Note: Descriptions are shown in the official language in which they were submitted.
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
Novel Genes and Proteins of Brachyspira hyodysenteriae
and Uses Thereof
Field of Invention
This invention relates to novel genes in Brachyspira hyodysenteriae and the
proteins
encoded therein. This invention further relates to use of these novel genes
and proteins for
diagnosis of B. hyodysenteriae disease, vaccines against B. hyodysenteriae and
for screening
for compounds that kill B. hyodysenteriae or block the pathogenic effects of
B.
hyodysenteriae. These sequences may also be useful for diagnostic and
therapeutic and/or
prophylactic treatment of diseases in animals caused by other Brachyspira
species, including
B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B.
murdochii, and B.
pilosicoli.
Background of Invention
Swine dysentery is a significant endemic disease of pigs in Australia and
worldwide.
Swine dysentery is a contagious mucohaemorrhagic diarrhoeal disease,
characterised by
extensive inflammation and necrosis of the epithelial surface of the large
intestine. Economic
losses due to swine dysentery result mainly from growth retardation, costs of
medication and
mortality. The causative agent of swine dysentery was first identified as an
anaerobic
spirochaete (Treponema hyodysenteriae) in 1971, and was recently reassigned to
the genus
Brachyspira as B. hyodysenteriae. Where swine dysentery is established in a
piggery, the
disease spectrum can vary from being mild, transient or unapparent, to being
severe and even
fatal. Medication strategies on individual piggeries may mask clinical signs
and on some
piggeries the disease may go unnoticed, or may only be suspected. Whether or
not obvious
disease occurs, B. hyodysenteriae may persist in infected pigs, or in other
reservoir hosts such
as rodents, or in the environment. All these sources pose potential for
transmission of the
disease to uninfected herds. Commercial poultry may also be colonized by B.
hyodysenteriae, although it is not clear how commonly this occurs under field
conditions.
Colonisation by B. hyodysenteriae elicits a strong immunological response
against the
spirochaete, hence indirect evidence of exposure to the spirochaete can be
obtained by
measuring circulating antibody titres in the blood of infected animals. These
antibody titres
have been reported to be maintained at low levels, even in animals that have
recovered from
swine dysentery. Serological tests for detection of antibodies therefore have
considerable
potential for detecting subclinical infections and recovered carrier pigs that
have undetectable
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
numbers of spirochaetes in their large intestines. These tests would be
particularly valuable
in an easy to use kit form, such as an enzyme-linked immunosorbent assay. A
variety of
techniques have been developed to demonstrate the presence of circulating
antibodies against
B. hyodysenteriae, including indirect fluorescent antibody tests,
haemagglutination tests,
microtitration agglutination tests, complement fixation tests, and ELISA using
either
lipopolysaccharide or whole sonicated spirochaetes as antigen. All these tests
have suffered
from problems of specificity, as related non-pathogenic intestinal
spirochaetes can induce
cross-reactive antibodies. These tests are useful for detecting herds where
there is obvious
disease and high circulating antibody titres, but they are problematic for
identifying sub-
clinically infected herds and individual infected pigs. Consequently, to date,
no completely
sensitive and specific assays are available for the detection of antibodies
against B.
hyodysenteriae. The lack of suitable diagnostic tests has hampered control of
swine
dysentery.
A number of methods are employed to control swine dysentery, varying from the
prophylactic use of antimicrobial agents, to complete destocking of infected
herds and
prevention of re-entry of infected carrier pigs. All these options are
expensive and, if they are
to be fully effective, they require the use of sophisticated diagnostic tests
to monitor progress.
Currently, detection of swine dysentery in herds with sub-clinical infections,
and individual
healthy carrier animals, remains a major problem and is hampering
implementation of
effective control measures. A definitive diagnosis of swine dysentery
traditionally has
required the isolation and identification of B. hyodysenteriae from the faeces
or mucosa of
diseased pigs. Major problems involved include the slow growth and fastidious
nutritional
requirements of these anaerobic bacteria and confusion due to the presence of
morphologically similar spirochaetes in the normal flora of the pig intestine.
A significant
improvement in the diagnosis of individual affected pigs was achieved with the
development
of polymerase chain reaction (PCR) assays for the detection of spirochaetes
from faeces.
Unfortunately in practical applications the limit of detection of PCRs
rendered it unable to
detect carrier animals with subclinical infections. As a consequence of these
diagnostic
problems, there is a clear need to develop a simple and effective diagnostic
tool capable of
detecting B. hyodysenteriae infection at the herd and individual pig level.
A strong immunological response is induced against the spirochaete following
colonization with B. hyodysenteriae, and pigs recovered from swine dysentery
are protected
from re-infection. Despite this, attempts to develop vaccines to control swine
dysentery have
met with very limited success, either because they have provided inadequate
protection on a
2
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
herd basis, or they have been too costly and difficult to produce to make them
commercially
viable. Bacterin vaccines provide some level of protection, but they tend to
be
lipopolysaccharide serogroup-specific, which then requires the use of
multivalent bacterins.
Furthermore they are difficult and costly to produce on a large scale because
of the fastidious
anaerobic growth requirements of the spirochaete.
Several attempts have been made to develop attenuated live vaccines for swine
dysentery. This approach has the disadvantage that attenuated strains show
reduced
colonisation, and hence cause reduced immune stimulation. There also is
reluctance on the
part of producers and veterinarians to use live vaccines for swine dysentery
because of the
possibility of reversion to virulence, especially as very little is known
about genetic
regulation and organization in B. hyodysenteriae.
The use of recombinant subunit vaccines is an attractive alternative, since
the
products would be well-defined (essential for registration purposes), and
relatively easy to
produce on a large scale. To date the first reported use of a recombinant
protein from B.
hyodysenteriae as a vaccine candidate (a 38-kilodalton flagellar protein)
failed to prevent
colonisation in pigs. This failure is likely to relate specifically to the
particular recombinant
protein used, as well as to other more down-stream issues of delivery systems
and routes,
dose rates, choice of adjuvants etc. (Gabe, JD, Chang, RJ, Slomiany, R,
Andrews, WH and
McCaman, MT (1995) Isolation of extracytoplasmic proteins from Serpulina
hyodysenteriae
B204 and molecular cloning of the flaBl gene encoding a 38-kilodalton
flagellar protein.
Infection and Immunity 63:142-148). The first reported partially protective
recombinant B.
hyodysenteriae protein used for vaccination was a 29.7 kDa outer membrane
lipoprotein
(Bh1p29.7, also referred to as BmpB and B1pA) which had homology with the
methionine-
binding lipoproteins of various pathogenic bacteria. The use of the his-tagged
recombinant
Bh1p29.7 protein for vaccination of pigs, followed by experimental challenge
with B.
hyodysenteriae, resulted in 17-40% of vaccinated pigs developing disease
compared to 50-
70% of the unvaccinated control pigs developing disease. Since the incidence
of disease for
the Bh1p29.7 vaccinated pigs was significantly (P=0.047) less than for the
control pigs,
Bh1p29.7 appeared to have potential as a swine dysentery vaccine component
(La, T, Phillips,
ND, Reichel, MP and Hampson, DJ (2004). Protection of pigs from swine
dysentery by
vaccination with recombinant BmpB, a 29.7 kDa outer-membrane lipoprotein of
Brachyspira
hyodysenteriae. Veterinary Microbiology 102:97-109). A number of other
attempts have been
made to identify outer envelop proteins from B. hyodysenteriae that could be
used as
recombinant vaccine components, but again no successful vaccine has yet been
made. A
3
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
much more global approach is needed to the identification of potentially
useful immunogenic
recombinant proteins from B. hyodysenteriae is needed.
To date, only one study using DNA for vaccination has been reported. In this
study,
the B. hyodysenteriae ftnA gene, encoding a putative ferritin, was cloned into
an E. coli
plasmid and the plasmid DNA used to coat gold beads for ballistic vaccination.
A murine
model for swine dysentery was used to determine the protective nature of
vaccination with
DNA and/or recombinant protein. Vaccination with recombinant protein induced a
good
systemic response against ferritin however vaccination with DNA induced only a
detectable
systemic response. Vaccination with DNA followed a boost with recombinant
protein
induced a systemic immune response to ferritin only after boosting with
protein. However,
none of the vaccination regimes tested was able to provide the mice with
protection against B.
hyodysenteriae colonisation and the associated lesions. Interestingly,
vaccination of the mice
with DNA alone resulted in significant exacerbation of disease (Davis, A.J.,
Smith, S.C. and
Moore, R.J. (2005). The Brachyspira hyodysenteriae ftnA gene: DNA vaccination
and real-
time PCR quantification of bacteria in a mouse model of disease. Current
Microbiology 50:
285-291).
Brief Summary of Invention
It is an object of this invention to have novel genes from B. hyodysenteriae
and the
proteins encoded by those genes. It is a further object of this invention that
the novel genes
and the proteins encoded by those genes can be used for therapeutic and
diagnostic purposes.
One can use the genes and/or the proteins in a vaccine against B.
hyodysenteriae and to
diagnose B. hyodysenteriae infections.
It is an object of this invention to have novel B. hyodysenteriae genes having
the
nucleotide sequence contained in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17,
19, 21, 23, 25, 27,
29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and
65. It is also an
object of this invention to have nucleotide sequences that are identical to
SEQ ID NOs: 1, 3,
5, 7, 9, 1l, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43,
45, 47, 49, 51, 53, 55,
57, 59, 61, 63, and 65 where the percentage identity can be at least 95%, 90%,
85%, 80%,
75% and 70% (and every integer from 100 to 70). This invention also includes a
DNA
vaccine or DNA immunogenic composition containing the nucleotide sequence of
SEQ ID
NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37,
39, 41, 43, 45, 47, 49,
51, 53, 55, 57, 59, 61, 63, and 65 and sequences that are at least 95%, 90%,
85%, 80%, 75%
and 70% identical (and every integer from 100 to 70) to these sequences. This
invention
4
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
further includes a diagnostic assay containing DNA having the nucleotide
sequence of SEQ
ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37,
39, 41, 43, 45, 47,
49, 51, 53, 55, 57, 59, 61, 63, and 65 and sequences that are at least 95%,
90%, 85%, 80%,
75% and 70% identical (and every integer from 100 to 70) to these sequences.
It is also an object of this invention to have plasmids containing DNA having
the
sequence of SEQ ID NOs: l, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29,
31, 33, 35, 37,
39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65; prokaryotic and/or
eukaryotic
expression vectors containing DNA having the sequence of SEQ ID NOs: 1, 3, 5,
7, 9, 11, 13,
15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51,
53, 55, 57, 59, 61, 63,
and 65; and a cell containing the plasmids which contain DNA having the
sequence of SEQ
ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37,
39, 41, 43, 45, 47,
49, 51, 53, 55, 57, 59, 61, 63, and 65.
It is an object of this invention to have novel B. hyodysenteriae proteins
having the
amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18,
20, 22, 24, 26,
28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64,
and 66. It is another
object of this invention to have proteins that are at least 95%, 90%, 85%,
80%, 75% and 70%
homologous (and every integer from 100 to 70) to the sequences contained in
SEQ ID NOs:
2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40,
42, 44, 46, 48, 50, 52,
54, 56, 58, 60, 62, 64, and 66. It is also an object of this invention for a
vaccine or
immunogenic composition to contain the proteins having the amino acid sequence
contained
in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34,
36, 38, 40, 42, 44,
46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66, or amino acid sequences that
are at least 95%,
90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to
the
sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, 32,
34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. It is
a further aspect of
this invention to have a diagnostic kit containing one or more proteins having
a sequence
contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28,
30, 32, 34, 36, 38,
40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or that are at
least 95%, 90%, 85%,
80%, 75% and 70% homologous to the sequences contained in SEQ ID NOs: 2, 4, 6,
8, 10,
12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48,
50, 52, 54, 56, 58, 60,
62, 64, and 66.
It is another aspect of this invention to have nucleotide sequences which
encode the
proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8,
10, 12, 14, 16,
18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56, 58, 60, 62, 64, and
5
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
66, and encode the amino acid sequences that are at least 95%, 90%, 85%, 80%,
75% and
70% homologous (and every integer from 100 to 70) to the sequences contained
in SEQ ID
NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38,
40, 42, 44, 46, 48, 50,
52, 54, 56, 58, 60, 62, 64, and 66. The invention also covers plasmids,
eukaryotic and
prokaryotic expression vectors, and DNA vaccines which contain DNA having a
sequence
which encodes a protein having the amino acid sequence contained in SEQ ID
NOs: 2, 4, 6,
8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46,
48, 50, 52, 54, 56,
58, 60, 62, 64, and 66, and encode amino acid sequences that are at least 95%,
90%, 85%,
80%, 75% and 70% homologous (and every integer from 100 to 70) to the
sequences
contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28,
30, 32, 34, 36, 38,
40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. Cells which
contain these plasmids
and expression vectors are included in this invention.
This invention includes monoclonal antibodies that bind to proteins having an
amino
acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22,
24, 26, 28, 30,
32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or
bind to proteins that
are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer
from 100 to
70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18,
20, 22, 24, 26,
28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64,
and 66. Diagnostic
kits containing the monoclonal antibodies that bind to proteins having an
amino acid
sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, 32,
34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or bind
to proteins that are
at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from
100 to 70)
to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28,
30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66
are included in this
invention. These diagnostic kits can detect the presence of B. hyodysenteriae
in an animal.
The animal is preferably any mammal and bird; more preferably, chicken, goose,
duck,
turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow,
sheep, pig, monkey, and
human.
The invention also contemplates the method of preventing or treating an
infection of
B. hyodysenteriae in an animal by administering to an animal a DNA vaccine
containing one
or more nucleotide sequences listed in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15,
17, 19, 21, 23,
25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61,
63, and 65 or
sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and
every integer
from 100 to 70) to these sequences. This invention also covers a method of
preventing or
6
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
treating an infection of B. hyodysenteriae in an animal by administering to an
animal a
vaccine containing one or more proteins having the amino acid sequence
containing in SEQ
ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36,
38, 40, 42, 44, 46, 48,
50, 52, 54, 56, 58, 60, 62, 64, and 66 or sequences that are at least 95%,
90%, 85%, 80%,
75% and 70% homologous (and every integer from 100 to 70) to these sequences.
The
animal is preferably any mammal and bird; more preferably, chicken, goose,
duck, turkey,
parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig,
monkey, and human.
The invention also contemplates the method of generating an immune response in
an
animal by administering to an animal an immunogenic composition containing one
or more
nucleotide sequences listed in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19,
21, 23, 25, 27,
29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65
or sequences that
are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from
100 to 70)
to these sequences. This invention also covers a method of generating an
immune response
in an animal by administering to an animal an immunogenic composition
containing one or
more proteins having the amino acid sequence containing in SEQ ID NOs: 2, 4,
6, 8, 10, 12,
14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50,
52, 54, 56, 58, 60, 62,
64, and 66 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70%
homologous
(and every integer from 100 to 70) to these sequences. The animal is
preferably any mammal
and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat,
hamster, gerbil,
rabbit, ferret, horse, cow, sheep, pig, monkey, and human.
Detailed Summary of Invention
The articles "a" and "an" are used herein to refer to one or to more than one
(i.e., to at
least one) of the grammatical object of the article. By way of example, "an
element" means
one element or more than one element.
The term "amino acid" is intended to embrace all molecules, whether natural or
synthetic, which include both an amino functionality and an acid functionality
and capable of
being included in a polymer of naturally-occurring amino acids. Exemplary
amino acids
include naturally-occurring amino acids; analogs, derivatives and congeners
thereof; amino
acid analogs having variant side chains; and all stereoisomers of any of any
of the foregoing.
An animal can be any mammal or bird. Examples of mammals include dog, cat,
hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human.
Examples of birds
include chicken, goose, duck, turkey, and parakeet.
