Note: Descriptions are shown in the official language in which they were submitted.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
Compounds
The present invention relates to molecules which are able to modulate the
association between molecules in a complex comprising cAMP dependent protein
kinase (PKA) type II, AKAP18S, phosphodiesterase 4D (PDE4D), phospholamban
(PLB) and SERCA2 and their use to modulate signalling achieved through that
complex, particularly to produce pharmaceutical preparations to treat or
prevent
diseases which would benefit from modulation of said signalling, such as
cardiovascular diseases, e.g. heart failure. Preferably the molecules are
inhibitors of
the binding or association between AKAP18S and phospholamban or between
PDE4D and AKAP 188.
More specifically, the present invention provides molecules, e.g. direct
antagonistic inhibitors of the association or binding between PLB and AKAP 186
or
between PDE4D and AKAP18S. In particular, said antagonistic inhibitors, which
may be anchoring disruption peptides, bind to the PLB binding site of AKAP 188
to
antagonize PLB binding to AKAP18S, preferably to abolish that binding and thus
antagonize complex formation and signalling through that complex. Inhibitors
which prevent binding at the nucleotide level are also provided. In the
alternative
mimics are provided which bind or associate with components of the complex and
which may also facilitate localization or activation of certain components and
may
thus act as agonists of the associations and hence signalling through the
complex.
Cyclic AMP-dependent protein kinase (PKA) is an enzyme present in all
cells. Hormones and neurotransmitters binding to specific receptors stimulate
the
generation of the second messenger 3',5'-cyclic adenosine monophosphate
(cAMP).
Cyclic AMP is one of the most common and versatile second messengers. The best
characterized and major downstream effector mechanism whereby cAMP exerts its
effects involves binding to and activating PKA. PKA is a serine/threonine
protein
kinase which phosphorylates a number of different proteins within the cell,
and
thereby regulates their activity. It is known that ?KA regulates a vast
variety of
cellular processes such as metabolism, proliferation, differentiation and
regulation of
gene transcription.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-2-
The great diversity of cellular processes mediated by cAMP and PKA
strongly suggests that there exists mechanisms that provide the required
sensitivity
and specificity of the effector pathway to ensure that rapid and precise
signalling
processes take place. Specificity can be achieved by tissue- and cell-type
specific
expression of PKA isoforms with different biochemical properties. However,
targeting of PKA isoforms by A-kinase anchoring proteins (AKAPs) provides a
higher level of specificity to the signalling process by localizing PKA to
defined
subcellular sites in close proximity to the substrate. Anchoring of PKA by
AKAPs
may also tune the sensitivity of the signal pathway by recruiting PKA into
multiprotein complexes that include phosphodiesterases and protein
phosphatases as
well as other signal proteins in addition to PKA (Michel and Scott, 2002, Ann.
Rev.
Pharmacol. Toxicol., 42, p235-257).
PKA is made up of four different subunits, a regulatory (R) subunit dimer
and two catalytic (C) subunits. Two main classes of PKA isozymes, PKA type I
and
PKA type II (PKA I and PKA II, respectively) have been described. PKA I and
PKA II can be distinguished by their R subunits, designated RI and RII.
Isoforms of
RI and RII are referred to as RIa, RIP, RIIa and RII(3. Moreover, the C
subunits
also exist as isoforms referred to as Ca, C(3 and Cy. The different subunits
may
form multiple forms of PKA (isozymes) with potentially more than 18 different
forms.
Activation occurs upon binding of cAMP to the R subunits followed by the
release of the active catalytic subunit. PKA type II is mainly particulate and
associated with AKAPs whereas PKA type I is both soluble and particulate
although
PKA type I anchoring has remained more elusive. However, PKA type I is present
in the lipid raft fraction of the cell membrane and colocalizes with the TCR-
CD3
complex upon T-cell activation (Skalhegg et al., 1994, Science, 263, p84-87).
The cAMP signalling pathway has been iniplicated in numerous diseases.
Disease may correlate with hyperactivation (too much signalling) or
hypoactivation
(too little signalling) of the cAMP pathway. Hypoactivity in cAMP signalling
is
implicated in several diseases such as asthma and clironic obstructive
pulmonary
disease, cardiovascular diseases such as heart failure and atherosclerotic
peripheral
arterial disease, neurological disorders and erectile dysfunction (Corbin, et
al., 2002,
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-3-
Urology, 60, p4-11; Feldman and McNamara, 2002, Clin.Cardiol., 25, p256-262;
Grouse et al., 2002, J.Clin.Pharmacol., 42, p1291-1298; Manji et al., 2003,
Biol.Psyc., 53, p707-742; Spina, 2003, Curr. Opin. Pulm. Med., 9, p57-64),
whereas
hyperactivity of the cAMP signalling pathway correlates with control of
exocytotic
events in polarised epithelial cells with implications for diabetes insipidus,
hypertension, gastric ulcers, thyroid disease, diabetes mellitus and asthma.
Also (3-
adrenergic signalling in the heart, the control of metabolism in adipose
tissue and,
reproductive function requires localization of the cAMP signalling pathway.
All
these effects of cAMP appear to be mediated via PKA type II / AKAP complexes.
In
contrast, cAMP pathways that signal to anchored PKA type I /AKAP complexes are
involved in,the regulation of steroidogenesis and immune responses.
Rhythmic heart muscle contractions are regulated by action potentials
generated by pacemaker cells located in the sinus and other centres within the
heart
muscle. The action potentials induce opening of voltage-dependent L-type Ca2+
channels thereby eliciting an influx of Ca2+ into the cytosol of cardiac
myocytes
through those channels. L-type Ca2+ channels are located in the plasma
membrane of
the cells. The plasma membrane of myocytes is known as sarcolemma. The rise of
cytosolic CaZ+ activates Ca2+-activated Caz+ release channels (ryanodine R2
receptors, RyR2) located in the membrane surrounding the sarcoplasmic
reticulum
(SR). Activation of RyR2 induces the release of Ca2+ from the SR into the
cytosol.
The elevation of cytosolic Ca2+ triggers the contraction of cardiac myocytes
through
proteins of the cytoskeleton. Relaxation of the myocytes and thus of the heart
muscle after each contraction is achieved by removal of the cytosolic Ca2+,
mainly
into the SR through the ATP-dependent Ca2+ pump SERCA2 (sarcoplasmic
reticulum Ca2+-ATPase; Ca2+ reuptake).
SERCA2 is located in the membrane of the SR. During contraction SERCA2
is kept inactive by interaction with its inhibitor phospholamban (PLB or
occasionally referred to herein as PLN), a small protein of 5 kDa in its
monomeric
form. PLB may also pentamerize giving rise to a protein complex of 25 kDa. The
rise of cytosolic Ca2+ causes dissociation of PLB and thereby activation of
SERCA2.
The phenomenon of linking myocyte contraction to electric stiinulation (action
potential) is known as excitation-contraction coupling. All components of the
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-4-
system that regulates the cytosolic CaZ+ including RyR2, SERCA2 and PLB are
located at the SR membrane at junctions with the sarcolenuna where the L-type
Ca2+ channels are localized. The location is morphologically defined and
termed the
T-tubule.
The heart is subject to regulation by various hormones and neurotransmitters
including adrenalin, noradrenalin and other (3-adrenoreceptor agonists via the
cAMP
signalling pathway. P-adrenoreceptors are found in the sarcolemma with the T-
tubules. Sympathetic stimulation of the heart through (3-adrenergic receptors
increases both contraction force (inotropy) and heart rate (clironotropy). In
order for
the heart rate to increase, relaxation and Ca2+ decline must occur rapidly. (3-
adrenergic receptor stimulation activates a G-protein which stimulates the
production of cAMP, which in turn activates PKA. PKA then phosphorylates
several
proteins related to excitation-contraction coupling (L-type Ca2+ channels,
RyR,
troponin I and myosin binding protein C) thus regulating the Ca2+ -flux from L-
type
Ca2+ channels and the SR. Furthermore, PKA phosphorylates phospholamban that
regulates the activity of SERCA2 and leads to increased re-uptake of Ca2+ into
SR, a
process which is affected in failing hearts (Frank and Kranias, 2000, Ann.
Med., 32,
572-578; Movsesian, 1998, Ann. N.Y. Acad. Sci., 853, p231-239; Schwinger and
Frank, 2003, Sci. STKE, 2003, pe15-).
In failing hearts, RYR is hyperphosphorylated by PKA leading to an altered
channel function, while SERCA2 has reduced Ca2+-reuptake activity because PLB
is
hypo-phosphorylated. Upon heart failure, the heart can be damaged by
adrenergic
stimulation due to too much metabolic stress and beta-blockers that prevent
adrenergic pacing give increased survival during post-infarction heart
failure. Heart
failure is a major cause of death and disability and there remains a need for
suitable
therapeutic molecules to prevent or treat heart failure.
According to the current neurohumoral model, pharmacological treatment of
chronic heart failure (CHF) is aimed at preventing the maladaptive, biological
changes that occur in chronic CHF. In line with this, the only pharmacological
interventions proven conclusively to improve mortality and morbidity in
clironic
CHF, i.e. angiotensin converting enzyme (ACE) inhibitors/ angiotensin II type
1
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-5-
receptor antagonists, aldosterone antagonists and beta-adrenoceptor
antagonists
(beta-blockers), all address such neurohumoral changes.
The rationale for beta-blocker therapy in CHF is that chronic adrenergic
stimulation is a harmful compensatory mechanism in the failing human heart
(Bristow, 2000, Circulation, 101, p558-569). In end-stage failing heart, 50%
to 60%
of total beta-adrenergic signal transducing potential is lost, due to
desensitisation
changes in betal- and beta2-adrenoreceptors and downstream signalling
mechanisms
(Bristow, 1993, J. Am. Coll. Cardiol., 22, 61A-71A; Ungerer et al., 1994,
Circ. Res.,
74, p206-213). The remaining signalling capacity still appears harmful enough
to
explain the remarkable results with beta-blockade in CHF.
The inotropic effect of beta-adrenergic agonists in CHF is cAMP mediated
(Brattelid et al., 2004, Naunyn-Schmiedeberg's Arch. Pharmacol., 370, p157-
166;
Qvigstad et al., 2005, Cardiovasc. Res., 65, p869-878); Qvigstad et al., 2005,
Proceedings of the 25th European Section Meeting, International Society for
Heart
Research, Tromso, Norway, June 21-25, 2005, Medimond International
Proceedings, Bologna, Italy, p7-12). Peptides that specifically disrupt PKA
type II /
AKAP interactions may be used to displace PKA, and prevent phospholamban
phosphorylation and thus work as cardioprotective agents in post-infarction
heart
failure.
Conversely, if PLB becomes superinhibitory or chronically inhibitory this
may reduce contractility and induce dilated cardiomyopathy in mice and humans
(reviewed in MacLennan and Kranias, 2003, Nat. Rev. Mol. Cell Biol., p566-
577).
In support of this, ablation of PLB (Minamisawa et al, 1999, Cell, 99, p313-
322;
Sato et al., 2001, J. Biol. Chem. 276, p9392-9399; Freeman et al., 2001, J.
Clin.
Invest., 107, p967-974) or introduction of a pseudophosphorylated PLB
(Hoshijima
et al, 2002, Nat.Med., 8, p864-871) conlpletely or partially prevents
progression to
end-stage heart failure in various mouse models of dilated cardiomyopathy.
Similarly, short term adenoviral-mediated overexpression of SERCA2 or
overexpression of upstream regulators such as (3-adrenoreceptor kinase
inhibitor
which prevents termination of (3-adrenergic signals also delays development of
cardiac dysfunction in these models (Miamoto et al., 2000, Proc. Natl. Acad.
Sci.
USA, 97, p793-798; del Monte et al., 2001, Circulation, 104, 1424-1429; White
et
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-6-
al., 2000, Proc. Natl. Acad. Sci. USA, 97, p5428-5433; Shah et al., 2001,
Circulaiton, 103, p1311-1316). In humans, PLB mutations may cause dilated
cardiomyopathy by chronic inhibition of SERCA2 or by prevention of PKA
phosphorylation (Schmitt et al., 2003, Science, 299, p1410-1413; Haghighi et
al.,
2003, J. Clin. Invest., 111, p869-876). Such loss of normal PLB function also
increased cardiac susceptibility to ischemic injury (Cross et al., 2003, Am.
J.
Physiol. Heart. Circ. Physiol., 2003, 284, pH683-H690). Together this
indicates that
selective upregulation of PLB phosphorylation or reversal of the
hypophosphorylated state of PLB (as opposed to more general (3-adrenergic
stimulation leading to phosphorylation also of outer substrates such as RYR)
may be
beneficial in cardiac diseases. Mimics that target PKA to the PLB-SERCA2-
AKAP 186 complex may be used to achieve such selective increase in PLB
phosphorylation and suppress heart failure progression in progressive dilated
cardiomyopathies and cardiac muscle diseases.
Localized signalling is clearly important in the regulation of Ca2+ in the
heart. The cAMP increase in response to P-adrenergic stimuli is known to be
local
and controlled temporally. Such pools of cAMP are shaped by phosphodiesterases
localized in the vicinity of the SR. It is clear that the green fluorescent
protein/yellow fluorescent protein (GFP/YFP) PKA probe for cAMP (Zaccolo and
Pozzan, Science, 295, p1711) is targeted, indicating the presence of AKAPs.
The P-
AR and the L-type Ca2+-channel have known AKAPs associated with them that are
present in heart ((3-AR:AKAP79, and gravin:L-type Ca2+- channel:AKAP18a). '
AKAP-lbc (Diviani et al., 2001, J. Biol. Chem., 276, p44247-44257), AKAP18a
(Hulme et al., 2003, Proc. Natl. Acad. Sci. USA, 100, p13093-13098) and
AKAP188
(Henn et al., 2004, J. Biol. Chem., 279, p26654-26665) have been found to be
expressed in heart. Furthermore, rnAKAP has been shown to be colocalized with
RyR (Kapiloff et al., 2001, J. Cell Sci., 114, p3167-3176; Marks, 2001, J.
Mol. Cell
Cardiol., 33, p615-624), although the majority of mAKAP is at the nuclear
envelope
of cardiomyocytes. A mutant resulting in a single amino acid substitution in D-
AKAP2 (1646V) has lowered affinity for Rta and is associated with changes in
ECG-recordings and cardiac dysfunction, implicating D-AKAP2 in targeting of
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-7-
PKA, possibly to an ion channel although the exact location of D-AKAP2 is not
known (Kammerer et al., 2003, Proc. Natl. Acad. Sci. U.S.A, 100, p4066-4071).
AKAP 18, also referred to as AKAP7, comprises a fanlily of splice variants
including a, P, y and S(Gray et al., 1997, J. Biol. Chem., 272, p6297-6302;
Fraser et
al., 1998, EMBO J., 17, p2261-2272; Trotter et al., 1999, J. Cell Biol., 147,
p1481-
1492; Henn et al., 2004, J. Biol. Chem., 279, p26654-26665; gene bank entry
AKAP188: AY350741). AKAP18a (Fraser et al., 1998, supra) is also known as
AKAP15 (Gray et al., 1997, supra). AKAP18 variants function as AKAPs.
AKAP18a, 0, y and S interact witli RII subunits of PKA. The RII-binding
domain (LVRLSKRLVENAVL) is identical in all variants. In human and rat
AKAP 18a sequences it corresponds to amino acid residues 29-42. The RII-
binding
domain forms an amphipathic helix structure which is conserved within the AKAP
family. All AKAPs dock to the dimerization/docking domain of regulatory
subunits
through this motif.
A leucine zipper motif ELVRLSKRLVENAVLKAVQQYLEETQN) within
human and rat AKAP 18a (amino acid residues 28-54 of hunian AKAP 18a)
interacts
with a leucine zipper motif of skeletal muscle voltage-dependent L-type Ca2+
channel Cavl.1 (amino acid residues 1774-1821 of the rabbit protein; Hulme et
al.,
2002, J. Biol. Chem., 277, p4079-4087) and a leucine zipper motif of cardiac
voltage-dependent L-type Ca2+ channel Cavl.2 (amino acid residues 2062-2104 of
the rat protein; Hulme et al., 2003, supra). The leucine zipper motifs of
human and
rat AKAP 18a are identical with those of all other AKAP 18 variants. They
overlap
with the RI- and RII-binding domains. Surprisingly, only interaction of rat
and
human AKAP18a with L-type Ca2+ channels has been observed.
The present inventors have now identified that AKAP 188 anchors PKA type
II in heart sarcoplasmic reticulum and that this AKAP is in complex with PLB
which in turn is in complex with, and regulates the activity of SERCA2. PDE4D
which degrades cAMP, has also been found to be associated with AKAP 188 near
the PKA II binding site. Signalling is achieved by activation of PKA which
phosphorylates PLB whicli dissociates from SERCA2 to increase the activity of
SERCA2 which increases calcium reabsorption into the sarcoplasmic reticulum
which increases relaxation rates (lusitropic effect) which allows for
increasing the
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-8-
heart rate (chronotropic effect) as well as the contraction force (inotropic
effect) in
response to sympathetic nervous stimuli and adrenalin.
Modulation of the complex formation affects the PKA signalling achieved
through this complex. The inventors have found that removal or dissociation of
AKAP 188 from the complex by the use of anchoring disruption peptides disrupts
localization and thereby the regulatory function of PKA type II at this
specific locus.
siRNA has been found to be similarly useful. Removal of PDE4D from the complex
would lead to increased local cAMP levels and hence PKA activity and PLB
phosphorylation whicli in turn would increase the activity of SERCA2. These
mechanisms of modulating the complex and the signalling achieved through the
complex may thus be used in cardiology and in particular in the treatment of
myocardial infarction and heart failure in a similar but more potent manner to
currently used beta-blockers. The development of treatnients offering
alternatives to
beta-blockers is important because beta-blockers are contraindicated in
several
diseases, including asthma.
Anchoring disrupting peptides for PKA type I and type II have been
described previously, Ht31 (Carr et al., J. Biol. Chem, 266:14188-92, 1991;
Rosenmund et. al., Nature, 368(6474):853-6, 1994), AKAP-IS (Alto et. al., Proc
Natl Acad Sci USA. 100:4445-50, 2003), and PV38 (Burns-Hamuro et. al. Proc
Natl
Acad Sci USA. 100:4072-7, 2003).
The work carried out by the present inventors has identified the specific
interaction between AKAP188 and PKA type II. Furthermore, the interactions
between PLB and AKAP 188 and between AKAP 188 and PDE4D were not
previously known and thus present new targets in treating heart diseases and
conditions.
The present invention provides a variety of modes of modifying, e.g.
interrupting or enhancing PKA type II-mediated activation of SERCA2 by
affecting
the binding between PLB and AKAP18 S and/or between AKAP186 and PDE4D or
affecting the phosphorylation of PLB in the complex by increasing the levels
of
PKA in said complex such as by using the AKAP188:PKA association. Suitable
modes of interruption include the use of direct or indirect inhibitors of
those
interactions and modification of the wild-type forms to impair normal binding.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-9-
In a first aspect therefore, the present invention provides a method of
altering
PKA type II-mediated activation of SERCA2 (preferably SERCA2a) in a cell by
administration of an anchoring disruption molecule or binding partner mimic,
preferably as defined herein, which modifies, e.g. reduces, inliibits or
enhances the
binding between one or more of the following binding partners:
i) PLB and AKAP 185, and
ii) AKAP18S and PDE4D.
The binding between AKAP188 and PKA type II may also be used in certain
applications of the invention to modify PLB phosphorylation as described
hereinafter.
As referred to herein a "binding partner" refers to a molecule which
recognizes and binds or associates specifically (i.e. in preference to binding
to other
molecules) through a binding site to its binding partner. Such binding pairs
when
bound together form a complex.
The amino acid sequence of the human form of PLB appears in SEQ ID No.
1:
mekvqyltrs airrastiem pqqarqklqn lfinfclili cllliciivm 11
(SEQ ID No. 1)
The amino acid sequence of PLB from rat appears in SEQ ID No. 2:
mekvqyltrs airrastiem pqqarqnlqn lfinfclili cllliciivm 11
(SEQ ID No. 2)
The amino acid sequence of AKAP18S from rat appears in SEQ ID No. 3:
merpaageid ankcdhlsrg eegtgdlets pvgsladlpf aavdiqddcg lpdvpqgnvp
qgnpkrsken rgdrndhvkk rkkakkdyqp nyflsipitn kkitagikvl qnsilrqdnr
ltkamvgdgs fhitllvmql lnedevnigt dallelkpfv eeilegkhlt lpfhgigtfq
gqvgfvklad gdhvsallei aetakrtfqe kgilagesrt fkphltfmkl skapmlwkkg
vrkiepglye qfidhrfgee ilyqidlcsm lkkkqsngyy hcessivige kdrkepedae
lvrlskrlve navlkavqqy leetqnkkqp gegnsvkaee gdrngdgsdn nrk
(SEQ ID No. 3)
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-10-
The amino acid sequence of the huinan form of PKA type IIa appears in SEQ ID
No. 4:
mshiqippgl tellqgytve vlrqqppolv efaveyftrl rearapasvl paatprqslg
hpppepgpdr vadakgdses eededlevpv psrfnrrvsv caetynpdee eedtdprvih
pktdeqrcrl qeackdillf knldqeqlsq vldamferiv kadehvidqg ddgdnfyvie
rgtydilvtk dnqtrsvgqy dnrgsfgela lmyntpraat ivatsegslw gldrvtfrri
ivknnakkrk mfesfiesvp llkslevser mkivdvigek iykdgeriit qgekadsfyi
iesgevsili rsrtksnkdg gnqeveiarc hkgqyfgela lvtnkpraas ayavgdvkcl
vmdvqaferl lgpcmdimkr nishyeeqlv kmfgssvdlgnlgq
(SEQ ID No. 4)
The amino acid sequence of the human form of PKA type IIR appears in SEQ ID
No. 5:
msieipaglt ellqgftvev lrhqpadlle falqhftrlq qenerkgtar fghegrtwgd
lgaaagggtp skgvnfaeep mqsdsedgee eeaapadag'a fnapvinrft rrasvcaeay
npdeeeddae sriihpktdd qrnrlqeack dillfknldp eqmsqvldam feklvkdgeh
vidqgddgdn fyvidrgtfd iyvkcdgvgr cvgnydnrgs fgelalmynt praatitats
pgalwgldrv tfrriivknn akkrkmyesf ieslpflksl efserlkvvd vigtkvyndg
eqiiaqgdsa dsffivesge vkitmkrkgk seveengave iarcsrgqyf gelalvtnkp
raasahaigt vkclamdvqa ferllgpcme imkrniatye eqlvalfgtn mdivepta
(SEQ ID No. 5)
The amino acid sequence for human PDE4D appears in SEQ ID No. 6:
MMHVNNFPFR RHSWICFDVD NGTSAGRSPL DPMTSPGSGL ILQANFVHSQ RRESFLYRSD
SDYDLSPKSM SRNSSIASDI HGDDLIVTPF AQVLASLRTV RNNFAALTNL QDRAPSKRSP
MCNQPSINKA TITEEAYQKL ASETLEELDW CLDQLETLQT RHSVSEMASN KFKRMLNREL
THLSEMSRSG NQVSEFISNT FLDKQHEVEI PSPTQKEKEK KKRPMSQISG VKKLMHSSSL
TNSSIPRFGV KTEQEDVLAK ELEDVNKWGL HVFRIAELSG NRPLTVIMHT IFQERDLLKT
FKIPVDTLIT YLMTLEDHYH ADVAYHNNIH AADVVQSTHV LLSTPALEAV FTDLEILAAI
FASAIHDVDH PGVSNQFLIN TNSELALMYN DSSVLENHHL AVGFKLLQEE NCDIFQNLTK
KQRQSLRKMV IDIVLATDMS KHMNLLADLK TMVETKKVTS SGVLLLDNYS DRIQVLQNMV
HCADLSNPTK PLQLYRQWTD RIMEEFFRQG DRERERGMEI SPMCDKHNAS VEKSQVGFID
YIVHPLWETW ADLVHPDAQD ILDTLEDNRE WYQSTIPQSP SPAPDDPEEG RQGQTEKFQF
ELTLEEDGES DTEKDSGSQV EEDTSCSDSK TLCTQDSEST EIPLDEQVEE EAVGEEEESQ
PEACVIDDRS PDT
(SEQ ID No. 6)
The encoding nucleic acid sequences of SEQ ID Nos. 1-6 appears in SEQ ID Nos.
