Note: Descriptions are shown in the official language in which they were submitted.
CA 02836198 2013-12-09
Modified Plant Cell
Background to the Invention
In order to feed and fuel a growing world population against a backdrop of
threats to
harvests from climate change requires a dramatic leap in crop production of 40-
50%
by 2030 (IAASTD report (2009) Agriculture at a crossroads). Limitations of
nutrient,
light and water availability can have drastic detrimental effects on crop
yield. In
North America alone it is estimated that 40% of annual crop losses are due to
low
water availability (1AASTD report (2009) Agriculture at a crossroads; Lynch
(2011).
Plant Physiol 156:1041-9; Lynch (2013). Annals of Botany
doi:10.1093/aob/mcs293).
Similarly, sub-optimal levels of the essential nutrients phosphate and
nitrogen require
the application of fertilisers that are expensive to produce, have a
significant carbon
footprint, and can adversely affect natural habitats through run-off from
farmland.
The urgent need to improve crop performance while seeking to reduce fertiliser
and
irrigation inputs has brought renewed interest in the manipulation of
structural traits
to maximise nutrient-use efficiency, water-use efficiency and optimise the
capture of
solar energy. While the number and length of lateral branches produced by the
plant
have an important bearing on the extent of possible occupation of above and
below
ground space, it is the angle of growth of those branches that is the major
determinant
of the efficiency and effectiveness of resource capture both above and below
ground
(Lynch (2011) Plant Physiol 156:1041-9; Lynch (2013). Annals of Botany
doi:10.1093/aob/mcs293; Liao et al. (2001) Plant and Soil 232:69-79; Liao et
al.
(2004) Functional Plant Biology 31:959-70; Ouyang et al. (2011). J.
Integrative
Agriculture 1701-9). For example, shallow rooting genotypes in maize and bean
display up to a 50% increase in yield low phosphate soils (Liao et al. (2001)
Plant
and Soil 232:69-79; Liao et al. (2004) Functional Plant Biology 31:959-70).
The approach of breeders and biotechnology companies to the optimisation of
crop
architecture via the manipulation of GSA in crops has been severely limited by
the
1
CA 02836198 2013-12-09
complete lack of knowledge of the mechanisms underlying the regulation of
branch
angle. Hence approaches have been restricted to conventional breeding
practices that
are time-consuming and lack the precision required to optimise growth angle
without
compromising other performance traits.
The most desirable growth angle habit for root and shoot varies according to
the
agricultural environment. For example, in dry soils it can be advantageous to
have
steeper, more vertical lateral roots while, as noted above, in low phosphorous
soils, a
shallower, less vertical lateral root system can increase phosphate uptake
thereby
reducing or eliminating the need for additional inputs. Importantly, there are
also
crop-specific ideals for branch angle. For example, in oilseed rape a more
vertical
branch angle in the shoot canopy is desired because it improves light
penetration
during the crucial pod-filling phase prior to harvest.
The overall architecture of higher plants is determined by the number and
arrangement of lateral branches around the main root-shoot axis. The principal
function of these shoot and root branches is to hold leaves and other organs
to the
sun, and below ground, to facilitate the uptake of nutrients and water, and
provide
secure anchorage for the plant. Most commonly, these lateral root and shoot
branches
are set and maintained at specific angles with respect to gravity, a quantity
known as
the gravitropic setpoint angle (GSA). While the GSA of the primary root and
shoot is
typically approximately vertical, the GSA values of lateral shoots and roots
are most
often non-vertical, allowing the plant to optimise the capture of resources
both
above- and below-ground. Despite the importance of branch angle as a
fundamental
parameter of plant form, until recently the mechanism underlying the setting
and
maintenance of non-vertical GSAs was not known. A defining characteristic of
the
GSA concept is that upon being displaced from its GSA, an organ will rapidly
undergo a gravitropic response to return to its original angle of growth with
respect to
gravity (Digby RD and Firn J. (1995). Plant Cell Environ. 12:1434-40; Cline MG
(1996). Ann Bot (Lond) 78: 255-266). For the primary axis, in which vertically
growing roots and shoots have a GSA of 0 and 180 respectively, this is
readily
2
CA 02836198 2013-12-09
accounted for by the well-supported model for gravitropism proposed by
Cholodny
and Went (Mullen JP and Hangarter R, (2003). Advances in Space Research.
31:2229-2236; Morita MT (2010). Annu. Rev. Plant Biol. 61:705-20; Blancaflor
E.
B., Masson P. H. (2003). Plant Physiol. 133: 1677-1690): the orientation of
shoots
and roots is monitored in specialised gravity-sensing cells called statocytes
within
which starch-rich bodies called statoliths sediment according to the gravity
vector. As
such statoliths provide a biophysical sensor of statocyte orientation within
the gravity
field and displacement from the vertical leads to the PIN auxin efflux carrier-
mediated movement of auxin to the lower side in both root and shoot tissue.
This
auxin redistribution generates an asymmetry in auxin-regulated gene expression
between upper and lower tissues that drives organ-level bending growth (Morita
M T
(2010). Annu. Rev. Plant Biol. 61:705-20; Blancaflor E. B., Masson P. H.
(2003).
Plant Physiol. 133: 1677-1690). In the shoot, auxin promotes cell elongation,
causing
upward bending, while in the root auxin inhibits cell elongation, causing
downward
anisotropic growth (Morita M T (2010). Annu. Rev. Plant Biol. 61:705-20;
Blancaflor E. B., Masson P. H. (2003). Plant Physiol. 133: 1677-1690). The
magnitude of this gravitropic response can in many cases be described by sine
law,
formulated by von Sachs in 1882, which states that the strength of the
gravitropic
response is dependent on the sine of the initial displacement angle (Sachs J
(1882).
Arb Bot Inst Wu-rzburg 2:226-284. While there are species-specific differences
in
the range of displacement angles over which the sine law applies (Sachs J
(1882).
Arb Bot Inst Wu-rzburg 2:226-284; Galland P. (2002) Planta 215: 779-784), as a
general principle it is the case that the greater an organ is tilted away from
its GSA,
the greater the magnitude of the gravitropic response (Sachs J (1882). Arb Bot
Inst
Wtfrzburg 2:226-284; Galland P. (2002) Planta 215: 779-784).
In contrast to the primary axis, the robust maintenance of growth at non-
vertical
GSAs in lateral organs cannot be explained by standard model Cholodny-Went-
based
gravitropism as described above. We recently established the existence of a
mechanism, the anti-gravitropic offset (AGO), that counteracts gravitropic
response
3
CA 02836198 2013-12-09
specifically in the gravity-sensing cells of lateral branches but not in those
of the
primary root-shoot axis. Our key findings can be summarised as follows:
i. Gravity-dependent non-vertical growth of lateral root and shoot branches is
sustained by an anti-gravitropic offset (AGO) mechanism that operates in
tension
with gravitropic response to generate net non-vertical growth.
ii. The activity of the AGO requires auxin transport.
iii. The angle of growth of lateral root and shoot branches is dependent on
the
magnitude of this anti-gravitropic offset component; a stronger AGO induces
less
vertical growth and vice versa.
iv. Auxin regulates the magnitude of the AGO and hence the GSA of lateral
branches, separately from driving the anti-gravitropic growth itself.
v. Auxin's regulation of the AGO is effected, via TIR1/AFB-mediated
transcriptional
control, specifically in the gravity sensing cells of the root and shoot.
We have elucidated the means by which the growth angle of lateral root and
shoots
can be made either more or less vertical. The invention is therefore based on
the
finding that expressing regulators of auxin signalling in the gravity-sensing
cells of
the shoot and the root in higher plants is sufficient to alter the angles of
lateral root
and shoot branches in these species. For example, this may lead to plants
having
more vertical or less vertical lateral root and shoot branches. The targeted
manipulation of branch angle traits may play a significant role in enhancing
water
and nutrient acquisition and photosynthetic efficiency in plants (including
crops)
grown in a range of agricultural conditions.
Statements of the Invention
The disclosure relates to the manipulation of auxin signalling within the
gravity-
sensing cells of the root and shoot.
According to the invention there is provided a plant cell the genome of which
is
modified by the inclusion of a nucleic acid molecule adapted for expression in
a
4
CA 02836198 2013-12-09
gravity sensing cell wherein the nucleic acid molecule encodes a regulator of
auxin
signalling.
Preferably the plant cell is a transgenic plant cell.
As used herein a "gravity sensing cell" may be used interchangeably with
statocyte to
mean a cell which is responsive to gravitational forces. Statocytes contain
starch-rich
bodies called statoliths sediment according to the gravity vector.
As used herein a "regulator of auxin signalling" includes the protein
families: F-box
proteins called TRANSPORT INHIBITOR RESPONSE-1 (TIR1), or one of a small
family of related F-box proteins called Auxin signalling F-box Proteins
(AFBs),
auxin response factors (ARFs) and modified auxin/indole-3-acetic acid
(Aux/IAA)
transcriptional regulators (repressors).
ARF proteins have DNA binding domains and can bind promoter regions of genes
and activate or repress gene expression. AUX/IAA proteins can bind ARF
proteins
sitting on gene promoters and prevent them from doing their job. TIR1/AFB
proteins
are F-box proteins that have distinct domains giving them the ability to bind
to three
different ligands: a SKP1 protein (via the F-box domain) that tethers the F-
box
proteins to the other subunits of the SCFTIRI/AFB ubiquitin ligase complex,
auxin (so
TIR1/AFB proteins are auxin receptors), and AUX/IAA proteins (auxin and
AUX/IAA proteins bind to a common pocket in TIR1 formed from adjacent leucine-
rich repeats). Upon binding of auxin, a TIR1/AFB protein's auxin/AUX/IAA
binding
pocket has increased affinity for AUX/IAA repressor proteins, which when bound
to
TIR1/AFB and its SCF complex undergo ubiquitination and subsequent degradation
by a proteasome. The degradation of AUX/IAA proteins frees ARF proteins to
activate or repress genes at whose promoters they are bound.
In a preferred embodiment of the invention, the regulator of auxin signalling
is an
ARF which can be either transcriptional Activators (ARFA) or repressors
(ARFR).
5
CA 02836198 2013-12-09
Whether an ARF is an ARFA or ARFR depends on the make-up of a variable region
between the defined amino- and carboxy-terminal domains known as the middle
region (MR). The middle region (MR) of ARF proteins is flanked at its amino-
terminal end by the conserved ARF DNA binding domain (DBD) and at its carboxy-
terminal end by the conserved protein interaction domains III and IV (that
also occur
in Aux/IAA proteins). For reference, a highly conserved RVSP/LWEINE motif
occurs close to the end of the DBD and similarly, a TXXKVQ/Y/H motif (where X
can be any amino acid) occurs close to the start of domain III. Thus the MR
occurs
between these motifs. A small number of ARFs lack the carboxy-terminal domains
III and IV and in these cases the MR can be considered to run from the end of
the
DBD to the carboxy-terminus of the protein.
