Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 51
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 51
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-1-
MODULATION OF SPHINGOSINE KINASE SIGNALLING
FIELD OF THE INVENTION
The present invention relates generally to a method of modulating cellular
activity and to
agents for use therein. More particularly, the present invention provides a
method of
modulating the level of sphingosine kinase functional activity. In a related
aspect, the
present invention provides a method of modulating sphingosine kinase mediated
signalling
via modulation of its intracellular level of activity. The present invention
still further
extends to novel molecules which exhibit the capacity to induce sphingosine
kinase
activity. The methods and molecules of the present invention are useful, inter
alia, in the
treatment and/or prophylaxis of conditions characterised by aberrant, unwanted
or
otherwise inappropriate cellular functional activity and/or aberrant, unwanted
or otherwise
inappropriate sphingosine kinase mediated signalling. The present invention is
further
directed to methods for identifying and/or designing agents capable of
modulating the level
of sphingosine kinase activity.
BACKGROUND OF THE INVENTION
Bibliographic details of the publications referred to by author in this
specification are
collected alphabetically at the end of the description.
The reference to any prior art in this specification is not, and should not be
taken as, an
acknowledgment or any form of suggestion that that prior art forms part of the
common
general lcnowledge in Australia.
Sphingosine kinases (SK) are enzymes that catalyse the phosphorylation of
sphingosine to
generate the bio-active phospholipid, sphingosine 1-phosphate (S 1 P) (Pyne &
Pyne, 2002,
Biochim. Biophys. Acta 1582:121-131; Spiegel & Milstien, 2003, Nat. Rev Mol.
Cell Biol.
4:397-407). S 1P can affect many biological processes, including calcium
mobilization,
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-2-
mitogenesis, apoptosis, atherosclerosis, inflammatory responses and
cytoskeleton
rearrangement (Spiegel & Milstien, 2000, FEBS Lett. 476:55-57). As SK is the
main
regulator of S 1 P levels in mammalian cells (Spiegel & Milstien, 2003,
supra), the activity
and activation of this enzyme plays a central and crucial role in controlling
the observed
effects attributed to S 1P in the cell.
There is now considerable evidence implicating sphingosine kinase and S1P in
tumourigenesis through enhancing cell proliferation and cell survival. Xia et
al. (2000,
Curr. Biol. 10:1527-1530) have demonstrated overexpression of SK1 in NIH 3T3
fibroblasts induced neoplastic cell transformation as measured by foci
formation, cell
growth in soft agar, and the formation of tumours in NOD/SCID mice.
Additionally,
inhibition of SK1 by treatment of cells with N,N-dimethylsphingosine (DMS), an
inhibitor
of SK or through the use of a dominant-negative SK mutant which blocked
transformation
mediated by oncogenic H-Ras (Xia et al., 2000, supra). Other studies have
shown that,
hSK1 mRNA levels are higher in certain human tumours, including cancers of the
breast,
colon, lung, ovary, stomach, uterus, kidney and rectum (French et al., 2003,
Cancer Res.
63:5962-5969). Recently developed SK1 inhibitors have also been shown to block
breast
tumour growth in mice (French et al., 2003, supra). This is further supported
by other
studies that have also shown that SK1 activation is important in promoting
estrogen-
dependent tumour formation in breast cancer cells (Nava et al., 2002, Expt.
Cell Res.
281:115-127; Sukocheva et al., 2003, Mol. Enclocf inol. 17:2002-2012).
However, in addition to its role in cell growth and survival SK1 and S I P
appears to be
involved in other aspects of cellular regulation. It has been shown that S 1 P
may be
involved in inflammation and atherosclerosis through the induction of adhesion
molecule
expression on vascular endothelial cells (Xia et al., 1999, J. Biol. Chem.
274:34499-
34505). Other studies suggest its involvement in hypertension since high
levels of SK1 can
enhance blood vessel constriction (Bolz et al., 2003, Circulation 108:342-347;
Coussin et
al., 2002, Circ. Res. 91:151-157). Also, SK1 has been shown to involved in
TNFa-induced
activation of the pro-inflammatory transcription factor, NF-xB (Xia et al.,
2002, J. Biol.
Chem. 277:7996-8003). Similarly, S 1P appears to be associated with asthma as
it was
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-3-
found to enhance constriction of airway smooth muscle cells and histamine
rele;ise (Jolly
et al., 2001, Mol. Immunol. 38:1239-1245).
It has previously been shown that hSK1 has intrinsic catalytic activity that
is independent
of post-translational modifications of the protein (Pitson et al. 2000a,
Biochem. J.
350:429-441). Using a combination of techniques including chemical inhibition,
co-
immunoprecipitation and in vitro phosphorylation, we have also shown that
ERK1/2
phosphorylates hSK1 in vivo (Pitson et al., 2003, EMBO J. 22:1-10) This
phosphorylation
of hSK1 results directly in a 14-fold increase in the kcat of the enzyme,
while having no
significant effect on KM values for either sphingosine or ATP. In general,
activation of
hSK1 activity correlates with its translocation from the cytosol to the plasma
membrane
(Rosenfeldt et al., 2001, FASEB J 15:2649-2659; Young et al., 2003, Cell
calcium
33:119-128). The phosphorylation at Ser225 not only directly increases the
catalytic
activity of hSK1, but it was also shown to be necessary for agonist-induced
translocation
of the protein to the plasma membrane (Pitson et al., 2003, supra).
Translocation of SK1
may be important in localizing it to its potential substrate and hence
generate localized
signalling of S 1 P or its secretion to engage cell-surface S 1 P receptors
(Pitson et al., 2003,
supra). While this study has shown that activation of SK1 occurs by ERK1/2-
mediated
phosphorylation, many aspects of the regulation of this phosphorylation are
not yet known,
including the possibility that other phosphorylation-independent SK1
activation
mechanisms may also exist.
Two human sphingosine kinase isoforms exist (1 and 2), which differ in their
tissue
distribution, developmental expression, catalytic properties, and somewhat in
their
substrate specificity (Pitson et al., 2000, supra; Liu et al., 2000, J. Biol.
Chem. 275:19513-
19520). A number of studies have shown the effects of sphingosine kinase 1 in
enhancing
cell proliferation and suppressing apoptosis (Olivera et al., 1999, J. Cell
Biol. 147:545-
558; Xia et al., 2000, Curr. Biol. 10:1527-1530; Edsall et al., 2001, J
Neurochern.
76:1573-1584). Furthermore, overexpression of human sphingosine kinase 1(hSK1)
in
NIH3T3 fibroblasts results in acquisition of the transformed phenotype and the
ability to
form tumors in nude mice, demonstrating the oncogenic potential of this enzyme
(Xia et
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-4-
al., 2000, supra). More recent work has shown the involvement of hSK1 in
estrogen-
dependent regulation of breast tumor cell growth and survival (Nava et al.,
2002, Expt.
Cell Res. 281:115-127; Sukocheva et al., 2003, Mol. Endocrinol. 17:2002-2012),
while
other studies have shown elevated hSK1 mRNA in a variety of human solid tumors
and
inhibition of tumor growth in vivo by sphingosine kinase inhibitors (French et
al., 2003,
Cancer Res. 63:5962-5969). Thus, the involvement of hSKl in cell growth,
survival and
tumorigenesis is now well established.
In addition to SphKl, another isoform SphK2 has been cloned and characterized
(Liu et
al., 2000, JBiol Chem, 275,:9513-19520). Although both SphKl and SphK2
contribute to
total cellular SphK activity, these two isoforms demonstrate distinct enzyme
kinetics and
expression patterns (Kohama et al., 1998, JBiol Chem, 273:23722-23728; Liu et
al., 2000,
supra). While SphKl is described as a cytoplasmic enzyme, SphK2 was found to
localize
in the nuclei through its nuclear localization signal sequence (Igarashi et
al., 2003, JBiol
Cheni, 278:46832-46839). Additional functional distinctions between Sphkl and
Sphk2 are
also evident. For example, Sphkl enhances cell survival and proliferation,
whereas Sphk2
inhibits DNA synthesis (Liu et al., 2000, supra) and induces apoptosis
potentially through
a BH3 domain and Bcl-xL interactions (Liu et al., 2003, JBiol Chem, 278:40330-
40336).
A recent study using Drosophila SphK, suggests that SphK2 is the more
primitive of the
two mammalian enzymes involved in sphingolipid catabolism (Herr et al., 2004,
JBiol
Chem, 279:12685-12694). As there is no evidence that SphK2 expression or
activity are
regulated, the ability of SphKl to be regulated at both transcriptional and
post-
transcriptional levels in response to a variety of physiological stimuli may
be a relatively
recent evolutionary step, facilitating a signaling role in mammalian cells.
Accordingly, as detailed above, although the central role of sphingosine
kinase in the
context of its regulation of a wide variety of cellular activities is well
established, the
precise mechanisms by which this occurs have been only partially determined.
Accordingly, there is an ongoing need to both elucidate those mechanisms and
identify
molecules which can regulate those mechanisms in order to provide better means
for
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-5-
developing methods of regulating cellular activities via regulation of the
sphingosine
kinase signalling pathway.
In work leading up to the present invention it has been determined that the
interaction of
sphingosine kinase with eEF1A results in an increase in the intrinsic
catalytic activity of
sphingosine kinase. Still further, it has been determined that to effect
binding to
sphingosine kinase, the subject eEF1A must not be GTP bound. In fact, a
truncated form
of eEF 1 A which cannot be bound to GTP, corresponding to prostate tumour
inducer (PTI),
continues to exhibit sphingosine kinase binding activity and the capacity to
increase its
catalytic activity. The identification of this cellular signalling mechanism
has now enabled
the development of simple and streamlined methods of modulating, in particular
upregulating, sphingosine kinase mediated cellular functioning based on
modulating the
interaction of sphingosine kinase with eEF1A molecules. Accordingly, this has
provided
for the development of highly effective methods for therapeutically or
prophylactically
treating conditions characterised by unwanted or inappropriate cellular
functioning.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-6-
SUMMARY OF THE INVENTION
Throughout this specification and the claims which follow, unless the context
requires
otherwise, the word "comprise", and variations such as "comprises" and
"comprising",
will be understood to imply the inclusion of a stated integer or step or group
of integers or
steps but not the exclusion of any other integer or step or group of integers
or steps.
The subject specification contains nucleotide sequence information prepared
using the
programme PatentIn Version 3.1, presented herein after the bibliography. Each
nucleotide
sequence is identified in the sequence listing by the numeric indicator <201>
followed by
the sequence identifier (eg. <210>1, <210>2, etc). The length, type of
sequence (DNA,
etc) and source organism for each nucleotide sequence is indicated by
information
provided in the numeric indicator fields <211>, <212> and <213>, respectively.
Nucleotide sequences referred to in the specification are identified by the
indicator SEQ ID
NO: followed by the sequence identifier (eg. SEQ ID NO:1, SEQ ID NO:2, etc.).
The
sequence identifier referred to in the specification correlates to the
information provided in
numeric indicator field <400> in the sequence listing, which is followed by
the sequence
identifier (eg. <400>1, <400>2, etc). That is SEQ ID NO:1 as detailed in the
specification
correlates to the sequence indicated as <400>1 in the sequence listing.
One aspect of the present invention provides a method of modulating
sphingosine kinase
mediated signalling, said method comprising contacting sphingosine kinase with
an
effective amount of an agent for a time and under conditions sufficient to
modulate the
interaction of sphingosine kinase with eEF 1 A or functional derivative,
variant, homologue
or mimetic thereof wherein inducing or otherwise agonising said association
upregulates
sphingosine kinase catalytic activity and inhibiting or otherwise antagonising
said
association downregulates said catalytic activity.
