oo cv mm
o,~o oL° co m >,- cgn
'c ~° 'c Z ~ c ~ ~ ~ E .c '~ ~i $' m ~ a M ° c O -oc » $ ~
°' E ,~ ~ ~° ~ L = or .6 _
~ ,,&, o ~,~ ~ ~ m ~ a '= m n ar a d n ~ d ~ ~ z ~ $ ay d o E ~ E N m m ~ v o
~°
a c ~ c Wn W u! ~ to ~. ; °' y°d ~ ~ ~ °~ ~ ~ ~ Z
'° ° a '° d c' ~ uU1 ? ~ .o .n
~ ~ m M W ~ ~. C ~ N N 't7 .n N L [yJ a ~ N 'E L ~ 'g 0.' ~ ~ g ~ ~ ~ y f
c °cNU° o '°a$oEoaoE'~9~oJcvo~~~EU' E~EE Ea'
E ~ E ~ E ~ ~ E ~ o ~ o ~ ~ o '~ a ~ o .~ o m ,i °., ~ ~ ~ Vx c
t~°c ~ Z Z v
U ~ U m lit ~ i a_ i d = o m Z ~ x o x o a ~ n o cn U c x U N U a a a a to to
~ D yr U
v~°nnn °u°m°° ommo a°o°m
m° ~p
NW ~ ~N t_D°~ !'M~~
m m N J J J U U U ~ IL U U_ U U c°0 J J aD am0 O O O
a a a a Q a a a a xa a a as xa a » dw ula
O O O O M N ~ OD m
C'J <''> V O O O p Iv m G7 N m N ~O 47 m m m i° d N
n N ~ a~r- ~ O O O 1~ f~ a0 O ~ aD N N ~ N N ~ ~ O (Op
O O O r r ~ r ~ N ~ ~ r m ~ r M M N M ~ M
O O)
p O O a ~l ~l ~l ~ M M_
O O IW° ~ ~ O O O ~- V a0 M ~ off ~f1 fp
h h N ~ ' D u7 ~ u7 Z ~ O °~ (O J -~ ~ b O 4.
N N N ~ Q O O O O O O d' O U a a ~ ~ m M ~°
0 o a m ~ t~ U U U N U N ~ U ~ ~ ~ °° °°
x x z ~ a Q ~ Q UQ ~a_ a » o$ o
FN- ~U' CN7- N . C~ C~ C~~-. ~ C~ ~cy i~~~' C9 C~ C~ ~ ~ ~ h f-: V_
mt~112~2 2ZSmm and m ~zZZ~a a?
ml ao o~ ml ml ml m ml ml m~ ml ml ml m~ m~ m~ m m~ m~ ml ml l ml m~
o ~ c~ c~ c~ o c~ ~ c~ o o c~ c~ ~ c~ c~ 0 0 0 0 ~ ~ c~ o
No m m
O r O N O
r OD v- r U1 r
O m_ C7 Of N t0 OD
N N N N N N N
107
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
o~ ~n ~ as
w rn a> u,
I ~~ ha»oa»oa~Mh °'~nha~ o°' °-' ~ °'
° °' W °' ~o~
I h , o~ o> 07 0~ rn c~ o~ o~ c77 Orn °> om o> ' a> ' °~ ~
o~ ~ ~ o~
' g' "o>°' o.~ c ~ c ~ ~ ~ c.oic c~ I= ~=o,' ~ . o~
I a ~ Z ~ ~ -°,~ ~ ~ ~ ° Q ? O ~ ~ ~ ~ ~ Q Q ' ~ ~ ~ ~ ~ 0
3
o r ~ et O ef ~ ~ h h (V o eb V tn O O) r d7 h
01 N N c~ N N r N r N N r O N N r r O N N O e- <t e~M- r
I
CD O r W h In r tD 07 OD h O ~ (U ~ O ~ O N t0 t0 f0 V M
h ~ O r h O ~ r O Iv ~ is O °> et h M 47
r ~ N tD O~ t0 O O M a0 tD r O o> c~ N O W °> ch V W st °! c~ ch
~n
I t0 CO 07 OD oD t0 O ~ N 0D O O ~ O) O 00 !D V' tv h N CO ~ t0 D) h Q7 r h
M G7 01 O O c'rl fD u~ M C~ Q7 G7 O> r 07 tD ch M c'~ 47 V V ~o~ M ch Cl '? ch
E E E ,~ ,~ N E E E E E
E E E .o o ~o $ v ~ v ' N ~ $ 'n Q Q
E E E ~m ~ :? u, E -° ~ E
v~ m ov w of o. a n. a rn as W of a o U o. o o ~ .n 'rn a
E ° E E E ~ m ~ °-' ~' E E E E m G N m ~ ~ E ~ °' E
.~ o
C U C C C E E E E E ~ C C C E m ~ N E m m ~ E ~ 7 E U
~$' m m m .~ -'c c c -°c ~.' m m ~ E $ c o E E '~ ? 'c _o m
'~ 2 ~ 't5 ~ m m a~ H v ~ '~ v m m °-' ° m ~o 'E d F~i v v
~ c m m m ~ W ~ ~ ~ 3 m ~ a°~ '$~ ~ ~'m Q ° .m ~ :c s ~ m E .a
~' E
c c c c a a a a a m c a -$ a a a m a o m a o
O ~ O ~ O ~ ~ ~ ~ ~ ~ O C ~~ ~ ~ T E C E $ p p Z' ~ ~ ~ ~ N
U ~UVU~~~~~mU aUUU. gD ti Z ~D O U ~t~ U ~m
m
N ~ C ~,.~ ti!
O m ~ O a0 Q
C7 ~ O~OVN'. O' t amhd' N ~~ ~t<'O
a m s ~ E o. N _... ~ a x o~ x
07 01 O ~ [l~ $ H ~ ~ ~ C N ~ N
- ° O ~ 111 ~ U
m g U G ~ 'J (' O .-. m G m G
c ai ~ '~,: ~ '- . du _ ~ L °c Q p °o' '° ~ ~ ~ O
a°°o 'E° $' ~
.L m n °' "' ~" w ~' m c °' a ~ W c ~ o w ? °n °~
3 °~ v~. : _.._ _
E o~EcSi 5i 5i ~ v, cNC oQ~ ~ o visa; °,'$y-
Sdg~E E c Q ~Q~m o m N ~ 'o~E ''8::E
a H a m ~ $ ~ $ ~ U R ~ Em ~ m ~ z ~ Z m Q $ °' ~ m °' ~
u, m~'~o.m~~ ~ ~ s o.mEam ZE v W$m dv~
.c ~ ~ ~ m a H a .° m ~ N ~ ~ L ~ ~ ~ .:-: a °~ O °' p H
m
o, c ~' ~ ~ a E a m '' ai "m Q o ~ ~ ~ a z ° m ~ '~~- °' .. ~ Ti
0! F ~ ~ ~ $ ~ ~ ~ d ~ V d G Z ~ m m Cf ~ ~ ~ ~ O ~ 9 G $ ~ .OD E
:E o '~ ~ N ~ N ~ ° ~ o f" ~ m m N a~-n c ° W = ~ ~ ~ m
c° ~ ' ~~ ~° ~ ~ d
o ~ oa m~ri~co~ d~ ~Q ° N Eoo o a~ E m U cm.~c~~ ap-2M
E r E 'E m = -'mo = ~ = c ~ °° ~ E E ° s ~ ~ a ~ ~ IUL ~
'~ c ~ °' N Z E °~ ~ _
N7m NENEHE O~ 7 Ea.~Cr ° jrEZ o E V1N E _tnN
Q' ~ Z V G ~ O O~ _~ O $ ~ ~ m ~ U a? ~ m N ~ J O Q 1p O TJ ~' V '~R O $ U C M
$
m cE~S o .coQE ~ °oc~~ a~~=$ 'Em? ERo
1-a ~5 0 '~ E -°o m ~ m ~ Z ~ a: .°~_ ='° m O v ~ Q ~ U m
N in ~ :°. m L~ o ~ m _o
vi N oW ~ a..ma o. a ~ or a ~ w o~ a. a U ~ V ~ d W °~ rn E ~ m m u. 3
~ ~ $
$~~m~d~m~E m msZa'~ Ugh y°c °c°°' ~ro o~'3d
_ W E ~ E E - m O m ~ ao n_ - m m ° E $ r- N o
my ~.m ~ ~ ~-'c-°c ~ c N d d.?~ d c a~ ~ a Z_.'~c~-'c E E° m d
° ~ ~ ~, o v~
'G v Z v m ° , m m m _~, ~ m ~ U m M m O E = ~c °c; "- 'c ~'
W O m ~ N, N m !0 U O d: O O ~ W O ~N C m ~ C1 m
d N G am ~N m~ W m W W ~ m a ~ ~ a W N Oi O U ~ N ,.°, 1- ~ L ~ .C a ~
E ~ E
O
E m a ~ a .a a a a m mg '8 m o o ,_, a c a m a
~. Q1~1'Q TNmc~~t~'-m'EUVI~Q~~'°~oEi.,~
U v ~ U m Q ~ ~ ~ ~ ~ m U VJ m C7 V ~ ~ E ~ o~ a o m ~ ~ D ~ p ... U co ~ a7 U
m ~ ~n
N M
h N a0 N op N h tv r (~O h r N h ~ ~° N ~ n
n N O m ~ ~ ~ op h O h ~ ~ O op ~ N r Or ~ ~ N O ~ W ~
i r o t~ n t°.. ~ r~ p ~ ~ ~ .~- ~ ~ d' ~ o .fir U i
> > 5 U tL N ~ N ~ N ~ X ~ ~ )- Q J Q ~ ~ ~ d Q Q N ~ ~ N Q
ovovo
r O V !~ O r O O r N O l0 N O ~ O N r r r
l'9 r r O r ~!' r et r V N ti' O ~ O h ~ 07 r ~ ~ ~ M
O N t0 ~ O CO f0 0O f0 CD N r CO ~ tD W N c0 CD fp N h ~ ~ h ~ t0
N PO r (~ M c9 f~ f~7 f0 (~ Ln f0 W N t0 f~ t~. t~7 CO l~7 Gp M r
f4 !~ 2 N
M rnaroa t~UhUh Wn Uh N ~ h
O h ~ O h N M N N N V IL f0 h ~ N r _O h ~M O a O
j c~ ~ ~ ~ ~' m r m ~ u~! ~ N = o m ~ c°~~ o i° cw ,~ N '- 'hd'
j, r~
r~ U U U C9 U
C~ Z C~ fr O I- UJ F- U 1- ~ (~ c~ J Ur 101. f0 ~ U ~ ..~~ o 'r °m
U ~Umulg~~~gopU °-mUQ ~N t~! ~, _,45,d d 4
r r /- r r r r r f- r v- r /- N N r r r r
a o~QQ aaa ~ QQ ~ am
m cYmma~mmm~0~ am~m mm ~ t~u ~Z ? m m~ ~ mm
ml m~ m~ m~ m m~ ml m~ ml m) ml ml m~ m m, ml ml ml m~ ml m~ ml m ml ml ml ml
mi m
U n (~ (9 C9 U' C9 (~ C~ U' C7 C9 (~ (9 U' (7 U U' (9 C9 C9 U U (~ U C9 C9 (7
C~
N
N ~ ~ ~ ~ N 'V
N M M ~ M M
108 g ~ ~ ,
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
o~ ~n rn m m
m of ~ o '~n m ~ m ~ w
°' o °' ~ °~ ~ t= m ~ c° U °~ °~ y m
~ ~ ~ V m ~ ~ U ~ m rn
m
Q °' v~ QU c °'cQ do- c c c
~a' ~a' ~~ o, ~ o~oa', ? ~ in v~ _ ;o ;~ ~o ~ ~a
ch r~ <b N ~ N v r n ao r M r o c5 0 0~ Q ~ m d~ d~ ? cb o~ m
r r r r N N N r r '- r O N r N r N N r O N r m O r- N m
N r 1p m I~ ui N~ (h m 47 CO N 07 m N mN N O r- O m Ncp
fh W~ ~~ N00 ~N vr-~~~~ aNO, 'r0'_ ~~ MNNtnO_ am0_O ~ aOD
°~ (O r N N V m O~ (p ~ _ - m O ~ O m m m 07 W Q1 O O m N r
O) m M m sf m M m m f0 IO ~ M m eh m m m m m O st IfJ M 10 m
7 .~ m W ~ .~ ~ .~ n! j l6 j !I1
_U N Q y ~p a0 C1 ~p N N U N U N
E ~ _o '> N N ~ ~ $ _ o ~ ° E t_ c E
O N ~ ° O L O) ~~ v
m $'~ N 2~a n °w 'N° ~.a am v is v~ a ~
d H ~ d 3 ~ v. ~ R .~°. 3 °' E E ~ E
m
'=G ~ ~ ON y.~.- V 'O C ~ 7 7 7 C G E U 3 7 3 '' ~ C W = 7 >
U ~ C 'O. ~ V N E 'V U 'F~J N f0 ° O N 2 C1 V G ~ ~ ° b
N ~ O ~ .W-, f 1~ ~ ~ O O W t6 f0 41 ~ 3. L ~ Qf l0 l0 ~ 'n p ~ f0
C ~ n Ef N C ~ ' 7 ° .O ° O N c O ~ D O O C ~ a O
Z' ~,m o0o m° E mo2B..~U.E ~ ,-c mn~ S.~U.U~ ~y ~ v~
U ~i~ v» UU tUZ a~~~= Z v! ~Y.°~c ~~~U UO~. U ~O
U
N ° Q ~ c p m ~ (V ~ d
a ~ E t ~ ~ ~ ~ V ~ ~ m c °' ~° m ~
8 ~ ~ gi ~ ~ ~ N d ~ ~ ~ $ o~ ~ ~ ~ E
J M. ° E ~ N ~ v ~ ~ ~ ~ N ~ ~ E E
cEE .~~c E Z°d m ~ ~ d~ ~v~ ~ .°'n ma°', a a'Zo
~.. m.n o t '~'>~ m ~° A ~Z nY- a d m c ~ , E~o
of ~ '" .. '. a _o n ~ .n Z N ~ ~ . ~ ad ~ E ~' ~ °' ~: m Q °_ ~
" ~'W ~ .
o °' E a ~. ~ H ~ N N~ ui ~ 8 ~ v ~ O ~i E N ~ o w ~ E E
m ~ c a ~r ~ Or a j o ~ d s c° 2~ ° ~ ~ °c o Q
ar ~ y ~ ~ ~ ~ ~ a°o o ~ ~ o or a~ ~' amn a o 'o >
o. r '~ ~ GyL ~ v~ o v ~ a a oW° O
on
4'' m'N°~ " ~~ mE a~a~ain. O~d g~E d O a~ocn
n o c c n o d o Q fn W 5 n d y c o a >
o~~Ep 'g~~° rn m~j E.~p r°.LCai~ 2°':°- E~~c
~a~° c Eoc
C O U O = "°' = C ~ ~ U (,I N m N G! m 0 IUD W ~ N V C O~ ~ E ~~ U
f0 U
~° ~ > ~ ~ o ~° o i. _ ~ > d ch~ o ' o _ E ~ ~ a~ c > o m d o >
E Q
m ~ c~ v Y s r r ~ ~ .. ~ ~ c'S ~ c c .t E~ c 't3 ~ ~ m E E E ~ ~ Z
~-mmv BEN pe. '-'n m$a~rtn_rtnN~,°,°LW T m,~' mr and t MoD
~i~.~o ~~'r' eEno aU_ H~EmwmwEQj~c~a~_~EE ~o ~
U N ~, V ' d ~ ~ ~ 'N C! 1p E ~ E ~ Z W U ~ U f71 N N ~ ~ N U N
°'o '->EY Hm Qc'~c»cg~°,Op°mOpE~mo~~.~~~~E ~c E ~OY_'>
3? m~ ~J~? We ~a rnL-'~~E~EoC°'c°aN>°nm~mL°? n-
°' ~
E ~ ' ~ :g ° cv m % vi m V a m ' ' ?~ .c z s Z ~ m o '° a o $
? ~ d E ~ w E
H m ~ ~ ~ ~ c~ °' 1 m = E E E ,~ U' N G N E ~~ o ~ a ,~ E E E z .~ ;~ ~
E p° o
N ~ ~ tV c so o a ~ c z c z of ° E w m 7 7 ~ N f0 N 7
a> 'a m ~ m o m -c ~c ~c m a> - m N o c ._ .c . g3 m c ~ ,c Q t
W ~° ~ ~ c rmo, o a~' m ~ ~ c u~r ~ c ~ ~~ ~. ~m Z ~m Z c°'n ~ $
~ N a o~ ~ ~ ~ m ~ m ° ~ ar v ~ c m
~ 0 8 d ~ ~ Z ~ m ~ _ --° u'1 ~ .d 8 8 8' ~ d ~ d rN- °' ~ a ~ .
gQ ~ ~ E ~~ ~ H ~~ n $ O Q m
U o~in t~i~ HUU oWS rn0.~~~2~S~tN~J~t~Y~ a.~~~~U'c~Ua ~U S~~O m
O.p M N~a~N
007 N O ~ ~ ~ O n In O m ~ r ~ ~ m O ~j N O) N N O N
o cmn° ~~ o~ amok c°~r~W~oo o° r o~ ~oMO o0 0 0~
m m .~ m ~ r o C'J m ao D ~ U U ~ ~ ti o D .- u. ti ti ~
Q N Q ~ ~ Q > >- Q X N < Q Q Q Q ~ Q N Q r Q Q Q < Q Q
_ _ m
n m m ~ ~ ~ r 1~ Om ~ CY ~ ~ ~ h N 10 ' O ~ ~ O
W ~ ~ r ~ (r~) ~ r VO' ~f.? ~ ~ ~ f0 (h N '°V' ~ N N V N N Im n
[(/ m O N h m
a th LL tr0 O M O t0~7 ~ 4~7 N ~ ~ O O ~ ~ ~ N ~ m O ~ ~ O N
m ~~ j~ w~ ~a Q~~~Q Q
CD c'7 U CJ Q ~ d ,cS', ~ ~ N N M ~ IL
m mm >w Zm d~ mmm~i z W a~ ~m~m mm ~ mw
r rr rr rr rr trrrr r r rr rrrr rr r rr
r mn r
M ~ m h
o ~N
M fh M M M M M ~ °
O g ~ ~ ~ ~ ~ ~ O
109
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
0
t ~ ~ U I=F= j m ~ f= m U U > I=~ 1=F=
U e ~ ~ ~ ~ H
m y
L ~ U U o o, > U c u)tL o U ~ U U
o > > w o > c U
1u > > rn o
-~o~~o?-~ o o z ~z ~a= o z o o zo o ~ q q
N N ~ O r N O ~ N N ~ O O N ~ d7 O
O O N O r ~ ~ r r
- c~ N O
r r r r r ~ r
O 01 N 1fi4) aDN a0 O N O 07N M M
O) h ~D t~ O)
l0
f0 M M M M tp cp N M N N 4) 41a0 f~t~
h O ~I7 ~ M O
~ h N
N 4 O) fhM 1~N O O 0) 474) V O)t0 (~f?
r (p (O 4) h - N
N O -
~ O N O t0t0 n f~ ('~N at (D st4)
4 aD tvi (O f0 ~ M ~O M
h M OD ~
~ 'Q
M
M
7 ~t t0 M M M ~ M ~ M M M
M !D M M C
t~ V
_M N !/! N
_N
O O Q O O
O O O _O O
O O
N ~ U C V ' W l0
V ~
O O) CT
> m t ~ ~ ~ y 'g b
'g o C
C
~
u1 M ~
fG
C ~ 'C d m N ~ _ ~ N d E E y m d
d C C ~ ~ ~ ~ ~
O ~ ~
" '~' W .~ .~. W N '
b U ~ N N N p ~ ~Q f0W
J U V ~
W
~
IC GS b N N E9~ l0 ~ N N Ol n n td N V!
N N l0~ H x
C N
O O O O O O O n ~ Q Q O O Q O O O O
O o ~ O G! Q O
b O
T O O O ~ O ~ ~ O ~ O O
O 7 ~ O
O
>~ >. ~, O O O O
O a U7 _ = UJ
m f~
_
Q ~; z
c '~c co a m
(NO NN ~ ~(NpZ ~ ~ ~ _7
~t O ~ 100 ~ ~ N N ~ Z I_- ~ ~. #_ m m C
v- Z fn fn C1 QJ ~ O N r r
c '~ c c U ~ o m ~ ~ E co °? ". ~ ~ ~ ai ci
ro ~ d a a ~ ~ a a. ro W IV a c~; cv ao c a Q
~H,~~ cmU'U' 0 OrnUa r r m~
'~ N :~ :i H W U ~ ~ ~ ~ O U ~ ~ ~ E ~ N N 0. -H ~: .1N '~ n ~ 0' m
d °' m m N .o ~ d a N N d m a o c n ~ o. c~ m o al ~ d E a E m
E ~ E E '$ n 2 Z I I E w '" ° d m m ca m c .~ c .4' a In 'n to n
o c o o T $ E - - Y Y o ~ a E N E '2 E 'n o n o o. ~ ~
d ~ m d C y % U ~ ~ NI NI ~ ~ ~ ~ ~ O M a a O y V a M M ~ f00
OI O) O »p N Z Z ~ M p1 I (p V ~ Y ~ ~ O r N
mN M m a v c ° a~ U U ar '° ~ a o~ ~ ~ ~, ~ a~
nM nnQQ H ou W ~ ~ p.aU ?~ o ~~ 'off ~ ~ °.7 °~ U~U ~
C7M U U VU~NW W ~ ~_ ~ v m m °'~ - ~~ ~S~ S~ Ev E~~~y m~ d
> m » c r -o tn V! o o > c c°; e' ~ o t- o t- .- ~ c _ c _
~~ ~o~, y8~ ~ 'cue t~~ ~ ~m ~ a0 NN C~ O; ~~ ~ of of U d ~~ ~~
M U M M m m o a~ ~ '? n ~"~ a cc E :S v o c ° U ° ~ o E tn E v7
a ~ N c~ N to
2 m S Z ~ v N oo ~ n .- E r Z ~ r '~ ~ E ~ v m X tn X tn ~ o cn o t~ S m r ~ r
~
O dp C O O O NO t p O O O O O C 0 '~ N d U V ~ L.. O U, O (~ O ~ (' ~ (~ N. ~
O (~ O ('
7t0?777~~00 ~ ~ ~~ OCOCe'E.OOQ7N~O~O~O~ONOr~~
d ~ _ar ~ ui t ei .c t~m t ? ~ .~ ~_ ~ ~ ~ ~ ~ ~ a Z L Z 'u c Z c Z
c°~. ego t Z~ r 2
E H a~ E E E E 7 ~ 4! V N ~ ~ $ v~ E w m~ ~ m ~ ~ ~~ rUnU' vU,U' $ mU' dU' m~
mU~ ~U'
c m °. ~ '. ~'c c ° ~ d a m a. d $ ~ c ° 'm N yj ~ a' .~'
Q .~? ~ ? acr Z ~ E Z E Z d U m z v z
~'o.E o~~E' m T'S.a aa'a Ta ° ~'o.U Tc ~Z c nU'a.U TmU mU'nQ nU aU
a'~$aaaaol '~d'~a'~'~ oN ~W h~o~.~o~~jHWHWpp.tZtl~.lZL~c~LZIJ»W
° 2~ q o _ ~ b E o ~ ° n o ~R ~ o (~ a a n n m ~i o S o ~- n o ~
o S- o m o ~ o ~
oa~8.28.o~',>°.8to~o~o Lo ~~o~~c~~~~owow~QtUu°wo~owotau
=o~~~~Q n= °_ ~2 ti~2 ~~SD_tn malW =M=t°2t~tnUtoOtO=22cO=(O
00 o I. ~,,,~. 1O n r' o
h~007~m~~N n~~~~~~MI~PMpO~
r 10 O N O W O) IfJ b !~ M M M 07 OI T O M M Of O
N ~ N ~ ~ OU ~ Q O O M O N O O r N N M O O M O O O N N
as any°a~~ a a Q as aQa N aaQ a a as a a ud 'd'
COP~~o~~~ ~~~aMO~(NDOOtNOtNO~ rN00«cn0
c0 ~ 1~ ~ (O ~ ~ (O O) Or i~ h 1~ N t0 t0 M a0 c0
ID M M f0 N ~ t0 t0 N 47 c0 O tD eo e~ oD .- f0 t0 c0 N N ao et ~t
.- r- r N r u) r N t~ M M r N N M N N do r r
M M
m o Y Y r n
N n
m cn D rna~ m r cc r p r m m ~ ~ m
n m ~
m
M V O O p _ O O M ' ~ O M N N
~ Q n a O
O
~o ~~U' U U o c~o oU O NN~- ~ DU U o u_uo.