ARFAs have a MR that is glutamine/Q-rich and promote transcription (Ulmasov, T
et
al (1997b). Proc Natl Acad Sci USA 96: 5844-5849; Tiwari et al. (2003). Plant
Cell
15(2): 533-543). As used herein "glutamate rich" is intended to include those
MRs
having about 13 to 18% glutamate residues. This is in contrast to ARFRs that
have an
MR which is not glutamate rich (generally has between 5 and 8% glutamate
residues). MRs rich in proline/serine/threonine (P/SIT) residues act as
repressors of
transcription (Ulmasov et al. (1997). Proc Natl Acad Sci U S A 96: 5844-5849;
Tiwari et al. (2003). Plant Cell 15(2): 533-543. Of the 23 ARFs in
arabidopsis, only
5 (ARFs 5,6,7,8,19) fall into the activating class while the remainder are
repressors
(Ulmasov, T et al (1997b). Proc Natl Acad Sci USA 96: 5844-5849; Tiwari et al.
(2003). Plant Cell 15(2): 533-543) The MR of ARFR proteins also contain other
features that distinguish them from the ARFA subclade. These include a so-
called B3
repression domain (BRD) corresponding to the well conserved R/KLFGFN/1XL/IN
sequence (Ikeda and Ohme-Takadi, (2009) Plant Cell Physiol. 50(5):970-975) or
the
less well characterised but related F/I/LXLFGQ/KN/AXI sequence. Many ARFR
MRs also contain additional LxLxL EAR-type repression domains (Hiratsu et al.
(2004) Biochem Biophys Res Comnzun 321:172-178). There is a broad agreement
that
both BRD and EAR domains represent the interaction domains with the TPL/TPR
6
CA 02836198 2013-12-09
family of co-repressor proteins (Causier et al. (2012) Plant Physiol. 158:423-
438). In
summary, the MRs of ARFR are distinguished from those of ARFA by their lower
relative glutamine content and by the presence of at least one BRD or related
repression domain, and often the additional presence of typical EAR domain.
The regulator of auxin signalling may be an AREA which may be selected from
ARF5, ARF6, ARF7, ARF8 and ARF19.
The regulator of auxin signalling may be an ARFR which may be selected from
ARF I , ARF2, ARF3, ARF4, ARF9, ARF10, ARF11, ARF12, ARF13, ARF14,
ARF15, ARF16, ARF17, ARF18, ARF20, ARF21, ARF22, ARF23.
The regulator of auxin signalling may be a modified version of an Aux/IAA
transcriptional repressor. The term "Aux/IAA" encompasses any Aux/IAA that is
capable of interaction with an ARF, especially an AREA, and has repressor
activity,
the latter which is mediated sequences in domain I of the protein (Tiwari et
al., Plant
Cell, 16: 533-543 (2004)). AwdIAAs interact with ARFA via carboxyl terminal
domains II and IV within the Aux-IAA (Kim et al., PNAS, 94:11786-11791 (1997);
Tiwari et al., Plant cell, 15:533-543 (2003. In Arabidopsis thaliana, the
AUX/IAA
may be selected from IAAI to IAA34 (note that in the nomenclature of the
Arabidopsis thaliana AUX/IAA family the names IAA21, IAA22, IAA23, IAA24,
IAA25 are not used).
Examples of modified versions of AmdIAA falling within the present invention
include auxin resistant3-I (axr3-1), axr3-3, and bodenlos (bdl) (Rouse et al.,
(1998)
Science 279:1371-1373; Hamann et al. (2002) Genes Devel. 16:1610-1615).
The regulator of auxin signalling may be TIR1 (transport inhibitor response 1)
protein or AFB, for example AFB1, AFB2, AFB3, AFB4 or AFB5.
7
CA 02836198 2013-12-09
According to an aspect of the invention there is provided a plant cell the
genome of
which is modified by the inclusion of a nucleic acid molecule adapted for
expression
in a gravity sensing cell wherein the nucleic acid molecule is selected from:
i) a nucleic acid molecule encoding a polypeptide, or part thereof, with
ARF activity;
ii) a nucleic acid molecule encoding a modified polypeptide, or part
thereof, with Aux/IAA activity which modification is by the addition, deletion
or substitution of at least one nucleotide characterized in that said
modification provides an Aux/IAA which has increased activity when
compared to a non-transgenic reference cell of the same plant species; and
iii) a nucleic acid molecule encoding a polypeptide, or part thereof, with
TIR1 or AFB activity.
As used herein "part thereof' is intended to encompass truncated versions of
proteins
which retain transcription activator activity or auxin receptor activity.
In a preferred embodiment of the invention the nucleic acid molecule in (i)
encodes
an activating ARF, for example selected from ARF5, ARF6, ARF7, ARF8 and
ARF19. Preferably, the ARF is ARF7.
In a preferred embodiment of the invention the nucleic acid molecule in (ii)
is
modified by the addition, deletion or substitution of at least one nucleotide
characterized in that said modification provides an Aux/IAA which has
increased
activity when compared to a non-transgenic reference cell of the same plant
species.
According to an aspect of the invention there is provided a transgenic plant
cell the
genome of which is modified by the inclusion of a nucleic acid molecule
adapted for
expression in a gravity sensing cell wherein the nucleic acid molecule is
selected
from:
i) a nucleic acid molecule comprising a nucleic acid sequence as
represented in
Figure la, lb, lc, id or le;
8
CA 02836198 2013-12-09
i) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure la, lb, lc, 1 d or le
and encodes a polypeptide with ARF activity;
ii) a nucleic acid sequence represented in Figure 2 wherein said nucleic
acid molecule is modified by the addition, deletion or substitution of
at least one nucleotide characterized in that said modification provides
a transcription regulator which has increased activity when compared
to a non-transgenic reference cell of the same plant species;
iii) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure 2 and encodes a
polypeptide with Aux/IAA activity;
iv) a nucleic acid molecule comprising a nucleic acid sequence as
represented in Figure 3a (TIRO, Figure 3b (AFB1), Figure 3c (AFB2),
Figure 3d (AFB3), Figure 3e (AFB4) or Figure 3f (AFB5); and
v) a nucleic acid
molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure 3a, 3b, 3c, 3d, 3e or
3f and encodes a polypeptide with auxin receptor activity.
As used herein "repressor activity" refers to the effect of the Aux/IAA
proteins in
preventing the transcriptional activity of ARFs. By modifying the Aux/IAA
polypeptides to introduce a stabilising mutation, the AwdIAAs have no or
reduced
binding to ARFs thereby allowing the ARFs to resume transcriptional activity.
In a preferred aspect of the invention there is provided a transgenic plant
cell the
genome of which is modified by the inclusion of a nucleic acid molecule
adapted for
expression in a gravity sensing cell wherein the nucleic acid molecule
comprises a
nucleic acid sequence selected from:
i) a nucleic acid molecule comprising a nucleic acid sequence as
represented in Figure la, lb, lc, Id or le; and
9
CA 02836198 2013-12-09
ii) a nucleic acid molecule that hybridizes under stringent
hybridization
conditions to the nucleic acid sequence in Figure la, lb, lc, id or le
and encodes a polypeptide with (ARF) transcription factor activity.
In a preferred embodiment of the invention said nucleic acid molecule
comprises a
nucleic acid sequence as represented in Figure la, lb, lc, id or le.
In a preferred embodiment of the invention said nucleic acid molecule
comprises a
nucleic acid sequence as represented in Figure lc or le.
In a preferred embodiment of the invention said nucleic acid molecule
comprises or
consists of a nucleic acid sequence as represented in Figure lc.
In a preferred embodiment of the invention said nucleic acid molecule
comprises a
nucleic acid sequence as represented in Figure if, lg, lh, Ii or 1 j.
In a preferred aspect of the invention there is provided a plant cell the
genome of
which is modified by the inclusion of a nucleic acid molecule adapted for
expression
in a gravity sensing cell wherein the nucleic acid molecule comprises a
nucleic acid
sequence selected from:
i) a nucleic acid molecule comprising a nucleic acid sequence encoding
a polypeptide with ARFR activity; and
ii) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in (ii) and encodes a
25R
polypeptide with ARF activity.
In a preferred embodiment of the invention said nucleic acid molecule
comprises a
nucleic acid sequence as represented in Figure 4a or 4b.
In a preferred aspect of the invention there is provided a transgenic plant
cell the
genome of which is modified by the inclusion of a nucleic acid molecule
adapted for
CA 02836198 2013-12-09
expression in a gravity sensing cell wherein the nucleic acid molecule
comprises a
nucleic acid sequence selected from:
i) a nucleic acid molecule comprising a nucleic acid sequence as
represented in Figure 3a (TIRO, Figure 3b (AFB1), Figure 3c (AFB2),
Figure 3d (AFB3), Figure 3e (AFB4) or Figure 3f (AFB5); and
ii) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure 3a, 3b, 3c, 3d, 3e or
3f and encodes a polypeptide with auxin receptor activity.
In a preferred embodiment of the invention said nucleic acid molecule
comprises a
nucleic acid sequence as represented in Figure 3a.
Hybridization of a nucleic acid molecule occurs when two complementary nucleic
acid molecules undergo an amount of hydrogen bonding to each other. The
stringency of hybridization can vary according to the environmental conditions
surrounding the nucleic acids, the nature of the hybridization method, and the
composition and length of the nucleic acid molecules used. Calculations
regarding
hybridization conditions required for attaining particular degrees of
stringency are
discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold
Spring Harbour Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen,
Laboratory Techniques in Biochemistry and Molecular Biology¨Hybridization with
Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). The Tn, is
the
temperature at which 50% of a given strand of a nucleic acid molecule is
hybridized
to its complementary strand. The following is an exemplary set of
hybridization
conditions and is not limiting:
Very High Stringency (allows sequences that share at least 90% identity to
hybridize)
Hybridization: 5x SSC at 65 C for 16 hours
Wash twice: 2x SSC at room temperature (RT) for 15 minutes each
Wash twice: 0.5x SSC at 65 C for 20 minutes each
11
CA 02836198 2013-12-09
High Stringency (allows sequences that share at least 80% identity to
hybridize)
Hybridization: 5x-6x SSC at 65 C-70 C for 16-20 hours
Wash twice: 2x SSC at RT for 5-20 minutes each
Wash twice: lx SSC at 55 C-70 C for 30 minutes each
Low Stringency (allows sequences that share at least 50% identity to
hybridize)
Hybridization: 6x SSC at RT to 55 C for 16-20 hours
Wash at least twice: 2x-3x SSC at RT to 55 C for 20-30 minutes each.
The present invention also includes nucleic acid molecules that share at least
30%
homology with a nucleic acid molecule of the invention. In particular, the
nucleic
acid molecule may have 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96% 97%, 98% or
99% homology to a nucleic acid molecule of the invention.
In a preferred embodiment of the invention said transcription factor,
preferably ARF,
or auxin receptor, activity is increased when compared to a non-transgenic
reference
plant of the same species. Preferably said activity is increased by at least
about 2-
fold above a basal level of activity. More preferably said activity is
increased by at
least about 5 fold; 10 fold; 20 fold, 30 fold, 40 fold, 50 fold. Preferably
said activity
is increased by between at least 50 fold and 100 fold. Preferably said
increase is
greater than 100-fold.