Another aspect of the present invention provides a method of modulating
sphingosine
kinase 1 mediated signalling, said method comprising contacting sphingosine
kinase with
an effective amount of an agent for a time and under conditions sufficient to
modulate the
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-7-
interaction of sphingosine kinase 1 with eEF 1 A or functional derivative,
homologue or
mimetic thereof wherein inducing or otherwise agonising said association
upregulates
sphingosine kinase 1 catalytic activity and inhibiting or otherwise
antagonising said
association downregulates said catalytic activity.
Yet another aspect of the present invention provides a method of modulating
sphingosine
kinase mediated signalling, said method comprising contacting sphingosine
kinase with an
effective amount of an agent for a time and under conditions sufficient to
modulate the
interaction of sphingosine kinase with truncated eEF1A1 or derivative,
homologue or
mimetic thereof wherein inducing or otherwise agonising said association
upregulates
sphingosine kinase catalytic activity and inhibiting or otherwise antagonising
said
association downregulates said catalytic activity.
Still another aspect of the present invention provides a method of
upregulating sphingosine
kinase mediated signalling, said method comprising contacting sphingosine
kinase with an
effective amount of eEF 1 A or functional derivative, homologue or mimetic
thereof for a
time and under conditions sufficient to induce the interaction of sphingosine
kinase with
eEF 1 A and thereby upregulate sphingosine kinase catalytic activity.
Yet still another aspect of the present invention is directed to a method of
modulating
cellular activity, said method comprising contacting said cell with an
effective amount of
an agent for a time and under conditions sufficient to modulate the
interaction of
sphingosine kinase with eEF1A or functional derivative, homologue or mimetic
thereof
wherein inducing or otherwise agonising said association up-regulates said
cellular activity
and inhibiting or otherwise antagonising said association down-regulates said
cellular
activity.
Still yet another aspect of the present invention is directed to a method of
modulating
cellular activity, said method comprising contacting said cell with an
effective amount of
an agent for a time and under conditions sufficient to modulate the
interaction of
sphingosine kinase 1 with eEF1A or functional derivative, homologue or mimetic
thereof
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-8-
wherein inducing or otherwise agonising said association up-regulates said
cellular activity
and inhibiting or otherwise antagonising said association down-regulates said
cellular
activity.
A further aspect of the present invention is directed to a method of
modulating human
cellular activity, said method comprising contacting said cell with an
effective amount of
an agent for a time and under conditions sufficient to modulate the
interaction of
sphingosine kinase with tr.eEF1A1 wherein inducing or otherwise agonising said
association up-regulates said human cellular activity and inhibiting or
otherwise
antagonising said association down-regulates said human cellular activity.
Still another further aspect of the present invention is directed to a method
for the
treatment and/or prophylaxis of a condition in a mammal, which condition is
characterised
by aberrant, unwanted or otherwise inappropriate cellular activity, said
method comprising
administering to said mammal an effective amount of an agent for a time and
under
conditions sufficient to modulate the interaction of sphingosine kinase with
eEF1A or
functional derivative, homologue or mimetic thereof wherein inducing or
otherwise
agonising said association up-regulates said cellular activity and inhibiting
or otherwise
antagonising said association down-regulates said cellular activity.
Yet another further aspect of the present invention is directed to a method
for the treatment
and/or prophylaxis of a condition in a mammal, which condition is
characterised by
aberrant, unwanted or otherwise inappropriate sphingosine kinase functional
activity, said
method comprising administering to said mammal an effective amount of an agent
for a
time and under conditions sufficient to modulate interaction of sphingosine
kinase with
eEF1A or functional derivative, homologue or mimetic thereof wherein inducing
or
otherwise agonising said association up-regulates said sphingosine kinase
activity and
inhibiting or otherwise antagonising said association down-regulates said
sphingosine
kinase activity.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-9-
Still yet another fiirther aspect of the present invention is directed to a
method for the
treatment and/or prophylaxis of a condition in a human, which condition is
characterised
by aberrant, unwanted or otherwise inappropriate cellular activity, said
method comprising
administering to said human an effective amount of an agent for a time and
under
conditions sufficient to modulate the interaction of sphingosine kinase with
tr.eEF1A1,
wherein inducing or otherwise agonising said interaction up-regulates said
cellular activity
and inhibiting or otherwise antagonising said interaction down-regulates said
cellular
activity.
Yet still another further aspect of the present invention is directed to a
method for the
treatment and/or prophylaxis of a condition in a human, which condition is
characterised
by aberrant, unwanted or otherwise inappropriate sphingosine kinase functional
activity,
said method comprising administering to said human an effective amount of an
agent for a
time and under conditions sufficient to modulate the interaction of
sphingosine kinase with
tr.eEF1A1 wherein inducing or otherwise agonising said interaction up-
regulates said
sphingosine kinase functional activity and inhibiting or otherwise
antagonising said
interaction down-regulates said sphingosine kinase functional activity.
Another aspect of the present invention contemplates the use of an agent, as
hereinbefore
defined, in the manufacture of medicament for the treatment of a condition in
a mammal,
which condition is characterised by aberrant, unwanted or otherwise
inappropriate cellular
activity, wherein said agent modulates the interaction of sphingosine kinase
and wherein
inducing or otherwise agonising said interaction up-regulates said cellular
activity and
inhibiting or otherwise antagonising said interaction down-regulates said
cellular activity.
Still another aspect of the present invention contemplates the use of an
agent, as
hereinbefore defined, in the manufacture of medicament for the treatment of a
condition in
a mammal, which condition is characterised by aberrant, unwanted or otherwise
inappropriate sphingosine kinase functional activity, wherein said agent
modulates the
interaction of sphingosine kinase with eEF1A or functional derivative,
homologue or
mimetic thereof and wherein inducing or otherwise agonising said interaction
upregulates
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-10-
said sphingosine kinase functional activity and inhibiting or otherwise
antagonising said
interaction downregulates said sphingosine kinase functional activity.
In yet another further aspect, the present invention contemplates a
pharmaceutical
composition comprising the modulatory agent as hereinbefore defined together
with one or
more pharmaceutically acceptable carriers and/or diluents.
Yet another aspect of the present invention relates to the agent as
hereinbefore defined,
when used in the method of the present invention.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-11-
DETAILED DESCRIPTION OF THE INVENTION
The present invention is predicated, in part, on both the determination that
eEF1A
molecules upregulate the intrinsic catalytic activity of sphingosine kinase
and the
determination that only the GDP form of eEF1A, including the PTI truncated
form, will
achieve this outcome. These determinations now permit the rational design of
therapeutic
and/or prophylactic methods for treating conditions characterised by aberrant
or unwanted
cellular activity and/or sphingosine kinase functional activity. Further,
there is facilitated
the identification and/or design of agents which specifically modulate the
interaction of
eEF 1 A with sphingosine kinase.
Accordingly, one aspect of the present invention provides a method of
modulating
sphingosine kinase mediated signalling, said method comprising contacting
sphingosine
kinase with an effective amount of an agent for a time and under conditions
sufficient to
modulate the interaction of sphingosine kinase with eEF 1 A or functional
derivative,
variant, homologue or mimetic thereof wherein inducing or otherwise agonising
said
association upregulates sphingosine kinase catalytic activity and inhibiting
or otherwise
antagonising said association downregulates said catalytic activity.
Reference to "sphingosine kinase mediated signalling" should be understood as
a reference
to a signalling pathway in which the sphingosine kinase molecule forms a
fiuictional
component. In this regard, it is thought that sphingosine kinase is central to
the generation
of sphingosine-l-phosphate during activation of this pathway. It should be
understood that
modulation of sphingosine kinase mediated signalling encompasses both up and
downregulation of the signalling events, for example the induction or
cessation of a given
signalling event or a change to the level or degree of any given signalling
event.
In accordance with the present invention antagonising the interaction of
sphingosine kinase
with eEF 1 A (for example, where this interaction has either occurred
naturally by virtue of
endogenously expressed eEFlA or has resulted from a non-natural event such as
the
administration of a treatment protocol) prevents the completion of a
sphingosine kinase
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-12-
mediated signalling event while agonising or otherwise inducing the
interaction of
sphingosine kinase with eEF1A promotes sphingosine kinase mediated signalling.
It
should also be understood that the degree or level of a sphingosine kinase
mediated
signalling event can be modulated by increasing or decreasing the
concentration of
interacting molecules. Accordingly, the modulation of signalling need not
necessarily
equate to the onset or inhibition of signalling but may be designed to
regulate the level of
sphingosine kinase mediated signalling which occurs.
Reference to "sphingosine kinase" should be understood to include reference to
all forms
of sphingosine kinase protein and derivatives, variants, homologues or
mimetics thereof.
In this regard, "sphingosine kinase" should be understood as being a molecule
which is,
inter alia, involved in the generation of sphingosine-l-phosphate during
activation of the
sphingosine kinase signalling pathway. This includes, for example, all protein
forms of
sphingosine kinase and its functional derivatives, variants, homologues or
mimetics
thereof, including, for example, any isoforms which arise from alternative
splicing of
sphingosine kinase mRNA or allelic or polymorphic variants of sphingosine
kinase.
Without limiting the present invention to any one theory or mode of action,
two human
sphingosine kinase isoforms exist (1 and 2), which differ in their tissue
distribution,
developmental expression, catalytic properties, and somewhat in their
substrate specificity
(Pitson et al., 2000, supra; Liu et al., 2000, supra). A number of studies
have shown the
effects of sphingosine kinase 1 in enhancing cell proliferation and
suppressing apoptosis
(Olivera et al., 1999, supra; Xia et al., 2000, supra; Edsall et al., 2001,
supra).
Furthermore, overexpression of human sphingosine kinase 1(hSKl) in NIH3T3
fibroblasts
has been shown to result in acquisition of the transformed phenotype and the
ability to
form tumors in nude mice, demonstrating the oncogenic potential of this enzyme
(Xia et
al., 2000, supra).
Reference to a "functional" derivative, variant, homologue or mimetic thereof
should be
understood as a reference to a molecule which exhibits any one or more of the
functional
activities of sphingosine kinase or eEF1A.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-13-
Preferably, the present invention provides a method of modulating sphingosine
kinase 1
mediated signalling, said method comprising contacting sphingosine kinase with
an
effective amount of an agent for a time and under conditions sufficient to
modulate the
interaction of sphingosine kinase 1 with eEF1A or functional derivative,
homologue or
mimetic thereof wherein inducing or otherwise agonising said association
upregulates
sphingosine kinase 1 catalytic activity and inhibiting or otherwise
antagonising said
association downregulates said catalytic activity.
Reference to "eEF1A" (elongation factor 1 A) should be understood as a
reference to all
forms of this protein. This includes, for example, any isoforms which arise
from
alternative splicing of eEF1A mRNA or functional mutants or polymorphic
variants of this
molecule. Without limiting the present invention to any one theory or mode of
action, the
canonical role of eEF1A resides in the process of mammalian peptide elongation
during
protein synthesis, specifically, the non-ribosomal translation elongation
machinery that
facilitates peptide chain elongation during mRNA translation (Anderson et al.
2003). As
well as this role, however, eEF 1 A has also been implicated in seemingly
unrelated
processes including cytoskeletal rearrangement, cellular signalling and
tumourigenesis.
Two isoforms of eEF1A have been identified in the human, these being eEF1A1
and
eEF1A2 (Ejiri, 2002; Thornton et al. 2003). Both forms can upregulate the
catalytic
activity of sphingosine kinase. Still further, eEF1A functional derivatives,
such as the
truncated version of eEF1A1, which is missing 67 (with the addition of 3) N-
terminal
amino acids) similarly upregulate sphingosine kinase catalytic activity and
therefore fall
within the scope of the definition of "eEF1A". This truncated version of
eEF1A1 is also
known as prostate tumour inducer (PTI) but is herein referred to as truncated
eEF1A1
(tr.eEF 1 A l ).
Still without limiting the present invention in any way, it has been shown
that each of the
two eEF1A isoforms interact with hSKI and directly enhance its activity in
cells and in
vitro approximately three-fold. Notably, the artificial truncated eEF1A1 form
(PTI) also
interacts with hSK1 and enhances its activity, demonstrating that the SK 1 -
interacting and
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-14-
functional region of eEF1A resides in the non-GTP binding region of eEF1A1.
