Note: Descriptions are shown in the official language in which they were submitted.
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
LUNG TISSUE MODEL
FIELD OF TIIE INVENTION
The present invention provides for an engineered three dimensional pulmonary
model tissue culture which is free of
any artificial scaffold. Three dimensional models of healthy lung tissue as
well as disease tissues are available. The
product according to the invention can be marketed e.g. in the form of tissue
cultures, plates or arrays comprising
such cultures or kits. The invention is applicable in medical and scientific
research, for testing compounds for their
effect on lung tissue, for screening, testing and/or evaluating drugs, and in
certain cases in diagnostics of lung
diseases.
BACKGROUND ART
Tissue engineering is a rapidly developing field of biomedical research that
aims to repair, replace or regenerate
damaged tissues. Due to the latest events of disastrous phase 11 clinical drug
trials (e.g. TON1412), further goals of
tissue engineering include generation of human tissue models for safety and
efficacy testing of pharmaceutical
compounds. Tissue engineering in general and our model in particular exploits
biological morphogenesis, which is
an example of self-assembly.
Cell and tissue engineering is pursued nowadays from several perspectives. In
one aspect, it is used to gain deeper
insight into cell biology and physiology.
Two main directions are being developed in tissue engineering research: tissue
scaffold based and tissue scaffold
free systems. While scaffold based systems use mostly biodegradable scaffold
material to provide an artificial 3D
structure to facilitate cellular interactions, a scaffold free system allows
direct cell to cell interactions, and allows
cells to grow on their secreted scaffold material in the model.
In US 2001/0055804 Al (õThree dimensional in vitro model of human
preneoplastic breast disease") discloses a
three dimensional in vitro cell culture system useful as a model of a
preneoplastic breast disease for screening drugs.
Said model is prepared by co-culturing preneoplastic epithelial cells of
breast origin, endothelial cells and breast
fibroblasts on a reconstituted base membrane in a medium comprising further
additives like growth factors,
estrogens etc. Thus, in this solution a base membrane, preferably Matrigelt is
used as a tissue scaffold. According
to the description a network of branching ductal alveolar units vasculature is
formed within about 3-7 days in this
system.
The system relates to breast and not lung and there is no suggestion to make a
lung culture by that method.
In US 2003/0109920 (õEngineered animal tissue") microvascular endothelial
cells were obtained from adult lung
and placed between two layers of human dermal fibroblasts present in a three
dimensional collagen gel. Thus, a
sandwich structure was formed.
Though the vascular endothelial cells were obtained from human bmg, the
artificial tissue prepared by this method
was similar to -human skin, therefore, it can not be actually considered as a
pulmonary tissue model.
In US 2008/0112890 (õFetal pulmonary cells and uses thereof') a 3D tissue-like
preparation is taught which is based
on fetal mouse epithelial, endothelial and mesenchymal cells. The authors used
mouse embryonic lung cells to the
preparation in order to obtain lung prosthesis and perform screening on the 3D
tissue-like preparation. As a matrix, a
hydrogel, MATRIGELTm was used to establish appropriate cell-cell interactions.
It appears from the description that
a fibroblast overgrowth was experienced upon coculturing epithelial cells and
fibroblasts.
W02008/100555 (,Engineered lung tissue construction for high throughput
toxicity screening and drug discovery")
1
CA 2760768 2017-06-20
relates to a lung tissue model preparation comprising fetal pulmonary cells
and a tissue scaffold made of a
biocompatible material and preferably a fibroblast growth factor. Fetal
pulmonary cells comprise epithelial,
endothelial and mesenchymal cells. A number of applicable biocompatible
materials are listed.
W02004/046322 ("Replication of biological tissue") preparation of an
artificial 3-D tissue is proposed under
microgravity environment. The tissue is based on human breast cancer cells and
is useful as a breast cancer model.
In a rotating bioreactor chamber at first connective tissue cells are cultured
till the formation of a 3-D spheroid
structure, then sequentially endothelial and epithelial cells are added to the
culture. It is to be noted that the teaching
is theoretical and while protocols are provided to culture the cells and to
handle to cultures, no actual results of the
experiments are disclosed.
.. Vet-trees, RA, Zvvischenberger, JB et al. (2008) used a well documented
normal immortalized lung cell line to grow
as a traditional monolayer (ML) in culture flasks and as 3-D cultures in
rotating walled vessels. Comparison for
presence of differentiation and marker expression between these cultures and
control tissue collected from surgical
patient specimens was studied. The purpose of the authors was to develop both
traditional monolayer and 3-D cell
cultures of a known cell line.
Recently, Kelly BeruBe and her co-workers developed a 3D tissue engineering
model of the human lung epithelium
for safety testing. They used normal human bronchial epithelial cells [NHBE].
Primary cells, obtained from humans,
were grown on a microporous membrane to form a 3-dimensional (3D) cell
culture. The 3D cultures formed tight
junctions between cells, cells with active cilia, and others producing and
secreting mucus. These characteristics
closely resemble those found in the native human respiratory epithelial tissue
and were supposed to accurately
mimic the human responses to tissue damage. The culture in fact forms a thick
layer of cells modeling the mucous
membrane surface [Hughes Tracy et al. 2007].
Despite the extensive literature of lung models, it appears that the prior art
discloses only tissue scaffold based three
dimensional models and no simple, tissue scaffold free lung tissue model,
comprising at least epithelial cells and
fibroblasts, is disclosed in the prior art.
The present Inventors have surprisingly found that by simple biochemical
methods a tissue scaffold free lung tissue
model system can be rapidly created which is in several aspects more favorable
than two dimensional systems or
systems based on a matrix. The present invention provides a model tissue which
is ready for use in various tests. The
model is suitable to study cell-cell interactions in various lung tissues to
mimic normal function and disease
development.
SUMMARY
In one aspect, there is provided an engineered three dimensional pulmonary
model tissue culture, wherein the model
tissue culture
a) is free of an artificial tissue scaffold wherein the artificial tissue
scaffold is a porous three dimensional matrix; a
three dimensional gel matrix or a porous membrane support,
b) is composed of cultured cells, said cultured cells comprising pulmonary
small airways epithelial cells and
pulmonary fibroblasts,
c) has a morphology of one or more cellular aggregate(s), wherein the surface
of the aggregate(s) is enriched in the
2
pulmonary small airways epithelial cells, and
d) wherein the epithelial cells express one or more alveolar type II (ATII)
epithelial differentiation markers, said one
or more ATII epithelial differentiation markers comprising TTF1 transcription
factor, cytokeratin 7 (KRT7),
surfactant protein A (SFTPA), surfactant protein C (SFTPC) or aquaporin 3 (AQP
3).
In another aspect, there is provided a method for the preparation of an
engineered three dimensional pulmonary
model tissue culture, the method comprising:
- preparing a mixed cell suspension comprising pulmonary small airways
epithelial cells and pulmonary fibroblast
cells,
- pelleting the cells of the suspension, and
- incubating the pelleted cells of the suspension in the presence of CO2 to
form a three dimensional pulmonary
model tissue comprising one or more cellular aggregate(s).
In another aspect, there is provided a method for screening a drug for its
effect on lung tissue, the method
comprising:
- providing an engineered three dimensional pulmonary model tissue culture of
the invention,
- taking at least a test sample and a reference sample of the model tissue
culture,
- contacting the test sample with a drug while maintaining the test sample and
the reference sample under the same
conditions, and
- detecting any alteration or modification of the test sample in comparison
with the reference sample,
wherein if any alteration or modification of the test sample is detected it is
considered as an indication of the effect
of the drug.
In another aspect, there is provided an engineered three dimensional pulmonary
model tissue kit comprising a test
plate having an array of containers wherein at least two containers contain:
- samples of one or more types of engineered three dimensional pulmonary model
tissue cultures of the invention,
each sample placed in separate containers of the plate, and
- an appropriate medium for culturing cells of the model tissue cultures.
In other aspects, there is provided various uses of a three dimensional
pulmonary model tissue culture of the
invention, including use for parallel screening of compounds for their effect
on pulmonary tissue; use for patient
specific testing of compounds for their therapeutic potential, provided that
the model tissue culture is obtained from
primary patient pulmonary cells; use for studying cellular interaction in the
pulmonary tissue; and use for studying
genetic changes during pulmonary diseases.
BRIEF DESCRIPTION OF THE INVENTION
The invention provides for an engineered three dimensional pulmonary model
tissue culture, said model tissue
culture
a) being free of any artificial tissue scaffold,
b) being composed of cultured cells or having a cultured cellular material
wherein the cells are in direct cell-cell
interaction with cells of one or more other cell types of the tissue material,
2a
CA 2760768 2018-06-08
CA 2760768 2017-06-20
c) comprising at least pulmonary epithelial and mesenchymal cells, preferably
pulmonary mesenchymal cells,
preferably fibroblasts. Wherein preferably the ratio of the pulmonary
epithelial cells and the mesenchymal cells in
the model tissue is at least 1:6, preferably at least 1:3, and at most 6:1,
preferably at most 3:1,
d) having a morphology of one or more cellular aggregate(s) wherein the
surface of the aggregates is enriched in the
pulmonary epithelial cells, or wherein the pulmonary epithelial cells and the
mesenchymal cells, preferably
fibroblasts are at least partially segregated in said aggregates, and
e) wherein the epithelial cells express epithelial differentiation markers.
2b
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
a) In a preferred embodiment said model tissue culture is free of an
artificial matrix material for providing a three
dimensional environment to the cells. In an embodiment said model tissue
culture is free of any artificial tissue
scaffold material, either biodegradable or non-biodegradable tissue scaffold
material, e.g. a porous three
dimensional matrix; a three dimensional gel matrix. In an embodiment said
model tissue culture is free of or does
.. not comprise a microporous membrane support.
b) hi a preferred embodiment said model tissue culture also comprises an
extracellular matrix, the extracellular
matrix proteins of which are secreted by at least one of the cell types
comprising the tissue, preferably by
fibroblasts.
c) In further preferred embodiments the pulmonary epithelial cells comprise at
least one of the following cell types:
- type I pneumocytes, [alveolar type I cells (ATI)]
- type II pneumocytes, [alveolar type II cells (ATII)].
Preferably, said type TT pneumocytes (alveolar epithelial cells with ATH
characteristics) express one or more of the
following markers: TTF1 transcription factor, surfactant protein A (SFPA),
surfactant protein C (SFPC) and
aquaporin 3 (AQP 3).
Preferably, said type I pncumocytcs (alveolar epithelial cells with ATI
characteristics) express one or more of the
following markers: TTF1 transcription factor, aquaporin 3 (AQP 3), aquaporin 4
(AQP 4) and aquaporin 5 (AQP 5).
In various further embodiments at least one of pulmonary epithelial cells and
pulmonary mesenchymal cells are
present in the model.
Preferably, the cells are amphibian, reptilian, avian or, more preferably
mammalian cells.
Preferred avian cells are poultry pulmonary cells.
Preferred mammalian cells are cells of herbivorous animals, preferably
livestock animals like cells of e.g. sheep,
goat, bovine cells, or rodent cells, e.g. rabbit or marine cells. Further
preferred mammalian cells are those of
omnivorous animals like pig cells. Highly preferred cells are human cells.
In further embodiments the pulmonary epithelial cells and/or the mesenchymal
cells are obtained from
- established cell lines, preferably from commercial sources,
- healthy donors
- patient donors.
In a preferred embodiment the cells are primary cells. In a preferred
embodiment the cells are not de-differentiated
cells or only partially de-differentiated cells.
.. in a further preferred embodiment the cells are de-differentiated cells or
the cells are de-differentiated before
culturing them to 3D model tissue culture.
In a preferred embodiment the pulmonary epithelial cells comprise small
airways epithelial cells, preferably small
airways epithelial cells with ATII characteristics.
In a further preferred embodiment the model tissue culture of the invention
also comprises endothelial cells. In a
preferred embodiment the endothelial cells are HMVEC or HUVEC cells.
Optionally, the model tissue culture of the invention may further comprise
cells of further type selected from
macrophages, mast cells, smooth muscle cells.
d) In a preferred embodiment the average diameter or the typical diameter of
the aggregate is at least 10 Jim, 40 m,
60 gm. 80 pm, 100 gm or 120 gm and the average diameter or typical diameter of
the aggregate is at most 1000 gm,
800 pm, 600 gm, 500 m, 400 pm or 300 1.1m.
Highly advantageously the average diameter or typical diameter of the
aggregate is 100-300 pm, in a preferred
embodiment it is about 200 pm.
3
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
Average size of the aggregates can be assessed and calculated or estimated by
any experimentally and
mathematically correct means. While the aggregates are essentially spherical
in shape, it is evident that diameters for
each aggregate multiple diameters can be determined clue to a deviation from
the exact sphere and depending on the
position of the aggregate during measurement and on the measurement method.
For example, smallest and largest
diameter can be measured directly in the microscope measuring the size of
several aggregates and averaged.
Expediently, a microscope is used for this purpose.
In a preferred embodiment the majority of the aggregates, preferably at least
the 60%, 70%, 80% or 90% of the
aggregates has a diameter of at least 10 gm, 40 gm, 60 gm. 80 gm, 100 gm or
120 gm and a diameter of at most
1000 gm, 800 gm, 600 gm, 500 gm, 400 gm or 300 gm, highly advantageously the
diameter of the above ratio of
the aggregates is 100-300 gm, in a preferred embodiment it is about 200 gm.
In a preferred embodiment, the culture samples in each aggregate or each
container of a kit comprise cells in an
amount of
at least 103, preferably at least 104, more preferably at least 2*104, 3*104,
4*104, 5* l0 cells, and
at most 106, more preferably at most 5* l0, 4* l0, 3*105, 2* l0 or at most 105
cells.
