Note: Descriptions are shown in the official language in which they were submitted.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
1
LAGLIDADG HOMING ENDONUCLEASE VARIANTS HAVING NOVEL
SUBSTRATE SPECIFICITY AND USE THEREOF
The invention relates to a method for engineering LAGLIDADG
homing endonuclease variants having novel substrate specificity. The invention
relates
also to a variant obtainable by said method, to a vector encoding said
variant, to a cell,
an animal or a plant modified by said vector and to the use of said homing
endonuclease variant and derived products for genetic engineering, genome
therapy
and antiviral therapy.
Meganucleases are by definition sequence-specific endonucleases
with large (12-45 bp) cleavage sites that can deliver DNA double-strand breaks
(DSBs) at specific loci in living cells (Thierry, A. and Dujon B., Nucleic
Acids Res.,
1992, 20, 5625-5631). Meganucleases have been used to stimulate homologous
recombination in the vicinity of their target sequences in cultured cells and
plants
(Rouet et al., Mol. Cell. Biol., 1994, 14, 8096-8106; Choulika et aL, Mol.
Cell. Biol.,
1995, 15, 1968-1973; Donoho et al., Mol. Cell. Biol, 1998, 18, 4070-4078;
Elliott et
al., Mol. Cell. Biol., 1998, 18, 93-101; Sargent et al., Mol. Cell. Biol.,
1997, 17, 267-
277; Puchta et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 5055-5060; Chiurazzi
et al.,
Plant Cell, 1996, 8, 2057-2066), making meganuclease-induced recombination an
efficient and robust method for genome engineering.
The use of meganuclease-induced recombination has long been
limited by the repertoire of natural meganucleases, and the major limitation
of the
current technology is the requirement for the prior introduction of a
meganuclease
cleavage site in the locus of interest. Thus, the engineering of redesigned
meganucleases cleaving chosen targets is under intense investigation.
Such proteins could be used to cleave genuine chromosomal
sequences and open new perspectives for genome engineering in wide range of
applications. For example, meganucleases could be used to knoclc-out
endogenous
genes or knoclc-in exogenous sequences in the clu-omosome. It can as well be
used for
the precise in situ correction of mutations linked with monogenic diseases and
thereby
bypass the risk due to the randomly inserted transgenes encountered with
current gene
therapy approaches (Hacein-Bey-Abina et al., Science, 2003, 302, 415-419).
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
2
Recently, Zinc-Finger DNA binding domains of Cys2-His2 type
Zinc-Finger Proteins (ZFPs) were fused with the catalytic domain of the Fokl
endonuclease, to induce recombination in various cell types: mammalian
cultured
cells including human lymphoid cells, plants and insects (Smith et al.,
Nucleic Acids
Res, 1999, 27, 674-81; Pabo et al., Annu. Rev. Biochem, 2001, 70, 313-40;
Porteus,
M.H. and Baltimore, D., Science, 2003, 300, 763; Urnov et al., Nature, 2005,
435,
646-651; Bibikova et al., Science, 2003, 300, 764; Durai et al., Nucleic Acids
Res.,
2005, 33, 5978-5990; Porteus M.H., Mol. Ther., 2006, 13, 438-446). The binding
specificity of ZFPs is relatively easy to manipulate, and a repertoire of
novel artificial
ZFPs, able to bind many (g/a)nn(g/a)nn(g/a)nn sequences is now available (Pabo
et
al., precited; Segal, D.J. and Barbas, C.F., Curr. Opin. Biotechnol., 2001,
12, 632-637;
Isalan et al., Nat. Bioteclinol., 2001, 19, 656-660). However, preserving a
very narrow
specificity is one of the major issues for genome engineering applications,
and
presently it is unclear whether ZFPs would fulfill the very strict
requirements for
therapeutic applications. Furthermore, these fusion proteins have demonstrated
high
toxicity in Drosophila (Bibikova et al., Science, 2003, 300, 764; Bibikova et
al.,
Genetics, 2002, 161, 1169-1175) and mammalian NIHT3 cells (Alwin et al., Mol.
Ther., 2005, 12, 610-617; Porteus, M.H. and Baltimore, D., Science, 2003,
300,763;
Porteus, M.H. and Carroll, D., Nat. Biotechnol., 2005, 967-973), a genotoxic
effect
that is probably due to frequent off-site cleavage (Porteus, M.H., Mol. Ther.,
2006, 13,
438-446).
In nature, meganucleases are essentially represented by homing
endonucleases (HEs), a family of endonucleases encoded by mobile genetic
elements,
whose function is to initiate DNA double-strand break (DSB)-induced
recombination
events in a process referred to as homing (Chevalier, B.S. and Stoddard, B.L.,
Nucleic
Acids Res., 2001, 29, 3757-3774; Kostriken et al., Cell; 1983, 35, 167-174;
Jacquier,
A. and Dujon, B., Cell, 1985, 41, 383-394). Several hundreds of HEs have been
identified in bacteria, eukaryotes, and archea (Chevalier, B.S. and Stoddard,
B.L.,
Nucleic Acids Res., 2001, 29, 3757-3774); however the probability of finding a
HE
cleavage site in a chosen gene is very low.
Given their biological function and their exceptional cleavage
properties in terms of efficacy and specificity, HEs provide ideal scaffolds
to derive
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
3
novel endonucleases for genome engineering. Furthermore, in addition to their
exquisite specificity, homing endonuclease have shown to be less toxic -than
ZFPs,
probably because of better specificity (Alwin et aL, Mol. Ther., 2005, 12, 610-
617;
Porteus, M.H. and Baltimore, D., Science, 2003, 300, 763; Porteus, M.H. and
Carroll,
D., Nat. Biotechnol., 2005, 23, 967-973), two features that become essential
when
engaging into therapeutic applications.
Data have accumulated over the last decade, allowing a relatively
good characterization of the LAGLIDADG family, the largest of the four HE
families
(Chevalier, B.S. and Stoddard, B.L., Nucleic Acids Res., 2001, 29, 3757-74).
LAGLIDADG refers to the only sequence actually conserved throughout the
family,
and is found in one or (more often) two copies in the protein. Proteins with a
single
motif, such as I-CreI (Wang et al., Nucleic Acids Res., 1997, 25, 3767-3776)
form
homodimers and cleave palindromic or pseudo-palindromic DNA sequences, whereas
the larger, double motif proteins, such as I-SceI (Jacquier, A. and Dujon, B.,
Cell.,
1985, 41, 383-394) or I-Dmol (Dalgaard et al., Proc. Natl. Acad. Sci. USA,
1993, 90,
5417-5417) are monomers and cleave non palindromic targets. Nine different
LAGLIDADG proteins have been crystallized with or without bound DNA, showing a
very striking core structure conservation that contrasts with the lack of
similarity at
the primary sequence level (Heath et al., Nature Struct. Biol., 1997, 4, 468-
476; Duan
et al., Cell., 1997, 89, 555-564; Silva et al., J. Mol. Biol., 2003, 286, 1123-
1136;
Chevalier et al., Nat. Struct. Biol., 2001, 8, 312-316; Jurica et al., Mol.
Cell., 1998, 2,
469-476; Chevalier et al., J. Mol. Biol., 2003, 329, 253-269; Moure et al., J.
Mol.
Biol., 2003, 334, 685-695; Moure et al., Nat. Struct. Biol., 2002, 9, 764-770;
Ichiyanagi et al., J. Mol. Biol., 2000, 300, 889-901; Gimble et aL, J. Biol.
Chem.,
1998, 273, 30524-30529; Bolduc et al., Genes Dev. 2003, 17, 2875-2888; Silva
et al.,
J. Mol. Biol., 1999, 286, 1123-1136; Nakayama et al., J. Mol. Biol., Epub 29
septembre 2006, Spiegel et al., Structure, 2006, 14, 869-880). In contrast
with its
DNA bound crystal structure (Jurica et al., Mol. Cell., 1998, 2, 469-476;
Chevalier et
al., Nat. Struct. Biol., 2001, 8, 312-316; Chevalier et al., J. Mol. Biol.,
2003, 329,
253-269), the structure of I-Crel without bound DNA (Heath et al., Nature
Struct.
Biol., 1997, 4, 468-476), showed only one I-Crel monomer in the asymmetric
unit.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
4
Structural comparisons indicate that LAGLIDADG proteins adopt a
similar active conformation and their self-association forms two packed a-
helices
which separate two monomers or apparent domains. In this core structure
(Figure 1),
two characteristic a(3(3a(3(3a folds, contributed by two monomers, or two
domains in
double LAGLIDAG proteins, are facing each other with a two-fold symmetry. On
either side of the LAGLIDADG a-helices, a four stranded (3-sheet, forming a
saddle
on the DNA helix major groove, provides a DNA binding interface that drives
the
interaction of the protein with a half site of the target DNA sequence
(Chevalier et al.,
Nat. Struct. Biol., 2001, 8, 312-316; Jurica et al., Mol. Cell., 1998, 2, 469-
476). The
catalytic site is central, formed with contributions from helices of both
monomers. Just
above the catalytic site, the two LAGLIDADG a-helices play also an essential
role in
the dimerization interface. In addition to this core structure, other domains
can be
found, for instance, PI-Scel, an intein, has a protein splicing domain, and an
additional
DNA-binding domain (Moure et al., Nat. Struct. Biol., 2002, 9, 764-770;
Pingoud et
al., Biochemistry, 1998, 37, 8233-8243).
Modifying the substrate specificity of DNA binding proteins by
mutagenesis and screening/selection is a difficult task (Lanio et al., Protein
Eng.,
2000, 13, 275-281; Voziyanov et al., J. Mol. Biol., 2003, 326, 65-76; Santoro
et al.,
P.N.A.S., 2002, 99, 4185-4190; Buchholz, F. and Stewart, A.F., Nat.
Biotechnol.,
2001, 19, 1047-1052). This is even harder in the case of HEs whose main
characteristic is their large DNA recognition sites.
Analysis of the I-CreI/DNA crystal structure indicates that in each
monomer, nine residues (S32, Y33, Q38, N30, K28, Q26, Q44, R68 and R70)
establish direct interaction with eight bases at positions 3, 4, 5, 6, 7, 9,
10 and 11 of
the homing site (Jurica et al., Mol. Cell., 1998, 2, 469-76; Chevalier et al.,
J. Mol.
Biol., 2003, 329, 253-269), which randomization would result in 209
combinations, a
number beyond any screening capacity today. In addition, a total of 28 (Left-
monomer) or 24 (Right-monomer) water molecules mediate additional contacts
between nucleotides and protein side-chains in the protein/DNA interface
(Chevalier
et al., J. Mol. Biol., 2003, 329, 253-269).
Therefore, several laboratories have relied on a semi-rational
approach (Chica et al., Curr. Opin. Biotechnol., 2005, 16, 378-384) to limit
the
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
diversity of the mutant libraries to be handled, choosing a small set of
relevant amino
acid residues according to structural data. This set is generally composed of
amino
acid residues of the four stranded (3-sheet that, in the HE/DNA complex
structure,
make direct or water-mediated contacts with the nucleotide bases of the homing
site.
5 This semi-rational approach was used to locally alter the specificity
of the I-CreI (Seligman et al., Genetics, 1997, 147, 1653-64; Seligman et al.,
Nucleic
Acids Res., 2002, 30, 3870-3879; Sussman et al., J. Mol. Biol., 2004, 342, 31-
41;
Rosen et al., Nucleic Acids Res., 2006, 34, 4791-4800; Arnould et al., J. Mol.
Biol.,
2006, 355, 443-458; International PCT Applications WO 2006/097853 and WO
2006/097784; Smith et al., Nucleic Acids Res., Epub 27 November 2006), I-Scel
(Doyon et al., J. Am. Chem. Soc., 2006, 128, 2477-2484), PI-Scel (Gimble et
al., J.
Mol. Biol., 2003, 334, 993-1008) and I-Alsot (Ashworth et al., Nature, 2006,
441,
656-659) proteins.
By combining the semi-rational approach and high throughput
screening (HTS; Arnould et al., J. Mol. Biol., 2006, 355, 443-458;
International PCT
Applications WO 2006/097853 and WO 2006/097784; Smith et al., Nucleic Acids
Res., Epub 27 November 2006), it was possible to obtain large number of
locally
altered variants of the I-CreI meganuclease that recognize a variety of
targets, and to
assemble them by a combinatorial process, to obtain entirely redesigned
mutants with
chosen specificity.
However, this approach is not easy since the HEs DNA binding
interface is very compact and the two different P(3 hairpins which are
responsible for
virtually all base-specific interactions are part of a single fold. Thus, the
mutation of
several amino acids placed in close vicinity which is required for binding a
target
mutated at several positions may disrupt the structure of the binding
interface.
Therefore, to reach a larger number of sequences, it would be
extremely valuable to be able to identify other regions in the LAGLIDAG
endonucleases, which can be engineered to generate novel substrate
specificity.
