Note: Descriptions are shown in the official language in which they were submitted.
CA 02707765 2010-06-02
COMPOSITIONS, METHODS AND KITS FOR DETERMINING
THE PRESENCE OF TRICHOMONAS VAGINALIS
IN A TEST SAMPLE
10
FIELD OF THE INVENTION
The present invention relates to detection probes, helper probes, capture
probes, amplification oligonucleotides, nucleic acid compositions, probe
mixes, methods, and
kits useful for determining the presence of Trichomonas vaginalis in a test
sample.
BACKGROUND OF THE INVENTION
Trichomonas vaginalis is protozoan parasite that causes trichomoniasis, one
of the most common and treatable of the sexually transmitted diseases.
Trichomonas
vaginalis is a relatively delicate pear-shaped trophozoite that is typically 7
to 23 jzm long by
5 to 12 p m wide. The organism has four anterior flagella and a fifth forming
the outer edge
of a short undulating membrane. The anterior flagella propels the organism
through liquid
in a jerky, rapid fashion, sometimes causing the organism to rotate as it
moves. Trichomonas
vaginalis divides by binary fission in the urogenital tract of those infected.
The organism is
clear, uncolored, or slightly grey in appearance under the microscope. A
slender rod, the
axostyle, extends the length of the body and protrudes posteriorly. The
nucleus is near-
anterior and appears well-defined, containing many chromatin granules. The
appearance of
T. vaginalis is very similar to that of other trichomonads, such as
Trichomonas wax,
although only T. vaginalis is found in genitourinary tract infections.
Worldwide, T. vaginalis infects approximately 180 million people per year,
usually by direct person-to-person contact, making it the most common sexually
transmitted
disease (STD) agent. In the United States, it is believed that T. vaginalis
infects an estimated
5 million people annually. Despite its prevalence and geographic distribution,
T. vaginalis
has not been the focus of intensive study. Indeed, it is not even listed as a
"reportable disease"
-1-
CA 02707765 2010-06-02
by the U.S. Centers for Disease Control, and there are no active control or
prevention
programs. Recent reports, however, suggest growing public health interest in
this pathogen.
Infections in women are known to cause vaginitis, urethritis, and cervicitis.
Severe infections are accompanied by a foamy, yellowish-green discharge with a
foul odor,
and small hemorrhagic lesions may also be present in the genitourinary tract.
Complications
include premature labor, low-birth weight offspring, premature rupture of
membranes, and
post-abortion and post-hysterectomy infection. An association with pelvic
inflammatory
disease, tubal infertility, and cervical cancer have been reported.
Trichornonas vaginalis has
also been implicated as a co-factor in the transmission of HIV and other STD
agents. The
.0 organism can also be passed to neonates during passage through the birth
canal.
In men, symptoms of trichomoniasis include urethral discharge, urethral
stricture, epididymitis, the urge to urinate, and a burning sensation with
urination. In both
men and women, infections with T vaginalis are usually asymptomatic and self-
limiting. It
is estimated that, in women, 10-50% of T. vaginalis infections are
asymptomatic, with the
5 proportion in men probably being even higher. That said, with many women the
infection
becomes symptomatic and chronic, with periods of relief in response to
therapy. Recurrence
may be caused by re-infection from an asymptomatic sexual partner, or by
failure of the
standard course of therapy (a regimen of the antibiotic metronidazole). And
while T.
vaginalis infections almost always occur in the genitourinary tract, on rare
occasions they
ZO occur at ecotopic sites, and the parasite may be recovered from other areas
of a patient's body.
As a result of suboptimal comparative laboratory methods and a focus on other
STD sources, studies of T. vaginalis have often substantially underestimated
the prevalence
of infection. Despite this, levels of infection typically have been high, with
reported overall
prevalences ranging from 3-58%, with an unweighted average across studies of
21% (Cu-Uvin
Z5 et al. Clin. Infect. Dis. (2002) 34(10):1406-11). In studies that presented
information on
race/ethnicity, T. vaginalis infection rates have been reported to be highest
among African-
Americans (Sorvillo et at. Ernerg. Infect. Dis. (2001) 7(6):927-32). The
following chart
illustrates the trend reported by Sorvillo et at., with regard to the
prevalence of infection in
terms of the percentage of patients infected with trichomoniasis, chlamydia,
and/or gonorrhea
30 at certain health clinics in Baltimore, Maryland (B) and in New York, New
York (NY).
-2-
CA 02707765 2010-06-02
Year Patient City Trichomoniasis Chlamydia Gonorrhea
Number (%) (%) (%)
IF199 213 NY 51 9 5
1994 372 NY 27 7 2
1994 1404 NY 20 15 No Data
1992 279 B 26 21 14
1990-94 677 NY 22 6 1
Following exposure, the incubation period ranges from about 5 to 10 days,
although periods as short as 1 day to as many as 28 days have been reported.
If diagnosed,
.0 T. vaginalis infections can be readily treated by orally administered
antibiotics.
Given its relative prevalence and association with other STDs, there is
increasing interest in effectively diagnosing trichomoniasis. Conventional
diagnostic methods
for detecting T. vaginalis, however, are based on direct examination, "wet
mount"
microscopy, or cell culture, each of which has its own shortcomings. With
regard to direct
.5 patient examination, other infections mimic the appearance and odor of the
vaginal discharge.
Accordingly, laboratory techniques such as microscopy, antibody detection, and
cell culture
are often used. While it is possible to detect T. vaginalis using a "wet
mount" prepared by
mixing vaginal secretions with saline on a slide and examining the slide under
a microscope
for the presence of organisms having the characteristic size, shape, and
motility of T.
'-0 vaginalis, the sensitivity of such methods depends highly on the skill and
experience of the
microscopist, as well as the time spent transporting specimen to a laboratory.
Wet mount
diagnosis has been found to be only 35-80% as sensitive as other methods, such
as cell
culture, in detecting the presence of T. vaginalis. Other direct methods, such
as fluorescent
antibody detection and enzyme-linked immunoassays, have also been developed,
as has a non-
?5 amplified, DNA probe-based method (Affirm, Becton Dickinson), although
their sensitivities,
as compared to cell culture, range from 70-90%. For these reasons, cell
culture is considered
the current "gold standard" for clinical detection of T. vaginalis. Due to its
relatively delicate
nature, however, the organism is technically challenging, and typically
requires up to 7 days
for maximum sensitivity. Even then, the sensitivity of cell culture methods is
estimated to be
-3-
CA 02707765 2012-08-02
only about 85-95% due to problems associated with time lapses between sample
recovery and culture
inoculation, maintaining proper incubation conditions, visualizing low numbers
of the organism and/or
the motility of the protozoa.
Given the human health implications of trichomoniasis and relative inability
of
existing clinical laboratory methods to selectively and sensitively detect T.
vaginalis from a test
sample, a need clearly exists for a sensitive and specific assay which can be
used to determine the
presence of T. vaginalis in a particular sample of biological material.
SUMMARY OF THE INVENTION
The present invention provides a solution to the clinical need for a sensitive
assay
specific for T. vaginalis by featuring oligonucleotides that are useful for
determining whether T.
vaginalis is present in a test sample, such as a genitourinary specimen. The
featured oligonucleotides
may be contained in detection probes, helper probes, capture probes and/or
amplification
oligonucleotides that are useful for detecting, immobilizing and/or amplifying
T. vaginalis target
nucleic acid present in a test sample.
Various embodiments of this invention provide an amplification oligonucleotide
for
use in amplifying a target region of nucleic acid derived from Trichomonas
vaginalis, the base
sequence of the amplification oligonucleotide consisting of a target binding
region at least 12 bases in
length and, optionally, a 5' sequence recognized by an RNA polymerase or which
enhances initiation
or elongation by an RNA polymerase, wherein the base sequence of the target
binding region is
perfectly complementary to a sequence contained within the base sequence of
SEQ ID NO:53, SEQ ID
NO:54, SEQ ID NO:55 or SEQ ID NO:56. Also provided is a set of
oligonucleotides comprising the
aforementioned amplification oligonucleotide and a second amplification
oligonucleotide, the base
sequence of the second amplification oligonucleotide consisting of a target
binding region at least 12
bases in length and, optionally, a 5' sequence recognized by an RNA polymerase
or which enhances
initiation or elongation by an RNA polymerase, wherein the base sequence of
the target binding region
is perfectly complementary to a sequence contained within the base sequence of
SEQ ID NO:33, SEQ
ID NO:34, SEQ ID NO:35 or SEQ ID NO:36.
Various embodiments of this invention provide a method for amplifying a target
region of nucleic acid derived from Trichomonas vaginalis present in a sample,
the method
comprising the steps of. (a) contacting the sample with the amplification
oligonucleotide or set of
oligonucleotides as described above; and (b) exposing the sample to conditions
sufficient to amplify
the target region.
-4-
CA 02707765 2010-06-02
In one embodiment, detection probes are provided that can preferentially
hybridize to a target region present in nucleic acid derived from T. vaginalis
to form a
detectable probe:target hybrid indicating the presence of T. vaginalis. In
preferred
embodiments, the invention provides a detection probe for determining whether
T. vaginalis
is present in a test sample derived from a biological,material, preferably
taken from the
genitourinary tract of a patient. The detection probe contains a target
binding region having
an at least 10 contiguous base sequence that is at least about 80%, 90% or
100%
complementary to an at least 10 contiguous base region present in a target
sequence selected
from the group consisting of:
SEQ ID NO: 1: gccgaagtccttcggttaaagttctaattggg,
SEQ ID NO:2: gccgaaguccuucgguuaaaguucuaauuggg,
SEQ ID NO:3: cccaattagaactttaaccgaaggacttcggc, and
SEQ ID NO:4: cccaauuagaacuuuaaccgaaggacuucggc.
In another preferred embodiment, the present invention provides a detection
is probe which contains a target binding region having an at least 10
contiguous base sequence
-4a-
CA 02707765 2010-06-02
that is at least about 80%, 90% or 100% complementary to an at least 10
contiguous base
region present in a target sequence selected from the group consisting of.
SEQ ID NO:5: ccattggtgccttttggtactgtggatagg,
SEQ ID NO:6: ccauuggugccuuuugguacuguggauagg,
SEQ ID NO:7: cctatccacagtaccaaaaggcaccaatgg,
SEQ ID NO:8: ecuauccacaguaccaaaaggcaccaaugg,
SEQ ID NO:9: ttccattggtgccttttggtactgtg,
SEQ ID NO: 10: uuccauuggugccuuuugguacugug,
SEQ ID NO: 11: cacagtaccaaaaggcaccaauggaa,
SEQ ID NO:12: cacaguaccaaaaggcaccaauggaa,
SEQ ID NO: 13: ccattggtgccttttggtactgtggat,
SEQ ID NO: 14: ccauuggugccuuuugguacuguggau,
SEQ ID NO: 15: atccacagtaccaaaaggcaccaatgg, and
SEQ ID NO:16: auccacaguaccaaaaggcaccaaugg.
The core region targeted by this preferred detection probe is selected from
the group
consisting of:
SEQ ID NO: 17: ccattggtgccttttggtactgtg,
SEQ ID NO: 18: ccauuggugccuuuugguacugug,
SEQ ID NO: 19: cacagtaccaaaaggcaccaatgg, and
SEQ ID NO:20: cacaguaccaaaaggcaccaaugg.
Detection probes according to the invention preferentially hybridize to the
target nucleic acid and not to nucleic acid derived from non-T. vaginalis
organisms present
in a test sample under stringent hybridization conditions. In particular, the
detection probes
of the present invention preferentially hybridize to the target nucleic acid
and not to nucleic
acid derived from Trichonzonas tenax, which is considered to be the most
closely related
organism to T. vaginalis. Trichomonas tenax can be obtained from the American
Type
Culture Collection in Manassas, VA as ATCC No. 30207.
In the present invention, the detection probe may have a target binding region
of any length suitable to achieve the desired selectivity and specificity for
T. vagin.alis-derived
nucleic acid. The base sequence of a detection probe according to the present
invention is
preferably up to 100 bases in length, more preferably from 10 to 50 bases in
length, and most
-5-
CA 02707765 2010-06-02
preferably from 18 to 35 bases in length. In a preferred embodiment, the
detection probe
contains a target binding region having an at least 15 contiguous base
sequence which is at
least about 80%, 90% or 100% complementary to an at least 15 contiguous base
region
present in the target sequence. Preferably, the target binding region of the
detection probe
comprises a base sequence which is fully complementary to the target sequence.
More
preferably, the base sequence of the target binding region of the detection
probe is at least
about 80%, 90% or 100% complementary to the target sequence. Most preferably,
the base
sequence of the detection probe is at least about 80%, 90% or 100%
complementary to the
target sequence.
The target binding region may consist of deoxyribonucleic acid (DNA),
ribonucleic acid (RNA), a combination DNA and RNA, or it may be a nucleic acid
analog
(e.g., a peptide nucleic acid) or contain one or more modified nucleosides
(e.g., a
ribonucleoside having a 2'-O-methyl substitution to the ribofuranosyl moiety).
The target
binding region may additionally include molecules that do not hydrogen bond to
adenine,
cytosine, guanine, thymine or uracil, provided such molecules do not interfere
with the ability
of the detection probe to selectively and specifically bind to nucleic acid
derived from T.
vaginalis in the test sample. Such molecules could include, by way of example,
abasic
nucleotides or universal base analogues, such as 5-nitroindole, provided such
molecules do
not significantly affect duplex stability. See, e.g., Guo et al., "Artificial
Mismatch
Hybridization," U.S. Patent No. 5,780,233,
A detection probe of the present invention may include one or more base
sequences in addition to the base sequence of the target binding region which
do not stably
bind to nucleic acid derived from T. vaginalis under stringent hybridization
conditions. An
additional base sequence may be comprised of any desired base sequence, so
long as it does
not stably bind to nucleic acid derived from the T. vaginalis under stringent
hybridization
conditions or prevent stable hybridization of the probe to the target nucleic
acid. By way of
example, an additional base sequence may constitute the immobilized probe
binding region
of a capture probe, where the immobilized probe binding region is comprised
of, for example,
a 3' poly dA (adenine) region which hybridizes under stringent hybridization
conditions to a
5' poly dT (thymine) region of a polynucleotide bound directly or indirectly
to a solid support.
-6-
CA 02707765 2010-06-02
An additional base sequence might also be a 5' sequence recognized by a RNA
polymerase
or which enhances initiation or elongation by a RNA polymerase (e.g., a T7
promoter). More
than one additional base sequence may be included if the first sequence is
incorporated ixito,
for example, a self-hybridizing probe (i.e., a probe having distinct base
regions capable of
hybridizing to each other in the absence of a target sequence under the
conditions of an assay),
such as a "molecular beacon" probe. Molecular beacons are disclosed by Tyagi
et al.,
"Detectably Labeled Dual Conformation Oligonucleotide Probes, Assays and
Kits," U.S.
Patent No. 5,925,517 and
include a target binding region which is bounded by or overlaps with two base
sequences
having regions, referred to as "stems" or "arms," which are at least partially
complementary
to each other. A more detailed description of molecular beacons is provided
infra in the
section entitled "Detection Probes to Trichomonas vaginalis Ribosomal Nucleic
Acid." An
additional base-sequence may be joined directly to the target binding region
or, for example,
by means of a non-nucleotide linker (e.g., polyethylene glycol or an abasic
region).
While not required, detection probes of the present invention preferably
include at least one detectable label or group of interacting labels. The
label may be any
suitable labeling substance, including but not limited to a radioisotope, an
enzyme, an enzyme
cofactor, an enzyme substrate, a dye, a hapten, a chemiluminescent molecule, a
fluorescent
molecule, a phosphorescent molecule, an electrochemiluminescent molecule, a
chromophore,
a base sequence region that is unable to stably hybridize to the target
nucleic acid under the
stated conditions, and mixtures of these. In one particularly preferred
embodiment, the label
is an acridinium ester (AE), preferably 4-(2-succinimidyloxycarbonyl ethyl)-
phenyl-10-
methylacridinium-9-carboxylate fluorosulfonate (hereinafter referred to as
"standard AB").
Groups of interacting labels useful with a probe pair (see, e.g., Morrison,
"Competitive
Homogeneous Assay," U.S. Patent No. 5,928,862) or a self-hybridizing probe
(see, e.g., Tyagi
et al., U.S. Patent No. 5,925,517) include, but are not limited to,
enzyme/substrate,
enzyme/cofactor, luminescent/quencher, luminescent/adduct, dye dimers and
Forrester energy
transfer pairs. An interacting luminescent/quencher pair, such as fluoroscein
and DABCYL,
is particularly preferred.
In a further embodiment, the present invention contemplates probe mixes that
are useful for determining whether T. vaginalis is present in a test sample.
The probe mix
-7-
CA 02707765 2010-06-02
may comprise, for example, one of the above-described T. vaginalis detection
probes and a
helper probe. The base sequence of a helper probe according to the present
invention is
preferably up to 100 bases in length, more preferably from 10 to 50 bases in
length, and most
preferably from 18 to 35 bases in length. The helper probe preferably contains
an at least 10
contiguous base region which is at least about 80%, 90% or 100% complementary
to an at
least 10 contiguous base region present in a target sequence selected from the
group consisting
of:
SEQ ID NO:21: gctaacgagcgagattatcgccaattatttacttt,
SEQ ID NO:22: gcuaacgagcgagauuaucgccaauuauuuacuuu,
SEQ ID NO:23: aaagtaaataattggcgataatctcgctcgttagc,
SEQ ID NO:24: aaaguaaauaauuggcgauaaucucgcucguuagc,
SEQ ID NO:25: actccctgcgattttagcaggtggaagagg,
SEQ ID NO:26: acucccugcgauuuuagcagguggaagagg,
SEQ ID NO:27: cctcttccacctgctaaaatcgcagggagt, and
SEQ ID NO:28: ccucuuccaccugcuaaaaucgcagggagu.
Helper probes according to the present invention need not exhibit specificity
for the target
sequence in a test sample. In a preferred embodiment, the helper probe
comprises an at least
15 contiguous base sequence which is at least about 80%, 90% or 100%
complementary to
an at least 15 contiguous base region present in the target sequence.
Preferably, the helper
probe comprises a base sequence which is fully complementary to the target
sequence. The
base sequence of the helper probe of the present invention is most preferably
at least about
80%, 90%' or 100% complementary to the target sequence. In a preferred probe
mix, the
detection probe comprises an at least 10 contiguous base region which is at
least about 80%
complementary to an at least 10 contiguous base region present in a sequence
selected from
the group consisting of: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID
NO:4.
The invention also contemplates compositions comprising stable nucleic acid
duplexes formed between any of the above-described detection probes and/or
helper probes
and the target nucleic acids for the probes under stringent hybridization
conditions.
In another embodiment of the present invention, a capture probe is provided
for specifically isolating and purifying target nucleic acid derived from T.
vaginalis present
in a test sample. The capture probe includes a target binding region that
stably binds to nucleic
-8-
CA 02707765 2010-06-02
acid derived from T. vaginalis under assay conditions and which has an at
least 10 contiguous
base region which is at least about 80%, 90% or 100% complementary to an at
least 10
contiguous base region present in a target sequence selected from the group
consisting of:
SEQ ID NO:29: atatccacgggtagcagcaggc,
SEQ ID NO:30: auauccacggguagcagcaggc,
SEQ ID NO:31: gcctgctgctacccgtggatat, and
SEQ ID NO:32: gccugcugcuacccguggauau.
The base sequence of the target binding region of a capture probe according
to the present invention is preferably up to 100 bases in length, more
preferably from 10 to
50 bases in length, and most preferably from 18 to 35 bases in length. In a
preferred
embodiment, the target binding region of the capture probe comprises an at
least 15
contiguous base sequence which is at least about 80%, 90% or 100%
complementary to an
at least 15 contiguous base region present in the target sequence. Preferably,
the target binding
region of the capture probe comprises a base sequence fully complementary to
the target
sequence. The base sequence of the target binding region of the capture probe
of the present
invention is more preferably at least about 80%, 90% or 100% complementary to
the target
sequence. In a most preferred embodiment, the base sequence of the target
binding region of
the capture probe is at least about 80%, 90% or 100% complementary to the
target sequence,
and the capture probe does not include any other base sequences which stably
hybridize to
Z0 nucleic acid derived from T. vaginalis under assay conditions.
Capture probes according to the present invention may be immobilized on a
solid support by means of ligand-ligate binding pairs, such as avidin-biotin
linkages, but
preferably include an immobilized probe binding region. The immobilized probe
binding
region of the preferred capture probes is comprised of any base sequence
capable of stably
'.5 hybridizing under assay conditions to an oligonucleotide that is bound to
a solid support
present in a test sample. Preferably, the immobilized probe binding region is
a poly dA,
homopolymer tail positioned at the 3' end of the capture probe. In this
embodiment,
oligonucleotides bound to the solid support would include 5' poly dT tails of
sufficient length
to stably bind to the poly dA tails of the capture probes under assay
conditions. In a preferred
0 embodiment, the immobilized probe binding region includes a poly dA tail
which is about 30
adenines in length, and the capture probe includes a spacer region which is
about 3 thymines
-9-
CA 02707765 2010-06-02
in length for joining together the target binding region and the immobilized
probe binding
region.
The present invention also features amplification oligonucleotides useful for
determining the presence of T. vaginalis in an amplification assay. In a
preferred
embodiment, the invention provides at least one amplification oligonucleotide
for amplifying
nucleic acid derived from T. vaginalis present in a test sample, where the
amplification
oligonucleotide has a target binding region that preferably contains an at
least 10 contiguous
base region which is at least about 80%, 90% or 100% complementary to an at
least 10
contiguous base region present in a target sequence selected from the group
consisting of.
0 SEQ ID NO:33: gcgttgattcagctaacgagcgagattatcgcc,
SEQ ID NO:34:gcguugauucagcuaacgagcgagauuaucgcc,
SEQ ID NO:35: ggcgataatctcgctcgttagctgaatcaacgc,
SEQ ID NO:36: ggcgauaaucucgcucguuagcugaaucaacgc,
SEQ ID NO:37: ctgcgattttagcaggtggaagagggtagcaataacaggtccgtgatgcc,
5 SEQ ID NO:38: cugcgauuuuagcagguggaagaggguagcaauaacagguccgugaugcc,
SEQ ID NO:39: ggcatcacggacctgttattgctaccctcttccacctgctaaaatcgcag, and
SEQ ID NO:40:ggcaucacggaccuguuauugcuacccucuuccaccugcuaaaaucgcag.