In a preferred embodiment the pulmonary epithelial cells and the fibroblasts
are segregated based on a difference in
their surface tension. Preferably, the majority of the pulmonary epithelial
cells arc located on the surface of the
aggregate.
Preferably, the majority of the pulmonary epithelial cells form a pulmonary
epithelial cell lining on the surface of
the aggregate, preferably said pulmonary epithelial cell lining covering, at
least partly, the surface of the aggregate.
In a further preferred embodiment the aggregates also comprise endothelial
cells.
In a preferred embodiment the ratio of the endothelial cells, in comparison
with the epithelial and fibroblast cells is
higher in the center or central region of the aggregates that in the surface
of the aggregates, or the ratio of the
endothelial cells is increasing from the surface of the aggregates towards the
center of the aggregates.
In a preferred embodiment the aggregates have a layered structure wherein the
core or central region of the
aggregates comprises the maximum ratio of endothelial cells, the intermediate
layer or region of the aggregates
comprises the maximum ratio of fibroblasts and the outer layer or surface
layer of the aggregates comprises the
maximum layer of epithelial cells.
e) In a preferred embodiment the epithelial differentiation markers expressed
by the tissue cells of the engineered
three dimensional pulmonary model tissue are at least one or more markers
selected from the following group:
- ATII type differentiation markers, preferably TTF1 transcription factor,
cytokeratin 7, (KRT7), surfactant protein
A (SFPA), surfactant protein C (SFPC) and aquaporin 3 (AQP 3). and/or markers
- ATI type differentiation markers, preferably aquaporin 4 (AQP 4) and
aquaporin 5 (AQP 5).
The markers expressed also depend on the cell type used in the tissue culture.
The level of any of the markers can be detected at mRNA or a protein level.
Thus, the level of the marker may be
mRNA level and/or protein level.
Preferably, the model tissue culture of the present invention at least one of
the level of AQP3 and SFTPA is
increased, i.e. they are up-reguated in comparison with a control 2D culture.
Preferably, the model tissue culture of the present invention at least one
inflammatory marker selected from IL lb.
IL6 and CXCL8 is down-regulated, i.e. their level is decreased in 3D culture
conditions in comparison with a
control 2D culture.
Preferably, the model tissue culture of the present invention the level of at
least one of de-differentiation markers
SIO0A4 and N-cadherin is decreased in comparison with purified primary cells
in 2D culture conditions or in a
4
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
control 2D tissue culture.
In various further embodiments at least one of pulmonary epithelial cells and
pulmonary mesenchymal cells are
present in the model and, in analogy With embryonic lung development,
- pulmonary epithelial cells secrete one or more fibroblast growth factors
selected from FGF4, FGF8, FGF9.
- pulmonary epithelial cells express on the cell surface FGFR2b receptors.
- pulmonary mesenchymal cells, preferably fibroblasts secrete FGF7 and
FGF10 and expresses FGFR1c and
FGFR2c receptors.
In a preferred embodiment of the tissue culture of the present invention the
ATII type differentiation markers and/or
ATI type differentiation markers are expressed at a level higher, more
preferably at a level of at least 10%, at least
20%, or at least 30% higher than that measured in a two dimensional tissue
culture used as a reference.
Preferably, mRNA level(s) and/or protein level(s) of said epithelial marker(s)
in the model tissue is higher than
one OT more or each of the following reference cultures
- a two dimensional culture of the same cell types,
- a culture of only pulmonary epithelial cells,
- a culture of only primary fibroblast cells, preferably human fibroblast
cells.
Preferably, the level of at least two of said markers is elevated.
In a preferred embodiment small airways epithelial cells are applied.
In a further preferred embodiment small airways epithelial cells showing at
least some ATII type characteristics are
applied. In this case the model tissue shows increased mRNA level(s) and/or
protein level(s) of at least one or more
markers selected from the following group of ATII type differentiation
markers, e.g. those listed above.
The engineered three dimensional pulmonary model tissue of the invention
preferably shows a reduced expression
of one or more pro-inflammatory cytokine and or one or more EMT markers.
Preferably, mRNA level(s) and/or protein level(s) of said on or more pro-
inflammatory cytokine in the model tissue
is lower than one or more or each of the following reference cultures
- a two dimensional culture of the same composition of cells,
- a culture of only pulmonary epithelial cells, wherein said pulmonary
epithelial cells are treated analogously to the
model tissue culture.
Preferably, the pro-inflammatory cytokine(s) are selected from the following
group:
CXCL-8 pro-inflammatory cytokine, IL6, ILla, ILlb, TNFalpha.
Tn a highly preferred embodiment the pro-inflammatory chemolcine is CXCL-8
chemoattractant.
In a preferred embodiment the model tissue culture comprises pulmonary
epithelial cells and pulmonary
mesenchymal cells and does not comprise endothelial cells, wherein
- the level of one or more of the following markers is increased relative
to a control comprising non-cultured cells:
E-cad, IL-lb and/or IL6,
- the level of E-cad is increased relative to a control 2 dimensional culture,
- the level of one or more of the following markers is decreased relative
to a control 2 dimensional culture: IL-lb,
CXCL8, IL6.
In a preferred embodiment the model tissue culture comprises pulmonary
epithelial cells, pulmonary mesenchymal
cells and endothelial cells, wherein
the level of one or more of the following markers is decreased relative to a
control comprising non-cultured cells: E-
cad, N-c ad.
- the level of E-cad is increased relative to a control 2 dimensional
culture,
5
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
- the level of one or more of the following markers is decreased relative
to a control 2 dimensional culture: N-cad,
S100A4.
in a preferred embodiment the three dimensional pulmonary model tissue culture
further comprises cells selected
from the following group:
- endothelial cells, e.g. to mimic vasculature,
macrophages,
mast cells.
At later stages the model can be extended using cell types:
smooth muscle cells,
- nerve cells.
Disease Models
The invention also relates to an engineered three dimensional pulmonary model
tissue culture as defined above
wherein
said epithelial and/or fibroblast cells comprise affected cells having a
pathologic feature of a diseased lung tissue so
.. that said model tissue culture is a pulmonary disease model tissue culture.
In preferred embodiments the disease involves a condition selected from
inflammation, tumor, fibrosis, injury of a
tissue and the model tissue culture is to be considered as an inflammatory
model, a tumor model, a fibrosis model or
a regeneration model, respectively.
Affected cells of the disease model can be but are not limited to cells
obtained from patients (patient cells), cell lines
which have a disease feature, e.g. tumor cell lines; cells exposed to an
environmental effect, e.g. pro-inflammatory
material, causing a disease feature; cells exposed to the effect of a mutagen
and selected for a disease feature; or
genetically modified cells transformed to express a protein or in which a gene
is silenced so as to have a diseased
feature.
In a preferred embodiment the cells are obtained from healthy subjects and
disease state is induced therein. In this
.. embodiment for example signaling of tumor induction or potential drug
targets can be determined.
In an other embodiment tumor model tissue is prepared from immortal cells,
e.g. from malignously transformed or
tumorous cells or cell lines. While in this embodiment no "healthy" control is
present, this system is useful in drug
testing as a sample contacted with a placebo drug provides a control for drug
treatment samples.
In an embodiment tumorous cells are obtained from a patient, and efficiency of
a projected therapy can be tested.
Thus, the model tissue culture can be used for establishing personalized
therapy.
Method for preparation
The invention also provides for a method for the preparation of the engineered
three dimensional pulmonary model
tissue culture as defined herein, said method comprising the steps of
- preparing a mixed suspension of at least primary fibroblast cells and
pulmonary epithelial cells,
- placing the mixed suspension or an aliquot thereof in a container suitable
for pelleting the cells of the suspension,
- pelleting the cells,
- incubating the pelleted suspension in the presence of CO, for a time
sufficient to the cells to form a three
dimensional pulmonary model tissue comprising cellular aggregate(s),
- optionally assaying the model tissue for
.. a) expression of one or more epithelial differentiation markers
characteristic to lung tissue, and an increased
expression level as compared to a suitable reference culture e.g. as disclosed
herein, is considered as indicative of
the formation of a three dimensional pulmonary model tissue culture; and/or
6
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
b) expression of one or more pro-inflammatory cytokine, and a decreased
expression level as compared to any
suitable reference culture e.g. as disclosed herein, is considered as
indicative of the formation of a three dimensional
pulmonary model tissue culture.
Preferably, the container is a non-tissue culture treated container.
Preferably, multiple aliquots are placed into multiple containers,
Preferably, the containers are wells of a plate, e.g. a 96 well plate or a 384
well plate,
Preferably, pelleting is carried out at 200g to 600g, 1 to 20 minutes,
preferably 2 to 10 minutes.
Preferably, the cells are supplied with a reporter molecule, e.g. are stained
with a biocompatible dye to report on
cellular features as disclosed herein.
The containers can be V-bottom, flat-bottom or U-bottom containers, depending
on the purpose they are used for.
Upon preparation of a mixed suspension one or more type of cells are added to
a container within 18 hours,
preferably within 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours,
more preferably within 4 hours, 3 hours,
2 hours, highly preferably within 1 hour or 0.5 hours. Preferably each type of
cell used is added within the period
defined above.
In a preferred embodiment the pellcted suspension is incubated in the presence
of CO2 for a period not longer than
50 hours, 40 hours, 30 hours, 24 hours, 22 hours, 20 hours, 18 hours, 16
hours, 14 hours, 12 hours or 10 hours. In a
preferred embodiment the pelleted suspension is incubated in the presence of
CO2 for a period not less than 2 hours,
4 hours, 6 hours, 8 hours, 10 hours, 12 hours.
In an embodiment of the invention further type of cells are added to the mixed
suspension of the cells. In an
embodiment of the invention further type of cells are at least endothelial
cells. In an embodiment of the invention
further type of cells are selected from endothelial cells, smooth muscle
cells, nerve cells, granulocytes, dendritic
cells, mast cells, T/B lymphocytes, macrophages. Granulocytes, dendritic
cells, mast cells, T/B lymphocytes and
macrophages can be added to the cultures either in inactive or in
immunologically active state.
Optionally, the method according to the invention comprises de-differentiation
of one or more type of cells prior to
preparation of a mixed suspension.
Optionally, the method according to the invention comprises a propagation of
one or more type of cells prior to
preparation of a mixed suspension. This step is particularly required if
parallel testing of a large number of samples
are required, for example in HTS (High Throughput Screening) solutions.
Method for screening
The invention also relates to a method for screening of a drug for its effect
on lung tissue, said method comprising
the steps of
- providing an engineered three dimensional pulmonary model tissue culture
as defined herein,
- taking at least a test sample and a reference sample of said model tissue
culture,
- contacting the test sample with a drug while maintaining the test sample
and the reference sample under the same
conditions,
- detecting any alteration or modification of the test sample in comparison
with the reference sample
wherein if any alteration or modification of the test sample is detected it is
considered as an indication of the effect
of the drug.
In certain variant of the method only the direction of an alteration or
modification is observed and no physiological
values are calculated. In certain variants a predetermined threshold value is
defined based on a calibration curve and
comparison is made with this value.
In a preferred embodiment the model tissue culture is the model of a healthy
lung tissue and an adverse effect of a
7
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
drug is tested, wherein alteration or modification which is detrimental to the
cells of test sample is considered as a
toxic or adverse effect of said drug.
in a preferred embodiment the model tissue culture is a pulmonary disease
model tissue culture comprising affected
cells having a pathologic feature and the beneficial effect of a drug is
tested, wherein
- an assay to measure or assess said pathologic feature is provided for said
model tissue culture to obtain a measure
of disease,
- a reference sample of a healthy lung tissue (healthy reference sample)
and/or a reference sample of a diseased lung
tissue (diseased reference sample) is provided,
- the pathologic feature is measured or assessed in the healthy reference
sample and/or in the diseased reference
sample and in said at least one test sample before and after contacting it
with the drug, wherein
any alteration or modification in the test sample which shifts the measure of
disease in the test sample towards the
measure of disease in the healthy reference sample and or away from the
measure of disease in the diseased
reference sample is considered as a beneficial effect of said drug. In other
words, it is more similar to the state of the
healthy reference sample than to the diseased reference sample.
In a preferred embodiment primary cells obtained from a patient arc applied.
In a preferred embodiment primary
cells from a given patient are not or only partly de-differentiated and used
within 5, 4, 3. 2 or 1 day(s) or within 12,
10, 8, 6, 4, 3, 2, 1 hour(s) after obtaining them from said patient to prepare
the mixed suspension of the cells. In a
model tissue culture made of primary cells, features of the disease state of
the given patient can be studied and
therapeutic drugs and/or regimens can be tested.
Kits
The invention also relates to an engineered three dimensional pulmonary model
tissue kit comprising a test plate
having an array of containers wherein at least two containers contain
- samples of one or more types of engineered three dimensional pulmonary
model tissue cultures as defined in any
of the previous claims, each sample placed in separate containers of said
plate,
- an appropriate medium for culturing cells of the model tissue cultures.
Preferably a subset of the containers comprises one or more control samples.
Control samples can be pure cultures
of certain cell types, e.g. cultures of epithelium and fibroblasts only,
and/or two dimensional (2D) cultures. In
disease models controls can be cultures of healthy cells.
Preferably, the engineered three dimensional pulmonary model tissue kit has
one or more of the following
characteristics:
- the plate is a 96 well plate.
- the plate is a V-bottom plate or a flat bottom plate or a plate
comprising both V-bottom and flat-bottom wells. U-
bottom plates also can be applied.
- the culture samples in each container comprise cells in an amount of
at least 101, preferably at least 104, more preferably at least 2*104, 3*104,
4*104, 5*104 cells, and
at most 106, preferably at most 5*105, 4*105, 3*105, 2*105, or at most 105
cells,
- the containers are sealed, either separately or together and contain a
CO, enriched environment or atmosphere
suitable for a lung tissue culture.