7-12 as follows:
The nucleotide sequence of the human form of PLB:
1 agctaaacac ccgtaagact tcatacaaca caatactcta tactgtgatg atcacagctg
61 ccaaggctac ctaaaagaag acagttatct catatttggc tgccagcttt ttatctttct
121 ctcgaccact taaaacttca gacttcctgt cctgctggta tcatggagaa agtccaatac
181 ctcactcgct cagctataag aagagcctca accattgaaa tgcctcaaca agcacgtcaa
241 aagctacaga atctatttat caatttctgt ctcatcttaa tatgtctctt gctgatctgt
301 atcatcgtga tgcttctctg aagttctgct acaacctcta gatctgcagc ttgccacatc
361 agcttaaaat ctgtcatccc atgcagacag gaaaacaata ttgtataaca gaccacttcc
421 tgagtagaag agtttctttg tgaaaaggtc aagattaaga ctaaaactta ttgttaccat
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-11-
481 atgtattcat ctgttggatc ttgtaaacat gaaaagggct ttattttcaa aaattaactt
541 caaaataagt gtataaaatg caactgttga tttcctcaac atggctcaca aatttctatc
601 ccaaatcttt tctgaagatg aagagtttag ttttaaaact gcactgccaa caagttcact
661 tcatatataa agcattattt ttactctttt gaggtgaata taatttatat tacaatgtaa
721 aagcttcttt aatactaagt atttttcagg tcttcaccaa gtatcaaagt aataacacaa
781 atgaagtgtc attattcaaa atagtccact gactcctcac atctgttatc ttattataaa
841 gaactatttg tagtaactat cagaatctac attctaaaac agaaattgta ttttttctat
901 gccacattaa catcttttaa agttgatgag aatcaagtat ggaaaagtaa ggccatactc
961 ttacataata aaattccttt taagtaattt tttcaaagaa tcacagaatt ctagtacatg
1021 taggtaaatc ataaatctgt tctaagacat atgatcaaca gatgagaact ggtggttaat
1081 atgtgacagt gagattagtc atatcactaa tactaacaac agaatctaat cttcatttaa
1141 ggcactgtag tgaattatct gagctagagt tacctagctt accatactat atctttggaa
1201 tcatgaaacc ttaagacttc agaatgattt tgcaggttgt cttccattcc agcetaacat
1261 ccaatgcagg caaggaaaat aaaagatttc cagtgacaga aaaatatatt atctcaagta
1321 ttttttaaaa atatatgaat tctctctcca aatattaact aattattaga ttatattttg
1381 aaatgaactt gttggcccat ctattacatc tacagctgac ccttgaacat gggggttagg
1441 ggagctgaca attcgtgggt ccgcaaaatc ttaactacct aatagcctac tattgaccat
1501 aaaccttact gataacataa acagtaaatt aacacatatt ttgcgtgtta tatgtattat
1561 acactatatt cctacaataa agtaagctag agaaaatgtt atttagaaaa tcataagaaa
1621 gagaaaatat atttactatt cattaaatgg aagtgggtca acaaaaaaaa aaaaaaaaaa
1681 aaaaaaaaaa a
(SEQ ID No. 7)
The nucleotide sequence of PLB from rat:
1 cgcagctgag ctcccagact tcacacaact aaacagtctg cattgtgacg atcacagaag
61 ccaaggcctc ctaaaaggag acagctcgcg tttggctgcc tgctgtcaac tttttatctt
121 tctcttgact acttaaaaaa gacttgtctt cctacttttg tcttcctggc atcatggaaa
181 aagtccaata ccttactcgc tcggctatta ggagagcctc gactattgaa atgccccagc
241 aagcgcgtca gaacctccag aacctcttta tcaatttctg tctcatcttg atatgtctgc
301 tgctgatatg catcattgtg atgcttctgt gacaagctgt cgccaccgca gacctgcacc
361 atgccaacgc agttacaacc tggccctcca ccacgagggg agggcagtgc cgccgccttt
421 tccctgctgg gacatcgtcg tgaagggtca cgatttaaga gtgagactga tggcagccag
481 tgtgatcatc gctgatcttg taactttaca cgactagtgt gccacaatgt agctgcccgt
541 ttcctcagtg tggctcataa atgtctttcc taaatacttc tgacattgta gtatgagatt
601 ttaattttga aacagcacta caaaaaaagt tacactttct atatccagca ctagaaagtt
661 caacttatag cattcagttt ggggaataaa tgaaatttaa a
(SEQ ID No. 8)
The nucleotide sequence of AKAP18S from rat:
1 gtgccgggga tgctgcgact cgcagggctc tgcgcctccg taggcctggc cgccgcggcc
61 cgcgcccccg ctgccccgcg ggccccgggc ccgcgcctct gccttcgcgc cgcgaccatg
121 gagcgccccg ccgcgggaga aatagatgcc aataagtgtg atcatttatc aagaggagag
181 gaagggacgg gggacctgga gaccagccct gtaggttctc tggcagacct gccgtttgct
241 gccgtagaca ttcaagatga ctgtggactc cctgatgtac ctcaaggaaa tgtacctcaa
301 ggaaacccaa agagaagcaa agaaaataga ggcgacagga atgatcacgt gaagaagagg
361 aagaaggcca agaaagatta tcaacccaac tatttcctgt ccattccaat caccaacaaa
421 aagattacag ctggaattaa agtcttgcaa aattcgatac tgagacagga taatcgattg
481 accaaagcca tggtcggcga cggctccttt cacatcacct tgctagtgat gcagctatta
541 aacgaagatg aagtaaacat aggtaccgac gcgcttttgg aactgaagcc gttcgttgag
601 gagatccttg aggggaagca tctgactttg cccttccacg ggattggcac tttccaaggt
661 caggttggct ttgtgaagct ggcagacgga gatcacgtca gtgccctcct ggagatagca
721 gagactgcaa aaaggacatt tcaggaaaaa ggcatcctgg ctggagaaag cagaactttt
781 aagcctcacc tgacctttat gaagctgtcc aaagcaccaa tgctctggaa gaagggagtg
841 agaaaaatag agcctggatt gtatgagcaa tttatcgacc acagatttgg agaagaaata
901 ctgtaccaaa tagatctctg ctccatgctg aagaaaaaac agagcaatgg ttattaccac
961 tgcgagtctt cgatcgtgat cggtgagaag gaccgaaagg agcctgagga tgctgaactg
1021 gtcaggctca gtaagaggct ggtggagaac gccgtgctca aggctgtcca gcagtaccta
1081 gaagagacac agaacaaaaa gcagccgggg gaggggaact ccgtcaaagc tgaggaggga
1141 gatcggaatg gcgatggcag tgataacaac cggaagtgag agctgaaccc ggtccgctgc
1201 ccctccgcta agtcgcagac tgactcgcaa tgtgctagtg aagtgtcttg ttcaagccct
1261 ggagatcacc tagtgattga cgcgattgat gagttcggtt ttgctgcgac acaacagaaa
1321 agaatggggt gctgggacca gcagaaggaa ttactttaca gaagaacaac acgcacaagg
1381 gggagccggc acttcgggcc gcctgcccga ctcaaagggc agagggagag gactggtcgc
1441 cgacagaata ctgttctgcc gtttacattg cttcgatcct ttgactactt tatctgaggc
1501 caaaacttgc acacagctat caagtgctaa gttcactttg tcactgttga aatgaccatg
1561 agtatagtga gtccacaatg tttcctgttt gtccccccca tgtgctttta ccacacagtg
1621 atctttattt acagtaaatt gagttttgtg taaattatat atatttttgg caaatgcaat
1681 cttttctatg aaatgtgggt aatgttgtaa aggtttttga gccttatttt gataaagtca
1741 attgccatat ttaatgtcct ccgttgatat ttgtacttta aatgtatcat ataattttcc
1801 cccttaggca agaaaccagt tggaacccaa gacttaatta acgaagcttt gcaccgagaa
1861 aggatggagc tgaagtccaa agtgaaacag atcaaagaac ttttgttaaa gcctgagacc
1921 caggccaaga ttagaaagga gctttttgaa ggaagagttt ttaataatgg tgacccaact
1981 gatttcaaca tgactttgcc atagctctcc gctgctgtta cgcttgctca catgtttatg
2041 aactctcagc ccgttaaata gctctttggt gagtaaccaa agtgttctta cggtctctac
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-12-
2101 aaagcccaca aaccaacatt tggtaaggaa ctaacaactt cttgccaaag aaaacgtatt
2161 tttgccttat cgtggtcacc atcatcaccg tcatcatcgt catcaccacc ataaaattga
2221 gttttagaat gttccttttg gtatcttact cattttatat aaaaacttct taattagctg
2281 ttgtaagatg ttccatgggt ccttgcagat aatattatat atatatatat atatatacac
2341 acatatatgt acatatatat acatatatat acacatatac tcacacactt ttaaaaatcc
2401 tttatagaca aaaacagcaa aacaaaataa aaccaacaac agtattctaa gggtcacctg
2461 cctcctgttg atgtggtcct gttacttcaa aggaagcatt gtccgggcca gtccagtctc
2521 aaggtccttt tgctgagcgt ttgagtgctt attgaggatc agcacttgaa cagacattag
2581 taagcgtaat cgttgtagtc acgggttcag aatgttttat actatctata ttctctcttt
2641 cattgatgaa gtacagtttg cttttttttt taatttttta tttcttcgtg aacagtgttc
2701 agggttccta tttcctactc tctgaagatg agcccaagcc tgcgttcttc acggtttgag
2761 tagcttgcac tggttccttt gtaaacgagc attcttgagt gttatttggg tagtcacttt
2821 aaaattgctg ctactaatag atgatgggga aagaaagtga ttagagatta aatatataat
2881 catctcacag tccagtttgc tcgtggattt ttggctattt ctttccactg ggtaaatgat
2941 gcattaattc atgatgtatt cctttatacg tacctacgtt ttcatgcgtc ataataaaag
3001 tactctttcc tctaaaaaaa aaaaaaaaaa aaaaaaaaa
(Seq ID No. 9)
The nucleotide sequence of PKA type IIa from human:
1 ccaggtcggc cgtggtagcg tagggttgcg cggdccggaa acgcagagcc ggccaaagag
61 cggcgcgacg tgagccgggg ccgtgcgcga agagacctcg cgggcgcgga gcgaaaggcc
121 ggcgtgagtg agcgcggaga cagtggccgc cggcggccca acccgtctat cccttcggcc
181 gccgccggca tgagccacat ccagatcccg ccggggctca cggagctgct gcagggctac
241 acggtggagg tgctgcgaca gcagccgcct gacctcgtcg aattcgcagt ggagtacttc
301 acccgcctgc gcgaggcccg cgccccagcc tcagtcctgc ccgccgccac cccacgccag
361 agcctgggcc accccccgcc agaacccggc ccggaccgtg tcgccgacgc caaaggggac
421 agcgagtcgg aggaggacga ggacttggaa gttccagttc ctagcagatt taatagacga
481 gtatcagtct gtgctgagac ctataaccct gatgaggaag aggaagatac agatccaagg
541 gtgattcatc ctaaaactga tgaacagaga tgcagacttc aggaagcttg caaagatatt
601 ctccttttca aaaatcttga tcaggaacag ctttctcaag ttctcgatgc catgtttgaa
661 aggatagtca aagctgatga gcatgtcatt gaccaaggag atgatggaga caacttttat
721 gtcatagaac ggggaactta tgacatttta gtaacaaaag ataatcaaac ccgctctgtt
781 ggtcaatatg acaaccgtgg cagttttgga gaactagctc tgatgtacaa caccccgaga
841 gctgctacca ttgttgctac ctcagaaggc tccctttggg gactggaccg ggtgactttt
901 agaagaatca tagtgaaaaa taatgcaaag aagaggaaga tgtttgaatc atttattgag
961 tctgtgcccc tccttaaatc actagaggtg tcagaacgaa tgaagattgt ggatgtaata
1021 ggagagaaga tctataagga tggagaacgc ataatcactc agggtgaaaa ggctgatagc
1081 ttttacatca tagagtctgg cgaagtgagc atcttgatta gaagcaggac taaatcaaac
1141 aaggatggtg ggaaccagga ggtcgagatt gcccgctgcc ataaggggca gtactttgga
1201 gagcttgccc tggtcaccaa caaacccaga gctgcctcag cttatgcagt tggagatgtc
1261 aaatgcttag ttatggatgt acaagcattc gagaggcttc tggggccctg catggacatc
1321 atgaagagga acatctcaca ctatgaggaa cagctggtga agatgtttgg ctccagcgtg
1381 gatctgggca acctcgggca gtaggtgtgc cacaccccag agccttctta gtgtgacacc
1441 aaaaccttct ggtcagccac agaacacata cagaaaacag acatgacaga actgttcctg
1501 ccgttgccgc cactgctgcc attgctgtgg ttatgggcat ttagaaaact tgaaagtcag
1561 cactaaagga tgggcagagg ttcaacccac acctccactt tgcttctgaa ggcccattca
1621 ttagaccact tgtaaagatt actccaaccc agtttttata tctttggttc aaaacggcat
1681 gtctctccaa caatttaagt gcctgataca aagtccaaag tataaacatg ctcctttcct
1741 ctc
(SEQ ID No. 10)
The nucleotide sequence of PKA type 110 from human:
1 gacgcgcgcc gggagccgcg ggccgggcca gccgggccgc cggggcccag tgcgccgcgc
61 tcgcagccgg tagcgcgcca gcgccgtagg cgctcgctcg gcagccgcgg ggccctaggc
121 cgtgccgggg agggggcgag ggcggcgccc aggcgcctgc cgccccggag gcaggatgag
181 catcgagatc ccggcgggac tgacggagct gctgcagggc ttcacggtgg aggtgctgag
241 gcaccagccc gcggacctgc tggagttcgc gctgcagcac ttcacccgcc tgcagcagga
301 gaacgagcgc aaaggcaccg cgcgcttcgg ccatgagggc aggacctggg gggacctggg
361 cgccgctgcc gggggcggca cccccagcaa gggggtcaac ttcgccgagg agcccatgca
421 gtccgactcc gaggacgggg aggaggagga ggcggcgccc gcggacgcag gggcgttcaa
481 tgctccagta ataaaccgat tcacaaggcg tgcctcagta tgtgcagaag cttataatcc
541 tgatgaagaa gaagatgatg cagagtccag gattatacat ccaaaaactg atgatcaaag
601 aaataggttg caagaggctt gcaaagacat cctgctgttt aagaatctgg atccggagca
661 gatgtctcaa gtattagatg ccatgtttga aaaattggtc aaagatgggg agcatgtaat
721 tgatcaaggt gacgatggtg acaactttta tgtaattgat agaggcacat ttgatattta
781 tgtgaaatgt gatggtgttg gaagatgtgt tggtaactat gataatcgtg ggagtttcgg
841 cgaactggcc ttaatgtaca atacacccag agcagctaca atcactgcta cctctcctgg
901 tgctctgtgg ggtttggaca gggtaacctt caggagaata attgtgaaaa acaatgccaa
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-13-
961 aaagagaaaa atgtatgaaa gctttattga gtcactgcca ttccttaaat ctttggagtt
1021 ttctgaacgc ctgaaagtag tagatgtgat aggcaccaaa gtatacaacg atggagaaca
1081 aatcattgct cagggagatt cggctgattc ttttttcatt gtagaatctg gagaagtgaa
1141 aattactatg aaaagaaagg gtaaatcaga agtggaagag aatggtgcag tagaaatcgc
1201 tcgatgctcg cggggacagt actttggaga gcttgccctg gtaactaaca aacctcgagc
1261 agcttctgcc cacgccattg ggactgtcaa atgtttagca atggatgtgc aagcatttga
1321 aaggcttctg ggaccttgca tggaaattat gaaaaggaac atcgctacct atgaagaaca
1381 gttagttgcc ctgtttggaa cgaacatgga tattgttgaa cccactgcat gaagcaaaag
1441 tatggagcaa gacctgtagt gacaaaatta cacagtagtg gttagtccac tgagaatgtg
1501 tttgtgtaga tgccaagcat tttctgtgat ttcaggtttt ttcctttttt tacatttaca
1561 acgtatcaat aaacagtagt gatttaatag tcaataggct ttaacatcac tttctaaaga
1621 gtagttcata aaaaaatcaa catactgata aaatgacttt gtactccaca aaattatgac
1681 tgaaaggttt attaaaatga ttgtaatata tagaaagtat ctgtgtttaa gaagataatt
1741 aaaggatgtt atcataggct atatgtgttt tacttattca gactgataat catattagtg
1801 actatcccca tgtaagaggg cacttggcaa ttaaacatgc tacacagcat ggcatcactt
1861 ttttttataa ctcattaaac acagtaaaat tttaatcatt tttgttttaa agttttctag
1921 cttgataagt tatgtgctgg ccttggccta ttggtgaaat ggtataaaat atcatatgca
1981 gttttaaaac tttttatatt tttgcaataa agtacatttt gactttgttg gcataatgtc
2041 agtaacatac atattccagt ggttttatgg acaggcaatt tagtcattat gataataagg
2101 aaaacagtgt tttagatgag agatcattaa tgcatttttc cctcatcaag catatatctg
2161 ctttttttta ttttgcaatt ctctgtattc tatgtcttta aaaatttgat cttgacattt
2221 aatgtcacaa agttttgttt ttttaaaaag tgatttaaac ttaagatccg acattttttg
2281 tattctttaa gattttacac ctaaaaaatc tctcctatcc caaaaataat gtgggatcct
2341 tatcagcatg cccacagttt atttctttgt tcttcactag gcctgcataa tacagtccta
2401 tgtagacatc tgttcccttg ggtttccgtt ctttcttagg atggttgcca acccacaatc
2461 tcattgatca gcagccaata tgggtttgtt tggttttttt aattcttaaa aacatcctct
2521 agaggaatag aaacaaattt ttatgagcat aaccctatat aaagacaaaa tgaatttctg
2581 accttaccat atataccatt aggccttgcc attgctttaa tgtagactca tagttgaaat
2641 tagtgcagaa agaactcaga tgtactagat tttcattgtt cattgatatg ctcagtatgc
2701 tgccacataa gatgaattta attatattca accaaagcaa tatactctta catgatttct
2761 aggccccatg acccagtgtc tagagacatt aattctaacc agttgtttgc ttttaaatga
2821 gtgatttcat tttgggaaac aggtttcaaa tgaatatata tacatgggta aaattactct
2881 gtgctagtgt agtcttacta gagaatgttt atggtcccac ttgtatatga aaatgtggtt
2941 agaatgttaa ttggataatg tatatataag aagttaaagt atgtaaagta taacttcagc
3001 cacattttta gaacactgtt taacattttt gcaaaacctt cttgtaggaa aagagagctc
3061 tctacatgaa gatgacttgt tttatatttc agattttatt ttaaaagcca tgtctgttaa
3121 acaagaaaaa acacaaaaga actccagatt cctggttcat cattctgtat tcttactcac
3181 tttttcaagt tatctatttt gttgcataaa ctaattgtta actattcatg gaacagcaaa
3241 cgcctgttta ataaagaact ttgaccaagg ctataaatgc cacgtacatt attttcagta
3301 ttgttggtta tatttaaatt ttccttacaa taaagcacac ttttataata aaatacatga
3361 attattgttt ttcatacttt tttgcttgtt tctttaaagt tttctgacgt gcataatgca
3421 taattcattg aaaagcatga tagcaatgtg gcatgtggaa gcgaaccccc agggcataac
3481 atagtaagaa agtatggttc tgtatggcaa taggttttta aaattattag ctattcatca
3541 tgtgtgggag aaataattgt ggtgtgttgc agatttattt ggccatttag aataaccaaa
3601 tcaatctggc taactaggaa tttatgtgta aaattatctg attaaaacag ctcaagtttg
3661 aaaaaaaaaa aaaaaaaa
(SEQ ID No. 11)
The nucleotide sequence of human PDE4D:
1 ggaattcatc tgtaaaaatc actacatgta acgtaggaga caagaaaaat attaatgaca
61 gaagatctgc gaacatgatg cacgtgaata attttccctt tagaaggcat tcctggatat
121 gttttgatgt ggacaatggc acatctgcgg gacggagtcc cttggatccc atgaccagcc
181 caggatccgg gctaattctc caagcaaatt ttgtccacag tcaacgacgg gagtccttcc
241 tgtatcgatc cgacagcgat tatgacctct ctccaaagtc tatgtcccgg aactcctcca
301 ttgccagtga tatacacgga gatgacttga ttgtgactcc atttgctcag gtcttggcca
361 gtctgcgaac tgtacgaaac aactttgctg cattaactaa tttgcaagat cgagcaccta
421 gcaaaagatc acccatgtgc aaccaaccat ccatcaacaa agccaccata acagaggagg
481 cctaccagaa actggccagc gagaccctgg aggagctgga ctggtgtctg gaccagctag
541 agaccctaca gaccaggcac tccgtcagtg agatggcctc caacaagttt aaaaggatgc
601 ttaatcggga gctcacccat ctctctgaaa tgagtcggtc tggaaatcaa gtgtcagagt
661 ttatatcaaa cacattctta gataagcaac atgaagtgga aattccttct ccaactcaga
721 aggaaaagga gaaaaagaaa agaccaatgt ctcagatcag tggagtcaag aaattgatgc
781 acagctctag tctgactaat tcaagtatcc caaggtttgg agttaaaact gaacaagaag
841 atgtccttgc caaggaacta gaagatgtga acaaatgggg tcttcatgtt ttcagaatag
901 cagagttgtc tggtaaccgg cccttgactg ttatcatgca caccattttt caggaacggg
961 atttattaaa aacatttaaa attccagtag atactttaat tacatatctt atgactctcg
1021 aagaccatta ccatgctgat gtggcctatc acaacaatat ccatgctgca gatgttgtcc
1081 agtctactca tgtgctatta tctacacctg ctttggaggc tgtgtttaca gatttggaga
1141 ttcttgcagc aatttttgcc agtgcaatac atgatgtaga tcatcctggt gtgtccaatc
1201 aatttctgat caatacaaac tctgaacttg ccttgatgta caatgattcc tcagtcttag
1261 agaaccatca tttggctgtg ggctttaaat tgcttcagga agaaaactgt gacattttcc
1321 agaatttgac caaaaaacaa agacaatctt taaggaaaat ggtcattgac atcgtacttg
1381 caacagatat gtcaaaacac atgaatctac tggctgattt gaagactatg gttgaaacta
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-14-
1441 agaaagtgac aagctctgga gttcttcttc ttgataatta ttccgatagg attcaggttc
1501 ttcagaatat ggtgcactgt gcagatctga gcaacccaac aaagcctctc cagctgtacc
1561 gccagtggac ggaccggata atggaggagt tcttccgcca aggagaccga gagagggaac
1621 gtggcatgga gataagcccc atgtgtgaca agcacaatgc ttccgtggaa aaatcacagg
1681 tgggcttcat agactatatt gttcatcccc tctgggagac atgggcagac ctcgtccacc
1741 ctgacgccca ggatattttg gacactttgg aggacaatcg tgaatggtac cagagcacaa
1801 tccctcagag cccctctcct gcacctgatg acccagagga gggccggcag ggtcaaactg
1861 agaaattcca gtttgaacta actttagagg aagatggtga gtcagacacg gaaaaggaca
1921 gtggcagtca agtggaagaa gacactagct gcagtgactc caagactctt tgtactcaag
1981 actcagagtc tactgaaatt ccccttgatg aacaggttga agaggaggca gtaggggaag
2041 aagaggaaag ccagcctgaa gcctgtgtca tagatgatcg ttctcctgac acgtaacagt
2101 gcaaaaactt tcatgccttt ttttttttta agtagaaaaa ttgtttccaa agtgcatgtc
2161 acatgccaca accacggtca cacctcactg tcatctgcca ggacgtttgt tgaacaaaac
2221 tgaccttgac tactcagtcc agcgctcagg aatatcgtaa ccagtttttt cacctccatg
2281 tcatccgagc aaggtggaca tcttcacgaa cagcgttttt aacaagattt cagcttggta
2341 gagctgacaa agcagataaa atctactcca aattattttc aagagagtgt gactcatcag
2401 gcagcccaaa agtttattgg acttggggtt tctattcctt tttatttgtt tgcaatattt
2461 tcagaagaaa ggcattgcac agagtgaact taatggacga agcaacaaat atgtcaagaa
2521 caggacatag cacgaatctg ttaccagtag gaggaggatg agccacagaa attgcataat
2581 tttctaattt caagtcttcc tgatacatga ctgaatagtg tggttcagtg agctgcactg
2641 acctctacat tttgtatgat atgtaaaaca gattttttgt agagcttact tttattatta
2701 aatgtattga ggtattatat ttaaaaaaaa ctatgttcag aacttcatct gccactggtt
2761 atttttttct aaggagtaac ttgcaagttt tcagtacaaa tctgtgctac actggataaa
2821 aatctaattt atgaatttta cttgcacctt atagttcata gcaattaact gatttgtagt
2881 gattcattgt ttgttttata taccaatgac ttccatattt taaaagagaa aaacaacttt
2941 atgttgcagg aaaccctttt tgtaagtctt tattatttac tttgcatttt gtttcactct
3001 ttccagataa gcagagttgc tcttcaccag tgtttttctt catgtgcaaa gtgactattt
3061 gttctataat acttttatgt gtgttatatc aaatgtgtct taagcttcat gcaaactcag
3121 tcatcagttc gtgttgtctg aagcaagtgg gaaatatata aatacccagt agctaaaatg
3181 gtcagtcttt tttagatgtt ttcctactta gtatctccta ataacgtttt gctgtgtcac
3241 tagatgttca tttcacaagt gcatgtcttt ctaataatcc acacatttca tgctctaata
3301 atccacacat ttcatgctca tttttattgt ttttacagcc agttatagca agaaaaaggt
3361 ttttcccctt gtgctgcttt ataatttagc gtgtgtctga accttatcca tgtttgctag
3421 atgaggtctt gtcaaatata tcactaccat tgtcaccggt gaaaagaaac aggtagttaa
3481 gttagggtta acattcattt caaccacgag gttgtatatc atgactagct tttactcttg
3541 gtttacagag aaaagttaaa caaccaacta ggcagttttt aagaatatta acaatatatt
3601 aacaaacacc aatacaacta atcctatttg gttttaatga tttcaccatg ggattaagaa
3661 ctatatcagg aacatccctg agaaacggct ttaagtgtag caactactct tccttaatgg
3721 acagccacat aacgtgtagg aagtccttta tcacttatcc tcgatccata agcatatctt
3781 gcagagggga actacttctt taaacacatg gagggaaaga agatgatgcc actggcacca
3841 gagggttagt actgtgatgc atcctaaaat atttattata ttggtaaaaa ttctggttaa
3901 ataaaaaatt agagatcact cttggctgat ttcagcacca ggaactgtat tacagtttta
3961 gagattaatt cctagtgttt acctgattat agcagttggc atcatggggc atttaattct
4021 gactttatcc ccacgtcagc cttaataaag tcttctttac cttctctatg aagactttaa
4081 agcccaaata atcatttttc acattgatat tcaagaattg agatagatag aagccaaagt
4141 gggtatctga caagtggaaa atcaaacgtt taagaagaat tacaactctg aaaagcattt
4201 atatgtggaa cttctcaagg agcctcctgg ggactggaaa gtaagtcatc agccaggcaa
4261 atgactcatg ctgaagagag tccccatttc agtcccctga gatctagctg atgcttagat
4321 cctttgaaat aaaaattatg tctttataac tctgatcttt tacataaagc agaagaggaa
4381 tcaactagtt aattgcaagg tttctactct gtttcctctg taaagatcag atggtaatct
4441 ttcaaataag aaaaaaataa agacgtatgt ttgaccaagt agtttcacaa gaatatttgg
4501 gaacttgttt cttttaattt tatttgtccc tgagtgaagt ctagaaagaa aggtaaagag
4561 tctagagttt attcctcttt ccaaaacatt ctcattcctc tcctccctac acttagtatt
4621 tcccccacag agtgcctaga atcttaataa tgaataaaat aaaaagcagc aatatgtcat
4681 taacaaatcc agacctgaaa gggtaaaggg tttataactg cactaataaa gagaggctct
4741 ttttttttct tccagtttgt tggtttttaa tggtaccgtg ttgtaaagat acccactaat
4801 ggacaatcaa attgcagaaa aggctcaata tccaagagac agggactaat gcactgtaca
4861 atctgcttat ccttgccctt ctctcttgcc aaagtgtgct tcagaaatat atactgcttt
4921 aaaaaagaat aaaagaatat ccttttacaa gtggctttac atttcctaaa atgccataag
4981 aaaatgcaat atctgggtac tgtatgggga aaaaaatgtc caagtttgtg taaaaccagt
5041 gcatttcagc ttgcaagtta ctgaacacaa taatgctgtt ttaattttgt tttatatcag
5101 ttaaaattca caataatgta gatagaacaa attacagaca aggaaagaaa aaacttgaat
5161 gaaatggatt ttacagaaag ctttatgata atttttgaat gcattattta ttttttgtgc
5221 catgcatttt ttttctcacc aaatgacctt acctgtaata cagtcttgtt tgtctgttta
5281 caaccatgta tttattgcaa tgtacatact gtaatgttaa ttgtaaatta tctgttctta
5341 ttaaaacatc=atcccatgat ggggtggtgt tgatatattt ggaaactctt ggtgagagaa
5401 tgaatggtgt gtatacatac tctgtacatt tttcttttct cctgtaatat agtcttgtca
5461 ccttagagct tgtttatgga agattcaaga aaactataaa atacttaaag atatataaat
5521 ttaaaaaaac atagctgcag gtctttggtc ccagggctgt gccttaactt taaccaatat
5581 tttcttctgt tttgctgcat ttgaaaggta acagtggagc tagggctggg cattttacat
5641 ccaggctttt aattgattag aattctgcca ataggtggat tttacaaaac cacagacaac
5701 ctctgaaaga ttctgagacc cttttgagac agaagctctt aagtacttct tgccagggag
5761 cagcactgca tgtgtgatgg ttgtttgcca tctgttgatc aggaactact tcagctactt
5821 gcatttgatt atttcctttt tttttttttt taactcggaa acacaactgg gggaat
(SEQ ID No. 12)
Preferably the binding partners PLB, AKAP 185, PKA type II and PDE4D as
described herein refer to a polypeptide comprising SEQ ID NO. 1 (or 2), 3, 4
(or 5)
or 6, respectively, and their functionally equivalent variants, derivatives or
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-15-
fragments. Especially preferably the binding partners are those molecules
which
occur endogenously. Such variants, derivatives and fragments are described
hereinafter with particular reference to anchoring disruption molecules of the
invention. Variants, derivatives and fragments of the binding partners as
mentioned
herein are similarly defined.