In addition, since homing endonucleases can sometimes be harmful
at very high doses (Gouble et al., J. Gene Med., 2006, 8, 616-622), it would
be
extremely valuable to engineer LAGLIDADG endonucleases which are less toxic.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
6
The inventors have solved the structure of the I-Ct=eI dimer without
DNA; its comparison with the DNA bound crystal structure (PDB code lgz9;
Chevalier et al., Nat. Struct. Biol., 2001, 8, 312-316) depicts a different
conformation
of the C-terminal loop and the final helix a6, which suggests its implication
in DNA
binding. A site-directed mutagenesis study in this region demonstrates that
whereas
the C-terminal helix is negligible for DNA binding, the final C-terminal loop
which is
well conserved among homodimeric proteins froin the LAGLIDADG family (Figure
2) and makes a number of nonspecific contacts to the DNA phosphate backbone
(Jurica et al., Mol. Cell., 1998, 2, 469-76; Chevalier et al., J. Mol. Biol.,
2003, 329,
253-269), plays an important role not only in binding and cleavage but also in
target
specificity. In addition, some of the mutants in the C-terminal loop were
significantly
less toxic than wild-type I-Cr-el.
This region open new possibilities to engineer new homing
endonucleases having novel substrate specificities and thereby increases the
number
of DNA sequences that can be targeted with meganucleases. Thus, redesigned
meganucleases cleaving chosen genomic targets from genes of interest can be
engineered by combining previously identified mutations as defined above
(Arnould
et al., J. Mol. Biol., 2006, 355, 443-458; International PCT Applications WO
2006/097853, WO 2006/097854 and WO 2006/097784; Smith et al., Nucleic Acids
Res., Epub 27 November 2006), with mutations in the final C-terminal loop.
In addition, this region allows also the engineering of homing
endonucleases which are less toxic.
Potential applications include genetic engineering, genome
engineering, gene therapy and antiviral therapy.
The invention relates to a method for engineering a LAGLIDADG
homing endonuclease variant having novel substrate specificity, comprising at
least
the following steps:
(a) the mutation of at least one amino acid residue of the final C-
terminal loop of a parent LAGLIDADG homing endonuclease, with the exclusion of
the threonine 140 (T140) ofI-CyeI, and
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
7
(b) the selection and/or screening of the variants from step (a) having
a pattern of cleaved DNA targets that is different from that of the parent
LAGLIDADG homing endonuclease.
D('.f 111t103is
- Amino acid residues in a polypeptide sequence are designated
herein according to the one-letter code, in which, for example, Q means Gln or
Glutamine residue, R means Arg or Arginine residue and D means Asp or Aspartic
acid residue.
- hydrophobic amino acid refers to leucine (L), valine (V), isoleucine
(I), alanine (A), methionine (M), phenylalanine (F), tryptophane (W) and
tyrosine (Y).
- Nucleotides are designated as follows: one-letter code is used for
designating the base of a nucleoside: a is adenine, t is thymine, c is
cytosine, and g is
guanine. For the degenerated nucleotides, r represents g or a(purine
nucleotides), k
represents g or t, s represents g or c, w represents a or t, m represents a or
e, y repre-
sents t or c (pyrimidine nucleotides), d represents g, a or t, v represents g,
a or c, b
represents g, t or c, h represents a, t or c, and n represents g, a, t or c.
- by "meganuclease" is intended an endonuclease having a double-
stranded DNA target sequence of 12 to 45 pb.
- by "parent LAGLIDADG homing, endonuclease" is intended a wild-
type LAGLIDADG homing endonuclease or a functional variant thereof. Said
parent
LAGLIDADG homing endonuclease may be a monomer, a dimer (homodimer or
heterodimer) comprising two LAGLIDADG homing endonuclease core domains
which are associated in a functional endonuclease able to cleave a double-
stranded
DNA target of 22 to 24 bp.
- by "homodimeric LAGLIDADG homing endonuclease" is intended
a wild-type homodimeric LAGLIDADG homing endonuclease having a single
LAGLIDADG motif and cleaving palindromic DNA target sequences, such as I-Crel
or I-AIsoI or a functional variant thereof.
- by "LAGLIDADG homing endonuclease variant" or "variant" is
intended a protein obtained by replacing at least one amino acid of a
LAGLIDADG
homing endonuclease sequence, with a different amino acid.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
8
- by "functional variant" is intended a LAGLIDADG homing
endonuclease variant which is able to cleave a DNA target, preferably a new
DNA
target which is not cleaved by a wild-type LAGLIDADG homing endonuclease . For
example, such variants have amino acid variation at positions contacting the
DNA
target sequence or interacting directly or indirectly with said DNA target.
- by "homing endonuclease variant with novel specificity" is
intended a variant having a pattern of cleaved targets (cleavage profile)
different from
that of the parent homing endonuclease. The variants may cleave less targets
(restricted profile) or more targets than the parent homing endonuclease.
Preferably,
the variant is able to cleave at least one target that is not cleaved by the
parent homing
endonuclease.
The terms "novel specificity", "modified specificity", "novel
cleavage specificity", "novel substrate specificity" which are equivalent and
used
indifferently, refer to the specificity of the variant towards the nucleotides
of the DNA
target sequence.
- by "1-Crel" is intended the wild-type I-CreI having the sequence
SWISSPROT P05725 or pdb accession code 1g9y.
- by "domain" or "core domain" is intended the "LAGLIDADG
homing endonuclease core domain" which is the characteristic al RI R2a2R3(34a3
fold of
the homing endonucleases of the LAGLIDADG family, corresponding to a sequence
of about one hundred amino acid residues. Said domain comprises four beta-
strands
((31, P2, P3, P4) folded in an antiparallel beta-sheet which interacts with
one half of the
DNA target. This domain is able to associate with another LAGLIDADG homing
endonuclease core domain which interacts with the other half of the DNA target
to
form a functional endonuclease able to cleave said DNA target. For example, in
the
case of the dimeric homing endonuclease T-CreI (163 amino acids), the
LAGLIDADG
homing endonuclease core domain corresponds to the residues 6 to 94. In the
case of
monomeric homing endonucleases, two such domains are found in the sequence of
the
endonuclease; for example in I-DrnoI (194 amino acids), the first domain
(residues 7
to 99) and the second domain (residues 104 to 194) are separated by a short
linker
(residues 100 to 103).
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
9
- by "subdomain" is intended the region of a LAGLIDADG homing
endonuclease core domain which interacts with a distinct part of a homing
endonuclease DNA target half-site. Two different subdomains behave
independently
and the mutation in one subdomain does not alter the binding and cleavage
properties
of the other subdomain. Therefore, two subdomains bind distinct part of a
homing
endonuclease DNA target half-site.
- by "beta-hairpin" is intended two consecutive beta-strands of the
antiparallel beta-sheet of a LAGLIDADG homing endonuclease core domain ((31(32
or,
R3R4) which are connected by a loop or a turn,
- by "DNA target", "DNA target sequence", "target sequence",
"target-site", "target" , "site"; "recognition site", "recognition sequence",
"homing
recognition site", "homing site", "cleavage site" is intended a 22 to 24 bp
double-
stranded palindromic, partially palindromic (pseudo-palindromic) or non-
palindromic
polynucleotide sequence that is recognized and cleaved by a LAGLIDADG homing
endonuclease. These terms refer to a distinct DNA location, preferably a
genomic
location, at which a double stranded break (cleavage) is to be induced by the
endonuclease. The DNA target is defined by the 5' to 3' sequence of one strand
of the
double-stranded polynucleotide. For example, the palindromic DNA target
sequence
cleaved by wild-type I-CreI presented in figure 8 is defined by the sequence
5'- t_12c-
11a-10a-9a-8a-7C-69-St-4C-39-2t-lai-1C+2g+3a--4C+5g+6t1-7t+8t-i-9t+10g+11a+12
(SEQ ID NO :1).
Cleavage of the DNA target occurs at the nucleotides in positions +2 and -2,
respectively for the sense and the antisense strand. Unless otherwise
indicated, the
position at which cleavage of the DNA target by an I-Cre I meganuclease
variant
occurs, corresponds to the cleavage site on the sense strand of the DNA
target.
- by " DNA target half-site", "half cleavage site" or half-site" is
intended the portion of the DNA target which is bound by each LAGLIDADG homing
endonuclease core domain.
- by "chimeric DNA target"or "hybrid DNA target" is intended the
fusion of a different half of two parent meganuclease target sequences. In
addition at
least one half of said target may comprise the combination of nucleotides
which are
bound by separate subdomains (combined DNA target).
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
- by "vector" is intended a nucleic acid molecule capable of
transporting another nucleic acid to which it has been linked.
- by "mutation" is intended the substitution, the deletion, and/or the
addition of one or more nucleotides/amino acids in a nucleic acid/amino acid
5 sequence.
- by "homologous" is intended a sequence with enough identity to
another one to lead to a homologous recombination between sequences, more
particularly having at least 95 % identity, preferably 97 % identity and more
prefera-
bly 99 %.
10 - "Identit " refers to sequence identity between two nucleic acid
molecules or polypeptides. Identity can be determined by comparing a position
in
each sequence which may be aligned for purposes of comparison. When a position
in
the compared sequence is occupied by the same base, then the molecules are
identical
at that position. A degree of similarity or identity between nucleic acid or
amino acid
sequences is a function of the number of identical or matching nucleotides at
positions
shared by the nucleic acid sequences. Various alignment algorithms and/or
programs
may be used to calculate the identity between two sequences, including FASTA,
or
BLAST which are available as a part of the GCG sequence analysis package
(University of Wisconsin, Madison, Wis.), and can be used with, e.g., default
settings.
- "individual" includes mammals, as well as other vertebrates (e.g.,
birds, fish and reptiles). The terms "mammal" and "mammalian", as used herein,
refer
to any vertebrate animal, including monotremes, marsupials and placental, that
suckle
their young and either give birth to living young (eutharian or placental
manunals) or
are egg-laying (metatharian or nonplacental mammals). Examples of mammalian
species include humans and other primates (e.g., monkeys, chimpanzees),
rodents
(e.g., rats, mice, guinea pigs) and ruminants (e.g., cows, pigs, horses).
- "genetic disease" refers to any disease, partially or completely,
directly or indirectly, due to an abnormality in one or several genes. Said
abnormality
can be a mutation, an insertion or a deletion. Said mutation can be a punctual
muta-
tion. Said abnormality can affect the coding sequence of the gene or its
regulatory
sequence. Said abnormality can affect the structure of the genomic sequence or
the
structure or stability of the encoded mRNA. Said genetic disease can be
recessive or
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
11
dominant. Such genetic disease could be, but are not limited to, cystic
fibrosis,
Huntington's chorea, familial hyperchoiesterolemia (LDL receptor defect),
hepatoblastoma, Wilson's disease, congenital hepatic porphyrias, inherited
disorders
of hepatic metabolism, Lesch Nyhan syndrome, sickle cell anemia,
thalassaemias,
xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia
telangiectasia, Bloom's syndrome, retinoblastoma, Duchenne's muscular
dystrophy,
and Tay-Sachs disease.
According to the invention, the amino acids of the final C-terminal
loop correspond to positions 137 to 143 in I-Cr eI amino acid sequence SEQ ID
NO: 2
or Swissprot P05725. Knowing the positions of the final C-terminal loop in I-
Crel,
one skilled in the art can easily deduce the corresponding positions in
another
homodimeric LAGLIDADG homing endonuclease, using well-known protein
structure analyses softwares such as Pymol. For example, for I-MsoI, the final
C-
terminal loop corresponds to positions 143 to 149. According to an
advantageous
embodiment of said method, step (a) comprises the mutation of amino acid
residue(s)
of the final C-terminal loop that are contacting the phosphate backbone of the
parent
LAGLIDADG endonuclease DNA cleavage site (wild-type LAGLIDAG
endonuclease homing site). Preferably said residues are involved in binding
and
cleavage of said DNA cleavage site. More preferably, said residues are in
positions
138, 139, 142 or 143, by reference to the numbering of I-CreI amino acid
sequence
(SEQ ID NO: 2; figure 2). Two residues may be mutated in one variant provided
that
each mutation is in a different pair of residues chosen from the pair of
residues in
positions 138 and 139 and the pair of residues in positions 142 and 143.
According to the method of the invention, the mutations which are
introduced modify the interaction(s) of said amino acid(s) of the final C-
terminal loop
with the phosphate backbone of the parent LAGLIDADG endonuclease DNA
cleavage site.
According to another advantageous embodiment of said method, the
mutation in step (a) is a substitution of at least one amino acid of said
final C-terminal
loop, with a different amino acid.
Preferably, the residue in position 138 or 139 is substituted by an
hydrophobic amino acid to avoid the formation of hydrogen bonds with the
phosphate
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
12
backbone of the DNA cleavage site. For example, the residue in position 138 is
substituted by an alanine or the residue in position 139 is substituted by a
methionine.
