Note: Descriptions are shown in the official language in which they were submitted.
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
1
PROCESS FOR CULTURING BACTERIA OF THE PISCIRICKETTSIA GENUS
FIELD OF INVENTION
The present invention relates to the identification and culturing of
particular
isolates of bacteria belonging to the Piscirickettsia genus and to vaccines
based on
these bacterial isolates.
BACKGROUND OF THE INVENTION
A novel disease of fish, Salmonid rickettsia' septicemia (SRS), or
piscirickettsiosis,
was observed in 1989 among choho salmon, Oncorhynchus kisutch (Walbaum) in
Chile (Bravo & Campos 1989). The first signs of disease began 6-12 weeks after
fish were transferred from fresh water to sea water, and cumulative mortality
ranged from 30 to 90% (Bravo & Campos 1989). Anaemia caused by the systemic
spread and replication of an intracellular bacterium was the principal
characteristic
of the disease (Cvitanich, Garate &Smith 1991). The gram-negative
intracellular
bacterium was initially referred to as rickettsia-like (Fryer et al. 1990;
Cvitanich et
al. 1991) and was later grouped in the Gannmaproteobacteria and assigned to a
new genus and species Piscirickettsla salmonis by Fryer, Lannan, Giovannoni &
Wood (1992).
Some non-salmonid fish have been confirmed to be infected with P. salmonis;
white seabass from California, USA (Chen et al. 2000) and European seabass
(McCarthy et al. 2005).
In early studies, P. salmonis bacteria failed to grow on a number of
artificial
bacteriological media and the bacteria were thus considered to be obligate
intracellular organisms. It was observed, however, that the bacteria are able
to
propagate on a number of cell lines of salmon and non-salmonid origin, i.e.
CHSE-
214, CHH-1, CSE-119, TRG-2, EPC, and FHM (Cvitanich et al. 1991, Fryer et al.
1990 and 1992). More recent studies have shown that the bacteria have the
ability to replicate in Sf-9 insect cells (Birkbeck et al. 2004). The organism
is
capable of replication between 10-21 C . P. salmonis produces a cytopathic
effect
causing cytoplasmic vacuolation and rounding of infected cells. P. salmonis is
still
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
2
capable of reproducing the disease after nine passes in cell culture when
injected
into salmon (House et al. 1999).
Initial attempts to utilize whole cell bacterins to protect salmon from P.
salmonis
infection have shown variable results. In trials using formalin inactivated
bacterin
without adjuvant, Smith, etal. (1995 and 1997) demonstrated significant
protection to natural challenges with the bacterium, while fish receiving
adjuvant
and bacterin in the same trial showed no protection, or a greater
susceptibility to
infection. In other trials increased survival was observed when coho salmon
were
injected with whole cell bacterins in oil and water adjuvants (Kuzyk etal.
2001a).
However, better protection was observed with a vaccine prepared with
recombinant OspA alone or fused with T cell epitopes from tetanus toxin and
measles fusion protein (Kuzyk et al. 2001b). Although there are commercial
vaccines on the market today, piscirickettsiosis remains a major problem, in
particular in the South American sainnonid farming industry.
Bacteria similar to P. salmonis have, and probably will, continue to be
isolated
from a number of new fish species over a wide geographic range including in
more
temperate sea water conditions. Together with closely related bacteria, P.
salmonis may have a wide host and geographical range, which clearly suggests
that an efficient protection against infection with bacteria of the genus will
be
important for the fish farming industry.
However, with the current knowledge on processes for producing P. salmonis
antigen for vaccines against piscirikettsiosis, the manufacturers would solely
rely
on culturing the bacteria on suitable cell lines. This clearly provides
limitations for
large-scale production, since large-scale culture of P. salmonis in eukaryotic
cell
lines is laborious and expensive, and is not considered profitable for the
fish
industry.
Hence, an improved process for the production of P. salmonis antigen for
piscirickettsiosis vaccines would be advantageous, and in particular a more
efficient and cost effective process would be very useful for the providers of
vaccines for farmed fish.
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
3
SUMMARY OF THE INVENTION
A main aspect of the present invention pertains to a process for culturing a
bacterium belonging to the Piscirickettsia genus wherein said bacterium is
cultured in a substantially extracellular environment. A general feature of
the
process is the selection for bacteria that will reproduce in an extracellular
environment.
In a related aspect, the invention provides a process for producing a vaccine
comprising one or more steps of culturing a bacterium of the Piscirickettsia
genus,
wherein the bacterium is cultured in a substantially extracellular
environment.
Another aspect of the invention provides a process for obtaining a bacterium
belonging to the Piscirickettsia genus, which in some embodiments comprises
the
steps of:
a) providing a sample from a fish, which is infected with bacteria belonging
to
the Piscirickettsia genus;
b) inoculating into an essentially cell free culture medium bacteria from said
sample or dilution series hereof, or bacteria from a spread plate culture
established from said sample or dilution series hereof; and
c) selecting a bacterium that propagate freely in the medium.
Yet another main aspect of the invention provides a bacterium of the
Piscirickettsia genus, said bacterium having the ability to propagate in a
substantially extracellular environment. In some embodiments the bacterium may
be characterised as being one that is obtainable by the described process for
obtaining a bacterium belonging to the Piscirickettsia genus.
A further important aspect pertains to a vaccine comprising a bacterium
according
to the invention. In a related aspect the vaccine is provided in the form of a
feed.
Additional aspects of the invention relate to a bacterium according to the
invention or a subunit hereof for use in veterinary medicine.
, CA 02656032 2013-03-28
3a
Another aspect of the description provides a process for culturing a bacterium
of the species
Piscirickettsia salmonis comprising:
I. inoculating a culture medium with the bacterium;
II. subjecting the inoculated culture medium to conditions which allow
thebacterium
to multiply; and
III. harvesting the bacterium from the culture medium;
wherein the culture medium does not contain any host cells.
Yet another aspect of the description provides a process for producing a
vaccine comprising
i) a step of culturing a bacterium of the species Piscirickettsia salmonis,
comprising inoculating a culture medium with the bacterium, and subjecting the
inoculated
culture medium to conditions which allow the bacterium to multiply;
ii) harvesting the bacterium from the culture medium; and
iii) disrupting or inactivating the bacterium;
wherein the culture medium does not contain any host cells.
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
4
A still further aspect relates to the use of a bacterium according to the
invention
or a subunit of said bacterium in the manufacture of a medicament for the
prevention of infections with bacteria of the Piscirickettsia genus.
Finally, the invention provides a method for prevention of infections in fish
with
bacteria of the Piscirickettsia genus, said method comprising administering to
the
fish a vaccine according to the invention.
DETAILED DESCRIPTION OF THE INVENTION
Bacteria belonging to the Piscirickettsia genus, as represented by
Piscirickettsia
salmonis, have been identified as the causative agent of Salmonid rickettsial
septicemia (SRS), or piscirickettsiosis. The bacteria were believed to be
highly
fastidious obligate intracellular bacteria in agreement with the finding that
they
replicate within membrane-bound cytoplasmic vacuoles in tissue culture cells
or
those of the host fish. The present invention, however, is based on the
surprising
finding that it is possible to obtain isolates of bacteria of the
Piscirikettsia genus
that are capable of growing in an extracellular environment.
Based on this unexpected finding it was possible to provide a process where
bacteria belonging to the Piscirickettsia genus are cultured and harvested in
process steps and under conditions that favour bacteria which are capable of
growing in an extracellular or cell free environment. Thus, in its broadest
sense,
the invention therefore pertains to a process for culturing a bacterium
belonging
to the Piscirickettsia genus (Piscirickettsia spp.), and one of the advantages
of the
present process is that it comprises one or more steps during which bacteria
that
are capable of growing in an extracellular environment will be selected. In
the
process of the invention a selection pressure may be established by culturing
the
bacteria without any host cells or cells of non-mammalian origin or with a
number
of host cells that are considered inadequate to sustain intracellular growth
of a
sufficient number of bacteria. During the process, further steps selecting for
extracellular bacterial growth may be conducted. These may include harvesting
the cultured bacteria from the culture medium directly and under non-lysing
conditions, i.e. conditions that are not set to cause lysis of cells of non-
bacteral
origin. Thus, whether some cells of non-bacterial origin are present in the
culture
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
medium is immaterial, as the process does not rely on the capacity of these
cells
to act as host cells for the bacteria.
Thus, in a main aspect, the invention pertains to a process for culturing a
bacterium belonging to the Piscirickettsia genus (Piscirickettsia spp.)
wherein the
5 bacterium is propagated or cultured in a substantially extracellular
environment.
Thus, in the context of the present invention, the term "in a substantially
extracellular environment" further refers to a culture of bacteria, wherein at
least
10%, such as at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
98,
99, 99.5 or 100% of the bacteria propagate freely in the medium.