In particular such variants include naturally occurring variants such as
comparable proteins found in other species or more particularly variants and
alleles
found within humans. Conveniently, said variants may be described as having
more
than 75%, e.g. 80, 85 or 90, especially preferably more than 95% sequence
similarity or identity to the sequence described in SEQ ID Nos. 1 to 6.
Thus in a preferred 'aspect, the present invention provides a method of
altering the PKA type II-mediated activation of SERCA2 in a cell by
administration
of an anchoring disruption molecule or binding partner mimic as defined
herein,
which modifies, e.g. reduces, inhibits or enhances binding between one or more
of
the following binding partners:
i) a polypeptide comprising the sequence as set fortlz in SEQ ID No. 1(or 2)
or
a sequence with 95% similarity thereto or a sequence encoded by a
nucleotide sequence which hybridises under conditions of high stringency
to the nucleotide sequence encoding the amino acid sequence of SEQ ID
No. 1 (or 2), or a functionally equivalent fragment thereof,
and
a polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a
sequence with 95% similarity thereto or a sequence encoded by a
nucleotide sequence which hybridises under conditions of high stringency
to the nucleotide sequence encoding the amino acid sequence of SEQ ID
No. 3, or a functionally equivalent fragment thereof; or
ii) a polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a
sequence with 95% similarity thereto or a sequence encoded by a
nucleotide sequence which hybridises under conditions of high stringency
to the nucleotide sequence encoding the amino acid sequence of SEQ ID
No. 3, or a functionally equivalent fragment thereof,
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-16-
and
a polypeptide comprising the sequence as set forth in SEQ ID No. 6 or a
sequence with 95% similarity thereto or a sequence encoded by a
nucleotide sequence which hybridises under conditions of high stringency
to the nucleotide sequence encoding the amino acid sequence of SEQ ID
No. 6, or a functionally equivalent fragment thereof.
In connection with amino acid sequences, "sequence similarity", preferably
"identity", refers to sequences which have the stated value when assessed
using e.g.
using the SWISS-PROT protein sequence databank using FASTA pep-cmp with a
variable pamfactor, and gap creation penalty set at 12.0 and gap extension
penalty
set at 4.0, and a window of 2 amino acids). Sequence identity at a particular
residue
is intended to include identical- residues which have simply been derivatized.
"Hybridizing under conditions of high stringency" refers to hybridization
under non-stringent binding conditions of 6 x SSC/50% formainide at room
temperature and washing under conditions of high stringency, e.g. 2 x SSC, 65
C,
where SSC = 0.15 M NaCl, 0.015M sodium citrate, pH 7.2. As referred to herein,
sequences encoded by a sequence which hybridizes to a particular sequence
refers to
the polypeptide sequence encoded by the conlplementary sequence of a sequence
which hybridizes to the particular sequence.
Alternatively, or additionally, such hydridizing sequences may be described
as those which exhibit at least 70%, preferably at least 80 or 90%, e.g. at
least 95%
sequence identity (as determined by, e.g. FASTA Search using GCG packages,
with
default values and a variable pamfactor, and gap creation penalty set at 12.0
and gap
extension penalty set at 4.0 with a window of 6 nucleotides) to the sequence
which
encodes the recited polypeptide (encoding sequences are provided in SEQ ID
Nos.
7-12), or a sequence complementary to any of the aforesaid sequences, or a
fragment
of any of the aforesaid sequences encoding the relevant binding region.
"Functionally equivalent" variants, derivatives or fragments thereof refers
to molecules, preferably peptides, related to, or derived from the above
described
amino acid sequences, where the amino acid sequence has been modified by
single
or nlultiple (e.g. at 1 to 10, e.g. 1 to 5., preferably 1 or 2 residues) amino
acid
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-17-
substitution, addition and/or deletion or chemical modification, including
deglycosylation or glycosylation, but which nonetheless retain functional
activity,
insofar as they act as anchoring disruption molecules or binding partner
mimics and
thus antagonize or agonize the interaction between the binding partners (or in
the
case of functionally equivalent binding partners retain the ability to bind to
their
respective binding partners).
Within the meaning of "addition" variants are included amino and/or
carboxyl terminal fusion proteins or polypeptides, comprising an additional
protein
or polypeptide or other molecule fused to the anchoring disruption molecule
(or
binding partner or its mimic) sequence. "Substitution" variants preferably
involve
the replacement of one or more aniino acids with the same number of amino
acids
and making conservative substitutions.
Such functionally-equivalent variants mentioned above include in particular
naturally occurring biological variations (e.g. allelic variants or
geographical
variations within a species, most particularly variants and alleles found
within
humans) and derivatives prepared using known techniques. In particular
functionally equivalent variants of the anchoring disruption molecules (or
binding
partners or their mimic) described herein extend to anchoring disruption
molecules
(or binding partners or their mimics) which are functional in (or present in),
or
derived from proteins isolatable from, different genera or species than the
specific
anchoring disruption molecules and binding partner molecules mentioned herein.
Preferred "derivatives" or "variants" include those in which instead of the
naturally occurring amino acid the amino acid which appears in the sequence is
a
structural analogue thereof. Amino acids used in the sequences may also be
derivatized or modified, e.g. labelled, glycosylated or methylated, providing
the
function of the anchoring disruption molecule (or binding partner or its
mimic) is
not significantly adversely affected.
Derivatives particularly include peptidomimetics which may be prepared
using techniques known in the art and which are described hereinafter in more
detail. For example, non-standard amino acids such as a-aminobutyric acid,
penicillamine, pyroglutamic acid or conformationally restricted analogues,
e.g. such
as Tic (to replace Phe), Aib (to replace Ala) or pipecolic acid (to replace
Pro) may
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-18-
be used. Other alterations may be made when the anchoring disruption molecule
is
to be used in the methods of the invention described hereinafter (or the
binding
partners are to be used for screening for anchoring disruption molecules). In
such
cases, the stability of the anchoring disruption molecule (or binding partner
or its
mimic), e.g. peptide, may be enhanced, e.g. by the use of D-amino acids, or
amide
isosteres (such as N-methyl amide, retro-inverse amid, thioamide, thioester,
phosphonate, ketomethylene, hydroxymethylene, fluorovinyl, (E)-vinyl,
methyleneamino, methylenethio or alkane) which protect the peptides against
proteolytic degradation. Di(oligo)peptidomimetics may also be prepared.
Precursors of the anchoring disruption molecules (or binding partners or
their mimics) are also encompassed by the term functionally equivalent
variants and
include molecules which are larger than the anchoring disruption molecules (or
binding partners or their mimics) and which may optionally be processed, e.g.
by
proteolysis to yield the anchoring disruption molecule (or binding partner or
its
mimic). Additional moieties may also be added to the anchoring disruption
molecules (or binding partners or their mimics) to provide a required
function, e.g. a
moiety may be attached to assist or facilitate entry of the anchoring
disruption
molecule into the cell.
Derivatives and variants as described above may be prepared during
synthesis of the anchoring disruption molecule (or binding partner or its
mimic if
isolated binding partners are to be used), e.g. peptide, or by post-production
modification, or when the peptide is in recombinant form, using the known
techniques of site-directed mutagenesis including deletion, random mutagenesis
and/or ligation of nucleic acids.
Functionally-equivalent "fragments" according to the invention may be
made by truncation, e.g. by removal of a peptide from the N and/or C-terminal
ends.
Such fragments may be derived from the anchoring disruption peptides (or
binding
partners or their mimics) described above, or may be derived from a
functionally
equivalent peptide as described above, but which retain the ability to act as
an
anchoring disruption molecule (or binding partner or its mimic) according to
the
method of the invention. Preferably such fragments are between 6 and 30
residues
in length, e.g. 6 to 25 or 10 to 15 residues. Preferably these fragments
satisfy the
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-19-
homology (relative to a comparable region) or hybridizing conditions mentioned
herein. Preferably functional variants according to the invention have an
aniino acid
sequence which has more than 75%, e.g. 75 or 80%, preferably more than 85%,
e.g.
more than 90 or 95% or 98% similarity or identity to the aforementioned
anclioring
disruption molecule or binding partner sequences (according to the test
described
hereinbefore).
Especially preferably said nucleotide sequences are the degenerate
sequences which encode the recited polypeptides or their variants or
fragments.
Especially preferably said binding partners consist of, or coniprise, specific
fragments (functionally equivalent fragments) of said above described
polypeptides
which correspond to the relevant binding sites.
PLB binds to AKAP18S through residues 7-23 of PLB and residues 181-
215 (or 201-220) and/or 237-257 of AKAP186 (rat). Further experiments reveal a
binding site in the region 67-181, preferably 124-181, especially preferably
124 to
138. Binding of AKAP186 to PKA type II involves residues 301-314 of AKAP188
(rat) and residues 1-44 of PKA type II (rat or human). PDE4D binds to AKAP 186
close to the PKAII binding site on AKAP18S.
Thus, in a particularly preferred aspect said binding partner polypeptide
consists of at least the following amino acid sequence or a sequence with 95%
similarity tllereto or a sequence encoded by a nucleotide sequence which
hybridizes
under conditions of high stringency to the nucleotide sequence encoding said
amino
acid sequence:
(a) amino acids 7-23 of SEQ ID No. 1 (or 2) for binding to SEQ ID No. 3 or its
variants; or
(b) amino acids 61-181 and/or 181-215 and/or 201-220 and/or 237-257 of SEQ
ID No. 3 for binding to SEQ ID No. 1(or 2) or its variants.
Such variants are as described previously.
Thus, preferably said first binding partner polypeptide comprises or consists
of amino acids 7-23 of SEQ ID No. 1(or 2) or a sequence with 95% similarity
thereto or a sequence encoded by a nucleotide sequence which hybridizes under
conditions of high stringency to the nucleotide sequence encoding said amino
acid
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-20-
sequence; and/or said second binding partner polypeptide comprises or consists
of
amino acids 61-181 (preferably 124-138) and/or 181-215 and/or 201-220 and/or
237-257 of SEQ ID No. 3 or a sequence with 95% similarity thereto or a
sequence
encoded by a nucleotide sequence which hybridizes under conditions of high
stringency to the nucleotide sequence encoding said amino acid sequence.
Where appropriate, inhibitors of the binding between even smaller
fragments of the afore-described binding partners may be used.
Binding between these binding partners may be affected in a variety of
ways. Conveniently inhibitors of said binding which directly interfere with
the
binding at the binding site may be employed. Alternatively and as described
hereinafter, binding may be reduced by modifying the endogenous molecules
taking
part in binding.
By "anchoring disruption molecule" it is meant a molecule which interferes
with the association of AKAP18S, PDE4D and/or PLB with each other and thereby
is capable of preventing the normal PKA:AKAP18S:PLB and AKAPI8S:PDE4D
interaction taking place. As a result, when used in cells, PKA RII does not
become
localised to the complex and cannot function to signal in the PKA type II-
mediated
activation of SERCA2. The presence of an anchoring disruption molecule in a
cell
thus alters, preferably reduces, PKA type II-mediated activation of SERCA2.
Such
molecules include nucleic acid molecules which encode peptides or polypeptides
of
interest.
Anchoring disruption molecules as referred to herein include both direct
inhibitors such as antagonists (e.g. anchoring disruption peptides and
antibodies) and
the molecules used to achieve an alteration in the form or expression of one
or more
of the endogenous binding partners. Such molecules are all referred to herein
as
inhibitors or anchoring disruption molecules even though their mode of
interaction
may not necessarily achieve direct inhibition of the binding site (i.e, a
steric
inhibitor). Thus molecules which act to ultimately achieve inhibition of
binding
between binding partners (preferably endogenous binding partners) are referred
to
herein as inhibitors or anchoring disruption molecules. Such molecules include
peptides and proteins as well as nucleic acid molecules, such as those which
encode
peptide/protein inhibitors which may be used to express the peptide/protein
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-21-
inhibitors within the cell or may be used to derive sense or antisense
nucleotide
sequences, siRNA or RNAi sequences to cause co-suppression or suppression to
modify, e.g. reduce expression of the endogenous binding partner.
Thus in a further aspect the present invention provides an anchoring
disruption molecule which reduces or inhibits the binding between one or more
of
the binding partners as defined hereinbefore and which preferably is capable
of
altering PKA type 11-mediated activation of SERCA2 in a cell.
Preferably direct inhibitors of binding are antagonists of binding between
the specific binding pairs. Such inhibitors may themselves bind to one of the
binding pair at the binding site (e.g. as described hereinbefore) or at a site
on one or
other of the binding partners which prevents the successful interaction of
those
binding partners, e.g. through steric interference or altering the properties
of the
binding site, e.g. its spatial or charge confonnation or nucleic acid
molecules which
encode such inhibitors. As referred to herein an "antagonist" is a molecule or
complex of molecules which by virtue of structural similarity to one molecule
of a
binding pair competes with that molecule for binding to the other molecule of
the
binding pair.
Thus the anchoring disruption molecules may be molecules which
specifically recognize the binding site, such as antibodies (or fragments
thereof), or
proteins or peptides which associate with that region or associate
sufficiently close
to affect accessibility by the other binding partner. Other small molecules
which act
as inhibitors of binding between the binding partners which thereby act to
disrupt
binding, may also be used. Altennatively, molecules, particularly peptides or
larger
molecules, which mimic the binding site (or contain a region which mimics the
binding site) (e.g. peptides, proteins or anti-idiotypes) may be used to act
instead as
the pseudo-binding partner to reduce the extent of binding between the true
endogenous binding partners. Preferred mimics are peptides that comprise the
relevant binding site as described herein. Molecules which are complementary
to
the binding site, e.g. such that they bind to that site may also be used.
Molecules
which affect the binding site indirectly, by binding at a distant part of the
molecule,
but which affect the conformation of the binding site and thus the ability to
form
relevant interactions with its binding partner, may also be used.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-22-
Preferably appropriate molecules may be peptides which correspond to a
binding partner's binding site, e.g. comprise or consist of at least the
minimum
binding site (i.e. the minimum ainino acid sequence required for binding of
the
relevant binding partner), e.g. a fragment of 7, 9, 11, 13 or 15 residues of
the binding
site which may optionally include residues from the surrounding region.
Tlius, for example, an anchoring disruption molecule or binding partner
mimic is a peptide which consists of or comprises one or more sequences
selected
from:
(i) amino acids 7-23 of SEQ ID No. 1(or 2);
(ii) amino acids 61-181 of SEQ ID No. 3;
(iii) amino acids 124-138 of SEQ ID No. 3:
(iii) amino acids 181-215 of SEQ ID No. 3;
(iv) amino acids 201-220 of SEQ ID No. 3;
(v) amino acids 237-257 of SEQ ID No. 3;
(vi) amino acids 124-220 of SEQ ID No. 3;
or a sequence with 95% similarity thereto or a sequence encoded by a
nucleotide
sequence which hybridizes under conditions of high stringency to the
nucleotide
sequence encoding said amino acid sequence,
or a fragment thereof of 7 to 15 residues.
Appropriate molecules may for example be proteins or peptides or other
molecules which can affect binding, or a nucleic acid molecule which encodes
such
a product may be used to generate the inhibitor and are all encompassed by
anchoring disruption molecules. Conveniently small inhibitory molecules may be
used. However, where desired, large molecules containing the binding site may
be
employed, e.g. larger molecules which mimic the entire binding partner (e.g.
the
soluble portion thereof), but which have preferably been modified such that
one or
more properties required for involvement in the signalling pathway is missing
or
altered to lose or impair its ability to be involved in signalling. For
example in the
case of AKAP188 a large molecule absent only amino acids 301-314 may be used,
which would allow functional binding with PLB, but not PKA type II.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
23 -
Alternatively whilst the ability to bind one binding partner may be retained,
otlier relevant binding sites required to allow the development of the
signalling
scaffold may be impaired or removed such that a functional complex is not
formed,
e.g. by mutation. For example, in the case of AKAP 185, the full length
molecule
could be used with a mutation at the binding site for either PLB or PKA type
II.
Thus the present invention further extends to an anchoring disruption
molecule which is a polypeptide (or the nucleic acid molecules encoding it)
containing one or more mutations in one or more binding sites described herein
(e.g.
the minimum binding site), in which said mutation results in a molecule which
has
impaired binding at that site to the relevant binding partner relative to the
same
molecule witliout the mutation. For example, one or more of the residues in
the
PLB binding site of the AKAP18S molecule, e.g. amino acids 124-138 of SEQ ID
No. 3 may be mutated, preferably to a proline residue, and the resultant
molecule
used as an inhibitor to interfere with the ability of the endogenous protein
to bind to
its binding partner PLB.
The present invention thus also extends to novel modified, e.g. mutated
binding partners or functionally equivalent variants, derivatives or fragments
thereof
and the nucleic acid molecules which encode tliem.
Thus, viewed from a yet further aspect, the present invention provides a
nucleic acid molecule comprising a nucleic acid sequence encoding a binding
partner, or a functionally equivalent variant, derivative or fragment thereof,
as
defined above, wherein said sequence is modified as defined above to alter its
ability
to bind to its binding partner as defined above.
Particularly preferred anchoring disruption molecules of the invention are
peptides which disrupt the association between AKAP 188 and PLB or between
AKAP 188 and PDE4D. Peptides as referred to herein are referred to as
"anchoring
disruption peptides" in view of their effect on the anchoring of PKA to the
complex.
Other preferred anchoring disruption molecules are nucleic acid molecules.
corresponding to or derived from the sequences of AKAP18S, PLB or PDE4D, e.g.
antisense oligonucleotides or siR.NA. Other preferred inliibitors includes
ribozymes
and antibodies.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-24-
In this regard, the inventors have identified a family of molecules which
comprise newly defined amino acid sequences which share the property of
binding
to AKAP18S, PLB or PDE4D with high affinity and selectivity and tlierefore act
in a
cell to prevent or enhance PKA. II localising to its normal position within
the
SERCA2 complex or redirecting PKA II to another position. In this way the
function of PKA II on SERCA2 is modulated by affecting localisation or
recruitment.
Preferred anchoring disruption molecules or binding partner mimics of the
invention comprise the region of phospholaniban that binds to AKAP 185, or a
sequence which is closely related to the sequence of that region.
