Note: Descriptions are shown in the official language in which they were submitted.
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
1
METHOD FOR POLYMERISING GLYCOLIC ACID WITH
MICROORGANISMS
FIELD OF THE INVENTION
The present invention relates to a method for making polyglycolic acid
polymers
called PGA. More specifically, the invention relates to a method comprising
the steps of-
- cultivating a genetically engineered microorganism with a suitable carbon
source,
including or not glycolic acid, said microorganism expressing a gene encoding
an enzyme
that converts glycolate into glycolyl-CoA and at least one gene encoding an
enzyme
involved in PHA synthesis and
- recovering the polyglycolate polymer.
BACKGROUND OF THE INVENTION
PLA and PGA polymers are biodegradable thermoplastic materials, with a broad
range of industrial and biomedical applications (Williams and Peoples, 1996,
CHEMTECH
26, 38-44).
These polyesters play important roles not only as industrial plastics but also
as
medical biopolymers in applications such as drug delivery carriers (Drug
delivery and
targeting. Nature 392, 5-10 (1998), Langer, R.), biomaterial scaffolds and
medical devices
(Biodegradable polyesters for medical and ecological applications. Macromol.
Rapid
Commum. 21, 117-132 (2000), Ikada, Y. & Tsuji, H.; Sterilization, toxicity,
biocompatibility and clinical applications of polylactic acid/polyglycolic
acid copolymers.
Biomaterials 17, 93-102 (1996), Athanasiou, K. A. et al). PGA is a polyester
resin which
has good properties: a very high gas impermeability even under 80% humidity,
biodegradability, high mechanical strength, and good moldability (Poly
(glycolic acid) In
polymer data handbook (ed. Mark, J. E.) 566-569 (Oxford University Press, New
York,
1999) Lu, L; & Mikos, A. G). This unique combination of properties makes PGA
ideally
suited for high performance packaging and industrial applications. Today, the
targeted
application for PGA is multilayer polyethylene terephthalate (PET) bottles for
carbonated
soft drinks and beer. Since PGA offers a gas barrier 100 times higher that
that of PET, it is
possible to reduce the amount of PET used in these bottles by more than 20
percent, while
maintaining the equivalent barrier against C02 loss. This bottle redesign has
the potential
of yielding cost reduction. Perhaps most importantly, PGA's unique hydrolytic
properties
make it highly compatible with widely practiced industrial PET recycling
processes,
ensuring the material does not interfere with the purity and quality of
recycled PET. In
another packaging application, PGA multi-layer designs have been shown to
enhance the
gas and moisture barrier of bio-based polymers such as polylactic acid (PLA).
Through
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
2
expanded use in biodegradable applications, PGA will further contribute to
environmental
conservation.
At present, PGA is being prepared by two different chemical routes, either the
ring-
opening polymerization of cyclic diesters or the polycondensation of 2-
hydroxycarboxylic
acids. Ring-opening polymerization of cyclic diesters is in three steps: (i)
polycondensation
of c -hydroxycarboxylic acids, (ii) the synthesis of cyclic diesters by a
thermal unzipping
reaction and (iii) ring-opening polymerization of the cyclic diester
(Preparative Methods of
Polymer Chemistry 2"d edition, Interscience Publishers Inc, New York 1963,
Sorensen, W.
R. & Campbell, T. W ; Controlled Ring-opening Polymerization of Lactide and
Glycolide.
Chem. Rev. 104, 6147-6176 (2004), Dechy-Cabaret, O. et al.,). Alternatively,
it is well
known that low-molecular-weight PGA can be produced by the direct
polycondensation of
glycolic acid. The attainment of only low-molecular-weight polymers is largely
due to the
difficulty in removing water, the by-product during polymerization, which
favors
depolymerization (Synthesis of polylactides with different molecular weights.
Biomaterials
18, 1503-1508 (1997), Hyon, S. -H. et al.,). Therefore, ring-opening
polymerization of
cyclic diesters using coordination initiators is preferred for the synthesis
of high-
molecular-weight polymers. But this process has disadvantages due to the
addition of
solvents or chain coupling agents (initiators) which are not easy to remove.
Meanwhile, bacterial polyesters - also referred to as microbial polyesters and
polyhydroxyalkanoates, PHAs - are stored as intracellular granules as a result
of a
metabolic stress upon imbalanced growth due to a limited supply of an
essential nutrient
and the presence of an excess of a carbon source (Lenz and Marchessault 2005;
Lenz 1993;
Sudesh et al., 2000; Sudesh and Doi 2005; Steinbuchel and Fuchtenbusch 1998;
Steinbuchel and Valentin 1995; Steinbuchel 1991). PHAs are naturally
synthesized by a
wide range of different Gram-positive and Gram-negative bacteria, as well as
by some
Archaea. PHAs have attracted considerable attention in recent decades due to
similarity in
the physical properties of this biopolymer to conventional petrochemical-based
polypropylene in terms of their tensile strength and stiffness (Sudesh et al.,
2000). Unlike
conventional plastics, however, PHAs are biodegradable and recyclable in
nature thus,
making this class of polymer friendly to the environment.
Two types of PHAs according to the length of the side chain are distinguished.
One type is consisting of short-chain-length hydroxyalkanoic acids, sc1PHA,
with
short alkyl side chains (3-5 carbon atoms) that are produced by Ralstonia
eutropha (Lenz
and Marchessault 2005).
The second type is consisting of medium-chain-length hydroxyalkanoic acids,
mclPHA, with long alkyl side chains (6-14 carbon atoms) that are produced by
Pseudomonas oleovorans and other Pseudomonas (Timm and Steinbuchel, 1990)
(Nomura, C. T. & Taguchi, S., 2007; Steinbuchel, A. & Hazer, B., 2007).
Although the
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
3
most well-studied PHA is poly(3-hydroxybutyrate) (PHB), a polymer of 3-
hydroxybutyrate
(3HB), there are over 150 constituents monomers (Steinbuchel A. Valentin AE.
FEMS
Microbiol Lett 1995, 128:219-228; Madison L. and Huisman G. Microbiol and Mol
Biol
Reviews, 1999, 63:21-53; Rehm B. Biochem J 2003, 376:15-33). This wide variety
of
monomers yields PHAs with diverse material properties that depend on polymer
composition.