The residue in position 142 or 143 is advantageously substituted by a
small amino acid, for example a glycine, to decrease the size of the side
chains of
these amino acid residues.
According to the method of the invention, the mutation(s) in step (a)
are introduced in either a wild-type LAGLIDADG homing endonuclease or a
functional variant thereof.
The wild-type LAGLIDADG homing endonuclease is
advantageously homodimeric. Examples of wild-type homodimeric LAGLIDAG
homing endonucleases are presented in Table I of Lucas et al., Nucleic Acids
Res.,
2001, 29, 960-969. The wild-type homodimeric LAGLIDADG homing endonuclease
may be advantageously selected from the group consisting of : I-Cre1, I-Ceu1,
I-Msol
and I-Cpa1, preferably I Crel.
The functional variant comprises additional mutations outside the
final C-terminal loop, preferably in positions of amino acid residues which
interact
with a DNA target half-site. The LAGLIDADG homing endonucleases DNA
interacting residues are well-known in the art. The residues which are mutated
may
interact with the DNA backbone or with the nucleotide bases, directly or via a
water
nlolecule. Preferably said mutations modify the cleavage specificity of the
meganuclease and result in a meganuclease with novel specificity, which is
able to
cleave a DNA target from a gene of interest. More preferably, said mutations
are
substitutions of one or more amino acids in a first functional subdomain
corresponding to that situated from positions 26 to 40 of I-Cre1 amino acid
sequence,
that alter the specificity towards the nucleotide in positions 8 to 10 of
the DNA
target, and/or substitutions in a second functional subdomain corresponding to
that
situated from positions 44 to 77 of I-Crel amino acid sequence, that alter the
specificity towards the nucleotide in positions 3 to 5 of the DNA target, as
described
previously (International PCT Applications WO 2006/097784 and WO 2006/097853;
Arnould et al., J. Mol. Biol., 2006, 355, 443-458; Smith et al., Nucleic Acids
Res.,
2006). The substitutions correspond advantageously to positions 26, 28, 30,
32, 33,
38, and/or 40, 44, 68, 70, 75 and/or 77 of I-Crel amino acid sequence. For
cleaving a
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
13
DNA target, wherein n_4 is t or n+4 is a, said variant has advantageously a
glutamine
(Q) in position 44; for cleaving a DNA target, wherein n_4 is a or n+4 is t,
said variant
has an alanine (A) or an asparagine in position 44, and for cleaving a DNA
target,
wherein n_9 is g or n+9 is c, said variant has advantageously an arginine (R)
or a lysine
(K) in position 38.
According to a most preferred embodiment of said method, the
parent LAGLIDADG homing endonuclease is an I-CreI variant having mutations in
positions 26 to 40 and 44 to 77 of I-CreI and cleaving a palindromic DNA
sequence,
wherein at least the nucleotides in positions +3 to +5 and +8 to +10 or -10 to
-8 and -5
to -3 of one half of said DNA sequence correspond to the nucleotides in
positions +3
to +5 and +8 to +10 or -10 to -8 and -5 to -3 of one half of a DNA target from
a gene
of interest.
The mutations in step (a) are introduced according to standard
mutagenesis methods which are well-known in the art and commercially
available.
They may be advantageously produced by amplifying overlapping fragments
comprising the mutated position(s), as defined above, according to well-known
overlapping PCR techniques. Libraries of variants having amino acid variation
in the
final C-terminal loop may be generated according to standard methods.
Step (a) may comprise the introduction of additional mutations at
other positions contacting the DNA target sequence or interacting directly or
indirectly with said DNA target, as defined above. This step may be performed
by
generating combinatorial libraries as described in the International PCT
Application
WO 2004/067736, Arnould et al., J. Mol. Biol., 2006, 355, 443-458 and Smith et
al.,
Nucleic Acids Res., Epub 27 November 2006 and eventually, combining said
mutations intramolecularly, by amplifying overlapping fragments comprising
each of
the mutations, according to well-known overlapping PCR techniques.
Furthermore, random mutations may also be introduced on the whole
variant or in part of the variant, in particular the C-terminal half of the
variant
(positions 80 to 163 of I-Crel amino acid sequence SEQ ID NO:2) in order to
improve
the binding and/or cleavage properties of the variant towards a DNA target
from a
gene of interest.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
14
The additional mutations (random or site-specific) and the
mutation(s) in the final C-terminal loop may be introduced simultaneously or
subsequently.
In addition, one or more residues may be inserted at the NH2
terminus and/or COOH terminus of the variant monomer(s)/domain(s). For
example, a
methionine residue is introduced at the NH2 terminus, a tag (epitope or
polyhistidine
sequence) is introduced at the NHZ terminus and/or COOH terminus; said tag is
useful
for the detection and/or the purification of the meganuclease.
The selection and/or screening in step (b) may be performed by using
a cleavage assay in vitro or in vivo, as described in the International PCT
Application
WO 2004/067736.
According to another advantageous embodiment of said method, step
(b) is performed in vivo, under conditions where the double-strand break in a
mutated
DNA target sequence which is generated by said variant leads to the activation
of a
positive selection marker or a reporter gene, or the inactivation of a
negative selection
marker or a reporter gene, by recombination-mediated repair of said DNA double-
strand break.
For example, the cleavage activity of the variant of the invention
may be measured by a direct repeat recombination assay, in yeast or mammalian
cells,
using a reporter vector, as described in the PCT Application WO 2004/067736;
Epinat
et al., Nucleic Acids Res., 2003, 31, 2952-2962; Chames et al., Nucleic Acids
Res.,
2005, 33, e178, and Arnould et al., J. Mol. Biol., 2006, 355, 443-458. The
reporter
vector comprises two truncated, non-functional copies of a reporter gene
(direct
repeats) and a chimeric DNA target sequence within the intervening sequence,
cloned
in a yeast or a mammalian expression vector. The DNA target sequence is
derived
from the parent homing endonuclease cleavage site by replacement of at least
one
nucleotide by a different nucleotide. Preferably a panel of palindromic or non-
palindromic DNA targets representing the different combinations of the 4 bases
(g, a,
c, t) at one or more positions of the DNA cleavage site is tested (4"
palindromic targets
for n mutated positions). Expression of the variant results in a functional
endonuclease
wliich is able to cleave the DNA target sequence. This cleavage induces
homologous
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
recombination between the direct repeats, resulting in a functional reporter
gene,
whose expression can be monitored by appropriate assay.
According to another advantageous embodiment of said method, step
(b) comprises the selection and/or screening of the variants from step (a)
which are
5 able to cleave at least one DNA target sequence that is not cleaved by said
parent
LAGLIDADG homing endonuclease, said DNA target sequence being derived from
the parent LAGLIDADG homing endonuclease cleavage site, by the replacement of
at
least one nucleotide of one half of said cleavage site, with a different
nucleotide.
According to the method of the invention, the parent DNA target may
10 be palindromic, non-palindromic or pseudo-palindromic. Preferably, said DNA
target
sequence is derived from the I-CreI palindromic site having the sequence SEQ
ID
NO: 1. More preferably, said DNA target has nucleotide mutation(s) in
positions 1
to 2, 6 to 7, 8 to 10 and/or 11 to 12, still more preferably in
positions 1 to 2,
6 to 7 and/or 11 to 12.
15 According to another advantageous embodiment of said method, it
comprises a further step (c) of expressing one variant obtained in step (b),
so' as to
allow the formation of homodimers. Said homodimers are able to cleave a
palindromic or pseudo-palindromic target sequences.
According to another advantageous embodiment of said method, it
comprises a further step (c') of co-expressing one variant obtained in step
(b) and a
wild-type LAGLIDADG homing endonuclease or a functional variant thereof, so as
to
allow the formation of heterodimers. The assembly of functional heterodimers
by co-
expression of two different LAGLIDADG endonucleases monomers, has been
described previously in Arnould et al., J. Mol. Biol., 2006, 355, 443-458;
International
PCT Applications WO 2006/097853, WO 2006/097854 and WO 2006/097784; Smith
et al., Nucleic Acids Res., Epub 27 November 2006. Preferably, two different
variants
obtained in step (b) are co-expressed. Said heterodimers are able to cleave a
non-
palindromic chimeric target.
For example, host cells may be modified by one or two recombinant
expression vector(s) encoding said variant(s). The cells are then cultured
under condi-
tions allowing the expression of the variant(s) and the
homodimers/heterodimers
which are formed are then recovered from the cell culture.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
16
According to the method of the invention, single-chain chimeric
meganucleases may be constructed by the fusion of one variant obtained in step
(b)
with a homing endonuclease domain/monomer. Said domain/monomer may be from a
wild-type LAGLIDADG homing endonuclease or a functional variant thereof.
Preferably, the two domain(s)/monomer(s) are connected by a peptidic linker.
More
preferably, the single-chain meganuclease comprises two different variants
obtained in
step (b); said single-chain meganuclease is able cleave a non-palindromic
chimeric
target comprising one different half of each variant DNA target.
Methods for constructing single-chain chimeric meganucleases
derived from homing endonucleases are well-known in the art (Epinat et al.,
Nucleic
Acids Res., 2003, 31, 2952-62; Chevalier et al., Mol. Cell., 2002, 10, 895-
905; Steuer
et al., Chembiochem., 2004, 5, 206-13; International PCT Applications WO
03/078619 and WO 2004/031346). Any of such methods, may be applied for
constructing single-chain chimeric meganucleases derived from the variants as
defined in the present invention.
The invention relates also to an homodimeric or heterodimeric
LAGLIDADG homing endonuclease variant obtainable by the method as defined
above, with the exclusion of the homodimeric variants of SEQ ID NO: 3 and 4
and the
homodimeric or heterodimeric variants comprising a monomer of SEQ ID NO: 5;
the
LAGLIDADG homing endonuclease variant of the invention is also named as
variant,
meganuclease variant or meganuclease.
According to an advantageous embodiment of said variant, it is an
heterodimer comprising monomers from two different variants obtainable by the
method as defined above.
According to another advantageous embodiment of said variant, it is
an I-CreI variant having one or two mutations, each one from a different pair
of
mutations selected from the group consisting of the pair S138A and K139M and
the
pair K142G and T143G. Examples of such variants include SEQ ID NO: 6 to 9.
More preferably, said I-Cf-el variant is an heterodimer, comprising
two monomers, each one further comprising different mutations in positions 26
to 40
and 44 to 77 of I-Crel and being able to cleave a genomic DNA target from a
gene of
interest.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
17
The subject-matter of the present invention is also a single-chain
chimeric meganuclease derived from the variant as defined above; the single-
chain
chimeric meganuclease of the invention is also named as single-chain
derivative,
single-chain meganuclease, single-chain meganuclease derivative or
meganuclease.
The meganuclease of the invention includes both the meganuclease
variant and the single-chain meganuclease derivative.
The subject-matter of the present invention is also a polynucleotide
fragment encoding a variant or a single-chain derivative as defined above;
said
polynucleotide may encode one monomer of an homodimeric or heterodimeric
variant, or two domains/monomers of a single-chain derivative.
The subject-matter of the present invention is also a recombinant
vector for the expression of a variant or a single-chain derivative according
to the
invention. The recombinant vector comprises at least one polynucleotide
fragment
encoding a variant or a single-chain meganuclease, as defined above. In a
preferred
embodiment, said vector comprises two different polynucleotide fragments, each
encoding one of the monomers of an heterodimeric variant.
A vector which can be used in the present invention includes, but is
not limited to, a viral vector, a plasmid, a RNA vector or a linear or
circular DNA or
RNA molecule which may consists of a chromosomal, non chromosomal, semi-
synthetic or synthetic nucleic acids. Preferred vectors are those capable of
autonomous
replication (episomal vector) and/or expression of nucleic acids to which they
are
linked (expression vectors). Large numbers of suitable vectors are known to
those of
skill in the art and commercially available.
Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adeno-
associated viruses), coronavirus, negative strand RNA viruses such as
orthomyxovirus
(e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis
virus), para-
myxovirus (e. g. measles and Sendai), positive strand RNA viruses such as
picor-
navirus and alphavirus, and double-stranded DNA viruses including adenovirus,
herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus,
cytomega-
lovirus), and poxvirus (e. g., vaccinia, fowlpox and canarypox). Other viruses
include
Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus,
and
hepatitis virus, for example. Examples of retroviruses include: avian leukosis-
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
18
sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group,
lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their
replication,
In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-
Raven
Publishers, Philadelphia, 1996).
Preferred vectors include lentiviral vectors, and particularly self
inactivacting lentiviral vectors.
Vectors can comprise selectable markers, for example: neomycin
phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase,
hygromycin
phosphotransferase, herpes simplex virus thymidine kinase, adenosine
deaminase,
glutamine synthetase, and hypoxanthine-guanine phosphoribosyl transferase for
eukaryotic cell culture; TRPl for S. cerevisiae; tetracycline, rifampicin or
ampicillin
resistance in E. coli.