- the CO2 enriched environment or atmosphere comprises
at least 2%, 3%, 4% CO, environment,
at most 10%, 9%, 8% or 7% CO, environment,
highly preferably about 5% CO2.
8
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
In preferred embodiments the samples comprise test sample(s) and corresponding
control sample(s).
In preferred embodiments the test samples are present on a V-bottom plate or
in V-bottom wells on a plate and the
control samples are present on a flat-bottom plate or in flat-bottom wells on
a plate.
DEFINITIONS
The meaning of an "artificial tissue scaffold" in the context of the present
description is a solid support material
having a structure specially designed for and useful for cell attachment
and/or for assisting the structural three
dimensional arrangement of cells, in tissue or cell culture. Preferably, said
artificial tissue scaffold is manufactured
prior to culturing of the tissue or cells and contacted with the tissue or the
cells before or during culturing said tissue
or cells. Thus, an artificial tissue scaffold is typically a cell growth
support structure or material which contributes to
the structure, e.g. the three dimensional structure of the tissue or cell
culture by affecting at least a part of cellular
interactions (e.g. the cell-cell interactions) or the cellular environment
itself. As a consequence, if a tissue scaffold is
removed from the tissue or cell culture, the tissue or cell culture will
disintegrate or become disorganized. A skilled
person will understand, however, that if the artificial tissue scaffold is
made of a biodegradable material and it is
degraded gradually, allowing cell-cell interactions to be formed, this is not
to bc considered as a removal of the
tissue scaffold and in this process the tissue or cell culture may not become
disintegrated or disorganized.
In a version the artificial tissue scaffold is a three dimensional matrix,
preferably a three dimensional gel matrix or a
porous three dimensional matrix, said matrix preferably having microspaces or
pores in which the cells are located.
In a version the artificial tissue scaffold itself is a support on the surface
of which the cells are attached, preferably a
porous membrane support. In this version of the scaffold it has a structure
specially designed for and useful for cell
attachment, e.g. a porous or curved or engrailed or grooved surface to which
the cells are attached so that this
facilitates the formation of a 3 dimensional structure.
Preferably, an artificial tissue scaffold
- has a defined three dimensional structure
- is a porous, preferably a highly porous material or matrix,
- is a porous membrane,
- is a porous three dimensional matrix
- is made of a biocompatible material, and/or
- is made of a polymer.
Optionally, the "artificial tissue scaffold" is a polysaccharide-based matrix,
e.g. it is a cellulose-based matrix, e.g. a
methyl-cellulose matrix.
Optionally, the "artificial tissue scaffold" has a bead structure, e.g. it is
a cytodex bead.
A "three dimensional tissue culture free of any artificial tissue scaffold" is
understood herein as a tissue culture
having a three dimensional structure wherein the three dimensional structure
of said tissue culture is formed or
contributed by inherent cell-cell interactions and is not assisted by an
artificial tissue scaffold.
Thus, a three dimensional tissue culture free of any artificial tissue
scaffold does not disintegrate or become
disorganized in lack of an artificial tissue scaffold but maintains its three
dimensional structure. Even if said three
dimensional tissue culture free of any artificial tissue scaffold is cultured
and formed on a solid support material, the
formation of the three dimensional structure is not assisted by and is not due
to attachment of cells to this solid
support and it can be separated without destruction of the three dimensional
structure.
"Segregation of cells" as used herein relates to the spatial separation of at
least two types of cells of a tissue or cell
culture, whereby after this spatial separation i.e. segregation, a region of
the culture, e.g. a (partial) volume or
9
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
surface, can be defined or found in which the ratio of the two types of cells
is different from both the ratio of the
same types of cells in the same region of the culture before segregation and
the ratio of the same types of cells in an
other region of the culture. Preferably, a difference in the surface tension
of at least two types of cells significantly
contributes to their segregation in vitro.
"Enrichment" of a region, e.g. a volume or partial volume or surface or
partial surface of a culture in a certain cell
type is to be understood as a phenomenon when the ratio of a certain cell type
is higher in that region than in a
reference region, e.g. an other region of said culture. Typically "enrichment"
of a region of a culture is the result of
segregation of cells.
"Inflammation" is an adaptive response that is triggered by noxious stimuli
and conditions, such as infection and
tissue injury.
A number of cytokines, known collectively as "pro-inflammatory cytokines"
because they accelerate inflammation,
also regulate inflammatory reactions either directly or by their ability to
induce the synthesis of cellular adhesion
molecules or other cytokines in certain cell types. The major pro-inflammatory
cytokines that are responsible for
early responses are IL 1-alpha, ILI-beta, IL6, and TNF-alpha. Other pro-
inflammatory mediators include IFN-
gamma, CNTF, TGF-bcta, IL12, IL17, IL18, IL8 (CXCL8) and a variety of other
chemokincs that chcmoattract
inflammatory cells, and various neuromodulatory factors. The net effect of an
inflammatory response is determined
by the balance between pro-inflammatory cytokines and anti-inflammatory
cytokines (for example IL4, IL10, and
IL13, IL16, IFN-alpha, TGF-beta, ILlra, G-CSF, soluble receptors for TNF or
IL6). Activation of ILI-beta by
various caspases proceeds in a large multiprotein complex that has been termed
inflammasome.
LIF, GM-CSF, IL11 and OSM are further cytokines affecting inflammation
processes and which are possibly useful
in the preparation of disease models of the invention.
To the contrary, "anti-inflammatory cytokines", like IL10, regulate
inflammation processes so that they are inhibited
or alleviated.
The "average diameter" of three dimensional tissues is taken as the aritmetic
mean of several measurements of
three dimensional tissue diameters generated by the above described method.
The "typical diameter" (median diameter) is the diameter which marks the
division of a given sediment sample into
two equal parts by weight, one part containing all aggregates larger than that
diameter and the other part containing
all aggregates smaller.
An "array" of containers is to be understood as an arrangement of multiple
containers of the same size, shape and
material. The arrangement can be for example a sequence of container, or a two
dimensional matrix of the
containers.
Viruses are obligate intra-cellular pathogens that infect cells, often with
great specificity to a particular cell type. In
,`recombinant virus vectors" genes that are needed for the replication phase
of the viral life cycle are deleted and
genes of interest added to the viral genome. The recombinant viral vectors can
transduce the cell type it would
normally infect. To produce such recombinant viral vectors the non-essential
genes are provided in trans, either
integrated into the genome of the packaging cell line or on a plasmid. A
number of viruses have been developed,
interest has centred on four types; retroviruses (including lentiviruses),
adenoviruses, adeno-associated viruses &
herpes simplex virus type 1.
"Cancer" is a class of diseases in which a group of cells display uncontrolled
growth, invasion (intrusion on and
destruction of adjacent tissues), and sometimes metastasis (spread to other
locations in the body via lymph or
blood). These three malignant properties of cancers differentiate them from
benign tumors, which are self-limited,
do not invade or metastasize. 95% of lung tumors are bronchogenic carcinoma;
also bronchial carcinoids,
CA 02760768 2016-08-23
mesenchymal, miscellaneous neoplasms.
"Fibrosis" is the formation or development of excess fibrous connective tissue
in an organ or tissue as a reparative
or reactive process, as opposed to a formation of fibrous tissue as a normal
constituent of an organ or tissue.
Pulmonary fibrosis is a severe chronic disease characterized by a loss of
elasticity and lung epithelial cells, replaced
by interstitial myofibroblasts and deposition of extracellular matrix proteins
in the lung interstitium leading to
pulmonary structural remodelling.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Pelleted micro-tissue cultures containing different ratios of SAEC
and NHLF. Due to physiological
fluorescent markers SAEC cells are light grey on black and white copies
whereas NHLF cells are dark gray.
Figure 2. Matrigel based culture of 50%SAEC and 50%NHLF mix.
Figure 3. Structure of 3D two-cell type microcultures. SAEC and NHLF cells
were stained with the vital dyes of
CFSE or Dill, respectively. Cell populations either pure or mixed at various
ratios were pelleted and aggregates were
formed after 24 hour incubation, then transferred into 24 well cell culture
plates for imaging. Top row: phase
contrast microscopic images; Middle row: fluorescent microscopic images;
Bottom row: confocal images.
Figure 4a. mRNA levels of TTF-1 in 3D human lung micro-tissues. TTF1
transcription factor is a characteristic
marker of alveolar epithelial cells. While 3D fibroblast cultures show no TTF
I expression, TTF1 is present in 3D
SAEC monocultures and increased in 2D SAEC/NHLF co-cultures indicating the
beneficial effect of fibroblasts.
The highest level of TT I expression was reached in 3D SAEC/NHLF tissues.
Figure 4b. mRNA levels of AQP-3 water transporter in 3D human lung micro-
tissues. AQ3 is an AT1I epithelial
type marker in the lung. While 3D fibroblast cultures show no AQ3 expression,
AQ3 is present in 3D SAEC
monocultures and increased in 2D SAEC/NHLF co-cultures indicating the
beneficial effect of fibroblasts, but the
highest level of AQ3 was still observed in 3D SAEC/NHLF tissue cultures.
Figure 5. Gene expression changes in SAEC differentiation markers. Panel A:
Relative mRNA levels of AQP3
water transporter in 2D and 3D human lung micro-tissues. Relative AQP3
expression levels increased in mixed cell
cultures to that of SAEC-only cultures while no difference was detectable
between 2D and 3D culture conditions.
Panel B: Relative level of KRT7 mRNA expression was increased in mixed cell
cultures compared to SAEC-only
cultures. (Independent experiments: n=3) Panel C: RT-PCR analysis of SFTPA I
and beta-actin expression in 2D
and 3D cultures. SFTPA1 expression was only detected in SAEC+NHLF co-cultures.
The expression of SFTPA I
were consistently higher in 3D cultures than in 2D cultures. A representative
image of 3 independent experiments is
shown. Panel D: After 72h 2D or 3D co-culturing with NHLF cells, gene
expression changes in FACS-sorted SAEC
were examined. The levels of differentiation markers AQP3 and TTF-1 in re-
purified SAEC were significantly up-
regulated in 3D co-cultures compared to 2D co-cultures. Data shown are means
of two independent experiments.
(Purified primary lung cells used in all our experiments originated from
random donors).
Figure 6. EMT markers in the 3D lung tissue model. Panel A: Relative mRNA
levels of SI00A4 in 2D and 3D co-
cultures. The presence of fibroblasts significantly decreased the level of
S100A4 in SAEC-NI-ELF co-cultures
compared to SAEC-only cultures while 2D or 3D culture conditions did not alter
S100A4 expression significantly.
Panel B: Relative mRNA levels of E-cadherin (E-cad) is increased in 3D
cultures in the presence of NHLF. Panel
11
CA 02760768 2016-08-23
C: Relative mRNA levels of N-cadherin (N-cad) in 2D and 3D human lung micro-
tissues. Panel D: After 72h 2D or
3D co-culturing with NHLF cells, gene expression changes in FACS-sorted SAEC
were examined. The levels of
EMT markers SIO0A4 and E-cad in sorted lung epithelial cells were increased in
3D two-cell co-cultures compared
to 2D co-cultures, while N-cad was expressed at much lower levels in 3D mixed
cultures. Purified primary lung
cells used in our experiments originated from random donors. Data shown are
means of three (Panels A-C) or two
(Panel D) independent experiments. Purified primary lung cells used in all our
experiments originated from random
donors.
Figure 7. Inflammatory cytokine and chemokine secretion in human primary lung
cell cultures. Panel A: CXCL-8
secretion of 2D and 3D NHLF monocultures was barely detectable in cell culture
supernatants. 3D SAEC cultures
still produced CXCL8, although to a lesser degree than 2D SAEC cultures. 2D co-
cultures didn't significantly alter
CXCL-8 expression, indicating, that the presence of fibroblasts cannot
influence cytokine expression. CXCL-8
expression levels were significantly reduced in 3D tissue systems in both pure
SAEC and SAEC-NHLF co-cultures.
Panel B and C: Expression levels of IL-lb and IL-6 niRNA in human primary lung
cell cultures, respectively.
Compared to 2D cultures, inflammatory mRNA levels of inflammatory cytokines IL-
lb and IL-6 are consistently
lower in 3D cultures. In pure fibroblast cultures IL-lb mRNA expression was
not detectable, while 1L-6 levels were
much lower and the expression changes were also less prominent. (See also
Table 2) Panel D: Similarly to mixed
cell culture samples, inflammatory cytokines IL-lb and IL-6 levels also
decreased markedly in SAEC purified from
3D cultures, than that of 2D cultures. Data shown are means of three (Panels A-
C) or two (Panel D) independent
experiments. Purified primary lung cells used in all our experiments
originated from random donors.
Figure 8. Structure of 3D three-cell type microcultures consisting of SAEC,
NHLF, and HMVECs. SAEC, NHLF
and HMVECs were stained with the vital dyes CFSE, Dil, or DiD, respectively,
then aggregated. After 24 hour
incubation, the spontaneously rearranged two- or three-cell type microcultures
were carefully transferred into 24
well cell culture plates for imaging. Panel A: two-cell type cultures; Panel
B: three-cell type cultures. Top row:
phase contrast microscopic images; Middle row: fluorescent microscopic images;
Bottom row: confocal images.
Figure 9. Gene expression changes in three-cell type cultures. Panel A: The
expression levels of AQP3 and KRT7
increased, S 100A4 and N-cad decreased in 3D cultures compared to 2D cultures.
Panel B: Comparison of
expression changes of molecular markers in 3D SAEC-NHLF two-cell type cultures
and SAEC-NHLF-HMVEC
three-cell type cultures. AQP3 and E-cad mRNA levels are increased. S100A4 and
N-cad are decreased in indicating
that differentiation of the tissue was maintained in the three-cell type
model. Purified primary lung cells used in all
our experiments originated from random donors.
Figure 10. Flow chart of the preparation of a test-ready lung tissue kit
delivered in a 96 well plate.