U Q ~
~
~ a ~ ~ ~ ~ fO (V (n a Q CV fV
~ ~ fn a
,a,~~ N
_ _ ~ ~ ~
~ _ ~ ~ ~
~a ~mm~m i z a ma Via= m mma z m a z ~x
.
mi mi m/ m/mi I I I I I I 0 I I I I
mi m/ m/ I I I I I
m/ m I
C~ c9 (~ C7. . m m m m m a m m m m
U t7 c9 C7 m m m c9 m C7(~ m t9 c9m
C7 C7c9 C7 m c9 U c9
C7 c7 (~ t9
c7 C7
U
r
0 r N ~
4 C) a N a r
7 ~ 4) 4) 0 p
1(7
41 O 4) [~ ~ O
O O O
CA 02571917 2007-O1-08
WO 01166573 PCT/IB00/02035
rn rn oy'
m °°~' m°~~'o~ W ~~~~° ~ m ~ ~m ~ ~m~o~,
o~ o> > w a °' ~ Q > j Q d Q tUU UUJ y ~ ~° t .b c ,d
> > Q ~ Q ~ m ~ ~ -~ ~ tn ~ D D Li u. ? ti ~ '~ Ii ~ 1i
Q Q .p Q h -a '3 r- ~ r~ c~'~ c'~ N r. o r~ co d .~ cE
N N N ~ N a~ a0 O r r O r O O O r r M r r N r N N
_ _ O
O O ~ W h CO 07 W ~O W CO <D M t0 M O M W
O t(7 ~ N y0 W N O7 N O O O W
M ~ r N N f~ ~ ~ ~ ~ I~ ~ N M o0 h ~ ~ O
O O Ifi O) 1~. a0 V 1~ M O m O 00 (D m W O ~ D) t0 W O c0 a~
V' ~f M m M M n M M M M f0 M M (~ Q7 O O D) M O7 r l0 (D
M _U _U U_ d ~ _U ~ul ~N
ate. r m j ~ p ~ E N E .' O
m ~m._ ~dd~°_vL° > >
o ~ n ~ °c~ n a a n ' n ~ o~ o~ ~ o~ o~ a
R A °-'_m~ E °-'-''-''°'o°~ E E ~E E EE'E--
N 41 C ~ d W = N 7 7 7 7 ~ 7 G C C ~ C 7 7 = Z 5 7
E E o .c E E .g ~ 'c 'c ~ 'c ~j 'c a> m ~ ~ o ~! f~ ~ ~ 'c -
N m 'a d m o O p~ ~ m 0i w7 ~ 47 ~ 'a U V O O m m
0 0 9 ~o ~ a o a .n a a $ a a o a ~ ~ a ~ ~ a ~ .n
0 o E ~ o E o° c°~ v °v d S E E ~ Z' ~ Z' 2' v a
o ~, ~ E >, >. >, t,2 0 0 0 o c o 0 0 0 >. >.
O O 2 201- ~ m~~~~cn2S 2 U U wU U UU~~
NO t t Q
U W U W N r N N Z Z ~ ~ j, N ,Q
~D W
~U' ~U' NW = > > Nm Nm d ~m
O O W m (V T ~ (~ (~ W ~ ~p N 'O In N
H
~a ,:a ~a d (O m Y m ~ m E r C
U C C O
D 2 0 Z _ 7 N N m ~ 'C O C o aol
C9 C9 Q w E E _, d c. _d
-. J Z_ J Z O (L' C ~ ~ ~V N N N ~ . O ' :v :A~
V1 ~ o U N U a o » » o Q Q ' m ' vTv: ' m W m m
°~ Z Q U ° hi ui Y oa ~ ~ v ~ .. ~ -o n ni ui E
V W U W Z W V E E t E E ", m m m -oo W ~ E >,
m C~J m O ~ O C C ~ N_ N_ C ~ ~ C L 'O ~ = O
~ W m W ~ = v rn ~ W tL 111 rn b ~ rn v W T ~ n
C ~ C ~ ~ ~ O ~ ~ b Y! ~ N 'O ~ O N ~ H
O O U Q ~ N N y~ ~ >, H y y
V ~ V ~ ~~ O W V a D. L (V N m ~ ~ N OE L H ~ ~ Q N
tn Q m Q a ~ ~ E E 3 N N ~ t9 'O ~ 'o ~o ~ E m Q
o m a m o U ~ ~ ~. a v o ~ a ~ m '° .: a> o m m ~ ~ a o E o m
o a o .3n o ~ ~ n o '~ c°.> > > N Q n m .4~ d ~ ~ ~ >. X ~ a : ~ ~ m n
> j
o $ 2 O c ~ o o ~° ~ m ~o Z w c n c n ~ ~ ~ _ a m r ~ a o ~ w
E ~ E ~ N Z N m ~ o m M ~ m O m ~ d ~ d ~ m cvi ~ ~ U m cv ~ ~ m o ~ .5
O j; ~ ~ v ~ c a Z 2 o N v ~n y so m ~ ~ ~° m ~ r m ~ ~ ,v~ S n
W JTmz~~~~na1 N !ON~f%1~M~EOE~~~W V NTWW~OC.~ON~N
vin~'am°'0.~~$ml-~c °' $»$o'$~on~o~_na-vu ~n~~; ~'ifQ»
$~a°~Q$~°rn'°~-n~~ZL°o~~~ ~ ~d~~°_v~otc c-
ip4o~W ~o~~p'~n~~s~mao'~o~
G C 1 0 N C N N m U a T m O d L F L I ~ v, ~ N n ~ ~ N ~ v ~ C j a
~ W ~ A ~ ~ W- m ° ar ~ c~ v .2~ c U m ~ >. c U E m
Eo.~Eo.a'Z~~?E~m n, 3»>$~cwc~»~E »~m~cE»m
m E o m ~ o rWx, ~ Z. ~ ~ _ ~ c ~~ ~ ~u ~~ ~ v m l? ~ ~U' E R > ~ c ~E
~° > ~° urn $ ~ ~ ~ E
o ~° o m o ~ '° H a c N 'E E a ~ a ~O 8 .'°oO o y o ~ W
,$ v ~ - E '° a ~ ~ ~ a ,EL° a a $
~'tre'NOc~ora-.°c E ~U.~U.U~n°oEaEaoyo~'~ c°W .00.2',
~UUm
~0~.0o~~~ina~~rn ~ a~ ~~~~i~~=Z=ZU m ~U ~U W ~UaOU~~ o~
aND aN0 h ~ M y0 y~ N Y7 ~ ~O ~ ~ (O W tD Y M r t0
O O m ~ r ~° 07 tp 10 r O r r N N ~ N ~ r In N N
N N ~ O r r O r O M M N 0~ N ~O 07 N 47
U U ~ ~ .°~ d ° o ~'. ~ °° o °°
o o ~ aNO o ~i W v o J a°°o
Q Q < NQQ Y ~ ~~l~J~a~a a x x au =l WXQ~
t0 N W W N N N ~ ~ CO ~ M h M N N N
M (~ N N M 1~ (O M ~ W l~ Q) M (D t0 O D) O W Q Q)
c~ M 01 t0 W N c0 (~ N t0 N ~ N W ~ W W fD et ~ V
r Y Y N V' M V' M M ~ V V r N N N N M N
~n O
N N N O> M N N (n
N
D O aD m ~ a. Q W W O '" N N U O ~ ~ O N
Q Q ~ ~ U Q t7 °o U U S ~ °o m m ~ U ~ J ~ ~ J ° ~
NU' ~ ~ p ~ ~ ~ ~ ~ ~ cn ~ iV iii U U ~ U ~ uJ U
'' a ~a~~~~~ ~ a a as a a~aa
Z S uNJ mZ~ mmmmm Zm mam mdmm
m~ m m m~ m~ oo ml m~ ml ml ml ml ml ml m m~ ml ml ml ml ml ml ml m~
O C9 C9 C9 C9 C9 C9 (9 C9 C9 C7 C9 C9 C9 C~ C7 C9 (9 (7 C7 t7 C9 C7 (9
N n (Op ~ N r M
Y' W r r r w- r
r- m n o rn ~ ~ m
v
m
111
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
rn m ~ ~ n ~ ~ m
~i ~ ao ~ o, .
rn ~ ~ ~ n ~ ~ ~ ~ ~ : rn ~ uy ~ o~ rn
c c w t c °' Q c W V ~ d c c w V n m c V cvi -a V ~ a> > ~ °~ ~
cn > > D ~ ~ ~ ~ ~ D O m m ? -' D O ~ m ~ O ~ W O ~ ~ m Z ~ a -y ~ m -a
ao ' ~ n ~ o~ n ui d? ~ ~ ~ .'t n m ~ v c3 ~ ~' n ~o m ~ N oo Z n v ~0 7 N
N N O N r u7 O r O O U N N O O U N O U O N N P N ~- a0 r N O Iii r
h r 1f7 O) CD V' tn 1n (h O O O m m OD t0 P7 N C) t0 (D t0 1n O tD
V N ~ ~ °~ fD tO f0 t0 h fs n ('~ l0 N M O ~ ~ ~ O N
t0 O M CO ~ 0D ~ 07 (h (h O O O N ~ M O r f~7 r
M N N c0 N Q (O ~ ~ c0 aD o7 ~ Of Q) n h n e0 V M ~ ~ N _- _ __
fD t0 !D p (D m l0 ~ ~ Q1 O) O) O O) 0) M f~7 P7 p 10 ~O M V ~ (D (O ~D ~ fns
N 4) N rn E E E E E E E
Q 'O ,O ~O ~p V U U U U U U
° - E ~E E E E E E w_ a; ar a'> > ~n
o ' ' m $ m ~ m m m m m m m '~ 'o~ in in
w
vmm '~°a~ L°u> »> » > mm m~m_c
a a a .a n a O7 07 Oi v) o) OD p~ m °~ O of d
'c m
'C C C C ~ G1
> > > > ~ d > > ~ ~ ~'c '= c ~ ~ ~ m ~ ~ E E ,N ~a
v 'c ~c 'c ~c Q3 ~ ~c -c ~ m m ~ ~ ~ ~ ~' m E E E c c .a w
a ~ o ~ a n o a a o a m m o m d m a a o ~ = a m m ~ o E
o. o o c o o ~ o o c c c c c ~ v. d ~ ° a a c E $
a r c i. a o E >, i. c ~ ~ o c o ~ ~ c o ~~, m E ° ° >, i. ~ ~
tn ~~ »~U m~~~U UU~U UU ~U ~1LD o o~~ ~p_ in
N
E E °' m p Q
a
tNOtND ø~ %'°~~N
r ~- E E E r ' o
M ~ ~ m .~ .~ ' g ~ v X $ ~ v
c ~ c c ~ ~ ~ r' °' ~ ° 5 c :3
m - a~ d
E a E E a a ~ ~ ~ ~ ~ ~° m ~ H a
om or ~ ~ ~ ~ '~ m o v
w ~ H H .', o.~ ~ .. "'m m ~ ~m Z . H m $
'~ ~ c .~ E E c
o ~ 0 0 0 0 o m ~ a o E a~
d m ai ~ ~ ai ~ ai o _~ ° ~ Wn o c o a
m ° ~ m E.° ~ m m '° ~ .ac- S _m E N ~ N oW' n.
p, d
.4? ~' ,a! a? E.~ '~ .E~amm N ~' z m
a H n a N 'E w ~ w A r r oo E m o CJ ~ ~ a
$i of o o ~ ~ L ~° !a°.~ O 'a'- mn °cmm c E E a
O O U fD C7 O ~ ~ ~ .,0.. ° m
N ~ °. co ~> N ~ n ~ ~ L t r ~ '~ ° U °° E M
m o to ~ > N '-° m
O n ~ ~ 'ri n N n '° ar m v o m m d ~ v a ~ ", m E ~ ~ n ~ ai ~ o
_a
Z a ~ p Z v z ~ E E E h E E E n c~5 .'°- ° !° Q a ~
~ m o ~ m
m uo ~ m ai ~'c ~'~'~ ~' ~'~' 'n E ai Ed~.~tzcn yxga~~ a
E c E !~ m o 0 o cn o 0 o cn 3 $ a Z ,~ O o n m m_ 'E O '~
U 'w 'w ai _ w Tn y w w > > > c~ ° ~ a~ w O 'w m c
$~ W U~ T TTw~ TT .,Øw V~CO ~ w°O~G.
O v .,0., 10 m ~ ~ d ' d L L L ~ L L t CN ~ ~ i0 E ~ V ~ N N Q ~ m ~ .'w'
'= a .ma a a a a a Q a a ~ ~~ ~ n ~ c v o. ~ E d ~ ~ ~ t~ o ~ ~ a a om. 'c A
o ~ -b
° ~ ~ o o E E C u' '~ o ~ m W E H b w Eo ~ $ ~o °' ~ D m ~ a E w
?~ E $
U .-
w C .C ° °_~ C .~C C1 7 7 '_" ~ C C ~ m ~ ~ .k 'C ~ ~ $- ;~j G.
~ G ~ ~011OOO0 W 7 7
C m (O m ?~
~~4C)~~1U°. U~lg~~~~~ $$ ~~m~~fn.°IOm~ °~~1~~ O
° ~ a °~' m a a E d .G d N N N ~ d m m N m N O 'C N ~ d O m m m
C ° EO
~i.ag~ i.~ ~i,~Z ZZ 2 2Z ~o ~~°~ ~op ~m E i.>,~m
in ~ g ~ m ~ ~ m ~ ~ cn O O O m O D D t~ U rn Q u~ G E v~ A tL O ~ ~ t~ d v~
v W m m
~t
c~ ~ X00 ~ 1~7 ~ 1~f ~_ ~ f_~O ~ ~ ~ O n ~ N ' Mp ~ ~f ~ ~ ~ cmV ~ ~ N t0
O O ~ m ~ N 10 ~ N ~ t0 N h O V N fn
J ~M N~a0001 OM7 NNO N ~n NOap ~ OW70i000
Q N ~ ~ N N X 7 N ~ UJ W W ttl W W Q ~ ~ D ~ a X N N Q
N O O M a~ s~
m V tN0 ~OaMDa~°0 N 00 ~~~~ ~~ ~O ~fM~O r Nm~ ~ (p0
V' ~ N N ~ M ~ ~ ~ N N N N N N N N N ~ M ~ N ~ ~ M M e~-
p7 m n_ 07 M V7 m ~ p Z O n
O~ p ~ ~ M et V~ ~ M V' M ~ Z ~ ~ $ ~ J o0'7 ~ M N d
M ,~jm~j ~~rh °~a> h °~~ V ~ m Z>-m M Q
D U o U U a ~ U O N ~ N N ~
U F- ~ N J F- J F- a' N ~ d' r . N ~ ~ a ~ ~ ~ U U O O
~n ~~ °~~~~ ~~gw u~wgw ww qc.o °om °~ ~g'°
rrr ~~ ~~~~ ~~ ~~ ~ ~ ~ _.°.
m ~mm amaQOm mmaa aaaa as a~ mmtNU w Zm~aa m
i i i i i i i i i i i i i i i ~ i i ~ i i ~ i i i i i i
m mm mmmm mmm mmmg -mg mm mmm m mmmmm m
c9 c7 C7 O (7 c9 c9 c9 (9 c9 ~ c9 C7 c9 to c7 u~ C7 C9 C7 c7 O t9 C9 c9 O c7
C~ t7
M u~ N o
hV ~ p ~ ~ r
O
r
p
O O
~L
IIZ
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00102035
m
m
m ~°hl~°°°'°~'~~ °'°'m mrn ~~
c ~O- ~m ~m~~ m ~ rn
mQ n~~~ ~ mv~ m 3 °a ~° a m W » >Q of
m of ~ v~Z -~~ ~ ~~v~QO»p~ Q Q o
m N N N ~ N O fh N N (~ N ~ ~ m N a N N M O ~ ~ ~ N fb lb t0
O f0 aJ V' CO h a~ V' ~ O 47 c>' O M O (p 07 O V ~ h c1D O O ~ aD
N OD h O h O O IA h W IW (D M (O M
O m M f0 07 a0 O ('~ O aD CO t~ 47 O N O r ~t ~ t0 W (D N ~ I ; t0 (O a00
O 10 00 h 1~- aD aD h a0 M N 47 ill O D1 O Oi Is h h h O in O t!7 D O
M M M W 10 M O~ O O) 07 01 1() t0 Of l0 M V' V M M 1t) 10 at M V' ~Y M
U U ~ ~ ~~ U O O ~O ~.. v
m m E ~ ~ ~ .fl 8 B .m ~ ~ N t ° v N N al
o~ of m V 'S m m m m ~ rn of
m m a a a ao o~ v~ 00 ow a vi ° - a a a o 0 0
m mw~?~E EEE E~ ~E a a ww3 c c c
C N ~ ." 7 7 J ~ ~ ~~ U N V ' C O E 7 7 7 m N _tG
E
m D °' a d d ~ ~ ~ 'G 'E v ~ ~m v m %m ~ ~m ~m ~m m m m m
v a f w m m ~ a a a a L ~ a W ° c 'c ~ $F 'G ~ 'G ~u' = t r
°c °c a o a m m m m m c o m o o ~ m °c °c o o ap
° o o °'
O NOImO~a~~ ~ ~ ~'~ ~~ T EC9Y~COO~E N N
2 U Z U ~ ~ ~ U U U U U u1 ~ U ~ N 7 3 ~ 7 ~ ~ ~ Z O D p
N N N
Z ~ L° ~ m ~ W m
Z U ~ C C m N ° ° fV IV (V
IL C r- N ~0 N ~ ~ i~ o c0 t0 CO ' a' O
> > ~ to m !~ m c m IL ' U r p
IOU d °' G ~ F ~ ~ r' ~ °° 9 w n n n ~j ~ ~ ~ m
.~? .a~ c~ ~ ~°~ I° '~' c c 'E °° a ao ao
tO ~ m A m m m m d m a E c m m m ~ ~ z o z o Z
E 'o c o c ~ E ~ ~ ~ N ~ E E E m o O o O o O
of ~ E a m~. v ~° cv _.~ o ~ m a~0 x U ~ ~ ~ ~' ~ . D U D U D U
d c d E ~o ~E ~c E ° m ~ v m °' d m 5i m v ~ ~ Z 1 ~ Z ~ Z
m m m o o~ m ° m x E Q G m ,~ E E E E ui to to
~'nmrn m W~'-° '~'~ °c'~ 'vid~mE H mddm m0 and
W c Q a m o~ d U a ~ d ~ $ co E n ~ m ~ m w °, m ~ m ~ m !!J
m EOEm °c ~'cc ~~ . ~d m ooO ..°w ma~d~ o o~
U'a~~~ME ~$»°'_mB ~ pE~ ~mmQ~v ~' EpEE°. N~ No. cud
mdiLmILe ~mCN~rmrmm U4 O.~Zmm a ' ~U~~ m~ m m
V a ~- i,Up ~ ~ yj N h °. O C v. a C ~ ~ (O d C ~Q O!'a m _U M N ~ ~
Q.' ~ ~ H a 1°p ~ ~ N .°
oW' v o v M m -~ 'o E r -~ ,o E 'E .c M 'o . ~ '~ m $~ ~p ~ c ~ n m ~ chi Z ~
~ ~' E ~ 'a E ~ a.
m
~EoE2vvN$~mN$mN 2.~ pwEl°Esty°inI22~QQ~. OT'00>.D
O Z O h fEn N C N ~ ~ C ~ 9 T vi 'VI C ~ p U m m w ~ ~ p ~ ~ 01 N , m L C t C
m ~ N
O ~ U ~ O O O O m N O O m IC O H _O' m O m m N ~ Y =~ p 7 7 p _O O U T ~ (~
° ~ m ~ ~p m
M tp m y~ . U U Ol r. y_ O w O (l7
f~ p.'°cvy~~~~,-GO;D~~c~.~~~m~HQWN~xv~~~ 'Lo'~~~QO~Qp~Qc°
'~°w~m~'°~$~'~°~8mn~'°°°Bo.o°_
-'°-,Qo.a.~~.~E-~o~'a~MO~~Mm'
m y' E E E E .E ~ ~ ~ ~ ~ ~, ~ E E m E ~ c o ° E N E E ~° ~ Q ~_
Q h
_m IL v ~ v ~ c '°c ? -° 0 o E ~~ ~ E .~ o .k ~ E E E ~ o ~ ~ ~
~ Q
C G ' .. G ~ C O 3 7 3 m
'° in m 'FS ~ ~ m ~ > > ~' -° ° ~ m m ~m m m E c ~ c c_ ~
°i ~m ~d ~d :-o ~ m. ~ o m E tit! s~° E w
yr O 'E m f W m m ~ ~ °~ ° r,, ~' .c ~r YS ' tS 9; . o ,~
° Pi ZS t5 2S ,_.
° ~ _ ~ °c o n o .° v ~ U ~ ,D m~ G p ~ U o ~ C 1°
p m ~ N d d ~ ~ i O p ~ a0. ~ O 2'
E a m fi m ° 3 ° > a a > a '~ ~ ~
o mN w >.>.>.~ ~ZZ ~vZ >, m i,°'m~E ~Q vtr~ $ eU'~ 00~-~'O mD0
=ZUmU~~~mmOOmWOw°L.~mm~nE~NTaW ov'i~~~~'°O~~ O~a~~a
aD M p N
~o N
of ~ °' to p a~ho ~ ~ ~ °~ ~ ~ °~ m m ao ~ i~~~ m
O ~ ~ O 1C1 10. ~ ~ ~ sf ~ c0 O W f0~. p ~ p r O ~ ~ ~ ~ p p p
U °' °' °° V V
Q N~NNt°37D tLU°~a u°~~ ~n ~
~°op~rn°~o;o;rJ U
V' D N pp p r M(p ~(~ 1° N N N~ 01 aND 0 M ~ M1~ M1(~ h h M M ON7
11~ 1f~7
N .p.. ~ ~ ~ M ~ ~ fhO a~N- N e- r N e1°- N ~ ~ ~ ~ ~ n t~~. M h
r0 00 W
N ~ M M M fD ,- ,
M ~ (~ Q O
OdOa O ~-N M hm M PN7
O ILOWm4'!~~ O~ O W ~l~L ~ ~ NNN~ p O O
Q ~ ~~~~~ ooh oS ~~ m ~~on~UU~g U Q U
U -U ~ ~ ~ rn W W. aD uJ W ~ In ~ ~ ~ W ~ ay ~ ~ M co
~n~aQaQ <aa a~ as ~ ~aaaaQaa~ ~ v v
z~zmmmm aam am mm m maaaammmC9 z
m~ m~ m m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~
v c~c~vvvvv vvv vv vv v vvvvvvvvv v v v
O WO ~ ~ M h
O ~ O M O
O h oD N
N ~ ~ m
O O O O
113
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
~
m p~~ ~ m ~ m ~ m
o ~ o~ W
a a Q ~ I= ~ (j ~ ~ ~ ~ ~ m o ~
a 1= ~ ~ ~ m f"
rn ~
~
~
tiW ~ ~ O O ~ O m Q ~ ? - ,
i ~ Clm~ o ~ Q ' ~ tii
~ Q ? Q
Q O
N N N N ~ ~ Q
O O ~
a
N r (~ O N ob ~ (WY N N
~ ~ N N N ~ ~ N
N ~ N
t~h (O c'~ f0 01 V' O 07 O ~U 10 ~
thc~Ih t0 (p f~ Q) t0 O ~ N h
a0 O O ? c~ C7 O ~
N O O O M 0D ~ O O
V' 0) O
c~ 07 O
t~
~
c0
n r~m .- ao cn u~ o u~ un 0 ao ao v
v ~ co ~n ao o ~ s~ co
~ 0 n
v
r~
conm c~~in~ c~c~~nWn c~~ c~~c~rngimW oo ~~~~m ~
o
c
E E E E E E
E
E
O d E 'p U U U U _U C'->1
m ~n~ 0 E ~E ~E E _U ~
C G N N ~E U E > > O
m f0 E V
V (0 !0 E
G C E
L
~
D ~ U pp N Y ~ ~0 O
U ~ p~ b W ~ 7 > YO 7 y A O
~ > N 'O
N 3
$ 7
7
N ~ Imo m m U m ' .
m 'm ?o ~ c E
c
N . - EEE E ''c ~
- m EEE
W
.~ a.t . _'~'E'c -'cc~-' EEm mm
w - .r
Z 'c o m =n a) ..m. ~ UI
U ~~ M m N 0-! m 7
N
'O
'O
E
'C
~ t~",~~Tm~OGI~ UN N -~U~UU UUU Udm
aao o o ~ d'~~ v Oo
~ m '
~d E
c ~ m o a v a c o.
m m ~ ~$ Ea c ,a r c na
~ d ~ ~ a c O
m ~ c c c z' c
~ Z' Z' Z' ~' Z' Y
Z' U U
~
N tGN T c0 N
U U IL~~(n t ~ ~ ~~~~U ~~~ U~~W m
T ~
U~U
~
~ .1 n iAfn
N N
a1 C Cm C C
C
a l f U
fnfnN C~ O p N ~
C7 p H O
~ U H ~
U
~
y
Z
t0 Z ~l N N
m Q ~ _ ~ r
c ? tm
U U z ,
~~
m
O U Z ~ ~ . c
oo ~ .