In a further preferred aspect therefore, the present invention provides an
anchoring disruption molecule or phospholamban mimic, wherein said molecule or
mimic is a polypeptide which comprises the following amino acid sequence:
RRASTIE
or a sequence which has been modified by substitution or deletion of up to 3
residues, i.e. one, two or three substitutions or deletions or insertions of
up to 3
residues between the described residues, provided that said modified peptide
retains
its ability to bind to the relevant binding partner, or a peptidomimetic or
analogue
thereof, or a nucleic acid molecule encoding said polypeptide, Preferably only
one
or two substitutions or deletions are made. Preferably however the arginine
and
glutamic acid residues are not varied. Such molecules may be used in methods
of
the invention.
Especially preferably the sequence may be:
RSAIRRASTIEMP
or a sequence whicli has been modified by substitution or deletion of up to 5
residues, i.e. one, two, three, four one or five substitutions or deletions or
insertion
of up to 5 residues between the described residues, provided that said
modified
peptide retains its ability to bind to the relevant binding partner, or a
peptidomimetic
or analogue thereof, or a nucleic acid molecule encoding said polypeptide.
Preferably only one or two substitutions or deletions are made. Especially
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-25-
preferably the arginines at positions 1, 5 and 6 and the glutamic acid at
position 11
are not varied.
Where the arginines in the above described sequences are varied, they are
preferably substituted by lysine residues. When the glutamic acid residue in
the
above described sequences is varied, it is preferably substituted by an
aspartic acid
residue.
Particularly preferred substitutions of the above described sequences are
conservative, i.e. arginine may be replaced with lysine, serine may be
replaced with
threonine, alanine may be replaced with valine, leucine or isoleucine,
glutamic acid
may be replaced with aspartic acid and methionine may be replaced with
cysteine
(and vice versa).
Thus in a preferred embodiment the above described polypeptide comprises
the sequence (R/K)(R/K)X3(S/T)(T/S)X4(E/D) or
(R/K)(S/T)X1X2(R/K)(R/K)X3(S/T)(T/S)X4(E/D)(M/C)P, wherein Xi and X2
independeritly may be any amino acid except E, preferably A, V, L or I, and X3
and
X4 independently may be any amino acid except E or K, preferably A, V, L or I,
which sequences may be truncated and/or to which sequences additions may be
made, as described above, or a nucleic acid molecule encoding said
polypeptide.
In a particularly preferred embodiment the polypeptide comprises the above
described sequences or a sequence with at least 80, 90, 95 or 98% sequence
identity
thereto. Particularly preferred are those peptides described in the Examples
which
achieve substantially comparable binding to the unmodified sequence and
substitutions which are particularly preferred are those which do not
significantly
modify the binding of the peptide to the binding partner, e.g. achieve up to
80% of
the wild-type peptide binding.
Preferably deletions are made at the end of the above described sequence,
e.g. one or two residues may be removed, e.g. the sequence IRRASTIEMPQQ.
Additions may be made, preferably at the N or C-terminal of the above
described sequence, preferably to extend the binding sequence in line with the
naturally occurring sequence. Thus for example the sequence may be:
LTRSAIRRASTIEMPQQARQ, or
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-26-
VQYLTRSAIRRASTIEMPQQARQNLQ
or a peptidomimetic or analogue thereof for example comprising conservative
substitutions as described above.
The above described sequence is based on residues 4-29 of the rat
phospholamban sequence.
In an alternative embodiment the anchoring disruption molecule or binding
partner mimic of the invention further comprises an amino acid sequence which
assists cellular penetration of said anchoring disruption molecule or binding
partner
mimic, or a nucleic acid molecule encoding said polypeptide. Said additional
amino
acid sequence may for example be a polyarginine sequence, e.g. having from 3
to 16
residues, e.g. 8-12, preferably R4, Rlo or Ri i or the HIV tat sequence or
antennaepedia peptide (penetratin).
Anchoring disruption molecules mimicking the relevant binding sites
between AKAP 188 and PDE4D may also be used in methods described hereinafter.
Preferred anchoring disruption peptides include the sequence of the binding
sites of
AKAP 188 or PDE4D in which additions, deletions or substitutions (e.g. of up
to 5
residues) may be made to that sequence as described above or sequences with at
least 90% sequence identity thereto.
Appropriate anchoring disruption molecules for use in methods of the
invention may be identified or tested using appropriate screening tests. Thus
in a
further aspect, the present invention provides a method of screening for, or
testing
the ability or efficacy of, a molecule to reduce or inhibit binding between
any one of
the aforementioned binding partners, wherein said test molecule is contacted
with
said binding partners and the extent of binding is assessed. Optionally said
binding
partners are present in isolated form, for example the first of said binding
pair may
be immobilized on a solid support and the ability of the second of said pair
to bind
to said first binding partner may be assessed in the presence or absence of
said test
molecule, i.e. by competition. Alternatively, said binding partners may be
present in
endogenous form, e.g. in a cell and the ability of said test molecule to
affect PKA
type II signalling by examination of an indicator of said signalling, e.g. PLB
phosphorylation or SERCA 2 activation may be examined.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-27-
Antagonistic anchoring disruption molecules of the invention tlius have the
ability to interact with AKAP188, PLB or PDE4D (depending on which binding
they are modelled on) in a reversible or irreversible manner. In other words
the
anchoring disruption molecule associates with AKAP18S, PLB or PDE4D,
preferably AKAP 186. The structure of the antagonistic anchoring disruption
molecules of the invention are such that they bind to or associate with e.g.
AKA.P18S at the site at which PLB would normally interact with that AKAP
molecule. This site on AKAP 188 has been defined as residues 61-181 and/or 181-
215 (or 201-220) and/or 237-257 (rat). Thus the anchoring disruption molecule
associates with, preferably binds to, a molecule comprising amino acid
residues 61-
181 and/or 181-215 (or 201-220) and/or 237-257 of AKAP18S.
In one alternative, the anchoring disruption molecule may thus be considered
as being a direct inhibitor of PKA. RII anchoring, i.e. by acting as an
antagonist, i.e.
it associates with or binds to PLB, AKAP 188 or PDE4D and blocks the
interaction
of PLB and AKAP 186 or AKAP 188 and PDE4D e.g. sterically by occupying the
binding site on one of the binding partners. These molecules therefore act as
artificial binding sites and compete with endogenous molecules containing
those
binding sites to bind to the relevant binding partner. Such anchoring
disruption
molecules may thus be seen as conlpetitors of binding between PLB and AKAP 188
or AKAP18S and PDE4D as, for example, both endogenous PLB and anchoring
disruption molecules of the invention will bind to AKAP188. By affecting the
binding between PLB and AKP 185, PKA RII is prevented from being associated
with the SERCA2 complex with PLB and AKAP 188 and its normal localisation is
disrupted.
As a consequence of the anclloring disruption molecule being designed to
have a higher affinity for the binding partners, e.g. AKAP18S, than the
corresponding endogenous molecules, it is possible to displace the endogenous
molecules from their binding partners to which they are already bound when the
anchoring disruption molecule is administered.
The ability of a molecule to act as an antagonistic anchoring disruption
molecule is thus dependent on its ability to selectively associate with or
bind to one
of the above described binding partners with high affinity. As referred to
herein
"binding" refers to the interaction or association of a least two moieties in
a
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-28-
reversible or irreversible reaction, wherein said binding is preferably
specific and
selective. Specific binding refers to binding which relies on specific
features of the
molecules involved to achieve binding, i.e. does not occur when a non-specific
molecule is used (i.e. shows significant binding relative to background
levels) and is
selective insofar as binding occurs between those partners in preference to
binding
to any of the majority of other molecules which may be present, particularly
other
AKAPs.
The binding or association of the anchoring disruption molecule serves to
reduce or inhibit binding between the aforementioned binding partners.
"Reduced"
binding in this sense refers to a decrease in binding e.g. as manifest by
reduced
affinity for one another and/or an increased concentration of one of this
binding pair
required to achieve binding. Reduction includes a slight decrease as well as
absolute
abrogation of specific binding. A total reduction of specific binding is
considered to
equate to a prevention of binding. "Inhibited" binding refers to adversely
affecting
(e.g. by competitive interference) the binding of the binding partners by use
of an
anchoring disruption molecule which serves to reduce the partners' binding.
A reduction in binding or inhibition of binding may be assessed by any
appropriate technique which directly or indirectly measures binding between
the
binding partners. Thus relative affinity may be assessed, or indirect effects
reliant
on that binding may be assessed. Thus for example, the binding of the 2
binding
partners in isolated form may be assessed in the presence of the anchoring
disruption
molecule. Alternatively tests may be conducted in which the signalling
achieved by
the PKA type II pathway, particularly in relation to SERCA2 activation, is
examined
or by assessing disrupted or redirected localization as evident from the
presence of
one or more binding partners in biochemical subcellular fractionation or by
inununofluorescent staining and epifluorescence microscopy. Anchoring
disruption
molecules or binding partner mimics may be labelled to follow such processes.
As mentioned above, the anchoring disruption molecules of the invention
have a high affinity for the binding partner to which the molecule from which
they
are derived would bind. The antagonistic anchoring disruption molecules in
general
have a higher affinity for those binding partners than the endogenous
corresponding
binding partner. Preferably the anchoring disruption molecule has both a
higher
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-29-
affinity and specificity for the binding partner than the endogenous,
corresponding
binding partner.
The ability of a peptide or peptidomimetic to act as an anchoring disruption
molecule, i.e. to bind to one of the binding partners mentioned herein and the
strength of binding (the affinity of binding) can be measured in a number of
different ways, which are standard in the art and would be considered routine
by the
person skilled in the art. Examples of such methods include overlay or far
western
tecllniques, using radiolabelled binding partners (see the Examples),
measuring
dissociation constants or coimmunoprecipitation techniques. These techniques
may
also be used to deterniine whether a potential anchoring disruption molecule
has the
requisite level of selectivity or specificity.
,. ,
Alternatively, binding may be detected or measured based on the functional
effects of the binding as described above for measuring the extent of binding
between binding partners, e.g. between PLB and AKAP188, e.g. by measuring the
amount of PKA II signalling, particularly SERCA2 activation by PKA II
signalling
(e.g. by measuring a downstream signal or effect such as in the heart:
increased heart
rate, increased cardiac output, increased speed of Ca2+ release and reuptake
(phosphorylation of b2-AR, L-type Ca2+ channel, RYR, phospholamban)). Such
markers may be examined in individuals, organs or cells as appropriate.
'The antagonistic anchoring disruption molecule is capable of associating
with or binding to one c-"~ the binding partners described herein and has been
designed for and is intended for use in affecting the SERCA2 mediated PKA type
II
signalling pathway. Preferably therefore the anchoring disruption molecule
binding
to the binding partner is specific in that the anchoring disruption molecule
of the
invention has a higher affinity for that binding partner than for other
molecules in
the cell, e.g. in the case of PLB that it has higher affinity for AKAP18S than
it does
for other AKAPs and may thus be considered specific for AKAP 185. Preferably
the
binding affinity for the binding partner is 10 times, e.g. 50 times higher for
the
binding partner than for any other molecule in the cell, even more preferably
100
times, 200 times, 800 times, 1000 times or 2000 times higher. This may be
measured as described above.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-30-
Conveniently said binding may be assessed according to the KD between the
binding partners in the presence of the anclioring disruption molecule. Said
binding
may alternatively be assessed according to the KD between the anchoring
disruption
molecule and the binding site of the binding partner to which it binds.
Preferably
the KD should be 0.01-500nM, preferably 0.1-lOnM when assessed in vitro. This
can be assessed by any appropriate techniques which measures binding between
two
binding partners.
For example the dissociation constants (KD) may be measured directly by
fluorescence polarization, or using other standard techniques which are known
in the
art.
Binding partner "mimics" as described herein refer to molecules of the
invention which have at least one of the functions of a naturally occurring
binding
partner, e.g. bind to AKAP18S and/or also bind to one or more membrane bound
components and/or modulate signalling through PKA II or nucleic acid molecules
encoding such mimics. Said mimic may exhibit said function to a higher or
lesser
extent than the binding partner which it mimics, e.g. may have higher binding
affinity. Binding partner mimics which bind to AKAP186 or PLB preferably do so
with high affinity. Binding partner mimics enhance binding between binding
partners as described herein, preferably by enhancing the binding between an
endogenous binding partner molecule and the mimic. Such mimics according to
the
invention are molecules which mimic a binding site of an endogenous binding
partner as described herein and bind to the corresponding endogenous binding
partner and exhibit at least one of said binding partner's functions which it
mimics.
To act as mimics which allow the formation of a functional PKA signalling
complex, said mimics preferably include a targeting sequence to facilitate
anclloring
at a specific site. This site may be a site used by naturally occurring
binding
partners or a site not in use under normal circumstances. Such targeting
sequences
may target the bound molecules to the mitochondria, ER, sarcoplasmic
reticulum,
centrosomes or other appropriate location. Synthetic or known target sequences
may be used, e,g. targeting domains from D-AKAP1 (for targeting to the
mitochondria and ER) or AKAP450 (for targeting to the centrosome) may be used.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-31 -
These mimics thus may bind and act as binding partners and allow the
formation of relevant complexes to achieve SERCA2 mediated PKA type II
signalling. Molecules which are able to act as mimics may be determined using
the
same tests as described above to identify anchoring disruption molecules, but
the
mimics that serve to activate the SERCA2 mediated PKA type II signalling will
show markers of enlianced rather than depressed SERCA2 mediated PKA type II
signalling. Furthermore, PKA type I could also be targetted to the SERCA2
complex using appropriate mimics with a higher affinity PKA type I binding
domain.
Other mimics may not necessarily facilitate localization and complex
formation and may instead bind to one of the binding partners and for example
be
used to identify or isolate the same, e.g. may bind and allow the
identification or
isolation of specific PKA isotypes. In such cases the mimic may be labelled.
Other
binding partner mimics may mimic a functional role of a naturally occurring
binding
partner by modulating signalling of the SERCA2 mediated PKA type II pathway
through means not necessarily involving a PKA II:AKAPI8S:PLB or
AKAP 188: PDE4D interaction.
Molecules which affect the PKAII:AKAPI8S:PLB complex are also
contemplated. As described hereinbefore, PLB phosphorylation by PKAII affects
PKA signalling. Thus, hyperphosphorylation of PLB by PKA may be used in
methods of the invention, e.g. to suppress heart failure progression.
Thus a preferred aspect of the invention provides a method of altering PKA
type II activation of SERCA2 for the purposes described herein wherein a
molecule
is used which alters the phosphorylation level of PLB. This may be achieved,
e.g.
by disrupting binding of PD4ED and AKA.P18S to increase cAMP levels locally.
Molecules to disrupt binding of these binding partners are described above.
Alternatively, the level of PKA in the PKA:AKAP 1 88:PLB:SERCA2 complexes
may be increased.
As mentioned above, PKA II binds to AKAP 185. The binding between
these binding partners may be used to draw PKA into complexes containing PLB
where it can phosphorylate PLB. Thus, a mimic of the binding site of AKAPI86
may be used to capture PKA molecules. Attachment of the mimic to a targetting
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-32-
sequence allows the captured molecules to be directed to the correct location,
i.e. to
the con7plex containing PLB. Appropriate targetting molecules are as described
herein and include molecules which target to the sarcoplasmic reticulum, e.g.
as
described in Figure 21.
Thus in a further aspect, the present invention provides a method of altering
PKA type II-mediated, preferably PKA type IIa- mediated, activation of SERCA2
in a cell by administration of a binding partner mimic which enhances binding
between the following binding partners:
a first polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a
sequence with 95% similarity thereto or a sequence encoded by a nucleotide
sequence which hybridises under conditions of high stringency to the
nucleotide
sequence encoding the amino acid sequence of SEQ ID No. 3, or a functionally
equivalent fraginent thereof,
and
a second polypeptide comprising the sequence as set forth in SEQ ID No. 4 (or
5) or
a sequence with 95% similarity thereto or a sequence encoded by a nucleotide
sequence which hybridises under conditions of high stringency to the
nucleotide
sequence encoding the amino acid sequence of SEQ ID No. 4 (or 5), or a
functionally equivalent fragment thereof,
wherein said binding partner mimic comprises a targetting sequence and a
sequence
which mimics the binding site of said first polypeptide to said second
polypeptide
and binds to said second polypeptide, preferably binding to amino acids 1-44
of
SEQ ID No. 4 (or 5) or a sequence with 95% similarity tliereto or a sequence
encoded by a nucleotide sequence which hybridises under conditions of high
stringency to the nucleotide sequence encoding said amino acid sequence,
or a nucleic acid molecule encoding said targetting and mimic sequences.
The binding site between PKA II and AKAP18S is located at residues 1-44
of PKA II (SEQ ID No. 4 (or 5)) and residues 301-314 of AKAP188. Thus,
preferably the sequence which mimics the binding site of said first
polypeptide
consists of or comprises amino acids 301-314 of SEQ ID No. 3 or a sequence
with
95% similarity thereto or a sequence encoded by a nucleotide sequence which
hybridises under conditions of high stringency to the nucleotide sequence
encoding
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
- 33 -
said amino acid sequence of SEQ ID No. 3, or a fragment thereof of 7 to 15
residues.
The sequence which mimics the binding site of said first polypeptide may be
derived from the binding site of AKAP18S as described in the Examples, e.g.
consist
of or comprise PEDAELVRLSKRLVENAVE/LKAVQQY.
Examples of other molecules which may be used include ht31
(DLIEEAASRIVDAVIEQVKAAGAY), AKAP-IS (QIEYLAKQIVDNAIQQA)
and super-AKAP-IS (QIEYVAKQIVDYAIHQA) or MEME3
(LEQYANQLADQIIKEATE).
Other molecules whicli may be used to bind to PKA type II include peptides
as described in UK Patent Application No. 0421356.7, now PCT/GB2005/003677,
published as WO2006/032909, incorporated herein by reference, which bind to
PKA
type II. Thus alternatively, the sequence which mimics the binding site of
said first
polypeptide may comprise the following amino acid sequence:
Xl X2 EX3X4AKQIVX5X6X7I.X8X9Xlo
wherein Xl is Q, D, M, A, G, H, K, L, P, R, S, T, V, W or Y (preferably K, Q,
D or M);
X2 is I, L, V or Y (preferably I, L'or V);
X3 is Y, F, V, C, K, L, W or H (preferably K, Y, F or V);
X4 is V, K, C, L, H, F, Y, I or W (preferably V, K, C, L or H,
especially preferably K or V);
X5 is D, E, G, H, S, T or R (or A, C, K, M, N or W) (preferably D, G,
H, S, T or R);
X6 is Y, H, N, R, W, C, F, K or R (preferably K, Y, H or N,
especially preferably K or Y);
X7 is A, C or V;
X8 is H, C, Q or K (or L or W) (preferably K or H);
X9 is Q, C, K, H, A, G, N, R, S, T, V, W or Y (preferably K, Q or C);
and
Xlo is A, C, K (preferably K),
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-34-
provided that when X2 is I, either X3 is not Y, X4 is not L, X5 is not D, X6
is not N,
X7 is not A, X8 is not Q, X9 is not Q or Xio is not A,
or a peptidomimetic or analogue thereof, or a nucleic acid molecule encoding
said
peptide.
Preferably X4 is V; X6 is Y and X8 is H, especially preferably X4 is V; X6 is
YandXBisHandX1isQ,DorM;X2isl,LorV;X3isY,ForV;X5isDorE;X7
isAorV;X9isQandXtoisA.
Epecially preferably, the sequence is QIEYVAKQIVDYAIHQA.
In a further feature therefore, the present invention further provides a
method
of identifying and/or isolating a PKA type II molecule comprising contacting a
sample containing said PKA molecule with an AKAP 188 mimic as described
herein,
carrying a labelling means and capable of binding to PKA type II (e.g. PKA
lI(X)
with high affinity and assessing the level of said AKAP18S mimic which is
bound
and/or isolating said PKA to which said AKAP18S mimic is bound, wherein said
level of AKAP 18 S mimic is indicative of the level of said PKA molecule in
said
sample.
Alternative methods of reducing binding between the binding partners as
defined hereinbefore includes modification of endogenous molecules taking part
in
said binding. Thus, the invention extends to modifying the endogenous binding
partner as described hereinbefore in a cell. This may be achieved for example
by
manipulation of the wild-type gene, by manipulating expression of the gene
(e.g. by
affecting transcription or translation) or by manipulating the expressed
product.
This could for example be achieved by using antisense oligonucleotides
comprising
nucleic acid sequences as described hereinbefore (i.e. of binding partners or
of
relevant protein/peptide inhibitors) or their complementary sequences,
ribozymes,
RNAi or siRNA and the invention extends to such molecules and their uses. For
example, to manipulate the endogenous gene, this could be performed for
example
by somatic cell gene therapy with homologous recombination to for example
remove or mutate the binding site. This could be performed on for example
hematopoietic stem cells or on blood cells ex vivo or in vivo. Mutation of one
or
more of the residues to a proline residue in the AKAP 185 binding site for PLB
for
example could be performed to generated proteins that have reduced binding to
PLB.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-35-
Alternatively wild-type or mutated sequences may be used to cause co-
suppression of the naturally occurring molecule. Such exogenous molecules may
be
administered to cells as described hereinafter. In a particularly preferred
aspect,
expression of one or more of the endogenous binding partners described herein
is
suppressed. Conveniently this may be achieved using the known tecluniques
involving antisense molecules or siRNA. Preferably the oligonucleotides used
for
this purpose are derived from the sequences of the binding partners described
herein,
e.g. derived from SEQ ID Nos. 7-9 or 12 or a sequence with at least 80, 90 or
95%
sequence identity thereto or the complementary sequence thereof. Derived
sequences are those which are all or a part or fragment of the full sense or
antisense
sequence which are e.g. 10-500, preferably 10-30 bases in lengtli. Preferred
siRNA
molecules are described in the Examples. Thus in a preferred aspect, the
methods of
the invention are performed in which the anchoring disruption molecules are
nucleic
acid molecules or oligonucleotides (sense or antisense) derived from the
nucleotide
sequence of a binding partner as described hereinbefore or the complementary
sequence thereof.
"Polypeptides" or "peptides" as referred to herein are molecules with
preferably less than 100 amino acid residues but are preferably shorter, e.g.
less than
50 amino acid residues in length, preferably 10 to 35, 14 to 30, or 14 to 25
amino
acid residues in length. Anchoring disruption molecules of the invention are
preferably of this length.
Polypeptides and polynucleotides as described herein may be prepared by
any conventional modes of synthesis, including chemical synthesis or
recombinant
DNA technology. Chemical synthesis of polypeptides may be performed by
methods well known in the art involving cyclic sets of reactions of selective
deprotection of the functional groups of a terminal amino acid and coupling of
selectively protected amino acids, followed by complete deprotection of all
functional groups. Synthesis may be performed in solution or on a solid
support
using suitable solid phases known in the art. Preferably the anchoring
disruption
molecules or binding partner mimics are substantially purified, e.g. pyrogen-
free,
e.g. more than 70%, especially preferably more than 90% pure (as assessed for
example, in the case of peptides, by an appropriate technique such as peptide
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-36-
mapping, sequencing or chromatography). Purification may be performed for
example by chromatography (e.g. HPLC, size-exclusion, ion-exchange, affinity,
hydrophobic interaction, reverse-phase) or capillary electrophoresis.
As described above, peptidomimetics are also included within the scope of
the invention. Peptidomimetics and analogues as referred to herein are
molecules
which mimic the peptide described above in terms of function (i.e. their
ability to act
as an anchoring disruption molecule or binding partner mimic as described
herein
using the tests described herein) and/or structure. Functionally said
peptidomimetics
and analogues may show some reduced efficacy in perfonning the anchoring
disruption molecule or binding partner mimic function, but preferably are as
efficient or are more efficient.
Peptides, particularly when used in biological, e.g. medical applications may
not be without shortcoming as a result of e.g. poor oral and tissue
absorption, rapid
proteolysis cleavage, rapid excretion, potential antigenicity and poor shelf
stability.
One way in which this may be addressed is by the adoption of peptidomimetics
which retain the functional features of the peptide but present them in the
context of
a different, e.g. non-peptide structure. Such peptidomimetics may have
improved
distribution, metabolism and pharmacokinetics profiles, e.g. improved
stability and
membrane permeability. Such peptidomimetics have successfully been developed
and used for other particularly medical applications.
