Note: Descriptions are shown in the official language in which they were submitted.
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
METHOD FOR DISTINGUISHING BETWEEN LUNG SQUAMOUS CARCINOMA
AND OTHER NON SMALL CELL LUNG CANCERS
FIELD OF THE INVENTION
The invention relates in general to microRNA molecules associated with
specific types of
lung cancers, as well as various nucleic acid molecules relating thereto or
derived therefrom.
BACKGROUND OF THE INVENTION
In recent years, microRNAs (miRs) have emerged as an important novel class of
regulatory RNA, which have a profound impact on a wide array of biological
processes.
These small (typically 18-24 nucleotides long) non-coding RNA molecules can
modulate
protein expression patterns by promoting RNA degradation, inhibiting mRNA
translation,
and also affecting gene transcription. miRs play pivotal roles in diverse
processes such as
development and differentiation, control of cell proliferation, stress
response and
metabolism. The expression of many miRs was found to be altered in numerous
types of
human cancer, and in some cases strong evidence has been put forward in
support of the
conjecture that such alterations may play a causative role in tumor
progression. There are
currently about 700 known human miRs, and their number probably exceeds 800.
Classification of cancer has typically relied on the grouping of tumors based
on histology,
cytogenetics, immunohistochemistry, and known biological behavior. The
pathologic
diagnosis used to classify the tumor taken together with the stage of the
cancer is then used
to piedict prognosis and direct therapy. However, current methods of cancer
classification
and staging are not completely reliable.
Lung cancer is one of the most common cancers and has become a predominant
cause of
cancer-related death throughout the world. Scientists strive to explore
biomarkers and their
possible role in the diagnosis, treatment and prognosis of specific lung
cancers.
Making the correct diagnosis and specifically the distinction between lung
squamous
carcinoma and other Non Small Cell Lung Carcinoma (NSCLC) such as but not
limited to
lung adenocarcinoma, has practical importance for choice of therapy. Severe or
fatal
heinorrhage is a black box warning for lung squamous carcinoma patients
undergoing
bevacizumab (Avastin) therapy. To-date there is no objective standardized test
for
differentiating squamous from non squamous NSCLC.
1
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
The search for biomarkers for the early detection and accurate diagnosis of
various
NSCLC has met with little success. Much emphasis has been placed on the
discovery and
characterization of a unique tumor marker. However, no marker has been
identified that has
adequate sensitivity or specificity to be clinically useful, although a
combination of multiple
markers has been shown to increase diagnostic accuracy.
There is an unmet need for a reliable method for distinguishing between lung
squamous
cell carcinoma and other NSCLC.
SUMMARY OF THE INVENTION
The present invention provides specific nucleic acid sequences for use in the
identification, classification and diagnosis of specific lung cancers. The
nucleic acid
sequences can also be used as prognostic markers for prognostic evaluation of
a subject
based on their expression pattern in a biological sample.
The invention further provides a method of classifying NSCLC, the method
comprising:
obtaining a biological sample from a subject; measuring the relative abundance
in said
sample of a nucleic acid sequence selected from the group consisting of SEQ ID
NOS: 1-5,
13-30, a fragment thereof or a sequence having at least about 80% identity
thereto; and
comparing said obtained measurement to a reference number representing
abundance of said
nucleic acid; whereby the differential expression of said nucleic acid
sequence allows the
classification of said NSCLC.
According to some embodiments, said biological sample is selected from the
group
consisting of bodily fluid, a cell line and a tissue sample. According to some
embodiments,
said tissue is a fresh, frozen, fixed, wax-embedded or formalin fixed paraffm-
embedded
(FFPE) tissue. According to one embodiment, the tissue sample is a lung
sample.
According to some embodiments, said NSCLC is selected from the group
consisting of
lung squamous cell carcinoma, lung adenocarcinoma and lung undifferentiated
large cell
carcinoma. According to some embodiments, said lung undifferentiated large
cell carcinoma
is originated from lung squamous cell carcinoma or from adenocarcinoma.
The invention further provides a method for distinguishing between lung
squamous cell
carcinoma and other NSCLC, the method comprising: obtaining a biological
sample from a
subject; determining in said sample an expression level of a nucleic acid
sequence selected
from the group consisting of SEQ ID NOS: 1- 5, a fragment thereof or a
sequence having at
least 80% identity thereto; whereby a relative abundance of SEQ ID NO: 1
indicates the
presence of squamous cell carcinoma.
2
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
According. to some embodiments, said other NSCLC is lung adenocarcinoma.
According to some embodiments, the method comprises determining the expression
levels
of at least two nucleic acid sequences. According to some embodiments the
method further
comprising combining one or more expression ratios. According to some
embodiments, the
expression levels are determined by a method selected from the group
consisting of nucleic
acid hybridization, nucleic acid amplification, and a combination thereof.
According to
some embodiments, the nucleic acid hybridization is performed using a solid-
phase nucleic
acid biochip array. According to certain embodinients, the nucleic acid
hybridization is
performed using in situ hybridization. According to other embodiments, the
nucleic acid
amplification method is real-time PCR (RT-PCR). According to orie embodiment,
said real-
time PCR is quantitative real-time PCR (qRT-PCR).
According to some enibodiments, the RT-PCR method comprises forward and
reverse
primers. According to other embodiments, the forward primer comprises a
sequence
selected from the group consisting of any one of SEQ ID NOS: 7-9. According to
some
embodiments, the real-time PCR method furtlier comprises hybridization witli a
probe.
According to other embodiments, the probe comprises a sequence selected from
the group
consisting of any one of SEQ ID NOS: 10-12.
The invention further provides a method for distinguishing between lung
adenocarcinoma
and large cell carcinoma, the method comprising: obtaining a biological sample
from a
subject; determining in said sample an expression level of one or more nucleic
acid
sequences selected from the group consisting of SEQ ID NOS: 13-30, a fragment
thereof or
a sequence having at least 80% identity thereto; whereby a relative abundance
of said
nucleic acid indicates the presence of large cell carcinoma.
The invention further provides a kit for NSCLC classification, said kit
comprises a probe
comprising a nucleic acid sequence selected from the group consisting of any
one of SEQ
ID NOS: 10-12 and sequences having at least about 80% identity thereto.
According to
other embodiments, the kit further comprises a forward primer comprising a
sequence
selected from the group consisting of any one of SEQ ID NOS: 7-9. According to
some
embodirnents, the kit further comprises instructions for the use of one or
more expression
ratios in the diagnosis of a specific NCSLC. According to some embodiments,
said kit
comprises reagents for performing in situ hybridization analysis.
These and other embodiments of the present invention will become apparent in
conjunction with the figures, description and claims that follow.
3
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
BRIEF DESCRIPTION OF THE DRA.WINGS
Figure 1 is a graph showing the normalized expression level, of hsa-miR-205
(SEQ ID
NO: 1) based on biochip array, in lung samples originating from adenocarcinoma
(circles)
or squamous cell carcinoma (triangles). The samples are sorted according to
the expression
level of hsa-miR-205. X-axis is the sorted sanzples and y-axis is the
normalized expression
level. T-test p-value: 9.4735e-007.
Figure 2 is a graph showing the average normalized signal and standard error
(STD/sqrt(n)) of hsa-miR-205 in two lung sample sets: adenocarcinoma and
squamous cell
carcinoma.
Figure 3 is a table showing the sensitivity and specificity of miR-205 in lung
samples
originating from squamous cell carcinoma vs. adenocarcinoma. The sensitivity
of the
squamous cell carcinoma detection is 100% (9/9) and the specificity is 84.2 %
(16/19).
Figure 4 is a graph showing the full separation between samples originating
from lung
squamous cell carcinoma (asterisks) and samples originating from other NCSLC
(ellipses)
using qRT-PCR expression levels of hsa-miR-205 (SEQ ID NO: 1), normalized by
qRT-
PCR expression levels of hsa-miR-21 (SEQ ID NO: 2), U6 (SEQ ID NO: 3) and a
threshold
of a final score as described in Example 3. Full black line represents the
threshold. Dashed
black lines indicate low confidence area border.
Figure 5 is a photograph showing in situ hybridization detection of hsa-mir-
205.
Microphotographs of parallel sections of lung squamous cell carcinoma sections
were
hybridized to hsa-miR-205 specific probe (A) and control (scrambled) probe
(B).
Figure 6 is a graph showing the normalized expression level of hsa-miR-513
(SEQ ID
NO: 13) in lung satnples originating from adenocarcinoma (circles) or large
cell carcinoma
(triangles). The samples are sorted according to hsa-miR-513 expression level.
X-axis is the
sorted samples' and y-axis is the normalized expression level. T-test p-value:
6.1444e-005.
Figure 7 is a graph showing the average normalized signal and standard error
(STD/sqrt(n)) of hsa miR-513 in the two lung sample sets: adenocarcinoma and
large cell
carcinoma.
Figure 8 is a table showing the signal of hsa-miR-513 in lung samples
originating from
adenocarcinoma and large cell carcinoma. The signal below threshold is
adenocarcinoma.
The sensitivity of the adenocarcinoma detection is94.7% (18/19) and the
specificity of the
signal is 85.7% (6/7).
4
CA 02677043 2009-07-30
WO 2008/104985 PCT/1L2008/000261
DETAILED DESCRIPTION OF THE INVENTION
The invention is based on the discovery that specific nucleic acid sequences
(SEQ ID
NOS: 1-5, 13-30) can be used for the identification, classification and
diagnosis of specific
lung cancers.
The present invention provides a sensitive, specific and accurate method which
may be
used to distinguish between lung squamous cell carcinoma and other NSCLC.
The methods of the present invention have high sensitivity and specificity.
The possibility to
distinguish between lung squamous cell carcinoma and other NSCLC such as lung
adenocarcinoina or lung large cell carcinoma facilitates providing the patient
witll the best
and most suitable treatment.
