Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 45
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 45
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
STRESS TOLERANCE IN PLANTS THROUGH SELECTIVE INHIBITION OF
TREHALOSE-6-PHOSPHATE PHOSPHATASE
FIELD OF THE INVENTION
The present invention encompasses the stress-responsive expression of a
nucleic acid
sequence capable of down-regulating trehalose-6-phosphate phosphatase activity
for the
purpose of increasing yield and/or improving abiotic stress tolerance of
plants.
BACKGROUND OF THE INVENTION
Abiotic stress can affect plant development in different ways depending on the
timing,
severity, and duration of the stress. Maize plants are, for example,
relatively drought tolerant,
and can withstand moderate to severe drought in the early and late stages of
the growing
season. However, maize is quite susceptible to water stress during a 10-14 day
period around
flowering. Non-irrigated maize grown in the U.S. Corn Belt typically
experiences water
stress in late summer during flowering. This stress usually manifests itself
in the form of
reduced kernel set due to ovule/embryo abortion. In the simplest terms, when
roots are
experiencing osmotic stress, they produce abscisic acid (ABA) which is
translocated
throughout the plant. In the leaf, this triggers closure of the stomata, thus
reducing water loss
through transpiration. Unfortunately, this also limits gas exchange and
consequently
photosynthesis is reduced. Without sucrose from photosynthesis, the developing
ovule or
embryo rapidly depletes its starch reserve and aborts.
The trehalose pathway in plants is shown in Figure 1. The pathway is
positioned to
demonstrate similarity to sucrose synthesis via sucrose-6-phosphate synthase
(8) and sucrose-
6-phosphate phosphatase (9). Trehalose synthesis is catalyzed by trehalose-6-
phosphate
synthase (T6PS) (10), yielding trehalose-6-phosphate (T6P) and trehalose-6-
phosphate
phosphatase (T6PP) (11), yielding trehalose. Trehalase (12) cleaves trehalose
into two
glucose molecules. These enzymes are well characterized in microbes and were
thought to
occur in only a few plants, such as the dessication tolerant Myrothanmnus
flabellifolia,
because measurable trehalose accumulates when they dry down (reviewed in
Muller et al.,
1995). Many crops do not accumulate detectable trehalose, therefore most
researchers
believed they lacked the ability to make it. Furthermore, exogenously applied
trehalose can
be toxic to plant tissues (Veluthambi et al., 1981). The E. coli genes
encoding T6PS and
Page 1
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
T6PP were cloned in the early 1990's (Kaasen et al., 1992), and formed the
basis for early
work to use genetic engineering to improve plant tolerance to water stress
(Holmstrom et al.,
1996; Goddijn et al., 1997).
This early plant genetic engineering work was based on evidence obtained with
microorganisms. It is well established that trehalose improves desiccation
tolerance of
microorganisms and macromolecules (Weimken, 1990). These experiments provided
a direct
correlation between trehalose levels and desiccation tolerance. Many groups
attempted to
genetically engineer trehalose synthesis in plants (Rontein et al., 2002).
Much of their work is
aimed to increase trehalose levels (Hoekema et al., 1999). A number of
inventions used the E.
coli or yeast trehalose synthesis genes. In summary, engineered plants
produced only small
amounts of trehalose despite increasing the plant's capacity to make trehalose
by as much as
ten-fold (Londesborough et al., 2000).
Further investigation showed the low trehalose accumulation in transgenics was
due,
in part, to endogenous trehalase activity (Goddijn et al., 1997). Other
workers believed that
sucrose and starch synthesis limited the plant's capacity to make trehalose
(Hoekema et al.,
1999). More recent publications disclosed methods to improve trehalose
accumulation in
transgenic plants by inhibiting trehalase (Goddijn et al., 2003), expressing
an E. coli T6PS-
T6PP fusion protein (Garg et al., 2002; Jang et al., 2003) and expressing the
E. coli trehalose
synthesis gene in plastids (Lebel et al., 2004). Some groups acliieved
improved trehalose
accumulation and, most reported small improvements in drought tolerance even
though
overall growth defects were observed in the transgenic plants.
Advances in genome information and complementation work in yeast identified
plant
genes encoding functional T6PS, T6PP and trehalase (Vogel et al., 1998;
Blazquez et al.,
1998; Aescherbacher et al., 1999; Muller et al., 2001; Vogel et al., 2001).
Trehalose pathway
genes are expressed at low levels, but expression has been detected in all
tissues examined.
Sequence data from several plant species indicate the presence of trehalose
metabolism genes
(Leyman et al., 2001; Wingler, 2002; Eastmond and Graham, 2003; Eastmond et
al., 2003).
In most plant genetic engineering studies the trehalose pathway enzymes, or
genes
designed to influence a trehalose pathway enzyme activity (for example, an
antisense RNA
construct), are targeted to the cytosol (Holmstrom et al., 1996; Goddijn et
al., 1997; Romero
et al., 1997; Pilon-Smits et al., 1998; Garg et al., 2002; Jang et al., 2003).
Despite their
enormous increase--or change in--synthetic capacity, the experiments do little
to influence
trehalose or trehalose-6-phosphate in these plants. In fact, tobacco and
potato plants
Page 2
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
expressing the E. coli T6PS and T6PP genes tend to suffer pleotropic growth
defects
(Goddijn et al., 1997).
Thus, there is a need to develop stress tolerant plants that do not also
exhibit growth
defects.
SUMMARY
The present invention relates to transgenic plants comprising a polypeptide
encoding
a nucleic acid that targets an endogenous T6PP gene, wherein the isolated DNA
molecule is
under the control of a promoter that is stress-inducible in vegetative tissue.
The nucleic acid
may also be developmentally expressed in maturing kernels. Stress induced
expression of the
nucleic acid of the invention increases the availability of carbon to
developing florets/kemels
when plants are under stress conditions, such as a water deficit. The
polypeptide of the
present invention transformed into a plant thereby permits more photosynthate
to be directed
to the developing ovules/embryos resulting in stabilized yield in growing
environments that
are subject to periodic stress.
The present invention further includes an isolated DNA molecule comprising a
polynucleotide encoding a nucleic acid, the isolated DNA sequence is
operatively linked to a
promoter that is stress induced in vegetative tissue, wherein the nucleic acid
is capable of
down-regulating a T6PP gene.
The present invention includes a method of increasing the starch content in
the kernel
of a plant comprising the steps of transform.ing a plant cell with a DNA
molecule comprising
a polynucleotide encoding a nucleic acid, said polynucleotide is operatively
linked to a
promoter that is drought induced in vegetative tissue, wherein said nucleic
acid is capable of
down-regulating a T6PP; generating a plant from the plant cell; inducing
expression of the
nucleic acid in the vegetative tissue of the plant when the plant is subjected
to stress
conditions during its reproductive stage; and increasing starch content in the
kernel compared
to the starch content in the kernel of an isogenic plant not containing the
DNA molecule
when the transgenic plant and the isogenic plant are grown under substantially
the same stress
conditions.
The present invention further includes a double stranded short interfering
nucleic acid
(siRNA) molecule that down regulates expression of a T6PP gene in the
vegetative tissue of a
plant, wherein said siRNA molecule comprises at least about 21 base pairs.
Page 3
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
The present invention encompasses a double stranded siRNA molecule that down
regulates expression of a T6PP gene, wherein a first strand of the double
stranded siRNA
molecule comprises a nucleotide sequence substantially similar to the
nucleotide sequence of
a T6PP gene or a portion thereof and, wherein a second strand of the double-
stranded siRNA
molecule comprises a nucleotide sequence that is complementary to the sequence
of the first
strand.
The invention also includes an isolated DNA molecule comprising a
polynucleotide
encoding a nucleic acid, said polynucleotide is operatively linked to a
promoter that is
drought induced in vegetative tissue, wherein said nucleic acid is capable of
down-regulating
a T6PP gene.
The invention includes an isolated DNA molecule comprising a polynucleotide
wherein said polynucleotide is depicted by SEQ ID. NO 6.
The invention includes an isolated DNA molecule comprising a polynucleotide ,
wherein said nucleotide sequence comprises at least about 21 consecutive base
pairs of SEQ
ID NO. 6.
The invention includes an isolated DNA molecule comprising polynucleotide
encoding a nucleic acid, said polynucleotide is operatively linked to a
promoter that is
drought induced in vegetative tissue, wherein said nucleic acid is capable of
down-regulating
a T6PP gene, and wherein said polynucleotide is placed in a sense or antisense
orientation
relative to said promoter.
The invention also includes an isolated DNA molecule comprising a
polynucleotide
encoding a nucleic acid, said polynucleotide is operatively linked to a
promoter that is
drought induced in vegetative tissue, wherein said nucleic acid is capable of
down-regulating
a T6PP gene, wherein said promoter is derived from the 5' region of a Rab 17
gene and
exhibits promoter activity in plants.
The invention also includes an isolated DNA molecule comprising a
polynucleotide
encoding a nucleic acid, said polynucleotide is operatively linked to a
promoter that is
drought induced in vegetative tissue, wherein said nucleic acid is capable of
down-regulating
a T6PP gene, wherein said promoter is derived from the 5' region of a Rab 17
gene and
exhibits promoter activity in plants and further comprises a 3' region derived
from a Rab17
gene and exhibits terminator activity in plants.
The invention further includes an isolated DNA molecule comprising a
polynucleotide encoding a nucleic acid, said polynucleotide is operatively
linked to a
Page 4
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
promoter that is drought induced in vegetative tissue, wherein said nucleic
acid is capable of
down-regulating a T6PP gene, wherein said promoter comprises about 100-1649
contiguous
nucleotides of DNA, wherein said contiguous nucleotides of DNA have from 85%
to 100%
identity to about 100 to 1649 contiguous nucleotides of DNA having the
sequence of SEQ ID
NO. 42.
The invention further includes an isolated DNA molecule comprising a
polynucleotide encoding a nucleic acid wherein said nucleic acid is capable of
forming into a
double stranded RNA.
The invention further includes an isolated DNA molecule comprising a
polynucleotide encoding a nucleic acid wherein said nucleic acid comprises co-
suppressor
RNA.
The invention further includes an isolated DNA molecule comprising a
polynucleotide encoding a nucleic acid wherein said nucleic acid comprises
catalytic RNA.
The invention further includes an isolated DNA molecule comprising a
polynucleotide encoding a nucleic acid wherein said nucleic acid sequence is
capable of
forming into a triplex nucleic acid.
The invention further includes an isolated DNA molecule comprising a
polynucleotide encoding a nucleic acid, said polynucleotide is operatively
linked to a
promoter that is drought induced in vegetative tissue, wherein said nucleic
acid is capable of
down-regulating a T6PP gene, wherein said promoter is also expressed in seed
tissue.
The invention also includes a plant cell having an isolated DNA molecule
comprising
a polynucleotide encoding a nucleic acid, said polynucleotide is operatively
linked to a
promoter that is drought induced in vegetative tissue, wherein said nucleic
acid is capable of
down-regulating a T6PP gene, and also includes a transgenic plant derived from
said plant
cell.
The invention further includes an isolated DNA molecule wherein said DNA
molecule is depicted by SEQ ID NO. 8 or SEQ. ID. NO. 18.
DESCRIPTION OF THE FIGURES
Fig. 1 is a schematic representation of the primary sugar metabolism pathways
in a
typical plant cell. The various sugar and activated sugar pools associated
with starch and
sucrose synthesis are shown. A permanent block in trehalose synthesis has been
shown in the
art to be lethal. However, the present invention recognizes that a conditional
block in the
Page 5
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
pathway from T-6-P to trehalose using a stress-inducible promoter to express
T6PP-RNAi in
vegetative tissue, redirects flux to sucrose or starch synthesis in a stress-
inducible or
developmental pattern.
Fig. 2 is a schematic representation showing how the maize T6PP 1 cDNA
sequences
were assembled. In section (A), the cDNAs were identified by TBLASTN queries
of maize
EST and cDNA databases and assembled in Sequencher. The strands 1, 2, and 3
shown at the
bottom of section A show the plus (+) open reading frames. Strand 1(ZmT6PP-1)
contains
the largest continuous open reading frame and is highlighted. Section (B)
depicts the
ZmT6PP-1 protein sequence.
Figs. 3A and 3B show the alignment of T6PP protein sequences. The Arabidopsis
AtT6PPA and AtT6PPB sequences are aligned with the rice and maize homologs
OsT6PP-1,
OsT6PP-2, ZmT6PP-1, ZmT6PP-2, ZmT6PP-3. The alignment also includes ZmT6PP-
target.
The alignment was performed using AlignX within Vector NTI (Version 7.1).
Fig. 4A shows the phylogenetic relationship of the maize, rice and Arabidopsis
T6PP
proteins.
Fig. 4B shows a similarity and divergence table illustrating similarity of
each protein
to the others along the horizontal axis and divergence of each protein from
the others along
the vertical axis. Similarity values are above and divergence values are below
the '100' figure
in each column.
Fig. 5 is a bar chart showing the expression profile of the OsT6PP-1 gene in
various
tissues. Relative expression above 100 is considered significant. The
expression profile is
consistent with the known expression of the Arabidopsis AtT6PP-A gene.
Fig. 6 is a diagram showing sequence alignm.ent of the maize ESTs (GenBank
Accession Nos. BE510187, AW171812, AW081181, A1855276, BE453688 and A1941695).
ZmT6PP clone sequence data are denoted by t3.rev.91331.abi and
tl.rev.91323.ab1. Also
identified are the primers used to clone the ZmT6PP-1 cDNA fragment and to
construct the
ZmT6PP-dsRNA cassette.
Fig. 7 is a map of the maize T6PP-1 cDNA fragnient in the pCR 4 TOPO vector,
referred to as pCR4-TOPO-ZmT6PP-NS.
Fig. 8 is a map of the pNOV3210 expression cassette.
Fig. 9 is a map of the pNOV3232 expression cassette.
Fig. 10 is a map of the pRab 17-T6PP-RNAi construct. The complete Rab 17
expression cassette can be mobilized as a Kpnl fragment.
Page 6
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Fig. 11 A is a map of an AgYobacteriuna tumefaciens binary vector, pNOV2117,
that
contains the phosphmannose isomerase (cPMI-01) plant selectable marker within
its T-DNA
borders.
Fig. 11B is a map of an Agrobacterium tumefaciens Rabl7-T6PP-RNAi expression
cassette cloned in pNOV2117.
Fig. 12 illustrates kernel set yield data from a greenhouse experiment. Plants
representing each genotype were subjected to well-watered (WW) or salt-
stressed (SS)
conditions during the two-week period around flowering. Azygotes (WT) and
hemizygotes
(TPP) were then scored for kernel set. Data are the means, n=3-5.
Fig. 13 illustrates kernel set yield data from a second greenhouse experiment.
Plants
representing each genotype were subjected to well-watered (WW) or salt-
stressed (SS)
conditions during the two-week period around flowering. Azygotes (WT) and
hemizygotes
(TPP) were then scored for kernel set. Data are the means, n=14-20.
Fig. 14 illustrates kernel set yield data for Rabl7-T6PP-RNAi Event 78A18B in
the
field. Ears from each plant in the field were harvested and shelled. The
kernels counted and
weighed. The means for hemizygous and azygous plants were calculated. The
asterisk
indicates a statistically significant difference between azygous and
hemizygous plants.