Although
the molecular mechanism whereby eEF1A mediates this enhanced sphingosine
kinase
activity is not currently known, substrate kinetic analysis indicates that
this effect results
from a direct increase in the catalytic efficiency of sphingosine kinase,
rather than an
alteration in its affinity for either ATP or sphingosine. The involvement of
the guanidine
nucleotide bound state of eEF1A is another possibility for regulating the
interaction and
effect of eEF 1 A on sphingosine kinase. In cells, eEF 1 A(which contains a
Ras-like G
protein domain) exists in either GTP or GDP bound forms (Ejiri, 2002).
Transition
between these two forms results in a large conformational change in eEF1A
(Ejiri, 2002).
Like the small G proteins, the GTP/GDP bound state of eEF 1 A is actively
regulated by its
GTPase activity, as well as specific guanine nucleotide exchange factors
(GEFs) and
guanidine nucleotide dissociation inhibitors (GDIs) (Cans et al., 2003). It
has been found
that the guanidine nucleotide bound state of eEF 1 A, while not affecting its
interaction with
sphingosine kinase, does modulate the effect of eEF1A on the catalytic
activity of
sphingosine kinase. Thus, this represents a novel mechanism to dynamically
regulate the
effect of eEF 1 A on cellular sphingosine kinase activity. In contrast, GTP
bound eEF 1 A
had no effect on SK1 or SK2 activity. Consistent with this finding, the PTI
truncated form
of eEF1A1, lacking much of the G protein domain and therefore unable to bind
GTP,
retains the ability to bind sphingosine kinase and enhance its catalytic
activity.
The present invention therefore more particularly provides a method of
modulating
sphingosine kinase mediated signalling, said method comprising contacting
sphingosine
kinase with an effective amount of an agent for a time and under conditions
sufficient to
modulate the interaction of sphingosine kinase with truncated eEF1A1 or
derivative,
homologue or mimetic thereof wherein inducing or otherwise agonising said
association
upregulates sphingosine kinase catalytic activity and inhibiting or otherwise
antagonising
said association downregulates said catalytic activity.
Preferably, said sphingosine kinase is sphingosine kinase 1 or 2 and most
preferably
sphingosine kinase 1.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
- 15-
Most preferably, said sphingosine kinase mediated signalling is upregulated by
inducing or
agonising the interaction of sphingosine kinase with eEF1A or truncated eEF1A1
or
derivative, homologue or mimetic thereof.
Elucidation of both the role of eEF1A as an upregulator of the catalytic
activity of
sphingosine kinase and the region of interaction between these two molecules
now
provides a means for modulating sphingosine kinase mediated cellular activity.
By
"modulated" is meant upregulated or downregulated. For example, inducing or
otherwise
agonising the interaction of sphingosine kinase with eEF1A provides a means of
increasing
the level, degree or rate at which the signalling event occurs, in addition to
including
reference to inducing the subject signalling event thereby effectively
inducing,
upregulating or sustaining the subject cellular activity. Conversely, to the
extent that a
eEF 1 A mediated sphingosine kinase signalling event is unwanted (for example,
where it is
sought to reduce or terminate a treatment protocol by virtue of which a
patient was
administered eEF 1 A or where it is sought to downregulate a naturally
occurring
interaction) the present invention extends to decreasing the level, degree or
rate at which
the signalling event occurs, in addition to including reference to ablating
the subject
signalling event, thereby effectively ablating or downregulating the subject
cellular
activity. Accordingly, the agent which is utilised in accordance with the
method of the
present invention may be an agent which induces the subject event, agonises an
event
which has already undergone onset, antagonises a pre-existing event or
entirely prevents
the onset of such an event.
Reference to "inducing or otherwise agonising" should be understood as a
reference to:
(i) inducing the interaction of sphingosine kinase with eEF 1 A, in particular
the region
corresponding to truncated eEF1A1; or
(ii) up-regulating, enhancing or otherwise agonising a sphingosine
kinase/eEF1A
interaction subsequently to its initial induction.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-16-
Conversely, "inhibiting or otherwise antagonising" the interaction of
sphingosine kinase
with eEF 1 A, in particular the region corresponding to tr.eEF 1 A 1 is a
reference to:
(i) preventing the interaction of sphingosine kinase with eEF1A (for example,
in the
context of a prophylactic capacity where endogeneous eEF1A is known to
upregulate sphingosine kinase activity); or
(ii) antagonising an existing interaction of sphingosine kinase with eEF 1 A
such that it
is ineffective or less effective.
It should be understood that modulation of the interaction between sphingosine
kinase and
eEF 1 A (either in the sense of up-regulation or down-regulation) may be
partial or
complete. Partial modulation occurs where only some of the sphingosine
kinase/eEF1A
interactions which may normally occur in a given cell are affected by the
method of the
present invention (for example, the agent which is contacted with the subject
cell is
provided in a concentration insufficient to saturate the intracellular
sphingosine
kinase/eEF1A interactions) while complete modulation occurs where all
sphingosine
kinase/eEF1A interactions are modulated.
Modulation of the interaction between sphingosine kinase and eEF1A may be
achieved by
any one of a number of techniques including, but not limited to:
(i) introducing into a cell a nucleic acid molecule encoding eEF1A or
derivative,
homologue or mimetic thereof or introducing the proteinaceous form of eEF 1 A
or
derivative, homologue or mimetic thereof in order to modulate the
intracellular
concentrations of eEF1A which is available for signalling purposes.
(ii) introducing into a cell a proteinaceous or non-proteinaceous molecule
which
modulates the transcriptional and/or translational regulation of the eEF1A
gene.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-17-
(iii) introducing into a cell a proteinaceous or non-proteinaceous molecule
which
antagonises the interaction between a eEF1A and sphingosine kinase, such as a
competitive inhibiter or antibody.
(iv) introducing into a cell a proteinaceous or non-proteinaceous molecule
which
agonises the interaction between eEF 1 A and sphingosine kinase.
Reference to "agent" should be understood as a reference to any proteinaceous
or non-
proteinaceous molecule which modulates the interaction of sphingosine kinase
with eEF1A
and includes, for example, the molecules detailed in points (i) - (iv), above.
The subject
agent may be linked, bound or otherwise associated with any proteinaceous or
non-
proteinaceous molecule. For example, it may be associated with a molecule
which permits
its targeting to a localised region. In a preferred embodiment, the subject
agent is eEF1A
itself, or functional derivative, homologue or mimetic thereof, which is
introduced to
upregulate sphingosine kinase activation.
According to this preferred embodiment, there is therefore provided a method
of
upregulating sphingosine kinase mediated signalling, said method comprising
contacting
sphingosine kinase with an effective amount of eEF 1 A or functional
derivative,
homologue or mimetic thereof for a time and under conditions sufficient to
induce the
interaction of sphingosine kinase with eEF1A and thereby upregulate
sphingosine kinase
catalytic activity.
Said proteinaceous molecule may be derived from natural, recombinant or
synthetic
sources including fusion proteins or following, for example, natural product
screening.
Said non-proteinaceous molecule may be derived from natural sources, such as
for
example natural product screening or may be chemically synthesised. For
example, the
present invention contemplates chemical analogues of eEF 1 A capable of acting
as agonists
or antagonists of the sphingosine kinase interaction. Chemical agonists may
not
necessarily be derived from sphingosine kinase or eEF1A but may share certain
conformational similarities. Alternatively, chemical agonists may be
specifically designed
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-15-
to mimic or upregulate certain physiochemical properties of sphingosine kinase
or eEF 1 A.
Antagonists may be any compound capable of blocking, inhibiting or otherwise
preventing
sphingosine kinase and eEF 1 A from interacting. Antagonists include
antibodies (such as
monoclonal and polyclonal antibodies) specific for sphingosine kinase or
eEF1A, or parts
of said sphingosine kinase or eEF 1 A. Reference to antagonists also includes
antigens
which competitively inhibit sphingosine kinase/eEF 1 A interaction, siRNA,
antisense
molecules, ribozymes, DNAzymes, RNA aptamers, or molecules suitable for use in
co-
suppression. The proteinaceous and non-proteinaceous molecules referred to in
points (i)-
(iv), above, are herein collectively referred to as "modulatory agents".
Screening for the modulatory agents hereinbefore defined can be achieved by
any one of
several suitable methods including, but in no way limited to, contacting a
cell comprising
sphingosine kinase and eEF 1 A with an agent and screening for the modulation
of
sphingosine kinase/eEF1A functional activity (such as a specific cellular
activity) or
modulation of the activity or expression of a downstream sphingosine kinase or
eEF 1 A
cellular target. Detecting such modulation can be achieved utilising
techniques such as
Western blotting, electrophoretic mobility shift assays and/or the readout of
reporters of
sphingosine kinase or eEF1A activity such as luciferases, CAT and the like.
It should be understood that the sphingosine kinase or eEF 1 A protein may be
naturally
occurring in the cell which is the subject of testing or the genes encoding
them may have
been transfected into a host cell for the purpose of testing. Further, the
naturally occurring
or transfected gene may be constitutively expressed - thereby providing a
model useful for,
inter alia, screening for agents which down-regulate sphingosine kinase/eEF1A
interactivity or the gene may require activation - thereby providing a model
useful for,
inter alia, screening for agents which modulate sphingosine kinase/eEF 1 A
interactivity
under certain stimulatory conditions, such as phage-display and yeast two- or
multi-hybrid
screening. Further, to the extent that a sphingosine kinase or eEF1A nucleic
acid molecule
is transfected into a cell, that molecule may comprise the entire sphingosine
kinase or
eEF1A gene or it may merely comprise a portion of the gene such as the eEFlA
region
which binds to sphingosine kinase.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-19-
In another example, the subject of detection could be a downstream sphingosine
kinase
regulatory target, rather than sphingosine kinase itself. Yet another example
includes
sphingosine kinase or eEF1A binding sites ligated to a minimal reporter. For
example,
modulation of sphingosine kinase/eEF 1 A interactivity can be detected by
screening for the
modulation of a downstream signalling component. This is an example of a
system where
modulation of the molecules which sphingosine kinase and eEF1A regulate the
activity of,
are monitored. These methods provide a mechanism for performing high
throughput
screening of putative modulatory agents such as the proteinaceous or non-
proteinaceous
agents comprising synthetic, combinatorial, chemical or natural libraries.
The agents which are utilised in accordance with the method of the present
invention may
take any suitable form. For example, proteinaceous agents may be glycosylated
or
unglycosylated, phosphorylated or dephosphorylated to various degrees and/or
may
contain a range of other molecules fused, linked, bound or otherwise
associated with the
proteins such as amino acids, lipids, carbohydrates or other peptides,
polypeptides or
proteins. Similarly, the subject non-proteinaceous molecules may also take any
suitable
form. Both the proteinaceous and non-proteinaceous agents herein described may
be
linked, bound otherwise associated with any other proteinaceous or non-
proteinaceous
molecules. For example, in one embodiment of the present invention said agent
is
associated with a molecule which permits its targeting to a localised region,
such as a
specific tissue.
The term "expression" refers to the transcription and translation of a nucleic
acid molecule.
Reference to "expression product" is a reference to the product produced from
the
transcription and translation of a nucleic acid molecule. Reference to
"modulation" should
be understood as a reference to upregulation or downregulation.
"Derivatives" of the molecules herein described (for example sphingosine
kinase, eEF1A
or other proteinaceous or non-proteinaceous agents) include fragments, parts,
portions or
variants from either natural or non-natural sources. Non-natural sources
include, for
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-20-
example, recombinant or synthetic sources. By "recombinant sources" is meant
that the
cellular source from which the subject molecule is harvested has been
genetically altered.