More preferably, the target sequence of the amplification oligonucleotide is
selected from the
group consisting of:
:0 SEQ ID NO:41: gcgttgattcagctaacgagcg,
SEQ ID NO:42: gcguugauucagcuaacgagcg,
SEQ ID NO:43: cgctcgttagctgaatcaacgc,
SEQ ID NO:44: cgcucguuagcugaaucaacgc,
SEQ ID NO:45: gctaacgagcgagattatcgcc,
,5 SEQ ID NO:46: gcuaacgagcgagauuaucgcc,
SEQ ID NO:47: ggcgataatctcgctcgttagc,
SEQ ID NO:48: ggcgauaaucucgcucguuagc,
SEQ ID NO:49: ctgcgattttagcaggtggaagagg,
SEQ ID NO:50: cugcgauuuuagcagguggaagagg,
0 SEQ ID NO:51: cctcttccacctgctaaaatcgcag,
SEQ ID NO:52: ccucuuccaccugcuaaaaucgcag,
-10-
CA 02707765 2010-06-02
SEQ ID NO:53: gcaataacaggtccgtgatgcc,
SEQ ID NO:54: gcaauaacagguccgugaugcc,
SEQ ID NO:55: ggcatcacggacctgttattgc, and
SEQ ID NO:56: ggcaucacggaccuguuauugc.
In another preferred embodiment, the at least one amplification o'=
gonucleotide
for amplifying nucleic acid derived from T. vaginzalis present in a test
sample has a target
binding region that preferably contains an at least 10 contiguous base region
which is at least
about 80%, 90% or 100% complementary to an at least 10 contiguous base region
present in
a target sequence selected from the group consisting of:
SEQ ID NO:57: ggtagcagcaggcgcgaaactttcccactcgagactttcggaggaggtaat,
SEQ ID NO:58:gguagcagcaggcgcgaaacuuucccacucgagacuuucggaggagguaau,
SEQ ID NO:59: attacctcctccgaaagtctcgagtgggaaagtttcgcgcctgctgctacc,
SEQ ID NO:60:auuaccuccuccgaaagucucgagugggaaaguuucgcgccugcugcuacc,
SEQ ID NO:61: accgtaccgaaacctagcagagggccagtctggtgccagcagc,
SEQ ID NO:62:accguaccgaaaccuagcagagggccagucuggugccagcagc,
SEQ ID NO:63: gctgctggcaccagactggccctctgctaggtttcggtacggt, and
SEQ ID NO:64:gcugcuggcaccagacuggcccucugcuagguuucgguacggu.
More preferably, the target sequence of the amplification oligonucleotide is
selected from the
group consisting of:
SEQ ID NO:65: ggtagcagcaggcgcg,
SEQ ID NO:66: gguagcagcaggcgcg,
SEQ ID NO:67: cgcgcctgctgctacc,
SEQ ID NO:68: cgcgccugcugcuacc,
SEQ ID NO:69: ccactcgagactttcggagg,
SEQ ID NO:70: ccacucgagacuuucggagg,
SEQ ID NO:71: cctccgaaagtctcgagtgg,
SEQ ID NO:72: ccuccgaaagucucgagugg,
SEQ ID NO:73: gagactttcggaggaggtaat,
SEQ ID NO:74: gagacuuucggaggagguaau,
SEQ ID NO:75: attacctcctccgaaagtctc,
SEQ ID NO:76: auuaccuccuccgaaagucuc,
-11-
CA 02707765 2010-06-02
SEQ ID NO:77: accgtaccgaaacctagcagagg,
SEQ ID NO:78: accguaccgaaaccuagcagagg,
SEQ ID NO:79: cctctgctaggtttcggtacggt,
SEQ ID NO:80: ccucugcuagguuucgguacggu,
SEQ ID NO:81: cgaaacctagcagagggccagtc,
SEQ ID NO:82: cgaaaccuagcagagggccaguc,
SEQ ID NO:83: gactggccctctgctaggtttcg,
SEQ ID NO:84: gacuggcccucugcuagguuucg,
SEQ ID NO:85: ccagtctggtgccagcagc,
SEQ ID NO:86: ccagucuggugccagcagc,
SEQ ID NO:87: gctgctggcaccagactgg, and
SEQ ID NO:88: gcugcuggcaccagacugg.
Amplification oligonucleotides of the present invention have a target binding
region that is preferably from 18 to 40 bases in length. In a preferred
embodiment, the
amplification oligonucleotide contains a target binding region having an at
least 15 contiguous
base sequence which is at least about 80%, 90% or 100% complementary to an at
least 15
contiguous base region present in the target sequence. Preferably, the target
binding region
of the amplification oligonucleotide comprises a base sequence which is fully
complementary
to the target sequence. More preferably, the base sequence of the target
binding region of the
amplification oligonucleotide is at least about 80%, 90% or 100% complementary
to the target
sequence, and the amplification oligonucleotide does not include any other
base sequences
which stably hybridize to nucleic acid derived from T. vaginalis under
amplification
conditions. The amplification oligonucleotide optionally includes a 5'
sequence which is
recognized by a RNA polymerase or which enhances initiation or elongation by
RNA
polymerase. The T7 promoter sequence of SEQ ID NO:89:
aatttaatacgactcactatagggaga is
preferred, although other promoter sequences may be employed.
The invention further contemplates an amplification oligonucleotide which,
when contacted with a nucleic acid polymerase under amplification conditions,
will bind to
or cause extension through a nucleic acid region having a base sequence
selected from the
group consisting of: SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44,
SEQ
-12-
CA 02707765 2010-06-02
ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID
NO:50,
SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 and SEQ
ID NO:56. In an alternative embodiment, the amplification oligonucleotide
binds to or
extends through a nucleic acid region having a base sequence selected from the
group
consisting of. SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID
NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74,
SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID
NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ IDNO:83, SEQ ID NO:84, SEQ ID NO:85,
SEQ ID NO:86, SEQ ID NO:87 and SEQ ID NO:88. The base sequence of an
amplification
oligonucleotide of such embodiments consists of a target binding region up to
40 bases in
length and an optional 5' sequence which is recognized by a RNA polymerase or
which
enhances initiation or elongation by RNA polymerase (e.g., T7 promoter of SEQ
ID NO:89).
Amplification oligonucleotides of the present invention are preferably
employed in sets of at least two amplification oligonucleotides. One preferred
set includes
a first amplification oligonucleotide having a target binding region which
contains an at least
10 contiguous base region which is at least about 80% complementary to an at
least 10
contiguous base region present in a target sequence selected from the group
consisting of:
SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35 and SEQ ID NO:36. More preferably,
the
target sequence of the first amplification oligonucleotide is selected from
the group consisting
of: SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ
ID NO:46, SEQ ID NO:47 and SEQ ID NO:48. The second amplification
oligonucleotide of
this preferred set has a target binding region that contains an at least 10
contiguous base
region which is at least about 80% complementary to an at least 10 contiguous
base region
present in a target sequence selected from the group consisting of: SEQ ID
NO:37, SEQ ID
Z5 NO:38, SEQ ID NO:39 and SEQ ID NO:40. More preferably, the target sequence
of the
second amplification oligonucleotide is selected from the group consisting of.
SEQ ID NO:49,
SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID
NO:55 and SEQ ID N0:56. Other structural embodiments of the first and second
amplification oligonucleotides are those set forth above for individual
amplification
j0 oligonucleotides. It is preferred that at least one member of the set of
amplification
-13-
CA 02707765 2010-06-02
oligonucleotides include a 5' sequence which is recognized by a RNA polymerase
or which
enhances initiation or elongation by RNA polymerase (e.g., T7 promoter of SEQ
ID NO:89).
Another set of preferred amplification oligonucleotides includes a first
amplification oligonucleotide having a target binding region that contains an
at least 10
contiguous base region which is at least about 80% complementary to an at
least 10
contiguous base region present in a target sequence selected from the group
consisting of:
SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59 and SEQ ID NO:60. More preferably,
the
target sequence of the first amplification oligonucleotide is selected from
the group consisting
of: SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ
ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75
and SEQ ID NO:76. The second amplification oligonucleotide of this preferred
set has a target
binding region that contains an at least 10 contiguous base region which is at
least about 80%
complementary to an at least 10 contiguous base region present in a target
sequence selected
from the group consisting of. SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63 and SEQ
ID
NO:64. More preferably, the target sequence of the second amplification
oligonucleotide is
selected from the group consisting of. SEQ ID NO:77, SEQ ID NO:78, SEQ ID
NO:79, SEQ
ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID
NO:85,
SEQ ID NO:86, SEQ ID NO:87 and SEQ ID NO:88. Other structural embodiments of
the
first and second amplification oligonucleotides are those set forth above for
individual
?0 amplification oligonucleotides. It is preferred that at least one member of
the set of
amplification oligonucleotides include a 5' sequence which is recognized by a
RNA
polymerase or which enhances initiation or elongation by RNA polymerase (e.g.,
T7 promoter
of SEQ ID NO:89).
The invention additionally contemplates compositions comprising stable
Z5 nucleic acid duplexes formed between any of the above-described
amplification
oligonucleotides and the target nucleic acids for the amplification
oligonucleotides under
amplification conditions.
In yet another embodiment of the present invention, a set of oligonucleotides
is provided for determining the presence of T. vaginalis in a test sample,
where each member
30 of the set has a target binding region that contains an at least 10
contiguous base region which
-14-
CA 02707765 2010-06-02
is at least about 80% complementary to an at least 10 contiguous base region
present in a
target sequence selected from the group consisting of.
SEQ ID NO:90:
gcgttgattcagctaacgagcgagattatcgccaattatttactttgccgaagtccttcggttaaagttctaattggg
actccctgcgattttagcaggtggaagagggtagcaataacaggtccgtgatgcc,
SEQ ID
NO:91:gcguugauucagcuaacgagcgagauuaucgccaauuauuuacuuugccgaaguccuucgguuaaa
guucuaauugggacucccugcgauuuuagcagguggaagaggguagcaauaacagguccgugaugcc,
SEQ ID NO: 92:
ggcatcacggacctgttattgctaccctcttccacctgctaaaatcgcagggagtcccaattagaactttaaccga
aggacttcggcaaagtaaataattggcgataatctcgctcgttagctgaatcaacgc, and
SEQ ID
NO:93:ggcaucacggaccuguuauugcuacccucuuccaccugcuaaaaucgcagggagucccaauuagaac
uuuaaccgaaggacuucggcaaaguaaauaauuggcgauaaucucgcucguuagcugaaucaacgc.
In a preferred embodiment, the set of amplification oligonucleotides includes
at least one
detection probe, preferably one of the above-described detection probes, which
preferentially
hybridizes to the target sequence and not to nucleic acid derived from non-T.
vaginalis
organisms present in a test sample under stringent hybridization conditions.
In another
preferred embodiment, the set of oligonucleotides includes at least two
oligonucleotides,
preferably including one of the above-described detection probes and a helper
probe which
hybridizes to the target sequence under stringent hybridization conditions,
thereby facilitating
hybridization of the detection probe to the target sequence, where the helper
probe is
preferably one of the above-described helper probes. In yet another preferred
embodiment,
the set of oligonucleotides includes at least three oligonucleotides,
preferably including one
of the above-described detection probes and a pair of amplification
oligonucleotides capable
of amplifying all or a portion of the target sequence under amplification
conditions, preferably
including at least one of the above-described amplification oligonucleotides.
And, in a
particularly preferred embodiment, each member of the set of oligonucleotides
contains an
a target binding region which is fully complementary to a sequence contained
within the target
sequence, and none of the oligonucleotides includes any other base sequences
which stably
hybridize to nucleic acid derived from T. vaginalis under assay conditions.
In still another embodiment of the present invention, a set of
oligonucleotides
is provided for determining the presence of T. vaginalis in a test sample,
where each member
of the set has a target binding region that contains an at least 10 contiguous
base region which
-15-
CA 02707765 2010-06-02
is at least about 80% complementary to an at least 10 contiguous base region
present in a
target sequence selected from the group consisting of.
SEQIDNO:94:
ggtagcagcaggcgcgaaactttcccactcgagactttcggaggaggtaatgaccagttccattggtgccttttg
gtactgtggataggggtacggttttccaccgtaccgaaacctagcagagggccagtctggtgccagcagc,
SEQ ID NO:95:
gguagcagcaggcgcgaaacuuucccacucgagacuuucggaggagguaaugaccaguuccauugg
ugccuuuugguacuguggauagggguacgguuuuccaccguaccgaaaccuagcagagggccagucuggugccagcagc
,
SEQ ID NO:96:
gctgctggcaccagactggccctctgctaggtttcggtacggtggaaaaccgtacccctatccacagtaccaaa
aggcaccaatggaactggtcattacctcctccgaaagtctcgagtgggaaagtttcgcgcctgctgctacc, and
SEQ ID
NO:97:gcugcuggcaccagacuggcccucugcuagguuucgguacgguggaaaaccguaccccuauccaca
guaccaaaaggcaccaauggaacuggucauuaccuccuccgaaagucucgagugggaaaguuucgcgccugcugcuacc
.
In one preferred embodiment, the set of amplification oligonucleotides
includes at least one
detection probe, preferably one of the above-described detection probes, which
preferentially
hybridizes to the target sequence and not to nucleic acid derived from non-T.
vaginalis
organisms present in a test sample under stringent hybridization conditions.
In another
preferred embodiment, the set of oligonucleotides includes at least three
oligonucleotides,
preferably including one of the above-described detection probes and a pair of
amplification
oligonucleotides capable of amplifying all or a portion of the target sequence
under
amplification conditions, preferably including at least one of the above-
described
amplification oligonucleotides. And, in a particularly preferred embodiment,
each member
of the set of oligonucleotides contains an a target binding region which is
fully complementary
to a sequence contained within the target sequence, and none of the
oligonucleotides includes
any other base sequences which stably hybridize to nucleic acid derived from
T. vaginalis
under assay conditions.
The present invention further features methods for determining whether T.
vaginalis is present in a test sample. In certain embodiments, the invention
provides methods
for determining whether T. vaginalis is present in a test sample, where such
methods comprise
the steps of. (a) contacting the test sample with one of the above-described
detection probes
for detecting T. vaginalis under conditions permitting the probe to
preferentially hybridize to
a target nucleic acid derived from T. vaginalis, thereby forming a
probe:target hybrid stable
for detection; and (b) determining whether the hybrid is present in the test
sample as an
-16-
CA 02707765 2010-06-02
indication of the presence or absence of T. vaginalis in the test sample. This
method may
further include the step of quantifying the amount of hybrid present in the
test sample as a
means for estimating the amount of Ti vaginalis present in the test sample.
The methods for determining whether T. vaginalis is present in a test sample,
or the amount of T. vaginalis present in a test sample, may further include
the step of
contacting the test sample with one of the above-described helper probes for
facilitating
hybridization of the detection probe to a target sequence and/or one of the
above-described
capture probes for isolating and purifying a target nucleic acid and/or one of
the above-
described amplification oligonucleotides appropriate for amplifying a target
region present
in nucleic acid derived from T. vaginalis, as desired.
The invention also contemplates methods for amplifying a target sequence
contained in nucleic acid derived from T. vaginalis present in a test sample,
where the method
comprises the steps of. (a) contacting the test sample with at least one of
the above-described
amplification oligonucleotides; and (b) exposing the test sample to conditions
sufficient to
amplify the target sequence. Preferred amplification methods will include a
set of at least two
of the above-described amplification oligonucleotides.
In preferred embodiments, the methods for amplifying a target nucleic acid
sequence present in nucleic acid derived from T. vaginalis will further
include the steps of
(a) contacting the test sample with a detection probe which preferentially
hybridizes to the
target sequence or its complement under stringent hybridization conditions,
thereby forming
a probe:target hybrid stable for detection; and (b) determining whether the
hybrid is present
in the test sample as an indication of the presence or absence of T. vaginalis
in the test sample.
The above-described detection probes are preferred for these methods.
The invention also contemplates kits for determining whether T. vaginalis is
present in a test sample. These kits include at least one of the above-
described detection
probes specific for a target sequence derived from T. vaginalis and optionally
include written
instructions for determining the presence or amount of T. vaginalis in a test
sample- In
another embodiment, the kits further include the above-described helper probe
for aiding
hybridization of the detection probe to the target sequence. In a further
embodiment, the kits
also include at least one of the above-described amplification
oligonucleotides appropriate for
-17-
CA 02707765 2010-06-02
amplifying the target sequence or its complement. In yet another embodiment,
the kits further
include the above-described capture probe for separating the target sequence
from other
components of the test sample prior to amplifying or directly detecting the
target sequence or
its complement. In still another embodiment, the kits additionally include at
least two
members of a group made up of one or more of the above-described amplification
oligonucleotides, the above-described capture probe and the above-described
helper probe.
The invention also contemplates kits for amplifying a target sequence present
in nucleic acid derived from T. vaginalis which include at least one of the
above-described
amplification oligonucleotides and optionally include written instructions for
amplifying
.0 nucleic acid derived fiom T. vaginalis. In another embodiment, the kits
further include the
above-described capture probe for separating the target sequence from other
components of
the test sample prior to amplifying the target sequence.
Those skilled in the art will appreciate that the detection probes of the
present
invention may be used as amplification oligonucleotides or capture probes, the
amplification
5 oligonucleotides of the present invention may be used as helper probes or
capture probes, and
the helper probes of the present invention may be used as amplification
oligonucleotides or
capture probes, depending upon the degree of specificity required.
Other features and advantages of the invention will be apparent from the
following description of the preferred embodiments thereof and from the
claims.
:0
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention describes oligonucleotides targeted to nucleic acids
derived from T. vaginalis which are particularly useful for determining the
presence or
absence of T. vaginalis in a test sample. The oligonucleotides can aid in
detecting T.
.5 vaginalis in different ways, such as by functioning as detection probes,
helper probes, capture
probes and/or amplification oligonucleotides. Detection probes of the present
invention can
preferentially hybridize to a target nucleic acid sequence present in a target
nucleic acid
derived from T. vaginalis under stringent hybridization conditions to form
detectable duplexes
which indicate the presence of T. vaginalis in a test sample. Probes of the
present invention
0 are believed to be capable of distinguishing between T. vaginalis and its
known closest
-18-
CA 02707765 2010-06-02
phylogenetic neighbor. Helper probes of the present invention can hybridize to
a target nucleic
acid sequence present in nucleic acid derived from T. vaginalis under
stringent hybridization
conditions and can be used to enhance the formation of detection probe:target
nucleic acid
duplexes. Capture probes of the present invention can hybridize to a target
nucleic acid
sequence present in nucleic acid derived from T. vaginalis under assay
conditions and can be
used to separate target nucleic acid from other components of a clinical
specimen.
Amplification oligonucleotides of the present invention can hybridize to a
target nucleic acid
sequence present in nucleic acid derived from T. vaginalis under amplification
conditions and
can be used, for example, as primers in amplification reactions to generate
multiple copies of
T. vaginalis-derived nucleic acid. The probes and amplification
oligonucleotides can be used
in assays for the detection and/or quantitation of T. vaginalis in a test
sample.
A. Definitions
The following terms have the indicated meanings in the specification unless
expressly indicated to have a different meaning.
By "sample" or "test sample" is meant any substance suspected of containing
a target organism or nucleic acid derived from the target organism. The
substance may be,
for example, an unprocessed clinical specimen, such as a genitourinary tract
specimen, a
buffered medium containing the specimen, a medium containing the specimen and
lytic agents
ZO for releasing nucleic acid belonging to the target organism, or a medium
containing nucleic
acid derived from the target organism which has been isolated and/or purified
in a reaction
receptacle or on a reaction material or device. In the claims, the terms
"sample" and "test
sample" may refer to specimen in its raw form or to any stage of processing to
release, isolate
and purify nucleic acid derived from target organisms in the specimen. Thus,
within a method
15 of use claim, each reference to a "sample" or "test sample" may refer to a
substance suspected
of containing nucleic acid derived from the target organism or organisms at
different stages
of processing and is not limited to the initial form of the substance in the
claim.
By "target nucleic acid" or "target" is meant a nucleic acid containing a
target
nucleic acid sequence.
-19-
CA 02707765 2010-06-02
By "target nucleic acid sequence," "target sequence" or "target region" is
meant
a specific deoxyribonucleotide or ribonucleotide sequence comprising all or
part of the
nucleotide sequence of a single-stranded nucleic acid molecule.
By "oligonucleotide" or "oligomer" is meant a polymer made up of two or
more nucleoside subunits or nucleobase subunits coupled together. The
oligonucleotide may
be DNA and/or RNA and analogs thereof. The sugar groups of the nucleoside
subunits may
be ribose, deoxyribose and analogs thereof, including, for example,
ribonucleosides having
a 2'-O-methylsubstitution to the ribofuranosyl moiety. (Oligonucleotides
including nucleoside
subunits having 2' substitutions and which are useful as detection probes,
helper probes,
capture probes and/or amplification oligonucleotides are disclosed by Becker
et at., "Method
for Amplifying Target Nucleic Acids Using Modified Primers," U.S. Patent No.
6,130,038.)
The nucleoside subunits may be joined by linkages such as phosphodiester
linkages, modified
linkages, or by non-nucleotide moieties which do not prevent hybridization of
the
oligonucleotide to its complementary target nucleic acid sequence. Modified
linkages include
those linkages in which a standard phosphodiester linkage is replaced with a
different linkage,
such as a phosphorothioate linkage or a methylphosphonate linkage. The
nucleobase subunits
may be joined, for example, by replacing the natural deoxyribose phosphate
backbone of
DNA with a pseudo-peptide backbone, such as a 2-aminoethylglycine backbone
which
couples the nucleobase subunits by means of a carboxymethyl linker to the
central secondary
amine. (DNA analogs having a pseudo-peptide backbone are commonly referred to
as
"peptide nucleic acids" or "PNA", and are disclosed by Nielsen et at.,
"Peptide Nucleic
Acids," U.S. Patent No. 5,539,082.) Other non-limiting examples of
oligonucleotides or
oligomers contemplated by the present invention include nucleic acid analogs
containing
bicyclic and tricyclic nucleoside and nucleotide analogs referred to as
"Locked Nucleic
Acids," "Locked Nucleoside Analogues" or "LNA." (Locked Nucleic Acids are
disclosed by
Wang, "Conformationally Locked Nucleosides and Oligonucleotides," U.S. Patent
No.