Fig. 15 illustrates yield data for Rab 1 7-T6PP-RNAi Event 81AlOB progeny in
the
field. Ears from each plant in the field were harvested and shelled. The
kernels counted and
weighed. The means for hemizygous and azygous plants were calculated. The
asterisk
indicates a statistically significant difference between azygous and
hemizygous plants.
Figs. 16A and 16B illustrate the alignment of the conserved T6PP cDNA sequence
from several plant species. The aligrunent also includes T6PP-RNAi sequence.
The alignment
was performed using AlignX within Vector NTI (Version 7.1).
Fig. 17 shows the phylogenetic relationship of conserved T6PP cDNA sequence
from
several plant species. The table illustrates percent similarity of each
sequence to the others
along the horizontal axis. The analysis was performed using AlignX within
Vector NTI
(Version 7.1).
DETAILED DESCRIPTION OF THE INVENTION
The trehalose pathway represents a level of flux control through central sugar
metabolism. Several studies identified control mechanisms that regulate
enzymes in the
metabolic network shown in Figure 1. The data are by no means exhaustive.
However, given
the ubiquity of the trehalose pathway and pathway gene expression in plants
(Wingler, 2002),
Page 7
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
and the lethality of a knockout at the pathway's entry point (Eastmond et al.,
2002) the
present invention recognizes that the trehalose pathway probably functions as
a checkpoint to
help regulate glucose-l-phosphate (g-1-P), glucose-6-phosphate (g-6-P) and
fructose-6-
phosphate (f-6-P) pool size in the cytosol. In situations where the capacity
to generate these
molecules exceeds capacity to utilize them, the trehalose pathway acts as a
"spill way" to
quickly inactivate g-6-P and uridine diphosphate glucose (UDP-g) and recycle
the glucose
moiety. In this capacity the pathway sets up an apparent futile cycle that
needlessly consumes
energy, by converting substrates to products and later converts those products
back to the
original substrates. This assertion is not without precedence in plant
biochemical networks
(Rontein et al., 2002b; Ronocha et al., 2001). Such control mechanisms are
worth the slight,
but necessary, energy expenditure because of their greater role in maintaining
the stability of
the system. Thus, the present invention further recognizes that the trehalose
pathway provides
a rapid, probably low-capacity, control mechanism to stabilize cytosolic
hexose phosphate
pools.
The trehalose pathway is poised to compete with otller metabolic processes--
such as
starch synthesis, sucrose synthesis and glycolysis--for g-6-p and UDP-g. The
present
invention takes into account that engineering plants to express a heterologous
protein(s), such
as T6PP or T6PS, that may not be subject to endogenous regulation, using
strong constitutive
promoters pulls activated sugars out of central carbon metabolism. This wastes
considerable
energy and retards growth. Therefore, the composition and method of the
present invention
includes using promoters that are drought-inducible in vegetative tissue, that
may also
developmentally expressed in maturing kernels, operably linked to a nucleic
acid molecule
that when expressed in a plant cell, inhibits expression of the endogenous
T6PP gene or the
products thereof. By doing so, sugars are directed to synthesis of starch and
sucrose for their
availability to developing kernels when plants are subject to.enviromnental
stress.
The present invention uses genetic engineering to decrease or eliminate, via
down-
regulation, the expression of maize endogenous T6PP genes. There are numerous
methods
known to those skilled in the art for modifying expression of endogenous
genes. Post-
transcriptional gene silencing (PTGS), triplex-forming nucleic acid,
ribozymes, inactive
protein subunits and single-stranded monoclonal antibodies can all be used to
eliminate or
repress gene expression, as discussed in more detail below.
In diverse eukaryotes, including plants, double stranded RNA (dsRNA) triggers
destruction of any RNA sharing sequence with the double stranded RNA molecule
Page 8
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
(Hutvagner and Zamore, 2002). It begins by the conversion of dsRNA into short
21-23
nucleotide fragments by the multi-domain RNAse III enzyme, Dicer (Lee et al.,
2004; Pham
et al., 2004). These small interfering RNAs (siRNAs) direct the degradation of
target RNAs
complementary to the siRNA sequence (Elbashir et al., 2001). In addition Dicer
also cleaves
roughly 70 nt precursor stem-loop RNA structures into single-stranded 21-23 nt
RNAs
known as microRNAs (miRNAs) (Grishok et al., 2001; Reinhart et al., 2002).
This is the
basis for RNA interference (RNAi) technology that is used to suppress the
expression of
endogenous and heterologous genes in a sequence specific manner (Fire et al.,
1998;
Carthew, 2001; Elbashir et al., 2001). A RNAi suppressing construct can be
designed in a
number of ways, for example, transcription of a inverted repeat which can form
a long hair
pin molecule, inverted repeats separated by a spacer sequence that could be an
unrelated
sequence such as GUS or an intron sequence. The present invention also
contemplates
transcription of sense- and antisense-RNA strands by opposing promoters, or
cotranscription
of sense and antisense genes.
Antisense RNA technology can be also be used to down-regulate expression of a
specific endogenous gene. This is a down-regulation approach used to modify a
desired plant
enzyme level or activity. Antisense RNA results in down-regulation at the RNA
translational
level. Down-regulation by antisense RNA, as described by Shewmaker et al.
(1992) has been
shown effective with a variety of plant genes (Rothstein et al., 1987; Smith
et al., 1988; van
der Krol et al., 1988; Bird et al., 1991; Bartley et al., 1992; Gray et al.,
1992; Knutzon et al.,
1992; Shimada et al., 1993; Kull, et al., 1995; Slabas and Elborough, 2000).
In the nucleus,
antisense RNA may directly interfere with transcription or form duplexes with
the
heterogeneous nuclear RNA (hnRNA). Alternatively, in the cytoplasm, antisense
RNA may
form a double-stranded molecule with the complimentary mRNA and prevent the
translation
of mRNA into protein.
Co-suppression, as described by Seymour et al., (1993) is another approach
applicable
for down-regulation of plant gene expression. Co-suppressor RNA, in contrast
to anti-sense
RNA, is in the same orientation as the RNA transcribed from the target gene,
i.e., the "sense"
orientation. It has been used extensively to produce transgenic plants having
modified gene
expression levels (Napoli et al., 1990; Brusslan et al., 1993; Vaucheret et
al., 1995; Jorgensen
et al., 1996). The mechanism of co-suppression is thought to be caused by the
production of
antisense RNA by read-through transcription from distal promoters located on
the opposite
strand of the chromosomal DNA (Grierson et al. 1991). It's now understood that
there are
Page 9
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
common features associated with all forms of RNA-mediated gene silencing
(Matzke et al.,
2002; Tijsterman et al., 2002).
Another down regulation approach involves the use of ribozyme technology
(Atkins
et al., 1995; De-Feyter et al., 1996). Ribozyme technology, like antisense
methodologies, also
works at the RNA translational level and involves making catalytic RNA
molecules that bind
to, and cleave the mRNA of interest. Ribozymes have recently been demonstrated
as an
effective method for the down-regulation of plant proteins (Waterhouse and
Wang, 2002) and
control of plant pathogens (Atkins et al., 2002).
A further down-regulation method includes use of co-suppressor or 'sense'
nucleic
acids and dsRNAs. Nucleic acid sequences can be constructed which will bind to
duplex
nucleic acid either in the gene or the DNA:RNA complex of transcription, to
form a stable
triple helix-containing or triplex nucleic acid to inhibit transcription
and/or expression of the
target gene (Frank-Kamenetskii and Mirkin, 1995). Such nucleic acid sequences
are
constructed using the base-pairing rules of triple helix formation and the
nucleotide sequence
of the gene or mRNA of interest. These nucleic acid sequences can block target
gene-type
activity in a number of ways, including prevention of transcription of the
gene or by binding
to niRNA as it is transcribed by the gene.
A dominant-negative genetic approach can also be used to down-regulate
specific
types of enzymes. The presence of a dominant trait, i.e. the expression of a
transgene, results
in a reduction of enzyme activity or reduced production of the enzymatic end-
product. Some
enzymes are complexes of two or more protein subunits. Such an enzyme's
activity relies on
the proper assembly of these subunits to fonn functional enzyme. Expression of
a non-
functional subunit that can interact with the other subunit(s) can produce a
non-functional
enzyme and hence reduce enzymatic activity. The non-functional aspect may be
in respect to,
but not limited to, subunit interaction, substrate binding or enzyme
catalysis, for example.
Another approach to down-regulate proteins in plants relies on the use of
monoclonal
antibodies (MAb) and/or functional fraginents thereof, such as single chain
antibodies
(SCAb) that specifically recognize and bind transit peptides (Sukhapinda et
al., 2004). As a
result, steady-state levels of corresponding passenger proteins can be
reduced. The above
described technologies and other technologies known to those skilled in the
art for down
regulating genes may be used in the present invention.
The present invention includes down-regulating the endogenous maize T6PP gene
by
constructing a chimeric polynucleotide comprising a promoter that is drought-
inducible in
Page 10
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
vegetative tissue operatively linked to a nucleic acid, wherein when expressed
in a plant cell
the nucleic acid, or a portion thereof, is capable of reducing the expression
of an endogenous
T6PP gene of a plant cell. In one embodiment of the invention, the promoter is
drought-
inducible in vegetative tissue. In another embodiment of the invention, the
promoter is
derived from the 5' region of a Rab17 gene. The invention encompasses the
polypeptide also
having a terminator sequence derived from the 3' region of the Rab 17 gene.
When a recombinant promoter is used, the promoter can also be selected to
cause
expression of T6PP-RNAi in a manner that is different than how the ZmT6PP-1
protein is
expressed by the plant in its native state. For example, the promoter may have
no effect on
the level at which the ZmT6PP-1 protein is expressed, express the T6PP-RNAi
without being
induced by an environmental stress and/or express the T6PP-RNAi in response to
a different
form or degree of environmental stress than would otherwise be needed to
induce expression
of the Zm-T6PP-1 protein. The present invention recognizes that strong
constitutive
promoters should not be used to cause decreased levels of ZmT6PP-1 gene
expression.
Examples of such strong constitutive promoters include, but are not limited
to, the nopaline
synthase (NOS) and octopine synthase (OCS) promoters (Jones et al., 1992), the
cauliflower
mosaic virus (CaMV) 19S and 35S promoters (Odell et al., 1985) or the enhanced
CaMV 35S
promoters (Kay et al., 1987). Constitutively down-regulating the trehalose
pathway is known
to cause pleotropic growth defects. Specific down-regulation of T6PP to direct
photosynthate
to starch and sucrose in select cells is desirable.
A tissue specific promoter could be used to alter ZmT6PP-1 gene expression in
tissues that are highly sensitive to stress. Examples tissue-specific
promoters include, but are
not limited to, seed-specific promoters for the B. raapus napin gene (Kridl
and Knauf, 1995),
the soybean 7S promoter (Fujiwara and Beachy, 1994), the Arabidopsis 12S
globulin
(cruciferin) promoter (Pang et al., 1988), the maize 27 kD zein promoter (Ueda
et al., 1992)
and the rice glutelin 1 promoter (Goto et al., 1999), fruit active promoters
such as the E8
promoter from tomatoes (Mehta et al., 2002), tuber-specific promoters such as
the patatin
promoter (Kuehn et al., 2003), and the promoter for the small subunit of
ribulose-1,5-bis-
phosphate carboxylase (ssRUBISCO) whose expression is activated in
photosynthetic tissues
such as leaves (Laporte et al., 2001).
Alternatively, a promoter could be used to induce the expression of the T6PP-
RNAi
gene only at a proper time, such as prior to a drought that occurs at or
around the time of
flowering, thereby improving the reproductive capability of the crop and
increasing the
Page 11
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
productivity of the land. This may be accomplished by applying an exogenous
inducer by a
grower whenever desired (Chua and Aoyama, 2000; Caddock et al., 2003).
Similarly, a
promoter can be used which turns on at a dehydration condition that is wetter
than the
dehydration condition at which the plant normally exhibits dehydration
tolerance. This would
enable the level at which a plant responds to dehydration to be altered.
Promoters which are known or are found to cause inducible transcription of the
DNA
into mRNA in plant cells can be used in the present invention. Such promoters
may be
obtained from a variety of sources such as plant and inducible microbial
sources, and may be
activated by a variety of exogenous stimuli, such as cold, heat, dehydration,
pathogenesis and
chemical treatment. The particular promoter selected is preferably capable of
causing
sufficient expression of the T6PP-RNAi to enhance plant tolerance to
environmental stress
conditions such as water deficit. Examples of promoters which may be used
include, but are
not limited to, the promoter for the DRE (C-repeat) binding protein gene
dreb2a (Liu et al.,
1998) that is activated by dehydration and high-salt stress; the promoter for
delta 1-pyrroline-
5-carboxylate synthetase (P5CS) whose expression is induced by dehydration,
high salt and
treatment with the plant hormone abscisic acid (ABA) (Yoshiba et al., 1995;
Zhang et al.,
1997); the promoter for the rd22 gene from Arabidopsis whose transcription is
induced by
salt stress, water deficit and endogenous ABA (Yamaguchi-Shinozaki and
Shinozaki, 1993a);
the promoter for the rd29b gene (Yamaguchi-Shinizaki and Shinozaki, 1993b)
whose
expression is induced by desiccation, salt stress and exogenous ABA treatment
(Ishitani et al.,
1998); the promoter for the rabl8 gene, or other dehydrins, from Arabidopsis
whose
transcripts accumulate in plants exposed to water deficit or exogenous ABA
treatment
(Nylander et al., 2001); the maize Rab17 promoter that is drought-inducible in
vegetative
tissue and developmentally expressed in maturing kernels (Vilardell et al.,
1991); and the
promoter for the pathogenesis-related protein la (PR-la) gene whose expression
is induced
by pathogenesis organisms or by chemicals such as salicylic acid and
polyacrylic acid (Uknes
et al., 1993).
It should be noted that the promoters described above may be fu.rther modified
to alter
their expression characteristics. For example, the drought/ABA inducible
promoter for the
rab18 gene may be incorporated into seed-specific promoters such that the
rabl8 promoter is
drought/ABA inducible only in developing seeds. Similarly, any number of
chimeric
promoters can be created by ligating a DNA fragment sufficient to confer
environmental
stress inducibility from the promoters described above to constitute promoters
with other
Page 12
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
specificities such as tissue-specific promoters, developmentally regulated
promoters, light-
regulated promoters, hormone-responsive promoters, etc. This should result in
the creation of
chimeric promoters capable of being used to cause expression of the T6PP-RNAi
gene in any
plant tissue or combination of plant tissues. Expression can also be made to
occur either at a
specific time during a plant's life cycle or throughout the plant's life
cycle.