The minimal requirements for the synthesis of PHA in a microorganism are
source
of (>3)-hydroxyalkanoyl-CoA and an appropriate PHA synthase (Gerngross and
Martin,
PNAS 92:6279-83, 1995). Polyester synthases are key enzymes of polyester
biosynthesis
and catalyse the conversion of (R)-(>3)-hydroxyacyl-CoA thioesters to
polyesters with the
concomitant release of CoA. These polyester synthases have been biochemically
characterized. An overview of these recent findings is provided in (Rehm,
2003). There are
4 major classes of PHA synthases according to their sequence, their substrate
specificity,
and their subunit composition (Rhem B. H. A. Biochem J. 2003, 376: 15-33).
Owing to the
low substrate specificity of PHA synthases that represent the key enzyme for
PHA
biosynthesis, the variability of bacterial PHAs that can be directly produced
by
fermentation is extraordinary large. By choosing an appropriate production
strain as well
as a suitable cultivation conditions and carbon sources, PHA with tailor-made
compositions can be produced. There are many examples in the literature
showing the
production of PHAs by natural producer's organisms like Ralstonia eutropha,
Methylbacterium, Pseudomonas and by recombinant bacteria natural producers or
not like
E.coli (Qi et al., FEMS Microbiol. Lett., 157:155, 1997; Qi et al., FEMS
Microbiol. Lett.,
167:89, 1998; Langenbach et al., FEMS Microbiol. Lett., 150:303, 1997; Madison
L. and
Huisman G., 1999; WO 01/55436; U. S. Pat. No. 6.143.952; WO 98/54329; WO
99/61624).
PHA synthase synthesizes PHA using (>3)-hydroxyacyl-CoA as a substrate.
Therefore, the first step of polymerization is the obtention of (>3)-
hydroxyacyl-coA
thioesters, substrates of the synthases. Accordingly, conversion of hydroxy
acid to (R)-
(>3)-hydroxyacyl-CoA thioesters is an essential step for the biosynthesis of
polyesters.
The following enzymes are known as enzymes capable of generating 3-
hydroxyacyl-CoA; (3-ketothiolase (PhaA), acetoacetyl-CoA reductase (PhaB),
cloned from
Ralstonia eutropha, 3-hydroxydecanoyl-ACP:CoA transferase (PhaG) cloned from
Pseudomonas, (R)-specific enoyl-CoA hydratase (PhaJ) derived from Aeromonas
caviae
and Pseudomonas aeruginosa (Fukui et at., J. Bacteriol. 180:667, 1998; Tsage
et at.,
FEMS Microbiol. Lett. 184:193, 2000), 3-ketoacyl-ACP reductase (FabG) derived
from
E.coli and Pseudomonas aeruginosa (Taguchi et at., FEMS Microbiol. Lett.
176:183,
1999; Ren et at., J. Bacteriol. 182:2978, 2000; Park et at., FEMS Microbiol.
Lett. 214:217,
2002). Various kinds of PHAs have been synthesized with these enzymes using
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
4
hydroxyalkanoates hydroxylated at various positions in the carbon chain
(mainly the 3, 4,
5, and 6 positions). However, it has been reported that it has a little PHA
synthase activity
on hydroxyalkanoates which is hydroxylated at the 2-position (Zhan et at.,
Appl.
Microbiol. Biotechnol. 56:131, 2001; Valentin and Steinbuchel, Appl.
Microbiol.
Biotechnol. 40:699, 1994; Yuan et at., Arch. Biochem. Biophysics. 394:87,
2001).
The propionyl coenzymeA synthetase encoding gene from Salmonella enterica was
cloned in 2000 and named PrpE; see for reference (Valentin et al., 2000).
Reported
substrates of this enzyme are propionate, acetate, 3-hydroxypropionate, and
butyrate. This
enzyme catalyzes the transformation of these substrates into their
corresponding coenzyme
A esters. When this enzyme is co-expressed with a PHA synthase from Ralstonia
eutropha
in a recombinant E. coli, formation of a PHA copolymer is observed.
The acetyl-coA synthetase encoding gene from Escherichia coli was cloned in
2006
and named acs; see for reference (Lin et al., 2006). When overexpressed in E.
coli, this
enzyme reduces the acetate accumulation into the microorganism, by
transforming said
acetate into acetyl-coA.
Although over 150 different monomers have been incorporated into PHAs in
organisms, the production of biosynthetic polyglycolide PGA has never been
reported,
because a hydroalkanoate, such as glycolate hydroxylated at the 2-position
carbon, is not a
suitable substrate for PHA synthase.
Two patent applications describe the incorporation of 2-hydroxyacid monomers
in
polymers by the action of a PHA synthase in living cells.
US 2007/0277268 (Cho et al.) relates the bioproduction of polylactate (PLA) or
its
copolymers by cells or plants.
WO 2004/038030 (Martin et al.) shows the formation of co-polymers containing
monomers of glycolyl-CoA and at least one other monomer selected from the
group
consisting of 3-hydroxybutyric acid, 3-hydroxypropionic acid, 3-hydroxyvaleric
acid, etc
In this case, the substrate glycolyl-CoA is obtained via the 4-hydroxybutyryl-
CoA
molecule and a reaction requiring FadE, AtoB and thio lase 11.
Up to now, the available prior art documents have never reported a process for
the
production of a homopolymer of glycolic acid (PGA) by fermentation of a
microorganism.
Here, inventors have developed a method to produce high-molecular-weight PGA
using microorganisms. As disclosed herein, the inventors describe that
polyglycolic acid
homopolymers is produced by culturing recombinant microorganisms transformed
with a
PHA synthase gene and a gene encoding an enzyme that converts glycolate into
glycolyl-
CoA, in a production medium containing a suitable carbon source.
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
DESCRIPTION OF THE INVENTION
It is an object of the present invention to provide a method for the
biosynthesis of
PGA, a homopolymer of glycolic acid.
This method is based on the use of a recombinant microorganism, expressing:
5 1. a gene encoding for an heterologous polyhydroxyalkanoate (PHA)
synthase, and
2. at least one gene encoding for an enzyme(s) transforming the glycolic
acid into glycolyl-coA.
Other objects of the invention are a biosynthetic PGA such as obtained by the
process according to the invention, and a microorganism expressing genes for
biosynthesis
of PGA according to the invention.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1 shows the successive reactions for production of polyglycolic acid
polymer,
PGA. The first reaction is the formation of glycolyl-CoA, substrate of the
second reaction
of polymerisation catalyzed by the PHA synthase.
FIG. 2 is a schematic diagram showing the pathway for synthesizing
polyglycolate
using cells cultivated on a medium containing glucose plus glycolate.
