Note: Descriptions are shown in the official language in which they were submitted.
CA 02617827 2013-09-23
BROWN MUSHROOMS FOR COMMERCIAL PRODUCTION
SEQUENCE LISTING
[0001] This description contains a sequence listing in electronic form in
ASCII text format.
A copy of the sequence listing in electronic form is available from the
Canadian Intellectual
Property Office. The sequences in the sequence listing in electronic form are
reproduced in the
Sequence Table that follows.
BACKGROUND OF THE INVENTION
=
=
[0002] The cultivated white button variety of Agaricus bisporus, known as A.
bisporus (Lange)
Imbach (syn. A. brunnescens Peck), is the predominant mushroom species in
cultivation in the
world today. After many years in which commercial mushroom sales in the United
States were
restricted primarily to white button A. bisporus mushrooms, there has been a
recent trend toward
increased sales of brown A bisporus mushrooms of various types and other so-
called exotic strains'
(species other then A. bisporus), as such mushrooms have increased flavor
relative to the bland taste
of white button mushrooms. However, many of these more flavorful and exotic
tasting mushrooms
are difficult to produce commercially or can only be collected in the wild.
For example, Enoki
mushrooms, also called enokitake (Flammulina velutipes), originated in Japan
where they were
gathered in the wild, although in the United States they are cultivated on
live or dead tree trunks,
tree roots, or branches that have been coveted with soil. Shiitake mushrooms
(Lentinus edochis),
also known as Japanese black forest mushrooms, have been commercially
cultivated and are widely ,
available either fresh or dried in supermarkets as well as in Asian markets,
although their
commercial production is more difficult than that of A. bisporus, which grows
in easily harvested
beds. OriginAlly harvested from hardwood trees in their native country for at
least two thousand
years, shiitakes are often cultivated on artificial logs made from sawdust.
Morels (Morchella
eesculenta) are gathered in the wild in wooded areas in the spring.
Scandinavians refer to morels as
"truffles of the north." Chanterelles (Cantharellus cibarius) grow in the wild
in the Pacific =
Northwest in forests with pine trees and deciduous trees. Truffles (Tuber
aestivum), perhaps the
most famous fungus in the world and certainly the most expensive, are fungi
that grow underground
in wooded areas. They have never been successfully cultivated and are a
challenge to forage in the
1
CA 02617827 2008-02-01
WO 2007/019306
PCT/US2006/030436
wild. They can only be located by dogs or pigs that have been are specially
trained to recognize the
scent of the truffle. Black truffles from France, known as Perigord, are best
known for flavoring
pate de foie gras. White truffles from the Alba region of Italy are also
available.
[00031 As should be apparent from the description above, commercial production
of many exotic
strains is difficult. This difficulty in commercial production has been
overcome in part by
developing strains of A. bisporus with similar colors, appearances, and
flavors that can be used as a
replacement for the exotic or wild mushroom strains described above. These
"exotic" A. bisporus
strains can be appreciated by discriminating consumers while still being
capable of production in
the standard commercial processes developed for A. bisporus production.
Crimini (or cremini) is an
Agaricus bisporus strain, similar to the familiar white A. bisporus mushroom
strains found in most
grocery stores, but it has a brownish color and is denser in texture with a
pronounced earthy flavor.
Portabellas (also spelled portobellos), which have only been widely available
since the 1980s, are
sometime thought of as an Italian strain of mushrooms but are actually large
criminis that have been
allowed to grow for longer periods of time. Because of their longer growth
time, portabellas have a
distinctly pungent, earthy flavor and fleshy texture and have seen increased
use in recent years,
often as a substitute for meat in vegetarian dishes, in addition to being used
in side dishes or sauces
for their own distinctive flavor.
100041 Both white and brown strains ofAgaricus bisporus ¨ being varieties of
the same species ¨
have the same complex genetics and unusual biology. A. bisporus produces
predominantly two
sports per basidium, in contrast to most basidiomycetes fungi, which produce
four spores per
basidium. With four spores per basidium, each spore receives one of the four
haploid nuclei
produced by meiosis and germinates to form a haploid mycelium (a homokaryon).
In A. bisporus
each of the two spores typically receive two post meiotic nuclei referred to
as "a" and "b". There is
good evidence (Evans H. J., in Chromosoma 10 115-135 (1959)); Summerbell, R.
C., Castle, A. J.,
Horgen, P. A. & Anderson, J. B. in Genetics 123 293-300(1988)) that A.
bisporus spores derived
from two-spored basidia preferentially contain nuclei of complementary mating
type. These spores
germinate to produce diploid, self-fertile mycelium, known as heterokaryons,
which contain the two
nuclei a and b. This self fertile heterokaryon can, under the correct
environmental conditions,
2
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
undergo several fruiting cycles commonly referred to as "breaks." A crop of
mushrooms comprises
the total yield from several successive breaks.
[00051 In addition to self-fertile spores, viable non-self fertile spores are
produced at the rate of 1
to* 20%. These homokaryotic spores arise from aberrant three- and four-spored
basidia. The
homokaryotic mycelium derived from these spores can be used for the controlled
crossing that is the
foundation of A. bisporus breeding. A traditional Agaricus breeding program
utilizes the fact that
homokaryons grow more slowly than heterokaryons. This permits the screening of
large
populations of spores for suitable parents, which can then be used in
controlled crosses (Kerrigan,
R. W., Bailer, L. M., Horgen, P.A. & Anderson, J. B), in Mycologia 84575-
579(1992). This
approach was used successfully by G. Fritsche (described in The Mushroom
Journal 122 49-53
(1983) and in Genetics and Breeding of Agaricus, Chapter 1,3-20, Pudoc (1991))
to develop the
strains Ul and U3. Since their release in 1983, these stains have dominated
the industry, either as
Ul , as U3, or as derivatives sold worldwide by numerous spawn companies
(Castle, A. J., Horgen,
P. A. & Anderson, J. B., in Applied and Environmental Microbiology 53 816-822
(1987); Loftus,
M. G., Moore, D. & Elliott, T. J., in Theoretical and Applied Genetics 76712-
718 (1988)).
100061 These Ul and U3 hybrid strains and their typical progeny are the white
button mushrooms
commonly found in grocery stores. Brown Agaricus bisporus mushroom strains of
the portabella
type that are currently available for commercial use include, but are not
limited to, Sylvan SB65,
Lambert 800, Lambert 801, Sylvan 295, Amycel 2400, and Amycel Bella. These are
genetically
related strains of a general class often referred to as "old fashioned browns"
in the industry. Any
improvement in color, appearance, flavor, and/or production values of these
strains would be
commercially advantageous.
[00071 Recent developments in mushroom genetics have allowed new strains of
mushrooms to be
developed via crossing, although there is still too much complexity in the
genetic picture for
crossing of untested strains to occur in a predictable manner. Most of the
initial crosses have either
the characteristics of the parents and thus do not represent improvements or
have unexpected
characteristics that are less desirable than those of the parent strains.