In one embodiment, the promoter of the instant invention modulates ZmT6PP-1
expression in plants experiencing various abiotic or environmental stresses,
including cold,
heat, dehydration, and/or salt stress that directly affect plant water
relations. These promoters
come from genes, and the like, that include, but are not limited to, the
CBF/DREB family of
transcription factors shown to be induced by cold, salt, and dehydration
stress (Jaglo-Ottosen
et al., 1998); the maize Rabl7 promoter that is drought-inducible in
vegetative tissue and
developmentally expressed in maturing kernels (Vilardell et al., 1991); the
LP3 water-deficit-
induced gene (Wang et al., 2002); the Arabidopsis CIPK3 gene that is
responsive to ABA and
stress conditions, including cold, high salt, wounding, and drought (Kim et
al., 2003); the
barley (Hordeum vulgare) HVA22 gene that is induced dehydration, salinity,
extreme
temperatures, and ABA (Brands and Ho, 2002); the betaine aldehyde
dehydrogenase
(AcBADH) gene from the halophyte Atriplex centralasiatica Iljin that is
induced by drought,
salinity, cold stress and ABA (Yin et al., 2002); and the wheat Esi47 gene
which is induced
by salt stress and ABA (Shen et al., 2001). Expression of endogenous or
exogenous
nucleotides under the direction of a stress-induced promoter may result in
maintenance of a
desirable plant phenotype under adverse environmental conditions such as water
deficit.
Expression cassettes containing the above promoters can function with a
transcriptional terminator. In many cases the nopaline synthase (NOS)
terminator performs
this function. Many skilled in the art consider this terminator adequate for
most applications
(Lessard et al., 2002). However, there are exceptions. In some cases
expression cassette.
performance improves when the NOS terminator is replaced with a similar
sequence derived
from the same gene the promoter is based on (No et al., 2000; Nuccio and
Thomas, 2000;
Moreno-Fonseca and Covarrubias, 2001). These exceptions often arise when use
of the NOS
terminus yields unsatisfactory results. The role gene terminator sequences
play in overall
regulation is not fully understood. Those who recognize this potential and
require faithful
reproduction of an endogenous gene expression pattern will replace the NOS
terminator with
similar sequence derived from the gene used to produce the promoter. Likewise,
those skilled
Page 13
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
in the art may also choose a gene terminator derived from a gene other than
that used for the
promoter in order to construct an expression cassette with the desired
regulatory properties.
Stress-induced yield reduction in maize is most pronounced when plants
experience
stress approximately during the two-week period prior to anthesis and during
the first week of
anthesis. This corresponds to the V 12-V 18 period of maize development
(Ritchie et al.,
1997). During this time the ear is formed, and the number and arrangement of
ear spikelets is
determined (Kiesselbach, 1999). Ovules, the kernel progenitors, develop within
spikelets and
are very susceptible to stress (Zinselmeier et al., 1995a), such as drought.
One study showed
a correlation between ovule starch depletion and the propensity to abort
(Zinselmeier et al.,
1999). Other work suggested ovary abortion can be reversed by increasing
carbohydrate flux
to ovules during periods of stress (Zinselmeier et al., 1995b). The present
invention is
directed to genetic engineering solutions to reduce environmental stress
related yield loss in
maize by increasing carbohydrate flux to developing kernels when such kernels
are
developing during periods of environmental stress, by using a pronioter that
is drought-
inducible in vegetative tissue and that may also be developmentally expressed
in maturing
kernels.
Examples of suitable plants for which stress tolerance may be induced
according to
the methods of the present invention and which may be transformed with the
expression
cassettes of the invention include monocotyledonous and dicotyledonous plants
such as field
crops, cereals, fruit and vegetables such as: canola, sunflower, tobacco,
sugarbeet, cotton
soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples,
pears,
strawberries, bananas, melons, potatoes, carrots, lettuce, cabbage and onion.
Example 1: Identification and acquisition of the ZmTPP1 gene
The first vascular plant trehalose-6-phosphate phosphatase genes were cloned
from
Arabidopsis thaliana by complementation of a yeast tps2 deletion mutant (Vogel
et al. 1998).
The genes designated AtTPPA and AtTPPB (GenBank accessions AF007778 and
AF007779)
were shown at that time to have trehalose-6-phosphate phosphatase activity.
The AtTPPA
and AtTTPB protein sequences were used in TBLASTN queries of maize and rice
sequence
databases. Sequence alignments organized the hits into individual genes. Fig.
2A, is a cartoon
depicting the alignment that defines ZinT6PP-1. Three maize and two rice T6PP
homologs
were identified. The cDNA sequences corresponding to the predicted protein
sequence for
each gene--ZmT6PP-1, -2 and -3 and OsT6PP-1 and -2-- are depicted by SEQ. ID
NOS. 1, 2,
3, 4 and 5, respectively. These T6PPs are shown in global alignment the
Arabidopsis T6PPs
Page 14
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
in Figure 3. The relationship between each protein to the others is further
analyzed using a
phylogenetic tree (Fig. 4A) and a similarity/divergence table (Fig. 4B).
Results suggest that
ZmT6PP-1 is the likely maize homolog of AtTPPA and ZmT6PP-2 is the likely
maize
homolog of AtTPPB. The ZmT6PP-1 gene was targeted for inactivation because the
EST
data show it is expressed in a pattern consistent with AtT6PPA. However, the
EST data are
limited due to unequal tissue representation among the maize EST libraries. To
compensate,
the OsT6PP-1 eDNA sequence was used to query Expression Profiling data. The
results, in
Figure 5, show the OsT6PP-1 is expressed at a relatively low level in most
tissues, which
agrees with the data for AtT6PPA (Vogel et al., 1998).
A partial ZmT6PP-1 cDNA (SEQ ID NO. 13) was amplified from a maize mixed
tissue cDNA library in two steps (Fig. 6). The library was cloned in the Notl
and SaII
restriction sites of the Invitrogen vector pCMVSPORT6. A first fragment
referred to as
T6PP1 was produced in a 50 L reaction mixture consisting of 1 L maize cDNA
library,
200 M dNTPs (dATP, dCTP, dGTP, TTP), 1 L 20 M oligonucleotide primer ZmTPP-
lb
(5'-TTCTCCCTATCTATGTTGGAG-3') (SEQ ID NO. 19), 1 L 20 M oligonucleotide
primer ZmTPP-2 (5'-CGCAACACAGTGAAACACTAGAAGG-3') (SEQ ID NO. 20), 1 L
lOX Expand High Fidelity buffer and 1 L Expand High Fidelity polymerase
(Roche
Diagnostics, Cat. No. 1 759 078). The thermocycling program was 94 C for 2
minutes
followed by 40 cycles of (94 C for 15 seconds, 58 C for 30 seconds, 68 C for
1.0 minute)
followed by 68 C for 5.0 minutes.
A second fragment, referred to as T6PP2 (SEQ ID NO. 14), was produced in a 50
L
reaction mixture consisting of 1 L maize eDNA library, 200 M dNTPs, 1 L 20
M
oligonucleotide primer ZmTPP-2r (5'-CCTTCTAGTGTTTCACTGTGTTGCG-3') (SEQ ID
NO. 21), 1 L 20 M oligonucleotide primer psport-forward (5'-
GCCAGTGCCTAGCTTATAATACG-3') (SEQ ID NO. 22), 1 L lOX Expand High
Fidelity buffer and 1 L Expand High Fidelity polymerase (Roche Diagnostics,
Cat. No. 1
759 078). The thermocycling program was 94 C for 2 minutes followed by 40
cycles of
(94 C for 15 seconds, 58 C for 30 seconds, 68 C for 1.0 minute) followed by 68
C for 5.0
minutes.
The T6PP1 and T6PP2 fragments were joined using the splicing by overlap
extension
PCR method. The 50 L reaction mixture consisted of 2 L T6PP1 reaction mix, 2
L
T6PP2 reaction mix, 200 M dNTPs, 1 L 20 M oligonucleotide primer ZmTPP-lb,
1 L
Page 15
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
20 M oligonucleotide primer psport-forward, 1 L lOX Expand High Fidelity
buffer and 1
L Expand High Fidelity polymerase (Roche Diagnostics, Cat. No. 1 759 078). The
thermocycling program was 5 cycles of (94 C for 30 seconds, 68 C for 1.0
minute) followed
by 35 cycles of (94 C for 30 seconds, 58 C for 30 seconds, 68 C for 1.0
minute) followed by
68 C for 7.0 minutes. Cloned the 0.8 kb DNA product, encoding the ZmT6PP-1
fragment,
with the TOPO TA cloning kit for sequencing (Invitrogen, Cat. No. K4575-01).
2.0 L of the
reaction mix was transformed into 50 L Top10 competent cells (Invitrogen,
Cat. No.
C4040-03). The pCR-4-TOPO-ZmT6PP-NS recombinants containing the ZmT6PP-1
fragment were identified by digesting 5 L pCR-4-TOPO-ZmT6PP-NS miniprep DNA
(prepared using the QlAprep Spin Miniprep procedure from Qiagen, Cat. No.
27106) with
EcoRl (New England Biolabs) in a 20 L reaction containing 2 g BSA and 2 L l
OX EcoRl
restriction endonuclease buffer (New England Biolabs). The reaction was
incubated at 37 C
for 2 hours then pCR-4-TOPO-ZmT6PP-NS (EcoRI) products were resolved on 1% TAE
agarose. The pCR-4-TOPO-ZmT6PP-NS clones were sequenced using the ABI PRISM
dye
terminator cycle sequencing kit (Perkin Elrner). The pCR-4-TOPO-ZmT6PP-NS map
is
shown in Fig. 7.
Example 2: Construction of the Rab17 Expression Cassette
An expression cassette based on the maize Rab 17 gene was discovered to be
drought
inducible (Vilardell et al., 1990) in vegetative tissue and developmentally
expressed in
maturing seeds (Vilardell et al., 1991). One embodiment of the present
invention is to provide
a nucleic acid construct that comprises a promoter that is drought inducible
in vegetative
tissue operatively linked to a nucleic acid molecule, wherein when expressed
in a plant cell
the nucleic acid molecule is capable of reducing the expression of an
endogenous T6PP gene
of a plant cell.
The invention includes a nucleic acid construct having a promoter derived from
the 5'
region of a Rab 17 gene and that exhibits promoter activity in plants.
The invention also includes the nucleic acid construct comprising all or part
of a
nucleic acid sequence encoding T6PP-RNAi, wherein the Rab17 promoter drives
the T6PP-
RNAi expression cassette to create a conditional block in the trehalose
pathway. The T6PP-
RNAi expression cassette of the invention re-directs carbohydrate to sucrose
or starch
synthesis in reproductive tissue and in vegetative tissue during periods of
water deficit.
Page 16
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
The nucleic acid construct of the invention further includes both the 5' and
3'-regions
derived from the maize Rab 17 gene, wherein the regions exhibit promoter and
terminator
activity in plants, respectively. In one embodiment of the invention, both the
5' and 3'
regions were used in the nucleic acid construct to assure that the transgene
expression mimics
maize Rabl7 expression. To begin, eDNA sequence was gathered, aligned and
annotated.
The published gDNA sequence (GenBank Accession No. X159940) was used to query
public
and proprietary databases. The Rabl7 cDNA sequence was broken into exons and
aligned
with Rab l 7 gDNA to provide the requisite annotation and map the translation
start and stop
codons onto the gDNA.
The ZmRab 17 promoter was amplified from maize gDNA in a 50 L reaction
mixture
consisting of 100 ng maize gDNA, 200 M dNTPs, 1 L 20 M oligonucleotide
primer
000426A (5'-GGTACCAAGCTTAATTCGCCCTTATAAACT-3') (SEQ ID NO. 33), 1 L
M oligonucleotide primer 000426B (5'-
ACTGCAGTTAGATCTAGTCTTCGTGCTTGTGT-3') (SEQ ID NO. 24), 1 L 10X
15 Expand High Fidelity buffer and 1 L Expand High Fidelity polymerase. The
thermocycling
program was 94 C for 2 minutes followed by 40 cycles of (94 C for 15 seconds,
58 C for 30
seconds, 68 C for 2.0 minutes) followed by 68 C for 5.0 minutes. The 0.6 kb
DNA product
encoding the ZmRabl7 promoter was cloned with the TOPO TA cloning kit for
sequencing
following manufactures' instructions. 2.0 L of the reaction mix was
transformed into 50 L
20 ToplO competent cells following manufactures' instructions. pCR-4-TOPO-
pZmRabl7
recombinants containing the ZmRab 17 promoter were identified by digesting 5
L pCR-4-
TOPO-pZmRabl7 miniprep DNA with EcoRI in a 20 L reaction containing 2 g BSA
and
2 L lOX EcoRl restriction endonuclease buffer. The reaction was incubated at
37 C for 2
hours then pCR-4-TOPO-pZmRab 17 (EcoRI) products were resolved on 1% TAE
agarose.
The pCR-4-TOPO-pZmRab17 clones were sequenced using the ABI PRISM dye
terminator
cycle sequencing kit. The pCR-4-TOPO-pZmRab 17 sequence is given as SEQ ID NO.
11.
The ZmRabl7 terminator was amplified from maize gDNA in a 50 L reaction
mixture consisting of 100 ng maize gDNA, 200 M dNTPs, 1 L 20 M
oligonucleotide
primer 000426C (5'-ACTGCAGTACGTGGCTGTGCTGTG-3') (SEQ ID NO. 25), 1 L 20
M oligonucleotide primer 000426D (5'-CGGTACCAATTGCATGCGTCTAATCA-3')
(SEQ ID NO. 26), 1 L lOX Expand High Fidelity buffer and 1 L Expand High
Fidelity
poly.merase. The thermocycling program was 94 C for 2 minutes followed by 40
cycles of
Page 17
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
(94 C for 15 seconds, 58 C for 30 seconds, 68 C for 2.0 minutes) followed by
68 C for 5.0
minutes. The 0.6 kb DNA product encoding the ZmRab17 terminus was cloned with
the
TOPO TA cloning kit. 2.0 L of the reaction mix was transformed into 50 L
Top10
competent cells. pCR-4-TOPO-tZmRabl7 recombinants containing the ZmRab17
terminator
were identified by digesting 5 L pCR-4-TOPO-tZinRabl7 miniprep DNA with EcoRI
in a
20 L reaction containing 2 g BSA and 2 L lOX EcoRI restriction endonuclease
buffer.
The reaction was incubated at 37 C for 2 hours then pCR-4-TOPO-tZmRabl7
(EcoRI)
products were resolved on 1% TAE agarose. The pCR-4-TOPO-tZmRabl7 clones were
then
sequenced. The pCR-4-TOPO-tZmRabl7 sequence is given as SEQ ID NO. 12.
pZmRabl7 and tZmRabl7 were amplified from pCR-4-TOPO-pZxnRabl7 and pCR-
4-TOPO-tZmRabl7, respectively, as described above. The PCR products were
purified with
the MinElute PCR purification kit (Qiagen, Cat. No. 28004), digested in 50 L
reactions
containing 5 g BSA, 5 L lOX restriction endonuclease buffer 1, 2.5 L Kpnl
and 2.5 L
Pstl (New England Biolabs). The reactions were incubated at 37 C for more than
6 hours,
then at 70 C for 20 minutes. The 0.5 kb pRAB17 (KpnUPstl) and 0.7 kb tZmRab17
(KpnI/Pstl) DNA were resolved on 1.0% TAE agarose and the bands were excised.
The DNA
and extracted and recovered using the QlAquick Gel extraction kit (Qiagen,
Cat. No.28704).