Definitions
Before the present compositions and methods are disclosed and described, it is
to be
understood that the terminology used herein is for the purpose of describing
particular
embodiments only and is not intended to be limiting. It must be noted that, as
used in the
specification and the appended claims, the singular forms "a," "an" and "the"
include plural
referents unless the context clearly dictates otherwise.
For the recitation of numeric ranges herein, each intervening number there
between with
the same degree of precision is explicitly conteinplated. For example, for the
range of 6-9,
the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range
6.0-7.0, the
number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9 and 7.0 are explicitly
contemplated.
aberrant proliferation
As used herein, the term "aberrant proliferation" means cell proliferation
that deviates
fiom the normal, proper, or expected course. For example, aberrant cell
proliferation may
include inappropriate proliferation of cells whose DNA or other cellular
components have
become damaged or defective. Aberrant cell proliferation may include cell
proliferation
whose characteristics are associated with an indication caused by, mediated
by, or resulting
in inappropriately high levels of cell division, inappropriately low levels of
apoptosis, or
both. Such indications may be characterized, for example, by single or
multiple local
abnormal proliferations of cells, groups of cells, or tissue(s), whether
cancerous or non-
cancerous, benign or malignant.
about
As used herein, the term "about" refers to +/-10%.
5
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
antisense
The term "antisense," as used herein, refers to nucleotide sequences which are
conlplementary to a specific DNA or RNA sequen.ce. The term "antisense strand"
is used in
reference to a nucleic acid strand that is complementary to the "sense"
strand. Antisense
molecules may be produced by any method, including synthesis by ligating the
gene(s) of
interest in a reverse orientation to a viral promoter which permits the
synthesis of a
complementary strand. Once introduced into a cell, this transcribed strand
combines with
natural sequences produced by the cell to form duplexes. These duplexes then
block either
the further transcription or translation. In this mamler, mutant phenotypes
may be generated.
attached
"Attached" or "immobilized" as used herein refer to a probe and a solid
support and may
mean that the binding between the probe and the solid support is sufficient to
be stable
under conditions of binding, washing, analysis, and removal. The binding may
be covalent
or non-covalent. Covalent bonds may be formed directly between the probe and
the solid
support or may be formed by a cross linker or by inclusion of a specific
reactive group on
either the solid support or the probe, or both. Non-covalent binding may be
one or more of
electrostatic, hydrophilic, and hydrophobic interactions. Included in lion-
covalent binding is
the covalent attachment of a molecule, such as streptavidin, to the support
and the non-
covalent binding of a biotinylated probe to the streptavidin. Immobilization
may also
involve a coinbination of covalent and non-covalent interactions.
biological sample
"Biological sample" as used herein means a sample of biological tissue or
fluid that
comprises nucleic acids. Such saniples include, but are not limited to, tissue
or fluid isolated
from subjects. Biological samples may also include sections of tissues such as
biopsy and
autopsy samples, FFPE samples, frozen sections taken for histological
purposes, blood,
plasma, serum, sputum, stool, tears, mucus, hair, and skin. Biological samples
also include
explants and primary and/or transformed cell cultures derived from animal or
patient tissues.
Biological samples may also be blood, a blood fraction,- urine, effusions,
ascitic fluid,
saliva, cerebrospinal fluid, cervical secretions, vaginal secretions,
endometrial secretions,
gastrointestinal secretions, bronchial secretions, sputum, cell line, tissue
sample, or
secretions from the breast. A biological sample may be provided by removiing a
sample of
cells from an animal, but can also be accomplished by using previously
isolated cells (e.g.,
isolated by another person, at another time, and/or for another purpose), or
by performing
6
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
the methods described herein in vivo. Archival tissues, such as those having
treatment or
outcome history, may also be used.
cancer
The term "cancer" is meant to include all types of cancerous growths or
oncogenic
processes, metastatic tissues or malignantly transformed cells, tissues, or
organs,
irrespective of histopathologic type or stage of invasiveness. Exainples of
cancers include
but are nor liinited to solid tumors and leukemias, including: apudoma,
choristoma,
branchioma, malignant carcinoid syndrome, carcinoid heart disease, carcinoma
(e.g.,
Walker, basal cell, basosquamous, Brown-Pearce, ductal, Ehrlich tumor, small
cell lung,
non-small cell lung (e.g., lung squamous cell carcinoma, lung adenocarcinoma
and lung
undifferentiated large cell carcinoma), oat cell, pa.pillary, bronchiolar,
bronchogenic,
squainous cell, and transitional cell), histiocytic disorders, leukemia (e.g.,
B cell, mixed cell,
null cell, T cell, T-cell chronic, HTLV-II-associated, lymphocytic acute,
lymphocytic
chronic, mast cell, and myeloid), histiocytosis malignant, Hodgkin disease,
immunoproliferative small, non-Hodgkin lymphoma, plasmacytoma,
reticuloendotheliosis,
melanoma, chondroblastoma, chondroma, chondrosarcoma, fibroma, fibrosarcoma,
giant
cell turirnors, histiocytoma, lipoma, liposarcoma, mesothelioma, myxoma,
myxosarcoma,
osteoma, osteosarcoma, Ewing sarcoma, synovioma, adenofibroma, adenolymphoma,
carcinosarcoma, chordoma, craniopharyngioma, dysgerminoma, hamartoma,
mesenchymoma, mesonephroma, myosarcoma, ameloblastoma, cementoma, odontoma,
teratoma, thymoma, trophoblastic tumor, adeno-carcinoma, adenoma, cholangioma,
cholesteatoma, cylindroma, cystadenocarcinoma, cystadenoma, granulosa cell
tumor,
gynandroblastoma, hepatoma, hidradenoma, islet cell tumor, Leydig cell tumor,
papilloma,
Sertoli cell tumor, theca cell tumor, leiomyoma, leiomyosarcoma, myoblastoma,
myosarcoma, rhabdomyoma, rhabdomyosarcoma, ependymoma, ganglioneuroma, glioma,
medulloblastoma, meningioma, neurilemmoma, neuroblastoma, neuroepithelioma,
neurofibroma, neuroma, paraganglioma, paraganglioma nonchromaffin,
angiokeratoma,
angiolymphoid llyperplasia with eosinophilia, angioma sclerosing,
angiomatosis,
glomangioma, hemangioendothelioma, hemangioma, hemangiopericytoma,
hemangiosarcoma, lymphangioma, lymphangiomyoma, lymphangiosarcoma, pinealoma,
carcinosarcoma, chondrosarcoma, cystosarcoma, phyllodes, fibrosarcoma,
hemangiosarcoma, leimyosarcoma, leukosarcoma, liposarcoma, lymphangiosarcoma,
myo.sarcoina, nlyxosarcoma, ovarian carcinoma, rhabdomyosarcoma, sarcoma
(e.g., Ewing,
7
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
experimental, Kaposi, and mast cell), neurofibromatosis, and cervical
dysplasia, and other
conditions in which cells have become immortalized or transformed.
classification
"Classification" as used herein refers to a procedure and/or algorithm in
which individual
5* items are placed into groups or classes based on quantitative information
on one or more
characteristics inherent in the items (referred to as traits, variables,
characters, features, etc)
and based on a statistical model and/or a training set of previously labeled
items. According
to one embodiment, classification means determination of the type of lung
cancer.
complement 11
"Complement" or "complementary" as used herein means Watson-Crick (e.g.; A-T/U
and
C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of
nucleic acid
molecules. A full complement or fully complementary may mean 100%
complementary
base pairing between nucleotides or nucleotide analogs of nucleic acid
molecules.
Ct
"Ct" as used herein refers to Cycle Threshold of qRT-PCR, which is the
fractional cycle
number at which the fluorescence crosses the threshold.
detection
"Detection" means detecting the presence of a component in a sample. Detection
also
means detecting the absence of a component. Detection also means measuring the
level of a
component, either quantitatively or qualitatively.
differential expression
"Differeritial expression" means qualitative or quantitative differences in
the temporal
and/or cellular gene expression patterns within and among cells and tissue.
Thus, a
differentially expressed gene may qualitatively have its expression altered,
including an
activation or inactivation, in, e.g., normal versus disease tissue. Genes may
be turned on or
turned off in a particular state, relative to another state thus permitting
comparison of two or
more states. A qualitatively regulated gene may exhibit an expression pattern
within a state
or cell type which may be detectable by standard techniques. Some genes may be
expressed
in one state or cell type, but not in both. Alternatively, the difference in
expression may be
quantitative, e.g., in that expression is modulated, either up-regulated,
resulting in an
increased amount of transcript, or down-regulated, resulting in a decreased
amount of
transcript. The degree to which expression differs need only be large enough
to quantify via
standard characterization techniques such as expression arrays, quantitative
reverse
8
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
transcriptase PCR, northern analysis, real-time PCR, in situ hybridization and
RNase
protection.
expression ratio
"Expression ratio" as used herein refers to relative expression levels of two
or more
nucleic acids as determined by detecting the relative expression levels of the
corresponding
nucleic acids in a biological sample.
fragment'
"Fragment" is used herein to indicate a non-full length part of a nucleic acid
or
polypeptide. Thus, a fragment is itself also a nucleic ac'id or polypeptide,
respectively.
gene
"Gene" as used herein may be a natural (e.g., genomic) or synthetic gene
comprising
transcriptional and/or translational regulatory sequences and/or a coding
region and/or non-
translated sequences (e.g., introns, 5'- and 3'-untranslated sequences). The
coding region of
a gene may be a nucleotide sequence coding for an amino acid sequence or a
functional
RNA, such as tRNA, rRNA, catalytic RNA, siRNA, miRNA or antisense RNA. A gene
may also be an mRNA or eDNA corresponding to the coding regions (e.g., exons
and
miRNA) optionally comprising 5'- or 3'-untranslated sequences linked thereto.
A gene may
also be an amplified nucleic acid molecule produced in vitro comprising all or
a part of the
coding region and/or 5'- or 3'-untranslated sequences linked thereto.