Preferably said vectors are expression vectors, wherein the
sequence(s) encoding the variant/single-chain derivative of the invention is
placed
under control of appropriate transcriptional and translational control
elements to
permit production or synthesis of said meganuclease. Therefore, said
polynucleotide is
comprised in an expression cassette. More particularly, the vector comprises a
repli-
cation origin, a promoter operatively linked to said encoding polynucleotide,
a
ribosome-binding site, an RNA-splicing site (when genomic DNA is used), a
polyadenylation site and a transcription termination site. It also can
comprise an
enhancer. Selection of the promoter will depend upon the cell in which the
poly-
peptide is expressed. Preferably, when said variant is an heterodimer, the two
poly-
nucleotides encoding each of the monomers are included in one vector which is
able
to drive the expression of both polynucleotides, simultaneously. Suitable
promoters
include tissue specific and/or inducible promoters. Examples of inducible
promoters
are: eukaryotic metallothionine promoter which is induced by increased levels
of
heavy metals, prokaryotic lacZ promoter which is induced in response to
isopropyl-(3-
D-thiogalacto-pyranoside (IPTG) and eulcaryotic heat shock promoter which is
induced by increased temperature. Examples of tissue specific promoters are
skeletal
muscle creatine kinase, prostate-specific antigen (PSA), a-antitrypsin
protease, human
surfactant (SP) A and B proteins, (3-casein and acidic whey protein genes.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
19
According to another advantageous embodiment of said vector, it
includes a targeting DNA construct comprising sequences sharing homologies
with
the region surrounding the genomic DNA target cleavage site as defined above.
Alternatively, the vector coding for the meganuclease and the vector
comprising the targeting DNA construct are different vectors.
More preferably, the targeting DNA construct comprises:
a) sequences sharing homologies with the region surrounding the
genomic DNA cleavage site as defined above, and
b) a sequence to be introduced flanked by sequences as in a).
Preferably, homologous sequences of at least 50 bp, preferably more
than 100 bp and more preferably more than 200 bp are used. Indeed, shared DNA
homologies are located in regions flanking upstream and downstream the site of
the
break and the DNA sequence to be introduced should be located between the two
arms. The sequence to be introduced is preferably a sequence which repairs a
mutation
in the gene of interest (gene correction or recovery of a functional gene),
for the
purpose of genome therapy. Alternatively, it can be any other sequence used to
alter
the chromosomal DNA in some specific way including a sequence used to modify a
specific sequence, to attenuate or activate the endogenous gene of interest,
to
inactivate or delete the endogenous gene of interest or part thereof, to
introduce a
mutation into a site of interest or to introduce an exogenous gene or part
thereof.
The invention also concerns a prokaryotic or eukaryotic host cell
which is modified by a polynucleotide or a vector as defined above, preferably
an
expression vector.
The invention also concerns a non-human transgenic animal or a
transgenic plant, characterized in that all or part of their cells are
modified by a
polynucleotide or a vector as defined above.
As used herein, a cell refers to a prokaryotic cell, such as a bacterial
cell, or eukaryotic cell, such as an animal, plant or yeast cell.
The subject-matter of the present invention is further the use of a
meganuclease with the exclusion of SEQ ID NO: 5, one or two derived
polynucleotide(s), preferably included in expression vector(s), a cell, a
transgenic
plant, a non-human transgenic mammal, as defined above, for molecular biology,
for
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
in vivo or in vitro genetic engineering, and for in vivo or in vitro genome
engineering,
for non-therapeutic purposes.
Non therapeutic purposes include for example (i) gene targeting of
specific loci in cell packaging lines for protein production, (ii) gene
targeting of
5 specific loci in crop plants, for strain improvements and metabolic
engineering, (iii)
targeted recombination for the removal of markers in genetically modified crop
plants,
(iv) targeted recombination for the removal of markers in genetically modified
microorganism strains (for antibiotic production for example).
According to an advantageous embodiment of said use, it is for
10 inducing a double-strand break in a site of interest comprising a DNA
target sequence,
thereby inducing a DNA recombination event, a DNA loss or cell death.
According to the invention, said double-strand break is for: repairing
a specific sequence, modifying a specific sequence, restoring a functional
gene in
place of a mutated one, attenuating or activating an endogenous gene of
interest,
15 introducing a mutation into a site of interest, introducing an exogenous
gene or a part
thereof, inactivating or detecting an endogenous gene or a part thereof,
translocating a
chromosomal arm, or leaving the DNA unrepaired and degraded.
The subject-matter of the present invention is also a method of
genetic engineering, characterized in that it comprises a step of double-
strand nucleic
20 acid breaking in a site of interest located on a vector comprising a DNA
target as
defined hereabove, by contacting said vector with a meganuclease as defined
above,
with the exclusion of SEQ ID NO: 5, thereby inducing an homologous
recombination
with another vector presenting homology with the sequence surrounding the
cleavage
site of said meganuclease.
The subjet-matter of the present invention is also a method of
genome engineering, characterized in that it comprises the following steps: 1)
double-
strand breaking a genomic locus comprising at least one DNA target of a
meganuclease as defined above, by contacting said target with said
meganuclease,
with the exclusion of SEQ ID NO: 5 ; 2) maintaining said broken genomic locus
under
conditions appropriate for homologous recombination with a targeting DNA
construct
comprising the sequence to be introduced in said locus, flanked by sequences
sharing
homologies with the targeted locus.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
21
The subject-matter of the present invention is also a method of
genome engineering, characterized in that it comprises the following steps: 1)
double-
strand breaking a genomic locus comprising at least one DNA target of a
meganuclease as defined above, by contacting said cleavage site with said
meganuclease, with the exclusion of SEQ ID NO: 5; 2) maintaining said broken
genomic locus under conditions appropriate for homologous recombination with
chromosomal DNA sharing homologies to regions surrounding the cleavage site.
The subject-matter of the present invention is also the use of at least
one meganuclease as defined above, with the exclusion of SEQ ID NO: 5, one or
two
derived polynucleotide(s), preferably included in expression vector(s), as
defined
above, for the preparation of a medicament for preventing, improving or curing
a
genetic disease in an individual in need thereof, said medicament being
administrated
by any means to said individual.
The subject-matter of the present invention is also a method for
preventing, improving or curing a genetic disease in an individual in need
thereof, said
method comprising the step of administering to said individual a composition
comprising at least a meganuclease as defined above, by any means.
In this case, the use of the meganuclease as defined above,
comprises at least the step of (a) inducing in somatic tissue(s) of the
individual a
double stranded cleavage at a site of interest of a gene comprising at least
one
recognition and cleavage site of said meganuclease, and (b) introducing into
the
individual a targeting DNA, wherein said targeting DNA comprises (1) DNA
sharing
homologies to the region surrounding the cleavage site and (2) DNA which
repairs the
site of interest upon recombination between the targeting DNA and the
chromosomal
DNA. The targeting DNA is introduced into the individual under conditions
appropriate for introduction of the targeting DNA into the site of interest.
According to the present invention, said double-stranded cleavage
is induced, either in toto by administration of said meganuclease to an
individual,
or ex vivo by introduction of said meganuclease into somatic cells removed
from an
individual and returned into the individual after modification.
In a preferred embodiment of said use, the meganuclease is
combined with a targeting DNA construct comprising a sequence which repairs a
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
22
mutation in the gene flanked by sequences sharing homologies with the regions
of the
gene surrounding the genomic DNA cleavage site of said meganuclease, as
defined
above. The sequence which repairs the mutation is either a fragment of the
gene with
the correct sequence or an exon knock-in construct.
For correcting a gene, cleavage of the gene occurs in the vicinity of
the mutation, preferably, within 500 bp of the mutation. The targeting
construct
comprises a gene fragment which has at least 200 bp of homologous sequence
flanking the genomic DNA cleavage site (minimal repair matrix) for repairing
the
cleavage, and includes the correct sequence of the gene for repairing the
mutation.
Consequently, the targeting construct for gene correction comprises or
consists of the
minimal repair matrix; it is preferably from 200 pb to 6000 pb, more
preferably from
1000 pb to 2000 pb.
For restoring a functional gene, cleavage of the gene occurs
upstream of a mutation. Preferably said mutation is the first known mutation
in the
sequence of the gene, so that all the downstream mutations of the gene can be
corrected simultaneously. The targeting construct comprises the exons
downstream of
the genomic DNA cleavage site fused in frame (as in the cDNA) and with a
polyadenylation site to stop transcription in 3'. The sequence to be
introduced (exon
knock-in construct) is flanlced by introns or exons sequences surrounding the
cleavage
site, so as to allow the transcription of the engineered gene (exon knock-in
gene) into
a mRNA able to code for a functional protein. For example, the exon knock-in
construct is flanked by sequences upstream and downstream.
The subject-matter of the present invention is also the use of at least
one meganuclease as defined above, with the exclusion of SEQ ID NO: 5, one or
or
two derived polynucleotide(s), preferably included in expression vector(s), as
defined
above for the preparation of a medicament for preventing, improving or curing
a
disease caused by an infectious agent that presents a DNA intermediate, in an
individual in need thereof, said medicament being administrated by any means
to said
individual.
The subject-matter of the present invention is also a method for
preventing, improving or curing a disease caused by an infectious agent that
presents a
DNA intermediate, in an individual in need thereof, said method comprising at
least
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
23
the step of administering to said individual a composition as defined above,
by any
means.
The subject-matter of the present invention is also the use of at least
one meganuclease as defined above, one or two polynucleotide(s), preferably
included
in expression vector(s), as defined above, in vitro, for inhibiting the
propagation,
inactivating or deleting an infectious agent that presents a DNA intermediate,
in
biological derived products or products intended for biological uses or for
disinfecting
an object.
The subject-matter of the present invention is also a method for
decontaminating a product or a material from an infectious agent that presents
a DNA
intermediate, said method comprising at least the step of contacting a
biological
derived product, a product intended for biological use or an object, with a
composition
as defined above, for a time sufficient to inhibit the propagation, inactivate
or delete
said infectious agent.
In a particular embodiment, said infectious agent is a virus. For
example said virus is an adenovirus (Adl1, Ad21), herpesvirus (HSV, VZV, EBV,
CMV, herpesvirus 6, 7 or 8), hepadnavirus (HBV), papovavirus (HPV), poxvirus
or
retrovirus (HTLV, HIV).
The subject-matter of the present invention is also a composition
characterized in that it comprises at least one meganuclease with the
exclusion of SEQ
ID NO:5, one or two derived polynucleotide(s), preferably included in
expression
vector(s), as defined above.
In a preferred embodiment of said composition, it comprises a
targeting DNA construct comprising the sequence which repairs the site of
interest
flanlced by sequences sharing homologies with the targeted locus as defined
above.
Preferably, said targeting DNA construct is either included in a recombinant
vector or
it is included in an expression vector comprising the polynucleotide(s)
encoding the
meganuclease, as defined in the present invention.
The subject-matter of the present invention is also products
containing at least a meganuclease with the exclusion of SEQ ID NO: 5, or one
or two
expression vector(s) encoding said meganuclease, and a vector including a
targeting
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
24
construct, as defined above, as a combined preparation for simultaneous,
separate or
sequential use in the prevention or the treatment of a genetic disease.
For purposes of therapy, the meganuclease and a
pharmaceutically acceptable excipient are administered in a therapeutically
effective amount. Such a combination is said to be administered in a
"therapeutically effective amount" if the amount administered is
physiologically
significant. An agent is physiologically significant if its presence results
in a
detectable change in the physiology of the recipient. In the present context,
an
agent is physiologically significant if its presence results in a decrease in
the
severity of one or more symptoms of the targeted disease and in a genome
correction of the lesion or abnormality.
In one embodiment of the uses according to the present invention,
the meganuclease is substantially non-immunogenic, i.e., engenders little or
no
adverse immunological response. A variety of methods for ameliorating or
eliminating deleterious immunological reactions of this sort can be used in
accordance with the invention. In a preferred embodiment, the meganuclease is
substantially free of N-formyl methionine. Another way'to avoid unwanted
immunological reactions is to conjugate meganucleases to polyethylene glycol
("PEG") or polypropylene glycol ("PPG") (preferably of 500 to 20,000 daltons
average molecular weight (MW)). Conjugation with PEG or PPG, as described by
Davis et al. (US 4,179,337) for example, can provide non-immunogenic,
physiologically active, water soluble endonuclease conjugates with anti-viral
activity. Similar methods also using a polyethylene-polypropylene glycol
copolymer are described in Saifer et al. (US 5,006,333).
The megaiiuclease can be used either as a polypeptide or as a
polynucleotide construct/vector encoding said polypeptide. It is introduced
into
cells, in vitro, ex vivo or in vivo, by any convenient means well-known to
those in
the art, which are appropriate for the particular cell type, alone or in
association
with either at least an appropriate vehicle or carrier and/or with the
targeting DNA.