In one embodiment of the process of the invention, the bacterium is propagated
(cultured) substantially in the absence of cells of non-bacterial origin. It
will be
understood that cells of non-bacterial origin comprise vertebrate cells, such
as
cells that would otherwise be suitable as host cells for a bacterium belonging
to
the Piscirickettsia genus. Thus, within the scope of the present invention, is
a
process is provided wherein a bacterium belonging to the Piscirickettsia genus
is
cultured in a process that does not rely on the use of host cells.
In the present context the terms "in a substantially extracellular
environment"
and "substantially in the absence of cells of non-bacterial origin" define a
culture
of bacteria, wherein bacteria are cultured to a TCID50 titre of at least 1 x
104
bacteria/ml medium, such as at least 1 x 104, at least 5 x 104, at least 1 x
105, at
least 5 x 105, at least 1 x 106, at least 5 x 106, at least 1 x 107, at least
5 x 107,
at least 1 x 108, least 5 x 108, least 1 x 109, at least 2 x 109, at least 3 x
109, at
least 4 x 109, at least 5 x 109, at least 6 x 109, at least 7 x 109, at least
8 x 109,
at least 9 x 109, at least 1 x 1010, at least 2 x 1010, at least 3 x 1010, at
least 4 x
1010, or such as at least 5 x 1010 bacteria/ml medium in the presence of at
the
most 105 cells of non-bacterial origin/ml culture medium, such as at the most
2 x
105, such as at the most 3 x 105, at the most 4 x 105, at the most 5 x 105, at
the
most, 6 x 105, at the most 7 x 105, at the most 8 x 105, at the most 9 x 105,
or
such as in the presence of at the most 1 x 106 cells of non-bacterial
origin/m1
culture medium. The culture may be established by inoculating a culture with a
volume of a stock solution corresponding preferably to 0.25 to 4%, more
preferably 0.5 to 2%, most preferably 1% of the of the final volume of medium
in
said culture and having an optical density of between 2.5 and 3.5, such as an
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
6
optical density of 2.8 or 2.9. For this purpose the bacteria may be cultured
in
ventilated spinner flasks, preferably at 30-200 RPM and a temperature of 18.5
to
19.50C for a period of from 1-10 days, such as from 1 to 8 days, such as from
2
to 5 days, such as from 2 to 4 days, such as from 2 to 3 days. Alternatively,
P.salmonis can be grown in shaker flasks or in static cultures.
In an embodiment of the process of the invention, the process is one for
culturing
a bacterium belonging to the Piscirickettsia genus, wherein a substantial
amount
of the bacteria are propagated/cultured in an extracellular environment
An initial step of the process according to the invention may involve
establishing a
stock suspension of bacteria from a selected bacterial isolate. It is
contemplated
that the stock suspension may be established by selecting bacteria from
primary
isolates that are capable of propagating in an extracellular environment.
The stock suspension may contain bacteria of the Piscirikettsia genus in
amounts
of 105, 106, 107, 108, 108, 1010, 1011 TCID50/ml. The TCID50 unit is defined
as that
dilution of a virus required to infect 50% of a given batch of inoculated cell
cultures. The stock suspension can be frozen with a cryoprotectant such as
DMSO,
glycerol or others, and be kept for prolonged times at -80 C.
Thus, in a preferred embodiment, the process according to the invention thus
comprises establishing a stock suspension by a process comprising the steps
of:
a) providing a sample from a fish, which is infected with bacteria belonging
to
the Piscirickettsia genus;
b) inoculating into a culture medium, which is preferably essentially cell
free,
bacteria from said sample or dilution series hereof, or bacteria from a
spread plate culture established from said sample or dilution series hereof;
and
c) selecting bacteria that propagate freely in the medium.
In preferred embodiments of the present invention the bacterium belonging to
the
Piscirickettsia genus is a bacterium that has the ability to introduce the
symptoms
and disease of piscirickettsiosis in a fish. External symptoms of
piscirickettsiosis
include: dark colour, anorexia and lethargia, erratic swimming due to
infections in
CA 02656032 2011-09-20
7
the brain, skin lesions that can progress to shallow ulcersas well as pale
gills resulting from significant
anaemia. Internal symptoms include swollen and discoloured kidney, an enlarged
spleen, ascites in the
peritoneum, haemorrhages on the visceral fat, stomach, swim bladder, and body
musculature, as well as
whitish or yellow, multifocal, coalescing, pyogranulomatous nodules found in
the liver. Further internal
symptoms in the liver include multifocal necrosis of hepatocytes, accompanied
by a chronic inflammatory
infiltrate of mononuclear cells, vascular and perivascular necrosis and
intravascular coagulation resulting
in fibrin thrombi within major vessels.
In the kidney and spleen, vascular changes similar to those in the liver may
also be observed, and
granulomatous inflammation also occurs in the interstitium and parenchyma of
the kidney and spleen,
respectively. Meningitis, endocarditis, peritonitis, pancreatitis, and
branchitis may be observed with
accompanying chronic inflammatory and vascular changes similar to those in the
liver and
haematopoietic organs.
High magnification examination of lesions reveals aggregates of the organism
in the cytoplasm of
degenerated hepatocytes and in macrophages. Infected macrophages are usually
hypertrophied and
replete with cellular debris. In tissue sections stained with haematoxylin and
eosin, the organism appears
as basophilic or amphophilic spheres, about 1 pm in diameter.
For the purpose of the present invention, a presumptive diagnosis of fish,
which are infected with bacteria
belonging to the Piscirickettsia genus, may be by visualization of the
causative agent within macrophages
or hepatocytes in histological sections or tissue imprints. As a means of
confirmatory diagnosis, PCR
assays can also be conducted directly on isolated tissues (Marshal et al.,
1998, Mauel et al. 1996) and
thus PCR assays on tissues along with the observation of suspect organisms
within macrophages or
hepatocytes are suitable methods for confirmatory diagnosis. Bacteriological
culture on cystein heart agar
supplemented with 5% sheep blood can also be used as a means of diagnosis.
P.salmonis will usually
appear as whitish streaks on the plate, and may also form single colonies.
Alternatively, Piscirickettsia
spp. can be detected with Giemsa-stained tissue smears, followed by indirect
immunofluorescent
antibody test (IFAT), polymerase
CA 02656032 2011-09-20
8
chain reaction (PCR) with relevant primers and/or nucleic acid sequencing for
positive identification.
These are techniques which are known by the skilled person in the art.
A series of standard monitoring methods and diagnostic methods for
piscirickettsiosis have been
developed by the World Organization for Animal Health as published in the
Manual of Diagnostic tests for
Aquatic Animals 2003, part 2, section 2.1, chapter 2.1.13.
Infected fish tissues suitable for examination in IFAT, PCR, tissue imprints
and histology are kidney, liver
and blood, collected from diseased fish during either overt or covert
infections. Due to sensitivity of P.
salmonis to antibiotics in vitro, none should be used in media during
collection of tissue or the culture of
cells.
Similarly, the tissues mentioned above provide suitable sources for samples to
be used in the process of
isolating a bacterium of the Piscirickettsia genus and for establishing a
stock suspension of Piscirickettsia
spp. according to the present invention. Accordingly, preferred embodiments of
the invention pertains to a
process, wherein said sample is taken from a body tissue, a body fluid, a
secretion or, preferably, from a
tissue homogenate. In a further preferred embodiment the tissue homogenate has
been clarified by
centrifugation or filtration.
In a further preferred embodiment of the invention, the selected bacterium is
further cultured over at least
1, such as at least 2, at least 3, at least 4, at least 5, at least 10, at
least 11, at least 12, at least 13, at
least 14, or at least 15 passages before a stock suspension is established.
As mentioned, the present invention pertains to a process of culturing a
bacterium which is capable of
introducing the symptoms and disease of piscirickettsiosis. For the purpose of
determining whether a
bacterium belonging to the Piscirickettsia genus may cause the disease and
symptoms of
piscirickettsiosis, experiments may be conducted in which Atlantic salmon
weighing 20-40 grams are
challenged intraperitoneally in fresh water with 10-fold dilutions of
Piscirickettsia spp. cultures. Preferably,
the cultures should have a titre of at least 105 TCID50/m1 Piscirickettsia
spp. The fish should be observed
daily for the next five weeks, and
CA 02656032 2011-09-20
9
should display the above-mentioned symptoms of piscirickettsiosis within this
time.
As of present, bacteria of the species Piscirickettsia salmonis have been
identified as causative agents of
piscirickettsiosis. Accordingly, for the purpose of the present invention it
may be preferred that the
bacterium cultured in the process of the invention is of the species
Piscirickettsia salmonis.
As described in the below Examples, stock suspensions have been established
from a number of isolates
of Piscirickettsia spp that have been selected for the ability to grow in an
extracellular environment.
Samples from representative isolates have been deposited under the Budapest
Treaty with the European
Collection of Cell Culture (ECACC), Health Protection Agency, Porton Down,
Salisbury, Wiltshire (UK),
SP4 OJG UK on the 9 june 2006 under the following accession numbers: 06050901
(isolate AL10005),
06050902 (isolate AL10007), and 06050903 (isolate AL10008). A further
representative sample has been
deposited on 21 March 2007 under the accession number 07032110 (isolate
AL10014).