~ c c
p O ~ ~ j Eo ~ . ~ ~ w m a~
~ ~ 'i?
a E
[~ 'J . " o ' m '
C d m
. . E ~ ~ ~ ~ rn ~
z z o~ ~ Q ~ a L =m
c z a _ m ~ ~
.g 8
i
t
cn
v~
'
~ m
m
_ ..
U C'~ H ~ ~ a ~ V 8 i C . Vl
N C . V H j
~I M - ~ V
~
T~ z C ~ ~ > .. . ~ ~
~ d ~ . ~ ' V! _7
m ~ d a V
G . ~ ~O. ~'
~O.
f Z Z m~~ Q~ ~~c E ~ oa~o ~~o a ~ ~ Eo
~~o~
_
c
~
> > M rn ~ ~ m ~ _~ O m ~ o, .o
W ~ ~ ~ 'c ~ H 0
'~ r
w a n f~ Z0. m ~ d ~
' o ' '
d
v , . Q N , S n
!n(nva c c - V ,~ c o D.W E
,~ z O'.Q=Q'Q VQ~ ~ E
d c c
VUU~a ~a~
m ~ ~ O O C 7~ 'a'n ~ 'Q y
m m O C O O N
1 U C ~
U
C
N m m m ~ u C ~ ~ o ay. .d
~ ~ o ~ ~ ~ ' ~,
0 ~ U o
0
~ m
~
~
Y Y ocomo . c o c ,5~a c '~
on.o'a~~,~''.~c ~m~ a - om
U a~a c~'oa
c xvE o v?~~in~ -v 'oEc ~r,c
a E c
a ~oEv m
=~ o x
c ~ a ~ ~ ~ c v ~
~ 'rom ~ o ~
rn o m a~ N
a ~ o ~ ~ E o~
'~ a= c ~
~
et m o~ t m _ m ~ m M
a t Z U U Q
~
~
C C Y ~ ~ ~ Q 7 O ~ U U a ~ O
~ . U W ~ Q O W j~ V O
U Z Q O 4
C
~
=
U
U ~ C a00 C ~ m ~ Cn y T '~N O
G~ d j ;O E U O
m ~ ~ N m ~ ~O
U
p
> 0
> tp~=. m~a tG~a~ _UU
1 ~p .
~0Qj0 cu
WE~p~L?a~
'
$ m -m Uoo .'cLUiEm mmE m~o~~~ ~c~
~ ~ EEH -a~Z ~ mE~a a '
o ~c
!R~ ~~~
c
t
'
'-'. ~.E _ vWcc.~EE
c '~~. ~ cSc, E
10a a U w c
a a tp P c
E ~ a ~
c v~ ~ ~o
a E ~ o
a ~ ~
o '~ a N
m ~ E Vi
m Q ~o
~ .o " m
f0 cn m a
C ~ ~m ~
t~ "
E o 'c
m - 'c
m ~ ~
U ~C ~
U U m
~ ~ m
O ~ ~
O ~G
(d N
~ O ~ N C T
o ~e~ [JJ ~'oa~d ~.k~omc.u!'vEco ~ 7a
W.mUO.~moom ~o od~mm oo
[y) v
='o~u~imnad
O
O
E _ _ ~
c v ~ c '
a c 'G
E v
o Q
a ~
c '
Z o-
~li a
m a
:- a
~' n
m ct
~S o
a E
' .Z
~ a
v
z. z
~
~ ~
~Z
'
m
ms
~T
E
'~
=
U ~~~lll~~~~ ~ $ - i 2 a
9~ , ~ o ~ ~ . 2
s c ~ ~ o . ~
~ U Z3m ~
~a~aU~~~ Q D~ ~
l~~~
v
Cf m .n t' UDa v in
Ct a oOt o
i~
o~o~,r ~ c~ o ao
m w o, r t~
n r~o o ~ ~ N M
N n o
o ~p N ai o
O N ~ O O O ~ ~ O ~ N ('~7 N ~ G~0 ~
m ~ O O O N .~ N ~N..
p O (O O p~ ~ O n
h e- O ~ N r
N N ~ ~ ~ ~
O ~ O
~
O
t O
~a~Q N N ' a t 0 O O
a ~ a N w a '
N~ N O
a
a wr~ xu~r~w Via
~N~
N N n v c, c'o d.
T N m '- '- .
N N
Q
0 o or o o n o o n o v n ~ O
~ ~ O w ~ rn ~O N O o O aD a0
O N !~ O 10 n 00
~ N O K7
' O O
IA
01
tDapN l0 IA (D ~- d' Ih N N r ~ h O
sT N f0 N M l0 d N
~ l0
f~
N ~ ~ O
O
M 117 O ~ ~ m m m N
m O N
y~
N
00 t~t~iJsr~ oo o '~n~riQ ~~Q D' oo
o nMOo
C ~ U U o V n O ~n ~ o d. O
D ~ N ~ D ~ ~ ~ O
n ~ O ~ U
>
V iv~ m lU UJ U W Q ~ ~
OD lL .t N t
m !l
_
z as ~ ~ ~ a aaa aaa aaaaQ ,
mm~ a ~ Qa
z z m a u~ m aam mam aammm mm
mm u.i
m~m~m~ m m~ m~ m~ m~ m~ m~ ~ ~ ~
m~ m~ m~ ~ ~ ~ ~
m~ m~ ~ ~ ~
m~ '
m~ ~
c~c~c~ c~ c~ . c~ m m m m
c~ c~ c~ m m m m
c~ c~ c~ c~ c~ c~ m m c~
t~ c~ Cs c~ m Cs
c~ c~ m
c~ c~ c~
c~ C~
Cv
cn
~
O N t0 ~ a00 W ~ ~ n
co 0 0~ ~ ~'~ ~ ~ cnc n
0 o
~ n
0 o0 op co m w
o g o 0 0 0 0 0
0 0 0 0 0 0
114
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
o am n ~ n v
o~ a~ rn o~ o~ o~ °'
0o r' o~ oo ~ .°-' .°-' o~ n n n o~ n o~ n °' _ o~ n o, n
n o> n n cn °.' n
0 0> m o~ a~ rn m a~ m o> o o~ o~ rn a~ a~ m a> o~ o~ o~ V m o>
W > j Q ~ ~ ~ ~ m d m m m d m m U ~ ~ y v d m d d d d m It1 m °' ~
o. U
~ o ~ -~ g ~ ~ ~ ~ u. v~ m In u. v1 u. u~ o ~ m u. cn u. vj cn u, v~ v~ ar c?
al > vy iri o
~cb ooo>d>oo~ oo>o>d~oo~oo~co~ ~'oo~oo>o~od~rn~ Nor oo rnw ao
O ~ r N N O U r N N N r N r N O U r N r N N r N N O N N N N N
tn (p V n N n t0 n ~O cb N (G N N N O n ~ ~O n n N N cD u7 O VW p p
aD O n O (D N MwY N u7 1n ~ i~ n V' ~ O V' t~ N (O O> O) In O N M CO f~ fn O
N i~ O m N O) I~ tp W Q ~ n n t'! f~ N ~ 07 O) aD [~ [~ fD W C9 ~!7 O) 07 O)
In (p
O n a0 t~7 (h r O1 GO OD OD t0 CO 00 m OD CD 01 OD 0) c0 W GD OD aD O) A Is 07
°! ~ n n
t0 f~ M M t0 c0 (O M °~ O) O Ol O 01 Of W M °> O Of 07 O O
°~ O W O O 01 O O M fh
N_N N E E E EEE E EEEE EE E E E E
_'~ $ ' » » » » »
U ~ ~ ~ U U U .~ U U U _U U U U
Q ° ~N W N W ~ N m ~W ~N ~ N N N W N N m
U .~ - . ~ 07 07 01 01 O O m 01 O) 0) 01 O) O O! 01 O~ C
a ' ~ '~ ' o ~ E E E E E E E E E E E E E E E E E '°
" » m ~ m a, c c ~ ~ v r c ~ ~ c v z 'c c ~ c c
~ ~~'m ~ o a'r ~ ~ v ~ ~ ~ y ~ v ~ ~ a v ~ v ~ '~ '~ ~ a ~ v ~ v ? !!'
o a a i°ca a o ~ ~ .~ c .~ ~ d ~ '~ ~ ~ .~ .~ ~ c c ~ .~ ~ m ~ m ~ o '~
~ a
°' v ~ n v n n ~, Z, .,mQ Z, ~ Z, Z, ~, ~ Z. Z 2~ 2~ Z ~ ~ 2~ E 2' ~ ~
2~ x 2~ ° a
d ~ ~ F~ ~ t0 t~ U U 3 U ~ U U U ~ U ~ U ~ U ~ U U ~ U ~ U U 7 U U' Q
m ~ _
m
m
ci a m Q Q' E
U tND m 2Y' ~ O
O '~ r T C n W E
° 1~ L m C m O
V~ C C C C G C G G y m W U
(~ m o, m . , E E E E E m ° ,coo
a,; E E - m m m m ,o c E ~' ~ E
o a: c c c c ~ 'c ,~ a o
» ~ m m m ~m m m c a
C/~ w ~i~ 'n'~ ~ E E E. 'Eo ~ '°
°-'E'c~m Ea'~ L L L L tE :° U d JO
n o a E o ~ E n n n n o_,oc z ~ a U ~
E c m o c. !~ c o o c c o c c Q c o O ,v_ Q
[H $ o ° w m E Q m ? E m Q io w = a, ~ U
OI -O O ~ O).O L m m m ~ N m - d E ~ N N U N m
~m'~mm°=m=~a on> >on onE on .a En m _
.'°c a E ~ ov. E E W a'~ ~ ~ R d m m m A a m m o .E m c
c E ~ F- ~ E ~ c s ~ ~ L s ~' t s ° L ~ °' of ~ 'o m !-°
~' U c°; Q >, v of m n W ,a n n m a n m n m ~ ai ° v o L_ m
cZ °'y °act'°c°cai °c°ca°c~w
a ~° c
H n ~ ~ o ~ ~ ~ $ ~ ~ ~ E v 2' E Z' m m ~ E ~ ° ~ ~ ° L ~ ~
s a ~ ~E y m
'°c~~ N~r '°e'~ °'~ _°.g.°. o nc ~. a ~u=
°mv :: m°v ~ a
m . v v E E E ~ o w co m in E ao
H ,~ E !~ c., M, ~ ~ c m c ~ cco ~ c ~ c m ~ m c ~ m c ~ O ~ E ~ °
° a
oo~otD°c~QQm m°a.°m~m°m mnmaEmaov ~N. a ='v
!.°
Qt'yu"-oyo°o ~oao,k?~.,R~~oo ,~a,~ao,~o.o~H~E E m.~o'° ~o
p,na'~'ra v $_ a ~grgto'S ~v ~a ~ ~v ~.~'~ ~E"cn~d~ .m °.~ m
Q.3.orOOw~~~~ soo'somoAOr mom'vomocE'~E'o 'v Em
~' > > Q Q ~ c E Q v Q E ~ E ~ ~ E v E a Q E c~ ~ ~ ~ E o~ c ~ of m a > >
a ~ 'c Z Z z ~ ~ 'o ? Z c Z ~ c, _ 'v ? c ? c Z ~ c a'> ~m _ 5 'Wo c ~ m ~ o'
ov~00~EE$ u~~ vc~~_s ~o-~c ~~o~~~ic°r~=caic~~~WVv
o a a ~ ~ a a o m m ~ ~ E m m A m m m m m' R m m ~ C C m N C ~ N O
,o a m a E a w a w E a H E a m m m m ~, E d
°'c°~ dm$nn~ >oQo.SQ'>o~
>QSQ°~l'>Q°~Z.LOQm~ss° Q3on
d~~cLn~~inin~a . m~DC~mom~ o, m'Dm'o~m'D~U ~c'n'oY OINfnO~C~CJ v
o °o so m o n
O O N N M O aD ~O a0 O 47 O 4D CO O ~ O N a0 O n0 CD (O GD 47 pp ~
Ot~07D~000007 007tOOMm WCn~l~~007 ~fn'1001(h~7~pmlM(~Oh ~~ h MU "O
(O O O O d' e- st ~ _O V r < r .- at r O O r lp O ~ N O
n ro 4 ~ rn a o 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ~ o ~ .- U
D N Q Q N Q ~ IL X tL UJ lil X tll X 111 111 X 111 X l1! 111 X IL tL >- t1J
l1! Q 111 ~ Q
V' ~ ~ O V' O) c0 1p 1° CO ~° N t0 1n IA W ~I7 f0 In (O N In fp
It) 1n N ~ O ~ r N 0~7
O N a0 n_ OD t9 N N N N N N N N r N N N N N N N N o0 aD n
M ~1 ~ n n n n n n n n n n n h n 1~ n t0 (D t0 N W ~ O
N ~ V' Y ~ O O C~ n n ~ n n n f~ n f'~ n n n n n n n n f~ fh N c~ C~ c7 1n r
O
O
M N ~ m N N ~ m n
p r o° o ~ a- ~ n ~ d ~ a. ~ ~ a r~° a n ~ n. n ~ p n ,~°
N oo ~ '~ o
o U U' Q U O O o ~ cn m ro ~ cn ~ m m ~ co ~ ch ~a ~ M co = a M n W n o
~ ~[UI), V 111 mIOLIOLUlm1011m11~W pJplollmWIOLmU°J41U °IOU IL
~LlJ U
1-- I- 1-= 1- r I- r f- I- 1- r 1-~ 1-~ ~ 1-- 4- r 1- 1- 1-~ 1- E
~mamC~'J mamma mdddmdmdd mamdamOQØm dd d GQ.d 00.
ml ml ml ml ml.ml ml ~ . . ml ml ml m~ a 1 ml ml ml ~ ao ml ml ml m m~ ml m~
m~ ao m~ ml ml ml m~ ml
o c~ c~ c~ c~ c~ c~ w c~ c~ c~ c~ c~ c~ c~ c~ w c~ c~ c~ c~ c~ c~ c~ c~ c~ c~
c~ c~ c~ c~ c~ c~
r ~ ~ ~ ~ thD ~ M
n
N ~ O ~ n a0 O
O ~ 07 ~(W7 O W W ~ m m
O O O O O O O O ~ O p
115
CA 02571917 2007-O1-08
WO 01/66573 PCTIIB00/02035
o
m ~ m m ~ m m h M m a~ m r
o~ m m ~' -' m w ~
tn o> t=~ ' f= o~ o~ ~ o~ ~ a> oy' ~'
~ tn ' t ~ o~ m tn o,
~ c c o> a~ ~ >
c c c U c n n c
c c n
> > > U n. ~ U m ~ m ~ tn~ o~ a a a o
o~ o ~ - o > > a ~ a = ~~z
~ m cn ~~
>
> > o ~ ; o ~ ? c~ a a5 a
.> ~ ~ '~ ~ b m o
~ a %
h
Q
a ~ ~ ~ ~ o ~ ~ ~ a
h c N N $ N r N 1nr N ~ c
~ r r 1h ~
N r O r O N N
N
0 ~ ~r r t0 r~ ~~'01W NNCO N lOD r ~1~~
h W m0
~
n
r ~ ~ t0 N V: t0 h. c9. tp ~ (..
( r O W O M O~ .p
OSf ~ r N
t ~
D
tV r r
r c0
~
- O W (DO 01 V' ~O O CD f~ O In t0 N M
a0 M ~ M M ~ m st, W m h h
of 'Q M !D V' M tp O (D 1!~
M ~O ~U O h (h sf M t0
~ M M r
M
N
m U
N '4! U t/l U m
J ~ N
m
0 0 'E ' o _o '~o 'E
c c ~ c
~
m ~ d ~ ~ ~
r
c a a ~ a n c a o o
~ ~ ~ ~
~ o ~ ~ m ~ . c~~
' a m v ~ ?~
3
E ~ w m N w E E '~'~ ~ d a '
- N ,~ E a~ ' N
E ~ E ~
.c 'C
N ~ ~ _ _ l m ~ ~ ~ m m C -
3 ~ D a m = 'C C = ~ ~ .~'
7 = U t m ~ m
a m
m
h m T a G C d j, m m 7 ~7U ~ _
G! U L .p, C ~m a m'. V O (O
'd U 'd ~1
o mE~~ t tm m ~ E'- mmR$ ~~o ~ ~''
~'-~
. '
n
a U ~ nc,m ~ E ~ U U V Z'U Z Z' E E
S Z' E E c~ E ' c E io
~ W ~ F
~ Cn ~ U U Z T t~ ~ ~ m ~ o U rv tmn
U I In ~ u) Z ~ E 2 Q
Q ~d m ~'~
0
o c~ a> _
01 C~ M M x m ~ n 'O.
'o tNO ~ tj V ~- ~- D ~ ~ % v v v ~°
h o ~~ ~ ~ ~ ° U , of a nj
a>ioo~,? t~n~~m ~~i,~ma~'c~Z~ mz~ m
U ~ acr d ~ N C~ U ~ ~ d m ~ E ~ ~ = n g d ' o. m v U v
m. '- v~ o> ~ ~ c~ ~ ~ c °. o~ ~ o ,°, N ~ E E m ~ ~, c m m ,= W
H m o N ~ Z Z ° c ui ui ~ m d O E ~ ~ m a N ~ a o m
a c°' ~ E x U m E o~ E E o ° a c Z c .c ~ Z' ~ E d o a
m m m~ tm" mZ Z ~g °c °c.E cEo ~~tti °c~~ui ~E
tntn+r mUU(~j~ ~~.° c$Y~~.° moo~a EE a~
c c
n. o.~ ~ E> j E~ v m s m o~~ m~-Q m~m'E-Q a~ rm,
n o 0 o ui ~ ~ W t~at1 2 l m o o m ~ ~ o ma ~ '° E y .c 2 ~ Ivl
:p U U E m N O N U nj ~ U U W t .~. - ~ Y ,p U > Y 'E 'o Q L
~'a > >-o Eo~ : >tnUo,>,~.,' ~'-pmc »mc UN_a
t' a'
Q thn C M ~ O 'p. ~ _ _ M ~ ~ m ~ m ~ t O N m 7 d N ~ ~ d '~ U m
~ o d N ~. ~ ~ m N ~ N E H ~ ~ ~ T' ~ E N ~ ,~,~ E N O, o m E o
c E ° c -°° ~E N ~ ° C7 ~ U ~ o V ~~ ~ o c o ~ ~ p
E ~ ~o ~ E '~ o a a ,~ ~ m
mrn 3 ~ ui ~ ~ C ° ~' ~ ~ ~ ~ m ~ m m o» U m 'o E ' m E o ~ m c
m o m °' m ~ o, ~ a, m m ~ o $ v m f.° m ~ m m m ? E E m ~ ~ E u-
n c c_
IC_O ~ '~ d Ul m G m p N O N O U rn ~ ~ ~ C C 7 C N O m m j O m m. ~ .~ ~ ~ O
'° ~° E m E ~ E .f~ N ~ N ~ ~I E ~~ ~ E E E m H m w t E O ~ E 2
g ? E _c~ ,m,~
.t- H 7 > 7 y vi .- CI m r ~~ m
C . C - O > > > m :p C m
NE -~~o~~van ad. amna,m ~~ 'm'm,~~~ED~,dm ~~~ ~~~v v~z '-°
o~~wvt~'a~~'E~~E.mn vmWa~n ~~ mmmEomvmio~dov m~o~ E_:o~
°L'mf'~aWco,cU°c°m°mmm Q'~ oo~mm~o'~a~c~c oc
~E m~ m o ° E6 °v7~~W ~' °: i.i.>,a.~ m a~ $'o ~ ~ i.~~ o
_ m ~ cri ~ U ~ U d U 2 ~ Z ~ x w in d ~ ~ ~ m m m z m U m U ~ ~ m U ~ x m a
V ~ N p O O00 ~ m r_ OMf N . M GhD M N
M N O N h O ~ h N M m N N N N_ ~t7 N t0 V' 1U N
h h r N O M u1 10 r ~ t0 r O h O N h ~ h N M 10 O
m N O N N O tp O O i_~ M ~ N N O h t0 O O r ~ N ~ ~ N t0 O h
O O M O r O o~ O O O <n M r ~ O O O r O~ M O ~y, t0
J r J f~ J m U ~ C~ J m J O~ m U ~ lL O J lL O h IL o7 m
Arab a Na a a ax aNNn1 ~aa a >.. as >- x
M M W v ~ o h N m h
m M h
M ai M w h h r w m N M v ao v v M
h N ~ ~ N N N h m ~C!M V1 ~n
M ~ N N ~ N c
m m N m h m O! O
N 10 V
h
V' a ~ ~ N ~ ~ O ~ N ~ ~ O
m 0 N V O ~ M N
m r N
N f0 M N M u7 ' p ~ r r
m V' 7 r
X Z Z
N ~
~ N N m ~ ~ ~
P
a0 tn ~ u07 ~ U N M ~ ~ L N lL N ~
m N ~ M L t~~7 p
O ~ ~
O M g h~ U m~Z Oo ~ o
Q ' a
OM
> o o t > V ~ >~
~ U U U w
~
U ~ V ~ g Q U a Q i Q E- Q
U' ~ rJ- ~ ~ U u
~
tn ~ U V N b~ rn ~ ~ m Q U . v tn Q
N Q ~ Q ~ z
m g a
aaa~ ~ ~~ ~ ~ as aaaa a~~ ~ a a~ a aN~
v mmmm z ?x x v mm mmmm maa m m m m N
mZa
m~ m~ m~m~ m~ m~ m~ m~ m~ m~ ~ ~ ~ ~ m
m~ m~ m~ m~ m~ m m~ ~
m~ m~ ~ ~
m
v c~vvv v vv . . vv vvvv m v m m m m
v v vvv v vv v m
m
vvv
v
O
O n ~ ~ N ~ W
~
h r Q! N 01
m W ~ N N
O O ~ O O O O O O
116
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
~ rn m rn m m ~ ~ W m ~ ~ ~ ~ m ~ ~ r~ rn ~n h r'
c o 0 0 0 o W ~' ~ a o n ~ o. a c ~ (V17 W IVi! c c a
~ 5 > > > m ~ m o
~ Z Z Z Z Z O Q ~ Q z Q -~ Q Q ~ ~ ~ D d D -~ ? ti m tn z
O W c 7 (~ c~ O I'~ N W M 01 O7 (O t0 c~ V ? o Is O O C c'~ V' 07 ~ t~
r r r r r N r- N N N N N N N N N r N t~7 N N c~ N O N
O
t'~7 ~D O f0 c~ N tD V 4'! (n N a0 c~ CW O
N ~ W O N OMf_ Oh1 f0'J_ ~ ~ N ~D h t(7 C7 V (~D cal 10 ;O OM7 r N O tp O h O
y'7 O P7 O M 07 W ~ N r ef ~ CO (p N
M f0 (p O h O fs. In O V ~O O OG O) O O (O O fv O O ~ O 07 c0 (p
~f c'~ fn r V Q) V' (O 01 07 M O) C7 ~O u7 f~ c0 (p f'1 (O t~l tO ~ e- O) O) M
f~
E E E ,~ E E N N N H N N N E E
~O ~ ~ ~ O ~ ~ ~ ~ ~ ~o ~O O 'b ' ~O
a~o m A ~ m m m ~~ 0 0 0 0 ~ ' 3, m 3 E ~ ~ ~ m
d 7 7 ~ ~ N 7 rJ ~ H U U U m m m m m d m
a o~ of of a a o~ o~ o~ a a a $ a E a o~ o~ o,
E E E ~ °-' E E E o .o Io .~' ~ ~~ ~ ~ ~ ~n w E E E
7 G C C = = O ~ C 7 C C td W fO N 7 3 7 ' S 7 7 C '~C ~ ~ a1
r d m a d d .c .c m d m m $ H ~,' v 'c '~ 'c 'c 'c m °= °'
° m
a o o m ~ ~ a a ~ ~ .o m o 0 0 o a ~ a a ~ a a m m m ~ o
~8.E E ~~ ~8vt~ ~ E ~ m m v ~ 88S8SS 8~ ~ z~m
2 2 2 V U U g ~ U U Z U (n tO (p ~ ~ ~ ~ g ~ ~ ~ U U U
0
c
v
N N 'u cj z ~
'~° a~ rn ai d z ai '~° ~ co gin.
.c '~ " ''' v q.
tV uj lL , °' m (9 m D ai a p, 'o o a Q ~ N
V 4J IN N a y~ O z O U ~ ~' h N h N E. r
m 11 lL ~c ~ c~ S v N z ~ i6 m ~ ~ H m fn. H p a'
E > > :! a~ e: E ~ w
v~,t~u 111 as a m~ m ~ m o. c ~~ m ~~cE m ..
