Note: Descriptions are shown in the official language in which they were submitted.
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
MicroRNA-3 1 Compositions and Methods for Use in Autoimmune Disease
Background
Autoimmune conditions are associated with significant morbidity and, in some
cases,
mortality. The symptoms of autoimmune conditions may impact the ability to
work and
otherwise affect the quality of life of patients.
Systemic lupus erythematosus (SLE) is a multifactorial autoimmune condition
characterized by chronic activation of the immune system and multiple
immunological
phenotypes (Fairhurst et al., 2006; Anders et al., 2009). Many of the
identified molecular
aberrations explain certain established cell and cytokine defects in lupus. T
cells from lupus
patients display a number of signaling abnormalities (Nambiar et al., 2004;
Fujii et al., 2006;
Kong et al., 2003; Moulton et al., 2011).
Interleukin-2 (IL-2) is a multifunctional cytokine primarily produced by T
cells and is
essential for T cell activation, proliferation, and contraction (Lieberman et
al., 2010). It has been
reported that the production of IL-2 is decreased in SLE T cells and that
transcriptional
regulators responsible for transcription or suppression of IL-2 production are
imbalanced in SLE
T cells (Lieberman et al., 2010; Tenbrock et al., 2004; Katsiari et al., 2005;
Juang et al., 2005;
Herndon et al., 2002; Solomou et al., 2001).
Summary of the Disclosure
There is significant need for improved methods and compositions for use in the
diagnosis, management and treatment of autoimmune conditions. The present
disclosure
provides methods and compositions applicable to the treatment, evaluation,
diagnosis, and
prognosis of subjects having an autoimmune condition, such as systemic lupus
erythematosus.
In certain embodiments, the methods provided herein are based on the
correlation between
microRNA-31 expression and IL-2 expression in subjects.
In a first aspect, the disclosure provides a method of increasing interleukin-
2 (IL-2)
expression in a subject in need thereof, which subject has an autoimmune
condition. Such a
method comprises administering to the subject an effective amount of a
composition that
increases expression of microRNA-31 or decreases expression of RhoA. In
certain
embodiments, the subject in need thereof is a subject having systemic lupus
erythematosus. In
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
other embodiments, the subject in need thereof is a subject having another
autoimmune condition
that shares one or more features with SLE, such as a shared mechanism of
action, etiology,
correlation with IL-2 dysregulation, or correlation with misregulation of T
cells, particularly
misregulation of regulatory T cells.
In a second aspect, the disclosure provides a method of increasing interleukin-
2 (IL-2)
expression in T cells of a subject having an autoimmune condition. Such a
method comprises
contacting the T cells with an effective amount of a composition that
increases expression of
microRNA-31 or decreases expression of RhoA. Contacting T cells may be in
vivo, such as by
administering a composition to a subject. Alternatively, contacting T cells
may be in vitro, such
as by including a composition in a cell culture media. In certain embodiments,
the subject
having an autoimmune condition has systemic lupus erythematosus. In other
embodiments, the
subject in need thereof is a subject having another autoimmune condition that
shares one or more
features with SLE, such as a shared mechanism of action, etiology, correlation
with IL-2
dysregulation, or correlation with misregulation of T cells, particularly
misregulation of
regulatory T cells.
In a third aspect, the disclosure provides a method of treating an autoimmune
condition,
comprising administering to a subject in need thereof an effective amount of a
composition that
increases expression of microRNA-31 or decreases expression of RhoA to treat
the autoimmune
condition. In certain embodiments, the autoimmune condition is systemic lupus
erythematosus.
In other embodiments, the condition is another autoimmune condition that
shares one or more
features with SLE, such as a shared mechanism of action, etiology, correlation
with IL-2
dysregulation, or correlation with misregulation of T cells, particularly
misregulation of
regulatory T cells.
In a fourth aspect, the disclosure provides a method of decreasing RhoA
expression in a
subject having an autoimmune condition. Such a method comprises administering
to the subject
an effective amount of a composition that increases expression of microRNA-31.
In certain
embodiments, the autoimmune condition is systemic lupus erythematosus. In
other
embodiments, the condition is another autoimmune condition that shares one or
more features
with SLE, such as a shared mechanism of action, etiology, correlation with IL-
2 dysregulation,
or correlation with misregulation of T cells, particularly misregulation of
regulatory T cells.
-2-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
In a fifth aspect, the disclosure provides a method of decreasing RhoA
expression in T
cells of a subject having an autoimmune condition. Such a method comprises
contacting the T
cells with an effective amount of a composition that increases expression of
microRNA-31.
Contacting T cells may be in vivo, such as by administering a composition to a
subject.
Alternatively, contacting T cells may be in vitro, such as by including a
composition in a cell
culture media. In certain embodiments, the subject having an autoimmune
condition has
systemic lupus erythematosus. In other embodiments, the subject in need
thereof is a subject
having another autoimmune condition that shares one or more features with SLE,
such as a
shared mechanism of action, etiology, correlation with IL-2 dysregulation, or
correlation with
misregulation of T cells, particularly misregulation of regulatory T cells.
The disclosure contemplates that the following embodiments may be applicable
to any of
the foregoing aspects of the disclosure and/or any of the following
embodiments of the
disclosure. In certain embodiments, the subject is a human subject. In other
embodiments, the
subject is a non-human subject. In certain embodiments, the subject has
systemic lupus
erythematosus and is experiencing symptoms of a disease flare, such as
experiencing symptoms
of a disease flare prior to administration of the composition. In other
embodiments, the subject
has systemic lupus erythematosus and is not experiencing symptoms of a disease
flare, such as
prior to administration of the composition. In certain embodiments, the
symptoms of SLE
include lupus nephritis. In certain embodiments, the subject has another
autoimmune condition,
such as a condition that shares one or more features with SLE, such as a
shared mechanism of
action, etiology, correlation with IL-2 dysregulation, or correlation with
misregulation of T cells,
particularly misregulation of regulatory T cells. In certain embodiments, the
other autoimmune
condition is rheumatoid arthritis (RA) or type I diabetes.
In certain embodiments, the T cells contacted or acted on by the composition
are
activated T cells, such as activated T cells in vitro or in vivo.
In certain embodiments of any of the foregoing, the composition comprises a
nucleic acid
comprising a nucleotide sequence that increases expression of microRNA-31. In
certain
embodiments, the composition comprises a nucleic acid comprising a nucleotide
sequence that
decreases expression of RhoA. In other embodiments, the composition comprises
a polypeptide
or small organic molecule that increases expression of microRNA-31 and/or
decreases
-3-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
expression of RhoA. By increases or decreases expression, the disclosure
contemplates
embodiments in which transcript and/or protein expression are increased or
decreased.
In certain embodiments of any of the foregoing, the composition comprises
microRNA-
31 which is exogenously added. Such microRNA-31 may correspond to naturally
occurring
microRNA-31 or may comprise a synthetic nucleic acid. In certain embodiments,
the
composition comprises a short interfering nucleic acid (siNA), such as a
microRNA, an siRNA
or an antisense oligonucleotide. In certain embodiments, the composition
comprises an siNA
that can hybridize to RhoA.
In certain embodiments of any of the foregoing, decreases expression of RhoA
comprises
decreases expression of RhoA transcripts. In other embodiments, decreases
expression of RhoA
comprises decreases expression of RhoA protein. In certain embodiments,
increases expression
of IL-2 comprises increases expression of IL-2 transcripts. In other
embodiments, increases
expression of IL-2 comprises increases expression of IL-2 protein.
In certain embodiments of any of the foregoing, the method further comprises
one or
more assay steps. For example, in certain embodiments, the method further
comprises assaying
expression of IL-2 in a sample taken from the subject at a time subsequent to
administering the
composition. In other embodiments, the method further comprises assaying
expression of RhoA
in a sample taken from the subject at a time subsequent to administering the
composition. Such
samples may be taken by the same health care provider who or at the same
institution where the
therapeutic composition is administered, or such samples may be taken by
different health care
providers and/or at a different institution.
In certain embodiments, the sample used in an assaying step comprises a blood
sample.
For example, the assay may be performed using whole blood samples or using
lymphocytes
separated from the blood sample or using serum or some other component of the
blood. The
relevant sample is prepared based on the particular assay being used. In other
embodiments, the
sample used in the assaying step comprises a bone marrow sample. Regardless of
the sample
used for the assaying step, in certain embodiments, assaying expression of IL-
2 comprises
assaying expression of IL-2 transcripts, such as in T cells. In other
embodiments, assaying
expression of IL-2 comprises assaying expression of IL-2 protein in the
sample. Similarly,
regardless of the sample used for the assaying step, in certain embodiments,
assaying expression
of RhoA comprises assaying expression of RhoA transcripts, such as in T cells.
In other
-4-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
embodiments, assaying expression of RhoA comprises assaying expression of RhoA
protein in
the sample.
In a sixth aspect, the disclosure provides a method. The method comprises
assaying the
presence, absence or amount of a biomarker in a subject having an autoimmune
condition, such
as systemic lupus erythematosus, to whom a compound has been administered,
wherein the
biomarker is selected from microRNA-31, RhoA or IL-2; and determining whether
the dosage or
dosing regimen of the compound subsequently administered to the subject is
adjusted based on
the presence, absence or amount of the biomarker assayed. In certain
embodiments, the
autoimmune condition is systemic lupus erythematosus. In other embodiments,
the autoimmune
condition shares one or more features with SLE, such as a shared mechanism of
action, etiology,
correlation with IL-2 dysregulation, or correlation with misregulation of T
cells, particularly
misregulation of regulatory T cells.
In certain embodiments, the subject is a human subject. In other embodiments,
the
subject is a non-human subject. In certain embodiments, the subject has
systemic lupus
erythematosus and is experiencing symptoms of a disease flare. In other
embodiments, the
subject has systemic lupus erythematosus and is not experiencing symptoms of a
disease flare.
In certain embodiments, the symptoms of SLE include lupus nephritis. In
certain embodiments,
the subject has another autoimmune condition, such as a condition that shares
one or more
features with SLE, such as a shared mechanism of action, etiology, correlation
with IL-2
dysregulation, or correlation with misregulation of T cells, particularly
misregulation of
regulatory T cells. In certain embodiments, the other autoimmune condition is
rheumatoid
arthritis (RA) or type I diabetes.
In certain embodiments, the sample used for the assaying step comprises a
blood sample.
For example, an assay may be performed using a whole blood sample or using
lymphocytes
separated from the blood sample or using serum or some other component of the
blood. The
relevant sample is prepared based on the particular assay being used. In other
embodiments, the
sample used comprises a bone marrow sample. Regardless of the sample used for
the assaying
step, in certain embodiments, assaying expression of IL-2 comprises assaying
expression of IL-2
transcripts, such as in T cells. In other embodiments, assaying expression of
IL-2 comprises
assaying expression of IL-2 protein in the sample. Similarly, regardless of
the sample used for
the assaying step, in certain embodiments, assaying expression of RhoA
comprises assaying
-5-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
expression of RhoA transcripts, such as in T cells. In other embodiments,
assaying expression of
RhoA comprises assaying expression of RhoA protein in the sample.