This may occur, for example, in order to increase or otherwise enhance the
rate and
volume of production by that particular cellular source. Parts or fragments
include, for
example, active regions of the molecule. Derivatives may be derived from
insertion,
deletion or substitution of amino acids. Amino acid insertional derivatives
include amino
and/or carboxylic terminal fusions as well as intrasequence insertions of
single or multiple
amino acids. Insertional amino acid sequence variants are those in which one
or more
amino acid residues are introduced into a predetermined site in the protein
although
random insertion is also possible with suitable screening of the resulting
product.
Deletional variants are characterised by the removal of one or more amino
acids from the
sequence. Substitutional amino acid variants are those in which at least one
residue in a
sequence has been removed and a different residue inserted in its place.
Additions to
amino acid sequences include fusions with other peptides, polypeptides or
proteins, as
detailed above.
Derivatives also include fragments having particular epitopes or parts of the
entire protein
fused to peptides, polypeptides or other proteinaceous or non-proteinaceous
molecules.
For example, sphingosine kinase, eEF1A or derivative thereof may be fused to a
molecule
in order to facilitate cell membrane localisation. Analogs of the molecules
contemplated
herein include, but are not limited to, modification to side chains,
incorporating of
unnatural amino acids and/or their derivatives during peptide, polypeptide or
protein
synthesis and the use of crosslinkers and other methods which impose
conformational
constraints on the proteinaceous molecules or their analogs.
Derivatives of nucleic acid sequences which may be utilised in accordance with
the
method of the present invention may similarly be derived from single or
multiple
nucleotide substitutions, deletions and/or additions including fusion with
other nucleic acid
molecules. The derivatives of the nucleic acid molecules utilised in the
present invention
include oligonucleotides, PCR primers, antisense molecules, molecules suitable
for use in
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-21-
cosuppression and fusion of nucleic acid molecules. Derivatives of nucleic
acid sequences
also include degenerate variants.
A "variant" of sphingosine kinase or eEF1A should be understood to mean a
molecule
which exhibits at least some of the functional activity of the form of
sphingosine kinase or
eEF1A of which it is a variant. A variation may take any form and may be
naturally or
non-naturally occurring. A mutant molecule is one which exhibits modified
functional
activity.
By "homologue" is meant that the molecule is derived from a species other than
that which
is being treated in accordance with the method of the present invention.
"Mimetics" should be understood as molecules exhibiting any one or more of the
functional activities of the subject molecule, which functional equivalents
may be derived
from any source such as being chemically synthesised or identified via
screening processes
such as natural product screening. For example chemical or functional
equivalents can be
designed and/or identified utilising well known methods such as combinatorial
chemistry
or high throughput screening of recombinant libraries or following natural
product
screening. These methods may also be utilised to screen for any of the
modulatory agents
which are useful in the method of the present invention.
For example, libraries containing small organic molecules may be screened,
wherein
organic molecules having a large number of specific parent group substitutions
are used.
A general synthetic scheme may follow published methods (eg., Bunin et al.
(1994) Proc.
Natl. Acad. Sci. USA, 91:4708-4712; DeWitt et al. (1993) Proc. Natl. Acad.
Sci. USA,
90:6909-6913). Briefly, at each successive synthetic step, one of a plurality
of different
selected substituents is added to each of a selected subset of tubes in an
array, with the
selection of tube subsets being such as to generate all possible permutation
of the different
substituents employed in producing the library. One suitable permutation
strategy is
outlined in US. Patent No. 5,763,263.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-22-
There is currently widespread interest in using combinational libraries of
random organic
molecules to search for biologically active compounds (see for example U.S.
Patent No.
5,763,263). Ligands discovered by screening libraries of this type may be
useful in
mimicking or blocking natural ligands or interfering with the naturally
occurring ligands of
a biological target. In the present context, for example, they may be used as
a starting
point for developing sphingosine kinase/eEF1A agonists or antagonists.
Sphingosine
kinase and/or eEF1A or a relevant part thereof may, according to the present
invention, be
used in combination libraries formed by various solid-phase or solution-phase
synthetic
methods (see for example U.S. Patent No. 5,763,263 and references cited
therein). By use
of techniques, such as that disclosed in U.S. Patent No. 5,753,1 87, millions
of new
chemical and/or biological compounds may be routinely screened in less than a
few weeks.
Of the large number of compounds identified, only those exhibiting appropriate
biological
activity are further analysed.
With respect to high throughput library screening methods, oligomeric or small-
molecule
library compounds capable of interacting specifically with a selected
biological agent, such
as a biomolecule, a macromolecule complex, or cell, are screened utilising a
combinational
library device which is easily chosen by the person of skill in the art from
the range of
well-known methods, such as those described above. In such a method, each
member of
the library is screened for its ability to interact specifically with the
selected agent. In
practising the method, a biological agent is drawn into compound-containing
tubes and
allowed to interact with the individual library compound in each tube. The
interaction is
designed to produce a detectable signal that can be used to monitor the
presence of the
desired interaction. Preferably, the biological agent is present in an aqueous
solution and
further conditions are adapted depending on the desired interaction. Detection
may be
performed for example by any well-known functional or non-functional based
method for
the detection of substances.
"Analogues" of sphingosine kinase, eEF1A or agonistic or antagonistic agents
contemplated herein include, but are not limited to, modifications to side
chains,
incorporating unnatural amino acids and/or derivatives during peptide,
polypeptide or
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-23-
protein synthesis and the use of crosslinkers and other methods which impose
conformational constraints on the analogues. The specific form which such
modifications
can take will depend on whether the subject molecule is proteinaceous or non-
proteinaceous. The nature and/or suitability of a particular modification can
be routinely
determined by the person of skill in the art.
For example, examples of side chain modifications contemplated by the present
invention
include modifications of amino groups such as by reductive alkylation by
reaction with an
aldehyde followed by reduction with NaBH4; amidination with methylacetimidate;
acylation with acetic anhydride; carbamoylation of amino groups with cyanate;
trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic
acid (TNBS);
acylation of amino groups with succinic anhydride and tetrahydrophthalic
anhydride; and
pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with
NaBH4.
The guanidine group of arginine residues may be modified by the formation of
heterocyclic condensation products with reagents such as 2,3-butanedione,
phenylglyoxal
and glyoxal.
The carboxyl group may be modified by carbodiimide activation via 0-
acylisourea
formation followed by subsequent derivatisation, for example, to a
corresponding amide.
Sulphydryl groups may be modified by methods such as carboxymethylation with
iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid;
formation of a
mixed disulphides with other thiol compounds; reaction with maleimide, maleic
anhydride
or other substituted maleimide; formation of mercurial derivatives using
4-chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury
chloride,
2-chloromercuri-4-nitrophenol and other mercurials; carbamoylation with
cyanate at
alkaline pH.
Tryptophan residues may be modified by, for example, oxidation with
N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-
nitrobenzyl
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-24-
bromide or sulphenyl halides. Tyrosine residues on the other hand, may be
altered by
nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
Modification of the imidazole ring of a histidine residue may be accomplished
by
alkylation with iodoacetic acid derivatives or N-carboethoxylation with
diethylpyrocarbonate.
Examples of incorporating unnatural amino acids and derivatives during protein
synthesis
include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-
amino-3-
hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine,
norvaline,
phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid,
2-thienyl
alanine and/or D-isomers of amino acids. A list of unnatural amino acids
contemplated
herein is shown in Table 1.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
- 25 -
TABLE 1
Non-conventional Code Non-conventional Code
amino acid amino acid .
a-aminobutyric acid Abu L-N-methylalanine Nmala
a-amino-a-methylbutyrate Mgabu L-N-methylarginine Nmarg
aminocyclopropane- Cpro L-N-methylasparagine Nmasn
carboxylate L-N-methylaspartic acid Nmasp
aminoisobutyric acid Aib L-N-methylcysteine Nmcys
aminonorbornyl- Norb L-N-methylglutamine Nmgln
carboxylate L-N-methylglutamic acid Nmglu
cyclohexylalanine Chexa L-N-methylhistidine Nmhis
cyclopentylalanine Cpen L-N-methylisolleucine Nmile
D-alanine Dal L-N-methylleucine Nmleu
D-arginine Darg L-N-methyllysine Nmlys
D-aspartic acid Dasp L-N-methylmethionine Nmmet
D-cysteine Dcys L-N-methylnorleucine Nmnle
D-glutamine Dgln L-N-methylnorvaline Nmnva
D-glutamic acid Dglu L-N-methylornithine Nmorn
D-histidine Dhis L-N-methylphenylalanine Nmphe
D-isoleucine Dile L-N-methylproline Nmpro
D-leucine Dleu L-N-methylserine Nmser
D-lysine Dlys L-N-methylthreonine Nmthr
D-methionine Dmet L-N-methyltryptophan Nmtrp
D-ornithine Dorn L-N-methyltyrosine Nmtyr
D-phenylalanine Dphe L-N-methylvaline Nmval
D-proline Dpro L-N-methylethylglycine Nmetg
D-serine Dser L-N-methyl-t-butylglycine Nmtbug
D-threonine Dthr L-norleucine Nle
D-tryptophan Dtrp L-norvaline Nva
D-tyrosine Dtyr a-methyl-aminoisobutyrate Maib
D-valine Dval a-methyl- -aminobutyrate Mgabu
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-26-
D-a-methylalanine Dmala a-methylcyclohexylalanine Mchexa
D-a-methylarginine Dmarg a-methylcylcopentylalanine Mcpen
D-a-methylasparagine Dmasn a-methyl-a-napthylalanine Manap
D-a-methylaspartate Dmasp a-methylpenicillamine Mpen
D-a-methylcysteine Dmcys N-(4-aminobutyl)glycine Nglu
D-a-methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg
D-a-methylhistidine Dmhis N-(3-aminopropyl)glycine Norn
D-a-methylisoleucine Dmile N-amino-a-methylbutyrate Nmaabu
D-a-methylleucine Dmleu a-napthylalanine Anap
D-a-methyllysine Dmlys N-benzylglycine Nphe
D-a-methylmethionine Dmmet N-(2-carbamylethyl)glycine Ngln
D-a-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn
D-a-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine Nglu
D-a-methylproline Dmpro N-(carboxymethyl)glycine Nasp
D-a-methylserine Dmser N-cyclobutylglycine Ncbut
D-a-methylthreonine Dmthr N-cycloheptylglycine Nchep
D-a-methyltryptophan Dmtrp N-cyclohexylglycine Nchex
D-a-methyltyrosine Dmty N-cyclodecylglycine Ncdec
D-a-methylvaline Dmval N-cylcododecylglycine Ncdod
D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct
D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro
D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund
D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm
D-N-methylcysteine Dnmcys N-(3,3-diphenylpropyl)glycine Nbhe
D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg
D-N-methylglutamate Dnmglu N-(1-hydroxyethyl)glycine Nthr
D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser
D-N-methylisoleucine Dnmile N-(imidazolylethyl))glycine Nhis
D-N-methylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp
D-N-methyllysine Dnmlys N-methyl-y-aminobutyrate Nmgabu
N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet
D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-27-
N-methylglycine Nala D-N-methylphenylalanine Dnmphe
N-methylaminoisobutyrate Nmaib D-N-methylproline Dnmpro
N-(1-methylpropyl)glycine Nile D-N-methylserine Dnmser
N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr
D-N-methyltryptophan Dnmtrp N-(1-methylethyl)glycine Nval
D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap
D-N-methylvaline Dnmval N-methylpenicillamine Nmpen
y-aminobutyric acid Gabu N-(p-hydroxyphenyl)glycine Nhtyr
L-t-butylglycine Tbug N-(thiomethyl)glycine Ncys
L-ethylglycine Etg penicillamine Pen
L-homophenylalanine Hphe L-a-methylalanine Mala
L-a-methylarginine Marg L-a-methylasparagine Masn
L-a-methylaspartate Masp L-a-methyl-t-butylglycine Mtbug
L-a-methylcysteine Mcys L-methylethylglycine Metg
L-a-methylglutamine Mgln L-a-methylglutamate Mglu
L-a-methylhistidine Mhis L-a-methylhomophenylalanine Mhphe
L-a-methylisoleucine Mile N-(2-methylthioethyl)glycine Nmet
L-a-methylleucine Mleu L-a-methyllysine Mlys
L-a-methylmethionine Mmet L-a-methylnorleucine Mnle
L-a-methylnorvaline Mnva L-a-methylornithine Morn
L-a-methylphenylalanine Mphe L-a-methylproline Mpro
L-a-methylserine Mser L-a-methylthreonine Mthr
L-a-methyltryptophan Mtrp L-a-methyltyrosine Mtyr
L-a-methylvaline Mval L-N-methylhomophenylalanine Nmhphe
N-(N-(2,2-diphenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe
carbamylmethyl)glycine carbamylmethyl)glycine
1-carboxy-l-(2,2-diphenyl-Nmbc
ethylamino)cyclopropane
Crosslinkers can be used, for example, to stabilise 3D confornlations, using
homo-
bifunctional crosslinkers such as the bifunctional imido esters having (CHZ)n
spacer groups
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-28-
with n=1 to n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-
bifunctional
reagents which usually contain an amino-reactive moiety such as N-
hydroxysuccinimide
and another group specific-reactive moiety.