Figure 11.a. Adenoviral gene delivery into SAEC in the two-cell type model.
SAEC appear green in the surface of
the 3D tissue model due to GFP expression. Fibroblasts were pre- stained with
a physiological dye prior to the
aggregation.
Figure 11.b. Adenoviral gene delivery into SAEC in the two-cell type model. RT-
PCR reaction proves effective
GFP gene delivery into the model. GFP can be detected in adenovirally
transduced model cultures.
12
CA 02760768 2016-08-23
DETAILED DESCRIPTION OF THE INVENTION
The present inventors created a simple engineered three dimensional pulmonary
model tissue culture, useful as a
lung tissue model and ready for use in various test methods.
During the generation of the model, several aspects of tissue characteristics
including main characteristics of tissue
types of the lung, interaction of cell types during embryonic lung development
and technological advances in tissue
engineering were considered.
Both scaffold based and scaffold free systems were tested as described herein.
Analysis of lung tissue specific
markers surprisingly showed that the three dimensional scaffold free system
showed striking similarities with native
12a
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
lung tissue.
In the prior art fibroblast overgrowth was usual experience during attempts of
utilizing these type cells in model
tissues (US2008/0112890). Tit light of the results presented -herein it can be
assumed that the cause of such
overgrowth could have been a lack of formation of aggregates. Cells left out
from the aggregates might have
attached to the surface of the vessel, start propagation till contact
inhibition is achieved by them.
Hitherto developed lung tissue models used specialized scaffold materials and
were kept in culture lengthily
[Nichols, J.E. and Cortiella J. 2008]. In contrast, the model presented herein
allows easy handling, uses a simple
experimental setup and a relatively short culturing time. Moreover, no special
laboratory equipment is required. The
present system is appropriate for use with human cells, including human
primary cells and non-transformed human
cells.
It is to be understood that in certain systems the scaffold e.g. a matrix is
biodegradable. However, these systems are
not be considered as scaffold free systems even after the scaffold is degraded
because and if the scaffold affected or
defined the structure or shape of the tissue culture. Besides, in in vitro
systems like in the present invention
generally it can not be expected that a degradable membrane will be dissolved.
.. Moreover, dissolution of a biodegradable scaffold takes a long time, much
longer that the time for preparation and
usage of the tissue culture of the present invention.
Cell which are not de-differentiated cells can also be applied in the present
invention, however, the number of cells
will be small. Therefore, this embodiment is useful mainly in cases when a
small number of cells is sufficient to a
projected test, e.g. when the test is sensitive enough. In a rapid test it is
possible to start the preparation of the model
tissue culture of the invention from purified, differentiated cells. Such
cells can be freshly prepared from a subject.
This version of the method is particularly useful e.g. in patient-specific
testing of drugs or compounds or if the effect
of an active agent is to be tested in a specific disease setting (for example
for a potential manufacturer).
Primary cells can be obtained from commercial sources, too. For example Lonza
Verviers, S.p.r.l. Parc Industriel de
Petit-Rechain B-4800 Verviers, Belgium; Biocenter Ltd., Temesvari krt. 62 H-
6726 Szeged, Invitrogen Corporation
(part of Life Technologies Corporation 5791 Van Allen Way, Carlsbad,
California 92008 USA)
If large number of samples are needed, cells are to be propagated before
preparing the model tissue culture samples.
During this process de-differentiation may occur. This is the case in
screening (e.g. HTS) applications. In patient-
specific testing a smaller number of samples is sufficient.
When the cells are differentiated in an aggregate, propagation is slowed down
or stopped and thereafter the
aggregates do not increase significantly
If a small number of samples are sufficient no preliminary propagation is
needed. Typically, this may occur in
patient sample testing for a few drugs or if certain phenomena, e.g. signaling
processes are to be observed. However,
in screening processes a large number of samples are needed and propagation of
cells before the preparation of the
model tissue culture should be performed.
In preferred embodiment of the invention adult, dedifferentiated epithelial
cells are used. It was not known in the art
that in adult, dedifferentiated epithelial cells, simply co-cultured in the
presence of fibroblasts are capable of
effecting differentiation that would further increase in 3D conditions, in
particular in conditions appropriate for
formation of 3D aggregates. Thus, in a preferred embodiment the model tissue
culture preparation is started from
de-differentiated cells.
Primary cells, kept in a culture, e.g. in a 2D tissue culture will exhibit
certain dedifferentiation markers. Thus, such
cell can be applied in the present invention, as well. Dedifferentiation
markers include S100A4, N-cadherin and
inflammatory markers. Thereby a larger number of cells can be applied.
13
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
Pluripotent or undifferentiated cells can be rendered capable of
differentiation after addition of tissue component
and/or factors.
Cellular interactions within pulmonary tissue
Cellular de-differentiation and re-differentiation
Both stem cells and tissue specific progenitor cells can undergo directed
steps of tissue specific differentiation and
therefore represent an ideal source for generating organ specific tissue
culture material. Unfortunately, both cell
types are only available in limited numbers in differentiated tissues.
As tissue models need to be set up on a regular basis according to
experimental and/or testing requirements, tissue
specific differentiated cells represent a better source of primary material,
simply as there are more of them. The
present model system utilizes, at least in part, the phenomenon that
differentiated cells in two dimensional culture
conditions can de-differentiate and can be forced to re-differentiate using
the right culture conditions.
Cellular interactions
Lung development, as well as epithelial injury repair, is tightly coordinated
by a fine balance between stimulatory
versus inhibitory genes that appear to co-regulate the function of stem and
adult progenitor cells in the lung. For
example, FGF receptor tyrosine kinasc signaling is essential for respiratory
organogencsis and is negatively
regulated by a family of inducible FGF pathway inhibitors (Zhang, Stappenbeck
et al. 2005). Additionally, FGF
signaling is required for formation of new alveoli, protection of alveolar
epithelial cells from injury, as well as
migration and proliferation of putative alveolar stein/progenitor cells during
lung repair. Conversely, TGF beta
receptor serine-threonine kinase signaling via Smads 2, 3 and 4 inhibits lung
morphogenesis and can inhibit
postnatal alveolar development, while excessive TGF beta signaling via Smad3
causes interstitial fibrosis.
Thus, there is a requirement for reciprocal, albeit rather complex system of
interactions between the mesenchyme
and the epithelium. The present inventors hypothesized that a basic lung model
can be created by using a mix of
purified alveolar epithelium and fibroblasts.
Therefore, initially only two cell types were used: primary human fibroblasts
(NHLF) and small airways epithelial
cells (SAEC with ATII characteristics) that are both commercially available
(Lonza). It has been surprisingly found
that this two cell type sufficiently provides the necessary factors to form a
three dimensional pulmonary tissue
model. The skilled person will understand that by addition of further cell
types, for example of cell types listed
herein, the model can be further developed.
Segregation of cell types in mixed culture (sorting)
Our microscopic examinations demonstrate that spontaneous tissue
reorganization ¨ "sorting" - occurs in 3D lung
primary cell cultures. The present inventors used herein a simple
centrifugation method to aggregate cells similarly
to that of the preparation of fetal thymic organ cultures. [Hare, K.J. et al.
(1999)] Evidence is provided herein that
3D co-culturing of primary pulmonary epithelial cells with fibroblasts is more
advantageous for SAEC to maintain a
more differentiated status than in either 2D or 3D in vitro monocultures.
Inclusion of NHLFs not only facilitated
epithelial differentiation but the cohesion and structure of the 3D micro-
tissues were much more firm and compact
compared to SAEC-only (Figure 3) or SAEC-HMVEC (Figure 8.a) cultures.
The present two-cell type co-culture system, consisting of human small airway
epithelial cells (SAEC) and normal
human lung fibroblasts (NIILF) did not require the presence of externally
added ECM for the formation and
maintenance of 3D structure (Figure 3). Pelleting SAEC and NHLF cell
suspensions of single cell type and cell
mixtures of various ratios revealed that creation of pulmonary micro-tissues
require the presence of fibroblasts to
maintain a compact and stable 3D structure (Figure 3). Morphologic
examinations of 3D micro-tissues revealed that
segregation of the two cell types in mixed cultures was a feature of 3D micro-
tissues, fibroblasts forming the inner,
14
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
core part, while epithelial cells were covering the outer layer (Figure 3).
The phenomenon of segregation or
"sorting" is based on different adhesive energy characteristics of cell types
and has not been described for primary
human pulmonary tissue before. The spontaneous cell "sorting" is based upon
the disparity of the cohesive forces
between different cell types: the most cohesive core or central region of the
pulmonary micro-tissue is formed by the
.. NHLF population being surrounded by the less cohesive SAEC. The process of
segregation in primary,
differentiated human pulmonary tissues is particularly interesting, as
underlies the notion that even differentiated,
human adult cells maintain their ability to actively explore their own
rnicroenvironment. The cells in the 3D co-
cultures are capable of exchanging position with adjacent cells thus
structurally reorganizing the tissue. This process
also requires reorganization of the extracellular matrix. Studies of the
models of various SAEC,NHLF ratios in the
.. 3D micro-tissue models revealed that 1:1 ratio is sufficient for the
epithelial cells to cover the inner core of
fibroblasts therefore further analysis of the model was performed using the
1:1 setting. The model can be useful,
however, at other epithelial-mesenchymal cell ratios. The ratio sufficient for
full coverage may vary to some extent
depending on cell type.
Without being bound by theory, the present Inventors think that segregation of
cells in the present model is due to
.. different cohcsivity of the cell types in which a difference in their
surface tension plays a major role.
Any cell would actively explore its own microenvironment, are able to exchange
position with adjacent cells or to
reorganize the extracellular matrix in their vicinity. The latter process is
known to involve both mechanical traction
forces and enzymatic activity by matrix metalloproteases (MMPs). Based on
different adhesive energy
characteristics, it is a known experimental fact that certain cell
compositions of mixed cell types can segregate in an
.. aggregate.
III Segregated cell aggregates Of hanging drop cultures the most cohesive
population occupies the central region,
being surrounded by the less cohesive one. A measure of tissue cohesivity is
the surface tension of the cells. Thus,
surface tension, which is an experimentally detectable quantity, can predict
the sorting hierarchy. Therefore there
early attempts have been made in the art to by this sorting hierarchy can be
predicted to a certain extent if a new cell
type is to be involved (Neagu 2006).
However, surface tension factors are not known for specific cell types of the
human lung. The prior art was fully
silent as to whether the phenomenon of tissue sorting would happen in other
cultures or only in hanging drop
cultures. The present inventors experimentally determined show herein for the
first time that, surprisingly,
segregation of epithelial and fibroblast cells happens in pelleted mixed
alveolar epithelium and fibroblast cultures.
Size and structure of the tnicroaggregates
It was unexpectedly found by the present inventors that even very small but
structured aggregates exhibit tissue
features and thus are appropriate for studying interactions, and testing
compounds or environmental effects.
Small aggregates have several advantages, for example, no special reaction
vessels are needed, their size and ratio of
.. different cell types are reproducible and thereby interactions are more
casyly controlled. In small aggregates
practically no necrotization of the inner parts of the tissue aggregates can
be expected. Furthermore, a surprisingly
uniform size distribution can be achieved which renders them quite appropriate
for parallel testing.
Thus, preferably, according to the invention the size of the aggregates should
be kept small provided that tissue
features appear and thereby interactions can be examined.
If the aggregates are too small, a correct morphology as disclosed herein may
not take form and the aggregate may
not have a tissue like characteristic, if the aggregates are too large, their
size may largely deviate from the average.
Moreover, necrotization may occur inside the aggregates, due to a longer
culturing time and less perfusion of the
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
aggregates.
In lack of special additives, for example receiving only cell culture media
the growth of aggregates is controlled by
contact inhibition of the cells.
The size depends, however, on the number of cells in an aggregate. The skilled
person will understand that the size
and cell number of the aggregates can vary within the limits given herein
provided that the above-described
requirements are met.
It has been found that addition of endothelial cell did not change
significantly the size of the aggregates.
Cell types useful in the present invention
Fibroblast cells
Fibroblasts are the most versatile of the connective tissue cell family and
they are in fact the most ubiquitous cell
type. Fibroblasts are important structural elements of tissue integrity. They
participate in repair and regenerative
processes in almost every human tissue and organ, including the lung. Their
primary function is to secrete extra
cellular matrix (ECM) proteins that provide a tissue scaffold for normal
repair events such as epithelial cell
migration.
Fibroblasts, or distinct subpopulations thereof, perform tissue-specific
functions as immunoregulatory cell, secrete
chemokines and cytokines, which are able to trigger immune responses by
attracting inflammatory cells and immune
cells. Fibroblasts from different anatomical locations show an array of common
phenotypic attributes. Fibroblasts,
however, show distinct phenotypes in different anatomical locations.
Characteristic expression of fibroblast growth
factors and receptors are also a feature of pulmonary fibroblasts [De
Moerlooze, Spencer-Dene et al (2000)1.
The present inventors have found that it is possible to rely on fibroblast
physiology to create an artificial tissue
scaffold-free tissue system to mimic some aspects of distal pulmonary tissue
and an artificial matrix based model
not necessarily the only way to create three dimensional pulmonary cultures.
Without being bound by theory, the
present inventors assume that the fact that fibroblasts in the lung secrete
ECM significantly contributes to this result.
Pulmonary epithelial cells (Pneuomocytes)
Pneumocytes (pulmonary or alveolar epithelial cells or AECs) are epithelial
cells that line the normal alveolar
basement membrane, i.e. the peripheral gas exchange region within the distal
airways of the lungs. Pneumocytes or
AECs can be subdivided into type I and type II pneumocytes.
Characteristic markers for the two alveolar epithelial cell types are easily
traceable and can be monitored during
experiments e.g. using RT-PCR reactions or immuno-histochemistry.