7
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
The term "conserved residue" refers to an amino acid that is a member of a
group of
amino acids having certain common properties. The term "conservative amino
acid
substitution" refers to the substitution (conceptually or otherwise) of an
amino acid from one
such group with a different amino acid from the same group. A functional way
to define
common properties between individual amino acids is to analyze the normalized
frequencies
of amino acid changes between corresponding proteins of homologous organisms
(Schulz, G.
E. and R. H. Schinner., Principles of Protein Structure, Springer-Verlag).
According to such
analyses, groups of amino acids may be defined where amino acids within a
group exchange
preferentially with each other, and therefore resemble each other most in
their impact on the
overall protein structure (Schulz, G. E. and R. H. Schirmer, Principles of
Protein Structure,
Springer-Verlag). Examples of amino acid groups defined in this manner
include: (i) a
positively-charged group containing Lys, Arg and His, (ii) a negatively-
charged group
containing Glu and Asp, (iii) an aromatic group containing Phe, Tyr and Trp,
(iv) a nitrogen
ring group containing His and Trp, (v) a large aliphatic nonpolar group
containing Val, Leu
and De, (vi) a slightly-polar group containing Met and Cys, (vii) a small-
residue group
containing Ser, Thr, Asp, Asn, Gly, Ala, Glu, GIn and Pro, (viii) an aliphatic
group
containing Val, Leu, De, Met and Cys, and (ix) a small, hydroxyl group
containing Ser and
Thr.
A "fusion protein" or "fusion polypeptide" refers to a chimeric protein as
that term is
known in the art and may be constructed using methods known in the art. In
many examples
of fusion proteins, there are two different polypeptide sequences, and in
certain cases, there
may be more. The polynucleotide sequences encoding the fusion protein may be
operably
linked in frame so that the fusion protein may be translated correctly. A
fusion protein may
include polypeptide sequences from the same species or from different species.
In various
embodiments, the fusion polypeptide may contain one or more amino acid
sequences linked
to a first polypeptide. In the case where more than one amino acid sequence is
fused to a first
polypeptide, the fusion sequences may be multiple copies of the same sequence,
or
alternatively, may be different amino acid sequences. The fusion polypeptides
may be fused
to the N-terminus, the C-terminus, or the N- and C-terminus of the first
polypeptide.
Exemplary fusion proteins include polypeptides containing a glutathione S-
transferase tag
(GST-tag), histidine tag (His-tag), an immunoglobulin domain or an
immunoglobulin binding
domain.
The term "isolated polypeptide" refers to a polypeptide, in certain
embodiments
prepared from recombinant DNA or RNA, or of synthetic origin or natural
origin, or some
8
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
combination thereof, which (1) is not associated with proteins that it is
normally found with
in nature, (2) is separated from the cell in which it normally occurs, (3) is
free of other
proteins from the same cellular source, (4) is expressed by a cell from a
different species, or
(5) does not occur in nature. It is possible for an isolated polypeptide exist
but not qualify as
a purified polypeptide.
The term "isolated nucleic acid" and "isolated polynucleotide" refers to a
polynucleotide whether genomic DNA, cDNA, mRNA, tRNA, rRNA, iRNA, or a
polynucleotide obtained from a cellular organelle (such as mitochondria and
chloroplast), or
whether from synthetic origin, which (1) is not associated with the cell in
which the "isolated
nucleic acid" is found in nature, or (2) is operably linked to a
polynucleotide to which it is not
linked in nature. It is possible for an isolated polynucleotide exist but not
qualify as a
purified polynucleotide.
The term "nucleic acid" and "polynucleotide" refers to a polymeric form of
nucleotides, either ribonucleotides or deoxyribonucleotides or a modified form
of either type
of nucleotide. The terms should also be understood to include, as equivalents,
analogs of
either RNA or DNA made from nucleotide analogs, and, as applicable to the
embodiment
being described, single-stranded (such as sense or antisense) and double-
stranded
polynucleotides.
The term "nucleic acid of the invention" and "polynucleotide of the invention"
refers
to a nucleic acid encoding a polypeptide of the invention. A polynucleotide of
the invention
may comprise all, or a portion of, a subject nucleic acid sequence; a
nucleotide sequence at
least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to a subject
nucleic acid
sequence (and every integer between 60 and 100); a nucleotide sequence that
hybridizes
under stringent conditions to a subject nucleic acid sequence; nucleotide
sequences encoding
polypeptides that are functionally equivalent to polypeptides of the
invention; nucleotide
sequences encoding polypeptides at least about 60%, 70%, 80%, 85%, 90%, 95%,
98%, 99%
homologous or identical with a subject amino acid sequence (and every integer
between 60
and 100); nucleotide sequences encoding polypeptides having an activity of a
polypeptide of
the invention and having at least about 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%
or more
homology or identity with a subject amino acid sequence (and every integer
between 60 and
100); nucleotide sequences that differ by 1 to about 2, 3, 5, 7, 10, 15, 20,
30, 50, 75 or more
nucleotide substitutions, additions or deletions, such as allelic variants, of
a subject nucleic
acid sequence; nucleic acids derived from and evolutionarily related to a
subject nucleic acid
sequence; and complements of, and nucleotide sequences resulting from the
degeneracy of
9
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
the genetic code, for all of the foregoing and other nucleic acids of the
invention. Nucleic
acids of the invention also include homologs, e.g., orthologs and paralogs, of
a subject
nucleic acid sequence and also variants of a subject nucleic acid sequence
which have been
codon optimized for expression in a particular organism (e.g., host cell).
The term "operably linked", when describing the relationship between two
nucleic
acid regions, refers to a juxtaposition wherein the regions are in a
relationship permitting
them to function in their intended manner. For example, a control sequence
"operably
linked" to a coding sequence is ligated in such a way that expression of the
coding sequence
is achieved under conditions compatible with the control sequences, such as
when the
appropriate molecules (e.g., inducers and polymerases) are bound to the
control or regulatory
sequence(s).
The term "polypeptide", and the terms "protein" and "peptide" which are used
interchangeably herein, refers to a polymer of amino acids. Exemplary
polypeptides include
gene products, naturally-occurring proteins, homologs, orthologs, paralogs,
fragments, and
other equivalents, variants and analogs of the foregoing.
The terms "polypeptide fragment" or "fragment", when used in reference to a
reference polypeptide, refers to a polypeptide in which amino acid residues
are deleted as
compared to the reference polypeptide itself, but where the remaining amino
acid sequence is
usually identical to the corresponding positions in the reference polypeptide.
Such deletions
may occur at the amino-terminus or carboxy-terminus of the reference
polypeptide, or
alternatively both. Fragments typically are at least 5, 6, 8 or 10 amino acids
long, at least 14
amino acids long, at least 20, 30, 40 or 50 amino acids long, at least 75
amino acids long, or
at least 100, 150, 200, 300, 500 or more amino acids long. A fragment can
retain one or more
of the biological activities of the reference polypeptide. In certain
embodiments, a fragment
may comprise a domain having the desired biological activity, and optionally
additional
amino acids on one or both sides of the domain, which additional amino acids
may number
from 5, 10, 15, 20, 30, 40, 50, or up to 100 or more residues. Further,
fragments can include
a sub-fragment of a specific region, which sub-fragment retains a function of
the region from
which it is derived. In another embodiment, a fragment may have immunogenic
properties.
The term "polypeptide of the invention" refers to a polypeptide containing a
subject
amino acid sequence, or an equivalent or fragment thereof. Polypeptides of the
invention
include polypeptides containing all or a portion of a subject amino acid
sequence; a subject
amino acid sequence with 1 to about 2, 3, 5, 7, 10, 15, 20, 30, 50, 75 or more
conservative
amino acid substitutions; an amino acid sequence that is at least 60%, 70%,
80%, 90%, 95%,
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
96%, 97%, 98%, or 99% homologous to a subject amino acid sequence (and every
integer
between 60 and 100); and functional fragments thereof. Polypeptides of the
invention also
include homologs, e.g., orthologs and paralogs, of a subject amino acid
sequence.
It is also possible to modify the structure of the polypeptides of the
invention for such
purposes as enhancing therapeutic or prophylactic efficacy, or stability
(e.g., ex vivo shelf
life, resistance to proteolytic degradation in vivo, etc.). Such modified
polypeptides, when
designed to retain at least one activity of the naturally-occurring form of
the protein, are
considered "functional equivalents" of the polypeptides described in more
detail herein. Such
modified polypeptides may be produced, for instance, by amino acid
substitution, deletion, or
addition, which substitutions may consist in whole or part by conservative
amino acid
substitutions.
For instance, it is reasonable to expect that an isolated conservative amino
acid
substitution, such as replacement of a leucine with an isoleucine or valine,
an aspartate with a
glutamate, a threonine with a serine, will not have a major affect on the
biological activity of
the resulting molecule. Whether a change in the amino acid sequence of a
polypeptide results
in a functional homolog may be readily determined by assessing the ability of
the variant
polypeptide to produce a response similar to that of the wild-type protein.
Polypeptides in
which more than one replacement has taken place may readily be tested in the
same manner.
The term "purified" refers to an object species that is the predominant
species present
(i.e., on a molar basis it is more abundant than any other individual species
in the
composition). A "purified fraction" is a composition wherein the object
species is at least
about 50 percent (on a molar basis) of all species present. In making the
determination of the
purity or a species in solution or dispersion, the solvent or matrix in which
the species is
dissolved or dispersed is usually not included in such determination; instead,
only the species
(including the one of interest) dissolved or dispersed are taken into account.
Generally, a
purified composition will have one species that is more than about 80% of all
species present
in the composition, more than about 85%, 90%, 95%, 99% or more of all species
present.
The object species may be purified to essential homogeneity (contaminant
species cannot be
detected in the composition by conventional detection methods) wherein the
composition is
essentially a single species. A skilled artisan may purify a polypeptide of
the invention using
standard techniques for protein purification in light of the teachings herein.
Purity of a
polypeptide may be determined by a number of methods known to those of skill
in the art,
including for example, amino-terminal amino acid sequence analysis, gel
electrophoresis,
mass-spectrometry analysis and the methods described herein.
11
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
The terms "recombinant protein" or "recombinant polypeptide" refer to a
polypeptide
which is produced by recombinant DNA techniques. An example of such techniques
includes the case when DNA encoding the expressed protein is inserted into a
suitable
expression vector which is in turn used to transform a host cell to produce
the protein or
polypeptide encoded by the DNA.
The term "regulatory sequence" is a generic term used throughout the
specification to
refer to polynucleotide sequences, such as initiation signals, enhancers,
regulators and
promoters, that are necessary or desirable to affect the expression of coding
and non-coding
sequences to which they are operably linked. Exemplary regulatory sequences
are described
in Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press,
San
Diego, CA (1990), and include, for example, the early and late promoters of
SV40,
adenovirus or cytomegalovirus immediate early promoter, the lac system, the
trp system, the
TAC or TRC system, T7 promoter whose expression is directed by T7 RNA
polymerase, the
major operator and promoter regions of phage lambda, the control regions for
fd coat protein,
the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the
promoters of
acid phosphatase (e.g., Pho5), the promoters of the yeast a-mating factors,
the polyhedron
promoter of the baculovirus system and other sequences known to control the
expression of
genes of prokaryotic or eukaryotic cells or their viruses, and various
combinations thereof.
The nature and use of such control sequences may differ depending upon the
host organism.
In prokaryotes, such regulatory sequences generally include promoter,
ribosomal binding site,
and transcription termination sequences. The term "regulatory sequence" is
intended to
include, at a minimum, components whose presence may influence expression, and
may also
include additional components whose presence is advantageous, for example,
leader
sequences and fusion partner sequences. In certain embodiments, transcription
of a
polynucleotide sequence is under the control of a promoter sequence (or other
regulatory
sequence) which controls the expression of the polynucleotide in a cell-type
in which
expression is intended. It will also be understood that the polynucleotide can
be under the
control of regulatory sequences which are the same or different from those
sequences which
control expression of the naturally-occurring form of the polynucleotide.
The term "sequence homology" refers to the proportion of base matches between
two
nucleic acid sequences or the proportion of amino acid matches between two
amino acid
sequences. When sequence homology is expressed as a percentage, e.g., 50%, the
percentage
denotes the proportion of matches over the length of sequence from a desired
sequence that is
compared to some other sequence. Gaps (in either of the two sequences) are
permitted to
12
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
maximize matching; gap lengths of 15 bases or less are usually used, 6 bases
or less are used
more frequently, with 2 bases or less used even more frequently. The term
"sequence
identity" means that sequences are identical (i.e., on a nucleotide-by-
nucleotide basis for
nucleic acids or amino acid-by-amino acid basis for polypeptides) over a
window of
comparison. The term "percentage of sequence identity" is calculated by
comparing two
optimally aligned sequences over the comparison window, determining the number
of
positions at which the identical amino acids or nucleotides occurs in both
sequences to yield
the number of matched positions, dividing the number of matched positions by
the total
number of positions in the comparison window, and multiplying the result by
100 to yield the
percentage of sequence identity. Methods to calculate sequence identity are
known to those
of skill in the art and described in further detail below.
The term "soluble" as used herein with reference to a polypeptide of the
invention or
other protein, means that upon expression in cell culture, at least some
portion of the
polypeptide or protein expressed remains in the cytoplasmic fraction of the
cell and does not
fractionate with the cellular debris upon lysis and centrifugation of the
lysate. Solubility of a
polypeptide may be increased by a variety of art recognized methods, including
fusion to a
heterologous amino acid sequence, deletion of amino acid residues, amino acid
substitution
(e.g., enriching the sequence with amino acid residues having hydrophilic side
chains), and
chemical modification (e.g., addition of hydrophilic groups).
The solubility of polypeptides may be measured using a variety of art
recognized
techniques, including, dynamic light scattering to determine aggregation
state, UV
absorption, centrifugation to separate aggregated from non-aggregated
material, and SDS gel
electrophoresis (e.g., the amount of protein in the soluble fraction is
compared to the amount
of protein in the soluble and insoluble fractions combined). When expressed in
a host cell,
the polypeptides of the invention may be at least about 1%, 2%, 5%, 10%, 20%,
30%, 40%,
50%, 60%, 70%, 80%, 90% or more soluble, e.g., at least about 1%, 2%, 5%, 10%,
20%,
30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the total amount of protein
expressed in
the cell is found in the cytoplasmic fraction. In certain embodiments, a one
liter culture of
cells expressing a polypeptide of the invention will produce at least about
0.1, 0.2, 0.5, 1, 2,
5, 10, 20, 30, 40, 50 milligrams of more of soluble protein. In an exemplary
embodiment, a
polypeptide of the invention is at least about 10% soluble and will produce at
least about 1
milligram of protein from a one liter cell culture.
The term "specifically hybridizes" refers to detectable and specific nucleic
acid
binding. Polynucleotides, oligonucleotides and nucleic acids of the invention
selectively
13
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
hybridize to nucleic acid strands under hybridization and wash conditions that
minimize
appreciable amounts of detectable binding to nonspecific nucleic acids.
Stringent conditions
may be used to achieve selective hybridization conditions as known in the art
and discussed
herein. Generally, the nucleic acid sequence identity between the
polynucleotides,
oligonucleotides, and nucleic acids of the invention and a nucleic acid
sequence of interest
will be at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%, or
more (and
every integer between 30 and 100). In certain instances, hybridization and
washing
conditions are performed under stringent conditions according to conventional
hybridization
procedures and as described further herein.