In a preferred embodiment of the invention said Aux/IAA activity is increased
when
compared to a non-transgenic reference plant of the same species. Preferably
said
activity is increased by at least about 2-fold above a basal level of
activity. More
preferably said activity is increased by at least about 5 fold; 10 fold; 20
fold, 30 fold,
40 fold, 50 fold. Preferably said activity is increased by between at least 50
fold and
100 fold. Preferably said increase is greater than 100-fold.
It will be apparent that means to increase the activity of a polypeptide
encoded by a
nucleic acid molecule are known to the skilled artisan. For example, and not
by
12
CA 02836198 2013-12-09
limitation, increasing the gene dosage by providing a cell with multiple
copies of said
gene. Alternatively or in addition, a gene(s) may be placed under the control
of a
powerful promoter sequence or an inducible promoter sequence to elevate
expression
of mRNA encoded by said gene. The modulation of mRNA stability is also a
mechanism used to alter the steady state levels of an mRNA molecule, typically
via
alteration to the 5' or 3' untranslated regions of the mRNA.
In a preferred aspect of the invention there is provided a transgenic plant
cell the
genome of which is modified by the inclusion of a nucleic acid molecule
adapted for
expression in a gravity sensing cell wherein the nucleic acid molecule
comprises a
nucleic acid sequence as represented in Figure 2a or Figure 2b, or a nucleic
acid
sequence with homology to the sequence represented in Figure 2a or Figure 2b
and
which encodes a protein with Aux/IAA activity, wherein said nucleic acid
molecule
is modified by the addition, deletion or substitution of at least one
nucleotide
characterized in that said modification provides an Aux/IAA which has
increased
activity when compared to a non-transgenic reference cell of the same plant
species.
Preferably the modification (or mutation) is within domain II of nucleic acid
sequence encoding an Aux/IAA. Domain II is highly conserved in all plant
species
studied to date. The domain consists of 13 amino acids with an almost
invariant
VGWPP motif (for positions 3-7 in this sequence). In Arabidopsis thaliana the
consensus Aux/IAA domain II sequence is QVVGWPPVRSYRIC. For reference, the
13 amino acid domain 11 of IAA17/AXR3 lies between amino acids 82-94 of the
protein (nucleic acid residues 248-287 in the coding sequence (Figure 2b)).
For
IAA12/BDL the 13 amino acid domain II lies between amino acids 69-81 of the
protein (nucleic acid residues 208-247 in the coding sequence Figure 2a). The
mutation may involve substitution within the VGWPP motif of a proline residue
with
a non-proline residue (such as serine or leucine).
13
CA 02836198 2013-12-09
In a preferred embodiment of the invention said nucleic acid molecule is a
vector
adapted for transformation of said plant cell. Preferably said vector is
adapted for the
over expression of said nucleic acid molecule.
Suitable vectors can be constructed, containing appropriate regulatory
sequences,
including promoter sequences, terminator fragments, polyadenylation sequences,
enhancer sequences, marker genes and other sequences as appropriate. For
further
details see, for example, Molecular Cloning: Laboratory Manual: 2nd edition,
Sambrook et al. 1989, Cold Spring Habor Laboratory Press or Current Protocols
in
Molecular Biology, Second Edition, Ausubel et al. Eds., John Wiley & Sons,
1992.
Specifically included are shuttle vectors by which is meant a DNA vehicle
capable,
naturally or by design, of replication in two different host organisms, which
may be
selected from actinomycetes and related species, bacteria and eukaryotic (e.g.
higher
plant, mammalian, yeast or fungal cells).
Preferably the nucleic acid in the vector is under the control of, and
operably linked
to, an appropriate promoter or other regulatory elements for transcription in
a host
cell such as a microbial, (e.g. bacterial), or plant cell. The vector may be a
bi-
functional expression vector which functions in multiple hosts. In the case of
GTase
genomic DNA this may contain its own promoter or other regulatory elements and
in
the case of cDNA this may be under the control of an appropriate promoter or
other
regulatory elements for expression in the host cell.
By "promoter" is meant a nucleotide sequence upstream from the transcriptional
initiation site and which contains all the regulatory regions required for
transcription.
Suitable promoters include constitutive, tissue-specific, inducible,
developmental or
other promoters for expression in plant cells comprised in plants depending on
design. Such promoters include viral, fungal, bacterial, animal and plant-
derived
promoters capable of functioning in plant cells.
14
CA 02836198 2013-12-09
Chemical-regulated promoters can be used to modulate the expression of a gene
in a
plant through the application of an exogenous chemical regulator. Depending
upon
the objective, the promoter may be a chemical-inducible promoter, where
application
of the chemical induced gene expression, or a chemical-repressible promoter,
where
application of the chemical represses gene expression. Chemical-inducible
promoters are known in the art and include, but are not limited to, the maize
In2-2
promoter, which is activated by benzenesulfonamide herbicide safeners, the
maize
GST promoter, which is activated by hydrophobic electrophilic compounds that
are
used as pre-emergent herbicides, and the tobacco PR-la promoter, which is
activated
by salicylic acid. Other chemical-regulated promoters of interest include
steroid-
responsive promoters (see, for example, the glucocorticoid-inducible promoter
in
Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis
et al.
(1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline-
repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet.
227:
229-237, and US Patent Nos. 5,814,618 and 5,789,156, herein incorporated by
reference.
Where enhanced expression in particular tissues is desired, tissue-specific
promoters
can be utilised. Tissue-specific promoters include those described by Yamamoto
et
al. (1997) Plant J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol.
38(7):
792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al.
(1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol.
112(3):
1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni
et al.
(1996) Plant Physiol. 112(2): 513-524; Yamamoto et al. (1994) Plant Cell
Physiol.
35(5): 773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et
al.
(1993) Plant Mol. Biol. 23(6): 1129-1138; Mutsuoka et al. (1993) Proc. Natl.
Acad.
Sci. USA 90 (20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3):
495-50.
In a preferred embodiment of the invention the promoter is that of a gene that
is
expressed specifically in the gravity-sensing cells of the shoot (e.g.
SCARECROW
[SCR, AT3G54220; GENBANK: NM 115282 and Figure 5] or related genes, the
CA 02836198 2013-12-09
contents of which are incorporated by reference in their entirety, consisting
of 2500
bp upstream of the start of the SCR gene in Arabidopsis.
In a preferred embodiment of the invention the promoter is that of a gene that
is
expressed specifically in the gravity-sensing cells of the root (e.g. the ARL2
gene
[AT1G59980; GENBANK: NM 104690 and Figure 61 or related genes, the contents
of which are incorporated by reference in their entirety, consisting of 2441
bp
upstream of the start of the ARL2 gene in Arabidopsis).
The invention further provides an isolated nucleic acid molecule adapted for
expression in a gravity sensing cell wherein the nucleic acid molecule
comprises a
nucleic acid sequence encoding a protein involved in auxin signalling and a
promoter
that confers expression of said nucleic acid sequence in a gravity sensing
cell wherein
the nucleic acid sequence is selected from:
i) a nucleic acid molecule encoding an ARF;
ii) a nucleic acid sequence encoding an Aux/IAA wherein said
nucleic
acid molecule is modified by the addition, deletion or substitution of
at least one nucleotide characterized in that said modification provides
an Aux/IAA which has increased activity when compared to a non-
transgenic reference cell of the same plant species; and
i) a nucleic acid molecule encoding a TIR1 or AFB.
In one embodiment, the invention further provides an isolated nucleic acid
molecule
adapted for expression in a gravity sensing cell wherein the nucleic acid
molecule
comprises a nucleic acid sequence encoding a protein involved in auxin
signalling
and a promoter that confers expression of said nucleic acid sequence in a
gravity
sensing cell wherein the nucleic acid sequence is selected from:
i) a nucleic acid molecule comprising a nucleic acid sequence as
represented in Figure la, lb, lc, id or le;
16
CA 02836198 2013-12-09
ii) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure la, lb, lc, id or le
and encodes a polypeptide with (ARF) transcription factor activity;
iii) a nucleic acid sequence represented in Figure 2 wherein said nucleic
acid molecule is modified by the addition, deletion or substitution of
at least one nucleotide characterized in that said modification provides
an Aux/IAA which has increased activity when compared to a non-
transgenic reference cell of the same plant species;
iv) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure 2 and encodes a
polypeptide with Aux/IAA activity;
v) a nucleic acid molecule comprising a nucleic acid sequence as
represented in Figure 3a (TIR1), Figure 3b (AFB1), Figure 3c (AFB2),
Figure 3d (AFB3), Figure 3e (AFB4) or Figure 3f (AFB5); and
vi) a nucleic acid
molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure 3a, 3b, 3c, 3d, 3e or
3f and encodes a polypeptide with auxin receptor activity.
In a preferred aspect of the invention there is provided a nucleic acid
molecule
comprising a transcription cassette wherein said cassette includes a
nucleotide
sequence designed with reference to any one of Figures 1, 2 or 3 and is
adapted for
expression in a gravity sensing cell by provision of at least one promoter
operably
linked to said nucleotide sequence such that said nucleotide sequence is
expressed in
a gravity sensing cell. Preferably the promoter is suited to drive expression
of a
nucleotide sequence in the gravity sensing cells. The promoter may comprise
all or
part of the nucleic acid sequence represented in Figure 5 or Figure 6.
"Operably linked" means joined as part of the same nucleic acid molecule,
suitably
positioned and oriented for transcription to be initiated from the promoter.
DNA
operably linked to a promoter is "under transcriptional initiation regulation"
of the
promoter. In a preferred aspect, the promoter is an inducible promoter.
17
CA 02836198 2013-12-09
Particular of interest in the present context are nucleic acid constructs
which operate
as plant vectors. Specific procedures and vectors previously used with wide
success
upon plants are described by Guerineau and Mullineaux (1993) (Plant
transformation
and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed)
Oxford,
BIOS Scientific Publishers, pp 121-148. Suitable vectors may include plant
viral-
derived vectors (see e.g. EP-A-194809).
If desired, selectable genetic markers may be included in the construct, such
as those
that confer selectable phenotypes such as resistance to antibodies or
herbicides (e.g.
kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate,
gentamycin,
spectinomycin, imidazolinones and glyphosate).
Plants transformed with a DNA construct of the invention may be produced by
standard techniques known in the art for the genetic manipulation of plants.
DNA
can be introduced into plant cells using any suitable technology, such as a
disarmed
Ti-plasmid vector carried by Agrobacterium exploiting its natural gene
transferability
(EP-A-270355, EP-A-0116718, NAR 12(22):8711-87215 (1984), Townsend et al.,
US Patent No. 5,563,055); particle or microprojectile bombardment (US Patent
No.
5,100,792, EP-A-444882, EP-A-434616; Sanford et al, US Patent No. 4,945,050;
Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via
Microprojectile
Bombardment", in Plant Cell, Tissue and Organ Culture: Fundamental Methods,
ed.