Type 1 pneumocytes
Type 1 pneumocytes [alveolar type 1 pneumocytes, type 1 alveolocytes, alveolar
type 1 cells (abbr. ATI cells), also
called small alveolar cells, squamous alveolar cells, membranous pneumocytes,
or type 1 alveolar epithelial cells],
are complex branched cells with multiple cytoplasmic plates that represent the
gas exchange surface in the alveolus
of the lung. These cells are metabolically active and harbour cell surface
receptors for a variety of substances,
including extracellular matrix (ECM) proteins, growth factors, and cytokines.
About ninety-five per cent of the
alveolar surface is covered with type I pneumocytes.
Type 2 pneumocytes
Type 2 pneumocytes (alveolar type 2 pneumocytes, alveolar type 2 cells; abbr.
ATII cells, T2P) are cuboidal
epithelial cells also being referred to as type 2 alveolar epithelial cells
(abbr. AEC, also EPII cells), type 2 granular
pneumocytes, type 2 cells, type 2 alveolocytes, septal cells, or great
alveolar cells, large alveolar cells, or granular
pneumocytes. These cells arise from immature epithelial cell progenitors.
Alveolar type 2 pneumocytes are thought
to be progenitor cells of the alveolar epithelium. They are capable of self-
renewal and differentiation into squamous
16
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
type 1 pneumocytes. Type 11 cells are cuboidal cell, which comprise only 4 %
of the alveolar surface area, but
constitute 60 % of alveolar epithelial cells and 10-15 % of all lung cells
(Crapo et al, 1982).
Type 3 alveolar epithelial cells
Type 3 alveolar epithelial cells differ from flat type 1 cells and cuboidal
type 2 cells by the presence of an apical tuft
of microvilli and the absence of lamellar type secretory granules. These cells
are being referred to also as alveolar
brush cells.
Endothelial cells
Endothelial cells are oblong shaped cells that line the lumen of all blood
vessels as a single squamous epithelial cell
layer. They are derived from angioblasts and hemangioblasts.
Macrophages
Macrophages are cells derived from bone marrow-derived monocytes (bone marrow-
derived macrophages) that
have homed in to tissues. The differentiation of macrophages from uni- and
bipotential progenitor cells in the bone
marrow is controlled by a variety of cytokines. Further differentiation takes
place in tissues and the resulting
macrophage populations are being referred to as resident macrophages.
Mast cells
Mast cells arise from a multipotent CD34(+) precursor in the bone marrow
(Nakahata and Tom 2002; Austen and
Boyce, 2001). Immature mast cells assume their typical granular morphology
when they have migrated into tissues.
These cells also express Fe-epsilon RI and stop expressing CD34 and Fe-gamma
R2. Most mast cells in the lung
and intestinal mucosa produce only tryptase (designated MCT) or only chymase.
Mast cells play a central role in
immediate allergic reactions by releasing potent mediators.
Smooth muscle cells
Smooth muscle cells are highly specialized multifunctional contractile cells
that regulate the lumen of hollow organs
transiently (reversible contraction), or chronically (due to fibrosis and
muscle hypertrophy). Smooth muscle cells
play an important role in vasculogenesis and shape the wall of blood vessels
and maintain vascular tone.
Observations with further cells
Addition of endothelial cells resulted in stable aggregates comprising
differentiated cells. The degree of
differentiation is not reduced if endothelial cells are included into the
model tissue culture, as found based on the
markers expressed. It appears that these aggregates maintain a layered
structure, wherein the endothelial cells are
located inside.
EMBODIMENTS
Preparation of a three dimensional model tissue culture
In the method of the present invention at least pulmonary epithelial cells and
mesenchymal cells, preferably
fibroblasts are used. The cells are cultured separately in order to obtain
viable cultures, then mixed in an appropriate
ratio and cocultured in the presence of CO2 under appropriate conditions as
will be understood based on the present
disclosure and art methods. By setting ratio of the cells and selecting
conditions overgrowth of one cell type by
another can be avoided.
In a preferred embodiment said cells are obtained from human subject as
primary cells and either de-differentiated
or used immediately. De-differentiation can be carried out e.g. by known
methods (passages, removing other type of
cells, addition of growth factors). If the cells are capable of confluence,
they are considered as dedifferentiated.
Pelleting the coculturecl cell mixture is an important step to establish cell-
cell contacts and to result in an appropriate
17
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
distance between the cells. The most convenient way to pellet the cells is to
apply centrifugation. To select suitable
means for pelleting is well within the skills of a skilled person based on the
teaching provided herein.
in the present models in principle any of the cells listed above can be used
to obtain a lung model tissue close to a
native lung tissue. Each cell type applied have to be capable of growth under
conditions useful to obtain the three
dimensional model tissue as disclosed herein and being capable of association
with other cell types of the model.
These factors should be tested in preliminary experiments. Expediently a
relatively small ratio of further cells should
be initially applied then the ratio of the further cell type can be increased,
typically till a ratio similar to in vivo ratios
is achieved.
In preferred embodiments additional cell types that can be included in the
model are e.g. endothelial cells and
smooth muscle cells.
Disease models
Based on the above model and using various gene delivery methods and variable
target genes, the above system is
easily adaptable to study genetic changes during pulmonary diseases that can
lead to identification of novel drug
targets and development of novel therapies:
wherein the disease involves inflammation, the affected cells, preferably the
epithelial cells, express inflammatory
cytokines (above normal level) and the model is an inflammatory model,
wherein the disease is a tumor, the cells are transformed, e.g. malignantly
transformed or immortal cells and the
model is a tumor model,
wherein the disease involves fibrosis and the model is a fibrosis model,
wherein the disease involves injury of the tissue and the model is a
regeneration model.
Disease models can be utilized in drug testing.
Cells obtained from patients
In an embodiment, pulmonary cells are obtained from patients and cultured in
accordance with the present
invention. In this embodiment preferably no or only partial de-differentiation
is allowed. Thereafter, in a rapid
preparation method 3D model tissue culture is formed and drugs proposed for
treating said patient are tested or a
projected therapeutic regime can be tested. The advantage of this embodiment
among others is that pure and parallel
sample cultures with uniform composition and size can be prepared. Said
samples are also free of any pathogens and
may be purified as needed.
Models prepared from healthy cells
In a preferred embodiment, disease models are prepared by starting from
healthy cells and factors effecting disease
features (symptoms) in the cells are added later.
For example, tumor models are prepared from healthy cells and factors
effecting malignous transformation are
added and/or genes causing malignous transformation are expressed therein. It
has been observed that the level of
Wnt proteins, e.g. Wnt5 has increased in a pulmonary tumor tissue. It is thus
contemplated that tumor models can be
prepared by addition of tumorogenic factors, like EGF (epithelial growth
factor), IGF (insulin-like growth factor),
insulin, Wnt factors e.g. Wnt5 or a cocktail thereof to the cell mixture or
culture of the invention.
In an alternative of this method tumorous cells are added to the medium in
which the model culture according to the
invention is present but are separated by a semi-permeable membrane. Thereby
the factors produced by the
tumorous cell induce tumorous (malignus) transition of the cultured cells of
the invention.
18
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
Lung tumor models made of lung tumor cell lines
Lung tumor models can be prepared from lung tumor cell lines. Such cell lines
are readily available at the American
Type Culture Collection (ATCC; Rockville, MD), upon searching for tumor cell
lines.
Advisably, experiments are to be performed to find appropriate conditions for
culturing the cells and optimize the
ratio of the cell types used in a cell mixture.
Inflammation models
For inflammation models monocytes and/or macrophages can be added to the model
culture of the invention
preferably during the preparation process.
In this model pretreatment with LPS or WNT5A is advisable.
Cytokine production of activated macrophages as well as production of other
factors like Wnt5 affects the tissue
culture and enable an inflammation model.
If an inflammation model system is to be examined, neutrophyl cells can be
provided separated from the pulmonary
aggregates by a membrane in an appropriate chamber. In this case neutrophyl
migration and MMP production can
be measured as well.
In an alternative embodiment disease model pulmonary cell lines a cultured in
accordance with the invention. In this
embodiment drugs can be tested for efficiency against said disease.
In the disease models use of an overexpressing gene is to be avoided, rather
an inducible promoter is to be applied.
Inflammatory models from native three dimensional pulmonary cell aggregates
To mimic inflammatory conditions, native three dimensional pulmonary cell
aggregates can be treated with various
materials eliciting inflammatory reactions.
Such materials are for example:
chemical substances causing acute inflammation, such as vasoactive amines,
eicosanoids, etc.
proinflammatory polypeptides, such as growth factors, hydrolytic enzymes etc.
reactive oxygen species,
proinflammatory cytokines, e.g. IEN-7 and other cytokines,
bacterial cell wall extracts.
Inflammatory conditions are tested by detecting cytokine expression e.g. by
biochemical assays, immunological
assays, such as ELISA, by a PCR-based method, e.g. real time PCR, or by
expression analysis e.g. by applying a
gene chip.
Genetic modification of primary cells
Both epithelial and mesenchymal cells can be genetically modified using
recombinant viral delivery vectors
(rAdenoviral and rLentiviral vectors) and these gene delivery methods do not
harm the ability of cells to aggregate.
Characteristic genes for inflammation, tumor, fibrosis and regeneration can be
constitutively or inducibly
overexpressed or silenced and tissue morphology, cellular responses, gene and
protein expression changes can be
studied in a three dimensional microenvironment.
For example, one OT More genes known to promote tumor formation can be
introduced into a pulmonary cell line,
e.g. an alveolar type I or type II cell line, preferably type II cell line or
into a fibroblast cell line. Such a gene can be
e.g. an oncogene, e.g. a ras gene or a gene or a set of genes typical of
expression pattern of a tumor, e.g. a COX-2
gene It may happen that the expression of a ras gene alone is insufficient to
transform the cells, preferably immortal
cells, but proliferation is likely to be increased [Wang, XQ, Li, H et al.
(2009)], which may provide a disease feature
for the model.
19
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
Modification of secreted factor composition in primary cell aggregates using
genetically modified and sub-lethally
irradiated cell lines
in this embodiment all cell types are left non-infected, gene expressions
therefore are as normal as in any given three
dimensional lung tissue model. Cellular composition of the aggregates however
contains sub-lethally irradiated cells
(5-10% of total cell number of the aggregate), either fibroblast (W1-38) or
alveolar epithelial (A549) cell lines or
both, that are genetically modified and produce secreted factors (Wnt-s, Bone
Morphogenic Protein (BMP)-s,
inflammatory and pro-inflammatory cytokines, growth factors, etc) that modify
the cellular microenviromnent
within the aggregates. Sub-lethal irradiation can reduce propagation of cells
and prevent overgrowth of one cell type
by the other.
Products
The invention also provides for a kit comprising multiple samples of a 3D
model tissue culture.
Preferably, the containers are wells of a plate, e.g. a 96 well plate or a 384
well plate.
The 3D model tissue can be a model of a healthy tissue or a disease model
(disease model kit).
The plate expediently comprises an array of containers or wells wherein a
multiplicity of containers contain samples
of one or more types of engineered three dimensional pulmonary model tissue
cultures in an appropriate medium.
The container can be e.g. flat bottom, an U-bottom or, preferably, a V-bottom
container, on a plate allowing parallel
testing of multiple samples.
Preferably, the containers are non-tissue culture treated containers so as to
avoid sticking of the cells to the container
wall.
In a preferred embodiment, each container comprises a single aggregate. In a
preferred embodiment, the culture
samples in each container comprise cells in an amount as defined in the brief
description of the invention.
Preferably, the containers are sealed, either separately or together and
contain a CO2 enriched environment or
atmosphere suitable for a lung tissue culture as defined in the brief
description of the invention.
Typically, disease models require the same environment.
Preferably, the cells are stained with a biocompatiblc dye suitable to report
on one or more of the following cellular
features: cellular state for example cell phase, cellular viability, apoptosis
or moribund state of the cell; cell type;
cell location; malignous transformation; inflammation.
Controls
As control samples the kit contains cultures of epithelium and fibroblasts
only. On a plate, preferably at least 3-3
wells of controls (epithelium and fibroblasts, respectively) are present.
Preferably, a further control which is a 2D lung tissue is used to identify or
assess features specific to the 3D tissue.
Thus, on request, a 2D control plate (preferably a flat-bottom, adhesive
tissue culture plate) can be included to
accompany the 3D tissue. Alternatively, the plate may also contains wells of
2D lung tissue as a control, preferably
in a flat bottom wells.
Thus, in an embodiment of the invention a plate is used which contains both V-
bottom wells for 3D tissue and flat or
U-bottom wells for 2D tissue.
EXAMPLES
Example 1 ¨ Materials and methods
Primary SAEC, NHLF and pulmonary HMVEC cells were purchased from Lonza. All
cell types were isolated from
the lungs of multiple random donors of different sexes and ages. We used SAGM,
FGM or EGM-2 medium for the
CA 02760768 2016-08-23
initial expansion of SAEC, NITLF or pulmonary HMVEC, respectively, as
recommended by the manufacturer. Alt
types of cell cultures were incubated in an atmosphere containing 5% CO,, at
37 C. For 2D and 3D culturing, pure
or mixed cell populations were cultured in a 50-50% mixture of SAGM (Small
Airway Growth Medium, Lonza) and
complete DMEM. For two and three-cell cultures containing HMVEC cells, the
appropriate growth factor
supplements for HMVEC cells were added to the 50-50% mixture of SACiM and
DMEM. The compositions of cell
culture media were prepared in accordance with instructions of the
manufacturer. For 2D and 3D culturing, cells
were mixed at the indicated ratios and dispensed onto flat-bottom 6 well
plates or 96-well V-bottom plates =
(Sarstedt), respectively. V-bottom plates were immediately centrifuged after
cell seeding at 600xg for 10 minutes at
room temperat are.