It should be understood that the method of the present invention may be
performed in the
context of a cellular source which is located either in vitro or in vivo.
Since sphingosine kinase is a molecule which is central to the functioning of
an
intracellular signalling pathway, the method of the present invention provides
a means of
modulating cellular activity which is regulated or controlled by sphingosine
kinase
signalling. For example, the sphingosine kinase signalling pathway is known to
regulate
cellular activities, such as those which lead to inflammation, cellular
transformation,
apoptosis, cell proliferation, up-regulation of the production of inflammatory
mediators
such as cytokines, chemokines, eNOS and up-regulation of adhesion molecule
expression.
Said up-regulation may be induced by a number of stimuli including, for
example,
inflammatory cytokines such as tumour necrosis factor a and interleukin 1,
endotoxin,
oxidised or modified lipids, radiation or tissue injury. In this regard,
reference to
"modulating cellular activity" is a reference to up-regulating, down-
regulating or otherwise
altering any one or more of the activities which a cell is capable of
performing pursuant to
sphingosine kinase signalling such as, but not limited, one or more of
chemokine
production, cytokine production, nitric oxide synthesis, adhesion molecule
expression and
production of other inflammatory modulators. Although the preferred method is
to down-
regulate sphingosine kinase activity, thereby down-regulating unwanted
cellular activity,
the present invention should nevertheless be understood to encompass up-
regulating of
cellular activity, which may be desirable in certain circumstances.
Accordingly, yet another aspect of the present invention is directed to a
method of
modulating cellular activity, said method comprising contacting said cell with
an effective
amount of an agent for a time and under conditions sufficient to modulate the
interaction of
sphingosine kinase with eEF1A or functional derivative, homologue or mimetic
thereof
wherein inducing or otherwise agonising said association up-regulates said
cellular activity
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-29-
and inhibiting or otherwise antagonising said association down-regulates said
cellular
activity.
Preferably, the present invention is directed to a method of modulating
cellular activity,
said method comprising contacting said cell with an effective amount of an
agent for a
time and under conditions sufficient to modulate the interaction of
sphingosine kinase 1
with eEF 1 A or functional derivative, homologue or mimetic thereof wherein
inducing or
otherwise agonising said association up-regulates said cellular activity and
inhibiting or
otherwise antagonising said association down-regulates said cellular activity.
In a most preferred embodiment the present invention is directed to a method
of
modulating human cellular activity, said method comprising contacting said
cell with an
effective amount of an agent for a time and under conditions sufficient to
modulate the
interaction of sphingosine kinase with tr.eEF1A1 wherein inducing or otherwise
agonising
said association up-regulates said human cellular activity and inhibiting or
otherwise
antagonising said association down-regulates said human cellular activity.
Most preferably, said modulation is upregulation of cellular activity which is
achieved by
inducing or agonising the interaction of sphingosine kinase with eEF1A or
tr.eEF1A1.
Most preferably, said agent is eEF1A or tr.eEF1A1 itself.
A further aspect of the present invention relates to the use of the invention
in relation to the
treatment and/or prophylaxis of disease conditions. Without limiting the
present invention
to any one theory or mode of action, the broad range of cellular functional
activities which
are regulated'via the sphingosine kinase signalling pathway renders the
regulation of
sphingosine kinase functioning an integral component of every aspect of both
healthy and
disease state physiological processes. Accordingly, the method of the present
invention
provides a valuable tool for modulating aberrant or otherwise unwanted
cellular functional
activity which is regulated via the sphingosine kinase signalling pathway.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-30-
Accordingly, yet another aspect of the present invention is directed to a
method for the
treatment and/or prophylaxis of a condition in a mammal, which condition is
characterised
by aberrant, unwanted or otherwise inappropriate cellular activity, said
method comprising
administering to said mammal an effective amount of an agent for a time and
under
conditions sufficient to modulate the interaction of sphingosine kinase with
eEF1A or
functional derivative, homologue or mimetic thereof wherein inducing or
otherwise
agonising said association up-regulates said cellular activity and inhibiting
or otherwise
antagonising said association down-regulates said cellular activity.
Still another aspect of the present invention is directed to a method for the
treatment and/or
prophylaxis of a condition in a mammal, which condition is characterised by
aberrant,
unwanted or otherwise inappropriate sphingosine kinase functional activity,
said method
comprising administering to said mammal an effective amount of an agent for a
time and
under conditions sufficient to modulate interaction of sphingosine kinase with
eEF1A or
functional derivative, homologue or mimetic thereof wherein inducing or
otherwise
agonising said association up-regulates said sphingosine kinase activity and
inhibiting or
otherwise antagonising said association down-regulates said sphingosine kinase
functional
activity.
In a most preferred embodiment, the present invention is directed to a method
for the
treatment and/or prophylaxis of a condition in a human, which condition is
characterised
by aberrant, unwanted or otherwise inappropriate cellular activity, said
method comprising
administering to said human an effective amount of an agent for a time and
under
conditions sufficient to modulate the interaction of sphingosine kinase with
tr.eEF1Al,
wherein inducing or otherwise agonising said interaction up-regulates said
cellular activity
and inhibiting or otherwise antagonising said interaction down-regulates said
cellular
activity.
In another most preferred embodiment, the present invention is directed to a
method for the
treatment and/or prophylaxis of a condition in a human, which condition is
characterised
by aberrant, unwanted or otherwise inappropriate sphingosine kinase functional
activity,
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-31-
said method comprising administering to said human an effective amount of an
agent for a
time and under conditions sufficient to modulate the interaction of
sphingosine kinase with
tr.eEFlAl wherein inducing or otherwise agonising said interaction up-
regulates said
sphingosine kinase functional activity and inhibiting or otherwise
antagonising said
interaction down-regulates said sphingosine kinase functional activity.
Most preferably, said modulation is upregulation and said agent is eEF1A or
tr.eEF1A1 or
functional derivative, homologue or mimetic thereof.
Reference to "aberrant, unwanted or otherwise inappropriate" cellular activity
should be
understood as a reference to overactive cellular activity, to physiologically
normal cellular
activity which is inappropriate in that it is unwanted or to insufficient
cellular activity.
This definition applies in an analogous manner in relation to "aberrant,
unwanted or
otherwise, inappropriate" sphingosine kinase activity. For example, to the
extent that a
cell is neoplastic, it is desirable that the promotion of cellular
proliferation and anti-
apoptotic characteristics be down-regulated. Similarly, diseases which are
characterised
by inflammation, such as rheumatoid arthritis, atherosclerosis, asthma,
autoimmune
disease and inflammatory bowel disease, are known to involve cellular
activation leading
to the synthesis and secretion of inflammatory mediators, such as adhesion
molecules. In
such situations, it is also desirable to down-regulate such activity. In other
situations, it
may be desirable to agonise or otherwise induce sphingosine kinase activation
in order to
stimulate cellular proliferation, for example in order to promote
angiogenesis.
The term "mammal" as used herein includes humans, primates, livestock animals
(eg.
sheep, pigs, cattle, horses, donkeys), laboratory test animals (eg. mice,
rabbits, rats, guinea
pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. foxes,
kangaroos,
deer). Preferably, the mammal is human or a laboratory test animal Even more
preferably,
the mammal is a human.
An "effective amount" means an amount necessary at least partly to attain the
desired
response, or to delay the onset or inhibit progression or halt altogether, the
onset or
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-32-
progression of a particular condition being treated. The amount varies
depending upon the
health and physical condition of the individual to be treated, the taxonomic
group of
individual to be treated, the degree of protection desired, the formulation of
the
composition, the assessment of the medical situation, and other relevant
factors. It is
expected that the amount will fall in a relatively broad range that can be
determined
through routine trials.
Reference herein to "treatment" and "prophylaxis" is to be considered in its
broadest
context. The term "treatment" does not necessarily imply that a subject is
treated until
total recovery. Similarly, "prophylaxis" does not necessarily mean that the
subject will not
eventually contract a disease condition. Accordingly, treatment and
prophylaxis include
amelioration of the symptoms of a particular condition or preventing or
otherwise reducing
the risk of developing a particular condition. The term "prophylaxis" may be
considered
as reducing the severity or onset of a particular condition. "Treatment" may
also reduce
the severity of an existing condition.
The present invention further contemplates a combination of therapies, such as
the
administration of the agent together with subjection of the mammal to other
agents, drugs
or treatments which may be useful in relation to the treatment of the subject
condition such
as cytotoxic agents or radiotherapy in the treatment of cancer.
Administration of the modulatory agent, in the form of a pharmaceutical
composition, may
be perfomled by any convenient means. The modulatory agent of the
pharmaceutical
composition is contemplated to exhibit therapeutic activity when administered
in an
amount which depends on the particular case. The variation depends, for
example, on the
human or animal and the modulatory agent chosen. A broad range of doses may be
applicable. Considering a patient, for example, from about 0.1 mg to about 1
mg of
modulatory agent may be administered per kilogram of body weight per day.
Dosage
regimes may be adjusted to provide the optimum therapeutic response. For
example,
several divided doses may be adniinistered daily, weekly, monthly or other
suitable time
intervals or the dose may be proportionally reduced as indicated by the
exigencies of the
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-33-
situation.
The modulatory agent may be administered in a convenient manner such as by the
oral,
intravenous (where water soluble), intraperitoneal, intramuscular,
subcutaneous,
intradermal or suppository routes or implanting (e.g. using slow release
molecules). The
modulatory agent may be administered in the form of pharmaceutically
acceptable
nontoxic salts, such as acid addition salts or metal complexes, e.g. with
zinc, iron or the
like (which are considered as salts for purposes of this application).
Illustrative of such
acid addition salts are hydrochloride, hydrobromide, sulphate, phosphate,
maleate, acetate,
citrate, benzoate, succinate, malate, ascorbate, tartrate and the like. If the
active ingredient
is to be administered in tablet form, the tablet may contain a binder such as
tragacanth,
corn starch or gelatin; a disintegrating agent, such as alginic acid; and a
lubricant, such as
magnesium stearate.
Routes of administration include, but are not limited to, respiratorally,
intratracheally,
nasopharyngeally, intravenously, intraperitoneally, subcutaneously,
intracranially,
intradermally, intramuscularly, intraoccularly, intrathecally,
intracereberally, intranasally,
infusion, orally, rectally, via IV drip patch and implant.
In accordance with these methods, the agent defined in accordance with the
present
invention may be coadministered with one or more other compounds or molecules.