Gamborg and Phillips (Springer-Verlag, Berlin); and McCabe et al. (1988)
Biotechnology 6: 923-926); microinjection (WO 92/09696, WO 94/00583, EP
331083, EP 175966, Green et al. 91987) Plant Tissue and Cell Culture, Academic
Press, Crossway et al. (1986) Biotechniques 4:320-334); electroporation (EP
290395,
WO 8706614, Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606;
D'Halluin et al. 91992). Plant Cell 4:1495-1505 other forms of direct DNA
uptake
(DE 4005152, WO 9012096, US Patent No. 4,684,611, Paszkowski et al. (1984)
EMBO J. 3:2717-2722); liposome-mediated DNA uptake (e.g. Freeman et al (1984)
Plant Cell Physiol, 29:1353); or the vortexing method (e.g. Kindle (1990)
Proc. Nat.
18
CA 02836198 2013-12-09
Acad. Sci. USA 87:1228). Physical methods for the transformation of plant
cells are
reviewed in Oard (1991) Biotech. Adv. 9:1-11. See generally, Weissinger et al.
(1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Sciences
and
Technology 5:27-37; Christou et al. (1988) Plant Physiol. 87:671-674; McCabe
et al.
(1988) Bio/Technology 6:923-926; Finer and McMullen (1991) In Vitro Cell Dev.
Biol. 27P:175-182; Singh et al. (1988) Theor. Appl. Genet. 96:319-324; Datta
et al.
(1990) Biotechnology 8:736-740; Klein et at. (1988) Proc. Natl. Acad. Sci. USA
85:
4305-4309; Klein et al. (1988) Biotechnology 6:559-563; Tomes, US Patent No.
5,240,855; Buising et al. US Patent Nos. 5,322, 783 and 5,324,646; Klein et
al.
(1988) Plant Physiol 91: 440-444; Fromm et at (1990) Biotechnology 8:833-839;
Hooykaas-Von Slogteren et al. 91984). Nature (London) 311:763-764; Bytebier et
al.
(1987) Proc. Natl. Acad. Sci. USA 84:5345-5349; De Wet et al. (1985) in The
Experimental Manipulation of Ovule Tissues ed. Chapman et al. (Longman, New
York), pp. 197-209; Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and
Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566; Li et al. (1993) Plant
Cell
Reports 12: 250-255 and Christou and Ford (1995) Annals of Botany 75: 407-
413;Osjoda et al. (1996) Nature Biotechnology 14:745-750, all of which are
herein
incorporated by reference.
Agrobacteriurn transformation is widely used by those skilled in the art to
transform
dicotyledonous species. Recently, there has been substantial progress towards
the
routine production of stable, fertile transgenic plants in almost all
economically
relevant monocot plants (Toriyama et al. (1988) Bio/Technology 6: 1072-1074;
Zhang et al. (1988) Plant Cell rep. 7379-384; Zhang et al. (1988) Theor. Appl.
Genet.
76:835-840; Shimamoto et al. (1989) Nature 338:274-276; Datta et al. (1990)
Bio/Technology 8: 736-740; Christou et al. (1991) Bio/Technology 9:957-962;
Peng
et al (1991) International Rice Research Institute, Manila, Philippines,
pp.563-574;
Cao et al. (1992) Plant Cell Rep. 11: 585-591; Li et al. (1993) Plant Cell
Rep. 12:
250-255; Rathore et al. (1993) Plant Mol. Biol. 21:871-884; Fromm et al (1990)
Bio/Technology 8:833-839; Gordon Kamm et al. (1990) Plant Cell 2:603-618;
D'Halluin et al. (1992) Plant Cell 4:1495-1505; Walters et al. (1992) Plant
Mol. Biol.
19
CA 02836198 2013-12-09
18:189-200; Koziel et at. (1993). Biotechnology 11194-200; Vasil, I.K. (1994)
Plant
Mol. Biol. 25:925-937; Weeks et al (1993) Plant Physiol. 102:1077-1084; Somers
et
al. (1992) Bio/Technology 10:1589-1594; WO 92/14828). In particular,
Agrobacterium mediated transformation is now emerging also as a highly
efficient
transformation method in monocots. (Hiei, et al. (1994) The Plant Journal
6:271-
282). See also, Shimamoto, K. (1994) Current Opinion in Biotechnology 5:158-
162;
Vasil, et al. (1992) Bio/Technology 10:667-674; Vain, et al. (1995)
Biotechnology
Advances 13(4):653-671; Vasil, et at. (1996) Nature Biotechnology 14: 702).
Microprojectile bombardment, electroporation and direct DNA uptake are
preferred
where Agrobacterium is inefficient or ineffective. Alternatively, a
combination of
different techniques may be employed to enhance the efficiency of the
transformation
process, e.g. bombardment with Agrobacterium-coated microparticles (EP-A-
486234) or microprojectile bombardment to induce wounding followed by co-
cultivation with Agrobacterium (EP-A-486233).
According to a further aspect of the invention there is provided a plant
comprising a
plant cell according to the invention. Preferably the plant is a transgenic
plant
comprising a transgenic plant cell according to the invention.
In a preferred embodiment of the invention said plant is selected from the
group
consisting of: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.),
flax
(Linum usitatissimum), alfalfa (Medicago saliva), rice (Oryza saliva), rye
(Secale
cerale), sorghum (Sorghum bicolor, Sorghum vulgare), squash (Curcurbita spp.),
tomato (Solanum lycopersicum), sunflower (Helianthus annus), wheat (Tritium
aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum
tuberosunz), peanuts (Arachis hypogaea), cotton (Gossypium hirsuturn), sweet
potato
(lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.),
switchgrass
(Panicum virgatum), elephant grass (Miscanthus giganteus), coconut (Cocos
nucifera), pineapple (Anana comosus), citris tree (Citrus spp.) cocoa
(Theobroma
cacao), tea (Camellia senensis), banana (Musa spp.), avocado (Persea
americana),
CA 02836198 2013-12-09
fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive
(Olea
europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia
(Macadamia intergrifolia), almond (Prunus amygdalus), sugar beets (Beta
vulgaris),
oats (Avena sativa), barley (Hordeum vulgare), vegetables.
Grain plants that provide seeds of interest include oil-seed plants and
leguminous
plants. Seeds of interest include grain seeds, such as corn, wheat, barley,
rice,
sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower,
sunflower,
Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans
and
peas. Beans include guar, locust bean, fenugreek, soybean, garden beans,
cowpea,
mungbean, lima bean, fava been, lentils, chickpea, etc.
Important crops are oil-seed rape (canola), wheat, rice, maize, soybean and
cotton.
Preferably said crop is oil seed rape (canola).
According to a yet further aspect of the invention there is provided a seed
obtained
from a plant according to the invention.
According to a further aspect of the invention there is provided a method to
manipulate the angle of growth of a plant root and/or shoot comprising:
i) providing a plant cell a the genome of which is modified by the
inclusion of a
nucleic acid molecule adapted for expression in a gravity sensing cell wherein
the
nucleic acid molecule comprises a nucleic acid sequence selected from:
i) a nucleic acid molecule encoding an ARF;
ii) a nucleic acid sequence encoding a modified Aux/IAA wherein said
nucleic acid molecule is modified by the addition, deletion or
substitution of at least one nucleotide characterized in that said
modification provides an Aux/IAA which has increased activity when
compared to a non-transgenic reference cell of the same plant species;
and
iii) a nucleic acid molecule encoding a TIR1 or AFB;
21
CA 02836198 2013-12-09
ii) cultivating said cell to produce a plant; and optionally
iii) harvesting said plant or part thereof.
In an embodiment of the invention there is provided a method to manipulate the
angle of growth of a plant root and/or shoot comprising:
i) providing a plant cell the genome of which is modified by the
inclusion of a
nucleic acid molecule adapted for expression in a gravity sensing cell wherein
the
nucleic acid molecule comprises a nucleic acid sequence selected from:
i) a nucleic acid molecule comprising a nucleic acid sequence as
represented in Figure la, 1 b, lc, Id or le;
ii) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure 1 a, lb, 1 c, Id or le
and encodes a polypeptide with ARF activity;
iii) a nucleic acid sequence represented in Figure 2 wherein said nucleic
acid molecule is modified by the addition, deletion or substitution of
at least one nucleotide characterized in that said modification provides
an Aux/IAA which has increased activity when compared to a non-
transgenic reference cell of the same plant species;
iv) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure 2 and encodes a
polypeptide with Aux/IAA activity;
v) a nucleic acid molecule comprising a nucleic acid sequence as
represented in Figure 3a (TIRO, Figure 3b (AFB1), Figure 3c (AFB2),
Figure 3d (AFB3), Figure 3e (AFB4) or Figure 3f (AFB5); and
vi) a nucleic acid molecule that hybridizes under stringent hybridization
conditions to the nucleic acid sequence in Figure 3a, 3b, 3c, 3d, 3e or
3f and encodes a polypeptide with auxin receptor activity;
ii) cultivating said cell to produce a plant; and optionally
iii) harvesting said plant or part thereof.
22
CA 02836198 2013-12-09
In a preferred embodiment of the invention there is provided a method for
increasing
the vertical growth of a plant shoot when compared to the shoot of a non-
modified
reference plant of the same species comprising providing a plant cell the
genome of
which is modified by the inclusion of a nucleic acid molecule adapted for
expression
in a gravity sensing cell wherein the nucleic acid molecule comprises a
nucleic acid
molecule comprising a nucleic acid sequence as represented in Figure lc, or a
nucleic
acid sequence with homology to the sequence represented in Figure lc and which
encodes a protein with ARF activity.
In a preferred embodiment of the invention there is provided a method for
reducing
the vertical growth of a plant shoot when compared to the shoot of a non-
modified
reference plant of the same species comprising providing a plant cell the
genome of
which is modified by the inclusion of a nucleic acid molecule adapted for
expression
in a gravity sensing cell wherein said nucleic acid molecule comprises a
nucleic acid
sequence represented in Figure 2, or a nucleic acid sequence with homology to
the
sequence represented in Figure 2, for example Figure 2a, and which encodes a
protein with Aux/IAA activity, and wherein said nucleic acid molecule is
modified
by the addition, deletion or substitution of at least one nucleotide
characterized in
that said modification provides an Aux/IAA which has increased activity when
compared to a non-transgenic reference cell of the same plant species.
In a preferred embodiment of the invention there is provided a method for
increasing
the vertical growth of a plant root when compared to the root of a non-
modified
reference plant of the same species comprising providing a plant cell the
genome of
which is modified by the inclusion of a nucleic acid molecule adapted for
expression
in a gravity sensing cell wherein said nucleic acid molecule comprises a
nucleic acid
sequence represented in Figure 2, or a nucleic acid sequence with homology to
the
sequence represented in Figure 2, for example Figure 2b, which encodes a
protein
with Aux/IAA activity, and wherein said nucleic acid molecule is modified by
the
addition, deletion or substitution of at least one nucleotide characterized in
that said
23
CA 02836198 2013-12-09
modification provides an Aux/IAA which has increased activity when compared to
a
non-transgenic reference cell of the same plant species.