° m m m N E
t0 .. ~ H .' d m Q Q N N
O ~ ~ O1._
O o O N C E N ~ d ~ m N N ~ m .G a n
E e~ U v ~ '~ N 'i"" ~ 'f"n m ~ o ~ >. ~ = o ~, ? m m E
vn ~ d d v o .~ ~ 0 4 ~O o ~ o ~ co 0 0 .~ ey ~ Q ~ 'v
°3U'. (' aooi o~U ~ E ~ Ov .o H,~ ~ o °:w U U ~ ~ m~~o v c
d Z Z ti ~ u. E o X E .~ E m m d m d m E p m ~, o ,~' L o
Y °' °-' ~' Q a o W m c m c a~ a a _o ~ m ,Z, n v o
8 O O N ~ H ~ ° = m c ~ °~ c ~o c. o a E m 8 $ H o ~ o ~' 8 r d
w ~ ~ v
~ m m m d ~p H' ~ m c H W C7 o p o H U' > > H t_n v (~ c ' ° E ,o ~? ~
v
U T U 7 r L N y~ O 47 ~ V H ~ M ~ ~t ~ ~ 7 ' H ~ ~ O 'O O E (/j
M ~i p ~ ~ m a m p, '~ 'a ° v m m y m :Q m co d m ~ r ~ M m !9 ~
'a ~ o ~
,_" m z E E E '° 9 E r°- E '- d E E t m ~ ~ E x x ~o v v, ~: x a
m R ~ u. ~
'? ~n E E m m ~ o~ c p~ o m w m E m W ~ ,n ~ 'm °'- k E
EO ~ ~ ~ ~ ~ ~ ~ U ~p ~p ~p O O O ~ O > ~ C ~
°' ~ '~ E ~ '~ ~m v '° v ~ ~ '~' ' m ~ L c ~ 'E° ~.~ t m
c~
a C C O7 0) O! d a b1 01 ~ C OI U C C C C V D ~. d N a N ~ ~ 0l ~' ~ O a N E
H ° H >_> >~~ ~~ ~ o~~~ H ~iox'a_oZ v ~~.2 ~~ ~.~~ ~.,tp"~ a o ~~2
c ~ a m n ~ H ~~ .'c ' ~m o "' 'd. fl1 Cm ~ y N ~ L r L s V ~ ~ ~ ~ C is
~~° O ~m ~ t 8 c o~_o
°~ 'n o n v ~ tS 'G d ~H t5 ,0 8 'G. $ .n ~ ~ 8 ~ b o' a. p~r ~ m
c'3 is d m m ~° m m p. ~ m c m m m m W m m o0 0o i~ v ~ it o E ~ ~ ~ ~
m n
H E o E o ~ ~ ~ $ S. ~ a ~ ~ E E O ~ E d ~ U ~ U
T O O C O O O T ~ O ,C O O Q" O to m r T T T 7. >. t >, p O ' p g p C
gx ~x ~aU U~~U nHU 8xao 8Tn vi~virv~ ~~~~~~ a~c~ o,m c,o~x c°~
M ~ O o' ~ O O M V l n' l~ m a'~O M
~ V' ~ .p~ O Q1 a0 ~7 Of 10 00 m O aD t0 (D 01- O N ~t0p N N W N
amp ~~~N mOm001~1N0007~t~n~~OVO~~N~NNO
N O O O O O r O O O 10 1n O 1!7 II7 p~ V' ED O N
N Q~ Q ~ Q ~ ~ ~ Q ~ ~ ~ N N ~ ~ ~ X N ~ D UOl
° h h
M O O O ~ b h h h tm0 h
h th c~ f0 47 t0 a0 C7 10 < h 07 O
W n tn ~ ~Y V' O O ap t0 (p ~ OD OD ~ V ~d 4 O O Of V O f0 f0 O1
~O ~ ~ h 1~ h N O cn t~'7 N ch tp O O t0 N N N O N N N h m O a0 ~O.
th h h h at ~ h tD N t0 C~ f~i t~ f~ M cn ~t ~ V' N C~ V' v- n N M
m (Mp ~ N h 10 (n ~ CD 00 ~ 00 ~ ~ fn ~ (~7 Q Q
O e- ~ O O N ~ ~ O ' p0 ~ ~ c2 ~ ~ N ~ (U Q ) N Q)
Qt°LU°. °~~°
°No~~~~UUCr~'~(~~'xU~.jNNV
T o0 o N
m ~n a,a ,a,~~Q a r ~ ~ f0 N tUll, ~~~ ,~5,~~ ~~ m 1O11QT
~ ~ ~- .- e- '- _ _ _
aa~
~m~ m~ m~ ~~ ~~ ~~ m~ ~m~ m m~ m~ m m~ ao m~ m m m m m~ m m m~ m m~ m~ m~ m
c~ c~ ~ ~ c~ c~ c~ ~ c~ c~ ~ c~ ~ c~ ~ c~ c~ ~ ~ c~ ~ c~ ~ ~ ~ c~ ~ c~
t0 O~ N OV
O ~1' c0 W h h N ~ e-
p 0 O O O
_ ~ O O ~ m
O O O O O O O O O O
t~
117
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
w o> W m m o~ w m
a~ m m m m m m m
mro .°-°°-'mo mmm °_'m_,pm m m m
o °' °~ ~ F= t_ m m m ~ m ~j, ~ (S CS m >- m N F~- °~ f:.
°'
°,' > j ~ U U o ~ c o ~ ai ~ W ~1 o Q p, U U Q U ~ o
-~ m O O Z -> > Z ~ ~ Q D O Z ~ ~ O O Q O -s 2
m ~ N r= O O N ~ /~. N r V' N N N (d~7 O N N ~ N O a~~- N
w m w m o o co n co u~ m v oo w v o < o
t0 47 ~O (O O O O ~ t~7 _fh ~'7 07 O r h f0 N th m r ~ ~ O
M O O N O O w(p O t p_ .- M ~ ~- ~ M ~- ~pD N them c.n~ I : t n
mMM~ V'~M~~f~n('O)V~ MMCO~'d'~ M ~~M
N H
_O p m m
._ ~ C N N
m m m m m ~a
C 01 O O) m A E
E H.4~0 ~ OHyCCmNp
f0 m - .. j
N H N > M H ~ E O H E H H ~ ~ .~ % d m ~ Y M ~ H
c c c c c o v c o c c c E E c ~ c
d G) 61 ~~ N N H ~m ~p N ~a m m N o! ~ m
n n d ~p n ~d H 'E d O. n H M m 6 !~ ~ N a1 n E N
W m l0 ~ W n U m m U m N d d W t L d n tC ' W
1~ H H E H O N H m H H O~ O ~ b n Q O O W n H
O O O 7 O O ~ a E O 'p O O' ~ a o O O O ~ ~ O ~' O
O O O~ C O O H ~ 'm O ~ O O ~ ~ ~ O E E L L O O O
2 Z 2 1- 2 Z ~ ~ .~ I ~ Z 2 ~ Q U T O' O ~ ~ S U' I
U' U' E ",mUrn m
vv U~ z°~C v~tnVU~ ~ Q
l,' Z Z N N O Q ~ p. ~ ~
tn t0 j j °' ~ ~ ~ ~ 2~ % m m m ~ C~ ~ ai E
~c'ww ~Oa~ ~mo~~a~ m m ~~~~NO
tA tn ~ ~ m M a'c~ > > E E = Q O Z C~ a ~ o~ d ~ ~ O.
V U U ~ ~ Vml N (~ Z H
N "N~~v.~'m~ ~~~ tno U U Dm~Z ~Z_ E
dZ z QO D Nm n GjHUC N m .~~~.,~Z ~"~U C ~O IL~EmtL
o U (7 E ~ ~ n' E m ~ ~ E ~8 E ~ c a Q '~' U W V Z m ~ Z J~ .~ E c
v Z Z $ ~f~ ~~ 'p ~ io ip n ~ .~ g m m m ~ 7 t1! m oy1 ~ ~ m m
U U U a U ai m m r '~ d r m ~ m aHO °' o ~ tiJ ~ O ~ N ~ :2 m ~ N
~tZU w Ztan ta'n~"°, do mmdaco O O ~m~~ ~~ N ~ W~~mn
m > U ~ Z ~a Z ~ o d a ~ E d ~ m ~ tai. tai. c °' ~ ~ ~ ti ~ O ~ .~3 ~
U
~(" ~ O E ~ ~ ~ O d ~ ~ L a w 7 M U U O N p~ N ~ U U U ~ H ~ H
~° tn ~ m U Z' U ~ E Q a o E Q = o Q Q ' ~ H a Q Q ~ o 0 0.
n = ~ c E ~ L ~ ~ n d ~ $ m ~ U m m = o ; m fD 0~ (~ ~ N c
v~ ~ ~ ~ o ~ oz ~~ o~ ~o Eo ~ E U~~ o ~ o L m m ~n'm ~V v
of nm_~m_~O m a ~tpcn o.M o o '°U 1i pE ~; En ~ o o -~'=QQX
Y U = t '- C/~ _ ~ ~ I, H H N. G C H H c r) a m
0 o m "'_ m ~ y .~ N E ~ N Y t- is E E .o ~ U v cc'a v c E ~ ~ ~. > E o
off =~ =~ w ~ s ~ i ~ o r N U ? ~ U~ ~ ° E p ~ aNO a'~ m ~b ~ '°
H ° o Y~ U '~ Q a
E~ ~~ ~ ~ ~~C ~a~~fito ~ ~ ~ol~ °~ a~~ ac c cl~~° ~.'c
t tIl W E L. .C ~ C ~ O z ~ O' V !6 f0 ~ c Q .p C . ~ ~p ~ !O O x y ~ V
O H ~ p ~ ~ H ~ H ~ ~ 7 E O H C~J E H UI ~E r r 'Y~ U~ m m ~l ~ m CQ0 y 7 = N
~ t ~ O
c~c c. a~c~c~ owvuicZoc o ~~ cEabE'r
d g n m o. m a m a H. m ~c m a~ ~c m Q c .n m 'p Q. o ,~. , n o. m_ m H d c.~~
o Q ~
'a 'a 9 a v ~ n n H m m $ c U ~-vo. 1 ~ H H ~ t v !~ o ~ c ~ H ~ ~ Z o
m m ' m. ' W m m a a; ~ W ay w Z o ,~ ao ao n ~ n ~ ' m o ~ E ~ L ~° o
a m n $ ~w ._. ~ D
E E D E ~ ~ E E a m H H m E Cl $ o~ ~'I c 9 m v I E W i a a o °ro
o
0 0~ '°E E ~ a ei'~oc~o~c~°co ~°-o -m:E E~ao~c
x°x° ~x° 3r.'-i?iZQ 8~~'8=~~xx n Q Hd~ ~U~z o,a'~~ omF ~
8d~ ~x°m~2
u~ ~ ~ m m h ~ N o o cn c~ <o h m o
(D ~D f0 (O tD h ch O m m ~Y h 07 10 N b
N m m p~ T ~ O m f~ ~ O O N m m m V f0 OD
.N V ~t tp O M in O N m 1~ 1n tn a0 h a- u7. In r
S ~ aD r e- WO t(7 10 O N O_ g g O ~' r g ~O o
U U ~ U U o m o o ~ o (7 U U r ~ U U
4 Q ~ Q Q ~ N ~ ~ N ~ Q Q 4 ~ Q ~ Q Q Q Q N
o m ~ ~° m o o c h co r> u~ n v o o N
o h r. n '~~ v ao h h h n N N o 0o co
W t'7 H7 m t~ fh f~ m a0 O f~ f~ tn m m N V K7 N ~ h M ON1
t0 N N M r h a0 M C7 ~O M tn m m .o- m M h N N N
V' fn M N r .- h ('n e- r Cn t0 c9 m m C9 V' r .- aD m ~ h. 0D
mmOYVO~ C~ O NO ~~ ~ ~~~~h_
H ~ ~ ~ O ~ d n ~ O O ~ ~p O ~ O O '- 47 U.
p m ~ O O N h
U~444Qom1-U-~ZIU-OODQ ,~~~~Q ~ Ea..
N N f-. f9 l~ ~ ~ J N ~ !'S W !L lL () <- N V' Q C9 N Z
M 'O' V' (t-~ U' r _ r fn _ (D (~ O'
a~ ~ a= ~ a ~? ~ oai~a~ d a ZC9 ~ s d
m~ m~ m~ m~ m~ m~ m~ m~ m m m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~
c~ c~ c~ t~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ t~ c~ c~ c~ c~ c~ c~ c~ c~ c~
W m
a~0 r Or N ~ ~ O h
N
N N N N N cN9 M
m W ON W N W ON W
11~
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
o °' ~ ° ~ m ~ °n' ~ m ~ ~ o ~ m m ~ a ~ ~ ~ ~ ~ rn ~ rn
m o~ ~ o,
o, ~ rn o a c ,$ ~ .c a v~ rn = ~ Q o Q > j c c c c rn or °' w o' c
Z 2 ~ ~ ti ? 3 ti '~ Ii~ Q Q ~ ~ ~ Z ~ -~ a ~ 7 ~ -'a Q Q d Q ~
~'' chd cb ~d'n'' d~ob d'dN~ ~$r~n~~ ~b nNdu- c~''~
Ip N 01 N N N N N N ~ N N N r N r N N r N r r ~- N r ~ N 01 r
n st n (O t0 tD O) m n S O ~O (O O O n n O N n N V = O N
M n Q) O M M n O O (O N n!1 ~ 10 N M ~ 10 10 m V' ~ t0 Q) N M m
N 47 O M CO 07 'P m ~ N p V' (D (n~ r (h t0 (rp O O o i~ O M O) O! ~ O ~ ~0O1
O
'mQ' ~~ ~~ M ~~MM ~~ ~~MCn~Ib~~M~MM~ ~ ~MlOnl7 ~~M
°' E > > ~ mo H m
o E .E E .o o .o m _0 0
_ _'o _'o
m B m m ° a~ ~ ° ~ m ~ d ~ ~ m o m o
~ ~ U O ~ U ~ m U GI ~ N ~ N m ~ U W U m
m ~ E .°' E E .o m .~ .o ~ m ~ ~ H ~ ~ .a~ m .~, a
N N H N t_ N E ? $ m .~ o, ~ ° E E ~o o 'o ° E E E E _E E E
H ~ N E w E
U U U U ~ ~ O ~ O ~ ~ L G m f_0 m L C G G ~ C ~ ~~ G ~ ~ C
> >3 ~o H m~E~ aH .~°oEm~v,'r3vEmmm~m' ~ ~RE~'°mE W
E E E E ro o a c ° o c o c ° a a ~ d m.° a a a a n a
.° Q ~ o a $ a
7 77 7m o $~'~O 00 ~'~'H~H.U~U.~SSS8 H HH~oEH~H
D N ~ O d nj E cV M ~ N
H H 2. ~ ~. 2, ~ f0 O N (O ~ t0 O m
m ~ ~ G (p
E C Z 7 n U O a O N ~ aD O N N ~ r
v ~m :7 d w n
°E ~' ~°c ~ o. ~c d n acr d U' m E d
E E
.o Z °- _° ~' °' ~ . H ~. o~ ~ c o rn o~ ~ ~ mH' e>
U U~ .N . ~- _UZ tn~:E ~ N e0Y ~ tOp ~ m
~U n'o~~ Q ~ E'~~?..'c'.EEa~'E~ ~ E
m v ~ ui ~ ~ o c c ~ 0 0
N e1 O m m W U' O C ~ ~ O C = d d U C ~ C
E c ii o~ E c n ~ y' °v rn ~ Q. n acT ~ O o~
N m ~ H m O ~ of m O Y N .'V'-.. 4i wU.. O W Q "m" a m
c ~p v E °m n. ~ °m o.~o,°' n. 3.a ~'m' m ~ °
:Y N E r v ~ o N 'o E ~ cmo o E D ~ m E d o
~ ~ E can v o ~ N ? ~ m i a ri $ ~ ~ a o_ ~ $ N % a ~ ~ ~ Q o
G ~i~~ a.2 ~ m ~ ~a ~ 'o.m ~mt~~ c c ~_~ ~N m ~~~c-U~ w ~°~
v ~ °x v ~ '_ ~ ~ N. M aW ~ a~ °' a m v m M o o .° M ~ ~"
f~ ~ M m~ ,v_ a~ m v M
E O U ° '1p N ° E N U ~ N O N N m N ~ O N 0 'V7 tE9 ~ W N O
~ H O fp
WOtL v~N UO, OTUN TUU TVHOt.G(~Up$pH- - - (DG' U'C C1
r E .N a d! h E ~ G ° O C ~ 'E C 0 ' ~ Y Y N O ~' N ~ d EO ~ U d p E ~
o O
E o p W ~ ~ ~ oim ? H H ~ m o ~ H m ~ ? ~ Z Y o ~ m ~ m N ~ m ~° ~
m
p N E ~ MV E 'ip U 07 ~. ~ ~ ~, (' 07 T H U O ._ U ~ ~ j U
M7fn~~ ~.C ~C ~E~C EN~C EN37°UV~7777 7H7Tm~C
m 7 (- fMV VJ ~ d 'C = GU1 d m U CU1 L 'C ~ ~ m U G 'C L 'G 'G ~p 'C 'C V V L
V 'C
M C U T' H 'W ~ C. ~ H T C1 H ~'G ~ ~. w ~ ~, ~' N ~ N~ C7 01 U m >,
0~5o..c~~o~NmUUmEEN EnH~E~~~umwE~mmm ~=%~~~a- ~''mE°m
~~y~~~$$~~~~~sasa a~asy~. $~s
a c~~ ~~ m~~ mZS m~C7~2 UZ2 mCJ~A~~I,Ljtl~~~~~~~ ~H~~~U
a»n ~ m °~ ~ ~ ,~ cM~i ~ n n ,'tn °' o n m n
_ m
n O~ OO ~ N~MO n0 Y~MNO~aNDOONMfp~ h aOp.p ~t0 ~om0c~p
O m O O ~ n t0 O m O O O O ~ M N m~ m N O n M m n n O
> o ° o m O m U of C! rn o~ W J rn o eMO ~ ti ~ o~ M °'
a ~a ~a a ax~a xa x~N~~~aaN~N~ a aN~ao
u~ m n m N c m o ~o s< rn o u~ o
M OM (Np~ ~M ~ ~mm mW ONE n of e~-apCNpn mM
n M N n O n M N ~ m m N O M ~ fD m Q N M st N n
n M 07 O h O m M O r M O M O m m ~ O O) ~O (O O ~ ~O ~ 10 pv ~
r ~O N M m sT m N ~ r N ~O N M '? 47 r .- M M M M M n
O 4U7 iMf1 1A A W ~ ~ ~ N ~ ~ O n tn
a°~oo a°°o~ ~ My~.Qo yU.n ~UmoaNOaNO°ooMm~m ~
$mVli moo
a o Q o CJ ~ J h O J C~ J M U o 0 o Z U U C9 o U ~ U
,Q, O U U U' ~ U' U ~ ~ o~ o> IL U ~ ~ F- tn
sf ~ i~i ~ ~ o ~ U u~ Q U m U ~ ~ ~ ~ ~ ~ t/~ ~ ~ ~ ~ Q ~ ~ tn U ~ tn
w ~ ~d ~U' mmma m~U' m~~mmm~mmmmm ~ mmmm m~m
m m~ m~ m~ ~ m~ m~ m~ m~ m~ . m m~ pp m~ m~ m~ m~ m~ m~ m~ ~ m~ m~ m~ m~ m~ m~
m~ m~ m~ m~ m~
C9 C9 U' C9 C7 (9 C7 U' (7 (9 U' U' U' C9 C9 C9 U' V U' U' U' U' C9 O C9 U' C9
C9 U U' C9 U'
Q ~ ~ ~ r
n n
T' ~ ~ t0 N
M M ~ ~ ~ ~ ~ ~ 'W0'
O O O O O O O O O O O
119
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
r ~ ~ ~ M o
r m a0 t0 ~ ~ pp a0 M ~ OD t0 m O~ Of Of O M r r O 07 07 O W O~ M ~ V r
m rno~ o~o>a~ o~mo>o~ o> o~o~m m o o~a~o ~Va~m~jo>a~a~rn
Uoo Q~d ~~ °'U 't°' °' °'w' °' v rnvyV
U cto°,' ' t n
~'ozz ~~ ~~a', q~a~a' a' ~a'a m ~' aa'?O q Los doQ~v,~
N~NN WO ~°~NN~~NM c°v c~l~d'd' ,?~ ooo~ ~~''mr~r-r v
r r r r ~ N N N O O r OD N O N ~ N
hV Wa~D(00 NN W VM''~~OOOV ~ VO'V fOD ~ O NOO('7 !'~ 1~(~OO~P07 VO'Ot~I00
tO N~p ~ V O ~ ~O (h cp m O»(7 O M W .- cD up7 O N CD 1~ h O O t~ O ~ N~ 1~ 07
c'~ f~ 1~
M~fr~COn ~~ ~~~f~OM('~~M~ M tOOfO~~ CO~ M ~f~~I~r7M ~ f~07M(Op~f~h'7MtMDfO~M
N fn _N al IA
4J N W N N
O' O= O7 ~ ~ ~ m O O'
Vlf/1 -O y' m ~~p ~ ~Il ~ ~ ~C 'mm
~ m v ~ m m L° m '° o, ~ m ~ m d v o, m '~
m d
~'n~ ~ a ~°a .~ ~ ~ °-°-n' _ ~ ~ °c °c W n
~ ~ _ ,o ~ ~ a n
v, ~ .SR ~ ° E E E E ~' ~~ ~o E m m m ~ m t N w m N m E O ° .~
.,~ E E E
y m v v ~ c ~c c ' '.' ~' = E E E E ° ~ m m o m d c ° ~ 'o ~ c c
c
Nm T'~ UU~70VUU~ t t~n0 n C ~W mNm N UVEOmpU~IU
o w o o ~ a a a a c ~y d a ~~ o p v ~ ,v°°_ m o o E o o a ~m ~ o
o p a a v
E W m m ~ ° ° U ~ p~ U U ~ O ~ O l0 ~ t m~ O O ~ ~ O T
° ~ m O ~ T ~
O - W m ~ ~ ~~ ~~ 3 m x x ~ x x ~ ~ fn ~ x fn
x F U U iO ~ ~ ~ ~ uJ uJ U~ ~ L~ O O ~ tn
a
c a a> Q ~
Zm
°' U In c m m
c vm, m ~ cv '' a W ~ ~ °' ci cv
m ~a co 5 ~ x ~ ~ a n o 0
'c .B? ~ ~ v m cr~~ o .~ U' E c c v ° ~ s3
N c > > °' o. o p°n m Z '? cr n
a ~ c c .~ ~ c m 0.. ~ X v c c
z m m E E m. O ~ ~ W _n ~_ m m
°' °' S. E E E ~ Z N m m v c°~ E ~ E
E ~~ O Nm~ OOp°~IW O cOUV ~ CC x x Ot C 0) .