Once in a cell, the meganuclease and if present, the vector comprising
targeting
DNA and/or nucleic acid encoding a meganuclease are imported or translocated
by
the cell from the cytoplasm to the site of action in the nucleus.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
The meganuclease (polypeptide) may be advantageously associated
with: liposomes, polyethyleneimine (PEI), and/or membrane translocating
peptides
(Bonetta, The Scientist, 2002, 16, 38; Ford et al., Gene Ther., 2001, 8, 1-4 ;
Wadia
and Dowdy, Curr. Opin. Biotechnol., 2002, 13, 52-56); in the latter case, the
sequence
5 of the ineganuclease fused with the sequence of a membrane translocating
peptide
(fusion protein).
Vectors comprising targeting DNA and/or nucleic acid encoding a
meganuclease can be introduced into a cell by a variety of methods (e.g.,
injection,
direct uptake, projectile bombardment, liposomes, electroporation).
Meganucleases
10 can be stably or transiently expressed into cells using expression vectors.
Techniques
of expression in eukaryotic cells are well known to those in the art. (See
Current
Protocols in Human Genetics: Chapter 12 "Vectors For Gene Therapy" & Chapter
13
"Delivery Systems for Gene Therapy"). Optionally, it may be preferable to
incorporate a nuclear localization signal into the recombinant protein to be
sure that it
15 is expressed within the nucleus.
The uses of the meganuclease and the methods of using said
meganucleases according to the present invention include also the use of the
poly-
nucleotide(s), vector(s), cell, transgenic plant or non-human transgenic
mammal
encoding said meganuclease, as defined above.
20 According to another advantageous embodiment of the uses and
methods according to the present invention, said meganuclease,
polynucleotide(s),
vector(s), cell, transgenic plant or non-human transgenic mammal are
associated with
a targeting DNA construct as defined above. Preferably, said vector encoding
the
monomer(s) of the meganuclease, comprises the targeting DNA construct, as
defined
25 above.
The invention concerns also a first method for engineering I-CreI
variants able to cleave a genomic DNA target sequence from a gene of interest,
comprising at least the steps of:
(a1) constructing a first series of variants having at least one
substitution in a first functional subdomain of the LAGLIDADG core domain
situated
from positions 26 to 40 of I-Cr=eI,
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
26
(bl) constructing a second series of I-Crel variants having at least one
substitution in a second functional subdomain of the LAGLIDADG core domain
situated from positions 44 to 77 of I-Crel,
(cl) selecting and/or screening the variants from the first series of
step (al) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions -10 to -8 of the I-Crel site has been replaced with the
nucleotide triplet
which is present in positions -10 to -8 of said genomic target and (ii) the
nucleotide
triplet in positions +8 to +10 has been replaced with the reverse
complementary
sequence of the nucleotide triplet which is present in positions -10 to -8 of
said
genomic target,
(di) selecting and/or screening the variants from the second series of
step (b1) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions -5 to -3 of the I-Crel site has been replaced with the nucleotide
triplet
which is present in positions -5 to -3 of said genomic target and (ii) the
nucleotide
triplet in positions +3 to +5 has been replaced with the reverse complementary
sequence of the nucleotide triplet which is present in positions -5 to -3 of
said
genomic target,
(el) selecting and/or screening the variants from the first series of
step (al) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions +8 to +10 of the I-Crel site has been replaced with the
nucleotide triplet
which is present in positions +8 to +10 of said genomic target and (ii) the
nucleotide
triplet in positions -10 to -8 has been replaced with the reverse
complementary
sequence of the nucleotide triplet which is present in positions +8 to +10 of
said
genomic target,
(fl) selecting and/or screening the variants from the second series of
step (b) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions +3 to +5 of the I-Cf=eI site has been replaced with the
nucleotide triplet
which is present in positions +3 to +5 of said genomic target and (ii) the
nucleotide
triplet in positions -5 to -3 has been replaced with the reverse complementary
sequence of the nucleotide triplet which is present in positions +3 to +5 of
said
genomic target,
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
27
(gi) combining in a single variant, the mutation(s) in positions 26 to
40 and 44 to 77 of two variants from step (ci) and step (di), to obtain a
novel
homodimeric I-CreI variant which cleaves a sequence wherein (i) the nucleotide
triplet in positions -10 to -8 is identical to the nucleotide triplet which is
present in
positions -10 to -8 of said genomic target, (ii) the nucleotide triplet in
positions +8 to
+10 is identical to the reverse complementary sequence of the nucleotide
triplet which
is present in positions -10 to -8 of said genomic target, (iii) the nucleotide
triplet in
positions -5 to -3 is identical to the nucleotide triplet which is present in
positions -5 to
-3 of said genomic target and (iv) the nucleotide triplet in positions +3 to
+5 is identi-
cal to the reverse complementary sequence of the nucleotide triplet which is
present in
positions -5 to -3 of said genomic target,
(hl) combining in a single variant, the mutation(s) in positions 26 to
40 and 44 to 77 of two variants from step (el) and step (fl), to obtain a
novel
homodimeric I-CreI variant which cleaves a sequence wherein (i) the nucleotide
triplet in positions +3 to +5 is identical to the nucleotide triplet which is
present in
positions +3 to +5 of said genomic target, (ii) the nucleotide triplet in
positions -5 to -
3 is identical to the reverse complementary sequence of the nucleotide triplet
which is
present in positions +3 to +5 of said genomic target, (iii) the nucleotide
triplet in posi-
tions +8 to +10 of the I-Cr eI site has been replaced with the nucleotide
triplet which is
present in positions +8 to +10 of said genomic target and (iv) the nucleotide
triplet in
positions -10 to -8 is identical to the reverse complementary sequence of the
nucleo-
tide triplet in positions +8 to +10 of said genomic target,
(ij) introducing in the variants from step (gl) and/or (hi), at least one
mutation in the final C-terminal loop, preferably a substitution in position
138, 139,
142 or 143 of I-CreI, as defined above,
(j1) combining the variants obtained in steps (gi), (hi) and/or (il) to
form heterodimers, and
(kl) selecting and/or screening the heterodimers from step (j1) which
are able to cleave said genomic DNA target situated in a gene of interest.
Alternatively, the I-Cr=eI variant according to the invention may be
obtained by a second method for engineering I-CreI variants able to cleave a
genomic
DNA target sequence from a gene of interest, comprising at least the steps of:
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
28
(a2) constructing a first series of I-CreI variants having at least one
substitution in a first functional subdomain of the LAGLIDADG core domain
situated
from positions 26 to 40 of I-Crel and one mutation in the final C-terminal
loop,
preferably a substitution in position 138, 139, 142 or 143 of I-Crel, as
defined above,
(b2) constructing a second series of I-Cr=eI variants having at least
one substitution in a second functional subdomain of the LAGLIDADG core domain
situated from positions 44 to 77 of I-CreI and one mutation in the final C-
terminal
loop, preferably a substitution in position 138, 139, 142 or 143 of I-Crel, as
defined
above, with the proviso that at least one of the two series of I-CreI variants
comprise
at least one mutation in the final C-terminal loop,
(ca) selecting and/or screening the variants from the first series of
step (a2) which are able to cleave a mutant I-CreI site wherein (i) the
nucleotide triplet
in positions -10 to -8 and eventually at least one of the nucleotide
doublet(s) in
positions -12 to -11, -7 to -6 and/or -2 to -1 of the I-Crel site have been
replaced,
respectively with the nucleotide triplet which is present in positions -10 to -
8 and the
nucleotide doublet which is present in positions -12 to -11, -7 to -6 and/or -
2 to -1 of
said genomic target (ii) the nucleotide triplet in positions +8 to +10 and
eventually at
least one of the nucleotide doublet(s) in positions +1 to +2, +6 to +7, and/or
+11 to
+12 have been replaced with the reverse complementary sequence of
respectively, the
nucleotide triplet which is present in positions -10 to -8 and the nucleotide
doublet
which is present in positions -12 to -11, -7 to -6 and/or -2 to -1 of said
genomic target,
(d2) selecting and/or screening the variants from the second series of
step (b2) which are able to cleave a mutant I-CreI site wherein (i) the
nucleotide triplet
in positions -5 to -3 and eventually at least one of the nucleotide doublet(s)
in
positions -12 to -11, -7 to -6 and/or -2 to -1 of the I-CreI site have been
replaced
respectively with the nucleotide triplet which is present in positions -5 to -
3 and the
nucleotide doublet which is present in positions -12 to -11, -7 to -6 and/or -
2 to -1 of
said genomic target and (ii) the nucleotide triplet in positions +3 to +5 and
eventually
at least one of the nucleotide doublet(s) in positions +1 to +2, +6 to +7,
and/or +11 to
+12 have been replaced with the reverse complementary sequence of respectively
the
nucleotide triplet which is present in positions -5 to -3 and the nucleotide
doublet
which is present in positions -12 to -11, -7 to -6 and/or -2 to -1 of said
genomic target,
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
29
with the proviso that at least one of the two mutant I-Crel sites in step (c)
and (d) have
mutation(s) in at least one of the nucleotide doublet(s) in position -12 to -
11, -7 to -6
and/or -2 to -1 and at least one of the corresponding nucleotide doublet (s)
in positions
+1 to +2, +6 to +7, and/or +11 to +12 of the I-Crel site,
(e2) selecting and/or screening the variants from the first series of
step (a2) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions +8 to +10, and eventually at least one of the nucleotide
doublet(s) in
positions +1 to +2, +6 to +7, and/or +I 1 to +12 of the I-Crel site have been
replaced
respectively with the nucleotide triplet which is present in positions +8 to
+10, and the
nucleotide doublet which is present in positions +1 to +2, +6 to +7, and/or
+11 to +12
of said genomic target and (ii) the nucleotide triplet in positions -10 to -8
and
eventually the nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -
2 to -1
have been replaced with the reverse complementary sequence of respectively the
nucleotide triplet which is present in positions +8 to +10, and the nucleotide
doublet
which is present in positions +1 to +2, +6 to +7, and/or +11 to +12 of said
genomic
target,
(f2) selecting and/or screening the variants from the second series of
step (b2) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions +3 to +5, and eventually the nucleotide doublet(s) in positions
+1 to +2,
+6 to +7, and/or +11 to +12 of the I-Crel site, have been replaced
respectively with
the nucleotide triplet which is present in positions +3 to +5, and the
nucleotide
doublet(s) which is present in positions +1 to +2, +6 to +7, and/or +11 to +12
of said
genomic target and (ii) the nucleotide triplet in positions -5 to -3, and
eventually the
nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 have
been
replaced with the reverse complementary sequence of, respectively the
nucleotide
triplet which is present in positions +3 to +5, and the nucleotide doublet(s)
in positions
+1 to +2, +6 to +7, and/or +11 to +12 of said genomic target, with the proviso
that at
least one of the two mutant I-Crel sites in step (e) and (f) have mutation(s)
in at least
one of the nucleotide doublet(s) in positions +1 to +2, +6 to +7, and/or +11
to +12 and
at least one of the corresponding nucleotide doublet (s) in positions in
positions -12 to
-11, -7 to -6 and/or -2 to -1 of the I-Crel site,
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
(ga) combining in a single variant, the mutation(s) in positions 26 to
40, 44 to 77 and in the final C-terminal loop of two variants from step (c2)
and step
(d2), to obtain a novel homodimeric I-Crel variant which cleaves a sequence
wherein
(i) the nucleotide triplet in positions -10 to -8 and the nucleotide
doublet(s) in
5 positions -12 to -11, -7 to -6 and/or -2 to -1 are identical, respectively
to the nucleotide
triplet which is present in positions -10 to -8, and the nucleotide doublet(s)
in
positions -12 to -11, -7 to -6 and/or -2 to -1 of said genomic target, (ii)
the nucleotide
triplet in positions +8 to +10 and the nucleotide doublet(s) in positions +1
to +2, +6 to
+7, and/or +11 to +12 are identical to the reverse complementary sequence of,
10 respectively the nucleotide triplet which is present in positions -10 to -8
and the
nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 of
said genomic
target, (iii) the nucleotide triplet in positions -5 to -3 is identical to the
nucleotide
triplet which is present in positions -5 to -3 of said genomic target and (iv)
the
nucleotide triplet in positions +3 to +5 is identical to the reverse
complementary
15 sequence of the nucleotide triplet which is present in positions -5 to -3
of said
genomic target,
(h2) combining in a single variant, the mutation(s) in positions 26 to
40, 44 to 77 and in the final C-terminal loop of two variants from step (e2)
and step
(f2), to obtain a novel homodimeric I-Crel variant which cleaves a sequence
wherein
20 (i) the nucleotide triplet in positions +3 to +5 and the nucleotide
doublet(s) in
positions +1 to +2, +6 to +7, and/or +11 to +12 are identical, respectively to
the
nucleotide triplet which is present in positions +3 to +5 and the nucleotide
doublet(s)
in positions +1 to +2, +6 to +7, and/or +11 to +12 of said genomic target,
(ii) the
nucleotide triplet in positions -5 to -3 and the nucleotide doublet(s) in
positions -12 to
25 -11, -7 to -6 and/or -2 to -1 are identical to the reverse complementary
sequence of,
respectively the nucleotide triplet which is present in positions +3 to +5 and
the
nucleotide doublet(s) present in positions +1 to +2, +6 to +7, and/or +11 to
+12 of said
genomic target, (iii) the nucleotide triplet in positions +8 to +10 of the I-
Crel site has
been replaced with the nucleotide triplet which is present in positions +8 to
+10 of
30 said genomic target and (iv) the nucleotide triplet in positions -10 to -8
is identical to
the reverse complementary sequence of the nucleotide triplet in positions +8
to +10 of
said genomic target,
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
31
(i2) combining the variants obtained in steps (g2) and (h2) to form
heterodimers, and
02) selecting and/or screening the heterodimers from step (i2) which
are able to cleave said genomic DNA target situated in a gene of interest.