6,083,482; Imanishi et al., "Bicyclonucleoside and Oligonucleotide Analogues,"
U.S. Patent
No. 6,268,490; and Wengel et al., "Oligonucleotide Analogues," U.S. Patent No.
6,670,461.)
Any nucleic acid analog is contemplated by the present invention, provided
that the modified
oligonucleotide can hybridize to a target nucleic acid under stringent
hybridization conditions
-20-
CA 02707765 2010-06-02
or amplification conditions. In the case of detection probes, the modified
oligonucleotides
must also be capable of preferentially hybridizing to the target nucleic acid
under stringent
hybridization conditions.
OIigonucleotides of a defined sequence may be produced by techniques known
to those of ordinary skill in the art, such as by chemical or biochemical
synthesis, and by in
vitro or in vivo expression from recombinant nucleic acid molecules, e.g_,
bacterial or
retroviral vectors. As intended by this disclosure, an oligonucleotide does
not consist of wild-
type chromosomal DNA or the in vivo transcription products thereof. One use of
an
oligonucleotide is as a detection probe. Oligonucleotides may also be used as
helper probes,
capture probes and amplification oligonucleotides.
By "detection probe" or "probe" is meant a structure comprising an
oligonucleotide having a base sequence sufficiently complementary to its
target nucleic acid
sequence to form a probe:target hybrid stable for detection under stringent
hybridization
conditions. As would be understood by someone having ordinary skill in the
art, the
oligonucleotide is an isolated nucleic acid molecule, or an analog thereof, in
a form not found
in nature without human intervention (e.g., recombined with foreign nucleic
acid, isolated,
or purified to some extent). The probes of this invention may have additional
nucleosides or
nucleobases complementary to nucleotides outside of the targeted region so
long as such
nucleosides or nucleobases do not prevent hybridization under stringent
hybridization
conditions and, in the case of detection probes, do not prevent preferential
hybridization to
the target nucleic acid. A non-complementary sequence may also be included,
such as a target
capture sequence (generally a homopolymer tract, such as a poly-A, poly-T or
poly-U tail),
promotor sequence, a binding site for RNA transcription, a restriction
endonuclease
recognition site, or sequences which will confer a desired secondary or
tertiary structure, such
as a catalytic active site or a hairpin structure, which can be used to
facilitate detection and/or
amplification. Probes of a defined sequence may be produced by techniques
known to those
of ordinary skill in the art, such as by chemical synthesis, and by in vitro
or in vivo expression
from recombinant nucleic acid molecules.
By "stable" or "stable for detection" is meant that the temperature of a
reaction
mixture is at least 2 C below the melting temperature of a nucleic acid
duplex. The
-21-
CA 02707765 2010-06-02
temperature of the reaction mixture is more preferably at least 5 C below the
melting
temperature of the nucleic acid duplex, and even more preferably at least 10
C. below the
melting temperature of the reaction mixture.
By "substantially homologous," "substantially corresponding," or
"substantially
corresponds" is meant that the subject oligonucleotide has a base sequence
containing an at
least 10 contiguous base region that is at least 80% homologous, preferably at
least 90%
homologous, and most preferably 100% homologous to an at least 10 contiguous
base region
present in a reference base sequence (excluding RNA and DNA equivalents).
(Those skilled
in the art will readily appreciate modifications that could be made to the
hybridization assay
conditions at various percentages of homology to permit hybridization of the
oligonucleotide
to the target sequence while preventing unacceptable levels of non-specific
hybridization.)
The degree of similarity is determined by comparing the order of nucleobases
making up the
two sequences and does not take into consideration other structural
differences that may exist
between the two sequences, provided the structural differences do not prevent
hydrogen
bonding with complementary bases. The degree of homology between two sequences
can also
be expressed in terms of the number of base mismatches present in each set of
at least 10
contiguous bases being compared, which may range from 0 to 2 base differences.
By "substantially complementary" is meant that the subject oligonucleotide has
a base sequence containing an at least 10 contiguous base region that is at
least 80%
complementary, preferably at least 90% complementary, and most preferably 100%
complementary to an at least 10 contiguous base region present in a target
nucleic acid
sequence (excluding RNA and DNA equivalents). (Those skilled in the art will
readily
appreciate modifications that could be made to the hybridization assay
conditions at various
percentages of complementarity to permit hybridization of the oligonucleotide
to the target
sequence while preventing unacceptable levels of non-specific hybridization.)
The degree of
complementarity is determined by comparing the order of nucleobases making up
the two
sequences and does not take into consideration other structural differences
which may exist
between the two sequences, provided the structural differences do not prevent
hydrogen
bonding with complementary bases. The degree of complementarity between two
sequences
-22-
CA 02707765 2010-06-02
can also be expressed in terms of the number of base mismatches present in
each set of at least
contiguous bases being compared, which may range from 0 to 2 base mismatches.
By "about" is meant the nearest rounded whole number when referring to a
percentage of complementarity or homology (e.g., a lower limit of 24.4 bases
would be 24
5 bases and a lower limit of 24.5 bases would be 25 bases).
By "RNA and DNA equivalents" is meant RNA and DNA molecules having
the same complementary base pair hybridization properties. RNA and DNA
equivalents have
different sugar moieties (i.e., ribose versus deoxyribose) and may differ by
the presence of
uracil in RNA and thymine in DNA. The differences between RNA and DNA
equivalents do
10 not contribute to differences in homology because the equivalents have the
same degree of
complementarity to a particular sequence.
By "hybridization" or "hybridize" is meant the ability of two completely or
partially complementary nucleic acid strands to come together under specified
hybridization
assay conditions in a parallel or preferably antiparallel orientation to form
a stable structure
having a double-stranded region. The two constituent strands of this double-
stranded
structure, sometimes called a hybrid, are held together by hydrogen bonds.
Although these
hydrogen bonds most commonly form between nucleotides containing the bases
adenine and
thymine or uracil (A and T or U) or cytosine and guanine (C and G) on single
nucleic acid
strands, base pairing can also form between bases which are not members of
these "canonical"
pairs. Non-canonical base pairing is well-known in the art. (See, e.g., ROGER
L. P. ADAMS ET
AL., THE BIOCHEMISTRY OF THE NUCLEIC ACIDS (i 1`h ed. 1992).)
By "preferentially hybridize" is meant that under stringent hybridization
conditions, detection probes can hybridize to their target nucleic acids to
form stable
probe:target hybrids indicating the presence of at least one organism of
interest, and there is
not formed a sufficient number of stable probe:non-target hybrids to indicate
the presence of
non-targeted organisms, especially phylogenetically closely related organisms.
Thus, the probe
hybridizes to target nucleic acid to a sufficiently greater extent than to non-
target nucleic acid
to enable one having ordinary skill in the art to accurately detect the
presence (or absence) of
nucleic acid derived from T. vaginalis, as appropriate, and distinguish its
presence from that
of a phylogenetically closely related organism in a test sample. In general,
reducing the degree
-23-
CA 02707765 2010-06-02
of complenientarity between an oligonucleotide sequence and its target
sequence will decrease
the degree or rate of hybridization of the oligonucleotide to its target
region. However, the
inclusion of one or more non-complementary nucleosides or nucleobases may
facilitate the
ability of an oligonucleotide to discriminate against non-target organisms.
Preferential hybridization can be measured using techniques known in the art
and described herein, such as in the examples provided below. Preferably,
there is at least a
10-fold difference between target and non-target hybridization signals in a
test sample, more
preferably at least a 100-fold difference, and most preferably at least a
1,000-fold difference.
Preferably, non-target hybridization signals in a test sample are no more than
the background
0 signal level.
By "stringent hybridization conditions," or "stringent conditions" is meant
conditions permitting a detection probe to preferentially hybridize to a
target nucleic acid
(preferably rRNA or rDNA derived from T. vaginalis) and not to nucleic acid
derived from
a closely related non-target microorganism. Stringent hybridization conditions
may vary
5 depending upon factors including the GC content and length of the probe, the
degree of
similarity between the probe sequence and sequences of non-target sequences
which may be
present in the test sample, and the target sequence. Hybridization conditions
include the
temperature and the composition of the hybridization reagents or solutions.
Preferred
hybridization assay conditions for detecting target nucleic acids derived from
T. vaginalis with
;0 the probes of the present invention correspond to a temperature of about 60
C when the salt
concentration is in the range of about 0.6-0.9 M. Specific hybridization assay
conditions are
set forth infra in the Examples section and in the section entitled "Detection
Probes to
Trichoinonas vaginalis Ribosomal Nucleic Acid." Other acceptable stringent
hybridization
conditions could be easily ascertained by someone having ordinary skill in the
art.
5 By "assay conditions" is meant conditions permitting stable hybridization of
an oligonucleotide to a target nucleic acid. Assay conditions do not require
preferential
hybridization of the oligonucleotide to the target nucleic acid.
By "consists essentially of" or "consisting essentially of," when used with
reference to an oligonucleotide herein, is meant that the oligonueleotide has
a base sequence
SO substantially homologous to a specified base sequence and may have up to
four additional
-24-
CA 02707765 2010-06-02
bases and/or two bases deleted therefrom. Thus, these phrases contain both a
sequence length
limitation and a sequence variation limitation. Any additions or deletions are
non-material
variations of the specified base sequence which do not prevent the
oligonucleotide from
having its claimed property, such as being able to preferentially hybridize
under stringent
hybridization conditions to its target nucleic acid over non-target nucleic
acids. The
oligonucleotide may contain a base sequence substantially similar to a
specified nucleic acid
sequence without any additions or deletions. However, a probe or primer
containing an
oligonucleotide consisting essentially of (or which consists essentially of) a
specified base
sequence may include other nucleic acid molecules which do not participate in
hybridization
.0 of the probe to the target nucleic acid and which do not affect such
hybridization.
By "nucleic acid duplex," "duplex," "nucleic acid hybrid" or "hybrid" is meant
a stable nucleic acid structure comprising a double-stranded, hydrogen-bonded
region. Such
hybrids include RNA:RNA, RNA:DNA and DNA:DNA duplex molecules and analogs
thereof. The structure is sufficiently stable to be detectable by any known
means, including
5 means that do not require a probe associated label. For instance, the
detection method may
include a probe-coated substrate that is optically active and sensitive to
changes in mass at its
surface. Mass changes result in different reflective and transmissive
properties of the optically
active substrate in response to light and serve to indicate the presence or
amount of
immobilized target nucleic acid. (This exemplary form of optical detection is
disclosed by
0 Nygren et al., "Devices and Methods for Optical Detection of Nucleic Acid
Hybridization,"
U.S. Patent No. 6,060,237.) Other means for detecting the formation of a
nucleic acid duplex
that do not require the use of a labeled probe include the use of binding
agents, which include
intercalating agents such as ethidium bromide. See, e.g., Higuchi, "Homogenous
Methods
for Nucleic Amplification and Detection," U.S. Patent No. 5,994,056.
5 By "amplification oligonucleotide" or "primer" is meant an oligonucleotide
capable of hybridizing to a target nucleic acid and acting as a primer and/or
a promoter
template (e.g., for synthesis of a complementary strand, thereby forming a
functional promoter
sequence) for the initiation of nucleic acid synthesis. If the amplification
oligonucleotide is
designed to initiate RNA synthesis, the primer may contain a base sequence
which is non-
complementary to the target sequence but which is recognized by a RNA
polymerase such as
-25-
CA 02707765 2010-06-02
a T7, T3, or SP6 RNA polymerase. An amplification oligonucleotide may contain
a 3'
terminus that is modified to prevent or lessen the rate or amount of primer
extension.
(McDonough et al., "Methods of Amplifying Nucleic Acids Using Promoter-
Containing
Primer Sequences," U.S. Patent No. 5,766,849, disclose primers and promoter-
primers having
modified or blocked 3'-ends.) While the amplification oligonucleotides of the
present
invention may be chemically synthesized or derived from a vector, they are not
naturally
occurring nucleic acid molecules.
By "nucleic acid amplification" or "target amplification" is meant increasing
the number of nucleic acid molecules having at least one target nucleic acid
sequence. Target
_0 amplification according to the present invention may be either linear or
exponential, although
exponential amplification is preferred.
By "amplification conditions" is meant conditions permitting nucleic acid
amplification. Acceptable amplification conditions could be readily
ascertained without the
exercise of anything more than routine experimentation by someone having
ordinary skill in
.5 the art depending on the particular method of amplification employed.
By "antisense," "opposite sense," or "negative sense" is meant a nucleic acid
molecule perfectly complementary to a reference, or sense, nucleic acid
molecule.
By "sense," "same-sense," or "positive sense" is meant a nucleic acid molecule
perfectly homologous to a reference nucleic acid molecule.
!0 By "amplicon" is meant a nucleic acid molecule generated in a nucleic acid
amplification reaction and which is derived from a target nucleic acid. An
amplicon contains
a target nucleic acid sequence that may be of the same or opposite sense as
the target nucleic
acid.
By "derived" is meant that the referred to nucleic acid is obtained directly
from
!5 an organism or is the product of a nucleic acid amplification. Thus, a
nucleic acid that is
"derived" from an organism may be, for example, an antisense RNA molecule
which does not
naturally exist in the organism.
By "capture probe" is meant an oligonucleotide that is capable of binding to
a target nucleic acid (preferably in a region other than that targeted by a
detection probe) and,
;0 either directly or indirectly, to a solid support, thereby providing means
for immobilizing and
-26-
CA 02707765 2010-06-02
isolating the target nucleic acid in a test sample. The capture probe includes
a target binding
region that hybridizes to the target nucleic acid. Although the capture probe
may include a
member of ligand-ligate binding pair (e.g., avidin-biotin linkage) for
immobilizing the capture
probe on a solid support, preferred capture probes include an immobilized
probe binding
region that hybridizes to an immobilized probe bound to a solid support. While
the capture
probe preferably hybridizes to both the target nucleic acid and the
immobilized probe under
stringent conditions, the target binding and the immobilized probe binding
regions of the
capture probe may be designed to bind to their target sequences under
different hybridization
conditions. In this way, the capture probe may be designed so that it first
hybridizes to the
target nucleic acid under more favorable in solution kinetics before adjusting
the conditions
to permit hybridization of the immobilized probe binding region to the
immobilized probe.
The target binding and immobilized probe binding regions may be contained
within the same
oligonucleotide, directly adjoining each other or separated by one or more
optionally modified
nucleotides, or these regions may be joined to each other by means of a non-
nucleotide linker.
By "target binding region" is meant that portion of an oligonucleotide which
stably binds to a target sequence present in a target nucleic acid, a DNA or
RNA equivalent
of the target sequence or a complement of the target sequence under assay
conditions. The
assay conditions may be stringent hybridization conditions or amplification
conditions.
By "immobilized probe binding region" is meant that portion of an
oligonucleotide which hybridizes to an immobilized probe under assay
conditions.
By "homopolymer tail" in the claims is meant a contiguous base sequence of
at least 10 identical bases (e.g., 10 contiguous adenines or thymines).
By "immobilized probe" is meant an oligonucleotide for joining a capture
probe to an immobilized support. The immobilized probe is joined either
directly or indirectly
to the solid support by a linkage or interaction which remains stable under
the conditions
employed to hybridize the capture probe to the target nucleic acid and to the
immobilized
probe, whether those conditions are the same or different. The immobilized
probe facilitates
separation of the bound target nucleic acid from unbound materials in a
sample.
By "isolate" or "isolating" is meant that at least a port ion of the target
nucleic
acid present in a test sample is concentrated within a reaction receptacle or
on a reaction
-27-
CA 02707765 2010-06-02
device or solid carrier (e.g., test tube, cuvette, microtiter plate well,
nitrocellulose filter, slide
or pipette tip) in a fixed or releasable manner so that the target nucleic
acid can be purified
without significant loss of the target nucleic acid from the receptacle,
device or carrier.
By "purify" or "purifying" is meant that one or more components of the test
sample are removed from one or more other components of the sample. Sample
components
to be purified may include viruses, nucleic acids or, in particular, target
nucleic acids in a
generally aqueous solution phase which may also include undesirable materials
such as
proteins, carbohydrates, lipids, non-target nucleic acid and/or labeled
probes. Preferably, the
purifying step removes at least about 70%, more preferably at least about 90%
and, even more
preferably, at least about 95% of the undesirable components present in the
sample.
By "helper probe" or "helper oligonucleotide" is meant an oligonucleotide
designed to hybridize to a target nucleic -acid at a different locus than that
of a detection probe,
thereby either increasing the rate of hybridization of the probe to the target
nucleic acid,
increasing the melting temperature (Tm) of the probe:target hybrid, or both.
By "phylogenetically closely related" is meant that the organisms are closely
related to each other in an evolutionary sense and therefore would be expected
to have a
higher total nucleic acid sequence homology than organisms that are more
distantly related.
Organisms occupying adjacent and next to adjacent positions on
the,phylogenetic tree are
closely related. Organisms occupying positions farther away than adjacent or
next to adjacent
?0 positions on the phylogenetic tree will still be closely related if they
have significant total
nucleic acid sequence homology.
B. Hybridization Conditions and Probe Design
Hybridization reaction conditions, most importantly the temperature of
i5 hybridization and the concentration of salt in the hybridization solution,
can be selected to
allow the detection probes or, in some cases, amplification oligonucleotides
of the present
invention to preferentially hybridize to a T. vaginalis-derived target nucleic
acid and not to
other non-target nucleic acids suspected of being present in a test sample. At
decreased salt
concentrations and/or increased temperatures (conditions of increased
stringency) the extent
-28-
CA 02707765 2010-06-02
of nucleic acid hybridization decreases as hydrogen bonding between paired
nucleobases in
the double-stranded hybrid molecule is disrupted. This process is known as
"melting."
Generally speaking, the most stable hybrids are those having the largest
number of contiguous, perfectly matched (i.e., hydrogen-bonded) nucleotide
base pairs. Such
hybrids would usually be expected to be the last to melt as the stringency of
the hybridization
conditions increases. However, a double-stranded nucleic acid region
containing one or more
mismatched, "non-canonical," or imperfect base pairs (resulting in weaker or
non-existent
base pairing at that position in the nucleotide sequence of a nucleic acid)
may still be
sufficiently stable under conditions of relatively high stringency to allow
the nucleic acid
hybrid to be formed and detected in a hybridization assay without cross-
reacting with other,
non-selected nucleic acids which may be present in a test sample.
Hence, depending on the degree of similarity between the nucleotide sequences
of the target nucleic acid and those of non-target nucleic acids belonging to
phylogenetically
distinct, but closely-related organisms on one hand, and the degree of
complementarity
between the nucleotide sequences of a particular detection probe or
amplification
oligonucleotide and those of the target and non-target nucleic acids on the
other, one or more
mismatches will not necessarily defeat the ability of an oligonucleotide
contained in the probe
or amplification oligonucleotide to hybridize to the target nucleic acid and
not to non-target
nucleic acids.
The detection probes of the present invention were chosen, selected, and/or
designed to maximize the difference between the melting temperatures of the
probe:target
hybrid (T,,,, defined as the temperature at which half of the potentially
double-stranded
molecules in a given reaction mixture are in a single-stranded, denatured
state) and the T. of
a mismatched hybrid formed between the probe and ribosomal RNA (rRNA) or
ribosomal
DNA (rDNA) of the phylogenetically most closely-related organisms expected to
be present
in the test sample, but not sought to be detected. While the unlabeled
amplification
oligonucleotides, capture probes and helper probes need not have such an
extremely high
degree of specificity as the detection probe to be useful in the present
invention, they are
designed in a similar manner to preferentially hybridize to one or more target
nucleic acids
-29-
CA 02707765 2010-06-02
over other nucleic acids under specified amplification, assay or stringent
hybridization
conditions.
, To facilitate the identification of nucleic acid sequences to be used in the
design of probes, nucleotide sequences from different organisms were first
aligned to
maximize homology. The source organisms and the associated nucleotide
sequences used for
this comparison were obtained from the GenBank database and had the following
accession
numbers: Trichornonas vaginalis (Accession No. U17510), Trimastix pyrifonnis
(Accession
No. AF244903), Dientamoeba fragilis (Accession No. U37461), Trichonionas
gallinae
(Accession No. U86614), Trichoinonas tenax (Accession Nos. D49495 and U37711),
Tetratrichonaonas gallinariwn (Accession No. AF124608), Kalotennes flavicollis
(Accession
No. AF215856), Trichoinitus trypanoides (Accession No. X79559), Hodotermopsis
sjoestedti
(Accession No. AB032234), Pentatrichomonas honminis (Accession No. AF124609),
Pseudotrypanosoma giganteuln (Accession No. AF052706), Ditrichoinonas
honigbergi
(Accession No. U17505), Monotrichomonas species ATCC50693 (Accession . No.
AF072905), Pseudotrichornonas keilini (Accession No. U1751 1), Monocercomonas
species
ATCC 50210 (Accession No. U17507), Tritrichonionasfoetus (Accession No.
U17509) and
Entamoeba histolytica (Accession No. X64142).
Within the rRNA molecule there is a close relationship between secondary
structure (caused in part by intra-molecular hydrogen bonding) and function.
This fact
imposes restrictions on evolutionary changes in the primary nucleotide
sequence causing the
secondary structure to be maintained. For example, if a base is changed in one
"strand" of a
double helix (due to infra-molecular hydrogen bonding, both "strands" are part
of the same
rRNA molecule), a compensating substitution usually occurs in the primary
sequence of the
other "strand" in order to preserve complementarity (this is referred to as co-
variance), and
thus the necessary secondary structure. This allows two very different rRNA
sequences to be
aligned based both on the conserved primary sequence and also on the conserved
secondary
structure elements. Potential target sequences for the detection probes
described herein were
identified by noting variations in the homology of the aligned sequences.
The sequence evolution at each of the variable regions is mostly divergent.
Because of the divergence, corresponding rRNA variable regions of more distant
phylogenetic
-30-
CA 02707765 2010-06-02
relatives of T. vaginalis show greater differences from T. vaginalis rRNA than
do the rRNAs
of phylogenetically closer relatives. Sufficient variation between T.
vaginalis and other
organisms was observed to identify preferred target sites and to design
detection probes useful
for distinguishing T. vaginalis over non-T. vaginalis organisms in a test
sample, particularly
Trichomonas tenax, the most closely related organism to T. vaginalis.