Each fragment was eluted in 40 L ddH2O.
40 L of pRAB17 (KpnI/PstI) was ligated to 40 L tZmRabl7 (KpnI/PstI) in a 100
L reaction containing 10 L lOX T4 DNA ligase buffer (New England Biolabs) and
10 L
T4 DNA ligase (400 Units/ L- New England Biolabs). The ligation reaction was
incubated
more than 8 hours at 16 C. The ligation was precipitated with 20 g glycogen,
0.3 M
CH2COONa (pH 5.2) and 2.5 volumes ethanol at -20 C for more than 2 hours. The
ligation
products were recovered by micro centrifugation, washed with 70% ethanol,
dried under
vacuum and resuspended in 14 L ddH2O.
The ligation products were digested in a 20 L reaction containing 2 g BSA, 2
L
lOX restriction endonuclease buffer 1 and 2 L KpnI. The reaction was
incubated at 37 C for
more than 6 hours, then at 70 C for 20 minutes. The resolved DNA was digested
on 1.0%
TAE agarose and excised the 1.3 kb pZrnRabl7-tZmRab17 (Kpnl) band. The
pZmRab17-
tZmRab17 (Kpnl) DNA was extracted and recovered it using the QlAquick Gel
extraction kit
(Qiagen, Cat. No.28704). The recovered pZmRabl7-tZmRabl7 (Kpnl) DNA was
precipitated with 20 g glycogen, 0.3 M CH2COONa (pH 5.2) and 2.5 volumes
ethanol at -
Page 18
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
20 C for more than 2 hours. The pZmRab 1 7-tZmRab 17 (Kpnl) DNA was recovered
by micro
centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in
5 L
ddHZO.
2 g of pBluescript II (KS-)--aka pBS--DNA (QlAprep Spin Miniprep procedure
from Qiagen, Cat. No. 27106) was digested in a 20 L reaction containing 2 g
BSA, 2 L
l OX restriction endonuclease buffer 1 and 2 L Kpnl. Incubated the reaction
at 37 C for more
than 6 hours, then at 70 C for 20 minutes. 1 L 10X restriction endonuclease
buffer 1, 1 L 1
Unit/ L calf-intestinal alkaline phosphatase and 8 L ddHZO were then added to
the reaction
and incubated at 37 C for 30 minutes. The pBS (KpnI/CIP) DNA was resolved on
1.0% TAE
agarose and the 3.0 kb pBS (KpnI/CIP) band was excised. The pBS (Kpnl/CIP) DNA
was
recovered and precipitated with 20 g glycogen, 0.3 M CH2COONa (pH 5.2) and
2.5
volumes ethanol at -20 C for more than 2 hours. The pBS (KpnI/CIP) DNA was
recovered by
micro centrif-ugation, washed with 70% ethanol, dried under vacuum and
resuspended in 5 L
ddH2O.
4.0 L of pZmRab17-tZmRab17 (Kpnl) was ligated to 4.0 L pBS (Kpnl/CIP) in a
10
L reaction containing 1 L 10X T4 DNA ligase buffer and 1 L T4 DNA ligase
(400
Units/ L) and incubated more than 8 hours at 16 C. 5.0 L of ligation mix was
transformed
into 50 L Top10 competent cells. pBS-pZmRab17/tZmRab17 recombinants were
verified
by digesting 2 L pBS-pZmRab17/tZmRab17 miniprep DNA with 1.0 L Kpnl in 10 L
reactions containing 1 g BSA and 1 L 10X restriction endonuclease buffer 1.
The reactions
were incubated at 37 C for 2 hours then pBS-pZmRabl7/tZmRabl7 (KpnI) DNA was
resolved on 1% TAE agarose. The pBS-pZmRab 17/tZmRab 17 clones were then
sequenced.
The pBS-pZmRab17/tZmRab17 sequence was designated as pNOV3010 (SEQ ID NO. 17).
The pNOV3010 map is shown in Fig. 8.
pNOV3010 lacks flexibility to clone genes of interest. Additional restriction
sites
were added at the pZmRab17/tZmRab17 junction to increase flexibility by
ligating a
synthetic adapter to the vector. The adapter (Synthetic Adaptor I) was made by
combining 40
L of 50 M oligonucleotide 000809A (5'-PGATCGGCGCGCCTGTTAATTAATTGC
GGCCGC-3') (SEQ ID NO. 27), 40 L of 50 M oligonucleotide 000809B (5'-
PGATCGCGGCCGCAATTAATTAACAGGCGCGCC-3') (SEQ ID NO. 28)--where P is a
5'-phosphate group--in a 100 L mixture that is 25 mM in Tris-HC1 (pH 8.0) and
10 mM in
Page 19
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
MgC12. The mixture was boiled for 5 minutes, removed from heat and naturally
cooled to
room temperature (about 60 minutes). This yields a 20 M Synthetic Adaptor I
solution.
pNOV3010 was prepared by digesting 14 L of miniprep pNOV3010 DNA with 2 L
Bg1II in a 20 L reaction containing 2 g BSA and 2 L lOX restriction
endonuclease buffer
3. The reaction was incubated at 37 C for 6 hours, then at 70 C for 20
minutes. 1 L 10X of
the restriction endonuclease buffer 3, 1 L 1 Unit/ L calf-intestinal alkaline
phosphatase
(CIP-New England Biolabs) and 8 L ddH2O was added to the reaction and then
incubated at
37 C for 30 minutes. pNOV3010 (Bg1II/CIP) digestion products were resolved on
1% TAE
agarose, the pNOV3010 (Bg1II/CIP) DNA band was extracted and recovered. The
pNOV3010 (BgIII/CIP) DNA was then precipitated with 20 g glycogen, 0.3 M
CH2COONa
(pH 5.2) and 2.5 volumes ethanol at -20 C for more than 2 hours. pNOV3010
(BgIII/CIP)
DNA was recovered by micro centrifugation, washed with 70% ethanol, dried
under vacuum
and resuspended in 5 L ddH2O.
4.5 L Synthetic Adaptor I was ligated to 2.5 L pNOV3010 (Bg1II/CIP) in a 10
L
reaction containing 1 L lOX T4 DNA ligase buffer (New England Biolabs) and 1
L T4
DNA ligase (400 U/ L- New England Biolabs) and incubated more than 8 hours at
16 C. 4
L of ligation was transformed into 50 L XL-1 supercompetent cells
(Stratagene, Cat. No.
200236). The recombinants were verified by digesting 5 L miniprep DNA in a 20
L
reaction containing 2 g BSA, 2 L 10X restriction endonuclease buffer 4 and 1
L AscI.
The products were resolved on 1.0% TAE agarose. The finished clone was
designated as
pNOV3232 (SEQ ID NO. 7). The map for pNOV3232 is shown in Fig. 9.
Example 3: Construction of the T6PP-RNAi Expression Cassette
The primers used to produce the T6PP-RNAi gene are shown in Fig. 6. Two PCR
fragments were produced from pCR-4-TOPO-ZmT6PP-NS template (Fig. 7). Fragment
1
(SEQ ID NO. 15) contains a portion of the CMVpSPORT6 vector that functions as
the loop
in the T6PP-RNAi gene product. High-fidelity PCR was used to amplify Fragment
1 from
pCR-4-TOPO-ZmT6PP-1 in a 50 L reaction mixture consisting of 1 L pCR-4-TOPO-
ZmT6PP-NS miniprep DNA, 200 M dNTPs, 20 M oligonucleotide primer 001L (5'-
ATAGGCGCGCCATGTTGGAGATGACAGAACAGATC-3') (SEQ ID NO. 38), 20 M
oligonucleotide primer 002R (5'-ATACCGCGGGGACTGTCCTGCAGGTTTAAACG-3')
(SEQ ID NO. 39), 5 L lOX cloned Pfu buffer and 2.5 Units of Pfuturbo DNA
polymerase
Page 20
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
(Stratagene, Cat. No. 600252) in a final volume of 50 qL. The thermocycling
program was
95 C for 30 seconds then 40 cycles of (95 C for 10 seconds, 65 C for 60
seconds, 72 C for 2
minutes) then 72 C for 10 minutes. The Fragment 1 DNA product was recovered
and the
DNA was ethanol precipitated with glycogen carrier. The Fragment 1 DNA was
recovered by
micro centrifugation, washed with 70% ethanol, dried under vacuum and
resuspended in 14
L ddH2O.
Fragment 2 is given as SEQ ID NO. 16. High-fidelity PCR was used to amplify
Fragment 2 from pCR-4-TOPO-ZmT6PP-NS in a 50 L reaction mixture consisting of
1 L
pCR-4-TOPO-ZmT6PP-NS miniprep DNA, 200 M dNTPs, 20 M oligonucleotide primer
003L (5'-GCGTTAATTAAATGTTGGAGATGACAGAACAGATC-3') (SEQ ID NO. 40),
M oligonucleotide primer 004R (5'-
ATACCGCGGCGCAACACAGTGAAACACTAGAAGG-3') (SEQ ID NO. 41), 5 L lOX
cloned Pfu buffer and 2.5 Units of Pfuturbo DNA polymerase in a final volume
of 50 L. The
thermocycling program was 95 C for 30 seconds then 40 cycles of (95 C for 10
seconds,
15 65 C for 60 seconds, 72 C for 2 minutes) then 72 C for 10 minutes. The
Fragment 2 DNA
product was recovered and the DNA was ethanol precipitated with glycogen
carrier. The
Fragment 2 DNA was recovered by micro centrifugation, washed with 70% ethanol,
dried
under vacuum and resuspended in 14 L ddH2O.
Fragment 1 and Fragment 2 DNA were digested, separately, in a 20 L reaction
20 mixtures containing 2 g BSA, 2 L lOX restriction endonuclease buffer and
2 L SacII.
The digests were incubated at 37 C for 2 hours. The enzyme was inactivated by
incubation
for 15 minutes at 65 C. 4.0 L of Fragment 1(SacII) DNA was ligated to 4.0 L
Fragment 2
(SacII) DNA in a 10 L ligation mixture containing 1 L lOX T4 DNA ligase
buffer and 1
L T4 DNA ligase (400 Units/ L), which was incubated more than 24 hours at 16
C. The
enzyme was inactivated by incubation for 15 minutes at 65 C. This yielded the
T6PP-RNAi
gene (SEQ ID NO. 6).
The T6PP-RNAi gene was digested in a 20 L reaction mixture containing 2 g
BSA,
2 L l OX restriction endonuclease buffer, 1 L PacI and 1 L Ascl. The digest
was incubated
at 37 C for 2 hours. The ZmRabl7 expression cassette plasmid, pNOV3232 (Fig.
9) (SEQ ID
NO. 7), was digested in a 20 L reaction mixture containing 2 g BSA, 2 L lOX
restriction
endonuclease buffer, 1 L PacI and 1 L AscI. Resolved the T6PP-RNAi gene
(AscIlPacI)
and pNOV3232 (AscI/Pacl) digestion products on 1% TAE agarose, extracted the
1136 bp
Page 21
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
T6PP-RNAi gene (AscIlPacl) and 4262 bp pNOV3232 (AscI/Pacl) DNA bands and
recovered the DNAs. The recovered DNAs were precipitated with 20 g glycogen,
0.3 M
CH2COONa (pH 5.2) and 2.5 volumes ethanol at -20 C for more than 2 hours. The
DNAs
were recovered by micro centrifugation, washed with 70% ethanol, dried under
vacuum and
resuspended each in 5 L ddHaO.
4.0 L of the T6PP-RNAi gene (AscI/Pacl) was ligated to 4.0 L pNOV3232
(AscI/Pacl) in a 10 L reaction containing 1 L lOX T4 DNA ligase buffer and 1
L T4
DNA ligase (400 Units/ L) and incubated more than 8 hours at 16 C. 5.0 L of
the ligation
mix was transformed into 50 L Top 10 competent cells. pRab 17-T6PP-RNAi
recombinants
were verified by digesting 2 L pRab 17-T6PP-RNAi miniprep DNA with 1.0 L
Kpnl in 10
L reactions containing 1 g BSA and 1 L lOX restriction endonuclease buffer
1. The
reactions were incubated at 37 C for 2 hours then the pRabl7-T6PP-RNAi (KpnI)
DNA was
resolved on 1% TAE agarose. The pRabl7-T6PP-RNAi DNA sequence was verified and
the
construct designated SEQ ID NO. 8. The pRabl7-T6PP-RNAi expression cassette
map is
shown in Fig. 10.
Example 4: Construction of a modified Rab 1 7-T6PP-RNAi expression cassette
To improve trait performance the maize Rab 17 promoter sequence was modified
to
incorporate the complete Rabl7 5'-UTR, the first intron from the maize Rabl7
gene and
about 15 nucleotides of the second maize Rabl7 exon. This modified 5'-
regulatory sequence
of the invention was designed to replace the Rab 17 promoter in pNOV3 240.
Specific changes
made in the Rabl7 5'-regulatory sequence (Seq Id. No. 7) to construct the
modified promoter
are: (1) The 'G' at nucleotide 604 was changed to 'C', (2) The 'A' at
nucleotide 665 was
changed to 'T', (3) The 'A' at nucleotide 718 was changed to 'T', (4) The 'A'
at nucleotide 748
was changed to 'T' and (5) The 'G' at nucleotide 783 was changed to 'C'.
Finally, to facilitate
recombinant DNA procedures, the PacI and Ascl restriction endonuclease sites
were added
after the '...TCGGAGGAC' nucleotides of Rab 17 exon 2.
The maize Rabl7 5'-regulatory sequence was amplified from gDNA using high-
fidelity PCR. A 50 L reaction mixture contains 100 ng maize gDNA (Cv. 6N615),
200 M
dNTPs, 1 L 20 M prRabl7-F3 (5'-TCAAAACTATAGTATTTTAAAATTGC-3') (SEQ ID
NO. 29), 1 L 20 M prRabl7-R3 (5'-GTCCTCCGACTTAAACACG-3') (SEQ ID NO. 30),
5 L lOX Expand High Fidelity buffer and 1 L Expand High Fidelity polymerase.
The
Page 22
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
thermocycling program is 95 C for 2 minutes followed by 40 cycles of (94 C for
15 seconds,
68 C for 7.5 minutes) followed by 68 C for 10 minutes. The Rabl7 5'-regulatory
sequence
was cloned with the TOPO XL PCR cloning kit. pCR-XL-TOPO-Rabl7-gDNA
recombinants were identified by digesting 5 L pCR-XL-TOPO-Rabl7-gDNA miniprep
DNA in 20 L reactions containing 2 g BSA and 2 L lOX EcoRI restriction
endonuclease
buffer. The reactions were incubated at 37 C for 2 hours and the pCR-XL-TOPO-
Rabl7-
gDNA (EcoRI) products are resolved on 1% TAE agarose. The pCR-XL-TOPO-Rabl7-
gDNA clone was then sequenced.
The modified Rab17 promoter required several sequence changes. First,
potential
translation initiation codons were eliminated. First, potential translation
initiation codons
were eliminated using the Stratagene QuikChange Multi Site-Directed
Mutagenesis Kit (Cat.