Groove binder/minor groove binder (MGB)
"Groove binder" and/or "minor groove binder" may be used interchangeably and
refer to
small molecules that fit into the minor groove of double-stranded DNA,
typically in a
sequence-specific manner. Minor groove binders may be long, flat molecules
that can adopt
a crescent-like shape and thus, fit snugly into the minor groove of a double
helix, often
.25 displacing water. Minor groove binding molecules may typically comprise
several aromatic
rings connected by bonds with torsional freedom such as furan, benzene, or
pyrrole rings.
Minor groove binders may be antibiotics such as netropsin, distamycin,
berenil, pentamidine
and other aromatic diamidines, Hoechst 33258, SN 6999, aureolic anti-tumor
drugs such as
chromomycin and mithramycin, CC-1065, dihydrocyclopyrroloindole tripeptide
(DPI3), 1,2-
dihydro-(3H)-pyrrolo[3,2-e]indole-7-carboxylate (CDPI3), and related compounds
and
analogues, including those described in Nucleic Acids in Chemistry and
Biology, 2d ed.,
Blackburn and Gait, eds., Oxford University Press, 1996; and PCT Published
Applicatiori
No. WO 03/078450, the contents of which are incorporated herein by reference.
A minor
groove binder may be a component of a primer, a probe, a hybridization tag
complement, or
9
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
combinations thereof. Minor groove binders may increase the T,,, of the primer
or a probe to
which they are attached, allowing such primers or, probes to effectively
hybridize at higher
temperatures.
host cell
"Host cell" as used herein may be a naturally occurring cell or a transformed
cell that may
contain a vector and may support replication of the vector. Host cells may be
cultured cells,
explants, cells in vivo, and the like. Host cells may be prokaryotic cells
such as E. coli, or
eukaryotic cells such as yeast, insect, amphibian, or mammalian cells, such as
CHO and
HeLa.
identity
"Identical" or "identity" as used herein in the context of two or more nucleic
acids or
polypeptide sequences mean that the sequences have a specified percentage of
residues that
are the same over a specified region. The percentage may be calculated by
optimally
aligning the two sequences, comparing the two sequences over the specified
region,
determining the number of positions at which the identical residue occurs in
both sequences
to yield the number of matched positions, dividing the number of matched
positions by the
total number of positions in the specified region, and multiplying the result
by 100 to yield
the percentage of sequence identity. In cases where the two sequences are of
different
lengths or the alignment produces one or more staggered ends and the specified
region of
comparison includes only a single sequence, the residues of the single
sequence are included
in the denominator but not the numerator of the calculation. When comparing
DNA and
RNA, thymine (T) and uracil (U) may be considered equivalent. Identity may be
performed
manually or by using a coniputer sequence algorithm such as BLAST or BLAST
2Ø
in situ detection
"In situ detection" as used herein means the detection of expression or
expression levels
in the original site hereby meaning in a tissue sample such as biopsy.
label
"Label" as used herein means a composition detectable by spectroscopic,
photochemical,
biochemical, immunochemical, chemical, or other physical means. For example,
useful
labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g.,
as commonly
used in an ELISA), biotin, digoxigenin, or haptens and other entities which
can be made
detectable. A label may be incorporated into nucleic acids and proteins at any
position.
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
nucleic acid
"Nucleic acid" or "oligonucleotide" or "polynucleotide" as used herein mean at
least two
nucleotides covalently linked together. The depiction of a single strand also
defines the
sequence of the complementary strand. Thus, a nucleic acid also encompasses
the
complementary strand of a depicted single strand. Many variants of a nucleic
acid may be
used for the same purpose as a given nucleic acid. Thus, a nucleic acid also
encompasses
substantially identical nucleic acids and complements thereof. A single strand
provides a
probe that may hybridize to a target sequence under stringent hybridization
conditions.
Thus, a nucleic acid also encompasses a probe that hybridizes under stringent
hybridization
conditions.
Nucleic acids may be single stranded or double stranded, or may contain
portions of both
double stranded and single stranded sequence. The nucleic acid may be DNA,
both
genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain
combinations of
deoxyribo- and ribo-nucleotides, and combinations of bases including uracil,
adenine,
thymine, cytosine, guanine, inosine, xantliine hypoxanthine, isocytosine and-
isoguanine.
Nucleic acids may be obtained by chemical synthesis methods or by recoinbinant
methods.
A nucleic acid will generally contain phosphodiester bonds, although nucleic
acid analogs
may be included that may have at least one different linkage, e.g.,
phosphoramidate,
phosphorothioate, phosphorodithioate, or O-methylphosphoroamidite linkages and
peptide
nucleic acid backbones and linkages. Other analog nucleic acids include those
with positive
backbones; non-ionic backbones, and non-ribose backbones, including those
described in
U.S. Pat. Nos. 5,235,033 and 5,034,506, which are incorporated by reference.
Nucleic acids
containing one or more non-naturally occurring or modified nucleotides are
also included
within one definition of nucleic acids. The modified nucleotide analog may be
located for
example at the 5'-end and/or the 3'-end of the nucleic acid molecule.
Representative
examples of nucle6tide analogs may be selected from sugar- or backbone-
modified
ribonucleotides. It should be noted, however, that also nucleobase-modified
ribonucleotides,
i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead
of a naturally
occurring nucleobase such as uridines or cytidines modified at the 5-position,
e.g. 5-(2-
amino) propyl uridine, 5-bromo uridine; adenosines and guanosines modified at
the 8-
position, e.g. 8-bromo guanosine; deaza nucleotides, e.g. 7-deaza-adenosine; 0-
and N-
alkylated nucleotides, e.g. N6-methyl adenosine are suitable. The 2'-OH-group
may be
replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NER, NR2 or CN,
wherein
R is C1-C6 allryl, alkenyl or alkynyl and halo is F, Cl, Br or I. Modified
nucleotides also
11
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
include nucleotides conjugated with cholesterol through, e.g., a
hydroxyprolinol linkage as
described in Krutzfeldt et al., Nature 438:685-689 (2005) and Soutschek et
al., Nature
432:173-178 (2004), which are incorporated herein by reference. Modifications
of the
ribose-phosphate backbone may be done for a variety of reasons, e.g., to
increase the
stability and half-life of such molecules in physiological environments, to
enhance diffusion
across cell membranes, or as probes on a biochip. The backbone modification
may also
enhance resistance to degradation, such as in the harsh endocytic environment
of cells. The
backbone modification may also reduce nucleic acid clearance by hepatocytes,
such as in
the liver. Mixtures of naturally occurring nucleic acids and analogs may be
made;
alternatively, mixtures of different nucleic acid analogs, and mixtures of
naturally occurring
nucleic acids and analogs may be made.
probe
"Probe" as used herein means an oligonucleotide capable of binding to a target
nucleic
acid of complementary sequence tlirough one or more types of chemical bonds,
usually
through complementary base pairing, usually through hydrogen bond formation.
Probes
may bind target sequences lacking complete complementarity with the probe
sequence
depending upon the stringency of the hybridization conditions. There may be
any inumber
of base pair mismatches which will interfere with hybridization between the
target sequence
and the single stranded nucleic acids described herein. However, if the number
of mutations
is so great that no hybridization can occur under even the least stringent of
hybridization
conditions, the sequence is not a complementary target sequence. A probe may
be single
stranded or partially single and partially double stranded. The strandedness
of the probe is
dictated by the structure, composition, and properties of the target sequence.
Probes may be
directly labeled or indirectly labeled such as with biotin to which a
streptavidin complex
may later bind.
promoter
"Promoter" as used herein means a syntlletic or naturally-derived molecule
which is
capable of conferring, activating or enhancing expression of a nucleic acid in
a cell. A
promoter may comprise one or more specific transcriptional regulatory
sequences to further
enhance expression and/or to alter the spatial expression and/or temporal
expression of
same. A promoter may. also comprise distal enhancer or repressor elements,
which can be
located as much as several thousand base pairs from the start site of
transcription. A
promoter may be derived from sources including viral, bacterial, fungal,
plants, insects, and
animals. A promoter may regulate the expression of a gene component
constitutively, or
12
CA 02677043 2009-07-30
WO 2008/104985 PCT/1L2008/000261
differentially with respect to cell, the tissue or organ in which expression
occurs or, with
respect to the developmental stage at which expression occurs, or in response
to external
stimuli such as physiological stresses, pathogens, metal ions, or inducing
agents.
Representative examples of promoters include the bacteriophage T7 promoter,
bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter,
SV40 late
promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early
promoter or SV401ate promoter and the CMV IE promoter.
selectable marker
"Selectable marker" as used herein means any gene which confers a phenotype on
a host
cell in which it is expressed to facilitate the identification and/or
selection of cells which are
transfected or transformed with a genetic construct. Representative examples
of selectable
markers include the ampicillin-resistance gene (Ampr), tetracycline-resistance
gene (Tc%
bacterial kanamycin-resistance gene (Kanr), zeocin resistance gene, the AURI-C
gene which
confers resistance to the antibiotic aureobasidin A, phosphinotliricin-
resistance gene,
neomycin phosphotransferase gene (nptll), hygromycin-resistance gene, beta-
glucuronidase
(GUS) gene, chloramphenicol acetyltransferase (CAT) gene, green fluorescent
protein
(GFP)-encoding gene and luciferase gene.
stringent hybridization conditions
"Stringent hybridization conditions" as used herein mean conditions under
which a first
nucleic acid sequence (e.g., probe) will hybridize to a second nucleic acid
sequence (e.g.,
target), such as in a complex mixture of nucleic acids. Stringent conditions
are sequence-
dependent and will be different in different circumstances. Stringent
conditions may be
selected to be about 5-10 C lower than the thermal melting point (Tm) for the
specific
sequence at a defined ionic strength pH. The Tm may be the temperature (under
defined
ionic strength, pH, and nucleic acid concentration) at which 50% of ' the
probes
complementary to the target hybridize to the target sequence at equilibrium
(as the target
sequences are present in excess, at Tm, 50% of the probes are occupied at
equilibrium).