FIG. 3 is a schematic diagram showing the pathway for synthesizing
polyglycolate
using cells cultivated on a medium containing glucose without any exogenous
glycolate.
FIG. 4 represents the microscopic observation (X100) of strain AG 1122 grown
in
Erlenmeyer flask in LB + glucose. Optical microscope AVANTEC 3804921.
FIG. 5 represents the microscopic observation (X100) of strain AG 1122 grown
in
fermentor in LB + glucose. Optical microscope AVANTEC 3804921.
FIG. 6 represents the microscopic observation (X100) of strain AG1327 grown in
Erlenmeyer flask in modified M9 + glucose. Optical microscope AVANTEC 3804921
FIG. 7 represents LC-MS chromatogram of the reaction with glycolate on crude
cell extract of the strain AG1354
FIG. 8 represents LC-MS chromatogram of the reaction with glycolate on the
pure
protein PrpEst.
DETAILLED DESCRIPTION OF THE INVENTION
The present invention is related to a method for obtaining the polymerisation
of
glycolic acid into PGA with a microorganism, comprising the steps of:
- cultivating a microorganism expressing a gene encoding for an heterologous
polyhydroxyalkanoate (PHA) synthase, in a medium comprising a carbon source,
- and recovering the polymerised glycolic acid (PGA),
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
6
wherein the microorganism also expresses at least one gene encoding for an
enzyme(s)
transforming the glycolic acid into glycolyl-coA.
The term "polymerization" or "homopolymerization" means a chemical reaction in
which the molecules of a monomer are linked together to form large molecules
whose
molecular weight is a multiple of that of the original substance. When two or
more
different monomers are involved, the process is called copolymerization or
heteropolymerization.
`PGA' designates the polyglycolic acid, also called polyglycolate consisting
of
glycolic acid-recurring unit represented on the Figure n l and by the formula
I below:
-(-O-CH2-CO-)-
PGA is a homopolymer comprising at least at 55wt.% of the above-mentioned
glycolic acid-recurring unit (also called glycolate). The content of the above-
mentioned
glycolic acid-recurring unit in the PGA resin is at least 55 wt.%, preferably
at least 70
wt.%, further preferably 90 wt.%.
PGA may preferably have a weight-average molecular weight in a range of 10,000
- 600,000 Daltons according to GPC measurement using hexafluoroisopropanol
solvent.
Weight-average molecular weights of 150,000 - 300,000 Daltons are further
preferred.
According to the invention the terms `culture' or `fermentation' are used
interchangeably to denote the growth of bacteria on an appropriate growth
medium
containing a carbon source.
The sentence "recovering the polymerised glycolic acid from the culture
medium"
designates the action of recovering PGA such as well known by the man skilled
in the art.
In particular, after the producing cells are collected by centrifugation and
freeze-dried,
polymer substance accumulated in the strains is recovered using solvents such
as
HexaFluorolsoPropanol (HFIP), TetraHydroFurane (THF), DiMethylSulfOxyde or
Chlororforme (Lageveen et al., 1988; Amara et al., 2002). PGA is extracted
from
lyophilized cells using one of the solvents mentioned above, most
preferentially using
HFIP solvent and subsequently precipitated in ethanol or methanol. The
precipitate is
obtained by centrifugation, dissolved in chloroform and precipitated again in
order to
highly purified PGA. Polymers are further analyzed by NMR.
The term "microorganism" designates a bacterium, yeast or fungus.
Preferentially,
the microorganism is selected among Enterobacteriaceae, Bacillaceae,
Streptomycetaceae
and Corynebacteriaceae. More preferentially, the microorganism is a species of
Escherichia, Klebsiella, Pantoea, Salmonella or Corynebacterium. Even more
preferentially, the microorganism is Escherichia coli.
The term `carbon source' according to the present invention denotes any source
of
carbon that can be used by those skilled in the art to support the normal
growth of a
microorganism, which can be hexoses (such as glucose, galactose or lactose),
pentoses,
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
7
monosaccharides, disaccharides (such as sucrose, cellobiose or maltose),
oligosaccharides,
molasses, starch or its derivatives, hemicelluloses, glycerol and combinations
thereof. An
especially preferred simple carbon source is glucose. Another preferred simple
carbon
source is sucrose.
The term "an enzyme transforming the glycolic acid into glycolyl-CoA"
designates
an enzyme able to activate glycolic acid molecules into glycolyl-CoA,
substrate for the
PHA synthase in the polymerization process.
According to a first aspect of the invention, the glycolic acid is produced by
the
same microorganism expressing genes encoding a PHA synthase and at least one
enzyme
transforming the glycolic acid into glycolyl-CoA. Microorganisms producing
high level of
glycolic acid by fermentation from a renewable source of carbon have been
previously
described; see in particular WO 2007/140816 and WO 2007/141316.
It would be also advantageous to reduce the exportation of glycolic acid from
this
glycolic acid producing microorganism. The man skilled in the art knows
numerous means
to obtain such reduction of transport of a specific metabolite, in particular
reducing or
inhibiting the activity and/or the expression of a transport protein, able to
export glycolic
acid from the microorganism to the medium.
According to a second aspect of the invention, the glycolic acid is provided
to the
microorganism exogenously in the culture medium.
In particular, an amount of at least 2 grams/Liter of glycolic acid is added
in the
culture medium, preferentially at least IOg/L. The man skilled in the art will
adjust the
dose in a way to avoid the toxicity of high concentrations of glycolic acid,
such as 30g/L.
As described previously, the exportation of glycolic acid may be reduced or
even totally
prevented in the microorganism according to the invention. It would be also
advantageous
to improve the import of glycolic acid present in the culture media. The man
skilled in the
art knows numerous means to obtain such improvement of transport of a specific
metabolite, in particular increasing the activity and/or the expression of a
permease protein,
able to import glycolic acid from the the medium to the microorganism. In
particular, it
would be advantageous to overexpress the genes glcA, lldP and yjcG encoding
glycolate
importers (Nunez, F. et at., 2001 Microbiology, 147, 1069-1077; Nunez, F. et
at., 2002
Biochem. And Biophysical research communications 290, 824-829; Gimenez, R. et
at.,
2003 J. ofBacteriol. 185, 21, 6448-6455).
In a preferred aspect of the invention, the enzyme transforming the glycolic
acid
into glycolyl-CoA is chosen among :
- acyl-CoA synthetases or acyl-CoA transferases,
- phosphotransbutyrylase associated to butyrate kinase.