No. 200513). The primers that were used to make the changes are:
RabATG1 (5'-CGTGCAAGCATCATCGAGTACGGTCAGCAG-3')(SEQ ID NO. 31),
RabATG2 (5'-CGCCACGGGCCTTGTCGACCAGTACG-3') (SEQ ID NO. 32),
RabATG3 (5'-GCACCGGCGGCTTGAGGCACGGCA-3') (SEQ ID NO. 33),
RabATG4 (5'-CCACCGGCGGCTTGGGCCAGCTGG-3') (SEQ ID NO. 34), and
RabATG5 (5'-GGCGCTGGCATCGGTGGCGGGCAG-3') (SEQ ID NO. 35).
High-fidelity PCR was used to attach restriction endonuclease sites to the
modified
Rabl7 promoter. The 50 L reaction mixture contained 1 L pCR-XL-TOPO-Rabl7-
gDNA
mini-prep DNA, 300 M dNTPs, 1 L 20 M Ascl-Rab17 (5'-
TTAATTAAGGCGCGCCTTCAAAACTATAGTATTTTAAAATTGC-3') (SEQ ID NO.
36), 1 L 20 M Rab17-Paci-Asc-3 (5'-
TTGGCGCGCCTTAATTAAGTCCTCCGACTTAAACAC-3') (SEQ ID NO. 37), 5 L lOX
Proofstart High Fidelity buffer, 10 L Q solution and 2 L Proofstart High
Fidelity
polymerase. The thermocycling program was 95 C for 5 minutes followed by 45
cycles of
(94 C for 30 seconds, 50 C for 1 minute, 72 C for 4 minutes) followed by 72 C
for 15
minutes. The PCR product was purified and digested in 50 L reactions
containing 5 g
BSA, 5 L IOX restriction endonuclease buffer 4 and 5.0 L Ascl. The reaction
was
incubated at 37 C for more than 6 hours, then at 70 C for 20 minutes. The 1.0
kb pRab 17-
mod (Ascl) was resolved on 1.0% TAE agarose and the band was excised. The DNA
was
extracted and recovered. The recovered pRab17-mod (Ascl) DNA was ethanol
precipitated
with glycogen carrier. The pRab17-mod (Ascl) DNA fragment was recovered by
micro
Page 23
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in
5 L
ddHZO.
2 g of pNOV3240 miniprep DNA was digested in a 20 L reaction mixture
containing 2 g BSA, 2 L lOX restriction endonuclease buffer 4 and 2 L AscI.
The
reaction mixture was incubated at 37 C for more than 6 hours, then at 70 C for
20 minutes.
Then 1 L restriction endonuclease buffer 4, 1 L 1 Unit/ L calf-intestinal
alkaline
phosphatase and 8 L ddHaO were added to the reaction mixture and incubated at
37 C for
30 minutes. The pNOV3240 (AscI/CIP) DNA was resolved on 1.0% TAE agarose and
the 11
kb pNOV3240 (AscUCIP) band was excised. The pNOV3240 (AscI/CIP) DNA was
extracted
and recovered. The recovered pNOV3240 (Ascl/CIP) DNA was ethanol precipitated
with
glycogen carrier. The pNOV3240 (AscI/CIP) DNA was recovered by micro
centrifugation,
washed with 70% ethanol, and dried under vacuum and resuspended in 5 L ddH2O.
4.0 L pRabl7-mod (Ascl) was ligated to 4.0 L pNOV3240 (AscI/CIP) in a 10 L
ligation mixture containing 1 L lOX T4 DNA ligase buffer and 1 L T4 DNA
ligase (400
Units/ L). The ligation mixture was incubated for more than 8 hours at 16 C.
5.0 L of
ligation mixture was transformed into 50 L ToplO competent cells. The
modified-
pNOV3240 recombinants were verified by digesting 2 L modified-pNOV3240
miniprep
DNA with 1 L SaII in 10 L reactions containing 1 g BSA and 1 L of the
appropriate
10X restriction endonuclease buffer. Digests were incubated at 37 C for 2
hours then
resolved on 1% TAE agarose. The positive modified-pNOV3240 recombinants were
sequenced. The nucleotide sequence of the modified Rabl7-T6PP-RNAi expression
cassette
is depicted in SEQ ID NO. 18.
Example 5: Construction of the Binary Agrobacterium turnefaciens Plasmid
2 g of pNOV2117 (Fig. 11A) was digested in a 20 L reaction containing 2 g
BSA,
2 L lOX restriction endonuclease buffer 1 and 2 L Kpnl. The reaction was
incubated at
37 C for more than 6 hours, then at 70 C for 20 minutes. 1 L 10X restriction
endonuclease
buffer 1, 1 L 1 Unit/ L calf-intestinal alkaline phosphatase (CIP) and 8 L
ddH2O was then
added and incubated at 37 C for 30 minutes. 2 g pRabl7-T6PP-RNAi miniprep DNA
was
digested in a 20 L reaction containing 2 g BSA, 2 L lOX restriction
endonuclease buffer
1 and 2 L KpnI. The reaction was incubated at 37 C for more than 6 hours.
Page 24
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
The digested plasmid DNAs, pNOV2117 (KpnI/CIP) and pRabl7-T6PP-RNAi
(KpnI), were resolved on 1.0% TAE agarose and the 9.2 kb pNOV2117 (KpnI/CIP)
and the
2.5 kb pRabl7-T6PP-RNAi (Kpnl) DNA bands were excised. The pNOV2117 (KpnI/C]P)
and pRab17-T6PP-RNAi (KpnI) DNAs were extracted and then precipitated with 20
g
glycogen, 0.3 M CH2COONa (pH 5.2) and 2.5 volumes ethanol at -20 C for more
than 2
hours. The pNOV2117 (KpnI/CIP) and pRabl7-T6PP-RNAi (Kpnl) DNA fragments were
recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum
and
resuspended each in 5 L ddHaO.
4.0 L pNOV2117 (Kpnl/CIP) was ligated to 4.0 L pRab 1 7-T6PP-RNAi (Kpnl) in
a
10 L reaction containing 1 L lOX T4 DNA ligase buffer and 1 L T4 DNA ligase
(400
U/ L) and incubated more than 8 hours at 16 C. 5.0 L of ligation mix was
transformed into
50 L Top10 competent cells. pNOV2117-pRab17-T6PP-RNAi recombinants were
identified
by digesting 7.5 L pNOV2117-pRabl7-T6PP-RNAi miniprep DNA with 1.0 L KpnI in
10
L reactions containing 1 g BSA and 1 L lOX restriction endonuclease buffer
1. The
reactions were incubated at 37 C for 2 hours and then pNOV2117-pRabl7-T6PP-
RNAi
(Kpnl) DNA products were resolved on 1% TAE agarose. The pNOV2117-pRab17-T6PP-
RNAi junction sequence was verified and it was designated as pNOV3240. Its map
is shown
in Fig. 11 B.
Example 6: Maize Transformation
Numerous transformation vectors available for plant transformation are known
to
those of ordinary skill in the plant transformation arts, and the genes
pertinent to this
invention can be used in conjunction with any such vectors. The selection of
vector depends
upon the preferred transformation technique and the target species for
transformation. For
certain target species, different antibiotic or herbicide selection markers
are preferred.
Selection markers used routinely in transformation include the nptll gene,
which confers
resistance to kanamycin and related antibiotics (Vieira and Messing, 1982;
Bevan et al.,
1983), the bar gene, which confers resistance to the herbicide
phosphinothricin (White et al.,
1990; Spencer et al., 1990), the hph gene, which confers resistance to the
antibiotic
hygromycin (Blochlinger and Diggelmann, 1984), the naanA gene, which allows
for positive
selection in the presence of mannose (Miles and Guest, 1984; Bojsen et al.,
1998), and the
Page 25
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
dhfr gene, which confers resistance to methotrexate (Bourouis and
Bruno,1983), and the
EPSPS gene, which confers resistance to glyphosate (Shah et al., 1990; 1993).
Many vectors are available for transformation using Agrobacterium
turnefaciens.
These typically carry at least one T-DNA border sequence and include vectors
such as
pBIN19 (Bevan, 1984). Typical vectors suitable for Agrobacterium
transformation include
the binary vectors pCJB200 and pCIB2001, as well as the binary vector pCIB10
and
hygromycin selection derivatives thereof. (See, for example, Ligon et al.,
1997). Other
vectors are available for non Agrobacterium tumefaciens transformation.
Transformation
without the use of Agrobacterium tumefaciens circumvents the requirement for T-
DNA
sequences in the chosen transformation vector and consequently vectors lacking
these
sequences are utilized in addition to vectors such as the ones described above
which contain
T-DNA sequences. Transformation techniques that do not rely on Agrobacterium
include
transformation via particle bombardment, protoplast uptake (e.g. PEG and
electroporation)
and microinjection. The choice of vector depends largely on the preferred
selection for the
species being transformed. Typical vectors suitable for non-Agrobacterium
transformation
include pCIB3064, pSOG19, and pSOG35. (See, for example, Ligon et al., 1997).
Once the DNA sequence of interest is cloned into an expression system, it is
transformed into a plant cell. Methods for transformation and regeneration of
plants are well
known in the art. For example, Ti plasmid vectors have been utilized for the
delivery of
foreign DNA, as well as direct DNA uptake, liposomes, electroporation,
microinjection, and
microprojectiles. In addition, bacteria from the genus Agrobacterium can be
utilized to
transform plant cells.
Transformation techniques for dicotyledons are well known in the art and
include
Agrobacterium-based techniques and techniques that do not require
Agrobacterium. Non-
Agrobacterium techniques involve the uptake of exogenous genetic material
directly by
protoplasts or cells. This is accomplished by PEG- or electroporation-mediated
uptake,
particle bombardment-mediated delivery, or microinjection. In each case the
transformed
cells are regenerated to whole plants using standard techniques known in the
art.
Transformation of most monocotyledon species has now also become routine.
Preferred techniques include direct gene transfer into protoplasts using PEG
or
electroporation techniques, particle bombardment into callus tissue, as well
as
Agf=obacterium-mediated transformation.
Page 26
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Plants from transformation events are grown, propagated and bred to yield
progeny
with the desired trait, and seeds are obtained with the desired trait, using
processes well
known in the art
Once a nucleic acid sequence of the invention has been cloned into an
expression
system, it is transformed into a plant cell. The receptor and target
expression cassettes of the
present invention can be introduced into the plant cell in a number of art-
recognized ways.
Methods for regeneration of plants are also well known in the art. For
example, Ti plasmid
vectors have been utilized for the delivery of foreign DNA, as well as direct
DNA uptake via
electroporation, microinjection, and microprojectiles. In addition, bacteria
from the genus
Agrobactenium can be utilized to transform plant cells. Below are descriptions
of
representative techniques for transforming both dicotyledonous and
monocotyledonous
plants, as well as a representative plastid transformation technique.
Transformation techniques for dicotyledons are well known in the art and
include
Agrobacterium-based techniques and techniques that do not require
Agrobacterium. Non-
Agrobacterium techniques involve the uptake of exogenous genetic material
directly by
protoplasts or cells. This can be accomplished by PEG- or electroporation-
mediated uptake,
particle bombardment-mediated delivery, or microinjection. Examples of these
techniques are
described (Paszkowski et al., 1984; Potrykus et al., 1985; Reich et al., 1986;
Klein et al.,
1987). In each case the transformed cells are regenerated to whole plants
using standard
techniques known in the art.
Agrobactenium-mediated transformation is a preferred technique for
transformation of
dicotyledons because of its high efficiency of transformation and its broad
utility with many
different species. Agrobacteniurn transformation typically involves the
transfer of the binary
vector carrying the foreign DNA of interest (e.g. pCIB200 or pCIB2001) to an
appropriate
Agrobacterium strain. This may depend on the complement of Vir genes carried
by the host
Agrobacteriuin strain either on a co-resident Ti plasmid or on the chromosome
(e.g. strain
CIB542 for pCIB200 and pCIB2001 (Uknes et al., 1993)). The transfer of the
recombinant
binary vector to Agrobacterium is accomplished by a triparental mating
procedure using E.
coli carrying the recombinant binary vector, a helper E. coli strain which
carries a plasmid
such as pRK2013 and which is able to mobilize the recombinant binary vector to
the target
Agrobacterium strain. Alternatively, the recombinant binary vector can be
transferred to
Agrobacterium by DNA transformation (Hofgen and Willmitzer, 1988).
Page 27
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Transformation of the target plant species by recombinant Agrobacterium
usually
involves co-cultivation of the Agrobacterium with explants from the plant to
be transformed
and follows protocols well known in the art. Transformed tissue is regenerated
on selection
medium containing the antibiotic, herbicide or other compound that the
selectable marker,
present between the binary plasmid T-DNA borders, is designed to provide
resistance.
Another approach to transforming plant cells with a gene involves propelling
inert or
biologically active particles at plant tissues and cells. This technique is
disclosed in Sanford
et al. (1990; 1991; 1992). Generally, this procedure involves propelling inert
or biologically
active particles at the cells under conditions effective to penetrate the
outer surface of the cell
and afford incorporation within the interior thereof. When inert particles are
utilized, the
vector can be introduced into the cell by coating the particles with the
vector containing the
desired gene. Alternatively, the target cell can be surrounded by the vector
so that the vector
is carried into the cell by the wake of the particle. Biologically active
particles (e.g., dried
yeast cells, dried bacterium or a bacteriophage, each containing DNA sought to
be
introduced) can also be propelled into plant cell tissue.
Transformation of most monocotyledon species has now also become routine.
Preferred techniques include direct gene transfer into protoplasts using PEG
or
electroporation techniques, and particle bombardment into callus tissue.
Transformations can
be undertaken with a single DNA species or multiple DNA species (i.e. co-
transformation)
and both these techniques are suitable for use with this invention. Co-
transformation may
have the advantage of avoiding complete vector construction and of generating
transgenic
plants with unlinked loci for the gene of interest and the selectable marker,
enabling the
removal of the selectable marker in subsequent generations, should this be
regarded desirable.
However, a disadvantage of the use of co-transformation is the less than 100%
frequency
with which separate DNA species are integrated into the genome (Schocher et
al., 1986).
Several U.S. Patents describe techniques for the preparation of callus and
protoplasts
from an elite inbred line of maize, transformation of protoplasts using PEG or
electroporation, and the regeneration of maize plants from transformed
protoplasts (Tomes et
al., 1999; Dudits et al., 2001; Koziel et al., 2002). Gordon-Kamm et al.
(1990) and Fromm et
al. (1990) have published techniques for transformation of A188-derived maize
lines using
particle bombardment. Furthermore, Koziel et al. (1993, 2002) describe
techniques for the
transformation of elite inbred lines of maize by particle bombardment. This
technique utilizes
Page 28
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
immature maize embryos of 1.5-2.5 mm length excised from a maize ear 14-15
days after
pollination and a PDS-1000He Biolistics device for bombardment.
Transformation of rice can also be undertaken by direct gene transfer
techniques
utilizing protoplasts or particle bombardment. Protoplast-mediated
transformation has been
described for Japonica-types and Indica-types (Zhang et al., 1988; Shimamoto
et al., 1989;
Datta et al., 1990). Both types are also routinely transformable using
particle bombardment
(Christou et al., 1991). Furthermore, Gobel and Nakakido (1993) describe
techniques for the
transformation of rice via electroporation.
