Note: Descriptions are shown in the official language in which they were submitted.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-1-
INTERLEUKIN-1 MUTEINS LINKED TO VIRUS-LIKE PARTICLES TO TREAT IL-1 ASSOCIATED
DISEASES
FIELD OF THE INVENTION
[0001] The present invention is in the fields of medicine, public health,
immunology,
molecular biology and virology. The invention provides compositions comprising
a virus-like
particle (VLP) or a virus particle and at least one antigen, wherein said
antigen is an
Interleukin-1 (IL-1) protein, an IL-1 fragment or peptide or an IL-1 mutein
covalently linked
to the VLP or the virus particle, wherein most preferably the antigen is an IL-
1 mutein,
preferably mutein of IL-1 beta or IL-1 alpha. The invention also provides a
process for
producing the compositions. The compositions of this invention are useful in
the production
of vaccines for the treatment of various human disorders, including rheumatoid
arthritis
osteoarthritis and others. The compositions of the invention hereby induce
efficient immune
responses, in particular antibody responses.
RELATED ART
[0002] IL-1 is a potent proinflammatory cytokine produced by various cell
types, including
macrophages, dendritic cells, B-cells and T-cells (Dinarello C.A., 1991. Blood
77(8):1627-
1652). It consists of two molecular species, IL-la and IL-1(3, which share
only limited
sequence identity but exert similar biological activities through binding to
IL-1 receptor type I
(IL-1RI) (Dinarello C.A. et al., 1997, Cytokine & Growth Factor Rev. 8:253).
Both IL-1
molecules also bind to a second IL-1 receptor (IL-1RII), which lacks the
intracellular
signalling domain, and is believed to play a regulatory role as a decoy
receptor (Dinarello
C.A. et al., 1997, Cytokine & Growth Factor Rev. 8:253). In addition, a third
member of the
IL-1 family, the IL-1 receptor antagonist (IL-lra), binds to both receptors
without exerting
any agonistic activity. IL-lra together with IL-1RII and the shed forms of IL-
1RI and IL-1RII
counteract the activity of IL-la and IL-l(3 and ensure a tight regulation of
the inflammatory
response.
[0003] A dysregulation of the IL-1-mediated inflammatory response is observed
in many
human disorders, including rheumatoid arthritis, inflammatory bowel disease,
kidney
diseases, osteoporosis and others. In each of these diseases either
overproduction of IL-1
and/or underproduction of IL-lra predisposes to the development of disease
(Arend W.P.,
2002, Cytokine & Growth Factor Reviews 13:323-340). A recombinant version of
IL-lra
(anakinra, Kineret(g) is efficacious in reducing inflammation and preventing
tissue damage in
several inflammatory disorders, but the need for high systemic concentrations
and the short
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-2-
half life of the drug require frequent (daily) administrations of high doses (-
100 mg),
resulting in high cost of goods and potential patient compliance problems
(Kineret
prescribing information, Amgen; Granowitz E.V. et al. 1992, Cytokine 4:353).
In addition, a
large proportion of patients develop antibodies against Kineret , which
potentially neutralize
the biological activity of the drug (Fleischmann R.M., et al., 2003, Arthritis
Rheum 46:2287).
[0004] New therapeutic techniques therefore focus on active immunization
strategies, which
induce the production of IL-1-neutralizing antibodies by the immune system of
the patient.
Svenson and co-workers (2000, J. Immunol. Methods 236:1-8) immunized mice with
recombinant IL-la chemically crosslinked to purified protein derivative of
tuberculin (PPD),
and observed the induction of antibodies which neutralized the biological
activity of IL-loa.
This strategy relies on the delivery of T-cell help to autoreactive B-cells by
physical linkage
of the self-antigen to a foreign antigen.
[0005] US patent 6,093,405 discloses a method of reducing the level of a
circulating
cytokine by immunization with an immunogenic composition containing the
chemically or
physically inactivated cytokine itself. Whereas in this method native
cytokines are rendered
immunogenic by physical or chemical treatment, the present invention discloses
a method for
making native cytokines immunogenic by presenting them in a highly repetitive
fashion on
the surface of VLPs. W02003/084979 furthermore describes the use of
immunogenic
compounds containing cytokine-derived peptides of 5-40 amino acids length for
the treatment
of diseases associated with an overproduction of cytokines.
SUMMARY OF THE INVENTION
[0006] We have, now, surprisingly found that the inventive compositions and
vaccines,
respectively, comprising at least one IL-1 molecule, preferably a IL-1 mutein,
are not only
capable of inducing immune responses against IL-l, and hereby in particular
antibody
responses, but are, furthermore, capable of neutralizing the pro-inflammatory
activity of IL-1
in vivo. In addition, we have surprisingly found that IL-1 molecule, when
covalently linked to
the VLP in accordance with the invention, can protect from inflammation and
from clinical
signs of arthritis in a mouse model of rheumatoid arthritis. Moreover, we have
found that the
inventive compositions protected mice better from the development of arthritis
symptoms
than the recombinant IL-1 receptor antagonist Kineret , which is approved for
the treatment
of human rheumatoid arthritis (Example 7). We surprisingly found that
compositions of the
invention were able to inhibit the development of atherosclerotic symptoms,
when injected
into genetically susceptible mice (Example 4) and therefore are an efficient
treatment for
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-3-
atherosclerosis. We also demonstrated that IL-1 a is involved in the
pathogenesis of
atherosclerosis. It was found that muteins of IL-1 beta and IL-1 alpha showing
reduced
biological activity can be obtained (Examples 11 and 16), and that such
muteins of IL-1 beta
are capable of inducing antibodies with neutralizing activity in vitro
(Example 12 D).
Furthermore, structurally similar regions of IL-1 beta and IL-1 alpha have
been identified
where mutations, especially amino acid exchanges or deletions, result in
muteins which are
useful in the context of the invention.
[0007] Thus, in one aspect, the present invention provides a composition which
comprises
(a) a virus-like particle (VLP) with at least one first attachment site; and
(b) at least one
antigen with at least one second attachment site, wherein said at least one
antigen an IL-1
molecule, preferably selected from the group consisting of IL-1 protein, IL-1
mature
fragment, IL-1 peptide and IL-1 mutein, wherein (a) and (b) are linked through
said at least
one first and said at least one second attachment site, preferably to form an
ordered and
repetitive antigen array. In preferred embodiments of the invention, the virus-
like particles
suitable for use in the present invention comprises recombinant protein,
preferably
recombinant coat protein, mutants or fragments thereof, of a virus, preferably
of an RNA
bacteriophage. In one preferred embodiment, the inventive composition
comprises at least one
IL-1 mature fragment, preferably comprising the biological activity of IL-l.
Thus, the present
invention uses the presentation of the self-antigen in a highly repetitive
fashion on virus-like
particles to stimulate autoreactive B-cells.
[0008] In a further aspect the invention provides a composition comprising (a)
a virus-like
particle (VLP) with at least one first attachment site; and (b) at least one,
preferably one,
antigen with at least one, preferably one, second attachment site; wherein
said at least one
antigen is an IL-1 mutein, and wherein said IL-1 mutein comprises at least
one, preferably
one, mutated amino acid sequence derived from a wild type amino acid sequence,
wherein
said wild type amino acid sequence is an IL-1 beta amino acid sequence
selected from the
group consisting of: (1) position 3 to 11 of SEQ ID NO:64; (2) position 46 to
56 of SEQ ID
NO:64; (3) position 88 to 109 of SEQ ID NO:64; and (4) position 143 to 153 of
SEQ ID
NO:64; or wherein said wild type amino acid sequence is an IL-1 alpha amino
acid sequence
selected from the group consisting of: (5) position 9 to 20 of SEQ ID NO:63;
(6) position 52
to 62 of SEQ ID NO:63; (7) position 94 to 113 of SEQ ID NO:63; and (8)
position 143 to 153
of SEQ ID NO:63; and wherein said at least one mutated amino acid sequence is
characterized by an amino acid exchange in one, two or three positions as
compared to said
wild type amino acid sequence it is derived from; or wherein said at least one
mutated amino
acid sequence is characterized by a deletion of one to four consecutive amino
acids of said
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-4-
wild type amino acid sequence it is derived from; and wherein (a) and (b) are
linked through
said at least one first and said at least one second attachment site. In a
preferred embodiment
said IL-1 mutein is an IL-1 beta mutein, wherein said IL-1 beta mutein
comprise or preferably
consist of a polypeptide having the amino acid sequence of SEQ ID NO:136. In a
further
preferred embodiment said IL-1 mutein is an IL-1 alpha mutein, wherein said IL-
1 alpha
mutein comprise or preferably consist of a polypeptide having the amino acid
sequence of
SEQ ID NO:210.
[0009] In another aspect, the present invention provides a vaccine
composition.
[0010] Furthermore, the present invention provides a method to administering
the vaccine
composition to a human or an animal, preferably a mammal. The inventive
vaccine
composition is capable of inducing strong immune response, in particular
antibody response,
typically and preferably without the presence of at least one adjuvant. Thus,
in one preferred
embodiment, the vaccine is devoid of an adjuvant. The avoidance of using
adjuvant may
reduce a possible occurrence of unwanted inflammatory T cell responses.
[0011] In one preferred embodiment, the VLP is a VLP of an RNA bacteriophage.
In a
further preferred embodiment said RNA bacteriophage is an RNA bacteriophage
selected
from the group consisting of: Q(3, fr, GA and AP2051n a further preferred
embodiment said
VLP of an RNA bacteriophage comprised by the composition and the vaccine
composition,
respectively, is recombinantly produced in a host and the VLP of an RNA
bacteriophage is
essentially free of host RNA, preferably host nucleic acid. It is advantageous
to reduce, or
preferably to eliminate, the amount of host RNA to avoid unwanted T cell
responses as well
as other unwanted side effects, such as fever.
[0012] In one aspect, the present invention provides a method of treating a
disease selected
from the group consisting of: (a) vascular diseases; (b) inherited IL-1-
dependent
inflammatory diseases; (c) chronic autoimmune inflammatory diseases; (d) bone
and cartilage
degenerative diseases; (e) allergic diseases; and (f) neurological disease; in
which diseases IL-
1 protein mediates, or contributes to the condition, wherein the method
comprises
administering the inventive composition or the invention vaccine composition,
respectively,
to an animal, preferably human. Diseases, in which IL-1 protein mediates, or
contributes to
the condition, are, for example, atherosclerosis, familial Mediterranean
fever, rheumatoid
arthritis, osteoarthritis, and allergy.
[0013] In a further aspect, the present invention provides a pharmaceutical
composition
comprising the inventive composition and an acceptable pharmaceutical carrier.
[0014] In again a further aspect, the present invention provides for a method
of producing
the composition of the invention comprising (a) providing a VLP with at least
one first
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-5-
attachment site; (b) providing at least one antigen, wherein said antigen is
an IL-1 molecule,
an IL-1 protein, an IL-1 mature fragment, an IL-1 peptide or an IL-1 mutein,
with at least one
second attachment site; and (c) combining said VLP and said at least one
antigen to produce
said composition, wherein said at least one antigen and said VLP are linked
through said at
least one first and said at least one second attachment sites.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1: Coupling of mIL-1(3119_269 protein to Q(3 capsid protein
[0015] Proteins were analyzed on a 12 % SDS-polyacrylamide gel under reducing
conditions. The gel was stained with Coomassie Brilliant Blue. Molecular
weights of marker
proteins are given in kDa on the left margin, identities of protein bands are
indicated on the
right margin. Lane 1: Pre stained protein marker (New England Biolabs). Lane
2: derivatized
Q(3 capsid protein. Lane 3: free reduced mIL-1(3119_269 protein. Lane 4: Q(3-
mIL-l(3119_269
coupling reaction.
Figure 2: Coupling of mIL-1a117_270 protein to Q(3 capsid protein
[0016] Proteins were analyzed on a 12 % SDS-polyacrylamide gel under reducing
conditions. The gel was stained with Coomassie Brilliant Blue. Molecular
weights of marker
proteins are given in kDa on the left margin, identities of protein bands are
indicated on the
right margin. Lane 1: Prestained protein marker (New England Biolabs). Lane 2:
derivatized
Q(3 capsid protein. Lane 3: free reduced mIL-lai17_270 protein. Lane 4: Q(3-
mIL-la117_27o
coupling reaction.
DETAILED DESCRIPTION OF THE INVENTION
[0017] Unless defined otherwise, all technical and scientific terms used
herein have the
same meanings as commonly understood by one of ordinary skill in the art to
which this
invention belongs.
[0018] Adjuvant: The term "adjuvant" as used herein refers to non-specific
stimulators of
the immune response or substances that allow generation of a depot in the host
which when
combined with the vaccine and pharmaceutical composition, respectively, of the
present
invention may provide for an even more enhanced immune response. Preferred
adjuvants are
complete and incomplete Freund's adjuvant, aluminum containing adjuvant,
preferably
aluminium hydroxide, and modified muramyldipeptide. Further preferred
adjuvants are
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-6-
mineral gels such as aluminum hydroxide, surface active substances such as
lysolecithin,
pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins,
dinitrophenol, and human adjuvants such as BCG (bacille Calmette Guerin) and
Corynebacterium parvum. Such adjuvants are also well known in the art. Further
adjuvants
that can be administered with the compositions of the invention include, but
are not limited to,
Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005,
Aluminum salts (Alum), MF-59, OM-174, OM-197, OM-294, and Virosomal adjuvant
technology. The adjuvants can also comprise a mixture of these substances. VLP
have been
generally described as an adjuvant. However, the term "adjuvant", as used
within the context
of this application, refers to an adjuvant not being the VLP used for the
inventive
compositions, rather it relates to an additional, distinct component.
[0019] Antigen: As used herein, the term "antigen" refers to a molecule
capable of being
bound by an antibody or a T-cell receptor (TCR) if presented by MHC molecules.
The term
"antigen", as used herein, also refers to T-cell epitopes. An antigen is
additionally capable of
being recognized by the immune system and/or being capable of inducing a
humoral immune
response and/or cellular immune response leading to the activation of B-
and/or T-
lymphocytes. This may, however, require that, at least in certain cases, the
antigen contains or
is linked to a Th cell epitope and is given in adjuvant. An antigen can have
one or more
epitopes (B- and T-epitopes). The specific reaction referred to above is meant
to indicate that
the antigen will preferably react, typically in a highly selective manner,
with its corresponding
antibody or TCR and not with the multitude of other antibodies or TCRs which
may be
evoked by other antigens. Antigens as used herein may also be mixtures of
several individual
antigens. The term "antigen" as used herein preferably refers to the IL-1
molecule, the IL-1
protein, IL-1 mature fragment, the IL-1 fragment, the IL-1 peptide and the IL-
1 mutein, most
preferably "antigen" refers to the IL-1 mutein. If not indicated otherwise,
the term "antigen"
as used herein does not refer to the virus-like particle.
[0020] epitope: The term epitope refers to continuous or discontinuous
portions of an
antigen, preferably a polypeptide, wherein said portions can be specifically
bound by an
antibody or by a T-cell receptor within the context of an MHC molecule. With
respect to
antibodies, specific binding excludes non-specific binding but does not
necessarily exclude
cross-reactivity. An epitope typically comprise 5-10 amino acids in a spatial
conformation
which is unique to the antigenic site.
[0021] Specific binding (antibody / antigen): Within this application,
antibodies are defined
to be specifically binding if they bind to the antigen with a binding affinity
(Ka) of 106 M-1 or
greater, preferably 107 M-1 or greater, more preferably 108 M-1 or greater,
and most preferably
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-7-
109 M-' or greater. The affinity of an antibody can be readily determined by
one of ordinary
skill in the art (for example by Scatchard analysis, by ELISA or by Biacore
analysis).
[0022] Specific binding (IL-1 / IL-1 receptor): The interaction between a
receptor and a
receptor ligand can be characterized by biophysical methods generally known in
the art,
including, for example, ELISA or Biacore analysis. An IL-1 molecule is
regarded as capable
of specifically binding an IL-1 receptor, when the binding affinity (Ka) of
said IL-1 to said
IL-1 receptor is at least 105 M-', preferably at least 106 M-', more
preferably at least 10' M-',
still more preferably at least 108 M-1, and most preferably at least 109 M-1;
wherein preferably
said IL-1 receptor is an IL-1 receptor from mouse or human, most preferably
human. Further
preferably, said IL-1 receptor comprises or more preferably consists of any
one of the
sequences SEQ ID NO:166 to SEQ ID NO:169, most preferably said IL-1 receptor
comprises
or preferably consists of any one of the sequences SEQ ID NO: 166 and SEQ ID
NO: 167.
[0023] Associated: The terms "associated" or "association" as used herein
refer to all
possible ways, preferably chemical interactions, by which two molecules are
joined together.
Chemical interactions include covalent and non-covalent interactions. Typical
examples for
non-covalent interactions are ionic interactions, hydrophobic interactions or
hydrogen bonds,
whereas covalent interactions are based, by way of example, on covalent bonds
such as ester,
ether, phosphoester, amide, peptide, carbon-phosphorus bonds, carbon-sulfur
bonds such as
thioether, or imide bonds.
[0024] Attachment Site, First: As used herein, the phrase "first attachment
site" refers to an
element which is naturally occurring with the VLP or which is artificially
added to the VLP,
and to which the second attachment site may be linked. The first attachment
site preferably is
a protein, a polypeptide, an amino acid, a peptide, a sugar, a polynucleotide,
a natural or
synthetic polymer, a secondary metabolite or compound (biotin, fluorescein,
retinol,
digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a chemically
reactive group such
as an amino group, a carboxyl group, a sulfhydryl group, a hydroxyl group, a
guanidinyl
group, histidinyl group, or a combination thereof. A preferred embodiment of a
chemically
reactive group being the first attachment site is the amino group of an amino
acid, preferably
of lysine. The first attachment site is located, typically on the surface, and
preferably on the
outer surface of the VLP. Multiple first attachment sites are present on the
surface, preferably
on the outer surface of virus-like particle, typically in a repetitive
configuration. In a preferred
embodiment the first attachment site is associated with the VLP, through at
least one covalent
bond, preferably through at least one peptide bond. In a further preferred
embodiment the first
attachment site is naturally occurring with the VLP. Alternatively, in a
preferred embodiment
the first attachment site is artificially added to the VLP.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-8-
[0025] Attachment Site, Second: As used herein, the phrase "second attachment
site" refers
to an element which is naturally occurring with or which is artificially added
to the IL-1
molecule and to which the first attachment site may be linked. The second
attachment site of
the IL-1 molecule preferably is a protein, a polypeptide, a peptide, an amino
acid, a sugar, a
polynucleotide, a natural or synthetic polymer, a secondary metabolite or
compound (biotin,
fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride),
or a chemically
reactive group such as an amino group, a carboxyl group, a sulfhydryl group, a
hydroxyl
group, a guanidinyl group, histidinyl group, or a combination thereof. A
preferred
embodiment of a chemically reactive group being the second attachment site is
the sulfliydryl
group, preferably of an amino acid cysteine. The term "IL-1 molecule with at
least one second
attachment site" refers, therefore, to a construct comprising the IL-1
molecule and at least one
second attachment site. However, in particular for a second attachment site,
which is not
naturally occurring within the IL-1 molecule, such a construct typically and
preferably further
comprises a "linker". In another preferred embodiment the second attachment
site is
associated with the IL-1 molecule through at least one covalent bond,
preferably through at
least one peptide bond. In a further embodiment, the second attachment site is
naturally
occurring within the IL-1 molecule. In another further preferred embodiment,
the second
attachment site is artificially added to the IL-1 molecule through a linker,
wherein said linker
comprises or alternatively consists of a cysteine. Preferably the linker is
fused to the IL-1
molecule by a peptide bond.
[0026] Coat protein: The term "coat protein" and the interchangeably used term
"capsid
protein" within this application, refers to a viral protein, preferably a
subunit of a natural
capsid of a virus, preferably of a RNA-phage, which is capable of being
incorporated into a
virus capsid or a VLP.
[0027] IL-1 molecule: The term "IL-1 molecule" or shortly "IL-1", as used
herein, refers to
any polypeptide having an amino acid sequence having at least 80 %, preferably
at least 90 %,
more preferably at least 95 %, even more preferably at least 99 % and most
preferably 100 %
sequence identity with any one of the sequences selected from the group
consisting of SEQ
ID NO:36 to SEQ ID NO:116, SEQ ID NO:130 to SEQ ID NO:140 and SEQ ID NO:163 to
SEQ ID NO:165. The term "IL-1-molecule", as used herein, preferably refers to
any IL-1
protein, IL-1 fragment, IL-1 mature fragment, IL-1 peptide or IL-1 mutein
comprising or
alternatively consisting of a polypeptide having an amino acid sequence having
at least 80 %,
preferably at least 90 %, more preferably at least 95 %, even more preferably
at least 99 %
and most preferably 100 % sequence identity with any one of the sequences
selected from the
group consisting of SEQ ID NO:36 to SEQ ID NO:116, SEQ ID NO:130 to SEQ ID
NO:140
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-9-
and SEQ ID NO:163 to SEQ ID NO:165. The term IL-1 molecule, as used herein,
also
typically and preferably refers to orthologs of IL-1 proteins of any animal
species. An IL-1
molecule is preferably, but not necessarily, capable of binding to the IL-1
receptor and further
preferably comprises biological activity.
[0028] IL-1 alpha molecule: The term "IL-1 alpha molecule" or shortly "IL-1
alpha", as
used herein, refers to an IL-1 alpha protein, IL-1 alpha fragment, IL-1 alpha
mature fragment,
IL-1 alpha peptide or IL-1 alpha mutein comprising or alternatively consisting
of an
polypeptide having an amino acid sequence having at least 80 %, preferably at
least 90 %,
more preferably at least 95 %, even more preferably at least 99 % and most
preferably 100 %
sequence identity with any one of the sequences selected from the group
consisting of SEQ
ID NO:36 to 48, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67 to SEQ ID BO:88, and
SEQ
ID NO:163. A specifically preferred embodiment of IL-1 alpha is human IL-1
alpha 119-271
(SEQ ID NO:63).
[0029] IL-1 beta molecule: The term "IL-1 beta molecule" or shortly "IL-1
beta", as used
herein, refers to an IL-1 beta protein, IL-1 beta fragment, IL-1 beta mature
fragment, IL-1
beta peptide or IL-1 beta mutein comprising or alternatively consisting of an
polypeptide
having an amino acid sequence having at least 80 %, preferably at least 90 %,
more preferably
at least 95 %, even more preferably at least 99 % and most preferably 100 %
sequence
identity with any one of the sequences selected from the group consisting of
SEQ ID NO:49
to SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:89 to SEQ ID NO:116,
SEQ
ID NO:130 to SEQ ID NO:140, SEQ ID NO:164, and SEQ ID NO:165. A specifically
preferred embodiment of IL-1 beta is human IL-1 beta 117-269 (SEQ ID NO:64).
[0030] IL-1 protein: The term "IL-1 protein", as used herein, refers to a
naturally occurring
protein, wherein said naturally occurring protein has an amino acid sequence
having at least
80 %, preferably at least 90 %, more preferably at least 95 %, even more
preferably at least
99 % and most preferably 100 % sequence identity with any one of SEQ ID NO:36
to SEQ ID
NO:62; or wherein said naturally occurring protein.is capable of binding the
IL-1 receptor and
preferably comprises biological activity. The term "IL-1 protein", as used
herein, preferably
refers to a naturally occurring protein, wherein said naturally occurring
protein has an amino
acid sequence having at least 80 %, preferably at least 90 %, more preferably
at least 95 %,
even more preferably at least 99 % and most preferably 100 % sequence identity
with any one
of SEQ ID NO:36 to SEQ ID NO:62; and wherein said naturally occurring
protein.is capable
of binding the IL-1 receptor and preferably comprises biological activity.
Typically and
preferably, the term "IL-1 protein", as used herein, refers to at least one
naturally occurring
protein, wherein said protein is capable of binding the IL-1 receptor and
comprises biological
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-10-
activity, and wherein further said protein comprises or alternatively consists
of a polypeptide
having an amino acid sequence having at least 80 %, preferably at least 90 %,
more preferably
at least 95 %, even more preferably at least 99 % and most preferably 100 %
sequence
identity with any one of SEQ ID NO:36 to SEQ ID NO:62. Accordingly, the term
"IL-1 alpha
protein" relates to an IL-1 protein comprising or alternatively consisting of
a polypeptide
having an amino acid sequence having at least 80 %, preferably at least 90 %,
more preferably
at least 95 %, even more preferably at least 99 % and most preferably 100 %
sequence
identity with any one of SEQ ID NO:36 to SEQ ID NO:48, whereas the term "IL-1
beta
protein" relates to an IL-1 protein comprising or alternatively consisting of
a polypeptide
having an amino acid sequence having at least 80 %, preferably at least 90 %,
more preferably
at least 95 %, even more preferably at least 99 % and most preferably 100 %
sequence
identity with any one of SEQ ID NO:49 to SEQ ID NO:62.
[0031] IL-1 fragment: The term "IL-1 fragment", as used herein, relates to a
polypeptide
comprising a consecutive stretch of an IL-1 protein, wherein said polypeptide
is at least 50,
preferably at least 100, most preferably at least 150 amino acids in length.
Typically and
preferably said IL-1 fragment is at most 300, more preferably at most 250, and
most
preferably at most 200 amino acids in length. Typically and preferably, IL-1
fragments are
capable of binding the IL-1 receptor and further preferably comprises
biological activity.
Accordingly, the terms "IL-1 alpha fragment" and "IL-1 beta fragment" relate
to an IL-1
fragment as defined, wherein said IL-1 protein is an IL-1 alpha protein or an
IL-1 beta
protein, respectively.
[0032] IL-1 mature fragment: The term "IL-1 mature fragment", as used herein,
relates to a
IL-1 fragment, wherein said IL-1 fragment is a naturally occurring maturation
product of an
IL-1 protein. Accordingly, the terms "IL-1 alpha mature fragment" and "IL-1
beta mature
fragment", as used herein relate to IL-1 mature fragments as defined, wherein
said IL-1
protein is an IL-1 alpha protein or an IL-1 beta protein, respectively.
Preferred embodiments
of IL-1 alpha mature fragments are SEQ ID NO:63, SEQ ID NO:65 and SEQ ID
NO:163.
Preferred embodiments of IL-1 beta mature fragments are SEQ ID NO:64, SEQ ID
NO:66,
SEQ ID NO:130, SEQ ID NO:164, and SEQ ID NO:165.