Acyl-CoA transferases found in anaerobic bacteria are known to catalyze the
formation of
short- to medium-chain-length CoA-thioesters (Mack, M. and Buckel, W., 1997).
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
8
In a first aspect of the invention, the enzyme transforming the glycolic acid
into
glycolyl-CoA is chosen among genes belonging to Enterobacteriaceae species and
most
preferred is:
- a propionyl coenzyme A synthetase from Escherichia coli or Salmonella
Thyphimurium encoded by the gene prpE; or
- the acetyl-CoA transferase from E. coli encoded by the gene acs.
In a second embodiment of the invention, the phophotransbutyrylase is encoded
by
the gene ptb and the butyrate kinase is encoded by the gene buk.
The terms "encoding" or "coding" refer to the process by which a
polynucleotide,
through the mechanisms of transcription and translation, produces an amino-
acid sequence.
This process is allowed by the genetic code, which is the relation between the
sequence of
bases in DNA and the sequence of amino-acids in proteins. One major feature of
the
genetic code is to be degenerate, meaning that one amino-acid can be coded by
more than
one triplet of bases (one "codon"). The direct consequence is that the same
amino-acid
sequence can be encoded by different polynucleotides. It is well known from
the man
skilled in the art that the use of codons can vary according to the organisms.
Among the
codons coding for the same amino-acid, some can be used preferentially by a
given
microorganism. It can thus be of interest to design a polynucleotide adapted
to the codon
usage of a particular microorganism in order to optimize the expression of the
corresponding protein in this organism.
In the description of the present invention, genes and proteins are identified
using
the denominations of the corresponding genes in E. coli. However, and unless
specified
otherwise, use of these denominations has a more general meaning according to
the
invention and covers all the corresponding genes and proteins in other
organisms, more
particularly microorganisms.
PFAM (protein families database of alignments and hidden Markov models;
http://www.sanger.ac.uk/Software/Pfam/) represents a large collection of
protein sequence
alignments. Each PFAM makes it possible to visualize multiple alignments, see
protein
domains, evaluate distribution among organisms, gain access to other
databases, and
visualize known protein structures.
COGs (clusters of orthologous groups of proteins;
http://www.ncbi.nlm.nih.gov/COG/ are obtained by comparing protein sequences
from 66
fully sequenced genomes representing 30 major phylogenic lines. Each COG is
defined
from at least three lines, which permits the identification of former
conserved domains.
The means of identifying homologous sequences and their percentage homologies
are well known to those skilled in the art, and include in particular the
BLAST programs,
which can be used from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the
default
parameters indicated on that website. The sequences obtained can then be
exploited (e.g.,
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
9
aligned) using, for example, the programs CLUSTALW
(http://www.ebi.ac.uk/clustalw/)
or MULTALIN (http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pll),
with the
default parameters indicated on those websites.
Using the references given in GenBank for known genes, those skilled in the
art are
able to determine the equivalent genes in other organisms, bacterial strains,
yeasts, fungi,
mammals, plants, etc. This routine work is advantageously done using consensus
sequences that can be determined by carrying out sequence alignments with
genes derived
from other microorganisms, and designing degenerate probes to clone the
corresponding
gene in another organism. These routine methods of molecular biology are well
known to
those skilled in the art, and are claimed, for example, in Sambrook et at.
(1989 Molecular
Cloning: a Laboratory Manual. 2"d ed. Cold Spring Harbor Lab., Cold Spring
Harbor, New
York.).
The present invention is also related to an expression cassette comprising a
polynucleotide encoding an enzyme transforming the glycolic acid into glycolyl-
CoA
under the control of regulatory elements functional in a host microorganism.
The term "expression" refers to the transcription and translation of a gene
sequence
leading to the generation of the corresponding protein, product of the gene.
In a preferred aspect of the invention, the gene(s) encoding for the enzyme(s)
transforming the glycolic acid into glycolyl-CoA is(are) overexpressed into
the
microorganism.
The terms "increased expression" "enhanced expression" or "overexpression" are
used interchangeably in the text and have similar meaning, i.e. that the
transcription and
translation of the gene is increased compared to a non-recombinant
microorgansim, leading
to an increased amount of enzyme into the cell.
To increase the expression of a gene, the expert in the field knows different
ways to
manipulate genes expression. In particular, the gene may be expressed using
promoters
with different strength, which may be inducible. These promoters may be
homologous or
heterologous. The man skilled in the art knows which promoters are the most
convenient,
for example, promoters Ptrc, Ptac, Plac or the lambda promoter cI are widely
used.
In an embodiment of the invention, the gene(s) may be expressed by a plasmid
or
vector introduced into the microorganism. Said microorganism is then said a
"host
microorganism", referring to a microorganism able to receive foreign or
heterologous
genes or extra copies of its own genes and able to express those genes to
produce an active
protein product.
The term "transformation" refers to the introduction of new genes or extra
copies of
existing genes into a host organism. As an example, in E. coli, a method for
transferring
DNA into a host organism is electroporation.
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
The term "transformation vector" refers to any vehicle used to introduce a
polynucleotide in a host organism. Such vehicle can be for example a plasmid,
a phage or
other elements known from the expert in the art according to the organism
used. The
transformation vector usually contains in addition to the polynucleotide or
the expression
5 cassette other elements to facilitate the transformation of a particular
host cell. An
expression vector comprises an expression cassette allowing the suitable
expression of the
gene borne by the cassette and additional elements allowing the replication of
the vector
into the host organism. An expression vector can be present at a single copy
in the host
organism or at multiple copies. The man skilled in the art knows different
types of
10 plasmids that differ with respect to their origin of replication and thus
their copy number in
the cell. They may be present as 1-5 copies, about 20 or up to 500 copies,
corresponding to
low copy number plasmids with tight replication (pSC101, RK2), low copy number
plasmids (pACYC, pRSF1010) or high copy number plasmids (pSK bluescript II).
The present invention provides a transformation vector comprising a gene
encoding
for an enzyme transforming the glycolic acid into glycolyl-coA.
In another embodiment of the invention, said gene(s) may be integrated into
the
chromosome of the microorganism. There may be one or several copies of the
gene that
can be introduced into the genome of an organism, by methods of recombination
well
known by the man skilled in the art.
Another mean to obtain an overexpression of the genes is to modify the
expression
or regulation of the elements stabilizing the corresponding messenger RNA
(Carrier et at.
Biotechnol Bioeng. 59:666-72, 1998) if translation of the mRNA is optimized,
then the
amount of available enzyme is increased.