Horn et al. (1989) describe techniques for the generation, transformation and
regeneration of Pooideae protoplasts. These techniques allow the
transformation of Dactylis
and wheat. Furthermore, wheat transformation has been described by Vasil et
al. (1992) using
particle bombardment into cells of type C long-term regenerable callus, and
also by Vasil et
al. (1993) and Weeks et al. (1993) using particle bombardment of immature
embryos and
immature embryo-derived callus. A preferred technique for wheat
transformation, however,
involves the transformation of wheat by particle bombardment of immature
embryos and
includes either a high sucrose or a high maltose step prior to gene delivery.
Prior to
bombardment, 0.75-1.0 millimeter embryos are plated onto MS medium with 3%
sucrose
(Murashige and Skoog, 1962) and 3 mg/L 2,4-D for induction of somatic embryos,
which
proceeds in the dark. On the chosen day of bombardment, embryos are removed
from the
induction medium and placed onto the osmoticum (induction medium with sucrose
or
maltose added at the desired concentration, typically 15%). Embryos plasmolyze
for 2-3
hours, then they are bombarded. Although not critical, each target plate
usually contains
twenty embryos.
An appropriate gene-carrying plasmid (such as pCIB3064 or pSG35) is
precipitated
onto micrometer size gold particles using standard procedures. Each plate of
embryos is shot
with the DuPont Biolistics helium device using a burst pressure of -1000 psi
using a
standard 80 mesh screen. After bombardment, the embryos (still on osmoticum)
are placed
back into the dark to recover for about 24 hours. Then embryos are removed
from the
osmoticum and placed back onto induction medium where they stay for about a
month before
regeneration. Embryo explants with developing embryogenic callus are then
transferred to
regeneration medium (MS + 1 mg/L NAA, 5 mg/L GA), and further containing the
appropriate selection agent (10 mg/L basta in the case of pCIB3064 and 2 mg/L
methotrexate
in the case of pSOG35). After approximately one month, developed shoots are
transferred to
Page 29
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
larger sterile containers known as "GA7s" which contain half-strength MS, 2%
sucrose, and
the same concentration of selection agent.
Transformation of monocotyledons using Agrobactef=ium has also been described
(See, Hiei and Komari, 1994; 1997; and Negrotto et al., 2000) incorporated
herein by
reference.
The plasmid, pNOV3240, was introduced in Agrobacterium tumefaciens using
electroporation. Transformed Agrobacterium cells were used to transfer the
Rab17-T6PP-
RNAi expression cassette into the maize (Al88xHiTI) genome. The T-DNA enables
positive
identification of transformants via regeneration on media containing mannose.
Sixty-three
events were generated. Of these, Taqman analysis identified 15 events with a
single copy of
the transgene and no beyond border sequence. When possible, TO plants were
self-pollinated;
otherwise they were pollinated with JHAF031.
Example 7: Greenhouse Growth Conditions
Corn seed is sown into 2.5 SVD pots (Classic 600, - 2 gallon nursery
containers) in
Universal mix (Sungrow Horticulture, Pine Bluff, AR). Universal mix is 45%
Peat moss,
45% bark , 5% perlite, 5% vermiculite. Environmental conditions for greenhouse
maize
cultivation is typically 16 hour days (average light intensity 600 mol m as
2), day time
temperature of 80-86 F, night time temperature 70-76 F and relative humidity
greater than
50%. Plants are placed on 2" platforms to avoid contact with the greenhouse
floor. Plants are
hand watered until daily irrigation is required, then they are placed on
irrigation drip. The
irrigation schedule is 4 minutes every other day. Plants were routinely
treated with
insecticides to control pests.
Example 8: Evaluation of Transgenic Maize Expressing Rabl7-T6PP-RNAi in the
Greenhouse
The greenhouse evaluation is a controlled water-stress experiment that
quantifies
ovule viability in water-stressed and unstressed plants. Data from unstressed
plants represent
the genotype's potential to set seed under ideal conditions. Data from water-
stressed plants
quantify kernel abortion that results froni drought at the time of flowering.
The results of
these experiments can be predictive of field performance. We used this tool to
select
transgenic events for field evaluations.
Page 30
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Seed from selfed plants were sown as above. Taqman analysis was used to divide
the
progeny hemizygous (containing Rabl7-T6PP-RNAi) and azygous (lost the Rabl7-
T6PP-
RNAi) groups. Seedlings were transferred to 600 pots, above, and maintained
using standard
greenhouse procedures until they reached the V6 growth stage (Ritchie et al.,
1997). All
plants were treated with the systemic pesticide, Marathon, to reduce
susceptibility to pests.
Water stress was gradually imposed, using salt as the osmoticum (Nuccio et al.
1998). The
salt consisted of sodium chloride/calcium chloride at a 10:1 molar ratio,
delivered in 0.5X
Hoagland's Solution, to prevent sodium-induced disruption of potassium uptake.
Salt
concentration in the irrigant was increased from 50 mM to 100 mM to 150 mM
every three
days to give plants time to adjust to the salt. Plants were maintained on 150
mM salt solution
through the flowering period, typically two weeks, after which pots were
thoroughly flushed
with water and plants were returned to normal irrigation. This protocol
typically reduced
kernel set by 40-60%, compared to control plants that received no salt.
Each plant's ability to adjust to the imposed water stress was measured by
sampling
the first fully expanded leaf, at its mid-point, for solute potential. Three
3/4 inch circular leaf
punches were collected and analyzed for leaf-sap solute potential using a
dewpoint vapor
pressure osmometer. Plants were sampled three days after the 150 mM salt
treatment between
10:00-11:00 AM. The leaf sap solute potentials were compared to soil solute
potentials to
determine how well the plant adjusted to the water stress. Typically plants
did not differ in
their adjustment to the imposed water stress.
Typically 15-20 seed per transgenic event were sown to give 7-10 individual
azygotes
and 7-10 individual hemizygotes. Plants were arranged in a complete,
randomized block
design consisting of three replicates per treatment. Developing ears were
covered with
pollination bags before silk emergence. Pollen shed and silk emergence dates
were recorded
and individual ears were hand pollinated 2-3 times with donor pollen on
successive days.
Pollination bags were removed after completing all pollinations. Ears were
harvested 30 days
after pollinations, and dried for 4 days to 15% moisture content. Ears were
shelled and the
kernels were counted and weighed.
Example 9: Greenhouse Experiment 1
Eight Rab17-T6PP-RNAi events were studied for their ability to set seed under
water
stress. Twenty-four T1 seed from each event (a selfed TO parent) were
germinated. Taqman
analysis was used to establish zygosity in each seedling. Homozygotes were set
aside for seed
Page 31
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
bulking. Hemizygotes and azygotes were analyzed using the greenhouse water
stress
protocol, above (Example 8). In this experiment non-transformed A188 plants
served as the
benchmark. The kernel set data, summarized in Figure 12, show that each event
is unique.
The water stress protocol was somewhat severe in that the benchmark A188
plants suffered
more than 70% reduction in kernel set. In general the presence of the
transgene improves
kernel set in water stressed plants, the average improvement across all
transgenic events was
39%. In particular, in Event 81AlOB, hemizygotes had more than double the
kernel set of
corresponding azygotes. Also, water-stressed hemizygotes from Event 78A18B set
six times
more kernels than azygotes. The data indicate the Rabl7-T6PP-RNAi expression
cassette
improves kernel set in maize.
Example 10: Greenhouse Experiment 2
Two Rabl7-T6PP-RNAi events, 78A18B(13) and 81A10B(10) were studied for their
ability to set seed under water stress. Ninety-six T2 seed from each event (a
selfed Tl parent)
were germinated. Taqman analysis was used to establish zygosity in each
seedling.
Hemizygotes and azygotes were analyzed using the greenhouse water stress
protocol, above
(Example 8). In this experiment 81AlOB(10) azygotes served as the benchmark.
The water
stress protocol was effective in that the benchmark 81AlOB(10) azygotes
suffered about a
45% reduction in kernel set. In general the presence of the transgene may
reduce kernel set in
well-watered plants. However, the transgene either has little effect on, or
slightly improves
kernel set in water-stressed plants.
Example 11: Evaluation of Transgenic Maize Expressing Rabl7-T6PP-RNAi in the
Field
The field evaluations were conducted to test transgene performance under
conditions
typically used by growers. The general field criteria were four-row plots,
17.5 feet long
separated by 2-3 foot alleys with about 40 plants per row. The outer rows were
planted with
azygotes and the inner rows were planted with segregating transgenics. The
field was divided
into a well-watered treatment block and a water-stressed treatment block, and
drip irrigation
was used to water the fields. Each block had a dedicated irrigation manifold.
To maintain
uniformity the most remote plot was less than 100 feet from the irrigation
manifold. There
were 3 plots per Event per treatment (a total of six per Event). Event plots
were planted at a
different distance from the irrigation manifold in a randomized complete block
design. Well-
watered and water-stress treatment blocks were separated by 16 rows (50 ft).
Page 32
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
T1 homozygous seed from Event 78A18B and Event 81AlOB were back-crossed
twice with JHAF031, and the 1:1 segregating seed were planted in the summer of
2003 in
Hawaii. The planting site has well drained sandy soil and typically gets less
than 3" of
rainfall during the summer. Taqman analysis of seedlings was performed to
establish the
presence of the transgene. Tn this way, azygotes and hemizygotes were randomly
dispersed in
each plot.
The well-watered block was irrigated optimally throughout the experiment. The
water-stress block was watered optimally until plants reached approximately
V6, at which
time water was withheld. Plants were returned to optimal irrigation after 90%
silk emergence.
The amount of water applied to the field and rainfall were recorded. After
plants
transitioned to reproductive development, pollen shed and silk emergence dates
were
recorded for each plant. Plant response to water deficit was also recorded by
monitoring
appearance of physiological stress symptoms such as leaf greying and curling,
and sampling
leaf tissue to measure solute potential. Each plant's ability to adjust to the
imposed water
stress was measured by sampling the first fully expanded leaf, at its mid-
point, for solute
potential. Three 3/4 inch circular leaf punches were collected and analyzed
for leaf-sap solute
potential using a dewpoint vapor pressure osmometer. Plants in the water-
stressed block were
sampled during the period of maximum stress. Plants in the well-watered block
were sampled
a few days after the water-stressed block. Sampling took place between 8:00-
10:00 AM. The
leaf sap solute potentials for plants within each plot were compared to
establish field
uniformity.
Ears from each plant were harvested and shelled. Kernels were counted and
weighed.
The data from hemizygous individuals were compared to azygous individuals to
gauge the
transgene's effect on kernel set. Results for the two Rabl7-T6PP-RNAi events
are
summarized in Figures 14 and 15. On average, the water-stress reduced kernel
set in azygous
A78A18B (Fig. 14) individuals by 47 %, whereas the hemizygous individuals
suffered only a
30% yield reduction under the same conditions. Figure 15 shows the A81AlOB
hemizygous
individuals suffered a slightly greater drought-induced yield reduction than
the corresponding
azygotes (30% vs. 25%, respectively). However, this yield reduction is
significantly offset by
the more than 10% yield enhancement afforded by the transgene. Results from
this field
experiment demonstrate the effectiveness of the Rab17-T6PP-RNAi transgene in
stabilizing
kernel set in drought stressed maize.
Page 33
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Example 12: Application of the Rabl7-T6PP-RNAi to other plant species
The gene silencing activity of a double-stranded RNA is sequence specific.
Studies in
plant, insect, nematode, mammalian and other eukaryotic systems indicate that
a homologous
21-23 base sequence is sufficient to cause gene silencing (Waterhouse and
Helliwell, 2003;
McManus and Sharp, 2002). The length requirement of 21 bases is a lower limit
and there is
evidence that mismatches can be tolerated (McManus and Sharp, 2002). With this
in mind,
it's clear that more effective RNA-mediated gene silencing is achieved with
longer templates
(Thomas et al., 2001). Furthermore gene regulatory sequence does function in a
predictable
way across species boundaries (See, for example, Nuccio and Thomas, 2000).
The transgenic constructs of the present invention can be used to reduce
expression of
T6PP in other plants species. Cross-species efficacy was established by
querying public and
proprietary cDNA databases to identify T6PP encoding sequences in other plant
species. The
"hits" were aligned and used to generate contigs as described in Fig. 2. T6PP
homologues
from sorghum, barley, wheat, sugar cane and rye were identified. The sequence
fragments
from each gene corresponding to the T6PP-RNAi fragment were compared by
alignment
(Fig. 16) and similarity (Fig. 17). For comparison ZmT6PP-1 amino acids 334-
393, in Fig. 3,
are encoded by nucleotides 1-180 of the ZmT6PP-1 cDNA shown in Fig. 16.
The results demonstrate there the transgenic construct of the present
invention will
function to silence T6PP in other crop species. This shows the construct can
be used to
improve environmental stress tolerance in not only maize, but also other
important cereal
crops.
Page 34
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
References
Aeschbacher, R.A., Miiller, J., Boller, T., Wiemken, A. (1999). Purification
of the trehalase
GMTRE1 from Soybean nodules and cloning of its cDNA. GMTREI is expressed at a
low
level in multiple tissues. Plant Physio1.119, 489-495.
Atkins, D., Young, M., Uzzell, S., Kelly, L., Fillatti, J., Gerlach, W.L.
(1995). The expression
of antisense and ribozyme genes targeting citrus exocortis viroid in
transgenic plants. J. Gen.
Virol. 76, 1781-1790.
Atkins, D.G., Gerlach, W.L., Young, M.J. (2002). Ribozyme nucleic acids and
methods of
use thereof for controlling viral pathogens. U.S. Patent 6,451,603. Filed
March 2, 1995,
issued Sept. 17, 2002.
Bartley, G.E., Viitanen, P.V., Bacot, K.O., Scolnik, P.A. (1992). A tomato
gene expressed
during fruit ripening encodes an enzymes of the carotenoid biosynthesis
pathway. J. Biol.
Chem. 267, 5036-5039.
Batzer, M.A., Carlton, J.E., Deininger, P.L. (1991). Enhanced evolutionary PCR
using
oligonucleotides with inosine at the 3'-terminus. Nucl. Acids Res. 19, 5081.
Bevan, M.W., Flavell, R.B., Chilton, M.-D. (1983) A chimaeric antibiotic
resistance gene as
a selectable marker for plant cell transformation. Nature. 304,184-187.
Bevan, M. (1984). Binary Agrobacterium vectors for plant transformation. Nucl.
Acids Res.
12, 8711-8721.
Bird, C.R., Ray, J.A., Fletcher, J.D., Boniwell, J.M., Bird, A.M., Teulieres,
C., Blain, I.,
Bramley, P.M. (1991). Using antisense RNA to study gene function: inhibition
of carotenoid
biosynthesis in transgenic tomatoes. Bio/Technol. 9, 635-639.
Bla.zquez, M.A., Santos, E., Flores, C.-L., Martinez-Zapater, J.M., Salinas,
J., Gancedo, C.
(1998). Isolation and molecular characterization of the Arabidopsis TPSl gene,
encoding
trehalose-6-phosphate synthase. Plant J. 13, 685-689.