In certain embodiments, the compound comprises a steroid or an
immunosuppressive
agent. In other embodiments, the compound comprises a composition of the
present disclosure.
In certain embodiments, the compound comprises a composition that increases
microRNA-31
expression or decreases RhoA expression. In certain embodiments, the compound
comprises IL-
2.
In certain embodiments, the biomarker examined is microRNA-31. In other
embodiments, the biomarker examined is RhoA. In other embodiments, the
biomarker examined
is IL-2. In still other embodiments, a combination of one or more of the
foregoing biomarkers is
examined. Biomarkers may be examined at the transcript or protein level.
In a seventh aspect, the disclosure provides a method of diagnosing an
autoimmune
condition, such as systemic lupus erythematosus. The method comprises
obtaining a sample
from a subject suspected of having an autoimmune condition, such as systemic
lupus
erythematosus; and assaying in the sample expression of microRNA-31 or RhoA.
In certain embodiments, the subject is a human subject. In other embodiments,
the
subject is a non-human subject. In certain embodiments, the subject has
systemic lupus
erythematosus and is experiencing symptoms of a disease flare. In other
embodiments, the
subject has systemic lupus erythematosus and is not experiencing symptoms of a
disease flare.
In certain embodiments, the symptoms of SLE include lupus nephritis. In
certain embodiments,
the subject has another autoimmune condition, such as a condition that shares
one or more
features with SLE, such as a shared mechanism of action, etiology, correlation
with IL-2
dysregulation, or correlation with misregulation of T cells, particularly
misregulation of
regulatory T cells. In certain embodiments, the other autoimmune condition is
rheumatoid
arthritis (RA) or type I diabetes.
In certain embodiments, the sample used for the assaying step comprises a
blood sample.
For example, an assay may be performed using a whole blood sample or using
lymphocytes
separated from the blood sample or using serum or some other component of the
blood. The
relevant sample is prepared based on the particular assay being used. In other
embodiments, the
sample used comprises a bone marrow sample. Regardless of the sample used for
the assaying
step, in certain embodiments, assaying expression of IL-2 comprises assaying
expression of IL-2
-6-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
transcripts, such as in T cells. In other embodiments, assaying expression of
IL-2 comprises
assaying expression of IL-2 protein in the sample. Similarly, regardless of
the sample used for
the assaying step, in certain embodiments, assaying expression of RhoA
comprises assaying
expression of RhoA transcripts, such as in T cells. In other embodiments,
assaying expression of
RhoA comprises assaying expression of RhoA protein in the sample.
In an eighth aspect, the disclosure provides a method of monitoring treatment
of an
autoimmune condition, such as systemic lupus erythematosus. The method
comprises detecting
expression of microRNA-31 or RhoA in a sample from a subject undergoing
treatment for an
autoimmune condition, such as systemic lupus erythematosus; and comparing the
expression of
microRNA-31 or RhoA to expression in a sample from the same subject obtained
prior to the
treatment or at an earlier time point during the treatment. In such a method,
an increase in
microRNA-31 or a decrease in RhoA in a sample obtained at a later point during
treatment
versus that obtained prior to treatment or at an earlier time point during
treatment indicates
effectiveness of the treatment, thereby monitoring the treatment.
In certain embodiments, the subject is a human subject. In other embodiments,
the
subject is a non-human subject. In certain embodiments, the subject has
systemic lupus
erythematosus and is experiencing symptoms of a disease flare. In other
embodiments, the
subject has systemic lupus erythematosus and is not experiencing symptoms of a
disease flare.
In certain embodiments, the symptoms of SLE include lupus nephritis. In
certain embodiments,
the subject has another autoimmune condition, such as a condition that shares
one or more
features with SLE, such as a shared mechanism of action, etiology, correlation
with IL-2
dysregulation, or correlation with misregulation of T cells, particularly
misregulation of
regulatory T cells. In certain embodiments, the other autoimmune condition is
rheumatoid
arthritis (RA) or type I diabetes.
In certain embodiments, the sample used for the assaying step comprises a
blood sample.
For example, an assay may be performed using a whole blood sample or using
lymphocytes
separated from the blood sample or using serum or some other component of the
blood. The
relevant sample is prepared based on the particular assay being used. In other
embodiments, the
sample used comprises a bone marrow sample. Regardless of the sample used for
the assaying
step, in certain embodiments, assaying expression of IL-2 comprises assaying
expression of IL-2
transcripts, such as in T cells. In other embodiments, assaying expression of
IL-2 comprises
-7-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
assaying expression of IL-2 protein in the sample. Similarly, regardless of
the sample used for
the assaying step, in certain embodiments, assaying expression of RhoA
comprises assaying
expression of RhoA transcripts, such as in T cells. In other embodiments,
assaying expression of
RhoA comprises assaying expression of RhoA protein in the sample.
In a ninth aspect, the disclosure provides a method of treating a subject
having an
autoimmune condition, such as systemic lupus erythematosus. The method
comprises
comparing expression of microRNA-31 or RhoA from a sample taken from a subject
prior to
initiation of a particular treatment for the autoimmune condition to a
standard range reflecting
expression in samples from healthy subjects, wherein expression of microRNA-31
below the
standard range or expression of RhoA above the standard range indicates
susceptibility to
treatment for, for example, systemic lupus erythematosus. The method further
comprises
treating the subject with an effective amount of a composition comprising
microRNA-31, siNA
that hybridizes to RhoA or IL-2 protein, or another composition of the
disclosure, if the subject is
determined to be susceptible to treatment for systemic lupus erythematosus;
detecting expression
of microRNA-31 or RhoA in a post-treatment sample from the subject; and
comparing
expression of microRNA-31 or RhoA in the post-treatment sample to expression
in the sample
taken prior to initiation of the particular treatment.
In certain embodiments, the subject is a human subject. In other embodiments,
the
subject is a non-human subject. In certain embodiments, the subject has
systemic lupus
erythematosus and is experiencing symptoms of a disease flare. In other
embodiments, the
subject has systemic lupus erythematosus and is not experiencing symptoms of a
disease flare.
In certain embodiments, the symptoms of SLE include lupus nephritis. In
certain embodiments,
the subject has another autoimmune condition, such as a condition that shares
one or more
features with SLE, such as a shared mechanism of action, etiology, correlation
with IL-2
dysregulation, or correlation with misregulation of T cells, particularly
misregulation of
regulatory T cells. In certain embodiments, the other autoimmune condition is
rheumatoid
arthritis (RA) or type I diabetes.
In certain embodiments, the sample used for the assaying step comprises a
blood sample.
For example, an assay may be performed using a whole blood sample or using
lymphocytes
separated from the blood sample or using serum or some other component of the
blood. The
relevant sample is prepared based on the particular assay being used. In other
embodiments, the
-8-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
sample used comprises a bone marrow sample. Regardless of the sample used for
the assaying
step, in certain embodiments, assaying expression of IL-2 comprises assaying
expression of IL-2
transcripts, such as in T cells. In other embodiments, assaying expression of
IL-2 comprises
assaying expression of IL-2 protein in the sample. Similarly, regardless of
the sample used for
the assaying step, in certain embodiments, assaying expression of RhoA
comprises assaying
expression of RhoA transcripts, such as in T cells. In other embodiments,
assaying expression of
RhoA comprises assaying expression of RhoA protein in the sample.
The disclosure contemplates that any one or more of the foregoing aspects and
embodiments may be combined and/or may be combined with any of the embodiments
described
in the detailed description and examples.
Brief Description of the Figures and Tables
Figure 1 shows decreased expression of miR-31 in lupus patients as compared
with
normal control (NC) subjects. (A) miR-31 expression in T cells, B cells and
monocytes was
determined by the Taqman quantitative PCR. Results are expressed as mean
SEM, normalized
to the expression of B cells from three healthy donors. (B) An independent
verification of miR-
31 expression in T cells from 32 lupus patients and 11 normal controls is
shown using the
Taqman quantitative PCR (P<0.0001). Results above are presented as mean SEM.
P values
were determined by Mann-Whitney U test.
Figure 2 shows the expression of the miR-31. (A) Taqman quantitative PCR
analysis of
miR-31 expression in activated primary T cells 24 hours post-transfection of
miR-31 mimic or
control (Ctrl). (B) Taqman quantitative PCR analysis of miR-31 expression in
activated primary
T cells 24 hours post-transfection of antagomir-31 or control.
Figure 3 presents experimental results showing that miR-31 regulates IL-2
expression
and the activity of the IL-2 promoter. (A) Primary T cells were stimulated
with PMA and
ionomycin and miR-31 levels were measured at different time by the Taqman
quantitative PCR.
RNU48 levels were used to normalize expression. Each bar is the mean of three
independent
experiments. (B) Quantitative PCR analysis of IL-2 expression in activated
primary T cells 24
hours post-transfection of miR-31 mimic or control mimic (Ctrl) and antagomir-
31 or antagomir-
control(Ctr1). Histograms show fold changes in mRNA expression with respect to
the controls
after normalization with the housekeeping gene RPL13A. (C) IL-2 levels in the
culture
-9-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
supernatant of activated primary T cells transfected with miR-31 mimic or
control mimic and
antagomir-31 or antagomir-control were detected by ELISA. Values in B and C
are the mean
SEM for four representative healthy donors. (D) The linear correlation
analysis between the
expression of IL-2 and miR-31 in activated T cells of patients with lupus (n =
15). (E) Jurkat
cells were co-transfected with miR-31 mimic or control mimic and the IL-2
promoter-luc
reporter plasmid together, with pGL3-basic-luc used for normalization of
transfection. Cells
were not stimulated or stimulated with PMA and ionomycin for 24 hours and the
relative
promoter activity was measured by dual luciferase assay. Each bar is the mean
of three
independent experiments. (F) miR-31 enhanced the luciferase activity of IL-2
promoter in a
dose-dependent manner. Results are from three representative experiments.
"P<0.01;***P<0.001.
Figure 4 presents experimental results identifying miR-31 as a negative
regulator of
RhoA expression. (A) RhoA mRNA expression levels in activated T lymphocytes
transfected
with either miR-31 mimic or control mimic were analyzed by RT-PCR. Data are
from three
independent experiments. Results are presented as mean SEM. (B) Immunoblot
analysis of
RhoA protein expression in T cells (n = 3) 48 hours post transfection of miR-
31 mimic or control
mimic. (C) The expression of RhoA in T cells from SLE patients (n=32) and
normal controls
(n=11) were measured by RT-PCR. Results above are presented as mean SEM. P
values were
determined by Mann-Whitney U test. (D) The linear correlation analysis between
the expression
of RhoA and miR-31 in primary T cells of lupus patients (n = 32).