The recombinant microorganism used in the invention also expresses a gene
encoding for a polyhydroxyalkanoate synthase. Four major classes of PHA can be
distinguished (Rhem, B., 2003). Class I and Class II PHA synthases comprise
enzymes
consisting of only one type of subunit (PhaC). According to their in vivo and
in vitro
specificity, class I PHA synthases (e.g. in Ralstonia eutropha) preferentially
utilize CoA-
thioester of various hydroxy fatty acids comprising 3 to 5 carbons atoms,
whereas class II
PHA synthases (e.g. in Pseudomonas aeruginosa) preferentially utilize CoA-
thioester of
various hydroxy fatty acids comprising 6 to 14 carbon atoms. Class III
synthases (e.g. in
Allochromatium vinosum) comprises enzymes consisting of two different types of
subunits:
the PhaC and the PhaE subunits. These PHA synthases prefer CoA-thioesters of
hydroxy
fatty acids comprising 3 to 5 carbons atoms. Class IV PHA synthases (e.g. in
Bacillus
megaterium) resemble the class III PHA synthases, but PhaE is replaced by
PhaR.
In a specific embodiment of the invention, the gene encoding the heterologous
PHA
synthase is chosen among phaC, phaEC or phaCR, preferentially among phaC and
phaEC
and most preferentially the gene selected is phaC encoding an enzyme of Class
I PHA
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
11
synthases. As previously exposed, use of these denominations `phaC', `phaEC'
and
`phaCR' cover all the corresponding genes and proteins in other organisms,
more
particularly microorganisms. Indeed, using the references given in GenBank for
known
genes, those skilled in the art are able to determine the equivalent genes in
other
organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. This
routine work is
advantageously done using consensus sequences that can be determined by
carrying out
sequence alignments with genes derived from other microorganisms, and
designing
degenerate probes to clone the corresponding gene in another organism. All
equivalent
genes are incorporated herein by reference.
Preferentially, said gene encoding a heterologous PHA synthase is
overexpressed.
As previously described, the overexpression of a gene may be obtained by
different ways
known by the man skilled in the art; the gene may be expressed by an
expression vector
introduced into the microorganism, or be integrated into the chromosome of
said
microorganism.
In a preferred embodiment of the invention, the recombinant microorganism used
in
the method also expresses a PhaR/PhaP regulatory system, particularly the
microorganism
expresses genes phaP and phaR from W. eutropha encoding respectively for a
phasin and
its transcriptional expression regulator. The phasin protein, PhaP is likely
to be involved in
maintenance of the optimal intracellular environment of PHA synthesis and
provides
guidance during the process of granule formation (Wieczorek, R. et at. 1995).
The PhaR
homologs have been investigated both in vitro and in vivo (Wieczorek R. et at.
1995 and
York G.M. et at. 2002) and is proposed to function as a regulator of the phaP
transcription.
Use of these denominations `phaP' and `phaR' cover all the corresponding genes
and proteins in other microorganisms.
The invention is also relative to a polymerised glycolic acid (PGA) obtained
by the
method according to the invention.
The main advantage of the invention is to produce PGA in an easier and cheaper
way than the chemical one that necessitates the use of glycolide, a compound
difficult to
produce from glycolic acid.
The invention is also relative to a microorganism expressing genes encoding
for a
heterologous PHA synthase and at least one enzyme transforming the glycolic
acid into
glycolyl-CoA.
Preferentially, said microorganism is an Enterobacteriaceae, more
preferentially an
Escherichia coli.
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
12
EXAMPLES
Gene Name Sequence Objective
prpE F SEQ ID NO 1 tcta2a22atccaagttcaacaggagagcattatg overexpression
prpE R SEQ ID NO 2 ggatcc2cta2cccta=tacgtactactcttccatcgcctggc overexpression
prpEst F SEQ ID NO 3 cgatttaattaatctagaggcgtaagttctaaggaggtatattatgtc
overexpression
ttttagcgaattttatcagcg
prpEst R SEQ ID NO 4 tacgcctagggctagcctattcttcgatcgcctggcg overexpression
acs F SEQ ID NO 5 tcta2aa2atctcctacaaggagaacaaaagcatg overexpression
acs R SEQ ID NO 6 #gatct2ctagccctAgg actattacgatggcatcgcgatag overexpression
Table 1: sequences of the oligonucleotides used in the constructions described
below.
PtrcOl promoter with operator and RBS sequence SEQ ID N 7:
gagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaattTACGTAtaaggaggtat
att
In capital letter: restriction site SnaBI.
EXAMPLE 1
Construction of Recombinant Vectors Containing a Gene Encoding acyl-CoA
synthetase
Construction of pSCB-acs, pSCB-prpE and pSCB-prpEst
Two proteins are used to transform glycolic acid in glycolyl-CoA, either a
propionyl-CoA synthetase encodes by prpE (from E.coli or from S.thyphimurium)
or an
acetyl-CoA synthetase encodes by acs. Each gene is co-expressed in the cell
with the gene
phaCl from Ralstonia eutropha encoding the PHA synthase.
To amplify acs and prpE genes, PCR are carried out using chromosomal DNA of
Escherichia coli as template and the above primers (cf. table 1), named asc F
and acs R for
acs amplification and prpE F and prpE R for prpE amplification.
The PCR fragment of acs is cloned into the vector pSCB (Stratagene Blunt PCR
Cloning
Kit CAT 240207-5) resulting in plasmid pSCB-acs.
The PCR fragment of prpE is cloned into the vector pSCB resulting in plasmid
pSCB-prpE.
To amplify the gene prpE from Salmonella enterica thyphimurium, a PCR is
carried out using plasmid pPRP45 (from Alexander R Horswill, Jorge C Escalante-
Semerena
"Characterization of the Propionyl-CoA Synthetase (PrpE) Enzyme of Salmonella
enterica: Residue Lys592 Is Required for Propionyl-AMP Synthesis") as template
and the
above primers (cf. table 1), named prpEst F and prpEst R for prpEst
amplification.
The PCR fragment of prpEst is cloned into the vector pSCB (Stratagene Blunt
PCR
Cloning Kit CAT 240207-5) resulting in plasmid pSCB-prpEst.
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
13
EXAMPLE 2
Construction of Recombinant Vectors Containing Genes Encoding PHA synthase and
acyl-CoA synthetase
Construction of pMK-Ptrc01/OP01/RBS01 phaClre-TT02
The plasmid carrying the gene phaCl from Ralstonia eutropha is provided by a
company that synthesized the gene with an optimized sequence to get the best
transcription
rate in E.coli.