However, once a desirable
3
CA 02617827 2008-02-01
WO 2007/019306
PCT/US2006/030436
strain has been identified and developed, cell cultivation techniques allow
commercial production of
genetic clones via mushroom spawn, and the identification of genetic markers
in the new strain
allows its desirable characteristics to be followed into its progeny and used
to select desirable
strains from future crossings. At least one new mushroom strain has been the
subject of a U.S. plant
, patent (No. Plant 7,636), while utility patents have issued on specific
strains with improved
characteristics (e.g., U.S. Pat. Nos. 4,996,390, 5,304,721, and 5,832,659).
[0008] All brown strains commonly available for sale in the U.S. are
genetically identical, except
the hybrid Sylvan 600 (syn. X618). There are a number of advantages for
introducing greater
genetic diversity into commercial brown mushroom production. The genetic
homogeneity of the
commercial brown crosses is especially problematic if a novel crop pathogen
emerges which causes
devastating crop losses. Since nearly all of the commercial brown strains are
identical, they would
be equally affected.
100091 Additionally, cap color is one of them most important economic physical
characteristic of
A. bisporus strains. Currently available brown strains of A. bisporus all have
generally the same
(more or less) brown tone, and the development of brown strains that have a
darker color would be
economically advantageous.
[0010] Accordingly, there is a need for new mushroom strains having genetic
diversity as well as
improved appearance, flavor, and/or production characteristics that that
exceed those of existing
portabella mushrooms. By the introduction of wild mushroom germ plasma into
commercial
mushroom strains, we have a developed a novel breeding pedigree. The products
of our pedigree
give brown mushrooms of the portabella and crimin¨i varieties having good
flavor and appearance as
well as having excellent production values.
=
4
CA 02617827 2013-09-23
BRIEF SUMMARY OF THE INVENTION
100111 Some embodiments of the invention provide brown varieties of
Agaricus bisporus mushroom
with improved commercial characteristics relative to existing brown commercial
mushrooms.
Specifically, it is an object of the invention to provide mushrooms that have
one or more (most
preferably all) of the following characteristics (relative to brown Agaricus
bisporus now being.
marketed):
= Increased productivity
= Darker, more attractive cap color
= Thicker cap = =
= Non-compatibility with existing strains or antagonism with existing
strains (genetic disease
bonier).
[0012] Some embodiments of the invention provide a hybrid
Agaricus bisporus mushroom strain obtained by crossing a mushroom of wild
strain AA-0096 or a
progeny thereof with a second Agaricus bisporus strain, wherein the mushroom
of the invention (1)
has (a) at least one genetic characteristic of wild strain AA-0096 not present
in the second Agaricus
bisporus strain and (b) at least one genetic characteristic of the second
Agciricus bisporus strain not =
present in wild strain AA-0096 and (2) either (a) has at least one physical
characteristic selected
from the group consisting of cap color, cap thickness, and productivity that
is statistically better
than the corresponding physical characteristic of comparison strain Amycel
2400 or (b) is =
genetically non-compatible with comparison strain Amycel 2400.
=
CA 02617827 2015-05-11
CA 2617827
[0012A] Various embodiments of the claimed invention relate to a method for
producing a
hybrid Agaricus bisporus mushroom strain comprising: crossing a mushroom of
wild strain AA-
0096 with a mushroom of Agaricus bisporus bridging cross strain 4x29, wherein
a representative
culture of said bridging cross strain 4x29 is deposited under ATCC Accession
No. PTA-6877 and a
representative culture of said wild strain AA-0096 is deposited under ATCC
Accession No. PTA-
6903, wherein said hybrid mushroom strain has at least one RAPD marker
selected from the group
consisting of: OP-C4910, 0PC-71200, OPC-8500, OPC-8450, OPC-1 0420, OPC-1
1700, OPC-1 1600, OPC-
1 31300, OPF-51900, OPF-92200, OPF-1 1 I too, OPH-11700, OPH-51900, OPH-61200,
OPH-16480, OPH-
1 81400, OPL-81200, OPJ-41500, OPJ-5-1800, OPJ-71850, OPK-1690, and OPK-8900.
10012B] Various embodiments of the claimed invention relate to a method for
producing a
hybrid mushroom culture of Agaricus bisporus comprising: crossing a culture of
Agaricus bisporus
wild strain AA-0096 with a culture of Agaricus bisporus bridging cross strain
4x29, wherein a
representative culture of said bridging cross strain 4x29 is deposited under
ATCC Accession No.
PTA-6877and a representative culture of said wild strain AA-0096 is deposited
under ATCC
Accession No. PTA-6903, wherein said hybrid mushroom culture produces a
mushroom that has at
least one RAPD marker selected from the group consisting of: OP-C4910, OPC-
71200, OPC-8500,
OPC-8450, 0PC-10420, OPC-1 1700, OPC-1 1600, 0PC-131300, OPF-51900, OPF-92200,
OPF-1 11100, OPH-
11700, OPH-5 1900, OPH-61200, OPH-16480, OPH-1 81400, OPL-81200, OPJ-41500,
OPJ-5-1800, OPJ-71850,
OPK-1690, and OPK-8900.
[0012C] Various embodiments of the claimed invention relate to a method of
producing
commercial brown mushrooms, which comprises: (i) inoculating a mushroom growth
medium with
a hybrid Agaricus bisporus mushroom strain obtained by crossing a mushroom of
wild strain AA-
0096 with a mushroom of an Agaricus bisporus bridging cross strain 4x29,
wherein a representative
culture of strain 4x29 is deposited under ATCC Accession No. PTA-6877 and a
representative
culture of said wild strain AA-0096 is deposited under ATCC Accession No. PTA-
6903; (ii)
maintaining said inoculated growth medium under conditions conducive to
mushroom fruiting; and
(iii) collecting mushrooms from said growth medium, wherein said mushrooms
have at least one
RAPD marker selected from the group consisting of: OP-C4910, OPC-71200, OPC-
8500, OPC-8450,
OPC-10420, OPC-1 boo, OPC-1 1600, OPC-131300, OPF-51900, OPF-92200, OPF-1
11100, OPH-1t7oo,
OPH-51900, OPH-61200, OPH-16480, OPH-1 81400, OPL-81200, OPJ-41500, OPT-5-
1800, OPJ-71850, OPK-
1690, and OPK-8900.
5a
CA 02617827 2014-09-03
CA 2617827
[0012D] Various embodiments of this invention relate to a method of producing
commercial
brown mushrooms, which comprises: (i) inoculating a mushroom growth medium
with strain
BRO6, wherein a representative culture of strain BRO6 is deposited under ATCC
Accession No.
PTA-6876; (ii) maintaining said inoculated growth medium under conditions
conducive to
mushroom fruiting; and (iii) collecting mushrooms from said growth medium.
[0012E] Various embodiments of this invention relate to cells of hybrid
mushroom strain
BRO6.
5b
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
iEEUD DESCRIPTION OF THE INVENTION
[0013] The present invention arose from a breeding program that crossed
mushrooms derived
from commercial Agaricus bisporus strains with wild mushroom strains. The
specific wild
mushroom strain that was eventually found to provide the desired genetic
characteristics is known
as AA-0096. This wild strain was previously described in the scientific
literature because of its
unique genetics. Strain AA-0096 is also known as BP-1 and ARP-023 and is
available from the
American Type Culture Collection (ATCC) under accession number 76562 as a non-
patent deposit.