SAECs and NTILFs were stained with the following fluorescent physiological
dyes: Dii [Honig, M. G. and R. 1.
Hume (1989)] and CFSE [Wang, X. Q., X. M. Duan, et al. (2005)] to be able to
follow cellular movements in
culture. Cells with or without matrigel were pipetted into V-bottom, 96-well,
non-tissue culture treated plates and
were incubated for one hour in a CO, incubator at 37 C. Following incubation,
cells were pelleted with 2000 rpm, 5
min, room temperature, then the resulting cell pellets were incubated
overnight (5% CO 37 C).
The A549 line was initiated in 1972 by D. J. Giard of al. (1973) through
explant culture of lung carcinomatous tissue
from a 58-year-old male. A549 cells are adenocarcinomic human alveolar basal
epithelial cells. A549 cells fall
under the squamous subdivision of epithelial cells. Cells seeded at a
concentration of 2x104 cells/cm2 in the above
culture medium will be 100% confluent in 5 days.
A549 cells are available at the American Type Culture Collection (ATCC;
Rockville, MD) as CCL-185 and can be
grown in Ham's F-12 medium (GIRCO BRL, Grand Island, NY) with 10% fetal calf
serum (FCS; GIBCO BRL) Or
according to recommendations of the supplier.
The WI-38 cell line was developed in 1962 from lung tissue taken from a
therapeutically aborted fetus of about 3
months gestational age. Cells released by trypsin digestion of the lung tissue
were used for the primary culture. The
cell morphology is fibroblast-like. The karyotype is 46,XX; normal diploid
female. A maximum lifespan of 50 =
population doublings for this culture was obtained at the Repository. A
thymidine labelling index of 86% was
obtained after recovery. G6PD is isoenzyme type B. This culture of WI-38 is an
expansion from passage 9 frozen
cells obtained from the submitter.
WI-38 cells available at American Type
Culture Collection (ATCC; Rockville, MD) as CCL-75 are grown according to
recommendations of the supplier.
CL 13 or CL30 cells (Wardlaw et al., 2002) were cultured in Dulbecco's
modified Eagles/F12 medium containing
5% fetal calf serum and 25% microWm1 gentamiein.
human cells are preferably maintained at 37 C in a humid atmosphere containing
CO, as needed.
Fluorescent and confocal microscopy
Prior to 2D and 3D culturing, SAECs, NHLFs and HMVECs were stained with
fluorescent physiological dyes
CFSE, DiT and DiD, respectively (all from Molecular Probes). Cells were washed
twice in PBS and incubated with
CFSE, DiT or IND at the concentration of 0,5 ug/m1 at 37 C for 10 minutes. The
excess dyes were removed by
washing the cells with DMEM+10%FCS. 2D and 3D cultures were prepared using the
fluorescent-labeled cells, as
indicated before. After overnight incubation, 3D cell cultures were removed
carefully from the V-bottom plates and
transferred to coverslip-bottom dishes (MatTek). Lung tissue microcultures
were investigated by fluorescent
microscopy (Olympus IX-81 microscope) or confocal microscopy (Olympus FV1000
confocal imaging system)
21
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
Cell sorting
SAEC and NHLF were stained with CFSE and DiI according to manufacturers
instructions (Molecular probes).
Cells were mixed and cultured for 72 hours in 2D and 3D systems. Stained cells
were dissociated by mild trypsin
treatment followed by PBS+EDTA treatment. Dissociated cells were sorted using
a BD FACSVantage cell sorter
into tubes with lysis buffer for mRNA preparation (Miltenyi Biotech).
cDNA synthesis and quantitative RT-PCR
Total RNA was prepared from 2D and 3D cell cultures using Nucleo Spin RNAII
kit (Machery-Nagel) with on-
column DNase digestion. Messenger RNA was prepared from sorted SAEC samples
with IIMACS mRNA isolation
system (Miltenyi Biotech). cDNA was prepared from RNA samples with a MMuLV
reverse transcriptase kit
(Thermo Scientific). Real-time quantitative PCR examinations were carried out
using ABsolute QPCR SYBR Green
Low ROX master mix (ABGene) and an Applied Biosystems 7500 thermal cycler
system. Primers are listed in
Table 1.
Recombinant adenoviral vectors
The full gene-of-interest or GFP only sequence was amplified by PCR reaction
using Forward (5'): 5'- -3', Reverse
(3'): 5'- -3' primer sequences and cloned into the Shuttle vector, then by
homologous recombination into the
adenoviral vector. Adenovirus was produced by transfecting the linearised
plasmid DNA into the 293 packaging cell
line (American Type Culture Collection, Rockville, MD) using Lipofectamine
2000 (Invitrogen). The resulting
plaques were amplified, the adenovirus purified and concentrated using the
adenoviral purification kit (BD
Bio sciences ).
Adenoviral Infection of epithelial cells
Adenovims containing GFP or gene-of-interest-GFP were added to SAEC in 2D or
3D. 1 x106 cells were
resuspended in 250 jul of cell culture medium and 50,u1 of virus for 90
minutes at 37 C.
22
Table 1
_______________________________________________________________________________
_________________________________ 0
Abbrevi- Accesion
Product IJ
ation Official gene name number Forward primer sequence
Reverse primer sequence length
AQP3 Homo sapiens aquaporin 3 NM _004925 AGCCCCTTCAGGATTTCCA
GACCCAAATTCCGGTTCCA 86 cc
AQP4 Homo sapiens aquaporin 4 NI\4 001650 GCGAGGACAGCTCCTATGAT
ACTGGTGCCAGCATGAATC 110
AQP5 IIomo sapiens aquaporin 5 NM 001651 CCTTGCGGTGGTCATGA
ATGGGGCCCTACCCAGAAAAC 61
E-cad Homo sapiens cadherin 1 NM 004360 GACCGGTGCAATCTTCAAA
TTGACGCCGAGAGCTACAC 93
IL-lb Homo sapiens interleukin 1, beta
NM _000576 TCAGCCAATCTTCATTGCTCAA TGGCGAGCTCAGGTACTTCTG 62
IL-6 Homo sapiens interleakin 6 NM _000600 AGGGCTCTTCGGCAAATGTA
GAAGGAATGCCCATTAACAACAA 62
KRT7 Homo sapiens keratin 7 NM _005556 CCACCCACAATCACAAGAAGATT
TCACTTTCCAGACTGTCTCACTGTCT 78
0
N-cad IIomo sapiens cadherin 2 NI\4 001792 AGCTTCTCACGGCATACACC
GTGCATGAAGGACAGCCTCT 133
S1 00A4 Homo sapiens S100 calcium binding protein A4 NM 002961 TGGAGAAGGCCCTG
CCCTCTTTGCCCGAGTACTTG 58
SFTPA1 Homo sapiens surfactant protein Al
NM _005411 CCCCTTGTCTGCAGGATTT ATCCCTGGAGAGTGTGGAGA 128
0
SFTPB Homo sapiens surfactant protein B NM _198843 GCACTTTAAAGGACGGTGTCTT
GATGCCCACACCACCTG 128
SFTPC Homo sapiens surfactant protein C NM _003018 AAAGTCCACAACTTCCAGATGGA
CCTGGCCCAGCTTAGACGTA 73
TTF-1 IIomo sapiens NK2 homeobox 1 (NKX2.1),
NM _003317 CATGTCGATGAGTCCAAAGCA GCCCACTTTCTTGTAGCTTTCC 85
17JI
l=J
oe
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
C'XCL-8 assay
CXCL-8 (IL-8) content of 2D and 3D cell culture supernatants was measured with
Quantikine CXCL-8/IL-8
ELISA kit (R&D Systems). The sandwich ELISA assay was performed according to
the manufacturer's
instructions. Briefly, identically diluted cell culture supernatant samples
and CXCL-8 standards were dispensed
onto the wells pre-coated with anti-CXCL-8 monoclonal antibody. After 2 hours
incubation at room
temperature, the plate was washed 4 times with the provided washing buffer.
Then HRPO-conjugated
polyclonal anti-CXCL-8 antibody was added for one hour. After a final washing
step, TMB substrate solution
was added to the wells. The optical density was determined with an iEMS Reader
MF (Thermo Labsystems) at
450 and 570nm and data were analyzed using Ascent software.
Data quantitation
Quantitative real-time RT-PCR data were analyzed by the delta CI (dCt) and
Relative Quantity (RQ) methods as
suggested by Applied Biosystems using 7500 System SDS Software. All samples
were set up in duplicates.
Briefly, Ct values were determined for each sample using an automatic
threshold level determined by the 7500
System SDS Software. Delta Ct (dCt) values were determined according to the
following formula: dCt(target
gene) = Ct(target gene)¨ Ct(housekeeping gene). Changes in gene expression are
shown as RQ values
calculated using the next formula:
RQ _ 2 -ddCt
,where ddCt values were calculated as ddCt = dCt(sample) ¨ dCt(reference
sample).
CXCL-8 content of the cell culture supernatants were determinded by comparing
the OD to a standard curve
calculated from 7 different concentrations in the range of 31.2 ¨ 2000 pg/ml
CXCL-8. Samples were dispensed
in duplicates and the means were used for further data analysis.
EXAMPLE 2 ¨Experiments for development of a three dimensional lung tissue
model
Hanging drop model
To simulate human lung structure, we started with a 3D cell aggregate of 100
000 cells, in roughly equal
amounts of distinct fibroblast (NHLF) and small airway epithelial cell
populations (SAEC), randomly
intermixed. Within a day of incubation in a hanging drop assay, the cells
generated loose tissue structures. On
Figure 1 a hanging drop culture of 50%SAEC and 50% NHLF mix is shown.
The formation, however, was not stable and was not possible to transfer the
generated micro-tissues from the
initial culture conditions to another test plate without irrecoverable damage
to the tissue structure.
Pelleted, matrigel containing model
To improve the stability of mixed lung micro-tissues, 1:1 ratio of SAEC and
NIILF were pelleted and grown in the
presence of matrigel. Many 3D lung and other tissue models use matrigel to
create a three dimensional structure
where various cell types can grow and interact with one another. SAECs and
NHLFs were stained with a
fluorescent physiological dyes Dil (Honig and Hume 1989) and CFSE (Wang, Duan
et al. 2005) to be able to
follow cellular movements in culture. Cells and matrigel were pipetted into V-
bottom, 96-well, non-tissue culture
treated plates and left for one hour in a CO2 incubator at 37 C. Following
incubation, cells were pelleted with 2000
rpm, 5 min, room temperature, then the resulting cell pellets were incubated
overnight (5% CO2, 37 C).
On Figure 2 a matrigel based culture of 50%SAEC and 50%NIILF mix is shown. It
is apparent that, despite the
presence of matrigel, SAEC and NHLF were unable to form stable 3D structures.
Furthermore, it appeared that
small spherical tissue structures containing mostly epithelial cells were
leaving the tissue/matrigel mass.
EXAMPLE 3 - Pelleted, artificial tissue scaffold free model
As a next step in simulating 3D culture conditions of the human lung, the
random mix of equal number of
epithelial cells (SAEC) and fibroblasts (NHLF) were pelleted without matrigel
in two stages. Cells were
24
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
pipetted into V-bottom, 96-well, non-tissue culture treated plates and left
for one hour in a CO2 incubator at
37 C. Following incubation, cells were pelleted with 2000 rpm, 5 min, room
temperature, then the resulting cell
pellets were incubated overnight (5% CO), 37 C). Cells prior to mixed
culturing were stained using 1:1000
dilutions in PBS (phosphate buffer saline pH 7.2) of physiological fluorescent
dyes of Dil (1mg/m1 stock in
DMSO) and CFSE (1mg/m1 stock in DMSO). In these culture conditions cells
formed a stable aggregate, where
the most adhesive fibroblast (red or dark gay) were surrounded by those of the
less adhesive epithelial cell type
(green or light grey) (Figure 3). The aggregate diameter is about 200 pm.
In a further experiment, the ratio of SAEC and NHLF cells was systematically
changed and cultures were
prepared using the following SAEC:NHLF ratios, respectively: 0/100%; 25/75%,
50/50%, 75/25, 100/0%,
otherwise as described above. On Figure 3 the pelleted micro-tissue cultures
containing different ratios of SAEC
and NHLF are shown. As evidenced by the figure, the most pronounced 3D
structure aggregates with a surface
epithelial cell lining were formed when equal amount of epithelial and
fibroblasts cells were applied, aggregates
have a fair epithelial cell lining albeit are somewhat smaller and less
convincing in morphology at a ratio of
25/75%, whereas a much more even epithelial lining is formed at an excess of
SAEC cells, i.e. when the ratio of
cell epithelial cells and fibroblasts is 75/25%. Pure cultures either do not
form aggregates of 3D structure
(epithelial cells) or the aggregates are much smaller in size (fibroblast
cells).
EXAMPLE 4 - Characterization of the two cell type tissue scaffold-free 3D
pulmonary, tissue model
Differentiation markers
Molecular characterization of the model was based on epithelial
differentiation markers using real-time PCR
analysis. mRNA was purified from the cell aggregates and cDNA was generated.
Using TTF1 (Figure 4a), AQ3
(Figure 4b) and AQ5 specific primers, results were analysed relative to beta-
actin as internal control.
On Figure 4 a. mRNA levels of TTF-1 in 3D human lung micro-tissues are
indicated. TTF1 transcription factor
is a characteristic marker of alveolar epithelial cells. While 3D fibroblast
cultures show no TTF1 expression,
TTF1 is present in 3D SAEC monocultures and increased in 2D SAEC/NHLF co-
cultures indicating the
beneficial effect of fibroblasts. The highest level of TT1 expression was
reached in 3D SAEGNHLF tissues.