By
"coadministered" is meant simultaneous administration in the same formulation
or in two
different formulations via the same or different routes or sequential
administration by the
same or different routes. For example, the subject agent may be administered
together
with an agonistic agent in order to enhance its effects. By "sequential"
administration is
meant a time difference of from seconds, minutes, hours or days between the
administration of the two types of molecules. These molecules may be
administered in any
order.
Another aspect of the present invention contemplates the use of an agent, as
hereinbefore
defined, in the manufacture of inedicament for the treatment of a condition in
a mammal,
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-34-
which condition is characterised by aberrant, unwanted or otherwise
inappropriate cellular
activity, wherein said agent modulates the interaction of sphingosine kinase
and wherein
inducing or otherwise agonising said interaction up-regulates said cellular
activity and
inhibiting or otherwise antagonising said interaction down-regulates said
cellular activity.
Still another aspect of the present invention contemplates the use of an
agent, as
hereinbefore defined, in the manufacture of medicament for the treatment of a
condition in
a mammal, which condition is characterised by aberrant, unwanted or otherwise
inappropriate sphingosine kinase functional activity, wherein said agent
modulates the
interaction of sphingosine kinase with eEF 1 A or functional derivative,
homologue or
mimetic thereof and wherein inducing or otherwise agonising said interaction
upregulates
said sphingosine kinase functional activity and inhibiting or otherwise
antagonising said
interaction downregulates said sphingosine kinase functional activity.
Preferably, said interaction is interaction with tr.eEFlA1.
Even more preferably, said mammal is a human, and said modulation is
upregulation.
In yet another further aspect, the present invention contemplates a
pharmaceutical
composition comprising the modulatory agent as hereinbefore defined together
with one or
more pharmaceutically acceptable carriers and/or diluents. These agents are
referred to as
the active ingredients.
The pharmaceutical forms suitable for injectable use include sterile aqueous
solutions
(where water soluble) or dispersions and sterile powders for the
extemporaneous
preparation of sterile injectable solutions or dispersion or may be in the
form of a cream or
other form suitable for topical application. It must be stable under the
conditions of
manufacture and storage and must be preserved against the contaminating action
of
microorganisms such as bacteria and fungi. The carrier can be a solvent or
dispersion
medium containing, for example, water, ethanol, polyol (for example, glycerol,
propylene
glycol and liquid polyethylene glycol, and the like), suitable mixtures
thereof, and
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-35-
vegetable oils. The proper fluidity can be maintained, for example, by the use
of a coating
such as lecithin, by the maintenance of the required particle size in the case
of dispersion
and by the use of superfactants. The preventions of the action of
microorganisms can be
brought about by various antibacterial and antifungal agents, for example,
parabens,
chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it
will be
preferable to include isotonic agents, for example, sugars or sodium chloride.
Prolonged
absorption of the injectable compositions can be brought about by the use in
the
compositions of agents delaying absorption, for example, aluminum monostearate
and
gelatin.
Sterile injectable solutions are prepared by incorporating the active
compounds in the
required amount in the appropriate solvent with various of the other
ingredients
enumerated above, as required, followed by filtered sterilisation. Generally,
dispersions
are prepared by incorporating the various sterilised active ingredient into a
sterile vehicle
which contains the basic dispersion medium and the required other ingredients
from those
enumerated above. In the case of sterile powders for the preparation of
sterile injectable
solutions, the preferred methods of preparation are vacuum drying and the
freeze-drying
technique which yield a powder of the active ingredient plus any additional
desired
ingredient from previously sterile-filtered solution thereof.
When the active ingredients are suitably protected they may be orally
administered, for
example, with an inert diluent or with an assimilable edible carrier, or it
may be enclosed
in hard or soft shell gelatin capsule, or it may be compressed into tablets,
or it may be
incorporated directly with the food of the diet. For oral therapeutic
administration, the
active compound may be incorporated with excipients and used in the form of
ingestible
tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups,
wafers, and the like.
Such compositions and preparations should contain at least 1% by weight of
active
compound. The percentage of the compositions and preparations may, of course,
be varied
and may conveniently be between about 5 to about 80% of the weight of the
unit. The
amount of active compound in such therapeutically useful compositions in such
that a
suitable dosage will be obtained. Preferred compositions or preparations
according to the
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-36-
present invention are prepared so that an oral dosage unit form contains
between about 0.1
g and 2000 mg of active compound.
The tablets, troches, pills, capsules and the like may also contain the
components as listed
hereafter: a binder such as gum, acacia, corn starch or gelatin; excipients
such as dicalcimn
phosphate; a disintegrating agent such as corn starch, potato starch, alginic
acid and the
like; a lubricant such as magnesium stearate; and a sweetening agent such as
sucrose,
lactose or saccharin may be added or a flavouring agent such as peppermint,
oil of
wintergreen, or cherry flavouring. When the dosage unit form is a capsule, it
may contain,
in addition to materials of the above type, a liquid carrier. Various other
materials may be
present as coatings or to otherwise modify the physical form of the dosage
unit. For
instance, tablets, pills, or capsules may be coated with shellac, sugar or
both. A syrup or
elixir may contain the active compound, sucrose as a sweetening agent, methyl
and
propylparabens as preservatives, a dye and flavouring such as cherry or orange
flavour. Of
course, any material used in preparing any dosage unit form should be
pharmaceutically
pure and substantially non-toxic in the amounts employed. In addition, the
active
compound(s) may be incorporated into sustained-release preparations and
formulations.
The pharmaceutical composition may also comprise genetic molecules such as a
vector
capable of transfecting target cells where the vector carries a nucleic acid
molecule
encoding a modulatory agent. The vector may, for example, be a viral vector.
Yet another aspect of the present invention relates to the agent as
hereinbefore defined,
when used in the method of the present invention.
The present invention is now described with reference to the following non-
limiting
examples.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-37-
EXAMPLE 1
SPHINGOSINE KINASE ACTIVATION THROUGH INTERACTION WITH
eEF1A
Materials and Methods
Cell culture and transfection
Human embryonic kidney cells (HEK-293T, ATCC CRL-1573) cells were cultured in
Dulbecco's modified Eagle's medium (CSL Biosciences, Parkville, Australia)
containing
10% fetal bovine serum (CSL Biosciences), 2 mM glutamine, 0.2% (w/v) sodium
bicarbonate, penicillin (1.2 mg/ml), and streptomycin (1.6 mg/ml). Cells were
transiently
transfected using the calcium phosphate precipitation method, harvested 24 h
later by
scraping into cold PBS, and lysed by sonication (3 watts for 30s at 4 C) in
extraction
buffer containing 50mM Tris/HCl pH 7.4, 150mM NaCl, 2mM Na3VO4, 10mM NaF,
1mM EDTA, 10% glycerol, 0.05% Triton X-100, 10 mM 0-glycerophosphate, 1 mM DTT
and protease inhibitors (Complete; Roche Molecular Biochemicals). Protein
concentrations
of cell lysates were determined with Coomassie Brilliant Blue reagent (Sigma)
using BSA
as standard.
Yeast two-hybrid screen
Yeast two-hybrid screening was performed using the Matchmaker Ga14 Two-Hybrid
System 3 (Clontech) according to the manufacturer's instructions. Full-length
hSK1 cDNA
(Genbank accession number AF200328) was cloned into pGBKT7 (Clontech) in-frame
with the Ga14 DNA-binding domain. This bait construct was then transformed
into the
yeast strain AH107 together with a human leukocyte cDNA library in pACT2
(Clontech).
A total of 1 x 106 independent clones were screened.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-38-
Cloning of eEF1A1 and eEF1A2 and generation of trunc-eEF1A1
Primers for PCR amplification of the full-length human eEF1A1 coding region
were
designed using the published eEF1A1 cDNA sequence (306; Genbank accession
number
NM001402). The eEF1A1 cDNA was amplified from a human foreskin fibroblast cDNA
and HA-epitope tagged at the c-terminus with primers 5'-
CCGGATCCGCCACCATGGGAAAGGAAAAGACTCATA-3' (SEQ ID NO:1) and 5'-
GGCTCGAGTCAAGCGTAATCTGGAACATCGTATGGGTATTTAGCCTTCTGAGC
TTTCTG-3' (SEQ ID NO:2). The PCR product was then cloned into pcDNA3
(Invitrogen)
for mammalian expression and pGEX4T-1 (GE Health) for bacteria expression
following
digestion with BamHI and Xhol. Sequencing verified the integrity of the human
HA-
eEF1A1 cDNA sequence. An N-terminal truncated eEFlAl (tr.eEF1A1) modelled on
the
sequence of the naturally occurring PTI-1 protein (292; Genbank accession
number
L41490) was generated by PCR from the pcDNA3-eEF1A1-HA plasmid using the
primer
5'-TAGAATTCGCCACCATGCAGTCGGAACGTGGTATCACCATTGAT-3' (SEQ ID
NO:3). The PCR product was then cloned into pcDNA3 and pGEX4T-1 following
digestion with EcoRI and Xho1. Primers for PCR amplification of the eEF1A2
coding
region were designed using the published murine eEF1A2 cDNA sequence (307;
Genbank
accession number NM007906). The murine eEF1A2 cDNA was amplified from mouse
brain cDNA and HA-epitope tagged at the C-terminus with primers 5'-
TAGAATTCCGGCCACCATGGGCAAGGAGAAGACACA-3' (SEQ ID NO:4) and 5'-
TAGAATTCAAGCGTAATCTGGAACATCGTATGGGTACTTGCCCGCTTTCTGAGC
-3' (SEQ ID NO:5). The PCR product was then cloned into both pcDNA3 and pGEX4T-
2
following digestion with EcoRI. Sequencing verified the orientation and
integrity of the
mouse eEF1A2 cDNA sequence.
Generation of GST-fusion proteins
eEF1A1, tr.eEF1A1 and eEF1A2 eDNAs were expressed in E. coli BL21 in bacteria
as
glutathione s-transferase (GST)-fusion proteins. Overnight cultures were grown
with
shaking (200 rpm) at 37 C in Luria broth containing 100 mg/L ampicillin. The
culture was
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-39-
then diluted 1 in 30 into fresh Luria broth and grown with shaking at 37 C to
a OD600 of
0.6-1Ø Expression of the GST-fusion proteins was then induced with 0.1 mM
IPTG and
the cultures incubation with shaking at 37 C for a fu.rther 90 min. The
bacterial cells were
then harvested by centrifugation at 6000 g for 20min at 4 C, resuspended in 20
ml of cold
PBS, and lysed by sonication (three pulses of 5 watts for 30 s on ice with 30
s cooling
between each pulse). Triton X- 100 was then added to the bacterial lysates to
a final
concentration of 1%, lysates mixed well, and then centrifugation at 50000 g
for 25 min at
4 C. The resultant clarified bacterial lysate was then incubated with GSH-
Sepharose 4B
for 2 h at 4 C with constant mixing. After this time the GSH-Sepharose beads
(with bound
protein) were pelleted by centrifugation at 3000 g for 5 min at 4 C and washed
twice in
cold PBS. Protein attached to the GSH-Sepharose was quantitated with Coomassie
brilliant
blue staining following SDS-PAGE using BSA as standard. These beads were then
either
used directly in pull-down analysis, or the GST-fusion proteins eluted by
incubation with
cold PBS containing 10 mM GSH for 30 min with constant mixing. GST-hSK1 fusion
protein was produced as previously described (Pitson et al., 2000).
Sphingosine kinase assays
Sphingosine kinase activity was routinely determined using D-erythro-
sphingosine
(Biomol, Plymouth Meeting, PA) and [y32P]ATP (PerkinElmer, Melbourne,
Australia) as
substrates, as described previously (Roberts et al., 2004, Anal. Biochem.
331:122-129). A
unit (U) of sphingosine kinase activity is defined as the amount of enzyme
required to
produce 1 pmol S 1 P / min. Substrate kinetics were analysed using Michaelis-
Menten
kinetics with the non-linear regression program, Hyper 1.1 s.