Peptidomimetics, particularly non-peptidic molecules may be generated
through various processes, including conformational-based drug design,
screening,
focused library design and classical medicinal chemistry. Strategies that have
been
used to identify peptidomimetics from the parent peptide structure which serve
as
scaffolds for enhancing non-peptide character may include 3-dimensional
conformation analysis of the peptide followed by the establishment of organic
synthetic strategies to prepare non-peptidic analogues witli similar or
improved
interaction with the pharmacophore groups on the ligand and the receptor. Thus
for
example various elements may be used to conformationally restrict certain
relevant
portions of the molecule, e.g. the distance between binding centers, a, (3 or
y turns,
(3-strands or a helices.
Thus not only may oligomers of unnatural amino acids or other organic
building blocks be used, but also carbohydrates, heterocyclic or macrocyclic
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-37-
compounds or any organic molecule that comprises structural elements and
confomlation that provides a molecular electrostatic surface that mimics the
same
properties of the 3-dimensional conformation of the peptide may be used
(Martin-
Martinez et al., 2002, Bioorg. Med. Chem. Letters, 12, p109-112; Andronati et
al.,
2004, Current Med. Chem., 11(9), p1183-1211; Eguchi et al., 2003,
Combinatorial
Chemistry and High Throughput Screening, 6(7), p611-621; Freidinger, 2003, J.
Med. Chem., 46(26), p5553-5566; Jones et al, 2003, Current Opin. Pharm.,
3.(5),
p530-543; Le et al., Drug Discovery Today, 8(15), p701-709; Schirmeister &
Kaeppler, 2003, Mini-reviews in Med. Chem., 3(4), 361-373; Eguchi & Kahn, Mini-
reviews in Med. Chem., 2(5), p447-462).
Thus the peptidomimetics may bear little or no resemblance to a peptide
backbone. Peptidomimetics may comprise an entirely synthetic non-peptide form
(e.g. based on a carbohydrate backbone with appropriate substituents) or may
retain
one or more elements of the peptide on which it is based, e.g. by derivatizing
one or
more amino acids or replacing one or more amino acids with alternative non-
peptide
components. Peptide-like templates include pseudopeptides and cyclic peptides.
Structural elements considered redundant for the function of the peptide may
be
minimized to retain a scaffold function only or removed where appropriate.
When
peptidomimetics retain one or more peptide elements, i.e. more than one amino
acid,
such amino acids may be replaced with a non-standard or structural analogue
thereof. Amino acids retained in the sequences may also be derivatised or
modified
(e.g. labelled, glycosylated or methylated) as long as the ability of the
polypeptide to
associate with or bind to a binding partner and compete with binding to the
complementary binding partner or act as an binding partner mimic is not
compromised by the substitution, derivatisation or modification.
The peptidomimetics are referred to as being "derivable from" a certain
polypeptide sequence. By this it is meant that the peptidomimetic is designed
with
reference to a defined polypeptide sequence, such that it retains the
structural
features of the peptide which are essential for its function. This may be the
particular side chains of the polypeptide, or hydrogen bonding potential of
the
structure. Such features may be provided by non-peptide components or one or
more of the amino acid residues or the bonds linking said amino acid residues
of the
polypeptide may be modified so as to improve certain functions of the
polypeptide
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-38 -
such as stability or protease resistance, while retaining the structural
features of the
polypeptide whicli are essential for its function. In other words the
peptidomimetic
or analogue has the same functional characteristics as a polypeptide having
the
defined sequence with respect to its ability to associate with or bind to a
binding
partner and to act as an anchoring disruption molecule or to act as an binding
partner
mimic and thereby alter the SERCA2 mediated PKA RII signalling pathway. The
peptidomimetic or analogue's functional characteristics are inherent from the
structure of the peptidomimetic and the structure is designed to retain these
properties. For example, in peptidomimetics retaining at least a partial amino
acid
content, one or more of these amino acid residues may be replaced with
structural
analogues, as long as the key structural features which provide the ability to
bind to
the binding partner, e.g. PKA RII or AKAP18S are retained.
Examples of non-standard or structural analogue amino acids which may be
used are D amino acids, amide isosteres (such as N-methyl amide, retro-inverse
amid, thioamide, thioester, phosphonate, ketomethylene, hydroxymethylene,
fluorovinyl, (E)-vinyl, metliyleneamino, methylenethio or alkane), L-N
methylamino acids, D-V methylamino acids, D-N-methylamino acids. Examples of
non-conventional amino acids are listed in Table 1.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-39-
TABLE 1
Non-conventional Code Non-conventional Code
amino acid amino acid
a-aminobutyric acid ' Abu ,b -N-methylalanine Nmala
a-amino-a-methylbutyrate Mgabu L-N-methylarginine Nmarg
aminocyclopropane- Cpro L-N-methylasparagine Nmasn
carboxylate L-N-methylaspartic acid Nmasp
aminoisobutyric acid Aib L-N-methylcysteine Nmcys
aminonorbornyl- Norb L-Nmethylglutanmine Nmgln
carboxylate L-N-methylglutamic acid Nmg1u
cyclohexylalanine Chexa L-N-methylhistidine Nmhis
cyclopentylalanine Cpen L-N methylisolleuci.ne Nmile
D-alanine Dal L-N-methylleucine Nmleu
D-arginine Darg L-N-methyllysine Nmlys
D-aspartic acid Dasp L-N-methylmethionine Nmmet
D-cystein:e Dcys L-N-methylnorleucine Nmnle
D-glutamine Dgln L-N,methylnorvaline Nmnva
D-glutamic acid Dglu L N methylornithine Nmorn
D-histidine Dhis L-N-methylphenylalanine , Nmphe
D-isoleucine Dile L-N-methylproline Nmpro
D-leucine Dleu L-N-methylserine Nmser
D-lysine Dlys L-N-methylthreonine Nm.thr
D-methionine Dmet L-N-methyltryptophan Nmtrp
D-ornithine Dorn L-N-methyltyrosine Nmtyr
D-phenylalanine Dphe L-N-methylvaline Nmval
D-proline Dpro L-N-methylethylglycine Nmetg
D-seriae Dser L-N-methyl-t-butylglycine Nmtbug
D-threonine Dthr L-norleucine Nle
D-tryptophan Dtrp L-norvaline Nva
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-40-
D-tyrosine Dtyr a-methyl-aminoisobutyrate Maib
D-valine Dval a-methyl-y-a.minobutyrate Mgabu
B=a-methylalanine Dmala a-methylcyclohexylalanine Mchexa.
D-a-methylarginine Dmarg a-methylcylcopentylalanine Mcpen
D-a-methylasparagine Dmasn a-methyi-a-napthylalanine Manap
D-a-methylaspartate Dmasp a-methylpenicillaniine Mpen
D-a-methylcysteme Dmcys N-(4-aminobutyl)glycine Nglu
D-a-methylglutamine Dmgln N-(2-aniinoethyl)glycine Naeg
D-a-methylhistidine Dmhis N-(3-aminopropyl)glycine Norn
D-a-methylisoleucine Dmile N-amino-a-methylbutyrate Ninaabu
D-a-methylleucine Dmleu a-napthylalanine Anap
D-a-methyllysine Dmlys N-benzylglycine Nphe
D-a-methylmethionine Dmmet N-(2-carbamylethyl)glycine Ngln
D-a-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn
D-a-methylphenyialanine Dmphe N-(2-carboxyethyl)glycine Nglu
D-a-methyiproline Dmpro N-(carboxymethyl)glycine Nasp
D-amethylserine Dmser N-cyclobutylglycine Ncbut
D-a-methylthreonine Dmthr N-cycloheptylglycine Nchep
D-a-methyltryptophan Dmtrp N-cyclohexylglycine Nchex
D-a-methyltyrosine Dmty N-cyclodecylglycine Ncdec
D-a-methylvaline Dmval N-cylcododecylglycine Ncdod
JN -methylala.nine Dnmala N-cyclooctylglycine Ncoct
D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro
D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund
D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm
D-N-methylcysteine Dnmcys N-(3,3-diphenylpropyl)glycine Nbhe
D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg
D-N-methylglutamate Dnmglu N-(1-hydroxyethyl)glycine Nthr
D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser,
D-N-methylisoleucine Dnmile N-(inudazolylethyl))glycine Nhis
D-N-metbylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-41-
D-N-methyllysine Dnmlys N-methyl-y-aminobutyrate Nmgabu
N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet
D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen
N-methylglycine Nala D-N-methylphenylalanine Dnmphe
N-methylaminoisobutyrate Nmaib D-N-methylproline Dnrnpro
N-(1-methylpropyl)glycine Nile D-N-methylserine Dnmser
N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr
D-N-methyltryptophan Dnmtrp N-(1-methylethyl)glycine Nval
D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap
.D-N-methylvaline Dnmval N-methylpenicillamine Nmpen
y-aminobutyric acid Gabu N-(p-hydroxyphenyl)glycine Nhtyr
L-t-butylglycine Thug N-(thiomethyl)glycine Ncys
L-ethylglycine Etg penicillamine Pen
Irhomophenylalanine Hphe L-a-methylalanine Mala
L-a-methylarginine Marg L-a-methylasparagine Masn
L-a-methylaspartate Masp L-a-methyl-t-butylglycine. Mtbug
L-a-methyicysteine Mcys L-methylethylglycine Metg
L-a-methylglutamine Mgln L-a-methylglutamate Mglu
L-a-methylhistidine Mhis L-a-methylhomophenylalanine Mhphe
L-a-methylisoleucine Mile. N-(2-methylthioethyl)glycine Nmet
L-a-methylleucine Mieu L-a-methyllysine Mlys
L-a-methylmethionine Mmet L-a-methylnorleucine Ivfnle
L-a-methylnorvaline Mnva L--a-methylornithine Morn
L-a-methylphenylalanine Mphe L-a-methylproline Mpro
L-a-methylserine Mser L-a-methyltlu-eonine Mthr
L-a-methyltryptophan Mtrp L-a-methyltyrosine Mtyr
L-a-methylvaline Mval L-N-methylhomophenylalanine Nmhphe
N-(N-(2,2-diphenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe
carbamylmethyl)glycine carbamylmethyl)glycine
1-carboxy-l-(2,2-diphenyl- Nmbc L-O-methyl serine Omser
ethylamino)cyclopropane L-O-methyl homoserine Omhser
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-42-
Non-standard amino acids which may be used include conformationally
restricted analogues, e.g. such as Tic (to replace F), Aib (to replace A) or
pipecolic
acid (to replace Pro).
Analogues also include molecules to which additional conlponents have been
added. This includes precursors of the anchoring disruption molecules or
binding
partner mimics or their peptidomimetics which may optionally be processed to
yield
the. anchoring disruption molecule or binding partner mimic or peptidomimetic.
Additional moieties may also be added to provide a required function, e.g. a
moiety
may be attached to assist or facilitate entry of the molecule into the cell.
Peptidoinimetics and analogues such as those exemplified above may be
prepared by chemical synthesis or where they retain amino acids, during
synthesis of
the polypeptide or by post production modification, using techniques which are
well
known in the art. Synthetic techniques for generating peptidomimetics from a
known polypeptide are well known in the art.
As mentioned above, an anchoring disruption molecule or binding partner
mimic will alter the SERCA2 mediated PKA type II signalling pathway, when
administered to a cell. The SERCA2 mediated PKA type II signalling pathway may
be up or down regulated, i.e. signalling may be increased or reduced.
The "PKA type II signalling pathway" as referred to herein refers to a series
of signalling events in which PKA type II is activated (or not), resulting in
increased
(or reduced) kinase activity of this enzyine. This signalling pathway is
intended to
include molecular events from activation of PKA type II to end effects such as
described previously, e.g. phosphorylation of phospholamban. Preferably the
invention is concerned with PKA type IIa or PKA type IIp, especially
preferably
PKA type IIa. "SERCA2 mediated PKA type II signalling" refers to a series of
signalling events in which PKA type II is activated (or not) resulting in
phosphorylation of phospholaniban (or not) which in turn activates SERCA2,
preferably SERCA2a, (or not). "PKA type II signalling that regulates SERCA2
activity" refers to the PKA type II signalling pathway which is responsible
for
regulation of SERCA2 activity.
In another aspect, a PKA type I signalling pathway may be engineered to
signal to PLB and SERCA2.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
- 43 -
As referred to herein the phrase "altering the activity of the PKA type II
signalling pathway" or the SERCA2 pathway is intended to mean the alteration
of
one or more signalling elements in the pathway (e.g. to affect its enzymatic
or other
functional properties) which affects downstream signalling events,
specifically the
activity of SERCA2. "Alteration" of the signalling elements refers to the
ability to
form interactions with other molecules, e.g. protein-protein interactions. The
ultimate effect is to down-regulate or up-regulate downstream events which
typify
PKA type II signalling, specifically the activity of SERCA2. Alteration of
said
signalling pathway may be assessed by determining the extent of activation of
a
molecule involved in said pathway, e.g. phosphorylation of a relevant molecule
as
described previously, or examination of levels of molecules whose levels are
dependent on the activity of said pathway. For use in particularly clinical
conditions, down-regulation or up-regulation of the PKA type II signalling
pathway,
i.e. enhancing or reversing the effects of cAMP activation, e.g. to regulate
the
cardiovascular system, is required depending on whether the clinical condition
is
typified by elevated or suppressed PKA type- II signalling and/or would
benefit from
elevation or suppression of the same.
The present invention also extends to antibodies (monoclonal or polyclonal)
and their antigen-binding fragments (e.g. F(ab)2, Fab and Fv fragments i.e.
fragments of the "variable" region of the antibody, which comprise the antigen
binding site) directed to the anchoring disruption molecules or binding
partner
mimics as defined hereinbefore, i.e. which bind to epitopes present on the
anchoring
disruption molecules and/or binding partner mimics and thus bind selectively
and
specifically to such anchoring disruption molecules and/or binding partner
mimics
relative to binding to other molecules such as other AKAPs and which may be
used
to inhibit the binding of PLB to AKAP18S or AKAP18S to PDE4D.
The invention also relates to nucleic acid molecules comprising a sequence
encoding a polypeptide or peptide described above or for targetting and
silencing the
expression of a polypeptide described above.
The nucleic acid molecules described above may be operatively linked to an
expression control sequence, or a recombinant DNA cloning vehicle or vector
containing such a recombinant DNA molecule. This allows intracellular
expression
of the anchoring disruption molecule or binding partner mimic as a gene
product, the
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-44-
expression of which is directed by the gene(s) introduced into cells of
interest. Gene
expression is directed from a promoter active in the cells of interest and may
be
inserted in any form of linear or circular DNA vector for incorporation in the
genome or for independent replication or transient transfection/expression.
Alternatively, the naked DNA, RNA or cheinically derived and stabilized
nucleic
acid molecule (e.g. PNA) may be injected directly into the cell, particularly
where
the anchoring disruption molecule is a nucleic acid molecule such as siRNA or
an
antisense oligonucleotide.
Appropriate expression vectors include appropriate control sequences such
as for example translational (e.g. start and stop codons, ribosomal binding
sites) and
transcriptional control elements (e.g. promoter-operator regions, termination
stop
sequences) linked in matching reading frame with the nucleic acid molecules
required for performance of the method of the invention as described
hereinafter.
Appropriate vectors may include plasmids and viruses (including both
bacteriophage
and eukaryotic viruses). Suitable viral vectors include baculovirus and also
adenovirus, adeno-associated virus, herpes and vaccinia/pox viruses. Many
other
viral vectors are described in the art. Preferred vectors include bacterial
and
mammalian expression vectors pGEX-KG, pEF-neo and pEF-HA. The nucleic acid
molecule may conveniently be fused with DNA encoding an additional
polypeptide,
e.g. glutathione-S-transferase, to produce a fusion protein on expression.
Thus viewed from a further aspect, the present invention provides a vector,
preferably an expression vector, comprising a nucleic acid molecule as defined
above.
Other aspects of the invention include methods for preparing recombinant
nucleic acid molecules according to the invention, comprising inserting
nucleotide
sequences encoding the anchoring disruption molecule or binding, partner mimic
into
vector nucleic acid.
In order to affect the signalling pathway, anchoring disruption molecules or
binding partner mimics as described hereinbefore are conveniently added to a
cell.
This may be achieved by relying on spontaneous uptake of the anchoring
disruption
molecule or binding partner mimic into the cells or appropriate carrier means
may
be provided. Exogenous peptides or proteins may thus be introduced by any
suitable
technique known in the art such as in a liposome, niosome or nanoparticle or
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
- 45 -
attached to a carrier or targeting molecule (see hereinafter). Thus for
example, as
discussed above, the anchoring disruption molecule or binding partner mimic
may
be tagged with a suitable sequence that allows the anchoring disruption
molecule or
binding partner mimic to cross the cell menibrane. An example of such a tag is
the
HIV tat sequence, a stretch of e.g. 11 arginines or the attachment of stearic
acid.
It will be appreciated that the level of exogenous molecules introduced into a
cell will need to be controlled to avoid adverse effects. The anchoring
disruption
molecule or binding partner mimic may be transported into the cell in the fomi
of
the polypeptide or in the form of a precursor, e.g. with an attached moiety to
allow
passage across the cell membrane (e.g. via endocytosis, pinocytosis or macro
pinocytosis) or for cell targeting or in a form which is only activated on
conversion,
e.g. by proteolysis or transcription and translation.
The anchoring disruption molecule or binding partner mimic may be
administered to a cell by transfection of a cell with a nucleic acid molecule
encoding
the anchoring disruption molecule or binding partner mimic. As mentioned
above,
the present invention thus extends to nucleic acid molecules comprising a
sequence
which encodes the anchoring disruption molecule or binding partner mimic
described herein and their use in methods described herein. Preferably said
nucleic
acid molecules are contained in a vector, e.g. an expression vector.
Nucleic acid molecules of the invention or for use in the invention,
preferably contained in a vector, may be introduced into a cell by any
appropriate
means. Suitable transformation or transfection techniques are well described
in the
literature. A variety of techniques are known and may be used to introduce
such
vectors into prokaryotic or eukaryotic cells for expression. Preferred host
cells for
this purpose include insect cell lines, eukaryotic cell lines or E. coli, such
as strain
BL21/DE3. The invention also extends to transformed or transfected prokaryotic
or
eukaryotic host cells containing a nucleic acid molecule, particularly a
vector as
defined above.
A further aspect of the invention provides a method of preparing an
anchoring disruption molecule or binding partner mimic of the invention as
hereinbefore defined, which comprises culturing a host cell containing a
nucleic acid
molecule as defined above, under conditions whereby said anchoring disruption
molecule or binding partner mimic is expressed and recovering said molecule
thus
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-46-
produced. The expressed anchoring disruption molecule or binding partner mimic
product forms a further aspect of the invention.
The invention also extends to an anchoring disruption molecule or binding
partner mimic encoded by a nucleic acid molecule as hereinbefore described.
This
may be produced by expression of a host cell as described above.
Cells containing anchoring disruption molecules or binding partner mimics
of the invention, introduced directly or by expression of encoding nucleic
acid
material form further aspects of the invention.
Nucleic acid molecules which may be used according to the invention may
be single or double stranded DNA, cDNA or RNA, preferably DNA and include
degenerate sequences. Ideally however genomic DNA or cDNA is employed.
Anchoring disruption molecules or binding partner mimics as described
herein may be used to alter SERCA2 mediated PKA RII signalling.
Thus in a further aspect, the present invention provides a method of altering
the SERCA2 mediated PKA type II signalling pathway in a cell by administration
of
an anchoring disruption molecule or binding partner mimic (or a nucleic acid
molecule encoding said anchoring disruption molecule or binding partner mimic)
as
defined herein. This method may be used in vitro, for example in cell or organ
culture, particularly for affecting SERCA2 mediated PKA type II signalling
pathways which have been activated (or not) or to reduce or increase the
extent of
endogenous signalling or to stimulate or suppress SERCA2 mediated PKA type II
signalling.
The method may also be used ex vivo, on animal parts or products, for
example organs or collected blood, cells or tissues, particularly when it is
contemplated that these will be reintroduced into the body from which they are
derived. In particular, in samples in which abnormal levels of PKA type II
signalling that regulates SERCA2 activity are occurring, levels may be
normalized,
e.g. by inhibiting (or activating) the activity of the SERCA2 mediated PKA
type II
signalling pathway, as necessary. In such a method of treatment, the sample
may be
harvested from a patient and then returned to that patient.
In this context, a"sample" refers to any material obtained from a human or
non-human animal, including tissues and body fluid. "Body fluids" in this case
include in particular blood, spinal fluid and lymph and "tissues" include
tissue
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-47-
obtained by surgery or other means. Such methods are particularly useful wlien
the
anchoring disruption molecule or binding partner mimic is to be introduced
into the
body by expression of an appropriate nucleic acid molecule or if the anchoring
disruption molecule is itself a nucleic acid molecule.
In such methods the methods of treatment of the invention as described
hereinafter comprise the initial step of obtaining a saniple from an
individual or
subject, contacting cells from said sample with an anchoring disruption
molecule or
binding partner mimic (or a nucleic acid molecule encoding an anchoring
disruption
molecule or binding partner mimic) of the invention and administering said
cells of
said sample to the individual or subject. The step of contacting refers to the
use of
any suitable technique which results in the presence of said anchoring
disruption
molecule or binding partner mimic in cells of the sample.
The method may also be used in. vivo for the treatment or prevention of
diseases in which abnormal SERCA2 PKA type II signalling occurs or in which
alteration of such signalling would produce a positive effect and this will be
discussed in more detail below.
As described previously the methods of altering SERCA2 mediated PKA
type II signalling have utility in a variety of clinical indications in which
abnormal
PKA type II signalling that regulates SERCA2 activity is exhibited.
Alternatively
the signalling may be at nonnal levels but alleviation of disease progression
or
symptoms may be achieved by reducing or elevating the levels of SERCA2
mediated PKA type II signalling.
Abnormal signalling may be elevated or reduced relative to a normal cell,
sample or individual. Diseases or conditions in which reduced signalling
occurs (i.e.
hypoactivation) include cardiovascular diseases such as heart failure.
Diseases or
conditions in which elevated signalling occurs (i.e. hyperactivity) include
hypertension. P-adrenergic signalling in the heart may be modified with
molecules
as described herein. Hypoactivity may be treated with the binding partner
mimics
described herein and hyperactivity may be treated with the anchoring
disruption
molecules described herein. P-adrenergic signalling may be reduced to avoid
post-
infarction heart failure by using anchoring disruption molecules of the
invention as
cardioprotective agents. Furthermore, PLB phosphorylation may be increased in
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
- 48 -
states wliere PLB is hypo-phosphorylated by mimics to improve progressive
cardiac
contractile dysfunction in dilated cardiomyopathy.
Since PKA type II is a key regulator of (3-adrenergic signalling, diseases
wliich exhibit impaired or elevated (3-adrenergic signalling or would benefit
from
such modification of the same are particular targets for this treatment.
Specifically,
the anchoring disruption molecules or binding partner mimics which abolish or
enhance the function of PKA type II may be used to produce pharmaceutical
preparations to treat the above described diseases or disorders.
Thus, the anchoring disruption molecules or binding partner mimics may be
used to treat or prevent diseases or disorders typified by aberrant PKA type
II
signalling that regulates SERCA2 activity or disorders or diseases in which
SERCA2 mediated PKA type II signalling has been implicated or disorders or
diseases which would be alleviated (e.g. by a reduction in symptoms) by
reducing or
elevating SERCA2 mediated PKA type II signalling.
The invention further relates to an anchoring disruption molecule or binding
partner mimic or their encoding nucleic acid molecule as defined herein or
pharmaceutical compositions containing such molecules for use in medicine.
Specifically, the anchoring disruption molecules or binding partner mimics
which
affect SERCA 2 mediated PKA type II signalling may be used to produce
pharmaceutical preparations.
The invention further relates to the use of an anchoring disruption molecule
or binding partner mimic as defined herein in the manufacture of a medicament
for
treating or preventing diseases or disorders with abnormal PKA type II
signalling
that regulates SERCA2 activity or which would benefit from a reduction or
elevation in the levels of SERCA2 mediated PKA type II signalling, e.g.
cardiovascular diseases, including hypertension or post-infarction heart
failure.
The invention also relates to a method of treating or preventing such diseases
or disorders comprising the step of administering an effective amount of an
anchoring disruption molecule or binding partner mimic as defined herein to a
human or non-human animal, e.g. a mammal in need thereof.
Preferred mammals are humans.