Blochlinger, K., Diggelmann, H. (1984). Hygromycin B phosphotransferase as a
selectable
marker for DNA transfer experiments with higher eucaryotic cells, Mol. Cell.
Biol. 4, 2929-
2931.
Bojsen, K., Donaldson, I., Haldrup, A., Joersboe, M., Kreiberg, J.D., Nielsen,
J., Okkels,
F.T., Petersen, S.G. (1998). Mannose or xylose based positive selection. U.S.
Pat. No.
5,767,378.
Bourouis, M., Bruno, J. (1983). Vectors containing a prokaryotic dihydrofolate
reductase
gene transform Drosophila cells to methotrexate-resistance. EMBO J. 2, 1099-
1104.
Brands, A., Ho, T.H.D. (2002). Function of a plant stress-induced gene, HVA22.
Synthetic
enhancement screen with its yeast homolog reveals its role in vesicular
traffic. Plant Physiol.
130, 1121-1131.
Page 35
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Brusslan, J.A., Karlin-Neumann, G.A., Huang, L., Tobin, E.M. (1993). An
Arabidopsis
mutant with a reduced level of cab140 RNA is a result of cosuppression. Plant
Cell. 5, 667-
677.
Caddick, M.X., Greenland, A.J., Riddell, K.V., Schuch, W.W., Tomsett, A.B.
(2003). DNA
constructs and plants incorporating them. U.S. Pat. No. 6,605,754.
Carthew, R.W. (2001). Gene silencing by double-stranded RNA. Current Opin.
Cell Biol. 13,
244-248.
Christou, P., Ford, T.L., Kofron, M. (1991). Production of transgenic rice
(Or.yza sativa L.)
plants from agronomically important Indica and Japonica varieties via electric
discharge
particle acceleration of exogenous DNA into immature zygotic embryos.
Bio/Technol. 9,
957-962.
Chua, N.-H., Aoyama, T. (2000). Chemical inducible promoter used to obtain
transgenic
plants with a silent marker. U.S. Pat. No. 6,063,985.
Datta, S.K., Peterhans, A., Datta, K., Potrykus, I. Genetically engineered
fertile Indica rice
recovered from protoplasts. Bio/Technol. 8, 736-740.
De-Feyter, R., Young, M., Schroeder, K., Dennis, E.S., Gerlach, W. (1996). A
ribozyme gene
and an antisense gene are equally effective in conferring resistance to
tobacco mosaic virus
on transgenic tobacco. Mol. Gen. Genet. 250, 329-338.
Dudits, D., Morocz, S., Nemeth, J., Donn, G. (2001). Zea mays (L.) with
capability of long
term, highly efficient plant regeneration including fertile transgenic maize
plants having a
heterologous gene, and their preparation. U.S. Pat. No. 6,284,945.
Eastmond, P.J., van Dijken, A.J.H., Spielman, M., Kerr, A., Tissier, A.F.,
Dickinson, H.G.,
Jones, J.D.G., Smeekens, S.C., Graham, I.A. (2002). Trehalose-6-phosphate
synthase 1,
which catalyses the first step in trehalose synthesis, is essential for
Arabidopsis embryo
maturation. Plant J. 29, 225-235.
Eastmond, P.J., Graham, I.A. (2003). Trehalose metabolism: a regulatory role
for trehalose-6-
phosphate synthase? Current Opin. Plant Biol. 6, 231-235.
Eastmond, P.J., Li, Y., Graham, I.A. (2003). Is trehalose-6-phosphate a
regulator of sugar
metabolism in plants? J. Exp. Botany. 54, 533-537.
Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., Tuschl, T.
(2001).
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian
cells.
Nature. 411, 494-498.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C.
(1998). Potent
and specific genetic interference by double stranded RNA in Caenorhabditis
elegans. Nature.
391, 806-811.
Page 36
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Frank-Kamenetskii, M.D., Mirkin, S.M. (1995). Triplex DNA structures. Ann.
Rev.
Biochem. 64, 65-95.
Fromm, M.E., Morrish, F., Armstrong, C., Williams, R., Thomas, J., Klein, T.M.
(1990).
Inheritance and expression of chimeric genes in the progeny of transgenic
maize plants.
Bio/Technol. 8, 833-839.
Garg, A.K., Kim, J.-K., Owens, T.G., Ranwala, A.P., Choi, Y.D., Kochian, L.V.,
and Wu,
R.J. (2002). Trehalose accumulation in rice plants confers high tolerance
levels to different
abiotic stresses. Proc. Natl. Acad. Sci. USA. 99, 15898-15903.
Gobel, E., Nakakido, F. (1993). Transformation of monocot cells. WO 93/21335.
Goddijn, O.J.M., Verwoerd, T.C., Voogd, E., Krutwagen, R.W.H.H., de Graaf,
P.T.H.M.,
Poels, J., van Dun, K., Ponstein, A.S., Damm, B., Pen, J. (1997). Inhibition
of trehalase
activity enhances trehalose accumulation in transgenic plants. Plant Physiol.
113, 181-190.
Goddijn, O.J.M., Pen, J., Smeekens, J.C.M., Smits, M.T. (2003). Regulating
metabolism by
modifying the level of trehalose-6-phosphate by inhibiting endogenous
trehalase levels. U.S.
Pat. Application 20030177531.
Goddijn, O.J.M., Pen, J., Smeekens, J.C.M., (2004). Regulating metabolism by
modifying the
level of trehalose-6-phosphate. U.S. Pat. Application 20040093641.
Gordon-Kamm, W. J., Spencer, T. M., Mangano, M. L., Adams, T. R., Daines, R.
J., Start,
W. G., O'Brien, J. V., Chambers, S. A., Adams, W. R. Jr, Willetts, N. G.,
Rice, T. B.,
Mackey, C. J., Krueger, R. W., Kausch, A. P., Lemaux, P. G. (1990).
Transformation of
Maize Cells and Regeneration of Fertile Transgenic Plants. Plant Cell. 2, 603-
618.
Goto, F., Yashihara, T., Shigemoto, N., Toki, S., Takaiwa, F. (1999). Iron
fortification of rice
seed by the soybean ferritin gene. Nat. Biotechno1.17, 282-286.
Gray, J., Pictra, S., Shabber, J., Schuch, W., Grierson, D. (1992). Molecular
biology of fruit
ripening and its manipulation with antisense genes. Plant Mol. Biol. 19, 69-
87.
Grierson, D., Fray, R.G., Hamilton, A.J., Smith, C.J.S., Watson, C.F., (1991)
Does co-
suppression of sense genes in transgenic plants involve antisense RNA? Trends
Biotech. 9,
122-123.
Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I.,
Baillie, D.L., Fire, A.,
Ruvkun, G., Mello, C.M. (2001). Genes and mechanisms related to RNA
interference
regulate expression of the small temporal RNAs that control C. elegans
developmental
timing. Cell. 106, 23-34.
Hiei, Y., Komari, T. (1994). Method for transforming monocotyledons. WO
94/00977.
Hiei, Y., Komari, T. (1997). Method for transforming monocotyledons. U.S. Pat.
No.
5,591,616.
Page 37
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Hoekema, A., Pen, J., Does, M.P., Van Den Elzen, P.J.M. (1999). Production of
trehalose in
plants. U.S. Pat. No. 5,925,804.
Hofgen, R., Willmitzer, L. (1988). Storage of competent cells for
Agrobacterium
transformation. Nucl. Acids Res. 16, 9877.
Holmstrom, K.-O., Mantyla, E., Welin, B., Mandal, A., Palva, T.E., Tunnela,
O.E.,
Londesborough, J. (1996). Drought tolerance in tobacco. Nature. 379, 683-684.
Horn, M.E., Harms, C.T., Shillito, R.D. (1989). Regeneration von Gramineen-
Pflanzen aus
der Unterfamilie Pooideae ausgehenc von Protoplasten. EP 0 332 581. Filed Mar.
8, 1988,
issued Mar. 2, 1989.
Hutva.gner, G., Zamore, P.D. (2002). RNAi: nature abhors a double-strand.
Curr. Opin.
Genet. Dev. 12, 225-232.
Ishitani, M., Xiong, L., Lee, H., Stevenson, B., Zhu, J.K. (1998). HOS1, a
genetic locus
involved in cold-responsive gene expression in Arabidopsis. Plant Cell. 10,
1151-1161.
Jaglo-Ottosen, K.R., Gilmour, S.J., Zarka, D.G., Schabenberger, 0., Thomashow,
M.F.
(1998). Arabidopsis CBF1 overexpression induces COR genes and enhances
freezing
tolerance. Science. 280, 104-106.
Jang, I.-C., Oh, S.-J., Seo, J.-S., Choi, W.-B., Song, S.I., Kim, C.H., Kim,
Y.S., Seo, H.-S.,
Choi, Y.D., Nahm, B.H., and Kim, J.-K. (2003). Expression of a bifunctional
fusion of the
Escherichia coli genes for trehalose-6-phosphate synthase and trehalose-6-
phosphate
phosphatase in transgenic rice plants increases trehalose accumulation and
abiotic stress
tolerance without stunting growth. Plant Physiol. 131 516-524.
Jones, J.D.G., Shlunlukov, L., Carland, F., English, J., Scofield, S.R.,
Bishop, G.J., Harrison,
K. (1992). Effective vectors for transformation, expression of heterologous
genes, and
assaying transposon excision in transgenic plants. Transgenic Res. 1, 285-297.
Jorgensen, R.A., Cluster, P.D., English, J., Que, Q., Napoli, C.A. (1996).
Chalconse synthase
cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense
constructs
and single-copy vs. complex T-DNA sequences. Plant Mol. Biol. 31, 957-973.
Kaasen, I., Falkenberg, P., Styrvold, O.B., Strom, A.R. (1992). Molecular
cloning and
physical mapping of the ostBA genes, which encode the osmoregulatory pathway
of
Escherichia coli: evidence that transcription is activated by KatF (AppR). J.
Bacteriol. 174,
889-898.
Kay, R., Chan, A., Daly, M., McPherson, J. (1987). Duplication of CaMV 35S
Promoter
sequences creates a strong enhancer for plant genes. Science. 236, 1299-1302.
Kiesselbach, T.A. (1999). The Structure and Reproduction of Corn, 50th
Anniversary
Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York.
Pgs. 51-63.
Page 38
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Kim, K.N., Cheong, Y.H., Grant, J.J., Pandey, G.K., Luan, S. (2003). CIPK3, a
calcium
sensor-associated protein kinase that regulates abscisic acid and cold signal
transduction in
Arabidopsis. Plant Cell. 15, 411-423.
Klein, T.M., Wolf, E.D., Wu, R., Sanford, J.C.. (1987). High-velocity
microprojectiles for
delivering nucleic acids into living cells. Nature. 327, 70-73.
Knutzon, D.S., Thompson, G.A., Radke, S.E., Johnson, W.B., Knauf, V.C.,
Kridle, J.C.
(1992). Modification of Brassica seed oil by antisense expression of a
stearoyl-acyl carrier
protein desaturase gene. Proc. Natl. Acad. Sci. USA. 89, 2624-2628.
Koziel, M.G., Beland, G.L., Bowman, C., Carozzi, N.B., Crenshaw, R.,
Crossland, L.,
Dawson, J., Desai, N., Hill, M., Kadwell, S. (1993). Field performance of
elite transgenic
maize plants expressing an insecticidal protein derived from Bacillus
thuringiensis.
Bio/Technol. 11, 194-200.
Koziel, M.G. et al. (2002). Method of producing transgenic maize using direct
transformation
of commercially important genotypes. U.S. Pat. No. 6,403,865.
Kridl, J.C., Knauf, V.C. (1995). Seed-specific transcriptional regulation.
U.S. Pat. No.
5,420,034.
Kuehn, C., Hajirezaei, M.R., Fernie, A.R., Roessner-Tunali, U., Czechowski,
T., Himer, B.,
Frommer, W.B. (2003). The sucrose transporter StSUTl localizes to sieve
elements in potato
tuber phloem and influences tuber physiology and development. Plant Physiol.
131, 102-113.
Kull, B., Salamini, F., Rohde, W. (1995). Genetic engineering of potato starch
composition:
inhibition of amylose biosynthesis in tubers from transgenic potato lines by
the expression of
antisense sequences of the gene for granule-bound starch synthase. J. Genet.
Breed. 49, 67-
76.
Laporte, M.M., Galagan, J.A., Prasch, A.L., Vanderveer, P.J., Hanson, D.T.,
Shewmaker,
C.K., Sharkey, T.D. (2001). Promoter strength and tissue specificity effects
on growth of
tomato plants transformed with maize sucrose-phosphate synthase. Planta. 212,
817-822.
Lebel, E.G., Heifetz, P.B., Goff, S.A. (2004). Expression of trehalose-6-
phosphate synthase
in plant plastids. U.S. Pat. No. 6,686,516.
Lee, Y.S., Nakahara, K., Pham, J.W., Kim, K., He, Z., Sontheimer, E.J.,
Carthew, R.W.
(2004). Distinct Roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA
silencing
pathways. Cell. 117, 69-8 1.
Lessard, P.A., Kulaveerasingam, H., York, G.M., Strong, A., Sinskey, A.J.
(2002).
Manipulating gene expression for the metabolic engineering of plants. Metab.
Eng. 4, 67-79.
Leyman, B., Van Dijck, P., Thevelein, J.M. (2001). An unexpected plethora of
trehalose
biosynthesis genes in Arabidopsis thaliana. Trends Plant Sci. 6, 510-513.
Page 39
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Ligon, J.M., Hill, D.S., Ryals, J.A., Lam, S.T., Hammer, P.E. (1997). Genes
for the synthesis
of antipathogenic substances. U.S. Pat. No. 5,639,949.
Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K.,
Shinozaki,
K. (1998). Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA
binding domain separated two cellular signal transduction pathways in drought-
and low-
temperature-responsive gene expression, respectively, in Arabidopsis. Plant
Cell 10, 1391-
1406.
Londesborough, J., Tunnela, 0., Holmstrom, K.-O., Mantyla, E., Welin, B.,
Mandal, A.,
Palva, T.E. (2000). Transgenic plants producing trehalose. U. S. Pat. No.
6,130,368.
Matzke, M.A., Aufsatz, W., Kanno, T., Mette, M.F., Matzke, A.J. (2002).
Homology-
dependent gene silencing and host defense in plants. Adv. Genet. 46, 235-275.
McManus, M.T., Sharp, P.A. (2002). Gene silencing in mammals by small
interfering RNAs.
Nature Rev. Genet. 3, 737-747.
Mehta, R.A., Cassol, T., Li, N., Ali, N., Handa, A.K., Mattoo, A.K. (2002).
Engineered
polyamine accumulation in tomato enhances phytonutrient content, juice
quality, and vine
life. Nat. Biotechnol. 20, 613-618.
Miles, J.S., Guest, J.R. (1984). Nucleotide sequence and transcriptional start
point of the
phosphomannose isomerase gene (manA) of Escherichia coli. Gene. 32, 625-631.
Moreno-Fonseca, L.P., Covarrubias, A.A. (2001). Downstream DNA sequences are
required
to modulate Pvlea-18 gene expression in response to dehydration. Plant Mol.