Merely identifying putatively unique potential target nucleotide sequences
does
not guarantee that a functionally species-specific detection probe may be made
to hybridize
to T. vaginalis rRNA or rDNA comprising that sequence. Various other factors
will determine
the suitability of a nucleic acid locus as a target site for genus-specific or
species-specific
probes. Because the extent and specificity of hybridization reactions such as
those described
herein are affected by a number of factors, manipulation of one or more of
those factors will
determine the exact sensitivity and specificity of a particular
oligonucleotide, whether
perfectly complementary to its target or not. The importance and effect of
various assay
conditions are known to those skilled in the art and are disclosed by Hogan et
al., "Nucleic
Acid Probes for Detection and/or Quantitation of Non-Viral Organisms," U.S.
Patent No.
5,840,488; Hogan et al., "Nucleic Acid Probes to Mycobacteriuin gordonae,"
U.S. Patent No.
5,216,143; and Kohne, "Method for Detection, Identification and Quantitation
of Non-Viral
Organisms," U.S. Patent No. 4,851,330.
1.
The desired. temperature of hybridization and the hybridization solution
composition (such as salt concentration, detergents, and other solutes). can
also greatly affect
the stability of double-stranded hybrids. Conditions such as ionic strength
and the temperature
at which a probe will be allowed to hybridize to a target must be taken into
account in
constructing a genus-specific or species-specific probe. The thermal stability
of hybrid nucleic
acids generally increases with the ionic strength of the reaction mixture. On
the other hand,
chemical reagents that disrupt hydrogen bonds, such as formamide, urea,
dimethyl sulfoxide
and alcohols, can greatly reduce the thermal stability of the hybrids.
To maximize the specificity of a probe for its target, the subject probes of
the
present invention were designed to hybridize to their targets under conditions
of high
stringency. Under such conditions only single nucleic acid strands having a
high degree of
-31-
CA 02707765 2010-06-02
complementarity will hybridize to each other. Single nucleic acid strands
without such a high
degree of complementarity will not form hybrids. Accordingly, the stringency
of the assay
conditions determines the amount of complementarity that should exist between
two nucleic
acid strands in order to form a hybrid. Stringency is chosen to maximize the
difference in
stability between the hybrid formed between the probe and the target nucleic
acid and
potential hybrids between the probe and any non-target nucleic acids present
in a test sample.
Proper specificity may be achieved by minimizing the length of the detection
probe having perfect complementarity to sequences of non-target organisms, by
avoiding G
and C rich regions of complementarity to non-target nucleic acids, and by
constructing the
0 probe to contain as many destabilizing mismatches to non-target sequences as
possible.
Whether a probe is appropriate for detecting only a specific type of organism
depends largely
on the thermal stability difference between probe:target hybrids versus
probe:non-target
hybrids. In designing probes, the differences in these Tm values should be as
large as possible
(preferably 2-5'C or more). Manipulation of the T. can be accomplished by
changes to probe
5 length and probe composition (e.g., GC content versus AT content).
In general, the optimal hybridization temperature for oligonucleotide probes
is approximately 5 C below the melting temperature for a given duplex.
Incubation at
temperatures below the optimum temperature may allow mismatched base sequences
to
hybridize and can therefore decrease specificity. The longer the probe, the
more hydrogen
0 bonding between base pairs and, in general, the higher the Tm. Increasing
the percentage of
G and C also increases the Tm because G-C base pairs exhibit additional
hydrogen bonding
and therefore greater thermal stability than A-T base pairs. Such
considerations are known in
the art. (See, e.g., J. SAMBROOK ET AL., MOLECULAR CLONING: A LABORATORY
MANUAL,
ch. 11 (2"d ed. 1989).)
5 A preferred method to determine Tm measures hybridization using the well
known Hybridization Protection Assay (HPA) disclosed by Arnold et al.,
"Homogenous
Protection Assay," U.S. Patent No. 5,283,174,
The T. can be measured using HPA in the following manner. Probe
molecules are labeled with an acridinium ester and permitted to form
probe:target hybrids in
3 a lithium succinate buffer (0.1 M lithium succinate buffer, pH 4.7, 20 mM
EDTA, 15 mm
aldrithiol-2, 1.2 M LiCI, 3% (v/v) ethanol absolute, 2% (wlv) lithium lauryl
sulfate) using an
-32-
CA 02707765 2010-06-02
excess amount of target. Aliquots of the solution containing the probe:target
hybrids are then
diluted in the lithium succinate buffered solution and incubated for five
minutes at various
temperatures starting below that of the anticipated T,,, (typically 55 C)and
increasing in 2-5 C
increments. This solution is then diluted with a mild alkaline borate buffer
(600 mM boric
acid, 240 mM NaOH, 1% (v/v) TRITON X-100 detergent, pH 8.5) and incubated at
an equal
or lower temperature (for example 50 C) for ten minutes.
Under these conditions the acridinium ester attached to the single-stranded
probe is hydrolyzed, while the acridinium ester attached to hybridized probe
is relatively
protected from hydrolysis. Thus, the amount of acridinium ester remaining
after hydrolysis
treatment is proportional to the number of hybrid molecules. The remaining
acridinium ester
can be measured by monitoring the chemiluminescence produced from the
remaining
acridinium ester by adding hydrogen peroxide and alkali to the solution.
Chemiluminescence
can be measured in a luminometer, such as a LEADER HC+ Luminometer (Gen-Probe
Incorporated; San Diego, CA; Cat. No. 4747). The resulting data is plotted as
percent of
maximum signal (usually from the lowest temperature) versus temperature. The
T. is defined
as the temperature at which 50% of the maximum signal remains. In addition to
the method
above, T. may be determined by isotopic methods known to those skilled in the
art (see, e.g.,
Hogan et al., U.S. Patent No. 5,840,488).
To ensure specificity of a detection probe for its target, it is preferable to
design
probes that hybridize only to target nucleic acid under conditions of high
stringency. Only
highly complementary sequences will form hybrids under conditions of high
stringency.
Accordingly, the stringency of the assay conditions determines the amount of
complementarity needed between two sequences in order for a stable hybrid to
form.
Stringency should be chosen to maximize the difference in stability between
the probe:target
hybrid and potential probe: non-target hybrids.
Examples of specific stringent hybridization conditions are provided in the
Examples section infra. Of course, alternative stringent hybridization
conditions can be
determined by those of ordinary skill in the art based on the present
disclosure. (See, e.g.,
SAMBROOK ET AL., supra, ch. 11.)
The length of the target nucleic acid sequence region and, accordingly, the
length of the probe sequence can also be important. In some cases, there may
be several
-33-
CA 02707765 2010-06-02
sequences from a particular region, varying in location and length, which may
be used to
design probes with the desired hybridization characteristics. In other cases,
one probe may be
significantly better with regard to specificity than another that differs from
it merely by a
single base. While it is possible for nucleic acids that are not perfectly
complementary to
hybridize, the longest stretch of perfectly complementary bases, as well as
the base
compositions, will generally determine hybrid stability.
Regions of rRNA known to form strong internal structures inhibitory to
hybridization are less preferred target regions, especially in assays where
helper probes
described infra are not used. Likewise, probes with extensive self-
complementarity are
generally to be avoided, with specific exceptions being discussed below. If a
strand is wholly
or partially involved in an intramolecular or intermolecular hybrid, it will
be less able to
participate in the formation of a new intermolecular probe:target hybrid
without a change in
the reaction conditions. Ribosomal RNA molecules are known to form very stable
intramolecular helices and secondary structures by hydrogen bonding. By
designing a probe
to a region of the target nucleic acid which remains substantially single-
stranded under
hybridization conditions, the rate and extent of hybridization between probe
and target may
be increased.
A genomic ribosomal nucleic acid (rDNA) target occurs naturally in a double-
stranded form, as does the product of the polymerase chain reaction (PCR).
These double-
A stranded targets are naturally inhibitory to hybridization with a probe and
require denaturation
prior to hybridization. Appropriate denaturation and hybridization conditions
are known in
the art (see, e.g., Southern, E.M., J. Mol. Biol., 98:503 (1975)).
A number of formulae are available which will provide an estimate of the
melting temperature for perfectly matched oligonucleotides to their target
nucleic acids. One
?5 such formula is the following:
Tm =81.5+16.6(log10[Na+])+0.41(fraction G+C)-(600/N)
(where N = the length of the oligonucleotide in number of nucleotides)
provides a good
estimate of the T. for oligonucleotides between 14 and 60 to 70 nucleotides in
length. From
such calculations, subsequent empirical verification or "fine tuning" of the
T. may be made
~0 using screening techniques well known in the art. For further information
on hybridization and
oligonucleotide probes reference may be made to SAMBROOK ET AL., supra, ch.
11. This
-34-
CA 02707765 2010-06-02
reference, among others well known in the art, also provides estimates of the
effect of
mismatches on the T. of a hybrid. Thus, from the known nucleotide sequence of
a given
region of the ribosomal RNA (or rDNA) of two or more organisms,
oligonucleotides may be
designed which will distinguish these organisms from one another.
C. Nucleic Acid Amplification
Preferably, the amplification oligonucleotides of the present invention are
oligodeoxynucleotides and are sufficiently long to be used as a substrate for
the synthesis of
extension products by a nucleic acid polymerase. Optimal amplification
oligonucleotide
length should take into account several factors, including the temperature of
reaction, the
structure and base composition of the amplification oligonucleotide, and how
the
amplification oligonucleotide is to be used. For example, for optimal
specificity the
oligonucleotide amplification oligonucleotide generally should be at least 12
bases in length,
depending on the complexity of the target nucleic acid sequence. If such
specificity is not
essential, shorter amplification oligonucleotides may be used. In such a case,
it may be
desirable to carry out the reaction at cooler temperatures in order to form
stable hybrid
complexes with the template nucleic acid.
Useful guidelines for designing amplification oligonucleotides and detection
probes with desired characteristics are described infra in the section
entitled "Preparation of
Oligonucleotides." Optimal sites for amplifying and probing contain at least
two, and
preferably' three, conserved regions of T. vaginalis nucleic acid. These
regions are about 15
to 350 bases in length, and preferably between about 15 and 150 bases in
length.
The degree of amplification observed with a set of amplification
oligonucleotides (e.g., primers and/or promoter-primers) depends on several
factors, including
the ability of the amplification oligonucleotides to hybridize to their
specific target sequences
and their ability to be extended or copied enzymatically. While amplification
oligonucleotides
of different lengths and base compositions may be used, amplification
oligonucleotides
preferred in this invention have target binding regions of 18 to 40 bases with
a predicted Tm
to target of about 42 C.
Parameters affecting probe hybridization, such as Tm, complementarity, and
secondary structure of the target sequence, also affect amplification
oligonucleotide
-35-
CA 02707765 2012-08-02
hybridization and therefore performance of the amplification oligonucleotides.
The degree of
non-specific extension (primer-dimer or non-target copying) can also affect
amplification
efficiency. Thus, amplification oligonucleotides are selected to have low self-
complementarity
or cross-complementarity, particularly at the 3' ends of their sequences.
Notwithstanding, it
should be noted that the "signal primers" described infra could be modified to
include regions
of self-complementarity, thereby transforming them into "molecular torch" or
"molecular
beacon" signal primers, such as these terms are defined below. Lengthy
homopolymer runs
and high GC content are avoided to reduce spurious primer extension. Computer
programs
are available to aid in this aspect of the design, including Oligo Tech
analysis software which
is available from Oligos Etc. Inc.
A nucleic acid polymerase used in conjunction with the amplification
oligonucleotides of the present invention refers to a chemical, physical, or
biological agent
that incorporates either ribonucleotides or deoxyribonucleotides, or both,
into a nucleic acid
polymer, or strand, in a template-dependent manner. Examples of nucleic acid
polymerases
include DNA-directed DNA polymerases, RNA-directed DNA polymerases, and RNA-
directed RNA polymerases. DNA polymerises bring about nucleic acid synthesis
in a
template-dependent manner and in a 5' to 3' direction. Because of the typical
anti-parallel
orientation of the two strands in a double-stranded nucleic acid, this
direction is from a 3'
region on the template to a 5' region on the template. Examples of DNA-
directed DNA
polymerases include E. coli DNA polymerase I, the thermostable DNA polymerase
from
Thermos aquaticus (Taq), and the large fragment of DNA polymerase I from
Bacillus
stearotherinophilis (Bst). Examples of RNA directed DNA polymerases include
various
retroviral reverse transcriptases, such as Moloney murine leukemia virus
(MMLV) reverse
transcriptase or avian myeloblastosis virus (AMV) reverse transcriptase.
During most nucleic acid amplification reactions, a nucleic acid polymerase
adds nucleotide residues to the 3' end of the primer using the target nucleic
acid as a template,
thus synthesizing a second nucleic acid strand having a nucleotide sequence
partially or
completely complementary to a region of the target nucleic acid. In many
nucleic acid
amplification reactions, the two strands comprising the resulting double-
stranded structure
must be separated by chemical or physical means in order to allow the
amplification reaction
-36-
CA 02707765 2010-06-02
to proceed. Alternatively, the newly synthesized template strand may be made
available for
hybridization with a second primer or promoter-primer by other means, such as
through strand
displacement or the use of a nucleolytic enzyme which digests part or all of
the original target
strand. In this way the process may be repeated through a number of cycles,
resulting in a
large increase in the number of nucleic acid molecules having the target
nucleotide sequence.
Either the first or second amplification oligonucleotide, or both, may be a
promoter-primer. (In some applications, the amplification oligonucleotides may
only consist
of promoter-primers which are complementary to the sense strand, as disclosed
by Kacian et
al., "Nucleic Acid Sequence Amplification Method, Composition and Kit," U.S.
Patent No.
5,554,516.) A promoter-primer usually contains an oligonucleotide that is not
complementary
to a nucleotide sequence present in the target nucleic acid molecule or primer
extension
product(s) (see Kacian et al., "Nucleic Acid Sequence Amplification Methods,"
U.S. Patent
No. 5,399,491, for a description of such oligonucleotides). These non-
complementary
sequences may be located 5' to the complementary sequences on the
amplification
oligonucleotide and may provide a locus for initiation of RNA synthesis when
made double-
stranded through the action of a nucleic acid polymerase. The promoter thus
provided may
allow for the in vitro transcription of multiple RNA copies of the target
nucleic acid sequence.
It will be appreciated that when reference is made to a primer in this
specification, such
reference is intended to include the primer aspect of a promoter-primer as
well, unless the
context of the reference clearly indicates otherwise.
In some amplification systems (see, e.g., the amplification methods disclosed
by Dattagupta et at., "Isothermal Strand Displacement Amplification," U.S.
Patent No.
6,087,133), the amplification oligonucleotides may contain 5' non-
complementary nucleotides
which assist in strand displacement. Furthermore, when used in conjunction
with a nucleic
?5 acid polymerase having 5' exonuclease activity, the amplification
oligonucleotides may have
modifications at their 5' end to prevent enzymatic digestion. Alternatively,
the nucleic acid
polymerase may be modified to remove the 5' exonuclease activity, such as by
treatment with
a protease that generates an active polymerase fragment with no such nuclease
activity. In
such a case the primers need not be modified at their 5' ends.
-37-
CA 02707765 2010-06-02
1. Preparation of Oligonucleotides
The detection probes, capture probes, helper probes and amplification
oligonucleotides of the present invention can be readily prepared by methods
known in the
art. Preferably, the oligonucleotides are synthesized using solid phase
methods. For example,
Caruthers describes using standard phosphoramidite solid-phase chemistry to
join nucleotides
by phosphodiester linkages. See Caruthers et al., "Chemical Synthesis of
Deoxynucleotides
by the Phosphoram Bite Method," Methods Enzynmol., 154:287 (1987). Automated
solid-phase
chemical synthesis using cyanoethyl phosphoramidite precursors has been
described by
Barone. See Barone et al., "In Situ Activation of bis-dialkylaminephosphines --
a New
Method for Synthesizing Deoxyoligonucleotides on Polymer Supports," Nucleic
Acids Res.,
12(10):4051 (1984). Likewise, Batt, "Method and Reagent for Sulfurization of
Organophosphorous Compounds," U.S. Patent No. 5,449,769, discloses a procedure
for
synthesizing oligonucleotides containing phosphorothioate linkages. In
addition, Riley et al.,
"Process for the Purification of Oligomers," U.S. Patent No. 5,811,538
disclose the synthesis
of oligonucleotides having different linkages, including methylphosphonate
linkages.
Moreover, methods for the organic synthesis of oligonucleotides are known to
those of skill
in the art and are described in, for example, SAMBROOK ET AL., supra, ch. 10.
Following synthesis of a particular oligonucleotide, several different
procedures may be utilized to purify and control the quality of the
oligonucleotide. Suitable
procedures include polyacrylamide gel electrophoresis or high pressure liquid
chromatography. Both of these procedures are well known to those skilled in
the art.
All of the oligonucleotides of the present invention, whether detection
probes,
helper probes, capture probes or amplification oligonucleotides, may be
modified with
chemical groups to enhance their performance or to facilitate the
characterization of
amplification products.
For example, backbone-modified oligonucleotides such as those having
phosphorothioate, methylphosphonate, 2'-0-alkyl, or peptide groups which
render the
oligonucleotides resistant to the nucleolytic activity of certain polymerases
or to nuclease
enzymes may allow the use of such enzymes in an amplification or other
reaction. Another
example of a modification involves using non-nucleotide linkers incorporated
between
nucleotides in the nucleic acid chain of a probe or primer, and which do not
prevent
-38-
CA 02707765 2010-06-02
hybridization of a probe or hybridization and elongation of a primer. (See
Arnold et al., "Non-
Nucleotide Linking Reagents for Nucleotide Probes," U.S. Patent No. 6,031,091,
The oligonucleotides of the present
invention may also contain mixtures of the desired modified and natural
nucleotides.
The 3' end of an amplification oligonucleotide, particularly a promoter-
primer,
may be modified or blocked to prevent or inhibit initiation of DNA synthesis,
as disclosed by
Kacian et al., U.S. Patent No. 5,554,516. The 3' end of the primer can be
modified in a variety
of ways well known in the art. By way of example, appropriate modifications to
a promoter-
primer can include the addition of ribonucleotides, 3' deoxynucleotide
residues (e.g.,
cordycepin), 2',3'-dideoxynucleotide residues, modified nucleotides such as
phosphorothioates, and non-nucleotide linkages such as those disclosed by
Arnold et al. in
U.S. Patent No. 6,031,091 or alkane-diol modifications (see Wilk et al.,
"Backbone-Modified
Oligonucleotides Containing a Butanediol-1,3 Moiety as a `Vicarious Segment'
for the
Deoxyribosyl Moiety -- Synthesis and Enzyme Studies," Nucleic Acids Res.,
18(8):2065
(1990)), or the modification may simply consist of a region 3' to the priming
sequence that is
non-complementary to the target nucleic acid sequence. Additionally, a mixture
of different
3' blocked promoter-primers or of 3' blocked and unblocked promoter-primers
may increase
the efficiency of nucleic acid amplification, as described therein.
As disclosed above, the 5' end of primers maybe modified to be resistant to
the 5'-exonuclease activity present in some nucleic acid polymerases. Such
modifications can
be carried out by adding a non-nucleotide group to the terminal 5' nucleotide
of the primer
using techniques such as those disclosed by Arnold et al., U.S. Patent No.
6,031,091.
Once synthesized, a selected oligonucleotide may be labeled by any well
known method (see, e.g., SAMBROOK ET AL., supra, ch. 10). Useful labels
include
radioisotopes as well as non-radioactive reporting groups. Isotopic labels
include 3H, 35S, 32p,
1251, 57Co, and '4C. Isotopic labels can be introduced into the
oligonucleotide by techniques
known in the art such as nick translation, end labeling, second strand
synthesis, the use of
reverse transcription, and by chemical methods. When using radiolabeled
probes,
hybridization can be detected by autoradiography, scintillation counting, or
gamma counting.
The detection method selected will depend upon the particular radioisotope
used for labeling.
-39-
CA 02707765 2010-06-02
Non-isotopic materials can also be used for labeling and may be introduced
internally into the nucleic acid sequence or at the end of the nucleic acid
sequence. Modified
nucleotides may be incorporated enzymatically or chemically. Chemical
modifications of the
probe may be performed during or after synthesis of the probe, for example,
through the use
of non-nucleotide linker groups as disclosed by Arnold et al., U.S. Patent No.
6,031,091. Non-
isotopic labels include fluorescent molecules (individual labels or
combinations of labels,
such as the fluorescence resonance energy transfer (FRET) pairs disclosed by
Tyagi et al.,
"Detectably Labeled Dual Conformation Oligonucleotide Probes," U.S. Patent No.
5,925,517), chemiluminescent molecules, enzymes, cofactors, enzyme substrates,
haptens, or
other ligands.
With the detection probes of the present invention, the probes are preferably
labeled using of a non-nucleotide linker with an acridinium ester. Acridinium
ester labeling
may be performed as disclosed by Arnold et al., "Acridinium Ester Labelling
and Purification
of Nucleotide Probes," U.S. Patent No. 5,185,439.
2. Amplification of Trichontonas vaginalis Ribosomal Nucleic Acid
The amplification oligonucleotides of the present invention are directed to
18S
regions of ribosomal nucleic acid derived from T. vaginalis. These
amplification
oligonucleotides may flank, overlap, or be contained within at least one of
the target
sequences of a detection probe (or its complement) used to detect the presence
of T. vaginalis
in a nucleic acid amplification assay. As indicated above, the amplification
oligonucleotides
may also include non-complementary bases at their 5' ends comprising a
promoter sequence
able to bind a RNA polymerase and direct RNA transcription using the target
nucleic acid as
a template. A T7 promoter sequence, such as SEQ ID NO:89, may be used.