Stringent conditions may be those in wliich the salt concentration is less
than about 1.0 M
sodium ion, *such as about 0.01-1.0 M sodium ion concentration (or other
salts) at pH 7.0 to
8.3 and the temperature is at least about 30 C for short probes (e.g., about
10-50.
nucleotides) and at least about 60 C for long probes (e.g., greater than about
50
nucleotides). Stringent conditions may also be achieved with the addition of
destabilizing
agents such as formamide. For selective or specific hybridizatiori, a positive
signal may be
at least 2 to 10 times background hybridization. Exemplary stringent
hybridization
13
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
conditions include the following: 50% formamide, 5x SSC, and 1% SDS,
incubating at
42 C, or, 5x SSC, 1% SDS, incubating at 65 C, with wash in 0.2x SSC, and 0.1%
SDS at
65 C.
substantially complementary
"Substantially complementary" as used herein means that a first sequence is at
least 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the complement
of a
second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23,
24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more
nucleotides, or that
the two sequences hybridize under stringent hybridization conditions.
substantially identical
"Substantially identical" as used herein means that a first and a second
sequence are at
least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical over a
region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides or amino
acids, or with
respect to nucleic acids, if the first sequence is substantially complementary
to the
complement of the second sequence.
subject
As used herein, the term "subject" refers to a mammal, including both human
and other
mammals. The methods of the present invention are preferably applied to human
subjects.
target nucleic acid
"Target nucleic acid" as used herein means a nucleic acid or variant thereof
that may be
bound by another nucleic acid. A target nucleic acid may be a DNA sequence.
The target
nucleic acid may be RNA. The target nucleic acid may comprise a mRNA, tRNA,
shRNA,
siRNA or Piwi-interacting RNA, or a pri-miRNA, pre-miRNA, miRNA, or anti-
miRNA.
The target nucleic, acid may comprise a target miRNA binding site or a variant
thereof.
One or more probes may bind the target nucleic acid. The target binding site
may comprise
5-100 or 10-60 nucleotides. The target binding site may comprise a total of 5,
6, 7, 8, 9, 10,
11, 12, 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30-
40, 40-50, 50-60,
61, 62 or 63 nucleotides. The target site sequence may comprise at least 5
nucleotides of the
sequence of a target miRNA binding site disclosed in U.S. Patent Application
Nos.
11/384,049, 11/418,870 or 11/429,720, the contents of wliich are incorporated
herein.
tissue sample
As used herein, a tissue sample is tissue obtained from a tissue biopsy using
methods well
known to those of ordinary skill in the related medical arts. The phrase
"suspected of being
14
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
cancerous" as used herein means a cancer tissue sample believed by one of
ordinary skill in
the medical -arts to contain cancerous cells. Methods for obtaining the sample
from the
biopsy include gross apportioning of a mass, microdissection, laser-based
microdissection,
or other art-known cell-separation methods.
variant
"Variant" as used herein referring to a nucleic acid means (i) a portion of a
referenced
nucleotide sequence; (ii) the complement of a referenced nucleotide sequence
or portion
thereof; (iii) a nucleic acid that is substantially identical to a referenced
nucleic acid or the
complement thereof; or (iv) a nucleic acid that hybridizes under stringent
conditions to the
referenced nucleic acid, complement thereof, or a sequence substantially
identical thereto.
vector
"Vector" as used herein means a nucleic acid sequence containing an origin of
replication.
A vector may be a plasmid, bacteriophage, bacterial artificial chromosome or
yeast artificial
chromosome. A vector may be a DNA or RNA vector. A vector may be either a self-
replicating extrachromosomal vector or a vector which integrates into a host
genome.
wild type
As used herein, the term "wild type" sequence refers to a coding, a non-coding
or an
interface sequence which is an allelic form of sequence that performs the
natural or normal
function for that sequence. Wild type sequences include multiple allelic forms
of a cognate
sequence, for example, multiple alleles of a wild type sequence may encode
silent or
conservative changes to the protein sequence that a coding sequence encodes.
The present invention employs miRNA for the'identification, classification and
diagnosis
of specific lung cancers,
MicroRNA processing
A gene coding for a microRNA (miRNA) may be transcribed leading to production
of an
miRNA precursor known as the pri-miRNA. The pri-miRNA may be part of a
polycistronic
RNA comprising multiple pri-miRNAs. The pri-miRNA may form a hairpin structure
with
a stem and loop. The stem may comprise mismatched bases.
The hairpin structure of the pri-miRNA may be recognized by Drosha, which is
an RNase
III endonuclease. Drosha may recognize terminal loops in the pri-miRNA and
cleave
approximately two helical turns into the stem to produce a 60-70 nucleotide
precursor
known as the pre-miRNA. Drosha may cleave the pri-iniRNA with a staggered cut
typical
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
of RNase III endonucleases yielding a pre-miRNA stem loop with a 5' phosphate
and -2
nucleotide 3' overhang. Approximately one helical turn of the stem (-10
nucleotides)
extending beyond the Drosha cleavage site may be essential for efficient
processing. The
pre-miRNA may then be actively transported from the nucleus to the cytoplasm
by Ran-
GTP and the export receptor Ex-portin-5.
The pre-miRNA may be recognized by Dicer, which is also an RNase III
endonuclease.
Dicer may recognize the double-stranded stem of the pre-miRNA. Dicer may also
recognize the 5' phosphate and 3' overhang at the base of the stem loop. Dicer
may cleave
off the terminal loop two helical turns away from the base of the stem loop
leaving an
additional 5' phosphate and -2 nucleotide 3' overhang. The resulting siRNA-
like duplex,
which may comprise mismatches, comprises the mature miRNA and a similar-sized
fragment known as the miRNA*. The miRNA and miRNA* may be derived from
opposing
arms of the pri-miRNA and pre-miRNA. MiRNA* sequences may be found in
libraries of
cloned miRNAs but typically at lower frequency than the miRNAs.
Although initially present as a double-stranded species with miRNA*, the miRNA
may
eventually become incorporated as a single-stranded RNA into a
ribonucleoprotein complex
known as the RNA-induced silencing complex (RISC). Various proteins can form
the
RISC, which can lead to variability in specificity for miRNA/miRNA* duplexes,
binding
site of the target gene, activity of miRNA (repression or activation), and
which strand of the
miRNA/miRNA* duplex is loaded in to the RISC.
When the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the
miRNA* may be removed and degraded. The strand of the miRNA:miRNA* duplex that
is
loaded into the RISC may be the strand whose 5' end is less tightly paired. In
cases where
both ends of the miRNA:miRNA* have roughly.equivalent 5' pairing, both miRNA
and
miRNA* may have gene silencing activity.
The RISC may identify target nucleic acids based on high levels of
complementarity
between the miRNA and the mRNA, especially by nucleotides 2-7 of the miRNA.
Only one
case has been reported in animals where the interaction between the miRNA and
its target
was along the entire lengtli of the miRNA. This was shown for mir-196 and Hox
B8 and it
was further shown that mir-196 mediates the cleavage of the Hox B8 mRNA (Yekta
et al
2004, Science 304-594). Otherwise, such interactions are known only in plants
(Bartel &
Barte12003, Plant Physiol 132-709).
A number of studies have studied the base-pairing requirement between miRNA
and its
mRNA target for achieving efficient inhibition of translation (reviewed by
Bartel 2004, Cell
16
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
116-281). In mammalian cells, the first 8 nucleotides of the miRNA may be
important
(Doench & Sharp 2004 GenesDev 2004-504). However, other parts of the microRNA
may
also participate in mRNA binding. Moreover, sufficient base pairing at the 3'
can
compensate for insufficient pairing at the 5' (Brennecke et al, 2005 PLoS 3-
e85).
Computation studies, analyzing miRNA binding on whole genomes have suggested a
specific role for bases 2-7 at the 5' of the miRNA in target binding but the
role of the first
nucleotide, found usually to be "A" was also recognized (Lewis et at 2005 Cell
120-15).
Similarly, nucleotides 1-7 or 2-8 were used to identify and validate targets
by Krek et al
(2005, Nat Genet 37-495).
The target sites in the mRNA may be in the 5' UTR, the 3' UTR or in the coding
region.
Interestingly, multiple miRNAs may regulate the same mRNA target by
recognizing the
saine or multiple sites. The presence of multiple miRNA binding sites in most
genetically
identified targets may indicate that the cooperative action of multiple RISCs
provides the
most efficient translational inhibition.
miRNAs may direct the RISC to downregulate gene expression by either of two
mechanisms: mRNA cleavage or translational repression. The miRNA may specify
cleavage of the mRNA if the mRNA has a certain degree of complementarity to
the
miRNA. When a miRNA guides cleavage, the cut may be between the nucleotides
pairing
to residues 10 and 11 of the miRNA. Alternatively, the miRNA may repress
translation if
the miRNA does not have the requisite degree of complementarity to the miRNA.
Translational repression may be more prevalent in animals since ailimals may
have a lower
degree of coniplementarity between the miRNA and the binding site.
It should be noted that there may be variability in the 5' and 3' ends of any
pair of
niiRNA and miRNA*. This variability may be due to variability in the enzymatic
processing of Drosha and Dicer with respect to the site of cleavage.
Variability at the 5' and
3' ends of miRNA and miRNA* may also be due to mismatches in the stem
structures of the
pri-miRNA and pre-miRNA. The mismatches of the stem strands may lead to a
population
of different hairpin structures. Variability in the stem structures may also
lead to variability
in the products of cleavage by Drosha and Dicer.