The anchoring disruption molecules or binding partner mimics as described
herein may therefore be formulated as pharmaceutical compositions in which the
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-49-
anclioring disruption molecule or binding partner mimic may be provided as a
pharmaceutically acceptable salt. Pharmaceutically acceptable salts may be
readily
prepared using counterions and techniques well known in the art.
The invention thus further extends to pharmaceutical compositions
comprising one or more anchoring disruption molecules or binding partner
mimics
(e.g. nucleic acid molecules, peptides or proteins, antisense
oligonucleotides,
siRNA, ribozymes or antibodies as defined above) and one or more
pharmaceutically acceptable excipients and/or diluents. By "pharmaceutically
acceptable" is meant that the ingredient must be compatible with other
ingredients in
the composition as well as physiologically acceptable to the recipient.
The active ingredient for administration may be appropriately modified for
use in a pharmaceutical composition. For example when peptides are used these
may be stabilized against proteolytic degradation by the use of derivatives
such as
peptidomimetics as described hereinbefore. The active ingredient may also be
stabilized for example by the use of appropriate additives such as salts or
non-
electrolytes, acetate, SDS, EDTA, citrate or acetate buffers, mannitol,
glycine, HSA
or polysorbate.
Conjugates may be formulated to provide improved lipophilicity, increase
cellular transport, increase solubility or allow targeting. Conjugates may be
made
terminally or on side portion of the molecules, e.g. on side chains of amino
acids.
These conjugates may be cleavable such that the conjugate behaves as a pro-
drug.
Stability may also be conferred by use of appropriate metal complexes, e.g.
with Zn,
Ca or Fe.
The active ingredient may be formulated in an appropriate vehicle for
delivery or for targeting particular cells, organs or tissues. Thus the
pharmaceutical
compositions may take the form of microemulsions, liposomes, niosomes or
nanoparticles with which the active ingredient may be absorbed, adsorbed,
incorporated or bound. This can effectively convert the product to an
insoluble
form. These particulate forms have utility for transfer of nucleic acid
molecules
and/or protein/peptides and may overcome both stability (e.g. enzymatic
degradation) and delivery problems.
These particles may carry appropriate surface molecules to improve
circulation time (e.g. serum components, surfactants, polyoxamine908, PEG
etc.) or
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-50-
moieties for site-specific targeting, such as ligands to particular cell borne
receptors.
Appropriate tecluiiques for drug delivery and for targeting are well known in
the art
and are described in W099/62315. Clearly such methods have particular
applications in the methods of the invention described herein.
Such derivatized or conjugated active ingredients are intended to fall within
the definition of anchoring disruption molecules or binding partner mimics
which
are described herein.
Pharannaceutical compositions for use according to the invention may be
formulated in conventional manner using readily available ingredients. Thus,
the
active ingredient may be incorporated, optionally together with other active
substances as a coinbined preparation, with one or more conventional carriers,
diluents and/or excipients, to produce conventional galenic preparations such
as
tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions (as
injection
or infusion fluids), emulsions, solutions, syrups, aerosols (as a solid or in
a liquid
medium), ointments, soft and hard gelatin capsules, suppositories, sterile
injectable
solutions, sterile packaged powders, and the like. Biodegradable polymers
(such as
polyesters, polyanhydrides, polylactic acid, or polyglycolic acid) may also be
used
for solid iniplants. The compositions may be stabilized by use of freeze-
drying,
undercooling or Permazyme.
Suitable excipients, carriers or diluents are lactose, dextrose, sucrose,
sorbitol, mannitol, starches, gum acacia, calcium phosphate, calcium
carbonate,
calciuni lactose, corn starch, aglinates, tragacanth, gelatin, calcium
silicate,
microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water syrup,
water,
water/ethanol, water/glycol, water/polyethylene, glycol, propylene glycol,
metliyl
cellulose, methylhydroxybenzoates, propyl hydroxybenzoates, talc, magnesium
stearate, mineral oil or fatty substances such as hard fat or suitable
mixtures thereof.
Agents for obtaining sustained release formulations, such as
carboxypolymethylene,
carboxymethyl cellulose, cellulose acetate phthalate, or polyvinylacetate may
also
be used. The compositions may additionally include lubricating agents, wetting
agents, viscosity increasing agents, colouring agents, granulating agents,
disintegrating agents, binding agents, osmotic active agents, emulsifying
agents,
suspending agents, preserving agents, sweetening agents, flavouring agents,
adsorption enhancers, e.g. for nasal delivery (bile salts, lecithins,
surfactants, fatty
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-51-
acids, chelators) and the like. The compositions of the invention may be
formulated
so as to provide quick, sustained or delayed release of the active ingredient
after
administration of the patient by employing procedures well known in the art.
The active ingredient in such conipositions may comprise from about 0.01%
to about 99% by weiglit of the formulation, preferably from about 0.1 to about
50%,
for exanlple 10%.
The invention also extends to pharmaceutical compositions as described
above for use as a medicament.
In methods of the invention, anchoring disruption molecules or binding
partner mimics should be used at appropriate concentrations such that a
significant
number of the relevant binding partners' interactions, are prevented or where
mimics
are used, such that SERCA2 mediated PKA II signalling is increased relative to
untreated samples or individuals.
Preferably the pharmaceutical composition is formulated in a unit dosage
form, e.g. with each dosage containing from about 0.1 to 500mg of the active
ingredient. The precise dosage of the active compound to be adniinistered and
the
length of the course of treatment will of course, depend on a number of
factors
including for example, the age and weight of the patient, the specific
condition
requiring treatment and its severity, and the route of administration.
Generally
however, an effective dose may lie in the range of from about 0.01mg/kg to
20mg/kg, depending on the animal to be treated, and the substance being
administered, taken as a single dose.
For methods in which the anchoring disruption molecule or binding partner
mimic or their encoding molecule is administered to a sample ex vivo to be
returned
to the body, suitable dosages of said anchoring disruption molecule are 25-
100nM or
lower, such as 10-50nM, 5-25nM, 1-5nM or 0.2-5nM.
The administration may be by any suitable method known in the medicinal
arts, including for example oral, parenteral (e.g. intramuscular,
subcutaneous,
intraperitoneal or intravenous) percutaneous, buccal, rectal or topical
administration
or administration by inhalation. The preferred administration forms will be
administered orally, rectally or by injection or infusion. As will be
appreciated oral
administration has its limitations if the active ingredient is digestible. To
overcome
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-52-
such problems, ingredients may be stabilized as mentioned previously and see
also
the review by Bernkop-Scluiurch, 1998, J. Controlled Release, 52, p1-16.
It will be appreciated that since the active ingredient for performance of the
invention takes a variety of forms, e.g. oligonucleotide, antibody, ribozyme,
nucleic
acid molecule (which may be in a vector) or polypeptide/peptide, the form of
the
composition and route of delivery will vary. Preferably however liquid
solutions or
suspensions would be employed, particularly e.g. for nasal delivery and
administration will be systemic.
As mentioned above, these pharmaceutical compositions may be used for
treating or preventing conditions in which PKA type II signalling which
regulates
SERCA2 is abnormal, in particular when the activity of this pathway is
elevated or
reduced. Furthennore, anchoring disruption may be beneficial also when the
signalling is normal in cases when the heart is damaged and needs to be
protected
from adrenergic stimuli and pacing.
Thus, viewed from a further aspect the present invention provides a method
of treating or preventing diseases or disorders exhibiting abnormal PKA type
II
signalling that regulates SERCA2 activity or which would benefit from a
reduction
or elevation in the levels of SERCA2 mediated PKA type II signalling,
preferably as
described hereinbefore, in a human or non-human animal wherein a
pharmaceutical
composition as described hereinbefore is administered to said animal.
Alternatively stated, the present invention provides the use of a
pharmaceutical composition as defined above for the preparation of a
medicament
for the treatment or prevention of diseases or disorders exhibiting abnormal
PKA
type II signalling that regulates SERCA2 activity or which would benefit from
a
reduction or elevation in the levels of SERCA2 mediated PKA type II
signalling,
preferably as described hereinbefore.
As referred to herein a "disorder" or "disease" refers to an underlying
pathological disturbance in a symptomatic or asymptomatic organism relative to
a
normal organism, which may result, for example, from infection or an acquired
or
congenital genetic imperfection. A "condition" refers to a state of the mind
or body
of an organism which has not occurred through disease, e.g, the presence of a
moiety in the body such as a toxin, drug or pollutant.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-53-
As referred to herein "cardiovascular disease" refers to a disease or disorder
of the heart or vascular system which may be congenital or acquired and
enconipasses diseases such as congenital heart failure, hypertension,
myocardial
infarction, congestive heart failure, dilated cardiomyopathy, atherosclerotic
peripheral arterial disease and alveolar hypoxia leading to pulmonary
hypertension
and right ventricle failure. Preferred conditions for treatment according to
the
invention are as described previously.
Subjects whicli may be treated are preferably mammalian, preferably humans
and companion or agricultural animals such as dogs, cats, monkeys, horses,
sheep,
goats, cows, rabbits, rats and mice.
As used herein, "treating" refers to the reduction, alleviation or
elimination,
preferably to normal levels, of one or more of the syrnptoms of said disease,
disorder
or condition which is being treated, e.g. normal blood pressure, cardiac
function,
etc., relative to the symptoms prior to treatment. Where not explicitly
stated,
treatment encompasses prevention. "Preventing" refers to absolute prevention,
i.e.
maintenance of normal levels with reference to the extent or appearance of a
particular symptom (e.g. hypertension) or reduction or alleviation of the
extent or
timing (e.g. delaying) of the onset of that symptom.
The method of treatment according to the invention may advantageously be
combined with administration of one or more active ingredients which are
effective
in treating the disorder or disease to be treated.
Thus, pharmaceutical compositions of the invention may additionally contain
one or more of such active ingredients.
In a further aspect, the present invention provides methods and/or
compositions which combine one or more anchoring disruption molecules or
binding partner mimics as described herein with compounds that improve the
tolerability of the active ingredient, especially during long term treatment.
Typical
compounds include antihistamine and proton pump inhibitors.
According to a yet further aspect of the invention we provide products
containing
one or more anchoring disruption molecules or binding partner mimics as herein
defined and one or more additional active ingredients as a combined
preparation for
simultaneous, separate or sequential use in human or animal therapy.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-54-
The following Examples are given by way of illustration only in which the
Figures referred to are as follows:
Figure 1 shows PKA-RII binding proteins in sarcoplasmatic reticulum (SR) from
rat
heart. RII binding was detected by a solid-phase binding assay using 32P-
radiolabeled RIIa (R-overlay) as a probe in absence (upper panel) or presence
(lower panel) of 500 nM the Ht31 anchoring inhibitor protein. Molecular weight
standards are indicated (Benchmark, Invitrogen). Calsequestrin which is a
major
Caz+ binding protein of SR was used as an SR marker and indicator for the
quality of
the fractions (lower panel);
Figure 2 shows the identification of a RII-binding protein of approximately 50
kDa
in the anti-AKAP 188 precipitation and in the total cell lysate isolated from
rat heart
analysed by R-overlay. Recombinant AKAP18S protein and rabbit IgG was used as
a positive control negative control, respectively. PKA-reg refers to PKA R
subunit
detected in overlay assay;
Figure 3 shows the identification of AKAP188 in rat heart SR (fractions 11-13)
and
the presence of the catalytic (PKA-C) subunit and the different regulatory
subunits
(RIa, RIIa and RII(3) in all fractions. Pep refers to the use of peptide
antigen to
block antibody. Calsequestrin was used as an SR marker and indicator for the
quality of the fractions (data not shown);
Figure 4 shows the presence of the Ca2+-activated Ca2+ release channels
ryanodine
receptors 2 (RyR2) and Ins(1,4,5)P3 receptor (IP3R), the ATP-dependent Ca2+
pump
(SERCA2a) and pentamer and monomer forms of phospholamban (PLB) in SR.
Calsequestrin was used as an SR marker and indicator for the quality of the
fractions
(data not shown);
Figure 5 shows colocalization (yellow merge) of the AKAP 18b (red) with a-
actinin
(green), RIIa (green), SERCA2a (green) and PLB (green) by immunofluorescence
analysis of rat heart tissue using monoclonal and polyclonal antibodies (four
upper
most panels). Two lower most panels shows colocalization (yellow merge) of
SERCA2a (red) with a-actinin (green) and PKA-RIIa (green) analysed by
immunofluorescence analysis of rat heart tissue. The relative fluorescence
intensity
in each panel was measured and is shown at the right;
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-55-
Fiure 6 shows colocalization (yellow merge) of a-actinin (red) and AKAP18S
(red)
by immunofluorescence analysis of rat neonatal cardiac myocytes;
Figure 7 shows copurification of AKAP 185 and SERCA2a together with PKA-RIta
and PKA-C in a cAMP pull down experiment using Rp-8-AHA-cAMP agarose
beads (antagonist that does not dissociate PKA C). Negative control with free
cAMP present upon binding is shown at right;
Figure 8 shows coimmunoprecipitation of PLB pentamer (upper band) and monomer
(lower band) with AKAP 185 from SR (rat heart) using polyclonal antibodies
against
AKAP 185. SR lysate and rabbit IgG was used as positive and negative control,
respectively;
Figure 9 shows results of immunoprecipitation experiments with the antibodies
indicated on total cell lysate from rat heart, followed by SDS-PAGE and
western
blotting using an antibody against PLB. PLB coprecipitated with AKAP188 but
not
with preimmune serum or a-actinin. Lysate and immunoprecipitation of PLB using
anti-PLB were used as positive controls;
Fi ug re 10 shows identification of a dynamic AKAP18S binding site in PLB. In
an
overlay experiment, GST-AKAP18S bound PLB (synthesized on membrane as 20
mers) (upper panel), but not when PLB contained a phosphorylated Serine (at
residue 16 in full length PLB) (lower 2 panels). GST protein was used as a
negative
control in both experiments;
Fi ug: re 11 shows substitution with either a proline (P) (upper panel) or
alanine (A)
(lower panel) in the PLB sequence to identify amino acids important for AKAP
188
binding. The bar diagram at the right shows the relative affinity of the PLB
derivatives with a higher affinity than the wild-type PLB sequence;
Figure 12 shows epitope mapping of the monoclonal PLB antibody by peptide
array
technology and immunoblotting. The antibody epitope is within the same region
as
the AKAP 186 binding site;
Figure 13 shows analysis of the AKAP18S binding site in PLB. A GST-AKAP18S
overlay on a two dimensional array of 400 PLB derivatives (spotted as 20-mer
peptides) in which each residue in the PLB sequence (given by their single-
letter
codes above the array) was replaced with residues having every possible side
chain
(given by their single-letter codes to the left of the array). The two first
rows
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-56-
correspond to the native PLB sequence. White circles denote peptides in the
array
that correspond to the native PLB sequence. GST overlay was performed as a
negative control (data not shown);
Figure 14 shows analysis of the minimal AKAP 186 binding site in PLB. A GST-
AKAP18S overlay on a two dimensional array of 260 PLB derivatives (spotted as
13-mer peptides) in which each residue in the PLB sequence (given by their
single-
letter codes above the array) was replaced with residues having every possible
side
chain (given by their single-letter codes to the left of the array). The two
first rows
correspond to the native PLB sequence. White circles denote peptides in the
array
that correspond to the native PLB sequence. GST overlay was performed as a
negative control (data not shown). The experiments identify amino acids in PLB
important for AKAP 186 binding;
Fi ug re 15 shows that AKAP188 binds in a dynamic fashion to both a 13-mer
peptide
and a 20-mer peptide of PLB and also when PLB contains the R9C mutation (an
inherited mutation in human dilated cardiomyopathy, Schmitt et al., 2003,
Science,
299, p1410-1413). The on/off binding is regulated by phosphorylation of a
serine
residue in the peptides (serine at position 16 in full length PLB);
Figure 16 shows that AKAP18S is not able to bind to PLB(R9C) after incubation
with the PKA-C subunit, indicating that the binding site is blocked by PKA-C;
Figure 17 shows down regulation of Ser16 PLB phosphorylation after anchoring
disruption using the PKA type II specific peptide, super-AKAP-is. Super-AKAP-
is
disrupts the PKA-AKAP 18 interaction;
Fig-ure 18 shows representative kinetics of Ca2+ re-uptake in the sarcoplasmic
reticulum (SR). Neonatal cardiac myocytes were transfected with the FRET-based
Ca2+ sensor cameleon targeted to the SR and the response to a 10 mM caffeine
pulse
(Is, arrow) was recorded in control cells (filled squares) or cells pre-
treated with 50
gM peptide (R R A S T I E M P Q Q R R R R R R R R R R R) for 40 min and/ or
Ne 10 mM and IBMX 100 mM for 20 min, as indicated;
Figure 19 shows the averages of time constant i(tau), calculated by fitting
the
recovery phase in the curve of Ca2+ re-uptake as shown in Figure 18 by using
the
exponential function f(t) =Eni=1 Ai e-t/ti + C. For each sample n > 20
independent
cells were used. * p = 0.02, ** p = 0.001, *** p< 6.16226e-10, Student's t-
test;
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-57-
Fi ruge 20 shows delineation of the minimal binding region of PLB, RRASTIE, by
peptide array and AKAP 188 overlay in vitro;
Fi ug re 21 shows a schematic illustration of a construct that potentially can
be used
to enhance PKA-phosphorylation of PLB. A high affinity PKA type II or type I
binding sequence is coupled to the SR targeting domain of PLB. Such a
construct
should target PKA to SR with high efficiency and PKA will successively
phosphorylate PLB. Optinally, two glycine spacers (ten glycine residues) are
included as spacers between the two functional domains and a myc tag (or
another
tag) could be added in between. In some cases the high affinity PKA type I
binding
sequence MEME3 (LEQYANQLADQIIKEATE) might be exchanged with super-
AKAP-is;
Figare 22 shows that disruption of PKA anchoring with the PKA anchoring
disruptor peptide L314E or inhibition of PKA inhibits (3-adrenoreceptor-
mediated
phosphorylation of phospholamban (PLB) in neonatal cardiac myocytes.
Incubations
were carried out in the absence or presence of the PKA anchoring disruptor
peptide
L314E (100 M, 30 min preincubation) or the PKA inhibitor H89 (30 M, 30 min
preincubation). Cells were next treated with isoprotenerol ((3-AR agonist). At
the
indicated times cells were harvested and phospho-phospholamban phosphorylated
by PKA at Serl6, and total phospholamban were detected by Western blotting.
Shown is one representative experiment (upper panel). Signal was
densitometrically
analysed (n=3 independent experiments, mean SD, lower panel);
Figure 23 shows knockdown of AKAP188 using selective RNA; measured by FACS
analysis. HEK293 cells co-expressing selective AKAP18b-RNA; and AKAP18S-
YFP or AKAPI8S-YFP and vector without (w/o) RNA; were subjected to FACS
analysis. As further controls, the cells were transfected with the indicated
(+)
combinations of vectors (mean SD, n=3 independent experiments);
Figure 24 shows knockdown of AKAP186 using selective RNA;. Detection of
AKAP 185-YFP in HEK293 cells expressing the indicated vectors or combinations
thereof using AKAP185-specific antibody A1884 by Western blotting. Right
panel,
densitometric analysis of the signals obtained in the Western blot depicted in
the left
panel;
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-58-
Figure 25 shows that disruption of the AKAP18S-phospholamban interaction
alters
Ca2+ reuptake into the SR of cardiac myocytes. Rat neonatal cardiac myocytes
were
left untreated or incubated with the AKAPI8S -phospholamban disruptor peptide
S-
PLB-1 (50 M, 30 min) stearic acid-VQYLTRSAIRRASTIEMPQQARQNLQ-NH2,
amino acid residues 4-29 in rat phospholamban (protein data base entry XP-
579462). During the last 10 nlin of the incubation the cells were loaded with
Fluo-4-
AM (1 M) by adding the fluophore into the medium. Line scans were performed
using a laser scanning microscope (1 line scan/ 20 ms, total of 10,0001ine
scans).
Where indicated isoproterenol (Iso) was added to the incubation chamber. Line
scans were taken 10 and 35 seconds after isoprotenerol treatment;
Figure 26 shows that PLB is precipitated with AKAP 185 in HEK293 transfected
cells. HEK293 cells were grown in petri dishes (40 mm diameter) and
transfected
with plasmids encoding AKAP 188-YFP, PLB-CFP or with both. The samples were
applied to SDS-PAGE and Western blot analysis as indicated. Preimmune serum
1854 was used as negative control;
Fig e 27 shows the PLB binding site in AKAP 18&. Rat AKAP 18S sequence was
synthesized on membrane as 20-mers and with 3 amino acids offset. Binding to
PLB
was analysed in an overlay experiment using biotinylated-PLB (biotin-
MEKVQYLTRSAIRRASTIEM). The PLB binding sequence in AKAP18S is shown
in dark shading. The lighter shaded box shows the RII binding domain;
Figure 28 shows knockdown of AKAP 188 using RNAi303 and RNAi700.
RNAi directed against both AKAP18S and AKAP18y was generated. HEK293 cells
were left untransfected, co-transfected with one of the two and AKAP18S-YFP,
or
with empty RNAi vector and AKAP18S -YFP, or with a vectors encoding GFP and
RNA;303 or RNA;700. The cellular fluorescence was evaluated by FACS analysis.
The mean fluorescences determined in two independent experiments are shown;
Figure 29 shows copurification of AKAP 188 (left lane: cAMP agarose) from
adult
rat heart lysates in a pull down experiment using Rp-8-AHA-cAMP agarose beads
(antagonist that does not dissociate PKA). As a positive control recombinant
AKAP 185 (lane: rec. AKAP 185) is shown; as a negative control the pull down
experiment was carried out in the presence of cAMP which prevents association
of
AKAP 188 with the cAMP agarose beads;
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-59-
Fi re 30 shows AKAP188 overlay binding assay with an array of immobilized
PLB peptides as indicated in the absence (left) or presence (right) of the PLB-
derived disruptor peptide in solution. As can be seen, AKAPI8S-PLB disruptor
peptide competed with binding of AKAP18S to PLB;
Figure 31 shows the effect of the PLB-derived disruptor peptide on
isoproterenol-
induced phospholamban Ser16 phosphorylation. Mouse neonatal cardiac myocytes
were treated with or without Arg9_> >-PLB peptide (50 M) for 30 min before
stimulation with isoproterenol (0.1 M) for 5 min as indicated. Scrambled
peptide
(Argi i-scramPLB) was used as negative control (data not shown). pSer16-PLB
(upper panel) immunoblots are shown. Calsequestrin blot is shown as control.
Phosphorylated Ser16-PLB was quantified by densiometry (bottom graph). Error
bars
represent the SEM from n=2-3 independent experiments;
Figure 32 shows siRNA-mediated knock down of AKAP 188 inhibits the adrenergic
effect on Ca2+-reabsorption into sarcoplasmic reticulum. Efficacy of knockdown
was
tested by transfecting AKAP 188 and siRNA into a keratinocyte cell line,
HaCaT,
together with a FLAG-tagged control for transfection efficacy (upper panel).
Kinetics of Ca2+ release and re-uptake in the SR of cardiac myocytes
transfected
with the YC6.2 sensor alone (squares, middle and bottom panels) or in
combination
with AKAP 185 siRNA (middle panel, circles) or control siRNA (bottom panel,
triangles) subsequent to treatment with 50 M BHQ. The arrow indicates the
time
point at which 10 M NE was added to cells stimulated with the beta-agonist
(filled
symbols, no NE, open symbols with NE). Note: time scale differs at break-
point.
The averages of time constants ti were calculated as before (right). For each
sample
n=l 1-12 independent cells were analysed (p < 0.025, Student's t-test);
Figure 33 shows deletional mapping of the phospholainban binding domain in
AKAP 18S by use of GST-AKAP 188 truncated proteins in peptide array overlay
experiments of PLB (A) and coexpression and co-immunoprecipitation of PLB-GFP
and AKAP18S truncated proteins in HEK293 cells;
Figure 34 shows colocalization of the AKAP 188/PLB/SERCA2 complex in
cardiomyocyte sarcoplasmic reticulum by immunogold staining and electron
microscopy. Neonatal rat hearts were obtained and processed for immunogold
electron microscopy as described in "Experimental Procedures". Immunogold
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-60-
staining was performed using secondary antibodies labeled with gold particle
of two
sizes to allow dual staining. Co-staining of PLB and SERCA2 labeled with 15
and
nm gold grains respectively is shown (upper left), SERCA2 and AKAP 185 were
labeled with 10 and 15 nm gold grains (upper riglit) and PLB and AKAP 185 were
5 labeled with 10 and 15 nm gold grains respectively (two bottom panels).