In a preferred embodiment of the invention there is provided a method for
reducing
the vertical growth of a plant root when compared to the root of a non-
modified
reference plant of the same species comprising providing a plant cell the
genome of
which is modified by the inclusion of a nucleic acid molecule adapted for
expression
in a gravity sensing cell wherein the nucleic acid molecule comprises a
nucleic acid
molecule comprising a nucleic acid sequence as represented in Figure lc or a
nucleic
acid sequence with homology to the sequence represented in Figure lc and which
encodes a protein with ARF activity.
Mutagenesis as a means in induce phenotypic changes in organisms is well known
in
the art and includes but is not limited to the use of mutagenic agents such as
chemical
mutagens [e.g. base analogues, deaminating agents, DNA intercalating agents,
alkylating agents, transposons, bromine, sodium azide] and physical mutagens
[e.g.
ionizing radiation, psoralen exposure combined with UV irradiation].
According to a further aspect of the invention there is provided a method to
produce
a plant variety that has increased expression of an ARF comprising the steps
of:
i) mutagenesis of wild-type seed from a plant that does express said
ARF;
ii) cultivation of the seed in i) to produce first and subsequent
generations of plants;
iii) obtaining seed from the first generation plant subsequent generations
of plants;
iv) determining if the seed from said first and subsequent generations of
plants has increased expression of said ARF;
v) obtaining a sample and analysing the nucleic acid sequence of a
nucleic acid molecule selected from the group consisting of:
24
CA 02836198 2013-12-09
a) a nucleic acid molecule comprising a nucleic acid
sequence as represented in Figure la, lb, lc, id or le;
b) a nucleic acid molecule that hybridises to the nucleic acid
molecule in a) under stringent hybridisation conditions
and that encodes a polypeptide with transcription factor
activity; and optionally
vi) comparing the sequence of the nucleic acid molecule in said sample to
a nucleic acid sequence of a nucleic acid molecule of a plant that has
increased expression of said ARF.
In a preferred method of the invention said nucleic acid molecule is analysed
by a
method comprising the steps of:
i) extracting nucleic acid from said mutated plants;
ii) amplification of a part of said nucleic acid molecule by a polymerase
chain reaction;
iii) forming a preparation comprising the amplified nucleic acid and
nucleic acid extracted from wild-type seed to form heteroduplex
nucleic acid;
iv) incubating said preparation with a single stranded nuclease that cuts
at
a region of heteroduplex nucleic acid to identify the mismatch in said
heteroduplex; and
v) determining the site of the mismatch in said nucleic acid
heteroduplex.
In a preferred method of the invention said plant variety has increased
expression of
ARF 7 and/or ARF19.
According to a further aspect of the invention there is provided a plant
obtained by
the method according to the invention wherein said plant is modified wherein
said
modification is transformation with a nucleic acid molecule encoding an ARF
CA 02836198 2013-12-09
wherein said nucleic acid molecule is operably linked to a promoter that
controls
expression of said nucleic acid molecule in a gravity sensing cell.
According to an aspect of the invention there is provided an isolated nucleic
acid
molecule that encodes an ARF wherein said nucleic acid molecule comprises or
consists of a nucleotide sequence selected from the group consisting of:
i) a nucleotide sequence as represented by the sequence in Figure I a, lb,
lc, id or le;
ii) a nucleotide sequence wherein said sequence is degenerate as a result
of the genetic code to the nucleotide sequence defined in (i); and
iii) a nucleic acid molecule the complementary strand of which hybridizes
under stringent hybridization conditions to the sequence in Figure la,
lb, 1 c, Id or le wherein said nucleic acid molecule encodes an ARF.
Preferably the nucleotide sequence is represented by the sequence in Figure lc
or le.
Throughout the description and claims of this specification, the words
"comprise"
and "contain" and variations of the words, for example "comprising" and
"comprises", means "including but not limited to", and is not intended to (and
does
not) exclude other moieties, additives, components, integers or steps.
Throughout the description and claims of this specification, the singular
encompasses
the plural unless the context otherwise requires. In particular, where the
indefinite
article is used, the specification is to be understood as contemplating
plurality as well
as singularity, unless the context requires otherwise.
Features, integers, characteristics, compounds, chemical moieties or groups
described
in conjunction with a particular aspect, embodiment or example of the
invention are
to be understood to be applicable to any other aspect, embodiment or example
described herein unless incompatible therewith.
26
CA 02836198 2013-12-09
An embodiment of the invention will now be described by example only and with
reference to the following figures:
Figures la to e are the truncated nucleic acid sequences of ARF 5 (1a), 6
(lb), 7 (lc),
8 (1d) and 19 (le); truncations are as shown in Table 1;
Figures 1 f to j are the nucleic acid sequences of full length ARF 5 (if), 6
(1g), 7 (1h),
8 (1i) and 19 (1j);
Figure 2i to xxix list the nucleic acid sequences of IAA 1 to 20 and 26 to 34
respectively; (a) is the nucleic acid sequence of IAA12/BDL which contains a
stabilising mutation at position 74 within the conserved domain II; (b) the
nucleic
acid sequence of IAA17/AXR3 which contains a stabilising mutation at position
88
within the conserved domain II;
Figure 3a is the nucleic acid sequence of TIR1;
Figures 3b to fare the nucleic acid sequences of AFB1 (3b), AFB2 (3c), AFB3
(3d),
AFB4 (3e) and AFB5 (31);
Figure 4a is the nucleic acid sequence of ARF 10;
Figure 4b is the nucleic acid sequence of ARF 16;
Figure 5 is the nucleic acid sequence of the promoter of the SCARECROW gene;
Figure 6 is the nucleic acid sequence of the promoter of the ARL2 gene;
Figure 7 is a table showing the alignment of the ARF sequences in Arabidopsis;
percentage identity matrix for the activating ARF (ARFA) protein family in
Arabidopsis thaliana. Values range from 39.44% to 63.32% (amino acid
identity);
Figure 8 is a table showing the alignment of the ARF sequences in Arabidopsis;
percentage identity matrix for the TIR1/AFB protein family in Arabidopsis
thaliana.
Values range from 47.54% to 86.43%;
Figure 9A to I Gravitropic Setpoint Angle (GSA) and the anti-gravitropic
offset; (A)
Typical GSA profiles of A. thaliana (Col. 0) shoot and root branches with
diagram of
GSA designations.
(B and C) Changes in the GSA of Arabidopsis and pea subapical branches after
removal of the shoot apex and application of 1 mM IAA or mock treatment to the
apical stump (white arrowheads, decapitated apices; red arrowheads, subapical
lateral
27
CA 02836198 2013-12-09
branches) (B). Quantitative analysis of branch GSA is shown (p < 0.05; error
bars
indicate the SEM) (C).
(D, E, G, and H) Effect of horizontal clinorotation on lateral shoot (D and E)
and
lateral root (G and H) GSA. Note: for clinorotated plants, a nominal GSA was
derived by measurement of the growth angle of the final 5 mm of cauline
branches
and 2 mm of lateral roots with respect to the vertical in upright plants.
Green and red
lines represent the action of gravitropic and antigravitropic growth
components,
respectively. Lateral shoot GSA (E) and lateral root GSA (H) in wild-type and
ein2-1
mutant plants are shown.
(F and I) Effect of local application of the auxin transport inhibitor NPA and
subsequent clinorotation on lateral shoot (F) and lateral root GSA (1).
Clinorotation at 4 rph (D¨F) and 1 rpm (G-1). Scale bars represent 1 cm (D)
and
0.5 cm (G). Error bars indicate the SEM.
Figure 10A to K Lateral branch GSA phenotypes of auxin signalling mutants;
Changes in (Fig 10A) lateral shoot GSA and (Fig 10B) lateral root GSA induced
by
loss-of-function mutations affecting the AFB4 and AFB5 auxin receptors: ajb4-2
and
afb4-2 afb5-5 double mutant. The afb4-2 afb5-5 double mutant [26] has a
significantly less vertical cauline branch and lateral root GSA, while afb4-2
single
mutants are not significantly different from wild-type. Although we cannot
rule out
possible redundancy between AFB4 and AFB5 in this analysis, these data suggest
that
at the very least, AFB5 does contribute to GSA control (Fig 10C,D) GSA
phenotypes
of mutants with altered auxin levels (wild-type Col-0, yuccal-ld and yucID
auxin
overproducing mutants and wei8 lar2 auxin deficient biosynthesis mutants).
Lateral
shoot GSA (Fig 10C) and lateral root GSA (Fig 10D). GSA recorded for
successive
0.8 mm segments in the root and 0.5 cm segments in the shoot (mean of 12-15
lateral
roots or shoots, one way ANOVA, p<0.05 for Fig 10C and data points 5-10 in Fig
10D). (Fig 10E) Comparison of changes in lateral shoot GSA between wild-type
plants and the arf10-3 arf16-2 and the arf10-3 arf16-2 ayr3-10 double and
triple
mutants (mean of 12-15 roots, one-way ANOVA, p<0.05). (Fig 10F) Effects on
lateral root GSA of growth on media containing 10 nM IAA or 10 nM 2,4-D (mean
of 12-15 lateral roots, one-way ANOVA, p<0.05, data points 6-10). (Fig 10G)
28
CA 02836198 2013-12-09
Comparison of changes in lateral shoot GSA in the tir1-1 and nph4-1 arf19-1
mutants (mean of 12-15 lateral roots, one-way ANOVA, p<0.05). (Fig 10H) The
effect of auxin treatment on lateral root GSA in bean and crown root GSA in
rice
(p<0.05, Student's t-test, n=15-20). (Fig 101) Changes in the GSA of nph4-I
arf19-1
sub-apical branches after removal of the shoot apex and application of 1 mM
IAA or
mock treatment to the apical stump (12-15 lateral shoots, Student's t-test,
p<0.05).
(Fig 10J,K) Comparison of changes in lateral root GSA between wild-type plants
and
the axr3-10, arf7-201 (Fig 10J) and nph4-1 arf19-1 (Fig 10K) mutants (mean of
12-
lateral roots, one way ANOVA (Fig 10J), Student's t-test (Fig 10K), p<0.05,
data
10 points 2-10). Error bars: s.e.m. Scale bar = 1 cm.
Figure 11 A to D Auxin specifies shoot and root branch GSA by regulating the
magnitude of the anti-gravitropic offset component. Auxin specifies shoot and
root
branch GSA by regulating the magnitude of the anti-gravitropic offset
component.
(Fig 11A,B) Lateral branch GSA before and after re-orientation by 45 in wild-
type
15 and auxin response mutants. (A) Lateral shoot GSA measured using the
final 0.5 mm
segment of 5-6 cm long lateral shoots or (B) the final 0.2 mm segment of 2-4
mm
long lateral roots. (C,D) Comparison of the changes in lateral shoot GSA (C)
and
lateral root GSA (D) following clinorotation (4 rph shoots/1 rpm roots, 8
hours) in
the auxin response mutants: (C) nph4-1 arf19-1 and arf10-3 arfl 6-2 (wild-type
Col.
0 in main Figure 3A) ; (D) wild-type Ler and axr3-10 plants. Error bars:
s.e.m. Scale
bars = 1 cm (C) and 0.5 cm (D).