[0033] Preferred IL-1 alpha mature fragments comprise or preferably consist of
an amino
acid sequence selected from the group consisting of: (a) human IL-1 alpha 119-
271 (SEQ ID
NO:63); (b) mouse IL-1 alpha 117-270 (SEQ ID NO:65); (c) mouse IL-1 alpha 117-
270s
(SEQ ID NO:163); and (e) an amino acid sequence which is at least 80 %, or
preferably at
least 90 %, more preferably at least 95 %, or most preferably at least 99 %
identical with any
one of SEQ ID NO:63, SEQ ID NO:65 and SEQ ID NO:163.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-11-
[0034] Preferred IL-1 beta mature fragments comprise or preferably consist of
an amino
acid sequence selected from the group consisting of: (a) human IL-1 beta 117-
269 (SEQ ID
NO:64); (b) human IL-1 beta 116-269 (SEQ ID NO:165); (c) mouse IL-1 beta 119-
269 (SEQ
ID NO:66); (d) mouse IL-1 beta 119-269s (SEQ ID NO:164); and (e) an amino acid
sequence
which is at least 80 %, or preferably at least 90 %, more preferably at least
95 %, or most
preferably at least 99 % identical with any one of SEQ ID NO:64, SEQ ID NO:66,
SEQ ID
NO:164 and SEQ ID NO:165.
[0035] IL-1 peptide: The term "IL-1 peptide", as used herein, relates to a
polypeptide
comprising a consecutive stretch of a naturally occurring protein, wherein
said protein is
capable of binding the IL-1 receptor and preferably comprises biological
activity, wherein
said polypeptide is 4 to 49, preferably 6 to 35, most preferably 10 to 25
amino acids in length.
The IL-1 peptide may be, but typically is not, capable of binding the IL-1
receptor and
typically has no biological activity. Accordingly, the terms "IL-1 alpha
peptide" and "IL-1
beta peptide", as used herein relate to IL-1 peptides as defined, wherein said
naturally
occurring protein is an IL-1 alpha protein or an IL-1 beta protein,
respectively. Preferred IL-1
peptides are SEQ ID NO:82 to SEQ ID NO:116.
[0036] IL-1 mutein: The term "IL-1 mutein" as used herein comprise or
preferably consist
of any polypeptide derived from an IL-1 molecule, preferably from an IL-1
alpha or an IL-1
beta protein, an IL-1 alpha or an IL-1 beta fragment, an IL-1 alpha or an IL-1
beta mature
fragment or an IL-1 alpha or an IL-1 beta peptide, wherein preferably said
polypeptide
exhibits reduced biological activity as compared to the IL-1 molecule it is
derived from.
Accordingly, IL-1 alpha muteins and IL-1 beta muteins are IL-1 muteins as
defined, wherein
said polypeptide is derived from an IL-1 alpha molecule or an IL-1 beta
molecule,
respectively. Very preferred IL-1 beta muteins are IL-1 beta muteins derived
from IL-1 beta
mature fragments, preferably from human IL-1(3117_269 (SEQ ID NO:64). Very
preferred IL-1
alpha muteins are derived from IL-1 alpha mature fragments, preferably from
human IL-1
a119_271 (SEQ ID NO:63).
[0037] In preferred IL-1 muteins, said biological activity is less than 80 %,
more preferably
less than 60 %, still more preferably less than 40 %, still more preferably
less than 20 % of
the biological activity of the IL-1 molecule it is derived from, wherein
further preferably said
biological activity is determined by the capacity of said IL-1 mutein to
induce IL-6 in human
PBMCs, wherein most preferably said biological activity is determined
essentially as
described in Example 11 B.
[0038] In preferred IL-1 beta muteins, said biological activity is less than
80 %, more
preferably less than 60 %, still more preferably less than 40 %, still more
preferably less than
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-12-
20 % of the biological activity of the IL-1 beta molecule it is derived from,
wherein
preferably said IL-1 beta molecule is an IL-1 beta mature fragment, preferably
human IL-
1(3117_269 (SEQ ID NO:64), and wherein further preferably said biological
activity is
determined by the capacity of said IL-1 beta mutein to induce IL-6 in human
PBMCs,
wherein most preferably said biological activity is determined essentially as
described in
Example 11 B.
[0039] In preferred IL-1 alpha muteins, said biological activity is less than
80 %, more
preferably less than 60 %, still more preferably less than 40 %, still more
preferably less than
20 % of the biological activity of the IL-1 alpha molecule it is derived from,
wherein
preferably said IL-1 alpha molecule is an IL-1 alpha mature fragment,
preferably human
human IL-1 a119_271 (SEQ ID NO:63), and wherein further preferably said
biological activity
is determined by the capacity of said IL-1 alpha mutein to induce IL-6 in
human PBMCs,
wherein most preferably said biological activity is determined essentially as
described in
Example 16.
[0040] Further preferred IL-1 muteins are derived from an IL-1 mature
fragment, wherein
the biological activity of said IL-1 mutein is less than 80 %, more preferably
less than 60 %,
still more preferably less than 40 %, still more preferably less than 20 % of
the biological
activity of the IL-1 mature fragment said IL-1 mutein is derived from. Very
preferred IL-1
muteins do not exhibit biological activity.
[0041] Further preferably, but not necessarily, IL-1 muteins are capable of
specifically
binding an IL-1 receptor.
[0042] When introduced into an animal, compositions of the invention
comprising a
preferred IL-1 mutein as the sole antigen induce a titer of antibodies capable
of specifically
binding the IL-1 molecule said IL-1 mutein is derived from, wherein said titer
is at least 20 %,
preferably at least 40 %, still more preferably at least 60 %, still more
preferably at least 80 %
and most preferably at least 100 % of the titer obtained with a composition
comprising the IL-
1 molecule said IL-1 mutein is derived from as the sole antigen, wherein
preferably said titer
is determined essentially as described in Example 12 D.
[0043] When introduced into an animal, compositions of the invention
comprising a
preferred IL-1 beta mutein as the sole antigen induce a titer of antibodies
capable of
specifically binding the IL-1 beta molecule said IL-1 beta mutein is derived
from, wherein
preferably said IL-1 beta molecule is an IL-1 beta mature fragment, most
preferably human
IL-1(3117_269 (SEQ ID NO:64), wherein said titer is at least 20 %, preferably
at least 40 %, still
more preferably at least 60 %, still more preferably at least 80 % and most
preferably at least
100 % of the titer obtained with a composition comprising the IL-1 beta
molecule said IL-1
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
- 13 -
beta mutein is derived from, preferably said IL-1 beta mature fragment, most
preferably said
human IL-1(3117_269 (SEQ ID NO:64) as the sole antigen, wherein further
preferably said titer
is determined essentially as described in Example 12 D.
[0044] When introduced into an animal, compositions of the invention
comprising a
preferred IL-1 alpha mutein as the sole antigen induce a titer of antibodies
capable of
specifically binding the IL-1 alpha molecule said IL-1 alpha mutein is derived
from, wherein
preferably said IL-1 alpha molecule is an IL-1 alpha mature fragment, most
preferably human
IL-1 a119_271 (SEQ ID NO:63), wherein said titer is at least 20 %, preferably
at least 40 %, still
more preferably at least 60 %, still more preferably at least 80 % and most
preferably at least
100 % of the titer obtained with a composition comprising the IL-1 alpha
molecule said IL-1
alpha mutein is derived from, preferably said IL-1 alpha mature fragment, most
preferably
said human IL-1 aii9_271 (SEQ ID NO:63)as the sole antigen, wherein further
preferably said
titer is determined essentially as described in Example 12 D.
[0045] A very preferred are IL-1 mutein is an IL-1 mutein, wherein said
biological activity
is less than 80 %, more preferably less than 60 %, still more preferably less
than 40 %, still
more preferably less than 20 % of the biological activity of the IL-1 molecule
it is derived
from, wherein further preferably said biological activity is determined by the
capacity of said
IL-1 mutein to induce IL-6 in human PBMCs, wherein most preferably said
biological
activity is determined essentially as described in Example 11 B, and wherein
additionally
compositions of the invention comprising said very preferred IL-1 mutein as
the sole antigen
induce a titer of antibodies capable of specifically binding the IL-1 molecule
said very
preferred IL-1 mutein is derived from, wherein said titer is at least 20 %,
preferably at least 40
%, still more preferably at least 60 %, still more preferably at least 80 %
and most preferably
at least 100 % of the titer obtained with a composition comprising the IL-1
molecule said very
preferred IL-1 mutein is derived from as the sole antigen, wherein preferably
said titer is
determined essentially as described in Example 12 D.
[0046] Very preferred are IL-1 muteins derived from (i) an IL-1 protein,
preferably from
SEQ ID NO:36 to SEQ ID NO:62; or (ii) more preferably of an IL-1 mature
fragment,
preferably from any one of SEQ ID NO:63 to SEQ ID NO:66, SEQ ID NO:130, and
SEQ ID
NO:163 to SEQ ID NO:165.
[0047] IL-1 muteins useful in the context have been described in Kamogashira
et al. (1988)
J. Biochem. 104:837-840; Gehrke et al. (1990) The Journal of Biological
Chemistry
265(11):5922-5925; Conca et al. (1991) The Journal of Biological Chemistry
266(25):16265-
16268;Ju et al. (1991) PNAS 88:2658-2662; Auron et al. (1992) Biochemistry
31:6632-6638;
Guinet et al. (1993) Eur. J. Biochem 211:583-590; Camacho (1993) Biochemistry
32:8749-
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-14-
8757; Baumann (1993) Journal of Recepror Research 13(1-4):245-262; Simon
(1993) The
Journal of Biological Chemistry 268(13):9771-9779; and Simoncsits (1994)
Cytokine
6(2):206-214, the disclosure of which is incorporated herein by reference.
[0048] Preferred IL-1 muteins comprise or preferably consist of a polypeptide
having an
amino acid sequence which differs from the amino acid sequence of an IL-1
protein, an IL-1
fragment, an IL-1 mature fragment or an IL-1 peptide in 1 to 10, preferably 1
to 6, more
preferably 1 to 5, still more preferably 1 to 4, still more preferably 1 to 3,
still more preferably
1 to 2, and most preferably in exactly 1 amino acid residue(s), wherein
preferably said amino
acid residue(s) are (i) deleted from said polypeptide, (ii) inserted into said
polypeptide, (iii)
exchanged by another amino acid residue, or (iv) any combination of (i) to
(iii). In a preferred
embodiment, said amino acid residues are in one consecutive stretch. Further
preferred IL-1
muteins comprise or preferably consist of a polypeptide having an amino acid
sequence which
differs from the amino acid sequence of an IL-1 protein, an IL-1 fragment, or
an IL-1 mature
fragment, preferably of an IL-1 mature fragment, in 1 to 10, preferably 1 to
6, more preferably
1 to 5, still more preferably 1 to 4, still more preferably 1 to 3, still more
preferably 1 to 2,
and most preferably in exactly 1 amino acid residue(s), wherein preferably
said amino acid
residue(s) are (i) deleted from said polypeptide, (ii) inserted into said
polypeptide, (iii)
exchanged by another amino acid residue, or (iv) any combination of (i) to
(iii).
[0049] Further preferred IL-1 muteins comprise or more preferably consist of a
polypeptide
having an amino acid sequence which differs from the amino acid sequence of
any one of
SEQ ID NO:36 to SEQ ID NO:48 or SEQ ID NO:49 to SEQ ID NO:62 in 1 to 10,
preferably
1 to 6, more preferably 1 to 5, still more preferably 1 to 4, still more
preferably 1 to 3, still
more preferably 1 to 2, and most preferably in exactly 1 amino acid
residue(s), wherein
preferably said amino acid residue(s) are (i) deleted from said polypeptide,
(ii) inserted into
said polypeptide, (iii) exchanged by another amino acid residue, or (iv) any
combination of (i)
to (iii). Further preferred IL-1 muteins comprise or preferably consist of a
polypeptide having
an amino acid sequence which differs from the amino acid sequence selected
from the group
consisting of (i) any one of SEQ ID NO:63, SEQ ID NO:65, and SEQ ID NO:163,
most
preferably SEQ ID NO:63; or (ii) of any one selected from the group consisting
of SEQ ID
NO:64, SEQ ID NO:66, SEQ ID NO:130, SEQ ID NO:164, and SEQ ID NO:165, most
preferably SEQ ID NO:64 in 1 to 10, preferably 1 to 6, more preferably 1 to 5,
still more
preferably 1 to 4, still more preferably 1 to 3, still more preferably 1 to 2,
and most preferably
in exactly 1 amino acid residue(s), wherein preferably said amino acid
residue(s) are (i)
deleted from said polypeptide, (ii) inserted into said polypeptide, (iii)
exchanged by another
amino acid residue, or (iv) any combination of (i) to (iii).
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-15-
[0050] Further preferred IL-1 muteins are IL-1 alpha muteins, wherein said IL-
1 alpha
muteins comprise or more preferably consist of a polypeptide having an amino
acid sequence
which differs from the amino acid sequence of any one of SEQ ID NO:36 to SEQ
ID NO:48
in 1 to 6, preferably 1 to 5, more preferably 1 to 4, still more preferably 1
to 3, still more
preferably 1 to 2, and most preferably in exactly 1 amino acid residue(s),
wherein preferably
said amino acid residue(s) are (i) deleted from said polypeptide, (ii)
inserted into said
polypeptide, (iii) exchanged by another amino acid residue, or (iv) any
combination of (i) to
(iii). Further preferred IL-1 alpha muteins comprise or preferably consist of
a polypeptide
having an amino acid sequence which differs from the amino acid sequence
selected from the
group consisting of (i) any one of SEQ ID NO:63, SEQ ID NO:65, and SEQ ID
NO:163, most
preferably SEQ ID NO:63, in 1 to 6, preferably 1 to 5, more preferably 1 to 4,
still more
preferably 1 to 3, still more preferably 1 to 2, and most preferably in
exactly 1 amino acid
residue(s), wherein preferably said amino acid residue(s) are (i) deleted from
said
polypeptide, (ii) inserted into said polypeptide, (iii) exchanged by another
amino acid residue,
or (iv) any combination of (i) to (iii). Very preferred IL-1 alpha muteins
comprise or
preferably consist of a polypeptide having an amino acid sequence which
differs from the
amino acid sequence of SEQ ID NO:63 in 1 to 10, preferably 1 to 6, more
preferably 1 to 5,
still more preferably 1 to 4, still more preferably 1 to 3, still more
preferably 1 to 2, and most
preferably in exactly 1 amino acid residue(s), wherein preferably said amino
acid residue(s)
are (i) deleted from said polypeptide, (ii) inserted into said polypeptide,
(iii) exchanged by
another amino acid residue, or (iv) any combination of (i) to (iii). Still
more preferred IL-1
alpha muteins comprise or preferably consist of a polypeptide having an amino
acid sequence
selected from any one of the group consisting of SEQ ID NO:210 to SEQ ID
NO:218.
[0051] Further preferred IL-1 muteins are IL-1 beta muteins, wherein said IL-1
beta muteins
comprise or more preferably consist of a polypeptide having an amino acid
sequence which
differs from the amino acid sequence of any one of SEQ ID NO:49 to SEQ ID
NO:62 in 1 to
6, preferably 1 to 5, more preferably 1 to 4, still more preferably 1 to 3,
still more preferably 1
to 2, and most preferably in exactly 1 amino acid residue(s), wherein
preferably said amino
acid residue(s) are (i) deleted from said polypeptide, (ii) inserted into said
polypeptide, (iii)
exchanged by another amino acid residue, or (iv) any combination of (i) to
(iii). Further
preferred IL-1 beta muteins comprise or preferably consist of a polypeptide
having an amino
acid sequence which differs from the amino acid sequence selected from the
group consisting
of SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:130, SEQ ID NO:164, and SEQ ID
NO:165,
most preferably SEQ ID NO:64, in 1 to 6, preferably 1 to 5, more preferably 1
to 4, still more
preferably 1 to 3, still more preferably 1 to 2, and most preferably in
exactly 1 amino acid
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-16-
residue(s), wherein preferably said amino acid residue(s) are (i) deleted from
said
polypeptide, (ii) inserted into said polypeptide, (iii) exchanged by another
amino acid residue,
or (iv) any combination of (i) to (iii). Very preferred IL-1 beta muteins
comprise or preferably
consist of a polypeptide having an amino acid sequence which differs from the
amino acid
sequence of SEQ ID NO:64 in 1 to 10, preferably 1 to 6, more preferably 1 to
5, still more
preferably 1 to 4, still more preferably 1 to 3, still more preferably 1 to 2,
and most preferably
in exactly 1 amino acid residue(s), wherein preferably said amino acid
residue(s) are (i)
deleted from said polypeptide, (ii) inserted into said polypeptide, (iii)
exchanged by another
amino acid residue, or (iv) any combination of (i) to (iii). Still more
preferred IL-1 beta
muteins comprise or preferably consist of a polypeptide having an amino acid
sequence
selected from any one of the group consisting of SEQ ID NO:131 to SEQ ID
NO:140 and
SEQ ID NO:205 to SEQ ID NO:209.
[0052] "derived from": in the context of the invention the expression an amino
acid
sequence which is derived from another amino acid sequence means that said
amino acid
sequence is essentially identical with the amino acid sequence it is derived
from, with the
exception of certain mutations, wherein said mutations are selected from the
group consisting
of (i) amino acid exchanges, (ii) deletions, (iii) insertions, and (iv) any
combination of (i) to
(iii), wherein preferably said mutations are selected from (i) amino acid
exchanges and (ii)
deletions. In particular, a mutated amino acid sequence derived from a wild
type amino acid
sequence preferably differs from said wild type amino acid sequence in 1 to
10, preferably 1
to 6, more preferably 1 to 5, still more preferably 1 to 4, still more
preferably 1 to 3, still more
preferably 1 to 2, and most preferably in exactly 1 amino acid residue(s),
wherein preferably
said amino acid residue(s) are (i) exchanged by another amino acid, (ii)
deleted from said wild
type amino acid, (iii) inserted into said wild type sequence, and (iv) any
combination of (i) to
(iii), wherein most preferably said amino acid residue(s) are (i) exchanged by
another amino
acid, or (ii) deleted from said wild type amino acid. Deletions of more than
one amino acid
residue preferably occur as a deletion of a consecutive stretch of amino acid
residues of said
wild type amino acid sequence. A mutated amino acid sequence which is derived
from a wild
type amino acid sequence preferably has at least 90 %, 91 %, 92 %, 93 %, 94 %,
95 %, 96 %,
97 %, 98 %, and most preferably at least 99 % sequence identity with said wild
type amino
acid sequence.
[0053] Similarly, the expression "mutein derived from a IL-1 molecule" refers
to a mutein,
wherein said mutein comprises or preferably consists of a polypeptide having
an amino acid
sequence which is essentially identical to that of the IL-1 molecule it is
derived from, with the
exception of certain mutations, wherein said mutations are selected from the
group consisting
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-17-
of (i) amino acid exchanges, (ii) deletions, (iii) insertions, and (iv) any
combination of (i) to
(iii), wherein preferably said mutations are selected from (i) amino acid
exchanges and (ii)
deletions. In particular, an IL-1 mutein derived from an IL-1 molecule differs
from said IL-1
molecule in 1 to 10, preferably 1 to 6, more preferably 1 to 5, still more
preferably 1 to 4, still
more preferably 1 to 3, still more preferably 1 to 2, and most preferably in
exactly 1 amino
acid residue(s), wherein preferably said amino acid residue(s) are (i)
exchanged by another
amino acid, (ii) deleted from said wild type amino acid, (iii) inserted into
said wild type
sequence, and (iv) any combination of (i) to (iii), wherein most preferably
said amino acid
residue(s) are (i) exchanged by another amino acid, or (ii) deleted from said
wild type amino
acid. Deletions of more than one amino acid residue preferably occur as a
deletion of a
consecutive stretch of amino acid residues of the IL-1 molecule said IL-1
mutein is derived
from. A mutein derived from a wild type amino acid sequence preferably has at
least 90 %, 91
%, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, and most preferably at least 99 %
sequence
identity with the IL-1 molecule said IL-1 mutein is derived from.
[0054] Amino acid exchange: the expression amino acid exchange refers to the
exchange of
an amino acid residue in a certain position of an amino acid sequence by any
other amino acid
residue.
[0055] Agonistic effect/biological activity of the IL-l: The terms "biological
activity" or
"biologically active" as used herein with respect to IL-1 refer to the ability
of the IL-1
molecule to induce the production of IL-6 after systemical administration into
animals,
preferably as outlined in Example 2 E. and in Example 3 E. By biological
activity of the IL-1
molecule is also meant the ability to induce the proliferation of thymocytes
(Epps et al.,
Cytokine 9(3):149-156 (1997), D10.G4.1 T helper cells (Orencole and Dinarello,
Cytokine
1(1):14-22 (1989), or the ability to induce the production of IL-6 from MG64
or HaCaT cells
(Boraschi et al., J. Immunol. 155:4719-4725 (1995) or fibroblasts (Dinarello
et al., Current
Protocols in Immunology 6.2.1-6-2-7 (2000)), or the production of IL-2 from EL-
4 thymoma
cells (Simon et al., J. Immunol. Methods 84(1-2):85-94 (1985)), or the ability
to inhibit the
growth of the human melanoma cell line A375 (Nakai et al., Biochem. Biophys.
Res.
Commun. 154:1189-1196 (1988)). Very preferably, the term biological activity
of an IL-1
molecule or an IL-1 mutein refers to the capacity of a composition of the
invention
comprising said IL-1 molecule or said IL-1 mutein to induce IL-6 in human
PBMCs, wherein
preferably said IL-1 molecule or said IL-1 mutein is the sole antigen in said
composition, and
wherein most preferably said biological activity is determined essentially as
described in
Example 11 B.
[0056] Linked: The terms "linked" or "linkage" as used herein, refer to all
possible ways,
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
- 18-
preferably chemical interactions, by which the at least one first attachment
site and the at least
one second attachment site are joined together. Chemical interactions include
covalent and
non-covalent interactions. Typical examples for non-covalent interactions are
ionic
interactions, hydrophobic interactions or hydrogen bonds, whereas covalent
interactions are
based, by way of example, on covalent bonds such as ester, ether,
phosphoester, amide,
peptide, carbon-phosphorus bonds, carbon-sulfur bonds such as thioether, or
imide bonds. In
certain preferred embodiments the first attachment site and the second
attachment site are
linked through at least one covalent bond, preferably through at least one non-
peptide bond,
and even more preferably through exclusively non-peptide bond(s). The term
"linked" as used
herein, however, shall not only refer to a direct linkage of the at least one
first attachment site
and the at least one second attachment site but also, alternatively and
preferably, an indirect
linkage of the at least one first attachment site and the at least one second
attachment site
through intermediate molecule(s), and hereby typically and preferably by using
at least one,
preferably one, heterobifunctional cross-linker. In other preferred
embodiments the first
attachment site and the second attachment site are linked through at least one
covalent bond,
preferably through at least one peptide bond, and even more preferably through
exclusively
peptide bond(s). In a very preferred embodiment the first attachment site and
the second
attachment site are linked exclusively by peptide bounds, preferably by
genetic fusion, either
directly, or, preferably, via an amino acid linker. In a further preferred
embodiment the
second attachment site is linked to the C-terminus of said first attachment
site exclusively by
peptide bounds, preferably by genetic fusion.
[0057] Linker: A "linker", as used herein, either associates the second
attachment site with
the IL-1 molecule or already comprises, essentially consists of, or consists
of the second
attachment site. Preferably, a "linker", as used herein, already comprises the
second
attachment site, typically and preferably - but not necessarily - as one amino
acid residue,
preferably as a cysteine residue. A "linker" as used herein is also termed
"amino acid linker",
in particular when a linker according to the invention contains at least one
amino acid residue.
Thus, the terms "linker" and "amino acid linker" are interchangeably used
herein. However,
this does not imply that such a linker consists exclusively of amino acid
residues, even if a
linker consisting of amino acid residues is a preferred embodiment of the
present invention.
The amino acid residues of the linker are, preferably, composed of naturally
occurring amino
acids or unnatural amino acids known in the art, all-L or all-D or mixtures
thereof. Further
preferred embodiments of a linker in accordance with this invention are
molecules comprising
a sulfliydryl group or a cysteine residue and such molecules are, therefore,
also encompassed
within this invention. Further linkers useful for the present invention are
molecules
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-19-
comprising a Cl-C6 alkyl-, a cycloalkyl such as a cyclopentyl or cyclohexyl, a
cycloalkenyl,
aryl or heteroaryl moiety. Moreover, linkers comprising preferably a Cl-C6
alkyl-,
cycloalkyl- (C5, C6), aryl- or heteroaryl- moiety and additional amino acid(s)
can also be
used as linkers for the present invention and shall be encompassed within the
scope of the
invention. Association of the linker with the IL-1 molecule is preferably by
way of at least
one covalent bond, more preferably by way of at least one peptide bond. In the
context of
linkage by genetic fusion, a linker may be absent or preferably is an amino
acid linker, more
preferably an amino acid linker consisting exclusively of amino acid residues.
Very preferred
linkers for genetic fusion are flexible amino acid linkers. In the context of
linkage by genetic
fusion linkers preferred consist of 1 to 20, more preferably of 2 to 15, still
more preferably of
2 to 10, still more preferably of 2 to 5, and most preferably of 3 amino
acids. Very preferred
linkers for genetic fusion comprise or preferably consist of GSG (SEQ ID NO:
189).
[0058] Ordered and repetitive antigen array: As used herein, the term "ordered
and repetitive
antigen array" generally refers to a repeating pattern of antigen or,
characterized by a typically
and preferably high order of uniformity in spacial arrangement of the antigens
with respect to
virus-like particle, respectively. In one embodiment of the invention, the
repeating pattern
may be a geometric pattern. Certain embodiments of the invention, such as
antigens coupled
to the VLP of RNA bacteriophages, are typical and preferred examples of
suitable ordered
and repetitive antigen arrays which, moreover, possess strictly repetitive
paracrystalline
orders of antigens, preferably with spacing of 1 to 30 nanometers, preferably
2 to 15
nanometers, even more preferably 2 to 10 nanometers, even again more
preferably 2 to 8
nanometers, and further more preferably 1.6 to 7 nanometers.
[0059] Packaged: The term "packaged" as used herein refers to the state of a
polyanionic
macromolecule or immunostimulatory substances in relation to the VLP. The term
"packaged" as used herein includes binding that may be covalent, e.g., by
chemically
coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions,
hydrogen bonds,
etc. The term also includes the enclosement, or partial enclosement, of a
polyanionic
macromolecule. Thus, the polyanionic macromolecule or immunostimulatory
substances can
be enclosed by the VLP without the existence of an actual binding, in
particular of a covalent
binding. In preferred embodiments, the at least one polyanionic macromolecule
or
immunostimulatory substances is packaged inside the VLP, most preferably in a
non-covalent
manner. In case said immunostimulatory substances is nucleic acid, preferably
a DNA, the
term packaged implies that said nucleic acid is not accessible to nucleases
hydrolysis,
preferably not accessible to DNAse hydrolysis (e.g. DNasel or Benzonase),
wherein
preferably said accessibility is assayed as described in Examples 11-17 of
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-20-
W02003/024481A2.