This strain has been re-deposited by the current inventors under the Budapest
Treaty governing the
deposit of organisms for patent purposes at the American Type Culture
Collection, Rockville, Md.,
USA, under ATCC accession No. PTA-6903 (inventors' identification AA-0096,
deposited on
August 3, 2005). Specific progeny strains obtained by crossing AA-0096 with
other A. bisporus
strains can be selected to have at least one (preferably all four) of the
improved characteristics
described herein by using the procedures described herein. Examples of such
strains include the
BRO6 strain that is described in more detail below.
[0014] As a result of the ATCC deposit recited above (and other deposits
described below relating
to preferred embodiments), anyone can practice the current invention using
standard methods of
mushroom breeding and/or production, using either the already deposited
strains or (in the future)
commercial mushrooms derived from strain AA-0096 that have reached the
marketplace, as
processes for cloning mushrooms from mushrooms available at the retail level
(as in grocery stores)
are well known. Specific cloning processes (which produce genetically
identical crops of
mushrooms) and crossing processes (which produce non-genetically identical
progeny) that can be
used in the practice of the invention are described in this application. For
example, the genetic
characteristics of preferred strain BRO6 can be transmitted to cloned
mushrooms without change, or
new progeny of the original wild strain having the commercially desirable
characteristics recited
herein (referred to as "commercially acceptable AA-0096 derivatives") can be
prepared using the
general breeding techniques described here, and further progeny (as well as
later crosses derived
from these progeny) can be selected for the recited commercially desirable
characteristics.
6
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
[00151 Methods for the production of mushroom strains, either as direct
progeny (clones) of a
given strain or as hybrid progeny by crossing with a second strain, are well
known.: See, for
example, U.S. Pat. No. 5,304,721, entitled "Method for the ProAuctiou e!_f Wel
Proportions, of
Homokaryons in Breeding Stock of the Mushroom Agaricus Bisporus" and U.S. Pat.
No. 4,996,390,
entitled "Novel Interspecific Mushroom Strains," as well as numerous
publications in the scientific
literature, including Sonnenberg et al., "An Efficient
Protoplasting/Regeneration System for
Agaricus bisporus and Agaricus bitorquis," Curr. Microbiol., 17:285-291
(1988); May et al.,
"Confirmation of Crosses Between Lines of Agaricus brunnescens by Isozyme
Analysis," Exp.
Mycology, 6:283-292 (1982); Herbraud et al., "Protoplast Production and
Regeneration from
Mycorrhiz.al Fungi and Their Use for Isolation and Mutants," Can. J.
Microbiol., 34:157-161
(1988); Loftus et al., "DNA Polymoiphisms in Commercial and Wild Strains, of
the Cultivated
Mushroom, Agaricus bisporus," Theor. App!. Genet., 76:712-718 (1988); Elliott,
"The Genetics and
Breeding of Species of Agaricus," in Flegg. et al., eds, The Biology and
Technology of the
Cultivated Mushroom, John Wiley and Sons, 1985, pp. 111-139; Castle et al.,
"Crosses Among
Homokaryons from Commercial and Wild-Collected Strains of the Mushroom
Agaricus
brunnescens (=A. bisporus)," Appl. Environ. Microbiol., 54:1643-1648 (1988);
and Castle et al.,
"Restriction Fragment Length Polymorphism in the Mushrooms Agaricus
brunnescens and
Agaricus bitorquis," Appl. Environ. Microbiol., 53:816-822 (1987).
[0016] These are merely a few of the numerous publications in the field of
mushroom strain
production and recognition, and many equivalent publications exist for those
who are less familiar
with this area of technology and would like to pursue additional background
material (see, for
example, the publications cited in each of the patent or other publications
listed above). Now that
the genetic material of the newly developed strains has been placed in the
hands of those skilled in
the art of mushroom production by the present invention, one can practice the
invention (including
the development of progeny strains from the parent deposited strains) simply
by using standard
mushroom breeding techniques. In particular, progeny of the deposited strains
can be prepared
simply by following the procedures shown in detail in the Examples that
follow.
[0017] Numerous wild mushrooms strains were tested to determine whether wild
strains of
7
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
musnroom cotuu De used to improve commercial strains of brown A. bisporus
mushrooms, most
without success in producing any commercially viable varieties. Wild
heterokaryon AA-0096 had
been chosen as one of the test strains because it is very different
genetically from common
commercial mushroom cultivars (Callac, P., Biliette, C., Imbernon,
M.A.Kerrigan, R. W., in
Mycologia 85 835-851 (1993)). These genetic differences, however, made it
unpredictable as to
what results would be obtained by using this strain in attempts to produce
commercially viable
brown strains. For example, although experiments conducted by us showed that
AA-0096 had
generally good agronomic characteristics when grown under specific conditions,
it had significantly
lower productivity compared to the generally available commercial brown
strains when grown
under standard A. bisporus conditions, thus making it an unlikely candidate
for producing a
successful commercial strain.
[0018] This difficult genetic background became even more evident when our
initial crosses were
prepared. A number of test crosses were made between AA-0096 and white or
brown commercial
A. bisporus varieties. None of these test crosses produced hybrids with
acceptable agronomic
characteristics. All of the crosses between AA-0096 and the commercial whites
strains produced
cream and tan colored mushrooms too light in color for use as a brown
mushroom. The crosses
between AA-0096 with the commercial browns produced hybrids with unacceptable
commercial
productivity or, in some cases, did not even produce mushrooms. It was not
until we crossed
homokaryons from commercial browns and commercial whites, creating a "bridging
cross strain,"
that we were able to produce darker, more productive mushrooms by introducing
the genetic
material from AA-0096 via a second cross with the bridging cross strain.
[0019] One preferred mushroom strain of the invention contains a mixture of
genetic material
from the wild AA-0096 strain and the commercial brown strain known as Amycel
2400, as well as
genetic material from a commercial white hybrid (a Ul derivative) that was
introduced by
formation of a bridging cross strain between the commercial strains prior to
introduction of genetic
material from the wild strain. This particular bridging cross strain, know in
our examples as the
4x29 strain, on its own does not produce mushrooms that are dark enough for
commercial
production as a brown mushroom. Furthermore, the combination of AA-0096 with
either the
8
CA 02617827 2013-09-23
=
, =
commercial white or commercial brown on their own does not produce
commercially acceptable
strains. Therefore it was not apparent before the completion of the breeding
program that darker
cap color and increased productivity Could be obtained from using genetic
material from the AA-
0096 strain.
[00201 However, now that the breeding program has been completed, the
desirable genetic
characteristics of strain AA-0096 can be incorporated into commercial
musbrooni stains by
initially forming a bridging cross strain from any commercial white and any
commercial brown A.
bisporus strains. The bridging cross strain is then crossed further with the
AA-0096 strain, and the
resulting strains are selected for physical properties as described herein.