C : Vl' N _: O O N H Z Z ~ ~ 'O C O' C' Z Z ~ p' -
N N ° E ~ ~C ~O O m V O U ~ r O' c O m m m m m m N '.
m n °- ao ao E m V Z E m ~ W ~ m w ~ v E yn E
m m u~ ° ° ~1 ci cV o '° Q W c ° n ur m. o g m o
Q m m t d N O7 O) d -°p CD ~ m .~ V' O m ~ N N d C N '~ d
Z c.n nm~°EE~m U' c ~~ c °.n°'$°'~E
n_'°'
E E d ~: °: ~ ,°k ,°k m t ~ ~ c 'o E ~ m o o ai o 'n
m ao o y c ?3
d N N m E E d O O ~ N N ~ h ~ ° U ~ U U M ~ O ~ Q ~ E N E
7 H ~ ~ 9 N m O. ~ ~t U U 47
U U _ U N ~ x U
~o N °° °> c ~ ~ '° ~ m ~ ,Q ~ .~ O ~ ~m m ~ E E ~
m pap ~ a°'o d o c ~ ~ vh' cn
11 ~i IL ~ h h N ~. E E n ° ~ n c o o 'cZ ~- ~ m
m = S a o ~°n ion = ~ p ~3_ ~ = E ~ ~ ~ 'Np ~ ~ X iWn = o~ ~ ° o
O w ~ t~
ONN 4E7~ OINE~EE~E VT VV-C.GE N~fr(~mm NC~MNOMEE
- - O 0 4p
N C U U V T .O ~~ O a O O O . (~ ~m 'V O = m V et O O ~ Q O U 8 ~, m Q H u1
N t O U V V > .m.. w r Q N ~ L ~ N ~ ~ m m O W 09 ~
o mrn rn w ~ ~ ~ ~ ~ N ~ d rn ~ O " ~ m ~ ~ m ~ E ~ ~ E E E m ~ U ~ N X m
L° L°
m n m ar m ? ~ m " Y Y ~ c° c° N ~ c W ~,m W ~ ° H c c t
r t ? E $ ~ ~ 9 ~' m m
~ ~ r =_' m ~ on > > > z v v ~ m m ~ 9 m Y m d ~ ~ a ~ v ~ ' c c 3 ° m
''.m-e ~ m > > >
~ a ~c ~c 'c ~c ~ 'c E E u~ ~ E m E c m ~. c U U m d. ~c E ~ v y n 'c ~c ~c
~ ~ ~o ~o ~ a ~ ~ a a '3 ~ 'c a a ~. E o a ~ ~°n W ~ ~ ~ ~ c m o .h c H
'°~c ~ ,~ o o ',m" .m ~ a ~
E N ~ d .U~. o U U U ~~ U U O . ° ~ m E ~ O m ~ p G C 7 E O O m~T O = U
~ ~ W O:~Q! ~U. ~U. ~U.
wOUU in~'~~'~'~'uIUW ~'O~ooao~Qm o~Q °Q mxx~x o,x ~~'ui~nU=x222
r. o o~ in r co 0 o cn o
m d 1~ ~ M u~ (D to ~p V V N m
mooo ~~n ~ononcocyvao ~ oao ~ Nn°°ni ,~ vcoaococ~ ao n
a0 a0 a0 01 t~ 07 tfi M u7 O O a0 N 0D (C ~ O) N O ~O N O ~p N r
M t~7 M ~t O V' t0 N f~ O O ~ M O t~ f~ f'~ O O O d. O O r O G~ c7 O N O r
~ m J ~ O~f ~ J ~ et _V~ M N yi u. o U o U U ° U U ago o ° 0 ,n
°° ~ o°
X N N Q 7 N N Q N > > IV ~ Q Q Q Q '~ Q Q Q Q Q N 7 Q a ~ ~ N ~ N
M M O d CO O ~ t0 ~ M M O ~ ~ O W N c~
P ~ ~ ~ ~O V' M O GO N 07 f~ tp ~ ~ O f~ t~ N V ~ N M 01
O N t0 tD f~ O O N °~ N a0 a0 Q m V' K7 h o0 07 1~ h ~ ~D ~O 'Q c0 ~ M
O V7 V' 01
~O th ~ ~ 1~ 'C M V' a0 ~ f~ I~ 07 ~ O 00 N 'Q O W 0) O) tD (O aD W (~ 10 h- N
07 1~ 07 00
N f- M do t~ N M N c'1 M M u7 r ~ a0 f0 r it7 r r r r r M r '- ~ C'1 M M t~f
C~
O o
NN n0 ~xWOM7~N O) Nmf~Olr00)~~~OaO
'p a U U a°°o U cw OU.. v ~ o ~' m o ti v v a ~ n n r Z °
O c~ r~
~i V ~ ~ U V ~ ~ ~ Q ~ = o Q Q ° ° v o o V ~ C'l m ~ O U
o° V
~ g w w N ~ ~ ~ ~ ~ ~ ~ ~ g ~ ~ S~ u. ~- Z U U ~ U U U U w U U_' E- o -~
~OUU . O U, 4~a ~ ~ .na~.N~m ~ ~ILtnU a~7~
~n>~~ as aaa~~a~ ~ N~~ ~ a ~~o~ ~ ~~a ~~a~Q
u~0?z mm mmma m ? x Za2 a m aa~d a mZaOm m
m~ m~ m~ m~ m~ m~ m~ m~ m~ m m~ m~ m~ m~ , m~ . m~ m~ m~ m~ m~ m~ m~ m~ m~ m~
m~ m~ m~ m~ m~ m~ m~ m~ m~
C~ t9 c9 C~ c9 c9 (9 C9 C~ C7 C7 O C~ C7 c9 (~ c9 c9 c9 O C9 O O C~ t9 t9 C~
U' c9 (~ (~ C~ c9 C7
n n Wn ~ m m ~
00 N ~ Ip tp h aO O
O tn tO O 47 ' ~ N ~ ~ h
v- w- ,- r e
0 0 0 0 0 0 0 0 0 0 0
m m m m m ~a m m m m m
120
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
v~ o~ n n n a~ o~ n cn co
m ai °~ m a~ a~ °~ m °~ rn
o> ~ o a~ o~ o~ a~ ,o ~n a> o c~ °' m o °' o_> o o~
m ~~ ~' ~ o~~F-F=!=~ c°o' ~> m~ °'~~ ~W
o . 5 .n Q > > Q U U U o ~ c m ° ~ c 5 Q > > Q tiJ U U
z ~ -~ m ~ -~ d ~ O O Z ° ~ z 5 0 ~' ~ ~ g O O O
-' ,.'~ '' i:u- c~~rn~n~ooQooo ~7uS~ ?-' nv
N ~1 ~- ~ r N O N N N ~ r r N N M N ~ r ~ O N
r ~D o0 t0 N 01 tp '~t V' ~T N tp n n O_ ~t n N 01 (h M O C~ O O O U7 (p
(U V7 (O O to (O (O W n ~ ~ M N 1~ W Q) O N OD O (D N n
W n O ~O N t~ O~ m co aD h U7 O~ ~ O r O O O ~ c~7 n ~ N e< o0
M M ~ ~ ~ V t00 ~ ej V' M f°~~ ~ ~~ f00 ~ c0'1 ~ ~ M O f0~7 ~ ~ ~
~ V'
N m j m j
.m .tn U .01 U
d m
O ~ ~ - O N W m ~ m ~~0 N
9
m ~ m C U Op p)~C ~ m ~ ~ N
O j h C C m ~ O U O m N
E ~ ~ U E E '~ b
m m m E ~n ~y E u, m ~n m ~ m m ~ o, ~ E E .~ m
c c c _3 c ~ j ~ c c "~ E E m m m ~ ? m ~ ~ E
W N N U N ~U N~ ~~~ v~ N a~ d ~O- ~ T ~ ~ V ~ Q ~ m ,.m. ~ T a3 N
0 0 o ao ~pEE~>'Sa o,~,n;~o ~-o >;c oo~ a
E E c~ E O a N m m ca E E
Z Z ~ ~ Z FL- ~ ~ ~ Fo- h lo- Z Z U'g t~ D O ~ ~ ~ U ~ ~ U in O t-~-
ao
01 N Q1 C N z ~ N N m i a
O ~ O N O CV N W ~ (V ~ 9 m d ~ f0
~g
~° '° ~ p m ~ y m <° ;~ m °' E N E
N' ~ z ~V C~ a Q a~ m N d ~ V ~ O a
r D r N O m 'p ~ m ~ ~ yj n
U ~ ~ ~ m m Hi E U E U m W C
E ~ N In N m Z E- m m ~ C Y .m-.. ~ Y m O m C d
o N ~ ~ d ~ E o D m O a~- °' ~ ~~ H a E w a
n n n m ~ Z ~, N m 3. 3 ~ °~ o Q
U N o U N.~ H ~ H Q m m_ O m O $ a N ~ O cg N m O 8
Q r U O r: E E D. E h m (I1 Z ~ ~ H O 7 m ~ = W U m m~"v C n O
N C ~ N O ° Q O U ~ ~ ~ H ~ m ~ C C m lL m ~ 10 O V m ~ N L m m
O ~ l0 (G ~ ~ ~ R L ~ ~ ~ ~ ~ ~ L ~ ~ ~ d L Op N ~ O N
c rr~. mf E n n o nv o °.o~
p S'°mm om mmmo.-~ ,~ e? aaE ~~m m~rcm
n °~ ~ n v ~ .~ a'~ ~ . a a n H j ~ '~ a ~ ai v w. v ~ ~ w Q c ~ N "~ O
m c C N v
aim~EZ~A~ °n~suaTm~°.~~Q_m:°.~~~~
o Q a o ~ o t m o m ~ ~ m o W Q. m ~ m m 'c n o. o r° w ° Z m ~
m of
umd ~m0 Enco c~ci=Zm~$yi3~ro°Tp.nE~oU' oOE~m'Oa.~g'o~ ~u
0
EdE Em~TU~~c'~va'ma'2j2~dr~vn.ac°.mtTB~ocTBoEo°' ~o
m ~ ~.= m m M c o. M o n ° ~ E v m a o o c _L = E v m m m m a m m t m r
~
~ v~~g'~~~vOvpvN~E~c~rEnpU' d.E~'~-wE~~»~E~~~Aw~c $r~
W ~ W ° 'm 'C ~ ~ 'fp ~ M N 41 Z A ' O m C ~ t Z O O m .O . E 7 N ~
~ m N a
N ~ N V O a! ~ ~ n n n m M U m ~p U U C a N N _U C ~ ~ C ~ n ~
X°o~ x°o~czW
~md~ood°'~~°o;~~cOUNUEm~'~oa~mmoaNm,c~~ nE
. ~~ E E p ~ 2 d tJ U V m M ~ (~ O ~ ~ Q O ~N v O ~ ~ a U d~ Q Cu T v ~ p ~ U
N i0
aQo~ N °oao Em_-m E m~E c'c~ oX~(7 ~ °~ mZ.~S_~'~ v E y'~~ v E y
H m~Y
E c C9 E ' m ~ ~ _ ~ ~ ~o N tn v, Q ~ E $ a ~~'m ~ N .'C' m 'o ~ M a 3 ~ ~ M
o. H o m n ~ r'
a N d~ V E N d O 4 7 m 7 r ~ ~ O '- O ~ fn E ~ 47 N m ~ e' C ~ V 'p ~ d ~ ~ a
O ~ n E' ~ ~ ~ m
t r d L. r D m N r ~.- T . Q O' ~ C
a m am c"3~c~> ~. ~ a ~~~ '-NJU)? ~~ or:~ u.°aZr'Za m ~~ a~ W~.E '"~~
~~ o
ONN N O ~ ?'sy >~'~Q W ~Q~ c° o o ~s_ E ~Y ~ o'o ~Y~ am R~~fnQ
E N E C E N U ~ Z ~ U ~ E Q 19 01f W ~ 'm E m O m ~ ~1--O r O ~ U U ~' ,fg ' f
i/i O ~ Z Z
S 4 = U 2 Q ~ = WU'' ~ ~ ~ in f~ Fo- h i, i~~ C~'J L tn =U' ~ ~ ~ ~ K U W. o,
~ ~ U ~ n in n'~ U 1W- ~
'd n ~f ~1 07 V' N (O Ice. O O O
W O CO N O h ~ 01 N O O a0
t'1 V' t~ n O O) (~ W m O P~ N h m OD r n ~ ~p ~ O ~p 10 N ~
V V' 00 n W O O O O ~ N ~ N ~ n. N p ~ ~p N ~. tD N
M N f0 t0 N N N ~O M M !h a0 O c_'I c~ tp N W N ap ap N 1~ ~O
J J -J ~N ILJW~,Of'D1~O N J~ ILLOL ~MlL WhIL IOL
a Q a N ~a a x a > > > x U' ~ a a a a ~ K a N .J Q Q U
n n
~ ~ O M O M m
~ ~ te
c t V D O O N O U7 r O O) 00
D 0 ' V N O ~ 10 - u7
n n O) ' ( N C~ N 1n 00 O
M N N C~ 00 W f~ c0 .-
O O O N a0
.-
n0 O O r V' V' c0 N O O C7 OD 01 n
N N Q) O O O t0 N 07 O O th c7 V c'7.
.- N r t0 tD (O M .- .- c'7 d' N
C~ t0 ~D V7 V ~ .- M
d
o N o. V m
O Q 07 M M O N ~ 01 a U1 m m N N
N C7 N N O O
~
o' . ~~~ ~o z~~
E.-'NZ~~~~~~, N U ~ i j
p ti q ~ t~
cc u
>
Z T ~ ~ .~ ti _ t t t
S j c u- ~ ~ ~ i
. ~ Z ~ N ~ ' g Q
q ~ ~ 4
E" h ~ 1- F- ~ ~. a~ N
~ ~aam oa tn
v~
a a m ___ a ? y m y y w
a ui y y m ~ y y m
a W m m
W y
>
>
>
i ~ i t n i i ~ i
l m i i i mm mmm t m m m
m mm I t ~
m i i mmm
i .-mmmm
mmmmmmmm-.
(~ t9t~ c9 C9 C~ c9 c7 c9 c9 C~ C~ C~ c9 (~
C~ C~ C7 t~ C9 c9 ~7 c9 c9
c9 (~ c9 c9
a~ v M
~
n ~ ~ ~ ~ ~ ~ ~ m
n O N O~ O N aD O7 N
~ ~ m 0 0 ~
n
~
1O f ( f n
0 0 0
_
O O O O O O O O O O
121 .
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
m ~r
m
a~ o> .. o~ ~ ~ ~ ~ ~ ~ ~ w m m ..
U o~QQ~~QQ c~ c °'~ cUU°'t~t1°~Q°'
O ZZ~~-°a~~~ ~Q~~ QQ~00 ~DU°~.Q
c~ th ~ a5 ~ cb N ~ N N t~7 Q
N N N O N ~ N N N N ~ N ~ ~ r ~ ~ N N Ob
O
1~ f~ t0 M N tn V' V O u1 N O t~ O O O N N O~
tC u7 a t~ G~ V' W Of c0 m7 ~ O c0 Wn O m (D O N N
(n tp tD ~° a0 tC CV o0 t0 N ~ a0 c0 O O O ~P V ~ (D W r- O O
V' c~~ ~ t0~7 ~ ~ M VN' V N ~ f0 M ~ ~ ~ ~ ~ O M M M C~ M
N E
N ~
O a
O w w' E
O ~~U W N ~'
O O
R ~ y N N 7l C C °~ t4 t
'- ° '~ 'c n m E ~ a
N h N tIl ~ N M N E E ° (p ~ ~ d N ~ ~ C M N
C C ~ C C C C > > C U T
E v m o a~ m d a~ d 'c ~c ~ m W a E E ~d m ' d
~N N 3 'N ~O ~4~J N ~N ~ p b N H E a c. v ~ ~ N M d
0 o E o '~ 0 0 0 ~ a Q o ~ o ~ o o c ~ ~ E o 0
E E N E a E E E c~ S d E ~ ~ ° o
i x° ~ x d= z i ~~~n x° x z ~o' o v ~dN xx
a
z
_o c ~ m m m
E Z Z ° ~ ~ ~ v ~ E a_r
c Z z m °' °~ ~ m ~ ~ °~ Z Z o ~; c y o~ ~
U n a o c m m a m .
UUmE Ecc c ojc~M (~O o w.
W1ZL9 0 °~ v E ~..~ ~cOn UU °'oaW '~~
i: ~ d ~ ~ ~ 2 w O ~ ~ Z ~ .,,,~ ;. .~ o m m
n CO U E N N D D ~ ° ~ N 5 7 ~ c x g' C
o c~ c~ m N E C r ~ O d d ~ m m E w O
a ~ N N C c O m h ~ U ~ ~ ~ C U ~ U V
d d C
n r~ ~ ~- ~- n 'n o~ w o '° z ~ ~ c~ ~ ~' Z' o E
~ V O' V N w 9 g N (V m o i~1 ~ ~ C
1' f' M V7 Y ° W ~ O C
"' E E o o ar E O m ~ x x '" °''W°- m o~
.j. ~ ~ O E E D. _O M ~ '$ M C ~Q ~ o a ~ N
,g x x E ~ a~ m A °- y ~ '~° '» Z
U ~ m ~ di ~ '- O ~ m a~ $ tn ~ H ~ c~ ~ % of of Q n D tn u>
(7 o c m a m ~p p> > N 1 N ~ m U ~j U ~ v o o w o_
~ c~j Z ~ ~ N ,o m ~- ~ t~, o ° ~ o ~ d ~ '° ~ ~ m m
~J Ti c~ 'c. o ~ o 0 o c y c y c.> m v O ~ E Z m H Z ay a~ D in v - o m
.O Q. ~~ 7 ~p 7 x V E ~ , ~ C C ' tI!
m ~ d ~ o ,~,~ p ~ p n d n m n ~E o 1-~ ~ ~ ~? ~ O ~ o i-°~ ~ ~ ~ ~ ~ o
x
'~' '° Z o ~ ~ .D E a ar U d C m C N o 0 0 -~ ,~ o N ~ E ~ ~ '~ m ~ n o
W E ~ o o » ° ~ z o a o m a m a o o z ~_E uw N a ° o ~ o ~
m c ' v ~ = c
d d E d ~ -o° m d B M ~ a E ~ ~ ° ~ ~ n °' ~ w o m g E ~
m
H o ~ c ~ Jc ~ tn °.~ c ~ ~ ~ ° ~ 0 7 ~ N ~ cw~ O ~ m d ~ d ~ m
~ ~ m ~°-~ ~ ~ '~ 2 ~ d
tn cl~ o o m to a E E W m °' d x a '° N_ 2
m g m °-' tn .-is ~. a_~ m °' o o 'Y '~ °~ w v ~ M ;c ~ ~
m tn 'E 2 '~ °- Z o> . o.
O ~~ (L ~ oo ~ W ~ c..~°o ~ ,.~ m ~ ~ U ~ E N ~ j ~ ~ ~ ~ t L IL ~~~ W
~ ~ N 'q. "
VJa o0 o~U' ~~ o d? o m°m~om~ a~ a ~~~~mc0° ~ o »O
r°n0 c~~ no~UU' V
=a=a E~x° mQ= N T~ a~ ~~~ o~~w~z m °~aao'a ~ a~d~v c~tm~ c~
m NN~NO~1~ ~~ MfMD~~M O
W W O M N ~ t~ 1~ 07 c0 ~ N O O f0 f0 n 00 N ~ 47 N
N O~ p~ O M ~° N N ap :p t0 ~ ~ O> O O O n O h
O O ~' p N N N h O O O O ~
o OL~, ~ tD t0 O a0 O V O O O p ~ ~ N N~
a '~ aQ ~ ~ NN~ ~ ~L ~ as a ~ ~Xa C7m
(O CO 4J a0 N t0 GO a0 O
00 V' ~ W (O O) f~ N O (O 47 O 1° 10 ~ (D O aD (h 1° 1°
I-. ~ N o') 1~ o 1~ ~ d' ~h O O ~C N ~0 ~- V t0 M t!
N ~- e- d' .- .- .- ~ V M d' ~d' V M V e- v- .- ~ h r- cn 47 ~O
O N O N O ~ o f~ °~ °~ CNY n
°f D D ~ O a tMU N N °~ N ~ ~ d O O ~ (~ °~ If1 b
a0 N N ~ ~Q O QO O Q O N N O
_ 2IQUoU~~ E.-~U~ =~°~Q(J'~Fa---QNm
fn ° ~ ~ n. o
N U' C7~'V~'~VvhM-~ 'H I-~-~ C7U~' r
W ~ ~ w a as w w ~~m W w t~ii
00~ ~ m m~ Q1~ m m~ a7, m .. m~ m~ m~ m~ m m~ op m, m m, m~ m m~ m~ m~
C~ U' C9 (~ C9 C7 U (~ C9 C9 (9 U' (9 C9 C7 U' C~ C~ C9 C9 C9 C9 t9 C9
N O v
co ~- oo r- o~ w v°
o~ o ~ t- n s ,n
n rN.n.~n coaNO
0 0 0 0 0 0 0 0
122
CA 02571917 2007-O1-08
WO 01!66573 PCT/IB00/02035
m rn rn ~ ~ -~ m m m m o~ m m °' a~ a~ r' m M m w m r m m
r ~ Y H f= t= °' ~' ~ °' °> °' ~ o~ o~ ~ o~ o~ ~
o~ m ~ W rn ~ o~ rn rn
o Q U U U > >' a ~ o ~ w n Q m d Q m m ~ ~ m o~ o y c
~_z~o 0 0 -~a -~za = Q ~' ~v~ ~m v~~ v~ =z u.
cu dW d~ .~ d~ ~ ~ o~ d~ ab Q ab ~ .- ,1~ ~ ~ d~ dwE ~ ~b a d
~ N r N ~ r- N ~ ~ ~ N ~- ~ r ~ N N cD M r-
t0 ~ O V V' f0 O O O O 4'! 07 M N ~ r If7 O O b r O 10 g Q1 r b
07 N ~O (O (D r a- m (O N N r M N m O N O V O c0 r O m ~t
~ O QO b ~ b a! N N N b 47 r (h O pp 01 07 0 h C7 'Q b N 0 QO (tDp
~~MMCr~Mfb~~~~~M 007nr~fb~fM~~fm~ f0~1t~0~'00'~~~1~
a .~ E ~ E n ~ E
_m m .~ . ~O
C C C m ~ E -E m ~ N 0 W O! 10 W
vi oW ~ ~° ~° ~ ~ ~ .~ ~ .o o ~ a a ~ ~ ~ o m
° v a~ a~ a n. n a m o of w a .p °' E E ~.° 'C a~ of N D
~o o ~ .,mo m ~ E E E E .~ v ~ ~ ~ ~ d c ~ E c m~ H ~ a m ~ 3 U
s r t ~ m ~ ~ ~ ~ ~ ~° W m m °m° ~°o m W m m m c
.~ o A ~ ~ ~ ~ ~ ~c
~dzy°ao 0 0' aaa aoo c caCOa'Qc~c~sm La '°Ecc
.c .c E c c c $ $ °v -$ c m Z' E E ~, o !° o m° °
,c $ a
v c) ~ m ~ ~ T T T T ~ O E ~ E O L i0 ~ m G m 'C 0f ~ ~ T
It~ I'B x U U U ~ ~ ~ ~ U O C~ ~ ~ m U m U U ~ U ~ U ~ > ~ U 2 ~ U ~ do
Z Z Z ~ m m
E Z Z Z U ~ m N m
O r ~ D: ~ ~ N m Z G~
m ~ O W W W ~ N ~ ~ E 'G = G O~ tN0
7~N, ~~ J ~ 00. C '~ ~ ~ mN ~ bl..m. ~_ ujb
E a °' w a tau d ~ ~ z 3 3 E- ~ o e? n c '$ c
_~ nE~v> v) W E E o>U ~ ~ m ~ ~ ~p >, ao ZS W E
d
m v n ~ ~ ~ N ~ tL Z ~ °' c. a~ d .. . m 'o ' ~ Q . ~ W m
-°- ~a v : '- '- ui m ° Z rvn ~ r a a o m ~~ m Z 'c eo' d
m o ~ ~ ~ ~ ~ d ~ ~ a ~ ~ i° $ $ ~ a ~ v a E ~ m
ow r r r ° o d u1 a 'a m ° ~ w o ~ m m
~cccm%~o:'mco zz ~~mn~~° '~'~°v
c ~ ~ O ri3 ~ a Q p, c'S ~ _o E ~ D O ~ m E ~ o ~ °= t
o~>>opEuiNm$=c JE'a~a'=$~N~ a°cE
O ~ C °~ d 4:
O M 07 Hi O N N M U W ~ x ~ 3 t~ ~ O 1~ ~ C C $
~cEEE>,o,t~>~a°~accc,~v~mgo~fmdd°a~°~>
N ~ H ~ N ~ ~ N v- ~ !L O V a m m_ O O m_ p E' O E N ~ N T~O v
O n O d n M m m M ;p E 'C ~ ~ ~ op ~ = b D m O O O x M
~ E v E -~ ~ v 2 v v = ~ o- i. y ~ °: ~"c ~o m ~'c m ~ m '~ o> Y a ~n.
~ ~ x
o~odo o~,~EE _mm c ~ cn ma»fa n af~m E' o~vco a,mm
m ~ ~ V ~V f0 n O O C L al 7 _N t0 W O C .
~ U E U 'O V 'O ~ O ~ ~ V d N m ~ O ~p E C O ~ C ~ = Z N. C ~ '° O Ol
~ G C C C C C ~, d N ~ C N V V N E ~ U d U V d ~ ~J O W $ ~ N C O
N ~ N m 7 O 7 p ~ W O W r .~ ~ E N (0 O m O ~ O °~ M
._ °~dcann nmorj,O.o~~~a m~mc c opnm amui Enu. ~v.°
Y Y ~ o _ y . v _ .~ m °~ w y ~ t1! v v E m m m m ~ E = ~ m m ~ o J
~ ~ r c
(~ c°~ ~.c-~n~.3t .~~ .!Qt > > > >:~ mM m.~ y.c c~nr~~. aY,-~°n
n~v: v ,°~ $ m am~°U U m E
t r t caa W. ~ W am IUiI .°' .m m m ~ ~ ~ m E ~ ° ~ ~ m ? m 3 ~
O e' o o ~ E ~ d co U ,a ~ d
~d°oaU' oU'~oU~'a-a.n ao'o~.'~~°~
~y~vUv_oU~rc~ivNrvc°~apo,~~ ~m.n
UUdm~C~d~$~$' $dmW~ d~' >>.GC~IC~~m,~CLCS 77 ~~$
m l0 t0 ~ ~ d' N ~ T T T T (0 E M m O 7 ~ ~o ~ ~ ~ ~q ~ C7 (0 'E O 4'~ ~ ~ >.