[0060] Polypeptide: The term "polypeptide" as used herein refers to a molecule
composed
of monomers (amino acids) linearly linked by amide bonds (also known as
peptide bonds). It
indicates a molecular chain of amino acids and does not refer to a specific
length of the
product. Thus, peptides, dipeptides, tripeptides, oligopeptides and proteins
are included within
the definition of polypeptide. Post-translational modifications of the
polypeptide, for example,
glycosylations, acetylations, phosphorylations, and the like are also
encompassed.
[0061] Recombinant VLP: The term "recombinant VLP", as used herein, refers to
a VLP
that is obtained by a process which comprises at least one step of recombinant
DNA
technology. The term "VLP recombinantly produced", as used herein, refers to a
VLP that is
obtained by a process which comprises at least one step of recombinant DNA
technology.
Thus, the terms "recombinant VLP" and "VLP recombinantly produced" are
interchangeably
used herein and should have the identical meaning.
[0062] Virus particle: The term "virus particle" as used herein refers to the
morphological
form of a virus. In some virus types it comprises a genome surrounded by a
protein capsid;
others have additional structures (e.g., envelopes, tails, etc.).
[0063] Virus-like particle (VLP), as used herein, refers to a non-replicative
or non-
infectious, preferably a non-replicative and non-infectious virus particle, or
refers to a non-
replicative or non-infectious, preferably a non-replicative and non-infectious
structure
resembling a virus particle, preferably a capsid of a virus. The term "non-
replicative", as used
herein, refers to being incapable of replicating the genome comprised by the
VLP. The term
"non-infectious", as used herein, refers to being incapable of entering the
host cell. Preferably
a virus-like particle in accordance with the invention is non-replicative
and/or non-infectious
since it lacks all or part of the viral genome or genome function. In one
embodiment, a virus-
like particle is a virus particle, in which the viral genome has been
physically or chemically
inactivated. Typically and more preferably a virus-like particle lacks all or
part of the
replicative and infectious components of the viral genome. A virus-like
particle in accordance
with the invention may contain nucleic acid distinct from their genome. A
typical and
preferred embodiment of a virus-like particle in accordance with the present
invention is a
viral capsid such as the viral capsid of the corresponding virus,
bacteriophage, preferably
RNA bacteriophage. The terms "viral capsid" or "capsid", refer to a
macromolecular
assembly composed of viral protein subunits. Typically, there are 60, 120,
180, 240, 300, 360
and more than 360 viral protein subunits. Typically and preferably, the
interactions of these
subunits lead to the formation of viral capsid or viral-capsid like structure
with an inherent
repetitive organization, wherein said structure is, typically, spherical or
tubular. For example,
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-21-
the capsids of RNA bacteriophages or HBcAgs have a spherical form of
icosahedral
symmetry. The term "capsid-like structure" as used herein, refers to a
macromolecular
assembly composed of viral protein subunits resembling the capsid morphology
in the above
defined sense but deviating from the typical symmetrical assembly while
maintaining a
sufficient degree of order and repetitiveness. One common feature of virus
particle and virus-
like particle is its highly ordered and repetitive arrangement of its
subunits.
[0064] Virus-like particle of an RNA bacteriophage: As used herein, the term
"virus-like
particle of an RNA bacteriophage" refers to a virus-like particle comprising,
or preferably
consisting essentially of or consisting of coat proteins, mutants or fragments
thereof, of an
RNA bacteriophage. In addition, virus-like particle of an RNA bacteriophage
resembling the
structure of an RNA bacteriophage, being non replicative and/or non-
infectious, and lacking
at least the gene or genes encoding for the replication machinery of the RNA
bacteriophage,
and typically also lacking the gene or genes encoding the protein or proteins
responsible for
viral attachment to or entry into the host. This definition should, however,
also encompass
virus-like particles of RNA bacteriophages, in which the aforementioned gene
or genes are
still present but inactive, and, therefore, also leading to non-replicative
and/or non-infectious
virus-like particles of an RNA bacteriophage. Preferred VLPs derived from RNA
bacteriophages exhibit icosahedral symmetry and consist of 180 subunits
(monomers).
Preferred methods to render a virus-like particle of an RNA bacteriophage non
replicative
and/or non-infectious is by physical, chemical inactivation, such as UV
irradiation,
formaldehyde treatment, typically and preferably by genetic manipulation.
[0065] One, a, or an: when the terms "one", "a", or "an" are used in this
disclosure, they
mean "at least one" or "one or more" unless otherwise indicated.
[0066] The amino acid sequence identity of polypeptides can be determined
conventionally
using known computer programs such as the Bestfit program. When using Bestfit
or any other
sequence alignment program, preferably using Bestfit, to determine whether a
particular
sequence is, for instance, 95 % identical to a reference amino acid sequence,
the parameters
are set such that the percentage of identity is calculated over the full
length of the reference
amino acid sequence and that gaps in homology of up to 5% of the total number
of amino acid
residues in the reference sequence are allowed. This aforementioned method in
determining
the percentage of identity between polypeptides is applicable to all proteins,
polypeptides or a
fragment thereof disclosed in this invention.
[0067] This invention provides compositions and methods for enhancing immune
responses
against IL-1 in an animal or in human. Compositions of the invention comprise:
(a) a core
particle with at least one first attachment site, wherein said core particle
is a virus-like particle
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-22-
(VLP) or a virus particle; and (b) at least one antigen with at least one
second attachment site,
wherein the at least one antigen is an IL-1 molecule, preferably selected from
the group
consisting of IL-1 protein, IL-1 mature fragment, IL-1 peptide and IL-1
mutein, wherein (a)
and (b) are covalently linked through the at least one first and the at least
one second
attachment site. Preferably, said IL-1 molecule is linked to the core
particle, so as to form an
ordered and repetitive antigen-VLP array. In preferred embodiments of the
invention, at least
20, preferably at least 30, more preferably at least 60, again more preferably
at least 120 and
further more preferably at least 180 IL-1 molecules are linked to the core
particle.
[0068] Any virus known in the art having an ordered and repetitive structure
may be
selected as a VLP or a virus particle of the invention. Illustrative DNA or
RNA viruses, the
coat or capsid protein of which can be used for the preparation of VLPs have
been disclosed
in WO 2004/009124 on page 25, line 10-21, on page 26, line 11-28, and on page
28, line 4 to
page 31, line 4. These disclosures are incorporated herein by way of
reference.
[0069] Virus or virus-like particle can be produced and purified from virus-
infected cell
cultures. The resulting virus or virus-like particle for vaccine purpose
should be preferably
non-replicative or non-infectious, more preferably non-replicative and non-
infectious. UV
irradiation, chemical treatment, such as with formaldehyde or chloroform, are
the general
methods known to skilled person in the art to inactivate virus.
[0070] In one preferred embodiment, the core particle is a virus particle, and
wherein
preferably said virus particle is a bacteriophage, and wherein further
preferably said
bacteriophage is an RNA bacteriophage, and wherein even further preferably
said RNA
bacteriophage is an RNA bacteriophage selected from Q(3, fr, GA or AP205.
[0071] In one preferred embodiment, the core particle is a VLP. In a further
preferred
embodiment, the VLP is a recombinant VLP. Almost all commonly known viruses
have been
sequenced and are readily available to the public. The gene encoding the coat
protein can be
easily identified by a skilled artisan. The preparation of VLPs by
recombinantly expressing
the coat protein in a host is within the common knowledge of a skilled
artisan.
[0072] In one preferred embodiment, the virus-like particle comprises, or
alternatively
consists of, recombinant proteins, mutants or fragments thereof, of a virus
selected form the
group consisting of: a) RNA bacteriophages; b) bacteriophages; c) Hepatitis B
virus,
preferably its capsid protein (Ulrich, et al., Virus Res. 50:141-182 (1998))
or its surface
protein (WO 92/11291); d) measles virus (Warnes, et al., Gene 160:173-178
(1995)); e)
Sindbis virus; f) rotavirus (US 5,071,651 and US 5,374,426); g) foot-and-mouth-
disease virus
(Twomey, et al., Vaccine 13:1603 1610, (1995)); h) Norwalk virus (Jiang, X.,
et al., Science
250:1580 1583 (1990); Matsui, S.M., et al., J. Clin. Invest. 87:1456 1461
(1991)); i)
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
- 23 -
Alphavirus; j) retrovirus, preferably its GAG protein (WO 96/30523); k)
retrotransposon Ty,
preferably the protein pl; 1) human Papilloma virus (WO 98/15631); m) Polyoma
virus; n)
Tobacco mosaic virus; and o) Flock House Virus.
[0073] VLP comprising more than one different recombinant proteins is
generally referred,
in this application, as mosaic VLP. In one embodiment, the VLP is a mosaic
VLP, wherein
said mosaic VLP comprises, or consists of, more than one recombinant protein,
preferably of
two recombinant proteins, most preferably of two recombinant capsid proteins,
mutants or
fragments thereof.
[0074] The term "fragment of a recombinant protein" or the term "fragment of a
coat
protein", as used herein, is defined as a polypeptide, which is of at least
70%, preferably at
least 80%, more preferably at least 90%, even more preferably at least 95% the
length of the
wild-type recombinant protein, or coat protein, respectively and which
preferably retains the
capability of forming VLP. Preferably, the fragment is obtained by at least
one internal
deletion, at least one truncation or at least one combination thereof. Further
preferably, the
fragment is obtained by at most 5, 4, 3 or 2 internal deletions, by at most 2
truncations or by
exactly one combination thereof.
[0075] The term "fragment of a recombinant protein" or "fragment of a coat
protein" shall
further refer to a polypeptide, which has at least 80%, preferably 90%, even
more preferably
95% amino acid sequence identity with the "fragment of a recombinant protein"
or "fragment
of a coat protein", respectively, as defined above and which is preferably
capable of
assembling into a virus-like particle.
[0076] The term "mutant coat protein" refers to a polypeptide having an amino
acid sequence
derived from the wild type recombinant protein, or coat protein, respectively,
wherein the
amino acid sequence is at least 80 %, preferably at least 85 %, 90 %, 95 %, 97
%, or 99 %
identical to the wild type sequence and preferably retains the ability to
assemble into a VLP.
[0077] In one preferred embodiment, the virus-like particle of the invention
is of Hepatitis B
virus. The preparation of Hepatitis B virus-like particles has been disclosed,
inter alia, in WO
00/32227, WO 01/85208 and in WO 01/056905. All three documents are explicitly
incorporated herein by way of reference. Other variants of HBcAg suitable for
use in the
practice of the present invention have been disclosed in page 34-39 of WO
01/056905.
[0078] In one further preferred embodiment of the invention, a lysine residue
is introduced
into the HBcAg polypeptide, to mediate the linking of IL-1 molecule to the VLP
of HBcAg.
In preferred embodiments, VLPs and compositions of the invention are prepared
using a
HBcAg comprising, or alternatively consisting of, amino acids 1-144, or 1-149,
1-185 of SEQ
ID NO:l, which is modified so that the amino acids at positions 79 and 80 are
replaced with a
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-24-
peptide having the amino acid sequence of Gly-Gly-Lys-Gly-Gly (SEQ ID NO:
170). This
modification changes the SEQ ID NO:l to SEQ ID NO:2. In further preferred
embodiments,
the cysteine residues at positions 48 and 110 of SEQ ID NO:2, or its
corresponding
fragments, preferably 1-144 or 1-149, are mutated to serine. The invention
further includes
compositions comprising Hepatitis B core protein mutants having above noted
corresponding
amino acid alterations. The invention further includes compositions and
vaccines,
respectively, comprising HBcAg polypeptides which comprise, or alternatively
consist of,
amino acid sequences which are at least 80%, 85%, 90%, 95%, 97% or 99%
identical to SEQ
ID NO:2.
[0079] In one preferred embodiment of the invention, the virus-like particle
of the invention
comprises, consists essentially of, or alternatively consists of, recombinant
coat proteins,
mutants or fragments thereof, of an RNA bacteriophage. Preferably, the RNA
bacteriophage
is selected from the group consisting of a) bacteriophage Q(3; b)
bacteriophage R17; c)
bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage
MS2; g)
bacteriophage M11; h) bacteriophage MXl; i) bacteriophage NL95; k)
bacteriophage f2; 1)
bacteriophage PP7 and m) bacteriophage AP205.
[0080] In one preferred embodiment of the invention, the composition comprises
coat
protein, mutants or fragments thereof, of RNA bacteriophages, wherein the coat
protein has
amino acid sequence selected from the group consisting of: (a) SEQ ID NO:3
referring to P
CP; (b) a mixture of SEQ ID NO:3 and SEQ ID NO:4 (Q(3 Al protein); (c) SEQ ID
NO:5
(R17 capsid protein); (d) SEQ ID NO:6 (fr capsid protein); (e) SEQ ID NO:7 (GA
capsid
protein); (f) SEQ ID NO:8 (SP capsid protein); (g) a mixture of SEQ ID NO:8
and SEQ ID
NO:9; (h) SEQ ID NO:10 (MS2 capsid protein); (i) SEQ ID NO:l 1(Ml 1 capsid
protein); (j)
SEQ ID NO:12 (MXl capsid protein); (k) SEQ ID NO:13 (NL95 capsid protein); (1)
SEQ ID
NO:14 (f2 capsid protein); (m) SEQ ID NO:15 (PP7 capsid protein); and (n) SEQ
ID NO:21
(AP205 capsid protein).
[0081] In one preferred embodiment of the invention, the VLP is a mosaic VLP
comprising
or alternatively consisting of more than one amino acid sequence, preferably
two amino acid
sequences, of coat proteins, mutants or fragments thereof, of an RNA
bacteriophage.
[0082] In one very preferred embodiment, the VLP comprises or alternatively
consists of
two different coat proteins of an RNA bacteriophage, said two coat proteins
have an amino
acid sequence of CP Q(3 (SEQ ID NO: 3) and CP Q(3 Al (SEQ ID NO:4), or of CP
SP (SEQ
ID NO:8) and CP SP Al (SEQ ID NO:9).
[0083] In preferred embodiments of the present invention, the virus-like
particle of the
invention comprises, or alternatively consists essentially of, or
alternatively consists of
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
- 25 -
recombinant coat proteins, mutants or fragments thereof, of the RNA-
bacteriophage Q(3, fr,
AP205 or GA.
[0084] In one preferred embodiment, the VLP of the invention is a VLP of RNA
bacteriophage Q(3. The capsid or virus-like particle of Q(3 showed an
icosahedral phage-like
capsid structure with a diameter of 25 nm and T=3 quasi symmetry. The capsid
contains 180
copies of the coat protein, which are linked in covalent pentamers and
hexamers by disulfide
bridges (Golmohammadi, R. et al., Structure 4:543-5554 (1996)), leading to a
remarkable
stability of the Q(3 capsid. Capsids or VLPs made from recombinant Q(3 coat
protein may
contain, however, subunits not linked via disulfide bonds to other subunits
within the capsid,
or incompletely linked. The capsid or VLP of Q(3 shows unusual resistance to
organic
solvents and denaturing agents. Surprisingly, we have observed that DMSO and
acetonitrile
concentrations as high as 30 %, and guanidinium concentrations as high as 1 M
do not affect
the stability of the capsid. The high stability of the capsid or VLP of Q(3 is
an advantageous
feature, in particular, for its use in immunization and vaccination of mammals
and humans in
accordance of the present invention.
[0085] Further preferred virus-like particles of RNA bacteriophages, in
particular of Q(3 and
fr in accordance of this invention are disclosed in WO 02/056905, the
disclosure of which is
herewith incorporated by reference in its entirety. Particular example 18 of
WO 02/056905
gave detailed description of preparation of VLP particles from Q(3.
[0086] In another preferred embodiment, the VLP of the invention is a VLP of
RNA
bacteriophage AP205. Assembly-competent mutant forms of AP205 VLPs, including
AP205
coat protein with the substitution of proline at amino acid 5 to threonine,
may also be used in
the practice of the invention and leads to other preferred embodiments of the
invention. WO
2004/007538 describes, in particular in Example 1 and Example 2, how to obtain
VLP
comprising AP205 coat proteins, and hereby in particular the expression and
the purification
thereto. WO 2004/007538 is incorporated herein by way of reference. AP205 VLPs
are highly
immunogenic, and can be linked with IL-1 molecule to typically and preferably
generate
vaccine constructs displaying the IL-1 molecule oriented in a repetitive
manner.
[0087] In one preferred embodiment, the VLP of the invention comprises or
consists of a
mutant coat protein of a virus, preferably an RNA bacteriophage, wherein the
mutant coat
protein has been modified by removal of at least one lysine residue by way of
substitution
and/or by way of deletion. In another preferred embodiment, the VLP of the
invention
comprises or consists of a mutant coat protein of a virus, preferably an RNA
bacteriophage,
wherein the mutant coat protein has been modified by addition of at least one
lysine residue
by way of substitution and/or by way of insertion. The deletion, substitution
or addition of at
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-26-
least one lysine residue allows varying the degree of coupling, i.e. the
amount of IL-1
molecule per subunits of the VLP of a virus, preferably of an RNA
bacteriophages, in
particular, to match and tailor the requirements of the vaccine.
[0088] In one preferred embodiment, the compositions and vaccines of the
invention have
an antigen density being from 0.5 to 4Ø The term "antigen density", as used
herein, refers to
the average number of IL-1 molecules which is linked per subunit, preferably
per coat protein,
of the VLP, and hereby preferably of the VLP of an RNA bacteriophage. Thus,
this value is
calculated as an average over all the subunits of the VLP, preferably of the
VLP of the RNA
bacteriophage, in the composition or vaccines of the invention.
[0089] VLPs or capsids of Q(3 coat protein display a defined number of lysine
residues on
their surface, with a defined topology with three lysine residues pointing
towards the interior
of the capsid and interacting with the RNA, and four other lysine residues
exposed to the
exterior of the capsid. Preferably, the at least one first attachment site is
a lysine residue,
pointing to or being on the exterior of the VLP.
[0090] Q(3 mutants, of which exposed lysine residues are replaced by arginines
can be used
for the present invention. Thus, in another preferred embodiment of the
present invention, the
virus-like particle comprises, consists essentially of or alternatively
consists of mutant Q(3
coat proteins. Preferably these mutant coat proteins comprise or alternatively
consist of an
amino acid sequence selected from the group of a) Q(3-240 (SEQ ID NO:16, Lys13-
Arg of
SEQ ID NO: 3) b) Q(3-243 (SEQ ID NO:17, AsnlO-Lys of SEQ ID NO:3); c) Q(3-250
(SEQ
ID NO:18, Lys2-Arg of SEQ ID NO:3) d) Q(3-251 (SEQ ID NO:19, Lys16-Arg of SEQ
ID
NO:3); and e) Q(3-259 (SEQ ID NO:20, Lys2-Arg, Lys16-Arg of SEQ ID NO:3). The
construction, expression and purification of the above indicated Q(3 mutant
coat proteins,
mutant Q(3 coat protein VLPs and capsids, respectively, are described in WO
02/056905. In
particular is hereby referred to Example 18 of above mentioned application.
[0091] In another preferred embodiment of the present invention, the virus-
like particle
comprises, or alternatively consists essentially of, or alternatively consists
of mutant coat
protein of Q(3, or mutants or fragments thereof, and the corresponding Al
protein. In a further
preferred embodiment, the virus-like particle comprises, or alternatively
consists essentially
of, or alternatively consists of mutant coat protein with amino acid sequence
SEQ ID NO:16,
17, 18, 19, or 20 and the corresponding Al protein.
[0092] Further RNA bacteriophage coat proteins have also been shown to self-
assemble
upon expression in a bacterial host (Kastelein, RA. et al., Gene 23:245-254
(1983),
Kozlovskaya, TM. et al., Dokl. Akad. Nauk SSSR 287:452-455 (1986), Adhin, MR.
et al.,
Virology 170:238-242 (1989), Priano, C. et al., J. Mol. Biol. 249:283-297
(1995)). In
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-27-
particular the biological and biochemical properties of GA (Ni, CZ., et al.,
Protein Sci.
5:2485-2493 (1996), Tars, K et al., J. Mol.Biol. 271:759-773(1997)) and of fr
(Pushko P. et
al., Prot. Eng. 6:883-891 (1993), Liljas, L et al. J Mol. Biol. 244:279-290,
(1994)) have been
disclosed. The crystal structure of several RNA bacteriophages has been
determined
(Golmohammadi, R. et al., Structure 4:543-554 (1996)). Using such information,
surface
exposed residues can be identified and, thus, RNA bacteriophage coat proteins
can be
modified such that one or more reactive amino acid residues can be inserted by
way of
insertion or substitution. Another advantage of the VLPs derived from RNA
bacteriophages is
their high expression yield in bacteria that allows production of large
quantities of material at
affordable cost.
[0093] In one preferred embodiment, the composition of the invention comprises
at least one
antigen, preferably one to four, more preferably one to three, still more
preferably one to two
and most preferably exactly one antigen, wherein said antigen is an IL-1
molecule, preferably
an IL-1 protein, an IL-1 fragment, an IL-1 mature fragment, an IL-1 peptide or
an IL-1
mutein, wherein said IL-1 molecule preferably comprises or even more
preferably consists of
a polypeptide having an amino acid sequence having at least 80 %, preferably
at least 90 %,
more preferably at least 95 %, even more preferably at least 99 % and most
preferably 100 %
sequence identity with any one of SEQ ID NO:36 to SEQ ID NO:116, SEQ ID NO:130
to
SEQ ID NO:140 and SEQ ID NO:163 to SEQ ID NO:165.
[0094] In a further preferred embodiment said antigen is an IL-1 molecule
derived from an
organism selected from the group consisting of: (a) humans; (b) primates; (c)
rodents; (d)
horses; (e) sheep; (f) cat; (g) cattle; (h) pig; (i) rabbit; (j) dog; (k)
mouse; and (1) rat. Most
preferably said IL-1 molecule is derived from humans, preferably comprising or
even more
preferably consisting of a polypeptide having at least 80 %, preferably at
least 90 %, more
preferably at least 95 %, even more preferably at least 99 % and most
preferably 100 %
sequence identity with any one of the sequences selected from the group
consisting of SEQ
ID NO:36, SEQ ID NO:49, SEQ ID NO:63, SEQ ID NO:64, any one of SEQ ID NO:67 to
110, and one of SEQ ID NO:130-140, and SEQ ID NO:165.
[0095] In a further preferred embodiment said IL-1 molecule derived from rat
or mouse,
preferably mouse, wherein said IL-1 molecule preferably comprises or even more
preferably
consists of a polypeptide having an amino acid sequence having at least 80 %,
preferably at
least 90 %, more preferably at least 95 %, even more preferably at least 99 %
and most
preferably 100 % sequence identity with any one of SEQ ID NO:45, SEQ ID NO:46,
SEQ ID
NO:53, SEQ ID NO:54, SEQ ID NO:65, SEQ ID NO:66, any one of SEQ ID NO:l 11 to
SEQ
ID NO:116, SEQ ID NO:163, and SEQ ID NO:164.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-28-
[0096] In a further preferred embodiment IL-1 molecule is an IL-1 alpha
molecule,
preferably an IL-1 alpha protein, an IL-1 alpha fragment, an IL-1 alpha mature
fragment, an
IL-1 alpha peptide or an IL-1 alpha mutein, wherein said IL-1 alpha molecule
preferably
comprises or even more preferably consists of a polypeptide having an amino
acid sequence
having at least 80 %, preferably at least 90 %, more preferably at least 95 %,
even more
preferably at least 99 % and most preferably 100 % sequence identity with any
one of the
sequences selected from the group consisting of SEQ ID NO:36 to 48, SEQ ID
NO:63, SEQ
ID NO:65, SEQ ID NO:67 to 88, and SEQ ID NO:165. Specifically preferred
embodiments of
IL-1 alpha molecules are human IL-1 alpha molecules, preferably human IL-1
alpha proteins,
human IL-1 alpha fragments or human IL-1 alpha mature fragments, wherein said
IL-1 alpha
molecules preferably comprise or even more preferably consist of a polypeptide
having an
amino acid sequence having at least 80 %, preferably at least 90 %, more
preferably at least
95 %, even more preferably at least 99 % and most preferably 100 % sequence
identity with
any one of SEQ ID NO:36, SEQ ID NO:63, and SEQ ID NO:163, most preferably SEQ
ID
NO:63.
[0097] In a further preferred embodiment said IL-1 molecule is an IL-1 beta
molecule,
preferably an IL-1 beta protein, an IL-1 beta fragment, an IL-1 beta mature
fragment, an IL-1
beta peptide or an IL-1 beta mutein, wherein said IL-1 beta molecule
preferably comprises or
even more preferably consists of a polypeptide having an amino acid sequence
having at least
80 %, preferably at least 90 %, more preferably at least 95 %, even more
preferably at least
99 % and most preferably 100 % sequence identity with any one of the sequences
selected
from the group consisting of SEQ ID NO:49 to 62, SEQ ID NO:64, SEQ ID NO:66,
SEQ ID
NO:89 to 116, SEQ ID NO:130 to SEQ ID NO:140, SEQ ID NO:164, and SEQ ID
NO:165.
Specifically preferred embodiments of IL-1 beta molecules are human IL-1 beta
molecules,
preferably human IL-1 beta proteins, human IL-1 beta fragments or human IL-1
beta mature
fragments, wherein said IL-1 beta molecules preferably comprises or even more
preferably
consists of a polypeptide having an amino acid sequence having at least 80 %,
preferably at
least 90 %, more preferably at least 95 %, even more preferably at least 99 %
and most
preferably 100 % sequence identity with any one of SEQ ID NO:49, SEQ ID NO:64,
SEQ ID
NO:130 to SEQ ID NO:140 and SEQ ID NO:165, most preferably SEQ ID NO:64.
[0098] In a further preferred embodiment said IL-1 molecule is an IL-1
protein, an IL-1
fragment or, preferably, an IL-1 mature fragment, wherein said IL-1 protein,
IL-1 fragment or
IL-1 mature fragment preferably are capable of binding to the IL-1 receptor
and, still more
preferably, additionally also comprise biological activity.
[0099] In a further preferred embodiment said IL-1 molecule is an IL-1
protein, wherein
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-29-
said IL-1 protein preferably comprises or even more preferably consists of a
polypeptide
having an amino acid sequence having at least 80 %, preferably at least 90 %,
more preferably
at least 95 %, even more preferably at least 99 % and most preferably 100 %
sequence
identity with any one of SEQ ID NO:36 to SEQ ID NO:62.
[00100] In a further preferred embodiment said IL-1 protein is an IL-1 alpha
protein, wherein
said IL-1 alpha protein preferably comprises or even more preferably consists
of a
polypeptide having an amino acid sequence having at least 80 %, preferably at
least 90 %,
more preferably at least 95 %, even more preferably at least 99 % and most
preferably 100 %
sequence identity with any one of the sequences selected from the group
consisting of SEQ
ID NO:36 to SEQ ID NO:48. Most preferably said IL-1 alpha protein is a human
IL-1 alpha
protein, wherein said human IL-1 alpha protein preferably comprises or even
more preferably
consists of a polypeptide having least 80 %, preferably at least 90 %, more
preferably at least
95 %, even more preferably at least 99 % and most preferably 100 % sequence
identity with
SEQ ID NO:36.