Amplification oligonucleotides of the present invention are capable of
amplifying a target region of nucleic acid derived from T. vaginalis under
amplification
conditions. The amplification oligonucleotides have a target binding region up
to 40 bases in
length which stably hybridizes to a target sequence selected from the group
consisting of SEQ
ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID
NO:38,
SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID
-40-
CA 02707765 2010-06-02
NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63 and SEQ ID NO:64 under
amplification conditions. The amplification oligonucleotide does not include
any other base
sequences which stably hybridize to nucleic acid derived from T vaginalis
under
amplification conditions. Preferably, the base sequence of the target binding
region
comprises, overlaps with, consists essentially of, consists of, substantially
corresponds to, or
is contained within a base sequence selected from the group consisting of SEQ
ID NO:41,
SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID
NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52,
SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:65, SEQ ID
NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71,
SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID
NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82,
SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87 and SEQ
ID NO:88.
Alternatively, amplification oligonucleotides of the present invention consist
of a target binding region up to 40 bases in length and an optional 5'
sequence which is
recognized by a RNA polymerase or which enhances initiation or elongation by a
RNA
polymerase, where the amplification oligonucleotide will, when contacted with
a nucleic acid
polymerase under amplification conditions, bind to or cause extension through
a nucleic acid
region having a base sequence selected from the group consisting of SEQ ID
NO:41, SEQ ID
NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47,
SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:5 1, SEQ ID NO:52, SEQ ID
NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:65, SEQ ID NO:66,
SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID
NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ Ili NO:76, SEQ ID NO:77,
SEQ ID NO:78, SEQ ID NO.:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID
NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87 or SEQ ID NO:88.
In one preferred embodiment, a set of at least two amplification
oligonucleotides for amplifying T. vaginalis-derived nucleic acid is provided
which includes:
(i) a first amplification oligonucleotide having a target binding region up to
40 bases in length
which stably hybridizes to a target sequence selected from the group
consisting of SEQ ID
-41-
CA 02707765 2010-06-02
NO:33, SEQ ID NO:34, SEQ ID NO:35 and SEQ ID NO:36 under amplification
conditions;
and (ii) a second amplification oligonucleotide having a target binding region
up to 40 bases
in length which stably hybridizes to a target sequence selected from the group
consisting of
SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40 under amplification
conditions. Preferably, the first amplification oligonucleotide has a target
binding region
which includes a base sequence comprising, overlapping with, consisting
essentially of,
consisting of, substantially corresponding to, or contained within a base
sequence selected
from the group consisting of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID
NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47 and SEQ ID NO:48, and the
second
l0 amplification oligonucleotide has a target binding region which includes a
base sequence
comprising, overlapping with, consisting essentially of, consisting of,
substantially
corresponding to, or contained within a base sequence selected from the group
consisting of
SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID
NO:54 SEQ ID NO:55 and SEQ ID NO:56. More preferably, the base sequence of the
target
5 binding region of the first amplification oligonucleotide comprises,
overlaps with, consists
essentially of, consists of, substantially corresponds to, or is contained
within the base
sequence of SEQ ID NO:41 or SEQ ID NO:45, and the base sequence of the target
binding
region of the second amplification oligonucleotide comprises, overlaps with,
consists
essentially of, consists of, substantially corresponds to, or is contained
within the base
?0 sequence of SEQ ID NO:51 or SEQ ID NO:55. The second amplification
oligonucleotide
preferably includes a 5' promoter sequence (e.g., the T7 promoter sequence of
SEQ ID
NO:89).
In another preferred embodiment, a set of at least two amplification
oligonucleotides for amplifying T. vaginalis-derived nucleic acid is provided
which includes:
(i) a first amplification oligonucleotide having a target binding region up to
40 bases in length
which stably hybridizes to a target sequence selected from the group
consisting of SEQ ID
NO:57, SEQ ID NO:58, SEQ ID NO:59 and SEQ ID NO:60 under amplification
conditions;
and (ii) a second amplification oligonucleotide having a target binding region
up to 40 bases
in length which stably hybridizes to a target sequence selected from the group
consisting of
>0 SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63 and SEQ ID NO:64 under
amplification
conditions. Preferably, first amplification oligonucleotide has a target
binding region which
-42-
CA 02707765 2010-06-02
includes a base sequence comprising, overlapping with, consisting essentially
of, consisting
of, substantially corresponding to, or contained within a base sequence
selected from the
group consisting of SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68,
SEQ
ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID
NO:74,
SEQ ID NO:75 and SEQ ID NO:76, and the second amplification oligonucleotide
has a target
binding region which includes a base sequence comprising, overlapping with,
consisting
essentially of, consisting of, substantially corresponding to, or contained
within a base
sequence of selected from the group consisting of SEQ ID NO:77, SEQ ID NO:78,
SEQ ID
NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84,
SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87 and SEQ ID NO:88. More preferably,
the
base sequence of the target binding region of the first amplification
oligonucleotide
comprises, overlaps with, consists essentially of, consists of, substantially
corresponds to, or
is contained within the base sequence of SEQ ID NO:65, SEQ ID NO:69 or SEQ ID
NO:73,
and base sequence of the target binding region of the second amplification
oligonucleotide
comprises, overlaps with, consists essentially of, consists of, substantially
corresponds to, or
is contained within the base sequence of SEQ ID NO:79, SEQ ID NO:83 or SEQ ID
NO:87.
The second amplification oligonucleotide preferably includes a 5' promoter
sequence (e.g.,
the T7 promoter sequence of SEQ ID NO:89).
Amplification oligonucleotides of the present invention may have
modifications, such as blocked 3' and/or 5' termini (as discussed above) or
sequence additions
including, but not limited to, a specific nucleotide sequence recognized by a
RNA polymerase
(e.g., a promoter sequence for 77, T3 or SP6 RNA polymerase), a sequence which
enhances
initiation or elongation of RNA transcription by a RNA polymerase, or a
sequence which may
provide for infra-molecular base pairing and encourage the formation of
secondary or tertiary
nucleic acid structures.
Amplification oligonucleotides are used in any suitable nucleic acid
amplification procedure now known or later developed. Existing amplification
procedures
include the polymerase chain reaction (PCR), transcription-mediated
amplification (TMA),
nucleic acid sequence-based amplification (NASBA), self-sustained sequence
replication
(3SR), ligase chain reaction (LCR), strand displacement amplification (SDA),
and Loop-
Mediated Isothermal Amplification (LAMP), each of which is well known in the
art. See,
-43-
CA 02707765 2010-06-02
e.g., Mullis, "Process for Amplifying Nucleic Acid Sequences," U.S. Patent No.
4,683,202;
Erlich et al., "Kits for Amplifying and Detecting Nucleic Acid Sequences,"
U.S. Patent No.
6,197,563; Walker et al., Nucleic Acids Res., 20:1691-1696 (1992); Fahy et
al., "Self-
sustained Sequence Replication (3SR): An Isothermal Transcription-Based
Amplification
System Alternative to PCR," PCR Methods and Applications,1:25-33 (1991);
Kacian et al.,
U.S. Patent No. 5,399,491; Kacian et al., "Nucleic Acid Sequence Amplification
Methods,"
U.S. Patent No. 5,480,784; Davey et al., "Nucleic Acid Amplification Process,"
U.S. Patent
No. 5,554,517; Birkenmeyer et al., "Amplification of Target Nucleic Acids
Using Gap Filling
Ligase Chain Reaction," U.S. Patent No. 5,427,930; Marshall et al.,
"Amplification of RNA
t0 Sequences Using the Ligase Chain Reaction," U.S. Patent No. 5,686,272;
Walker, "Strand
Displacement Amplification," U.S. Patent No. 5,712,124; Notomi et al.,
"Process for
Synthesizing Nucleic Acid," European Patent Application No. 1 020 534 Al;
Dattagupta et
al., "Isothermal Strand Displacement Amplification," U.S. Patent No.
6,214,587; and HELEN
H. LEE ET AL., NUCLEIC ACID AMPLIFICATION TECHNOLOGIES: APPLICATION TO DISEASE
l5 DIAGNOSIS (1997).
Any other amplification procedure which meets the definition of "nucleic
acid amplification" supra is also contemplated by the inventors.
Amplification oligonucleotides of the present invention are preferably
unlabeled but may include one or more reporter groups to facilitate detection
of a target
?0 nucleic acid in combination with or exclusive of a detection probe. A wide
variety of methods
are available to detect an amplified target sequence. For example, the
nucleotide substrates
or the amplification oligonucleotides can include a detectable label that is
incorporated into
newly synthesized DNA. The resulting labeled amplification product is then
generally
separated from the unused labeled nucleotides or amplification
oligonucleotides and the label
is detected in the separated product fraction. (See, e.g., Wu, "Detection of
Amplified Nucleic
Acid Using Secondary Capture Oligonucleotides and Test Kit," U.S. Patent No.
5,387,510.)
A separation step is not required, however, if the amplification
oligonucleotide
is modified by, for example, linking it to an interacting label pair, such as
two dyes which
form a donor/acceptor dye pair. The modified amplification oligonucleotide can
be designed
;o so that the fluorescence of one dye pair member remains quenched by the
other dye pair
member, so long as the amplification oligonucleotide does not hybridize to
target nucleic acid,
-44-
CA 02707765 2010-06-02
thereby physically separating the two dyes. Moreover, the amplification
oligonucleotide can
be further modified to include a restriction endonuclease recognition site
positioned between
the two dyes so that when a hybrid is formed between the modified
amplification
oligonucleotide and target nucleic acid, the restriction endonuclease
recognition site is
rendered double-stranded and available for cleavage or nicking by an
appropriate restriction
endonuclease. Cleavage or nicking of the hybrid then separates the two dyes,
resulting in a
change in fluorescence due to decreased quenching which can be detected as an
indication of
the presence of the target organism in the test sample. This type of modified
amplification
oligonucleotide, referred to as a "signal primer," is disclosed by Nadeau et
al., "Detection of
Nucleic Acids by Fluorescence Quenching," U.S. Patent No. 6,054,279.
Substances which can serve as useful detectable labels are well known in the
art and include radioactive isotopes, fluorescent molecules, chemiluminescent
molecules,
chromophores, as well as ligands such as biotin and haptens which, while not
directly
detectable, can be readily detected by a reaction with labeled forms of their
specific binding
partners, e.g., avidin and antibodies, respectively.
Another approach is to detect the amplification product by hybridization with
a detectably labeled oligonucleotide probe and measuring the resulting hybrids
in any
conventional manner. In particular, the product can be assayed by hybridizing
a
chemiluminescent acridinium ester-labeled oligonucleotide probe to the target
sequence,
selectively hydrolyzing the acridinium ester present on unhybridized probe,
and measuring
the chemiluminescence produced from the remaining acridinium ester in a
luminometer. (See,
e. g., Arnold et al., U.S. Patent No. 5,283,174, and NORMAN C. NELSON ET AL.,
NONISOTOPIC
PROBING, BLOTTING, AND SEQUENCING, ch. 17 (Larry J. Kricka ed., 2d ed. 1995).)
Because genitourinary specimens tend to contain large amounts of T. vaginalis
when an individual is infected with the organism, it may be desirable to
include a co-
amplifiable pseudo target in the amplification reaction mixture in order to
render the assay
less sensitive, especially when quantification is an objective of the assay.
Pseudo targets and
their uses are disclosed by Nunomura, "Polynucleotide Amplification Method,"
U.S. Patent
No. 6,294,338. In the present
application, the pseudo target may be, for example, a known amount of a
Trichoinonas tenax
18S rRNA transcript that can be amplified with a set of amplification
oligonucleotides of the
-45-
CA 02707765 2010-06-02
present invention under amplification conditions, but which does not contain
or result in a
sequence that is detectable with a detection probe of the present invention.
D. Sample Processing
Sample processing prior to amplification or detection of a target sequence may
be necessary or useful for discriminating a target sequence from non-target
nucleic acid
present in a sample. Sample processing procedures may include, for example,
direct or
indirect immobilization of nucleic acids and/or oligonucleotides from the
liquid phase in a
heterogeneous assay. With some procedures, such immobilization may require
multiple
hybridization events. Ranki et al., "Detection of Microbial Nucleic Acids by a
One-Step
Sandwich Hybridization Test," U.S. Patent Nos. 4,486,539 and 4,563,419, for
example,
disclose a one-step nucleic acid "sandwich" hybridization method involving the
use of a solid-
phase bound nucleic acid having a target complementary sequence and a labeled
nucleic acid
probe which is complementary to a distinct region of the target nucleic acid.
Stabinsky,
"Methods and Kits for Performing Nucleic Acid Hybridization Assays," U.S.
Patent No.
4,751,177, discloses methods including a "mediator" polynucleotide that
reportedly
overcomes sensitivity problems associated with Ranki's method resulting from
leakage of
immobilized probe from the solid support. Instead of directly immobilizing the
target nucleic
acid, the mediator polynucleotides of Stabinsky are used to bind and
indirectly immobilize
target polynucleotide:probe polynucleotide complexes which have formed free in
solution.
Any known solid support may be used for sample processing, such as matrices
and particles free in solution. The solid support may be, for example,
nitrocellulose, nylon,
glass, polyacrylate, mixed polymers, polystyrene, silane polypropylene and,
preferably,
particles having a magnetic charge to facilitate recovering sample and/or
removing unbound
nucleic acids or other sample components. Particularly preferred supports are
magnetic
spheres that are monodisperse (i.e., uniform in size 5%), thereby providing
consistent
results, which is particularly advantageous for use in an automated procedure.
One such
automated procedure is disclosed by Ammann et al., "Automated Process for
Isolating and
Amplifying a Target Nucleic Acid Sequence," U.S. Patent No. 6,335,166.
An oligonucleotide for immobilizing a target nucleic acid on a solid support
may be joined directly or indirectly to the solid support by any linkage or
interaction which
-46-
CA 02707765 2010-06-02
is stable under assay conditions (e.g., conditions for amplification and/or
detection). Referred
to herein as an "immobilized probe," this oligonucleotide may bind directly to
the target
nucleic acid or it may include a base sequence region, such as a homopolymeric
tract (e.g.,
a poly dT) or a simple short repeating sequence (e.g., an AT repeat), which
hybridizes to a
complementary base sequence region present on a capture probe. Direct joining
occurs when
the immobilized probe is joined to the solid support in the absence of an
intermediate group.
For example, direct joining may be via a covalent linkage, chelation or ionic
interaction.
Indirect joining occurs when the immobilized probe is joined to the solid
support by one or
more linkers. A "linker" is a means for binding at least two different
molecules into a stable
complex and contains one or more components of a binding partner set.
Members of a binding partner set are able to recognize and bind to each other.
Binding partner sets may be, for example, receptor and ligand, enzyme and
substrate, enzyme
and cofactor, enzyme and coenzyme, antibody and antigen, sugar and lectin,
biotin and
streptavidin, ligand and chelating agent, nickel and histidine, substantially
complementary
oligonucleotides, and complementary homopolymeric nucleic acids or
homopolymeric
portions of polymeric nucleic acids. Components of a binding partner set are
the regions of
the members that participate in binding.
A preferred sample processing system having practical advantages in terms of
its ease of use and rapidity comprises an immobilized probe containing a base
sequence which
is complementary to a base sequence of a capture probe, referred to herein as
an "immobilized
probe binding region." The capture probe additionally contains a base
sequence, referred to
herein as a "target binding region," which may specifically hybridize to a
target sequence
contained in a target nucleic acid under assay conditions. (While specificity
of the target
binding region of the capture probe for a region of the target nucleic acid is
desirable to
minimize the number of non-target nucleic acids remaining from the sample
after a separation
step, it is not a requirement of the capture probes of the present invention
if the capture probes
are being used solely to isolate target nucleic acid.) If the capture probe is
not being employed
to isolate a target nucleic acid for subsequent amplification of a target
sequence, the capture
probe may further include a detectable label attached within or near the
target binding region,
such as a substituted or unsubstituted acridinium ester. The labeled capture
probe may be
used in a homogeneous or semi-homogenous assay to specifically detect hybrid
nucleic acids
-47-
CA 02707765 2010-06-02
without detecting single-stranded nucleic acids, such as the capture probe. A
preferred
homogenous assay which could be used with this system is the hybridization
protection assay
(HPA), which is discussed above in the section entitled "Hybridization
Conditions and Probe
Design." Following the HPA format, label associated with capture probes which
have not
hybridized to target nucleic acids would be hydrolyzed with the addition of a
mild base, while
label associated with capture probe:target hybrids would be protected from
hydrolysis.
An advantage of this latter assay system is that only a single target-specific
hybridization event (capture probe:target) is necessary for target detection,
rather than
multiple such events (e.g., capture probe:target and probe:target or
probe:amplicon) which are
required in other sample processing procedures described herein. Also, fewer
oligonucleotides in an assay tend to make the assay faster and simpler to
optimize, since the
overall rate at which a target nucleic acid is captured and detected is
limited by the slowest
hybridizing oligonucleotide. While the target binding region of a capture
probe may be less
specific in alternative assay systems, it must still be rare enough to avoid
significant saturation
of the capture probe with non-target nucleic acids. Thus, the requirement that
two separate
and specific target sequences be identified in these alternative systems could
place constraints
on the identification of an appropriate target. By contrast, only one such
target sequence is
needed when the capture probe simultaneously functions as the detection probe.
Whichever approach is adopted, the assay needs to include means for detecting
the presence of the target nucleic acid in the test sample. A variety of means
for detecting
target nucleic acids are well known to those skilled in the art of nucleic
acid detection,
including means which do not require the presence of a detectable label.
Nevertheless, probes
including a detectable label are preferred. A labeled probe for detecting the
presence of a
target nucleic acid would have to include a base sequence which is
substantially
complementary and specifically hybridizes to a target sequence contained in
the target nucleic
acid. Once the probe stably binds to the target nucleic acid, and the
resulting target:probe
hybrid has been directly or indirectly immobilized, unbound probe can be
washed away or
inactivated and the remaining bound probe can be detected and/or measured.
Preferred sample processing systems combine the elements of detection and
nucleic acid amplification. These systems first directly or indirectly
immobilize a target
nucleic acid using a capture probe, the captured target nucleic acid is
purified by removing
-48-
CA 02707765 2010-06-02
inter alia cellular debris, non-target nucleic acid and amplification
inhibitors from the sample-
containing vessel, which is followed by amplification of a target sequence
contained in the
target nucleic acid. Amplified product is then detected, preferably in
solution with a labeled
probe. (The target nucleic acid may remain in the immobilized state during
amplification or
it may be eluted from the solid support prior to amplification using
appropriate conditions,
such as by first incubating at a temperature above the Tm of the capture
probe:target complex
and/or the Tm of the capture probe:immobilized probe complex.) A preferred
embodiment of
this system is disclosed by Weisburg et al., "Two-Step Hybridization and
Capture of a
Polynucleotide," U.S. Patent No. 6,110,678. In this system, the capture probe
hybridizes to
the target nucleic acid and an immobilized probe hybridizes to the capture
probe:target
complex under different hybridization conditions. Under a first set of
hybridization
conditions, hybridization of the capture probe to the target nucleic acid is
favored over
hybridization of the capture probe to the immobilized probe. Thus, under this
first set of
conditions, the capture probe is in solution rather than bound to a solid
support, thereby
maximizing the concentration of the free capture probe and utilizing favorable
liquid phase
kinetics for hybridization to the target nucleic acid. After the capture probe
has had sufficient
time to hybridize to the target nucleic acid, a second set of hybridization
conditions is imposed
permitting in the capture probe:target complex to hybridize to the immobilized
probe, thereby
isolating the target nucleic acid in the sample solution. The immobilized
target nucleic acid
may then be purified, and a target sequence present in the target nucleic acid
may be amplified
and detected. A purification procedure which includes one or more wash steps
is generally
desirable when working with crude samples (e.g., clinical samples) to prevent
enzyme
inhibition and/or nucleic acid degradation due to substances present in the
sample.
A preferred amplification method is the transcription-mediated amplification
method disclosed by Kacian et al., "Nucleic Acid Sequence Amplification
Methods," U.S.
Patent No. 5,480,789. In accord with this method, a promoter-primer having a
3' region
complementary to a portion of the target and a 5' promoter region and a primer
having the
same nucleotide sequence as a portion of the target are contacted with a
target RNA molecule.
The primer and promoter-primer define the boundaries of the target region to
be amplified,
including both the sense present on the target molecule and its complement,
and thus the
length and sequence of the amplicon. In this preferred embodiment, the
amplification
-49-
CA 02707765 2010-06-02
oligonucleotides and immobilized target RNA are contacted in the presence of
effective
amounts of Moloney murine leukemia virus-derived reverse transcriptase and T7
RNA
polymerase, both ribonucleotide and deoxyribonucleotide triphosphates, and
necessary salts
and cofactors at 42 C. Under these conditions, nucleic acid amplification
occurs, resulting
predominantly in the production of RNA amplicons of a sense opposite to that
of the target
nucleic acid. These amplicons can then be detected in solution by, for
example, using an
acridinium ester-labeled hybridization assay probe of the same sense as the
target nucleic acid,
employing HPA, as disclosed by Arnold et al. in U.S. Patent No. 5,283,174.
The 3' terminus of the immobilized probe and the capture probe are preferably
"capped" or blocked to prevent or inhibit their use as templates for nucleic
acid polymerase
activity. Capping may involve adding 3' deoxyribonucleotides (such as
cordycepin), 3', 2'-
dideoxynucleotide residues, non-nucleotide linkers, such as those disclosed by
Arnold et al.
in U.S. Patent No. 6,031,091, alkane-diol modifications, or non-complementary
nucleotide
residues at the 3' terminus.
Those skilled in the art will recognize that the above-described methodology
is amenable, either as described or with obvious modifications, to various
other amplification
schemes, including, for example, the polymerase chain reaction (PCR), Q13
replicase-mediated
amplification, self-sustained sequence replication (3SR), strand displacement
amplification
(SDA), nucleic acid sequence-based amplification (NASBA), loop-mediated
isothermal
amplification (LAMP), and the ligase chain reaction (LCR).
E. Capture Probes for Isolating Tiichomonas vaginalis Ribosomal Nucleic Acid
Capture probes of the present invention are designed to bind to and isolate
nucleic acid derived from the 18S ribosomal nucleic acid of T. vaginalis in
the presence of
non-target nucleic acid. As such, the capture probes preferably include both a
target binding
region and an immobilized probe binding region. The target binding region of
the capture
probes includes a base sequence which hybridizes to a target sequence derived
from 18S
ribosomal nucleic acid from T. vaginalis under assay cc 3itions. While not
essential, the
target binding region preferably exhibits specificity for the target sequence
in the presence of
non-target nucleic acid under assay conditions. The immobilized probe binding
region has a
base sequence which hybridizes to an immobilized probe comprising a
polynucleotide, or a
-50-
CA 02707765 2010-06-02
chimeric containing polynucleotide sequences, which is joined to a solid
support present in
the test sample, either directly or indirectly. The target binding region and
the immobilized
probe binding region may be joined to each other directly or by means of, for
example, a
nucleotide base sequence, an abasic sequence or a non-nucleotide linker.