Nucleic Acids
Nucleic acids are provided herein. The nucleic acids comprise the sequence of
SEQ ID
NOS: 1-30 or variants thereof. The variant may be a complenient of the
referenced
nucleotide sequence. The variant may also be a nucleotide sequence that is
substantially
identical to the refereilced nucleotide sequence or the coniplement thereof.
The variant may
17
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
also be a nucleotide sequence which hybridizes under stringent conditions to
the referenced
nucleotide sequence, complements thereof, or nucleotide sequences
substantially identical"
thereto.
The nucleic acid may have a length of from 10 to 250 nucleotides. The nucleic
acid may
.5 have a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200 or 250
nucleotides. The
nucleic acid may be synthesized or expressed in a cell (in vitro or in vivo)
using a synthetic
gene described herein. The nucleic acid may be synthesized as a single strand
molecule and
hybridized to a substantially complementary nucleic acid to form a duplex. The
nucleic acid
may be introduced to a cell, tissue or organ in a single- or double-stranded
form or capable
of being expressed by a synthetic gene using methods well known to those
skilled in the art,
including as described in U.S. Patent No. 6,506,559 whieh is incorporated by
reference.
Nucleic acid complexes
The nucleic acid may further comprise one or more of the following: a peptide,
a protein,
a RNA-DNA hybrid, an antibody, an antibody fragment, a Fab fragment, and an
aptamer.
Pri-miRNA
The nucleic acid may comprise a sequence of a pri-miRNA or a variant thereof.
The pri-
miRNA sequence may comprise from 45-30,000, 50-25,000, 100-20,000, 1,000-1,500
or
80-100 nucleotides. The sequence of the pri-miRNA may comprise a pre-miRNA,
miRNA
and miRNA*, as set forth herein, and variants thereof. The sequence of the pri-
miRNA may
comprise the sequence of SEQ ID NOS: 1-2, 4-5, 13-30 or variants thereof.
The pri-miRNA may form a hairpin structure. The hairpin may comprise a first
and a
second nucleic acid sequence that are substantially complimentary. The first
and second
nucleic acid sequence may be from 37-50 nucleotides. The first and second
nucleic acid
sequence may be separated by a third sequence of from 8-12 nucleotides. The
hairpin
structure may have a free energy of less than -25 Kcal/mole, as calculated by
the Vienna
algorithm, with default parameters as described in Hofacker et al.,
Monatshefte f. Cllemie
125: 167-188 (1994), the contents of which are incorporated herein. The
hairpin may
conlprise a terminal loop of 4-20, 8-12 or 10 nucleotides. The pri-miRNA may
comprise at
least 19% adenosine nucleotides, at least 16% cytosine nucleotides, at least
23% thymine
nucleotides and at least 19% guanine nucleotides.
Pre-miRNA
The nucleic acid may also comprise a sequence of a pre-miRNA or a variant
thereof. The
pre-miRNA sequence may comprise from 45-90, 60-80 or 60-70 nucleotides. The
sequence
18
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
of the pre-miRNA may comprise a miRNA and a miRNA* as set forth herein. The
sequence
of the pre-miRNA may also be that of a pri-miRNA excluding from 0-160
nucleotides from
the 5' and 3' ends of the pri-miRNA. The sequence of the pre-miRNA may
comprise the
sequence of SEQ ID NOS: 1- 2, 4-5, 13-30 or variants thereof.
miRNA
The nucleic acid may also comprise a sequence of a miRNA (including miRNA*) or
a
variant thereof. The miRNA sequence may comprise from 13-33, 18-24 or 21-23
nucleotides. The miRNA may also comprise a total of at least 5, 6, 7, 8, 9,
10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37,
38, 39 or 40 nucleotides. The sequence of the miRNA may be the first 13-33
nucleotides of
the pre-miRNA. The sequence of the miRNA may also be the last 13-33
nucleotides of the
pre-n1iRNA. The sequence of the miRNA may comprise the sequence of SEQ ID NOS:
1-
2, 13-21 or variants thereof.
Anti-miRNA
The nucleic acid may also comprise a sequence of an anti-miRNA capable of
blocking the
activity of a miRNA or miRNA*, such as by binding to the pri-miRNA, pre-miRNA,
miRNA or miRNA* (e.g. antisense or RNA silencing), or by binding to the target
binding
site. The anti-miRNA may comprise a total of 5-100 or 10-60 nucleotides. The
anti-
miRNA may also comprise a total of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39 or 40
nucleotides. The sequence of the anti-miRNA may comprise (a) at least 5
nucleotides that
are substantially identical or complimentary to the 5' of a miRNA and at least
5-12
nucleotides that are substantially complimentary to the flanking regions of
the target site
from the 5' end of the miRNA, or (b) at least 5-12 nucleotides that are
substantially identical
or complimentary to the 3' of a miRNA and at least 5 nucleotide that are
substantially
complimentary to the flanking region of the target site from the 3' end of the
miRNA. The
sequence of the anti-miRNA may comprise the compliment of SEQ ID NOS: 1-2., 4-
5, 13-
or variants thereof.
Binding Site of Target
30 The nucleic acid may also comprise a sequence of a target microRNA binding
site or a
variant thereof. The target site sequence may comprise a total of 5-100 or 10-
60
nucleotides. The target site sequence may also comprise a total of at least 5,
6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56, 57, 58,
19
CA 02677043 2009-07-30
WO 2008/104985 PCT/1L2008/000261
59, 60, 61, 62 or 63 nucleotides. The target site sequence may comprise at
least 5
nucleotides of the sequence of SEQ ID NOS: 1-2, 4-5 or 13-30.
Synthetic Gene
A synthetic gene is also provided comprising a nucleic acid described herein
operably
linked to a transcriptional and/or translational regulatory sequence. The
synthetic gene may
be capable of modifying the expression of a target gene with a binding site
for a nucleic acid
described herein. Expression of the target gene may be modified in a cell,
tissue or organ.
The synthetic gene may be synthesized or derived from naturally-occurring
genes by
standard recoinbinant teclmiques. The synthetic gene may also comprise
terminators at the
3'-end of the transcriptional unit of the synthetic gene sequence. The
synthetic gene may
also comprise a selectable marker.
Vector
A vector is also provided comprising a synthetic gene described herein. The
vector may
be an expression vector. An expression vector may comprise additional
elements. For
example, the expression vector may have two replication systems allowing it to
be
maintained in two organisms, e.g., in one host cell for expression and in a
second host cell
(e.g., bacteria) for cloning and ainplification. For integrating expression
vectors, the
expression vector may contain at least one sequence homologous to the host
cell genome,
and preferably two homologous sequences which flank the expression construct.
The
integrating vector may be directed to a specific locus in the host cell by
selecting the
appropriate homologous sequence for inclusion in the vector. The vector may
also comprise
a selectable marker gene to allow the selection of transformed host cells.
Host Cell
A host cell is also provided comprising a vector, synthetic gene or nucleic
acid described
herein. The cell may be a bacterial, fungal, plant, insect or animal cell. For
example, the
host cell line may be DG44 and DUXB 11 (Chinese Hamster Ovary lines, DHFR
minus),
HELA (human cervical carcinoma), CVI (monkey kidney line), COS (a derivative
of CVI
with SV40 T antigen), R1610 (Chinese hamster fibroblast) BALBC/3T3 (mouse
fibroblast),
HAK (hamster kidney line), SP2/O (mouse myeloma), P3x63-Ag3.653 (mouse
myeloma),
BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocyte) and 293 (liuman
kidney). Host cell lines may be available from commercial services, the
American Tissue
Culture Collection or from published literature.
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
Probes
A probe is provided herein. A probe may comprise a nucleic acid. The probe may
have a
length of from 8 to 500, 10 to 100 or 20 to 60 nucleotides. The probe may also
have a length
of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29,
30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240,
260, 280 or 300
nucleotides. The probe may comprise a nucleic acid of 18-25 nucleotides.
A probe may be capable of binding to a target nucleic acid of complementary
sequence
through one or more types of chemical bonds, usually through complementary
base pairing,
usually through hydrogen bond formation. Probes may bind target sequences
lacking
complete complementarity with the probe sequence depending upon the stringency
of the
hybridization conditions. A probe may be single stranded or partially single
and partially
double stranded. The strandedness of the probe is dictated by the structure,
composition, and
properties of the target sequence. Probes may be directly labeled or
indirectly labeled.
Test Probe
The probe may be a test probe. The test probe may comprise a nucleic acid
sequence that
is complementary to a miRNA, a miRNA*, a pre-miRNA, or a pri-miRNA. The
sequence of
the test probe may be selected from SEQ ID NOS: 10-12.
Linker Sequences
The probe may further comprise a linker. The linker may be 10-60 nucleotides
in length.
The linker may be 20-27 nucleotides in length. The linker may be of sufficient
length to
allow the probe to be a total length of 45-60 nucleotides. The linker may not
be capable of
forming a stable secondary structure, or may not be capable of folding on
itself, or may not
be capable of folding on a non-linker portion of a nucleic acid contained in
the probe. The
sequence of the linker may not appear in the genome of the animal from which
the probe
non-linker nucleic acid is derived.
Reverse Transcription
Target sequences of a cDNA may be generated by reverse transcription of the
target RNA.
Methods for generating cDNA may be reverse transcribing polyadenylated RNA. or
alternatively, RNA with a ligated adaptor sequence.
Reverse Transcription using Adaptor Sequence Ligated to RNA
The RNA may be ligated to an adapter sequence prior to reverse transcription.
A ligation
reaction may be performed by T4 RNA ligase to ligate an adaptor sequence at
the 3' end of
the RNA. Reverse transcription (RT) reaction may then be performed using a
primer
comprising a sequence that is complementary to the 3' end of the adaptor
sequence.
21
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
Reverse Transcription using Polyadenylated Sequence Ligated to RNA
Polyadenylated RNA may be used in a reverse transcription (RT) reaction using
a poly(T)
primer comprising a 5' adaptor sequeiice. The poly(T) sequence may comprise 8,
9, 10, 11,
12, 13, or 14 consecutive thymines. The reverse transcription primer may
comprise SEQ ID
NO:6.