[00101] In a further preferred embodiment said said IL-1 protein is an is an
IL-1 beta protein,
wherein said IL-1 beta protein preferably comprises or even more preferably
consists of a
polypeptide having an amino acid sequence having at least 80 %, preferably at
least 90 %,
more preferably at least 95 %, even more preferably at least 99 % and most
preferably 100 %
sequence identity with any one of the sequences selected from the group
consisting of SEQ
ID NO:49 to SEQ ID NO:62. Most preferably said IL-1 beta protein is a human IL-
1 beta
protein, wherein said human IL-1 beta protein preferably comprises or even
more preferably
consists of a polypeptide having least 80 %, preferably at least 90 %, more
preferably at least
95 %, even more preferably at least 99 % and most preferably 100 % sequence
identity with
SEQ ID NO:49.
[00102] In a further preferred embodiment said IL-1 molecule is an IL-1
fragment, preferably
an IL-1 mature fragment, and wherein said IL-1 fragment or said IL-1 mature
fragment
preferably is derived from mouse or human, most preferably human. Preferably
said IL-1
fragment or said IL-1 mature fragment comprises or even more preferably
consists of a
polypeptide having an amino acid sequence having at least 80 %, preferably at
least 90 %,
more preferably at least 95 %, even more preferably at least 99 % and most
preferably 100 %
sequence identity with any one of SEQ ID NO:63 to SEQ ID NO:66, SEQ ID NO:130,
and
SEQ ID NO:163 to SEQ ID NO:165.
[00103] In a further preferred embodiment said IL-1 mature fragment is an IL-1
alpha mature
fragment, wherein said IL-1 alpha mature fragment preferably comprises
biological activity
and wherein further said IL-1 alpha mature fragment preferably comprises or
even more
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-30-
preferably consists of a polypeptide having an amino acid sequence having at
least 80 %,
preferably at least 90 %, more preferably at least 95 %, even more preferably
at least 99 %
and most preferably 100 % sequence identity with any one of SEQ ID NO:63 or
SEQ ID
NO:65, most preferably SEQ ID NO:63.
[00104] In a further preferred embodiment said IL-1 mature fragment is an IL-1
beta mature
fragment, wherein said IL-1 beta mature fragment preferably comprises
biological activity
and wherein further said IL-1 beta mature fragment preferably comprises or
even more
preferably consists of a polypeptide having an amino acid sequence having at
least 80 %,
preferably at least 90 %, more preferably at least 95 %, even more preferably
at least 99 %
and most preferably 100 % sequence identity with any one of SEQ ID NO:64, SEQ
ID
NO:66, and SEQ ID NO:130, most preferably SEQ ID NO:64.
[00105] In a further preferred embodiment said IL-1 molecule is an IL-1
peptide, wherein
said IL-1 peptide is derived from mouse, rat or human, most preferably human.
Preferably
said IL-1 peptide comprises or even more preferably consists of a polypeptide
having an
amino acid sequence having at least 80 %, preferably at least 90 %, more
preferably at least
95 %, even more preferably at least 99 % and most preferably 100 % sequence
identity with
any one of SEQ ID NO:67 to SEQ ID NO:116.
[00106] In a further preferred embodiment said IL-1 molecule is an IL-1
mutein, wherein
preferably said IL-1 mutein comprises reduced or more preferably no biological
activity, and
wherein further said IL-1 mutein is capable of binding the IL-1 receptor. In a
further preferred
embodiment said IL-1 mutein comprises or preferably consists of a polypeptide
having an
amino acid sequence which differs from the amino acid sequence of an IL-1
mature fragment
in 1 to 3, more preferably in 1 to 2, and most preferably in exactly 1 amino
acid residue.
[00107] In one preferred embodiment, said IL-1 mutein comprises at least one,
preferably
one, mutated amino acid sequence derived from a wild type amino acid sequence,
wherein
said wild type amino acid sequence is an IL-1 beta amino acid sequence
selected from the
group consisting of: (1) position 3 to 11 of SEQ ID NO:64; (2) position 46 to
56 of SEQ ID
NO:64; (3) position 88 to 109 of SEQ ID NO:64; and (4) position 143 to 153 of
SEQ ID
NO:64; or wherein said wild type amino acid sequence is an IL-1 alpha amino
acid sequence
selected from the group consisting of: (5) position 9 to 20 of SEQ ID NO:63;
(6) position 52
to 62 of SEQ ID NO:63; (7) position 94 to 113 of SEQ ID NO:63; and (8)
position 143 to 153
of SEQ ID NO:63; and wherein said at least one mutated amino acid sequence is
characterized by an amino acid exchange in one to four positions, preferably
in one, two or
three positions, more preferably in one or two positions, as compared to said
wild type amino
acid sequence it is derived from; or wherein said at least one mutated amino
acid sequence is
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-31-
characterized by a deletion of one to four consecutive amino acids of said
wild type amino
acid sequence it is derived from.
[00108] In a further preferred embodiment said IL-1 mutein comprises at most
one mutated
amino acid sequence derived from each of said L-1 beta amino acid sequences
(1) to (4); or
wherein said IL-1 mutein comprises at most one mutated amino acid sequence
derived from
each of said IL-1 alpha amino acid sequences (5) to (8).
[00109] In a very preferred embodiment said IL-1 mutein comprises exactly one
of said at
least one mutated amino acid sequence, wherein preferably said exactly one
mutated amino
acid sequence is derived from a wild type amino acid sequence, wherein said
wild type amino
acid sequence is position 143 to 153 of SEQ ID NO:64 or position 143 to 153 of
SEQ ID
NO:63.
[00110] In a further preferred embodiment said at least one mutated amino acid
sequence is
characterized by a deletion of one to three, preferably of one to two,
consecutive amino acids
of said wild type amino acid sequence it is derived from.
[00111] In a further preferred embodiment said at least one mutated amino acid
sequence is
characterized by a deletion of exactly one amino acid of said wild type amino
acid sequence it
is derived from.
[00112] In a further preferred embodiment said at least one mutated amino acid
sequence is
derived from a wild type amino acid sequence, wherein said wild type amino
acid sequence is
position 143 to 153 of SEQ ID NO:64 or position 143 to 153 of SEQ ID NO:63.
Most
preferably said at least one mutated amino acid sequence is derived from
position 143 to 153
of SEQ ID NO:64.
[00113] In a further preferred embodiment said at least one mutated amino acid
sequence is
derived from a wild type amino acid sequence, wherein said wild type amino
acid sequence is
position 46 to 56 of SEQ ID NO:64 or position 52 to 62 of SEQ ID NO:63,
wherein
preferably said at least one mutated amino acid sequence is characterized by a
deletion of one
to four, preferably of two to three, consecutive amino acids of said wild type
amino acid
sequence it is derived from. In a very preferred embodiment said IL-1 mutein
comprises or
preferably consists of a polypeptide having the amino acid sequence of SEQ ID
NO:137 or
SEQ ID NO:138.
[00114] In a further preferred embodiment said at least one mutated amino acid
sequence is
derived from a wild type amino acid sequence, wherein said wild type amino
acid sequence is
position 88 to 109 of SEQ ID NO:64 or position 94-113 of SEQ ID NO:63, wherein
said at
least one mutated amino acid sequence is characterized by the deletion of one
to four,
preferably of one to three, more preferably of one to two consecutive amino
acids of said wild
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-32-
type amino acid sequence it is derived from.
[00115] In a further preferred embodiment said at least one mutated amino acid
sequence is
characterized by an amino acid exchange in one or two positions, preferably in
exactly one
position, as compared to said wild type amino acid sequence it is derived
from.
[00116] In a further preferred embodiment said wild type amino acid sequence
is position 143
to 153 of SEQ ID NO:64 or position 143 to 153 of SEQ ID NO:63 and said at
least one
mutated amino acid sequence is characterized by an amino acid exchange in one
or two
positions, preferably in exactly one position, as compared to said wild type
amino acid
sequence, wherein further preferably said exactly one position is position 145
of SEQ ID
NO:64 or position 145 of SEQ ID NO:63, wherein still further preferably said
amino acid
exchange is an exchange of aspartic acid (D) to an amino acid selected from
the group
consisting of lysine (K), tyrosine (Y), phenylalanine (F), asparagine (N) and
arginine (R).
[00117] In a very preferred embodiment said amino acid exchange is an exchange
of aspartic
acid (D) to lysine (K).
[00118] In a further preferred embodiment said wild type amino acid sequence
is position 143
to 153 of SEQ ID NO:64 or position 143 to 153 of SEQ ID NO:63 and said at
least one
mutated amino acid sequence is characterized by an amino acid exchange in
exactly one
position as compared to said wild type amino acid sequence, wherein further
preferably said
exactly one position is position 146 of SEQ ID NO:64 or position 146 of SEQ ID
NO:63,
wherein still further preferably said amino acid exchange is an exchange of
phenylalanine (F)
to an amino acid selected from the group consisting of asparagine (N),
glutamine (Q), and
serine (S).
[00119] In a further preferred embodiment said IL-1 mutein is an IL-1 beta
mutein,
preferably a human IL-1 beta mutein, most preferably a human IL-1 beta mutein
selected
from SEQ ID NO:131 to SEQ ID NO:140.
[00120] In a further preferred embodiment said IL-1 mutein is an IL-1 beta
mutein, wherein
preferably said IL-1 beta mutein comprises or preferably consists of a
polypeptide having an
amino acid sequence, wherein said amino acid sequence differs from the amino
acid sequence
of SEQ ID NO:64 in 1 to 10, l to 9, l to 8, l to 7, l to 6, l to 5, l to 4, l
to 3, or l to 2 amino
acid residues. Most preferably said amino acid sequence differs from the amino
acid sequence
of SEQ ID NO:64 in exactly 1 amino acid residue. In a very preferred
embodiment said IL-1
beta mutein comprises or preferably consists of a polypeptide having an amino
acid sequence
selected from the group consisting of SEQ ID NO:131 to SEQ ID NO:140 and SEQ
ID
NO:205 to SEQ ID NO:209, wherein most preferably said IL-1 beta mutein
comprises or
preferably consists of a polypeptide having the amino acid sequence of SEQ ID
NO:136.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-33-
[00121] In a further preferred embodiment said IL-1 mutein is an IL-1 alpha
mutein, wherein
preferably said IL-1 alpha mutein comprises or preferably consists of a
polypeptide having an
amino acid sequence, wherein said amino acid sequence differs from the amino
acid sequence
of SEQ ID NO:63 in 1 to 10, l to 9, l to 8, l to 7, l to 6, l to 5, l to 4, l
to 3, or l to 2 amino
acid residues. Most preferably said amino acid sequence differs from the amino
acid sequence
of SEQ ID NO:63 in exactly 1 amino acid residue. In a very preferred
embodiment said IL-1
alpha mutein comprise or preferably consist of a polypeptide having an amino
acid sequence
selected from the group consisting of SEQ ID NO:210 to SEQ ID NO:218, wherein
most
preferably said IL-1 alpha mutein comprises or preferably consists of a
polypeptide having
the amino acid sequence of SEQ ID NO:210.
[00122] The present invention provides for a method of producing the
composition of the
invention comprising (a) providing a VLP with at least one first attachment
site; (b) providing
at least one antigen, wherein said antigen is an IL-1 molecule, an IL-1
protein, an IL-1
fragment, preferably an IL-1 mature fragment, an IL-1 peptide or an IL-1
mutein, with at least
one second attachment site; and (c) combining said VLP and said at least one
antigen to
produce said composition, wherein said at least one antigen and said VLP are
linked through
the first and the second attachment sites. In a preferred embodiment, the
provision of the at
least one antigen, i.e. IL-1 molecule, an IL-1 protein, an IL-1 fragment,
preferably an IL-1
mature fragment, an IL-1 peptide or an IL-1 mutein, with the at least one
second attachment
site is by way of expression, preferably by way of expression in a bacterial
system, preferably
in E. coli. Usually a purification tag, such as His tag, Myc tag, Fc tag or HA
tag is added to
facilitate the purification process. In another approach particularly the IL-1
peptides or IL-1
muteins with no longer than 50 amino acids are chemically synthesized.
[00123] In one preferred embodiment of the invention, the VLP with at least
one first
attachment site is linked to the IL-1 molecule with at least one second
attachment site via at
least one peptide bond. A gene encoding an IL-1 molecule, preferably an IL-1
mature
fragment, is in-frame ligated, either internally or preferably to the N- or
the C-terminus to the
gene encoding the coat protein of the VLP. Fusion may also be effected by
inserting
sequences of the IL-1 into a mutant coat protein where part of the coat
protein sequence has
been deleted, that are further referred to as truncation mutants. Truncation
mutants may have
N- or C-terminal, or internal deletions of part of the sequence of the coat
protein. For example
for the specific VLP HBcAg, amino acids 79-80 are replaced with a foreign
epitope. The
fusion protein shall preferably retain the ability of assembly into a VLP upon
expression
which can be examined by electromicroscopy.
[00124] Flanking amino acid residues may be added to increase the distance
between the coat
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-34-
protein and foreign epitope. Glycine and serine residues are particularly
favored amino acids
to be used in the flanking sequences. Such a flanking sequence confers
additional flexibility,
which may diminish the potential destabilizing effect of fusing a foreign
sequence into the
sequence of a VLP subunit and diminish the interference with the assembly by
the presence of
the foreign epitope.
[00125] In other embodiments, the at least one IL-1 molecule, preferably the
IL-1 mature
fragment can be fused to a number of other viral coat protein, as way of
examples, to the C-
terminus of a truncated form of the Al protein of Q(3 (Kozlovska, T. M., et
al., Intervirology
39:9-15 (1996)), or being inserted between position 72 and 73 of the CP
extension. As
another example, the IL-1 can be inserted between amino acid 2 and 3 of the fr
CP, leading to
a IL-1-fr CP fusion protein (Pushko P. et al., Prot. Eng. 6:883-891 (1993)).
Furthermore, IL-1
can be fused to the N-terminal protuberant (3-hairpin of the coat protein of
RNA
bacteriophage MS-2 (WO 92/13081). Alternatively, the IL-1 can be fused to a
capsid protein
of papillomavirus, preferably to the major capsid protein Ll of bovine
papillomavirus type 1
(BPV-1) (Chackerian, B. et al., Proc. Natl. Acad. Sci.USA 96:2373-2378 (1999),
WO
00/23955). Substitution of amino acids 130-136 of BPV-1 Ll with an IL-1 is
also an
embodiment of the invention. Further embodiments of fusing an IL-1 molecule to
coat
protein, mutants or fragments thereof, to a coat protein of a virus have been
disclosed in WO
2004/009124 page 62 line 20 to page 68 line 17 and herein are incorporated by
way of
reference.
[00126] US 5,698,424 describes a modified coat protein of bacteriophage MS-2
capable of
forming a capsid, wherein the coat protein is modified by an insertion of a
cysteine residue
into the N-terminal hairpin region, and by replacement of each of the cysteine
residues located
external to the N-terminal hairpin region by a non-cysteine amino acid
residue. The inserted
cysteine may then be linked directly to a desired molecular species to be
presented such as an
epitope or an antigenic protein.
[00127] We note, however, that the presence of an exposed free cysteine
residue in the capsid
may lead to oligomerization of capsids by way of disulfide bridge formation.
Moreover,
attachment between capsids and antigenic proteins by way of disulfide bonds
are labile, in
particular, to sulfhydryl-moiety containing molecules, and are, furthermore,
less stable in
serum than, for example, thioether attachments (Martin FJ. and Papahadjopoulos
D. (1982)
Irreversible Coupling of Immunoglobulin Fragments to Preformed Vesicles. J.
Biol. Chem.
257: 286-288).
[00128] Therefore, in a further very preferred embodiment of the present
invention, the
association or linkage of the VLP and the at least one antigen, i.e. IL-1
molecule, does not
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-35-
comprise a disulfide bond. Further preferred hereby, the at least one second
attachment
comprise, or preferably is, a sulfliydryl group. Moreover, in again a very
preferred
embodiment of the present invention, the association or linkage of the VLP and
the at least
one IL-1 molecule does not comprise a sulphur-sulphur bond. Further preferred
hereby, the at
least one second attachment comprise, or preferably is, a sulfliydryl group.
In a further very
preferred embodiment, said at least one first attachment site is not or does
not comprise a
sulfliydryl group. In again a further very preferred embodiment, said at least
one first
attachment site is not or does not comprise a sulfliydryl group of a cysteine.
[00129] In a further preferred embodiment said at least one first attachment
comprises an
amino group and said second attachment comprises a sulfliydryl group.
[00130] In a further preferred embodiment only one of said second attachment
sites
associates with said first attachment site through at least one non-peptide
covalent bond
leading to a single and uniform type of binding of said IL-1 molecule to said
core particle,
wherein said only one second attachment site that associates with said first
attachment site is a
sulfhydryl group, and wherein said IL-1 molecule and said core particle
interact through said
association to form an ordered and repetitive antigen array.
[00131] In another preferred embodiment, an IL-1 molecule, preferably an IL-1
protein, more
preferably an IL-1 mature fragment, still more preferably an IL-1 mature
fragment comprising
or consisting of amino acid sequenced SEQ ID NO:63 to SEQ ID NO:66, most
preferably
SEQ ID NO:63 or SEQ ID NO:64, is fused to either the N- or the C-terminus,
preferably the
C-terminus, of a coat protein, mutants or fragments thereof, of RNA
bacteriophage AP205.
VLPs comprising fusion proteins of coat protein of bacteriophage AP205 with an
antigen are
generally disclosed in W02006/032674A1 which is incorporated herein by
reference. In one
further preferred embodiment, the fusion protein further comprises a linker,
wherein said
linker is fused to the coat protein, fragments or mutants thereof, of AP205
and the IL-1
molecule. In a further preferred embodiment said IL-1 molecule is fused to the
C-terminus of
said coat protein, fragments or mutants thereof, of AP205 via said linker.
[00132] It has been found that IL-1 molecules, in particular IL-1 proteins and
IL-1 fragments
comprising at least 100 and up to 300 amino acids, typically and preferably
about 140 to 160
amino acids, and most preferably about 155 amino acids, can be fused to coat
protein of
bacteriophages, preferably to coat protein of AP205, while maintaining the
ability of the coat
protein to self assemble into a VLP.
[00133] Given the large size of IL-1 proteins, IL-1 fragments and IL-1 mature
fragments and
also for steric reasons, an expression system producing mosaic VLPs comprising
AP205 coat
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-36-
proteins fused to an IL-1 molecule as well as wt coat protein subunits was
constructed. In this
system, suppression of the stop codon yields the AP205-IL-1 coat protein
fusion, while proper
termination yields the wt AP205 coat protein. Both proteins are produced
simultaneously in
the cell and assemble into a mosaic VLP. The advantage of such a system is
that large
proteins can be displayed without interfering with the assembly of the VLP. As
the level of
incorporation of AP205-IL-1 fusion protein into the mosaic VLP is depending on
the level of
suppression, AP205-IL-1 is expressed in E.coli cells already containing a
plasmid
overexpressing a suppressor t-RNA. For opal suppression, plasmid pISM3001
(Smiley, B.K.,
Minion, F.C. (1993) Enhanced readthrough of opal (UGA) stop codons and
production of
Mycoplasma pneumoniae Pl epitopes in Escherichia coli. Gene 134, 33-40), which
encodes a
suppressor t-RNA recognizing the opal stop codon and introducing Trp is used.
Suppression
of amber termination can be increased by use of plasmid pISM579, which
overexpresses a
suppressor t-RNA recognizing the amber stop codon and introducing Trp as well.
Plasmid
pISM579 was generated by excising the trpTl76 gene from pISM3001 with
restriction
endonuclease EcoRI and replacing it by an EcoRI fragment from plasmid pMY579
(gift of
Michael Yarus) containing an amber t-RNA suppressor gene. This t-RNA
suppressor gene is
a mutant of trpTl75 (Raftery LA. Et al. (1984) J. Bacteriol. 158:849-859), and
differs from
trpT at three positions: G33, A24 and T35. Expression of the AP205-interleukin-
lalpha fusion
protein in an E.coli strain with amber suppression (supE or glnh) such as E.
coli JM109 may
generate a proportion of AP205-IL-1 fusion proteins with a Gln instead of Trp
introduced at
the amber stop codon, in addition to AP205-IL-1 fusion proteins with a Trp
introduced at the
amber stop codon.The identity of the amino acid translated at the stop codon
may therefore
depend on the combination of suppressor t-RNA overexpressed, and strain
phenotype. As
described by Miller JH et al. ((1983) J. Mol. Biol. 164: 59-71) and as is well
known in the art,
the efficiency of suppression is context dependent. In particular, the codon
3' of the stop
codon and the first base 3' from the stop codon are particularly important.
For example, stop
codons followed by a purine base are in general well suppressed.
[00134] Thus, in a preferred embodiment said VLP is a mosaic VLP, wherein said
mosaic
VLP comprises or preferably consists of at least one, preferably one, first
polypeptide and of
at least one, preferably one, second polypeptide, wherein said first
polypeptide is a
recombinant capsid protein, mutant or fragments thereof; and wherein said
second
polypeptide is a genetic fusion product of a recombinant capsid protein,
mutant or fragments
thereof, preferably of said first polypeptide, with an IL-1 molecule. In a
further preferred
embodiment said first polypeptide is a recombinant capsid protein of
bacteriophage AP205 or
a mutant or fragment thereof. In a further preferred embodiment said first
polypeptide is
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-37-
selected from SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23. In a very preferred
embodiment said first polypeptide is SEQ ID NO:21. Mosaic VLPs of
bacteriophage AP205
comprising an antigen are generally disclosed in W02006/032674A1, in
particular in
paragraph 107 of said publication. In a further preferred embodiment said
second polypeptide
is a genetic fusion product of a recombinant capsid protein, mutant or
fragments thereof,
preferably of said first polypeptide, with an IL-1 molecule, wherein said IL-1
molecule is
fused to the C-terminus of said recombinant capsid protein, mutant or
fragments thereof,
preferably via an amino acid linker. In a further preferred embodiment said IL-
1 molecule
comprises or preferably consists of 100 to 300 amino acids, typically and
preferably about
140 to 160 amino acids, and most preferably about 155 amino acids. In a very
preferred
embodiment, the molar ratio of said first polypeptide and said second
polypeptide in said
mosaic VLP is 10:1 to 5:1, preferably 8:1 to 6:1, most preferably about 7:1.
[00135] In one preferred embodiment of the present invention, the composition
comprises or
alternatively consists essentially of a virus-like particle with at least one
first attachment site
linked to at least one antigen, i.e. an IL-1 molecule, with at least one
second attachment site
via at least one covalent bond, wherein preferably the covalent bond is a non-
peptide bond. In
a preferred embodiment of the present invention, the first attachment site
comprises, or
preferably is, an amino group, preferably the amino group of a lysine residue.
In another
preferred embodiment of the present invention, the second attachment site
comprises, or
preferably is, a sulfhydryl group, preferably a sulfhydryl group of a
cysteine.
[00136] In a very preferred embodiment of the invention, the at least one
first attachment site
is an amino group, preferably an amino group of a lysine residue and the at
least one second
attachment site is a sulfliydryl group, preferably a sulfhydryl group of a
cysteine.
[00137] In one preferred embodiment of the invention, the IL-1 molecule is
linked to the VLP
by way of chemical cross-linking, typically and preferably by using a
heterobifunctional
cross-linker. In preferred embodiments, the hetero-bifunctional cross-linker
contains a
functional group which can react with the preferred first attachment sites,
preferably with the
amino group, more preferably with the amino groups of lysine residue(s) of the
VLP, and a
further functional group which can react with the preferred second attachment
site, i.e. a
sulfhydryl group, preferably of cysteine(s) residue inherent of, or
artificially added to the IL-1
molecule, and optionally also made available for reaction by reduction.
Several hetero-
bifunctional cross-linkers are known to the art. These include the preferred
cross-linkers
SMPH (Pierce), Sulfo-MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB, Sulfo-SMPB,
Sulfo-
SMCC, SVSB, SIA and other cross-linkers available for example from the Pierce
Chemical
Company, and having one functional group reactive towards amino groups and one
functional
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-38-
group reactive towards sulfhydryl groups. The above mentioned cross-linkers
all lead to
formation of an amide bond after reaction with the amino group and a thioether
linkage with
the sulfhydryl groups. Another class of cross-linkers suitable in the practice
of the invention is
characterized by the introduction of a disulfide linkage between the IL-1
molecule and the
VLP upon coupling. Preferred cross-linkers belonging to this class include,
for example,
SPDP and Sulfo-LC-SPDP (Pierce).
[00138] In a preferred embodiment, the composition of the invention further
comprises a
linker. Engineering of a second attachment site onto the IL-1 molecule is
achieved by the
association of a linker, preferably containing at least one amino acid
suitable as second
attachment site according to the disclosures of this invention. Therefore, in
a preferred
embodiment of the present invention, a linker is associated to the IL-1
molecule by way of at
least one covalent bond, preferably, by at least one, preferably one peptide
bond. Preferably,
the linker comprises, or alternatively consists of, the second attachment
site. In a further
preferred embodiment, the linker comprises a sulfhydryl group, preferably of a
cysteine
residue. In another preferred embodiment, the amino acid linker is a cysteine
residue.
[00139] The selection of a linker will be dependent on the nature of the IL-1
molecule, on its
biochemical properties, such as pI, charge distribution and glycosylation. In
general, flexible
amino acid linkers are favored. In a further preferred embodiment of the
present invention, the
linker consists of amino acids, wherein further preferably the linker consists
of at least one
and at most 25, preferably at most 20, more preferably at most 15 amino acids.
In an again
preferred embodiment of the invention, the amino acid linker contains 1 to 10
amino acids.
Preferred embodiments of the linker are selected from the group consisting of:
(a) CGG (SEQ
ID NO:171); (b) N-terminal gamma 1-linker, preferably CGDKTHTSPP (SEQ ID
NO:172);
(c) N-terminal gamma 3-linker, preferably CGGPKPSTPPGSSGGAP(SEQ ID NO:173);
(d)
Ig hinge regions; (e) N-terminal glycine linkers, preferably GCGGGG (SEQ ID
NO:174); (f)
(G)kC(G)n with n=0-12 and k=0-5 (SEQ ID NO:175); (g) N-terminal glycine-serine
linkers,
preferably (GGGGS)n, n=1-3 (SEQ ID NO:176) with one further cysteine; (h)
(G)kC(G)m(S)1(GGGGS)n with n=0-3, k=0-5, m=0-10, 1=0-2 (SEQ ID NO:177); (i)
GGC
(SEQ ID NO:178); (k) GGC-NH2 (SEQ ID NO:179); (1) C-terminal gamma 1-linker,
preferably DKTHTSPPCG (SEQ ID NO:180); (m) C-terminal gamma 3-linker,
preferably
PKPSTPPGSSGGAPGGCG (SEQ ID NO:181); (n) C-terminal glycine linkers, preferably
GGGGCG (SEQ ID NO:182)); (o) (G)nC(G)k with n=0-12 and k=0-5 (SEQ ID NO:183);
(p)
C-terminal glycine-serine linkers, preferably (SGGGG)n n=1-3 (SEQ ID NO:184)
with one
further cysteine; (q) (G)m(S)1(GGGGS)n(G)oC(G)k with n=0-3, k=0-5, m=0-10, 1=0-
2, and
o=0-8 (SEQ ID NO:185). In a further preferred embodiment the linker is added
to the N-
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-39-
terminus of the IL-1 molecule. In another preferred embodiment of the
invention, the linker is
added to the C-terminus of IL-1 molecule.