The terms "stringent conditions" or "stringent hybridization conditions" refer
to
conditions which promote specific hybridization between two complementary
polynucleotide
strands so as to form a duplex. Stringent conditions may be selected to be
about 5 C lower
than the thermal melting point (Tm) for a given polynucleotide duplex at a
defined ionic
strength and pH. The length of the complementary polynucleotide strands and
their GC
content will determine the Tm of the duplex, and thus the hybridization
conditions necessary
for obtaining a desired specificity of hybridization. The Tm is the
temperature (under defined
ionic strength and pH) at which 50% of a polynucleotide sequence hybridizes to
a perfectly
matched complementary strand. In certain cases it may be desirable to increase
the stringency
of the hybridization conditions to be about equal to the Tm for a particular
duplex.
A variety of techniques for estimating the Tm are available. Typically, G-C
base
pairs in a duplex are estimated to contribute about 3 C to the Tm, while A-T
base pairs are
estimated to contribute about 2 C, up to a theoretical maximum of about 80-100
C.
However, more sophisticated models of Tm are available in which G-C stacking
interactions, solvent effects, the desired assay temperature and the like are
taken into account.
For example, probes can be designed to have a dissociation temperature (Td) of
approximately 60 C, using the formula: Td = (((3 x#GC) + (2 x #AT)) x 37) -
562)/#bp) - 5;
where #GC, #AT, and #bp are the number of guanine-cytosine base pairs, the
number of
adenine-thymine base pairs, and the number of total base pairs, respectively,
involved in the
formation of the duplex.
Hybridization may be carried out in 5x SSC, 4x SSC, 3x SSC, 2x SSC, lx SSC or
0.2x SSC for at least about 1 hour, 2 hours, 5 hours, 12 hours, or 24 hours.
The temperature
of the hybridization may be increased to adjust the stringency of the
reaction, for example,
from about 25 C (room temperature), to about 45 C, 50 C, 55 C, 60 C, or 65 C.
The
hybridization reaction may also include another agent affecting the
stringency, for example,
14
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
hybridization conducted in the presence of 50% formamide increases the
stringency of
hybridization at a defined temperature.
The hybridization reaction may be followed by a single wash step, or two or
more
wash steps, which may be at the same or a different salinity and temperature.
For example,
the temperature of the wash may be increased to adjust the stringency from
about 25 C (room
temperature), to about 45 C, 50 C, 55 C, 60 C, 65 C, or higher. The wash step
may be
conducted in the presence of a detergent, e.g., 0.1 or 0.2% SDS. For example,
hybridization
may be followed by two wash steps at 65 C each for about 20 minutes in 2x SSC,
0.1% SDS,
and optionally two additional wash steps at 65 C each for about 20 minutes in
0.2x SSC,
0.1%SDS.
Exemplary stringent hybridization conditions include overnight hybridization
at 65 C
in a solution containing 50% formamide, lOx Denhardt (0.2% Ficoll, 0.2%
polyvinylpyrrolidone, 0.2% bovine serum albumin) and 200 g/ml of denatured
carrier DNA,
e.g., sheared salmon sperm DNA, followed by two wash steps at 65 C each for
about
20 minutes in 2x SSC, 0.1% SDS, and two wash steps at 65 C each for about 20
minutes in
0.2x SSC, 0.1% SDS.
Hybridization may consist of hybridizing two nucleic acids in solution, or a
nucleic
acid in solution to a nucleic acid attached to a solid support, e.g., a
filter. When one nucleic
acid is on a solid support, a prehybridization step may be conducted prior to
hybridization.
Prehybridization may be carried out for at least about 1 hour, 3 hours or 10
hours in the same
solution and at the same temperature as the hybridization solution (without
the
complementary polynucleotide strand).
Appropriate stringency conditions are known to those skilled in the art or may
be
determined experimentally by the skilled artisan. See, for example, Current
Protocols in
Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-12.3.6; Sambrook et
al., 1989,
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; S.
Agrawal (ed.)
Methods in Molecular Biology, volume 20; Tijssen (1993) Laboratory Techniques
in
Biochemistry and Molecular Biology -- Hybridization With Nucleic Acid Probes,
e.g., part I
chapter 2 "Overview of principles of hybridization and the strategy of nucleic
acid probe
assays", Elsevier, New York; and Tibanyenda, N. et al., Eur. J. Biochem.
139:19 (1984) and
Ebel, S. et al., Biochem. 31:12083 (1992).
The term "vector" refers to a nucleic acid capable of transporting another
nucleic acid
to which it has been linked. One type of vector which may be used in accord
with the
invention is an episome, i.e., a nucleic acid capable of extra-chromosomal
replication. Other
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
vectors include those capable of autonomous replication and expression of
nucleic acids to
which they are linked. Vectors capable of directing the expression of genes to
which they are
operatively linked are referred to herein as "expression vectors". In general,
expression
vectors of utility in recombinant DNA techniques are often in the form of
"plasmids" which
refer to circular double stranded DNA molecules which, in their vector form
are not bound to
the chromosome. In the present specification, "plasmid" and "vector" are used
interchangeably as the plasmid is the most commonly used form of vector.
However, the
invention is intended to include such other forms of expression vectors which
serve
equivalent functions and which become known in the art subsequently hereto.
The nucleic acids of the invention may be used as diagnostic reagents to
detect the
presence or absence of the target DNA or RNA sequences to which they
specifically bind,
such as for determining the level of expression of a nucleic acid of the
invention. In one
aspect, the present invention contemplates a method for detecting the presence
of a nucleic
acid of the invention or a portion thereof in a sample, the method of the
steps of: (a)
providing an oligonucleotide at least eight nucleotides in length, the
oligonucleotide being
complementary to a portion of a nucleic acid of the invention; (b) contacting
the
oligonucleotide with a sample containing at least one nucleic acid under
conditions that
permit hybridization of the oligonucleotide with a nucleic acid of the
invention or a portion
thereof; and (c) detecting hybridization of the oligonucleotide to a nucleic
acid in the sample,
thereby detecting the presence of a nucleic acid of the invention or a portion
thereof in the
sample. In another aspect, the present invention contemplates a method for
detecting the
presence of a nucleic acid of the invention or a portion thereof in a sample,
by (a) providing a
pair of single stranded oligonucleotides, each of which is at least eight
nucleotides in length,
complementary to sequences of a nucleic acid of the invention, and wherein the
sequences to
which the oligonucleotides are complementary are at least ten nucleotides
apart; and (b)
contacting the oligonucleotides with a sample containing at least one nucleic
acid under
hybridization conditions; (c) amplifying the nucleotide sequence between the
two
oligonucleotide primers; and (d) detecting the presence of the amplified
sequence, thereby
detecting the presence of a nucleic acid of the invention or a portion thereof
in the sample.
In another aspect of the invention, the polynucleotide of the invention is
provided in
an expression vector containing a nucleotide sequence encoding a polypeptide
of the
invention and operably linked to at least one regulatory sequence. It should
be understood
that the design of the expression vector may depend on such factors as the
choice of the host
cell to be transformed and/or the type of protein desired to be expressed. The
vector's copy
16
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
number, the ability to control that copy number and the expression of any
other protein
encoded by the vector, such as antibiotic markers, should be considered.
An expression vector containing the polynucleotide of the invention can then
be used
as a pharmaceutical agent to treat an animal infected with B. hyodysenteriae
or as a vaccine
(also a pharmaceutical agent) to prevent an animal from being infected with B.
hyodysenteriae, or to reduce the symptoms and course of the disease if the
animal does
become infected. One manner of using an expression vector as a pharmaceutical
agent is to
administer a nucleic acid vaccine to the animal at risk of being infected or
to the animal after
being infected. Nucleic acid vaccine technology is well-described in the art.
Some
descriptions can be found in U.S. Patent 6,562,376 (Hooper et al.); U.S.
Patent 5,589,466
(Felgner, et al.); U.S. Patent 6,673,776 (Felgner, et al.); and U.S. Patent
6,710,035 (Felgner,
et al.). Nucleic acid vaccines can be injected into muscle or intradermally,
can be
electroporated into the animal (see WO 01/23537, King et al.; and WO 01/68889,
Malone et
al.), via lipid compositions (see U.S. Patent 5,703,055, Felgner, et al), or
other mechanisms
known in the art field.
Expression vectors can also be transfected into bacteria which can be
administered to
the target animal to induce an immune response to the protein encoded by the
nucleotides of
this invention contained on the expression vector. The expression vector can
contain
eukaryotic expression sequences such that the nucleotides of this invention
are transcribed
and translated in the host animal. Alternatively, the expression vector can be
transcribed in
the bacteria and then translated in the host animal. The bacteria used as a
carrier of the
expression vector should be attenuated but still invasive. One can use
Shigella spp.,
Salmonella spp., Escherichia spp., and Aeromonas spp., just to name a few,
that have been
attenuated but still invasive. Examples of these methods can be found in U.S.
Patent
5,824,538 (Branstrom et al); U.S. Patent 5,877,159 (Powell, et al.); U.S.
Patent 6,150,170
(Powell, et al.); U.S. Patent 6,500,419 (Hone, et al.); and U.S. Patent
6,682,729 (Powell, et
al.).
Alternatively, the polynucleotides of this invention can be placed in certain
viruses
which act a vector. Viral vectors can either express the proteins of this
invention on the
surface of the virus, or carry polynucleotides of this invention into an
animal cell where the
polynucleotide is transcribed and translated into a protein. The animal
infected with the viral
vectors can develop an immune response to the proteins encoded by the
polynucleotides of
this invention. Thereby one can alleviate or prevent an infection by B.
hyodysenteriae in the
animal which received the viral vectors. Examples of viral vectors can be
found U.S. Patent
17
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
5,283,191 (Morgan et al.); U.S. Patent 5,554,525 (Sondermeijer et al) and U.S.
Patent
5,712,118 (Murphy).
The polynucleotide of the invention may be used to cause expression and over-
expression of a polypeptide of the invention in cells propagated in culture,
e.g. to produce
proteins or polypeptides, including fusion proteins or polypeptides.
This invention pertains to a host cell transfected with a recombinant gene in
order to
express a polypeptide of the invention. The host cell may be any prokaryotic
or eukaryotic
cell. For example, a polypeptide of the invention may be expressed in
bacterial cells, such as
E. coli, insect cells (baculovirus), yeast, plant, or mammalian cells. In
those instances when
the host cell is human, it may or may not be in a live subject. Other suitable
host cells are
known to those skilled in the art. Additionally, the host cell may be
supplemented with tRNA
molecules not typically found in the host so as to optimize expression of the
polypeptide.
Alternatively, the nucleotide sequence may be altered to optimize expression
in the host cell,
yet the protein produced would have high homology to the originally encoded
protein. Other
methods suitable for maximizing expression of the polypeptide will be known to
those in the
art.
The present invention further pertains to methods of producing the
polypeptides of the
invention. For example, a host cell transfected with an expression vector
encoding a
polypeptide of the invention may be cultured under appropriate conditions to
allow
expression of the polypeptide to occur. The polypeptide may be secreted and
isolated from a
mixture of cells and medium containing the polypeptide. Alternatively, the
polypeptide may
be retained cytoplasmically and the cells harvested, lysed and the protein
isolated.
A cell culture includes host cells, media and other byproducts. Suitable media
for cell
culture are well known in the art. The polypeptide may be isolated from cell
culture medium,
host cells, or both using techniques known in the art for purifying proteins,
including ion-
exchange chromatography, gel filtration chromatography, ultrafiltration,
electrophoresis, and
immunoaffinity purification with antibodies specific for particular epitopes
of a polypeptide
of the invention.
Thus, a nucleotide sequence encoding all or a selected portion of polypeptide
of the
invention, may be used to produce a recombinant form of the protein via
microbial or
eukaryotic cellular processes. Ligating the sequence into a polynucleotide
construct, such as
an expression vector, and transforming or transfecting into hosts, either
eukaryotic (yeast,
avian, insect or mammalian) or prokaryotic (bacterial cells), are standard
procedures. Similar
18
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
procedures, or modifications thereof, may be employed to prepare recombinant
polypeptides
of the invention by microbial means or tissue-culture technology.
Suitable vectors for the expression of a polypeptide of the invention include
plasmids
of the types: pTrcHis-derived plasmids, pET-derived plasmids, pBR322-derived
plasmids,
pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-
derived
plasmids for expression in prokaryotic cells, such as E. coli. The various
methods employed
in the preparation of the plasmids and transformation of host organisms are
well known in the
art. For other suitable expression systems for both prokaryotic and eukaryotic
cells, as well
as general recombinant procedures, see Molecular Cloning, A Laboratory Manual,
2nd Ed.,
ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press,
1989)
Chapters 16 and 17.
Coding sequences for a polypeptide of interest may be incorporated as a part
of a
fusion gene including a nucleotide sequence encoding a different polypeptide.
The present
invention contemplates an isolated polynucleotide containing a nucleic acid of
the invention
and at least one heterologous sequence encoding a heterologous peptide linked
in frame to the
nucleotide sequence of the nucleic acid of the invention so as to encode a
fusion protein
containing the heterologous polypeptide. The heterologous polypeptide may be
fused to
(a) the C-terminus of the polypeptide of the invention, (b) the N-terminus of
the polypeptide
of the invention, or (c) the C-terminus and the N-terminus of the polypeptide
of the invention.
In certain instances, the heterologous sequence encodes a polypeptide
permitting the
detection, isolation, solubilization and/or stabilization of the polypeptide
to which it is fused.
In still other embodiments, the heterologous sequence encodes a polypeptide
such as a poly
His tag, myc, HA, GST, protein A, protein G, calmodulin-binding peptide,
thioredoxin,
maltose-binding protein, poly arginine, poly His-Asp, FLAG, a portion of an
immunoglobulin protein, and a transcytosis peptide.
Fusion expression systems can be useful when it is desirable to produce an
immunogenic fragment of a polypeptide of the invention. For example, the VP6
capsid
protein of rotavirus may be used as an immunologic carrier protein for
portions of
polypeptide, either in the monomeric form or in the form of a viral particle.
The nucleic acid
sequences corresponding to the portion of a polypeptide of the invention to
which antibodies
are to be raised may be incorporated into a fusion gene construct which
includes coding
sequences for a late vaccinia virus structural protein to produce a set of
recombinant viruses
expressing fusion proteins comprising a portion of the protein as part of the
virion. The
Hepatitis B surface antigen may also be utilized in this role as well.
Similarly, chimeric
19
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
constructs coding for fusion proteins containing a portion of a polypeptide of
the invention
and the poliovirus capsid protein may be created to enhance immunogenicity
(see, for
example, EP Publication NO: 0259149; and Evans et al., (1989) Nature 339:385;
Huang et
al., (1988) J. Virol. 62:3855; and Schlienger et al., (1992) J. Virol. 66:2).
Fusion proteins may facilitate the expression and/or purification of proteins.
For
example, a polypeptide of the invention may be generated as a glutathione-S-
transferase
(GST) fusion protein. Such GST fusion proteins may be used to simplify
purification of a
polypeptide of the invention, such as through the use of glutathione-
derivatized matrices (see,
for example, Current Protocols in Molecular Biology, eds. Ausubel et al.,
(N.Y.: John Wiley
& Sons, 1991)). In another embodiment, a fusion gene coding for a purification
leader
sequence, such as a poly-(His)/enterokinase cleavage site sequence at the N-
terminus of the
desired portion of the recombinant protein, may allow purification of the
expressed fusion
protein by affinity chromatography using a Ni2+ metal resin. The purification
leader
sequence may then be subsequently removed by treatment with enterokinase to
provide the
purified protein (e.g., see Hochuli et al., (1987) J. Chromatography 411: 177;
and Janknecht
et al., PNAS USA 88:8972).
Techniques for making fusion genes are well known. Essentially, the joining of
various DNA fragments coding for different polypeptide sequences is performed
in
accordance with conventional techniques, employing blunt-ended or stagger-
ended termini
for ligation, restriction enzyme digestion to provide for appropriate termini,
filling-in of
cohesive ends as appropriate, alkaline phosphatase treatment to avoid
undesirable joining,
and enzymatic ligation. In another embodiment, the fusion gene may be
synthesized by
conventional techniques including automated DNA synthesizers. Alternatively,
PCR
amplification of gene fragments may be carried out using anchor primers which
give rise to
complementary overhangs between two consecutive gene fragments which may
subsequently
be annealed to generate a chimeric gene sequence (see, for example, Current
Protocols in
Molecular Biology, eds. Ausubel et al., John Wiley & Sons: 1992).