RT-PCR of RNA
The 'reverse transcript of the RNA may be amplified by real time PCR, using a
specific
forward primer comprising at least 15 nucleic acids complementary to the
target nucleic
acid and a 5' tail sequence; a reverse primer that is complementary to the 3'
end of the
adaptor sequence; and a probe comprising at least 8 nucleic acids
complementary to the
target nucleic acid. The probe may be partially complementary to the 5' end of
the adaptor
sequence.
PCR of Target Nucleic Acids
Methods of amplifying target nucleic acids are described herein. The
amplification may be
by a method comprising PCR. The first cycles of the PCR reaction may have an
annealing
temp of 56 C, 57 C, 58 C, 59 C, or 60 C. The first cycles may comprise 1-10
cycles. The
remaining cycles of the PCR reaction may be 60 C. The remaining cycles may
comprise 2-
40 cycles. The amlealing temperature may cause the PCR to be more sensitive.
The PCR
may generate longer products that can serve as higher stringency PCR
templates.
Forward Primer
The PCR reaction may comprise a forward primer. The forward primer may
comprise 15,
16, 17, 18, 19, 20, or 21 nucleotides identical to the target nucleic acid.
The 3' end of the forward primer may be sensitive to differences in sequence
between a
target nucleic acid and a sibling nucleic acid.
The forward primer may also comprise a 5' overhanging tail. The 5' tail may
increase the
melting temperature of the forward primer. The sequence of the 5' tail may
comprise a
sequence that is non-identical to the genome of the animal from which the
target nucleic
acid is isolated. The sequence of the 5' tail may also be synthetic. The 5'
tail may coinprise
8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides. The forward primer may
comprise SEQ ID
NOS: 7-9.
Reverse Primer
The PCR reaction may comprise a reverse primer. The reverse primer may be
complementary to a target nucleic acid. The reverse primer may also comprise a
sequence
22
CA 02677043 2009-07-30
WO 2008/104985 PCT/1L2008/000261
complementary to an adaptor sequence. The sequence complementary to an adaptor
sequence may comprise 12-24 nucleotides.
Biochip
A biochip is also provided. The biochip may comprise a solid substrate
comprising an
attached probe or plurality of probes described herein. The probes may be
capable of
hybridizing to a target sequence under stringent hybridization conditions. The
probes may
be attached at spatially defined locations on the substrate. More than one
probe per target
sequence may be used, with either overlapping probes or probes to different
sections of a
particular target sequence. The probes may be capable of -hybridizing to
target sequences
associated with a single disorder appreciated by those in the art. The probes
may either be
synthesized first, with subsequent attachment to the biochip, or may be
directly synthesized
on the biochip.
The solid substrate may be a material that may be modified to contain discrete
individual
sites appropriate for the attachment or association of the probes and is
amenable to at least
one detection method. Representative examples of substrate materials include
glass and
modified or functionalized glass, plastics (including acrylics, polystyrene
and copolymers of
styrene and other materials, polypropylene, polyethylene, polybutylene;
polyurethanes,
TeflonJ, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or
silica-based
materials including silicon and modified silicon, carbon, metals, inorganic
glasses and
plastics. The substrates may allow optical detection without appreciably
fluorescing.
The substrate may be planar, although other configurations of substrates may
be used as
well. For example, probes may be placed on the inside surface of a tube, for
flow-through
sample analysis to minimize sample volume. Similarly, the substrate may be
flexible, such
as flexible foam, including closed cell foams made of particular plastics.
The substrate of the biochip and the probe may be derivatized with chemical
functional
groups for subsequent attachment of the two. For example, the biochip may be
derivatized
with a chemical functional group including, but not limited to, amino groups,
carboxyl
groups, oxo groups or thiol groups. Using these functional groups, the probes
may be
attached using functional groups on the probes either directly or indirectly
using a linker.
The probes may be attached to the solid support by either the 5' terminus, 3'
terminus, or
via an internal nucleotide.
The probe may also be attached to the solid support non-covalently. For
example,
biotinylated oligonucleotides can be made, which may bind to surfaces
covalently coated
23
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
with streptavidin, resulting in attachment. Alternatively, probes may be
synthesized on the
surface using techniques such as photopolymerization and photolithography.
Diagnostics
A method of diagnosis is also provided. The method comprises detecting a
differential
expression level of lung cancer-associated nucleic acids in a biological
sample. The sample
may be derived from a patient. Diagnosis of a cancer state, and its
histological type, in a
patient may allow for prognosis and selection of therapeutic strategy.
Further, the
developmental stage of cells may be classified by determining temporarily
expressed
cancer-associated nucleic acids.
In situ hybridization of labeled probes to tissue arrays may be performed.
When
comparing the fingerprints between an individual and a standard, the skilled
artisan can
make a diagnosis, a prognosis, or a prediction based on the fmdings. It is
further understood
that the genes which indicate the diagnosis may differ from those which
indicate the
prognosis and molecular profiling of the condition of the cells may lead to
distinctions
between responsive or refractory conditions or may be predictive of outcomes.
Kits
A kit is also provided and may comprise a nucleic acid described herein
together with any
or all of the following: assay reagents, buffers, probes and/or primers, and
sterile saline or
another pharmaceutically acceptable emulsion and suspension base. In addition,
the kits
may include instructional materials containing directions (e.g., protocols)
for the practice of
the methods described herein.
For example, the kit may be used for the amplification, detection,
identification or
quantification of a target nucleic acid sequence. The kit may comprise a
poly(T) primer, a
forward primer, a reverse primer, and a probe.
Any of the compositions described herein may be comprised in a kit. In a non-
limiting
example, reagents for isolating miRNA, labeling miRNA, and/or evaluating a
miRNA
population using an array are included in a kit. The kit may further include
reagents for
creating or synthesizing miRNA probes. The kits will thus comprise, in
suitable container
means, an enzyme for labeling the miRNA by incorporating labeled nucleotide or
unlabeled
nucleotides that are subsequently labeled. It may also include one or more
buffers, such as
reaction buffer, labeling buffer, washing buffer, or a hybridization buffer,
compounds for
preparing the miRNA probes, components for in situ hybridization and
components for
isolating miRNA. Other kits of the invention may include components for making
a nucleic
acid array comprising miRNA, and thus, may include, for example, a solid
support.
24
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
The following examples are presented in order to more fully illustrate some
embodiments
of the invention. They should, in no way be construed, however, as limiting
the broad scope
of the invention.
EXAMPLES
Example 1
Experimental Procedures
1. miRdicatorTM array platform
Custom microarrays were produced by printing DNA oligonucleotide probes to 688
miRs
(miRNA) [Sanger database, version 9.1 (miRBase: microRNA sequences, targets
and gene
nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright
AJ. NAR,
2006, 34, Database Issue, D140-D144) and additional Rosetta genomics validated
and
predicted miRs]. Each probe carries up to 22-nucleotide (nt) linker at the 3'
end of the
miRNA's coinplement sequence in addition to an amine group used to couple the
probes to
coated glass slides. 20 M of each probe were dissolved in 2X SSC + 0.0035% SDS
and
spotted in triplicate on Schott NexterionOO Slide E coated microarray slides
using a
Genomic Solutions BioRobotics MicroGrid II according the MicroGrid
manufacturer's
directions. 64 negative control probes were designed using the sense sequences
of different
miRNAs. Two groups of positive control probes were designed to hybridize to
miRdicatorTM array (1) synthetic spikes small RNA were added to the RNA before
labeling
to verify the labeling efficiency and (2) probes for abundant small RNA [e.g.
small nuclear
RNAs (U43, U49, U24, Z30, U6, U48, U44), 5.8s and 5s ribosomal RNA] were
spotted on
the array to verify RNA quality. The slides were blocked in a solution
containing 50 mM
etlianolamine, 1M Tris (pH 9.0) and 0.1%SDS for 20 min at 50 C, then
thoroughly rinsed
with water and spun dry.
2. Cy-dye labeling of microRNA for miRdicatorTM array
15 gg of total RNA was labeled by ligation of a RNA-linker p-rCrU-Cy- dye
(Thomson et
al., 2004, Nat Methods 1, 47-53) (Dharmacon) to the 3' -end with Cy3 or Cy5.
The labeling
reaction contained total RNA, spikes (20-0.1 finoles), 500ng RNA-linker-dye,
15% DMSO,
lx ligase buffer and 20 units of T4 RNA ligase (NEB) and proceeded at 4 C. for
lhr
followed by lhr at 37 C. The labeled RNA was mixed with 3x hybridization
buffer
(Ambion), heated to 95 C for 3 min and then added on top of the miRdicatorTM
array. Slides
were hybridize 12-16hr, followed by two washes with 1xSSC and 0.2% SDS and a
final
wash with 0.1xSSC.
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
The array was scanned using an Agilent Microarray Scanner Bundle G2565BA
(resolution
of 10 m at 100% power). The data was analyzed using SpotReader software.
3. RNA extraction
RNA was extracted from frozen or formalin fixed paraffin-embedded (FFPE)
tissues
originating from lung adenocarcinoma, lung squamous cell carcinoma and lung
large cell
carcinoma.
Total RNA from frozen tissues was extracted with the miRvana miRNA isolation
kit
(Ainbion) according to the manufacturer's instructions.