In vitro phosphorylation of hSK1 and eEF1A
In vitro phosphorylation of His- tagged hSK1 in solution was performed as
described
previously (Pitson et al., 2003). In vitro phosphorylation of GST-hSK1 was
also performed
while the protein remained bound to the GSH-Sepharose beads by incubating
these beads
(7 g GST-hSK1) with 60 units of ERK2 (Calbiochem) and 1 mM ATP in ERK assay
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-40-
buffer (9 mM MOPS, 11 mM (3-glycerophosphate, 2.2 mM EGTA and 0.4 mM sodium
orthovanadate) for 60 min at 30 C. The beads were then washed with 50 mM
Tris/HCl
buffer containing 150 mM NaCI and 10% glycerol. In vitro phosphorylation of
GST-
eEFlAl bound to GSH-Sepharose was performed in a similar manner by incubating
these
beads (containing 1 g GST-eEF1A1) with 0.1 units of S6 kinase (Upstate), 3.5
mM
[y32P]ATP (70 nCi/ l) in buffer (7 mM MOPS, 0.1 mM EDTA, 4 M (3-
glycerophosphate,
0.2 M DTT, 0.15mM orthovanadate, 0.9 mM EGTA, pH 7.4) for 30 min at 37 C.
The
beads were then washed three times with cold PBS.
Immunoprecipitation and western blotting
Lysates from cells expressing the hSK1(FLAG) or hSK2(FLAG) alone and/or in
combination with HA-eEF1A isoforms were centrifuged at 13,000 g for 10 min at
4 C to
remove insoluble material. Anti-HA monoclonal antibodies (Sigma), M2 anti-FLAG
monoclonal antibodies (Sigma), or rabbit anti-hSKl antibodies (Pitson et al.,
2003) were
added to the lysates and incubated at 4 C for 3 hr with constant agitation.
The immune
complexes were then captured by incubation with protein A-sepharose (Amersham
Pharmacia Biotech) for 3 hr at 4 C, washed with cold extraction buffer,
subjected to SDS-
PAGE and the proteins transferred to nitrocellulose membranes. hSK1 was
quantitated
with either the monoclonal M2 anti-FLAG antibody (Sigma), or polyclonal
chicken or
rabbit anti-hSK1 antibodies (Pitson et al., 2003). eEF1A1 was determined with
either anti-
HA antibodies (12CA5; Sigma) or anti-eEF1A antibodies (Upstate). The
immunocomplexes were detected with HRP-conjugated anti-mouse (Pierce), anti-
rabbit
(Pierce) or anti-chicken IgG (IMVS, Adelaide, Australia) using an enhanced
chemiluminescence kit (ECL, Amersham Pharmacia Biotech).
GSTfusion protein binding analyses
Lysates from transiently transfected HEK-293T cells were incubated with GSH-
sepharose
beads containing 1 g of either GST, GST-eEF1A, GST-tr.eEF1A1, or GST-hSK1 for
2 h
at 4 C with constant mixing. The beads were then washed three times in 15 mM
Tris/HC1,
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-41 -
pH 7.4, containing 40 mM NaCI and 10% glycerol, subjected to SDS-PAGE, and
associated proteins detected by western blotting with either anti-FLAG or anti-
HA
antibodies. Interaction of GST-eEF1A1 with purified recombinant hSK1 or hSK2
was
performed in a similar manner with GST-eEF1A1 bound to GSH-sepharose incubated
with
1 g of His-tagged recombinant hSK1 (Pitson et al., 2002, J. Biol. Chem.
277:49545-
49553) or hSK2 (Roberts et al., 2004, supra) for 3 h at 4 C with constant
mixing. The
beads were then washed as described above, subjected to SDS-PAGE, and
associated
proteins detected by western blotting with anti-His antibodies (Santa Cruz
Biotechnology).
The effect of guanidine nucleotides on the interaction of eEF1A1 with hSK1 and
hSK2
was analysed by pre-incubation of 1 g GST-eEF1A1 or GST-trunc-eEF1A1 bound to
GSH-sepharose beads with 0.1 mM GTPyS, 10 mM GTP or 10 mM GDP in 10 mM
Tris/HCI, pH 7.4, containing 20 mM MgC12 for 30 min at 4 C with constant
mixing. The
guanidine nucleotide loaded proteins were then isolated by centrifugation
(3000 g for 5
min at 4 C) and assessed for their ability to bind recombinant hSKl and hSK2
as described
above.
Results:
eEF1A1 is a hSK1 interacting protein:
In an attempt to understand the mechanisms regulating the activity and
function of hSK1 a
yeast two-hybrid screen was performed to identify proteins that interact with
hSK1. One
partial cDNA that was isolated in this screen encoded the C-termina1312 amino
acids of
elongation factor l A 1(eEF 1 A 1).
To confirm the interaction between eEFlAl and hSK1, bacterial and mammalian
expression constructs encoding the full-length eEF1Al cDNA were generated by
PCR
from human foreskin fibroblast cDNA. The interaction of eEF1A1 with hSK1 was
first
assessed by pull down experiments using GST-eEF1A1 or GST alone bound to
glutathione
sepharose and lysates from HEK-293T cells overexpressing FLAG-epitope tagged
hSK1.
The results (Fig lA) demonstrate a specific interaction of hSK1 with GST-
eEF1A1 and not
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-42-
with GST alone. Further, reverse pull down experiments were performed using
GST-
hSKl or GST alone bound to glutathione sepharose and HEK-293T cell lysates
overexpressing HA-epitope tagged eEF1Al. Again, the results (Fig 1B)
demonstrated the
specific interaction of GST-hSK1 with eEF1A1. To further confirm the
interaction
between eEF1A1 and hSK1, co-immunoprecipitation studies were performed on
lysates
from HEK-293T cells co-expressing HA-eEF1A1 and hSK1-FLAG. The presence of
hSKl in the anti-HA (eEF 1 A 1) immuno-complexes was observed (Fig 1 C),
further
indicating an interaction between hSK1 and eEF1A1. Finally, we were able to
demonstrate the physiological interaction between hSK1 and eEF1A1 through the
co-
immunoprecipitation of the endogenous proteins in untransfected HEK-293T cell
lysates
(Fig 1D) using anti-hSKl (Pitson et al., 2003) and anti-eEF1A1 antibodies.
eEF1Al directly enhances hSKl activity in vitro:
Although the canonical role for eEF1A1 is in polypeptide elongation during
protein
synthesis (Browne and Proud, 2002; Ejiri, 2002; Abbott and Proud, 2004)
various other
apparently unrelated cellular functions have been attributed to eEF1Al,
including roles in
signal transduction, cytoskeletal organization, apoptosis and most importantly
oncogenic
transformation (Ejiri, 2002; Thornton et al., 2003; Tatsuka et al., 1992).
SK activity assays using recombinant GST-eEF1A1 or GST alone with recombinant
hSK1
(rec-hSK1) were performed. While under these conditions GST alone had no
effect on
hSKl activity, GST-eEF1Al enhanced the catalytic activity of hSK1 by 2-3 fold
(Fig 2A).
This effect was not as a result of eEF1A1 increasing the stability of rec-hSK
1 in this
enzyme assay, since under these assay conditions rec-hSKl was shown to be
stable with
linear reaction kinetics (data not shown). Taken together, these results
indicate that
eEF1A1 has a direct stimulatory effect on the activity of hSK 1. To examine if
this in vitro
effect of eEF1Al on hSKl activity was dose dependent, the effect of increasing
concentrations of GST-eEF1A1 on rec-hSKl activity was determined. Results
showed
that hSKl activity continued to increase with increasing amounts of eEF1A1,
with a
significant effect seen with a half fold molar excess of eEF1A1 and maximum
stimulation
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
- 43 -
with a ten fold molar excess of eEF1A1 (Fig 2A).
Despite these in vitro effects, when eEF1A1 was overexpressed in HEK-293T
cells no
increase in cellular SK activity was observed (refer Fig 8C). This result was
not surprising
since eEF1A1 is one of the most highly expressed proteins in cultured cells
(Dapas et al.,
2003). Thus, overexpression of eEF1A1 is likely to only result in a modest
increase in
cellular eEF1A1 levels.
Effect of eEF1A1 on hSK1 substrate kinetics:
As eEF1A1 directly increases the activity of rec-hSK1, the effect of eEF1Al on
hSK1
substrate kinetics was examined. The results show that the KM values of hSK1
for both
sphingosine and ATP were unaltered by the presence of eEF1Al (Fig 2B). In
contrast, the
k,,at for hSK1 was increased approximately two to three fold by the presence
of eEF1A1
(Fig 2B). Taken together these results indicate that eEF1Al does not increase
the binding
affinity of hSK1 for its substrates but does enhance the rate of catalysis.
eEF1A1 interacts with and enhances hSK2 activity:
Since eEF1A1 interacts with hSK1 and has a direct effect on its activity, its
effect on the
other human SK isoform, hSK2 was examined. The interaction between eEF1Al and
hSK2 was investigated using GST-eEF1A1 or GST alone bound to glutathione
sepharose
and rec-hSK2. Like hSK1, hSK2 was able to specifically interact with GST-
eEF1A1 (Fig
3A).
Having demonstrated that eEF1Al and hSK2 interact, the effect of the
interaction on the
activity of hSK2 was examined. Purified GST-eEF1A1 and rec-hSK2 were incubated
in
vitro and the resultant SK activity was measured. As with hSKl, GST-eEF1A1 was
shown
to increase hSK2 activity by 2-3 fold (Fig 3B).
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-44-
eEF1A2 is an hSK1 interacting protein:
A second isomer of eEF1A1 has been identified in humans and is referred to as
eEF1A2.
While the sequence homology between these two proteins is extremely high
(greater than
95% nucleotide sequence identity) (Thornton et al., 2003), some differences
have been
observed in their distribution within human tissues (Thornton et al., 2003;
Abbott and
Proud, 2004), with eEF1A1 ubiquitously expressed, and eEF1A2 only present in
heart,
brain and skeletal muscle cells (Thornton et al., 2003). Given the sequence
homology of
the two proteins, an examination was made as to whether SK1 also interacted
with
eEFlA2. Co-immunoprecipitations were performed using lysates from HEK-293T
cells
coexpressing HA-eEF1A1 and SKl-FLAG, demonstrating that as with eEF1A1, eEFlA2
also associates SKl (Fig 4A).
In agreement with the eEF1A1 results, in vitro studies have shown that GST-
eEF1A2 is
able to increase the activity of rec-hSK1 two to three fold (Fig 4B). As with
HA-eEF1A1,
however, ectopic expression of HA-eEF1A2 in HEK-293T cells had no effect on
endogenous SK activity (refer Fig 8C).
hSK1- eEF1A1 interaction is not regulated by phosphorylation
The interaction between eEF1Al and various proteins is known to be regulated
by
phosphorylation, either of eEF1A1 (Yang and Boss, 1994) or its target proteins
(Ejiri,
2002; Chang et al., 2002). Therefore, an analysis was performed as to whether
the
phosphorylation state of hSK1 or eEF1A1 affected their ability to interact.
The effect of
hSKl phosphorylation by phosphorylating GST-hSK1 bound to glutathione
sepharose
using recombinant ERK2 was first investigated. ERK2 is known to specifically
phosphorylate hSK1 at Ser225 in vitro, which appears to be the only
physiological
phosphorylation site in this protein (Pitson et al., 2003). This
phosphorylated GST-hSKl
was then used in pull down assays with lysates from HEK-293T cells
overexpressing HA-
eEFlA1. Both non-phosphorylated GST-hSK1 and phosphorylated GST-hSKl
interacted
with HA-eEF1A1 in a comparable manner (Fig 5A), The phosphorylation of GST-
hSK1
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-45-
also did not affect the ability of GST-eEF1A1 to increase its activity. To
confirm this
result pull down experiments using GST-eEF1Al bound to glutathione sepharose
and
lysates from HEK-293T cells overexpressing either wild type hSK1, known to be
phosphorylated (Pitson et al., 2003), or its non phosphorylatable counterpart
hSKl
(S225A) (Pitson et al., 2003) were performed. The results of the pull down
experiments
showed that both forms of hSK1 interacted with eEF1A1 to a comparable extent
(Fig 5B).