[00140] Preferred linkers according to this invention are glycine linkers (G)n
further
containing a cysteine residue as second attachment site, such as N-terminal
glycine linker
(GCGGGG, SEQ ID NO:174) and C-terminal glycine linker (GGGGCG, SEQ ID NO:182).
Further preferred embodiments are C-terminal glycine-lysine linker (GGKKGC,
SEQ ID
NO: 186) and N-terminal glycine-lysine linker (CGKKGG, SEQ ID NO: 187), GGCG
(SEQ
ID NO:188) and GGC (SEQ ID NO:178) or GGC-NH2 (SEQ ID NO:179, "NH2" stands for
amidation) linkers at the C-terminus of the peptide or CGG (SEQ ID NO:171) at
its N-
terminus. In general, glycine residues will be inserted between bulky amino
acids and the
cysteine to be used as second attachment site, to avoid potential steric
hindrance of the bulkier
amino acid in the coupling reaction.
[00141] Linking of the IL-1 molecule to the VLP by using a hetero-bifunctional
cross-linker
according to the preferred methods described above, allows coupling of the IL-
1 molecule to
the VLP in an oriented fashion. Other methods of linking the IL-1 molecule to
the VLP
include methods wherein the IL-1 molecule is cross-linked to the VLP, using
the
carbodiimide EDC, and NHS. The IL-1 molecule may also be first thiolated
through reaction,
for example with SATA, SATP or iminothiolane. The IL-1 molecule, after
deprotection if
required, may then be coupled to the VLP as follows. After separation of the
excess thiolation
reagent, the IL-1 molecule is reacted with the VLP, previously activated with
a hetero-
bifunctional cross-linker comprising a cysteine reactive moiety, and therefore
displaying at
least one or several functional groups reactive towards cysteine residues, to
which the
thiolated IL-1 molecule can react, such as described above. Optionally, low
amounts of a
reducing agent are included in the reaction mixture. In further methods, the
IL-1 molecule is
attached to the VLP, using a homo-bifunctional cross-linker such as
glutaraldehyde, DSG,
BM[PEO]4, BS3, (Pierce) or other known homo-bifunctional cross-linkers with
functional
groups reactive towards amine groups or carboxyl groups of the VLP.
[00142] In other embodiments of the present invention, the composition
comprises or
alternatively consists essentially of a virus-like particle linked to IL-1
molecule via chemical
interactions, wherein at least one of these interactions is not a covalent
bond.
[00143] Linking of the VLP to the IL-1 molecule can be effected by
biotinylating the VLP
and expressing the IL-1 molecule as a streptavidin-fusion protein.
[00144] One or several antigen molecules, i.e. IL-1 molecules, can be attached
to one subunit
of the VLP, preferably of RNA bacteriophage coat proteins, preferably through
the exposed
lysine residues of the coat proteins of RNA bacteriophage VLP, if sterically
allowable. A
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-40-
specific feature of the VLPs of RNA bacteriophage and in particular of the Q[3
coat protein
VLP is thus the possibility to couple several antigens per subunit. This
allows for the
generation of a dense antigen array.
[00145] In very preferred embodiments of the invention, the IL-1 molecule is
linked via a
cysteine residue, having been added to either the N-terminus or the C-terminus
of, or a natural
cysteine residue within an IL-1 molecule, to lysine residues of coat proteins
of the VLPs of
RNA bacteriophage, and in particular to the coat protein of Q.
[00146] As described above, four lysine residues are exposed on the surface of
the VLP of
Q[3 coat protein. Typically and preferably these residues are derivatized upon
reaction with a
cross-linker molecule. In the instance where not all of the exposed lysine
residues can be
coupled to an antigen, the lysine residues which have reacted with the cross-
linker are left
with a cross-linker molecule attached to the s-amino group after the
derivatization step. This
leads to disappearance of one or several positive charges, which may be
detrimental to the
solubility and stability of the VLP. By replacing some of the lysine residues
with arginines, as
in the disclosed Q(3 coat protein mutants, we prevent the excessive
disappearance of positive
charges since the arginine residues do not react with the preferred cross-
linkers. Moreover,
replacement of lysine residues by arginine residues may lead to more defined
antigen arrays,
as fewer sites are available for reaction to the antigen.
[00147] Accordingly, exposed lysine residues were replaced by arginines in the
following Q(3
coat protein mutants: Q(3-240 (Lysl3-Arg; SEQ ID NO:16), Q(3-250 (Lys 2-Arg,
Lysl3-Arg;
SEQ ID NO:18), Q(3-259 (Lys 2-Arg, Lysl6-Arg; SEQ ID NO:20) and Q(3-251;
(Lysl6-Arg,
SEQ ID NO:19). In a further embodiment, we disclose a Q[3 mutant coat protein
with one
additional lysine residue Q(3-243 (Asn l0-Lys; SEQ ID NO:17), suitable for
obtaining even
higher density arrays of antigens.
[00148] In one preferred embodiment of the invention, the VLP of an RNA
bacteriophage is
recombinantly produced by a host and wherein said VLP is essentially free of
host RNA,
preferably host nucleic acids. In one further preferred embodiment, the
composition further
comprises at least one polyanionic macromolecule bound to, preferably packaged
in or
enclosed in, the VLP. In a still further preferred embodiment, the polyanionic
macromolecule
is polyglutamic acid and/or polyaspartic acid.
[00149] In another preferred embodiment, the composition further comprises at
least one
immunostimulatory substance bound to, preferably packaged in or enclosed in,
the VLP. In a
still further preferred embodiment, the immunostimulatory substance is a
nucleic acid,
preferably DNA, most preferably an unmethylated CpG containing
oligonucleotide.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-41-
[00150] Essentially free of host RNA, preferably host nucleic acids: The term
"essentially
free of host RNA, preferably host nucleic acids" as used herein, refers to the
amount of host
RNA, preferably host nucleic acids, comprised by the VLP, which amount
typically and
preferably is less than 30 g, preferably less than 20 g, more preferably
less than 10 g,
even more preferably less than 8 g, even more preferably less than 6 g, even
more
preferably less than 4 g, most preferably less than 2 g, per mg of the VLP.
Host, as used
within the afore-mentioned context, refers to the host in which the VLP is
recombinantly
produced. Conventional methods of determining the amount of RNA, preferably
nucleic
acids, are known to the skilled person in the art. The typical and preferred
method to
determine the amount of RNA, preferably nucleic acids, in accordance with the
present
invention is described in Example 17 of W02006/037787A2. Identical, similar or
analogous
conditions are, typically and preferably, used for the determination of the
amount of RNA,
preferably nucleic acids, for inventive compositions comprising VLPs other
than Q. The
modifications of the conditions eventually needed are within the knowledge of
the skilled
person in the art. The numeric value of the amounts determined should
typically and
preferably be understood as comprising values having a deviation of 10%,
preferably
having a deviation of 5%, of the indicated numeric value.
[00151] Polyanionic macromolecule: The term "polyanionic macromolecule", as
used
herein, refers to a molecule of high relative molecular mass which comprises
repetitive groups
of negative charge, the structure of which essentially comprises the multiple
repetition of
units derived, actually or conceptually, from molecules of low relative
molecular mass. A
polyanionic macromolecule should have a molecular weight of at least 2000
Dalton, more
preferably of at least 3000 Dalton and even more preferably of at least 5000
Dalton. The term
"polyanionic macromolecule" as used herein, typically and preferably refers to
a molecule
that is not capable of activating toll-like receptors. Thus, the term
"polyanionic
macromolecule" typically and preferably excludes Toll-like receptors ligands,
and even more
preferably furthermore excludes immunostimulatory substances such as Toll-like
receptors
ligands, immunostimulatory nucleic acids, and lipopolysacchrides (LPS). More
preferably the
term "polyanionic macromolecule" as used herein, refers to a molecule that is
not capable of
inducing cytokine production. Even more preferably the term "polyanionic
macromolecule"
excludes immunostimulatory substances. The term "immunostimulatory substance",
as used
herein, refers to a molecule that is capable of inducing and/or enhancing
immune response
specifically against the antigen comprised in the present invention.
[00152] Host RNA, preferably host nucleic acids: The term "host RNA,
preferably host
nucleic acids" or the term "host RNA, preferably host nucleic acids, with
secondary
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-42-
structure", as used herein, refers to the RNA, or preferably nucleic acids,
that are originally
synthesized by the host. The RNA, preferably nucleic acids, may, however,
undergo chemical
and/or physical changes during the procedure of reducing or eliminating the
amount of RNA,
preferably nucleic acids, typically and preferably by way of the inventive
methods, for
example, the size of the RNA, preferably nucleic acids, may be shortened or
the secondary
structure thereof may be altered. However, even such resulting RNA or nucleic
acids is still
considered as host RNA, or host nucleic acids.
[00153] Methods to determine the amount of RNA and to reduce the amount of RNA
comprised by the VLP have disclosed in US provisional application filed by the
same
assignee on October 5, 2004 and thus the entire application is incorporated
herein by way of
reference. Reducing or eliminating the amount of host RNA, preferably host
nucleic,
minimizes or reduces unwanted T cell responses, such as inflammatory T cell
response and
cytotoxic T cell response, and other unwanted side effects, such as fever,
while maintaining
strong antibody response specifically against IL-1.
[00154] In one preferred embodiment, this invention provides a method of
preparing the
inventive compositions and VLP of an RNA-bacteriophage the invention, wherein
said VLP
is recombinantly produced by a host and wherein said VLP is essentially free
of host RNA,
preferably host nucleic acids, comprising the steps of: a) recombinantly
producing a virus-like
particle (VLP) with at least one first attachment site by a host, wherein said
VLP comprises
coat proteins, variants or fragments thereof, of a RNA-bacteriophage; b)
disassembling said
virus-like particle to said coat proteins, variants or fragments thereof, of
said RNA-
bacteriophage; c) purifying said coat proteins, variants or fragments thereof;
d) reassembling
said purified coat proteins, variants or fragments thereof, of said RNA-
bacteriophage to a
virus-like particle, wherein said virus-like particle is essentially free of
host RNA, preferably
host nucleic acids; and e) linking at least one antigen of the invention with
at least one second
attachment site to said VLP obtained from step d). In a further preferred
embodiment, the
reassembling of said purified coat proteins, variants or fragments thereof, is
effected in the
presence of at least one polyanionic macromolecule.
[00155] In one aspect, the invention provides a vaccine comprising the
composition of the
invention. In one preferred embodiment, the IL-1 molecule which is linked to
the VLP in the
vaccine composition may be of animal, preferably mammal or human origin. In
preferred
embodiments, the IL-1 of the invention is of human, bovine, dog, cat, mouse,
rat, pig or horse
origin.
[00156] In one preferred embodiment, the vaccine composition further comprises
at least
one adjuvant. The administration of the at least one adjuvant may hereby occur
prior to,
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
- 43 -
contemporaneously or after the administration of the inventive composition.
The term
"adjuvant" as used herein refers to non-specific stimulators of the immune
response or
substances that allow generation of a depot in the host which when combined
with the vaccine
and pharmaceutical composition, respectively, of the present invention may
provide for an
even more enhanced immune response.
[00157] In another preferred embodiment, the vaccine composition is devoid of
adjuvant.
[00158] An advantageous feature of the present invention is the high
immunogenicity of
the composition, even in the absence of adjuvants. The absence of an adjuvant,
furthermore,
minimizes the occurrence of unwanted inflammatory T-cell responses
representing a safety
concern in the vaccination against self antigens. Thus, the administration of
the vaccine of the
invention to a patient will preferably occur without administering at least
one adjuvant to the
same patient prior to, contemporaneously or after the administration of the
vaccine.
[00159] The invention further discloses a method of immunization comprising
administering the vaccine of the present invention to an animal or a human.
The animal is
preferably a mammal, such as cat, sheep, pig, horse, bovine, dog, rat, mouse
and particularly
human. The vaccine may be administered to an animal or a human by various
methods known
in the art, but will normally be administered by injection, infusion,
inhalation, oral
administration, or other suitable physical methods. The conjugates may
alternatively be
administered intramuscularly, intravenously, transmucosally, transdermally,
intranasally,
intraperitoneally or subcutaneously. Components of conjugates for
administration include
sterile aqueous (e.g., physiological saline) or non-aqueous solutions and
suspensions.
Examples of non-aqueous solvents are propylene glycol, polyethylene glycol,
vegetable oils
such as olive oil, and injectable organic esters such as ethyl oleate.
Carriers or occlusive
dressings can be used to increase skin permeability and enhance antigen
absorption.
[00160] Vaccines of the invention are said to be "pharmacologically
acceptable" if their
administration can be tolerated by a recipient individual. Further, the
vaccines of the
invention will be administered in a "therapeutically effective amount" (i.e.,
an amount that
produces a desired physiological effect). The nature or type of immune
response is not a
limiting factor of this disclosure. Without the intention to limit the present
invention by the
following mechanistic explanation, the inventive vaccine might induce
antibodies which bind
to IL-1 and thus reducing its concentration and/or interfering with its
physiological or
pathological function.
[00161] In one aspect, the invention provides a pharmaceutical composition
comprising
the composition as taught in the present invention and an acceptable
pharmaceutical carrier.
When vaccine of the invention is administered to an individual, it may be in a
form which
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-44-
contains salts, buffers, adjuvants, or other substances which are desirable
for improving the
efficacy of the conjugate. Examples of materials suitable for use in
preparation of
pharmaceutical compositions are provided in numerous sources including
Remington's
Pharmaceutical Sciences (Osol, A, ed., Mack Publishing Co., (1990)).
[00162] The invention teaches a process for producing the composition of the
invention
comprising the steps of: (a) providing a VLP with at least one first
attachment site; (b)
providing a IL-1 molecule with at least one second attachment site, and (c)
combining said
VLP and said IL-1 molecule to produce a composition, wherein said IL-1
molecule and said
VLP are linked through the first and the second attachment sites.
[00163] In a further preferred embodiment, the step of providing a VLP with at
least one
first attachment site comprises further steps: (a) disassembling said virus-
like particle to said
coat proteins, mutants or fragments thereof, of said RNA-bacteriophage; (b)
purifying said
coat proteins, mutants or fragments thereof; (c) reassembling said purified
coat proteins,
mutants or fragments thereof, of said RNA-bacteriophage to a virus-like
particle, wherein said
virus-like particle is essentially free of host RNA, preferably host nucleic
acids. In a still
further preferred embodiment, the reassembling of said purified coat proteins
is effected in the
presence of at least one polyanionic macromolecule.
[00164] The invention provides a method of using the compositions of the
invention for
treating and/or attenuating diseases or conditions in which IL-1 exerts an
important
pathological function in an animal or in human.
[00165] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably dog, cat
horse or human, most preferably human, wherein said disease is preferably
selected from the
group consisting of: (a) vascular diseases, preferably coronary artery
disease, atherosclerosis
and vasculitis, most preferably atherosclerosis; (b) inherited IL-1-dependent
inflammatory
diseases, preferably Familial Mediterranean Fever (FMF), Familial Cold
Autoinflammatory
Syndrome (FCAS) Neonatal Onset Multisystem Inflammatory Disease (NOMID) and
Muckle
Wells Syndrome, most preferably Familial Mediterranean Fever (FMF); (c)
chronic
autoimmune inflammatory diseases, preferably rheumatoid arthritis, systemic
onset juvenile
idiopathic arthritis, adult onset Still's disease, psoriasis, Crohn's disease
and ulcerative colitis,
most preferably rheumatoid athritis; (d) bone and cartilage degenerative
diseases, preferably
gout, osteoporosis and osteoarthritis, most preferably osteoarthritis; (e)
allergic diseases,
preferably contact hypersensitivity, type 1 hypersensitivity and allergy, most
preferably
allergy; and (f) neurological diseases, preferably Alzheimer's disease,
epilepsy, Parkinson's
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
- 45 -
disease and multiple sclerosis, most preferably multiple sclerosis.
[00166] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably dog, cat
horse or human, most preferably human, wherein said disease is a vascular
disease, preferably
coronary artery disease, atherosclerosis and vasculitis, most preferably
atherosclerosis, and
wherein said at least one antigen comprised by said composition, said vaccine
or said
pharmaceutical composition is an IL-1 alpha molecule of the invention,
preferably an IL-1
alpha mature fragment, most preferably SEQ ID NO:63 or a mutein thereof.
[00167] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably dog, cat
horse or human, most preferably human, wherein said disease is selected from
the group
consisting of: (a) inherited IL-1-dependent inflammatory diseases, preferably
Familial
Mediterranean Fever (FMF), Familial Cold Autoinflammatory Syndrome (FCAS)
Neonatal
Onset Multisystem Inflammatory Disease (NOMID) and Muckle Wells Syndrome, most
preferably Familial Mediterranean Fever (FMF); (b) chronic autoimmune
inflammatory
diseases, preferably rheumatoid arthritis, systemic onset juvenile idiopathic
arthritis, adult
onset Still's disease, psoriasis, Crohn's disease and ulcerative colitis, most
preferably
rheumatoid athritis; (c) bone and cartilage degenerative diseases, preferably
gout,
osteoporosis and osteoarthritis, most preferably osteoarthritis; (d) allergic
diseases, preferably
contact hypersensitivity, type 1 hypersensitivity and allergy, most preferably
allergy; and (e)
neurological diseases, preferably Alzheimer's disease, epilepsy, Parkinson's
disease and
multiple sclerosis, most preferably multiple sclerosis, and wherein said at
least one antigen
comprised by said composition, said vaccine or said pharmaceutical composition
is an IL-1
beta molecule, preferably an IL-1 beta mature fragment, most preferably SEQ ID
NO:64 or a
mutein thereof.
[00168] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably dog, cat
horse or human, most preferably human, wherein said disease is an inherited IL-
1-dependent
inflammatory diseases, preferably Familial Mediterranean Fever (FMF); and
wherein said at
least one antigen comprised by said composition, said vaccine or said
pharmaceutical
composition is an IL-1 beta molecule, preferably an IL-1 beta mature fragment,
most
preferably SEQ ID NO:64 or a mutein thereof.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-46-
[00169] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably human,
wherein said disease is a vascular disease, preferably atherosclerosis.
[00170] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably human,
wherein said disease is an inherited IL-1-dependent inflammatory diseases,
preferably familial
mediterranean fever (FMF).
[00171] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably human,
wherein said disease is a chronic autoimmune inflammatory diseases, preferably
rheumatoid
arthritis.
[00172] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably human,
wherein said disease is a bone and cartilage degenerative diseases, preferably
osteoarthritis.
[00173] The invention further provides for use of the compositions of the
invention or the
vaccine of the invention or the pharmaceutical composition of the invention
for the
manufacture of a medicament for treatment of a disease in an animal,
preferably human,
wherein said disease is a neurological disease, preferably multiple sclerosis.
[00174] The invention further provides a method of treating a disease, the
method
comprising administering the composition of the invention, the vaccine of the
invention or the
pharmaceutical composition of the invention to an animal, preferably dog, cat
horse or
human, most preferably human, wherein said disease is preferably selected from
the group
consisting of: (a) vascular diseases, preferably coronary artery disease,
atherosclerosis and
vasculitis, most preferably atherosclerosis; (b) inherited IL-1-dependent
inflammatory
diseases, preferably Familial Mediterranean Fever (FMF), Familial Cold
autoinflammatory
Syndrome (FCAS) Neonatal Onset Multisystem Inflammatory Disease (NOMID) and
Muckle
Wells Syndrome, most preferably Familial Mediterranean Fever (FMF); (c)
chronic
autoimmune inflammatory diseases, preferably rheumatoid arthritis, systemic
onset juvenile
idiopathic arthritis, adult onset Still's disease, psoriasis, Crohn's disease
and ulcerative colitis,
most preferably rheumatoid athritis; (d) bone and cartilage degenerative
diseases, preferably
gout, osteoporosis and osteoarthritis, most preferably osteoarthritis; (e)
allergic diseases,
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-47-
preferably contact hypersensitivity, type 1 hypersensitivity and allergy, most
preferably
allergy; and (f) neurological diseases, preferably Alzheimer's disease,
epilepsy, Parkinson's
disease and multiple sclerosis, preferably multiple sclerosis.
[00175] The invention further provides a method of treating a disease, the
method
comprising administering the composition of the invention, the vaccine of the
invention or the
pharmaceutical composition of the invention to an animal, preferably dog, cat
horse or
human, most preferably human, wherein said disease is a vascular diseases,
preferably
coronary artery disease, atherosclerosis and vasculitis, most preferably
atherosclerosis, and
wherein said at least one antigen comprised by said composition, said vaccine
or said
pharmaceutical composition is an IL-1 alpha molecule, preferably an IL-1 alpha
mature
fragment, most preferably SEQ ID NO:63 or a mutein thereof.
[00176] The invention further provides a method of treating a disease, the
method
comprising administering the composition of the invention, the vaccine of the
invention or the
pharmaceutical composition of the invention to an animal, preferably dog, cat
horse or
human, most preferably human, wherein said disease is preferably selected from
the group
consisting of: (a) inherited IL-1-dependent inflammatory diseases, preferably
Familial
Mediterranean Fever (FMF), Familial Cold Autoinflammatory Syndrome (FCAS)
Neonatal
Onset Multisystem Inflammatory Disease (NOMID) and Muckle Wells Syndrome, most
preferably Familial Mediterranean Fever (FMF); (b) chronic autoimmune
inflammatory
diseases, preferably rheumatoid arthritis, systemic onset juvenile idiopathic
arthritis, adult
onset Still's disease, psoriasis, Crohn's disease and ulcerative colitis, most
preferably
rheumatoid athritis; (c) bone and cartilage degenerative diseases, preferably
gout,
osteoporosis and osteoarthritis, most preferably osteoarthritis; (d) allergic
diseases, preferably
contact hypersensitivity, type 1 hypersensitivity and allergy, most preferably
allergy; and (e)
neurological diseases, preferably Alzheimer's disease, epilepsy, Parkinson's
disease and
multiple sclerosis, most preferably multiple sclerosis, and wherein said at
least one antigen
comprised by said composition, said vaccine or said pharmaceutical composition
is an IL-1
beta molecule, preferably an IL-1 beta mature fragment, most preferably SEQ ID
NO:64 or a
mutein thereof.
[00177] The invention further provides a method of treating a disease, the
method
comprising administering the composition of the invention, the vaccine of the
invention or the
pharmaceutical composition of the invention to an animal, preferably dog, cat
horse or
human, most preferably human, wherein said disease is an inherited IL-1-
dependent
inflammatory diseases, preferably Familial Mediterranean Fever (FMF); and
wherein said at
least one antigen comprised by said composition, said vaccine or said
pharmaceutical
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-48-
composition is an IL-1 beta molecule, preferably an IL-1 beta mature fragment,
most
preferably SEQ ID NO:64 or a mutein thereof.
[00178] The invention further provides a method of treating a disease, the
method comprising
administering the composition of the invention, the vaccine of the invention
or the
pharmaceutical composition of the invention to an animal, preferably human,
wherein said
disease is a vascular disease, preferably atherosclerosis.
[00179] The invention further provides a method of treating a disease, the
method comprising
administering the composition of the invention, the vaccine of the invention
or the
pharmaceutical composition of the invention to an animal, preferably human,
wherein said
disease is an inherited IL-1-dependent inflammatory diseases, preferably
familial
mediterranean fever (FMF).
[00180] The invention further provides a method of treating a disease, the
method comprising
administering the composition of the invention, the vaccine of the invention
or the
pharmaceutical composition of the invention to an animal, preferably human,
wherein said
disease is a chronic autoimmune inflammatory diseases, preferably rheumatoid
arthritis.
[00181] The invention further provides a method of treating a disease, the
method comprising
administering the composition of the invention, the vaccine of the invention
or the
pharmaceutical composition of the invention to an animal, preferably human,
wherein said
disease is a bone and cartilage degenerative diseases, preferably
osteoarthritis.
All references cited herein are incorporated entirely by reference.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-49-
EXAMPLES
EXAMPLE 1
Cloning, expression and purification of murine IL1a117_270 and IL-1(3119_269
[00182] The nucleotide sequence encoding amino acids 117-270 of murine IL-la
was
amplified by PCR from a cDNA library of TNFa-activated murine macrophages
using
oligonucleotides ILlal (5'-ATATATGCTAGCCCCTTACACCTACCAGAGTGATTTG-3';
SEQ ID NO:24) and ILloa2 (5'-ATATATCTCGAGTGATATCTGGAAGTCTGTCATA
GAG-3'; SEQ ID NO:25). Using the same cDNA library, the nucleotide sequence
encoding
amino acids 119-269 of the murine IL-1(3 precursor was amplified with
oligonucleotides
ILl(31 (5'-ATATATGCTAGCCCCCATTAGACAGCTGCACTACAGG-3'; SEQ ID NO:26)
and ILl(32 (5'-ATATATCTCGAGGGAAGACACAGATTCCATGGTGAAG-3';
SEQ ID NO: 27). Both DNA fragments were digested with NheI and Xhol, and
cloned into
the expression vector pModEC 1(SEQ ID NO:29)
[00183] The vector pModECl (SEQ ID NO:29) is a derivative of pET22b(+)
(Novagen Inc.),
and was constructed in two steps. In a first step the multiple cloning site of
pET22b(+) was
changed by replacing the original sequence between the Ndel and Xhol sites
with the
annealed oligos primerMCS-1F (5'-TATGGATCCGGCTAGCGCTCGAGGGTTTA
AACGGCGGCCGCAT-3'; SEQ ID NO:30) and primerMCS-1R (5'-TCGAATGCGGCCG
CCGTTTAAACCCTCGAGCGCTAGCCGGATCCA-3'; SEQ ID NO:31) (annealing in
15 mM TrisHCl pH 8 buffer). The resulting plasmid was termed pModOO, and had
Ndel,
BamHI, Nhel, Xhol, Pmel and Notl restriction sites in its multiple cloning
site. The annealed
pair of oligos Bamhis6-EK-Nhe-F (5'-GATCCACACCACCACCACCACCACGG
TTCTGGTGACGACGATGACAAAGCGCTAGCCC-3'; SEQ ID NO:32) and Bamhis6-
EKNhe-R (5'-TCGAGGGCTAGCGCTTTGTCATCGTCGTCACCAGAACCGTGGT
GGTGGTGGTGGTGTG-3'; SEQ ID NO:33) and the annealed pair of oligolF-C-glycine-
linker (5'-TCGAGGGTGGTGGTGGTGGTTGCGGTTAATAAGTTTAAACGC-3';
SEQ ID NO:34) and oligolR-C-glycine-linker (5'-GGCCGCGTTTAAACTTATTA
ACCGCAACCACCACCACCACCC-3'; SEQ ID NO:35) were ligated together into the
BamHI-Notl digested pModOO plasmid to obtain pModECl, which encodes an N-
terminal
hexahistidine tag, an enterokinase cleavage site and a C-terminal glycine
linker containing
one cysteine residue.