In preferred embodiments of the invention relating to the process, said
bacterium belonging to the
Piscirickettsia genus thus has genotypic and/or phenotypic characteristics
related to those of any of the
bacteria which are deposited in the European Collection of Cell Culture
(ECACC) Health Protection
Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on the 9 june 2006
under the following
provisional accession numbers: 06050901 (isolate AL10005), 06050902 (isolate
AL10007), 06050903
(isolate AL10008) or to those of the bacteria deposited on 21 March 2007 under
the accession number
07032110 (isolate AL10014).
Specific genotypic characteristics which are often used for distinguishing
between bacterial species and
isolates are the sequences of their internal transcribed spacers (ITS) and the
sequences of the genes
coding for the 16S and 23S ribosomal RNAs. The ITS are non-coding regions of
DNA sequence that
separate genes coding for the 16S and 23S ribosomal RNAs. These ribosomal RNA
(rRNA) genes are
relatively conserved across taxa and species while the spacers between them
may be specific for
particular species and isolates. The conservation of the
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
rRNA genes allows for easy access to the ITS regions with "versatile" primers
for
polymerase chain reaction (PCR) amplification. The inventors have found that
the
isolates of bacteria belonging to the Piscirickettsia genus which are able to
grow
substantially in the absence of cells of non-bacterial origin have ITS
sequences
5 that can be as little as 95%, 96%, 97%, 98% or 99% identical to those of
isolates
that are obligate intracellular bacteria. Thus, a preferred embodiment of the
invention relates to a process, wherein said bacterium belonging to the
Piscirickettsia genus is characterised by having an internal transcribed
spacer
region which comprises a nucleic acid sequence which is more than 95%
identical
10 to the sequence:
GTATAAGTAAAGATTCCTTGATrAATI-TAGGGITA IIIIIATMCGATTGAGATGTATM
TATGTTTTGATTGATAAATGGGAATAA IIIIIAGTTTATTTAATTAACGAGTCTTGGTAATT
TTTGAAAACCGGTGTTGAGATATAGTITTGATTGGITTTAGTTAATAGATTTTAGATTTATT
GATATAAGAC !III' GGGGTTATATGATCAAGTGAATAAGTGCAT (SEQ ID. NO. 1).
In further specific embodiments said bacterium belonging to the
Piscirickettsia
genus is characterised by having an 16S rRNA gene which comprises a nucleic
acid sequence which is at least 97% identical to the sequence:
GTATAAGTAAAGATTCCTI-GATTAATITAGGGTTA __ IIIIiATTITCGATTGAGATGTATTTT
TATGTTTTGATTGATAAATGGGAATAA I I I I I AGTTTATTTAATTAACGAGTCTTGGTAATT
TTTGAAAACCGGIGTTGAGATATAGTTITGATTGGTTTTAGTTAATAGATTTTAGATTTATT
GATATAAGACI __ I Ii IGGGGTrATATGATCAAGTGAATAAGTGCAT (SEQ ID. NO. 1),
such as at least 97,0%, at least 97,2%, at least 97,3%, at least 97,4%, at
least
97,5%, at least 97,6%, such as at least 97,7%, at least 97,8%, at least 97,9%,
at least 98%, at least 99%%, at least 100%, identical to said sequence.
The term "sequence identity" indicates a quantitative measure of the degree of
homology between two amino acid sequences or between two nucleic acid
sequences of equal length. If the two sequences to be compared are not of
equal
length, they must be aligned to give the best possible fit, allowing the
insertion of
gaps or, alternatively, truncation at the ends of the polypeptide sequences or
nucleotide sequences. The sequence identity can be calculated as N-f ,
wherein Ndif is the total number of non-identical residues in the two
sequences
when aligned and wherein Nref is the number of residues in one of the
sequences.
Hence, the DNA sequence AGTCAGTC will have a sequence identity of 75% with
CA 02656032 2011-09-20
11
the sequence AATCAATC (Ndif=2 and Nref=8). A gap is counted as non-identity of
the specific
residue(s), i.e. the DNA sequence AGTGTC will have a sequence identity of 75%
with the DNA sequence
AGTCAGTC (Ndif=2 and Nref=8).
With respect all embodiments of the invention relating to nucleotide
sequences, the percentage of
sequence identity between one or more sequences may also be based on
alignments using the clustalW
software (http:/www.ebi.ac.uk/clustalW/index.html) with default settings. For
nucleotide sequence
alignments these settings are: Alignment=3Dfull, Gap Open 10.00, Gap Ext.
0.20, Gap separation Dist. 4,
DNA weight matrix: identity (IUB).
Alternatively, and as illustrated in the examples, nucleotide sequences may be
analysed using
programme DNASIS Max. This service is based on the two comparison algorithms
called Smith-
Waterman (SW) and ParAlign. The first algorithm was published by Smith and
Waterman (1981) and is a
well established method that finds the optimal local alignment of two
sequences. The other algorithm,
ParAlign, is a heuristic method for sequence alignment; details on the method
is published in Rognes
(2001). Default settings for score matrix and Gap penalties as well as E-
values were used.
In further preferred embodiments of the present invention, said bacterium
belonging to the Piscirickettsia
genus is characterised by having an internal transcribed spacer region which
comprises the sequence of
SEQ ID NO: 1.
The bacterium belonging to the Piscirickettsia genus may be further
characterised by having a 16S rRNA
gene which comprises a nucleic acid sequence which is at least 95,0% identical
to the sequence of. SEQ
ID. NO. 2, such as at least 95,1%, at least 95,2%, at least 95,3%, at least
95,4%, at least 95,5%, at least
95,6%, such as at least 95,7%, at least 95,8%, at least 95,9%, at least 96%,
at least 97%, at least 98%,
at least 99%, or such as at least 99.5% identical to the sequence of SEQ ID.
NO. 2. In particular
embodiments the 16S rRNA gene comprises a sequence which is identical to that
of an isolate of obligate
intracellular bacteria of the Piscirickettsia salmonis species. Accordingly,
in an embodiment of the process
according to the invention, said bacterium belonging to the Piscirickettsia
genus may be further
characterised by having a 16S rRNA
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
12
gene, which comprises the sequence
ATCCATAGCTGGTTTGAGAGAATGGCCAGCCACACTGGGACTGAGACACGGCCCAGACT
CCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGGGGAACCCTGATCCAGCAAT
GCCACGTGTGTGAAGAAGGCCTTAGGGTIGTAAAGCAL I i I CAGCGGGGAGGAAGGTAA
GCTAATTAATACTTGGCTTAATTGACGTTACCTGCAGAAGAAGCACCGGCTAACTCCGTG
CCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAG
GGCGCGTAGGCGGAAGATTAAGTTGGATGTGAAATCCCAGGGCTCAACCTTGGAACTGC
ATCCGAAACTGGTATTCTAGAGTATGGTAGAGGAAAGTGGTTTCGCAGGTGTA (SEQ ID
NO: 2).
The sequences of the 16S rRNA of a bacterium belonging to the Piscirickettsia
genus may be amplified in a nested PCR procedure using primers according to
Mauel et al, 1996. These primers amplify a conserved region of the
Piscirickettsia
salmonis 16S rRNA gene. For amplification of a 283 base pair sequence from the
ITS region, primers according to Marshall etal., 1998 are used.
Other specific genotypic characteristics comprise a Pulsed Field Gel
Electrophoresis PFGE band pattern as shown in Figure 2 for isolate AL 10007
(accession number 06050902). Specific phenotypic characteristics comprise a
band pattern similar to that seen with AL 10005 (accession number 06050901)
when performing Western blotting with an anti-P.salmonis antibody.
In the presently most preferred embodiment(s), said bacteria belonging to the
Piscirickettsia genus is any of the bacteria, which are deposited deposited
under
the Budapest Treaty with the European Collection of Cell Culture (ECACC),
Health
Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on the 9
june 2006 under the following accession numbers: 06050901 (isolate AL10005),
06050902 (isolate AL10007) and 06050903 (isolate AL10008) or the bacteria
which are deposited on 21 March 2007 under the accession number 07032110
(isolate AL10014).
A bacterial stock suspension as described above provides a source of bacteria
for
the bacterial culture that is eventually established for production of the
bacterium
belonging to the Piscirickettsia genus. In the process of the present
invention it
may however be preferred to culture the bacteria of the stock suspension in
one
or more pre-cultures before eventually transferring the cells to the
production
CA 02656032 2011-09-20
13
culture. In particular, this is relevant when production of the bacteria is
performed in large scale, such as
in industrial scale.
In further preferred embodiments relating to the process of the invention, the
bacterium is propagated at a
temperature of between 10 and 25 C, preferably at a temperature of between 12
and 23 C, more
preferably of between 15 and 22 C, even more preferably of between 17 and 21
C, still more preferably
of between 18 and 20 C and most preferably at a temperature of between 18.5
and 19.5 C.