Commercial strains of
white and brown A. bisporus mushrooms do not need to be deposited in, order
for the broader
aspects of the invention to be practiced, as they can simply be purchased from
suppliers and/or
retailers, such as grocery stores, and then crossed to form a bridging cross
strain prior to the final '
cross -with strain AA-0096. However, in. order to make possible the
preparation of all possible
crosses of AA-0096 and the specific bridging cross strain (x29) developed by
the present inventors
(which constitutes a preferred embodiment of the present invention), strain
4x29 has also been
deposited under the provisions of the Budapest Treaty with the American Type
Culture Collection,
Roelcville, Md., USA, ATCC accession No. PTA-6877 (inventors' identification
4x29 A. bisporus,
deposited on July 20, 2005). .
[00211 It should be recognized that the mnahrooms of the invention are hybrids
(equivalent to
crosses), as they are formed by the hybridization of wild strain AA-0096 with
a second A. bisporus
strain (with the second strain in some cases being a cross itself between two
commercial A. bisporus
strains, such as the 4x29 strain). = Thus the terminology used in recently
published U.S. Patent
Application No. 20040144020 (which describes a cross between a different wild
A. bisporus strain
and a commercial strain as being a "hybrid mushroom") applies equally well to
the present
invention_ = Such
. differences in terminology (and in the specific techniques used in that
application) are merely
indicative of the variety of terminology and techniques used in the mushroom
production field.
9
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
Genetics of Mushrooms of the Invention
[0022] Mushrooms within the scope of the present invention referred to as
"clones" can be
prepared by any of the known cloning processes (as well as those that may be
discovered in the
future) from a mushroom of the invention, whether from one of the deposited
strains or from a
strain that is a progeny of the deposited strains. These clones are prepared
without a sexual crossing
process and have the same genetic and physical characteristics as their
parents. Mushrooms within
the scope of the present invention referred to as "progeny," rather than being
clones of the deposited
mushrooms, are strains that have been obtained by crossing a deposited strain
(e.g., AA-0096 or
BRO6) or one of their progeny with a second mushroom strain and are
characterized by having at
least one "genetic characteristic" of the strain of the invention that is not
present as a corresponding
genetic characteristic of the second strain with which it has been crossed. A
"genetic characteristic"
is any property of the genetic material of a mushroom strain (usually a gene
sequence) that is
measurable by a standard analytical technique. Examples of genetic
characteristics include RAPD,
RFLP, AFLP or SCAR bands as they appear on gels using standard analytical
techniques. These
well-know analytical techniques are described in numerous scientific
publications, including the
following:
SCAR: Paran, I. and R.W. Michelmore (1993). Development of reliable
PCR-based markers linked to downy mildew resistance genes in lettuce. Theor.
Appl. Genet. 85:985-993.
RAPD: Khush, R.S., Becker, E. & M. Wach (1992). DNA Amplification
Polymorphisms of the cultivated mushroom Agaricus bisporus. App!. Env
Microbiol 59:2971-2977
RFLP: Castle, A.J., P.A. Horgen & J.B Anderson 1987. Restriction
fragment length polymorphisms in the mushrooms Agaricus brunnescnes and
Agaricus bitorquis. App! Env Microbiol 53:816-822
AFLP: Mueller UG and Wolfenbarger LL (1999) AFLP genotyping and
fingerprinting. Trends Ecol Evol 14:389-394.
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
[00231 Such genetic characteristics (and the unique nature of the genetic
characteristics of the
strains of the invention relative to non-AA-0096-derived strains) are
exemplified in the RAPD
marker Tables 1 and 2 below. In Table 1, strains that contain a specified
genetic fragment are
indicated by having a "+" symbol, while strains lacking this fragment are
indicated with a
symbol. Following this convention, strains that share a genetic characteristic
(which can be either
the presence or absence of a specific genetic fragments) will have
corresponding "+" or "-" symbols
(i.e., +/+ or -/-). A number of different gene characteristics (which show as
a + for one strain and a
¨ for the other) can be observed in the strains of the invention relative to
the Amycel 2400 strain (a
commercial brown strain that is one of the parents crossed to make the
bridging cross strain).
Similar unique differences can be seen relative to the parent bridging cross
strain 4x29 that contains
genetic material from both a brown and a white commercial strain. The
fragments different from
those of the parent 2400 or 4x29 strains were inherited from the AA-0096
parent and are unique to
its progeny. For example, a 910 bp fragment is present in AA-0096 and BRO6
strains that is not
present in either 4x29 or Amycel 2400. This band is just one of many
characteristics bands that can
be used to identify strains of the invention.
11
CA 02617827 2008-02-01
WO 2007/019306
PCT/US2006/030436
Table 1 Table 2
4x29 2400 AA-0096 BRO6 Sequences
OPC-4 CCGCATCTAC
OP-C41400 + + - - (SEQ ID NO: 0001)
OPC-7 GTCCCGACGA
OPC-4910 - - + + (SEQ ID NO: 0002)
OPC8 TGGACCGGTG
OPC-71200 - - + + (SEQ ID NO: 0003)
OPC-10 TGTCTGrGGTG
OPC-8500 - - + + (SEQ ID NO: 0004)
OPC-11 AAAGCTGCGG
OPC-8450 - - + + (SEQ ID NO: 0005)
OPC-13 AAGCCTCGTC
OPC-10420 - - + + (SEQ ID NO: 0006)
OPF-5 CCGAATTCCC
OPC-117oo - - + + (SEQ ID NO: 0007)
OPF-8 GGGATATCGG
OPC-11600 - - + + (SEQ ID NO: 0008)
OPF-9 CCAAGCTTCC
OPC-13130 - - + + (SEQ ID NO: 0009)
OPF-11 TTGGTACCCC
OPF-51900 - - + + (SEQ ID NO: 0010)
OPH-1 GGTCGGAGAA
OPF-8200 + + - - , (SEQ ID NO: 0011)
OPH-5 AGTCGTCCCC
OPF-92200 - - + + (SEQ ID NO: 0012)
OPH-6 ACGCATCGCA
OPF-111100 - - + + (SEQ ID NO: 0013)
OPH-16 TCTCAGCTGG
OPH-12500 + + - - (SEQ ID NO: 0014)
OPH-18 GAATCGGCCA
OPH-11700 -- + + (SEQ ID NO: 0015)
_ -
OPJ-4 CCGAACACGG
OPH-51900 - - + + (SEQ ID NO: 0016)
OPJ-5 CTCCATGGGG
OPH-61200 - - + + (SEQ ID NO: 0017)
OPJ-7 CCTCTCGACA
OPH-16480 - - + + _ (SEQ JD NO: 0018)
OPJ-9 TGAGCCTCAC
OPH-181400 - - + + (SEQ ID NO: 0019)
_
OPK-1 CATTCGAGCC
OPH-181000 + + - - (SEQ ID NO: 0020)
12
CA 02617827 2008-02-01
WO 2007/019306
PCT/US2006/030436
OPK-6 CACCTTTCCC
OPL-61800 4- + - - S (SEQ ID NO: 0021)
OPK-8 GAACACTGGG
OPL-621 + + - (SEQ ID NO: 0022)
OPL-8 AGCAGGTGGA
OPL-81200 -- + + (SEQ ID NO: 0023)
OPJ-41500 - . + +
_
OPJ-5-1800 - - + +
OPJ-51200 + + _ _
OPJ-71850 - - + +
OPK-1690- - + +
OPK-1810 + + - -
OPK-8900 -- + +
13
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
100241 Similar unique genetic characteristics can be seen in SCAR data set out
in Tables 3-6. For
example, Tables 3 and 4 show that a 550 bp fragment is found in the BRO6
strain, one of the
progeny of AA-0096, as well as in AA-0096 itself, using the primer sequences
for R&D#9
described in Table 5, but is not found in Amycel 2400 or Sylvan 600
(commercial brown strains).