In other embodiments, the invention provides for nucleic acids of the
invention
immobilized onto a solid surface, including, plates, microtiter plates,
slides, beads, particles,
spheres, films, strands, precipitates, gels, sheets, tubing, containers,
capillaries, pads, slices,
etc. The nucleic acids of the invention may be immobilized onto a chip as part
of an array.
The array may contain one or more polynucleotides of the invention as
described herein. In
one embodiment, the chip contains one or more polynucleotides of the invention
as part of an
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
array of polynucleotide sequences from the same pathogenic species as such
polynucleotide(s).
In a preferred form of the invention there is provided isolated B.
hyodysenteriae
polypeptides as herein described, and also the polynucleotide sequences
encoding these
polypeptides. More desirably the B. hyodysenteriae polypeptides are provided
in
substantially purified form.
Preferred polypeptides of the invention will have one or more biological
properties
(e.g., in vivo, in vitro or immunological properties) of the native full-
length polypeptide.
Non-functional polypeptides are also included within the scope of the
invention because they
may be useful, for example, as antagonists of the functional polypeptides. The
biological
properties of analogues, fragments, or derivatives relative to wild type may
be determined,
for example, by means of biological assays.
Polypeptides, including analogues, fragments and derivatives, can be prepared
synthetically (e.g., using the well known techniques of solid phase or
solution phase peptide
synthesis). Preferably, solid phase synthetic techniques are employed.
Alternatively, the
polypeptides of the invention can be prepared using well known genetic
engineering
techniques, as described infra. In yet another embodiment, the polypeptides
can be purified
(e.g., by immunoaffinity purification) from a biological fluid, such as but
not limited to
plasma, faeces, serum, or urine from animals, including, but not limited to,
pig, chicken,
goose, duck, turkey, parakeet, human, monkey, dog, cat, horse, hamster,
gerbil, rabbit, ferret,
horse, cattle, and sheep. An animal can be any mammal or bird.
The B. hyodysenteriae polypeptide analogues include those polypeptides having
the
amino acid sequence, wherein one or more of the amino acids are substituted
with another
amino acid which substitutions do not substantially alter the biological
activity of the
molecule.
According to the invention, the polypeptides of the invention produced
recombinantly
or by chemical synthesis and fragments or other derivatives or analogues
thereof, including
fusion proteins, may be used as an immunogen to generate antibodies that
recognize the
polypeptides.
A molecule is "antigenic" when it is capable of specifically interacting with
an antigen
recognition molecule of the immune system, such as an immunoglobulin
(antibody) or T cell
antigen receptor. An antigenic amino acid sequence contains at least about 5,
and preferably
at least about 10, amino acids. An antigenic portion of a molecule can be the
portion that is
immunodominant for antibody or T cell receptor recognition, or it can be a
portion used to
21
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
generate an antibody to the molecule by conjugating the antigenic portion to a
carrier
molecule for immunization. A molecule that is antigenic need not be itself
immunogenic,
i.e., capable of eliciting an immune response without a carrier.
An "antibody" is any immunoglobulin, including antibodies and fragments
thereof,
that binds a specific epitope. The term encompasses polyclonal, monoclonal,
and chimeric
antibodies, the last mentioned described in further detail in U.S. Patent Nos.
4,816,397 and
4,816,567, as well as antigen binding portions of antibodies, including Fab,
F(ab')2 and F(v)
(including single chain antibodies). Accordingly, the phrase "antibody
molecule" in its
various grammatical forms as used herein contemplates both an intact
immunoglobulin
molecule and an immunologically active portion of an immunoglobulin molecule
containing
the antibody combining site. An "antibody combining site" is that structural
portion of an
antibody molecule comprised of heavy and light chain variable and
hypervariable regions that
specifically binds an antigen.
Exemplary antibody molecules are intact immunoglobulin molecules,
substantially
intact immunoglobulin molecules and those portions of an immunoglobulin
molecule that
contain the paratope, including those portions known in the art as Fab, Fab',
F(ab')2 and F(v),
which portions are preferred for use in the therapeutic methods described
herein.
Fab and F(ab')2 portions of antibody molecules are prepared by the proteolytic
reaction of papain and pepsin, respectively, on substantially intact antibody
molecules by
methods that are well-known. See for example, U.S. Patent No. 4,342,566 to
Theofilopolous
et al. Fab' antibody molecule portions are also well-known and are produced
from F(ab')2
portions followed by reduction with mercaptoethanol of the disulfide bonds
linking the two
heavy chain portions, and followed by alkylation of the resulting protein
mercaptan with a
reagent such as iodoacetamide. An antibody containing intact antibody
molecules is
preferred herein.
The phrase "monoclonal antibody" in its various grammatical forms refers to an
antibody having only one species of antibody combining site capable of
immunoreacting with
a particular antigen. A monoclonal antibody thus typically displays a single
binding affinity
for any antigen with which it immunoreacts. A monoclonal antibody may
therefore contain
an antibody molecule having a plurality of antibody combining sites, each
immunospecific
for a different antigen; e.g., a bispecific (chimeric) monoclonal antibody.
The term "adjuvant" refers to a compound or mixture that enhances the immune
response to an antigen. An adjuvant can serve as a tissue depot that slowly
releases the
antigen and also as a lymphoid system activator that non-specifically enhances
the immune
22
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
response [Hood et al., in Immunology, p. 384, Second Ed., Benjamin/Cummings,
Menlo
Park, California (1984)]. Often, a primary challenge with an antigen alone, in
the absence of
an adjuvant, will fail to elicit a humoral or cellular immune response.
Adjuvants include, but
are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant,
saponin,
mineral gels such as aluminium hydroxide, surface active substances such as
lysolecithin,
pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole
limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG
(bacille
Calmette-Guerin) and Corynebacterium parvum. Preferably, the adjuvant is
pharmaceutically acceptable.
Various procedures known in the art may be used for the production of
polyclonal
antibodies to the polypeptides of the invention. For the production of
antibody, various host
animals can be immunised by injection with the polypeptide of the invention,
including but
not limited to rabbits, mice, rats, sheep, goats, etc. In one embodiment, a
polypeptide of the
invention can be conjugated to an immunogenic carrier, e.g., bovine serum
albumin (BSA) or
keyhole limpet hemocyanin (KLH). Various adjuvants may be used to increase the
immunological response, depending on the host species, including but not
limited to Freund's
(complete and incomplete), mineral gels such as aluminum hydroxide, surface
active
substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions,
keyhole limpet hemocyanins, dinitrophenol, and potentially useful human
adjuvants such as
BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
For preparation of monoclonal antibodies directed toward a polypeptide of the
invention, any technique that provides for the production of antibody
molecules by
continuous cell lines in culture may be used. These include but are not
limited to the
hybridoma technique originally developed by Kohler et al., (1975) Nature,
256:495-497, the
trioma technique, the human B-cell hybridoma technique [Kozbor et al., (1983)
Immunology
Today, 4:72], and the EBV-hybridoma technique to produce human monoclonal
antibodies
[Cole et al., (1985) in Monoclonal Antibodies and Cancer Therapy, pp. 77-96,
Alan R. Liss,
Inc.]. Immortal, antibody-producing cell lines can be created by techniques
other than fusion,
such as direct transformation of B lymphocytes with oncogenic DNA, or
transfection with
Epstein-Barr virus. See, e.g., U.S. Patent Nos. 4,341,761; 4,399,121;
4,427,783; 4,444,887;
4,451,570; 4,466,917; 4,472,500; 4,491,632; and 4,493,890.
In an additional embodiment of the invention, monoclonal antibodies can be
produced
in germ-free animals utilising recent technology. According to the invention,
chicken or
swine antibodies may be used and can be obtained by using chicken or swine
hybridomas or
23
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
by transforming B cells with EBV virus in vitro. In fact, according to the
invention,
techniques developed for the production of "chimeric antibodies" [Morrison et
al., (1984) T.
Bacteriol., 159-870; Neuberger et al., (1984) Nature, 312:604-608; Takeda et
al., (1985)
Nature, 314:452-454] by splicing the genes from a mouse antibody molecule
specific for a
polypeptide of the invention together with genes from an antibody molecule of
appropriate
biological activity can be used; such antibodies are within the scope of this
invention. Such
chimeric antibodies are preferred for use in therapy of intestinal diseases or
disorders
(described infra), since the antibodies are much less likely than xenogenic
antibodies to
induce an immune response, in particular an allergic response, themselves.
According to the invention, techniques described for the production of single
chain
antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain
antibodies specific
for an polypeptide of the invention. An additional embodiment of the invention
utilises the
techniques described for the construction of Fab expression libraries [Huse et
al., (1989)
Science, 246:1275-1281] to allow rapid and easy identification of monoclonal
Fab fragments
with the desired specificity for a polypeptide of the invention.
Antibody fragments, which contain the idiotype of the antibody molecule, can
be
generated by known techniques. For example, such fragments include but are not
limited to:
the F(ab')2 fragment which can be produced by pepsin digestion of the antibody
molecule; the
Fab' fragments which can be generated by reducing the disulfide bridges of the
F(ab')2
fragment, and the Fab fragments which can be generated by treating the
antibody molecule
with papain and a reducing agent.
In the production of antibodies, screening for the desired antibody can be
accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA,
"sandwich"
immunoassays, immunoradiometric assays, gel diffusion precipitin reactions,
immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope
labels, for example), Western blots, precipitation reactions, agglutination
assays (e.g., gel
agglutination assays, hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, immunoelectrophoresis assays,
etc. In one
embodiment, antibody binding is detected by detecting a label on the primary
antibody. In
another embodiment, the primary antibody is detected by detecting binding of a
secondary
antibody or reagent to the primary antibody. In a further embodiment, the
secondary
antibody is labelled. Many means are known in the art for detecting binding in
an
immunoassay and are within the scope of the present invention. For example, to
select
antibodies that recognise a specific epitope of a polypeptide of the
invention, one may assay
24
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
generated hybridomas for a product that binds to a fragment of a polypeptide
of the invention
containing such epitope.
The invention also covers diagnostic and prognostic methods to detect the
presence of
B. hyodysenteriae using a polypeptide of the invention and/or antibodies which
bind to the
polypeptide of the invention and kits useful for diagnosis and prognosis of B.
hyodysenteriae
infections.
Diagnostic and prognostic methods will generally be conducted using a
biological
sample obtained from an animal, such as chicken or swine. A "sample" refers to
an animal's
tissue or fluid suspected of containing a Brachyspira species, such as B.
hyodysenteriae, or its
polynucleotides or its polypeptides. Examples of such tissue or fluids
include, but not limited
to, plasma, serum, faecal material, urine, lung, heart, skeletal muscle,
stomach, intestines, and
in vitro cell culture constituents.
The invention provides methods for detecting the presence of a polypeptide of
the
invention in a sample, with the following steps: (a) contacting a sample
suspected of
containing a polypeptide of the invention with an antibody (preferably bound
to a solid
support) that specifically binds to the polypeptide of the invention under
conditions which
allow for the formation of reaction complexes comprising the antibody and the
polypeptide of
the invention; and (b) detecting the formation of reaction complexes
comprising the antibody
and polypeptide of the invention in the sample, wherein detection of the
formation of reaction
complexes indicates the presence of the polypeptide of the invention in the
sample.
Preferably, the antibody used in this method is derived from an affinity-
purified
polyclonal antibody, and more preferably a monoclonal antibody. In addition,
it is preferable
for the antibody molecules used herein be in the form of Fab, Fab', F(ab')2 or
F(v) portions or
whole antibody molecules.
Particularly preferred methods for detecting B. hyodysenteriae based on the
above
method include enzyme linked immunosorbent assays, radioimmunoassays,
immunoradiometric assays and immunoenzymatic assays, including sandwich assays
using
monoclonal and/or polyclonal antibodies.
Three such procedures that are especially useful utilise either polypeptide of
the
invention (or a fragment thereof) labelled with a detectable label, antibody
Abi labelled with
a detectable label, or antibody Ab2 labelled with a detectable label. The
procedures may be
summarized by the following equations wherein the asterisk indicates that the
particle is
labelled and "AA" stands for the polypeptide of the invention:
A. AA* + Abi = AA*Abi
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
B. AA+Ab*i =AAAbi*
C. AA + Abi + Abz* = Abi AA Abz*
The procedures and their application are all familiar to those skilled in the
art and
accordingly may be utilised within the scope of the present invention. The
"competitive"
procedure, Procedure A, is described in U.S. Patent Nos. 3,654,090 and
3,850,752.
Procedure B is representative of well-known competitive assay techniques.
Procedure C, the
"sandwich" procedure, is described in U.S. Patent Nos. RE 31,006 and
4,016,043. Still other
procedures are known, such as the "double antibody" or "DASP" procedure, and
can be used.
In each instance, the polypeptide of the invention form complexes with one or
more
antibody(ies) or binding partners and one member of the complex is labelled
with a
detectable label. The fact that a complex has formed and, if desired, the
amount thereof, can
be determined by known methods applicable to the detection of labels.
It will be seen from the above, that a characteristic property of Ab2 is that
it will react
with Abi. This reaction is because Abi, raised in one mammalian species, has
been used in
another species as an antigen to raise the antibody, Ab2. For example, Ab2 may
be raised in
goats using rabbit antibodies as antigens. Ab2 therefore would be anti-rabbit
antibody raised
in goats. For purposes of this description and claims, Abi will be referred to
as a primary
antibody, and Ab2 will be referred to as a secondary or anti-Abi antibody.
The labels most commonly employed for these studies are radioactive elements,
enzymes, chemicals that fluoresce when exposed to ultraviolet light, and
others. Examples of
fluorescent materials capable of being utilised as labels include fluorescein,
rhodamine and
auramine. A particular detecting material is anti-rabbit antibody prepared in
goats and
conjugated with fluorescein through an isothiocyanate. Examples of preferred
isotope
include 3H, 14C, 32P, 35S, 36C1, 51Cr , 57Co, 5gCo, 5917e, 90Y, 125I5 131I,and
186 Re. The radioactive
label can be detected by any of the currently available counting procedures.
While many
enzymes can be used, examples of preferred enzymes are peroxidase, B-
glucuronidase,
13-D-glucosidase,l3-D-galactosidase, urease, glucose oxidase plus peroxidase
and alkaline
phosphatase. Enzyme are conjugated to the selected particle by reaction with
bridging
molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like.
Enzyme labels
can be detected by any of the presently utilized colorimetric,
spectrophotometric,
fluorospectrophotometric, amperometric or gasometric techniques. U.S. Patent
Nos.
3,654,090; 3,850,752; and 4,016,043 are referred to by way of example for
their disclosure of
alternate labelling material and methods.
26
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
The invention also provides a method of detecting antibodies to a polypeptide
of the
invention in biological samples, using the following steps: (a) providing a
polypeptide of the
invention or a fragment thereof; (b) incubating a biological sample with said
polypeptide of
the invention under conditions which allow for the formation of an antibody-
antigen
complex; and (c) determining whether an antibody-antigen complex with the
polypeptide of
the invention is formed.
In another embodiment of the invention there are provided in vitro methods for
evaluating the level of antibodies to a polypeptide of the invention in a
biological sample
using the following steps: (a) detecting the formation of reaction complexes
in a biological
sample according to the method noted above; and (b) evaluating the amount of
reaction
complexes formed, which amount of reaction complexes corresponds to the level
of
polypeptide of the invention in the biological sample.