Scale bars,
1 rn. The magnified views show representative areas where the indicated
proteins
co-localize; and
Figure 35 shows the a]ignment of rat AKAP 18a, rat AKAP 180, and rat AKA.P 18S
with human AKAP 18y amino acid sequences, showing that the AKAP 185 and
AKAP18y splice variants both cover the regions 124-138 and 201-220 where PLB
binds.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-61-
EXAMPLES
Methods
Autospot Peptide Array. Peptide arrays were synthesized on cellulose paper by
using Multipep automated peptide synthesizer (INTAVIS Bioanalytical
Instruments
AG, Koeln, Germany) as described (Frank, R., 1992, Tetrahedron 48, 123-132).
Protein expression and purification. AKAP188-GST was expressed in E.cola B121
by IPTG induction. The AKAP 18d-GST containing pellet was incubated in lysis
buffer (10 mM MOPS, pH 6.5, 100 mM NaCI, added protease inhibitors) and
sonicated (UP400s Ultraschall processor) for 1 minute in three intervals at 0
C.
After centrifugation, the supernatant was incubated with glutathione-agarose
beads
(Sigma) and rotated overnight at 4 C. The AKAP 1 8d-GST protein bound to the
beads was washed two times in lysis buffer thereafter two times in the washing
buffer (5 mM MOPS, pH 6.5, 0.5 M NaCI) and finally two times in lysis buffer.
The
AKAP18d-GST protein was eluted in 20 mM L-Glutathione (reduced, in 50 mM
Tris-HCl (pH 8.4) 150 mM NaCI) at 4 C ON before dialysis into PBS overnight.
Immunoblot analysis. Cell lysates, immunocomplexes, were analyzed on a 4-20%
PAGE and blotted onto PVDF membranes. The filters were blocked in 5% non-fat
dry milk in TBST for 30 minutes at RT, incubated 1 hour at RT or overnight at
4 C
with primary antibodies, washed four times 5 minutes in TBST with 0.1 % Tween-
20
and incubated with a horseradish-peroxidase-conjugated secondary antibody.
Blots
were developed by using Supersignal West Dura Extended Duration Substrate or
Supersignal West Pico substrate (Pierce).
Antibodies. PLB or AKAP 1 8d were immunoprecipitated with monoclonal (Upstate)
or polyclonal (Biogenes, Berlin, Germany; Henn et al., 2004, supra) antibodies
at a 4
g ml-1 or 5-10 l/ml of lysate dilution, respectively. Monoclonal antibodies
against
human RIa, RIIa and RII(3 (Transduction laboratories) were used at a 0.5 g ml-
I
dilution for Western blotting. Polyclonal antibodies against human Ca (Santa
Cruz
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-62-
Biotechnology), Calsequestrin (Upstate), Serca2a and IP3R-II (Santa Cruz) were
used at a 1 gg m1"1 dilution for Western blotting. Monoclonal antibodies
against RyR
(Affinity BioReagents) and PLB (Upstate) were used at a 1 g m1"1 dilution for
Western blotting. Polyclonal antibodies against phospho-PLB (Badrilla), GST
(Amersham Pharmacia Biotech) and Biotin (Abcain) were used at a 1:5000
dilution
for Western blotting. HRP-conjugated anti-mouse or anti-rabbit IgGs were used
as
secondary antibodies at a 1:5000 dilution (Jackson Imnzunoresearch).
Monoclonal mouse antibodies directed against a-actinin (clone EA-53) were
purchased from Sigma, against SERCA2a (clone 2A7-Al) from Alexis
Biochemicals. An anti-phospho-phospholamban serine 16 antibody was from
Upstate Technolgy.
Cell cultures and transient transfections. The human keratinocyte cell line
HaCaT
was cultured in serum-free keratinocyte medium (Gibco BRL) supplemented with
2.5 ng/ml epidermal growth factor, 25 g/m1 bovine pituitary extract, 100
g/ml
streptomycin and 100 U/ml penicillin in a humidified atmosphere of 5% CO2. The
cell line was regularly passaged at sub-confluence and plated 1 or 2 days
before
transfection. HaCaT cells at 50-80% confluency were transfected with 5 g of
plasmid DNA (PLB-YFP, AKAP 18S-GFP), by using lipofectamin 2000
(Invitrogen), loaded with arginine coupled SuperAKAP-IS peptide (Lygren et al,
unpublished data) for 12 hours, before being stimulated and lysed after 30
hours in
lysis buffer (20 mM Hepes, pH 7.5, 150 mM NaCI, 1 mM EDTA, 1% Triton X-100)
witll protease inhibitors (Complete Mini, EDTA-free tablets, Roclie).
Immunoprecipitation from SR lysate. SR lysate was incubated with antibodies
and protein A agarose beads (Invitrogen) ON at 4 C. Immunocomplexes were
washed three times in lysis buffer (20 mM Hepes, pH 7.5, 150 mM NaCI, 1 mM
EDTA and 1% Triton) before being resolved by SDS/PAGE and detected by
immunoblotting.
cAMP pulldown. SR fraction was subjected to cAMP pulldown experiment using
Rp-8-AHA-cAMP agarose beads (antagonist that does not dissociate PKA, Biolog)
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
- 63 -
in homogenate buffer (20 mM Hepes pH 7.4, 20 mM NaC, 5mM EDTA, 5 mM
EGTA, 0.5 % Triton X-100, 1 mM DTT, protease inhibitor). PKA-complexes were
washed four times in washing buffer (10 mM Hepes pH 7.4, 1.5 mM MgC12a 10 mM
KCI, 0.1 % NP-40, 1 mM DTT, protease inhibitor) before being eluted with 75 M
cAMP.
Overlays. Interaction of spotted peptides with AKAP 18S-GST, GST, PKA-C or
biotin-PLB peptide was tested by overlaying the membranes with 1 g/ml of
recombinant protein or 2 g/ml peptide in TBST. Bound recombinant proteins
were
detected witli anti-GST or anti-biotin. The procedure and detection of signals
is
identical with immunoblot analysis (see above).
Heart subcellular fractionation. (Modification of Kapiloff et al, 2001,
supra). Two
rat hearts (Pel-freeze) were disrupted using a mortar in 20 ml Buffer B(10 mM
Hepes, pH 7.4, 1 g/ml pepstatin,l g/ml leupeptin, 1 mM AEBSF, 1 mM
benzamidine, 5 mM EDTA) with 0.32 M sucrose. Whole heart homogenate was
filtered through cheesecloth, before low-speed centrifugation at 3800 g for 20
minutes. The supernatant fraction (S 1) was re-centrifuged at 100,000 g for 1
hour.
The resulting pellet (P2 fraction), containing SR, Golgi apparatus and plasma
membrane, was resuspended in 2 ml buffer B and 0.32 M sucrose. Purified SR was
obtained from the P2 fraction by sucrose step gradient centrifugation (8 parts
24%, 6
parts 40%, 2 parts 50% sucrose in 5 mM Hepes buffer) at 100,000 g for 90
minutes.
Purified SR forms a layer at the interface between 24% and 40% sucrose.
Peptides.
PLB-Arg, RRASTIEMPQQ-Argl 1
Biotin-PLB, biotin-MEKVQYLTRSAIRRASTIEM
S-PLB-1, stearic acid-VQYLT RSAIR RASTI EMPQQ ARQNL Q-NH2
SuperAKAPIS-Arg, Argl I -QIEYVAKQIVDYAIHQA
(see U.K. patent application No. 0421356.7 filed on September 24, 2004, supra)
L314E, stearic acid- PEDAELVRLSKRLVENAVEKAVQQY-NH2
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-64-
AKAP 18d-PP, stearic acid PEDAELVRLSKRLPENAPLKAVQQY-NH2
(patent application filed with the German authorities (DE 10 2004 031 579.5:
Peptide zur Inliibition der Interaktion von Proteinkinase A und Proteinkinase
A-
Ankerprotein - peptides for inliibition of the interaction of protein kinase A
and A
kinase anchoring proteins). PCT application will be filed 2 a September 2005)
RNA; directed against AKAP188. Oligonucleotides encoding RNAi for selective
knockdown of AKAP 188 (derived from bp 18-3 8 of the AKAP 186 cDNA, RNAi
AKAP18S, sequence see below) was cloned into the Block-it inducible H1
lentiviral
RNAi system, Version B (Invitrogen, Karlsruhe, Germany). For this purpose an
inducible RNAi entry vector was generated as follows: The oligonucleotide
sequences listed below were annealed to form double stranded oligonucleotides
(ds
oligo) and cloned into the vector pENTRm/H 1/TO as in the manufacturer's
instructions. LacZ2.1 oligonucleotides were provided by the manufacturer for
use as
a control. All other oligonucleotides were ordered from Biotez (Berlin,
Germany).
RNAi AKAP 188 caccgggagaaatagatgccaataacgaattattggcatctatttctccc
aaaagggagaaatagatgccaataattcgttattggcatctatttctccc
RNAi LacZ2.1 caccaaatcgctgatttgtgtagtcggagacgactacacaaatcagcga
aaaatcgctgatttgtgtagtcgtctccgactacacaaatcagcgattt
The RNAi AKAP 18S-encoding entry vector is suitable for expression in
mammalian
cells. In order to test its efficiency in knockdown of AKAP 188 Fluorescence
Activated Cell Sorting (FACS) analysis was performed. HEK293 cells were plated
into 12 well plates and co-transfected at 30-50% confluency using Transfectin
reagent (Bio-Rad Laboratories, Munich, Germany) with the vector and the vector
YFP-AKAP 186 or vector pEYFP-C 1(encoding YFP only) according to the
manufacturer's instructions. All transfections were performed in duplicate.
The cells
were then trypsinised and collected in 1% BSA. After 48 h the cells were
subjected
to FACS analysis (FACSsCalibur; Becton and Dickinson).
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-65-
A pLenti-based expression vector was created as follows: The HI/TO RNAi
cassette
from the pENTRTM/H 1/TO vector was transferred into the pLenti4/BLOCK-iTTM-
DEST vector via LR recombination. A control vector pLenti4-GW/H1/TO-
laminSWNA expressing an shRNA targeting the Lamin A/C gene was provided in the
kit. The pLenti4/BLOCK-iTTM-DEST expression construct and the ViraPowerTM
Packaging Mix were co-transfected into the HEK293FT cell line to produce a
lentiviral stock. All steps were performed as in the manufacturers
instructions.
In addition to the AKAPI8S-selective RNAi, RNAi directed against both AKAP18S
and AKAP 1&y was generated:
RNAi303 (Pos. 303-321 of AKAP188 cDNA)
303: aaagattacagctggaatt
RNAi700 (Pos. 701-720)
701: ccaatgctctggaagaagg
Cardiac myocyte preparation. Ventricles were isolated from 1-3 day old Wistar
rat
hearts enzymatically digested at 37 C using 0.48 mg/ml collagenase type II
(Biochrom AG, Berlin, Germany) and 0.6 mg/ml pancreatin (Sigma, Deisenhofen,
Germany) and suspended in a mix of 4:1 DMEM:M199 media supplemented with
10% horse serum (Invitrogen, Gibco) and 5% fetal calf serum (Invitrogen,
Gibco),
and were plated for 1 h on tissue culture plates to deplete fibroblasts. The
non-
adherent myocytes were plated on 1%(w/v) gelatin pre-coated plates or glass
cover
slips pre-coated with 0.5 mg/ml Laminin (Roche, Mannheim, Germany). After 24
hs, the medium was changed to low serum medium (DMEM:M199) containing 4%
horse serum.
Calcium imaging. Rat neonatal cardiac myocytes were prepared on laminin coated
glass coverslips (see above). Cells were incubated with the above listed
peptides S-
PLB-1 derived from PLB (50 M, 30min, 37 C). The cells were then loaded with
1 M Fluo-4, AM (Molecular Probes, Groningen, The Netherlands) and further
incubated at 37 C for 10 min. The glass cover slips were transferred to a
chamber
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-66-
containing Tyrodes solution. Line scans were performed at LSM5 10 (1 line scan
per
20 ms for 10000 line scans). Isoproterenol (Sigma) was added to the chamber as
indicated,
Immnnohistocheniistry. Rats (R. noti~egicus) were sacrificed; the left
ventricles of
the hearts were removed and cut into smaller fragments using a razor blade.
The
tissue was shock frozen in liquid nitrogen. It was embedded in Tissue
Embedding
Medium (Jung, Tissue freezing medium, Leica Instruments GmbH, Nussloch,
Germany) mounted in the cryostate and cut into sections (4 m; Cryostate CM
3000
from Lyeka) using a D-knife. While cutting the tissue temperature was -20 C,
room
temperature in the cryostate was -16 to -18 C. Sections (3 or 4) were
transferred
from the knife to each glass slide (Menzel, Superfrost Plus), and fixed with
2.5%
paraformaldehyde in sodium cacodylate buffer (100 mM sodium cacodylate and 100
mM sucrose, pH 7.4) for 30 min. After three washes with phosphate-buffered
saline
(PBS), cells were permeabilized in PBS containing 0.1 % Triton X-100 for 5 min
and
rewashed three times. Blocking was carried out in blocking solution (0.3 m145
%
fish skin gelatine/100 ml PBS) in a humidifying chamber by incubation for 45
min
at 37 C. After three washes with PBS (10 min each wash), antibody diluted in
blocking solution (30 l) directed against a-actinin (1:100), PKA RIIa
subunits,1:100), SERCA2a (1:100), phospholamban (1:50), mouse IgG2a (1:50),
anti-AKAP 18 antibodies A18S3 and A18S4 (1:100 each) or combinations of the
antibodies were added. The slides were incubated in a humidifying chamber by
incubation for 45 min at 37 C. The slides were washed three times (10 min each
wash) with cold PBS, and subsequently incubated in a humidifying chamber for
45
min at 37 C with Cy3-conjugated anti-rabbit IgG or anti-mouse Cy5-conjugated
secondary antibody (1:600 each).
Coverslips were mounted with a mixture of glycerol (70%) and PBS (30%). 1,4-
Diazabicyclo[2.2.2]octane (DABCO) (Sigma; 100 mg/ml) was added to reduce
photobleaching (Oksche et al:, 1992). Alternatively, Immu-Mount (Thermo
Shandon, Thermo Electron Corporation, Dreieich, Germany, cat. no. 9990402) was
used for mounting according to the manufacturer's instructions. Samples were
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-67-
visualized by confocal microscopy on a Zeiss laser scanning microscope LSM 510
(Zeiss, Jena, Gerrnany).
Immunoprecipitation from adult rat heart tissue and Western blotting.
Phospholamban was immunoprecipitated witli specific antibodies (see above) or
co-
immunoprecipitated with anti-AKAP 18 antibodies 1964 and A18S4 (see above)
from adult rat heart tissue (see above; Henn et al.). As a control,
precipitations were
carried out with the corresponding rabbit preimmune sera and mouse IgG.
Precipitates were analyzed by Western blotting.
The lower side of the left ventricle of fresh rat heart was lysed in lysis
buffer (2-5
ml; 20 mM HEPES, 150 mM NaCI, 1 mM EDTA, 0,5 % Tween 20, pH 7.5)
containing 8 gl/ml protease inhibitor stock solution (2 mg/mi soybean trypsin
inhibitor, 1.43 mg/ml Trasylol (aprotinin), 100 mM Benzamidine, 500 M
Phenylmethanesulfonyl fluoride (PMSF); Asahi et al., 1999, J. Biol. Chem.,
274,
p32855-32862).
Samples (1 ml each) were homogenized in a glass/teflon homogenizer (10
strokes,
1250 rpm) and centrifuged (24,000 x g, 20 min, 4 C). Supernatants were
collected
and at least 10 l were retained as controls for Western Blotting. Protein A-
suspension (25 l/ml) and antibody (anti-phospholamban, mouse IgG2a, each
1 l/lml of lysate; A1864 or 1964 each 5-l0 l/lml of lysate; preimmune serum
corresponding to A1864, 5-10 1/ml of lysate) were added. The samples were
rotated
overnight at 4 C, and subsequently washed 4 times with 200 l lysis buffer.
The
washing included centrifugations of 30 s at 1,000 x g. Sample buffer (3 x)
containing 1,4-Dithio-DL-threitol (DTT) was added and the samples were
analysed
by SDS-PAGE and Western blotting.
Western blotting was carried out as described (Tamma et al., 2003, J. Cell
Sci., 116,
p3285-3294; Henn et al, 2004, supra). Phospholamban was detected using mouse
antibody (see above; 1:2,000 dilution). As a control, mouse IgG2a were used
(1:2,000 dilution). Bound primary antibodies were visualized with
corresponding
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-68-
secondary horseradish peroxidase-conjugated anti-mouse antibodies (see above;
1:2,000 dilutions for all) and the Lumi-Imager Fl (Roche Diagnostics,
Mannheim,
Germany).
Immunoprecipitation of AKAP186-YFP and PLB-CFP from HEK293 cells.
HEK293 cells were grown in petri dishes (40 mm diameter) and transfected with
plasmids encoding AKAP 188-YFP, PLB-CFP or with both using TransFectin Lipid
Reagent (Bio-Rad) according to the manufacturer's instructions. Cells were
lysed for
IP after 24h of transfection. The cells were washed 4 times with PBS prior to
addition of lysis buffer (10 mM K2HPO, 150 mM NaCI, 5 mM EDTA, 5 mM
EGTA, 0,5% Triton X 100, pH7.5; lml/dish) containing protease inhibitors (see
above). Cells were collected using a cell scraper and briefly shaken
vigorously
(vortex). The lysates were centrifuged (12,000 x g, 10 min, 4 C). The
supernatant
was collected. An aliquot (10 l) was withdrawn and served' as control for
Western
Blotting. Antibodies (phospholamban, mouse IgG2a, A18S4 and the corresponding
preimmuneserum were used as described for immunoprecipitations from adult rat
heart) and 25 l/ml protein A-suspension (see above) were added. The samples
rotated overnight at 4 C, were washed 4 times with 200 l lysis buffer (with
centrifugation steps of 30 s, 1000 x g). Sample buffer (3 x) and DDT were
added
and the samples were applied to SDS-PAGE and Western blot analysis.
SiRNA
SiRNA sequences used for the experiment in Fig. 32 are:
AKAP185: 5' GGG AGA AAU AGA UGC CAA UAA 3'
5' AUU GGC AUC UAU UUC UCC CGC 3'
control: 5' GGG ACA AAU ACA UGG CAA UAA 3'
5' A UUG CCA UGU AUU UGU CCC GC 3'
Immunogold electron microscopy
Immunogold electron microscopy was carried out as described (Henn V, et al. J.
Biol. Chem. 279:26654-26665, 2004). Hearts were obtained from neonatal rats,
fixed (0.25 % glutaraldehyde, 3 % formaldehyde), cryosubstituted in a Leica
AFS
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-69-
freeze-substitution unit and embedded in LR-White. The samples were
sequentially
equilibrated over 4 days in methanol at temperatures gradually increasing from
-90
C to -45 C. The samples were infiltrated witli LR-White for 72 h at -20 C,
and
polymerised for 1 h at -20 C and 2 h at 4 C. Sections (60 nm) were cut on a
Reichert Ultracut S, placed on nickel grids and blocked with glycine.
The sections were incubated with mouse anti-PLB (ABR, Affinity Bioreagents,
Dianova, Hamburg Germany) and goat anti-SERCA2 antibody (ABR, Affinity
Bioreagents, Dianova). The sections were washed with PBS and incubated with
anti-
mouse antibody and anti-goat antibody coupled to 15 and 10 nin gold grains,
respectively. Co-staining of PLB and AKAP188 was perfomied with primary mouse
anti-PLB and affinity-purified rabbit anti-AKAP18 8(Henn V, et al., 2004,
supra)
antibodies. As secondary antibodies anti-mouse and anti-rabbit secondary
antibodies
coupled to 10 and 15 nm gold grains were used. For co-staining of SERCA2 and
AKAP 18S mouse anti-SERCA2 (ABR, Affinity Bioreagents, Dianova, Hamburg
Germany) and affinity-purified rabbit anti-AKAP 18 S antibodies were employed.
As
secondary antibodies anti-mouse 10 nm gold grain-coupled and anti-rabbit 15 nm
gold grain-coupled antibodies were utilized. All primary antibodies were 1:100
diluted. All secondary antibodies were from Dianova and applied in 1:20
dilutions.
The sections were stained with uranyl acetate and lead citrate. The sections
were
analysed with a 80 kV electron microscope (902A, LEO, Obercochem, Germany)
equipped with a slow scan CCD camera (Megaview III, Soft Imaging System,
Germany) and the analySIS software (Soft Inlaging System).
EXAMPLE 1 - Identification of RII-binding proteins in sarcoplasmatic
reticulum.
Adult rat hearts were fractionated for comparison of the constituents of
different
membrane compartments (Kapiloff et al., 2001, supra). SR fractions were
prepared
from the P2 fraction (described in methods) by sucrose gradient centrifugation
(sedimentation), followed by analysis on a 4-20% PAGE and blotting onto PVDF
membrane. Fractions 4-13 were analysed for RII binding proteins by R-overlay.
32P-
labelled RII binding was detected in absence (Figure 1, upper panel) or
presence
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-70-
(lower panel) of 500 nM Ht31 anchoring inhibitor protein and signals were
detected
by autoradiography. Three bands of 50-kDa, 130-kDa and 200-kDa were positive
in
the SR fractions (no. 9-12) after 12 hours exposure. The 200-kDa protein
corresponds probably to mAKAP and the 130 kDa to a degradation product
thereof.
The 50-kDa protein corresponds to the new RII binding protein. Calsequestrin
which
is a major Ca2+ binding protein of SR was used as an SR marker and indicator
for
the quality of the fractions (lower panel).
EXAMPLE 2- Identification of a RII binding protein in the AKAP188
immunoprecipitate
A 50-kDa RII binding protein was identified in the AKAP18S immunoprecipitate
by
R-overlay (Figure 2).
EXAMPLE 3 - Identification of AKAP188 in sarcoplasmic reticulum.
Adult rat hearts were fractionated as described in Example 1 and followed by
analysis on a 4-20% PAGE and blotting onto PVDF membrane. A 50-kDa band
was recognized by the AKAP18S antibodies in SR (Figure 3, uppermost panel),
but
not if the antibody was preincubated with the peptide used for inununisation
(second
panel). PKA type II (RIIa and RIIp), PKA type I(RIIcx ) and PKA catalytic
subunit
were also present in the SR fractions. Molecular weight standards are
indicated at
left (Benchmark, Invitrogen).
EXAMPLE 4 - Identification of PLB and different Ca2+ channels in SR
fractions
Adult rat hearts were fractionated as described in Example 1 and followed by
analysis on a 4-20% PAGE and blotting onto PVDF membrane. The presence of the
Ca2+-activated Ca2+ release channels ryanodine receptors 2 (RyR2) (Figure 4,
uppermost panel) and Ins(1,4,5)P3 receptor (IP3R) (second upper most panel),
the
ATP-dependent Caz+ pump (SERCA2a) (second lower most panel) and pentamer
and monomer forms of phospholamban (PLB) (lower panel) was identified in SR
using different monoclonal and polyclonal antibodies against the proteins
indicated.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-71-
EXA.MPLE 5- AKAP185 co-localizes with phospholamban and SERCA2a at
T-tubules in cardiac myocytes.
Left ventricles of adult rat hearts were cut into sections (4 M) and mounted
on
slides. The cells were fixed and permeabilized. AKAP 185 was detected using
the
anti-AKAP 18 8-selective antibody A1884. The indicated proteins a-actinin,
RIIa
subunits of PKA, SERCA2a, pliospholamban (PLB) were detected with specific
primary antibodies. The results are shown in Figure 5. Primary antibodies were
visualized by using Cy3- (red) and Cy5- (green) conjugated secondary
antibodies.
Fluorescence signals were detected by laser scanning microscopy. The overlay
of
Cy3 and Cy5 fluorescence signals is shown in the merge image. Yellow colour
indicated co-localization of the two proteins stained in the image. Magnified
views
from each merge image were taken from the indicated regions. The right panel
shows a quantitative analysis of fluorescence signals obtained by scanning the
images perpendicularly to the striated staining pattern. The different lines
(originally
in red and green) depict Cy3- and Cy5 fluorescence signals, respectively.