According to yet another alternative, the I-Crel variant of the
invention may be obtained by a third method for engineering I-Crel variants
able to
cleave a genomic DNA target sequence from a gene of interest, comprising at
least the
steps of:
(a3) constructing a first series of variants having at least one
substitution in a first functional subdomain of the LAGLIDADG core domain
situated
from positions 26 to 40 of I-Cre1,
(b3) constructing a second series of I-Crel variants having at least one
substitution in a second functional subdomain of the LAGLIDADG core domain
situated from positions 44 to 77 of I-CreI,
(c3) constructing a third series of variants having at least one
mutation in the final C-terminal loop, preferably a substitution in position
138, 139,
142 or 143 of I-CreI, as defined above,
(d3) selecting and/or screening the variants from the first series of
step (a3) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions -10 to -8 of the I-Crel site has been replaced with the
nucleotide triplet
which is present in positions -10 to -8 of said genomic target and (ii) the
nucleotide
triplet in positions +8 to +10 has been replaced with the reverse
complementary
sequence of the nucleotide triplet which is present in positions -10 to -8 of
said
genomic target,
(e3) selecting and/or screening the variants from the second series of
step (b3) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions -5 to -3 of the I-CreI site has been replaced with the nucleotide
triplet
which is present in positions -5 to -3 of said genomic target and (ii) the
nucleotide
triplet in positions +3 to +5 has been replaced with the reverse complementary
sequence of the nucleotide triplet which is present in positions -5 to -3 of
said
genomic target,
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
32
(f3) selecting and/or screening the variants from the third series of
step (C3) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide
doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 of the I-CreI
site has been
replaced with the nucleotide triplet which is present in positions -12 to -11,
-7 to -6
and/or -2 to -1, respectively, of said genomic target and (ii) the nucleotide
doublet(s)
in positions +1 to +2 ,+6 to +7, and/or +11 to +12 has been replaced with the
reverse
complementary sequence of the nucleotide triplet which is present in positions
-2 to -
1, -7 to -6, and/or -12 to -11, respectively, of said genomic target,
(g3) selecting and/or screening the variants from the first series of
step (a3) which are able to cleave a mutant I-CreI site wherein (i) the
nucleotide triplet
in positions +8 to +10 of the I-Crel site has been replaced with the
nucleotide triplet
which is present in positions +8 to +10 of said genomic target and (ii) the
nucleotide
triplet in positions -10 to -8 has been replaced with the reverse
complementary
sequence of the nucleotide triplet which is present in positions +8 to +10 of
said
genomic target,
(h3) selecting and/or screening the variants from the second series of
step (b3) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions +3 to +5 of the I-Crel site has been replaced with the nucleotide
triplet
which is present in positions +3 to +5 of said genomic target and (ii) the
nucleotide
triplet in positions -5 to -3 has been replaced with the reverse complementary
sequence of the nucleotide triplet which is present in positions +3 to +5 of
said
genomic target,
(i3) selecting and/or screening the variants from the third series of
step (c3) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide
doublet(s) in positions +1 to +2, +6 to +7, and/or +11 to +12 of the I-Crel
site has
been replaced with the nucleotide doublet(s) which is present in positions +1
to +2, +6
to +7, and/or +11 to +12, respectively, of said genomic target and (ii) the
nucleotide
doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 has been replaced
with the
reverse complementary sequence of the nucleotide doublet which is present in
positions +11 to +12, +6 to +7, and/or +l to +2, respectively, of said genomic
target,
03) combining in a single variant, the mutation(s) in positions 26 to
40, 44 to 77 and in the final C-terminal loop of three variants from step (d3)
(e3) and
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
33
(f3), to obtain a novel homodimeric I-CreI variant which cleaves a sequence
wherein
(i) the nucleotide triplet in positions -10 to -8 is identical to the
nucleotide triplet
which is present in positions -10 to -8 of said genomic target, (ii) the
nucleotide triplet
in positions +8 to +10 is identical to the reverse complementary sequence of
the
nucleotide triplet which is present in positions -10'to -8 of said genomic
target, (iii)
the nucleotide triplet in positions -5 to -3 is identical to the nucleotide
triplet which is
present in positions -5 to -3 of said genomic target and (iv) the nucleotide
triplet in
positions +3 to +5 is identical to the reverse complementary sequence of the
nucleotide triplet which is present in positions -5 to -3 of said genomic
target, (v) the
nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 is
identical to the
nucleotide triplet which is present in positions -12 to -11, -7 to -6 and/or -
2 to -1,
respectively, -of said genomic target, (vi) the nucleotide doublet(s) in
positions +1 to
+2 ,+6 to +7, and/or +11 to +12 is identical to the reverse complementary
sequence of
the nucleotide doublet(s) which is present in positions -2 to -1, -7 to -6,
and/or -12 to -
11, respectively, of said genomic target,
(k3) combining in a single variant, the mutation(s) in positions 26 to
40, 44 to 77 and in the final C-terminal loop of three variants from step (g3)
(h3) and
(i3), to obtain a novel homodimeric I-Crel variant which cleaves a sequence
wherein
(i) the nucleotide triplet in positions +3 to +5 is identical to the
nucleotide triplet
which is present in positions +3 to +5 of said genomic target, (ii) the
nucleotide triplet
in positions -5 to -3 is identical to the reverse complementary sequence of
the
nucleotide triplet which is present in positions +3 to +5 of said genomic
target, (iii)
the nucleotide triplet in positions +8 to +10 of the I-CreI site has been
replaced with
the nucleotide triplet which is present in positions +8 to +10 of said genomic
target
and (iv) the nucleotide triplet in positions -10 to -8 is identical to the
reverse
complementary sequence of the nucleotide triplet in positions +8 to +10 of
said
genomic target, (v) the nucleotide doublet(s) in positions +1 to +2 ,+6 to +7,
and/or
+11 to +12 is identical to the nucleotide doublet(s) which is present in
positions +1 to
+2 ,+6 to +7, and/or +11 to +12, respectively of said genomic target, (vi) the
nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 is
identical to the
reverse complementary sequence of the nucleotide doublet(s) which is present
in
positions +11 to +12, +6 to +7, and/or +1 to +2, respectively of said genomic
target,
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
34
(13) combining the variants obtained in steps 03) and (k3) to form
heterodimers, and
(ml) selecting and/or screening the heterodimers from step (13) which
are able to cleave said genomic DNA target situated in a gene of interest.
The steps (ai), (a2), (bi), (b2), (a3), (b3), (cA (gi), (g2), (hi), (h2),
(ij),
03), and (k3) may comprise the introduction of additional mutations in order
to
improve the binding and/or cleavage properties of the mutants, particularly at
other
positions contacting the DNA target sequence or interacting directly or
indirectly with
said DNA target. These steps may be performed by generating a combinatorial
library
as described in the International PCT Application WO 2004/067736, Arnould et
al., J.
Mol. Biol., 2006, 355, 443-458 and Smith et al., Nucleic Acids Research, Epub
27
November 2006.
Steps (g1), (g2), (hl), (h2), (i1), 03) and (k3), may further comprise the
introduction of random mutations on the whole variant or in a part of the
variant, in
particular the C-terminal half of the variant (positions 80 to 163). This may
be
performed by generating random mutagenesis libraries on a pool of variants,
according to standard mutagenesis methods which are well-known in the art and
commercially available.
Step (il) may also comprise the selection and/or screening of the
homodimers which are able to cleave a sequence wherein the nucleotide doublet
in
positions +1 to +2, +6 to +7 and/or +11 to +12 is identical to the nucleotide
doublet
which is present in positions +l to +2, +6 to +7 and/or +11 to +12,
respectively of said
genomic target, and the nucleotide doublet in positions -12 to -11, -7 to -6,
and/or -2
to -1 is identical to the reverse complementary sequence of the nucleotide
triplet
which is present in positions +11 to +12, +6 to +7, and/or +1 to +2,
respectively of
said genomic target.
The (intramolecular) combination of mutations in steps (gi), (g2),
(hi), (ha), 03) and (k3) may be performed by amplifying overlapping fragments
comprising each of the two subdomains, according to well-known overlapping PCR
techniques, as described for example in Smith et aL, Nucleic Acids Res., Epub
27
November 2006.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
The (intermolecular) combination of the variants in step 61), (i2) and
(13) is performed by co-expressing one variant from step (g1), (g2) or (il),
(j3) with one
variant from step (hi), (h2) or (il), (k3), respectively, so as to allow the
formation of
heterodimers. For example, host cells may be modified by one or two
recombinant
5 expression vector(s) encoding said variant(s). The cells are then cultured
under condi-
tions allowing the expression of the variant(s), so that heterodimers are
formed in the
host cells, as described previously in Arnould et al., J. Mol. Biol., 2006,
355, 443-458;
International PCT Applications WO 2006/097853, WO 2006/097854 and WO
2006/097784; Smith et al., Nucleic Acids Res., Epub 27 November 2006.
10 The selection and/or screening steps may be performed by using a
cleavage assay in vitro or in vivo, as defined above. Preferably, it is
performed in vivo,
under conditions where the double-strand break in the mutated DNA target
sequence
which is generated by said variant leads to the activation of a positive
selection marker
or a reporter gene, or the inactivation of a negative selection marker or a
reporter
15 gene, by recombination-mediated repair of said DNA double-strand break, as
defined
above.
The subject-matter of the present invention is also the use of at least
one meganuclease, as defined above, as a scaffold for making other
meganucleases.
For example other rounds of mutagenesis and selection/screening can be
performed on
20 the variant, for the purpose of making novel homing endonucleases.
The subject-matter of the present invention is also a method for
decreasing the toxicity of a parent LAGLIDADG homing endonuclease, comprising
:
the mutation of at least one amino acid of the final C-terminal loop of said
parent
LAGLIDADG homing endonuclease.
25 According to an advantageous embodiment of said method the parent
endonuclease is I-CreI or a functional variant thereof. Preferably, the K139
and/or
T143 residues are mutated. More preferably K139 is mutated in an hydrophobic
amino acid such as a methionine (K139M) and/or T143 is mutated in a small
amino
acid such as a glycine (T143G).
30 The polynucleotide fragments having the sequence of the targeting
DNA construct or the sequence encoding the meganuclease variant or single-
chain
meganuclease derivative as defined in the present invention, may be prepared
by any
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
36
method known by the man skilled in the art. For example, they are amplified
from a
DNA template, by polymerase chain reaction with specific primers. Preferably
the
codons of the cDNAs encoding the megaunclease variant or single-chain
meganuclease derivative are chosen to favour the expression of said proteins
in the
desired expression system.
The recombinant vector comprising said polynucleotides may be
obtained and introduced in a host cell by the well-known recombinant DNA and
genetic engineering techniques.
The meganuclease variant or single-chain meganuclease derivative
as defined in the present the invention are produced by expressing the
polypeptide(s)
as defined above; preferably said polypeptide(s) are expressed or co-expressed
(in the
case of the variant only) in a host cell or a transgenic animal/plant modified
by one
expression vector or two expression vectors (in the case of the variant only),
under
conditions suitable for the expression or co-expression of the polypeptide(s),
and the
meganuclease variant or single-chain meganuclease derivative is recovered from
the
host cell culture or from the transgenic animal/plant.
The practice of the present invention will employ, unless otherwise
indicated, conventional techniques of cell biology, cell culture, molecular
biology,
transgenic biology, microbiology, recombinant DNA, and immunology, which are
within the skill of the art. Such techniques are explained fully in the
literature. See, for
example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000,
Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory
Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York:
Cold
Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait ed.,
1984);
Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D.
Harries & S.
J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J.
Higgins
eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc.,
1987);
Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide
To
Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J. Abelson and
M. Simon, eds.-in-chief, Academic Press, Inc., New York), specifically,
Vols.154 and
155 (Wu et al. eds.) and Vol. 185, "Gene Expression Technology" (D. Goeddel,
ed.);
Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds.,
1987,
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
37
Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular
Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of
Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds.,
1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory
Press,
Cold Spring Harbor, N.Y., 1986).