Further there are provided in vitro methods for monitoring therapeutic
treatment of a
disease associated with B. hyodysenteriae in an animal host by evaluating, as
describe above,
the levels of antibodies to a polypeptide of the invention in a series of
biological samples
obtained at different time points from an animal host undergoing such
therapeutic treatment.
The present invention further provides methods for detecting the presence or
absence
of B. hyodysenteriae in a biological sample by: (a) bringing the biological
sample into contact
with a polynucleotide probe or primer of polynucleotide of the invention under
suitable
hybridizing conditions; and (b) detecting any duplex formed between the probe
or primer and
nucleic acid in the sample.
According to one embodiment of the invention, detection of B. hyodysenteriae
may be
accomplished by directly amplifying polynucleotide sequences from biological
sample, using
known techniques and then detecting the presence of polynucleotide of the
invention
sequences.
In one form of the invention, the target nucleic acid sequence is amplified by
PCR and
then detected using any of the specific methods mentioned above. Other useful
diagnostic
techniques for detecting the presence of polynucleotide sequences include, but
are not limited
to: 1) allele-specific PCR; 2) single stranded conformation analysis; 3)
denaturing gradient
gel electrophoresis; 4) RNase protection assays; 5) the use of proteins which
recognize
nucleotide mismatches, such as the E. coli mutS protein; 6) allele-specific
oligonucleotides;
and 7) fluorescent in situ hybridisation.
In addition to the above methods polynucleotide sequences may be detected
using
conventional probe technology. When probes are used to detect the presence of
the desired
27
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
polynucleotide sequences, the biological sample to be analysed, such as blood
or serum, may
be treated, if desired, to extract the nucleic acids. The sample
polynucleotide sequences may
be prepared in various ways to facilitate detection of the target sequence;
e.g. denaturation,
restriction digestion, electrophoresis or dot blotting. The targeted region of
the sample
polynucleotide sequence usually must be at least partially single-stranded to
form hybrids
with the targeting sequence of the probe. If the sequence is naturally single-
stranded,
denaturation will not be required. However, if the sequence is double-
stranded, the sequence
will probably need to be denatured. Denaturation can be carried out by various
techniques
known in the art.
Sample polynucleotide sequences and probes are incubated under conditions that
promote stable hybrid formation of the target sequence in the probe with the
putative desired
polynucleotide sequence in the sample. Preferably, high stringency conditions
are used in
order to prevent false positives.
Detection, if any, of the resulting hybrid is usually accomplished by the use
of
labelled probes. Alternatively, the probe may be unlabeled, but may be
detectable by specific
binding with a ligand that is labelled, either directly or indirectly.
Suitable labels and
methods for labelling probes and ligands are known in the art, and include,
for example,
radioactive labels which may be incorporated by known methods (e.g., nick
translation,
random priming or kinasing), biotin, fluorescent groups, chemiluminescent
groups (e.g.,
dioxetanes, particularly triggered dioxetanes), enzymes, antibodies and the
like. Variations
of this basic scheme are known in the art, and include those variations that
facilitate
separation of the hybrids to be detected from extraneous materials and/or that
amplify the
signal from the labelled moiety.
It is also contemplated within the scope of this invention that the nucleic
acid probe
assays of this invention may employ a cocktail of nucleic acid probes capable
of detecting the
desired polynucleotide sequences of this invention. Thus, in one example to
detect the
presence of polynucleotide sequences of this invention in a cell sample, more
than one probe
complementary to a polynucleotide sequences is employed and in particular the
number of
different probes is alternatively 2, 3, or 5 different nucleic acid probe
sequences.
The polynucleotide sequences described herein (preferably in the form of
probes) may
also be immobilised to a solid phase support for the detection of Brachyspira
species,
including but not limited to B. hyodysenteriae, B. intermedia, B. alvinipulli,
B. aalborgi, B.
innocens, B. murdochii, and B. pilosicoli. Alternatively the polynucleotide
sequences
described herein will form part of a library of DNA molecules that may be used
to detect
28
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
simultaneously a number of different genes from Brachyspira species, such as
B.
hyodysenteriae. In a further alternate form of the invention polynucleotide
sequences
described herein together with other polynucleotide sequences (such as from
other bacteria or
viruses) may be immobilised on a solid support in such a manner permitting
identification of
the presence of a Brachyspira species, such as B. hyodysenteriae and/or any of
the other
polynucleotide sequences bound onto the solid support.
Techniques for producing immobilised libraries of DNA molecules have been
described in the art. Generally, most prior art methods describe the synthesis
of single-
stranded nucleic acid molecule libraries, using for example masking techniques
to build up
various permutations of sequences at the various discrete positions on the
solid substrate.
U.S. Patent No. 5,837,832 describes an improved method for producing DNA
arrays
immobilised to silicon substrates based on very large scale integration
technology. In
particular, U.S. Patent No. 5,837,832 describes a strategy called "tiling" to
synthesize specific
sets of probes at spatially defined locations on a substrate that may be used
to produced the
immobilised DNA libraries of the present invention. U.S. Patent No. 5,837,832
also provides
references for earlier techniques that may also be used. Thus polynucleotide
sequence probes
may be synthesised in situ on the surface of the substrate.
Alternatively, single-stranded molecules may be synthesised off the solid
substrate
and each pre-formed sequence applied to a discrete position on the solid
substrate. For
example, polynucleotide sequences may be printed directly onto the substrate
using robotic
devices equipped with either pins or pizo electric devices.
The library sequences are typically immobilised onto or in discrete regions of
a solid
substrate. The substrate may be porous to allow immobilisation within the
substrate or
substantially non-porous, in which case the library sequences are typically
immobilised on
the surface of the substrate. The solid substrate may be made of any material
to which
polypeptides can bind, either directly or indirectly. Examples of suitable
solid substrates
include flat glass, silicon wafers, mica, ceramics and organic polymers such
as plastics,
including polystyrene and polymethacrylate. It may also be possible to use
semi-permeable
membranes such as nitrocellulose or nylon membranes, which are widely
available. The
semi-permeable membranes may be mounted on a more robust solid surface such as
glass.
The surfaces may optionally be coated with a layer of metal, such as gold,
platinum or other
transition metal.
Preferably, the solid substrate is generally a material having a rigid or semi-
rigid
surface. In preferred embodiments, at least one surface of the substrate will
be substantially
29
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
flat, although in some embodiments it may be desirable to physically separate
synthesis
regions for different polymers with, for example, raised regions or etched
trenches. It is also
preferred that the solid substrate is suitable for the high density
application of DNA
sequences in discrete areas of typically from 50 to 100 m, giving a density
of 10000 to
40000 dots/crri 2.
The solid substrate is conveniently divided up into sections. This may be
achieved by
techniques such as photoetching, or by the application of hydrophobic inks,
for example
teflon-based inks (Cel-line, USA).
Discrete positions, in which each different member of the library is located
may have
any convenient shape, e.g., circular, rectangular, elliptical, wedge-shaped,
etc.
Attachment of the polynucleotide sequences to the substrate may be by covalent
or
non-covalent means. The polynucleotide sequences may be attached to the
substrate via a
layer of molecules to which the library sequences bind. For example, the
polynucleotide
sequences may be labelled with biotin and the substrate coated with avidin
and/or
streptavidin. A convenient feature of using biotinylated polynucleotide
sequences is that the
efficiency of coupling to the solid substrate can be determined easily. Since
the
polynucleotide sequences may bind only poorly to some solid substrates, it is
often necessary
to provide a chemical interface between the solid substrate (such as in the
case of glass) and
the nucleic acid sequences. Examples of suitable chemical interfaces include
hexaethylene
glycol. Another example is the use of polylysine coated glass, the polylysine
then being
chemically modified using standard procedures to introduce an affinity ligand.
Other methods
for attaching molecules to the surfaces of solid substrate by the use of
coupling agents are
known in the art, see for example W098/49557.
Binding of complementary polynucleotide sequences to the immobilised nucleic
acid
library may be determined by a variety of means such as changes in the optical
characteristics
of the bound polynucleotide sequence (i.e. by the use of ethidium bromide) or
by the use of
labelled nucleic acids, such as polypeptides labelled with fluorophores. Other
detection
techniques that do not require the use of labels include optical techniques
such as
optoacoustics, reflectometry, ellipsometry and surface plasmon resonance (see
W097/49989).
Thus, the present invention provides a solid substrate having immobilized
thereon at
least one polynucleotide of the present invention, preferably two or more
different
polynucleotide sequences of the present invention.
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
The present invention also can be used as a prophylactic or therapeutic, which
may be
utilised for the purpose of stimulating humoral and cell mediated responses in
animals, such
as chickens and swine, thereby providing protection against colonisation with
Brachyspira
species, including but not limited to B. hyodysenteriae, B. suanatina, B.
intermedia, B.
alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli.
Natural infection with a
Brachyspira species, such as B. hyodysenteriae induces circulating antibody
titres against the
proteins described herein. Therefore, the amino acid sequences described
herein or parts
thereof, have the potential to form the basis of a systemically or orally
administered
prophylactic or therapeutic to provide protection against intestinal
spirochaetosis.
Accordingly, in one embodiment the present invention provides the amino acid
sequences described herein or fragments thereof or antibodies that bind the
amino acid
sequences or the polynucleotide sequences described herein in a
therapeutically effective
amount admixed with a pharmaceutically acceptable carrier, diluent, or
excipient.
The phrase "therapeutically effective amount" is used herein to mean an amount
sufficient to reduce by at least about 15%, preferably by at least 50%, more
preferably by at
least 90%, and most preferably prevent, a clinically significant deficit in
the activity, function
and response of the animal host. Alternatively, a therapeutically effective
amount is
sufficient to cause an improvement in a clinically significant condition in
the animal host.
The phrase "pharmaceutically acceptable" refers to molecular entities and
compositions that are physiologically tolerable and do not typically produce
an allergic or
similarly untoward reaction, such as gastric upset and the like, when
administered to an
animal. The term "carrier" refers to a diluent, adjuvant, excipient, or
vehicle with which the
compound is administered. Such pharmaceutical carriers can be sterile liquids,
such as water
and oils, including those of petroleum, animal, vegetable or synthetic origin,
such as peanut
oil, soybean oil, mineral oil, sesame oil and the like. Water or saline
solutions and aqueous
dextrose and glycerol solutions are preferably employed as carriers,
particularly for injectable
solutions. Suitable pharmaceutical carriers are described in Martin,
Remington's
Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA, (1990).
In a more specific form of the invention there are provided pharmaceutical
compositions comprising therapeutically effective amounts of the amino acid
sequences
described herein or an analogue, fragment or derivative product thereof or
antibodies thereto
together with pharmaceutically acceptable diluents, preservatives,
solubilizes, emulsifiers,
adjuvants and/or carriers. Such compositions include diluents of various
buffer content (e.g.,
Tris-HC1, acetate, phosphate), pH and ionic strength and additives such as
detergents and
31
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g.,
ascorbic acid,
sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and
bulking substances
(e.g., lactose, mannitol). The material may be incorporated into particulate
preparations of
polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into
liposomes.
Hylauronic acid may also be used. Such compositions may influence the physical
state,
stability, rate of in vivo release, and rate of in vivo clearance of the
present proteins and
derivatives. See, e.g., Martin, Remington's Pharmaceutical Sciences, 18th Ed.
(1990, Mack
Publishing Co., Easton, PA 18042) pages 1435-1712 that are herein incorporated
by
reference. The compositions may be prepared in liquid form, or may be in dried
powder,
such as lyophilised form.
Alternatively, the polynucleotides of the invention can be optimized for
expression in
plants (e.g., corn). The plant may be transformed with plasmids containing the
optimized
polynucleotides. Then the plant is grown, and the proteins of the invention
are expressed in
the plant, or the plant-optimized version is expressed. The plant is later
harvested, and the
section of the plant containing the proteins of the invention is processed
into feed for the
animal. This animal feed will impart immunity against B. hyodysenteriae when
eaten by the
animal. Examples of prior art detailing these methods can be found in U.S.
Patent 5,914,123
(Arntzen, et al.); U.S. Patent 6,034,298 (Lam, et al.); and U.S. Patent
6,136,320 (Arntzen, et
al.).
It will be appreciated that pharmaceutical compositions provided accordingly
to the
invention may be administered by any means known in the art. Preferably, the
pharmaceutical compositions for administration are administered by injection,
orally, or by
the pulmonary, or nasal route. The amino acid sequences described herein or
antibodies
derived therefrom are more preferably delivered by intravenous, intraarterial,
intraperitoneal,
intramuscular, or subcutaneous routes of administration. Alternatively, the
amino acid
sequence described herein or antibodies derived therefrom, properly
formulated, can be
administered by nasal or oral administration.
Also encompassed by the present invention is the use of polynucleotide
sequences of
the invention, as well as antisense and ribozyme polynucleotide sequences
hybridisable to a
polynucleotide sequence encoding an amino acid sequence according to the
invention, for
manufacture of a medicament for modulation of a disease associated B.
hyodysenteriae.
Polynucleotide sequences encoding antisense constructs or ribozymes for use in
therapeutic methods are desirably administered directly as a naked nucleic
acid construct.
Uptake of naked nucleic acid constructs by bacterial cells is enhanced by
several known
32
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
transfection techniques, for example those including the use of transfection
agents. Example
of these agents include cationic agents (for example calcium phosphate and
DEAE-dextran)
and lipofectants. Typically, nucleic acid constructs are mixed with the
transfection agent to
produce a composition.
Alternatively the antisense construct or ribozymes may be combined with a
pharmaceutically acceptable carrier or diluent to produce a pharmaceutical
composition.
Suitable carriers and diluents include isotonic saline solutions, for example
phosphate-
buffered saline. The composition may be formulated for parenteral,
intramuscular,
intravenous, subcutaneous, intraocular, oral or transdermal administration.
The routes of
administration described are intended only as a guide since a skilled
practitioner will be able
to determine readily the optimum route of administration and any dosage for
any particular
animal and condition.
The invention also includes kits for screening animals suspected of being
infected
with a Brachyspira species, such as B. hyodysenteriae or to confirm that an
animal is infected
with a Brachyspira species, such as B. hyodysenteriae. In a further embodiment
of this
invention, kits suitable for use by a specialist may be prepared to determine
the presence or
absence of Brachyspira species, including but not limited to B.
hyodysenteriae, B. suanatina,
B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B.
pilosicoli in
suspected infected animals or to quantitatively measure a Brachyspira species,
including but
not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli,
B. aalborgi and
B. pilosicoli infection. In accordance with the testing techniques discussed
above, such kits
can contain at least a labelled version of one of the amino acid sequences
described herein or
its binding partner, for instance an antibody specific thereto, and directions
depending upon
the method selected, e.g., "competitive," "sandwich," "DASP" and the like.
Alternatively,
such kits can contain at least a polynucleotide sequence complementary to a
portion of one of
the polynucleotide sequences described herein together with instructions for
its use. The kits
may also contain peripheral reagents such as buffers, stabilizers, etc.
Accordingly, a test kit for the demonstration of the presence of a Brachyspira
species,
including but not limited to B. hyodysenteriae, B. suanatina, B. intermedia,
B. alvinipulli, B.
aalborgi, B. innocens, B. murdochii, and B. pilosicoli, may contain the
following:
(a) a predetermined amount of at least one labelled immunochemically reactive
component obtained by the direct or indirect attachment of one of the amino
acid sequences
described herein or a specific binding partner thereto, to a detectable label;
(b) other reagents; and
33
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
(c) directions for use of said kit.
More specifically, the diagnostic test kit may contain:
(a) a known amount of one of the amino acid sequences described herein as
described above (or a binding partner) generally bound to a solid phase to
form an
immunosorbent, or in the alternative, bound to a suitable tag, or there are a
plural of such end
products, etc;
(b) if necessary, other reagents; and
(c) directions for use of said test kit.