In equally preferred embodiments, the bacterium is propagated at a pH of
between 5.5 and 8.0, more
preferably of between 5.7 and 7.0, even more preferably of between 5.9 and
6.8, still more preferably of
between 6.1 and 6.6, and most preferably between 6.2 and 6.5.
It is contemplated that higher titres of bacteria may be obtained when the pH
in the culture is tightly
controlled. Suitable means for controlling the pH include automatic addition
of acid or base or Na2HCO3
and CO2.
Various different culture media may be used in the process according to the
invention, including many
commercially available media. For industrial scale production of the bacteria
belonging to the
Piscirikettsia genus it will in most cases be desirable to optimise the
process to give a maximum output
and for this and other purposes, it may be preferred to culture the bacteria
in a nutrition rich medium.
More specifically, it may be preferred that the medium contains one or more
compounds selected from
the group consisting of proteins, amino acids, carbohydrates, fatty acids,
lipids and micronutrients.
In further preferred embodiments the medium is a medium for insect cells; in
the currently medium as
described by Godwin and Whitford, 1993. Alternatively the Sf-900 III medium
may be used. As of
present, both media are commercially available from Invitrogen.
In specific embodiments of the invention the process comprises the steps of:
a) inoculating a first pre-culture with a working seed suspension or stock
suspension of a bacterium
belonging to the Piscirickettsia genus and
CA 02656032 2011-09-20
14
culturing the bacterium under the above-mentioned conditions until reaching an
optical density
(0.D.600,m) of at least 0.7, such as at least 0.8, such as at least 0.9 such
as at least 1, such as
at least 2, such as at least 3, such as at least 4, such as at least 5, such
as at least 6, such as
at least 7, such as at least 8, such as at least 9 or such as at least 10;
b) transferring a suspension of the bacterium to a second pre-culture and
culturing the bacterium
under the above-mentioned conditions until reaching an optical
density(O.D.60onm) of at least
0.7, such as at least 0.8 such as at least 0.9 such as at least 1, such as at
least 2, such as at
least 3, such as at least 4, such as at least 5, such as at least 6, such as
at least 7, such as at
least 8, such as at least 9 or such as at least 10;
c) transferring a suspension of the bacterium to a production culture,
culturing the bacterium until
reaching an optical density (0.a600nm) of minimum 3; and harvesting the
bacterium.
In preferred embodiments, the bacterial cells are harvested from the
production culture after incubation
for a period of 2-8 days, such as from 3-7 days or such as from 4-6 days, when
an optical density
(0.D.600nm) of from 4-20 is reached, such as when an optical density of from 5-
15 is reached, when an
optical density of from 6-13 is reached, when an optical density of from 6-14
is reached or preferably
when an optical density of from 6-15 is reached.
In equally preferred embodiments the invention provides a process, wherein
a) said first pre-culture is inoculated with a volume of stock suspension
corresponding to 0.1% or
more (preferably 0.25 to 4%, more preferably 0.5 to 2%) of the volume of
medium in said first
pre-culture; and/or
b) said second pre-culture is inoculated with a volume of first pre-culture
corresponding to 0.1%
or more (preferably 0.25 to 4%, more preferably 0.5 to 2%) of medium in said
second pre-
culture in order to obtain a production culture; and/or
c) said production culture is inoculated with a volume of said second pre-
culture corresponding to
0.1% or more (preferably 0.25 to 4%, more preferably 0.5 to 2%) of medium
volume in said
production culture.
CA 02656032 2011-09-20
To the person of skills within the field of bacterial fermentation it will be
apparent that the process of the
present invention may be performed by culturing the bacterium by batch
fermentation, by fed-batch
fermentation as well as by continuous fermentation. At present batch
fermentation is preferred, also when
using the process of the invention for culturing a bacterium of the
Piscirickettsia genus at industrial scale.
At present, a batch volume of 100 ¨ 5000 litres of medium is contemplated.
Preferred batch sizes are
from 200 ¨ 4000 litres of medium, such as from 300 ¨ 3000 litre of medium, or
such as from 450 ¨ 2000
litres of medium.
In a second main aspect the present invention provides a process for producing
a vaccine comprising one
or more steps of culturing a bacterium of the Piscirickettsia genus, wherein
the bacterium is propagated
or cultured in a substantially extracellular environment. It is to be
understood that the process for
producing a vaccine may be characterised by any of the features described
above in relation to the
process for culturing a bacterium belonging to the Piscirickettsia genus.
The process for producing a vaccine may further comprise steps of harvesting
the bacterium from the
culture medium as well as steps of concentrating and/or disrupting, and
inactivating the bacterium.
It will be known to the skilled person that inactivated bacteria can be
attained in general by chemical or by
physical means. Chemical inactivation can be carried out by treatment of the
bacteria for example, but not
limited to, with enzymes, with formaldehyde, beta-propiolactone, or
ethyleneimine or derivative thereof,
with organic solvents (e.g. TritonTm or TweenTm). Physiochemical inactivation
can advantageously be
carried out by subjecting the bacteria to energy-rich radiation, such as UV
light, gamma irradiation or X-
rays. If necessary the inactivation agent can be neutralized; for example
formaldehyde-inactivated
preparations can be neutralized with thiosulphate. If required, the pH is
subsequently returned to about 7.
Inactivation of bacteria by means of physical stress, using e.g. heat or a
French Press, provides a
suitable starting material for the manufacturing of a vaccine. Thus, a
bacterin need not necessarily be in
the form of inactivated whole cells; the cells may be disrupted.
=
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
16
In certain embodiments the process may include a step of attenuating the
bacterium. Thus, in some embodiments according to the invention the bacteria
have been attenuated. Several approaches for obtaining attenuated bacteria are
available to the skilled person. An attenuated strain of a bacteria belonging
to the
Piscirickettsia genus may be generated for instance by passing the bacteria
through culture a number of times, or deleting or mutating a gene involved in
a
biosynthetic pathway.
In preferred embodiments of the invention the step for concentrating the
bacterium comprises the use of filtration techniques selected from the group
consisting of: continuous cross flow filtration, diafiltration,
centrifugation, or any
combination hereof.
In further preferred embodiments relating to the process for producing a
vaccine,
a concentration factor is obtained that is larger than 0 and less than or
equal to
12, such as from 1.2 to 11, from 1.4 to 10, from 1.6 to 9, from 1.8 to 8, from
2 to
7, from 2.25 to 6, from 2.5 to 5, or such as from 2.75 to 4. In a presently
preferred embodiment, the concentration factor for a suspension of inactivated
bacteria belonging to the Piscirickettsia genus is 2-6. The concentration
factor is
calculated from the total amount of antigen suspension fed to the system,
divided
on the product recovery including hold-up volume in the filtration unit. The
"hold-
up volume" is the volume of concentrate of bacteria belonging to the
Piscirickettsia genus remaining in the filtration unit after collection of the
concentrate.
While the vaccine may be based for instance on whole bacteria as described
above
it may according to some embodiments relating to the invention be preferred to
develop a vaccine based on subunits of the bacterium of the Piscirickettsia
genus.
Therefore, in some embodiments, the process comprises one or more steps for
isolation and/or purification of a subunit the bacteria.
In the context of the present invention the term "subunit" refers to any
component of the bacteria which alone or in combination with others is capable
of
eliciting an immune response. In the present context particularly suitable
subunits
are those that are capable of eliciting a protective immune response.
Particular
examples of subunits that may be suitable in the present context are
CA 02656032 2011-09-20
17
lipopolysaccarides, proteins or peptides which are able to elicit an antibody
response in fish, mice or
rabbits.
In the present context, the expression a "protective immune response" refers
to an immune response
which results in a relative percent survival of vaccinated fish of at least
20. The relative percent survival,
{1- (% mortalities in vaccinated group/% mortalities in control group)}*100,
may be determined in
experiments wherein a group of at least 20 fish of a relevant species is
immunized intraperitoneally with
0.05 ¨ 0.5 ml of an antigen preparation and compared to a group of fish which
have received phosphate
buffered saline (PBS). The fish are challenged intraperitoneally after 350-600
degree days with an
appropriate amount of bacteria belonging to the Piscirickettsia genus, such as
1,33 x 104 TCID50
Piscirickettsia salmonis isolate AL10007. The bacteria are titrated by end
point dilution by the method of
Karber (1931).
The appropriate dose must be determined for each experiment by doing a pre
challenge of the same
stock of fish with dilutions of challenge material. The fish are followed for
30-40 days, and the number of
mortalities in each group recorded The skilled person will be aware of the
suitable means and measures
for purification of subunits of interest. In particular embodiments of the
invention the subunit is isolated or
purified in a process comprising one or more steps of chromatography, in
particular one or more steps of
affinity chromatography. In general, a lot of guidance is provided to the
skilled person by publications in
the field on how to develop and perform chromatographic purification of the
relevant substances. In
particular the skilled person may consult publications such as "Protein
purification methods; a practical
approach" Eds. ELV Harris and S Angal, published in the Practical Approach
Series, series editors D
Rickwood & BD Hames, IRL Press, Oxford 1989, and "Affinity Chromatography;
Principles and Methods,
Edition AB, Published by Amersham Pharmacia Biotech.