In a preferred embodiment, capture probes according to the present invention
include a target binding region having a base sequence region which comprises,
overlaps with,
consists essentially of, consists of, substantially corresponds to, or is
contained within the
base sequence of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31 or SEQ ID NO:32. The
immobilized probe binding region of these preferred capture probes comprises a
base
sequence which hybridizes to an immobilized probe joined directly or
indirectly to a solid
support provided to the test sample under assay conditions. Preferably, the
immobilized probe
binding region comprises a homopolymeric region (e.g., poly dA) located at the
3' end of the
capture probe which is complementary to a homopolymeric region (e.g., poly dT)
located at
the 5' end of the immobilized probe. The immobilized probe binding region
preferably
consists of the base sequence of SEQ ID NO:98
tttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa. Other
base sequences may be incorporated into the immobilized probe binding region,
including,
for example, short repeating sequences.
To prevent undesirable cross-hybridization reactions, the capture probes of
the
present invention preferably exclude nucleotide base sequences, other than the
nucleotide base
sequence of the target binding region, which can stably bind to nucleic acid
derived from any
organism which may be present in the test sample under assay conditions.
Consistent with
this approach, and in order to maximize the immobilization of capture
probe:target complexes
which are formed, the nucleotide base sequence of the immobilized probe
binding region is
preferably designed so that it can stably bind to a nucleotide base sequence
present in the
immobilized probe under assay conditions and not to nucleic acid derived from
any organism
which may be present in the test sample.
The target binding region and the immobilized probe binding region of the
capture probe may be selected so that the capture probe:target complex has a
higher T. than
the T,,, of the capture probe:immobilized probe complex. In this way, a first
set of conditions
may be imposed which favors hybridization of the capture probe to the target
sequence over
the immobilized probe, thereby providing for optimal liquid phase
hybridization kinetics for
-51-
CA 02707765 2010-06-02
hybridization of the capture probe to the target sequence. Once sufficient
time has passed for
the capture probe to bind to the target sequence, a second set of less
stringent conditions may
be imposed which allows for hybridization of the capture probe to the
immobilized probe.
Capture probes of the present invention may also include a label or a pair of
interacting labels for direct detection of the target sequence in a test
sample. Non-limiting
examples of labels, combinations of labels and means for labeling probes are
set forth supra
in the section entitled "Preparation of Oligonucleotides" and infra in the
section entitled
"Detection Probes to Trichomonas vaginalis Ribosomal Nucleic Acid." A
particularly useful
method for detecting the presence of a capture probe hybridized to a target
nucleic acid is the
Hybridization Protection Assay (HPA), which is described above in the section
entitled
"Hybridization Conditions and Probe Design." HPA is a homogenous assay which
distinguishes between probe hybridized to target nucleic acid and probe which
remains
unhybridized. Signal detected from an HPA reaction vessel provides an
indication of the
presence or amount of target organisms in the test sample.
Despite their application in a direct detection assay, the most common use of
capture probes is in the isolation and purification of target nucleic acid
prior to amplifying a
target sequence contained in the target nucleic acid. By isolating and
purifying the target
nucleic acid prior to amplification, the number of unintended amplification
reactions (i.e.,
amplification of non-target nucleic acid) can be severely limited. And, to
prevent or inhibit
the capture probe itself from functioning as a template for nucleic acid
polymerase activity
in the presence of amplification reagents and under amplification conditions,
the 3' end of the
capture probe may be capped or blocked. Examples of capping agents include 3'
deoxyribonucleotides, 3', 2'-dideoxynucleotide residues, non-nucleotide
linkers, alkane-diol
modifications, and non-complementary nucleotide residues at the 3' terminus.
F. Detection Probes to Trichomonas vaginalis Ribosomal Nucleic Acid
This embodiment of the invention relates to novel detection probes.
Hybridization is the association of two single strands of complementary
nucleic acid to form
a hydrogen-bonded double strand. A nucleic acid sequence able to hybridize to
a nucleic acid
sequence sought to be detected ("target sequence") can serve as a probe for
the target
sequence. Hybridization may occur between complementary nucleic acid strands,
including
-52-
CA 02707765 2010-06-02
DNAIDNA, DNA/RNA, and RNA/RNA, as well as between single-stranded nucleic
acids
wherein one or both strands of the resulting hybrid contain at least one
modified nucleotide,
nucleoside, nucleobase, and/or base-to-base linkage. In any case, two single
strands of
sufficient complementarity may hybridize to form a double-stranded structure
in which the
two strands are held together by hydrogen bonds between pairs of complementary
bases. As
described above, in general A is hydrogen-bonded to T or U, while G is
hydrogen-bonded to
C. At any point along the hybridized strands, therefore, the classical base
pairs AT or AU, TA
or UA, GC, or CG may be found. Thus, when a first single strand of nucleic
acid contains
sufficient contiguous complementary bases to a second, and those two strands
are brought
together under conditions that promote their hybridization, double-stranded
nucleic acid will
result. Accordingly, under appropriate conditions, double-stranded nucleic
acid hybrids may
be formed.
The rate and extent of hybridization is influenced by a number of factors. For
instance, it is implicit that if one of the two strands is wholly or partially
involved in a hybrid,
it will be less able to participate in the formation of a new hybrid. By
designing a probe so that
a substantial portion of the sequence of interest is single-stranded, the rate
and extent of
hybridization may be greatly increased. Also, if the target is an integrated
genomic sequence
it will naturally occur in a double-stranded form, as is the case with a
product of PCR. These
double-stranded targets are naturally inhibitory to hybridization with a
single-stranded probe
and require denaturation (in at least the region to be targeted by the probe)
prior to the
hybridization step. In addition, there can be intra-molecular and inter-
molecular hybrids
formed within a probe if there is sufficient self-complementarity. Regions of
the nucleic acid
known or expected to form strong internal structures inhibitory to
hybridization are less
preferred. Examples of such structures include hairpin loops. Likewise, probes
with extensive
self-complementarity generally should be avoided. All these undesirable
structures can be
avoided through careful probe design, and commercial computer programs are
available to
search for these types of interactions, such as the Oligo Tech analysis
software.
In some applications, probes exhibiting at least some degree of self'
complementarity are desirable to facilitate detection of probe:target duplexes
in a test sample
without first requiring the removal of unhybridized probe prior to detection.
Molecular torch
probes are a type of self-complementary probes that are disclosed by Becker et
al., "Molecular
-53-
CA 02707765 2010-06-02
Torches," U.S. Patent No. 6,361,945. The molecular torch probes disclosed
Becker et al.
have distinct regions of self-complementarity, referred to as "the target
binding domain" and
"the target closing domain," which are connected by a joining region and which
hybridize to
one another under predetermined hybridization assay conditions. When exposed
to denaturing
conditions, the complementary regions (which may be fully or partially
complementary) of
the molecular torch probe melt, leaving the target binding domain available
for hybridization
to a target sequence when the predetermined hybridization assay conditions are
restored. And
when exposed to strand displacement conditions, a portion of the target
sequence binds to the
target binding domain and displaces the target closing domain from the target
binding domain.
.0 Molecular torch probes are designed so that the target binding domain
favors hybridization
to the target sequence over the target closing domain. The target binding
domain and the
target closing domain of a molecular torch probe include interacting labels
(e.g.,
luminescent/quencher) positioned so that a different signal is produced when
the molecular
torch probe is self-hybridized as opposed to when the molecular torch probe is
hybridized to
.5 a target nucleic acid, thereby permitting detection of probe:target
duplexes in a test sample
in the presence of unhybridized probe having a viable label or labels
associated therewith.
Another example of detection probes having self-complementarity are the
molecular beacon probes disclosed by Tyagi et al. in U.S. Patent No.
5,925,517. Molecular
beacon probes include nucleic acid molecules having a target complement
sequence, an
?0 affinity pair (or nucleic acid arms) holding the probe in a closed
conformation in the absence
of a target nucleic acid sequence, and a label pair that interacts when the
probe is in a closed
conformation. Hybridization of the target nucleic acid and the target
complement sequence
separates the members of the affinity pair, thereby shifting the probe to an
open confirmation.
The shift to the open confirmation is detectable due to reduced interaction of
the label pair,
?5 which may be, for example, a fluorophore and quencher, such as DABCYL and
EDANS.
The rate at which a probe hybridizes to its target is one measure of the
thermal
stability of the target secondary structure in the probe region. The standard
measurement of
hybridization rate is the Cot,a, which is measured as moles of nucleotide per
liter times
seconds. Thus, it is the concentration of probe times the time at which 50% of
maximal
30 hybridization occurs at that concentration. This value is determined by
hybridizing various
amounts of probe to a constant amount of target for a fixed time. The Cot,r,
is found
-54-
CA 02707765 2010-06-02
graphically by standard procedures. The probe:target hybrid melting
temperature may be
determined by isotopic methods well-known to those skilled in the art. The
melting
temperature (T,,,) for a given hybrid will vary depending on the hybridization
solution being
used.
Preferred detection probes are sufficiently complementary to the target
nucleic
acid sequence, or its complement, to hybridize therewith under stringent
hybridization
conditions corresponding to a temperature of about 60 C when the salt
concentration is in the
range of about 0.6-0.9 M. Preferred salts include lithium chloride, but other
salts such as
sodium chloride and sodium citrate also can be used in the hybridization
solution. Examples
of high stringency hybridization conditions are alternatively provided by 0.48
M sodium
phosphate buffer, 0.1% sodium dodecyl sulfate, and 1 mM each of EDTA and EGTA
at a
temperature of about 60 C, or by 0.6 M LiCl, 1 % lithium lauryl sulfate (LLS),
60 mM lithium
succinate and 10 ml\i each of EDTA and EGTA at a temperature of about 60 C.
Thus, in a first aspect, the present invention features detection probes able
to
distinguish T. vaginalis-derived nucleic acid from non-T. vaginalis nucleic
acid (e.g.,
Trichomzosnas tenax) by virtue of the ability of the detection probe to
preferentially hybridize
to T. vaginalis-derived nucleic acid) under stringent hybridization
conditions. Specifically,
the detection probes contain an oligonucleotide having a base sequence that is
substantially
complementary to a target sequence present in T. vaginalis-derived nucleic
acid.
In the case of a hybridization assay, the length of the target nucleic acid
sequence and, accordingly, the length of the probe sequence can be important.
In some cases,
there may be several sequences from a particular region, varying in location
and length, which
will yield probes with the desired hybridization characteristics. In other
cases, one sequence
may have better hybridization characteristics than another that differs merely
by a single base.
While it is possible for nucleic acids that are not perfectly complementary to
hybridize, the
longest stretch of perfectly homologous base sequence will normally primarily
determine
hybrid stability. While probes of different lengths and base composition may
be used, the
probes preferred in the present invention are up to 100 bases in length, more
preferably from
12 to 50 bases in length, and even more preferably from 18 to 35 bases in
length.
The detection probes include a base sequence that is substantially
complementary to a target sequence present in 18S ribosomal RNA (rRNA), or the
encoding
-55-
CA 02707765 2010-06-02
DNA (rDNA), of T. vaginalis. Thus, the detection probes are able to stably
hybridize to a
target sequence derived from T. vaginalis under stringent hybridization
conditions. The
detection probes may also have additional bases outside of the targeted
nucleic acid region
which may or may not be complementary to T. vaginalis-derived nucleic acid but
which are
not complementary to nucleic acid derived from a non-target organism which
maybe present
in the test sample.
Probes (and amplification oligonucleotides) of the present invention may also
be designed to include a capture tail comprised of a base sequence (distinct
from the base
sequence intended to hybridize to the target sequence) that can hybridize
under predetermined
to hybridization conditions to a substantially complementary base sequence
present in an
immobilized oligonucleotide that is joined to a solid support. The immobilized
oligonucleotide is preferably joined to a magnetically charged particle that
can be isolated in
a reaction vessel during a purification step after a sufficient period of time
has passed for
probe to hybridize to target nucleic acid. (An example of an instrument which
can be used to
perform such a purification step is the DTSTM 1600 Target Capture System (Gen-
Probe; Cat.
No. 5202).) The probe is preferably designed so that the melting temperature
of the
probe:target hybrid is greater than the melting temperature of the
probe:immobilized
oligonucleotide hybrid. In this way, different sets of hybridization assay
conditions can be
employed to facilitate hybridization of the probe to the target nucleic acid
prior to
io hybridization of the probe to the immobilized oligonucleotide, thereby
maximizing the
concentration of free probe and providing favorable liquid phase hybridization
kinetics. This
"two-step" target capture method is disclosed by Weisburg et al., "Two Step
Hybridization
and Capture of a Polynucleotide," U.S. Patent No. 6,110,678.
Other target capture schemes which could be readily
adapted to the present invention are well known in the art and include, for
example, those
disclosed by Ranki et al., "Detection of Microbial Nucleic Acids by a One-Step
Sandwich
Hybridization Test," U.S. Patent No. 4,486,539, and Stabinsky, "Methods and
Kits for
Performing Nucleic Acid Hybridization Assays," U.S. Patent No. 4,751,177.
For T. vaginalis detection probes, the terms "target nucleic acid sequence,"
"target nucleotide sequence," "target sequence," and "target region" all refer
to a nucleic acid
sequence present in T. vaginalis rRNA or rDNA, or a sequence complementary
thereto, which
-56-
CA 02707765 2010-06-02
is not identically present in the nucleic acid of a closely related species.
Nucleic acids having
nucleotide sequences complementary to a target sequence may be generated by
target
amplification techniques disclosed elsewhere herein.
Organisms closely related to T. vaginalis include Trichomonas gallinae',
Trichoinonas tenax, Monotrichomonas species ATCC 50693, Ditrichomonas
honigbergi,
Tritrichoinonasfoetus, Tetratrichonionas gallinarunz and Pentatrichonaonas
hominis, with
Trichomonas tenax being the most closely related. In addition to these
organisms, organisms
that might be expected to be present in a T. vaginalis-containing test sample
include, for
example, Escherichia coli, Chlanaydia trachoinatis and Neiserria gonorrhoeae.
These lists
of organisms are by no means intended to be fully representative of the
organisms that the T.
vaginalis detection probes of the present invention can be used to distinguish
over. In general,
the T. vaginalis detection probes of the present invention can be used to
distinguish T.
vaginalis-derived nucleic acid from any non-T. vaginalis nucleic acid that
does not stably
hybridize with the probe(s) under stringent hybridization conditions.
In. one embodiment, T. vaginalis detection probes of the present invention are
preferably up to 100 bases in length and comprise a target binding region
which forms a
hybrid stable for detection with a sequence contained within a target sequence
selected from
the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4.
More preferably, the base sequence of the target binding region comprises,
overlaps with,
consists essentially of, consists of, substantially corresponds to, or is
contained within the base
sequence of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4. In a
particularly
preferred mode, these detection probes include an acridinium ester label
joined to the probes
by means of a non-nucleotide linker positioned between nucleotides 17 and 18
(reading 5' to
3') of SEQ ID NO: 1 or SEQ ID NO:2 and between nucleotides 15 and 16 (reading
5' to 3') of
SEQ ID NO:3 or SEQ ID NO:4. The acridinium ester label may be joined to the
probe in
accordance with the teachings of Arnold et al. in U.S. Patent Nos. 5,185,439
and 6,031,091.
In another embodiment of the present invention, T. vaginalis detection probes
are preferably up to 100 bases in length and comprise a target binding region
which forms a
hybrid stable for detection with a sequence contained within a target sequence
selected from
the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8,
SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO: 11, SEQ ID NO:12 SEQ ID NO:13, SEQ ID NO:14,
SEQ
-57-
CA 02707765 2010-06-02
ID NO:15 or SEQ ID NO:16. More preferably, the base sequence of the target
binding region
comprises, overlaps with, consists essentially of, consists of, substantially
corresponds to, or
is contained within the base sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID
NO:7, SEQ
ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 SEQ ID NO:13,
SEQ ID NO:14, SEQ ID NO:15 or SEQ ID NO:16. One group of preferred T.
vaginalis
detection probes has a target binding region comprising, overlapping with,
consisting
essentially of, consisting of, substantially corresponding to, or contained
within the base
sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, and which
may
include an acridinium ester label joined to the probe by means of a non-
nucleotide linker
positioned between, for example, nucleotides 12 and 13 (reading 5' to 3') of
SEQ ID NO:5 or
SEQ ID NO:6 and between, for example, nucleotides 18 and 19 (reading 5' to 3')
of SEQ ID
NO:7 or SEQ ID NO:8. Another group of preferred T. vaginalis detection probes
has a target
binding region comprising, overlapping with, consisting essentially of,
consisting of,
substantially corresponding to, or contained within the base sequence of SEQ
ID NO:9, SEQ
ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12, and which may include an acridinium
ester
label joined to the probe by means of a non-nucleotide linker positioned
between, for
example, nucleotides 17 and 18 (reading 5' to 3') of SEQ ID NO:9 or SEQ ID
NO:10 and
between, for example, nucleotides 9 and 10 (reading 5' to 3') of SEQ ID NO: 11
or SEQ ID
NO:12. A further group of preferred T. vaginalis probes has a target binding
region
comprising, overlapping with, consisting essentially of, consisting of,
substantially
corresponding to, or contained within the base sequence of SEQ ID NO:13, SEQ
ID NO:14,
SEQ ID NO:15 or SEQ ID NO:16, and which may include an acridinium ester label
joined
to the probe by means of a non-nucleotide linker positioned between, for
example, nucleotides
8 and 9 (reading 5' to 3') of SEQ ID NO:13 or SEQ ID NO:14 and between, for
example,
nucleotides 19 and 20 (reading 5' to 3') of SEQ ID NO:15 or SEQ ID NO:16. The
acridinium
ester label may be joined to the probe in accordance with the teachings of
Arnold et al. in U.S.
Patent Nos. 5,185,439 and 6,031,091.
Thus, in one aspect of the present invention a detection probe is provided
which is useful for determining whether T. vaginalis is present in a test
sample. The probe is
up to 100 bases in length and comprises a target binding region having a base
sequence which
comprises, overlaps with, consists essentially of, consists of, substantially
corresponds to, or
-58-
CA 02707765 2010-06-02
is contained within a base sequence selected from the group consisting of SEQ
ID NO: 1, SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ
ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 11, SEQ ID NO:12, SEQ ID NO:13,
SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO:16. The probe preferentially
hybridizes
under stringent hybridization conditions to a target nucleic acid derived from
T. vaginalis over
nucleic acid derived from non-T. vaginalis organisms present in the test
sample. In particular,
the probe does not form a hybrid stable for detection with Trichonaonas tenax
under the
stringent hybridization conditions used.
Once synthesized, the probes may be labeled with a detectable label or
reporter
group by any well-known method. (See, e.g., SAMBROOK ET AL., supra, ch. 10.)
The probe
may be labeled with a detectable moiety such as a radioisotope, antigen or
chemiluminescent
moiety to facilitate detection of the target sequence. Useful labels include
radioisotopes as
well as non-radioactive reporting groups. Isotopic labels include 3H, 35S,
32P, 1251, 57Co and
"C. Isotopic labels can be introduced into an oligonucleotide by techniques
known in the art
such as nick translation, end labeling, second strand synthesis, reverse
transcription and by
chemical methods. When using radiolabeled probes, hybridization can be
detected by
techniques such as autoradiography, scintillation counting or gamma counting.
The chosen
detection method depends on the particular radioisotope used for labeling.
Non-isotopic materials can also be used for labeling and may be introduced
internally between nucleotides or at an end of the oligonucleotide. Modified
nucleotides may
be incorporated enzymatically or chemically. Chemical modifications of the
oligonucleotide
may be performed during or after synthesis of the oligonucleotide using
techniques known in
the art. For example, through use of non-nucleotide linker groups disclosed by
Arnold et al.
in U.S. Patent No. 6,031,091. Non-isotopic labels include fluorescent
molecules,
chemiluminescent molecules, fluorescent cherniluminescent molecules,
phosphorescent
molecules, electrochemiluminescent molecules, chromophores, enzymes, enzyme
cofactors,
enzyme substrates, dyes and haptens or other ligands. Another useful labeling
technique is
a base sequence that is unable to stably hybridize to the target nucleic acid
under stringent
conditions. Probes of the present invention are preferably labeled with an
acridinium ester.
(Acridinium ester labeling is disclosed by Arnold et al. in U.S. Patent No.
5,185,439.)
-59-
CA 02707765 2010-06-02
The selected detection probe can then be brought into contact with a test
sample suspected of containing T. vaginalis. Generally, the test sample is
from a source that
also contains unknown organisms. Typically, the source of the test sample will
be a patient
specimen, such as a genitourinary specimen. After bringing the probe into
contact with
nucleic acids derived from the test sample, the probe and sample-derived
nucleic acids can
be incubated under conditions permitting preferential hybridization of the
probe to a target
nucleic acid derived from T. vaginalis that may be present in the test sample
in the presence
of nucleic acid derived from other organisms present in the test sample.
Detection probes may also be combined with one or more unlabeled helper
0 probes to facilitate binding to target nucleic acid derived from T.
vaginalis. After a detection
probe has hybridized to target nucleic acid present in the test sample, the
resulting hybrid may
be separated and detected by various techniques well known in the art, such as
hydroxyapatite
adsorption and radioactive monitoring. Other techniques include those which
involve
selectively degrading label associated with unhybridized probe and then
measuring the
5 amount of remaining label associated with hybridized probe, as disclosed in
U.S. Patent No.
5,283,174. The inventors particularly prefer this latter technique.
G. Helper Probes Used in the Detection of Trichomonas vaginalis
Another embodiment of this invention relates to novel helper probes. As
:0 mentioned above, helper probes can be used to facilitate hybridization of
detection probes to
their intended target nucleic acids, so that the detection probes more readily
form probe: target
nucleic acid duplexes than they would in the absence of helper probes. (Helper
probes are
disclosed by Hogan et al., "Means and Method for Enhancing Nucleic Acid
Hybridization,"
U.S. Patent No. 5,030,557.) Each helper probe contains an oligonucleotide that
is sufficiently
5 complementary to a target nucleic acid sequence to form a helper
probe:target nucleic acid
duplex under stringent hybridization conditions. The stringent hybridization
conditions
employed with a given helper probe are determined by the conditions used for
preferentially
hybridizing the associated detection probe to the target nucleic acid.