Biol. 45, 501-
515.
Miiller, J., Aeschbacher, R.A., Wingler, A., Boller, T. and Wiemken, A.
(2001). Trehalose
and trehalase in Arabidopsis. Plant Physiol. 125, 1086-1093.
Murashige, T. & Skoog, F. (1962). A revised medium for rapid growth and bio
assays with
tobacco tissue cultures. Physiologia Plantarum. 15, 473-497.
Napoli, C., Lemieux, C., Jorgensen, R., (1990). Introduction of a chimeric
chalcone synthase
gene into petunia results in reversible co-suppression of homologous genes in
trans. Plant
Cell. 2, 279-289.
Negrotto, D., Jolley, M., Beer, S., Wenck, A.R., Hansen, G. (2000). The use of
phosphomannose-isomerase as a selectable marker to recover transgenic maize
plants (Zea
mays L.) via Agrobacterium transformation. Plant Cell Rep. 19, 798-803.
No, E.G., Zhou, Y., Loopstra, C.A. (2000). Sequences upstream and downstream
of two
xylem-specific pine genes influence their expression. Plant Sci. 160, 77-86.
Nuccio, M.L., Russell, B.L., Nolte, K.D., Rathinasabapathi, B., Gage, D.A.,
Hanson, D.A.
(1998). The endogenous choline supply limits glycine betaine synthesis in
transgenic tobacco
expressing choline monooxygenase. Plant J. 16, 487-496.
Page 40
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Nuccio. M.L., Thomas, T.L. (2000). Seed specific promoters based on
Arabidopsis genes.
U.S. Pat. No. 6,100,450.
Nylander, M., Svensson, J., Palva, E.T., Welin, B.V. (2001). Stress-induced
accumulation
and tissue-specific localization of dehydrins in Arabidopsis thaliana. Plant
Mol. Biol. 45,
263-279.
Odell, J.T., Nagy, F., Chua, N.-H. (1985). Identification of DNA sequences
required for the
activity of the cauliflower mosaic virus 35S promoter. Nature. 313, 810-812.
Pang, P.P., Pruitt, R.E., Meyerowitz, E.M. (1988). Molecular cloning, genomic
organization,
expression and evolution of 12S seed storage protein genes of Arabidopsis
thaliana. Plant
Mol. Biol. 11, 805-820.
Paszkowski, J., Shillito, D., Saul, M., Mandak, V., Hohn, T., Hohn, B.,
Potrykus, I. (1984).
Direct gene transfer to plants. EMBO J. 3, 2717-2722.
Pilon-Smits, E.A.H., Terry, N., Sears, T., Kim, H., Zayed, A., Hwang, S.B.,
van Dun, K.,
Voogd, E., Verwoerd, T.C., Krutwagen, R.W.H.H., Goddijn, O.J.M. (1998).
Trehalose-
producing transgenic tobacco plants show improved growth performance under
drought
stress. J. Plant Physiol. 152, 525-532.
Potrykus, I., Paszkowski, J., Saul, M.W., Petruska, J., Shillito, R.D. (1985).
Molecular and
general genetics of a hybrid foreign gene introduced into tobacco by direct
gene transfer.
Mol. Gen. Genet. 199,169-177.
Ranocha, P., McNeil, S.D., Ziemak, M.J., Li, C., Tarczynski, M.C., and Hanson,
A.D.
(2001). The S-methylmethionine cycle in angiosperms: ubiquity, antiquity and
activity. Plant
J. 25, 575-584.
Reich, T.J., Iyer, V.N., Miki, B.L. (1986). Efficient transformation of
alfalfa protoplasts by
the intranuclear microinjection of Ti plasmids. Bio/Technol. 4, 1001-1004.
Reinhart, B.J., Weinstein, E.J., Rhoades, M.W., Bartel, B., Bartel, D.P.
(2002). MicroRNAs
in plants. Genes Dev. 16, 1616-1626.
Ritchie, S.W., Hanway, J.J., Benson, G.O. (1997). How a Corn Plant Develops.
Special
Report No. 48. Iowa State University of Science and Technology Cooperative
Extension
Service. Ames, Iowa.
Romero, C., Belles, J.M., Vaya, J.L., Serrano, R., Culianez-Macia, F.A.
(1997). Expression
of the yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants:
pleotropic
phenotypes include drought tolerance. Planta. 201, 293-297.
Rontein, D., Dieuaide-Noubhani, M., Dufourc, E.J., Raymond, P., Rolin, D.
(2002b). The
metabolic architecture of plant cells. Stability of central metabolism and
flexibility of
anabolic pathways during the growth cycle of tomato cells. J. Biol. Chem. 277,
42948-43960.
Page 41
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Rothstein, S.J., DiMaio, J., Strand, M., Rice, D. (1987). Stable and heritable
inhibition of the
expression of nopaline synthase in tobacco expressing antisense RNA. Proc.
Natl. Acad. Sci.
USA. 84, 8439-8443.
Sanford, J.C., Wolf, E.D., Allen, N.K. (1990). Method for transporting
substances into living
cells and tissues and apparatus therefor. U.S. Pat. No. 4,945,050.
Sanford, J.C., Wolf, E.D., Allen, N.K. (1991). Method for transporting
substances into living
cells and tissues and apparatus therefor. U.S. Pat. No. 5,036,006.
Sanford, J.C., Wolf, E.D., Allen, N.K. (1992). Method for transporting
substances into living
cells and tissues. U.S. Pat. No. 5,100,792.
Schocher, R.J., Shillito, R.D., Saul, M.W., Paszkowski, J., Potrykus, I.
(1986). Co-
transformation of unlinked foreign genes into plants by direct gene transfer.
Bio/technol. 4,
1093-1096.
Seymour, J.F., Kurzrock, R., Freireich, E.J., Estey, E.H. (1993). Down-
regulation of two non-
homologous endogenous tomato genes with a single chimaeric sense gene
construct. Plant
Mol. Biol. 23, 1-9.
Shah, D.M., Rogers, S.G., Horsch, R.B., Fraley, R.T. (1990). Glyphosate-
resistant plants.
U.S. Pat. No. 4,940,835.
Shah, D.M., Rogers, S.G., Horsch, R.B., Fraley, R.T. (1993). Glyphosate-
resistant plants.
U.S. Pat. No. 5,188,642.
Shen, W., Gomez-Cadenas, A., Routly, E.L., Ho, T.H.D., Simmonds, J.A., Gulick,
P.J.
(2001). The salt stress-inducible protein kinase gene, Esi47, from the salt-
tolerant wheatgrass
Lophopyrum elongatum is involved in plant hormone signaling. Plant Physiol.
125, 1429-
1441.
Shewmaker, C.K., Kridl, J.C., Hiatt, W.R., Knauf, V. (1992). Anti-sense
regulation of gene
expression in plant cells. U.S. Pat. No. 5,107,065.
Shimada, H., Tada, Y., Kawasaki, T., Fujimura, T. (1993). Antisense regulation
of the rice
waxy gene expression using a PCR amplified fragment of the rice genome reduces
the
amylose content in grain starch. Theor. Appl. Genet. 86, 665-672.
Shimamoto, K., Terada, R., Izawa, T., Fujimoto, H. (1989). Fertile transgenic
rice plants
regenerated from transformed protoplasts. Nature. 338, 274-277.-
Slabas, A.R., Elborough, K.M. (1998). Plant gene encoding acetyl coenzyme a
carboxylase
biotin carboxyl carrier protein. U.S. Pat. No. 6,150,586.
Smith, C.J.S., Watson, C.F., Ray, J., Bird, C.R., Morris, P.C., Schuch, W.,
Grierson, D.
(1988). Antisense RNA inhibition of polygalacturonase gene expression in
transgenic
tomatoes. Nature. 334, 724-726.
Page 42
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Sukhapinda, K., Hasler, J.M., Petell, J.K., Strickland, J.A., Folkerts, O.
(2004). Antibody-
mediated down-regulation of plant proteins. U.S. Pat. No. 6,767,742.
Thomas, C.L., Jones, L., Baulcombe, D.C., Maule, A.J. (2001). Size constraints
for targeting
post-transcriptional gene silencing and for RNA-directed methylation in
Nicotiana
benthamiana using a potato virus X vector. Plant J. 25, 417-425.
Tij sterman, M., Ketting, R.F., Plasterk, R.H.A. (2002). The genetics of RNA
silencing. Ann.
Rev. Genet. 36, 489-519.
Tomes, D.T., Weissinger, A., Sanford, J.C., Klein, T.M. (1999). Stable
transformation of
plant cells. U.S. Pat. No. 5,990,387.
Ueda, T., Piscataway, N.J., Waverczak, W., Ward, K., Sher, N., Ketudat, M.,
Schmidt, R.J.,
Messing, J. (1992). Mutations of the 22- and 27-kD zein promoters affect
transactivation by
the opaque-2 protein. Plant Cell 4, 701-709.
Uknes, S., Dincher, S., Friedrich, L., Negrotto, D., Williams, S., Thompson-
Taylor, H.,
Potter, S., Ward, E., Ryals, J. (1993). Regulation of pathogenesis-related
protein-la gene
expression in tobacco. Plant Cell. 5, 159-169.
van der Krol, A.R., Lenting, P.E., Veenstra, J., van der Meer, I.M., Koes,
R.E., Gerats,
A.G.M., Mol, J.N.M., Suitje, A.R. (1988). An anti-sense chalcone synthase gene
in
transgenic plants inhibits flower pigmentation. Nature. 333, 866-869.
Vasil, V., Castillo, A.M., Fromm, M.E., Vasil, I.K. (1992). Herbicide
resistant fertile
transgenic wheat plants obtained by microprojectile bombardment of regenerable
embryogenic callus. Bio/Technol. 10, 662-674.
Vasil,V., Srivastava,V., Castillo, A.M., Fromm, M.E., Vasil, I.K. (1993).
Rapid production of
transgenic wheat plants by direct bombardment of cultured immature embryos.
Bio/Technol.
11, 1553-1558.
Vaucheret, H., Palauqui, J.-G., Elmayan, T., Moffatt, B. (1995). Molecular and
genetic
analysis of nitrite reductase co-suppression in transgenic tobacco plants.
Mol. Gen. Genet.
248, 311-317.
Veluthambi, K., Mahadevan, S., Maheshwari, R. (1981). Trehalose toxicity in
Cuscuta
reflexa. Plant Physiol. 68, 1369-1374.
Vieira, J., Messing, J. (1982). The pUC plasmids, an M13mp7-derived system for
insertion
mutagenesis and sequencing with synthetic universal primers. Gene 19, 259-268.
Vilardell, J., Goday, A., Freire, M.A., Torrent, M., Martinez, M.C., Tome,
J.M. and Pages,
M. (1990). Gene sequence, developmental expression, and protein
phosphorylation of RAB-
17 in maize. Plant Mol. Bio1.14, 423-432.
Page 43
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Vilardell, J., Mundy, J., Stilling, B., Leroux, B., Pla, M., Freyssinet, G.,
Pages, M. (1991).
Regulation of the maize rabl7gene promoter in transgenic heterologous systems.
Plant Mol.
Biol. 17, 985-993.
Vogel, G., Aeschbacher, R.A., Mi,iller, J., Boller, T. and Wiemken, A. (1998).
Trehalose-6-
phosphate phosphatases from Arabidopsis thaliana: identification by functional
complementation of the yeast tps2 mutant. Plant J. 13, 673-683.
Vogel, G., Feihn, 0., Jean-Richard-dit-Bressel, L., Boller, T., Wiemken, A.,
Aeschbacher,
R.A., Wingler, A. (2001). Trehalose metabolism in Arabidopsis: occurrence of
trehalose and
molecular cloning and characterization of trehalose-6-phosphate synthase
homologues. J.
Exp. Botany. 52, 1817-1826.
Wang, J.T., Gould, J.H., Padmanabhan, V., Newton, R.J. (2002). Analysis and
localization of
the water-deficit stress-induced gene (lp3). J. Plant Growth Reg. 21, 469-478.
Waterhouse, P.M., Wang, M.-B. (2002). Methods for obtaining modified
phenotypes in
plants. U.S. Pat. No. 6,423,885.
Waterhouse, P.M. and Helliwell, C.A. (2003). Exploring plant genomes by RNA-
induced
gene silencing. Nature Rev. Genet. 4, 29-38.
Weeks et al. (1993). Rapid Production of Multiple Independent Lines of Fertile
Transgenic
Wheat (Triticurn aestivum). Plant Physiol. 102, 1077-1084.
Weiniken, A. (1990). Trehalose in yeast, stress protectant rather than reserve
carbohydrate.
Ant. Van Leeuwenhoek J. Gen. Microbiol. 58, 209-217.
Wingler, A. (2002). The function of trehalose biosynthesis in plants.
Phytochem. 60, 437-
440.
Yamaguchi-Shinozaki, K., Shinozaki, K. (1993a). The plant hormone abscisic
acid mediates
the drought-induced expression but not the seed-specific expression of rd22, a
gene
responsive to dehydration stress in Arabidopsis thaliana. Mol. Gen. Genet.
238, 17-25.
Yamaguchi-Shinozaki, K., Shinozaki, K. (1993b). Arabidopsis DNA encoding two
desiccation-responsive rd29 genes. Plant Physiol. 101, 1119-1120.
Yin, Z., Zhao, Y., Luo, D., Zhang, H. (2002). Isolating the promoter of a
stress-induced gene
encoding betaine aldehyde dehydrogenase from the halophyte Atriplex
centralasiatica IIjin.
Biochim. Biophys. Acta. 1577, 452-456.
Yoshiba, Y., (1995). Correlation between the induction of a gene for DELTA- 1 -
pyrroline-5-
carboxylate synthetase and the accumulation of proline in Arabidopsis thaliana
under osmotic
stress. Plant J. 7, 751-760.
Zhang, H.M., Yang, H., Rech, E.L., Golds, T.J., Davis, A.S., Mulligan, B.J.,
Cocking, E.C.,
Davey, M.R. (1988). Transgenic rice plants produced by electroporation-
mediated plasmid
uptake into protoplasts. Plant Cell Rep. 7, 379-384.
Page 44
CA 02588372 2007-05-17
WO 2006/060376 PCT/US2005/043097
Zhang, C.S., Lu, Q., Verma, D.P.S. (1997). Characterization of DELTA-1-
pyrroline-5-
carboxylate synthetase gene promoter in transgenic Arabidopsis thaliana
subjected to water
stress. Plant Sci. 129, 81-89.
Zinselmeier, C., Westgate, M.E., Schussler, J.R., Jones, R.J. (1995a). Low
water potential
disrupts carbohydrate metabolism in maize (Zea mays L.) ovaries. Plant
Physiol. 107, 385-
391.
Zinselmeier, C., Lauer, M.J., Boyer, J.S. (1995b). Reversing drought-induced
losses in grain
yield: sucrose maintains embryo growth in maize. Crop Sci. 35, 1390-1400.
Zinselmeier, C., Byeong-Ryong, .J., Boyer, J.S. (1995b). Starch and the
control of kernel
number in maize at low water potentials. Plant Physiol. 121, 25-25.
Page 45
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 45
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 45
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