Figure 5 shows the effect of siRNA against RhoA. (A) Quantitative PCR analysis
of
RhoA expression in primary T cells post-transfection of siRNA-1, siRNA-2 or
control. (B)
Immunoblot analysis of RhoA expression in primary T cells after the
transfection of two siRNAs
(siR-1 and siR-2) or control directed against RhoA. Results above are
presented as mean
SEM. P values were determined by Mann-Whitney U test.
Figure 6 presents experimental results showing that siRNA-mediated knockdown
of
RhoA regulates IL-2 production and the activity of the IL-2 promoter. (A)
Quantitative PCR
analysis of IL-2 expression in activated primary T cells 24 hours post-
transfection of miR-31
mimic or control mimic and two siRNAs. (B) IL-2 levels in the culture
supernatant of activated
primary T cells transfected with miR-31 mimic, control mimic, or two siRNAs
were detected by
ELISA. Values in A and B are the mean SEM for three representative healthy
donors. (C)
-10-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Dual luciferase assay of Jurkat cells co-transfected with the reporter vectors
containing the IL-2
promoter and RhoA siRNA, miR-31 mimic or control mimic with pGL3-basic-luc
used for
normalization of transfection. The data are shown as relative luciferase
activity of miR-31 and
siRNA transfected cells with respect to the controls from three independent
experiments.
Figure 7 presents experimental results identifying the roles of miR-31, RhoA
and IL-2 in
activated T cells from SLE patients. (A) The expression of miR-31 in activated
T cells of 15
SLE patients and 10 normal controls (NC) was detected by the Taqman
quantitative PCR. (B)
RhoA expression was quantified by RT-PCR in the samples above. (C) IL-2
protein levels in the
supernatant of activated T cells from 12 SLE patients and 10 normal controls
were measured by
ELISA. (D) ELISA analysis of IL-2 expression in the culture supernatant of
activated T cells
from SLE patients (n=3) post-transfection of miR-31 mimic or control mimic.
Results above are
presented as mean SEM. P values were determined by Mann-Whitney U test.
Table 1 summarizes the clinical features of patients used in the studies
presented in
Figure 1B.
Table 2 summarizes the clinical features of patients used in the studies
presented in
Figure 7.
Detailed Description
(1) Overview
Systemic lupus erythematosus (SLE) is a multifactorial autoimmune disorder
characterized by chronic activation of the immune system and multiple
immunological
phenotypes. The instant disclosure is based in part on the identification of a
mechanism in
autoimmune disease involving signaling via microRNA-31, RhoA and IL-2.
MicroRNAs (miRNAs) are a class of single-stranded noncoding RNAs that act as
key
post-transcriptional regulators of gene expression (Denli et al., 2004;
Gregory et al., 2004). In
animals, miRNAs usually conduct imperfect base pairing with the 3'
untranslated region (UTR)
of target genes and regulate target gene expression by either translational
inhibition, or mRNA
degradation (Ambros. 2004).
Without being bound by theory, the instant disclosure is based, in part, on
the Examples
provided below. The Examples reflect studies in which under-expression of
endogenous miR-31
levels was identified in SLE T cells. It was also determined that miR-31 is a
positive regulator
-11-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
of IL-2 production in activated T cells, and that RhoA expression is inversely
correlated to miR-
31 expression. This regulation appears to occur via regulation of the promoter
activity of IL-2.
Moreover, the expression of RhoA was significantly higher in lupus T cells
compared to healthy
volunteers.
(ii) Definitions
Before continuing to describe the present disclosure in further detail, it is
to be
understood that this disclosure is not limited to specific compositions or
process steps, as such
may vary. It must be noted that, as used in this specification and the
appended claims, the
singular form "a", "an" and "the" include plural referents unless the context
clearly dictates
otherwise.
Unless defined otherwise, all technical and scientific terms used herein have
the same
meaning as commonly understood by one of ordinary skill in the art to which
this disclosure is
related. For example, the Concise Dictionary of Biomedicine and Molecular
Biology, Juo, Pei-
Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology,
3rd ed., 1999,
Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular
Biology, Revised,
2000, Oxford University Press, provide one of skill with a general dictionary
of many of the
terms used in this disclosure.
It is convenient to point out here that "and/or" where used herein is to be
taken as specific
disclosure of each of the two specified features or components with or without
the other. For
example "A and/or B" is to be taken as specific disclosure of each of (i) A,
(ii) B and (iii) A and
B, just as if each is set out individually herein.
(iii) Compositions
This section of the specification describes compositions for use in any of the
claimed
methods. The disclosure contemplates the use of any such compositions of the
disclosure,
described based on any combination of functional and/or structural features,
in any of the
methods described herein.
The present disclosure is based in part on the positive and negative
correlations and
mechanistic links between microRNA-31, RhoA and IL-2. Accordingly, the
disclosure provides
compositions useful in various methods, in vivo and in vitro, including
therapeutic and diagnostic
-12-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
methods. Compositions of the disclosure include compositions comprising, as
the active
ingredient, nucleic acids, polypeptides, or small organic molecules. Moreover,
in certain
embodiments, compositions of the disclosure are cellular compositions, such as
a composition in
which a cell that comprises and expresses a given nucleic acid or polypeptide
is administered.
The term "compositions of the disclosure" is used to refer to any such
compositions
useful in the present methods, including useful in diagnostic or therapeutic
methods. Any
compositions of the disclosure may be used in any of the methods described
herein.
Furthermore, any of the compositions of the disclosure may be described using
any of the
structural and/or functional features described herein.
A "nucleic acid" as used herein generally refers to a molecule (one, two or
more strands)
of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A
nucleobase includes,
for example, a naturally occurring purine or pyrimidine base found in DNA
(e.g., an adenine "A,"
a guanine "G," a thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an
uracil "U" or a C).
-13-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
precursors are generally between 62 and 110 nucleotides in humans. Nucleic
acids herein
provided may have regions of identity or complementarity to another nucleic
acid. It is
contemplated that the region of complementarity or identity can be at least 5
contiguous
residues, though it is specifically contemplated that the region, is at least,
is at most, or is about
5, 6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,
51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190,
200, 250, 300, 350,
400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 contiguous
nucleotides. In
certain embodiments, regardless of the length of nucleic acid molecule used,
it is understood that
the nucleic acid molecule is a fragment and corresponds to something less that
the full length
sequence of a naturally occurring molecule.
A nucleic acid may also comprise a vector, including without limitation a
plasmid or
virus. The vector may code for a pre-processed nucleic acid molecule, or for
the mature post-
processed molecule (e.g., pre-processed or post-processed miRNA or siRNA).
As provided herein a "synthetic nucleic acid" means that the nucleic acid does
not have a
chemical structure or sequence of a naturally occurring nucleic acid.
Consequently, it is
understood that the term "synthetic miRNA" refers to a "synthetic nucleic
acid" that is not
isolated from a cell and is artificially manufactured, but which may sometimes
function in a cell
or under physiological conditions.
As used herein "stringent condition(s)" or "high stringency" are those
conditions that allow
hybridization between or within one or more nucleic acid strand(s) containing
complementary
sequence(s), but preclude hybridization of random sequences. Stringent
conditions tolerate little, if any,
mismatch between a nucleic acid and a target strand. Such conditions are
known, and are preferred for
applications requiring high selectivity. Non-limiting applications include
isolating a nucleic acid, such
as a gene or a nucleic acid segment thereof, or detecting at least one
specific mRNA transcript or a
nucleic acid segment thereof, and the like.
Stringent conditions may comprise low salt and/or high temperature conditions,
such as
provided by about 0.02 M to about 0.5 M NaC1 at temperatures of about 42 C to
about 70 C. It is
understood that the temperature and ionic strength of a desired stringency are
determined in part by the
length of the particular nucleic acid(s), the length and nucleobase content of
the target sequence(s), the
-14-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
charge composition of the nucleic acid(s), and the presence or concentration
of formamide,
tetramethylammonium chloride or other solvent(s) in a hybridization mixture.
It is understood that these ranges, compositions and conditions for
hybridization are mentioned
by way of non-limiting examples only, and that the desired stringency for a
particular hybridization
reaction is often determined empirically by comparison to one or more positive
or negative controls.
Depending on the application envisioned varying conditions of hybridization
may be employed to
achieve varying degrees of selectivity of a nucleic acid towards a target
sequence. In a non-limiting
example, identification or isolation of a related target nucleic acid that
does not hybridize to a nucleic
acid under stringent conditions may be achieved by hybridization at low
temperature and/or high ionic
strength. Such conditions are termed "low stringency" or "low stringency
conditions," and non-limiting
examples of low stringency include hybridization performed at about 0.15 M to
about 0.9 M NaC1 at a
temperature range of about 20 C to about 50 C. The low or high stringency
conditions may be further
modified to suit a particular application.
siNA
siNA refers to a class of nucleic acid molecules capable of mediating sequence
specific RNAi,
for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-
RNA (miRNA),
short hairpin RNA (shRNA), short interfering oligonucleotide, short
interfering nucleic acid, short
interfering modified oligonucleotide, chemically-modified siRNA, post-
transcriptional gene silencing
RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant
to be equivalent to
other terms used to describe sequence specific RNA interference, such as post
transcriptional gene
silencing, or epigenetics. For example, siNA molecules can be used to
epigenetically silence genes at
either or both of the post-transcriptional level and the pre-transcriptional
level. In a nonlimiting example,
epigenetic regulation of gene expression by siNA molecules of the technology
can result from siNA
mediated modification of chromatin structure to alter gene expression. Thus, a
siNA may be used
therapeutically to mediate the level of a polypeptide or protein. This
regulation may be direct or
indirect, such as by inhibiting expression of a protein that is itself a
repressor of a protein of interest.
A siNA may be a double-stranded polynucleotide molecule comprising self-
complementary
sense and antisense regions, where the antisense region comprises nucleotide
sequence that is
complementary to nucleotide sequence in a target nucleic acid molecule or a
portion thereof and the
sense region having nucleotide sequence corresponding to the target nucleic
acid sequence or a
portion thereof. A siNA can be assembled from two separate oligonucleotides,
where one strand is the
-15-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
sense strand and the other is the antisense strand, where the antisense and
sense strands are self-
complementary. In some embodiments, each strand comprises nucleotide sequence
that is
complementary to nucleotide sequence in the other strand; such as where the
antisense strand and
sense strand form a duplex or double stranded structure, for example where the
double stranded region
is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, or 25 or more
base pairs.