Figure 12A and B: Auxin specifies GSA within the gravity-sensing cells of the
root
and shoot; Induction of a mutated, stabilised form of IAA12/BDL in the gravity-
sensing cells of the shoot (SCR::bdl:GR) causes branches to grow at an extreme
non-vertical GSA. This phenotype is lost 72 hours after the cessation of
dexamethasone treatment. (B) Reversion of the lateral shoot GSA phenotype
three
days after the last DEX treatment. Scale bar = 1 cm.
Figure 13 (A) Representative mock and DEX treated SCR:..TIR1:GR plants (B)
Quantification of GSA from an average of 10 lateral branches showing a more
vertical GSA phenotype in DEX treated plants. Bars represent standard error.
29
CA 02836198 2013-12-09
DETAILED DESCRIPTION:
Analysis of Gravitropic Setpoint Angle (GSA) and the anti-gravitropic offset
Materials and Methods
Plant material and tissue culture growth conditions
Arabidopsis thaliana ecotypes Col-0 and Ler were used in this study. The
mutant
lines yuccal-ld, yuclD, wei8 tar2, tin1-1, afb4-2, afb4-2 afb5-5, arf7-201,
nph4-1
arf19-1, arf10-3 arf16-2, axr3-10, ein2-1 and SCR:.-bd1 have been described
previously. Because of the critical importance of the ethylene insensitivity
to the
interpretation of clinostat studies, ein2-1 was verified as ethylene resistant
by
assaying growth on 1 1.1M ACC (data not shown). The arf10-3 arf16-2 axr3-10
triple
mutant was generated by crossing, while the SCR::bd1..GR and SCR::ARF7..GR
transgenic lines were constructed for this study (see below). The enhancer
trap lines
J1092 and M0013 were obtained from the Nottingham Arabidopsis Stock Centre.
The seeds were surface sterilised using chlorine gas (produced by a mixture of
100
ml bleach and 3 ml conc. HC1) for three hours in a desiccator. Seeds were
placed on
round 9 cm petri dishes containing sterile ATS medium (5 mM KNO3, 2.5 mM
KH2PO4 (pH 5.5), 2 mM Mg504, 2 mM Ca(NO3)2, 50 tM Fe-EDTA, 70 M
H3B03, 14 M MnC12, 0.5 M CuSO4, 1 M ZnSO4, 0.2 M NaMo04, 10 M NaC1,
0.01 M CoC12, 1% sucrose, 0.8% agar) and stratified for three days. The
plates were
then incubated vertically in a plant growth room (20-22 C, 16 h day). Five
days
post-germination, seedlings were transferred to 120 mm square petri plates
containing 50 ml of ATS medium. These plates were incubated vertically in a
plant
growth room with growth conditions as described above for a further seven
days.
Hormone and auxin transport inhibitor treatments
For hormone treatments, five day old seedlings growing on ATS medium in 9 cm
petri dishes were transferred to 120 mm square petri dishes containing 50 ml
sterile
ATS medium with 50 nM IAA, 50 nM 2,4-D or no auxin. 100 M hormone stock
solutions were made up in 70% ethanol. The plates were incubated vertically
and
seedlings were allowed to grow for a further 12 days prior to analysis. For
root NPA
treatments, ten day old Wt Col-0 seedlings growing on ATS medium on 9 cm petri
CA 02836198 2013-12-09
dishes were transferred to fresh ATS medium containing either 0.2 or 1 ftM
NPA.
The seedlings were left to grow on the NPA plates for 4 hours and scanned just
before being clinorotated at 1 rpm for 8 hours. The plates were then scanned
again
and changes in GSA were measured using imaga For shoot NPA treatments, NPA
was mixed with lanolin to a final concentration of 10 jiM and applied along
the
length of the lateral branch of intact plants using a fine needle. The plants
were left in
the glasshouse for 2 hours and photographed before being clinorotated for 8
hours at
4 rph. For rice and bean auxin treatments, seeds were germinated on moist
filter
paper in petri dishes and transferred to `Cyg' seed germination pouches
(Minnesota,
USA) containing 50 ml of liquid medium [S11 with/without 50nM IAA. Plants were
allowed to grow for seven days before being photographed.
Image analysis and lateral root GSA measurements
For root and angle measurements, 12 day old seedlings growing on 120 mm square
petri plates were scanned using an HP Scanjet G4050 photo scanner and the
images
obtained were analysed using ImageJ. Each lateral root analysed was divided
into 0.8
mm segments and the GSA of each segment was measured with reference to the
gravity vector. For clinorotation and reorientation experiments the angle of
growth
with respect to the vertical of the final 2 mm section of lateral root was
recorded. The
data were statistically evaluated using the Wilkes-Shapiro and Kolmogorov-
Shapiro
tests for normality followed by a paired t-test or one-way ANOVA. A p value of
<0.05 was used in all statistical tests.
Analysis of shoot GSA
To analyse lateral shoot GSA, seeds of WT Col-0, yucca] -ID, wei8 tar2, tin-],
nph4-1 arf19-1, arf10-3 arf16-2 axr3-10, SCR::bd1 and SCR::bdl:GR lines were
sown in small 5 cm pots containing compost which were stratified for 48 hours
to
promote uniform germination. After germination, seedlings were transplanted to
individual square pots and allowed to grow for 28 days in the greenhouse at a
photoperiod of 16 h day and 8 h darkness at 20 + 2 C. Photographs of
individual
branches were taken using a digital camera and the GSA of individual lateral
31
CA 02836198 2013-12-09
branches was measured using ImageJ. Each shoot was divided into 0.5 cm
segments
and the GSA of each segment was measured with reference to the gravity vector.
For
clinorotation and reorientation experiments the angle of growth with respect
to the
vertical of the final 0.5 cm section of cauline branch was recorded. The data
were
evaluated using the statistical tests described above.
Decapitation experiments
For measuring changes in GSA in response to decapitation, the apical branch
was
decapitated in 28-day-old plants. For auxin treatments, IAA was mixed with
lanolin
to a final concentration of 1mM and was applied carefully to the tip of
decapitated
shoots using a fine needle. The decapitated plants were left to grow for a
further five
days prior to being photographed and analysed as described above. For pea
experiments, seeds were sown in individual pots and stratified for 24 hours.
21-day-
old plants were then decapitated and treated with auxin as described above.
Clinostat experiments
For clinorotation studies in lateral roots and shoots, either 10 day old
seedlings
growing on 9 cm round petri dishes or 28-day-old intact or decapitated plants
growing individually in square pots were placed on a 1-D clinostat in an
orientation
parallel to the axis of rotation. For clinorotation at 4 rph a Mikrops
Electric Clinostat
(Flatters & Garnett, Manchester, UK) was used. For clinorotation at speeds
between
0.5 and 5 rpm clinostats were constructed using geared, variable speed
electric
motors. In order to minimise effects of plant movement during clinorotation
(i.e.
flopping), thin stakes were inserted to support the primary shoot along the
axis of
rotation. The plates or plants were subjected to horizontal or vertical
clinorotation
gravistimulation for 8 hours at a speed of 1 rpm or 4 rph. For lateral roots,
the plates
were scanned while lateral shoots were photographed prior to analysis using
ImageJ.
The final GSA of each lateral organ was measured with reference to the gravity
vector.
32
CA 02836198 2013-12-09
Generation of SCR::ARF7:GR and SCR::bdl:GR transgenic plants
The SCR:..ARF7:GR and SCR: ..bdl:GR constructs were generated using 2-
fragments
MultiSite Gateway Pro technology (Invitrogen). A 2.5Kb SCR promoter fragment
was amplified from arabidopsis genomic DNA using Gateway primers with B1 and
B5r extensions (BlpSCR: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTAAT
TTTGAATCCATTCTCAAAG CTTTGC-3' and pSCRB5r: 5'-GGGGACAACTTTTGTA
TACAAAGTTG TGGAGATTGAAGGGTTGTTGGTCGTG-3'). The NPH4/ARF7 and
bdl mutant genes were amplified respectively from arabidopsis WT and bdl
mutant
cDNA using primers with B5 and B2 extensions. (B5KARF7: 5' ¨
GGGGACAACTTTG TATACAAAAGTTGAACAATGAAAGCT CCTTCATCAAATGG-
3', and ARF7B2: 5'- GGGG
ACCACTTTGTACAAGAAAGCTGGGTCCCGGTTAAACGAAGTGGCTG-3' ,
B5Kbdl: 5'- GGGGACAACTTTGTATACAAAAGTTGAACAATGCGTGGTGTGTC
AGAATTG GAGG-3' and bd1B2: 5'- GGGGACCACTTTGTACAAGAAAGCTGGG
TCAACAGGGTTGTTTCTTTGTCT ATCCTTCTGC-3'). Following BP reactions the
SCR promoter was cloned into pDONR 221 P1-P5r, while ARF7 and bdl were cloned
into pDONR 221 P5-P2. The final binary vectors were assembled using 2-
fragments
LR reactions into a modified pFP100 vector containing the GR fragment and the
NOS terminator. Constructs were transformed into Agrobacteriurn strain GV3101.
WT Col-0 plants were transformed using the Agrobacterium floral dipping
method.
RESULTS:
Arabidopsis lateral branches are actively maintained at specific angles with
respect
to gravity (their GSA). To study the regulation of lateral branch GSA we used
arabidopsis cauline branches and first-order lateral roots as model lateral
shoot and
root organs. In the ecotypes we examined (Col. 0 and Ler), newly emerged
cauline
branches begin growth at a very shallow GSA (120 -130 ) that becomes
increasingly,
although never entirely, vertical (Figure 9A). Similarly, newly emerged
lateral roots
(<0.5 mm) have a very shallow GSA (60 -70 ) that becomes progressively more
vertical as the lateral root grows out (Figure 9A). Following reorientation,
lateral
roots and lateral shoots of a range of lengths undergo anisotropic growth to
return to,
33
CA 02836198 2013-12-09
or close to, their original GSA. In the root this bending growth is confined
to the
short elongation zone just behind the root apex while in the shoot branches,
anisotropic growth along the youngest 2.5-3.5 cm of the branch can contribute
to the
reorientation of the organ. In these experiments the angle of the final 0.5 cm
section
of cauline branches and the final 2 mm section of lateral roots was recorded.
In these
experiments, lateral organs were displaced both above and below their GSA by
45
meaning that some lateral roots must grow up, and some cauline branches move
down to reacquire their GSA (Fig 9 A,C insets). Because in most cases this
reorientation would not cause major displacements of statoliths to the
opposite face
of the statocyte, this indicates the existence of a mechanism to drive growth
in the
opposite direction to gravitropic response (white and black arrows: gravity
vector;
red arrow: direction of GSA reorientation). It also confirms that the observed
non-
vertical GSAs of lateral branches cannot be attributed to partial or reduced
gravitropic capacity compared to the primary axis. These data form an
important
baseline for the work presented here and confirm that at all points in the
development
of the lateral branches upon which the study is based, the angle of growth
with
respect to gravity is being monitored and maintained. The mean lateral shoot
GSA
(Fig 9B) and lateral root GSA (Fig 9D) for branches of increasing ages
(defined as
branch length size classes) before and after 45 plant re-orientation. (Fig
9E,F)
Quantitative changes in lateral shoot GSA and lateral root GSA following
clinorotation of branches either on or off the axis of rotation. (Fig 9G)
Placing
primary shoots and roots at an angle to the axis of rotation does not alter
their
direction of growth under horizontal clinorotation at the speeds used for the
experiments here (4 rph-1 rpm for shoots, 0.5-1 rpm for roots); at higher rpm
(5-60
rpm) random changes in the direction of growth of the primary root can
sometimes
be observed and hence were avoided for our experiments (data not shown). N.B.