Regions of single-stranded RNA and DNA can be involved in secondary and
0 tertiary structures even under stringent hybridization conditions. Such
structures can sterically
inhibit or block hybridization of a detection probe to a target nucleic acid.
Hybridization of
-60-
CA 02707765 2010-06-02
the helper probe to the target nucleic acid alters the secondary and tertiary
structure of the
target nucleic acid, thereby rendering the target region more accessible by
the detection probe.
As a result, helper probes enhance the kinetics and/or the melting temperature
of the detection
probe:target nucleic acid duplex. Helper probes are generally selected to
hybridize to nucleic
acid sequences located near the target region of the detection probe.
Helper probes which can be used with the T. vaginalis detection probes of the
present invention are targeted to nucleic acid sequences within T. vaginalis-
derived nucleic
acid. Likewise, helper probes which can be used with the T. vaginalis
detection probes of the
present invention are targeted to nucleic acid sequences within T. vaginalis-
derived nucleic
acid. Each helper probe comprises an oligonucleotide which targets and stably
hybridizes to
a base region present in nucleic acid derived from T. vaginalis under
stringent hybridization
conditions. Helper probes and their associated detection probes have different
target
sequences contained within the same target nucleic acid. The helper probes of
the present
invention are preferably oligonucleotides up to 100 bases in length, more
preferably from 12
to 50 bases in length, and even more preferably from 18 to 35 bases in length.
Preferred T. vaginalis helper probes useful in the present invention have a
base
sequence comprising, overlapping with, consisting essentially of, consisting
of, substantially
corresponding to, or contained within the base sequence of SEQ ID NO:21, SEQ
ID NO:22,
SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27 or SEQ
ID NO:28. The preferred T. vaginalis detection probe for use with one or more
of these
helper probes has a target binding region comprising, overlapping with,
consisting essentially
of, consisting of, substantially corresponding to, or contained within the
base sequence of
SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4, where the detection
probe
preferentially hybridizes under stringent hybridization conditions to a target
nucleic acid
derived from T. vaginalis over nucleic acid derived from non-T. vaginalis
organisms present
in a test sample. In particular, the probe does not form a hybrid stable for
detection with
Trichornonas ten.ax under the stringent hybridization conditions used.
R. Nucleic Acid Compositions
In another related aspect, the present invention features compositions
comprising a nucleic acid hybrid formed between a detection probe and a target
nucleic acid
-61-
CA 02707765 2010-06-02
("probe: target") under stringent hybridization conditions. One use of the
hybrid formed
between a probe and a target nucleic acid is to provide an indication of the
presence or amount
of a target organism or group of organisms in a test sample. For example,
acridinium ester
(AE) present in nucleic acid hybrids is resistant to hydrolysis in an alkali
solution, whereas
AE present in single-stranded nucleic acid is susceptible to hydrolysis in an
alkali solution
(see U.S. Patent No.5,238,174). Thus, the presence of target nucleic acids can
be detected,
after the hydrolysis of the unbound AE-labeled probe, by measuring
chemiluminescence of
acridinium ester remaining associated with the nucleic acid hybrid.
The present invention also contemplates compositions comprising nucleic acid
hybrids formed between a capture probe and a target nucleic acid ("capture
probe:target")
under stringent hybridization conditions. One use of the hybrid formed between
a capture
probe and a target nucleic acid is to isolate and purify the target nucleic
acid in a test sample
prior to amplification of a target sequence contained in the target nucleic
acid or detection of
the target nucleic acid in, for example, a heterogenous assay. By isolating
and purifying target
nucleic acid prior to amplification or detection, the opportunities for non-
specific binding or
amplification are significantly minimized.
The present invention further contemplates compositions comprising nucleic
acid hybrids formed between a helper probe and a target nucleic acid ("helper
probe:target")
under stringent hybridization conditions. One use of the hybrid formed between
a helper
probe and a target nucleic acid is to make available a particular nucleic acid
sequence for
hybridization. For example, a hybrid formed between a helper probe and a
target nucleic acid
may render a nucleic acid sequence available for hybridization with a
hybridization assay
probe. A full description of the use of helper probes is provided by Hogan et
al. in U.S.
Patent No. 5,030,557.
The present invention also features compositions comprising a nucleic acid
formed between an amplification oligonucleotide and a target nucleic acid
("amplification
oligonucleotide:target") under amplification conditions. One use of the hybrid
formed
between a primer and a target nucleic acid is to provide an initiation site
for a nucleic acid
polymerase at the 3' end of the amplification oligonucleotide. For example, a
hybrid may form
an initiation site for reverse transcriptase, DNA polymerases such as Taq
polymerase or T4
-62-
CA 02707765 2010-06-02
DNA polymerase, and RNA polymerases such as T7 polymerase, SP6 polymerase, T3
polymerase, and the like.
Compositions of the present invention include compositions for determining
the presence or amount of T. vaginalis in a test sample comprising a nucleic
acid hybrid
formed between a target nucleic acid derived from T. vaginalis and one or more
oligonucleotides, where the base sequence of each oligonucleotide comprises,
overlaps with,
consists essentially of, consists of, substantially corresponds to, or is
contained within the base
sequence of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5,
SEQ
ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 11,
SEQ
ID NO:12, SEQ IDNO:13, SEQ IDNO:14, SEQ IDNO:15, SEQ IDNO:16, SEQ ID NO:21,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID
NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32,
SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID
NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51,
SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID
NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70,
SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID
NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NOS 80, SEQ ID NO:81,
SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID
NO:87 or SEQ ID NO:88. The oligonucleotides of these compositions may include
at least
one additional nucleotide base sequence region which does not stably bind to
nucleic acid
derived from T. vaginalis under stringent hybridization conditions. In another
embodiment,
the probe:target compositions may further comprise at least one helper probe
hybridized to
the T. vaginalis-derived target nucleic acid.
The present invention also contemplates compositions for determining the
presence or amount of T. vaginalis in a test sample comprising a nucleic acid
hybrid formed
between a target nucleic acid derived from T. vaginalis and a detection probe,
where the base
sequence of the detection probe comprises, overlaps with, consists essentially
of, consists of,
substantially corresponds to, or is contained within the base sequence of SEQ
ID NO: 1, SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ
-63-
CA 02707765 2010-06-02
ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 11, SEQ ID NO:12, SEQ ID NO:13,
SEQ ID NO:14, SEQ ID NO:15 or SEQ ID NO:16.
Also contemplated by the present invention are compositions for immobilizing
a target nucleic acid derived from a T. vaginalis present in a test sample
comprising a nucleic
acid hybrid formed between the target nucleic acid and a capture probe
comprising a target
binding region which comprises, overlaps with, consists essentially of,
consists of,
substantially corresponds to, or is contained within the base sequence of SEQ
ID NO:29, SEQ
ID NO:30, SEQ ID NO:31 or SEQ ID NO:32. In a further embodiment, these
compositions
additionally include a nucleic acid hybrid formed between an immobilized probe
binding
region of the capture probe and an immobilized probe.
The present invention also contemplates compositions for amplifying a target
sequence present in a target nucleic acid derived from T. vaginalis, where the
compositions
comprise a nucleic acid hybrid formed between the target nucleic acid and an
amplification
oligonucleotide, where the base sequence of the amplification oligonucleotide
comprises,
overlaps with, consists essentially of, consists of, substantially corresponds
to, or consists of
the base sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44,
SEQ
ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID
NO:50,
SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID
NO:56, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69,
SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID
NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80,
SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID
NO:86, SEQ ID NO:87 or SEQ ID NO:88. The amplification primer of these
compositions
optionally includes a 5' sequence which is recognized by a RNA polymerase or
which
enhances initiation or elongation by a RNA polymerase. When included, a T7
promoter, such
as the nucleotide base sequence of SEQ ID NO:89, is preferred.
1. Assay Methods
The present invention contemplates various methods for assaying for the
presence or amount of nucleic acid derived from T. vaginalis in a test sample.
One skilled in
the art will understand that the exact assay conditions, probes, and/or
amplification
-64-
CA 02707765 2010-06-02
oligonucleotides used will vary depending on the particular assay format used
and the source
of the sample.
One aspect of the present invention relates to a method for determining the
presence or amount of T. vaginalis in a test sample by contacting the test
sample under
stringent hybridization conditions with a detection probe capable of
preferentially hybridizing
under stringent hybridization hybridization conditions to a T. vaginalis-
derived target nucleic
acid over nucleic acids from non-T. vaginalis organisms present in the test
sample. In such
methods, the target nucleic acid contains a base sequence having or
substantially
corresponding to the base sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3,
SEQ ID
NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 or
SEQ ID NO: 16. (Depending on the source, the test sample may contain unknown
organisms
that the probes of this method can distinguish over.) The base sequence of a
preferred probe
for use in this method comprises, overlaps with, consists essentially of,
consists of,
substantially corresponds to, or is contained within the base sequence of SEQ
ID NO: 1, SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID N0:6, SEQ ID NO:7, SEQ
ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13,
SEQ ID NO:14, SEQ ID NO:15 or SEQ ID NO:16.
In one preferred embodiment, the method for determining the presence or
amount of T. vaginalis in a test sample may also include the step of
contacting the test sample
with one or more helper probes for facilitating hybridization of the probe to
the target nucleic
acid. While the helper probes may be added to the sample before or after the
addition of the
detection probe, the helper probes and detection probe are preferably provided
to the test
sample at the same time. The base sequence of a preferred helper probe for use
in this method
comprises, overlaps with, consists essentially of, consists of, substantially
corresponds to, or
is contained within the base sequence of SEQ ID N0:21, SEQ ID NO:22, SEQ ID
NO:23,
SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27 or SEQ ID NO:28, and is
used in combination with a detection probe, where the base sequence of the
detection probe
comprises, overlaps with, consists essentially of, consists of, substantially
corresponds to, or
is contained within the base sequence of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID
NO:3 or SEQ
ID NO:4, and where the detection probe preferentially hybridizes to T.
vaginalis-derived
-65-
CA 02707765 2010-06-02
nucleic acid over nucleic acid derived from non-T. vaginalis organisms present
in the test
sample under stringent hybridization conditions.
Another aspect of the present invention relates to a method for amplifying T.
vaginalis-derived nucleic acid in a test sample by contacting the test sample
under
amplification conditions with one or more amplification oligonucleotides
which, when
contacted with a nucleic acid polymerase, will bind to or cause elongation
through a nucleic
acid region having a base sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID
NO:43, SEQ
ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID
NO:49,
SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID
0 NO:55, SEQ ID NO:56, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68,
SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID
NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79,
SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID
NO:85, SEQ ID NO:86, SEQ ID NO:87 or SEQ ID NO:88. The amplification
oligonucleotide.
l5 optionally includes a nucleic acid sequence recognized by a RNA polymerase
or which
enhances initiation or elongation by a RNA polymerase. Particular combinations
of
amplification oligonucleotides that can be used in this method are set forth
above under the
heading "Amplification of Trichontonas vaginalis Ribosomal Nucleic Acid."
In preferred embodiments, the methods for amplifying T. vaginalis-derived
?0 nucleic acid in a test sample further include the step of contacting the
test sample under
stringent hybridization conditions with a detection probe capable of
preferentially hybridizing
under stringent hybridization conditions to an amplified T. vaginalis target
nucleic acid over
nucleic acids from non-T. vaginalis organisms present in the test sample.
While the test
sample is generally contacted with the detection probe after a sufficient
period for
25 amplification has passed, the amplification oligonucleotides and detection
probe may be added
to the sample in any order, as when the detection probe is a self-hybridizing
probe, such as a
molecular torch probe discussed supra. This step of contacting the test sample
with a detection
probe is performed so that the presence or amount of T. vaginalis in the test
sample can be
determined. The base sequence of a preferred probe for use in this method
comprises, overlaps
30 with, consists essentially of, consists of, substantially corresponds to,
or is contained within
the base sequence of SEQ ID NO: I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ
ID
-66-
CA 02707765 2010-06-02
NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID
NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 or SEQ ID NO:16.
The detection probes may further include a label to facilitate detection in
the test sample.
In certain preferred embodiments, these methods are carried out with a set of
at least two amplification oligonucleotides for amplifying T. vaginalis-
derived nucleic acid
Preferred sets of amplification oligonucleotides that can be used in these
methods are set forth
above under the heading "Amplification of Trichotnonas vaginalis Ribosomal
Nucleic Acid."
Still another aspect of the present invention relates to a method for
immobilizing a target nucleic acid derived from a T. vaginalis in a test
sample which
comprises providing to the test sample a capture probe having a target binding
region and an
immobilized probe binding region under a first set of hybridization conditions
permitting the
capture probe to stably bind the target nucleic acid, thereby forming a
capture probe:target
complex, and a second set of hybridization conditions permitting the capture
probe to stably
bind to an immobilized probe in the test sample, thereby forming an
immobilized
probe:capture probe:target complex. The first and second sets of hybridization
conditions may
be the same or different and the capture probe:target complex remains stable
under the second
set of hybridization conditions. The target binding region of this capture
probe comprises,
overlaps with, consists essentially of, consists of, substantially corresponds
to, or consists of
the base sequence of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31 or SEQ ID NO:32.
A
purifying step preferably follows the immobilizing step to remove one or more
components
of the test sample that might interfere with or prevent amplification or
specific detection of
a target sequence contained in the immobilized target nucleic acid. This
method for
immobilizing and optionally purifying a T. vaginalis-derived nucleic may
precede any of the
methods described above for amplifying and/or detecting the presence of a
target nucleic acid
derived from T. vaginalis. If a purifying step is included, the target nucleic
acid may be
indirectly eluted from the immobilized probe or directly eluted from the
capture probe of the
immobilized probe:capture probe:target complex by altering the sample
conditions prior to
amplifying or detecting the target sequence.
-67-
CA 02707765 2010-06-02
J. Diagnostic Systems
The present invention also contemplates diagnostic systems in kit form. A
diagnostic system of the present invention may include a kit that contains, in
an amount
sufficient for at least one assay, any of the detection probes, helper probes,
capture probes
and/or amplification oligonucleotides of the present invention in a packaging
material.
Typically, the kits will also include instructions recorded in a tangible form
(e.g., contained
on paper or an electronic medium, such as a disk, CD-ROM, DVD or video tape)
for using
the packaged probes and/or amplification oligonucleotides in an amplification
and/or detection
assay for determining the presence or amount of T. vaginalis in a test sample.
The various components of the diagnostic systems may be provided in a variety
of forms. For example, the required enzymes, the nucleotide triphosphates, the
probes and/or
primers may be provided as a lyophilized reagent. These lyophilized reagents
may be pre-
mixed before lyophilization so that when reconstituted they form a complete
mixture with the
proper ratio of each of the components ready for use in the assay. In
addition, the diagnostic
systems of the present invention may contain a reconstitution reagent for
reconstituting the
lyophilized reagents of the kit. In preferred kits for amplifying target
nucleic acid derived from
T. vaginalis, the enzymes, nucleotide triphosphates and required cofactors for
the enzymes are
provided as a single lyophilized reagent that, when reconstituted, forms a
proper reagent for
use in the present amplification methods. In these kits, a lyophilized primer
reagent may also
be provided. In other preferred kits, lyophilized probe reagents are provided.
Typical packaging materials would include solid matrices such as glass,
plastic,
paper, foil, micro-particles and the like, capable of holding within fixed
limits detection
probes, helper probes and/or amplification oligonucleotides of the present
invention. Thus,
for example, the packaging materials can include glass vials used to contain
sub-milligram
(e.g., picogram or nanogram) quantities of a contemplated probe or primer, or
they can be
microtiter plate wells to which probes or primers of the present invention
have been
operatively affixed, i.e., linked so as to be capable of participating in an
amplification and/or
detection method of the present invention.
The instructions will typically indicate the reagents and/or concentrations of
reagents and at least one assay method parameter that might be, for example,
the relative
-68-
CA 02707765 2010-06-02
amounts of reagents to use per amount of sample. In addition, such specifics
as maintenance,
time periods, temperature and buffer conditions may also be included.
The diagnostic systems of the present invention contemplate kits having any
of the detection probes, helper probes, capture probes and/or amplification
oligonucleotides
described herein, whether provided individually or in one of the preferred
combinations
described above, for use in amplifying and/or determining the presence or
amount of T.
vaginalis in a test sample.
EXAMPLES
Examples are provided below illustrating different aspects and embodiments
of the invention. It is believed that these examples accurately reflect the
details of experiments
actually performed, however, it is possible that some minor discrepancies may
exist between
the work actually performed and the experimental details set forth below which
do not affect
the conclusions of these experiments. Skilled artisans will appreciate that
these examples are
not intended to limit the invention to the specific embodiments described
therein.
1. Organism Lysis
Whole cells in the examples below were chemically lysed in a transport
medium described below in the "Reagents" section. This transport medium is a
detergent-
containing buffered solution which, in addition to lysing cells, protects
released RNAs by
inhibiting the activity of RNAses present in a test sample.
2. Oligonucleotide Synthesis
Oligonucleotides featured in the examples below include detection probes,
helper probes, primers and capture probes. These oligonucleotides were
synthesized using
standard phosphoramidite chemistry, various methods of which are well known in
the art.
See, e.g., Caruthers et al., Methods in Enzynzol., 154:287 (1987). Synthesis
was performed
using an ExpediteTM 8909 Nucleic Acid Synthesizer (Applied Biosystems; Foster
City, CA).
The detection probes were also synthesized to include a non-nucleotide linker,
as disclosed
by Arnold et al. in U.S. Patent Nos. 5,585,481 and 5,639,604, and labeled with
a
chemiluminescent acridinium ester, as disclosed by Arnold et al. in U.S. Pat.
No. 5,185,439.
-69-
CA 02707765 2010-06-02
3. Transcription-Mediated Amplification
Amplification of a target sequence in the following examples was by a
Transcription-Mediated Amplification (TMA) procedure disclosed by, for
example, Kacian
et al. in U.S. Patent Nos. 5,399,491 and 5,480,784 and by LEE ET AL., supra,
ch. 8. TMA is
an isothermal amplification procedure which allows for a greater than one
billion-fold increase
in copy number of the target sequence using reverse transcriptase and RNA
polymerase (see
Enzyme Reagents below). A TMA reaction involves converting a single-stranded
target
sequence to a double-stranded DNA intermediate by reverse transcriptase in the
presence of
a pair of amplification oligonucleotides, one of which has a 5' RNA polymerase-
specific
promoter sequence. In this embodiment, the DNA intermediate includes a double-
stranded
promoter sequence which is recognized by a RNA polymerase and directs
transcription of the
target sequence into hundreds of copies of RNA. Each of these transcribed RNA
molecules,
in turn, can be converted to a double-stranded DNA intermediate which is used
for producing
additional RNA. Thus, the TMA reaction proceeds exponentially. The particulars
of the
TMA reactions used in the following examples are set forth below.
4. Reagents
Various reagents are identified in the examples below, which include a lysis
buffer, a target capture reagent, an amplification reagent, a primer reagent,
an enzyme reagent,
a hybridization reagent, a selection reagent, and detection reagents. With the
exception of
Example 1, the formulations and pH values (where relevant) of these reagents
were as follows.
Lysis Buffer: The "Lysis Buffer" of the following examples contained 15 mM
sodium phosphate monobasic monohydrate, 15 mM sodium phosphate dibasic
anhydrous, 1.0
mM EDTA disodium dihydrate, 1.0 mM EGTA free acid, and 110 mM lithium lauryl
sulfate,
pH 6.7.
Target Capture Reagent: The "Target Capture Reagent" of the following
examples contained 250 mM HEPES free acid dihydrate, 310 mM lithium hydroxide
monohydrate, 1.88 M lithium chloride, 100 mM EDTA free acid, 2 M lithium
hydroxide to
pH 6.4, and 250 gg/ml 1 micron magnetic particles Sera-MagTM MG-CM Carboxylate
-70-
CA 02707765 2010-06-02
Modified (Seradyn, Inc.; Indianapolis, Indiana; Cat. No. 24152105-050450)
having
oligo(dT)14 covalently bound thereto.
Wash Solution: The "Wash Solution" of the following examples contained
10 mM HEPES free acid, 6.5 mM sodium hydroxide, 1 mM EDTA free acid, 0.3%
(v/v) ethyl
alcohol absolute, 0.02% (w/v) methyl paraben, 0.01% (w/v) propyl paraben, 150
mM sodium
chloride, 0.1% (w/v) lauryl sulfate, sodium (SDS), and 4 M sodium hydroxide to
pH 7.5.
Amplification Reagent: The "Amplification Reagent" was a lyophilized form
of a 3.6 mL solution containing 26.7 mM rATP, 5.0 mM rCTP, 33.3 mM rGTP and
5.0 mM
rUTP, 125 mM HEPES free acid, 8% (w/v) trehalose dihydrate, 1.33 mM dATP, 1.33
mM
dCTP, 1.33 mM dGTP and 1.33 mM dTTP, and 4 M sodium hydroxide to pH 7.5. The
Amplification Reagent was reconstituted in 9.7 mL of the Amplification Reagent
Reconstitution Solution described below.
Amplification Reagent Reconstitution Solution: The "Amplification Reagent
Reconstitution Solution" contained 0.4% (v/v) ethyl alcohol absolute, 0.10%
(w/v) methyl
paraben, 0.02% (w/v) propyl paraben, 33 mM KCl, 30.6 mM MgCl,, 0.003% phenol
red.
Primer Reagent: The "Primer Reagent' 'of the following examples contained
1 mM EDTA disodium dihydrate, ACS, 10 mM Trizma base, and 6M hydrochloric
acid to
pH 7.5.