In addition to the preceding features, the invention further comprises
other features which will emerge from the description which follows, which
refers to
examples illustrating I-CreI meganuclease variants and their uses according to
the
invention, as well as to the appended drawings in which:
- figure 1 represents the superposition of the Ca ribbon
representation of the I-CreI and I-Crel-DNA structures. DNA has been omitted
for
clarity.
-figure 2 represents the sequence alignment of the C-terminal region
from members of the I-CreI family (Lucas et al., Nucleic Acids Res., 2001, 29,
960-
969). The position of the mutated residues in the SKTRKTT motif is indicated
with a
grey triangle (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi).
- figure 3 represents a detailed view of S138, K139, K142 and T143
contacts with the DNA backbone (a) and the comparison of the positions of
S138,
K139, K142 and T143 between the bound and unbound DNA structures (b).
- figure 4 illustrates the biophysical characterization of the I-CreI C-
terminal region mutants. a) Circular dichroism thermal denaturation. b)
Monodimensional H-H NMR spectra.
- figure 5 illustrates dimer formation by the I-CreI C-terminal region
mutants, measured by analytical ultracentrifugation. Sedimentation velocity
distribution of the I-Crel proteins (1 mg/ml in PBS buffer) at 42,000 rpm and
20 C.
Inset, sedimentation equilibrium gradient of I-CreI proteins (4 mg/inl in PBS
buffer)
at 11,000 rpm and 20 C. Open circles represent the experimental data, the two
solid
lines represent the theoretical gradients of a I-CreI monomer (20,045) and
dimer
(41,000).
- figure 6 represents electrophoretic mobility shift assays of the C-
terminal truncated, double and single mutants in the presence of MgZ+ and
Caa+.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
38
- figure 7 is a summary of the gel in vitro cleavage assay of the C-
terminal truncated, double and single mutants.
- figure 8 illustrates the in vivo cleavage assay used for profiling the
single mutants and the l ONNN P DNA target cleavage profile of the single
mutants.
a) Yeast screening assay principle. A strain harboring the expression vector
encoding
a single mutant is mated with a strain harboring a reporter plasmid. In the
reporter
plasmid, a LacZ reporter gene is interrupted with an insert containing one of
the target
sites of interest, flanlced by two direct repeats. Upon mating, the
meganuclease (grey
oval) generates a double-strand break at the site of interest, allowing
restoration of a
functional LacZ gene by single-strand annealing (SSA) between the two flanking
direct repeats. The functional LacZ gene is visualized by a blue staining. b)
DNA
targets. The C1221 target (top) is a palindromic target cleaved by I-CreI. All
targets
used in this study are palindromic targets derived from C 1221 by substitution
of six
nucleotides in 8, 9 and 10 (SEQ ID NO: 1 and 10 to 16). A few examples are
shown (bottom). The l OGGG P target differs from the C1221 target by the GGG
triplet in -10, -9, -8 and CCC in +8, +9 and +10. c) Mutant target profiles.
Each
mutant was profiled in yeast on a series of 64 palindromic targets (lONNN P).
An
example of cleavage activity in yeast for a single mutant (K139M) compared to
I-Cf=eI
D75N is presented. Blue staining indicates cleavage. Additionally a
representation of
the lONNN P cleavage profile of all single mutants compared to I-Crel D75N and
I-
Cy-eI. Grey levels reflect the intensity of the signal. I-Crel is toxic in
yeast and profiles
have been established at 30 C instead of 37 C. All other mutants were
studied at
37 C.
- figure 9 illustrates the 5NNN P DNA target cleavage profile of the
single mutants. The targets (64) are palindromic targets with variations in
positions
3 to 5).
- figure 10 illustrates the 2NN DNA target cleavage profile of the
single mutants. The targets (16x16) are non-palindromic targets with
variations in
positions I to 2.
- figure 11 illustrates the 12NN P DNA target (A) and 7NN P DNA
target (B) cleavage profiles of the single mutants. The targets in A (16) and
B (16) are
palindromic targets with variations in positions 11 to 12 and 6 to 7,
respectively.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
39
Example 1: Structural differences between the bound and unbound I-CreI DNA
structures
1) Materials and Methods
a) Protein expression, purification and crystallization
Protein expression and purification was performed as in (Arnould et
al., J. Mol. Biol., 2006, 355, 443-458). An initial screening for I-CreI
crystallization
conditions was performed in 96 well plates by vapour-diffusion methods using
the
Hampton crystal screening using drops containing 1 l protein solution (7
mg/ml in 20
mM HEPES, pH 7.5) and 1 l precipitant solution equilibrated against 50 l of
reservoir solution at 20 C. Crystals were obtained under several conditions
(Crystal
Screen 1 conditions 10, 22, 33, 40, 41 and Crystal Screen 2 condition 32).
Crystal was
made by hanging-drop vapour-diffusion methods using VDX plates; optimization
experiments led to the following conditions for crystallization: 1 l protein
at 7 mg/ml
in 20 mM HEPES pH 7.5 and 1 l precipitating buffer containing 20 % PEG 4000,
0.1
M HEPES pH 7.5, 10 % Iso-propanol, 10 % Ethylene glycol and 0.01 M Magnesium
acetate equilibrated against 500 l precipitating buffer at 20 C. Rod-shaped
crystals
grown in 4-8 days and were directly collected and frozen in liquid nitrogen.
b) Data collection, structure solution, model building and refinement
All data were collected at cryogenic temperatures using synchrotron
radiation at 100K. I-Cf-el crystals were mounted and cryoprotected. The data
sets
were collected using synchrotron radiation at the ID14-4 beamline at the ESRF
(Grenoble), and at the PX beamline at the SLS (Villigen). Diffraction data
were
recorded on an ADSC-Q4 or Mar225 CCD detectors depending on the beamline.
Processing and scaling were accomplished with HKL2000 (Otwinowski, Z. and
Minof=, W.: Processing of X-ray Diffraction Data Collected in Oscillation
Mode, In
Methods in Enzyrnology, 1997, Academic Press, New York). The structure was
solved
using the molecular replacement method as implemented in the program MOLREP
(Vagin, A. and Teplyakov, A. Acta Crystallogr. D Biol. Crystallogr., 2000, 56
Pt 12,
1622-1624).
2) Results
The structure of the I-Crel was solved by molecular replacement and
refinement to 2.OA resolution. The best data set (Table I) was collected using
a
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
OcP =1 and a wavelength of 0.97 A. Statistics for the crystallographic data
are
summarized in Table I. The search model was based on a poly-alanine backbone
derived from the PDB lgz9 found in the Protein Data Bank. The coordinates from
the
DNA were deleted in the search model. A refined 2Fo-Fc map showed clear and
5 contiguous electron density for the protein backbone and for many of the
side-chains.
ARP/wARP and REFMAC5 were applied for automatic model building and
refinement to 2.0 A (Table I).
Table I: Data collection and refinement statistics
Data Collection
Space group P43
Number of crystals 1
Temperature (K) 100
Wavelength (A) 0.97
Cell dimensions (A, a=b=69.088, c=93.040
a =90
No. mol ASU 2
Data collection environment, beamline ADSC-Q4, ID14-4 ESRF
Completeness (%) 93.2
Multiplicity 5.3
Rs m % 6
Refinement
No Reflections 25943
Resolution range (A) 34.54-2.00
R-factor / R-free (%) 18/23
No protein atoms (Average B, A
No water molecules (Average B, A
r.m.s bond length (A) 0.029
r.m.s. bond angle 2.137
Ramachandran plot outliers number 0
10 The dimer without DNA allowed the observation of the protein
conformational changes upon DNA binding after comparison with the protein-DNA
complex (PDB code lgz9) (Figure 1). The most striking differences are in the C-
terminal region conformation. Whereas in the DNA bound structure the C-helix
and
the C-loop are aligned with the DNA, in the unbound structure both elements
are
15 located on top of the cavity where the DNA binds, suggesting that the loop
and the C-
helix could work as a lock opening and closing the DNA binding groove. This
region
was not observed in a previous structure of I-Cf=el with only one monomer in
the
asymmetric unit (Heath et al., Nat Struct Biol, 1997, 4, 468-476). Besides,
the C-
terminal domain of I-CreI is well conserved among homodimeric proteins from
the
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
41
LAGLIDADG family (Lucas et al., Nucleic Acids Res., 2001, 29, 960-969)
indicating
its important role in this meganuclease group working mechanism (Figure 2). A
detailed view of the protein-DNA interactions in the C-terminal area showed
that
Ser138, Lys139, Lys142 and Thr143 at the SKTRKTT motif are involved in
hydrogen
bonds with the DNA baclcbone (Figure 3a). The position of these residues is
completely different in the unbound DNA state (Figure 3b), indicating that a
conformational change is needed to bind the nucleic acid. Although these
interactions
were described before (Chevalier et al., J. Mol. Biol., 2003, 329, 253-269)
and the
amino acids are conserved, there is no information about their role during
meganuclease action.
Example 2: Biophysical analysis
1) Materials and Methods
a) Construction of the I-Crel mutants
The I-Crel deletion mutants (Al and A2) were amplified by PCR on
the wild-type I-Crel (I-CreI D75) cDNA template, with the forward primer 5'
gatataccatggccaataccaaatataac 3' (SEQ ID NO: 18) for both mutants and the
reverse
primer ICrel deltaCter-R: 5' ttatcagtcggccgcatcgttcagagctgcaatctgatccacccagg
3'
(SEQ ID NO: 19) for the Al mutant or Creh2: 5'
gagtgcggccgcagtggttttacgcgtcttagaatcg 3' (SEQ ID NO: 20) for theA2 mutant.
The I-Crel single and double mutants were amplified by round-the-
world PCR with a Quickchange kit (STRATAGENE # 200518), appropriate
mutagenizing oligos and the wild-type I-Crel (I-CreI D75) eDNA as template.
b) Circular Dichroism thermal analysis
Data were acquired with a Jasco 810 model dichrograph, previously
calibrated with d-10-camphorsulphonic acid, and equipped with a Jasco Peltier
thermoelectric temperature controller CDF-426S model. Experiments were
performed
in PBS at 1 C/min intervals. The protein concentration was 10 M. The
ellipticity at
222 nm was followed from 5 to 95 C in a 2 mm Hellma 110-QS cell.
c) Analytical utracentrifugation
Sedimentation equilibrium experiments were performed at 20 C in
an Optima XL-A (Beckman-Coulter) analytical ultracentrifuge equipped with UV-
visible optics, using an An50Ti rotor, with 3,mm double sector centerpieces of
Epon
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
42
charcoal. Protein concentration was 200 M in PBS buffer. Short column (23
l), low
speed sedimentation equilibrium was performed at three successive speeds
(11,000,
13,000, and 15,000 rpm), the system was assumed to be at equilibrium when
successive scans overlaid and the equilibrium scans were obtained at
wavelength of
280 nm. The base-line signal was measured after high speed centrifugation (5 h
at
42,000 rpm). Whole-cell apparent molecular weight of the protein was obtained
using
the program EQASSOC (Minton, A.P., In: Modern Analytical Ultracentrifugation,
1994, Birkhauser Boston, I77c., Cambridge, MA). The partial specific volume of
I-CreI
was 0.7436 ml/g at 20 C, calculated from the amino acid composition with the
program SEDNTERP (retrieved from the RASMB server; Laue, T.M.S, B.D.,
Ridgeway, T.M., Pelletier, S.L., In: Computer-aided interpretation of
analytical
sedimentation data for proteins, 1992, Royal Society of Chemistry, Cambridge,
UK).
The sedimentation velocity experiment was carried out in an XL-A analytical
ultracentrifuge (Beckman-Coulter Inc.) at 42,000 rpm and 20 C, using an
An50Ti
rotor and 1.2mm double-sector centerpieces. Absorbance scans were taken at 280
nm.
The protein concentration was 50 M in PBS. The sedimentation coefficients
were
calculated by continuous distribution c(s) Lamm equation model (Schuck, P.,
Biophys. J., 2000, 78, 1606-1619) as implemented in the SEDFIT program. These
experimental sedimentation values were corrected to standard conditions to get
the
corresponding s20,, values using the SEDNTERP program (Laue, T.M.S:, B.D.,
Ridgeway, TM, Pelletier, S:L., In: Computer-aided interpretation of analytical
sedimentation data for proteins, 1992, Royal Society of Chemistry, Cambridge,
UK).