[00184] The cloning of the above mentioned fragments into pModECl gave rise to
plasmids
pModECl-His-EK-mILlai17_270 and pModECl-His-EK-mILl(3119_269, respectively.
These
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-50-
plasmids encode fusion proteins consisting of an N-terminal His-tag, an
enterokinase cleavage
site, the mature murine IL-la or IL-1(3, respectively, and a C-terminal
cysteine-containing
linker (GGGGGCG, SEQ ID NO:28). For expression, Escherichia coli BL21 cells
harbouring
either plasmid were grown at 37 C to an OD at 600 nm of 1.0 and then induced
by addition of
isopropyl-(3-D-thiogalactopyranoside at a concentration of 1 mM. Bacteria were
grown for 4
more hours at 37 C, harvested by centrifugation and resuspended in 80 ml lysis
buffer (10
mM NazHPO4, 30 mM NaC1, pH 7.0). Cells were then disrupted by sonication and
cellular
DNA and RNA were digested by 30 min incubation at room temperature with 64 1
2 M
MgC12 and 10 1 Benzonase. Cellular debris was removed by centrifugation (SS34
rotor,
20000 rpm, 4 C, 60 min), and the cleared lysate was applied to a Ni +-NTA
agarose column
(Qiagen, Hilden, Germany). After extensive washing of the column with washing
buffer (50
mM NaH2PO4, 300 mM NaC1, 20 mM Imidazol, pH 8.0) the proteins were eluted with
elution
buffer (50 mM NaH2PO4, 300 mM NaC1, 200 mM Imidazol, pH 8.0). Purified
proteins were
dialysed against PBS pH 7.2, flash-frozen in liquid nitrogen and stored at -80
C until further
use.
EXAMPLE 2
A. Coupling of mouse IL-1(3119-269 to Q(3 virus-like particles
[00185] A solution containing 1.3 mg/ml of the purified murine IL-1(3119_269
protein from
EXAMPLE 1(SEQ ID NO:66) in PBS pH 7.2 was incubated for 60 min at room
temperature
with an equimolar amount of TCEP for reduction of the C-terminal cysteine
residue.
[00186] A solution of 6 ml of 2 mg/ml Q(3 capsid protein in PBS pH 7.2 was
then reacted for
60 min at room temperature with 131 1 of a SMPH solution (65 mM in DMSO). The
reaction solution was dialysed at 4 C against three 3 1 changes of 20 mM
HEPES, 150 mM
NaC1 pH 7.2 over 24 hours. Seventy-five 1 of the derivatized and dialyzed Q(3
solution was
mixed with 117 1 H20 and 308 1 of the purified and pre-reduced mouse IL-
1(3119_269 protein
and incubated over night at 15 C for chemical crosslinking. Uncoupled protein
was removed
by tangential flow filtration against PBS using cellulose ester membranes with
a molecular
weight cutoff of 300.000 Da.
[00187] Coupled products were analyzed on a 12 % SDS-polyacrylamide gel under
reducing
conditions. The Coomassie stained gel is shown in Fig. 1. Several bands of
increased
molecular weight with respect to the Q(3 capsid monomer are visible, clearly
demonstrating
the successful cross-linking of the mouse IL-1(3119_269 protein to the Q(3
capsid.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-51 -
B. Immunization of mice with mouse IL-1(3119_269 protein coupled
to Q(3 capsid (Q[3-mIL-1(3119_269)
[00188] Five female balb/c mice were immunized with Q[3-mIL-1(3119_269 (SEQ ID
NO:66).
Fifty g of total protein were diluted in PBS to 200 1 and injected
subcutaneously (100 1 on
two ventral sides) on day 0 and day 21. Mice were bled retroorbitally on day
0, 21, and 35,
and sera were analyzed using mouse IL-1(3119_269-specific ELISA.
C. ELISA
[00189] ELISA plates were coated with mouse IL-1(3119_269 protein at a
concentration of 1
g/ml. The plates were blocked and then incubated with serially diluted mouse
sera from day
0, 21, and 35. Bound antibodies were detected with enzymatically labeled anti-
mouse IgG
antibody. Antibody titers of mouse sera were calculated as the average of
those dilutions
which led to half maximal optical density at 450 nm. The average anti-mouse IL-
1(3119_269 titer
was 1:22262 at day 21 and 1:309276 at day 35. This demonstrates that
immunization with Q(3
coupled to the mouse IL-1(3119_269 protein could overcome immunological
tolerance and
produce high titer antibodies which recognize specifically IL-1(3119_269_
D. In vitro neutralization of IL-1(3
[00190] Sera of mice immunized with Q[3-mIL-1(3119_269 (SEQ ID NO:66) were
then tested
for their ability to inhibit the binding of mouse IL-l(3 protein to its
receptor. ELISA plates
were therefore coated with a recombinant mIL-lreceptorI-hFc fusion protein at
a
concentration of 1 g/ml, and co-incubated with serial dilutions of sera from
mice which had
been immunized either with mouse IL-1(3119_269 coupled to Q(3 capsid or Wi
mouse IL-la117_
z7o coupled to Q[3 capsid and 100 ng/mlfomouse IL-1(3119_269_ Binding of IL-
1(3119_269 to the
immobilized mIL-lreceptorI-hFc fusion protein was detected with a biotinylated
anti-mouse
IL-1(3 antibody and horse radish peroxidase conjugated streptavidin. All sera
from mice
immunized against murine IL-1(3119_269 inhibited completely the binding of
mouse IL-1(3119_269
to its receptor at concentrations of _0.4 %, whereas sera from mice immunized
against mouse
IL-laii7_270 did not show any inhibitory effect even at the highest
concentration used (3.3 %).
These data demonstrate that immunization with mouse IL-1(3119_269 coupled to
Q(3 capsid can
yield antibodies which are able to neutralize the interaction of mouse IL-
1(3119_269 and its
receptor.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-52-
E. In vivo neutralization of IL-1(3
[00191] The in vivo neutralizing capacity of the antibodies raised by
immunization with Q[3-
mIL-1(3119_269 was investigated next. Four female balb/c mice were therefore
immunized twice
at days 0 and 14 with Q[3-mIL-1(3119_269 and four mice were immunized at the
same time with
Q(3 capsid alone. At da~ 1 all mice were injected intravenously with 1 g free
IL-1(3119_269.
As readout of the inflammatory activity of the injected IL-1(3119_269, serum
samples were
analysed 3 h after injection for the relative increase in the concentration of
the pro-
inflammatory cytokine IL-6. Q(3-immunized mice showed an average increase in
the serum
IL-6 concentration of 1.01 0.61 ng/ml, whereas mice immunized with Q[3-mIL-
1(3119_269
showed an average increase of only 0.11 0.30 ng/ml (p=0.04). As a control on
day 28 all
mice were injected with 1 g mIL-la. Three hours after injection mice
immunized with Q(3
carrier alone showed an average increase in serum IL-6 concentrations of 40.24
8.06 ng/ml,
while mice immunized with Q[3-mIL-1(3119_269 showed an increase of 57.98
29.92 ng/ml
(p=0.30). These data indicate that the antibodies produced by immunization
with Q[3-mIL-
1(3119_269 were able to neutralize specifically and efficiently the pro-
inflammatory activity of
IL-1(3.
F. Efficacy of Q[3-mIL-1(3119_269 in a mouse model of rheumatoid arthritis
[00192] The efficacy of Q[3-mIL-1(3119_269 immunization was tested in the
murine collagen-
induced arthritis model (CIA). This model reflects most of the immunological
and
histological aspects of human rheumatoid arthritis and is therefore routinely
used to assay the
efficacy of anti-inflammatory agents. Male DBA/1 mice were immunized
subcutaneously
three times (days 0, 14 and 28) with 50 g of either Q[3-mIL-1(3119_269 (n=8)
or Q(3 alone
(n=8), and then injected intradermally at day 42 with 200 g bovine type II
collagen mixed
with complete Freund's adjuvant. After a booster injection of 200 g bovine
type II collagen
mixed with incomplete Freund's adjuvant at day 63 mice were examined on a
daily basis for
the development of arthritis symptoms.
[00193] A clinical score ranging from 0 to 3 was assigned to each limb
according to the
degree of reddening and swelling observed, and ankle thickness of all hind
limbs was
measured. The clinical score was assigned over 3 consecutive weeks to each
limb according
to the following definitions: 0 normal, 1 mild erythema and/or swelling of
digits/paw, 2
erythema and swelling extending over whole paw/joint, 3 strong swelling,
deformation of
paw/joint, stiffness. Cumulative clinical scores of individual mice were
calculated as the sum
of clinical scores of all four limbs, resulting in a possible maximal
cumulative score per
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-53-
mouse of 12.
[00194] Two weeks after the second collagen injection Q(3-immunized mice
showed an
average cumulative clinical score of 4.44, while Q[3-mIL-1(3119_269-immunized
mice showed
an average score of only 1.06. Moreover, the average increase in hind ankle
thickness was
18 % for Q(3-immunized mice and only 1% for mice which had been immunized with
Q[3-
mIL-1(3119_269_ As an additional readout of the inflammatory reaction, serum
levels of IL-6
were determined 1 week after the second collagen injection. Q(3-immunized mice
had an
average IL-6 serum concentration of 1.92 0.36 while Q[3-mIL-1(3119_269-
immunizedmice had
an average IL-6 concentration of only 0.79 0.16 (p=0.01). Taken together,
these data show
that immunization with Q[3-mIL-1(3119_269 strongly protects mice from
inflammation and
clinical signs of arthritis in the CIA model.
EXAMPLE 3
A. Coupling of mouse IL-1a117_270 to Q(3 virus-like particles
[00195] A solution containing 1.8 mg/ml o f the purified IL- l oai 17-270
protein from EXAMPLE
1(SEQ ID NO:65) in PBS pH 7.2 was incubated for 60 min at room temperature
with an
equimolar amount of TCEP for reduction of the C-terminal cysteine residue.
[00196] A solution of 6 ml of 2 mg/ml Q(3 capsid protein in PBS pH 7.2 was
then reacted for
60 minutes at room temperature with 131 1 of a SMPH solution (65 mM in DMSO).
The
reaction solution was dialyzed at 4 C against three 3 1 changes of 20 mM
HEPES, 150 mM
NaC1 pH 7.2 over 24 hours. Seventy-five 1 of the derivatized and dialyzed Q(3
solution was
mixed with 192 1 H20 and 233 1 of the purified and pre-reduced mouse IL-
lai17_270 protein
and incubated over night at 15 C for chemical crosslinking. Uncoupled protein
was removed
by tangential flow filtration against PBS using cellulose ester membranes with
a molecular
weight cutoff of 300.000 Da.
[00197] Coupled products were analyzed on a 12 % SDS-polyacrylamide gel under
reducing
conditions. The Coomassie stained gel is shown in Fig. 2. Several bands of
increased
molecular weight with respect to the Q(3 capsid monomer are visible, clearly
demonstrating
the successful cross-linking of the mouse IL-laii7_270 protein to the Q(3
capsid.
B. Immunization of mice with mouse IL-1a117_270 protein coupled
to Q(3 capsid (Q[3-mIL-W117_27o)
[00198] Five female balb/c mice were immunized with Q[3-mIL-lai17_270. Fifty
g of total
protein were diluted in PBS to 200 1 and injected subcutaneously (100 1 on
two ventral
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-54-
sides) on day 0 and day 21. Mice were bled retroorbitally on day 0, 21, and
35, and sera were
analyzed using mouse IL-laii7_27o-specific ELISA.
C. ELISA
[00199] ELISA plates were coated with mouse IL-la117_270 protein at a
concentration of 1
g/ml. The plates were blocked and then incubated with serially diluted mouse
sera from day
0, 21, and 35. Bound antibodies were detected with enzymatically labeled anti-
mouse IgG
antibody. Antibody titers of mouse sera were calculated as the average of
those dilutions
which led to half maximal optical density at 450 nm. The average anti-mouse IL-
laii7_270 titer
was 1:9252 at day 21 and 1:736912 at day 35. This demonstrates that
immunization with Q(3
coupled to the mouse IL-lai17_270 protein could overcome immunological
tolerance and
produce high titer antibodies which recognize specifically IL-laii7_27o.
D. In vitro neutralization of IL-la
[00200] Sera of mice immunized with Q[3-mIL-laii7_270 were then tested for
their ability to
inhibit the binding of mouse IL-la protein to its receptor. ELISA plates were
therefore coated
with a recombinant mIL-lreceptorI-hFc fusion protein at a concentration of 1
g/ml, and co-
incubated with serial dilutions of sera from mice which had been immunized
either with
mouse IL-la117_270 coupled to Q(3 capsid or with mousIL-1(3119_269 coupled to
Q[3 capsid and
ng/ml of mouse IL-laii7_270. Binding ofIL-laii7_270 to the immobilized mIL-
lreceptorI-hFc
fusion protein was detected with a biotinylated anti-mouse IL-1a antibody and
horse radish
peroxidase conjugated streptavidin. All sera from mice immunized against
murine IL-laii7_27o
inhibited completely the binding of mouse IL-lai17_270 to its receptor at
concentrations of
_ 0.4%, whereas sera from mice immunized against mouse IL-1(3119_269 did not
show a
significant inhibitory effect even at the highest concentration used (3.3 %).
These data
demonstrate that immunization with mouse IL-la117_270 coupled to Q(3 capsid
can yield
antibodies which are able to neutralize specifically the interaction of mouse
IL-la117_270 and
its receptor.
E. In vivo neutralization of IL-la
[00201] The in vivo neutralizing capacity of the antibodies raised by
immunization with Q[3-
mIL-loaii7_270 was investigated next. Four female balb/c mice were therefore
immunized twice
at days 0 and 14 with Q[3-mIL-laii7_270 and four mice were immunized at the
same time with
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-55-
Q(3 capsid ahe. At day 21 all mice were injected intravenously with 1 g free
IL-loai17_270=
As readout of the inflammatory activity of the injected IL-loai17_270, serum
samples were
analysed 3 h after injection for the relative increase in the concentration of
the pro-
inflammatory cytokine IL-6. Q(3-immunized mice showed an average increase in
the serum
IL-6 concentration of 8.16 2.33 ng/ml, whereas mice immunized with Q[3-mIL-
loai17_27o
showed an average increase of only 0.15 0.27 ng/ml (p=0.0005). As a control
on day 28 all
mice were injected with 1 g mIL-1(3. Three hours after injection mice
immunized with Q(3
carrier alone showed an average increase in serum IL-6 concentrations of 9.52
7.33 ng/ml,
while mice immunized with Q[3-mIL-loa117_270 showed an increase of 21.46
27.36 ng/ml
(p=0.43). These data indicate that the antibodies produced by immunization
with Q[3-mIL-
loa117_270 were able to neutralize specifically and efficiently the pro-
inflammatory activity of
IL-1 a.
F. Efficacy of Q[3-mIL-1oc117_270 in a mouse model of rheumatoid arthritis
[00202] The efficacy of Q[3-mIL-loa117_270 immunization was tested in the
murine collagen-
induced arthritis model (CIA). This model reflects most of the immunological
and
histological aspects of human rheumatoid arthritis and is therefore routinely
used to assay the
efficacy of anti-inflammatory agents. Male DBA/1 mice were immunized
subcutaneously
three times (days 0, 14 and 28) with 50 g of either Q[3-mIL-loa117_270 (n=8)
or Q(3 alone
(n=8), and then injected intradermally at day 42 with 200 g bovine type II
collagen mixed
with complete Freund's adjuvant. After a booster injection of 200 g bovine
type II collagen
mixed with incomplete Freund's adjuvant at day 63 mice were examined on a
daily basis for
the development of arthritis symptoms. A clinical score as defined in EXAMPLE
2F was
assigned to each limb according to the degree of reddening and swelling
observed, and ankle
thickness of all hind limbs was measured. Two weeks after the second collagen
injection Q(3-
immunized mice showed an average cumulative clinical score of 4.44, while Q[3-
mIL-loa117_
270-immunized mice showed an average score of only 2.31. Moreover, the average
increase in
hind ankle thickness was 18 % for Q(3-immunized mice and only 7 % for mice
which had
been immunized with Q[3-mIL-loaii7_270. As an additional readout of the
inflammatory
reaction, serum levels of IL-6 were determined 1 week after the second
collagen injection.
Q(3-immunized mice had an average IL-6 serum concentration of 1.92 0.36
while Q[3-mIL-
loa117_270-immunized mice had an average IL-6 concentration of only 0.94
0.48. Taken
together, these data show that immunization with Q[3-mIL-loaii7_270 protects
mice from
inflammation and clinical signs of arthritis in the CIA model.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-56-
EXAMPLE 4
Efficacy of Q[3-mlL-la117_270 in a mouse model of atherosclerosis
[00203] Seven to eight weeks old male Apoe /- mice (The Jackson Laboratory,
Bar Harbor
ME) were injected subcutaneously with either 50 g Q[3-mIL-laii7_27o vaccine
(n=13) or with
50 g Q(3 (n=12) on day 0, 14, 28, 56, 105 and 133 (5 animals, 3 in the Q[3-
mIL-la117_270 and
2 in the Q(3 groups were received their second boost on day 33). The mice were
fed initially
with a normal chow diet, which was replaced on day 21 by a western diet (20 %
fat, 0.15 %
cholesterol, Provimi Kliba AG, Switzerland). Mice were bled at regular
intervals throughout
the experiment and the antibody response against IL-lalpha was measured in the
sera.
Sacrifice was on day 159, and the aorta were isolated and prepared essentially
as described
(Tangirala R.K. et al. (1995) J. Lipid. Res. 36: 2320-2328). In addition,
hearts were removed
and snap-frozen in liquid nitrogen for subsequent histologic preparation
essentially as
described by Paigen B. et al. (Atherosclerosis 1987;68:231-240) and Zhou X. et
al.
(Arterioscler Thromb Vasc Biol 2001;21:108-114). The animals were bled by
cardiac
puncture and perfused with cold PBS. The aorta was then exposed, as much as
possible of the
adventitia removed in situ, and the aorta finally sectioned 2 mm from the
heart. The heart was
sectioned in the middle, and the upper part was immediately frozen in Hank's
balanced salt
solution in a plastic tube in liquid nitrogen. Serial sections (7 m
thickness) were cut in a
cryostat through the origin of the aorta and harvested upon appearance of at
least two valve
cusps, until disappearance of the last valve cusps. Sections were fixed in
formalin, stained
with oil red 0, and plaque load was evaluated in 4-7 sections (3 sections in
one animal of the
Q(3 group) per mouse by quantitative image analysis. An average plaque area
was computed
for each animal from the plaque area of each section used for the evaluation.
An average
group plaque area was computed for the Q[3-mIL-la117_270 and Q(3 group
respectively.
Statistical analysis was performed with a Student t-test. P<0.05 was
considered statistically
significant.
[00204] For the evaluation of atherosclerosis in the whole aorta, these were
further cleaned
from residual adventitia on a glass petri dish filled with cold PBS, and the
arch was sectioned
mm down from the left sub-clavian artery. The aorta were cut longitudinally,
pinned out on
a black wax surface and fixed overnight in 4 % formalin. They were then
stained overnight in
oil red O. The plaques were quantified with an imaging software (Motic Image
Plus 2.0) on
digital photographs. The plaque load was expressed as the sum of the surface
of all plaques of
the aorta taken up to the iliac bifurcation, divided by the total surface of
the aorta measured up
to the iliac bifurcation, in percentage. The difference in mean or median of
the plaque load
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-57-
between the Q[3-mIL-laii7_27o and Q(3 group was analyzed.
[00205] The antibody response was measured in a classical ELISA, with
recombinant IL-
lalpha coated on the ELISA plate. Binding of specific antibodies was detected
using a goat
anti-mouse HRP conjugate. The titers against IL-lalpha were calculated as the
reciprocal of
the serum dilution giving half-maximal binding in the assay. Specificity of
the response was
assessed by measuring pre-immune serum. The pre-immune titer was below the
lowest serum
dilution used in the assay, and was assigned this lowest-serum dilution value.
The results of
the measurement of the antibody response in the Q[3-mIL-laii7_270 immunized
animals are
shown in Table 1, and clearly demonstrate that immunization against murine IL-
lalpha
coupled to Q(3 led to a strong and sustained specific antibody response
against IL-lalpha,
since nearly no titer was detectable in the preimmune (dO) sera. Furthermore,
induction of an
antibody response specific for IL-lalpha led to a reduction of 37 % in plaque
area at the aortic
origin in the Q[3-mIL-la117_270 group compared to the Q(3 group (292803
21272 m2 vs.
464694 36545 m2, p=0.0005). In addition, a reduction of 31 % in median
plaque load in
whole aortas prepared "en face" (5.7 vs. 8.3, p=0.06) was observed.
[00206] These data demonstrate that induction of anti-ILlalpha antibodies by
the Q[3-mIL-
1 ai 17_270 vaccine inhibited the development of atherosclerosis and therefore
that the Q[3-mIL-
1 ai 17_270 vaccine is an effective treatment for atherosclerosis.
Furthermore, these data
demonstrate that IL-lalpha is involved in the pathogenesis of atherosclerosis.
Table 1: Geometric mean anti-ILl alpha antibody titer in Apoe l- mice
immunized with Qb-
ILl alpha (geometric mean titer standard error of the mean)
dO d21 d28* d56 d84 d105 d159
Geomean f <1000 225400 167867 522864 712061 621687 805370
SEM 0 93385 121345 106887 144922 184389 155764
* For 5 animals, the values are from day 33.
EXAMPLE 5
Protection from TNBS-induced inflammatory bowel disease by immunization
with Qp-mlL-ta117_270 and/or Qp-mIL-1P119_269
[00207] Eight weeks old male SJL mice (5 per group) are injected
subcutaneously three times
at two week intervals with either 50 g of Q[3-mIL-la117_270 or 50 g Q[3-mIL-
1(3119_269, or a
mixture of 50 g each of Q[3-mIL-la1 17_270 and Q[3-mIL-1(3119_269. As a
control 5 mice are
injected at the same regimen with Q(3 VLPs alone. Two weeks after the last
immunization, all
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-58-
mice are slightly anesthetized with Isofluran, and 1 mg of
trinitrobenzesulfonic acid (TNBS)
in 100 1 50 % ethanol is administered intrarectally via a polyethylene
catheter at a distance
of 4 cm of the anus. Body weight is recorded daily as readout of disease
progression, and 7
days after TNBS administration all mice are sacrificed. The colon of each
mouse is removed,
a specimen of colon located 2 cm proximal to the anus is fixed in PBS-buffered
formalin, and
the degree of inflammation is graded semi-quantitatively on hematoxylin- and
eosin-stained
colonic cross-sections according to Neurath M.F. et al. (JEM (1995), 182:1281-
1290).
[00208] Immunization with either Q[3-mIL-lai17_270 or Q[3-mIL-1(3119_269
alone, or with a
combination of Q[3-mIL-laii7_270 and Q[3-mIL-1(3119_269 reduces the TNBS-
induced weight
loss, as compared to Q(3-immunized mice. Furthermore, histological examination
of colonic
cross-sections reveals, that Q[3-mIL-la117_270 and/or Q[3-mIL-1(3119_269-
immunized mice
display a markedly reduced infiltration of inflammatory cells into the colonic
tissue when
compared to Q(3-immunized mice.
EXAMPLE 6
Amelioration of Endotoxin-hypersensitivity in mice carrying a truncated
version of the
MEFV gene by immunization with Q[3-mIL-1(3119_269
[00209] Familial Mediterranean Fever is a recessively inherited inflammatory
disorder
characterized by recurrent fever as well as peritonitis, serositis, arthritis
and skin rashes.
Affected individuals carry a missense mutation in the MEFV gene, leading to
expression of a
truncated pyrin protein. Mice carrying a similar mutation in the MEFV gene
show an
increased caspase-1 activity, leading to overproduction of mature IL-1(3 and
increased
hypothermia and lethality after LPS administration. Eight weeks old homozygote
pyrin-
truncation mice (5 per group) are immunized three times at two weeks intervals
with 50 g of
Q[3-mIL-1(3119_269 or 50 g of Q[3 VLPs alone. Two weeks after the last
immunizain all mice
are injected intraperitoneally with a mixture 20 mg D-Galactosamine and 0.01
g/g LPS. Q[3-
mIL-1(3119_269-immunized mice show a markedly reduced hypothermia and a
reduced lethality
in response to LPS administration, when compared to Q[3-immunized controls.
EXAMPLE 7
Comparison of Qp-mIL-1a117_270 and Qp-mIL-1R119_269 immunization to Kineret
treatment in a mouse model of rheumatoid arthritis
[00210] Kineret (Anakinra, Amgen) is a recombinant version of the human IL-1
receptor
antagonist, which is approved for the treatment of human rheumatoid arthritis.
In order to
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-59-
reach a clinical benefit, relatively high amounts (100 mg) have to be applied
via subcutaneous
injection on a daily basis. The collagen-induced arthritis model was used to
compare the
efficacy of Q[3-mIL-la117_270 and Q[3-mIL-1(3119_269 immunization with daily
applications of
different doses of Kineret . Male DBA/1 mice were immunized subcutaneously
three times
(days 0, 14 and 28) with 50 g of either Q[3-mIL-la117_27o (n=8), Q[3-mIL-
1(3119_269 (n=8) or
Q(3 alone (n=32), and then injected intradermally on day 42 with 200 g bovine
type II
collagen mixed with complete Freund's adjuvant. From day 42 on, mice immunized
with Q[3-
mIL-loai17_270 and Q[3-mIL-1(3119_269, and one group of Q(3-immunized mice
(n=8) received
daily intraperitoneal injections of 200 1 PBS, while three additional Q(3-
immunized groups
received daily intraperitoneal injections of either 37.5 g (n=8), 375 g
(n=8), or 3.75 mg
(n=8) Kineret . A daily injection of 37.5 g Kineret per mouse corresponds
roughly to a
dose of 1.5 mg/kg, which is in the range of the recommended efficacious amount
for humans
(100 mg). All mice were boosted on day 63 by intradermal injection of 200 g
bovine type II
collagen mixed with incomplete Freund's adjuvant, and examined on a daily
basis for the
development of arthritis symptoms.
[00211] Four weeks after the second collagen injection, Q(3-immunized control
mice showed
an average cumulative clinical score (as defined in EXAMPLE 2F) of 3.75, while
Q[3-mIL-
l ai i7_270- and Q[3-mIL-1(3119_269-immunized mice showed average scores of
only 0.81 and
1.44, respectively (see Table 2). Mice treated with 37.5 g or 375 g Kineret
reached an
average score of 2.44 and 2.63, respectively, while mice treated with 3.75 mg
Kineret
remained largely asymptomatic, reaching a maximal score of only 0.19.