Accordingly, this sequence can be used in the process of identifying progeny
of AA-0096. In a
similar manner, any of the R&D series makers unique for AA-0096 identified in
the tables herein
can be used to identify the progeny of AA-0096 crossed with 4x29 and
differentiate them from
Amycel 2400, other commercial brown strains, or future brown mushroom strains
created using
breeding programs that do not involve AA-0096. In a similar manner, unique
gene fragments can
be found that distinguish the progeny from a white mushroom strain (a Ul
derivative in our
example), other commercial white strains, or future white mushroom strains
created using breeding
programs that do not involve AA-0096.
Table 3: Variations from commercial brown strain Amycel 2400
Marker Amycel 2400 BRO6 AA-0096
R&D#17 480/450/396 460/450/396 460/450/396
R&D#9 520 550/520/510 550/520/510
R&D#701 480/120 500/290/120 500/290/120
R&D#552 490/300/200/60 490/450/300/200/60490/450/300/200/60
1-To obtain results product was cut with Restriction Enzyme Hinf I
2-To obtain results product was cut with Restriction Enzyme Taq I
Table 4: Variations from commercial brown strain Sylvan 600
Marker Sylvan 600 BRO6
R&D#17 480/450/396 460/450/396
R&D#9 510 550/520/510
R&D#701 520/510 500/290/120
R&D#552 200 490/450/300/200/60
1-To obtain results product was cut with Restriction Enzyme Cfol
2-To obtain results product was cut with Restriction Enzyme Rsal
14
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
Table 5: Sequence of primer fragments
R&D#17 R&D#9 R&D#70 R&D#55
Forward aggtgegatgtegtccctca gtcccggtgtgacca ccttccaagaaaacccact
tggtcacagaaggtcctcag
primer 5' (SEQ ID NO: 0024) (SEQ ID NO: 0026) (SEQ ID Nth 0028) (SEQ ID NO:
0030)
Reverse tgggtgggatacttcgctgg gccatgagcgatcat atttccgagatcaccgaga
cgcatacattccaagagcac
prime 5' (SEQ ID NO: 0025) (SEQ ID NO: 0027) (SEQ ID NO: 0029) (SEQ ID NO:
0031)
Table 6: Variations from other commercial brown strains
Sylvan Lambert Lambert
Marker SB65 Sylvan 600 800 801 Amycel 2400 BRO6 AA-0096
R&D#17 480/450/396480/450/396 480/450/396 480/450/396 480/450/396 460/450/396
460/450/396
R&D#9 520 520 520 520 520 550/520/510
550/520/510
R&D#701480/120 480/120 480/120 480/120 480/120 500/290/120
500/290/120 "
490/300/ 490/300 490/300/ 490/300/ 490/300/ 490/450/300/
490/450/300/
R&D#552200/60 200/60 200/60 200/60 200/60 200/60 200/60
1-To obtain results product was cut with Restriction Enzyme Cfol
2-To obtain results product was cut with Restriction Enzyme Rsal
[0025] Characteristic genetic information identified as shown herein (or by
any other technique)
for other mushroom strains or species used in a crossing program can be used
to help identify
progeny of the deposited strains. Generally, the more characteristic bands
that are present, the more
closely the progeny will resemble the parent. The first-generation class of
progeny strains derived
from AA-0096 theoretically will share numerous genetic characteristics with AA-
0096, which will
be apparent by both SCAR analysis and RAPD analysis. Although no further
crosses are required
to obtain mushrooms of the invention, additional crosses may be carried out to
add other genetic
characteristics or in attempts to disguise the lineage of the strain. After
several crosses, only a few
characteristic bands may be present (depending on random reassortment process
during meiosis).
Preferred strains retain at least 5, preferably at least 10, unique RAPD bands
from AA-0096 or at
least 2, preferably at least 5, characteristic RFLP or SCAR bands.
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
[0026] Although the current examples describe comparison of strains of the
invention with the
commercial brown strain that is one of their ancestors via the crossing
program described herein,
comparisons can be made to any strain to show the differences of AA-0096
progeny from that
strain.
[0027] In addition to characteristic bands associated with the genetic
material derived from AA-
0096, a mushroom strain obtained by crossing a strain of the invention with a
different mushroom
strain will have genetic characteristics of the second strain; e.g., the
mushroom strain, in addition to
having a characteristic RAPD or RPLP band derived from AA-0096 will have at
least one RAPD or
RFLP band in common with the second strain (e.g., Amycel 2400) that is not
present as a
corresponding RAPD or RFLP band from strain AA-0096. These characteristic
bands will be useful
in identifying the second strain that has been crossed with a parent strain of
the invention to give a
progeny strain of the invention.
Selection of Desired Progeny
[0028] Any progeny strain genetically derived from AA-0096 that retains a
commercially
desirable characteristic of the strains of the invention remains within the
scope of the invention.
Such brown progeny strains (relative to the standard) can readily be selected
by color analysis of
mushroom caps, mushroom cap thickness measurement, antagonism with the
commercial brown
strain 2400, and significantly different productivity after crossing, as well
as the identification of
genetic characteristics. The commercially desirable characteristics can be
measured quantitatively
using the following general techniques, which are illustrated by specific
techniques in the Examples
that follow:
= Productivity: fruit strains in a controlled environment and collect
weight data on all
mushrooms produced.
= Cap color: measure color of caps using a color analysis instrument.
= Cap thickness: measure cap width and divide by cap height to obtain a
ratio.
16
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
= Genetic antagonism: attempt to cross strain under consideration with
commercial brown and
white existing strains; genetically antagonistic strains will not produce
viable crosses.
[0029] Some or all of these characteristics may be present in progeny of the
invention, depending
on genetic sorting. All progeny will have genetic bands in common with AA-0096
and one or more
of these physical characteristics.
Cap Color
[0030] Whiteness, or brightness, is measured by ability to reflect all
wavelengths of visible light.
Following this definition, mushroom strains that reflected less light would be
considered darker or
less white. The Specific measurement techniques are set forth in detail in the
Examples, but other
measurement techniques can be used as well, as long as the same technique is
used to measure
whiteness (darkness) of both the strains of the invention and the reference
Amycel 2400 strain. A
given strain will be sufficiently darker to be considered within the scope of
the invention when the
strain has a white light reflectance significantly less than that of strain
2400 at a confidence level of
at least 95% when measured by a single reflectance measurement technique.
Statistical analysis is
by standard techniques such as those described in N. M. Downie and R. W.