UJIt~xUdUdUd~~~ ~UOo~ U o~U U mUd m~ mUXx viXU o~I2UU dr $~
r C07 b tp m <O V' 4D V' V' ~'~ N b N m O Y ~ O '~ ~' W 07 b b h
r r r N m N N O N r O c0 O ~ ap ~ r_ r b h m b W
01 O h [~ r r O (~ m O ~ O r- b b O b b M O r M C1 O h
a0 O N p~ O O ~ h aD sf O 07 O ~ O O m M ~ M O v- .- b r M
IL M o~ a~ m r a~ r r a U ~i o a~ d m m m m ~ o~
~ Q ~ N N N N N J N ~ Q Q >- ~ X ~ Q X ~ ~ ~ ~ ~ X X ~ N
O m W m M m a0
o b cv v ~t v M u> m M h r o
o M r h ~ rn o m m m m m v w ~ ~ ~ ~ 01 O O O N m N O
O ~ r r Of to O) O7 OC b aW I7 N m_ N N fD cD O> m W
r O M r r r 01 O m Of m ~ ~ O N h b Y M O ~- ~t Of (O ~ A
~- r- ~ ~ ~ r- M < M M M ~- f0 ~- N ~ ~ N m '- ~- ~- M e- N m N
Ot ~- ~- _~- d. W
l~ b n Z ON7 ~ fmD N N ~ d o r 111 b it
M b m O
0-' M ~ b d O
°oN~ ~ ~ UUC7 U~~ '- Z o ~$°o °o ~~ Z~ °pnDD j U
U M U U V 1- ~ W I- Q ti Q C~. n. a. .. V U C7 C~ I-
(9 (9 ~ ~ ~ ~ t ~ ~ Q ,U, ~ U ~ a ~ X ~ U ~ Q U U
aaa a~t- ~ a ~ N
mi mt mt xt xt =t mt mt mt mt zt_ rt mt mt mt ~t at at ~t mt y zt y y ~t mt mt
ml
mmmm m m mmm mmm m m m mm m mm mm mmmm m m
C~ t7 c9 C~ c9 t~ C~ U C~ (~ c9 U c9 c9 C~ C~ c9 C~ c9 t~ c9 C~ c9 c9 c9 c9 c9
c9
O N ~O 01 O
rV O ~ ~ ~ t°0 ~ O N
r .- m O~ ~ 41 OD a- r- m
O m N ~ O CD ~ O N
a00 ~ W m ~ ~ O ~ N N
O O O O O O O O O O
123
CA 02571917 2007-O1-08
WO 01/66573 PCTlIB00/02035
m
'
m ~ ~n~ w ~ o~ m o~
o~
0
t a a~' v> =wa ~da a v a t Q
~ ~
~a' ~
oZ?o~
1~ 1~M 00 eF V' ~ N
~ ~d ~ r M V r N ~ r O
Q7 V'
~ N
- O
~ tD N
' N
r e N
N
N N
V
O ~ onO ~NO O) O M Il7
N ~ r m n ~ ) 1
N f ~
~ ~
~ u
~
M
~
O V r X11r 7 O N ~ ~
h !~ M N _O) a0 WW I~ N t0 M m
~ In N m MN 1~ M M M M M
N t0 ~ ~f V O
N ~ 1~
V M M M A
01 ~ t~
V N
O O M
m M
M M
V!
47
M
> j _N
_4!!
U V ~ a..
~ d ~
~
E ~E
g ~ o o ~ o c
_7 U U m W O! _U E _U
_' ~ 07 ~ '
O7
m
~
~ ~
2
d d ~ ? m d ? m c m a~
v ~ c S
~ ~ cc ~ c $ ~ ~ ~ L
m c 3
> ~
> E
v 8
~ ~C
'C '
'C
~
. mm ~ N v1
C N
m
a v a .n Nan0 T T d t
E W W ~ ~ '
L7 ~ U
L7 ~
'~ ~
W ro
at
m m ~ ~ wm on a p a g Q p
o n
m
a
r
m
U U ~ ~ EE m E ' m o
m E ~
cg $
v o
~ ~
E
>. O ip OO .~ O ~ O
T O T ~ D i '
~ a
y~
O
U a Zs tn t tn n U m
~ x ~
~ ~
w D
x
; in _
$ m o ~ m
~ ~ Q
~
.- c Z
0 'rno
0 O
~.
r~ m c ~~ ~ ~ c "' p Q
~? x p a m
a a
E E ~~ E c~ o
a E c E a v Oa
~ U z Z
~
7 ~ oy $ z . ~ ~,
o ~ ~ ~m.
'
~ Z z
'
m . QI E~ ~, U
E ~
~ d
E a c
4 ~
~
,~ Q w 8~ WmO E mrJ .
c.i w ? ma~ d p ~ ._
i ~ d o r R w w s
o ' cv '
ago
c
'' ~ ~ mY N Q o $ o
o ~ ai m tn
-' =
. E .N ~ E a o W~
v ~ a w c '~
' ~
~
o . r= ~ oc
,~
~'
o
~a ~n oo~'N mrn
i~ mv
o
t w~~ o~~ZO ~ ~~ r hp $'r
d= Wnn Q
C m O t J Z ~ y E ~
~ ~ 9 m U
m C~~f
~ E
~
~ C WC
7 ~ E G1 UO N N h O O Q O Q
W W O) ~ >' E
~ E W
~ O
Z ~
N d U ('m $ E V O ~ Z O Z
10 ~a ~ .. N a C O t0~1D
N. , o ~ N ~ U
Y1 ~ o
N~ C
c ~ g
m ~a
o
$
$
-
C ~ W R ~ ~ 'E ~ vi ~ M a 7
C ~ Q ~ Q ~ ~ W
' ~' N ~=
N W
d N
~
E = 07 ~ i N '~-~ u. ~ U 9 O
2 U~ j a > m O ~
d a
d o
Q ~
~I
E ~ OED'~~NfE9~j ~~O$UN4~= $~~WIL q~ VNIL dU M~'U
Zm ~ .
'c n O ~ ~ ' ~ yn
m r. Z~ U g' ~ a E O
O ~ ,~ d E a O 0
c O'~ a
~ L O ~
o M p ~
~
mN
vQ
O
N N . Ta .r y(n! E 0 _:
U C m .~W (C G $$
U m 2 W .. N
E I1 ~!7 ~ O .-
~1 U
N
r
d
O
y W O ~' (~ CN ~.pm C =O
Ow= ~.GD ~
af0
p ~ ~ O r~ 7 ~ ~ N 7 N Z
- fpp ~ d' >' ~ E ~ V
~, E Oi
9v Oi
~ '
3
~
UUa~~ui Na t .-s=hoo .-cnmQ hai
N cExv~x n~~oo
E >
,-
v mn W u~ ~ ~ in
H
a00 nCJ O'~ ~ M O
O ~ ~ ~ ~
W O'
~
N
~
~
i0 NO~Ia~Oh~l~ ~Q p Om1O M M
W OOTOnf ~~h0
~ V
~ K X ~Q ~ ~ m a X Q X
~ Q Q ~
N N
N ~ Q
o~ m o
M m o v N o n r~ m n
~ v u '
~~ ~ ~~~
ago oom vn ~ r ~n
~~ ~
vN
M M N N V'r M r M - r (p 47 m
r M ~
N M
Y w
Ot
N ~ ~ ~ ~
O V (' ~ M t0 ~ O ~ O
~ ~ M o ~ ~ ~ M o ?-
~ cJ
~ o
o
ao O O ~M Q O C~ ~ O w r w
g ~ ~
m q ~ r
~ O
U U
a7 ~ ..UW ~UUU~ -a op g V a V
C~(9 ~ UoF
~
~
g ~ ~ qCn.g~:; cn~ M v~ ~ ~,n,
cocoa
,
~,~
a a aa~aaa~ ~~a~~ aaa~ ~ ~ a ~ Q
m m mm wamaw mmmx c~ = m w m
mmmw
m~ m~ m~ m~m~ m~ m~ m~ m~ m m~ m~
m~ m~ m~ m~
m~ ~
m~ ~
m~
m~
m~
c9 t9 c~ C~c9 C~ m C7 c~ i7 c9 c9
C~ (~ (~ m
C~ C7
c9 O
(~ t~
C~ t9
t9
no. g
N o
7 r- r- e-
r N ~
O
tv N ~l7 t0 r
N M M O u-
f~
m
O NO N N
124
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
~o>~ ~tc crn rn°'~ ~°'°'~
Z ~ 7 0 0 ~ ~ ~ ~ > > ~ > > ~ ? 3 w
N ~ N M t~ N ~ r r .= N N r- N N N ~
I~Op d' O V' p~p~ V(~'
4N7 M W~p ~
~
~ ~r N N~~ ~ ~ ~~ u N M
- - '7_
~
f M N c0 Oi O~ O a0 ap O O~ O~ 4i
V' V M tD m m a) ~ W O7 - O) m 1n
m M 'd'
M M m
f0
m
j 5 7 7 7 7 7 7
Q U U U U U U U U
N W N N N A N
N m N 10
N O O _7 7 7 7 7 7 7 ~J O
(D
d
m W m m m ~ o~ rn w of rn rn o~
m ~ m
m > > 7
L L ~ ~ E > ~ '~ O
C r ~ 7 ~ ~ y
E
~
7
d ~ d d
~ - ~ 0 ~ ~
d A N W .~ N A t0 N N N
ttl H r . N W
a a a a a a a a
' ' a
E _ N ~ U ~ ~ ~ L'~ ~' Z' ~ ~ V
W a U
N U
Q ~ ~ U U U U U U U U
~~
Q Q Q
a~
d a U N -o U ~ U E'
N
E C m
c~ i E' ' E'
'o
c v cc : ~ m m m :
a
:' c '_
dQ 01 G) H NnN N
~~
(/~ E 07 _ ~ d A 'O Nm
W C S L'n T ~ d N
~ ~
~
E:= ~ U ' t v=-'~ t U P
~ ~:'~
t '
~o
d d m . ~ ~ C ~ _
o a ~ m 10
~ N
~ ~
O O) a
N cg'm ~ ',
P: .-
~
E N ~ ~ C y., ?:
IL ~ N 10 .- U ~ N -
~
~
W - O
Q' ~
Q U ~ ~ 0 O H ~ a W C n ~ O
cm- ' H ~ ~ m N G R ~
cm ~ U
~
~ ~~ ~ c rE
~ Y ~ sE ~ ~
' m a
n '
~
~ ~ Q c .~_ ~ Ii r Yy
U v m v O m ~ ~- . ~ Lp v
J('Q gm W ~ C7mE ~ ~ ~ ~ c
H~ ~ ~~CNN
~~C~
mam ~ ~ - N Ro~._~a~Nm dE m
~ ~o~._mE
m
~N ~
~ ~U U Paz z ~~.~~-go~~g~~.~ 'g ~~~go
gg~'g~ 4
m 8~ p ~o _ ~
'
'
E ~y' m~'~O o Z~7'
>~ h -~ro a ~o d ~ Z
~ - HC
Hz ~ m
z
G
8 ~ U ~ U
m N ~ pOGU p0 p
1 U ~ e
_ ~ -
_
g
~ E !O ~ ~ O) C m lp
O N ' Cl m ~ ~
~ N. m
~ Z U c ~ m
Z Z U
Z
~7 N N 'O m = m Z ~ v
O 2- . ~ '-' O! ~ C
'p m
. ~
~~
~ S ~ H
8 E ~ ~
~ ~
~ m W ~
~
~
.3 (0 t0 W ~ N N ~ N W ~ ~
fE IU c ~ ~ p1 ~ ~ ~ U H ~
m c c ~ U
c c a w c c o
2' o
U
a a . of c c oo of c
~ ~ ~~~~m~mm m c o.
~Nm ~~~N"~'
~~~
~'r rr s rEE E ~~
-
Q W m N ? w V C 'C ~ H G n 7 O H G
Q N 'C . H r C 7 ~ O. H
N C . r C 7 C
a m a m a
m o a y o a
-
~ ~ E E E ~ E a,
~ m aa a E a o
c ~ E ~ c
E ' c
yv y ov S ,~.c c >,? ~ ~ ~ o
~ cp ~ i ~ o
o W > ' ,
b
~ L : . E c~ ~ E ~ ~ or -' E ~
Z g $ ~ E' m ~ U E' ~
U ~ ~ m ~ U o m m a
~ m U o w ~ m U v U U o ~o
Q Q ~e U c m m
~n ~ U ~
Q ~
n ~ v ~ v
~
m'N '~r'co ~m'e 'a ~ h~i W ~~ .i W "-'
'
ao 00
~ U ao co o ~0 0 o co iv ~
~ U ~
. a w
a 7 o ~ Q QX Q X Q
Q p~ X
~
Q Q Q J Q
M M
~ o ' '
~
ao t m ~ ~ ~ ~ m ~ ~ ,~
n u r
~
c~ o o co 0
u~ n ~ m m ~ a. v v a~
N ~o
n
M
v
~ V p p p m
~ U
~
a nf'1m ~ m ~ N ~ O) N ~ ~ O m
~ c~ ~ ~
m
'~c~
~ o ~ g Q ~ a r'
a ~ m ~ Q
m ~ (~
m
Q 1- Ii ~ ~ u.
p ~ 4 Q U
Q ~
~~a a ~ a a ~ a a a ~ a
a a a a m m m m m m m m m m
a a I m I I I I I
I I I
I 1 t
I
I I I I I
m mm m mmm m .m . m m m m m m m m
m
c9 r' (~ (~ c9 C~ t7 (7 c7 t~ C~ C~ c~ c9
(9 t~ (~
C7
y n ~ o v ono
a
m as m
M co n "~
0 0 o _
No
125
CA 02571917 2007-O1-08
WO 01!66573 PCT/IB00/02035
m
m ~? ~ m ~~ y °'
z a
r~ ~ N ~= . N ~ N ~
u~5 ~
O O O O
M
O O N (O fD N ~ ~ ~ W (nD O ~ W W
O
O ~ t0() ~ ~ ~ ~ 0~7 ~ W pip ~ ~j ~ N
Of !D
E E E E _m E E E E E E E E
U ~1 V U V ~ U U U U
E ~E E E E E E ~E E E ~E E
m . m m m ~ m ca m m m m m m d
7 ~ 7 7 y ~ J ~ 7 3 7 j j
o~ o~ ~ o> of a w rn o~ o~ o~ m o~ o,
c c E ~~ E .~' -'~L ~ .~ E E 2 ~
d m m m ~ ~ N N N N m y N
~1 U V U ~ U V U ~J U U U U
m m m m o m m m m m m m m
a a a a a a a a a a a a
m m ° a~ ar ,a m m m m m a~ m y o
C C ~ C C p C C C C C C C C
N Z' ~' U Z' ~' Z' ~' ~,'
F~a-U U~~ U~U ~~ Utn
oy' or of w L~ °' c~ w m ~ U m
c of
° r? :° ~ :° m ~? :°.
a a
.~ ~ Ni° c ~ ~ ~ ~° c r w.° ~ m ~ or ,~ m m ~ o~ o. ~ m
c'°'o c U'
o v ~' m E ~ my °~' ~o' ~ ~ v m a! W, ~. E' °~ m m o a o, y
H _ O N ~ m vW__ m'D~N_.
~mLE° m~mwi°E' d~HrEn m ~m~,L°~ m ~~.mn'~U d
Cj,v d~Cj,v mrN~Tv ~!.':: '...mC~~ OlElm'.'~ N
m ~ ai c °. °. a; ~ ~ vi c; E a ao W ~ ri m c ~ d m ~ .~ m ~ o,
air E m
ar.~ ~ p~ V ~ ~ 'E fJ V p~ C ~ E ~ ~ ?~ OJ L E ~ ~ ~ T 'm-' L E ~ ~ U
~' 7 ~ m Gl E1 Y ~' 7 ~ H N ~ m ~ ~ m ~ d E ~ ~. ~ ~ H N E N J, j ~ H y ~m 'C
~~'~~E~ °~2~$~E'~ a~Z~~mE -o fq.~,$~E.° a,9JtmEo a
o,gE~8m ~o~gEyBm Ea,gE,~88 ~ o,gE.~'S8~ ~o,g'E.~g~
~. at ° ~ ~ ~ ~ .~~ m ° ~ ~ p 8 ~, '° ° ~ d c p ~,
m o ~ ~ c ~ ~, m o o vi ~ rn
gZDoco~ og.ZOoc~ ~agZ~.o~~ o~ gZOo~r .ct°;ZC7o~.c I
,~ o~'° NZ ~:~ rn mzW~.~ oy 'm m~ ~nc caE -Q,m~ vy ~~
m m of o m Z ~ m c o m 2 m 'c m m
~'~ ~.cE'a m~ o E~°~N ~ ~m m ~~°-~ ~ oiE °~ E~d ~o~E E E
~ m~E'z E c
(1 m _ 'V ~ N m . v ~ U ~ m _ m Zj m U d ~ ~ ~ U C~J U N ~ ~ V m
.-. .
m W ~E oo °~ E' m ~ '~ ~E rn a'. ~ ~ m y E o~ m m ~ .m ~ E ~ °'
.m .m m ~ E ~, N ~E c
m ~'''
O)C Cv~U ~ 01C G'~~ .a OoC CvT01 ~ m m ~~,7 ~ 7 N N ~ j,~ O
_ V U U 01 C. C tn O! -01 C C
c .d m m ~ m E ~ b d " c '° E ? ~ m m ~ ~ ~ ' m W ~ > > > ~ ~ m ~ ~
m m_S L':3 E _d c L.p E o m.~c 2~'F3 m ui E ~ ~ c ~ p_~ a'_~'~ ~ c ~ c'c a; m
m ~ M ~ ~ U m ~ N ~ m ~ ~ M m d ~ m m x ~ ail U' m U m m ~ ~ ~N m d D1
G1 C ~ G C m ° ~ C ~ C C W n N C Q C C U N m m C O~ C C ~ m ~ m~ C
O G C m
aE°ca;°'~°r°' a'oEgQ'wor
~o~EgE'°'g~o°' ~Eb''L'.°°ooooEgi~L'~oo3
U o m m m U ~ U o m m m U ~ U o m m m U o U ~ o m m m U v U U o m m m U o ~
O ~ O ~ ~ O O M ~ O
a0 1~ cp c0 1~ N m ~ I~ W h ~' n) t(~
O Y N O O ~ W O O r
O t0 O O (p ~j O O ~p O p p p
!L m llJ !L m a0 !L !L O tL IL t1 li l1
Q X Q Q X N Q Q X Q Q Q Q Q N
007 1N 6 ~ h o 007 ~ ~ ~j In (D (O O
c~ O f~ a0 O M ~ t0 O O O
O Wit' 01 O
'~ C7 O N V' W N ~ D)
V ~ m V T n ao V n c° ~ m N C~
0o cp ao C7 o m~ u~ C~ m yo
o °o o ~ V o a Q v ii st
E- ti ti (9 a t°i ~ t°L t°i. U
Q U QN Q U ~ Q ~ U Q Q Q Q Q.. N tI)
oQOm~ mmm
I 1 I I I I 1 I I I 1 I I I 1
m m mm m rnm .. m pp m m a1m m m
(9 U' C7 C9 C9 U' (9 C9 U C7 C7 C9 (9 C~ C9
N m
o N ~° ~
T
r
N N
N
126
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
V ~ 't m ~ ~ M
O m O O O O h O h h O ~ ~ M m O~ On O~
W ED ~ ~ ~ m ~ ~ ~ Q1 O) O p7 QI ~ ~ W QI ~ m 01 ~ ~ ~ ~ 0~1
o~ o~ c c a n c b. ~ ~. m ~ Q o> m
i > > m ~ a> >, m a m n c a m .° ~ m ~ Q ~ Q ~ ~ ~ D O ~ ~ ~ -oa O
> > ~ -, u. -, U v~ m Q w m v~ m ~ u_
-' ,-~.~n°'~b~ mu-~~-~ ~~u. Q ~n~~ r-~ cnd~c~5r-. ~cb
r' r r (b N u7 m N m t0 N N O O N O N N O r O r r
~t N aD O at ~O O M h _V~ O ~ ~ 1° N o0 h O V' N h M N h h M r
N CO M O~ h V cD OD u7 cD R7 O O O h ~ M h h t0 h N V 01 V' O ? N N O
u7 Ifj 1~ 01 07 tt O~ N (O I~ M (D N aD ~ ~ O nfJ O) N 1~ t0 P Y) 00 y r b- . -
v ~ O !~ r
m i~ l0 D) CO O M O) O h M O O 07 47 fh O (O a0 t(1 h ~ D> h fh O O t0 '- t~
O O ~ M M M ~ ~t M 01 O M ~ O r r M M M t0 M M tO M O M M ~ ~ ~ m h !D
E E _ E E E E E E E E
tp N ~ O O 7 7 7 ~ N t!1 N W _N
.Sa r ~ V .~ V .~ ~ t N 'N N 'N
E E -° -° E o E E E E E E o d ° a o 0
m m ~ ~ m N m m m W m m m c
o~ o~ n n om U '° ~ .~ ~ .2 ~ ? 'E ~ '° Lm° m m ~ m ~ ~ ~
m ~ n
E E ~~EU -°' EE_E EEE :°_ W~°-n~mm°-
Q'~°-n',~ ~.3m~~a
> > '~ m c ~ c '~ m 8 '~ '~ 'd v F E .~'c W'c c -' c ~'c a c > > > > > >
m a ~c 'c ~c ~c ~c
8 v ~ ~ v ~ °' m °-' v ~ ._ v ~ U U 7 m m a, m m a a~ m E ~n m m
a m m m
a m '° ~° m o °' '° '~ ~ ~ c m ~ ~ air m o, W m ~
coo o m A ~ ~ W ~m m m m m
Z' Z' v° °v c ~° o ~ ° c c r c c c c m N a a
,n a o 0 0 °. ° '° o a o 0 0
m Fa s ~ ~' 2' U ~' ~o~a. 2d~ a ° ~ ~ ~ ~ ~U, U U E ~ ~ U ~ U U U
U U ~~~~_~ =UUIifU ~~U lil D~~~~~~~Qm2~~~~~'~
m m
ti _m
o~ or a m m F- v
lV fV U ~ d- ~ ~ N C N
1p t0 ~ N m °~ E ~ ~ O t'
m !N'0 C C ~ V' ~ d d ~ N ~ ~ O N N
~ ~°_ o~ d d E a m '~ E a~ 'n La ~ m m m c c
c - m m
E E $ r m m a
of or n a m o 0 o E
N' ~ N N C U g ~g '~''' ~ ~ ' .. ~ m ~ ~ N b ~°, ~ Qp~07
oma~N~ oou-°'v~ .h°oE °°'~ ~~n c o o rI~,E aiEc
L~p ~m ~~j.U NC ClllO00n
(~y~ C ~ ~ N d O X h~~,. O h U m 1A ~ ~ O) m m ~ m C C C m
mmC~%~m ~NmE~ Nwa = °) m X001 jG~L
ClLrn.C dNOmQN d~~OO RCN C) d ~ a~UN ywO
v, ~ E U ° ~ E E m a_ ~ Z ~ N ~' ° ~ m r a n c U E n Q o. o
_o W o m m °~ ~ -E ~ E E .c ~ E E
_O U O ~ ~ ~ x ~ = m ° D7 O ~ m O Z O
O O C ~C > > j, O U ~ U ~ ~ ~ d O Q N ~ ~ ~ M N N m y N U p U > M ~ y m
O! C ~'~ ~ ~ ~ y a m a C ~ E ~ c ~ L ~ m ~ N N N N ~ N ~ U ~ ~ m m ~ a
Z ~~.5 m MM m ar m r°nQ m m n of oM mmmmMm~Q~ ~c,~ M.
~ ~ W U_ ~ t~ ~U _O~ N b ~. ~ m O U_ d ~ ~ t0 L m N N W N' N N~ E O E ~ ~ E E
N C9
E N ' ~ E O w O ~ ~ ~ m 'CS ~ E A W E '~ a O ~ U U U U ~ ~ ~E m0 ~ O
d ~ ~ N r
~'~"''.°~?.~ mmaUE~° E>»~ 3°~dE
omWL°L°~m'~~mEm~m~
~~~°n E '~~V °-°-n' ocmYE ~QEE:° ~»m~d~dx~5'$dy
~ n O ~U N ~N E ~ O C E = ~ ~ ~ ~ ~ ~ E ~ 'C C 'C C C G 'C °' m C C G ~
'C t
mm~~~m 'U~y,t°~rm L~-$m$~ W c~ tn°' .~mmmE~Q~møøii mmm.
dGpmO~ ~N(~O~OECR CN~Cddm~NO~ ~~ (OD~~Al~62NAW~N~NA
C V ~ °) ~ H ,~~. ~~. ~ m ~ ~ ~ L Z' U E a a ~ m '° C ~ ~ ~ ~
~~ ~ ~ ~ O E U
U o m m 'mU~~~Um=~ =m~ti3U c°~mOU~IL o~.~E~~~~~~~~_~~~~~~
g (gyp t~D (00 ~ p O D fh (p N
N r N O~ V' y~ ~ t0 1~ M r cp O~ h v0 4~ p~ M h h M M h O N O O p~ O
op O .- 01 N N r O O O ~ ep ' 07 O u7 W N r O O g N p a~ O O
_ m M o o m m o 0 0
~O M l0 W aO O pp r
O O ap h ~O t0 ~ m (,O1 N O ~ O N O O h ~ OJ O O ~ ~ O d U ~ Oi O h aD O
N N ~C ~ Q .~ a o w ~ 'd o w ~d i- ~ N G 7 ~ Q N ~ Q Q Q N ~ J N ~
f0 a0 ~? N 4'1 h ImfJ N h D ~ O M ?