The relative frequency of codon use varies widely depending on the organism
and
organelle. Many design programs for synthetic protein coding sequences allow
the choice
of organism. The codon usage database has codon usage statistics for many
common and
sequenced organisms like E.coli.
The synthetic gene phaCi encoding the PHA synthase is provided ready to use by
the company. The gene is cloned under a PtrcOl promoter with operator and RBS
sequences (SEQ N l) located upstream the gene, and a terminator sequence
located
downstream phaClre, leading to the plasmid pMK-PtrcOl/OPO1/RBSOl phaCl re-
TT02.
Construction of pUC19-Ptrc0l/OP01/RBS01 phaClre-TT02 and pBBR1MCS5-
PtrcO1/OP01/RBS01phaClre-TT02
Plasmid pMK-PtrcOl/OPO1/RBSOl phaClre-TT02 is digested with HindIII and
BamHI and the resulting DNA fragment comprising PtrcOl/OPOl/RBSOl phaClre-TT02
is cloned into the vector pBBR1MCS5 cut by the same restriction enzymes. The
resulting
plasmid is named pBBR1MCS5-Ptrc0l/OPO1/RBSOl phaClre-TT02.
Plasmid pMK-PtrcOl/OPO1/RBSOl phaClre-TT02 is digested with HindIII and
BamHI and the resulting DNA fragment comprising PtrcOl/OPOl/RBSOl phaClre-TT02
is cloned into the vector pUC19 cut by the same restriction enzymes. The
resulting plasmid
is named pUC19-Ptrc0l/OPO1/RBSOl phaClre-TT02.
Construction of pMK-Ptrc01/OP01IRBS01 phaClre-acs-TT02, pMK-
PtrcOl/OP01/RBS01phaClre prpE-TT02
Plasmids pSCB-acs and pSCB-prpE are digested with Xbal and Mel and the
resulting DNA fragments comprising either acs or prpE are cloned into the
vector pMK-
PtrcOl/OPO1/RBSOl phaClre-TT02 cut by the same restriction enzymes. The
resulting
plasmids are named pMK-PtrcOl/OP01/RBSOl phaClre-acs-TT02 and pMK-
Ptrc01/OPO1/RBSOl phaClre prpE-TT02.
Construction of pBBR1MCS5-Ptrc01/OP01IRBS01 phaClre prpEst-TT02 and
pUC19-Ptrc01/OP01IRBS01 phaClre prpEst-TT02
Plasmid pSCB-prpEst is digested with PacI and Mel and the resulting DNA
fragment comprising prpEst is cloned into the vector pBBR1MCS5-
PtrcOl/OPO1/RBSO1-
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
14
phaCl re-TT02 cut by the same restriction enzymes. The resulting plasmid is
named
pBBR1MCS5-Ptrc0l/OPO1/RBSOl phaClre prpEst-TT02.
Plasmid pSCB-prpEst is digested with PacI and Nhel and the resulting DNA
fragment comprising prpEst is cloned into the vector pUC19-PtrcOl/OPO1/RBSO1-
phaCl re-TT02 cut by the same restriction enzymes. The resulting plasmid is
named
pUC19-PtrcOl/OP01/RBSO1 phaClreprpEst-TT02.
EXAMPLE 3
Construction of Recombinant E. coli Strains Producing PGA when Cultivated in
Presence of Glycolate and Preparation of Polyglycolate Polymer
Vector pMK-PtrcOl/OPO1/RBSOl phaClre-acs-TT02 and pMK-
PtrcOl/OP01/RBSO1 phaClreprpE-TT02 are introduced by electroporation into an
E.coli
MG1655 wild-type strain, leading to strains MG1655 (pMK-PtrcOl/OP01/RBS01-
phaClre-acs-TT02) and MG1655 (pMK-PtrcOl/OPO 1/RBSO1phaClreprpE-TTO2)
respectively.
Vector pBBRMCS5-PtrcOl/OP01/RBSO1 phaClreprpEst-TT02 and pUC19-
PtrcOl/OP01/RBSO1 phaClreprpEst-TT02 are introduced by electroporation into an
E.coli MG1655 wild-type strain, leading to strains MG1655 (pBBRMCS5-
Ptrc01/OPO1/RBSOl phaClre-acs-TT02) and MG1655 (pUC19-Ptrc01/OP01/RBS01-
phaCl re prpE-TT 02) respectively.
The resulting strains (FIG. 2) are cultured in LB or MM media containing
around 5
g/L of glycolate (details of conditions in following exemples), followed by
centrifugation
to recover the strains. The recovered strains are freeze-dried to recover
polymer substance
accumulated in the cells using solvents as hexafluoroisopropanol or
chloroform. To
confirm that the obtained polymer is polyglycolate, NMR analyses are done on
the
recovered polymer substance.
Construction of Recombinant E. coli Strains Producing PGA when Cultivated on
Glucose Only and Preparation of Polyglycolate Polymer
The strains genetically engineered to produce glycolic acid from glucose as a
carbon source are disclosed in patents WO 2007/141316 A, WO 2007/140816 A, US
61/162,712 and EP 09155971, 6. The strains are used herein for introduction of
plasmids
allowing production of PGA from glucose only.
Vector pMK-Ptrc0l/OPO1/RBSO1 phaClreprpE-TT02 and pMK-
PtrcOl/OP01/RBSOlphaClre-acs-TT02 are introduced by electroporation into an
E.coli
strain genetically modified to produce glycolic acid.
Vector pBBRMCS5-PtrcOl/OP01/RBSO1 phaClreprpEst-TT02 and pUC19-
PtrcOl/OP01/RBSO1 phaClreprpEst-TT02 are introduced by electroporation into an
E.coli strain genetically modified to produce glycolic acid.
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
EXAMPLE 4
Fermentation of a Strain producing POLYglycolic acid polymer from glucose in
Erlenmeyer flasks
5 The production of PGA by fermentation was done with the strain AG 1122
having
the following genotype (MG1655 Ptrc50/RBSB/TTG-icd::Cm AaceB Agcl AglcDEFGB
AaldA AiciR Aedd+eda ApoxB AackA+pta (pME101 ycdW-TT07-PaceA-aceA-TTO1)
(pMK-PtrcOl/OP01/RBSOl phaClre prpE-TT02) )
The production of PGA in intracellular was done in 500m1 baffled Erlenmeyer
flask
10 (this example) and in batch fermentor (Example 5).