The antisense strand can comprise a nucleotide sequence that is complementary
to nucleotide
sequence in a target nucleic acid molecule or a portion thereof and the sense
strand can comprise
nucleotide sequence corresponding to the target nucleic acid sequence or a
portion thereof. In some
embodiments, a siNA can be assembled from a single oligonucleotide, where the
self complementary
sense and antisense regions of the siNA are linked by means of a nucleic acid
based or non-nucleic
acid-based linker(s). A siNA can be a polynucleotide with a hairpin secondary
structure, having self-
complementary sense and antisense regions, where the antisense region
comprises nucleotide
sequence that is complementary to nucleotide sequence in a separate target
nucleic acid molecule or a
portion thereof and the sense region having nucleotide sequence corresponding
to the target nucleic
acid sequence or a portion thereof. A siNA can be a circular single-stranded
polynucleotide having
two or more loop structures and a stem comprising self complementary sense and
antisense regions,
where the antisense region comprises nucleotide sequence that is complementary
to nucleotide
sequence in a target nucleic acid molecule or a portion thereof and the sense
region having nucleotide
sequence corresponding to the target nucleic acid sequence or a portion
thereof, and where the circular
polynucleotide can be processed either in vivo or in vitro to generate an
active siNA molecule capable
of mediating RNAi.
In some embodiments a siNA comprises two strands of RNA. In certain
embodiments a
siNA comprises two strands of DNA. A siNA may sometimes be a hybrid,
comprising one strand of
RNA and one strand of DNA. One or both strands may also comprise mixed RNA and
DNA. In some
embodiments a strand of a siNA (e.g., a strand of a siRNA) may be about 5 to
about 60 nucleotides
in length (e.g., about 6,7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 41, 42, 43, 44 45 46 47 48, 49, 50,
51, 52, 53, 54, 55, 56, 57, 58 or
59 nucleotides). A siNA strand sometimes may exceed 60 nucleotides.
A siNA may also comprise a single-stranded polynucleotide having a nucleotide
sequence
complementary to nucleotide sequence in a target nucleic acid molecule or a
portion thereof (for
-16-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
example, where such siNA molecule does not require the presence within the
siNA molecule of
nucleotide sequence corresponding to the target nucleic acid sequence or a
portion thereof),
where the single stranded polynucleotide can further comprise a terminal
phosphate group, such as a
' -phosphate or 5', 3 ' -diphosphate.
5 In certain embodiments, a siNA molecule may comprise separate sense and
antisense
sequences or regions, where the sense and antisense regions are covalently
linked by nucleotide or
nonnucleotide linker molecules as is known in the art, or are alternately non-
covalently linked by ionic
interactions, hydrogen bonding, van der waals interactions, hydrophobic
interactions, and/or
stacking interactions. In certain embodiments, a siNA molecule comprises a
nucleotide sequence that
is complementary to nucleotide sequence of a target gene. In some embodiments,
the siNA molecule
interacts with nucleotide sequence of a target gene in a manner that causes
inhibition of expression of
the target gene.
In some embodiments, one or more nucleotides in an siNA are substituted with
another
nucleotide, are a modified base, are deleted and/or are inserted (e.g., 1,2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20 nucleotides in the siNA are substituted, are a
modified base, are deleted
and/or are inserted) relative to an unmodified reference siNA (e.g., a native
siNA). The function of
such a modified siNA in vivo or in vitro sometimes is the same as for a
reference siNA, and
sometimes is modified (e.g., greater or reduced). A modified function
typically is detectable and
sometimes is within 100-fold greater (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30,
35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95-fold greater) or 100-fold reduced (e.g., 2, 4, 6, 8, 10,
15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95-fold reduced) of the function elicited by a
reference siNA. In certain
embodiments, the methods of the disclosure comprise administering a
composition comprising an
siNA. In other words, siNA molecules are exogenously added to cells or
administered to patients.
Such exogenously added siNA molecules are expressed following their
introduction. Without being
bound by theory, in certain embodiments, the exogenously added siNA molecules
help upregulate
endogenous expression of a transcript or protein. In other embodiments,
expression of a particular
molecule is increased by exogenously adding siNA molecules, thereby
overexpression of particular
molecule is cells.
MicroRNA
MicroRNAs (also referred to interchangeably herein as "miRNAs") are a class of
non-coding
regulatory RNAs. Naturally occurring miRNAs are generally approximately from
15 to 30
-17-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
nucleotides up to 80-120 nucleotides in length as precursor microRNA. The term
"miRNA" generally
refers to a single-stranded molecule, but in specific embodiments, may also
encompass a region or an
additional strand that is partially (between 10 and 50% complementary across
the length of the
strand), substantially (greater than 50% but less than 100% complementary
across length of strand) or
fully complementary to another region of the same single-stranded molecule or
to another nucleic
acid. Thus, miRNA may encompass a single-stranded, double-stranded or
partially single-stranded
molecule. For example, precursor miRNA may have a self-complementary region,
which is up to
100% complementary.
Many microRNAs are highly conserved across a number of species while some are
species
specific. They regulate gene expression post-transcriptionally, primarily by
associating with the 3'
untranslated region (UTR) of their regulatory target mRNAs. MicroRNAs are
implicated in cell
proliferation, differentiation, and apoptosis, as well as other cellular,
molecular, and developmental
pathways. It is understood that some miRNA is derived from genomic sequences
or a gene. In this
respect, the term "gene" is used for simplicity to refer to the genomic
sequence encoding the precursor
miRNA for a given miRNA. However, some embodiments may involve genomic
sequences of a
miRNA that are involved in its expression, such as a promoter or other
regulatory sequences. The term
"recombinant" may be used and this generally refers to a molecule that has
been manipulated in vitro
or that is a replicated or expressed product of such a molecule.
Native miRNAs are regulatory RNAs that act as the recognition component of the
complex
RNA-induced Silencing Complex (RISC) riboprotein complex. The genes encoding
miRNAs are
longer than the processed mature miRNA molecule. Genomic microRNAs exist in
many different
forms, including individual genes, genetic clusters of multiple microRNAs, or
encoded within the
introns of protein coding genes. miRNAs are first transcribed as primary
transcripts or pri-miRNA
consisting of RNA transcripts averaging about 1.2 Kb, or within the introns of
long protein coding
transcripts.
Pri-miRs are processed by Drosha enzymes to short, roughly 70 to 120-
nucleotide stem-loop
structures, known as pre- or precursor miRNA in the cell nucleus. These pre-
miRNAs then are
processed to mature functional miRNAs in the cytoplasm by interaction with the
endonucleases
Argonaut, Dicer, and others to produce the RISC complex.
MicroRNAs generally inhibit translation or promote mRNA degradation by base-
pairing to
partially complementary sequences within the 3' untranslated regions (UTRs) of
regulatory target
-18-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
mRNAs. Individual messenger RNAs (mRNAs) can be targeted by several miRNAs,
and a single
miRNA can regulate multiple target mRNAs. MicroRNAs can coordinately regulate
a set of genes
encoding proteins with related functions, providing enormous complexity and
the potential of gene
regulation.
MicroRNAs can be labeled, used in array analysis, or employed in diagnostic,
therapeutic, or
prognostic applications. The RNA may have been endogenously produced by a
cell, or been
synthesized or produced chemically or by recombinant technology. They may be
isolated and/or
purified. Human miRNA molecules often are referenced herein with the prefix
"hsa-miR-". Unless
otherwise indicated, miRNAs referred to in the application are human
sequences, and non-human
miRNA sequences can be determined and prepared from these (e.g., for
applications in non-human
subjects).
In some embodiments, a miRNA may used that does not correspond to a known
human
miRNA.
In some embodiments, one or more nucleotides in an miRNA are substituted with
another
nucleotide, are a modified base, are deleted and/or are inserted (e.g., 1,2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in the miRNA are substituted, are
a modified base, are
deleted and/or are inserted) relative to an unmodified reference miRNA (e.g.,
a native miRNA). The
function of such a modified miRNA in vivo or in vitro sometimes is the same as
for the reference
miRNA, and sometimes is modified (e.g., greater or reduced). A modified
function typically is
detectable and sometimes is within 100-fold greater (e.g., 2, 4, 6, 8, 10, 15,
20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95-fold greater) or 100-fold reduced (e.g., 2,
4, 6, 8, 10, 15, 20, 25, 30,
35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold reduced) of the
function elicited by a reference
miRNA.
In some embodiments, the disclosure is based on assaying the expression of
microRNA-31
levels in cells or samples. When assaying expression, the disclosure
contemplates that endogenous
expression levels are determined, but also contemplates assaying expression
after a therapeutic
intervention, in which case a combination of endogenous expression and, in
certain embodiments,
expression of exogenously introduced nucleic acid may be evaluated.
Nucleic Acid Modification
Any of the modifications described below may be applied to a nucleic acid,
such as miRNA
and siRNA, as appropriate. It should be understood that a nucleic acid,
including a particular nucleic
-19-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
acid such as miRNA-31 may also include nucleic acid modifications. Examples of
modifications
include alterations to the RNA backbone, sugar or base, and various
combinations thereof. Any
suitable number of backbone linkages, sugars and/or bases in a miRNA or other
nucleic acid can be
modified (e.g., independently about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,
45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, up to 100% backbone linkages, sugars
and/or bases are
modified; or about 1,2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19 or 20 backbone
linkages, sugars and/or bases are modified). An unmodified miRNA nucleoside is
any one of the
bases adenine, cytosine, guanine, thymine, or uracil joined to the l' carbon
of beta-D-ribo-furanose.
A modified base is a nucleotide base other than adenine, guanine, cytosine and
uracil at a l'
position. Non-limiting examples of modified bases include inosine, purine,
pyridin-4-one, pyridin-2-
one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil,
dihydrouridine, naphthyl,
aminophenyl, 5-alkylcytidines (e. g., 5-methylcytidine), 5-alkyluridines (e.
g., ribothymidine), 5-
halouridine (e. g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines
(e. g. 6-methyluridine),
propyne, and the like. Other non-limiting examples of modified bases include
nitropyrrolyl (e.g., 3-
nitropyrrolyl), nitroindolyl (e.g., 4-, 5-, 6-nitroindoly1), hypoxanthinyl,
isoinosinyl, 2-aza-inosinyl, 7-
deaza-inosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl,
nitroindazolyl, aminoindolyl,
pyrrolopyrimidinyl, difluorotolyl, 4-fluoro-6-methylbenzimidazole, 4-
methylbenzimidazole, 3-methyl
isocarbostyrilyl, 5-methyl isocarbostyrilyl, 3-methyl-7-propynyl
isocarbostyrilyl, 7-azaindolyl, 6-
methy1-7-azaindolyl, imidizopyridinyl, 9-methyl-imidizopyridinyl,
pyrrolopyrizinyl, isocarbostyrilyl,
7-propynyl isocarbostyrilyl, propyny1-7-azaindolyl, 2,4,5- trimethylphenyl, 4-
methylindolyl, 4,6-
dimethylindolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl,
stilbenyl, tetracenyl,
pentacenyl and the like.