Further hydrodynamic analysis (i.e. calculation of frictional coefficient
ratio) was
performed with the SEDFIT program to obtain de c(M) distribution (Schuck, P.,
Biophys. J., 2000, 78, 1606-1619).
d) NMR data acquisition
NMR spectra were recorded at 25 C in a Bruker AVANCE 600
spectrometer equipped with a cryoprobe. Protein samples were 500 M in PBS
buffer
(137 mM NaCI, 10 mM NaaHPO4-2H20, 2.7 mM KCI, 2 mM KHaPO4, pH 7.4) plus 5
% 2 H20. DSS (2,2-Dimethyl-2-silapentane-5-sulfonate sodium salt ) was used as
internal proton chemical shift reference.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
43
2) Results
To unravel the role of the C-terminal domain of I-Crel, a series a
series of trimmed, double and single mutants were designed based on the
structural
differences between the bound and unbound DNA structures. The two truncated
mutants were designed to clarify the role of the C-terminal region. I-Crel Al
(amino
acid number 1-137) lacked both the C-loop and the C-Helix whereas I-Crel A2
(aminoacid number 1-144 ) contained the C-loop. Based on the contacts with the
DNA backbone in the SKTRKTT motif, the double mutants I-Crel AM (S 13 8A,
K139M) and I-Crel GG (K142G, T143G) were produced, as well as their single
variants I-Crel S138A, I-Crel K139M, I-Crel K142G, I-Crel T143G. To
demonstrate
that the effect in meganuclease activity was due to the mutations, their
effect in the
protein stability, structure and oligomerization state, was studied. Thermal
denaturation circular dichroism was performed to confirm that all the mutants
were
folded. Indeed, all the mutants displayed a sigmoidal curve similar to the
wild type
(Figure 4a) with different Tm depending on the mutation. In addition,
monodimensional H-H NMR confirmed the thermal denaturation experiments, a well
defined dispersion of peaks in the amide region demonstrated that all the
mutants were
folded (Figure 4b). It is well known that the I-Crel family of meganucleases
binds
DNA as homodimers, therefore to analyze the oligomerization state of the
mutants
they were subjected to analytical ultracentrifugation. The experiment showed
that all
the mutants behaved as dimers independently of the mutation, with only little
variations corresponding to their molecular weights (Figure 5).
Altogether these experiments indicate that the mutants are folded and
conserve the I-Crel scaffold involved in meganuclease activity.
Example 3: DNA-binding activity the C-terminal mutants
1) Materials and Methods
Band shift assay conditions
Band shift assays were performed in 10 mM Tris-HCI pH 8, 50 mM
NaCI, 10 mM CaCla or MgC12, 1 mM DTT incubated 1 h at room temperature using
5 M (0.0793 g/ l) 6-FAM duplex (SEQ ID NO: 21; see figure 6) and 20 M
(0.463
gg/ l) protein and electrophoresed in a 15 % Acrylamide-TBE gel.
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
44
2) Results
Electrophoretic mobility shift assays (EMSA) in the presence of
Mg2+ and Ca2+ were used to analyze the behavior of the C-terminal mutants in
DNA
binding (Figure 6). Whereas the presence of Ca2+ allows DNA binding, Mg2+ is
indispensable to bind and cleave DNA (Chevalier et al., Biochemistry, 2004,
43,
14015-14026). Even though the binding capability of I-CreI was abolished in
the Al
mutant, the A2 was able to bind the labeled DNA probe demonstrating that the C-
loop
is essential in DNA binding. In addition, binding was detected in the presence
of both
cations as in the wild type I-Crel.
On the other hand, both I-Crel AM and I-CreI GG double mutants
were severely affected in their DNA binding properties independently of the
cation
present, indicating that Ser138, Lys139, Lys142 and Thr143 contacts with the
DNA
backbone are crucial to bind the nucleic acid. Therefore, these residues in
the
SKTRKTT motif constitute two new hot-spots essential for I-CNel DNA binding.
To define the distinct properties of each site in the C-loop, the single
mutants were assayed by EMSA in the same conditions. In contrast with the
double
mutants all the single ones were able to bind the labeled probe; however they
displayed differences depending of the cation present in the assay. Whereas a
clear
dependence of Mg could be observed in the Serl38-Lys139 site, the single
mutants in
the Lys142-Thr143 site could bind DNA notwithstanding the cation present in
the
mobility assay.
Thus, the mutation of both residues in each site is needed to abolish
DNA binding, indicating that a synergy between the two residues in each hot-
spot is
essential for DNA binding.
Example 4: DNA-cleavage activity of the C-terminal mutants, in vitro
1) Materials and Methods
In vitro cleavage assay conditions
Cleavage assays were perfoi7ned at 37 C in 10 mM Tris-HCl (pH 8),
50 mM NaCI, 10 mM MgC12 (or CaCl2) and 1 mM DTT. Concentrations were: 100 ng
for the Xinnl linearized target substrate (pGEM-T Easy C1221 GTC) and 40-
0.25ng
dilutions for I-Cf=eI and helix mutant proteins, in 25 l final volume
reaction. The
linearized target plasmid has 3 kb and after cleavage yields two smaller bands
of 2 kb
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
and 1 kb. Reactions were stopped after 1 hour by addition of 5 1 of 45 %
Glycerol,
95 mM EDTA (pH 8), 1.5 % (w/v) SDS, 1.5 mg/ml Proteinase K and 0.048 % (w/v)
Bromophenol blue (6x Buffer Stop), incubated at 37 C for 30 minutes and
electrophoresed in a 1% agarose gel. The fragments were quantified using SYBR
5 Safe DNA gel staining (IN VITROGEN). Gels were analysed using the ImageJ
software (http://rsb.info.nih.gov/iin to calculate the percentage of cleavage
according
to (21cb+lkb)/(3kb+2kb+lkb)* 100 formula.
2) Results
The analysis of the distinct mutants in the DNA binding assays has
10 clear implications for DNA cleavage activity, consequently an examination
of their
cleavage properties on a wild type DNA sequence was carried out. Figure 7
displays a
graph representing the percentage of cleavage against the amount of HE (Gels
with
raw data are available as supporting information). The mutants can be divided
in two
groups based on the comparison of their cleavage properties to the wild type
HE; the
15 first is composed of the truncated mutants I-CreI A1 and I-CreI A2 and the
double
mutants I-CreI AM and I-CreI GG which are , whereas the single mutants I-CreI
S138A, I-CreI K139M, I-CreI K142G, I-CreI T143G form the second. Members the
first group displayed a reduced cleavage activity when compared to the wild
type I-
CreI. Although I-CreI A 1 and I-CreI GG cleavage properties are completely
abolished,
20 I-CreI A2and I-CreI AM showed a reduced activity that is increased when
higher HE
amounts are used. However the cleavage properties of the single mutants that
composed the second group are not only similar to the wild type, but enhanced
in
some cases (Figure 7).
These results indicate that the trimmed and double mutants whose
25 DNA binding is abolished or severely affected do not cleave DNA or they
need higher
amounts of HE to cleave the plasmid. Noteworthy is the case of the I-Cre A2,
the
mutant that conserves the wild type amino acids in the C-loop but lacks the a6
helix,
even though its cleavage activity is affected the activity profile is the more
similar to
the I-CreI wild type.
30 On the other hand the single mutants depict a slightly enhanced
activity with respect to the wild type in all them. The activity assays
confirm the DNA
binding studies, indicating that the double mutants act in a concerted manner,
however
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
46
the effect of these mutations have implications not only in nucleic acid
binding but
also in DNA cleavage as we have shown.
Example 5: DNA-cleavage activity of the C-terminal mutants, in vivo
1) Materials and Methods
The in vivo cleavage assay (Figure 8a) has been described previously
in PCT Application WO 2004/067736; Epinat et al., Nucleic Acids Res., 2003,
31,
2952-2962; Chames et al., Nucleic Acids Res., 2005, 33, e178, and Arnould et
al., J.
Mol. Biol., 2006, 355, 443-458.
a) Construction of target clones
The C 1221 twenty-four bp target sequence (5'-
tcaaaacgtcgtacgacgttttga-3': SEQ ID NO: 1) is a palindrome of a half-site of
the
natural I-CreI target (5'-tcaaaacgtcgtgagacagtttgg-3': SEQ ID NO: 17). C1221
is
cleaved as efficiently as the I-Crel natural target in vitro and ex vivo in
both yeast and
mammalian cells. The palindromic targets, derived from C1221, were cloned as
previously described (Arnould et al., J. Mol. Biol., 2006, 355, 443-458) using
the
Gateway protocol (Invitrogen) into the reporter vectors: the yeast pFL39-ADH-
LACURAZ and the mammalian vector pcDNA3.1-LACURAZ-DURA, both described
previously (Epinat et al., Nucleic Acids Res., 2003, 31, 2952-2962) and
containing a
I-SceI target site as control. Yeast reporter vectors were transformed into S.
cerevisiae
strain FYBL2-7B (MAT a, ura34851, trpl d63, leu2dl, lys2d202).
b) Screening in yeast
The protocol for screening homodimer mutants is as described
previously (PCT Application WO 2004/067736; Epinat et al., Nucleic Acids Res.,
2003, 31, 2952-2962; Chames et al., Nucleic Acids Res., 2005, 33, e178; Amould
et
al., J. Mol. Biol., 2006, 355, 443-458).
c) Mating of meganuclease expressing clones and screening in yeast
Mating was perfoi7ned using a colony gridder (Qpixll, Genetix).
Mutants were gridded on nylon filters covering YPD plates, using a high
gridding
density (about 20 spots/cma). A second gridding process was performed on the
same
filters to spot a second layer consisting of 64 or 75 different reporter-
harboring yeast
strains for each variant. Membranes were placed on solid agar YPD rich medium,
and
incubated at 30 C for one night, to allow mating. Next, filters were
transferred to
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
47
synthetic medium, lacking leucine and tryptophan, with galactose (2 %) as a
carbon
source, and incubated for five days at 37 C (30 C for I-CreI), to select for
diploids
carrying the expression and target vectors. After 5 days, filters were placed
on solid
agarose medium with 0.02 % X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1
%
SDS, 6 % dimethyl formamide (DMF), 7 mM (3-mercaptoethanol, 1% agarose, and
incubated at 37 C, to monitor 0-galactosidase activity. Results were analyzed
by
scanning and quantification was performed using appropriate software.
2) Results
To confirm the results in vivo cleavage assays were performed with
all the mutants, as well as with the I-Crel and I-Crel D75N proteins, as
described
previously (Arnould et al., J. Mol. Biol., 2006, 355, 443-458).
None of the double mutants or truncated mutants, whose binding and
cleavage activity were affected by the mutations in vitro, displayed activity
on any of
the targets. As an example the I-Crel AM and I-CreI GG are shown (Figure 8c
upper
panel). By contrast, all the single mutants showed high activity on the wild-
type target
(C1221).
- l ONNN P target prof ling_ffiigure &)
All the single mutants showed high activity on the wild-type target
(C 1221), 10AAG P and I OAAT P. Lower levels of cleavage could also be
observed
with these four mutants with lOTCG P and lOAAC P. In addition the I-Crel K139M
mutant was also able to cleave seven additional targets (IOAGT P, 10GAG P,
IOGAA P, IOGAT P, 10CAG P, 10CAA P, 10CAT P) as it can be observed in
figure 8c. The profile of the I-Crel K139M mutant is very similar to I-CreI
(without
its toxicity), while the tliree other single mutants are closer to I-CreI
D75N.
- SNNN P _profiling (figure 9)
The profile of S138A and K139M is similar to the profile of I-Crel
D75N, whereas the profile of K142G and T143G is more restricted than the
profile of
I-CreI D75N.
- 2NN P prof ling (figure 10)
The profile of K142G and S138A is more restricted than the profile
of I-Crel D75N. Compared to D75N, T143G and K139M cleave 6 and 10 additional
targets, respectively, 6 of which are in common. In addition, at least 8
targets are
CA 02678526 2009-08-14
WO 2008/102198 PCT/IB2007/001527
48
cleaved more efficiently by K139M than by D75N. Five targets (2TT 2TG;
2TG 2TT, 2TA 2CT, 2TC_2TC, 2CT 2CT) are not cleaved by K139M; these targets
are cleaved by D75N, although less efficiently than by I Crel.
- 12NN P profling.(Figure 11A)
The profile of K142G and S138A is more restricted than the profile
of I-CreI D75N, with the profile of S138A being more restricted than the
profile of
K142G.
The profile of T143G is similar to the profile of I-CreI D75N.
The profile of K139M is similar to the profile of I-CreI but without
its toxicity; 7 additional targets are cleaved by K139M as compared to D75N.
- 7NN P prof ling (Figure 11 B)
The profile of K142G and S138A is similar to the profile of I-CreI
D75N.
K139M and T143G cleave 2 additional targets (7CG P and 7TT P)
as compared to D75N; however the cleavage profile of K139M and T143G is more
restricted than the profile of I-Crel.
These results demonstrate that the C-terminal region of I-Cr=eI is
essential for HE activity. Moreover the mutations in the flanking residues of
the
SKTRKTT region demonstrate that they control not only nucleic acid binding,
but
also target specificity.