Total RNA from formalin fixed, paraffin-embedded (FFPE) tissues was extracted
according to the following protocol:
1' ml Xylene (Biolab) was added to 1-2 mg tissue, incubated at 570 C for 5 min
and
centrifuged for 2 min at 10,000g. The supernatant was removed and 1 ml Ethanol
(100%)
(Biolab) was added. Following centrifugation for 10 min at 10,000g, the
supematant was
discarded and the washing procedure was repeated. Following air drying for 10-
15 min,
500 l Buffer B(NaCI 10mM, Tris pH 7.6, 500 mM, EDTA 201nM, SDS 1%) and 5 1
proteinase K(50mg/ml) (Sigma) were added. Following incubation at 450 C for 16
h,
inactivation of the proteinase K at 100 C for 7 min was preformed. Following
extraction
with acid phenol chloroform (1:1) (Sigma) and centrifugation for 10 min at
maximum speed
at 40 C, the upper phase was transferred to a new tube with the addition of 3
volumes of
100% Ethanol, 0.1volume of NaOAc (BioLab) and 8 1 glycogen (Ambion) and left
over
night at -20 C.
Following centrifugation at maximum speed for 40min at 4 C, washing with lml
Ethanol
(85%), aind drying, the RNA was re-suspended in 45 1 DDW.
The RNA concentration was tested and DNase Turbo (Ambion) was added
accordingly
(1 l DNase/10 g RNA). Following Incubation for 30 min at room temperature
and
extraction with acid phenol chloroform, the RNA was re-suspended in 45 1 DDW.
The
RNA concentration was tested again and DNase Turbo (Ambion) was added
accordingly
(1 l DNase/10 g RNA). Following incubation for 30 min at room temperature
and
extraction with acid phenol chloroform, the RNA was re-suspended in 20 1,DDW.
4. RNA polyadenylation and annealing of Poly(T) adapter
A mixture was prepared according to the following:
Component Vol/sample PNK buffer (NEB) 1 l
25mM MnC1Z (Sigma) 1 gl
26
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
10mM ATP (Promega) 2 1
Poly A polymerase (Takara) 1 l
Total Vol 5 1
l of the mixture were added to 5 l of appropriate RNA sample (1 g) (or to
the ultra pure
water of the No RNA control). The reaction was incubated for 1 hour at 37 C.
Poly(T) adapter (GCGAGCACAGAATTAATACGACTCACTATCGGTTTTTTTTTTTTVN -SEQ ID
5 NO: 6) inixture was prepared according to the following:
Component Vol/sample
0. 5 g/ l Poly(T) adapter 1 l
(IDT)
Ultra pure water 2 1
Total Vol 3 l
3 l from the Poly(T) adapter mixture and 5 1 from the poly-adenylated RNA or
negative
control were transferred to PCR tubes. Annealing process was performed by the
following
annealing program:
STEP 1: 85 C for 2 min
STEP 2: 70 C to 25 C - decrease of 1 C in each cycle for 20 sec.
5. Reverse Transcription
Reverse Transcription mixture was prepared according to the following:
Component Vol/sample
5x RT buffer 4 14
(Invitrogen)
Trehalose D 1.7M 3 l
(Calbiochem,
Sigma)
10rnM dNTPs mix 1 l
(Promega)
DTT (0.1 M) 2
(Invitrogen)
Total Vol IO I
1.5 l Recombinant Rnasin (Promega) and 1 l superscript II RT (Invitrogen)
were added to
the above inixture. 12.5 l of the mix were added to each PCR tabe containing
the aimealed
25 PolyA RNA and to the No RNA control.
The tubes were inserted into a PCR instrument (MJ Research Inc.) and the
following
prograin was performed:
STEP 1: 37 C for 5 min
STEP 2: 45 C for 5 min
27
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
STEP 3: Repeat steps 1-2, 5 times
STEP 4: End the program at 4 C
The eDNA microtubes were stored at - 20 C.
6. Real time PCR using MGB probe
Each cDNA sample was evaluated in triplicate for the following three RNAs: hsa-
miR-21
(SEQ ID NO: 2), hsa-miR-205 (SEQ ID NO: 1) and U6 (SEQ ID NO: 3).
A primer-probe mix was prepared. In each tube 10 M Fwd primer with the same
volume of
5 M of the corresponding MGB probe (ABI) specific for the same RNA were
mixed.. The
sequences of the Fwd primers and MGB probes are indicated in Table 1.
Table 1: Sequences of primers and probes
SEQ SEQ
Fwd (Forward miR specific)
Name ID TaqMan MGB probe ID
primer
NO NO
miR - CAGTCATTTGGGTCCTTCAT CGTTTTTTTTTTTTCAG
205 TCCACCGG 7 ACTCC
miR - CAGTCATTTGGGTAGCTTAT 8 CCGTTTTTTTTTTTTCA 11
21 CAGACTGA ACATCA
GCAAGGATGACACGCAAAT 9 AATATGGAACGCTTCA 12
U6 TC CG
The cDNA was diluted to a final concentration of 0.5ng1 1. PCR mixture was
prepared
according to the following: .
Component Vol per well
2 X TaqMan Universal PCR 10 1
(ABI)
RT-rev-primer-Race 10 M 1 l
(IDT)
Ultra pure water 6 1
Total Vol 17 1
681i1 (for No RNA control and for No cDNA control) or 170 l of the PCR mix
were
dispensed into the appropriately labeled microtubes.l0 l eDNA (0.5ng/ l) were
added into
the appropriately labeled microtubes containing the mix. The PCR plates were
prepared by
dispensing 18 1 from the mix into each well. 2 1 of primer probe mixture were
added into
each well using a PCR-multi-channel. The plates were loaded in a Real Time-
PCR
instruinent (Applied Biosystems) and the following program was performed:
28
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
Sta eg 1, Reps=1
STEP 1: Hold @ 95.0 for 10 min (MM:SS), Ramp Rate = 100
Sta e~ 2, Reps=40
STEP 1: Hold @ 95.0 for 0:15 (MM:SS), Ramp Rate = 100
STEP 2: Hold @ 60.0 for 1:00 (MM:SS), Ramp Rate = 100
Standard 7500 Mode
Sample Volume ( L): 20.0
Data Collection: Stage 2, Step 2
7. miRdicatorTM array data normalization
The initial data set consisted of signals measured for multiple probes for
every sample.
For the analysis, signals were used only for probes that were designed to
measure the
expression levels of known or validated human microRNAs.
Triplicate spots were combined into one signal by taking the logarithmic mean
of the
reliable spots. All data was log-transformed and the analysis was performed in
log-space. A
reference data vector for norinalization, R, was calculated by taking the mean
expression
level for each probe in two representative samples, one from each tumor type,
for example:
lung squamous cell carcinoma and lung adenocarcinoma.
For each sample k with data vector Sk, a 2nd degree polynomial Fk was found so
as to
provide the best fit between the sample data and the reference data, such that
R4~(S).
Remote data points ("outliers") were not used for fitting the polynomials F.
For each probe
in the sample (element S,.k in the vector Sk), the normalized value (in log-
space) Mk is
calculated from the initial value Sk by transforming it with the polynomial f-
unction Fk, so
that Mlk FI`( S'` ). Data is translated back to linear-space by taking the
exponent.
8. Statistical analysis
The purpose of this statistical analysis was to find probes whose normalized
signal levels
differ signiEcantly between the two compared sample sets. Probes that had
normalized
signal levels below log2(300) in the two sample sets were not analyzed. For
each probe, two
groups of normalized signals obtained for two sample sets were compared. The p-
value was
calculated for each probe, using the statistical un-paired two-sided t-test
method. The p-
value is the probability for obtaining, by chance, the measured signals or a
more extreme
difference between the groups, had the two groups of signals come from
distributions with
equal mean values. microRNAs whose probes had the lowest and most significant
t-test p-
values were selected. A p-value lower than 0.05 means that the probability
that the two
29
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
groups come from distributions with the same mean is lower than 0.05 or 5%,
under the
assumption of normal (Gaussian) signal distributions. The two groups of
signals are likely
to result from distributions with different means, and the relevant microRNA
is likely to be
differentially expressed between the two sets of sainples.
9. In situ hybridization detection of hsa-mir-205
Standard paraffin sections of lung squaimous cell carcinoma were mounted on
Superfrost
plus histological slides (Menzel-Glazer). Before the hybridization slides with
sections were
kept at 60 C for 2 hrs.
All incubations at pre- and posthybridization steps were performed at room
temperature
unless stated otherwise. All solutions were prepared using ultrapure water
purified by. an
EASYpure II system (Barnstead) equipped with ultrafilter.
A. Prehybridization treatment
Sections were deparaffinized by three consecutive incubations in xylene (5 min
each) and
rehydrated through the following series of ethanols: 100% - 3 changes 2 min
each, 95% and
70% - 2 min each. Then slides were washed for 5 min in ultrapure water, put
into 0.01M
citrate buffer (pH 6.0) and heated in a water bath until boiling and kept at
boiling
temperature for 10 min. Then slides were left in the buffer to cool down for
lhr at room
temperature.
Slides were incubated in proteinase K solution (20 g/ml in 1mM EDTA/lOmM Tris-
HCI
pH7.5) for 10 min at 37 C and immediately fixed in freshly prepared 10%
formalin solution
in phosphate buffered saline (PBS) for 20 min. Fonnalin fixation was followed
by 5 min
incubation in 0.2% glycine in PBS and three 2 min washes in ultrapure water.
Then slides were acetylated by shaking in 1.1 % (v/v) solution of
triethanolamine to which
0.25% (v/v) of acetic anhydride was added siniultaneously with slides. After 5
min a new
portion of acetic anhydride was added and acetylation proceeded for another 5
min.
Acetylation was followed by three 2 min washings in ultrapure water and then
slides were
rapidly dehydrated through graded ethanols (70%, 95%, 100% - 2 min each) and
air-dried.
B. Hybridization
Hybridization solution was prepared by dilution of digoxigenin labeled LNA
enhanced
probe coinplementary to hsa-miR-205 (Exiqon product# 18099-01) diluted to 25
nM in
hybridization buffer and -50 gl of this solution were applied to air-dried
sections. For the
negative control parallel sections were incubated with control hybridization
solution
prepared by dilution of digoxigenin labeled scramble-iniR LNA probe (Exiqon
product#
99001-01).