In a further variation, the test kit may contain:
(a) a labelled component which has been obtained by coupling one of the amino
acid sequences described herein to a detectable label;
(b) one or more additional immunochemical reagents of which at least one
reagent
is a ligand or an immobilized ligand, which ligand is selected from the group
consisting of:
(i) a ligand capable of binding with the labelled component (a);
(ii) a ligand capable of binding with a binding partner of the labelled
component (a);
(iii) a ligand capable of binding with at least one of the component(s) to be
determined; or
(iv) a ligand capable of binding with at least one of the binding partners of
at least one of the component(s) to be determined; and
(c) directions for the performance of a protocol for the detection and/or
determination of one or more components of an immunochemical reaction between
one of the
amino acid sequences described herein and a specific binding partner thereto.
Preparation of genomic library
A genomic library is prepared using an Australian porcine field isolate of B.
hyodysenteriae (strain WAl). This strain has been well-characterised and shown
to be
virulent following experimental challenge of pigs. The cetyltrimethylammonium
bromide
(CTAB) method is used to prepare high quality chromosomal DNA suitable for
preparation
of genomic DNA libraries. B. hyodysenteriae is grown in 100 ml anaerobic
trypticase soy
broth culture to a cell density of 109 cells/ml. The cells are harvested at
4,000 x g for 10
minutes, and the cell pellet resuspended in 9.5 ml TE buffer. SDS is added to
a final
concentration of 0.5 % (w/v), and the cells lysed at 37 C for 1 hour with 100
g of Proteinase
K. NaC1 is added to a final concentration of 0.7 M and 1.5 ml CTAB/NaC1
solution (10%
34
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
w/v CTAB, 0.7 M NaC1) is added before incubating the solution at 65 C for 20
minutes. The
lysate is extracted with an equal volume of chloroform/isoamyl alcohol, and
the tube is
centrifuged at 6,000 x g for 10 minutes to separate the phases. The aqueous
phase is
transferred to a fresh tube and 0.6 volumes of isopropanol are added to
precipitate the high
molecular weight DNA. The precipitated DNA is collected using a hooked glass
rod and
transferred to a tube containing 1 ml of 70 % (v/v) ethanol. The tube is
centrifuged at 10,000
x g and the pelleted DNA redissolved in 4 ml TE buffer overnight. A cesium
chloride
gradient containing 1.05 g/ml CsC1 and 0.5 mg/ml ethidium bromide is prepared
using the
redissolved DNA solution. The gradient is transferred to 4 ml sealable
centrifuge tubes and
centrifuged at 70,000 x g overnight at 15 C. The separated DNA is visualized
under an
ultraviolet light, and the high molecular weight DNA is withdrawn from the
gradient using a
15-g needle. The ethidium bromide is removed from the DNA by sequential
extraction with
CsC1-saturated isopropanol. The purified chromosomal DNA is dialysed against 2
litres TE
buffer and precipitated with isopropanol. The resuspended genomic DNA is
sheared using a
GeneMachines Hydroshear (Genomic Solutions, Ann Arbor, MI), and the sheared
DNA is
filled-in using Klenow DNA polymerase to generate blunt-end fragments. One
hundred ng of
the blunt-end DNA fragments is ligated with 25 ng of pSMART VC vector
(Lucigen,
Meddleton, WI) using CloneSmart DNA ligase. The ligated DNA is then
electroporated into
E. coli electrocompetent cells. A small insert (2-3 kb) library and medium
insert (3-10 kb)
library is constructed into the low copy version of the pSMART VC vector.
Genomic sequencing
After the genomic library is obtained, individual clones of E. coli containing
the
pSMART VC vector are picked. The plasmid DNA is purified and sequenced. The
purified
plasmids are subjected to automated direct sequencing of the pSMART VC vector
using the
forward and reverse primers specific for the pSMART VC vector. Each sequencing
reaction
is performed in a 10 1 volume consisting of 200 ng of plasmid DNA, 2 pmol of
primer, and
4 l of the ABI PRISMTM BigDye Terminator Cycle Sequencing Ready Reaction Mix
(PE
Applied Biosystems, Foster City, CA). Cycling conditions involve a 2 minute
denaturing step
at 96 C, followed by 25 cycles of denaturation at 96 C for 10 seconds, and a
combined
primer annealing and extension step at 60 C for 4 minutes. Residual dye
terminators are
removed from the sequencing products by precipitation with 95% (v/v) ethanol
containing 85
mM sodium acetate (pH 5.2), 3mM EDTA (pH 8), and vacuum dried. The plasmids
are
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
sequenced in duplicate using each primer. Sequencing products are analysed
using an ABI
373A DNA Sequencer (PE Applied Biosystems).
Annotation
Partial genome sequences for B. hyodysenteriae are assembled and annotated
using a
range of public domain bioinformatics tools to analyse and re-analyse the
sequences as part
of a quality assurance procedure on data analysis. Open reading frames (ORFs)
are predicted
using a variety of programs including GeneMark, GLIMMER, ORPHEUS, SELFID and
GetORF. Putative ORFs are examined for homology (DNA and protein) with
existing
international databases using searches including BLAST and FASTA. All the
predicted ORFs
are analysed to determine their cellular localisation using programs including
PSI-BLAST,
FASTA, MOTIFS, FINDPATTERNS, PHD, SIGNALP and PSORT. Databases including
Interpro, Prosite, ProDom, Pfam and Blocks are used to predict surface
associated proteins
such as transmembrane domains, leader peptides, homologies to known surface
proteins,
lipoprotein signature, outer membrane anchoring motifs and host cell binding
domains.
Phylogenetic and other molecular evolution analysis is conducted with the
identified genes
and with other species to assist in the assignment of function. The in silico
analysis of both
partially sequenced genomes produces a comprehensive list of all the predicted
ORFs present
in the sequence data available. Each ORF is interrogated for descriptive
information such as
predicted molecular weight, isoelectric point, hydrophobicity, and subcellular
localisation to
enable correlation with the in vitro properties of the native gene product.
Predicted genes
which encode proteins similar to surface localized components and/or virulence
factors in
other pathogenic bacteria are selected as potential vaccine targets.
Bioinformatics results
The shotgun sequencing of the B. hyodysenteriae genome results in 94.6%
(3028.6 kb
out of a predicted 3200 kb) of the genome being sequenced. The B.
hyodysenteriae sequence
is comprised of 294 contigs with an average contig size of 10.3 kb. For B.
hyodysenteriae,
2,593 open-reading frames (ORFs) are predicted from the 294 contigs.
Comparison of the
predicted ORFs with genes present in the nucleic acid and protein databases
indicate that
approximately 70% of the ORFs have homology with genes contained in the public
databases. The remaining 30% of the predicted ORFs have no known identity.
Vaccine candidates
To help reduce the number of ORFs that would be tested as a vaccine candidate,
ORF's showing reasonable homology (E-value less than e is) with outer surface
proteins,
secreted proteins, and possible virulence factors present in public databases
are selected as
36
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
potential vaccine candidates. Of the 2,593 ORFs obtained in the genomic
shotgun
sequencing, many passed this test but the results of thirty-three genes are
presented here.
Table 1 shows thirty-three genes selected as potential vaccine targets and
their similarity with
other known amino acid sequences obtained from SWISS-PROT database. It is
noted that
the percent identity of amino acids does not raise above 58% while the percent
similarity or
homology of amino acids remains less than 71%, thus indicating that these ORFs
are unique.
Table 1
Gene Identity of Protein With Highest Identity (amino Si(mamiliarnoity
Accession
Number
Homology acids) acids)
NAV- Variable surface protein (VspD) of 106/223 136/223 068157
H54 Brachyspira hyodysenteriae (47%) (60%)
NAV- Flagellar protein B of Leptospira 58/213 108/213 Q72SJ3
H55 interrogans (27%) 50%
NAV- Myosin-like major antigen 288/1509 609/1509 P21249
H56 19 / 40 /
NAV- Lytic murein transglycosylate (possibly 97/318 158/318 Q6F7W9
H57 outer membrane-bound) (25%) 41%
NAV- Outer membrane protein of Treponema 57/175 90/175 P96127
H58 pallidum (32%) 51%
NAV- Myosin-like major antigen 204/1012 432/1012 P21249
H59 20 / 42 /
NAV- Outer membrane protein and related 46/139 68/139 COG2885
H60 e tido 1 can-associated li o rotein (33%) (48%)
NAV- Putative lipoprotein of Treponema 336/805 483/805 Q73NTO
H61 denticola (41%) 60%
NAV- N1pA lipoprotein of Streptococcus suis 92/269 151/269 Q303L3
H62 34 / 56 /
NAV- 106/312 167/312
H63 N1pA lipoprotein of Streptococcus suis (33%) (53%) Q303L3
NAV- 112/337 198/337
Q303L3
H64 N1pA lipoprotein of Streptococcus suis (33%) (58%)
NAV- Putative secreted protein of Streptomyces 50/127 68/127 Q849M9
H65 violaceoruber (39%) (53%)
NAV- Toxin (YoeB) of Escherichia coli 42/85 (58%) 60/85 (76%) P69349
H66
NAV- Outer membrane protein (To1C) 80/350 171/350 Q2Z054
H67 (20%) 39%
NAV- Probable hemolysin-related protein of 121/415 204/415 Q3ZYX1
H68 Dehalococcoides sp. (29%) 49%
NAV- 193/357 256/357
H69 Outer surface protein of Bacillus cereus (54%) (71%) Q4MWSO
NAV- Membrane associated lipoprotein of 146/417 203/417 Q2SRL9
H70 Vibrio vulnificus (35%) (48%)
NAV- Surface layer protein of Methanosarcina 72/201 112/201 Q8TJE3
H71 barkeri (36%) 49%
NAV- Lytic murein transglycosylate (possibly 51/141 6/141 (53%) P44049
H72 outer membrane-bound)
36%
37
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
Table 1 (continued)
Gene Identity of Protein With Highest Identity (amino Si(mamiliarnoity
Accession
Number
Homology acids) acids)
NH73 Toxin (YoeB) of Escherichia coli 42/84 (50%) ~ 3~% P69349
NAV- Outer membrane protein/protective 210/833 339/833 COG4775
H74 antigen (25%) (40%)
NAV- variable surface protein (VspH) of 29% 43%
AAK14803.1
H22 Brachyspira hyodysenteriae (133/454) (199/454)
NAV- membrane associated lipoprotein of 43% 60%
AAF27178.1
H23 Mycoplasma mycoides (114/263) (159/263)
NAV- Outer membrane lipoprotein of 32% 53% ZP00300921.1
H24 Geobacter metallireducens (46/142) (76/142)
NAV- surface antigen (BspA) of Bacteroides 38% 55% AAC82625.1
H30 forsythus (83/216) (120/216)
NAV- hemolytic protein (H1pA) of Nostoc sp. 35% 56% NP488469.1
H32 (49/137) (77/137)
NAV- hemolytic protein of Prevotella 54% 70%
~C05836.1
H33 intermedia (64/117) (83/117)
NAV- virulence-mediating protein (VirC) of 36% 63%
H37 Vibrio parahaemolyticus (58/159) 101/159 NP800579.1
NAV- lytic murein transglycosylase (contains 26% 41% ZP00146104.1
H40 L sM/invasin domains) (120/449) (185/449)
NAV- surface antigen BspA of Bacteroides 41% 57% AAC82625.1
H41 forsythus (84/201) (115/201)
NAV- Hemolysins and related proteins of 35% 56% ZP00162711.2
H43 Anabaena variabilis (150/425) (242/425)
NAV- outer membrane porin of Leptospira 20% 41%
H44 interrogans 79/393 163/393 ~'P001419.1
NAV- virulence factor (MviN) protein of 32% 49%
H45 Geobacter sulfurreduceus (153/469) (231/469) NP952225.1
The DNA and amino acid sequences of NAV-H54 are found in SEQ ID NOs: 1 and 2,
respectively. The DNA and amino acid sequences of NAV-H55 are found in SEQ ID
NOs: 3
and 4, respectively. The DNA and amino acid sequences of NAV-H56 are found in
SEQ ID
NOs: 5 and 6, respectively. The DNA and amino acid sequences of NAV-H57 are
found in
SEQ ID NOs: 7 and 8, respectively. The DNA and amino acid sequences of NAV-H58
are
found in SEQ ID NOs: 9 and 10, respectively. The DNA and amino acid sequences
of NAV-
H59 are found in SEQ ID NOs: 11 and 12, respectively. The DNA and amino acid
sequences
of NAV-H60 are found in SEQ ID NOs: 13 and 14, respectively. The DNA and amino
acid
sequences of NAV-H61 are found in SEQ ID NOs: 15 and 16, respectively. The DNA
and
amino acid sequences of NAV-H62 are found in SEQ ID NOs: 17 and 18,
respectively. The
DNA and amino acid sequences of NAV-H63 are found in SEQ ID NOs: 19 and 20,
respectively. The DNA and amino acid sequences of NAV-H64 are found in SEQ ID
NOs:
38
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
21 and 22, respectively. The DNA and amino acid sequences of NAV-H65 are found
in SEQ
ID NOs: 23 and 24, respectively. The DNA and amino acid sequences of NAV-H66
are
found in SEQ ID NOs: 25 and 26, respectively. The DNA and amino acid sequences
of
NAV-H67 are found in SEQ ID NOs: 27 and 28, respectively. The DNA and amino
acid
sequences of NAV-H68 are found in SEQ ID NOs: 29 and 30, respectively. The DNA
and
amino acid sequences of NAV-H69 are found in SEQ ID NOs: 31 and 32,
respectively. The
DNA and amino acid sequences of NAV-H70 are found in SEQ ID NOs: 33 and 34,
respectively. The DNA and amino acid sequences of NAV-H71 are found in SEQ ID
NOs:
35 and 36, respectively. The DNA and amino acid sequences of NAV-H72 are found
in SEQ
ID NOs: 37 and 38, respectively. The DNA and amino acid sequences of NAV-H73
are
found in SEQ ID NOs: 39 and 40, respectively. The DNA and amino acid sequences
of
NAV-H74 are found in SEQ ID NOs: 41 and 42, respectively.
The DNA and amino acid sequences of NAV-H22 are found in SEQ ID NOs: 43 and
44, respectively. The DNA and amino acid sequences of NAV-H23 are found in SEQ
ID
NOs: 45 and 46, respectively. The DNA and amino acid sequences of NAV-H24 are
found
in SEQ ID NOs: 47 and 48, respectively. The DNA and amino acid sequences of
NAV-H30
are found in SEQ ID NOs: 49 and 50, respectively. The DNA and amino acid
sequences of
NAV-H32 are found in SEQ ID NOs: 51 and 52, respectively. The DNA and amino
acid
sequences of NAV-H33 are found in SEQ ID NOs: 53 and 54, respectively. The DNA
and
amino acid sequences of NAV-H37 are found in SEQ ID NOs: 55 and 56,
respectively. The
DNA and amino acid sequences of NAV-H40 are found in SEQ ID NOs: 57 and 58,
respectively. The DNA and amino acid sequences of NAV-H41 are found in SEQ ID
NOs:
59 and 60, respectively. The DNA and amino acid sequences of NAV-H43 are found
in SEQ
ID NOs: 61 and 62, respectively. The DNA and amino acid sequences of NAV-H44
are
found in SEQ ID NOs: 63 and 64, respectively. The DNA and amino acid sequences
of
NAV-H45 are found in SEQ ID NOs: 65 and 66, respectively.