Heath, Basic Statistical
Methods, Harper & Brothers, New York, 1959 (see especially chapter 12, pp. 123-
139, entitled
"Testing Difference Between Means"). Strain 2400 has a typical mean
reflectance of 60%. Strains
of the invention typically have a reflectance less than 58% (significant
difference at 95% confidence
level), preferably less than 56%, more preferably less than 54%.
Increased Productivity
[0031] Mushroom productivity is measured by comparing total crop yield means
expressed in
pounds of mushrooms produced per square foot of growing area. Data is gathered
over the three
standard "breaks" of the growing cycle. The specifics of mushroom growing are
set forth in the
Examples. Strains of the invention typically will yield the same as 2400 (no
significant difference
at 95% confidence level), preferably have yield that is 5% higher then 2400
(significant difference
17
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
at 95% confidence level), more preferably a yield that is 10% greater then
2400 (significant
difference at 95% confidence level).
Thicker Cap/Cap Shve (CS)
[0032] The invented class produces brown mushrooms with thicker more domed
shape caps,
giving them a distinct shape compared to Ainycel 2400. Cap measurements can be
compared
between randomly selected mushrooms of the invention and a commercially
available brown
mushroom, such as Amycel 2400. Measurement data is typically collected from 20-
50 harvested
mushrooms grown and picked under specific and standard growing conditions. Cap
shape (CS) can
be quantified by first measuring the height of the cap (HC), the distance from
the top of the cap
adjacent to the mushroom stem to the top of the gills, and dividing this
result by cap diameter (CD).
Non-compatibility
[0033] The mycelia of compatible strains of mushrooms are able to fuse
together (anastomose)
and share nuclear constituents. Anastomosis also facilitates the
transportation of nutrients between
the two strains. Non-compatible strains can be defined as strains where this
type of mycelial fusion
is not possible or is reduced; in other words, anastomosis cannot occur or is
hindered. An
experiment can be carried out to quantify this phenomenon. Standard mushroom
growing utilizes
two inoculated substrates, inoculated or spawned compost and inoculated casing
or "cac".
Normally both of these substiates contain the same mushroom strain, which when
combined and
incubated under standard growing conditions produce commercially acceptable
yields of
mushrooms. Mycelium of the invented class, including BRO6, that are not
compatible with Amycel
2400 or other commercial brown mushrooms strains, will give different results.
Combination of
these two strains in the compost and the casing will result in retarded growth
and lower mushroom
yields, demonstrating non-compatibility. The lack of anastomosis between
strains has the potential
of limiting the infection and spread of viral disease (Kerrigan, R., Mushroom
News Volume 53
Number 14-23 (2005)).
[00341 In contrast to the first three commercially desirable characteristics,
in which the improved
properties can be said to be "better" than the corresponding properties of the
references strain
18
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
(better being darker, more productive, and thicker, respectively), non-
compatibility is more of an
absolute: two strains are either compatible or not, although there can be
different degrees of
compatibility as indicated by the co-growth assay described in the preceding
paragraph.
Accordingly, while the present invention achieves better commercial properties
of cap color,
productivity, and cap thickness relative to the standard, non-compatibility is
best described as
simply being present, rather than being "better." However, the disease
resistance will be better in
many cases when the disease attacks a mushroom characteristic based on the
genetics of the
currently available (and substantially genetically identical) brown Agaricus
bisporus commercial
strains.
Inheritance of Markers
[0035] The RAPD and SCAR data shown in the tables above clearly show the
segregation of
markers into BRO6. We concentrated on identifying loci inherited from AA-0096,
as these loci are
absent from Amycel 2400 brown mushrooms. However, the markers shown in the
examples are not
the only markers that can be used to characterize the strains and progeny
strains of the invention,
and the invention should not be considered limited to the example markers.
Novelty of the New Hybrid Strains
[0036] The uniqueness of the new hybrids is shown by the SCAR and RAPD
results. BRO6 is the
product of a unique nuclear fusion event (or cross) and has inherited markers
from both AA-0096
and 4x29. This invention, due to its novel genetics, may offer improved
resistance to known and
emerging mushroom pathogens (the importance of novel genetic characteristics
in providing disease
resistance is discussed in Kerrigan, R., Mushroom News Volume 53 Number 14-23
(2005)). BRO6
is a particularly preferred embodiment of the invention and, in addition to be
a representative of the
general class of AA-0096 progeny with improved characteristics, is also a
representative of the
preferred class of crosses between the 4x29 bridging cross strain and the wild
AA-0096 parent. All
crosses between the 4x29 bridging cross strain and the wild AA-0096 parent
that have at least one
19
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
improved characteristic noted herein (preferably at least two, more preferably
at least 3, and most
preferably all four) are members of this preferred class of crosses.
Production of Commercial Mushrooms from the New Hybrid Strains
[0037] As the hybrid mushrooms of the invention remain Agaricus bisporus
mushroom strains,
they can be grown using standard commercial mushroom growing processes that
have been
developed for Agaricus bisporus. Such processes are well known in the industry
and need not be
described here in detail. Examples of techniques for mushroom production are
shown in numerous
patents and technical publications, including those cited herein, with details
of production also
being shown in the Examples that follow. In general, the process comprises
inoculating a
mushroom growth medium with a hybrid Agaricus bisporus mushroom strain of the
invention,
maintaining the inoculated growth medium under conditions conducive to
mushroom fruiting, and
collecting mushrooms from the growth medium after they have reached the
desired maturity level
(e.g., for crimini or portabellas).
[0038] The invention now being generally described, specific examples are
provided showing
various embodiments of the invention. The invention, however, is not limited
to these specific
embodiments.
EXAMPLES
Strains
[0039] As noted previously, strains 4x29 and AA-0096 can now be obtained from
ATCC, along
with preferred strain BRO6, which was deposited under the provisions of the
Budapest Treaty with
the American Type Culture Collection, Rockville, Md., USA, ATCC accession No.
PTA-6876
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
(inventors' identification BRO6 A. bisporus, deposited on July 20, 2005).
Mycelium of mushroom
strain AA-0096 was used from our own collection; when others reproduce the
present invention,
this strain can be obtained through the ATCC. Mycelium from commercial strain
Amycel 2400
(material provided by Amycel, San Juan Bautista, Calif. 94045) and commercial
strain 901
(Lambert Spawn Company, PA) was used in creating breeding lines, including the
bridging cross
strains previously described. Among the examples of the breeding lines
produced by this initial
bridging cross is the 4x29 strain used in making certain preferred embodiments
of the invention.
100401 All strains were cultured, maintained, and selected on Compost Lite
Agar (CL) at
21° C. CL Agar comprises potato dextrose agar (PDA; Difco) with 0.5%
Yeast extract
(Sigma) and 10% compost extract. Compost extract was made by infusing equal
volumes (w/v) of
phase II compost and 1120. The compost and water were autoclaved twice for 90
minutes, and the
aqueous extract was added to make CL agar. Mushroom spawn was made using rye
grain
inoculated with 2 cm2 chunks of colonized CL agar. Spawn was grown for four
weeks and was
shaken at bi-weekly intervals.