Enzyme Reagent: The "Enzyme Reagent" of the following examples was a
lyophilized form of a 1.45 mL solution containing 20 mM HEPES free acid
dihydrate, 125
mM N-acetyl-L-cysteine, 0.1 mM EDTA disodium dihydrate, 0.2% (v/v) TRITON X-
100
detergent, 0.2 M trehalose dihydrate, 0.90 RTU/mL Moloney murine leukemia
virus
("MMLV") reverse transcriptase, and 0.20 U/mL T7 RNA polymerase, and 4M sodium
hydroxide to pH 7Ø (One "unit" or "RTU" of activity is defined as the
synthesis and release
of 5.75 fmol cDNA in 15 minutes at 37 C for MMLV reverse transcriptase, and
for T7 RNA
polymerase, one "unit" or "U" of activity is defined as the production of 5.0
fmol RNA
-71-
CA 02707765 2010-06-02
transcript in 20 minutes at 37 C.) The Enzyme Reagent was reconstituted in 3.6
mL of the
Enzyme Reagent Reconstitution Solution described below.
Enzyme Reagent Reconstitution Solution: The "Enzyme Reagent
Reconstitution Solution" of the following examples contained 50 mM HEPES free
acid, 1 mm
EDTA free acid, 10% (v/v) TRITON X-100 detergent, 120 mM potassium chloride,
20%
(v/v) glycerol anhydrous, and 4 M sodium hydroxide to pH 7Ø
Hybridization Reagent: The "Hybridization Reagent" contained 100 mM
succinic acid free acid, 2% (w/v) lithium lauryl sulfate, 100 mM lithium
hydroxide
monohydrate, 15 mM aldrithiol-2, 1.2 M lithium chloride, 20 mM EDTA free acid,
3.0% (v/v)
ethyl alcohol absolute, and 2M lithium hydroxide to pH 4.7.
Selection Reagent: The "Selection Reagent" of the following examples
contained 600 mM boric acid, ACS, 182.5 mM sodium hydroxide, ACS, 1% (v/v)
TRITON
X-100 detergent, and 4 M sodium hydroxide to pH 8.5.
Detection Reagents: The "Detection Reagents" of the following examples
comprised Detect Reagent I, which contained 1 mM nitric acid and 32 mM
hydrogen
peroxide, 30% (v/v), and Detect Reagent II, which contained 1.5 M sodium
hydroxide.
Oil Reagent: The "Oil Reagent" of the following examples was a silicone oil
(United Chemical Technologies, Inc., Bristol, PA; Cat. No. PS038).
Example I
Specificity of T. raginalis Direct Detection Assay
In this experiment, we compared the specificity of two detection probes
targeting different regions of the 18S rRNA of T. vaginalis (ATCC No. 50143)
in a non-
amplified, direct detection assay. The probes of this experiment were tested
alone or in
-72-
CA 02707765 2010-06-02
combination with each other and/or a pair of helper probes. For each organism
tested, sample
tubes were prepared containing two replicates of each of the approximate cell
amounts
indicated in Table 2 below. The non-target organisms included Giardia
intestinalis (ATCC
No. 30988), Triniastix pyriforinis (ATCC No. 50562) and Trichomonas tenax
(ATCC No.
30207). Two replicates each of both a negative control and a T. vaginalis rRNA
positive
control were also included to confirm that the reagents and conditions
supported detectable
hybridization of the probes to the target sequences and that detectable
hybridization would not
occur in the absence of the target nucleic acid. The negative control was also
used to
determine background signal. To lyse the cells and release nucleic acid, the
contents of each
sample tube were suspended in 300 /2L of a lysis buffer (Gen-Probe; Cat. No.
3275 or 3300)
and then heated in a 95 C water bath for about 10 minutes. Following
incubation, the
samples were cooled at room temperature for about 5 minutes.
Sample tubes were also set up in the tube rack of a magnetic separation unit
(Gen-Probe; Cat. No. 1639) and each was provided with 100 ,uL of a
hybridization reagent (3
mM EDTA disodium dihydrate, 3 mM EGTA free acid, 17% (w/v) lithium lauryl
sulfate, 190
mM succinic acid free acid, lithium hydroxide monohydrate, and 2 M lithium
hydroxide to
pH 5.1). The hybridization reagent included one of the probe or probe mix
reagents of Table
1 below, where the amount of probe is indicated by reference to an "RLU" or
relative light
units value, which is a measure of chemiluminescence. For these probe and
probe mix
reagents, Probe 1 had the base sequence of SEQ ID NO:7 and a standard
acridinium ester label
joined to the probe by means of a non-nucleotide linker positioned between
nucleotides 12 and
13 (reading 5' to 3'), Probe 2 had the base sequence of SEQ ID NO:3 and a
standard
acridinium ester label joined to the probe by means of a non-nucleotide linker
positioned
between nucleotides 14 and 15 (reading 5' to 3'), Helper Probe 1 had the base
sequence of
15 SEQ ID NO:23, and Helper Probe 2 had the base sequence of SEQ ID NO:27.
-73-
CA 02707765 2010-06-02
Table 1
Probe and Probe Mix Reagents
Probe I Probe 2 Helper Probe 1 Helper Probe 2
(3 x 106 RLU) (3 x 106 RLU) (3 pmol) (3 pmol)
Reagent A / / / /
Reagent B /
Reagent C /
Reagent D / / /
After adding the probe and probe mix reagents, the sample tubes were vortexed
for about 10 seconds to ensure homogeneity of the hybridization reagent. The
hybridization
reagent of each sample tube was combined with 100 AL of lysed material from
one of the
sample tubes above. The sample tubes were then covered with sealing cards (Gen-
Probe; Cat.
No. 2085) and the rack was hand-shaken several times to mix the contents of
the sample tubes
prior to incubating the sample tubes in a 60 C water bath for about 1 hour.
The tube rack was removed from the water bath and the sealing cards were
removed from the sample tubes before adding 1 mL of a separation suspension to
each sample
tube. The separation suspension was a 20:1 mixture of a selection reagent (222
mM 6N
hydrochloric acid solution, 190 mM sodium tetraborate, 0.01 % (v/v) gelatin
(fish skin), and
6.43% (v/v) TRITON X-102 detergent) and a separation reagent (1 mM EDTA
disodium
dihydrate, 0.02% (wlv) sodium azide and 1.25 mg/mL BioMag particles
(Polysciences, Inc.,
Warrington, PA; Cat. No. 8-4100T). The sample tubes were again covered with
sealing cards
and the tube rack was vigorously shaken 3 to 5 times to mix the contents
before placing it in
a 60 C water bath for about 10 minutes to immobilize nucleic acid present in
the sample tubes
on the BioMag particles. The tube rack was removed from the water bath and the
tube rack
was placed on the base of the magnetic separation unit for 5 minutes at room
temperature to
magnetically isolate the BioMag particles. With the sealing cards removed, the
tube rack and
base of the magnetic separation unit were inverted to decant the supernatants
of the sample
tubes. To remove residual liquid, the magnetic separation unit was then shaken
2 to 3 times
and the sample tubes were blotted 3 times for 5 seconds on absorbent paper.
Each sample
-74-
CA 02707765 2010-06-02
tube was then filled to the rim with a wash solution (25 mM sodium hydroxide,
20 mM
sodium tetraborate, 0.1% (w/v) Zwittergent 3-14 detergent, and 4M sodium
hydroxide to
pH 10.4) and allowed to remain on the base of the magnetic separation unit for
20 minutes at
room temperature. Holding the tube rack and base of the magnetic separation
unit together,
the supernatants were decanted and the magnetic separation unit was shaken 2
to 3 times. The
tubes were returned to their upright position, leaving about 50 to 100 ,uL of
the wash solution
in each sample tube, and the tube rack was separated from the base of the
magnetic separation
unit. The sample tubes were then analyzed in a LEADER 450h or a LEADER HC+
Luminometer equipped with automatic injection of Detection Reagent 1, followed
by
automatic injection of Detection Reagent 2. An RLU value of 1000 was
determined to be the
cut-off for a negative result.
The results are summarized in Table 2 below and indicate that the probes and
probe mixes tested in this experiment were specific for T. vaginalis.
-75-
CA 02707765 2010-06-02
Table 2
Specificity of T. vagirzalis Direct Detection Assay
Avg. RLU
Sample Cell Count Reagent A Reagent B Reagent C Reagent D
Giardia 2x 105 -189 170 58 315
intestinalis
2 x 104 191 -10 328 -31
Trirrzastix 1 x 105 31 -186 453 -128
pyriformis 4
1 x 10 -120 -26 266 -146
0 Trichornonas 4.9 x 105 -243 328 52 320
tenax 4.9 x 104 -127 126 14 137
Trichornorzas 2x 105 636,638 298,244 25,439 356,041
vaginalis 4
2 x 104 407,087 53,470 5,165 299,776
Positive 10.5 ng 85,274 7,317 2,506 55,597
.5 Control RNA
Negative N/A 282 219 3 6 651
Control
!0
Example 2
Sensitivity and Specificity of T. vaginalis Amplification Assay
This experiment was conducted to determine the sensitivity and specificity of
an amplification assay targeting 18S rRNA of T. vaginalis (ATCC No. 50143) in
the presence
'.5 of several closely-related, non-target organisms. The non-target organisms
in this experiment
included Giardia intestinalis (ATCC No. 30888), TrinzastiX pyriformis (ATCC
No. 50562)
and Triclzornonas tenaz (ATCC No. 30207), the latter being the most closely
related to T.
vaginalis. Sample tubes were prepared in replicates of four for each organism
at each of the
approximate cell concentrations indicated in Table 2 below. Two replicates
each of a T.
30 vaginalis RNA positive control (5 fg/replicate) and a negative control were
also prepared. To
lyse the cells and release target nucleic acid, 400 AL of the Lysis Buffer was
added to each
-76-
CA 02707765 2010-06-02
sample tube, and the sample tubes were heated for about 10 minutes in a 95 C
water bath.
Following incubation, the samples were cooled at room temperature for about 5
minutes.
To separate T. vaginalis target nucleic acid from other components present in
the sample tubes, the contents of the sample tubes were transferred to the
reaction tubes of
Ten-Tube Units (Gen-Probe; Cat. No. TU0022) and combined with 100 uL of the
Target
Capture Reagent containing 3 pmol of a target capture probe having the
sequence of. SEQ ID
NO:99 gcctgctgctacccgtggatattttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa. This capture
probe includes
a 5' target binding region (SEQ ID NO:31) and a 3' immobilized probe binding
region (SEQ
ID NO:98). The TTUs were covered with a sealing card (Gen-Probe; Cat. No.
2085), hand-
shaken, incubated in a 62 C water bath for about 30 minutes to permit
hybridization of the
target binding region of the capture probe to the target nucleic acid, and
cooled at room
temperature for about 30 minutes to facilitate hybridization of the
oligo(dA)30 sequence of the
immobilized probe binding region of the capture probe to oligo(dT)14 bound to
the magnetic
particles. Following cooling of the samples, a DTSTM 1600 Target Capture
System (Gen-
Probe; Cat. No. 5202) was used to isolate and wash the magnetic particles. The
DTS 1600
Target Capture System has a test tube bay for positioning TTUs and applying a
magnetic field
thereto. The TTUs were placed in the test tube bay on the DTSTM 1600 Target
Capture System
for about 5 minutes in the presence of the magnetic field to isolate the
magnetic particles
within the reaction tubes, after which the sample solutions were aspirated
from the TTUs.
Each tube was then provided with 1 mL of the Wash Solution, covered with a
sealing card and
vortexed for 10 to 20 seconds to resuspend the magnetic particles. The TTUs
were returned
to the test tube bay on the DTSTM 1600 Target Capture System and allowed to
stand at room
temperature for about 5 minutes before the wash solution was aspirated.
Following the target capture step, 75 uL of the reconstituted Amplification
Reagent spiked with a pair of primers was added to each of the reaction tubes.
Each primer
was present at a concentration of 15 pmol in the spiked Amplification Reagent.
(It is noted
that 4 pmol of each primer per reaction mixture is currently preferred.) The
primers for this
experiment included a primer having the base sequence of SEQ ID NO:45 and a
promoter-
primer having the base sequence of SEQ ID NO: 100
a.atttaatacgactcactatagggagaggcatcacggac
ctgttattgc. The promoter primer included a 3' target-binding portion (SEQ ID
NO:55) and a
5' T7 promoter sequence (SEQ ID NO:89). The reaction tubes were then provided
with 200
-77-
CA 02707765 2010-06-02
L of the Oil Reagent, covered with a sealing card, and vortexed for about 10
seconds before
being incubated in a 62 C water bath for about 10 minutes for an initial
anneal step to
promote binding of the promoter-primers to the target nucleic acid. The
reaction tubes were
transferred to a 42 C water bath for about 5 minutes, the sealing cards were
removed from the
reaction tubes, and 25 L of the reconstituted Enzyme Reagent was added to
each of the
reaction tubes. The reaction tubes were again covered with a sealing card,
removed from the
water bath, and their contents were gently mixed by hand. After mixing, the
reaction tubes
were again incubated in the 42 C water bath for about 60 minutes.
For detection of T. vaginalis amplification products, the reaction tubes were
0 removed from the water bath and 100 gL of the Hybridization Reagent
containing 100 fmol
of a detection probe was added to each reaction tube. The detection probe had
the base
sequence of SEQ ID NO:3 and a standard acridinium ester label joined to the
probe by means
of a non-nucleotide linker positioned between nucleotides 17 and 18, reading
5' to 3'. The
reaction tubes were covered with a sealing card and vortexed for about 10
seconds before
5 being incubated in a 62 C water bath for about 20 minutes to allow
hybridization of the
detection probe to amplification products present in the reaction tubes. The
reaction tubes
were then removed from the water bath and allowed to cool at room temperature
for about 5
minutes before adding 250 jiL of the Selection Reagent to each reaction tube.
The reaction
tubes were covered with a sealing card and vortexed for about 10 seconds
before being
0 incubated in a 62 C water bath for about 10 minutes to hydrolyze acridinium
ester labels
associated with unhybridized probe. The reaction tubes were then cooled in a
18 to 28 C
water bath for about 15 minutes before being analyzed in a LEADER 450h or a
LEADER
HC+ Luminometer equipped with automatic injection of Detection Reagent 1,
followed by
automatic injection of Detection Reagent 2. The cut-off for a negative result
in this experiment
5 was 50,000 RLU.
The results are summarized in Table 3 below and indicate that the T. vaginalis
assay of this experiment amplified and detected T. vaginalis-derived nucleic
acid without
cross-reacting with nucleic acid derived from Giardia lamblia, Trinzastix
pyrifornzis or
Trichon2onas tenax. As above, the term "RLU" in this table stands for relative
light units, and
3 the term "CV" stands for coefficient of variation and represents the
standard deviation of the
replicates over the mean of the replicates as a percentage.
-78-
CA 02707765 2010-06-02
Table 3
Sensitivity and Specificity of the T. vaginalis Amplification Assay
Sample Cell Count Avg. RLU % CV
4 x 104 2925 9
Giardia
laniblia 4 x 103 2882 16
4x 1022 3100 28
4 x 105 3322 14
Trimastix 4 x 104 2720 7
pyriformis
4 x 103 2769 19
4 x 104 2473 18
Trichomonas 4x 103 4613 71
tenax
4 x 102 2315 7
4x104 2,362,258 59
Trichonzonas 4x 103 1,427,954 46
vaginalis
4 x 102 2,754,667 31
Positive Control N/A 4,359,224 2
Negative Control N/A 5122 47
Example 3
Primer Sets for Use in a T. vaginalis Amplification Assay
Directed to the 400 Region of T. vaginalis 18S rRNA
The purpose of this experiment was to compare the amplification efficiency
of various primer sets for amplifying a portion of the 400 region of a
transcript derived from
the 18S rRNA of T. vaginalis at different initial annealing temperatures. The
amplification
and detection procedures of this experiment were identical to those of Example
2 above,
except that one group of primer sets was exposed to an 95 C initial annealing
step instead of
a 62 C initial annealing step after the Oil Reagent was added to the sample
tubes. Because
the primer sets of this experiment targeted transcript, a target capture step
was not included.
-79-
CA 02707765 2010-06-02
The detection probe used for detecting the formation of amplification products
in this experiment had the base sequence of SEQ ID NO:9 and a standard
acridinium ester
label joined to the probe by means of a non-nucleotide linker positioned
between nucleotides
17 and 18, reading 5' to 3. Primers 1-3 identified in Tables 3 and 4 below had
the base
sequences of SEQ ID Nos. 61, 65 and 69, respectively. And Primers 4-6
identified in Tables
3 and 4 below were promoter-primers having the following base sequences:
Primer 4: aatttaatacgactcactatagggagacctctgctaggtttcggtacggt (SEQ ID NO:101),
Primer 5: aatttaatacgactcactatagggagagactggccetctgctaggttteg (SEQ ID NO:102),
and
Primer 6: aatttaatacgactcactatagggagagetgetggcaceagactgg (SEQ ID NO: 103).
0 Primers 4-6 had a 5' promoter sequence (SEQ ID NO:89) and 3' target binding
portions having
the base sequences of SEQ ID Nos. 79, 83 and 87, respectively.
The results are summarized in Tables 4 and 5 below and indicate that the
primer set of Primers 3 and 5 performed the best at amplifying the target
region under both
sets of conditions. The results also indicate that in most instances, the
amplification efficiency
5 of the primer sets was better with a 95 C rather than a 62 C initial
annealing step. As above,
the term "RLU" in these tables stands for relative light units, and the term
"CV" stands for
coefficient of variation.
Table 4
0 Primer Sets for T. vaginalis rRNA Amplification
Employing a 62 C Initial Annealing Step
Primer Set Copy Number Avg. RLU %CV
Primers 1.5 x 104 41,788 30
:5 3 and 4 1,875 30,053 23
Primers 1.5 x 104 53,763 10
3 and 5
1,875 46,493 13
Primers 1.5 x 104 3,619 4
1 and 6
1,875 3,176 4
Primers 1.5 x 104 28,059 43
2 and 6
1,875 11,758 90
-80-
CA 02707765 2010-06-02
Primer Set Copy Number Avg. RLU %CV
Primers 1.5 x 104 46,365 12
3 and 6 1,875 6,646 13
Table 5
Primer Sets for T. vaginalis rRNA Amplification
Employing a 95'C Initial Annealing Step
Primer Set Copy Number Avg. RLU %CV
Primers 1.5 x 104 59,660 22
3 and 4
1,875 40,248 15.
Primers 1.5 x 104 85,698 53
3and5
1,875 45,099 12
Primers 1.5 x 104 5,553 65
1and6
1,875 11,286 157
Primers 1.5 x 104 20,033 47
2 and 6
1,875 17,104 47
Primers 1.5 x 104 40,969 8
3and6
1,875 13,323 46
Example 4
Primer Sets for Use in a T. vaginalis Amplification Assay
Directed to the 1100 Region of T. vaginalis 18S rRNA
The purpose of this experiment was to compare the amplification efficiency
of several primer sets for amplifying a portion of the 1100 region of a
transcript derived from
the 18S rRNA of T. vaginalis. The amplification and detection procedures of
this experiment
were identical to those of Example 2 above. A target capture step was not
included.
The detection probe used for detecting the formation of amplification products
in this experiment had the base sequence of SEQ ID NO:3 and a standard
acridinium ester
label joined to the probe by means of a non-nucleotide linker positioned
between nucleotides
-81-
CA 02707765 2010-06-02
17 and 18, reading 5' to 3'. Primers 1 and 2 identified in Table 5 below had
the base sequences
of SEQ ID Nos. 41 and 45, respectively. And Primers 3 and 4 identified in
Tables 6 below
were promoter-primers having the following base sequences:
Primer 3: aatttaatacgactcactatagggagacctcttccacctgctaaaatcgcag (SEQ 3D NO:
104),
and
Primer 4: aatttaatacgactcactatagggagaggcatcacggacctgttattgc (SEQ ID NO: 105).
Primers 3 and 4 had a 5' promoter sequence (SEQ ID NO:89) and 3' target
binding portions
having the base sequences of SEQ ID Nos. 51 and 55, respectively.
The results are summarized in Table 6 below and indicate that primer sets
0 which included the promoter-primer of SEQ ID NO: 105 (Primer 4) were
superior at
amplifying the target region. As above, the term "RLU" in this table stands
for relative light
units, and the term "CV" stands for coefficient of variation.
Table 6
5 Primer Sets for T. vaginalis rRNA Amplification
Primer Set Copy Number Avg. RLU %CV
Primers 1.5 x 104 306,917 4
1 and 3
1,875 130,842 10
.0 Primers 1.5 x 104 5,262,130 1
1 and 4 1,875 4,584,780 1
Primers 1.5 x 104 169,767 6
2 and 3 1,875 27,693 16
Primers 1.5 x 104 5,193,952 3
.5 2and4
1,875 5,049,133 1
Example 5
Sensitivity of T. vaginalis Amplification Assay
.10 This experiment was designed to evaluate the sensitivity of an
aniplification
assay targeting a portion of the 1100 region of 18S rRNA of T. vaginalis
present in a transcript
-82-
CA 02707765 2010-06-02
derived from T. vaginalis nucleic acid following the procedures and employing
the detection
probe and Primers 2 and 4 of Example 4 above. The results of this experiment
are
summarized in Table 7 below and indicate at least about 19 copy sensitivity
(one of the
replicates had a total RLU of about 300,000, the cut-off for a positive result
in this assay). As
above, the term "RLU" in this table stands for relative light units, and the
term "CV" stands
for coefficient of variation. The CV values are generally larger with lower
concentrations of
transcript because some of the replicates are being amplified, while others
were not, thereby
resulting in a higher standard deviation between the replicates.
Table 7
Varying Concentrations of Transcript
in T. vaginalis Amplification Assay
Copy Number Avg. RLU %CV
20,000 5,182,728 2
10,000 5,163,317 2
5000 5,400,837 3
2500 5,360,159 1
1250 5,371,082 4
?0 625 5,242,293 2
312 5,098,105 2
156 5,017,485 2
78 4,831,400 2
39 4,661,045 5
?5 19 2,908,561 63
0 2695 4
While the present invention has been described and shown in considerable
i0 detail with reference to certain preferred embodiments, those skilled in
the art will readily
-83-
CA 02707765 2012-08-02
appreciate other embodiments of the present invention are encompassed within
the scope of the
following appended claims.
This description contains a sequence listing in electronic form in ASCII text
format (file no.
82022-55D_ca_seglist_vl_02Jun20lO.txt). A copy of the sequence listing in
electronic form is
available from the Canadian Intellectual Property Office.
-84-