Together, these results definitively show that, unlike some other eEF1A1
associated
proteins, the phosphorylation state of hSK1 does not affect its ability to
interact with
eEF1A1.
Next, the effect of eEF1A1 phosphorylation on its ability to interact with
hSKl was
examined. eEF1A1 is known to be phosphorylated in vitro by S6 kinase (S6K)
(Thornton
et al., 2003), PKC (Kielbassa et al., 1995) and Rho-associated kinase (RhoK)
(Ejiri, 2002).
Since S6K phosphorylates.eEF1A1 at multiple sites including those sites
phosphorylated
by PKC and RhoK (Thornton et al., 2003; Ejiri, 2002), GST-eEF1A1 bound to
glutathione
sepharose was phosphorylated with S6K (Fig 6A) and then used in pull down
experiments
with rec-hSKl and rec-hSK2. The results indicate that both non-phosphorylated
and
phosphorylated GST-eEF1Al are able to interact with hSKl and hSK2 to a similar
extent
(Fig 6B). The phosphorylated GST-eEF1A1 was also able to activate rec-hSK1 to
the
same extent as non-phosphorylated GST-eEFlAl. Therefore, the results from
these
phosphorylation experiments show that unlike the situation with some other
eEF1Al
interacting proteins, the phosphorylation state of eEF1A1 or SK has no effect
on the
interaction of these two proteins.
hSK1-eEF1AI interaction is not regulated by GTP although hSKl activity is:
In cells, eEF 1 A 1 exists in two states; a GTP bound form, and a GDP bound
form.
Interconversion between these two forms is mediated by both the low GTPase
activity of
eEF 1 A 1 and other eEF 1 subunits that act as guanidine nucleotide exchange
factors in a
comparable manner to that observed with the small G proteins (Ejiri, 2002;
Lamberti et al.,
2004). During this conversion between the GTP bound and GDP bound forms eEF1A1
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-46-
undergoes a large conformational change which alters its ability to bind to aa-
tRNA (Ejiri,
2002). The possibility that the guanidine nucleotide bound state of eEF1Al may
alter its
interaction with SK and/or its effect on SK activity was therefore
investigated. To
investigate this we initially examined the ability of rec-hSK1 and rec-hSK2 to
interact with
GST-eEF1A1 bound to glutathione sepharose that had been pre-treated with
GTPyS.
Results from these pull down experiments indicate that hSK1 or hSK2 does not
have a
higher binding affinity for one form of eEF 1 A 1 over the other (Fig 6A).
However, when
the effect of the guanidine nucleotide state of eEF1Al on SK activity was
examined it was
found that the eEFlA1.GTP was unable to increase rec-hSK1 and rec-hSK2
activity as
previously seen. In stark contrast, nil treated eEF1A1 retained the ability to
enhance rec-
hSKl and hSK2 activity two to three fold (Fig 6B). Taken together these
results indicate
that while the guanidine nucleotide bound state of eEF 1 A1 does not affect
its ability to
interact with hSKl or hSK2, it does affect the ability of this protein to
enhance SK activity.
To fizrther examine the guanidine nucleotide state of eEFlAl on SK activity,
an artificially
truncated version of eEFlAl was generated, missing 67 (with the addition of 3)
N-terminal
amino acids, based on the naturally occurring truncated eEF1A1 protein,
prostate tumour
inducer (PTI). This truncated version of eEFlAl (PTI) lacks most of the Ras-
like G
protein domain including residues essential for GTP binding (Mansilla et al.,
2005). As
with full length eEF1A1, PTI was shown to interact with both SK1 and SK2 (Fig
8A).
This result was not surprising as the partial eEF 1 A 1 cDNA obtained from the
yeast two-
hybrid screen generated a version of eEFlAl lacking even more of the N-
terminus, but
clearly retained binding to hSK1. Further examination of the effect of PTI on
the in vitro
activity of rec-hSKl and rec-hSK2 activity revealed that this GTP-binding
deficient
version of eEF1Al retained the ability to enhance SK activity 2-3 fold (Fig
8B).
Furthermore, unlike wildtype eEF1A1, when PTI was overexpressed in HEK-293T
cells a
2-3 fold increase in endogenous SK activity was observed compared to vector
control (Fig
8C).
Those skilled in the art will appreciate that the invention described herein
is susceptible to
variations and modifications other than those specifically described. It is to
be understood
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-47-
that the invention includes all such variations and modifications. The
invention also
includes all of the steps, features, compositions and compounds referred to or
indicated in
this specification, individually or collectively, and any and all combinations
of any two or
more of said steps or features.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
- 48 -
BIBLIOGRAPHY:
Abbott,C.M. and Proud,C.G. (2004). Translation factors: in sickness and in
health. Trends
Biochem. Sci. 29:25-31
Browne,G.J. and Proud,C.G. (2002). Regulation of peptide-chain elongation in
mammalian
cells. Eur. J. Biochem. 269:5360-5368
Cans,C., Passer,B.J., Shalak,V., Nancy-Portebois,V., Crible,V., Amzallag,N.,
Allanic,D.,
Tufino,R., Argentini,M., Moras,D., Fiucci,G., Goud,B., Mirande,M., Amson,R.,
and
Telerman,A. (2003). Translationally controlled tumor protein acts as a guanine
nucleotide
dissociation inhibitor on the translation elongation factor eEF 1 A. Proc.
Natl. Acad. Sci. U.
S. A 100:13892-13897
Chang,J.S., Seok,H., Kwon,T.K., Min,d.S., Ahn,B.H., Lee,Y.H., Suh,J.W.,
Kim,J.W.,
Iwashita,S., Omori,A., Ichinose,S., Numata,O., Seo,J.K., Oh,Y.S., and Suh,P.G.
(2002).
Interaction of elongation factor-lalpha and pleckstrin homology domain of
phospholipase
C-gamma 1 with activating its activity. J. Biol. Chem. 277:19697-19702
Dapas,B., Tell,G., Scaloni,A., Pines,A., Ferrara,L., Quadrifoglio,F., and
Scaggiante,B.
(2003). Identification of different isoforms of eEF1A in the nuclear fraction
of huinan T-
lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT
oligomers.
Eur. J Biochem. 270:3251-3262
Ejiri,S. (2002). Moonlighting functions of polypeptide elongation factor 1:
from actin
bundling to zinc finger protein R1-associated nuclear localization. Biosci.
Biotechnol.
Biochem. 66:1-21
French,K.J., Schrecengost,R.S., Lee,B.D., Zhuang,Y., Smith,S.N., Eberly,J.L.,
Yun,J.K.,
and Smith,C.D. (2003). Discovery and evaluation of inhibitors of human
sphingosine
kinase. Cancer Res. 63:5962-5969
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-49-
Kielbassa,K., Muller,H.J., Meyer,H.E., Marks,F., and Gschwendt,M. (1995).
Protein
kinase C delta-specific phosphorylation of the elongation factor eEF-alpha and
an eEF-1
alpha peptide at threonine 431. J. Biol. Chem. 270:6156-6162
Lamberti,A., Caraglia,M., Longo,O., Marra,M., Abbruzzese,A., and Arcari,P.
(2004). The
translation elongation factor 1 A in tumorigenesis, signal transduction and
apoptosis:
review article. Amino. Acids 26:443-448
Mansilla,F., Hansen,L.L., Jakobsen,H., Kjeldgaard,N.O., Clark,B.F., and
Knudsen,C.R.
(2005). Deconstructing PTI-1: PTI-1 is a truncated, but not mutated, form of
translation
elongatin factor IA1, eEF1A1. Biochim. Biophys. Acta 1727:116-124
Nava,V.E., Hobson,J.P., Murthy,S., Milstien,S., and Spiegel,S. (2002).
Sphingosine kinase
type 1 promotes estrogen-dependent tumorigenesis of breast cancer MCF-7 cells.
Exp. Cell
Res. 281:115-127
Pitson,S.M., D'Andrea,R.J., Vandeleur,L., Moretti,P.A., Xia,P., Gamble,J.R.,
Vadas,M.A.,
and Wattenberg,B.W. (2000). Human sphingosine kinase: purification, molecular
cloning
and characterization of the native and recombinant enzymes. Biochem. J.
350(2):429-441
Pitson,S.M., Moretti,P.A., Zebol,J.R., Lynn,H.E., Xia,P., Vadas,M.A., and
Wattenberg,B.W. (2003). Activation of sphingosine kinase 1 by ERK1/2-mediated
phosphorylation. EMBO J. 22:5491-5500
Pitson,S.M., Moretti,P.A., Zebol,J.R., Zareie,R., Derian,C.K., Darrow,A.L.,
Qi,J.,
D'Andrea,R.J., Bagley,C.J., Vadas,M.A., and Wattenberg,B.W. (2002). The
nucleotide-
binding site of human sphingosine kinase 1. J. Biol. Chem. 277:49545-49553
Pyne S & Pyne NJ (2002) Sphingosine 1-phosphate signaling and termination at
lipid
phosphate receptors. Biochim. Biophys. Acta 1582:121-131
Roberts,J.L., Moretti,P.A., Darrow,A.L., Derian,C.K., Vadas,M.A., and
Pitson,S.M.
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-50-
(2004). An assay for sphingosine kinase activity using biotinylated
sphingosine and
streptavidin-coated membranes. Anal. Biochem. 331:122-129
Spiegel S & Milstien S (2000) Sphingosine-1-phosphate: signaling inside and
out. FEBS
Lett. 476:55-57
Spiegel S & Milstien S (2003) Sphingosine-1-Phosphate: An Enigmatic Signaling
Lipid.
Nat. Rev Mol. Cell Biol. 4:397-407
Spiegel,S., English,D., and Milstien,S. (2002). Sphingosine 1-phosphate
signalling:
providing cells with a sense of direction. Trends Cell Biol. 12:236-242
Sukocheva,O.A., Wang,L., Albanese,N., Pitson,S.M., Vadas,M.A., and Xia,P.
(2003).
Sphingosine kinase transmits estrogen signalling in human breast cancer cells.
Mol.
Endocrinol. 17:2002-2012
Tatsuka,M., Mitsui,H., Wada,M., Nagata,A., Nojima,H., and Okayama,H. (1992).
Elongation factor-1 alpha gene determines susceptibility to transformation.
Nature
359:333-336.
Thornton,S., Anand,N., Purcell,D., and Lee,J. (2003). Not just for
housekeeping: protein
initiation and elongation factors in cell growth and tumorigenesis. J. Mol.
Med. 81:536-
548.
Xia P, Wang L, Gamble JR & Vada MA (1999) Activation of sphingosine kinase by
tumour necrosis factor-a inhibits apoptosis in human endothelial cells. J.
Biol. Chem.
274:34499-34505
Xia,P., Gamble,J.R., Wang,L., Pitson,S.M., Moretti,P.A., Wattenberg,B.W.,
D'Andrea,R.J., and Vadas,M.A. (2000). An oncogenic role of sphingosine kinase.
Curr.
Biol. 10:1527-1530
CA 02612644 2007-12-19
WO 2006/135968 PCT/AU2006/000866
-51 -
Xia,P., Wang,L., Moretti,P.A., Albanese,N., Chai,F., Pitson,S.M.,
D'Andrea,R.J.,
Gamble,J.R., and Vadas,M.A. (2002). Sphingosine kinase interacts with TRAF2
and
dissects tumor necrosis factor-alpha signalling. J. Biol. Chem. 277:7996-8003
Yang,W. and Boss,W.F. (1994). Regulation of phosphatidylinositol 4-kinase by
the protein
activator PIK-A49. Activation requires phosphorylation of PIK-A49. J. Biol.
Chem.
269:3852-3857
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 51
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 51
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