In some embodiments, for example, a nucleic acid may comprise modified nucleic
acid
molecules, with phosphate backbone modifications. Non-limiting examples of
backbone
modifications include phosphorothioate, phosphorodithioate, methylphosphonate,
phosphotriester,
morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide,
sulfonate, sulfonamide,
sulfamate, formacetal, thioformacetal, and/or alkylsilyl modifications. In
certain instances, a ribose
sugar moiety that naturally occurs in a nucleoside is replaced with a hexose
sugar, polycyclic
heteroalkyl ring, or cyclohexenyl group. In certain instances, the hexose
sugar is an allose, altrose,
glucose, mannose, gulose, idose, galactose, talose, or a derivative thereof.
The hexose may be a D-
hexose, glucose, or mannose. In certain instances, the polycyclic heteroalkyl
group may be a bicyclic
-20-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
ring containing one oxygen atom in the ring. In certain instances, the
polycyclic heteroalkyl group is a
bicyclo[2.2.1]heptane, a bicyclo[3.2.1]octane, or a bicyclo[3.3.1]nonane.
Nitropyrrolyl and nitroindolyl nucleobases are members of a class of compounds
known as
universal bases. Universal bases are those compounds that can replace any of
the four naturally
occurring bases without substantially affecting the melting behavior or
activity of the oligonucleotide
duplex. In contrast to the stabilizing, hydrogen-bonding interactions
associated with naturally
occurring nucleobases, oligonucleotide duplexes containing 3-
nitropyrrolylnucleobases may be
stabilized solely by stacking interactions. The absence of significant
hydrogen-bonding interactions
with nitropyrrolyl nucleobases obviates the specificity for a specific
complementary base. In addition,
4-, 5- and 6-nitroindoly1 display very little specificity for the four natural
bases. Procedures for the
preparation of 1-(2'-0-methykbeta.-D-ribofuranosyl)-5-nitroindole are
described in Gaubert, G.;
Wengel, J. Tetrahedron Letters 2004, 45, 5629. Other universal bases include
hypoxanthinyl,
isoinosinyl, 2-aza-inosinyl, 7-deaza-inosinyl, nitroimidazolyl,
nitropyrazolyl, nitrobenzimidazolyl,
nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, and structural derivatives
thereof.
Difluorotolyl is a non-natural nucleobase that functions as a universal base.
Difluorotolyl is
an isostere of the natural nucleobase thymine. However, unlike thymine,
difluorotolyl shows no
appreciable selectivity for any of the natural bases. Other aromatic compounds
that function as
universal bases are 4-fluoro-6-methylbenzimidazole and 4-methylbenzimidazole.
In addition, the
relatively hydrophobic isocarbostyrilyl derivatives 3-methyl isocarbostyrilyl,
5-methyl
isocarbostyrilyl, and 3- methyl-7-propynyl isocarbostyrilyl are universal
bases which cause only slight
destabilization of oligonucleotide duplexes compared to the oligonucleotide
sequence containing only
natural bases. Other non-natural nucleobases include 7-azaindolyl, 6-methyl-7-
azaindolyl,
imidizopyridinyl, 9-methyl-imidizopyridinyl, pyrrolopyrizinyl,
isocarbostyrilyl, 7-propynyl
isocarbostyrilyl, propyny1-7- azaindolyl, 2,4,5-trimethylphenyl, 4-
methylindolyl, 4,6-dimethylindolyl,
phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl,
tetracenyl, pentacenyl, and
structural derivates thereof. For a more detailed discussion, including
synthetic procedures, of
difluorotolyl, 4-fluoro-6- methylbenzimidazole, 4-methylbenzimidazole, and
other non-natural bases
mentioned above, see: Schweitzer et al., J. Org Chem., 59:7238-7242 (1994).
Compositions comprising nucleic acids also include nucleic acids containing
modified,
i.e. non-naturally occurring internucleoside linkages. Such non-naturally
internucleoside linkages
are often selected over naturally occurring forms because of desirable
properties such as, for
-21-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
example, enhanced cellular uptake, enhanced affinity for other
oligonucleotides or nucleic acid
targets and increased stability in the presence of nucleases. Oligomeric
compounds of the
invention can have one or more modified internucleoside linkages. As defined
in this
specification, oligonucleotides having modified internucleoside linkages
include internucleoside
linkages that retain a phosphorus atom and internucleoside linkages that do
not have a
phosphorus atom.
A suitable phosphorus-containing modified internucleoside linkage is the
phosphorothioate internucleoside linkage. Additional modified oligonucleotide
backbones
(internucleoside linkages) containing a phosphorus atom therein include, for
example, chiral
phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl
and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene
phosphonates and
chiral phosphonates, phosphinates, phosphoramidates including 3'-amino
phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, selenophosphates and boranophosphates having
normal 3'-5'
linkages, 2'-5' linked analogs of these, and those having inverted polarity
wherein one or more
internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.
Oligonucleotides having inverted
polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide
linkage i.e. a single
inverted nucleoside residue which may be abasic (the nucleobase is missing or
has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid forms are
also included.
A nucleotide analog may also include a "locked" nucleic acid. Certain
compositions can be
used to essentially "anchor" or "lock" an endogenous nucleic acid into a
particular structure.
Anchoring sequences serve to prevent disassociation of a nucleic acid siNA
complex, and thus not
only can prevent copying but may also enable labeling, modification, and/or
cloning of the
endogenous sequence. The locked structure may regulate gene expression (i.e.
inhibit or enhance
transcription or replication), or can be used as a stable structure that can
be used to label or otherwise
modify the endogenous nucleic acid sequence, or can be used to isolate the
endogenous sequence, i.e.
for cloning.
Nucleic acid molecules need not be limited to those molecules containing only
RNA or DNA,
but further encompass chemically-modified nucleotides and non-nucleotides. The
percent of non-
nucleotides or modified nucleotides may be from 1% to 100% (e.g., about 5, 10,
15, 20, 25, 30, 35, 40,
45, 50, 55, 60, 65, 70,75, 80, 85, 90 or 95% are non-nucleotides or modified
nucleotides; or about 1,
-22-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 non-
nucleotides or modified nucleotides in
the nucleic acid). In certain embodiments, a nucleic acid lacks 2'- hydroxyl
(2'-OH) containing
nucleotides. In certain embodiments a nucleic acid does not require the
presence of nucleotides having
a 2'- hydroxy group for mediating a function and as such, a nucleic acid may
include no
ribonucleotides (e. g., nucleotides having a 2'-OH group). Such nucleic acid
molecules that do not
require the presence of ribonucleotides to support a function can however have
an attached linker or
linkers or other attached or associated groups, moieties, or chains containing
one or more nucleotides
with 2'-OH groups. Sometimes nucleic acid molecules can comprise
ribonucleotides at about 5, 10,
20, 30, 40, or 50% of the nucleotide positions.
Biomarkers
Provided herein are microRNA (also referred to herein as "miRNA") biomarkers,
as well as
other biomarkers. Particular biomarkers for use in the subject methods include
miRNA-31, RhoA and
IL-2. The use of biomarkers is discussed in more detail in subsequent sections
of the application. The
disclosure contemplates detecting protein and/or transcript levels. By way of
example, biomarkers
can be detected using probes and primers to detect transcript levels, as well
as using antibodies to
detect protein levels.
Conjugates
In certain embodiments, the disclosure comprises administration of a
composition
comprising, as an active ingredient, a nucleic acid comprising a nucleotide
sequence. In other
words, in certain embodiments, the methods of the disclosure involve
administration of
exogenous nucleic acid molecules that are expression following introduction
into cells. In
certain embodiments, such nucleic acids may be appended with one or more
moieties or
conjugates which enhance the activity, cellular distribution or cellular
uptake of the resulting
oligomeric compounds. In one embodiment such modified nucleic acid
compositions are
prepared by covalently attaching conjugate groups to functional groups such as
hydroxyl or
amino groups. Conjugate groups of the disclosure include intercalators,
reporter molecules,
polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance
the
pharmacodynamic properties of oligomers, and groups that enhance the
pharmacokinetic
properties of oligomers. Typical conjugates groups include cholesterols,
carbohydrates, lipids,
phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone,
acridine, fluoresceins,
rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic
properties include
-23-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
groups that improve nucleic acid uptake, enhance resistance to degradation,
and/or strengthen
hybridization with RNA. Groups that enhance the pharmacokinetic properties
include groups
that improve uptake, distribution, metabolism or excretion. Representative
conjugate groups are
disclosed in International Patent Application PCT/US92/09196, filed Oct. 23,
1992 the entire
disclosure of which is incorporated herein by reference. Conjugate moieties
include but are not
limited to lipid moieties such as a cholesterol moiety (Letsinger et al.,
Proc. Natl. Acad. Sci.
USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem.
Let., 1994, 4,
1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann.
N.Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770),
a thiocholesterol
(Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118;
Kabanov et al.,
FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-
54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-
glycero-3-H-
phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et
al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain
(Manoharan et al.,
Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid
(Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys.
Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-
oxycholesterol
moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
Furthermore, the nucleic acid compounds of the disclosure can have one or more
moieties
bound or conjugated, which facilitates the active or passive transport,
localization, or
compartmentalization of the oligomeric compound. Cellular localization
includes, but is not
limited to, localization to within the nucleus, the nucleolus, or the
cytoplasm.
Compartmentalization includes, but is not limited to, any directed movement to
a cellular
compartment including the nucleus, nucleolus, mitochondrion, or imbedding into
a cellular
membrane.
Ribozymes
The compositions of the disclosure may also comprise ribozymes. Ribozymes are
catalytic RNA molecules with ribonuclease activity which are capable of
cleaving a single-
stranded nucleic acid, such as an mRNA, to which they have a complementary
region. Thus,
ribozymes (e.g., hammerhead ribozymes; described in Haselhoff and Gerlach,
1988, Nature
-24-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
334:585-591) can be used to catalytically cleave mRNA transcripts to thereby
inhibit translation
of the protein encoded by the mRNA. A ribozyme having specificity for a
nucleic acid molecule
encoding, for example, RhoA, can be designed based upon the nucleotide
sequence of RhoA.
Regardless of the particular nucleic acid containing composition used, the
disclosure
contemplates compositions comprising nucleic acids that increase miRNA-31
expression and
compositions comprising nucleic acids that decrease RhoA expression.
Particularly suitable
compositions can be used to increase expression of IL-2. It is understood that
some nucleic acid
compositions may function to increase endogenous expression of, for example,
microRNA-31.
However, in certain embodiments, expression of microRNA-31 is increased by
exogenously
providing to cells microRNA-31 in a form that is capable of being expressed
upon introduction
into cells, such as set forth in the examples. Administration of an
exogenously provided
molecule (single stranded, double stranded, partially double stranded, etc.)
that comprises a
sequence that, upon expression, mimics that of endogenous microRNA-31 may also
be referred
to as a microRNA-31 mimic which is also an example of a siNA molecule. In
certain
embodiments, the microRNA-31 mimic comprises an oligonucleotide (single
stranded, double
stranded, partially double stranded, etc.) comprising a sequence that
corresponds to that of
naturally occurring human microRNA-31 or pre-microRNA-31.