To further reduce the number of ORFs that would be tested as a vaccine
candidate,
gene products predicted by the in silico analysis to be localised in the
cytoplasm or inner
membrane of the spirochaete are abandoned. As a result, twenty one of the
thirty three genes
presented in Table 1 are further analysed. These include NAV-H58, NAV-H60, NAV-
H62,
NAV-H64, NAV-H66, NAV-H67, NAV-H69, NAV-H71, NAV-H73, NAV-H22, NAV-H23,
NAV-H24, NAV-H30, NAV-H32, NAV-H33, NAV-H37, NAV-H40, NAV-H41, NAV-H43,
NAV-H44, and NAV-H45.
39
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
Analysis of gene distribution usingpolymerase chain reaction (PCR)
One or two primer pairs which anneal to different regions of the target gene
encoding
region are designed and optimised for PCR detection. Individual primers are
designed using
Oligo Explorer 1.2 and primer sets with calculated melting temperatures of
approximately
55-60 C are selected. These primers sets are also selected to generate PCR
products greater
than 200 bp. A medium-stringency primer annealing temperature of 50 C is
selected for the
distribution analysis PCR. The medium-stringency conditions would allow
potential minor
mismatched sequences (because of strain differences) occurring at the primer
binding sites to
not affect primer binding. Distribution analysis of the twenty one B.
hyodysenteriae target
genes are performed on 23 strains of B. hyodysenteriae, including two strains
which have
been shown to be avirulent. PCR analysis is performed in a 25 1 total volume
using Taq
DNA polymerase (Biotech International, Thurmont, MD). The amplification
mixture consists
of lx PCR buffer (containing 1.5 mM of MgC1z), 1 U of Taq DNA polymerase, 0.2
mM of
each dNTP (Amersham Pharmacia Biotech, Piscataway, NJ), 0.5 M of the primer
pair, and
1 l purified chromosomal template DNA. Cycling conditions involve an initial
template
denaturation step of 5 minutes at 94 C, follow by 35 cycles of denaturation at
94 C for 30
seconds, annealing at 50 C for 15 seconds, and primer extension at 68 C for 4
minutes. The
PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in lx
TAE buffer (40
mM Tris-acetate, 1 mM EDTA), staining with a 1 g/ml ethidium bromide solution
and
viewing over UV light.
The primers used for eighteen genes (out of twenty one) are indicated in Table
2. Of
these eighteen genes, three of them (NAV-H23, NAV-H41 and NAV-H71) are present
in
83% of the B. hyodysenteriae strains tested; three of them (NAV-H24, NAV-H30
and NAV-
H73) are present in 87% of the strains tested, seven of them (NAV-H22, NAV-
H32, NAV-
H33, NAV-H37, NAV-H43, NAV-H64 and NAV-H69) are present in 91% of the strains
tested, and three of them (NAV-H40, NAV-H44, and NAV-H45) are present in 100%
of the
strains tested. The remaining three genes are present in less than 80% of the
B.
hyodysenteriae strains tested. The poor distribution of these genes makes them
less useful as
a vaccine subunit. For this reason, further analysis of these genes has been
abandoned.
Table 2
Gene Primer name Primer Sequence (5'-3')
NAV-H22 H22-F4 AAACGTTTATATTTTATTTTATC SEQ ID NO: 67)
H22-R1308 AAACTTCCAAGTGATACC (SEQ ID NO: 68)
NAV-H23 H23-F4 AAATATAAACCTACAAGCAG (SEQ ID NO: 69)
H23-R2366 AATATTTCAGTTAATCTAAAATC (SEQ ID NO: 70)
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
NAV-H24 H24-F19 ACTTTAATCTTTGTATTAATTTTG (SEQ ID NO: 71)
H24-R729 TTGTTTTAATTTGATAATATCAG (SEQ ID NO: 72)
Table 2 (continued)
Gene Primer Primer Sequence (5'-3')
name
NAV-H30 H30-F4 AAAAAAATTATTTTATTAATATTTATATT (SEQ ID NO: 73)
H30-R969 TTCTCTTATAATCTTTACAGTTG (SEQ ID NO: 74)
NAV-H32 H32-F4 CATATTTCTGGTGATTCTC (SEQ ID NO: 75)
H32-R564 TTTTTTGATAAATAAGTTTTTTATTTG (SEQ ID NO: 76)
NAV-H33 H33-F4 TTTAATACTCCTATATTATTAATTATTT (SEQ ID NO: 77)
H33-R396 AAGGAGAATCACCAGAAA (SEQ ID NO: 78)
NAV-H37 H37-F4 AATGATATTATTAAAGTGATAAA (SEQ ID NO: 79)
H37-R825 AAAATCTAATATAACGGATT (SEQ ID NO: 80)
NAV-H40 H40-F16 AAATATGCTTCCATTATAGG (SEQ ID NO: 81
H40-R1815 ACTTTTAGGAAGAAGTTTAAC (SEQ ID NO: 82)
NAV-H41 H41-F19 TATATTTTCATTATATATTTATTAG (SEQ ID NO: 83)
H41-R1067 CTAGGCATAGATTTTCCA (SEQ ID NO: 84)
NAV-H43 H43-F46 TTTGCCATGTCGGAAATTGCAG (SEQ ID NO: 85)
H43-R1236 TATTCTAGCACCGTCCATATC (SEQ ID NO: 86)
NAV-H44 H44-F43 GTATGTTTATATGCTCAGGATAC (SEQ ID NO: 87)
H44-R2931 AACAGCAGCACTATCTTGTAA (SEQ ID NO: 88)
H44-F80 CAGCAGCAACAAATAATACTACTG (SEQ ID NO: 89)
H44-R929 TGAATATAAACACCTTCTCTCAAAG (SEQ ID NO: 90)
NAV-H45 H45-F52 AAAATGTCATTGGTAACTACTGTAAG (SEQ ID NO: 91)
H45-R1595 CTTGATAATCTGCCTTTAAACATAC (SEQ ID NO: 92)
NAV-H62 H62-F69 ATGTGAGGAAAAAACAGAAAG (SEQ ID NO: 93)
H62-R866 TCATTACCAGAAAACCATACTC (SEQ ID NO: 94)
NAV-H64 H64-F69 AGGAAATAAAGCTCCTGCTGCTTCAGC (SEQ ID NO: 95)
H64-R253 GCATAGCAGCAACTTCAGAAGGTCCA (SEQ ID NO: 96)
NAV-H66 H66-F114 CTTATTAATTGGTATAGGAAAACC (SEQ ID NO: 97)
H66-R200 AATCTATGTTCTTGATTTATTAGCC (SEQ ID NO: 98)
NAV-H69 H69-F546 AGAAGCTACTTTTGGACCTTGGCCTGT (SEQ ID NO: 99)
H69-R662 ACACAGTCAACACCAAGAGC (SEQ ID NO: 100)
NAV-H71 H71-F568 AAACAGCAGACTAGCTGGTG (SEQ ID NO: 101
H71-R773 TGACCATTACTTACACCGGATACCCCA (SEQ ID NO: 102)
H71-F37 TTAATGACTATATCGCTTTCATACACTTTC (SEQ ID NO: 103)
H71-R1241 TCAATTCTTCCAGACATAAAATCAGTAAG (SEQ ID NO: 104)
NAV-H73 H73-F37 TATATAGAGTGGGTATCAGAAG (SEQ ID NO: 105)
H73-R254 TCATAATGGTATTTACAAGATG (SEQ ID NO: 106)
pTrcHis plasmid extraction
Escherichia coli JM109 clones harboring the pTrcHis plasmid (Invitrogen,
Carlsbad,
CA) are streaked out from glycerol stock storage onto Luria-Bertani (LB) agar
plates
supplemented with 100 mg/l ampicillin and incubated at 37 C for 16 hours. A
single colony
is used to inoculate 10 ml of LB broth supplemented with 100 mg/l ampicillin,
and the broth
culture is incubated at 37 C for 12 hours with shaking. The entire overnight
culture is
centrifuged at 5,000 x g for 10 minutes, and the plasmid contained in the
cells is extracted
using the QlAprep Spin Miniprep Kit (Qiagen, Doncaster VIC). The pelleted
cells are
41
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
resuspended with 250 l cell resuspension buffer Pl and then are lysed with
the addition of
250 l cell lysis buffer P2. The lysed cells are neutralized with 350 l
neutralization buffer
N3, and the precipitated cell debris is pelleted by centrifugation at 20,000 x
g for 10 minutes.
The supematant is transferred to a spin column and centrifuged at 10,000 x g
for 1 minute.
After discarding the flow-through, 500 l wash buffer PE is applied to the
column and
centrifuged as before. The flow-through is discarded, and the column is dried
by
centrifugation at 20,000 x g for 3 minutes. The plasmid DNA is eluted from the
column with
100 l elution buffer EB. The purified plasmid is quantified using a Dynaquant
DNA
fluorometer (Hoefer, San Francisco, CA), and the DNA concentration is adjusted
to 100
g/ml by dilution with TE buffer. The purified pTrcHis plasmid is stored at -20
C.
Vector preparation
Two g of the purified pTrcHis plasmid is digested at 37 C for 1-4 hours in a
total
volume of 50 1 containing 5 U of two restriction enzymes in 100 mM Tris-
HC1(pH 7.5), 50
mM NaC1, 10 mM MgC12, 1 mM DTT and 100 g/ml BSA. The particular pair of
restriction
enzymes used depends on the sequence of the primers and the sequence of the
ORF; the goal
being to use primers that would not cut the ORFs. The restricted vector is
verified by
electrophoresing 1 1 of the digestion reaction through a 1% (w/v) agarose gel
in lX TAE
buffer at 90V for 1 hour. The electrophoresed DNA is stained with 1 g/ml
ethidium bromide
and is viewed over ultraviolet (UV) light.
Linearised pTrcHis vector is purified using the UltraClean PCR Clean-up Kit
(Mo Bio
Laboratories, Carlsbad, CA). Briefly, the restriction reaction (50 l) is
mixed with 250 1
SpinBind buffer B 1, and the entire volume is added to a spin-column. After
centrifugation at
8,000 x g for 1 minute, the flow-through is discarded and 300 1 SpinClean
buffer B2 is
added to the column. The column is centrifuged as before, and the flow-through
is discarded
before drying the column at 20,000 x g for 3 minutes. The purified vector is
eluted from the
column with 50 l TE buffer. Purified linear vector is quantified using a
fluorometer, and the
DNA concentration is adjusted to 50 g/ml by dilution with TE buffer. The
purified restricted
vector is stored at -20 C.
Primer design for insert preparation
Primer pairs are designed to amplify as much of the coding region of the
target gene
as possible using genomic DNA as the starting point. All primers sequences
include terminal
restriction enzyme sites to enable cohesive-end ligation of the resultant
amplicon into the
linearised pTrcHis vector. The primers are tested using Amplify 1.2
(University of
42
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
Wisconsin, Madison, WI) and the theoretical amplicon sequence is inserted into
the
appropriate position in the pTrcHis vector sequence. Deduced translation of
the chimeric
pTrcHis expression cassette is performed using Vector NTI version 6 (InforMax)
to confirm
that the gene inserts would be in the correct reading frame. Table 3 also
provides the gene
size, the protein size, the predicted molecular weight of the native protein
in daltons and the
predicted pI of the protein. It is noted that the histidine-fusion of the
recombinant protein
adds approximately 4 kDa to the native protein's predicted molecular weight.
Table 3
Gene size Protein size Predicted MW of
Predicted pI
Gene (bp) (aa) native protein (Da)
NAV-H40 1815 605 97,733 9.4853
NAV-H41 1068 356 39,870 5.2168
NAV-H44 2940 980 113,722 5.1864
NAV-H62 1014 338 37642 4.3944
NAV-H64 1011 337 36468 4.4953
NAV-H66 264 88 10629 9.3027
NAV-H69 1080 360 41525 5.7123
NAV-H73 258 86 10527 9.5920
Amplification of the gene inserts
Using genomic DNA, all target gene inserts are amplified by PCR in a 100 1
total
volume using Taq DNA polymerase (Biotech International) and Pfu DNA polymerase
(Promega, Madison, WI). The amplification mixture consists of lx PCR buffer
(containing
1.5 mM of MgC1z), 1 U of Taq DNA polymerase, 0.01 U Pfu DNA polymerase, 0.2 mM
of
each dNTP (Amersham Pharmacia Biotech), 0.5 M of the appropriate primer pair
and 1 l
of purified chromosomal DNA. The chromosomal DNA is prepared from the same B.
hyodysenteriae strain used for genome sequencing. Cycling conditions involve
an initial
template denaturation step of 5 minutes at 94 C, followed by 35 cycles of
denaturation at
94 C for 30 seconds, annealing at 50 C for 15 seconds, and primer extension at
68 C for 4
minutes. The PCR products are subjected to electrophoresis in 1% (w/v) agarose
gels in lx
TAE buffer, are stained with a 1 g/ml ethidium bromide solution and are
viewed over UV
light. After verifying the presence of the correct size PCR product, the PCR
reaction is
purified using the UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Carlsbad,
CA). The
PCR reaction (100 1) is mixed with 500 l SpinBind buffer Bl, and the entire
volume is
added to a spin-column. After centrifugation at 8,000 x g for 1 minute, the
flow-through is
43
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
discarded, and 300 l SpinClean buffer B2 is added to the column. The column
is centrifuged
as before and the flow-through is discarded before drying the column at 20,000
x g for 3
minutes. The purified vector is eluted from the column with 100 l TE buffer.
Restriction enzyme di~4estion of the ~4ene inserts
Thirty g1 of the purified PCR product are digested in a 50 g1 total volume
with 1 U of
each restriction enzyme compatible with the terminal restriction endonuclease
recognition
site determined by the cloning oligonucleotide primer. The restriction
reaction consists of
100 mM Tris-HC1(pH 7.5), 50 mM NaC1, 10 mM MgC1z, 1 mM DTT and 100 gg/ml BSA
with 1 U of each restriction enzyme at 37 C for 1-4 hours. The digested insert
DNA are
purified using the UltraClean PCR Clean-up Kit (see above). Purified digested
insert DNA
are quantified using the fluorometer, and the DNA concentration is adjusted to
20 gg/ml by
dilution with TE buffer. The purified restricted insert DNA are used
immediately for vector
ligation.
Li~4ation of the ~4ene inserts into the pTrcHis vector
Ligation reactions are all performed in a total volume of 20 1. One hundred
ng of
linearised pTrcHis is incubated with 20 ng of restricted insert at 16 C for 16
hours in 30 mM
Tris-HC1(pH 7.8), 10 mM MgC1z, 10 mM DTT and 1 mM ATP containing 1 U of T4 DNA
ligase (Promega). An identical ligation reaction containing no insert DNA is
also included as
a vector re-circularisation negative control. The appropriate restriction
enzyme is used for
each reaction.
Transformation of pTrcHis ligations into E. coli cells
Competent E. coli JM109 (Promega) cells are thawed from -80 C storage on ice
and
then 50 1 of the cells are transferred into ice-cold 1.5 ml microfuge tubes
containing 5 1 of
the overnight ligation reactions (equivalent to 25 ng of pTrcHis vector). The
tubes are mixed
by gently tapping the bottom of each tube on the bench and left on ice for 30
minutes. The
cells are then heat-shocked by placing the tubes into a 42 C water bath for 45
seconds before
returning the tube to ice for 2 minutes. The transformed cells are recovered
in 1 ml LB broth
for 1 hour at 37 C with gentle mixing. The recovered cells are harvested at
2,500 x g for 5
minutes, and the cells are resuspended in 50 1 of fresh LB broth. The entire
50 1 of
resuspended cells are spread evenly onto a LB agar plate containing 100 mg/l
ampicillin
using a sterile glass rod. Plates are incubated at 37 C for 16 hours.
Detection of recombinant pTrcHis constructs in E. coli by PC
44
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
Twelve single transformant colonies for each construct are streaked onto fresh
LB
agar plates containing 100 mg/l ampicillin and incubated at 37 C for 16 hours.