EXAMPLE 6- Colocalization of AKAP186 with a-actinin in SR in rat neonatal
cardiac myocytes
Neonatal cardiac myocytes were fixed, permeabilized and stained for a-actinin
and
AKAP18S using specific antibodies and secondary Cy3- and Cy5-conjugated
antibodies, respectively (see Figure 6).
EXAMPLE 7- Identification of an AKAP186-PKA complex in SR by cAMP
pull down
A cAMP pull down experiment using Rp-8-AHA-cAMP agarose beads (an
antagonist that does not dissociate PKA) to identify proteins coprecipitating
with
PKA from SR lysate was performed. The eluate was analysed on a 4-20% PAGE
and blotted onto PVDF membrane. The catalytic and regulatory subunits of the
PKA
holoenzyme were detected by immunoblotting using specific polyclonal and
monoclonal antibodies. Presence of the C subunit was a positive control for
the
experiment. The results are shown in Figure 7. An approximately 50-kDa protein
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-72-
was recognized by AKAP 186 polyclonal antibodies in the eluate. SERCA2a was
identified in the eluate by using specific antibodies against SERCA2a.
EXAMPLE 8- Coimmunoprecipitation of PLB with AKAP185 from SR
fractions
Immunocomplexes from SR using an AKAP 188 antibody was analysed on a 4-20%
PAGE and blotted onto PVDF membrane. PLB binding was detected by
immunoblotting using a monoclonal antibody. Both PLB as monomer
(approximately 5-kDa) and pentamer (25-kDa) coprecipitated with AKAP 185 (see
Figure 8).
EXAMPLE 9- AKAP186 interacts with phospholamban.
Left ventricles of adult rat hearts were subjected to immunoprecipitation
using
antibody 1964 directed against all members of the AKAP 18 family (AKAP 18a, P,
Y
and S, the corresponding preimmune serum, anti-phospholamban (PLB), anti- a -
actinin and control IgG (IgG2a, see materials and methods) antibodies (Figure
9). As
a control, lysates prior to immunoprecipitation were applied. PLB was detected
by
Western blotting.
EXAMPLE 10 -Identification of the AKAP188 binding site in PLB
The whole native PLB sequence was synthesized as 20-mer peptides (with 3 amino
acid offset) on membrane (MultiPep, Intavis AG) and AKAPI8S binding was
analysed by GST-AKAP 18S-overlay. The AKAP 188 binding sequence was
identified in the N-terminus of PLB. The AKAP 185 core binding sequence is
underlined and peptides are in bold (Figure 10).
In a second experiment, the PLB (7-26) peptide was synthesized witli or
without a
phosphorylated serine (pS) in position 16 and AKAP 186 binding was analysed by
overlay. AKAP188 was not able to bind to PLB(7-26) containing a phosphorylated
serine residue (mimicking PKA phosphorylated PLB), see lower 3 panels.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-73-
EXAMPLE 11- Characterization of the AKAP188 binding site by proline and
alanine substitutions.
Native PLB sequence (10-29 aa) (20-mer) and peptides with a proline in each
position from 10 to 29 in the sequence were syntliesized on a membrane
(MultiPep,
Intavis AG) and AKAP 188 binding was analysed by overlay (Figure 11, upper
panel
at left). Proline substitutions in the PLB sequence in position R13, R14 or
R25
disrupted the AKAP 18 binding, indicating that amino acids in these positions
are
important for binding. It is noteworthy that R13 and R14 are within the PKA
phosphorylation site (RRAS).
Native PLB sequence (7-26 aa) (20-mer) and peptides with a proline in each
position from 7 to 26 in the sequence were synthesized on a meinbrane
(MultiPep,
Intavis AG) and AKAP 186 binding was analysed by overlay (Figure 11, upper
panel
at right). Proline substitutions in the PLB sequence in position A15, S16,
T17, 118,
E19, M20, P21, Q22, Q23, A24, R25 and Q26 disrupted the AKA.P18 binding,
indicating that amino acids in these positions are important for binding.
Native PLB sequence (13-23) (11 -mer) and peptides with a proline substitution
in
each position from 13-23 were synthesized on a membrane (MultiPep, Intavis AG)
and AKAP18S binding was analysed by overlay (lower panel at left, proline
scan).
Proline substitutions in the PLB sequence in position R13, R14, A15, S16 or
Q23
disrupted the AKAP 186 binding, indicating that amino acids in these positions
are
important for binding in the 11-mer peptide. Proline substitution in position
T17,
118, E19, M20 or P21 restored and even increased the AKAP188 binding to PLB
(13-23). These amino acids (17-21) lie within the identified hinge region
between
the two helix domains in PLB (Zamoon et al., 2003, Biophysical J., 85, p2589-
2598). Thus, by introducing the helix-breaking amino acid proline into this
region,
the AKAP186 binding is increased. The bar diagram at the right shows the
relative
affinity of the PLB derivatives with a higher affinity than the PLB wild-type
sequence. These include the following substitutions, I18P, E19P and M20P.
Native PLB sequence (7-26 aa) (20-mer) and peptides with an alanine in each
position from 7 to 26 in the sequence were synthesized on a membrane
(MultiPep,
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-74-
Intavis AG) and AKAP188 binding was analysed by overlay (Figure 11, alanine
scan, left panel). Alanine substitutions in the PLB sequence in position R9,
R13,
R14, P21, Q22, Q23 and R25 disrupted the AKAP18S binding, indicating that
amino
acids in these positions are important for binding. Alanine substitutions in
the hinge
region (17-20) showed a somewhat increased AKAP188 binding. Double alanine
substitutions (panel at right) in the PLB sequence in positions T8 and R9, R9
and
S10, 112 and R13, R13 and R14, R14 and A15, M20 and P21, P21 and Q22, Q22
and Q23, Q23 and A24, A24 and R25, R25 and Q26 disrupted or reduced the
AKAP18S binding, indicating that amino acids in these positions are important
for
binding.
EXAMPLE 12 - Epitope mapping of the monoclonal PLB antibody
The whole native rat PLB sequence (1-52 aa) was synthesized on a membrane as
20-
mer peptides (MultiPep, Intavis AG) and the recognition sequence/epitope for
the
monoclonal PLB antibody was identified by immunoblotting (Figure 12). The
epitope was identified within the N-terminus of PLB and is overlapping with
the
AKAP188 binding region. This finding indicates that immunoprecipitation using
the
monoclonal PLB antibody will only be able to precipitate unbound PLB (which is
consistent with our other data not shown).
The epitope for the monoclonal PLB antibody was mapped to the same region in
the
native human PLB sequence as well (data not shown).
EXAMPLE 13 -PLB derivated anchoring disruptors (20-mers)
The PLB (7-26) sequence was further analysed for AKAP188 binding by a two-
dimensional array (Figure 13). A two dimensional peptide array of 400 PLB
derivatives (spotted as 20-mer peptides) in which each residue in the PLB
sequence
(given by their single-letter codes above the array) was replaced with
residues
having every possible side chain (given by their single-letter codes to the
left of the
array). The two first rows correspond to the native PLB sequence. The PLB
derivatives were analysed for AKAP 188 binding using a recombinant and
purified
GST- AKAP 185 protein. Binding was detected by immunoblotting. Substitutions
of
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-75-
R13 and R14 generally decreased the AKAP186 binding. It is noteworthy that
AKAP185 bound to the PLB (R9C).
EXAMPLE 14 -PLB derivated anchoring disruptors (13-mers)
A shorter peptide of PLB (9-21) containing the AKAP 188 binding site was
analysed
for binding by a two dimensional peptide array of 260 PLB derivatives (spotted
as
13-mer peptides) as described in Example 13. The two-dimensional peptide array
of
the smaller PLB peptide was much more discriminating than the array of the 20-
mer
described in Example 13 (see Figure 14). Substitutions of R9, R13 R14 and E19
almost abolished the AKAP18S binding, indicating the importance of the amino
acids in these positions.
EXAMPLE 15- AKAP186-PLB dynamic binding
The PLB (13-23), PLB (7-26) and PLB (7-26) (R9C) peptides were synthesized
without and with a phosphorylated serine residue in position 16 (mimicking PKA
phosphorylated PLB) on a membrane (MultiPep, Intavis AG) and AKAP 188 binding
was analysed by overlay and immunoblotting. AKAP 188 bound to the three PLB
peptides with an unphosphorylated serine but no AKAP18S binding was observed
to
PLB when serine was phosphorylated (Figure 15). Thus, the AKAP18S binding
seems to be dynamic and regulated by the PKA phosphorylation status of serine.
EXAMPLE 16 -PKA-C subunit blocks the AKAP186 binding to PLB.
Three PLB peptide sequences containing the AKAP 185 binding domain (PLB (5-
24), PLB (7-26), and PLB (9-28) with and without the R9C mutation) (two lower
most panels) were synthesized in triplicates. PKA-C subunit was incubated with
the
membranes (left panels, Figure 16) two hours before the AKAP 188 binding was
analysed by a second overlay using GST-AKAP 185. AKAP 186 was able to bind all
three peptides in presence of the C subunit (upper most panel). However, no
AKAP 188 binding was observed when the peptides containing the R9C mutation
(two lower most panels) was pre-incubated with the C subunit (second lower
most
panel). PKA-C is reported to be trapped in PLB(R9C) by Schmitt et al., 2003,
Science, supra) and our data shows that trapped C blocks the AKAP 185 binding
to
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-76-
PLB. AKAP188 did not bind to PLB or PLB (R9C) wlien serine was
phosphorylated indicating a dynamic binding (second and last panel).
EXAMPLE 17- Inhibition of the PKA phosphorylation of PLB by the
anchoring disruption peptide, super-AKAP-is.
The PLB-AKAP I 8-PKA complex was reconstituted in HaCat cells by transfecting
the cells with PLB-YFP and AKA.P188-EGFP. Approximately 16 hours after the
transfection, the cells were treated with the high affinity anchoring
disruption
peptide, super-AKAP-is, for 24 hours, and thereafter stimulated with
forskolin. The
total cell lysate was analysed on a 4-20% PAGE and blotted onto PVDF membrane
(Figure 17). The phosphorylation level of PLB was detected using a antibody
against PLB (Ser16). Upon forskolin stimulation and no super-AKAP-is, the
level of
phosphorylated PLB was increased (left panel). Phosphorylated PLB was hardly
detectable in cells treated with super-AKAP-is although the cells were
stimulated
with forskolin (right panel). Disruption of the AKAP 185-PKA interaction by
super-
AKAP-is abolished the phosphorylation of PLB by endogenous PKA. The presence
of AKAP 188-EGFP was detected using anti-GFP.
EXAMPLE 18 - Defective Ca2+ re-uptake in the sarcoplasmic reticulum in
neonatal cardiac myocytes after treatment with the RRASTIEMPQQ-Argll
peptide
Neonatal cardiac myocytes were transfected with the FRET-based Ca2+ sensor
cameleon targeted to the SR and the response to a 10 mM caffeine pulse (1s,
arrow)
was recorded in control cells (filled squares) or cells pre-treated with 50 gM
of
RRASTIEMPQQ-Arg11 for 40 min and/ or Ne 10 mM and IBMX 100 mM for 20
min, as indicated (Figure 18).
Neonatal cardiac myocytes treated with the anchoring disruption peptide,
RRASTIEMPQQ-Argl l, had a reduced Ca2+ re-uptake in the sarcoplasmic reticulum
both at basal level and after stimulation with Ne and treatment with IBMX. The
peptide, RRASTIEMPQQ-Argl l disrupts the PLB-AKAP 188 interaction and
thereby, is delocalize the AKAP-PKA complex from the PLB-SERCA2a complex.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-77-
EXAMPLE 19 - A higher time constant is observed in neonatal cardiac
myocytes treated with the RRASTIEMPQQ-Argll peptide
The averages of time constant i, calculated by fitting the recovery phase in
the curve
of Ca2+ re-uptake as shown in Figure 18 by using the exponential function f(t)
Eni=1 Ai e-t/ti + C (Figure 19). For each sample n> 20 independent cells were
used. * p = 0.02, ** p = 0.001, *** p< 6.16226e-10 , Student's t-test. The
time
constant was higher for cells treated with the peptide both at basal level and
after
stimulation (NE-IBMX).
EXAMPLE 20 - Extreme niinimal AKAP188 binding region in PLB
The PLB (7-26) peptide and truncations thereof was synthesized on membrane
(MultiPep, Intavis AG) and AKAP18S binding was analysed by overlay and
immunoblotting (Figure 20).
A minimal AKAP 186 core binding region was identified and includes the amino
acid sequence; RRASTIE.
EXAMPLE 21- Enhanced PKA type II signaling pathway
A high affinity PKA type II or PKA type I binding sequence, such as e.g. super-
AKAP-is or MEME3 (LEQYANQLADQIIKEATE), can be coupled to the SR
targeting domain of PLB. Such a construct will target PKA type II or type I,
respectively, to SR with high efficiency and PKA will hyper-phosphorylate PLB
upon cAMP stimulation (Figure 21).
PLB(R9C) is reported to block PKA-mediated phosphorylation of wild type PLB by
trapping PKA into mutated PLB(R9C) (Schmitt et al., 2003, Science, supra). By
using a construct similar to that described above, the problem with hypo-
phosphorylation of PLB in PLB(R9C) should be overcome.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-78-
EXAMPLE 22- Disruption of PKA anchoring in cardiac myocytes prevents (3-
adrenoreceptor-mediated PKA phosphorylation of phopholamban
0-adrenoreceptor activation in cardiac myocytes induces PKA phosphorylation of
PLB and thereby the dissociation of PLB from SERCA2a. The dissociation
increases contractility of cardiac myocytes (positive inotropic, positive
chronotropic
and positive lusitropic effects). The increase in PKA-mediated phosphorylation
of
PLB is detectable in neonatal cardiac myocytes after (i-adrenoreceptor
stimulation
with isoprotenerol using a phospho-specific anti-phospholamban antibody
(phospho-
PLB Ser16). The PKA inhibitor H89 prevented the phosphorylation. In order to
test
whether the anchoring of PKA to AKAPs is a prerequisite for PLB
phosphorylation,
rat neonatal cardiac myocytes were incubated with the AKAP188-derived high
affinity membrane-permeable (stearic acid-coupled) PKA anchoring disruptor
peptide L314E. The peptide inhibited (3-adrenoreceptor agonist (isoprotenerol)-
induced PLB phosphorylation indicating that PKA anchoring to AKAPs is a
prerequisite for PLB phosphorylation (Figure 22).
EXAMPLE 23 - Knockdown of 18SYFP expression by RNAi confirmed by'
FACS analysis
In order to analyse the role of AKAP 188 in cardiac myocyte contraction, RNAi
(derived from bp 18-3 8 of the AKAP 186 cDNA, RNAi AKAP 185, sequence, see the
methods section) was established. AKAP 18S-selective RNAi was co-expressed
with
AKAPI8S-YFP or empty vector in HEK293 cells. FACS analysis of the cells
revealed a knockdown of AKAP18d by about 70 % (Figure 23).
EXAMPLE 24- Knockdown of 186YFP expression by RNAi confirmed by
western blotting and the sequence of the RNAi
The knockdown of AKAP 188 was also confirmed by Western blot analysis of the
cells (Figure 24). Therefore, the RNAi identified here represents a valuable
tool for
the functional analysis of AKAP18S. The RNAi AKAP18S sequence was derived
from bp 18-38 of the AKAP18S cDNA as described in the methods section.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-79-
EXAMPLE 25- Disruption of the AKAP188-phospholamban interaction in
neonatal cardiac myocytes slows Ca2+ reuptake into the SR
The functional role of the AKAP188-phospholamban interaction was tested by
disruption of the interaction in neonatal cardiac myocytes. The cells were
treated
witli a membrane-permeable peptide mimicking the interaction site of PLB (S-
PLB-
1). Ca2+ imaging by applying line scan analysis and a laser scazuiing
microscope
revealed that the peptide extended the relaxation period (Figure 25). This was
indicated by the extension of the time between two Ca2+ peaks in the presence
of S-
PLB-1. The 0-adrenoreceptor agonist isoprotenerol induced an increase in peak
frequency (measurements 10 and 35 seconds after addition of isoprotenerol).
Compared to resting condition the peak frequency also increased in the
presence of
the peptide. However, compared to the cells not treated with the peptide the
rise in
frequency was lower. The data show that the interaction of AKAP 1 8d and PLB
is
involved in the regulation regulation of Ca2+ reuptake into the SR, presumably
by
facilitating P-adrenoreceptor-mediated phosphorylation of PLB by PKA.
EXAMPLE 26 - Immunoprecipitation of AKAP188-YFP and PLB-CFP from
HEK293 cells
The AKAP186 specific antibody, A1884, imniunoprecipitated PLB from HEK293
cells expressing the fusion proteins AKAP 18S-YFP and PLB-CFP (Figure 26). The
preimmune serum corresponding to antibody 1964 did not precipitate detectable
amounts of PLB. Antibody A1884 precipitated a small amount of PLB. Taken
together, the data indicate that AKAP 188 and PLB form a complex inside the
cells.
EXAMPLE 27 - PLB binding site in AKA.P181i.
To identify the PLB binding site, rat AKAP188 sequence was synthesized on
membrane as 20-mers. The PLB binding domain was identified in a PLB overlay
experiment and was found to reside within the AKAP18S (181-257 aa) fragment
(dark shading) (n=2). The PLB binding domain was upstream of the PKA-RII
binding domain (indicated in light shading).
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-80-
EXAMPLE 28 - Knockdown of AKAP186 using RNAi303 and RNAi700.
In order to analyse the role of AKAP18S in cardiac myocyte contraction, RNAi
that
specifically targetted AKAP18S and RNAi that targetted both AKAP18S and
AKAP187 was developed. RNA;303 and RNA;700 (RNA;303 (Pos. 303-321 of
AKAP 186 cDNA) and RNA;700 (Pos. 701-720)) directed against both AKAP 188
and AKAP 18y knocked down expression of AKAP 185 in HEK293 transfected cells
(Figure 28). The RNAi identified here represent valuable tools for the
functional
analysis of AKAP18S.
EXAMPLE 29 - Purification of PKA - AKAP186 complex from adult rat heart
A cAMP pull down experiment using Rp-8-AHA-cAMP agarose beads (an
antagonist that does not dissociate PKA) and adult rat heart lysate was
carried out in
the absence (cAMP agarose) or presence of cAMP (control + cAMP). The eluate
was separated on a 12 % SDS-PAGE and blotted onto PVDF membrane. AKAP18S
was detected by inununoblotting using specific antibody A1884. As a positive
control recombinant AKAP 185 (rec. AKAP 185) was detected. The result is shown
in Figure 29.
EXAMPLE 30 - PLB-derived disruptor peptide in solution competes with
binding of PLB to AKAP188.
We identified the AKAP 186 binding site in the cytoplasmic part of PLB. The
cytoplasmic PLB (1-36) sequence was synthesized as 20-mer peptides with 2
amino
acid offset on a membrane and analyzed for AKAP 185 binding by overlay with
purified, recombinant GST-AKAP 188 protein, followed by anti-GST
immunoblotting (Fig. 30, left column). GST was used as a negative control for
the
overlay experiment (not shown). To evaluate the specificity of the assay, an
AKAP 18Fi-PLB disruptor peptide was included in the overlay (right column),
which
abolished binding. The AKAP 185 core binding sequence was defined to amino
acids
13-20 in PLB (Fig. 30, right). This motif is positioned at the end of domain
IA
(amino acids 1-16) and in the whole loop domain (amino acids 17-21) which is
within the hinge region between the two helical domains of PLB.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-81-
EXAMPLE 31 - PLB-derived disruptor peptide attenuates isoproterenol-
induced phospholamban Ser16 phosphorylation.
The isoproterenol-induced phosphorylation of PLB-Ser16 was analyzed in
presence
and absence of the disruptor peptide (Fig. 31). Neonatal cardiac myocytes were
incubated with or without the Arg9-PLB peptide (Arg9-RRASTIEMPQQ) for 30
min, and stimulated with 100 nm isoproterenol. The phosphorylation of PLB at
Ser16
clearly increased by (3-adrenergic stimulation (Fig 31, middle lane). The
presence of
the PLB-peptide inhibited the increase in phosphorylation by almost 50% (Fig.
31,
right lane). This indicates that AKAP 186 is necessary for recruitment of PKA
to its
target, PLB. In contrast, a scrambled control peptide Arg9-scramPLB (Arg9-
QAEMSITRPQR) used as negative control had little or no influence on the
phosphorylation level of PLB-Ser16 after stimulation (not shown).
EXAMPLE 32 - siRNA-niediated knock down of AKAP185 abolishes the
adrenergic stintulatory effect on Ca2+-reabsorption into sarcoplasmic
reticulum
To confirm the involvement of AKAP188 in the PKA/AKAP188/PLB/SERCA2
complex as a prerequisite for phosphorylation of PLB, we knocked down AKAP18S
using siRNA (see upper panel for efficacy of siRNA mediated knockdown as
tested
in HaCaT cells) and measured Ca2+ re-uptake. siRNA labeled with Cy3 flurochrom
was injected into cardiomyocytes together with the FRET-based Ca2+ sensor
YC6.2.
SR was emptied by placing the cells in a Ca2+-free solution and by blocking
SERCA2 with BHQ (a reversible inhibitor). Then, BHQ was washed away before
Ca2+ was added and CaZ+ re-uptake measured (Fig. 32). This demonstrates that
AKAP188 siRNA oligos abolished the effect of norepinephrine on Ca2+ re-uptake
in
the SR whereas control siRNA had no effect. These data indicate that AICAP18S
recruitment of PKA to a supramolecular complex containing PLB and SERCA2 is
important to discretely regulate PKA phosphorylation of PLB at Ser16 and
thereby
the PLB iiihibitory effect on SERCA2 and Ca2+ reuptake in heart sarcoplasmic
reticulum.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-82-
EXAMPLE 33 - Deletional mapping of the phospholamban binding domain in
AKAP188 by AKAP188 truncated proteins in peptide array overlay
experiments of phospholamban.
The PLB binding site in AKAP188 was delineated by deletional mapping and
interaction analysis by overlay of GST-AKAP18S truncated proteins on PLB
cytoplasmic part arrays (20-mer peptides, 2 amino acid offset) (Fig. 33A). GST-
protein was used as a negative control (not shown). Binding of various
constructs is
indicated (right, yes/no). This outlines amino acids 124 to 138 and amino
acids 201
to 220 as important for binding. To analyze these amino acids for PLB binding
in
situ, different AKAP 188 fragments were cloned into a mammalian expression
vector
and expressed in HEK293 cells together with PLB fused to GFP. GFP
immunoprecipitation demonstrated that AKAP 188 constructs covering amino acids
1-220 containing both binding regions and 1-138 containing the N-terminal
binding
region were co-immunoprecipitated with PLB-GFP. Notably, the AKAP18S 1-138
appeared to interact more weakly, suggesting that both domains might cooperate
in
binding in vivo.
EXAMPLE 34 - The AKAP188(PKA)/PLB/SERCA2 complex is present in
sarcoplasniic reticulum as assessed by by immunogold staining and electron
microscopy.
Immunogold staining using specific antibodies labeled with two different sizes
of
gold particles allowed for colocalization of the complex by electron
microscopy
(Fig. 34). As evident from the ultrastructure all three proteins localize on
stacks of
sarcoplasmic reticulum that are interspersed with the contractile machinery.
Furthermore, more than 20% of PLB and SERCA2 staining colocalized within 60
nm, more than 10% of the SERCA2 and AKAP186 colocalized and more than 12%
of the PLB and AKAP 186 colocalized within distances of less than 60 nm.
This analysis of the co-localization of AKAP 185, PLB and SERCA2 by
immunogold EM (Fig. 34) supports the finding of colocalization by
imniunofluorescence in heart tissue and provides a higher resolution.
CA 02621272 2008-03-04
WO 2007/028969 PCT/GB2006/003273
-83-
EXAMPLE 35 - Homology comparisons of rat and hunian AKAP18 splice
variants.
The binding region mapped using the different GST constructs is not unique for
the
delta isoform of AKAP18, but is also present in the AKAP18y isoform, see Fig
35
for alignment of rat AKAP 186 with the human sequence for AKAP 18y. The
sequence of PLB binding sites in human AKAP 188 are expected to be closely
related to those observed in human AKAP 18y. Thus preferably the binding sites
of
the binding partaier of the invention (when referring to AKAP 188) are the
regions of
human AKAP18y corresponding to ainino acids 61-181 (preferably 124-138) and/or
181-215 and/or 201-220 and/or 237-257 of rat AKAP18S.