Vertical clinorotation at speeds from 4 rph to 5 rpm does not affect GSA in
arabidopsis cauline branches and lateral roots (data not shown) (Fig 9H,I).
The
ethylene insensitive mutant ein2-1 shows similar responses to wild-type plants
upon
horizontal clinorotation: lateral shoot GSA (4 rph, 8 hours) (Fig 9H), lateral
root
34
CA 02836198 2013-12-09
GSA (1 rpm, 8 hours) (Fig 91) Error bars: s.e.m. (Fig 9B,D). Scale bars = 1 cm
(Fig
9A,E, G left panel, H) and 0.5 cm (Fig 9B,F, G right panel, 1).
See also Figure legends to Figures 10 to 12.
Manipulation of lateral branch growth angles
The Methodology
The invention is implemented in the chosen target plant species using a
common,
generic methodology: wild-type or modified versions of auxin signalling
components
from the ARF, AwdIAA, and TIR1/AFB protein families are incorporated into
plant
expression vectors such that they are placed downstream of a gene promoter
that
drives expression in the gravity-sensing cells of the root or shoot. These
constructs
are then used, with a suitable plant transformation protocol, to generate
stable,
homozygous transgenic plants. Specific changes to either more vertical or less
vertical growth angles are determined by the nature of the auxin signalling
effector
whose expression is targeted to the gravity-sensing cells. For example:
- the expression of the Arabidopsis thaliana gene ARF7 (Arabidopsis Genome
Initiative number: AT5g20730; GENBANK: NM 122080) or related genes in the
gravity-sensing cells of the shoot induces more vertical growth.
- the expression of a mutated, stabilised version of the Arabidopsis
thaliana gene
BDL/I4Al2 (bdl; AT1G04550;) or mutated versions of related genes in the
gravity-
sensing cells of the shoot induces less vertical growth.
- the expression of a mutated, stabilised version of the Arabidopsis
thaliana gene
AXR3/I4A17 (axr3-1 or cvcr3-3; AT1G04250; GENBANK: NM 100306) or mutated
versions of related genes in the gravity-sensing cells of the root induces
more vertical
growth.
35
CA 02836198 2013-12-09
- the expression of the Arabidopsis thaliana gene ARF7 (AT5g20730; GENBANK:
NM 122080) or related genes in the gravity-sensing cells of the root induces
less
vertical growth.
Further details are set out below with specific examples of the
implementation:
Modulation of lateral root and shoot branching angles using activating ARFA
polypeptide and related sequences:
Modulation of shoot angle:
A method of inducing a more vertical root GSA phenotype in shoot lateral
branches
comprises the incorporation of a heterologous nucleic acid sequence that
alters the
expression levels of an activating ARF or related gene in the gravity-sensing
cells by
means of transformation and regenerating the plant from one or more
transformed
cells.
The full (or truncated/ARF-DCA* [see Figure 1 and Table 1 below for gene
sequences of truncated/ARF-DCA genes]) gene sequence coding for activating
ARFs
(sequences shown in Figure 1) and related polypeptides may be amplified from
genomic or cDNA of a plant species using appropriate primer sequences. The
promoter sequence of a gene that is expressed specifically in the gravity-
sensing cells
of the shoot (e.g. SCARECROW [SCR, AT3G54220; GENBANK: NM_115282]
(Figure 5) or related genes, consisting of 2500 bp upstream of the start of
the SCR
gene in Arabidopsis) is similarly amplified from the genomic or cDNA of the
target
plant species. Using conventional or GATEWAY cloning techniques the SCR or
related promoter is placed upstream of the activating ARF sequence in a
suitable
binary plant transformation vector. Using a plant transformation technique
appropriate for the desired species such as floral dipping, Agrobacterium
mediated
co-cultivation, microprojectile or particle bombardment the binary vector
containing
the SCR and activating ARF gene sequences are introduced into the plant
cell(s).
Plants or cells used for transformation preferably lack mutations in
activating ARF
gene sequences and may for example, be wild type. Following transformation the
36
CA 02836198 2013-12-09
transgenic plants are regenerated e.g. from seed, single cells, callus tissue
or leaf
discs as is standard for the said species. The angle of shoot branches is
compared to
control plants in which the expression of the activating ARF related
polypeptide is
not increased in the shoot gravity-sensing cells.
Note on the use of truncated ARF4/ARF-DCA (DCA = dominant constitutive
activation) genes. Because Aux/IAA repressor proteins interact with ARFA
proteins
via the carboxyl-terminal domains III and IV common to both protein families,
the
truncation of domains III and IV from the ARFA increases its capacity for
transcriptional activation (see 35S::ARF7-DCA supporting data). Thus, ARF-DCA
is
deployed in place of the cognate full-length ARF gene in the approaches
described
here in order to enhance the effects on root and shoot branch growth angle.
Induced expression or activity of an activating ARF related polypeptide at a
specific
stage of plant development is achieved by the addition of an additional
regulatory or
inducible element such as the glucocorticoid receptor (GR) sequence upstream
or
downstream of the activating ARF related polypeptide sequence within the plant
binary vector used for transformation.
Modulation of root angle:
The full (or truncated) gene sequence coding for activating ARFs and related
polypeptides is amplified from genomic or cDNA of a plant species using
appropriate
primer sequences. The promoter sequence of a gene that is expressed
specifically in
the gravity-sensing cells of the root (e.g. the ARL2 gene [AT1G59980; GENBANK:
NM 104690] (Figure 6) or related genes, consisting of 2441 bp upstream of the
start
of the ARL2 gene in Arabidopsis) is similarly amplified from the genomic or
cDNA
of the appropriate plant species. Using conventional or GATEWAY cloning
techniques the ARL2 or related promoter is placed upstream of the activating
ARF
sequence in a suitable binary plant transformation vector. Using a plant
transformation technique appropriate for the desired species such as floral
dipping,
Agrobacterium mediated co-cultivation, microprojectile or particle
bombardment, the
37
CA 02836198 2013-12-09
binary vector containing the ARL2 or related promoter and activating ARF gene
sequences is introduced into the plant cell(s). Plants or cells used for
transformation
preferably lack mutations in activating ARF gene sequences and are for
example, be
wild type. Following transformation the transgenic plants are regenerated e.g.
from
seed, single cells, callus tissue or leaf discs as is standard for the said
species. The
angle of root branches are compared to control plants in which the expression
of the
activating ARF related polypeptide is not increased in the root gravity-
sensing cells.
An alternative method of expressing a gene sequence coding for activating ARFs
and
related polypeptides in the root gravity-sensing cells consista of amplifying
its full (or
truncated) gene coding sequence from genomic or cDNA and cloning this sequence
downstream of a 3XUAS cassette (Field and Song (1989). Nature 340:245-246) in
a
suitably plant binary vector. Using a plant transformation technique
appropriate for
the desired species such as floral dipping, Agrobacterium mediated co-
cultivation,
microprojectile or particle bombardment the binary vector containing the UAS
cassette and activating ARF gene sequences may be introduced into the plant
cell(s).
Plants or cells used for transformation preferably lack mutations in
activating ARF
related gene sequences and may for example, be wild type. Following
transformation
the transgenic plants may be regenerated e.g. from seed, single cells, callus
tissue or
leaf discs as is standard for the said species. Such regenerated plants may
then be
crossed with plants from an enhancer trap line, which is able to drive the
expression
of any gene downstream of a UAS cassette in a specific cell type, in this case
the
columella gravity-sensing cells of the root. The expression of the activating
ARF
related polypeptide may then be determined in the progeny plants and progeny
plants
in which the expression of the activating ARF related polypeptide is increased
relative to control plants may be identified. The angle of root branches may
be
compared to control plants in which the expression of the activating ARF
related
polypeptide is not increased in the root gravity-sensing cells.
38
CA 02836198 2013-12-09
Table 1. Structure of truncated ARFA genes:
Gene Size of C- Start End Start End amino
terminal nucluotide nucleotide amino acid acid
deletion
ARF7 390 bp 1 3108 M1 R1036
ARF19 393 bp 1 2868 Ml R956
ARF8 327 bp 1 2109 M1 Q703
ARF6 426 bp 1 2382 M1 Q793
ARF5 336 bp 1 2373 M1 R791
Modulation of lateral root and shoot branching angles using stabilised Aux/IAA
transcriptional repressor polypeptide related sequences:
Modulation of shoot angle:
A method of inducing a more vertical root GSA phenotype in shoot lateral
branches
comprises incorporating a heterologous nucleic acid sequence which alters the
expression levels of an Aux/IAA and related genes containing a stabilizing
mutation
in the conserved domain H region of the proteins in the gravity-sensing cells
by
means of transformation and regenerating the plant from one or more
transformed
cells.
The full Aux/IAA gene coding sequence (with the stabilising mutation in the
conserved domain II region) is amplified from genomic or cDNA of a plant
species
using appropriate primer sequences. The promoter sequence of a gene that is
expressed specifically in the gravity-sensing cells of the shoot (e.g.
SCARECROW
[SCR, AT3G54220; GENBANK: NM_115282] or related genes, consisting of 2500
bp upstream of the start of the SCR gene in Arabidopsis) is similarly
amplified from
the genomic or cDNA of the target plant species. Using conventional or GATEWAY
cloning techniques the SCR or related promoter may be placed upstream of the
Aux/IAA related sequence in a suitable binary plant transformation vector.
Using a
plant transformation technique appropriate for the desired species such as
floral
39
CA 02836198 2013-12-09
dipping, Agrobacterium mediated co-cultivation, microprojectile or particle
bombardment the binary vector containing the SCR and activating ARF gene
sequences may be introduced into the plant cell(s). Plants or cells used for
transformation preferably lack mutations in Aux/IAA related gene sequences and
may for example, be wild type. Following transformation the transgenic plants
may
be regenerated e.g. from seed, single cells, callus tissue or leaf discs as is
standard for
the said species. The angle of shoot branches may be compared to control
plants in
which the expression of the AindIAA related polypeptide is not increased in
the
shoot gravity-sensing cells.
Modulation of root angle:
The full Aux/IAA gene coding sequence (with the stabilising mutation in the
conserved domain II region) is amplified from genomic or cDNA of a plant
species
using appropriate primer sequences. The promoter sequence of a gene that is
expressed specifically in the gravity-sensing cells of the root (e.g. the ARL2
gene
[AT1G59980; GENBANK: NM 104690] or related genes, consisting of 2441 bp
upstream of the start of the ARL2 gene in Arabidopsis) is similarly amplified
from the
genomic or cDNA of the appropriate plant species. Using conventional or
GATEWAY cloning techniques the ARL2 or related promoter is placed upstream of
the Aux/IAA related sequence in a suitable binary plant transformation vector.