In a specific embodiment, a composition of the disclosure comprises an siNA
that inhibits
expression of RhoA, such as an siRNA that hybridizes to RhoA. In another
embodiment, a
composition of the disclosure comprises an siNA that increases endogenous
expression of
microRNA-31. In other embodiments, a composition of the disclosure comprises a
nucleic acid
comprising a nucleotide sequence corresponding to that of microRNA-31 (either
the naturally
occurring sequence or a modified variant thereof) such that expression of an
exogenously
supplied nucleic acid increased expression of microRNA-31.
Nucleic acid compositions can be isolated, made and/or delivered using well
known
methods in the art. In one embodiment, a composition of the disclosure
comprises a nucleic acid
that increases microRNA-31 expression or decreases RhoA expression, said
nucleic acid being
part of an expression vector that expresses the nucleic acid in a suitable
host. In particular, such
nucleic acids may have promoters, for example, heterologous promoters, said
promoter being
inducible or constitutive, and, optionally, tissue-specific.
-25-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Delivery of nucleic acids into a subject may be either direct, in which case
the subject is
directly exposed to the nucleic acid or nucleic acid-carrying vectors, or
indirect, in which case,
cells are first transformed with the nucleic acids in vitro, then transplanted
into the subject. These
two approaches are known, respectively, as in vivo or ex vivo gene therapy.
Thus, in certain
embodiments, disclosure includes the use of cellular compositions.
Isolated and/or recombinant nucleic acids, such as miRNA gene products, can be
obtained using a number of standard techniques. For example, the miRNA gene
products can be
chemically synthesized using one of several methods. In one method, miRNA gene
products are
chemically synthesized using appropriately protected ribonucleoside
phosphoramidites and a
conventional DNA/RNA synthesizer. Commercial suppliers of synthetic RNA
molecules or
synthesis reagents include, but are not limited to, Proligo (Hamburg,
Germany), Dharmacon
Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science,
Rockford, Ill.,
USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and
Cruachem
(Glasgow, UK).
Alternatively, nucleic acids, such as miRNA gene products can be expressed
from
recombinant circular or linear DNA plasmids using any suitable promoter.
Suitable promoters
for expressing RNA from a plasmid include, but are not limited to, the U6 or
H1 RNA pol III
promoter sequences, or the cytomegalovirus promoters. Recombinant plasmids may
further
comprise inducible or regulatable promoters for expression of the miRNA gene
products in
cancer cells.
Nucleic acid gene products, such as miRNA gene products, that are expressed
from
recombinant plasmids can be isolated from cultured cell expression systems by
standard
techniques.
Selection of plasmids suitable for expressing, for example, miRNA gene
products,
methods for inserting nucleic acid sequences into a plasmid to express gene
products, and
methods of delivering a recombinant plasmid into cells of interest may be
considered from
numerous publications. See, for example, Zeng et al., Molecular Cell 9:1327-
1333 (2002);
Tuschl, Nat. Biotechnol 20:446-448 (2002); Brummelkamp et al., Science 296:550-
553 (2002);
Miyagishi et al., Nat. Biotechnol. 20:497-500 ((2002); Paddison et al., Genes
Dev. 16:948-958
(2002); Lee et al., Nat. Biotechnol. 20:500-505 (2002); and Paul et al., Nat.
Biotechnol. 20:505-
508 (2002), the entire disclosures of which are herein incorporated by
reference.
-26-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
miRNA gene products can also be expressed from recombinant viral vectors. It
is
contemplated that the miRNA gene products can be expressed from two separate
recombinant
viral vectors, or from the same viral vector. The RNA expressed from the
recombinant viral
vectors can either be isolated from cultured cell expression systems by
standard techniques, or
can be used directly to infect cells in vitro or in vivo.
Recombinant viral vectors may comprise sequences encoding the miRNA gene
products
and any suitable promoter for expressing the RNA sequences. Suitable promoters
include, for
example, the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus
promoters.
Any viral vector capable of accepting coding sequences for miRNA gene products
(or
complementary sequences thereof) can be used, including, but not limited to,
vectors derived
from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g.,
lentiviruses (LV),
Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism
of the viral
vectors can be modified by pseudotyping the vectors with envelope proteins or
other surface
antigens from other viruses, or by substituting different viral capsid
proteins, as appropriate.
Transfection methods for eukaryotic cells include, but are not limited to,
direct injection
of the nucleic acid into the nucleus or pronucleus of a cell; electroporation;
liposome transfer or
transfer mediated by lipophilic materials; receptor mediated nucleic acid
delivery, bioballistic or
particle acceleration; calcium phosphate precipitation, and transfection
mediated by viral vectors.
For example, cells can be transfected with a liposomal transfer compound
(i.e., for
example, DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium
methylsulfate,
Boehringer-Mannheim) or an equivalent, such as Lipofectin. The amount of
nucleic acid used is
not critical to the practice of the invention; acceptable results may be
achieved with 0.1-100
micrograms of nucleic acid/10<sup>5</sup> cells. For example, a ratio of about 0.5
micrograms of
plasmid vector in 3 micrograms of DOTAP per 105.
The foregoing provides detailed description of compositions of the disclosure,
particularly nucleic acid-based compositions. In certain embodiments, the
composition for use in
the claimed methods comprises a nucleic acid comprising or consisting of a
nucleotide sequence
of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; optionally provided as part of
a vector. In
certain embodiments, the nucleic acid comprises a nucleotide sequence which is
an
oligonucleotide, such as an siNA molecule, that corresponds to a functional
portion of a naturally
occurring nucleic acid sequence. Additionally, compositions of the disclosure
include
-27-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
compositions in which the active agent is a polypeptide, such as an antibody,
or a small organic
molecule. Any of the classes of compounds can be formulated and administered
as a
composition or as a pharmaceutical composition.
Polypeptides and peptide fragments: In certain embodiments, the compounds are
polypeptides or peptide fragments. Exemplary polypeptides or peptide fragments
include
wildtype, as well as variant sequences. Variant polypeptides include amino
acid sequences at
least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to a particular
wild type
polypeptide.
In addition to polypeptides and peptide fragments, the present invention also
contemplates isolated nucleic acids comprising nucleotide sequences that
encode said
polypeptides and fragments. The term nucleic acid as used herein is intended
to include
fragments as equivalents, wherein such fragments have substantially the same
function as the full
length nucleic acid sequence from which it is derived. Equivalent nucleotide
sequences will
include sequences that differ by one or more nucleotide substitutions,
additions or deletions, such
as allelic variants; and will, therefore, include sequences that differ from
the nucleotide sequence
of, for example, the native nucleotide sequence. Equivalent sequences include
those that vary
from a known wildtype or variant sequence due to the degeneracy of the genetic
code.
Equivalent sequences may also include nucleotide sequences that hybridize
under stringent
conditions (i.e., equivalent to about 20-27 C below the melting temperature
(Tm) of the DNA
duplex formed in about 1M salt) to the native nucleotide sequence. Further
examples of
stringent hybridization conditions include a wash step of 0.2X SSC at 65 C.
Equivalent
nucleotide sequences will be understood to encode polypeptides which retain
the activity of the
polypeptide encoded by the native nucleotide sequence.
Equivalent nucleotide sequences for use in the methods described herein also
include
sequences which are at least 60% identical to a given nucleotide sequence. In
another
embodiment, the nucleotide sequence is at least 70%, 75%, 80%, 85%, 90%, 95%,
98%, 99%, or
100% identical to the nucleotide sequence of a native sequence.
Nucleic acids having a sequence that differs from nucleotide sequences which
encode a
particular polypeptide due to degeneracy in the genetic code are also within
the scope of the
invention. Such nucleic acids encode functionally equivalent peptides but
differ in sequence
from wildtype sequences known in the art due to degeneracy in the genetic
code. For example, a
-28-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
number of amino acids are designated by more than one triplet. Codons that
specify the same
amino acid, or synonyms (for example, CAU and CAC each encode histidine) may
result in
"silent" mutations which do not affect the amino acid sequence. However, it is
expected that
DNA sequence polymorphisms that do lead to changes in the amino acid sequences
will also
exist. One skilled in the art will appreciate that these variations in one or
more nucleotides (up to
about 3-5% of the nucleotides) of the nucleic acids encoding polypeptides may
exist among
individuals of a given species due to natural allelic variation.
Antibodies: Exemplary compounds also include antibodies. Antibodies can have
extraordinary affinity and specificity for particular epitopes. Without being
bound by theory,
antibodies can inhibit or potentiate the activity of proteins and signaling
pathways in cells,
thereby exerting or inducing a particular affect on cells, tissues, or
organisms.
Monoclonal or polyclonal antibodies can be made using standard protocols (See,
for
example, Antibodies: A laboratory manual ed. by Harlow and Lane (Cold Spring
Harbor Press:
1988)). A mammal, such as a mouse, a hamster or rabbit can be immunized with
an
immunogenic form of a peptide. Techniques for conferring immunogenicity on a
protein or
peptide include conjugation to carriers or other techniques well known in the
art. An
immunogenic portion of a protein can be administered in the presence of
adjuvant. The progress
of immunization can be monitored by detection of antibody titers in plasma or
serum. Standard
ELISA or other immunoassays can be used with the immunogen as antigen to
assess the levels of
antibodies. We note that antibodies may be immunospecific for a particular
protein, may be
immunospecific for a particular family of proteins, or may by less
immunospecific and cross-
react with multiple proteins from related families of proteins. Antibodies
which are
immunospecific do not substantially cross-react with non-homologous protein.
By not
substantially cross react is meant that the antibody has a binding affinity
for a non-homologous
proteins which is at least one order of magnitude, more preferably at least 2
orders of magnitude,
and even more preferably at least 3 orders of magnitude less than the binding
affinity of the
antibody for the protein or proteins for which the antibody is immunospecific.
Note that antibodies are also of particular use in diagnostic methods, such as
antibodies to
detect expression of IL-2 or RhoA.
Peptidomimetics: In other embodiments, the invention contemplates that the
agent is a
peptidomimetic. Peptidomimetics are compounds based on, or derived from,
peptides and
-29-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
proteins. Peptidomimetics can be obtained by structural modification of the
amino acid sequence
of a known protein using unnatural amino acids, conformational restraints,
isosteric replacement,
and the like. The subject peptidomimetics constitute the continuum of
structural space between
peptides and non-peptide synthetic structures.