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
After application of hybridization solution sections were covered with pieces
of
polyethylene film cut to the size of sections and incubated overnight at 50 C.
Composition of hybridization buffer:
Dextran sulfaw 10%
SSC x4
Deionized Formamide 50%
Denhardt`s Solution xl
Salmon sperm DNA 0.5 mg/ml
Yeast tRNA 0.25 mg/ml
C. Posthybridization washing and immunodetection
After hybridization slides were transferred into 5xSSC preheated to 50 C and
incubated
for 30 min. During this incubation covers floated off the slides. Then slides
were washed for
another 30 min in 2xSSC at 50 C.
Then slides were briefly washed in Tris buffered saline with Tween-20 (TBST -
0.15M
NaCI, 0.05M Tris-HCI pH 7.5, 0.1% Tween-20) and incubated for lhr in blocking
solution
(10% bovine serum albumin in TBST).
For the detection of bound digoxigenin sections were incubated for 2 hrs with
sheep anti-
digoxigenin antibodies Fab conjugated to alkaline phosphatase (Roche Cat
#11093274910)
diluted 1:250 in blocking solution followed by 5 washings in TBST. Then slides
were
briefly washed in alkaline phosphatase buffer (APB - 0.1M Tris-HCI pH 9.5,
0.05M NaCl,
0.025M MgC12) and incubated for 5 hrs in staining solution - APB containing
4.5 l/ml of
5-bromo-4-chloro-3-indolyl-phosphate (BCIP - stock solution by Roche -
Cat#11383221001) and 3.5 l/ml of 4-Nitro blue tetrazoliuin chloride (NBT -
stock
solution by Roche - Cat# 11383213001).
Finally, sections were washed in distilled water and coverslipped using Immu-
Mount
(Thermo Scientific Cat# 9990402).
Example 2
Specific microRNAs are able to distinguish between lung adenocarcinoma and
lung
squamous cell carcinoma
The statistical analysis of the miRdicatorTM arrays results of lung
adenocarcinoxina vs. lung
squamous cell carcinoma are presented in Table 2. The results exhibited a
significant
difference in the expression pattern of hsa-miR-205 (SEQ ID NO 1).
31
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
The nonnalized expression levels of hsa-miR-205 were found to increase in lung
squamous
cell carcinoma in comparison to lung adenocarcinoma, as measured by
miRdicatorTM array
(Figures 1-3).
The sensitivity of the squamous cell carcinoma detection by hsa-miR-205 is 100
% (9/9)
and the specificity of the signal is 84.2% (16/19).
Table 2:
Mean Number Number
miR HID MID adeno- uamous samples, of
p-value
name carcinoma sq samples,
(log) adeno-
(log) carcinoma squamous
hsa- 4 1 7.49 12.04 19 9 9.47E-07
miR-205
miR name: is the miRBase registry name (release 9.1).
HID: is the SEQ ID NO of the microRNA hairpin precursor (Pre-microRNA).
MID: is the SEQ ID NO of the mature microRNA.
Mean adeno-carcinoma (log): is the mean of the logarithins (log) of chip
signal of lung
adenocarcinoma samples.
Mean squamous (log): is the mean of the logarithms (log) of chip signal of
lung squamous
samples.
Number of samples, adeno-carcinoma: is the number of lung adenocarcinoma
samples.
Number of samples, squamous: is the number of lung squamous san.lples.
p-value: is the result of the un-paired two-sided t-test between samples
Example 3
Establishment of qRT-PCR assay for distinguishing between lung squamous cell
carcinoma and other NSCLC
RNA was extracted from 20 lung samples of paraffin-embedded (FFPE) tissues
originating -from lung squamous cell carcinoma and other Non Small Cell Lung
Carcinoma
(NSCLC) as described in Example 1 (3). The expression levels of hsa-miR-205
(SEQ ID
NO: 1), hsa-miR-21 (SEQ ID NO: 2) and U6 (SEQ ID NO: 3) were detected by
quantitative
qRT-PCR assay as described in Example 1 (4-6). The weighted Ct of 3 repeats of
the 3
probes was calculated. The Ct of negative control wells was underdetermined.
The data was interpreted according to the following criteria:
32
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
U6 should have a weighted Ct of between 20 to 32. If not the experiment
failed.
The weighted Ct of the 3 repeats was calculated according to the following:
If all repeats were within a difference of 1 Ct, meaning that the difference
between the
minimal and maximal Cts was less than 1, then their average was calculated.
Ctmax-Ctmin ~ --> weighted Ct=( Ctmax+Ctmedian+Ctmin)/3
The average of the outlier Cts were calculated, if they had a difference of 1
Ct or less from
the middle Ct value.
Ctmax-Ctmedian g& Ctmedian-Ctm9n :514 weighted Ct=( Ctmax+Ctmedian'+"Ctmin)/3
Using the weighted calculated Ct, the assay final score was determined by
subtractiiig the
average Cts of U6 and hsa-mir-21 from the Ct of hsa-mir-205.
Assay final score= weighted Ctmir_2os- average [(weighted Ctmir_21 & weighted
Ctu6)]
If the Ct of hsa-mir-205 was undetermined and the weighted Ct of U6 was within
the
legitimate range then the assay result is "Non-Squamous" with "High"
confidence level.
Ct,,,ir_2os=ND & 20 -~CtU6 Assay result= Non-Squamous with high confidence.
Otherwise: The result analysis is based on the assay final score calculation
as described in
Table 3:
Table 3:
Assay finalscore Assay result Confidence
>4 Non-Squamous High
< 1 Squamous cell carcinoma High
~.5 and < 4 Non-Squamous Low
>1 and < 2.5 Squamous cell carcinoma Low
Figure 4 demonstrates the full separation between samples originated from lung
squamous
cell carcinoma (asterisks) and samples originated from other NSCLC including
lung
adenocarcinoma and lung undifferentiated large cell carcinoma (ellipses) using
RT-PCR
expression levels of hsa-miR-205 (SEQ ID NO: 1), normalized by qRT-PCR
expression
levels of hsa-miR-21 (SEQ ID NO: 2), U6 (SEQ'ID NO: 3) and a threshold of a
final score
as described above. The full black line represents the threshold. The dashed
black lines
indicate the low confidence area border.
Example 4
In situ hybridization detection of hsa-mir-205
33
CA 02677043 2009-07-30
WO 2008/104985 PCT/IL2008/000261
Sections of lung squamous cell carcinoma were hybridized to hsa-miR-205
specific probe
and control (scramble) probe (see Exainple 1).
As shown in figure 5, staining of varying intensity of cells of squamous cell
carcinoma was
observed (Fig. 5A) while no staining was detected in sections hybridized to
control
(scramble) probe (Fig. 5B).
Example 5
Specific microRNAs are able to distinguish between lung adenocarcinoma and
lung
large cell carcinoma
The statistical analysis of the miRdicatorTM arrays results of lung
adenocarcinoma vs. lung
large cell carcinoma are presented in Table 4. The results exhibited a
significant difference
in the expression pattern of several miRs, most prominent among them being hsa-
miR-513
(SEQ ID NO: 13).
The normalized expression levels of hsa-miR-513 were found to increase in lung
large cell
carcinoma in comparison to lung adenocarcinoma, as measured by miRdicatorTM
array
(Figures 6-8).
The sensitivity of the adenocarcinoma detection by hsa-miR-513 is 94.7%
(18/19) and the
specificity of the signal is 85.7% (6/7).
Table 4:
Number Number
Mean Mean of of
adeno- large samples, samples,
carcinoma cell adeno- large
miR name HID MID (log) lo carcinoma cell p-value
hsa-miR-513 22 13 8.27 10.31 19 7 6.14E-05
hsa-miR-183 23 14 8.21 10.47 19 7 1.71E-04
hsa=miR-189 24 15 7.03 8.5 19 7 4.08E-04
hsa-miR-103 25 16 10.39 8.59 19 7 4.55E-04
hsa-miR-525* 26 17 6.5 8.45 19 7 4.72E-04
hsa-iniR-492 27 18 7.99 9.57 19 7 5.67E-04
hsa-iniR-140 28 19 8.02 9.49 19 7 9.18E-04
hsa-miR-202* 29 20 7.24 8.7 19 7 1.09E-03
hsa-miR-449 30 21 9.37 11.55 19 7 1.90E-03
miR name: is the miRBase registry name (release 9.1).
HID: is the SEQ ID NO of the microRNA hairpin precursor (Pre-microRNA).
MID: is the SEQ ID NO of the mature microRNA.
Mean adeno-carcinoma (log): is the mean of the logarithms (log) of chip signal
of Lung
adenocarcinoma cells.
34
CA 02677043 2009-07-30
WO 2008/104985 PCT/1L2008/000261
Mean large cell (log): is the mean of the logaritluns (log) of chip signal of
Lung Large
cells.
Number of samples, adeno-carcinoma cells: is the number of samples of Lung
adenocarcinoma cells.
Number of samples, large cells: is the number of samples of Lung Large cells.
p-value: is the result of unmatched t-test between samples.
The foregoing description of the specific embodiments will so fully reveal the
general
nature. of the invention that others can, by applying current knowledge,
readily modify
and/or adapt for various applications such specific embodiments without undue
experimentation and without departing from the generic concept, and,
therefore, such
adaptations and modifications should and are intended to be comprehended
within the
meaning and range of equivalents of the disclosed einbodiments. Although the
invention has
been described in conjunction with specific embodiments thereof, it is evident
that many
alternatives, modifications and variations will be apparent to those skilled
in the art.
Accordingly, it is intended to embrace all such alternatives, modifications
and variations
that fall within the spirit and broad scope of the appended claims.
It should be understood that the detailed description and specific examples,
while
indicating preferred embodiments of the invention, are given by way of
illustration only,
since various changes and modifications within the spirit and scope of the
invention will
become apparent to those skilled in the art from this detailed description.