A third main aspect of the present invention pertains to a process for
obtaining a bacterium belonging to
the Piscirickettsia genus. In general the process involves culturing a
bacterium belonging to the
Piscirickettsia genus under conditions that favour bacteria which are capable
of growing substantially in
the absence of cells of non-bacterial origin as explained above. In preferred
embodiments, said
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
18
process for obtaining a bacterium belonging to the Piscirickettsia genus
comprises
the steps of:
a) providing a sample from a fish, which is infected with bacteria belonging
to
the Piscirickettsia genus;
b) inoculating into an essentially cell free culture medium bacteria from said
sample or dilution series hereof, or bacteria from a spread plate culture on
a Cystein Heart Agar supplemented with 5% sheep blood, established from
said sample of step (a) or dilution series hereof; and
c) selecting a bacterium that propagate freely in the culture medium.
In the present context the term "essentially cell free culture medium" refers
to a
culture medium comprising at the most 105 cells of non-bacterial origin/m1
culture
medium, such as at the most 2 x 105, such as at the most 3 x 105, at the most
4
x 105, at the most 5 x 105, at the most, 6 x 105, at the most 7 x 105, at the
most
8 x 105, at the most 9 x 105, or such as in the presence of at the most 1 x
106
cells of non-bacterial origin/nil culture medium. It will be understood that
an
"essentially cell free medium" will support growth of a bacterium belonging to
the
Piscirickettsia genus to the desired titres in a "substantially extracellular
environment" and "substantially in the absence of cells of non-bacterial
origin" as
herein before defined.
It is a further characteristic of the process that said sample may be taken
from a
body tissue, a body fluid, a secretion or from a tissue homogenate.
A further aspect of the invention pertains to a bacterium of the
Piscirickettsia
genus, said bacterium having the ability to propagate in a substantially
extracellular environment.
In the present context the term "ability to propagate in a substantially
extracellular environment" means that the bacteria will grow in a suitable
culture
medium ¨ as for instance the Sf-900 II SFM medium with no supplements. It is
to
be understood that the bacteria will grow to a titre of at least 1 x 104, at
least 5 x
104, at least 1 x 105, at leats 5 x 105, at least 1 x 106, at least 5 x 106,
at least 1
x 107, at least 5 x 107, at least 1 x 108, least 5 x 108, least 1 x 109, at
least 2 x
109, at least 3 x 109, at least 4 x 109, at least 5 x 109, at least 6 x 109,
at least 7
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
19
X 109, at least 8 x 109, at least 9 x 109, at least 1 x 1010 in a culture
without cells
of non-bacterial origin, established by inoculating a volume of a stock
solution
corresponding preferably to 0.25 to 4%, more preferably 0.5 to 2%, most
preferably 0.1%) of the of the final volume of medium in said first culture
and
having an optical density of between 2.5 and 3.5, such as an optical density
of 2.8
or 2.9. For this purpose the bacteria may be cultured for in ventilated
spinner
flasks at between 50 and 500 RPM and a temperature of 18.5 to 19.50C for a
period of from 1-10 days, such as from 1 to 8 days, such as from 2 to 5 days,
such as from 2 to 4 days, such as from 2 to 3 days.
In preferred embodiments of the invention the bacterium is one that is
obtainable
by a process as described above. In particular the bacterium is obtainable by
a
process comprising the steps of:
a) providing a sample from a fish, which is infected with bacteria belonging
to
the Piscirickettsia genus;
b) inoculating into a culture medium, which is preferably essentially cell
free,
bacteria from said sample or dilution series hereof, or bacteria from a
spread plate culture established from said sample or dilution series hereof;
and
c) selecting bacteria that propagate freely in the medium.
In further embodiments of the invention the bacterium is one which is in fact
obtained by a process as described above.
In preferred embodiments of this aspect the bacterium is one which is capable
of
introducing the above-described symptoms and disease of piscirickettsiosis,
and
wherein said bacteria have genotypic and/or phenotypic characteristics related
to
those of the above mentioned deposited isolates.
Use of sequences of genes encoding ribosomal RNAs and the internal transcribed
spacers for characterisation of the bacterium according to the invention has
been
explained above. Accordingly, for the present aspect of the invention it may
be
preferred that the bacterium belonging to the Piscirickettsia genus is
characterised
by having an internal transcribed spacer region which comprises a nucleic acid
sequence which is more than 95% identical to the sequence of SEQ ID. NO. 1.
CA 02656032 2011-09-20
In further specific embodiments said bacterium belonging to the
Piscirickettsia genus is characterised by
having an internal transcribed spacer region which comprises a nucleic acid
sequence which is at least
95,0% identical to the sequence of SEQ ID. NO. 1, such as at least 95,1%, at
least 95,2%, at least
95,3%, at least 95,4%, at least 95,5%, at least 95,6%, such as at least 95,7%,
at least 95,8%, at least
95,9%, at least 96%, at least 97%, at least 98%, at least 99%, or such as at
least 90.5% identical to the
sequence of SEQ ID. NO. 1.
In further preferred embodiments said bacterium may be characterised by having
an internal transcribed
spacer region which comprises the sequence of SEQ ID NO: 1.
Additionally, said bacterium belonging to the Piscirickettsia genus is
characterised by having a 16S rRNA
gene which comprises a nucleic acid sequence which is at least 95,0% identical
to the sequence of SEQ
ID. NO. 2, such as at least 95,1%, at least 95,2%, at least 95,3%, at least
95,4%, at least 95,5%, at least
95,6%, such as at least 95,7%, at least 95,8%, at least 95,9%, at least 96%,
at least 97%, at least 98%,
at least 99%, or such as at least 99.5% identical to the sequence of SEQ ID.
NO. 2.
In further specific embodiments said bacterium may be characterised by having
a 16S rRNA gene, which
comprises the sequence of SEQ ID NO: 2.
In the currently most preferred embodiment of this aspect of the invention the
bacterium is any of the
representative isolates that have been deposited under the Budapest Treaty
with the European Collection
of Cell Culture (ECACC), Health Protection Agency, Potion Down, Salisbury,
Wiltshire (UK), SP4 OJG UK
on the 9 june 2006 under the following accession numbers: 06050901 (isolate
AL10005), 06050902
(isolate AL10007) and 06050903 (isolate AL10008), or the isolate which has
been deposited on 21 March
2007 under the accession number 07032110 (isolate AL10014).
Yet another main aspect of the invention pertains to a vaccine comprising a
bacterium of the invention or
a subunit of the bacterium. Within the scope of this aspect are vaccines based
on concentrated and/or
disrupted and/or inactivated bacteria. In certain aspects the vaccine may be
based on attenuated
bacteria.
CA 02656032 2011-09-20
21
In further preferred embodiments, the vaccine comprises an amount of antigen,
which is higher than 0.05
mg/ml, such as from 0.05 to 5 mg/ml, from 0.1 to 4.5 mg/ml, from 0.2 to 4
mg/ml, from 0.3 to 3.5 mg/ml,
from 0.4 to 3 mg/ml, from 0.4 to 3 mg/ml, from 0.5 to 2.5 mg/ml, from 0.6 to 2
mg/ml, from 0.7 to 1.5
mg/ml, or such as from 0.8 to 1 mg/ml.
In further preferred embodiments the vaccine is in a formulation comprising an
adjuvant. Examples of
adjuvants frequently used in fish and shellfish farming are muramyldipeptides,
lipopolysaccharides,
several glucans and glycans, mineral oil and Carbopoi . An extensive overview
of adjuvants suitable for
fish and shellfish vaccines is given in the review paper by Jan Raa (1996).
The vaccine of the invention may further comprise a suitable pharmaceutical
carrier. In a currently
preferred embodiment the vaccine is formulated as an emulsion of water in oil.
The vaccine may also
comprise a so-called "vehicle". A vehicle is a device to which the antigen
adheres, without being
covalently bound to it. Such vehicles are i.a. biodegradable nano/micro-
particles or ¨capsules of PLGA
(poly-lactide-co-glycolic acid), alginate or chitosan, liposomes, niosomes,
micelles, multiple emulsions
and macrosols, all known in the art. A special form of such a vehicle, in
which the antigen is partially
embedded in the vehicle, is the so-called ISCOM (European patents EP 109.942,
EP 180.564 and EP
242.380.
In addition, the vaccine may comprise one or more suitable surface-active
compounds or emulsifiers, e.g.
Cremophore, Tween and Span . Also adjuvants such as interleukin, CpG and
glycoproteins may be
used.
It is to be understood that the vaccine may further be in a formulation
comprising an antigen from a
bacterial source other than a bacterium of the Piscirickettsia genus, an
antigenic material obtained from a
viral source, an antigenic material obtained from a parasitical source, and/or
an antigenic material
obtained from a fungal source.