Exemplary peptidomimetics can have such attributes as being non-hydrolyzable
(e.g.,
increased stability against proteases or other physiological conditions which
degrade the
corresponding peptide), having increased specificity and/or potency, and
having increased cell
permeability for intracellular localization. For illustrative purposes,
peptide analogs of the
present invention can be generated using, for example, benzodiazepines (e.g.,
see Freidinger et
al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher:
Leiden,
Netherlands, 1988), substituted gama lactam rings (Garvey et al. in Peptides:
Chemistry and
Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, p123),
C-7 mimics
(Huffman et al. in Peptides: Chemistry and Biologyy, G.R. Marshall ed., ESCOM
Publisher:
Leiden, Netherlands, 1988, p. 105), keto-methylene pseudopeptides (Ewenson et
al. (1986) J
Med Chem 29:295; and Ewenson et al. in Peptides: Structure and Function
(Proceedings of the
9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), I3-
turn dipeptide
cores (Nagai et al. (1985) Tetrahedron Lett 26:647; and Sato et al. (1986) J
Chem Soc Perkin
Trans 1:1231), I3-aminoalcohols (Gordon et al. (1985) Biochem Biophys Res
Commun126:419;
and Dann et al. (1986) Biochem Biophys Res Commun 134:71), diaminoketones
(Natarajan et al.
(1984) Biochem Biophys Res Commun 124:141), and methyleneamino-modifed (Roark
et al. in
Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden,
Netherlands,
1988, p134). Also, see generally, Session III: Analytic and synthetic methods,
in in Peptides:
Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden,
Netherlands, 1988)
In addition to a variety of sidechain replacements which can be carried out to
generate the
subject peptidomimetics, the present invention specifically contemplates the
use of
conformationally restrained mimics of peptide secondary structure. Numerous
surrogates have
been developed for the amide bond of peptides. Frequently exploited surrogates
for the amide
bond include the following groups (i) trans-olefins, (ii) fluoroalkene, (iii)
methyleneamino, (iv)
phosphonamides, and (v) sulfonamides.
-30-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Additionally, peptidomimietics based on more substantial modifications of the
backbone
of a peptide can be used. Peptidomimetics which fall in this category include
(i) retro-inverso
analogs, and (ii) N-alkyl glycine analogs (so-called peptoids).
Furthermore, the methods of combinatorial chemistry are being brought to bear,
e.g.,
PCT publication WO 99/48897, on the development of new peptidomimetics. For
example, one
embodiment of a so-called "peptide morphing" strategy focuses on the random
generation of a
library of peptide analogs that comprise a wide range of peptide bond
substitutes.
In an exemplary embodiment, the peptidomimetic can be derived as a retro-
inverso
analog of the peptide. Retro-inverso analogs can be made according to the
methods known in the
art, such as that described by the Sisto et al. U.S. Patent 4,522,752. As a
general guide, sites
which are most susceptible to proteolysis are typically altered, with less
susceptible amide
linkages being optional for mimetic switching. The final product, or
intermediates thereof, can
be purified by HPLC.
In another illustrative embodiment, the peptidomimetic can be derived as a
retro-enatio
analog of a peptide. Retro-enantio analogs such as this can be synthesized
using commercially
available D-amino acids (or analogs thereof) and standard solid- or solution-
phase peptide-
synthesis techniques. For example, in a preferred solid-phase synthesis
method, a suitably
amino-protected (t-butyloxycarbonyl, Boc) residue (or analog thereof) is
covalently bound to a
solid support such as chloromethyl resin. The resin is washed with
dichloromethane (DCM), and
the BOC protecting group removed by treatment with TFA in DCM. The resin is
washed and
neutralized, and the next Boc-protected D-amino acid is introduced by coupling
with
diisopropylcarbodiimide. The resin is again washed, and the cycle repeated for
each of the
remaining amino acids in turn. When synthesis of the protected retro-enantio
peptide is
complete, the protecting groups are removed and the peptide cleaved from the
solid support by
treatment with hydrofluoric acid/anisole/dimethyl sulfide/thioanisole. The
final product is
purified by HPLC to yield the pure retro-enantio analog.
In still another illustrative embodiment, trans-olefin derivatives can be made
for any of
the subject polypeptides. A trans olefin analog can be synthesized according
to the method of
Y.K. Shue et al. (1987) Tetrahedron Letters 28:3225 and also according to
other methods known
in the art. It will be appreciated that variations in the cited procedure, or
other procedures
available, may be necessary according to the nature of the reagent used.
-31-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
It is further possible to couple the pseudodipeptides synthesized by the above
method to
other pseudodipeptides, to make peptide analogs with several olefinic
functionalities in place of
amide functionalities.
Still another class of peptidomimetic derivatives include phosphonate
derivatives. The
synthesis of such phosphonate derivatives can be adapted from known synthesis
schemes. See,
for example, Loots et al. in Peptides: Chemistry and Biology, (Escom Science
Publishers,
Leiden, 1988, p. 118); Petrillo et al. in Peptides: Structure and Function
(Proceedings of the 9th
American Peptide Symposium, Pierce Chemical Co. Rockland, IL, 1985).
Many other peptidomimetic structures are known in the art and can be readily
adapted for
use in designing peptidomimetics. To illustrate, the peptidomimetic may
incorporate the 1-
azabicyclo[4.3.0]nonane surrogate (see Kim et al. (1997) J. Org. Chem.
62:2847), or an N-acyl
piperazic acid (see Xi et al. (1998) J. Am. Chem. Soc. 120:80), or a 2-
substituted piperazine
moiety as a constrained amino acid analogue (see Williams et al. (1996) J.
Med. Chem. 39:1345-
1348). In still other embodiments, certain amino acid residues can be replaced
with aryl and bi-
aryl moieties, e.g., monocyclic or bicyclic aromatic or heteroaromatic
nucleus, or a biaromatic,
aromatic, heteroaromatic, or biheteroaromatic nucleus.
Small organic or inorganic molecules: In certain embodiments, the compound is
a small
organic or inorganic molecule. Small organic or inorganic molecules can
agonize or antagonize
the function of a particular protein or class of proteins. By small organic or
inorganic molecule
is meant a carbon contain molecule having a molecular weight less than 5000
amu, preferably
less than 2500 amu, more preferably less than 1500 amu, and even more
preferably less than
750, 500, or 250 amu.
Small organic or inorganic molecules can be readily identified by screening
libraries of
organic molecules and/or chemical compounds to identify those compounds that
have a desired
function. Alternatively, single compounds or small numbers of candidate
compounds can be
screened individual or in combination. In certain embodiments, the small
molecule (e.g., an
inorganic or organic molecule) is a non-peptidyl compound containing two or
fewer, one or
fewer, or no peptide and/or saccharide linkages.
Small molecule inhibitors of RhoA are exemplary of small molecules that can be
used in
compositions of the disclosure. Several small molecule inhibitors are
commercially available.
-32-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
These can themselves be used as agents or used as a starting point for
medicinal chemistry to
generate additional small molecule RhoA inhibitors.
(iv) Autoimmune Conditions
The disclosure provides methods of diagnosing, monitoring and treating
autoimmune
conditions using any of the compositions of the disclosure. Any of the
compositions of the
disclosure described herein, may be used in subjects having or suspected of
having any of the
autoimmune conditions described herein. In certain embodiments, the methods
provided herein
are based on the correlation between microRNA-31 expression and IL-2
expression in subjects
having particular autoimmune conditions. In certain embodiments, the
autoimmune condition is
SLE or another autoimmune condition that shares one or more features with SLE,
such as a
shared mechanism of action, etiology, correlation with IL-2 dysregulation, or
correlation with
misregulation of T cells, particularly misregulation of regulatory T cells. In
certain
embodiments, the autoimmune condition is systemic lupus erythematosus, either
SLE during a
flare or during a period of remission. In other embodiments, the autoimmune
condition
correlates with decreased expression of IL-2 and/or decreased expression of
microRNA-31. In
certain embodiments, the symptoms or signs of SLE include lupus nephritis.
In certain embodiments, the subject has another autoimmune condition, such as
a
condition that shares one or more features with SLE, such as a shared
mechanism of action,
etiology, correlation with IL-2 dysregulation, or correlation with
misregulation of T cells,
particularly misregulation of regulatory T cells. In certain embodiments, the
other autoimmune
condition is rheumatoid arthritis (RA), type I diabetes, or an autoimmune
thyroid disease. In
certain embodiments, the other autoimmune condition is scleroderma. In certain
embodiments,
the autoimmune condition is correlated with decreased expression of IL-2
relative to healthy
subjects.
Exemplary autoimmune conditions, including symptoms of these conditions are
described below. Also provided are a few examples of animal models that are
used to evaluate
diagnostics and therapeutics for autoimmune conditions. These or other animal
models known in
the art may be used in developing a composition of the disclosure for use in a
method of
diagnosis or treatment. By "treating" is meant that administration of a
composition over the
course of one or more doses, reduces or eliminates one or more symptoms of the
condition. As
-33-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
used herein, the term "symptom" is used broadly to refer to signs and symptoms
of a condition,
whether observable directly by a patient or via medical testing, and also
refers to the downstream
complications of a disease that may be ameliorated via treatment.
Systemic lupus erythematosus (SLE)
Systemic lupus erythematosus, often abbreviated to SLE, is a systemic
autoimmune
condition that can affect any part of the body. It is a Type III
hypersensitivity reaction caused, at
least in part, by antibody-immune complex formation.
SLE most often harms the heart, joints, skin, lungs, blood vessels, liver,
kidneys, and
nervous system. The course of the disease is unpredictable, with periods of
illness (calledflares)
alternating with remissions The disease occurs nine times more often in women
than in men,
especially in women of child-bearing ages.
There is currently no cure for SLE, and management of symptoms has generally
been
limited to the use of general immunosuppression, such as with
cyclophosphamide,
corticosteroids and other immunosuppresants.
General symptoms of SLE include: arthritis; fatigue; general discomfort,
uneasiness or ill
feeling (malaise); joint pain and swelling; muscle aches; nausea and vomiting;
and skin rash.
Additionally symptoms may also include: abdominal pain; blood in the urine;
fingers that change
color upon pressure or in the cold; numbness and tingling; and red spots on
skin. In some
patients, SLE has lung or kidney involvement. In some cases, patients with SLE
develop a
particular kidney condition called lupus nephritis. The disclosure
contemplates that a subject in
need may have any one or more of these symptoms, and that therapeutic benefit
can be measured
based on improvement in any one or more of these symptoms.
Dermatological manifestations
Dermatological symptoms are very common, and 30% to 50% of subjects suffer
from the
classic malar rash, also known as butterfly rash. Some patients may exhibit
thick, red scaly
patches on the skin (referred to as discoid lupus). Other dermatological
manifestations include
alopecia; ulcers of the mouth, vagina, nasal tract, and/or urinary tract; skin
lesions; and small
tears in delicate tissue around the eyes.
Musculoskeletal
-34-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Joint pain is a common symptom of SLE with an estimated 90% of patients
reporting
joint and/or muscle pain at some time during the course of their illness. A
possible association
between rheumatoid arthritis and SLE has been suggested.