Compost and Media
[0041] Heterokaryons were fruited on standard phase II mushroom compost. The
compost was
colonized with inoculated rye spawn for thirteen to fourteen days, with bed
temperatures in the
range 210-27 C, and CO2 between 5000 and 10000 parts per million (ppm). Beds
were then
covered with a 5-cm layer of casing formulation (approximately 75% peat/25%
CaCO3), and the
cased beds were scratched after five days to encourage mycelial growth into
the casing layer. Two
days after scratching the beds were flushed, with the air temperature dropping
to 160 C and the CO2
dropping to 1000 to 1500 ppm. Mushrooms appeared approximately two weeks after
flushing, and
during first break bed temperatures were held at 18 -21 C. For every crop,
yield was assessed using
three breaks of production.
21
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
DNA Isolation for PCR Analysis
[0042] For DNA isolation, cultures were either grown in IVIPYFE liquid medium
(Castle et al.,
1987) or on cellophane over CL Agar. Harvested tissue was frozen at -70 C.
and was freeze dried
prior to DNA isolation.
[0043] DNA was prepared from freeze-dried mycelium. First, freeze dried tissue
was ground with
a glass rod, and 0.6 nil of 65 C. DNA extraction buffer (0.7 M sodium
chloride/0.1 M sodium
sulphite/0.1 M Tris-HC1, pH 7.5/0.05 M EDTA/1% SDS) was added. Tubes were
mixed and placed
at 65 C. for 30 minutes. Next, 0.6 ml of chloroformisoamyl alcohol (24:1) was
added, and the
tubes were mixed. Tubes were placed on ice for 30 minutes, followed by
centrifugation at high
speed (12000 x g) for 30 minutes.
[0044] Supernatants were placed in fresh tubes, and 2 volumes of ethanol were
added. After
mixing, the tubes were centrifuged at low speed (2000 x g) for 30 seconds.
Pellets were
resuspended in 200)11 sterile water, and 100 ul of 7.5 M ammonium acetate were
added. The tubes
were then mixed and placed on ice for 1 hour.
[0045] Next, the tubes were spun at high speed (12000 x g) for 30 minutes, and
the supernatants
were transferred to fresh tubes. Isopropanol (0.54 volume) was added, and the
tubes were mixed by
gentle inversion. Supernatants were removed, and pellets were washed with 70%
ethanol. Finally,
ethanol was removed through centrifugation and pipetting, and the DNA was
resuspended in 100 121.
of TE (10 mM Tris-HC1, pH 7.5/1 mM EDTA).
Derivation and Isolation of Homokaryons
[0046] All homokaryons used in the invention were derived from spontaneous
homokaryons
identified from single spore isolates (SSI). Spores were collected from
mushrooms, and the spores
were diluted in H20 containing 1% Tween 80. Spore density was calculated on a
haemocytometer
22
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
slide, and spore dilutions were plated out on PDA.
DNA Fingerprinting
[0047] For both parents (4x29 and AA-0096), SCAR makers derived from RAPD
markers (Paran,
I. and R.W. Michehnore (1993); Development of reliable PCR-based markers
linked to downy
mildew resistance genes in lettuce; Theor. Appl. Genet. 85:985-993) were used
to determine the
hornokaryotic nature of the single spore isolates.
[0048] Compatibility of homokaryons of both strains was determined by using
techniques
described using the MAT marker (Xu J, Kerrigan RW, Horgen PA, Anderson JB
(1993).
Localization of the mating type gene in Agaricus bisporus. Appl Environm.
Microbiol 59:3044-
3049), and by doing test crosses.
[0049] Homokaryons derived from 4x29 were screened for color using the L43
SCAR described
by Loftus, M., L. Bouchti King and C. Robles (2000) Science and Cultivation of
Edible Fungi: 201-
202.
[0050] DNA fingerprinting of novel strains was determined by polymerase chain
reaction (PCR)
analysis using sequence-characterized amplified region markers (SCAR) markers
and RAPD
markers. DNA fingerprinting techniques were adapted from those described in
Khush, R.S.,
Becker, E. & M. Wach (1992); DNA Amplification Polymorphisms of the cultivated
mushroom
Agaricus bisporus; AppL Env Microbiol 59:2971-2977, and Williams, LA.,
Kubeliki, K., Livat, K.,
Rafalski, J. & S. Tingey. (1991); DNA polymorphisms amplified by arbitrary
primers are useful as
genetic markers; Nuclei Acids Research. 22:6531-6525.
23
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
Hybrid Mushrooms Derived from Strain AA-0096 (syn. BP1)
[0051] Initial experiments were carried out to determine if wild strains of A.
bisporus could be
used to improve commercial strains, specifically to improve upon the
commercial brown A.
bisporus strain used to produce portabella (syn. portabello) and cremini
(small unopened brown
mushrooms) varieties. Various genetically identical versions of this brown
strain are sold by U.S.
mushroom spawn producers. The strain designated Amycel 2400 was used as the
primary
representative of this class for comparative purposes.
[0052] The hybrid known as 4x29 (now available as ATCC accession No. PTA-6877)
was chosen
as the variety to be crossed with AA-0096 because of its ability to produce
mushrooms with
increased cap thickness when compared to Amycel 2400, a potential benefit to
crop yield. The
hybrid 4x29 was created by combining compatible homokaryotic single spore
isolates of the
Amycel 2400 with homokaryotic single spore isolate of a commercially available
off-white hybrid
(present day version of the Horst Ul hybrid).
[0053] A total of 105 homokaryotic single spore isolates were collected from
AA-0096. The
nuclear constitution of the isolates was analyzed using SCAR markers.
[0054] A total of 250 homokaryotic single spores isolates were collected from
4x29. The nuclear
constitution of the isolates was analyzed using SCAR makers. Due to the nature
of this hybrid
additional analysis to determine the color loci inherited by each homokaryon
was also undertaken
using SCAR markers.
[0055] Compatible homokaryons of AA-0096 and 4x29 were crossed and the
resulting progeny
were screened for darker cap color and increased yield. A number of the
progeny, including a new
hybrid designated BRO6 (ATCC accession No. PTA-6876), exhibited darker caps
and increased
yield when compared to the commercial brown strain (Amycel 2400).
24
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
Yield Data
[0056] A series of three crops were grown to compare BRO6 to the commercial
brown strain
Amycel 2400. The crops were undertaken at the Amycel Intermediate Testing
Facility. Both
strains were fruited in small 1.8 ft2 mushroom trays on standard phase II
mushroom compost. The
compost was colonized with inoculated rye-grain spawn for fifteen days, with
bed temperatures in
the range 21 -27 C., and CO2 between 5000 and 10000 parts per million (ppm).
Beds were then
covered with a 5-cm layer of casing formulation (approximately 75% peat/25%
CaCO3), and the
cased beds were scratched after five days to encourage mycelial growth into
the casing layer. Three
days after scratching the beds were flushed, with the air temperature dropping
to 16 C. and the CO2
dropping to 1000 to 1500 ppm. Mushrooms appeared approximately two weeks after
flushing.
Mushrooms were harvested over a three-week period, and comprehensive yield
data was collected
using a system designed specifically for this purpose. The mean yield of the
two strains expressed
in pounds of mushrooms produced per square foot data for the three trials is
summarized below in
Table 7.