O h O M M O aW0 ~ ~ h ~ h 01 N V ~l 4~ ~ N 47 M ~u7 M M r M M
W M O f0 O b M 10 f0 cD CO O OO OD V N M N N M 10 h ~ 07 O 07 V' O
yt a0 h. O h O~ r O~ ~ M V of cO 1p O M 1. O N N O h N a0 N O M tD a0 O M
r M M M N r M r ~- M N r r N c0 M N ~! ~ ~ ~ N ~ r r ~ ~- M M N V'
U U
0
w ~ T U ~ v .°-' v a ~° ~ ~ ~ co ~ ~ c~ ~ ~ ,'~ ,~ nU.
v aov ~ ~ -i ~ o m o ~ i.°~ ~ ,° ~ ~ ~ h w ~ m o o m ~ 0 0 o y ~
o m yN. ~
a o U U C9 > o C9 0 ~ O o ~ ao 0 7- '- U U o o U U o 0 0 U' U o° CJ U o
u. ~ ~-- I- C9 U U ~ U ~ c'S U ti ~ o u. Q o t- J p p J t- o a U ~ !- o v7 0
a a ~~coa~~ gmwwq mwQ w c~~~»~~~ga~~»,~~,~
Qa~~~a ~aaa~ Qa~ ~ ~aaaQaaa~~aaaaQd
m m mm aam amamm mam mmmmmmmm ammmmmm
m~ m~ m~ m ao m~ m~ m~ m~ m~ m~ ao~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~
m m~ m~ m~ m~ m~ m
c~ c~ c~ c~ c~ c~ c~ c~ t~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ C~ c~ Co c~
c7 c~ c~ c~ o C~ t~
N tD O m OM1 1° W . N ~ Q
oD G~ M YJ N ~ M
f0 N ~ O
N
O O O O O O O p 0 N N
127
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
r. co r n m n n r~
m w °' r n
m m m oo ~ m rn ~ n r W n. r o~ m n n
o~ m m V= a n I= ci a ~ ~ 1= cu ~ m aW= cvi m m I= c~i m m
n ~ ~ O ~ p ~ O ~ ~ a U '° ~ a~ .n a U m ~ ~ ~ U ~n ~ d m .c a
c~ ~ ~ d~ z ow%> r~ °~ ~ ~ ~ m m ~ o> ~ u. ~ m e_' um. ti O m m ~ pi ti
N ~ ~ N 117 '- N N N O ~ U O M O ~ U N (b fb ~ ~ U ~ Ib O ~ U N N Cb (b
O V' V N t0 N N N 4J c0 O m m m 1~ f~ I~ ~7 P'7
r m m ~ ao co ~ ~ co 0 0 0 o r~ r~ M v v
f0 W ~ ~_ CO N In f0 O m m m d1 W 01 aO aD _
O h n 4~ 00 tD m f0 m c~ 1n N N N Ice. 1~ ~ V of t
co m r~ u~ v co m m r~ m <o ~o m m u»n u»n ~ cc cu <o cc co
E m
H m
N
-
m
d v 3'~ c a
a .- a v~ - v
~m ~a~ cd ~'~ ~~~a~
m ~ __~ 'm m -m g ~ ~~m ~~ v~ m
~U ~N ~N U O N ~ -N N .~ E E ~ W a ~ G ~ W C G ~ ~ ~ m ~ W C
O O ~ D E p O O ~ a Q G O C O C ~ ~ O C C C O ~ O ~ O ~ C
0 o i.~~ ~.o o ~o ~ ~' o f o~ccoE ccr~ o~oEcc
I I ~ ~ ~ Z Z 2 U ~ ~ U m U m O 7 U m 7 ~ ~ m U m U m 7 ~
c c c
y m coy r°~ m ~ ~m 'm
m ~ ~ N ~ fV ~ ~~ ~ O O O
OI C _ _ 1p Q O M !n C C
fn fn ~ z ta0 W I~11 C .mp c m .Hp c c
Q' m U m ~ O nC m
W W c ° c C9 C9 a m m d d m N
m n ~ ~ E ~ E O O ~ N m W N N °'N fm0
O O d ~ ~ d a . a d ~ n o n n
r '-° a a m =' %Z~ Z nm O L 8
Z Z o ~ ~ o Z Z ~ n c ° ~ c o 0
E a
a~ ,o C7 O y ~ ~ m U V w ~ s d ~' d E
m v Z Z o, Q of Z Z ~° o. m n °~. ~ m
- - °, m o 0 0
U U a!aZ mj ~ r -o° m ~ t ~ ~ t t
o~tzmZU Q~~ QClOW Em m ~ %m
n n a d o ~ 2~ o ~ ~ m .°c ~ ' t ~' ~ .°c r
~ tin > ~ E > ~ ~ c o y ~ p ~~ ~ N ~ ~ ~ ~ :5 yri Sri
'° o ~ ~ n m m ~ °° c° ~ o ~ N m c rn ~ ~ m c c ~
m
'~ o ~ r~ 2 m ~ $ S m ~ ~ ~ j a~ m ~ ~ ~ d ~ ~ ~ c
m ~ E E ~ ° m ~ m ~ u'S T O ~ ~ ~ ~ ~ ~ m a o ~ m m tn W
E c ~ ~ o c ~ m I Z ° ~ !~ ,~ -o o~ 7 7 ~ > > ~ o~ o~ 7 7
m ~'~d~~Z Z m yr :amE m dmE ~~E m
E E m ", ~ Q m m. m ~ m m .6 E ~ m m E m m E m m m m
t nr ai,a,~,'~ mZ ~ o o a ~ o '° nnm nam - - nn
~ ~ ~vpi c ~ c ~ ~ ~_° ~ ~ c ~ c ~ ~ ~ N m c E ~ ~-c ~~ c c _~ a a
w Vi 0 a'0 O. 'Oval. ~M V'~m~O.V dD ~ ~ aU ~ ~N V, r'e-~ ~ ~ ~N
p ~ m E ~ E O D f~ Qa~ p m N m dd ~ O C am m ~ ~ m d m d d ~ W O W m m
EO~CEOC'Vt?~~OEOE00~ 4Q~ dlDO COQ O'O'Z' ~ZCO'O.
n v 2 ~ Z ~ ~ ~ Q ~ ~ Z ~ 2 ~ vi W ~ th ~ Sao H ~ V7 U ai ~ U y> ~ o~ m ~ cd
t~O m N (MD V~' ~V V P'1 (9 M
ao M m n n u~ N m °~ m
OO~h~~O a~0 aMD~O ~NV~O VNVO ~ONM
0 0 0 0 0 0 0 0 m r o r' r i. o r r o r n
rn U U ao ti 7 ~ U U o an 1i m o N ~ m N c~,~ m o o
Q Q N Q Q N Q 4 lL Q Q Q lL ~? Q M Q u1 I1J
N N
n 10f7 C1 1~ aOD ~ m N f'7 m m m m m m m m m m m m
O N N N (O M M C~ m O c0 a0 u0 00 W a0 t0 c0 aD aO n0 PD
om7 ~ N M m m N c7 c7 1° N t° t0 u7 u7 u7 u1 N ~O o7 fD
r- ~ ~ '- .- ~ N ~(7 ~7 1° N N ~ tn ~ W O ~ N
~t ? n
OM7~mN~mn~ ~m ~ OM7
O O
O O N ~ N r ~ M ~ ~ ~ N M ~ N N ~ ~' ~' N c'~7
U U U~a UU U g °r° °o ~ ~n°o N~o ~ ~ ~n
iii a ~ Q N ~ iah' M w r~ ti ~ w m M a ~ M m o o ~ m
m i z mmw m= z a a ~ m a aam aam a a as
m mm~ mm m m mm
~ Cm7 ~ Cm7 Cm7 ~ Cm7 ~ w ~ tm7 uW 9 c9 C9 m c~ t~ ~ (~ (~ c~ c9
N M O '' 100 M O
r ~ ~ r.
n w
M m °v v ~ ~ v
0 0 ~ o ~ ~ o
128
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
m ~ ~ ~ ~ ~ ~ m
h m a~ ~ o~ o o a~ m o~ o~ o~ rn
O~ h r O~ ~ Q7 01 fn a~ Of i r r '- r M r r
n m F= cv v o >- ~ o~ o~ H- ~i a rn ~ ~ H ~ >- F- rn F- F=
m n U ~ ~ c Q m c ~ U 'n .~ or m Q U Q Q U n U
tn m O ~ m m ~ ti m w O ' ° ° u. ~ O ~ ~ O m ~ O
o~ ~ m ~ ~' -' o~ o ~ ~ of ~ m a O h tn (D N f0 N Is f~
N ~ O U I~ N f~ I~ O U 1~ N .- O O (~ N N
O O O O
c_o a_o ao 0 0 o w ao n r m o ao m v
O O ~ O N N ~0 c~ m co o n m u'W n
C~ M M O O ~ O ~ ~ r N O O~ ~ N N Y V
(D f0 t0 O O o0 O 1~ tD (O t0 c0 h M O 1~ O lD t0
~O 1° r r M r M 07 W C7 C7 M M r M V' C~ M
E E E E E
~ > > > >
U _U U U U
~E E ~E ~E E d d
m m m m m O N
7 7 ~O 3 J m 7 (p ~
07 m N O) 07 C OD ~ O O
2 ~ 2 c c
.m ~ .~ m m N t ~ m '" E E
G m c c c c m
U m U m ~ U e' U ~ G D. ~ N U7 a0 V d Ly m m
m ~ m ~ m m m m m ", ,~ n n n. m m n
.C ~ D .C ,p ~ L ,D ~ N CJ h 0m7 N O ~ h
~E ~ ~E ~ ~ ~ ~ o m m o 0 o W o o =~
U m 7 U m U U r U U m m x x 2 Q U x E O D
U N
m m m
a ~ ~ ~'o ~ O d m E 'o O ~.
'a ~ ~ o c°> >
c N o 0 o v ,n v ~ ~ ,o m o ai a fn a
m ~c ~j m ai m -7 ° Q c n ~ c' °' ~' Z v Z
mmc cc ~~aZamEEx~O
m o~ l a~ rn o m y ~ Q m ~ ~ h Z m Z
o a I = a m ~, ~ n m o o V o V
c ~ I iui m w '° v ~ a m ° °~ U o n ~ Z a0o z
c c ' ~° c c $ ~ E ~ .W .o ~ E ~ ~~ 7 ~ ~ _
d a _m(9 C9 aN(7M ~ °' v6 C~N c°a°t~n mt~n
'° a ~m' °-~m v 8~~o x° O o. Goo mc! c~
° n E m H ~ O E U ~ ~ m ~ U ~ ° Q ° a
c ° c c °'~'~i °' U °: ~~ mM m coy '°
m x c
Nz °' ~ ~' m Ez ~',~, i g~ m m n ~ E'~ E
c ~~ a On on. mC~~m Z°m N ~°~ ae°n~ »
o ' o c io ~ m io ~ z a a ~1 ~ o J Q a E E c
m N N ~ ~ O .
O ? N U ~N V = ~ C UJ ~' ° LI Q E V N I- p ~ '~ ~ U N
Zo $Uc~
~ E .m C 2 m m o~ ~ O ~ ~ m ~ ~ ~ m !r ~ n H ~ H ~ ~ of
d m 07 O ~ 07 O) ~ ,Q M NI G NI ~ C OD a ~I ° y~ 07 m. ~ °) O,.
G O O
m E > > G ~ v ~ ~ ~ ~ c c ~ I amo 'm °° W E E t°yl ~ ' ~
u. vn ~. Ii a
~~E E'm~'~o~ 'a ~c Ic NON y~~~ vEn~~aa'~
v,°'n ~ m m~ E ~m~ m~ c ~ A~I~ ~~,o ~ ~,nl~ 8 °~ aE ° QE
°c
Q r ~ ~c ~c N ~' m ~ ;n in .E ~ ° ~ ° m ~ v
Zp c °' o o ~ m ~ o ~ p ~ d ~W a cnl Eo g m Q W Q o ~ NI a c °'
U', v °°' O ~t
vn'nf~U U mU xU mU m U m2xx h ~~Q ~U °'xx ~~~ov~ O~
N N N ~ O M O ~ O ~ O
NM n o0 0 0 ~ ~ 00 0
01 a' O O ~ V' O~ O M ~O O _
h h O O M h O O W DD O ~ O ~ O O
w ~a ~ x X~ a w oa~a a a ~d a xQ a
~ m ~ n
W ' fOO N 01 (0O tOO O7 O> (OD M N O I~ O O
u7 t0 tt1 V' O N ~ ~ y0 ~ 47 t0 O V' O N Oh n
u) 47 In V' N N r In C~ '- t0 t(7 V'
O
0)
n W ~ M ~ o M O
rm~~UHhMNtOD Wh0_V =mto0
O 'NQ~ O ~ ~O O h 00~ N O m Yp O
J Q U J J ~ ~ U Q q Q (J ~ U U
w "~ ~ ~ w4? ~ w a ~ N Q g o' ~~Y c~
4 Q Q Q Q = Q Q Q Q t- m ~ ~ ~ ~ 1- t-
a n.m m m >m m a mxc9 w a m c9 >x x
1 I 1 1 1 1 I I 1 f 1 I I I I I 1 I I
O (~ w C9 C7 C9 C7 C7 w . C~ O C7 C~ C9 C7 C9 C7 U C9
N ~ m ~ ~ M
ro
n O m r
N N
129
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
t0 O O W O tD ~ M W O
W
a~ o~ m m o~ w ' o 0 0~ o~ o~ m
r~ ~ ~ ~ ~ m a> a~ ~ m m °' ~ m rn°' °' I-
W t W U U U W ~ b. c ~ .c t a ~. uU1 a ~ ~ U U
> > ~o m m ,4 ~ m v~ a_ a
$ O -~ D O O O D ~ m ~ ti ti -, -~ ° ~ O ~ o m m -~ O O
ch Y cn c%~ r~ U ~ o o yn Z o~ cv ~ a N U ~ c0 c$
O O ~ ~ ~ O r N ~- r r- e- N O N N op a0 ~- r r
c0 a0 O O N N V' r tt h (O f_~ t~ M O O N 0 0 m h h
N f0 t° N N ~ O W a0~ M N V' OD ~ N N M _ OD
W ~ M r c0 W 1~ I~ Q 1~ f0 a0 tY ~O tp N N c0 O CD GO
N M O m 0 0 f0 n h 0 61 07 st f° f0 l0 (D l0 O 0 ID m 0 0
M ~ ~ M M M M M M M f0 M M t0 M M tn 0 0 O M M C~ M M
41 N 01 W N ,f~ N ' _!n
,a n .n a a a .n a ~ rn a
Ø 3 w r ~ S y o 0
2 E E H ~, E
E E E E w vi vi E E m c v E E
> > > > c c c > > ? m c > > m ~ m a c ? E E
y '~ m a~ d m 'm ~ ~ m m ~m ~ m ~ ~ ~ ~ °' m 'm R w
m m w h H W m ~ ~ '-° ~ m ~ ~° E E ~ 3 ~ a .H w °m t s
o a a a o 0 o a a E c o ~° a c o r '° c o 0 0 ~° 0 0
O UUUE E E SSm ~E°°~cg.~ES~ayY ~ E E S
~ ~~ Z I Z ~~~ U m ~~U m tmn in > j 7 U I S ~ D D
° Y m
' c z z z E~3 '=-
m m ° m ~ Z Z Z ~ N cp <° ~° ~ F x O ~ F
O
E C Q ~ p ~ 7 7 O N (~07 r r ~' ~ ~ O N N
c O (~ CJ r c~ o to w m m
o,~°.~°'o dtwnt~n~ dW dm -~mUO daM'oaMS
TtdU~ E EO E E m c U O E°-' °'
t c v or ~ ~ ~ oW om ~ n m m ~ °~ U U
L d9 m~~ ~ .~'~"~ ~ ~t m m N ~ X ~° ~.c Z Z n~ d'~ co
m 01 7 m Y N m N w w ~ N m C - m m = m 'O d N U m
O ~ N ~ m T p T O C~ W ~' O 3 O O E 't 07 C Z Z O ° C. O C.
mo ~~~ mcm~ m 1 me cc o o~ cc~~°
~ ~ m °' ,°c ~° o mrn o U U Y o o~ Z w W o ~ ~ °
'° Z Z a~
~ .E % m ~ m v m Ti a a vy 'a m D m m E m ° o W w w m
~' m °c v t m si E a E x Z ~ E a m Q Q L O ~ ~ H a a ~ 5 °
a o 0 0~ oa °' ~ ~ E ~ H 1_ N. ~ E ~ of E E ,i ° o ~ d v rwn twn
E M ~ M
v .~ o ° a ~ ~'c ~ c m d m d m " ~C ~ ~ ~ > Sy v ° 2 a o ~ n ~ ~
~ ° E ~ E r'
m C m ~ m C ° C U C c°3 m ~ E oo ~ ~ w m to u~ o n
h v o m .Q p~ o d a ~ N w ~ ~ ~ ~ g o ~ a E ~ ~ ,~ 0 0
W amnx N~°yn n~ ~ wx~ a xx n EWE.~O V E ° N N x oy 4t~n
~N m ~ ~ p_ N N fd E ~ E ~ E m ~f0 N ~ C ~N N C ~ ~ ~ w ~ U ~ 0 O ~N
U m a~U c m o 0 0 0 ~ o ~ ° v o o ~ m S o m ' g U O
c o ~ N m > > ~o° ° o ° ~ ° a Y X ~ m c c ~
°' Z Z o t: O ~? O
2w~~~'.m3d ~~aE~_EM_E~'?~~N g ~~o O'°~mm~o. ~ m mmama
a = $ c o 0 0 ~ > > ~. ~ .~ ~ r ~ ? ~y ~ m ~ ~ m ~ u> a o- °, g o N o ~
~ ~ z c Z
E S % o ~ W a E E E m ~ H ~ H m E E o ~ ~ E E ~ ~ ~ N ~ Q ~ N N S ~ S E v U' y
U'
> c ~ c ~ c m o o cO ~ m > > m O o .~ ~... 'c m m
c n ai ~ m -c ~c ~c v w u, w v w 'c 'c m ,~ 'c 'c ~ m m °, .i. r m c d
'a m 'a ~c' E z E Z
cDm ca'~ mmma~n~Q~mm~m_ mm._ m_mc T~~- mmUwU
~n ~ ~ o ~ W ~ ~m W Coo amo p h p m p m' m o d ~ m A o '"rs '~' 'o ~ ~
'° '_Y ~% ~ ~ °~r ~ _ ~ t lZt1
.°° 'o ~ Q -~ o 0 0 ° m o ~ o ~ o ag t ~ E o o E c~ m m.
~ ~ ° m ° m a ~ O o U
0 0 ,~ ~ "~ ~ U U ° E a E d E n. o ,~Y ~ E ~ o E Q Q Q. Z. m E E E ~ o
°' d '~ f7
d' Ub m ~ U ~ ~~~xzxZ=Z~~7~fJm ~gm (nlnpfnCAU 01 x 7x 7~
O ~ ~ V N O c~J
O O ~ O ~ ~ r O ~ N ~ is A a°~D M O O !p ~~ N Q01
0 O u7 O r' O 117 ~ 1~ 1~ c0 1° M M M N O O
m ~~oU U U o'~i- NNr ~oooao o Mo 0
o> or of a~ o~ rn o o g m U
D Q N g a a a ~ N Q X N N X X x w s _ ~ a a n'°1 a a
f'~' M t0 N N
N O ~ p0 O ~ p ~ (O W n n GNO 007 ~ ~ ~ ~ O ~ 00I N
cD O O O ~- Of O O h 0 N N 0 ~ O G° aD o0 O
r ~ ~ V ~ ~ 47 st V' ~t N V ~P N 0 r r r M tr
O ~' ~ d' t~'7 ~ ~t ~ ~ N w w > LL m ~ ~ M ~ tOD
0_,Aa,~~r ~ mNOo
~NU'U U U GN O UUO ~X~oMm~ U U UU U
uW mQ q Q tn~~ ~ r-f-~ UU~ooU g Q t-a Q
m ~~~r~ ~ r~ ~~ m ~aD, c!)cn!L__cCy.) M in gv
aaa~ ~ ~ Qa~ a aaa JJaaa~
m mmmx x x mmw m mmm aaaaam z = m= z
ml ml ml ml ml ml ml ml ml ml ml ml ml ml ml ml ml m ml ml ml ml ml ml ml
U c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ O c~ c~ c~ c~ c~ t~ c~ C~ c~ c~
n O p M O M
~I' r e- (p
r' O ' ~ h A W
M M
O O ON W m
130
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
m
~f1 ~ ~ W On Or m m °~ M c0 ~ h ao
c °~c'~ ~ c ac c ~ ~ a c c mc°'v~-~' n.~n'
~'~°'m~~°'~°°U
m z m o a m > > m or ~ a c a . ~ , or
~ -~> Z ar CD -a w~llr ~-~~ j m W '~~~ m~~~ ND
N r N ~ ~ ~ ~ M N 1~ ~ ~ h ~ a ~ d Q Q !O In
N N N M N ~ O eh~- N f~f N ~ N (~
O tv N O O O ~ ~ O O p ~ M 0) 1p O O N 01 ~ h a0 Cp ~ N ~- O ~p ~°
M
N O ' ~D C Of ~ N ~t V O c0 h N V (O Ip N
aD O ~O O O O h W rtr ~ N IO M c0 ~ V h h N V: M h M On Oo ~ Or cV N t =
ao 'ao ao 0 0 0 of n ui o of of of of of of h ci ai ' of of or ' ' h
01 M 01 r ~ r M M M M M M 4~ ~ ~ tn M O V ~ M 47 M M M ~ ~ <t 1 M
E E E E E E
U ~ N N U a1 U N N
'~E- .~ E E E ~ .~ ~E ~ E _d ° o
A m m ° ~ m ~ ~ v
A ~ O O R N
m ~ E .2 ~ ro g ~ ~ ~ ~ ~ ~ ~ m 2
m
N N m m d H ~ m ~ ~~ ~~ ~ ~V ~ ~ U 01 E C '=C ~O N d ~ ~ N m C
R ~ ~ ~ ~ H N C y C ~ W b ~ ~ l0 O d C N O A O M t9 h N M ,N IC
c °c c ° ° ~ c E o 0 0 o.c o a c ~ ° o ~ a o 0 0 0
0 0 0
O C G O O ~ r m ~ ° 7, ~ r T ~ O m ° T ~ ~ O O O ° O
O >.
c~ ~t~ c»>x x .~d' c~ a t- ~'~incg~inc~ z~ ~~~cxxx~'xx~
ai
m ar ~ c
m m $ m o o ~ m
m C N N a ~ N N
°~ d ~ a N ~ C ~ _O t0 r0 U ~ (' aD ~ aD
N d Z N~ N ° U ~ O U ~ ~ U U
O C 0. ' N ° > V aQ0 N n ~ ~° C C C ~° C C
o ~ ~ ~ ~ ~ z m o c c ~ D z ~ v' ~ a' ~ Q c
cr a acr Z. °' a ~ ° o $ ~ ~ E E o v ~ E N N N E m ar
w
ar yr . ~ >. m ~ ~ L ~ ~ d '3 d v z y m m ar ~, d v
yr : c L '. -. ~ at w yr Ti o_ ~ g ~g yr o a L n - -v °~ m..%ro W m.. m
'r
E ~~ V w' ~~n' m zs, a E ',Yc vi E X ~u E ai E E E E E E
E ar E ~ E ~ '~ w °c' ~ mw acr oovo ~o
mom ~ wcc°~»u°r _,=n m~ p8v '°~d a c~ d
a c' v °' ~ ~ cv°. ~ o ~ m a a m Q ~ °~ a Q ~ ~ ~ ~ m <o
v ca ~n
E o m c . E ~ ~ Q ~ >~ E O !~ m E ~ m o m Mar % E E c v v o'a p
~ a d ar io N ° ° ~ or ° a m = '~' ~ °°
°' ° ~ E 3 ~ oo $ E E E ° E E
,hr~o too.M~'~~cZ Z,m pZ~m4a~~o_ m°~ ~Nyo~°~°8rn
x E ° v~u'ZU o °r~~_ ~°tiJ d ~2aN 2 EJ ro O i:
I~~oioioi=oioi~
~ ~ c '° > J ~ V .~ ~ O cr N o O ar E w E a ° m U o Q ~ ~ u> .m
S E E E ~N E E w
La ~ ~.~m ~~°rc'aocL~u~ ~~~~7 ~~~°o'°~o~°
.~inulUUarvo00~o'~m
F~1 a a~° ac.a~~mL°°~$~Q~~ ~Nan.'-'r~a~~
oa~na.a2QQEaEen
d a ' ~ m m E E u~ a m ~° W acr E E m o ~ ~ ~ ~ d c E r ~ E -~ _w O it
~ ~ ~~ a U U "~ U U m
E 7 ~~ A E ~ ~ N! C' ~ .~ r ~ ~ ° ~ N ~ ~ a 7 7 ~ ~ 7 U ~ N C O p V E E
~ N O- m E N N E
U trJ :G ~ % M m, U M M N Nyy ~ C M ~ ~ O O ~.w~. ~ T ° ~ ~ U~,~, U O!