The strain AG 1122 was grown in 500 ml baffled Erlenmeyer flask cultures using
LB broth (Bertani, 1951, J. Bacteriol. 62:293-300) or a modified M9 medium
(Anderson,
1946, Proc. Natl. Acad. Sci. USA 32:120-128) supplemented with 12.5 g/1
glucose itself
containing 5 g/1 MOPS and 5g/L of glucose. The pH of the medium was then
adjusted to
15 pH6.8. The antibiotics Spectinomycin and kanamycin were added to a final
concentration
of 50 mg/l. An overnight preculture was used to inoculate a 50m1 culture to an
OD600 nm of
0.3. The cultures were kept on a shaker at 37 C and 200rpm until the glucose
in the culture
medium was exhausted. Polyglycolic acid production was followed by microscopic
observations with an optical microscope of Avantec 3804921.
A picture of the cells after several hours of growth is presented on figure 1.
The
white zones in the cells correspond to granules of polymer.
EXAMPLE 5
Fermentation of a strain producing POL Yglycolic acid polymer from glucose in
batch
fermentor
The production of PGA by the strain AG1122 (MG1655 Ptrc50/RBSB/TTG-
icd::Cm AaceB Agcl AglcDEFGB AaldA AiclR Aedd+eda ApoxB AackA+pta (pMElOl-
ycdW-TT07-PaceA-aceA-TTOl) (pMK-PtrcOl/OPO 1/RBSO1phaClreprpE-TTO2) ) was
assessed in production conditions in a 600 ml fermentor using a fed batch
protocol.
A unique preculture was carried out in 21 Erlenmeyer flask filled with 200 ml
of LB
broth (Bertani, 1951, J. Bacteriol. 62:293-300) that was supplemented with
12.5 g/1
glucose at 37 C during 24 hours. This preculture was used for inoculation of
the fermentor.
The fermentor filled with 400 ml of LB broth supplemented with 20 g/1 of
glucose
and 50 mg/l of spectinomycin and kanamycin was inoculated at an initial
optical density of
1.5. The culture was carried out at 37 C with agitation and aeration adjusted
to maintain
the dissolved oxygen above 30% saturation. The pH was adjusted at 6.8 with
addition of
base. The culture was carried out in a batch mode for 24 hours or until
OD600nm > 10.
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
16
Polyglycolic acid polymer production was followed by microscopic observations.
A
picture of the strain under microscope is presented on figure 2.
The final titer of glycolic acid obtained in that culture was 1.5 g/1
(supernatant
analyzed by HPLC using a Biorad HPX 97H column for the separation and a
refractometer
for the detection).
The same fermentation was done in modified M9 medium supplemented with
glucose. The production was slower than in the LB broth.
EXAMPLE 6
Fermentation of a strain producing POLYglycolic acid polymer by bioconversion
of
glycolic acid in Erlenmeyer flasks
The bioconversion of glycolic acid into PGA was performed with the strain
AG1327 (MG1655 (pUC19-PtrcOl/OP01/RBSOl phaClre prpEst-TT02))
The bioconversion by AG1327 was assessed in 500 ml baffled Erlenmeyer flask
cultures using modified M9 medium that was supplemented with 5 g/1 MOPS, 5 g/1
glucose and 5g/L glycolic acid and adjusted at pH 6.8. A supply of LB broth at
10% v/v
was also added in order to enhance biomass growth. Ampicillin or carbenicillin
was added
at a concentration of 100 mg/l. An overnight preculture was used to inoculate
a 50 ml
culture to an OD600 nm of 0.3. The cultures were kept on a shaker at 30 C and
200 rpm and
polymer production was followed by microscopic observations.
At the end of the culture, glucose and glycolic acid were analyzed by HPLC
using a
Biorad HPX 97H column for the separation and a refractometer for the
detection.
Granules of polymers were observed in presence of glycolic acid and not in the
control culture, without addition of glycolic acid (figure 3).
Although the present invention has been described in detail with reference to
the
specific features, it will be apparent to those skilled in the art that this
description is only
for a preferred embodiment and does not limit the scope of the present
invention. Thus, the
substantial scope of the present invention will be defined by appended claims
and
equivalents thereof.
EXAMPLE 7
Conversion of glycolic acid into glycolyl-CoA by the Propionyl-CoA synthetase
from
Salmonella typhimurium
Construction of the Recombinant BL21 (DE3) (pLysS) (pPAL-prpEst) strain
To amplify the gene prpE from Salmonella enterica thyphimurium, a PCR is
carried out
using plasmid pPRP45 as template and the primers named pPAL-prpEst R and pPAL-
prpEst F
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
17
pPAL-prpEst R (SEQ ID NO 8)
CGAATTCCTATTCTTCGATCGCCTGGCG
pPAL-prpEst F (SEQ ID NO 9)
CCCAAGCTTTGATGTCTTTTAGCGAATTTTATCAGCG
PCR product is digested with HindIII and EcoRI and cloned into the vector
pPAL7
(Profanity eXact pPAL7 Vector Biorad) cut by the same restriction enzymes. The
resulting
plasmid is named pPAL-prpEst.
Vector pPAL-prpEst is introduced into E.coli BL21 (DE3) (pLysS) chemically
competent
cells, leading to strain BL21 (DE3) (pLysS) (pPAL-prpEst) named AG1354.
Overproduction of the Propionyl-CoA synthetase, PrpEst
The overproduction of the protein PrpEst is done in a 2L Erlenmeyer flask.
A unique preculture is carried out in 500mL Erlenmeyer flask filled with 50 ml
of LB
broth (Bertani, 1951, J. Bacteriol. 62:293-300) that is supplemented with 5
g/1 glucose, 100
ppm of ampicilline and lg/L MgS04. The preculture is cultivated at 37 C, 200
rpm until
OD600=0.5 and then used for inoculation of the 2L flask filled with 500mL of
LB
supplemented with 5 g/1 glucose, 100 ppm of ampicilline and lg/L MgS04. The
culture is
first carried out at 37 C and 200 rpm until OD600 is 0.6 - 0.8, and in a
second step moved at
C before the induction with 500 M IPTG. The culture is stopped when the OD600
is
20 around 4. Cells are centrifuged at 7000 rpm, 10 minutes at 4 C, and then
washed with
phosphate buffer before to be stored at -20 C.