A single
colony from each transformation event is resuspended in 50 1 of TE buffer and
is boiled for
1 minute. Two l of boiled cells are used as template for PCR. The
amplification mixture
consists of lx PCR buffer (containing 1.5 mM of MgC1z), 1 U of Taq DNA
polymerase, 0.2
mM of each dNTP, 0.5 M of the pTrcHis-F primer (5'-
CAATTTATCAGACAATCTGTGTG-3' SEQ ID NO: 107) and 0.5 M of the pTrcHis-R
primer (5'-TGCCTGGCAGTTCCCTACTCTCG-3' SEQ ID NO: 108). Cycling conditions
involve an initial template denaturation step of 5 minutes at 94 C, followed
by 35 cycles of
denaturation at 94 C for 30 seconds, annealing at 60 C for 15 seconds, and a
primer
extension at 72 C for 1 minute. The PCR products are subjected to
electrophoresis in 1%
(w/v) agarose gels in lx TAE buffer, are stained with a 1 g/ml ethidium
bromide solution
and are viewed over UV light. Cloning of the various inserts into the pTrcHis
expression
vector produces recombinant constructs of various sizes.
Pilot expression of recombinant His-tag egd proteins
Five to ten isolated colonies of recombinant pTrcHis construct in E. coli JM
109 are
inoculated into 3 ml LB broth in a 5 ml tube containing 100 mg/l ampicillin
and 1 mM IPTG
and incubated at 37 C for 16 hours with shaking. The cells are harvested by
centrifugation at
5,000 x g for 10 minutes at 4 C. The supematant is discarded, and each pellet
is resuspended
with 10 1 Ni-NTA denaturing lysis buffer (100 mM NaH2PO4, 10 mM Tris-HC1, 8 M
urea,
pH 8.0). After vortexing the tube for 1 minute, the cellular debris is
pelleted by centrifugation
at 10,000 x g for 10 minute at 4 C. The supematant is transferred to a new
tube and stored at
-20 C until analysis.
Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)
SDS-PAGE analysis of protein is performed using a discontinuous Tris-glycine
buffer
system. Thirty l of protein sample are mixed with 10 1 of 4x sample
treatment buffer (250
mM Tris-HC1(pH 6.0), 8% (w/v) SDS, 200 mM DTT, 40% (v/v) glycerol and 0.04 %
(w/v)
bromophenol blue). Samples are boiled for 5 minutes immediately prior to
loading 10 l of
the sample into wells in the gel. The gel comprises a stacking gel (125 mM
Tris-HC1 ph 6.8,
4% w/v acylamide, 0.15% w/v bis-acrylamide and 0.1% w/v SDS) and a separating
gel (375
mM Tris-HC1 ph 8.8, 12% w/v acylamide, 0.3 1% w/v bis-acrylamide and 0.1 % w/v
SDS).
These gels are polymerised by the addition of 0.1% (v/v) TEMED and 0.05% (w/v)
freshly
prepared ammonium sulphate solution and cast into the mini-Protean dual slab
cell (Bio-Rad,
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
Hercules, California). Samples are run at 150 V at room temperature (RT) until
the
bromophenol blue dye reaches the bottom of the gel. Pre-stained molecular
weight standards
are electrophoresed in parallel with the samples in order to allow molecular
weight
estimations. After electrophoresis, the gel is immediately stained using
Coomassie Brilliant
Blue G250 (Bio-Rad) or is subjected to electro-transfer onto nitrocellulose
membrane for
Western blotting.
Western blot analysis
Electrophoretic transfer of separated proteins from the SDS-PAGE gel to
nitrocellulose membrane is performed using the Towbin transfer buffer system.
After
electrophoresis, the gel is equilibrated in transfer buffer (25 mM Tris, 192
mM glycine, 20%
v/v methanol, pH 8.3) for 15 minutes. The proteins in the gel are electro-
transferred to
nitrocellulose membrane (Protran, Schleicher and Schuell BioScience, Inc.,
Keene, NH)
using the mini-Protean transblot apparatus (Bio-Rad) at 30 V overnight at 4 C.
The freshly
transferred nitrocellulose membrane containing the separated proteins is
blocked with 10 ml
of tris-buffered saline (TBS) containing 5% (w/v) skim milk powder for 1 hour
at room
temperature. The membrane is washed with TBS containing 0.1% (v/v) Tween 20
(TBST)
and then is incubated with 10 mL mouse anti-his antibody (diluted 5,000-fold
with TBST) for
1 hour at room temperature. After washing three times for 5 minutes with TBST,
the
membrane is incubated with 10 mL goat anti-mouse IgG (whole molecule)-AP
diluted 5,000-
fold in TBST for 1 hour at RT. The membrane is developed using the Alkaline
Phosphatase
Substrate Kit (Bio-Rad). The development reaction is stopped by washing the
membrane with
distilled water. The membrane is then dried and scanned for presentation.
Verification of reading frame of the recombinant pTrcHis constructs by direct
sequence analysis
Two transformant clones for each construct which produced the correct sized
PCR
products are inoculated into 10 ml LB broth containing 100 mg/l ampicillin and
incubated at
37 C for 12 hours with shaking. The entire overnight cultures are centrifuged
at 5,000 x g for
10 minutes, and the plasmid contained in the cells are extracted using the
QlAprep Spin
Miniprep Kit as described previously. The purified plasmid is quantified using
a fluorometer.
Both purified plasmids are subjected to automated direct sequencing of the
pTrcHis
expression cassette using the pTrcHis-F and pTrcHis-R primers. Each sequencing
reaction is
performed in a 10 1 volume consisting of 200 ng of plasmid DNA, 2 pmol of
primer, and 4
1 of the ABI PRISMTM BigDye Terminator Cycle Sequencing Ready Reaction Mix (PE
46
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
Applied Biosystems, Foster City, CA). Cycling conditions involve a 2 minute
denaturing step
at 96 C, followed by 25 cycles of denaturation at 96 C for 10 seconds, and a
combined
primer annealing and extension step at 60 C for 4 minutes. Residual dye
terminators are
removed from the sequencing products by precipitation with 95% (v/v) ethanol
containing 85
mM sodium acetate (pH 5.2), 3mM EDTA (pH 8), and vacuum dried. The plasmids
are
sequenced in duplicate using each primer. Sequencing products are analysed
using an ABI
373A DNA Sequencer (PE Applied Biosystems). Nucleotide sequencing of the
pTrcHis is
performed to verify that the expression cassette is in the correct reading
frame for each
constructs.
Expression and purification of recombinant His-ta"ed proteins
A single colony of the recombinant pTrcHis construct in E. coli JM109 is
inoculated
into 50 ml LB broth in a 250 ml conical flask containing 100 mg/l ampicillin
and incubated at
37 C for 16 hours with shaking. A 2 1 conical flask containing 1 1 of LB broth
supplemented
with 100 mg/l ampicillin is inoculated with 10 ml of the overnight culture and
incubated at
37 C until the optical density of the cells at 600 nm is 0.5 (approximately 3-
4 hours). The
culture is then induced by adding IPTG to a final concentration of 1 mM, and
the cells are
returned to 37 C with shaking. After 5 hours of induction, the culture is
transferred to 250 ml
centrifuge bottles, and the bottles are centrifuged at 5,000 x g for 20
minutes at 4 C. The
supernatant is discarded, and each pellet is resuspended with 8 ml Ni-NTA
denaturing lysis
buffer (100 mM NaH2PO4, 10 mM Tris-HC1, 8 M urea, pH 8.0). The resuspended
cells are
stored at -20 C overnight.
The cell suspension is removed from -20 C storage and thawed on ice. The cell
lysate
is then sonicated on ice 3 times for 30 seconds with 1 minute incubation on
ice between
sonication rounds. The lysed cells are cleared by centrifugation at 20,000 x g
for 10 minutes
at 4 C, and the supernatant is transferred to a 15 ml column containing a 0.5
ml bed volume
of Ni-NTA agarose resin (Qiagen). The recombinant His6-tagged protein is
allowed to bind to
the resin for 1 hour at 4 C with end-over-end mixing. The resin is then washed
with 30 ml of
Ni-NTA denaturing wash buffer (100 mM NaH2PO4, 10 mM Tris-HC1, 8 M urea, pH
6.3)
before elution with 12 ml of Ni-NTA denaturing elution buffer (100 mM NaH2PO4,
10 mM
Tris-HC1, 8 M urea, pH 4.5). Four 3 ml fractions of the eluate are collected
and stored at 4 C.
Thirty 1 of each eluate is treated with 10 1 of 4x sample treatment buffer
and boiled for 5
minutes. The samples are subjected to SDS-PAGE and stained with Coomassie
Brilliant Blue
47
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
G250 (Bio-Rad). The stained gel is equilibrated in distilled water for 1 hour
and dried
between two sheets of cellulose overnight at RT.
Expression of the selected recombinant E. coli clones is performed in medium-
scale
to generate sufficient recombinant protein for vaccination of mice (see
below).
Dialysis and lyophilisation of the purified recombinant His-tag egd protein
The eluted proteins are pooled and transferred into a hydrated dialysis tube
(Spectrum
Laboratories, Inc., Los Angeles, CA) with a molecular weight cut-off (MWCO) of
3,500 Da.
A 200 1 aliquot of the pooled eluate is taken and quantified using a
commercial Protein
Assay (Bio-Rad). The proteins are dialysed against 2 1 of distilled water at 4
C with stirring.
The dialysis buffer is changed 8 times at 12-hourly intervals. The dialysed
proteins are
transferred from the dialysis tube into a 50 ml centrifuge tubes (40 ml
maximum volume),
and the tubes are placed at -80 C overnight. Tubes are placed into a MAXI
freeze-drier
(Heto-Holten, Allerod, Denmark) and lyophilised to dryness. The lyophilised
proteins are
then re-hydrated with PBS to a calculated concentration of 2 mg/ml and stored
at -20 C.
Following dialysis and lyophilisation, stable recombinant antigen is
successfully produced.
Eight of the eighteen genes are successfully cloned into the E. coli
Expression System
and recombinant protein can be expressed stabily from these clones.
Serology using purified recombinant protein
Twenty g of purified recombinant protein is loaded into a 7 cm IEF well,
electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to
nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v)
and
assembled into the multi-screen apparatus (Bio-Rad). The wells are incubated
with 100 l of
diluted pig serum (100-fold) for 1 hour at room temperature. The pig serum is
obtained from
high health status pigs (n=3), experimentally challenged pigs showing clinical
SD (n=5),
naturally infected seroconverting pigs (n=5), and pigs recovered from natural
infection (n=4).
The membrane then is removed from the apparatus and washed three times with
TBST (0.1%
v/v) before incubating with 10 ml of goat anti-swine IgG (whole molecule)-AP
(5,000-fold)
for 1 hour at RT. The membrane is washed three times with TBST before color
development
using an Alkaline Phosphatase Substrate Kit (Bio-Rad). The membrane is washed
with tap
water when sufficient development has occurred, dried and scanned for
presentation.
The reactivity of the pig serum obtained from animal of differing health
status is
shown in the table below. All proteins are recognised by 100% of the panel of
serum thus
48
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
indicating that the genes are expressed in vivo and that they are able to
induce a systemic
immune response following exposure to the spirochaete.
Table 4. Gene distribution and serologic reactivity of the eight successfully
expressed B.
hyodysenteriae vaccine candidates. The gene distribution was analysed by PCR
using a panel
of 23 different strains. Serology was performed using 19 serum samples from
five different
categories of disease.
Gene Distribution (%) Serology (%)
NAV-H40 100 100%
NAV-H41 83 100%
NAV-H44 100 100%
NAV-H62 96 100%
NAV-H64 91 100%
NAV-H66 96 100%
NAV-H69 91 100%
NAV-H73 87 100%
Vaccination of mice using the purified recombinant his-ta"ed proteins
For each of the purified recombinant his-tagged proteins, ten mice are
systemically
and orally immunized to determine whether the recombinant protein would be
immunogenic.
The recombinant protein is emulsified with 30% (v/v) water in oil adjuvant and
injected
intramuscularly into the quadraceps muscle of ten mice (Balb/cJ: 5 weeks old
males). All
mice receive 100 g of protein in a total volume of 100 1. Three weeks after
the first
vaccination, all mice receive a second intramuscular vaccination identical to
the first
vaccination. All mice are killed two weeks after the second vaccination. Sera
are obtained
from the heart at post-mortem and tested in Western blot analysis for
antibodies against
cellular extracts of B. hyodysenteriae.
Western blot analysis
Twenty g of purified recombinant protein is loaded into a 7 cm IEF well,
electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to
nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v)
and
assembled into the multi-screen apparatus (Bio-Rad). The wells are incubated
with 100 l of
diluted mouse serum (100-fold) for 1 hour at room temperature. The membrane is
removed
49
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
from the apparatus and washed three times with TBST (0.1 % v/v) before
incubating with 10
ml of goat anti-mouse IgG (whole molecule)-AP (5,000-fold) for 1 hour at room
temperature.
The membrane is washed three times with TBST before color development using an
Alkaline
Phosphatase Substrate Kit (Bio-Rad). The membrane is washed with tap water
when
sufficient development has occurred, dried and scanned for presentation.
Western blot analysis shows a significant increase in antibody reactivity in
the mice
towards the recombinant vaccine antigens following vaccination. All the mice
recognise
recombinant proteins which are similar in molecular weight to that of the
coomassie blue
stained purified recombinant proteins. These experiments provide evidence that
the
recombinant proteins are immunogenic when used to vaccinate mice and that the
vaccination
protocol employed can induce specific circulating antibody titres against the
antigen. The
results indicate that the recombinant proteins can be useful in an effective
vaccine for animal
species from being colonised by B. hyodysenteriae.
Vaccination of pigs using the purified recombinant his-ta"ed proteins
For each of the purified recombinant his-tagged proteins, ten sero-negative
pigs are
injected intramuscularly with 1 mg of the particular antigen in 1 ml vaccine
volume. The
antigen is emulsified with an equal volume of a water-in-oil adjuvant. The
pigs are
vaccinated at three weeks of age and again at six weeks of age. A second group
of ten sero-
negative pigs is used as negative controls and are left unvaccinated. All pigs
are challenged
with 100 ml of an active B. hyodysenteriae culture (- 109 cells/ml) at eight
weeks of age, and
the pigs are observed for clinical signed of swine dysentery during the
experiment (up to six
weeks post-challenge) and at post-morten examination.
Diamostic kit
Serum is obtained from pigs in a piggery with known infection of B.
hyodysenteriae,
from pigs known to have not been infected with B. hyodysenteriae, and from
pigs in piggery
with unknown infection with B. hyodysenteriae. Twenty g of purified
recombinant protein
is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE
gel, and
electro-transferred to nitrocellulose membrane. The membrane is blocked with
TBS-skim
milk (5% w/v) and assembled into the multi-screen apparatus (Bio-Rad). The
wells are
incubated with 100 1 of diluted pig serum (100-fold) for 1 hour at room
temperature. The
membrane then is removed from the apparatus and washed three times with TBST
(0.1% v/v)
before incubating with 10 ml of goat anti-swine IgG (whole molecule)-AP (5,000-
fold) for 1
CA 02695306 2010-02-02
WO 2008/017636 PCT/EP2007/058049
hour at room temperature. The membrane is washed three times with TBST before
color
development using an Alkaline Phosphatase Substrate Kit (Bio-Rad). The
membrane is
washed with tap water when sufficient development has occurred, dried and
scanned for
presentation. One can determine if pigs are infected with B. hyodysenteriae by
comparing the
results to the positive and negative control.
While this invention has been described with a reference to specific
embodiments, it
will be obvious to those of ordinary skill in the art that variations in these
methods and
compositions may be used and that it is intended that the invention may be
practiced
otherwise than as specifically described herein. Accordingly this invention
includes all
modifications encompassed within the spirit and scope of the invention as
defined by the
claims.
51