In particular embodiments of the invention said antigen from a bacterial
source other than bacterium of
the Piscirickettsias genus is selected from the group consisting of live,
attenuated or killed bacteria of the
species, but not limiting to,
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
22
Aeromonas sp, Vibrio sp. Listonella sp., Moritella viscosa, Photobacterium
damsela, Flavobacterium sp., Yersinia sp. Renibacterium sp. Streptococcus sp.,
Lactococcus sp., Leuconostoc sp., Bifidobacterium sp., Pediococcus sp.,
Brevibacterium sp., Edwarsiella sp. Francisella sp. Pseudomonas sp., Cytophaga
sp., Nocardia sp., Mycobacerium sp., subunits of these bacteria, and any
combination hereof.
Other specific embodiments pertain to a vaccine, wherein the antigenic
material
obtained from a viral source contained within the formulation is selected from
the
group consisting of Glycoprotein of Viral Hemorrhagic Septicemia Virus (VHSV);
nucleoprotein of Viral Hemorrhagic Septicemia Virus (VHSV); glycoprotein of
Infectious Hematopoietic Necrosis virus (IHNV); inactivated Pancreatc Necrosis
Virus; VP1, VP2, VP3 or nucleoprotein structural proteins of Infectious
Pancreatic
Necrosis Virus (IPNV); G protein of Spring Viremia of Carp (SVC); and a
membrane-associated protein, tegunnin or capsid protein or glycoprotein of
Channel Catfish Virus (CCV); and antigenic material obtained from ISA virus.
Further embodiments pertain to a vaccine, wherein said viral source is
selected
from the group consisting of pancreatic disease virus (SPDV), Iridovirus,
Infectious Salmon Anaemia virus (ISAV), and heart and skeletal muscle
inflammation virus.
In preferred embodiments said parasitic source is selected from the group
consisting of Lepeophtheirus Sp., Caligus Sp., and khthyophthirius Sp.
In other preferred embodiments the vaccine comprises an antigenic material
obtained from a fungal source wherein said fungal source is selected from the
group consisting of Saprolegnia Sp., Branchiomyces sanguinis, Branchiomyces
demigrans and kthyophonus hoferi.
In a presently most preferred embodiment the vaccine comprises antigenic
amterial from Vibrio ordalii and Infectious Pancreatic Necrosis virus.
The vaccine according to the invention may in particular be formulated for
administration to a fin fish. More specifically the vaccine may be
(formulated) for
administration to a telostei. The teleostei include, but are not limited to
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
23
salmonids, basses, breams, cods, snappers, flatfish, catfish, yellowtails and
tilapias.
In further embodiments of the invention the vaccine is formulated for
administration by a route selected from the group consisting of: Bath,
immersion,
intraperitoneal injection, intramuscular injection and oral administration.
Optionally, the vaccine would be administered to young fish in the fresh-water
stage..
In preferred embodiments of the invention the vaccine is one that is
obtainable or
one that is actually obtained by a process as described above.
In a further aspect, the present invention provides a feed comprising the
vaccine
according to the invention, said feed may for example be pelleted or extruded
feed.
Further aspects of the invention pertain to a bacterium according to the
invention
or a subunit hereof for use in veterinary medicine.
Other aspects pertain to a bacterium according to the invention or a subunit
of
said bacteria in the manufacture of a medicament for the prevention of
infections
with bacteria of the Piscirickettsia genus. In particular a medicament
comprising a
bacterium according to the invention or a subunit hereof is relevant for the
prevention of infections with Piscirickettsia salmonis or other species of the
Piscirickettsia genus, hereunder for the prevention of piscirickettsiosis.
Finally, other aspects of the invention pertain to a method for prevention of
infections in fish with bacteria of the Piscirickettsia genus, said method
comprising
administering to the fish a vaccine according to the invention.
With respect to the above description of the various aspects of the present
invention and of the specific embodiments of these aspects it should be
understood that any feature and characteristic described or mentioned above in
connection with one aspect and/or one embodiment of an aspect of the invention
also apply by analogy to any or all other aspects and/or embodiments of the
invention described.
CA 02656032 2015-01-21
24
When an object according to the present invention or one of its features or
characteristics is referred to in singular this also refers to the object or
its features
or characteristics in plural. As an example, when referring to "a vaccine" It
is to be
understood as referring also to one or more vaccines.
Throughout the present specification the word "comprise", or variations such
as
"comprises" or "comprising", will be understood to imply the inclusion of a
stated
element, integer or step, or group of elements, integers or steps, but not the
exclusion of any other element, integer or step, or group of elements,
integers or
Steps.
The scope of the claims should not be limited by the preferred embodiments
set forth in the examples, but should be given the broadest interpretation
consistent with the description as a whole. The following examples are
offered by way of illustration and are not intended to limit the invention in
any way.
The invention will now be described in further details in the following non-
limiting
examples and figure 1 to 4.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1: Data from experiment conducted to reveal the ability of P. salmonis
to
grow on traditional bacterial media.
Figure 2: Pulsed Field Electrophoresis gel showing a band pattern of the AL
10005 isolate of P. salmonis.
Figure 3: 00600 nm values for fermentation with and without pH control
collected from experiments conducted in order to investigate if the use of
controlled pH batch fermentation would increase the production of P. salmonis,
Figure 4: Cumulative /ci mortality of fish Injected either with PBS or with a
vaccine containing inactivated Pisdric.kettsia salmonis cultured by the method
according to the invention.
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
EXAMPLES
5 Example 1. Isolation of P. salmonis from fish without the use of host
cells.
Liver samples from moribund Atlantic salmon diagnosed with P. salmonis were
aseptically removed and homogenised. The homogenate was diluted in SF900II
10 cell culturing medium and centrifuged at 2000 x g to remove liver tissue.
The
clarified homogenate was inoculated in a dilution series in SF900II medium and
incubated as static cultures at 18 degrees C. Bacterial growth could be
observed
within a few days. The bacterial suspension was identified to be P. salmonis
by
imnnunoflourescens microscopy using monoclonal antibodies as described in
15 example 2.
Example 2. Identification of P. salmonis isolate.
The bacterial isolate was verified to be P. salmonis using a commercial kit
"SRS
20 Fluorotest Directo" from Bios Chile, Chile. The kit is based on FITC-
conjugated
monoclonal antibodies against P salmonis. Positive controls were slides with
P.
salmonis, fixed in methanol/acetone and frozen at -20 C. Negative controls
were
slides with Aeromonas salmonicida, fixed in methanol/acetone and frozen at -
20 C. Positive samples were observed as containing spherical fluorescent
bacteria
25 when viewed in a fluorescence microscope set at the appropriate wavelength.
Example 3: Propagation of P. salmonis without host cells.
Example 3 illustrates multiple passages of P. salmonis in spinner flasks,
without
the presence of host cells initiated from a frozen stock.
All the bacterial cultures were grown in SF900II media from Invitrogen with no
supplements. The cultures were cultivated in ventilated spinner flasks at 75
rpm
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
26
and 20 degrees C. The growth was monitored by 0D600 nm measurement and
titration according to K rber, 1931 of the cultures.
The results shown in Table 1 clearly demonstrate the ability of P. salmon's to
replicate without the presence of host cells. After approximately 6 days post
resuscitation the bacteria reaches a typical growth pattern, and was sub
cultured
every 3-5th day. Maximum 0D600 values of more than 7 were reached within 4-5
days.
Table 1. Passage of P. sal in spinner flasks without Sf-9 cells in SF-900 II
medium
Passage Days Inoculum, OD Titre
p.i.
1st 0 1%
6 2.9
2nd 0 1% (OD 2.9)
2 1.1 4.22 x 109
3 2.4 3.83 x 109
3rd 0 1% (OD 2.4)
3 4.5 3.16 x 1019
4 7.1 2.15 x 1019
5 7.8 2.37 x 109
7 7.4
4th 0 1% (OD 4.5)
1 0.5
2 1.9 4.64 x 109
3 4,3 1.10 x 1019
4 7.2 1.47 x 1019
5th 0
2 1% (OD 1.9) 1.5 4.22 x 109
5 6.2 4.22 x 109
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
27
6th 0 _______ 1% (OD 1.5)
3 4.4 2.87 x 1010
7.8
7th 0 1% (OD 4.4)
2 2.0 8.25 x 108
8th 0 1% (OD 2.0)
2 2.6 1.62 x 1010
Example 4: Growth of P. salmonis in different media
5 This experiment was conducted to reveal the ability of P. salmonis to grow
on
traditional bacterial media. Shaker flasks with different media compositions
were
prepared according to Table 2. The flasks were inoculated 1:100 with passage 2
P.
salmonis from a spinner flask. The cultures were incubated at 20 degrees C and
with 100 rpm. 0D600 was measured daily. The results, which are presented in
Figure 1, demonstrate that P. salmonis has the ability to replicate using
tradition&
bacterial media, but the bacterial yield is higher when SF900II insect cell
media is
used.