Using
a plant transformation technique appropriate for the desired species such as
floral
dipping, Agrobacterium mediated co-cultivation, microprojectile or particle
bombardment the binary vector containing the ARL2 or related promoter and
activating ARF gene sequences is introduced into the plant cell(s). Plants or
cells
used for transformation preferably lack mutations in activating ARF gene
sequences
and may for example, be wild type. Following transformation the transgenic
plants
are regenerated e.g. from seed, single cells, callus tissue or leaf discs as
is standard
for the said species. The angles of root branches are compared to control
plants in
which the expression of the Aux/IAA related polypeptide is not increased in
the root
gravity-sensing cells.
CA 02836198 2013-12-09
An alternative method of expressing an activating Aux/IAA related polypeptide
in
the root gravity-sensing cells consists of amplifying its full gene coding
sequence
from genomic or cDNA and cloning this sequence downstream of a 3XUAS cassette
(Fischer et al. (1988) Nature 322:853-856) in a suitable plant binary vector
using
GATEWAY or conventional cloning techniques. Using a plant transformation
technique appropriate for the desired species such as floral dipping,
Agrobacterium
mediated co-cultivation, microprojectile or particle bombardment the binary
vector
containing the UAS cassette and Aux/IAA related polypeptide sequences are
introduced into the plant cell(s). Plants or cells used for transformation
preferably
lack mutations in Aux/IAA related gene sequences and are for example, be wild
type.
Following transformation the transgenic plants are regenerated e.g. from seed,
single
cells, callus tissue or leaf discs as is standard for the said species. Such
regenerated
plants are then crossed with plants from an enhancer trap line, which is able
to drive
the expression of any gene downstream of a UAS cassette in a specific cell
type, in
this case the columella gravity-sensing cells of the root. The expression of
the
Aux/IAA related polypeptide is then determined in the progeny plants and
progeny
plants in which the expression of the Aux/IAA related polypeptide is increased
relative to control plants may be identified. The angle of lateral roots is
compared to
control plants in which the expression of the Aux/IAA related polypeptide is
not
increased in the root gravity-sensing cells.
Modulation of lateral root and shoot branching angles using TIRVAFB auxin
receptor related polypeptide sequences:
Modulation of shoot angle:
A method of inducing a more vertical root GSA phenotype in shoot lateral
branches
comprises incorporating a heterologous nucleic acid sequence which alters the
expression levels of a TIR1/AFB auxin receptor or related gene in gravity-
sensing
cells by means of transformation and regenerating the plant from one or more
transformed cells.
41
CA 02836198 2013-12-09
The full length TIR1/AFB auxin receptor or related coding sequence is
amplified
from genomic or cDNA of a plant species using appropriate primer sequences.
The
promoter sequence of a gene that is expressed specifically in the gravity-
sensing cells
of the shoot (e.g. SCARECROW [SCR, AT3G54220; GENBANK: NM 115282] or
related genes, consisting of 2500 bp upstream of the start of the SCR gene in
Arabidopsis) is similarly amplified from the genomic or cDNA of the
appropriate
plant species. Using conventional or GATEWAY cloning techniques the SCR or
related promoter is placed upstream of the TIR1/AFB polypeptide related
sequence in
a suitable binary plant transformation vector. Using a plant transformation
technique
appropriate for the desired species such as floral dipping, Agrobacterium
mediated
co-cultivation, microprojectile or particle bombardment the binary vector
containing
the SCR and TIR1/AFB auxin receptor or related gene sequences is introduced
into
the plant cell(s). Plants or cells used for transformation preferably lack
mutations in
the TIR1/AFB auxin receptor related gene sequences and are for example, be
wild
type. Following transformation the transgenic plants are regenerated e.g. from
seed,
single cells, callus tissue or leaf discs as is standard for the said species.
The angle of
shoot branches is compared to control plants in which the expression of the
TIR1/AFB auxin receptor related polypeptide is not increased in the shoot
gravity-
sensing cells.
Modulation of root angle:
The full length TIR1/AFB auxin receptor or related coding sequence is
amplified
from genomic or cDNA of a plant species using appropriate primer sequences.
The
promoter sequence of a gene that is expressed specifically in the gravity-
sensing cells
of the root (e.g. the ARL2 gene [AT1G59980; GENBANK: NM 1046901 or related
genes, consisting of 2441 bp upstream of the start of the ARL2 gene in
Arabidopsis)
is similarly amplified from the genomic or cDNA of the appropriate plant
species.
Using conventional or GATEWAY cloning techniques the ARL2 or related promoter
is placed upstream of the TIR1/AFB auxin receptor-related gene sequence in a
suitable binary plant transformation vector. Using a plant transformation
technique
appropriate for the desired species such as floral dipping, Agrobacterium
mediated
42
CA 02836198 2013-12-09
co-cultivation, microprojectile or particle bombardment the binary vector
containing
the ARL2 or related promoter and TIR1/AFB auxin receptor related gene
sequences is
introduced into the plant cell(s). Plants or cells used for transformation
preferably
lack mutations in activating TIR1/AFB auxin receptor related sequences and are
for
example, wild type. Following transformation the transgenic plants are
regenerated
e.g. from seed, single cells, callus tissue or leaf discs as is standard for
the said
species. The angle of lateral roots is compared to control plants in which the
expression of the TIR1/AFB auxin receptor related polypeptide is not increased
in the
root gravity-sensing cells.
An alternative method of expressing a TIR1/AFB auxin receptor or related
polypeptide in the root gravity-sensing cells consists of amplifying its full
gene
coding sequence from genomic or cDNA and cloning this sequence downstream of a
3XUAS cassette (Field and Song (1989). Nature 340:245-246) in a suitable plant
binary vector using GATEWAY or conventional cloning techniques. Using a plant
transformation technique appropriate for the desired species such as floral
dipping,
Agrobacterium mediated co-cultivation, microprojectile or particle bombardment
the
binary vector containing the UAS cassette and TIR1/AFB auxin receptor related
polypeptide sequences are introduced into the plant cell(s). Plants or cells
used for
transformation preferably lack mutations in Aux/1AA gene sequences and are for
example, be wild type. Following transformation the transgenic plants are
regenerated e.g. from seed, single cells, callus tissue or leaf discs as is
standard for
the said species. Such regenerated plants are then crossed with plants from an
enhancer trap line, which is able to drive the expression of any gene
downstream of a
UAS cassette in a specific cell type, in this case the columella gravity-
sensing cells of
the root. The expression of the TIR1/AFB auxin receptor related polypeptide is
then
determined in the progeny plants and progeny plants may be identified in which
the
expression of the Aux/IAA related polypeptide is increased relative to control
plants.
The angles of lateral roots are compared to control plants in which the
expression of
the TIR1/AFB auxin receptor related polypeptide is not increased in the root
gravity-
sensing cells.
43
CA 02836198 2013-12-09
EXAMPLES:
Example 1:
In this example, transgenic Arabidopsis plants having more vertical shoot
branching
angles were generated by inducing the expression of the activating ARF7 in the
gravity-sensing cells of the shoot.
Unless stated otherwise, standard techniques were used as follows:
Arabidopsis growth conditions:
Arabidopsis thaliana (Col-0) plants were grown individually in pots containing
compost in the greenhouse with 20 h light and 8 h darkness at a temperature
range of
+ 2 C.
Generation of transgenic SCR:ARF7:GR plants:
15 The genomic construct SCR::ARF7:GR contains the SCARECROW promoter
upstream of the coding sequence of ARF7 (AT5g20730; GENBANK: NMI22080)
fused in to the GR protein coding sequence (the GR motif allows the nuclear
localisationof the ARF7:GR protein to be induced upon treatment with
dexamethasone). This construct was generated using the GATEWAY system
20 (Invitrogen). 2.5 Kb of the SCR promoter and the full length ARF7 coding
sequence
were amplified with PCR primers containing recombination sequences and cloned
into pDONR P1P5r and pDONR P5P2 Gateway entry vectors. A multisite LR
reaction was then performed with the two pDONR entry plasmids and a modified
pFP100 destination vector containing a GR fragment and a Nos terminator. The
SCR::ARF7:GR construct was transformed into Col-0 Arabidopsis plants by floral
dipping and transformants were selected on the basis of seed coat
fluorescence. Eight
independent transgenic lines were selected using seed coat fluorescence as a
marker
and grown in soil for two weeks. These plants (along with untransformed sister
controls) were sprayed with a solution of 30 uM Dexamethasone (in distilled
water)
for a period of ten days. All transgenic lines displayed varying strengths of
the more
vertical lateral shoot branch phenotype as compared to control plants.
44
CA 02836198 2013-12-09
Primer sequences:
SCR promoter:
BlpSCR: 5'-
GGGGACAAGTTTGTACAAAAAAGCAGGCTAATTTTGAA
TCCATTCTCAAAGCTTTGC-3
pSCRB5r:
5'-GGGGACAACTTTTGTATACAAAGTTGTGGAGATTGAA GGGTTGTT
GGTCGTG-3
ARF7:
B5KARF7:_
5'¨GGGGACAACTTTGTATACAAA4GTTGAACAATGAAAGCTCCTTCATC
AAATGG-3'
ARF7B2:
5'- GGGG ACCACTTTGTACAAGAAAGCTGGGTCCCGGTTAAACGAA
GTGGCTG-3',
Example 2:
In this example, transgenic Arabidopsis plants having more vertical lateral
root
angles through the expression of a stabilized form of IAA17/AXR3 (axr3-1) in
the
root columella gravity-sensing cells were generated.
Arabidopsis growth conditions:
Arabidopsis thaliana (Col-0) plants were grown individually in pots containing
compost in the greenhouse with 20 h light and 8 h darkness at a temperature
range of
20+2 C.
For lateral root angle analysis, transgenic plants along with suitable
controls were
grown on ATS medium on 120 cm square petri dishes with 20 h light and 8 h
darkness at a temperature range of 20 + 2 C.
Construction of UAS::axr3-1:
The genomic construct UAS::axr3-1 contains the GAL4 recognition sequence UAS
upstream of the coding sequence of AXR3/IAA17 (AT1G04250; GENBANK:
CA 02836198 2013-12-09
NM 100306) containing a stabilising proline to leucine mutation at position 88
within the conserved domain II of this protein (axr3-1). The UAS and axr3-1
sequences were subcloned into a BIN19 based plant transformation binary vector
and
transformed into wild-type Col-0 Arabidopsis plants using floral dipping.
Transformants were selected using kanamycin resistance as a marker.
Generation of transgenic UAS::axr3-1 x JI092 transgenic plants:
UAS:axr3-1 plants were crossed into the J1092 enhancer trap GAL4-GFP driver
line
which drives expression of axr3-1 in the columella and lateral root cap cells
of the
root. Seven independent transgenic lines were obtained displayed varying
strengths
of the more vertical lateral root branch phenotype as compared to control
plants.
46