Figure 4b. shows mRNA levels of AQP-3 water transporter in 3D human lung micro-
tissues. AQ3 is an ATI1
epithelial type marker in the lung. While 3D fibroblast cultures show no AQ3
expression, AQ3 is present in 3D
SAEC monocultures and increased in 2D SAEC/NHLF co-cultures indicating the
beneficial effect of
fibroblasts, but the highest level of AQ3 was still observed in 3D SAEC/NHLF
tissue cultures.
Thus, the above markers indicated an inducible increase in ATII type
differentiation that was further supported
by no increase in ATI type marker expressions.
The purified differentiated cell types we used in the experiments were
obtained from commercial sources.
Although these cell types originated from differentiated tissues, once they
were purified and kept in 2D culture
conditions the cells have shown almost immediate signs of dedifferentiation
indicated by increased level of
S100A4 (Figure 6 and Table 2). Once SAEC was co-cultured with NHLF, S100A4 and
N-cadherin levels
decreased significantly, while the E-cadherin levels increased. The "cadherin-
switch" [Zeisberg M and E.G.
Neilson (2009)]was more prominent in 3D than in 2D culture conditions (Figure
6) indicating that apart from
the presence of NHLF, the 3D structure was also necessary to decrease
dedifferentiation of SAEC.
These changes are also a feature of epithelial-mesenchymal transition (EMT),
characteristic for the epithelial
.. dedifferentiation process.
Pro-inflammatory cylokine expression
As triggered by pulmonary infection Of alveolar epithelial injury (disruption
of continuous epithelial cell layer)
pro-inflammatory cytokines are produced by the alveolar epithelium to attract
inflammatory cells, including
ncutrophils. To test CXCL-8 pro-inflammatory cytokinc expression, CXCL-8
protein levels were tested from
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
cellular supernatants of 2D mono and co-cultures and 3D tissue co-cultures,
set up as seen in Figure 3. Using a
commercially available ELISA test kit (R&D Laboratories) it has become
apparent that CXCL-8 expression
levels were significantly reduced in 3D tissue systems compared to
conventional 2D tissue cultures (Figure 7.a)
and the lowest levels were detected where epithelial cell ratios were the
highest, implicating that CXCL-8
expression is triggered by discontinuation in epithelial cell layers.
On the diagram on Figure 7.a CXCL-8 secretion is shown in a human, in vitro,
3D lung model. It was found that
3D monocultures of fibroblasts secreted no CXCL-8, while 3D SAEC still
produced the cytokine, (although to a
lesser degree than 2D SAEC cultures - data not shown). 2D co-cultures didn't
significantly alter CXCL-8
expression, indicating, that the presence of fibroblasts cannot influence
cytokine expression. CXCL-8
expression levels were significantly reduced in 3D tissue system where 75/25 %
was the epithelial-fibroblast
ratio, where epithelial cells essentially fully covered the fibroblast sphere,
implicating that CXCL-8 expression
can be triggered by discontinuation in the alveolar epithelial cell layer.
This reduction in CXCL-8 expression
was somewhat less pronounced at a ration of 50/50% and 25/75%.
Inflammatory cytokines IL-lbeta and IL-6 mRNA levels were also investigated
using quantitative real time RT-
PCR analysis. In 3D cultures compared to the respective 2D cultures, both IL-
lbeta and IL-6 mRNA levels
were significantly down-regulated (Figure 7B and 7C, respectively), when the
PCR was performed from the
mix of SAEC-NHLF mRNA. Once SAEC cells were sorted out from 2D and 3D NHLF co-
cultures, decreased
expression of IL-lbeta and IL-6 in SAEC cultured in 3D conditions was even
more striking (Figure 7D).
LXAMPLE 5 - Three-cell type model with epithelial, endothelial and fibroblast
components
To further improve the complexity our lung tissue culture model we added
primary human lung-derived
microvascular endothelial cells (HMVEC) to SAEC and NHLF cells and set up 2D
and 3D tissue micro-cultures
similarly to the SAEC and NHLF co-cultures.
Morphological examination of the micro-tissues by fluorescent and confocal
microscopy revealed, that
HMVECs could successfully be co-cultured with both SAEC and NHLF cells in 3D
conditions (Figure 8.a).
Interestingly, in co-cultures with either SAEC or NHLF, HIVIVECs formed the
inner, compact core of the
micro-cultures. When the three cell types (1:1:1) were cultured together in 3D
conditions, they adhered together
and formed a markedly compact and stable 3D structure (Figure 8.b).
Molecular characterization of three-cell cultures revealed that the level of
AQP3 and KRT7 expression
increased remarkably in 3D cultures compared to that of measured in 2D culture
conditions (Figure 9.a and
Table 2). The level of EMT markers S100A4 and N-cad were increasing when cells
were kept in 2D cultures,
but stabilized in 3D cultures. The slight decrease of E-cad in 3D cultures was
less than detected in 2D culture
conditions (Figure 9.a and Table 2). As the quantitative RT-PCR was performed
from the mixed mRNA of the
three cell types, further analysis of the three cell type 3D cultures is
required, however, to discover the optimal
proportions of the three cell types that would aid tissue building from
purified tissue elements.
Table 2 shows gene expression changes in human primary lung cell cultures.
Numbers are RQ values,
calculated according to the formula RQ = 2 , where ddCt values were
calculated as ddCt = dCt(sample) -
clCA(reference sample). Except for Sorted SAEC**, where data are presented as
dCt values, calculated as
follows: clCt= Ct(target gene) - Ct(housekeeping gene). A part of collected
cells before the set-up of the various
cultures were used always as reference samples. Delta Ct (dCt) values were
calculated as follows: dCt(target
gene) = Ct(target gene)- Ct(housekeeping gene). 18S ribosomal RNA was used as
housekeeping gene, except in
case of Sorted SAEC** saples, where actin was used as housekeeping gene.
26
1
I 2 dimensional cultures 3 dimensional cultures
0
IJ
Gene SAEC only SAEC-NHLF SAEC-NHLF- NHLF only Sorted
SAEC only 1 SAEC-NHLF -TSAEC-NHLF- ' NHLF
only Sorted c
1--,
i HMVEC SAEC**
HMVEC c
SAEC** 4,
r.o
oe
1 AQP3 6,890182077 11,40487803 ' 0,271602751 0,674274063
9,771933 5,78456172 13,31255896 3,62800556 2,854211675
8,571433
AQP4 N.D. N.D. N.A. N.D. N.C. N.C.
N.C. N.A. N.D. N.C.
;
;
AQP5 N.C. N.C. N.A. N.C. N.C. N.C.
N.C. N.A. N.C. N.C.
...............................................................................
......................... 4-
E-cad 2,409657267 1,772261436 0,215508996 N.D. 7,976 0,644138229
3,016491578 0,296617715 N.D. 6,4226
;
IL-lb 5,728006854 29,60546927 N.A. N.D. 4,6346 1
0,667615932 2,016755678 N.A. N.D. 5,7802 a
...............................................................................
......................... 4 ......
IL-6 5,189026016 28,09596712 N.A. 0,807285548
7,425867 i 0,114404135 8,323721329 N.A. 0,498089943 10,67543
0
n)
.-.1
...............................................................................
............... ; 61
.................................................. ====^"."4.
....................................... ".."+"""." .. 0
KRT7 4,851098336 7,462934362 2,181196885 N.D. -1,46075 r
1,34235123 3,684848466 3,765852951 rN.D. 0,4287 .-.1
N
al
N-cad 0,527520842 11,111301286
9,374683602 0,132931047 .4---6,17955 a 0,05583254 1
0,095682573 1,244810959 1 0,056255969-4- 11,4096 , 18
S100A4 2,536012377 0,421634905 ' 1,860860619 i- 0,380836664
8,929833 'r 2,03353463 0,415210465 1,050573185 1 0,157182738
6,653061
SETPA1 N.D.* Low* N.D.* N.D.* N.A. N.D.*
High* N.D.* N.D.* N.A.
.................................................... 1
............................................... + ......
SFTPB N.D. N.C. N.D. N.D. 5 N.A. N.C.
N.C. N.D. N.D. N.A.
......... % ...
____________________________________________________ 1 ...
SFTPC N.D. N.C. N.D. N.D. 5 N.A. N.C.
N.C. N.D. N.D. NA
TTF-1 1,023345722 0,863026227 _____
--'r
N.A. N.D. 1 10,351
0,926426355 1,059201358 N.A. N.D. 8,034067 1
...............................................................................
................................... .:1
Abbreviations: N.A.: N.A.: data are not available, expression level was not
determined. N.D.: No specific PCR product was detected with real-time QPCR.
N.D.*: No specific PCP,
product was detected with conventional PCR. N.C.: Specific expression levels
were not consequent in parallel wells or samples with real-time QPCR. Low*:
Relatively lc'S'
c
un
expression levels were detected by conventional PCR. High*: Relatively high
expression levels were detected with conventional PCR. 1--,
--4
oe
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
Summary of results with cellular markers and factors secreted by the cells
Here we provide evidence that 3D co-culturing of primary pulmonary epithelial
cells with fibroblasts is more
advantageous for SAEC to maintain a more differentiated status than in either
2D or 3D in vitro monocultures.
Inclusion of NHLFs not only facilitated epithelial differentiation but the
cohesion and structure of the 3D micro-
tissues were much more firm and compact compared to SAEC-only (Figure 3) or
SAEC-HMVEC (Figure 8.a)
cultures.
TTF1 transcription factor is a characteristic general marker of alveolar
epithelial cells during embryonic
development and after birth in ATIT cells. Cytokeratins are components of the
intermediate filaments of the
cytoskeleton and their expression patterns are important in cell lineage
identification. In our experiments, lung
epithelial markers TTF-1 and cytokeratin 7 KRT7 showed elevated expression
levels in 3D co-cultures.
Type II pneumocytes facilitate transepithelial movement of water (via members
of the aquaporin protein (AQP)
family). ATII marker Aquaporin 3 show elevated levels in the presence of
fibroblasts (Figure 5) Secretion of
surfactant proteins is a unique feature of ATII lung epithelial cells. [Dobbs,
L.G. (1989), Alcorn, J.L., et al.,
(1997) ] In our experiments, SAEC cells in monocultures failed to express
surfactant proteins, while surfactant
protein Al mRNA was consequently expressed in 3D and at a lesser amount in 2D
co-cultures.(Figure Sc)
However, surfactant proteins B and C were not consequently detectable in our
3D co-culture systems (data not
shown). We also examined the expression of ATI markers Aquaporin 4 and 5 in
both 2-cell and 3-cell cultures,
but the expression of these molecules was not consequently detectable, either,
presumably because the cells
(SAEC) used herein are rather of the ATII type. Moreover, a considerable
amount of time is needed for ATI
differentiation (data not shown). During a somewhat longer culturing time, if
cells with ATI type characteristics
are used, ATI markers would appear.
Thus, except of SFPC, differentiation markers AQP3, KRT7, TTF1 and SFPA were
up-regulated in the
presence of fibroblasts. Levels of AQP3 and SFTPA but not KRT7 or TTF1
differentiation markers were further
increased in 3D culture conditions.
5100A4 is a well-known molecular marker for epithelial-mesenchymal transition
and the level of its expression
is often high in metastatic carcinomas [Sherbet, G.V et al. 2009] as well as
in lung fibrosis [Guarino, M. et al.,
2009]. Up-regulation of S100A4 and N-cadherin and parallel down-regulation of
E-cadherin [Zeisberg, M. and
E.G. Neilson, (2009), Seike, M., et al., (2009)] are also features of
epithelial-mesenchymal transition (EMT),
that is characteristic for the epithelial dedifferentiation process and is
characterized by loss of cell adhesion,
repression of E-cadherin expression, and increased cell mobility.
De-differentiation markers Si 00A4 and N-cadherin appeared in purified primary
cells in 2D culture conditions.
The above de-differentiation markers decreased in the presence of fibroblasts
and further decreased in 3D
conditions.
Decrease of inflammatory markers including ILlb, IL6 and CXCL8 could be
observed in 3D cultures in
comparison with 2D cultures. Said markers were significantly down-regulated in
3D culture conditions; the
mere presence of fibroblasts, e.g. in 2D cultures, were not sufficient to
decrease their levels.
SFTPA1 expression was observed in 2-cell but not in 3-cell cultures. (Figure
5.c and data not shown).
EXAMPLE 6 ¨Disease models
Lung tumor models from lung tumor cell lines.
Artificial three dimensional lung tissue culture is prepared as described in
Example 3 with the following
modification.
28
CA 02760768 2016-08-23
Instead of epithelial cells (SAEC) a combination of type II alveolar
epithelial cells (A549) and 5-20% of CLI3
or CL30 cells (Wardlaw ct al., Molecular Pharmacology, 62, 326-333 2002),
derived from NNK [4-
(methylnitrosamino)-1-(3-pyridal)-1-butanonel treated A/J mouse, a model of
lung adenocarcinoma [Bclinsky et
al. (1992)] is used. CLI3 or CL30 cells carry mutations of the Ki-ras gene.
A series of experiment is performed to find appropriate ratio of A549 cells
and CL 13 or CL30 cells. A ratio
when tumor is spontaneously formed is used to prepare a 3D lung model tissue,
which is used as a lung tumor
disease model.
In an alternative of the above method patient tumor cells are used.
Mod? fication of secreted fitctor composition in primary cell aggregates using
genetically modified and sub-
lethally irradiated cell lines
All cell types are left non-infected, gene expressions therefore are as normal
as in any Riven three dimensional
lung tissue model. Cellular composition of the aggregates however contains sub-
lethally irradiated cells (5-10%
of total cell number of the aggregate) ¨either fibroblast (WI-38) or alveolar
epithelial (A549) cell lines that are
genetically modified and produce secreted factors (Wnt-s, Bone Morphogenic
Protein (BMP)-s, inflammatory
and pro-inflammatory cytokines, growth factors, etc) that modify the cellular
microenvironment within the
aggregates.