Table 2: Medium composition
1 2 4 5 6
Gram/litre
Yeast Extract 15 15 15 15
Casein 5 5 5 5
MgSO4x 7H20 0,4 0,4 0,4 0,4
NaCI 10 10 10 10
KCI 0,8 0,8 0,8 0,8
K2HPO4 0,3 0,3 0,3 0,3
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
28
Glyserol 85 % 10
Sucrose 10 5
Maltose 10 5
SF900II 50 ml
pH adjusted to 6.2 6.2 6.2 6.2 -
Growth OD
Start OD
Day 3, 0,62 0,13 0,15 0,30 0,29
Day 4, 2,09 0,84 0,61 1,85 1,95
Day 5, 2,50 2,16 2,19 2,24 2,34
Day 6, 2,85 4,16 2,60 2,58 2,61
Day 7, 2,82 5,72 2,74 2,28 2,53
Example 5: 16S rRNA and ITS gene analysis, Pulsed field Gel
Electrophoresis (PFGE) analysis of Piscirickettsia salmonis
Objective:
To analyse parts of both the spacer region between the 16S and 235 genes
(internal transcribed spacer, ITS) and the 16S rRNA gene to be able to
differentiate between species.
Method:
DNA was isolated from P.salmonis isolate AL10005, corresponding to the isolate
deposited under the Budapest Treaty with the European Collection of Cell
Culture
(ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4
OJG UK on the 9 june 2006 under the accession number 06050901 (grown with
and without Sf-9 cells), and isolate LF-89 (ATCC VR1361).
Primers were chosen to amplify parts of the 16S gene and the ITS using PCR.
The
PCR products were then sent for sequencing for comparison with known
sequences in a gene bank.
CA 02656032 2011-09-20
29
16S rRNA:
Universal bacterial 16S primers were used in a first PCR, and then specific
P.salmonis primers were used
in a nested PCR to amplify a 467hp PCR product of the 16S rRNA gene according
to Mauel, 1996.
ITS:
Specific P. salmonis primers were used to amplify a 236bp PCR product
according to Marshall et al, 1998
The PCR products were sent to GATC Biotech for sequencing. The sequences were
analysed using
programme DNASIS Max. This service is based on the two comparison algorithms
called Smith-
Waterman (SW) and ParAlign. The first algorithm was published by Smith and
Waterman (1981) and is a
well established method that finds the optimal local alignment of two
sequences The other algorithm,
ParAlign, is a heuristic method for sequence alignment; details on the method
is published in Rognes
(2001). Default settings for
score matrix and Gap penalties as well as E-values were used.
Result:
= 16S rRNA from AL10005 grown in Sf-9 cells:
ATCCATAGCTGGTTTGAGAGAATGGCCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG
GAGGCAGCAGTGGGGAATATTGGACAATGGGGGAAACCCTGATCCAGCAATGCCACGTGTGTGAAG
AAGGCCTTAGGGTTGTAAAGCACTTTCAGCGGGGAGGAAGGTAAGCTAATTAATACTTGGCTTAATT
GACGTTACCTGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGC
GAGCGTTAATCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGAAGATTAAGTTGGATGTGAAATC
CCAGGGCTCAACCTTGGAACTGCATCCGAAACTGGTATTCTAGAGTATGGTAGAGGAAAGTGGTTTC
GCAGGTG (SEQ ID NO. 2)
= 16S rRNA from AL10005 grown without cells:
ATCCATAGCTGGTTTGAGAGAATGGCCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG
GAGGCAGCAGTGGGGAATATTGGACAATGGGGGGAACCCTGATCCAGCAATGCCACGTGTGTGAA
GAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGGGGAGGAAGGTAA
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
GCTAATTAATACTIGGCTTAATTGACGTTACCTGCAGAAGAAGCACCGGCTAACTCCGTG
CCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAG
GGCGCGTAGGCGGAAGATTAAGTTGGATGTGAAATCCCAGGGCTCAACCTTGGAACTGC
ATCCGAAACTGGTATTCTAGAGTATGGTAGAGGAAAGTGGMCGCAGGTGTA (SEQ ID
5 NO. 2)
= 16S rRNA from LF-89:
The sequence deposited in PubMed for the 16S rRNA gene of LF-89 (accession
number U36941) was used for comparison with AL10005. Analysing the 16S rRNA
10 sequences in Paralign show that these sequences match the LF89 16S rRNA
gene
between base pair 275 and 667, and the homology is 100%. The match with the
EM-90 16S rRNA gene (accession number U36940) was 97%.
= ITS from AL10005 grown in Sf-9 cells:
15 GTATAAGTAAAGATTCCTTGATTAATTTAGGGTTA I I I I ATTTTCGATTGAGATGTATTIT
TATGTTITGATTGATAAATGGGAATAATTITTAGTTTATTTAATTAACGAGTCTIGGTAATT
TTTGAAAACCGGTGTTGAGATATAGTTTTGATTGGTTTTAGTTAATAGATITTAGATTTATT
GATATAAGACTTTTTGGGGTTATATGATCAAGTGAATAAGTGCAT (SEQ ID NO. 1)
20 = ITS from AL10005 grown without cells:
GTATAAGTAAAGATTCCTTGATTAATTTAGGGTTAIIIIIATTTTCGATTGAGATGTATTTT
TATGTTTTGATTGATAAATGGGAATAATTITTAGTTTATTTAATTAACGAGTCTIGGTAATT
TTTGAAAACCGGTGTTGAGATATAGTTTTGATTGGTTTTAGTTAATAGATITTAGATTTATT
GATATAAGAC __ I I I I I GGGGTTATATGATCAAGTGAATAAGTGCAT (SEQ ID NO. 1)
= ITS from LF89 grown in CHSE cells:
TTTAGGGTTAiiiiiAGtttacgttgagatgTAiiiiiATGTCTTGATTGATTATTAGAAATAATT
TTTAGTTTATTTAATTAACGAGTCTIGGTAAiiiiIGAAAACCGGTGTTGAGATATAGTTTT
GATTGGTATTAGTTAATAGATTITAGATTTATTGATATAAGACIiiiiGGGGTTATATGATC
AAGTGAATAAGTGCa (SEQ ID NO. 3)
Comparison of the LF89 sequence with the AL10005 sequence show a 95%
homology. Comparison with the Chilean isolate EM-90 ITS (accession nr U36944)
show a 100% homology between EM-90 ITS and AL 10005 ITS.
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
31
Conclusion
This shows that Piscirickettsia salmonis isolates able to grow without the
support
of eukaryotic cells can be as little as 95% similar to the type strain LF-89.
PFGE analysis
Preparation of chromosomal DNA plugs and pulse field gel
electrophoresis (PFGE).
P.salmonis, strain AL 10007, was cultured in Sf 900-11 medium. Bacterial
culture
was concentrated by centrifugation (4000 x g, 10 min, 4 C), re-suspended and
diluted in Cell Suspension Buffer (1M Tris, 0,5M EDTA, pH= 8.0). 25 pl
Proteinase
K (20 mg/ml) were added to 0, 5 ml cell suspension. Cells were embedded into
0.5 % agarose plugs by mixing the suspension 1:1 (v/v) with SeaKem Gold
agarose (1 % in (w/v) in TE [1M Tris, 0,5M EDTA, pH= 8.0] ) and 5 % sodium
dodecyl sulphate (20%).
The plugs were treated with lysis buffer (1M Tris, 0,5M EDTA, pH= 8.0) and 0,
5
% Proteinase K (20 mg/ml) at 54 C for 2 hours. The plugs were washed two
times with purified water for 10 minutes at 50 C and two times with TE buffer
for
15 minutes at 50 C. Barn I, Xho I, Xba I, Ecori I, Age I, Mlu I, Rsr II, Sma
I, Nc0
I, Sac II, Kpn I, Afl III were used for restriction endonuclease digestion in
accordance with the instructions of the manufacturers. The fragments were
resolved by PFGE in SeaKem Gold agarose (1%) by using the CHEF Mapper XA
system (Bio-Rad). The following parameters were used: running time 24 h;
temperature, 14 C; Voltage gradient, 6.0 V/cm, included angle, 120 ; an
initial
pulse time of 0.1 s and a final pulse time of 15 s. The gel was stained with
ethidium bromide (0.1p1/m1) for 30 min, distained in distilled water for 3x 30
minutes and photographed under UV light.
Results
A photo of the PFGE gel is shown in figure 2.
Lanes:
Lan 1 2 3 4 5 6 7 8 9 10 11 12 13 14
e
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
32
Enz ma Bann Xh Xb Eco Ag MI Rsr Sm Nc Sac Kp Afl mar
yme rke HI oI a RI el uI II al oI II nI III ker
Lane 8 and 9 where DNA from AL 10007 is treated with enzymes Rsr I or Sma I
displays how a PFGE band pattern from Piscirickettsia sp able to grow without
the
support of eukaryotic cells may appear.