Table 7
Amycel
BRO6 2400
Trial#1 6.41a 5.49b
Trial#2 6.39a 5.28b
TriaWt3 6.64a 5.65b
Any two means having a common letter are not significantly different at the 5%
level of
significance, using standard West analysis.
[0057] As can be seen from the data, the BRO6 significantly out yielded the
Amycel 2400 strain in
every case.
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
Color Measurements
[0058] Mushroom surface color data was evaluated with a chromameter (Konica
Minolta BC-10,
Osaka, Japan), by measuring the L* and b* parameters. L* is a brightness
variable and extends
from 0 (black) to 100 (white). The b* value represents yellowness-blueness
chromaticity.
[0059] Mushrooms of cap diameter 8-10 cm were collected from both BRO6 and
Amycel 2400 at
the same crop stage, and measurements were taken on the tops of the caps at
random. Thirty L* and
b* values for each strain was analyzed using standard t-test analysis
(Microsoft EXCEL 2000 Data
Analysis Package). Data is analyzed in Table 8.
Table 8
Amycel
2400 BRO6
L* Value 60.15a 56.66b
b* Value 11.6a 13.64b
Any two means having a common letter are not significantly different at the 5%
level of
significance, using standard t-test analysis.
[0060] BRO6 produced mushrooms that were both less bright (Lower L* value) and
more yellow
(higher b* Value) then the commercial brown Amycel 2400.
Cap Shape
[0061] Four experiments were undertaken to compare the Cap Shape (CS) of BRO6
versus
Amycel 2400. Cap Shape is the ratio of cap height (CH) and cap diameter (CD).
In all
experiments, 40 mushrooms were randomly selected from each treatment from
small experimental
trays, grown according to standard mushroom growing conditions (conditions
summarized above
under Yield Data). In all of the experiments mushrooms were harvested at the
same time.
[0062] The data from all of the above experiments are summarized in Table 9.
Statistical analysis
of the Cap Shape ratio was completed utilizing Microsoft Excel 2000. As can be
seen in all trials,
26
CA 02617827 2008-02-01
WO 2007/019306 PCT/US2006/030436
the BRO6 strain produced mushrooms with a higher Cap Shape value than the
Amycel 2400. Cap
Shape differences ranged from 0.02 to 0.05. The mushrooms produced by BRO6
were noticeably
thicker upon observation, and this carried out into the values obtained
through measurement.
Table 9
BRO6 Amycel 2400
Experiment#1 0.29a 0.27b
Experiment#2 0.26a 0.22b
Experiment#3 0.32a 0.30b
Experiment#4 0.30a 0.25b
Any two means having a common letter are not significantly different at the 5%
level of
Significance, using standard t-test analysis.
Non-Compatibility
[0063] Two experiments were completed to demonstrate the non-compatibility
between BRO6
and Amycel 2400. Treatment#1 and Treatment#3 are the un-mixed treatments (same
strain in
compost and casing) and Treatment#2 and Treatment#4 are the mixed treatments
(different strain in
compost and casing). Five trays of each of all of the treatments were grown in
small growing
rooms, according to standard mushroom growing practices (conditions summarized
above under
Yield Data).
[0064] At the time of scratch and flush, the growth of mushroom mycelium in
the casing layer of
the trays of the mixed treatments (#2 and #4) was greatly diminished compared
to growth in the
non-mixed treatments (#1 and #3). During mushroom fruiting the number of
mushroom pins
produced by the mixed treatments was greatly reduced in both of the mixed
treatments
(BRO6/Amycel 2400 and Amycel 2400/BR06) versus the non-mixed treatments.
27
CA 02617827 2013-09-23
= 1.00651 As can be seen in the tables, the total yield for the mixed
treatments Was greatly reduced
versus the non-mixed treatments (yield is expressed as pounds of mushrooms per
square foot of
growing area).
=
Table 10
Treatment#1 Treatment42
Strain Compost BRO6 BRO6
Strain Casing _BRO6 Amycel 2400
=
Experiment#1 6.52* 3.63"
Experimen1312 _ 4.919 1.87 b
Any two means having a common letter are not significantly different at the 5%
level of
Significance, using standard t-test analysis.
Table 11 .
Treatment/8 Treatment#4
Strain Compost Amycel 2400 Amycel 2400
=
Strain Casin_g Amycel 2400 BR06
Experiment#1 6.04a 1.56
Experiment#2 4.97' - 2.23"
Any two means having a common letter are not significantly different at the 5%
level of
Significance, using standard t-test analysis. =
[00661 The reduction in yield when BRO6 and Amycel 2400 are mixed together
indicates a
reduction of anastomosis between the two strains.
[0067]
The invention now being fully described, it will be apparent to one of
ordinary skill in the
art that many changes and modifications can be made thereto without departing
from the
scope of the invention.
28
CA 02617827 2013-09-23
SEQUENCE TABLE
<110> Amycel, Inc.
<120> Brown Mushrooms for Commercial Production
<130> 40637-306
<140> CA 2617827
<141> 2006-08-03
<150> US 60/705,862
<151> 2005-08-04
<150> US 11/267,043
<151> 2005-11-03
<160> 31
<170> PatentIn version 3.3
<210> 1
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 1
ccgcatctac 10
<210> 2
<211> 10
<212> DNA
<213> Artificial
<220>
=
=
<223> Primer
<400> 2
gtcccgacga 10
<210> 3
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 3
tggaccggtg 10
29
CA 02617827 2013-09-23
<210> 4
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 4
tgtctgggtg 10
<210> 5
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 5
aaagctgcgg 10
<210> 6
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 6
aagcctcgtc 10
<210> 7
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 7
ccgaattcce 10
<210> 8
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 8
gggatatcgg 10
CA 02617827 2013-09-23
<210> 9
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 9
ccaagcttcc 10
<210> 10
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 10
ttggtacccc 10
<210> 11
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 11
ggtcggagaa 10
<210> 12
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 12
agtcgtcccc 10
<210> 13
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 13
acgcatcgca 10
31
CA 02617827 2013-09-23
<210> 14
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 14
tctcagctgg 10
<210> 15
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 15
gaatcggcca 10
<210> 16
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 16
ccgaacacgg 10
<210> 17
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 17
ctccatgggg 10
<210> 18
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 18
cctctcgaca 10
32
CA 02617827 2013-09-23
<210> 19
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 19
tgagcctcac 10
<210> 20
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 20
cattcgagcc 10
<210> 21
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 21
cacctttccc 10
<210> 22
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 22
gaacactggg 10
<210> 23
<211> 10
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 23
agcaggtgga 10
33
CA 02617827 2013-09-23
<210> 24
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 24
aggtgcgatg tcgtccctca 20
<210> 25
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 25
tgggtgggat acttcgctgg 20
<210> 26
<211> 15
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 26
gtcccggtgt gacca 15
<210> 27
<211> 15
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 27
gccatgagcg atcat 15
<210> 28
<211> 19
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 28
ccttccaaga aaacccact 19
34
CA 02617827 2013-09-23
<210> 29
<211> 19
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 29
atttccgaga tcaccgaga 19
<210> 30
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 30
tggtcacaga aggtcctcag 20
<210> 31
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 31
cgcatacatt ccaagagcac 20