Purification of the protein PrpEst
The cells (45 mg) are lysed by sonication and cell debris are removed by
centrifugation at
25 12000g (4 C) for 30 man. The protein is purified from the crude cell-
extract by affinity on
a Profinity column (BIORAD, Bio-Scale Mini Profinity exact cartridge)
according to the
protocol recommended by the manufacturer. The Tag is removed from the protein
by
cleavage with 100 mM fluoride at room temperature for 30 min. The elution
buffer is
exchanged by dialysis against a solution composed of 100 MM potassium
phosphate, 150
mM NaCl and 10% glycerol.
The Bradford protein assay is used to measure protein concentration (i.e. 0.23
g/ L for
45mg of dried weight).
Detection of glycolyl-CoA by LC-MS
The activity of PrpE on glycolate is measured by LC-MS (Applied/DIONEX), by
detection
of the resulting molecule, the glycolyl-CoA (chemical features on scheme 1).
The reaction
mixture (250 L) contains 75 mM of potassium phosphate buffer (pH 7, 5), 1.5
mM ATP,
0.75 mM CoA and either 10 to 40 gg of crude cell-extract or 9 gg of purified
protein.
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
18
Reaction mixtures were started with different concentrations of glycolate (20,
40 and 100
mM). Samples were incubated at 37 C for 30 min before to be injected on the LC-
MS
machine (25 gL or 75 gL of the reaction were loaded). Three reaction mixtures
were
prepared as controls; 1) without CoA, 2) without enzyme or 3) without
glycolate.
The results are showed on Figure 7 or 8.
Figure 7 : reaction done with l00mM of glycolate and 40 g of crude cell-
extracts
of the strain AG1354 overproducing the protein PrepEst.
Figure 8 : reaction done with 40mM of glycolate and 9 g of the purified
protein.
In each case, only one pick is detected with a mass of 825 (Mass-1=824.0)
corresponding to the glycolyl-CoA.
NH2
HO O 0 O O N N
0,\\,0,\\,0
N N 0 P P N N
H H I 1 0
OH OH OH
0 OH
O ;P-OH
HO
Molecular Weight =825,58
Exact Mass =825
Molecular Formula =C23H38N7018P3S
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
19
REFERENCES
U.S. PATENT DOCUMENTS
2,772,268 A 11/2007 Cho J-H. et at.
6,143,952 A 11/2000 Srienc F. et at.
INTERNATIONAL PATENT DOCUMENTS
WO 2004/038030 A2 05/2004 Martin D. et at.
WO 2007/141316 A 12/2007 Soucaille P.
WO 2007/140816 A 12/2007 Soucaille P.
WO 01/55436 08/2001 Green P. R.
WO 98/54329 12/1998 Witholt B. et al.
WO 99/61624 12/1999 Skraly F. et at.
OTHER PUBLICATIONS
- Williams and Peoples, CHEMTECH 26, 38-44, 1996,
- Langer, R., Drug delivery and targeting. Nature 392, 5-10 (1998),
- Ikada, Y. & Tsuji, H. Macromol. Rapid Commum. 21, 117-132, 2000,
- Athanasiou, K. A. et at. Biomaterials 17, 93-102, 1996,
- Lu, L. & Mikos, A. G. Poly (glycolic acid) in polymer data handbook (ed.
Mark, J. E.)
566-569, Oxford University Press, New York, 1999,
- Sorensen, W. R. & Campbell, T. W. Preparative Methods of Polymer Chemistry
2d
edition, Interscience Publishers Inc, New York, 1963,
- Dechy-Cabaret, O. et at. Chem. Rev. 104, 6147-6176, 2004,
- Hyon, S. -H. et at. Biomaterials, 18, 1503-1508, 1997,
- Lenz R. W. and Marchessault R. H. Biomacromolecules. 6:1-8, 2005
- Lenz R. W. Adv Polym Sci 107:1-40, 1993
- Sudesh K. et al. Progr Polym Sci 25:1503-1555, 2000
- Sudesh K. and Doi Y. Handbook of biodegradable polymers. Rapra technology,
UK, pp
219-256, (Bastioli C. Editions), 2005
- Steinbuchel A. and Fuchtenbusch B. TIBTECH 16:419-427, 1998
- Steinbuchel A. Valentin AE. FEMS Microbiol Lett 1995, 128:219-228
- Steinbuchel A. Biomaterials. Macmillan, New York, pp 123-213, Byrom D.
Editions,
1991
- Timm A. and Steinbuchel A. Appl. Microbiol. Biotechnol. 56:3360-3367, 1990
- Nomura, C. T. & Taguchi, S. Appl Microbiol Biotechnol. 73:969-79, 2007
- Hazer B. & Steinbuchel A. Appl Microbiol Biotechnol. 74:1-12, 2007
CA 02730220 2011-01-07
WO 2010/004032 PCT/EP2009/058836
- Madison L. and Huisman G. Microbiol and Mol Biol Reviews, 63:21-53, 1999
- Rehm B. Biochem J. 376:15-33, 2003
- Gerngross T. and Martin D. Proc Natl Acad Sci U S A. 92:6279-83, 1995
- Qi et at. FEMS Microbiol. Lett., 157:155, 1997
5 - Qi et at. FEMS Microbiol. Lett., 167:89, 1998
- Langenbach et at. FEMS Microbiol. Lett., 150:303, 1997
- Amara A. et at. Appl Microbiol Biotechnol. 59:477-82, 2002
- Fukui et at. J. Bacteriol. 180:667, 1998
- Tsage et at. FEMS Microbiol. Lett. 184:193, 2000
10 - Taguchi et at. FEMS Microbiol. Lett. 176:183, 1999
- Ren et aL, J. Bacteriol. 182:2978, 2000
- Park et al, FEMS Microbiol. Lett. 214:217, 2002
- Zhan et aL Appl. Microbiol. Biotechnol. 56:131, 2001
- Valentin and Steinbuchel, Appl. Microbiol. Biotechnol. 40:699, 1994
15 - Yuan et aL, Arch. Biochem. Biophysics. 394:87, 2001
- Valentin et at. Appl Environ Microbiol. 66:5253-8, 2000
- Lin H. et at. Appl Microbiol Biotechnol. 71:870-4, 2006
- Mack, M. and Buckel, W. FEES Lett. 405:209-12, 1997
- Sambrook et al. Molecular Cloning: a Laboratory Manual. 2"d ed. Cold Spring
Harbor
20 Lab., Cold Spring Harbor, New York. 1989
- Carrier et at. Biotechnol Bioeng. 59:666-72, 1998
- Wieczorek R. et at. J. Bacteriol. 177: 2425-2435, 1995
- York G.M. et at. J. Bacteriol. 184: 59-66, 2002