Example 6: Fermentor culture
In order to investigate if the use of controlled pH batch fermentation would
increase the production of P. salmonis, fermentation with and without pH
control
was initiated. 0D600 nm was used to follow the production of bacteria and
total
protein was used to determined the final concentration of the cultures. The
cultures were grown using SF900II media with no supplements in a lab scale
fernnentor with 1.51 working volume. The temperature was 20 degrees C.
Stirring
speed was kept between 100-400 rpm with aeration.
The pH was maintained using automatically addition of Sodium Hydroxide or
Phosphoric acid.
The results from this experiment are presented in Figure 3 which clearly
demonstrates that the bacterial yields are increased when cultured in a batch
fermentor with a stabile pH of 6.5. Maximum 0D600 values of more than 13 were
reached within 5 days of cultivation.
Example 7: Detailed description of each step in the production process for
Piscirickettsia salmonis without the support of eukaryotic cells.
P.sal.-01: Pre-culture no. 1
A flask containing 50-125 ml medium is inoculated with
Working Seed suspension at a ratio of 0.5-2% of medium
volume. The flask is incubated at a temperature of 19 2 C
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
33
for 4-7 days or longer. The Optical Density (0D600nm) of the
culture at the moment of harvest will be at least 1.
The culture is transferred aseptically to the seed fermenter.
P.sal.-02: Pre-culture no. 2
A fermenter containing 7-9 litres of medium is inoculated with
a suspension of pre-culture no. 1 at a ratio of 0.5-2% of
medium volume. The culture is incubated at a temperature of
19 2 C for a period of 2-4 days or longer until the culture
has an Optical Density (0D600nm) of at leastl.
During fermentation pH is adjusted to 6.2-6.5 with sodium
hydroxide or phosphoric acid. Polypropylene glycol solution or
10% Pluronic (Polyoxyethylene-polyoxypropylene Block
Copolymer) solution is added automatically to control
foaming.
The culture is transferred aseptically to the main fermenter.
P.sal.-03: Production culture
A fermenter containing 450 - 2000 litres of medium is
inoculated with a suspension of pre-culture no. 2 at a ratio of
0.5-2% of medium volume. The culture is incubated at a
temperature of 19 2 C. At regular intervals samples are
taken to ensure that the culture is harvested in the
logarithmic phase of the growth curve. The Optical Density
(0D600,,,, ) of the culture at the moment of harvest will be
between 6-14. This value is normally obtained after incubation
for 3-6 days.
During fermentation pH is adjusted to 6.2-6.5 with sodium
hydroxide or phosphoric acid. Polypropylene glycol solution or
10% Pluronic (Polyoxyethylene-polyoxypropylene Block
Copolymer) is added automatically to control foaming.
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
34
The bacterial suspension is immediately inactivated.
P.sal.-04: Inactivation
Formaldehyde solution (35 per cent) is added to the culture to
a final concentration of 0.2% formaldehyde. The inactivant is
thoroughly mixed with the bacterial suspension, which is then
immediately transferred aseptically to the sterile inactivation
tank. The culture is kept at a temperature of 19 2 C during
a period of 90 minutes under continuous agitation.
The inactivated bacterial suspension is transferred aseptically
to the holding tank where the suspension is cooled.
P.sal.-05: Concentration
The inactivated P. salmonis suspension is concentrated by
continuous cross flow filtration followed by diafiltration, using
microfilters with a pore size of
0.2 urn.
During the processing all solutions in and out of the system
are monitored by weight. The control of this mass balance
ensures that the required concentration factor is achieved.
During the diafiltration (2-3 x with PBS) the ingredients of the
growth medium is partly substituted PBS.
The consistency is assured by the total protein measurement
after concentration. This total protein is used to calculate the
exact amount of concentrated antigen to be used in the
vaccine.
Example 8: Immunisation of fish, and challenge with Piscirickettsia
salmonis,
Vaccines
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
Piscirickettsia salmonis, isolate AL 10015 was grown in Sf900 II medium to an
OD
of 12.7 and inactivated with formalin. After inactivation, the antigen was
diafiltrated and concentrated against PBS, resulting in an antigen solution
with a
protein content of 17.9 mg/ml. The antigen was formulated in mineral oil
together
5 with inactivated Vibrio ordalii and Infectious Pancreatic Necrosis virus.
The
Piscirickettsia salmonis antigen dose was 2.2 mg/ml vaccine.
Vaccination and challenge trial
Groups of 50 fish with an average weight of 34.6 grams were immunized
10 intraperitoneally with a vaccine containing inactivated Piscirickettsia
salmonis,
Vibrio ordalii and Infectious Pancreatic Necrosis virus or phosphate buffered
saline
(PBS). The fish were kept at 12 C and challenged intraperitoneally after 45
days
with 1,33 x 104 TCID50 Piscirickettsia salmonis, isolate AL10007. The fish
were
followed for 42 days, and the number of mortalities in each group recorded.
Results
Figure 4 shows the cumulative % mortality of fish injected either with PBS or
with
a vaccine containing inactivated Piscirickettsia salmonis grown as described.
The
antigen was concentrated In the control group, 77.1% of the fish died, while
27.6
% of the fish died in the group vaccinated with a vaccine containing
inactivated
Piscirickettsia salmonis, Vibrio ordalii and Infectious Pancreatic Necrosis
virus. This
gives a relative % survival ({1-(%dead vaccinated group/% dead in control
group)}*100) in the vaccinated group of 64.2. This experiment clearly shows
that
a vaccine produced with Piscirickettsia salmonis produced as described in this
patent, mixed with other antigens reduced mortality against and elicits
protection
against piscirickettsiosis.
Example 9. Growth of Piscirickettsia salmonis on cystein heart agar
supplemented with 5% sheep blood.
AL 10005 was inoculated onto cystein heart agar supplemented with 5% sheep
blood. After one week incubation on 20 C, bacterial growth was observed as
whitish lines on the plates.
CA 02656032 2008-12-22
WO 2008/002152 PCT/N02007/000239
36
REFERENCES
"Affinity Chromatography; Principles and Methods", Edition AB, Published by
Amersham Pharmacia Biotech.
Birkbeck T. H. etal. 2004, Infection and Immunity, Vol 72, 6, 3693-3694.
Bravo S & Campos M, 1989, Fish Health Section Newsletter, American Fisheries
Society 17, 3.
Cvitanich, Garate & Smith, 1991, J. Fish Diseases, Vol. 14, 121-145.
Fryer J. L. et al., 1990, Fish Pathology, Vol. 25, 2, 107-114.
Fryer J. L. et al., 1992, International Journal of Systematic Bacteriology,
Vol. 42,
1, 120-126.
Godwin, G.P. and Whitford, W., 1993, Focus 15, 44.
House ML, Bartholomew JL, Winton JR and Fryer, 1999, Diseases of Aquatic
Organisms 35, 107-113.
Jan Raa, 1996, Reviews in Fisheries Science 4(3): 229-228
karber, G, 1931, Beitrag zur Kollektiven Behandlung Pharmakologischer
Reihenversuche. Arch. Exp. Pathol. Pharmakol. 162:480-483.
Kuzyk M. A. et al., 2001a, J. Mol. Microbiol. Biotechnol. Vol. 3, 1, 83-93.
Kuzyk M. A. et al., 2001b, Vaccine, Vol 19, 2337-2344.
Marshall S., Heath S., Henriquez V. & Orrego C., 1998, Minimally invasive
detection of Piscirickettsia salmonis in cultivated salmonids via the PCR.
App!.
Environ. Microbiol., 64, 3066-3069.
Mauel M. J., Giovannoni S.J. & Fryer J.L., 1996, Development of polymerase
chain
reaction assays for detection, identification, and differentiation of
Piscirickettsia
salmonis. Dis. Aquat. Org., 26, 189-195.
McCarthy U, Steiropoulos, Thompson KD, Adams A, Ellis AE and Ferguson
HW,2005, Diseases of Aquatic Organisms 64, 107-119.
"Protein purification methods; a practical approach" Eds. ELV Harris and S
Angal,
published in the Practical Approach Series, series editors D Rickwood & BD
Hames, IRL Press, Oxford 1989.
Rognes T, 2001, ParAlign: a parallel sequence alignment algorithm for rapid
and
sensitive database searches, Nucleic Acids Research, 29, 1647-1652.
Smith TF and Waterman MS, 1981, Identification of common molecular sub-
sequences.
Journal of Molecular Biology, 147, 195-197.
CA 02656032 2008-12-22
WO 2008/002152
PCT/N02007/000239
37
Smith PA, Lannan CN, Garces LH, Jarpa M, Larenas J, Caswell-Reno P, Whipple M
and Fryer JL, 1995, Bulletin of the European Fish Pathologists 15, 137-141.
Smith P. A., Contreras JR, Larenas 33, Aguillon JC,Garces LH, Perez B and
Fryer
JL, 1997, Dev. Biol. Stand. Vol. 90, 161-166.
World Organization for Animal Health as published in the Manual of Diagnostic
tests for Aquatic Animals 2003, part 2, section 2.1, chapter 2.1.13