[00212] As an additional readout of the inflammatory reaction, the hind ankle
thickness of all
animals was measured on a regular basis. Four weeks after the second collagen
injection Q(3-
immunized control mice showed an average increase in hind ankle thickness of
16 %, while
Qp-mIL-la117_270-immunized mice showed an increase of 2% and QD-mIL-1P119_269-
immunized mice showed an increase of 6 %. Mice treated with either 37.5 g or
375 g
Kineret showed an average increase of 13 % and 10 %, respectively, while mice
treated
with 3.75 mg Kineret showed no increase in hind ankle thickness at all.
[00213] In conclusion we surprisingly found that three injections of either
Q[3-mlL-lai17_27o
or Q[3-mIL-1(3119_269 protected mice better from the development of arthritis
symptoms than
daily injections of Kineret in amounts corresponding to the human dose or
even the ten-fold
human dose. Only application of the 100-fold human dose of Kineret showed an
increased
benefit with respect to Qp-mIL-1 a117_2-70 or Qp-mIL-1 P 119_269 vaccination.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-60-
Table 2: clinical disease symptoms in collagen-induced arthritis model.
Treatment average clinical Average increase in
score day 91 hind ankle thickness
(%) day 63-91
3x Q(3 s.c. + PBS i.p. (200 Uday) 3.75 16
3x Q[3-mIL-laii7_27o s.c. + PBS i.p. (200 Uday) 0.81 2
3x Q[3-mIL-1(3119_269 s.c. + PBS i.p. (200 Uday) 1.44 6
3x Q[3 s.c. + Kineret i.p. (37.5 g/day) 2.44 13
3x Q[3 s.c. + Kineret i.p. (375 g/day) 2.63 10
3x Q[3 s.c. + Kineret i.p. (3.75 mg/day) 0.19 0
EXAMPLE 8
A. Cloning, expression, and purification of virus-like particles consisting of
AP205 coat
protein genetically fused to mouse IL-1a117_270 (AP205_mIL-1(X117_270)
[00214] Given the large size of interleukin-lalpha and for steric reasons, an
expression
system producing so called mosaic particles, comprising AP205 coat proteins
fused to
interleukin-lalpha as well as wt coat protein subunits was constructed. In
this system,
suppression of the stop codon yields the AP205-interleukin-lalpha coat protein
fusion, while
proper termination yields the wt AP205 coat protein. Both proteins are
produced
simultaneously in the cell and assemble into a mosaic virus-like particle. Two
intermediary
plasmids, pAP590 and pAP592, encoding the AP205 coat protein gene terminated
by the
suppressor codons TAG (amber, pAP590) or TGA (opal, pAP592) were made. A
linker
sequence encoding the tripeptide Gly-Ser-Gly (SEQ ID NO: 189) was added
downstream and
in frame of the coat protein gene. Kpn2I and HindIII sites were added for
cloning sequences
encoding foreign amino acid sequences at the C-terminus of the Gly-Ser-Gly
amino acid
linker, C-terminal to the AP205 coat protein. The resulting constructs were:
AP590 (SEQ ID
NO:117): AP205 coat protein gene - amber codon - GSG(Kpn2I - HindIII); and
AP592
(SEQ ID NO: 118): AP205 coat protein gene - opal codon - GSG(Kpn2I - HindIII).
For
construction of plasmid pAP590, a PCR fragment obtained with oligonucleotides
p1.44 (5'-
NNCCATGGCAAATAAGCCAATGCAACCG-3'; SEQ ID NO:119) and pINC-36 (5'-
GTAAGCTTAGATGCATTATCCGGA TCCCTAAGCAGTAGTATCAGACGATACG-3';
SEQ ID NO: 120) was digested with Ncol and HindIII, and cloned into vector
pQbl85, which
had been digested with the same restriction enzymes. pQbl85 is a vector
derived from pGEM
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-61-
vector. Expression of the cloned genes in this vector is controlled by the trp
promoter
(Kozlovska, T. M. et al., Gene 137:133-37 (1993)). Similarly, plasmid pAP592
was
constructed by cloning a Ncol/HindIIl-digested PCR fragment obtained with
oligonucleotides
p1.44 and pINC-40 (5'-GTAAGCTTAGATGCATTATCCGGATCCTCAAGCAGTAGTA
TCAGACGATACG-3'; SEQ ID NO:121) into the same vector.
[00215] The sequence encoding amino acids 117-270 of murine IL-la was
amplified by PCR
from plasmid pModECl-His-EK-mILloCii7_270 (see EXAMPLE 1), using primers pINC-
34
(5'-GGTCCGGAGCGCTAGCCCCTTACAC-3'; SEQ ID NO:122) and pINC-35 (5'-
GTAAGCTTATGCATTATGATATCTGGAAGTCTGTCATAGA-3'; SEQ ID NO:123),
which added Kpn2I and HindIII restriction sites to the 5' and 3' ends,
respectively. The
obtained DNA fragment was digested with Kpn2I and HindIII and cloned into both
vector
pAP590, creating plasmid pAP594 (amber suppression), and into vector pAP592,
creating
plasmid pAP596 (opal suppression), respectively.
[00216] For expression of mosaic AP205 VLPs displaying murine IL-la on their
surface,
E.coli JM109 cells containing plasmid pISM 579 or pISM 3001 were transformed
with
plasmid pAP594 or pAP596, respectively. Plasmid pISM579 was generated by
excising the
trpTl76 gene from pISM3001 with restriction endonuclease EcoRI and replacing
it by an
EcoRI fragment from plasmid pMY579 (gift of Michael Yarus) containing an amber
t-RNA
suppressor gene. This t-RNA suppressor gene is a mutant of trpT175 (Raftery
LA. Et al.
(1984) J. Bacteriol. 158:849-859), and differs from trpT at three positions:
G33, A24 and T35.
Five milliliters of LB liquid medium containing 20 g/ml ampicillin and 10
g/ml kanamycin
were inoculated with a single colony, and incubated at 37 C for 16-24 h
without shaking. The
prepared inoculum was diluted 50 x with M9 medium containing 20 g/ml
ampicillin and 10
g/ml Kanamycin and incubated at 37 C overnight on a shaker. Cells were
harvested by
centrifugation.
[00217] Cells (1 g, transformed with plasmid pAP594 and containing pISM579)
were lysed
by ultrasonication in lysis buffer (20 mM Tris-HC1, 5mM EDTA, 150 mM NaC1, pH
7.8,
0.1 % Tween 20). The lysate was cleared by centrifugation, and the cell debris
were washed
with lysis buffer. Pooled supernatant were loaded on a Sepharose CL-4B column
eluted in
TEN buffer (20 mM Tris-HC1, 5mM EDTA, 150 mM NaC1, pH 7.8). The presence of
capsids
in the cleared lysate and wash supernatant was confirmed by agarose gel
electrophoresis (1 %
TAE, ethidium bromide stained gel and UV detection). Two peaks eluted from the
column as
determined by SDS-PAGE or UV-spectrometric analysis of light scattering at 310
nm.
Fractions of the second peak, containing the capsids, were pooled and loaded
on a Sepharose
CL-6B column. Peak fractions from the CL-6B columne were pooled and
concentrated using
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-62-
a centrifugal filter unit (Amicon Ultra 15 MWCO 30000, Millipore). The protein
was purified
further by one additional round of gel filtration on a CL-4B column, and the
resulting peak
fractions were pooled and concentrated on a centrifugal filter unit as above.
The buffer was
exchanged to 10 mM Hepes, pH 7.5, and glycerol was added to a final
concentration of 50 %.
[00218] Purification of AP205_mIL-lai17_270 from plasmid pAP596 was performed
essentially as described for pAP594 above, with the inclusion of an additional
sucrose
gradient purification step after the last CL-4B column. The protein was
layered on a gradient
prepared with the following sucrose solutions: 9 ml 36 %, 3 ml 30 %, 6 m125 %,
8 m120 %,
6 ml 15 %, 6 ml 10 % and 3 ml 5% sucrose. Fractions were identified by UV
spectroscopy,
and pooled fractions containing the capsids were concentrated on a centrifugal
filter unit as
above, and the buffer exchanged to 10 mM Hepes, pH 7.5. Glycerol was finally
added to a
final concentration of 50 %.
B. Immunization of mice with AP205 mIL-1a117_270
[00219] Four female balb/c mice were immunized with AP205_-mIL-lai17_270.
Twentyfive
g of total protein were diluted in PBS to 200 1 and injected subcutaneously
(100 1 on two
ventral sides) on day 0, day 14, and day 28. Mice were bled retroorbitally on
days 0, 14, 28
and 35, and sera were analyzed using mouse IL-laii7_27o-specific ELISA.
C. ELISA
[00220] ELISA plates were coated with mouse IL-la117_270 protein at a
concentration of
1 g/ml. The plates were blocked and then incubated with serially diluted
mouse sera from
days 14, 28 and 35. Bound antibodies were detected with enzymatically labeled
anti-mouse
IgG antibody. Antibody titers of mouse sera were calculated as the average of
those dilutions
which led to half maximal optical density at 450 nm. The average anti-mouse IL-
laii7_270 titer
was 1:4412 at day 14, 1:27955 on day 28 and 1:34824 on day 35. This
demonstrates that
immunization with AP205_mIL-lai17_270 could overcome immunological tolerance
and
produce high titer antibodies which recognize specifically IL-laii7_27o=
D. In vitro neutralization of IL-1a
[00221] Sera of mice immunized with AP205_mIL-lai17_270 were tested for their
ability to
inhibit the binding of mouse IL-la protein to its receptor. ELISA plates were
therefore coated
with a recombinant mIL-lreceptorI-hFc fusion protein at a concentration of 1
g/ml, and co-
incubated with serial dilutions of sera from mice which had been immunized
either with
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-63-
AP205_mIL-loaii7_270 or with AP205 alone and 100 ng/ml of mouse IL-loaii7_270.
Binding of
mIL-loaii7_270 to the immobilized mIL-lreceptorI-hFc fusion protein was
detected with a
biotinylated anti-mouse IL-la antibody and horse radish peroxidase conjugated
streptavidin.
All sera from mice immunized AP205_mIL-loa1 17_270 inhibited completely the
binding of
mouse IL-loa117_270 to its receptor at concentrations of _3.3 %, whereas sera
from mice
immunized with AP205 did not show a significant inhibitory effect at any
concentration used.
These data demonstrate that immunization with AP205_mIL-loai17_270 can yield
antibodies
which are able to neutralize specifically the interaction of mouse IL-1 oai
i7_270 with its receptor.
E. In vivo neutralization of IL-loc
[00222] The in vivo neutralizing capacity of the antibodies raised by
immunization with
AP205_mIL-loai17_270 was investigated next. Four female balb/c mice were
therefore
immunized three times on days 0, 14, and 28 with AP205_mIL-loai17_270 and four
mice were
immunized at the same time with AP205 alone. On day 42 all mice were injected
intravenously with 1 g of free murine IL-l oai 17_270. As readout of the
inflammatory activity
of the injected IL-loai17_270, serum samples were withdrawn before and 3 h
after injection and
analyzed for the relative increase in the concentration of the pro-
inflammatory cytokine IL-6.
AP205-immunized mice showed an average increase in the serum IL-6
concentration of
12.92 3.95 ng/ml, whereas mice immunized with AP205_mIL-loai17_270 showed an
average
increase of only 0.06 0.05 ng/ml (p < 0.01). These data indicate that the
antibodies produced
by immunization with AP205_mIL-loai17_270 were able to neutralize specifically
and
efficiently the pro-inflammatory activity of IL-loa.
F. Efficacy of AP205_mIL-1oc117_270 in a mouse model of rheumatoid arthritis
[00223] The efficacy of AP205_mIL-loa1 17_270-immunization was tested in the
murine
collagen-induced arthritis model (CIA). Male DBA/1 mice were immunized
subcutaneously
three times (days 0, 14 and 28) with 50 g of either AP205_mIL-loai17_270
(n=8) or AP205
alone (n=8), and then injected intradermally on day 42 with 200 g bovine type
II collagen
mixed with complete Freund's adjuvant. After a booster injection of 200 g
bovine type II
collagen mixed with incomplete Freund's adjuvant on day 63, mice were examined
on a daily
basis for the development of arthritis symptoms. A clinical score ranging from
0 to 3 was
assigned to each limb according to the degree of reddening and swelling
observed, and ankle
thickness of all hind limbs was measured. Four weeks after the second collagen
injection Q(3-
immunized mice showed an average cumulative clinical score of 5.81, while
AP205_mIL-
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-64-
1 ai i7_270-immunized mice showed an average score of only 2.06. Moreover, the
average
increase in hind ankle thickness was 19 % for AP205-immunized mice and only 9
% for mice
which had been immunized with AP205_mIL-lai17_27o. Taken together, these data
show that
immunization with AP205_mIL-lai17_270 strongly protects mice from inflammation
and
clinical signs of arthritis in the CIA model.
EXAMPLE 9
A. Cloning and expression of virus-like particles consisting of AP205 coat
protein
genetically fused to mouse IL-1(3119_269 (AP205_mIL-1(3j19_269)
[00224] Cloning, expression and purification of virus-like particles
consisting of AP205 coat
protein genetically fused to mouse IL-1(3119_269 is carried out essentially as
described for
AP205_mIL-lai17_270 in EXAMPLE 8. The sequence of murine interleukin 1 beta
was
amplified from plasmid pModECl-His-EK-mILl(3119_269 coding for murine
interleukin 1 beta
using primers pINC-75 (5'-GATCCGGAGGTGGTGTCCCCATTAGACAGCT-3', SEQ ID
NO:192) and pINC-77 (5'-GTAAGCTTAGGAAGACACAGATTCCAT-3', SEQ ID
NO: 193). These primers amplify a murine interleukin-1 beta gene with 5' Kpn2I
and 3' Hind
III sites, and encoding additionally the amino acid sequence Gly-Gly at the N-
terminus of
murine interleukin lbeta. The obtained mur-IL-1(3 fragment was digested with
Kpn2I and
HindIIl and cloned in the same restriction sites into vector pAP590 (amber
suppression)
creating plasmid pAP630. E.coli JM109 containing plasmid pISM 579, providing
amber
suppression, was transformed with plasmid pAP630. 5 ml of LB liquid medium
with 20 g/ml
ampicillin andl0 g/ml kanamycin were inoculated with a single colony, and
incubated at 37
C for 16-24 h without shaking. The prepared inoculum was diluted 50x with M9
medium
containing 20 g/ml ampicillin and 10 g/ml kanamycin and incubated at 37 C
overnight on a
shaker. Cells were harvested by centrifugation.
B. Cloning and expression of virus-like particles consisting of AP205 coat
protein
genetically fused to human IL-1(3116_269 (AP205_hIL-1(3116_269)
[00225] The sequence of human interleukin 1 beta was amplified from plasmid
pET42T-hIL-
1(3116_269 coding for human interleukin 1 beta using primers pINC-74 (5'- GA
TCC GGA GGT
GGT GCC CCT GTA CGA TCA CTG AAC TG -3', SEQ ID NO:194) and pINC-76 (5'-
GTATGCATTAGGAAGACACAAATTGCATGGTGAAGTC-3, SEQ ID NO:195),
introducing a 5' Kpn2I and 3' Mph1103I site, respectively. The obtained human-
IL-1(3
fragment was digested with Kpn2I and Mph1103I and cloned in the same
restriction sites into
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-65-
vector pAP590 (amber suppression) creating plasmid pAP649. E.coli JM109
containing
plasmid pISM 579 (providing amber suppression), was transformed with plasmid
pAP649. 5
ml of LB liquid medium with 20 g/ml ampicillin andl0 g/ml canamicin were
inoculated
with a single colony, and incubated at 37 C for 16-24 h without shaking. The
prepared
inoculum was diluted 50x with M9 medium containing 20 g/ml ampicillin and 10
g/ml
kanamycin and incubated at 37 C overnight on a shaker. Cells were harvested
by
centrifugation.
C. Immunization of mice with AP205_mIL-1(3119_269
[00226] Four female C3H/HeJ mice were immunized with AP205-mIL-1(3119_269_
Twentyfive
g of total protein were diluted in PBS to 200 1 and injected subcutaneously
(100 1 on two
ventral sides) on day 0, day 14, and day 28. Mice were bled retroorbitally on
days 0, 14, 28
and 35, and sera were analyzed using mIL-1(3119_269-specific ELISA.
D. ELISA
[00227] ELISA plates were coated with mouse IL-1(3119_269 protein at a
concentration of 1
g/ml. The plates were blocked and then incubated with serially diluted mouse
sera from days
0, 14, 28, and 35. Bound antibodies were detected with enzymatically labeled
anti-mouse IgG
antibody. Antibody titers of mouse sera were calculated as the average of
those dilutions
which lead to half maximal optical density at 450 nm. The average anti-mouse
IL-1(3119_269
titer was 1:19000 on day 14, 1:58200 on day 28 and 1:104700 on day 35. This
demonstrates
that immunization with AP205mIL-1(3119_269 could overcome immunological
tolerance and
produce high titer antibodies which recognize specifically mouse IL-
1(3119_269_
E. In vitro neutralization of IL-1(3
[00228] Sera of mice immunized with AP205-mIL-1(3119_269 are then tested for
their ability to
inhibit the binding of mouse IL-l(3 protein to its receptor. ELISA plates are
therefore coated
with a recombinant mIL-lreceptorI-hFc fusion protein at a concentration of 1
g/ml, and co-
incubated with serial dilutions of sera from mice immunized either with AP205-
mIL-1(3119_269
or with AP205 alone, and 100 ng/ml of mouse IL-1(3119_269_ Binding of IL-
1(3119_269 to the
immobilized mIL-lreceptorI-hFc fusion protein is detected with a biotinylated
anti-mouse IL-
1(3 antibody and horse radish peroxidase conjugated streptavidin. All sera
from mice
immunized with AP205mIL-1(3119_269 strongly inhibit the binding of mouse IL-
1(3119_269 to its
receptor, whereas sera from mice immunized with AP205 alone do not show any
inhibitory
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-66-
effect. These data demonstrate that immunization with AP205_mIL-1(3119_269 can
yield
antibodies which are able to neutralize the interaction of mouse IL-1(3119_269
and its receptor.
F. In vivo neutralization of IL-1(3
[00229] The in vivo neutralizing capacity of the antibodies raised by
immunization with
AP205_mIL-1(3119_269 were investigated next. Four female C3H/HeJ mice were
therefore
immunized three times on days 0, 14, and 28 with AP205_mIL-1(3119_269 and four
mice were
immunized at the same time with AP205 alone. On day 42 all mice were injected
intravenously with 1 g of free mIL-1(3119_269. As readout of the inflammatory
activity of the
injected mIL-1(3119_269, serum samples were withdrawn before and 3 h after
injection and
analysed for the relative increase in the concentration of the pro-
inflammatory cytokine IL-6.
AP205-immunized mice showed an increase of 0.28 ng/ml in serum IL-6
concentrations,
whereas mice immunized with AP205_mIL-1(3119_269 showed no increase at all.
These data
indicate that the antibodies produced by immunization with AP205_mIL-
1(3119_269 were able to
neutralize specifically and efficiently the pro-inflammatory activity of IL-
1(3.
G. Efficacy of AP205_mIL-1(3119_269 in a mouse model of rheumatoid arthritis
[00230] The efficacy of AP205_mIL-1(3119_269-immunization was tested in the
murine
collagen-induced arthritis model (CIA). Male DBA/1 mice were immunized
subcutaneously
four times (days 0, 14, 28, and 42) with 25 g of either AP205mIL-1(3119_269
(n=8) or AP205
alone (n=8), and then injected intradermally on day 58 with 200 g bovine type
II collagen
mixed with complete Freund's adjuvant. After a booster injection of 200 g
bovine type II
collagen mixed with incomplete Freund's adjuvant on day 79 mice were examined
on a daily
basis for the development of arthritis symptoms. A clinical score as defined
in EXAMPLE 2F
was assigned to each limb according to the degree of reddening and swelling
observed, and
ankle thickness of all hind limbs was measured. Twenty days after the second
collagen
injection AP205-immunized mice showed an average cumulative clinical score of
2.69, while
AP205_mIL-1(3119_269-immunized mice showed an average score of only 1Ø
Moreover, the
average increase in hind ankle thickness was 8.8% for AP205-immunized mice and
only 0.6%
for mice which had been immunized with AP205_mIL-1(3119_269. Taken together,
these data
show that immunization with AP205_mIL-1(3119_269 strongly protected mice from
inflammation and clinical signs of arthritis in the CIA model.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-67-
H. Immunization of mice with AP205_hIL-1(3116_269
[00231] Four female C3H/HeJ mice were immunized with AP205-hIL-1(3116_269.
Twentyfive
g of total protein were diluted in PBS to 200 1 and injected subcutaneously
(100 1 on two
ventral sides) on days 0, 14, and 28. Mice were bled retroorbitally on days 0,
14, 28 and 35,
and sera were analyzed using human IL-1(3116_269-specific ELISA.
1. ELISA
[00232] ELISA plates were coated with human IL-1(3116_269 protein at a
concentration of 1
g/ml. The plates were blocked and then incubated with serially diluted mouse
sera from days
0, 14, 28, and 35. Bound antibodies were detected with enzymatically labeled
anti-mouse IgG
antibody. Antibody titers of mouse sera were calculated as the average of
those dilutions
which lead to half maximal optical density at 450 nm. The average anti-human
IL-1(3116_269
titer was 1:39600 on day 14, 1:58300 on day 28 and 1:65600 on day 35. This
demonstrates
that AP205-hIL-1(3116_269 induces high titers of hIL-1(3116_269-specific
antibodies in mice.
EXAMPLE 10
A. Cloning, expression and purification of human IL-1(3116_269
[00233] The nucleotide sequence encoding amino acids 116-269 of human IL-1(3
(hIL-1(3116_
269) was amplified by PCR from a cDNA library of human liver tissue using
oligonucleotides
HIL-1 (5'- ATATATGATATCCCTGTACGATCACTGAACTGCACG-3'; SEQ ID NO:124)
and HIL-2 (5'-ATATATCTCGAGGGAAGACA CAAATTGCATGGTGAAG-3'; SEQ ID
NO: 125), digested with Xhol and EcoRV and cloned into the expression vector
pET42T(+).
[00234] Plasmid pET-42T(+) was constructed by replacing the whole region
between the T7
promoter and the T7 terminator of pET-42a(+) (Novagen) in two steps by new
linker
sequences, which facilitate the expression of a protein of interest as a
fusion with a C-terminal
tag (SEQ ID NO:190) comprising a His-tag and a cysteine containing linker. In
a first step
plasmid pET-42a(+) was digested with the restriction enzymes Ndel and AvrII,
liberating a
958 bp fragment between the T7 promoter and T7 terminator composed of a GST-
tag, S-tag,
two His-tags and the multiple cloning site. The residual 4972 bp fragment
containing the
vector backbone of pET-42a(+) was isolated and ligated to the annealed
complementary
oligonucleotides 42-1 (5'-TATGGATATCGAATTCAAGCTTCTGCAGCTGCTCGAGTAA
TTGATTAC-3'; SEQ ID NO:126) and 42-2 (5'-CTAGGTAATC AATTACTCGA
GCAGCTGCAGAAGCTTGAATTCGATATCCA-3'; SEQ ID NO:127), giving rise to
plasmid pET-42S(+). In the second step plasmid pET-42S(+) was linearized by
digestion with
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-68-
restriction enzymes Xhol and AvrII, and ligated to the complementary annealed
oligonucleotides 42T-1 (5'-TCGAGCACCACCACCACCACCACGGTGGTT
GCTAATAATAATTGATTAATAC-3'; SEQ ID NO:128) and 42T-2 (5'-
CTAGGTATTAATCAATTATTATTAGCAACCACCGTGGTGGTGGTGGTGGTGC-3';
SEQ ID NO:129), resulting in plasmid pET-42T(+).
[00235] The cloning of the above mentioned fragment hIL-1(3116_269 into pET-
42T(+) gave
rise to plasmid pET42T-hIL-1(3116_269. This plasmid encodes a fusion protein
corresponding to
the mature human IL-l(3 and a His-tag and a C-terminal cysteine-containing
linker (GGC,
SEQ ID NO:178). Thus, the fusion protein consists of SEQ ID NO:190 C-
terminally fused to
SEQ ID NO: 165. The original alanine residue at position 117 of human IL-1(3
was changed to
isoleucin in this fusion protein. Expression and purification of the human IL-
1(3116_269 protein
was performed essentially as described for the murine mILl (3119_269 protein
in EXAMPLE 1.
B Cloning, expression and purification of human IL-1(3116_269 muteins
[00236] By site directed mutagenesis of the plasmid pET42T-hIL-1(3116_269,
expression
vectors for ten different mutant human IL-1(3116_269 fusion proteins were
constructed. To this
aim the Quik-Change Site directed mutagenesis kit (Stratagene) was used
according to the
manufacturer's instructions. The expression vectors for these mutant IL-
1(3119_269 proteins are
listed in Table 3 together with the oligonucleotide pairs used for their
construction.
Expression and purification of the different human IL-1(3116_269 muteins was
performed as
described in EXAMPLE 1.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-69-
Table 3: Overview over IL-I muteins, expression vectors and oligonucleotides
used for their
construction.