~a O O 01 a) E d d d 'Q G7 d
E N~~. E~~~OUfpO.C7.C~:'mOrO~~~~ WN~~ar~~~Ca07~.A~~N~~N16N1NN
or v Z''° o,p.~~I~H a ~ Z'4EH'.~z ~~ °o v ~ Z'°° ~
Z'E ~ arUao U v LsE E E v E E v
U ~~~ ar ar(n mcn ~ ° ov~o~tr~~~ o ~ o m Qrri~ ~~=2IZ~=2~
yr U to W x or LL T o U O o E v! tn ~ U ~ in o Z D o
N h
~~'M'>O N 00 O m N~NNV
N ~~"r pOfOMfO O O ~ O ~~ONmmN t~°r m aN-N~NmnCrl~f~V
01 ~ N ~° a0 O O ao O ~ N ~r Y N Or O O O O O O O
oNO aocr nao~a o a°o 3 ~ Moc.-~o~- v c
X N ~ X °° = a 1- a ~ 4 a I~ Q ~ ~ N Q ~ X Q N ~ X Q Q Q N
Q Q N
M w co .- '° ao io v v v ao v w ~
M It) h 47 In h O f~ 01 N N
~ 00 ~ M M n O M 4N7 a0 c0 o N ONr N 07 N Or N Or N ~ sir st N ~ ~
h aD h N f0 O (O ~ h f0 a0 Or N h N 10 M ~O h h
N M N N N u7 ~ t~ ~- O h M M sf ~t M .- ~ r- .- M V ~- M ~ M M M ~ M
N h
W
O o0 M t~0 O M O O a0 ~ ~ O 10 ~N °r aD t0 CO O a0 Ifi
w aMr d °° 'rd' C! ~ m o ~ ~ h M n_ °o ~ v '° ~ u,
~ a
U ~ U U -° ~ r ~ m ~' 4 rii ~' '~ U C7 ~'U" U U' C7 Q 1V- °p r
U U U H U U ~
,Q, g M ~~~U~(n ,U, Z ~~ Wg~a~QQ~
~ H E- ~ F- F- ~ N .
aa~aaa~ a~ as=~~~a~~a
m mm mna.a w a m ui c9 mm mmmm mx mm>aaamaam
m m~ m~ m~ m~ m~ m~., m~ m~ m~ m m m~ m~ m~ m~ m~ m~ m~ m m m~ m m~ m~ m~ m m~
m~ m~ m~
C~ (7 C7 c9 c9 (~ C9 C~ C~ (~ C7 (~ c9 C~ C7 (~ (~ C9 t~ c9 c9' c9 C7 C9 (~ C9
C9 C9 (~ (~ C~
o ~ m m
w ~ ~~oMMr r~crm
cv ~ru°r$~n
o $ o ~ o m o o ,~°a m r~°v
~L
131
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
o> ~ a_> rn m o o> o~ o m cn °' ao ~ m rn o~ m o~ m m
~ o CS ~ W ~ ~ ~ ' m m °~ ~ a~ ~ O> rn or rn °~ o~ o~ o~
~ W Q ~ a a d d > > U ~ h d c > >° ~ o ~ n a
-~o~-~ da u. ~ ~ u.~ ~-~ o ~ dv~ °a a a z a a a
N ~ m ~ r v yn d> 06 ~ id ~-' n n c~ o~ n d~ o
O O n N N N N r '- a- (~ N N r ~ N N N
m tn W a0 m O m ~ V m M V (O W a0 c0 ~ N m ~ t0 m M
N C~7 n M f0 II) In t0 (~ N O ~f1 m m m O O ~_f
t~ m o 0 o m oo m n N v n o 0o ro .- o~ n n ao n o 0
n - n n ~ ~ ci o of n °i n n of ai of ao ui of n n
m f0 m M m m ~t ~ ~ ~ m M m m s< f~7 M ~ m ~ m m m m m
N
m _m ~ m w
~°
N ~ ~ m p ~ m 0 ~ ~ W C C
m ~ V_ (O Gl m V N N E N N
d ~ G) N ~$' l0 7 m Ci 7 7
O ~ O O
> > > ? ~ > > c c t > > g > > E d m ~ c c ~
N N d N T IU V V n a m ~ ~m T m d O'C 'C a a a ~b N
RmmmE~»~aoWmEm~c~oo~ a ~ ma'°n'
a a a a ° ~ E E o o 'o a .a o n o a ~ 0 0 0 °' °'
~~$c°y'°? '~ o o cao °°v ~ ac~. ~~ ~ 0 0 0
~'o2.~O2_
~ (O ~ ~ Z I d ~ ~ l0 ~ 7 ~ H u. u. Z T 2 to > m '>
y d c ~ m m a~
c~i .-. a n a ~ c d a~
c ~ a ~ '° i~ c E c E m D a n a
of ~ o Q r a E 'a> $ ~a: 8 0 ~ U' N E E
'$ v r~ ~ ~ o o Z °~ 8 8
Q N r o Q ~ a H E m y
d ~ O p ~ ~ ~ m d m E ° ~ ° d ~ O = ~ Z
E a" °~ ~ '~ ~ E E $ ~ U O U O 10
. N m 3 7 D' Q N d N T d p N .D ~ .~-~ ~ . N >~ E E
Q w
_ V7 J H ~.
° ~E E. EQE~O V~ ° (~ aYC YC mU E UV~ a
n ~ m m ~ ~ d m o ~~ ~~ m E n ~ ~ v
'~ °' c ~ ° Z ~ Z ~ U m ~ °, .coy o '~ E a E ~ ~ ~ m is
>.
°? a? ~ ! ~ ~ ~ d °' m °: E ~ a a ~ d ~ ~a m ~ m
a_> ~ r ~ m ~~ _yi ,.. ti c m . ~ vi c c
am n U c°U °c'p ~z ~ c oZm Z ~~ r ctii L°
dm Q °Q ~ m m m m a a W ii .n a
~$ ~N~°~ -~~acaSE 8o d; ~uio 'T'a~ ~'~N xo d .°°m m
.1 v ~ m sf ~_° ~ m c c . ' c . ~ H o~ 2 0~ n c c ~- ~ c m = ~ E E
n m r U -E ~ ~ v ~ -° ~ g ~ o ~ N ~ o o ~L~ m ~ m ~ n o r a m m
G7 ,.~ J m v d °. 1- °. o U a U E "~ m o ~,~~ v ~ ~- N
vxvv_ Y m a~ co - ~~ °Nr.u ~ .~ N~ V n m_ i 2 2
E ~ ~ w m ~, cn co !~ _ _ _ ° E x ,~ a c a o p_ ° °'
~a U o ~S >
E m E E N d > > m tL o lL a ~ ~E m y> tn m o- m ~ m ~ ~ E N.
0 0 0 0 ~ m E ~ E ~ E ~U' o ~U' a o o ~ o ~ o ~~ E Q W ~ o d ~ p m m
'~~°v__c_mEdEEaEa~ 'm~° v ~~~ m~'c:: o~ ~~ E
d ~ d d ~~ ~'o m 'n L Z s Z- m ~ ~ d ~ °' ~ :~ ~ a ~ a p~ m = ~ N_~ ~ Z
-~ E E E E ° ~. ~ ~ ~ ~_ our C~ H U' Y E E o E ~ E E c ~ c ~ OI m m
'° UI m m
3 ~ o ° E U ~ c° Z Z ._ .~ ~ ~ .- c v m Q ~ '~ ~ a o. ~ w ~ o 'a
'a
'C L ~_ 'C
maW aymy,r= U U m~ °oaiorn.c U m
~w~mmWEma o~p~-HUZlo °a~ E mc~°'oaa'~o n~o'to ~~~?' Hw~vm d
°vucgv~m,NQ~OoWOtal1'a~° °v~.S ~ ~~v~L~ N~~viU~°c
oWtO~.c~>~>ai
~~~~indF'>~>~x~nx~na ~~' ~n ~m~o~u.Q~~ac~3xW xcnxo~m-8m°°~
'vt O 07 n ~ ~ tD N ~ c0 O V V N ~ O
m O N m (00 N O N O O ~ Ol ~ O ?1 '? ~l n ~ V O f0 h
O N f- O °) m ~ N m m m 01 a0 c) O m m O t0 t0 r N t0 t°
n cc o 0 o n o 0 0 ~ o m cn so
O J ~ O J IL _ ~ LL (L O p1 n J J O N IlI (L LL a v a W o
~aN~aaa ~ a a ~ NJ a aN~ as a a a a ~
r t0 V~ O n n O) OD O O n ~t at
W O N N v- aD o7 D) O W n R7 O O W tc~ H7 1I7
c0 a0 N a0 r W O O tn m 07 m O O 01 N N ~f o0 V N N
1n N (D IA N m O N ~ °) 47 O1 r O) O st 07 ~C tD f0
(~ m m m N a0 m et .- r t0 01 m N O 47 ~ r ~ ~ .r .- 1A .)~ d.
U
(00 (OD ~ n O N aMp 'C
m n ~ ~.,~ ~ h ~ o O ~ n O ~ M O ~ ~ OnD ~ !OD
r O J N N (~O W m m ~ ~ m V o V N n 1b ~ 00 O m ~' d
O O n - x t0 O Y V
v Z U o U m ~ ~ u. ti U U' N ~ co ~ o m ~o C! U C! g
F- t~ U °° W to ~°y Q Q
a c°n N N Q ~ ~ ~n ~ N g ui ui
a a m m
aaaaa>~ ~ ~ ~ ~ as ~ aaa ~> >
i i i i i ~i i wi i xi ai mi mi mi mi ai mi mi ~i ~i ~i xt ~i ~i ~i
mmmmmmm m m. .m m . mm- m mmm mm m m m m m m
c~ c~ c~ c~ c~ c~ c~ c7 o O c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ o c~
o
n r W ~ o ~ ~ o
n n
f0 O m N m
O ~ ~ tND (D
N N N N N N
132
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
~rn mo ~m m om,
o~ ~ o~ o> o~ m M r r r' m m
~ ~ °' °> ~ ~ >- ~ o~ e' a; o~ ~ ay ~ rn a ~ ~ °~
n n > c
tmn v~ ~ z ~ > > ~ o o '°
~Nao ~o r~r~d o ~ coo~o~uS ao a a oz z
O O N N O O N N N N N N N ~ N N N IA 1r7
O O O a0 tD N t(7 ~ N M c'~ M W m r r aD r 01
c_~ ~ M_ f'7 t0 ~U h N N m aD c0 O u7 m ~ O N
O ~ ~ f0 O f~ tn 1n N O O r r aD (~ a0 O~
O> C~ O~ °i Oi 6~ aD a~ ~G V~ c0 a0 c0 N to N N is 47 M
f~ C~f tn O Of m M M l~ 01 O O (h P7 In C~ l'~ Cp Ih f~7
7 7 7 7 7 7 7 7 5
U U U V U U U_ U_ U_ O 'y
E E E ~E E E E E E m ?' ~ E
r010W y0 mN f0mm y~ N
7 J 7 ~ J 7 77 ~ 7 m m
G7 01 OD C1 O a) m m m ~ p p .O a
n.~. O C C Y J
'C 'C 'G C C ~ N N 3 C OI N RI U m E n m n
g gr m m m 'm c ? ~ d a~ m ~ y ~ E E
U U ~ '~ c"'i ~ n ~ Ø ~ v ~, > ~n ~4 0 _A ~ 'a n m
.~°a n ~ a a a ~ 5 ~ a a a E N ~ r 2° W H N a
cm c c ~ E o c c c v o 0 0 0 0 0 o t
2' 2~ t~ ,a m E ~ Z' 2' E E E o o a E E
0 0 0 0 0 ~ 0 0 0 0 0 0 0 0 0
U ~ U U U U ~ ~ Z U U U Z Z Z O D ~ S 2 m
d d crn~ ~c ~~ VIU11ULNLNOo
is n ~ ~ m o 1- ~ 2 ~ U. ~ ~ N N_ t0 Y C _ ~
U U ~ y N ~ m. H E E; ~ ~ ~ ~ $ ~ a ~ ~~
cc ~~d v ~mvm~-mo-ccNntnain'°
oz oz m ~d
Q Q N o ~ ~ ~ ~j J °~ U' °_~ . .d,U C~ °' n~ ~ 7 c
> > ~ Q .~ ~ ~ V ~o
y a ~ Z o >, co ~ z ~ z n- a n ~ o
:.° ~ ~ ~ ~ ~ ~° ~ ~.N.. Q 7 Q 7 ~ Z Z Nm ~ ~ ~' a ~
~ w c a_, d, E ~ m C7 m Cl m C7 U' ~a c
_ .C m c ~ ° o v to m w °' z z o '~ u~ m °'
o ~ .4 c '' ~ ~ o tn o tn r% U U o >, a '~C ai p
v v m~ ~ r ~=N v ~~ °~ aw IZL v~o~W
tV N C ~ N !V ~ N E a 1w~0 m E M ~ E E ~' E w U C7 p
v ~ .c ~ ~ m a o m m ~°n '~ c m ° 3 ° 3 > I1J LL t S
o~ o> ~ o~ ~ T' ~ S c a a o E R $ w ° N a ~ ~n W ~ h a m W m
O J ° C O c r _ :p O v ~. ~ vi
N n
O O' E E ~ O ~' z = -o .p r ~ E >' W . _ ~ a ° .mn o c ~
V_ U_ ~~Cm F- mNmUO E UC UC .girl r~ n~J~()ENm
c c E ~E C C ~ ~ U c c '° m ° 'k E ° y ~ m ai o m~ m~ .~
t o m
a' °! ~ m y m'c~. o ~ m m v a ~ o w ~ % '° ~'~ ~ ~ ~ n ~ E
a~''m o~ aa~'°$~~ aanp-a'~°~ o m~voW°-ac c -o°~'g~-
°'~
L c m m ~ ~ ~ o a t c~°>?~ c°°'vY o.,~ o ai ~ c nm
~'a;.
EEE E EE mm~>, .c nn ~' v mQn~aQ~ vmu Nt-c$.m
0 0 0 ~ o o .a. m °- m - m m m v c~ "' ~ m
w v mo~m~mmam Ema~n-~,ajmm
,°'m m orc~$e' Ecc~a c EomE.o'2ocmc~W °°
o ~ m~ ~ ~bv o ?~ n~ ao~c m nv n.c,a m.i~Z o~
o. m °o >z -°' !am mmc?jnanvd ~'~a;mvi
~mm m ~~2~ZCan~ .mu~~~~m%ca~°n~o~N~~~ouo~t~_~
7 7 F 7 ~ _7 ~ ~ = O ~ m m ~ ° j N ~ ~ N e- r O ° E ° '~
~ '~ m >. y~~' m m
dm~N~Nda°~mXEHc w~~EEoU' Ec uEoEo m oE'i.~
m o o L n o m Q ,c o ~ ~ ~ ~ _ ~ z ~ m n. ~ ~ a m a.
tn v) U ~i U B tn !~ ~ E io U o~ U O A Z Z m U Z ~n O .- .-
,°n o
'° '° u~ m ~ ~ w ~~-. ~ ° ~ o ~ a~'o a~'o ~ ~
O ~ ~ ~° M M O O M ~ O ~' O O O ~' O O
aa° ~ aa~~ a ~wwiN a a a Na a a
N N ~ ~ M
N N N N N N VO 117 O ~ a0 a0 n Is W O O r M
01 07 O~ 01 m W N ~ V' , ~ ~ ~ nfJ N ~ M M V' ~v- ~ N
<t
f0
Wl7 ~ N N (~D ~ O
OD -J .J W 0M0 U N ~ a ~ ~ 't O ~ ~ O ~- O O 'f
~,~a,U U ~~~~ a ~oo~n v a a ~a a
U .- in IlJ Itl Z
H N ~ N h -.~ H ~ H H ~ N M ~ ~ ~ UM~
aaa a as>v~ ~ aaa~~ ~ ~ ~- Q~
a~ a~ m~ mi ai ai of ui~ c9~ mi a~ a~ a~ ai d~ xt xi m~ xi =~ m~
mmm m mmmm m m.mmmm.. m m m mm m m
c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~
a ~ M o °o
t~ ~ ~ ~ cmo i: n r
N N ~V N ~ N N
O~ ~ L
133
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
m d' O O 47 c0 W W
W WW W O> Of W W W
W o~ ~ w ~ F= 1= ~ ~ o rn ~ W Q ~ ~ W
o IUtI~ m > >c c ~Q~V U ~3c» ~ m tUtJtUu
D~ ~ -o~-> > > ~Q ~O O ~-a m-~ ~~~~ v7 DD
v ! n'' '' i:mQ~ ~ ~r~-'~~d'mr~ o ~r~
.- O ~- ('h c~ ~- N f~1 N N ~- t~ O N N M .-
N c0 t0 ~ W t0 O cD O ~O n N c0 a0 a_D f0 <O g O (D ~1 W ~ W O
1A (') c0 f~ W V O t0 (D (~1 W N N W N O N O OD O (p M
c0 W 1n _ W t~ W (O OO N 1~ OD ? c0 CO V 'C W ~ 1~ (D OD Q O GO W
W 07 a0 a0 h n ~ W a0 CO O O N O ~ O n O o0 a0 W at
W C7 M f~ (~ f~ M (h M ~ V' ~O Q fn '- M (n W ~ M ('~ (n
E N N a1 ,N ~ ~ N
~~ ~O ~O ~ O _~
N ~N
O) a~ N d 47 y N N ~ 47
rn a m o~ a a a a E a a o~ a a o~
and E ~?~~ ~ N .o.w E~°'E o
yCJ "' ~ 7 7 7 C C 7 yo 7 C G 7 7 C ~~ 7 7 ~~ _7 ~ ~E C
~7 ~ ~ ~ N N N a ~ y ~ ~ N N ~~ ~~ m U N ~N U O 7 _(p m
D L .t a (0 N (0 h tp N Ol W N N A ~ N ~ W f0 ~ 7 7 O N
c °c °c ~ 0 0 0 0 0 °o ~ o o ~ 0 0 0 ~ o a~ c E E t o
Gtplm ~ UUUE E U_t~UE E UUE~L~'U~Zp'd1 t~ NE
U UU U ~~~Z I ~~~2 Z ~~Z~~~~~ ~7 .J=
m o
m ~ o m N :: 4: v
a Y m _~
> > ~ ao c
a c '° Q c cNO ~ ~ .r~,- ~ m cn ~ cNn c.i o N N 2
ac m -~ r c ~ ~ m ao r ~_a v ~ ' n
c a ~ ~_ t11 IL m M ~ Z -~ m
$ m O O
°~ o o ~ °' o c c c c c Q Q c c ~ ~ U. ~ d ° ~ Y
H u~ = s ~a w Q d m A m d ~ ~ m o a> m ~ o d a m
N N -~ Y N C C m U d . ,. U ~ Q
1 ~ d d N N A l0 N ~ .8 m n (~ H .. ~ h O Z [vj p O !L
rZ~~ m m m Q~'Q~ aW Vui EO,. O ~omU
.>v N ~ ~ E E aW r E N c c E E E ~ N ~ a
Z~~a °c °ca .3n °c$ofC~~f~~ °c°c me
o,o ? ~aE~
C G C 01 m p O N m ~ O' C N N N ~ N O c N
H o~ A '~, in of m o~ rn ~ ~ o~ m m m ~n a ai rn a a~ o o ~ o n .
x.v~~ t~n~v~c°: °'co re ~a.waQnQ ma> °~ ~~~ E
°oN~E
c d m c a~ a_~ '~ ~ E ~ Z Z m ~ ~ ~ g m o
V1 ~ N ~ d ~ ~ 7
~~3o~o°w'~°o'co~,a'~EE~E Eo ~~ OZIo
U U U Q ~ U O~ f0. m-'O r d N
G~NGW~O~d.~Y>n>r0' >2'm0~0~ »a0»COCfD UO~
a c f- c. c ~ m ~ r ~ ~ ~ ~ E c 2 ~ Z cWn ~ ~ m ~ n '~a !° f7
c Era ~ ~ ~zvid?3a mice '°Zozo zz~t'z_~_ ~ ~~ cZ.i v a vm_ ~ y
o T m ~ ~ Z ~ ~. ,o ~n ~E N ~ _a> K d ,~ ,e L z to Z to N m m ~ H E m m $ c ml
~~ .fir E o o H
W E d ~p ~ O ~ E ~ ~ ~ V ~ Qm a ~ p = O W y~l 0D NI 00 ~~ _O O E ~ V' OI m ~ ~
~ Q' b Q b O N
a ~ r~° U~ m A m ~ .c° a~ °' v m ~ °~ O ~' ~ v Q
~° °' E -"E, ~ ~ E ~~ p W c E
o~ g ~.c d v,aa~a a.n Q,Z'n2'ax 0 c~N ~N. aaZ we ap ml 4 NI _~ mr % o
[~ ~ o, o N Y .~°-' ~ Q E E E E n ~ .a ~ E ~ W o U o U E E w ? E E ~ o
~ ~ o ''
O U ~ 7 7 C 7 a1
d m v Y ~ d d o c ~° _ ~ 3 c ~ > > c tn ~ E ~n h E
C a d O U U U A m W m ~1 C E X O x O ~7 U 10 a ~ ~ ~' nj ~ Z Vj ~ ~ O W O C
albNOMO~'O~aaa"G~"caddo~°o'-° .non aso UlW tL GF~m
~ a mm)) m > m rp N '7 >. >, ~U. O 7 O ~ ,U~ .G n 01 N m ~ ~U, O O O U ~O, ~ ~
a ~ b a m ~ o M !-~-
r~.~UQU~ c-°..~~~~5===2U~2 own crM ~~=U~~m ~~d ~~~=UNtn
r N '- O o
n n u~ co o ~ ~ ~ o
W ~M W N ~~ f00 ~W~VO' OV NNN V~_~ONO m tn0
O ~ W o ~' ~ M O O M 10 ~ ~ ~ ~ N O O P'7 4_') ~ W ~ O O
4. oo j fi c oo U U m ~°~ W W m vt J
Q ~ Q ~ N ~ N Q Q N ~ N Q Q N N ~ ~ N ~ N ~ Q ~ Q
c~ rn m co m m o 0 o w m
N O ~ ~ ~Np W N N a0 W ~ W W O O W ~ h ~ ~ ~ n
O 1~ f0 O Il7 O M ~ n CO tp O t0 Ip N N W
V' t~ M ~t C~ ~t M r- M M N .- r N N W - N C~ N C~ c7 M v
Nr~N ~ ~Y~M ~ ~n~pOJ~~°_~~~ aMp V'm
m > m ~' o ?' o o ~ ~ (A N N ~ ~ N ~ 1M0 ~ U' °~
o E' o UoU~ o UUQ UU~~U~
ti ~ ~ ~ 1- o F- U U 1-- Y t~ g g I- 1- tn U~ I- J ~ ~ ~ ~ Vi
Q V M Q ~~LQ Q ~ V .~',N N ~~Z(~~~mN N
m Zw m mmma a mOmuml w mmammmmtmu w ?a
1 I I I I I I I I I I I I I t 1 I I I I I 1 I I
m mm m mmmm m mmmm.m mmmmmmmm m mm
c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ C~ c~ c~ C~ o n c~ C~ c~ c~ ' c~ c~ c~
n O N n
r m ~ ~ m
N r N ~ M t!J M
0r0 ~ N
134
CA 02571917 2007-O1-08
WO 01/66573 PCT/IB00/02035
H
n.
H
O
O
T.
C
N
N O
N
r- N
N
a °' H
o ~
E ~U
o ;_
c
0
r o E
~ ~ o
D
~ d
~N d
aaao c v
Eo°~rn'~
~ co m
a c ° n.
~' m c E
°v
N
H N
_. (n
z Vl
f~ (p p C
7 O ~ E-
T U r. cO
N
m
Z
a
m
c9
135
CA 02571917 2007-O1-08
CA 02571917 2007-O1-OB
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTS PARTIE DE CETTE DEMANDS OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour lea tomes additionels, veiUez contacter 1e Bureau Canadieat des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION l PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Offrce.