Native three dimensional pulmonary cell aggregates
To mimic inflammatory conditions, native three dimensional pulmonary cell
aggregates are treated with various
concentrations of bacterial cell wall extracts. Cytokine production is
determined using cytokine specific ELISA
techniques from tissue culture media, gene expression changes both in
epithelial and fibroblasts can be
quantified by real-time PCR reactions.
EXAMPLE 7 - 31) Lung tissue kit
In this example a lest-ready 3C lung tissue kit of the following features is
prepared:
1. Test-ready lung tissue is delivered in 96 well plates.
2. Small (80 000 cells/well) samples of lung model tissue, ready for
experiments or testS-, arc present in
the wells.
3. Each tissue consists of a mixed culture of human primary alveolar
epithelium and fibroblasts (25, 50
and 75 % epithelium respectively).
4. The plate contains 3-3 wells of controls (epithelium and fibroblasts
only).
5. The plates are sealed with a transparent, preferably adhesive, plastic
foil, e.g. with Saranrap '
The quality of tissue is guaranteed for three days, including delivery.
The plate itself is a 96, V-bottom well, non-adhesive tissue culture plate.
The model tissue is prepared as described in EXAMPLE 3. Each tissue is
submerged in 200 1 of tissue culture =
medium, optimal for lung culture in 5% CO2 environment, sealed and delivered
at room temperature or on ice.
Quality control: one tissue is taken from each well and viability is tested.
The differentiation markers are tested
by real-time PCR.
On request, a 21) control plate (tissue grown in 96-well, flat-bottom,
adhesive tissue culture plate) can be
included to accompany the 3D tissue.
INDUSTRIAL APPLICABILITY
Above, basic parameters and culture conditions are established for an ATII-
type tissue scaffold free lung model,
where spontaneous self-assembly of cells and cellular interactions can be
studied. The model allows easy
29
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
handling and genetic manipulation of complex tissue systems in both
theoretical and applied research and in
pharmaceutical testing. The model is also easily expanded by additional cell
types to include endothelial cell for
vascularization and even smooth muscle cells, where further reciprocal tissue
and cellular interactions can be
studied.
The scaffold-free 3D culturing allows trouble-free genetic manipulation of
simple or more complex tissue
systems in either theoretical or applied research and in pharmaceutical
testing. This pulmonary tissue model is
especially suitable for studying spontaneous self-assembly of cells and
cellular interactions. Both biomedical
research and pharmaceutical corporations are in need for in vitro models to
enhance the effectiveness of the
prediction for toxicity or efficacy of drug candidate molecules in the
preclinical stage. [Kramer, J.A. et al. 2007]
The newly set guidelines also put emphasis on the replacement of animal models
and urge the development of
new preclinical testing methods. [Innovative Medicine Research Initiative
Strategic Research Agenda. 2008,
European Technology Platform.]
Based on the above model and using various gene delivery methods and variable
target genes, our 3D human
pulmonary micro-tissue model system is easily adaptable to study genetic
changes during pulmonary diseases
that can lead to identification of novel drug targets and development of novel
therapies. These disease models
may include inflammatory models, tumor model, lung fibrosis model, or a
regeneration model.
Three dimensional models of healthy lung tissue as well as disease tissues are
available. The product according
to the invention can be marketed e.g. in the form of tissue cultures, plates
or arrays comprising such cultures or
kits.
REFERENCES
Alcorn, J.L., et al., (1997). Primary Cell Culture of Human Type II
Pneumonocytes: Maintenance of a
Differentiated Phenotype and Transfection with Recombinant Adenoviruses. Am.
J. Respir. Cell Mol. Biol.,
17(6): p. 672-682.]
Bclinsky ct al., (1992). Role of the alveolar type II cell in the development
and progression of pulmonary tumors
induced by 4-(methylnitmsamino)-1-(3-pyridy1)-1-butanone in the A/J mouse.
Cancer Res. 52 3164-3173
Bellusci, S., J. Grindley, et al. (1997). "Fibroblast growth factor 10 (FGF10)
and branching morphogenesis in
the embryonic mouse lung." Development. 124(23): 4867-4878.
Bruno, NI. D., R. J. Bohinski, et al. (1995). "Lung cell-specific expression
of the murine surfactant protein A
(SP-A) gene is mediated by interactions between the SP-A promoter and thyroid
transcription factor-1."
J.Biol.Chem. 270: 6531-6536.
Cardoso, W. V. (2001). "Molecular regulation of lung development." Annu Rev
Physiol. 63: 471-494.
Colvin, J. S., A. C. White, et al. (2001). "Lung hypoplasia and neonatal death
in Fgf9-null mice identify this
gene as an essential regulator of lung mesenchyme." Development 128(11): 2095-
2106.
Colvin, J. S., B. Feldman, et al. (1999). "Genomic organization and embryonic
expression of the mouse
fibroblast growth factor 9 gene." Dev Dyn. 216(1): 72-88.
De Moerlooze, L., B. Spencer-Dene, et al. (2000). "An important role for the
IIIb isoform of fibroblast growth
factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse
organogenesis." Development
127(3): 483-492.
Dobbs, L.G., (1989). Pulmonary Surfactant. Annual Review of Medicine, 40(1):
p. 431-446.;
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
Giard D. J. et al. (1973). In vitro cultivation of human tumors: establishment
of cell lines derived from a series
of solid tumors. J. Natl. Cancer Inst. [Bethesda] 51: 1417-1423
Guarino, M., A. Tosoni, and M. Nebuloni, (2009). Direct contribution of
epithelium to organ fibrosis:
epithelial-mesenchymal transition. Human Pathology, 40(10): p. 1365-1376.
Hare, K.J., E.J. Jenkinson, and G. Anderson, (1999). In vitromodels of T cell
development. Seminars in
Immunology, 11(1): p. 3-12.
Hare, K.J., E.J. Jenkinson, and 0. Anderson, (1999). In vitromodels of T cell
development. Seminars in
Immunology, 11(1): p. 3-12.
Honig, M. G. and R. I. Hume (1989). "Dil and diO: versatile fluorescent dyes
for neuronal labelling and
pathway tracing." Trends Neurosci. 12(9): 333-335.
Honig, M. G. and R. I. Hume (1989). Trends Neurosci. 12(9): 333-335.
Hughes Tracy et al., a poster presented at National Center for Replacement,
Refinement and Reduction of
animals in Research, Showcasing the 3Rs Portcullis House, 28 February 2007
Ikeda, A., J. C. Clark, et al. (1995). "Gene structure and expression of human
thyroid transcription factor-1 in
respiratory epithelial cells." J. Biol.Chem. 270: 8108-8114.
Innovative Medicine Research Initiative Strategic Research Agenda. 2008,
European Technology Platform.
Konigshoff, M., ct al., (2008). Functional Wnt Signaling Is Increased in
Idiopathic Pulmonary Fibrosis. PLoS
ONE, 3(5): p. e2142.
Kramer, J.A., J.E. Sagartz, and D.L. Morris, (2007). The application of
discovery toxicology and pathology
towards the design of safer pharmaceutical lead candidates. Nat Rev Drug
Discov, 6(8): p. 636-649.
Kreda, S. M., M. C. Gynn, ct al. (2001). "Expression and localization of
epithelial aquaporins in the adult
human lung." Am. J. Respir. Cell. Mol. Biol. 24: 224-234.
Lazzaro, D., 1\4. Price, et al. (1991). "The transcription factor, TTF-1, is
expressed at the onset of thyroid and
lung morphogenesis and in restricted regions of the foetal brain." Development
113: 1093-1104.
Min, II., D. M. Danilenko, et al. (1998). "Fgf-10 is required for both limb
and lung development and exhibits
striking functional similarity to Drosophila branchless." Genes Dev. 12(20):
3156-3161.
Napolitano, AP, Chai, P et al. (2007). "Dynamics of the self-assembly of
complex cellular aggregates on
micromolded nonadhesive hydrogels." Tissue Eng. 13(8): 2087-94.
Neagu, A. (2006). "COMPUTATIONAL MODELING OF TISSUE SELF-ASSEMBLY." Modem
Physics
Letters B 20: 1207-1231.
Nichols, J.E. and J. Cortiella, (2008). Engineering of a Complex Organ:
Progress Toward Development of a
Tissue-engineered Lung. Proc Am Thorac Soc,. 5(6): p. 723-730.
Omitz, D. M. and N. Itoh (2001). "Fibroblast growth factors." Genome Biol.
2(3): 3005.
Seike, 1\4., et al., (2009). Epithelial to Mesenchymal Transition of Lung
Cancer Cells. Journal of Nippon
Medical Scool, 76(4): p. 181-181.
Sekine, K., II. Ohuchi, et al. (1999). "Fgf10 is essential for limb and lung
formation." Nat Genet. 21(1): 138-
141.
Shannon, J. 1\4. and B. A. Hyatt (2004). "Epithelial-Mesenchymal Interactions
in the Developing Lung."
Annual Review of Physiology 66: 625-645.
Sherbet, G.V., (2009). Metastasis promoter S100A4 is a potentially valuable
molecular target for cancer
therapy. Cancer Letters, 280(1): p. 15-30.
31
CA 02760768 2011-11-02
WO 2010/128464 PCT/1B2010/051978
Vertrees, RA, Zwischenberger, JB et al. (2008) "Cellular differentiation in
three-dimensional lung cell
cultures." Cancer Biol Ther. Mar; 7(3): 404-12.
Wang, X. Q., II. Li, et al. (2009) "Oncogenic K-Ras Regulates Proliferation
and Cell Junctions in Lung
Epithelial Cells through Induction of Cyclooxygenase-2 and Activation of
Metalloproteinase-9" Molecular
Biology of the Cell 20, 791-800.
Wang, X. Q., X. M. Duan, et al. (2005). "Carboxylluorescein Diacetate
Succinimidyl Ester Fluorescent Dye for
Cell Labeling." Acta Biochimica Biophysica Sinica 37(6): 379-385.
Wang, X. Q., X. M. Duan, et al. (2005). Acta Biochimica Biophysica Sinica
37(6): 379-385.)
Wardlaw et al., (2002). Transcriptional regulation of basal cyclooxygenase-2
expression... Molecular
Pharmacology, 62, 326-333
Yang, M. C., Y. Guo, et al. (2006). "The TTF-ETAP26 complex differentially
modulates surfactant protein-B
(SP-B) and -C (SP-C) promoters in lung cells." Biochem Biophys Res Commun.
344(2): 484-490.
Zeisberg, M. and E.G. Neilson, (2009). Biomarkers for epithelial-mesenchymal
transitions. The Journal of
Clinical Investigation, 119(6): p. 1429-1437.
Zhang, X., T. S. Stappenbeck, et al. (2005). "Reciprocal epithelial-
mesenchymal FGF signaling is required for
c ec al development." Development. 133: 173-180.
32
CA 02760768 2011-11-02
=
SEQUENCE LISTING IN ELECTRONIC FORM
In accordance with section 111(1) of the Patent Rules, this,
description contains a sequence listing in electronic form in
ASCII text format (file: 95377-1seq01-11-11v1.txt).
A copy of the sequence listing in electronic form is available
from the Canadian Intellectual Property Office.
The sequences in the sequence listing in electronic form are
reproduced in the following table.
SEQUENCE TABLE
<110> UNIVERSITY OF PECS
<120> LUNG TISSUE MODEL
<130> 95377-1
<140> POT/1E32010/051978
<141> 2010-05-05
<150> HO 90900819
<151> 2009-05-05
<160> 26
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for AQP3
<400> 1
agccccttca ggatttcca 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for AQP3
<400> 2
gacccaaatt ccggttcca 19
<210> 3
33
CA 02760768 2011-11-02
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for AQP4
<400> 3
gcgaggacag ctcctatgat 20
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for AQP4
<400> 4
actggtgcca gcatgaatc 19
<210> 5
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for AQP5
<400> 5
ccttgcggtg gzcatga 17
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for AQP5
<400> 6
atggggccct acccagaaaa c 21
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for E-cad
<400> 7
gaccggtgca atottcaaa 19
34
CA 02760768 2011-11-02
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for E-cad
<400> 8
ttgacgccga gagctacac 19
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for IL-lb
<400> 9
tcagccaatc ttcattgctc aa 22
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for IL-lb
<400> 10
tggcgagele aggtacttot g 21
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for IL-6
<400> 11
agggctettc ggcaaatgta 20
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for IL-6
CA 02760768 2011-11-02
<400> 12
gaaggaatgc ccattaacaa caa 23
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for KRT7
<400> 13
ccacccacaa tcacaagaag att 23
<210> 14
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for KRT7
<400> 14
tcactttcca gactgtctca ctgtot 26
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for N-cad
<400> 15
agcttctcac ggcatacacc 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for N-cad
<400> 16
gtgcatgaag gacagoctot , 20
<210> 17
<211> 14
<212> DNA
<213> Artificial Sequence
36
CA 02760768 2011-11-02
<220>
<223> Forward primer for S100A4
<400> 17
tggagaaggc cctg 14
<210> 18
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for S100A4
<400> 18
coctctttgc ccgagtactt g 21
<210> 19
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for SFTPA1
<400> 19
ccccttgtot gcaggattt 19
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for SE1PA1
<400> 23
atccctggag agtgtggaga 20
<210> 21
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for SFTPB
<400> 21
gcactttaaa ggacggtgto tt 22
<210> 22
37
CA 02760768 2011-11-02
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for SFTPB
<400> 22
gatgcccaca ccacctg 17
<210> 23
=
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for SPITC
<400> 23
aaagtccaca acttccagat gga 23
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for SFTPC
<400> 24
cctggcccag cttagacgta 20
<210> 25
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for TTF-1
<400> 25
catgtcgatg agtccaaagc a , 21
<210> 26
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for 1TF-1
<400> 26
gcccactttc ttgtagcttt cc 22
38