Expression vector mutein sequence Oligonucleotide pair
(without
purification tag)
pET42T-hIL-1(3116_269 hIL-1(3ii6_269 (R4D) R4D-1 (5'-CATATGGATA TCCCTGTAGA
(R4D) (SEQ ID NO:131) CTCACTGAAC TGCACGCTC-3'; SEQ ID NO:143);
R4D-2 (5'-GAGCGTGCAG TTCAGTGAGT
CTACAGGGAT ATCCATATG-3'; SEQ ID NO:144)
pET42T-hIL-1(3116_269 hIL-1(3ii6_269 (L6A) L6A-1 (5'-GATATCCCTG TACGATCAGC
(L6A) (SEQID NO:132) TAACTGCACG CTCCGGGAC-3'; SEQ ID NO:145);
L6A-2 (5'-GTCCCGGAGC GTGCAGTTAG
CTGATCGTAC AGGGATATC-3'; SEQ ID NO:146)
pET42T-hIL-1(3116_269 hIL-1(3ii6_269(T9G) T9G-1 (5'-GTACGATCAC TGAACTGCGG
(T9G) (SEQ ID NO:133) TCTCCGGGAC TCACAGC-3'; SEQ ID NO:147)
T9G-2 (5'-GCTGTGAGTC CCGGAGACCG
CAGTTCAGTG ATCGTAC-3'; SEQ ID NO:148)
pET42T-hIL-1(3116_269 hIL-1(3i16_269 (R11G) R11G-1 (5'-GAACTGCACG CTCGGGGACT
CACAGC-3';
(R11G) (SEQ ID NO:134) SEQ ID NO:149)
R11G-2 (5'-GCTGTGAGTC CCCGAGCGTG CAGTTC-3';
SEQ ID NO:150)
pET42T-hIL-1(3116_269 hIL-1(3ii6_269(D54R) D54R-1 (5'-
(D54R) (SEQ ID NO: 135) CAAGGAGAAGAAAGTAATCGCAAAATACCTGTGGC
CTTG-3'; SEQ ID NO:151
D54R-2 (5'-
CAAGGCCACAGGTATTTTGCGATTACTTTCTTCTCCT
TG-3'; SEQ ID NO:152)
pET42T-hIL-1(3116_269 hIL-1(3ii6_269(D145K) D145K-1 (5'-
(D145K) (SEQ ID NO: 136) GCGGCCAGGATATAACTAAATTCACCATGCAATTTG
TGTC-3'; SEQ ID NO:161)
D145K-2 (5'-
GACACAAATTGCATGGTGAATTTAGTTATATCCTGG
CCGC-3'; SEQ ID NO: 162)
pET42T-hIL-1(3116_269 hIL-1(3ii6_269 EE-1 (5'-
(AEE50,51 ) (AEE5o,5i) CATGTCCTTTGTACAAGGAAGTAATGACAAAATACC
(SEQ ID NO: 137) TGTG-3'; SEQ ID NO:153)
EE-2 (5'-
CACAGGTATTTTGTCATTACTTCCTTGTACAAAGGAC
ATG-3'; SEQ ID NO:154)
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-70-
pET42T-hIL-1(3116-269 hIL-1(3116-269 SND- 1 (5'-
(ASND52-54) (ASND52-54) CTTTGTACAAGGAGAAGAAAAAATACCTGTGGCCTT
(SEQ ID NO:138) G-3'; SEQ ID NO:155)
SND-2 (5'-
CAAGGCCACAGGTATTTTTTCTTCTCCTTGTACAAAG
-3'; SEQ ID NO:156)
pET42T-hIL-1(3116-269 hIL-1(3116-269 K6365S-1 (5'-
(K63S/K65S) (K63S/K65S) GTGGCCTTGGGCCTCAGCGAAAGCAATCTGTACCTG
(SEQ ID NO: 139) TCCTG-3'; SEQ ID NO: 157)
K6365S-2 (5'-
CAGGACAGGTACAGATTGCTTTCGCTGAGGCCCAAG
GCCAC-3'; SEQ ID NO:158)
pET42T-hIL-1(3116-269 hIL-1(3116-269 QE-1 (5'-
(Q126A/E128A) (Q126A/E128A) GTACATCAGCACCTCTGCAGCAGCAAACATGCCCGT
(SEQ ID NO: 140) CTTC-3'; SEQ ID NO: 159)
QE-2 (5'-
GAAGACGGGCATGTTTGCTGCTGCAGAGGTGCTGAT
GTAC-3'; SEQ ID NO:160)
EXAMPLE 11
A. Biological activity of human IL-1(3116-269 and human IL-1(3116-269 muteins
in mice
[00237] Three female C3H/HeJ mice per group were injected intravenously with
10 g of
either the wild type human IL-1(3119-269 protein or one of the human IL-1(3119-
269 protein
muteins of EXAMPLE 10. Serum samples were withdrawn before and 3 h after
injection and
analysed for the relative increase in the concentration of the pro-
inflammatory cytokine IL-6.
As shown in table 4, mice injected with the wild type human IL-1(3119-269
protein showed an
increase of 2.38 ng/ml in serum IL-6 concentrations. With the exception of
muteins hIL-1(3116-
269 (D54R) and hIL-1(3116-269 (K63 S/K65 S), which induced similar serum IL-6
concentrations
as wild type human IL-1(3119-269, all muteins tested induced lower amounts of
IL-6, indicating
reduced biological activity.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-71-
Table 4: Biological activity of human IL-1(3116-269 and human IL-1(3116-269
muteins in mice.
Protein/mutein Average increase in serum IL-6
concentrations 3 h after injection
in ng/ml ( SD)
hIL-1(3116-269 2.38 0.69
hIL-1(3116-269 (R4D) 0.16 0.03
hIL-1(3116-269 (L6A) 1.03 0.65
hIL-1(3116-269 (T9G) 0.82 0.42
hIL-1(3116-269 (R11 G) 0.34 0.25
hIL-113116-269(D54R) 3.25 1.67
hIL-113116-269 (DEE50,51) 1.10 0.27
hIL-1(3116-269(OSND52-54) 0.13 0.08
hIL-1(3116-269 (K63S/K65S) 2.22 1.38
hIL-1(3116-269 (Q126A/E128A) 0.77 0.55
hIL-1(3116-269 (D145K) 1.39 0.26
B. Biological activity of human IL-1(3116-269 and human IL-1(3116-269 muteins
in human
PBMC
[00238] Peripheral blood mononuclear cells (PBMCs) were isolated from
heparinized blood
of a healthy donor by Ficoll density gradient centrifugation. 5x105 cells per
well were
incubated with titrating amounts of either the wild type human IL-1(3119-269
protein or one of
the human IL-1(3119-269 muteins of EXAMPLE 10. After over night incubation the
amount of
IL-6 in the cell culture supematant was measured as readout of the biological
activity. Table 5
shows that with the exception of muteins hIL-1(3116-269 (D54R) and hIL-1(3116-
269
(K63S/K65S), much higher amounts of all mutants were necessary to induce the
same IL-6
secretion as wild type human IL-1(3119-269, indicating a reduction in
bioactivity. The factor by
which biological activity was reduced ranged from 13 fold for mutein hIL-
1(3116-269 (Rl1G) to
381 foldformuteinhIL-1(3116-269(OSND52-54)
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-72-
Table 5: Biological activity of human IL-1(3116-269 and human IL-1(3116-269
muteins in human
PBMC.
Protein/mutein Protein / mutein Fold reduction in
concentration (in ng/ml) bioactivity relative to
required to induce 600 wild type hIL-1(3116-269
pg/ml IL-6 from human
PBMC
hIL-1(3116-269 2 -/-
hIL-1116-269 (R4D) 333 146
hIL-1(3116-269 (L6A) 31 14
hIL-1(3116-269 (T9G) 79 34
hIL-113116-269 (Rl 1 G) 30 13
hIL-1(3116-269 (D54R) 5 2
hIL-1(3116-269 (DEE50,51) 187 82
hIL-113116-269 (OSND52-54) 872 381
hIL-113116-269 (K63 S/K65 S) 13 6
hIL-1(3116-269 (Q126A/E128A) 94 41
hIL-1(3116-269 (D145K) 386 169
EXAMPLE 12
A. Coupling of human IL-1(3116-269 and human IL-1(3116-269 muteins to Q(3
virus-like
particles
[00239] Chemical cross-linking of the wild type human IL-1(3119-269 protein
and the human
IL-1(3119-269 muteins of EXAMPLE 10 to Q(3 virus-like particles was performed
essentially as
described in EXAMPLE 2A.
B. Immunization of mice with human IL-1(3116-269 and human IL-1(3116-269
muteins
coupled to Q(3 capsid
[00240] Four female balb/c mice per group were immunized with Q(3 coupled to
either the
wild type hIL-1(3116-269 protein or one of the hIL-1(3116-269 mutein proteins.
Fifty g of total
protein were diluted in PBS to 200 1 and injected subcutaneously (100 1 on
two ventral
sides) on day 0, 14 and 28. Mice were bled retroorbitally on day 35, and sera
were analyzed
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-73-
using ELISAs specific for either for the respective human IL-1(3116-269 mutein
used as
immunogen, or the wild type human IL-1(3116-269 protein.
C ELISA
[00241] ELISA plates were coated either with the wild type hIL-1(3116-269
protein or the
respective hIL-1(3116-269 mutein at a concentration of 1 g/ml. The plates
were blocked and
then incubated with serially diluted mouse sera from day 35. Bound antibodies
were detected
with enzymatically labeled anti-mouse IgG antibody. Antibody titers of mouse
sera were
calculated as the average of those dilutions which led to half maximal optical
density at
450 nm, and are shown in Table 6.
Table 6: Anti- hIL-1(3116-269 (wild type and mutein)-specific IgG titers
raised by
immunization with Qp-hIL-1 P116-269 or QP-hIL-1 P116-269 mutein vaccines.
Average anti-hIL-1(3116-269 Average anti-hIL-1(3116-269
Vaccine
wild type IgG titer ( SD) mutein IgG titer ( SD)
Q(3-hIL-1(3116-269 253325 184813 -/-
Q(3-hIL-1(3116-269 (R4D) 231879 115475 160666 79478
Q(3-hIL-1(3116-269 (L6A) 120224 7658 89377 17965
Q(3-hIL-1(3116-269 (T9G) 261249 153716 224809 131823
Q(3-hIL-1(3116-269 (Rl1G) 278342 50296 279290 47232
Q(3-hIL-1(3116-269 (D54R) 269807 122351 206516 90998
Q(3-hIL-1(3116-269 (D145K) 78365 26983 93241 28856
Q(3-hIL-1(3116-269 (DEE50,51) 287625 143835 229862 140169
Q(3-hIL-1(3116-269 (OSND52-54) 68895 14267 106116 25295
Q(3-hIL-1(3116-269 (K63S/K65S) 403712 402594 244552 173597
Q(3-hIL-1(3116-269 (Q126A/E128A) 195165 71436 170434 86831
[00242] Q(3-hIL-1(3116-269-immunization induced high titers of IgG antibodies
against hIL-
1(3116-269. Moreover, vaccination with either of the Q(3-hIL-1(3116-269 mutein
vaccines induced
high IgG titers against both the respective hIL-1(3116-269 mutein used as
immunogen, and the
wild type hIL-1(3116-269 protein.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-74-
D. In vitro neutralization of human IL-1(3
[00243] Sera of mice immunized with Q[3 coupdl to either wild type hIL-1(3116-
269 protein or
to one of the hIL-1(3116-269 muteins were tested for their ability to inhibit
the binding of human
IL-1(3 protein to its receptor. ELISA plates were therefore coated with a
recombinant human
IL-lreceptorI-hFc fusion protein at a concentration of 1 g/ml, and co-
incubated with serial
dilutions of the above mentioned sera and 100 ng/ml of hIL-1(3116-269 protein.
Binding of hIL-
1(3116-269 to the immobilized human IL-lreceptorI-hFc fusion protein was
detected with a
biotinylated anti-human IL-1(3 antibody and horse radish peroxidase conjugated
streptavidin.
All sera raised against Q(3-hIL-1(3116-269 mutein vaccines completely
inhibited the binding of
100 ng/ml wild type hIL-1(3116-269to hIL-1RI at serum concentrations _ 3.3 %.
[00244] The same sera were also tested for their ability to inhibit the hIL-
1(3116-269-induced
secretion of IL-6 from human cells. Human PBMCs were therefore prepared as
described in
EXAMPLE 11B and incubated with 10 ng/ml wild type hIL-1(3116-269, which had
been
premixed with titrating concentrations of the sera described above. After over
night
incubation the cell culture supematants were analyzed for the presence of IL-
6. The
neutralizing capacity of the sera was expressed as those dilutions which lead
to half maximal
inhibition of IL-6 secretion. In order to allow a direct comparison to the
neutralizing capacity
of the serum raised against wild type hIL-1(3116-269, the neutralizing titers
of all sera raised
against hIL-1(3116-269 muteins were corrected for the respective ELISA titers
measured against
wild type hIL-1(3116-269 (see Table 6). As shown in Table 7 all sera raised
against hIL-1(3116-269
muteins were able to inhibit the secretion of IL-6 induced by wild type hIL-
1(3116-269. The
neutralizing titers ranged from 1:113 for sera raised against Q(3-hIL-1(3116-
269 (Rl 1 G) to
1:4532 for sera raised against Q(3-hIL-1(3116-269 (D54R).
Table 7: Neutralizing titer determined in sera of mice immunized with various
IL-1 beta
muteins.
Neutralizing titer (corrected for ELISA titer
Vaccine
against wild type hIL-1(3116-269)
Q(3-hIL-1(3116-269 3333
Q(3-hIL-1(3116-269 (R4D) 2150
Q13-hIL-113116-269 (L6A) 2062
Q13-hIL-113116-269 (T9G) 1036
QR-hIL-1(3116-269 (Rl 1 G) 113
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-75-
Q(3-hIL-1(3116-269 (D54R) 4532
Q(3-hIL-1(3116-269 (DEE50,51) 2871
Q(3-hIL-1(3116-269 (OSND52-54) 1109
Q(3-hIL-1(3116-269 (K63 S/K65 S) 3432
QR-hIL-1(3116-269 (Q126A/E128A) 1237
Q(3-hIL-1(3116-269 (D145K) 2369
E. In vivo neutralization of IL-1(3
[00245] The in vivo neutralizing capacity of the antibodies raised by
immunization with QD
coupled to either wild type hIL-1(3116-269 protein or to one of the hIL-1(3116-
269 muteins is
investigated. Three female C3H/HeJ mice per group are therefore immunized
three times on
days 0, 14, and 28 with 50 g of either vaccine. On day 35 all immunized mice
are injected
intravenously with 1 g of free wild type hIL-1(3116-269. As a control three
naive mice are
injected at the same time with the same amount of wild type hIL-1(3116-269. As
readout of the
inflammatory activity of the injected hIL-1(3116-269, serum samples are
withdrawn immediately
before and 3 h after injection and analysed for the relative increase in the
concentration of the
pro-inflammatory cytokine IL-6. Whereas naive mice show a strong increase in
serum IL-6
concentrations 3h after injection of hIL-1(3116-269, all mice immunized with
Q[3 coupled to the
wild type hIL-1(3116-269 protein or to one of the hIL-1(3116-269 muteins do
not show any increase
in serum IL-6, indicating that the injected hIL-1(3116-269 is efficiently
neutralized by the
antibodies induced by the vaccines.
EXAMPLE 13
Amelioration of MSU-induced inflammation by immunization with Q(3-mIL-1(3119-
269
[00246] Gout is a painful inflammatory disorder caused by the precipitation of
monosodium
urate (MSU) crystals in joints and periarticular tissues. MSU crystals have
been shown to
activate the so called NALP3 inflammasome, resulting in the production of
active IL-1(3,
which is mainly responsible for initiating and promoting the inflammatory
response
characteristic of the disease. C57BL/6 mice (5 per group) are immunized
subcutaneously
three times at two weeks intervals with 50 g Q(3-mIL-1(3119-269 or 50 g of
Q[3 VLPs alone.
One week after the last immunization all mice are challenged intraperitoneally
with 1.5 mg
MSU crystals. Six hours after the challenge mice are sacrificed and neutrophil
numbers as
well as the concentrations of the neutrophil chemoattractants KC and MIP-2 are
measured in
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-76-
peritoneal exsudates. Q[3-mIL-1(3119-269-immunized mice show markedly reduced
neutrophilia
and MIP-2 and KC concentrations, when compared to Q[3-immunized controls.
EXAMPLE 14
Amelioration of experimental autoimmune encephalitis by immunization
with Qp-mIL-1P119-269
[00247] In a mouse model for multiple sclerosis, C57BL/6 mice (8 per group)
are immunized
subcutaneously three times at two weeks intervals with 50 g Q(3-mIL-1(3119-
269 or 50 g of
Q[3 VLPs alone. One week after the last immunization all mice are injected
subcutaneously
with 100 g MOG peptide (MEVGWYRSPFSRVVHLYRNGK, SEQ ID NO:191) mixed
with complete Freund's adjuvant. On the same day and two days later all mice
are injected
intraperitoneally with 400 ng of pertussis toxin. Mice are scored on a daily
basis for
development of neurological symptoms according to the following scheme: 0, no
clinical
disease; 0.5, end of tail limp; 1, tail completely limp; 1.5, limp tail and
hind limb weakness
(unsteady gait and poor grip of hind legs); 2, unilateral partial hind limb
paralysis; 2.5,
bilateral partial hind limb paralysis; 3, complete bilateral hind limb
paralysis; 3.5, complete
bilateral hind limb paralysis and unilateral front limb paralysis; 4, total
paralysis of hind and
front limbs. Q(3-mIL-1(3119-269-immunized mice show clearly reduced clinical
symptoms when
compared to Q(3-immunized mice.
EXAMPLE 15
A Cloning, expression and purification of mouse IL-1a115-27o and mouse IL-
1a115-270
(D145K)
[00248] The nucleotide sequence encoding amino acids 115-270 of wild type
murine IL-la
was amplified by PCR from a library of TNFa-activated murine macrophages using
oligonucleotides ILlalC (5'-ATATATCATA TGTCTGCCCC TTACACCTAC
CAGAGTG-3': SEQ ID NO:196) and ILla2 (5'-ATATATCTCG AGTGATATCT
GGAAGTCTGT CATAGAG-3'; SEQ ID NO:25). The DNA fragment was digested with
Nhel and Xhol, and cloned into the expression vector pET42T(+), giving rise to
the
expression plasmid pET42T-mIL-1 a115-270=
[00249] By site directed mutagenesis of the latter plasmid, an expression
vector for the
muteinmIL-1oa115-270 (D145K) was constructed. Using the oligonucleotide pair
alphaDl45K-
1: (5'-GGACTGCCCTCTATGACAAAATTCCAGATATCACTCGAG-3; SEQ ID NO:197)
alphaD145K-2 (5'-CTCGAGTGATATCTGGAATTTTGTCATAGAGGGCAGTCC-3'; SEQ
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-77-
ID NO:198) and the Quik-Change Site directed mutagenesis kit (Stratagene),
the D 145K
mutation was introduced. Expression and purification of wild type mouse IL-
1a115-27o and the
mutein mouse IL-1a115-270 (D145K) was performed as described in EXAMPLE 1.
B Cloning, expression and purification of human IL-1CC119-271 and human IL-
1a119-271
(D145K)
[00250] The nucleotide sequence encoding amino acids 119-271 of wild type
human IL-la
was amplified by PCR from a LPS-activated human B cell cDNA library using
oligonucleotides HIL-3 (5'-ATATATCATA TGCTGAGCAA TGTGAAATAC
AACTTTATG-3'; SEQ ID NO:141) and HIL-4 (5'-ATATATCTCG AGCGCCTGGT
TTTCCAGTAT CTGAAAG-3'; SEQ ID NO:142). The DNA fragment was digested with
NheI and XhoI, and cloned into the expression vector pET42T(+), giving rise to
the
expression plasmid pET42T-hIL- l ai i 9-z7i.
[00251] By site directed mutagenesis of the latter plasmid, an expression
vector for the
mutein hIL-lai19-271 (D145K) was constructed. Using the oligonucleotide pair
halphaDl45K-
1(5'-GGGCCACCCT CTATCACTAA ATTTCAGATA CTGGAAAACC-3': SEQ ID
NO:199) and halphaD145K-2 (5'-GGTTTTCCAG TATCTGAAAT TTAGTGATAG
AGGGTGGCCC-3'; SEQ ID NO:200) and the Quik-Change Site directed mutagenesis
kit
(Stratagene), the D145K mutation was introduced. Expression and purification
of wild type
human IL-lai19-271 and the human IL-lai19-271 (D145K) mutein was performed as
described
in EXAMPLE 1.
EXAMPLE 16
A. Biological activity of human IL-1a119-271, human IL-1a119-271 (D145K),
mouse IL-
1a115-270, and mouse IL-1a115-270 (D145K) in human PBMC
[00252] PBMC from a healthy donor (5x105 cells per well) were incubated with
titrating
amounts of either the wild type human IL-lai19-271 protein, the human IL-
loai19-271 (D145K)
mutein, the wild type mouse IL-1a115-270 protein, or the mouse IL-1a115-270
(D145K) mutein.
After over night incubation the amount of IL-6 in the cell culture supematant
was measured
by Sandwich ELISA as readout of the biological activity of the different
proteins. Table 8
shows that 21 fold higher amounts of the mouse IL-1oa115-270 (D145K) mutein
were required to
induce the same amount of IL-6 as the corresponding wild type mouse IL-1a115-
27o protein. In
the case of the human IL-loai19-271 (D145K) mutein 46-fold higher amounts than
the wild type
human IL-laii9-z7i protein were required. This demonstrates that both the
human IL-laii9-z7i
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-78-
(D145K) mutein and the mouse IL-1oa115-270 (D145K) mutein have reduced
bioactivity in
human cells as compared to their wild type counterparts.
Table 8: Biological activity of IL-la wild type proteins and muteins in human
PBMC as
determined by IL-6 induction.
Protein/mutein (expressed with SEQ ID Protein/mutein concentration required to
induce
NO:201 as C-terminal tag) 600 pg/ml IL-6 from human PBMC (ng/ml)
mouse IL-1oa115-270
4.7
(SEQ ID NO:202)
mouse IL-1oa115-270
100
(D145K) (SEQ ID NO:204)
human IL-1OG119-271
0.8
(SEQ ID NO:203)
human IL-loai19-271 (D145K)
37
(SEQ ID NO:210)
B. Biological activity of human IL-1a119-271, human IL-1a119-271 (D145K),
mouse IL-1a115-
270 protein, and mouse IL-1a115-270 (D145K) in mice
[00253] Four female Balb/c mice per group were injected intravenously with 10
ng of either
the wild type human IL-lai19-271 protein, the human IL-la119-271 (D145K)
mutein, the wild
type mouse IL-1a115-27o protein, or the mouse IL-1a115-270 (D145K) mutein.
Three hours after
injection serum amyloid A (SAA) was measured in serum of injected mice as
readout of the
bioactivity of the respective protein. As shown in Table 9 the mouse IL-1a115-
270 (D145K)
mutein induced 53 % less SAA than the corresponding wild type mouse IL-1a115-
270 protein
(p < 0.05, Student t-test) and the human IL-la119-271 (D145K) mutein induced
67% less SAA
than the corresponding wild type human IL-la119-271 protein (p < 0.001 Student
t-test). This
demonstrates that both the human IL-loai19-271 (D145K) mutein and the mouse IL-
1a115-270
(D145K) mutein have reduced bioactivity in mice when compared to their wild
type
counterparts.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-79-
Table 9: Biological activity of IL-la wild type proteins and muteins in mice
determined by
SAA.
Serum SAA concentration ( g/ml) 3 h after
Protein/mutein
protein/mutein injection ( SD)
mouse IL-loaiis-27o
115 ~ 32
(SEQ ID NO:202)
mouse IL-lai15-270 (D145K)
55~10
(SEQ ID NO:204)
human IL-1OG119-271
92~20
(SEQ ID NO:203)
human IL-loi19-271 (D145K) (SEQ ID
31~2
NO:210)
Example 17
Efficacy of mIL-1(3119-269 aõd mIL-1 a115-270 muteins coupled to Q(3 in a
mouse model of
rheumatoid arthritis
[00254] Mouse IL-1(3119-269 muteins and mouse IL-1 a11s-27omuteins carrying
the mutations of
the corresponding human muteins of SEQ ID NO:131 to 140 and SEQ ID NO:205 to
218 are
created according to table 10 and coupled to Q. The efficacy of mIL-1(3119-269
and mIL-1
a11s-27o muteins coupled to Q(3 is tested in the murine collagen-induced
arthritis model (CIA).
Male DBA/1 mice are immunized subcutaneously three times (days 0, 14 and 28)
with 50 g
of either Q[3-mIL-1(3119-269 mutein, Q[3-mIL-laiis-27o mutein or Q(3 alone,
and then injected
intradermally at day 42 with 200 g bovine type II collagen mixed with
complete Freund's
adjuvant. After a booster injection of 200 g bovine type II collagen mixed
with incomplete
Freund's adjuvant at day 63 mice were examined on a daily basis for the
development of
arthritis symptoms.
[00255] A clinical score was assigned to each limb as defined in Example 2F.
Two weeks
after the second collagen injection Q[3-mIL-1(3119-269 mutein and Q[3-mIL-
laiis-27o mutein
immunized mice show strongly reduced clinical scores as compared to Q(3-
immunized mice.
CA 02664418 2009-03-25
WO 2008/037504 PCT/EP2007/053007
-80-
Table 10: Mouse IL-1 beta and Mouse IL-1 alpha muteins corresponding to
preferred human
IL-1 beta muteins (SEQ ID NO:131 to 140 and SEQ ID NO:205 to 209) and human IL-
1
alpha muteins (SEQ ID NO:210 to 218) are created according to this table and
tested in the
mouse model of rheumatoid arthritis.
Human hIL-lbeta 116-269 Amino acid changes introduced in mouse IL-lbeta 119-
269 (SEQ
muteins ID NO:164) in order to obtain the corresponding mutation
R4D (SEQ ID NO:131) Exchange arginine at position 3 to aspartate
L6A (SEQ ID NO: 132) Exchange leucine at position 5 to alanine
T9G (SEQ ID NO: 133) Exchange arginine at position 8 to glycine
R11G(SEQ ID NO: 134) Exchange arginine at position 10 to glycine
D54R (SEQ ID NO: 135) Exchange aspartate at position 53 to arginine
D145K (SEQ ID NO:136) Exchange aspartate at position 143 to lysine
DEE50,51 (SEQ ID NO:137) Delete glutamate, proline at positions 49,50
OSND52-54 (SEQ ID NO:138) Delete serine, asparagine, aspartate at positions 51
to 53
K63S/K65S (SEQ ID NO: 139) Exchange lysines at positions 62 and 64 to serines
Q126A/E128A (SEQ ID NO: 140) Exchange glutamine at position 125 to alanine and
glutamate at
position 127 to alanine
K88N (SEQ ID NO:205) Exchange lysine at position 87 to asparagine
R98Q (SEQ ID NO:206) Exchange arginine at position 97 to glutamine
K103L (SEQ ID NO:207) Exchange lysine at position 102 to leucine
AKKK92-94 (SEQ ID NO:208) Delete lysine, lysine, lysine at positions 91 to 93
L10N (SEQ ID NO:209) Exchange leucine at position 9 to asparagine
Human hIL-lalpha 119-271 Amino acid changes introduced in mouse IL-lalpha 115-
270 (SEQ
muteins ID NO:202) in order to obtain corresponding mutation
D145K(SEQ ID NO:210) Exchange aspartate at position 153 to lysine
L18K (SEQ ID NO:211) Exchange methionine at position 25 to lysine
F146N (SEQ ID NO:212) Exchange phenylalanine at position 154 to asparagine
R10A (SEQ ID NO:213) Exchange lysine at position 17 to alanine
162A (SEQ ID NO:214) Exchange tyrosine at position 70 to alanine
W107F (SEQ ID NO:215) Exchange tryptophane at position 115 to phenylalanine
D20V (SEQ ID NO:216) Exchange aspartate at position 27 to valine
OFIL16-18 (SEQ ID NO:217) Delete phenylalanine, valine, methionine at
positions 23 to 25
AITGS96-99 (SEQ ID NO:218) Delete isoleucine, threonine, glycine, serine at
positions 104 to 107