Hematological
Up to 50% of SLE patients are anemic. Additionally, SLE patients appear to
have an
increased occurrence of antiphospholipid antibody syndrome, a thrombotic
disorder
characterized by the presence of autoantibodies to phospholipids in the serum.
Hallmarks of
antiphospholipid antibody syndrome include a prolonged partial thromboplastin
time and a
positive test for antiphospholipid antibodies, and the occurrence of these
findings is termed
"lupus anticoagulant-positive."
Cardiac
Cardac symptoms of SLE include inflammation of parts of the heart, including
the
pericardium (pericarditis), the myocardium (myocarditis) and the endocardium
(endocarditis).
Atherosclerosis tends to occur more frequently in SLE patients and, when
present, advances
more rapidly than observed in the general population.
Pulmonary
SLE patients often have a variety of symptoms of lung and pleura inflammation.
Such
inflammation may cause pleuritis, pleural effusion, lupus pneumonitis, chronic
diffuse
intersititial lung disease, pulmonary hypertension, pulmonary emboli,
pulmonary hemorrhage,
and shrinking lung syndrome.
Renal
Lupus nephritis is an inflammation of the kidney, and is a severe complication
of
systemic lupus erythematosus (SLE). SLE is characterized by spontaneous B and
T cell
autoreactivity and multiorgan immune injury. In the kidney, lupus nephritis
can lead to
debilitating loss of function. Patients with lupus nephritis may eventually
develop kidney failure
and require dialysis or kidney transplantation.
The WHO has divided lupus nephritis into five classes based on biopsy results.
This
classification was defined in 1982 and revised in 1995. Class I is minimal
mesangial
glomerulonephritis which is histologically normal on light microscopy but with
mesangial
deposits on electron microscopy. Class II is based on a finding of mesangial
proliferative lupus
nephritis. Class III is focal proliferative nephritis. Class IV is diffuse
proliferative nephritis.
-35-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Class V is membranous nephritis and is characterized by extreme edema and
protein loss. Class
VI is glomerulosclerosis. The disclosure contemplates treating patients having
lupus nephritis
categorized in any of Class I, II, III, IV, V, or VI. In certain embodiments,
the patient has lupus
nephritis categorized in Class III or higher, in Class IV or higher, or in
Class V or higher. In
certain embodiments, the patient has lupus nephritis categorized as Class VI.
Symptoms of lupus nephritis include: blood in the urine, foamy appearance to
urine, high
blood pressure, protein in the urine, fluid retention, and edema. Other
symptoms include signs
and symptoms of renal fibrosis and/or kidney failure. If left untreated, lupus
nephritis may lead
to kidney failure, and even end stage renal disease.
Lupus nephritis can be diagnosed and/or monitored using blood or urine tests,
as well as
by kidney biopsy. Such tests may be used to monitor improvement of symptoms
during or
following treatment. In certain embodiments, treatment comprises improvement
in any one or
more of these indica. By way of example, lupus nephritis can be diagnosed
and/or assessed by
evaluating blood and/or protein content in the urine. Treating may comprise
reducing blood
and/or protein content in urine, such as to normal or near normal levels.
Lupus nephritis can also
be diagnosed and/or assessed by evaluating creatinine and/or urea level in
blood, and/or by
estimates of glomerular filtration rate based on creatinine score.
Neuropsychiatric
The American College of Rheumatology defines 19 neuropsychiatric syndromes in
systemic lupus erythematosus, and these can occur due to affects on the
central and peripheral
nervous system. The most common neuropsychiatric disorder in SLE patients is
headache.
Other common symptoms include cognitive dysfunction, mood disorder,
cerebrovascular,
seizures, polyneuropathy, anxiety disorder and psychosis. Additional symptoms
less commonly
observed include acute confusion, Guillain-barre syndrome, aseptic meningitis,
autonomic
disorder, demyelinating syndrome, mononeuropathy, chorea, myasthenia gravis,
myelopathy,
cranial neuropathy and plexopathy.
Neurological
Neural symptoms represent a significant incidence of the morbidity and
mortality of SLE.
The neural manifestation of lupus is known as neuropsychiatric systematic
lupus erythematosus
(NPSLE). One aspect of this is severe damage to the epithelial cells of the
blood-brain barrier.
Systemic
-36-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
The most common systemic symptom of SLE is fatigue. Fatigue is probably due to
a
variety of factors including anemia, hypothyroidism, pain, depression, poor
sleep quality, and
disease activity.
The American College of Rheumatology established eleven criteria for use in
classifying
and operationalizing the definition of SLE in clinical trials. This
classification system was not
intended for use as an individual diagnostic scheme, but rather, was intended
for use in clinical
studies. For the purpose of identifying patients for clinical studies, a
person has SLE if any 4 out
of the following 11 symptoms are present simultaneously or serially on two
separate occasions:
molar rash; discoid rash; serositis or pericarditis; oral ulcers (including
oral or nasopharyngeal);
arthritis (particularly nonerosive arthritis of two or more peripheral
joints); photosensitivity; a
hemotologic disorder, particularly hemolytic anemia, leukopenia, lymphopenia,
or
thrombocytopenia; a renal disorder, particularly protein or cellular casts in
the urine; a positive
antinuclear antibody test; an immunological disorder, particularly a positive
anti-Smith, anti-
double stranded DNA or antiphospholipid test; and a neurological disorder,
particularly seizures
or psychosis.
When diagnosing individual patients, a more holistic approach is used. For
example,
some people with antiphospholipid syndrome may have SLE without four of the
above criteria.
Moreover, SLE may present with symptoms and features other than those listed
in the criteria.
Quality of life for SLE patients can be improved through flare prevention. The
warning
signs of an impending flare include increased fatigue, pain, rash, fever,
abdominal discomfort,
headache, and dizziness. Early recognition of warning signs and good
communication with a
doctor can help individuals remain active, experience less pain, and reduce
medical visits.
Current treatment options for SLE include preventing flares and reducing their
severity
and duration, as well as management of individual symptoms. Treatment can
include
corticosteroids, anti-malarial drugs, and nonsteroidal anti-inflammatory
drugs. Certain types of
lupus nephritis require bouts of cytotoxic drugs, including cyclophosphamide
and
mycopheno late.
Disease-modifying antirheumatic drugs (DMARDs) may also be used to reduce the
incidence of flares, the process of the disease, and lower the need for
steroid use. DMARDs
commonly in use are antimalarials, such as plaquenil, and immunosuppressants,
such as
methotexate and azathioprine.
-37-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Corticosteroids and immunosuppressants are also used to control the disease
and prevent
flares. However, the use of steroids may result in Cushing's syndrome and
other side-effects.
Since a large percentage of people with SLE suffer from varying amounts of
chronic
pain, various types of medications to manage pain are often used. Pain
management typically
begins with over-the-counter drugs, such as nonsteroidal anti-inflammatories.
However, to
manage moderate or severe pain, mild or strong opiates may be needed.
In certain embodiments, the disclosure provides methods of treating SLE and/or
increasing IL-2 levels in subjects having SLE by administering an effective
amount of a
composition of the disclosure. Administering a composition of the disclosure
can be used to
decrease one or more symptoms of SLE and/or to decrease the frequency or
severity of flares. In
certain embodiments, administering a composition of the disclosure is used to
treat SLE in a
patient with lupus nephritis. In such cases, treating SLE may comprise
treating lupus nephritis,
such as by reducing symptoms of lupus nephritis. In certain embodiments,
treating comprises
treating the skin symptoms of SLE. In certain embodiments, treating comprises
reducing one or
more symptoms of lupus nephritis. In certain embodiments, treating comprises
reducing,
delaying or eliminating the need for dialysis. In certain embodiments,
treating comprises
reducing, delaying, or eliminating the need for kidney transplantation. In
certain embodiments,
treating comprises delaying or preventing progression of lupus nephritis to
renal failure or end
stage renal disease.
The invention contemplates methods of treating SLE, including treating lupus
nephritis,
comprising administering a composition of the disclosure alone or as part of a
therapeutic
regimen combined with one or more other drugs, biologics, or other therapeutic
modalities. The
other modalities selected as part of a therapeutic regimen may be selected
depending on the
severity of the patient's disease, and the particular symptoms being primarily
targeted. By way
of example, compositions of the disclosure may, in certain embodiments, be
administered as part
of a therapeutic regimen with one or more of: analgesics or other pain
management medications
(e.g., to help alleviate pain associated with arthritic or other symptoms),
anti-inflammatory
medications, steroids, immunosuppresant agents, antimalarial agents, and
cytotoxic agents.
Further examples of agents and treatment modalities that can be used in
combination include
diet, exercise, stress management, acupuncture, and physical therapy. Other
specific examples
include the use of agents and therapies specific for alleviating symptoms of
lupus nephritis, such
-38-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
as blood pressure lowering medications, protein, potassium, and/or sodium
reduced diets,
cytotoxic agents, and/or immunosuppresants. Methods of treatment include
treatment in
combination with dialysis, kidney transplant, or one or more other therapies
for kidney failure.
The disease symptoms can be replicated in animal models, and such models are
readily
used to confirm efficacy of a therapy or combination therapy. To this end,
many murine models
have been developed (Foster, Relevance of Systemic Lupus Erythematosus
Nepthritis Animal
Models to Human Disease. Semin Nephrol. 1999, 19(1): 12-24). The models make
use of host-
graft interactions (Bruijn et al., Murine Chronic Graft-Versus-Host Disease as
a Model for Lupus
Nephritis. Am J Pathol., 1988, 130(3): 639-641), transgenic mice (Takahashi et
al., Suppression
of Experimental Lupus Nephritis by Aberrant Expression of the Soluble E-
Selectin Gene.
Pathology International, 2002, 52(3):175-180), and anti-DNA antibodies (Yung
and Chan, Anti-
DNA Antibodies in the Pathogenesis of Lupus Nephritis ¨ The Emerging
Mechanisms.
Autoimmunity Reviews, 2008, 7(4): 317-321). These and other available animal
models may be
used in the course of developing a diagnostic or therapeutic. Additionally, in
vitro systems, such
as blood and tissue samples from subjects that have been previously diagnosed
with SLE can be
used. Exemplary tissue samples include blood samples, bone marrow samples, and
cultures of T
cells generated following separation of T cells from blood samples.
Type I Diabetes
Diabetes mellitus type 1 (Type 1 diabetes, IDDM, or, formerly, juvenile
diabetes) is a
form of diabetes mellitus resulting from autoimmune destruction of insulin-
producing beta cells
of the pancreas. The subsequent lack of insulin leads to increased blood and
urine glucose.
Classical symptoms are polyuria, polydipsia, polyphagia and weight loss.
Currently, type 1 diabetes is generally fatal unless treated with insulin, and
such
treatment must be continued throughout the patient's life time. Even with
treatment,
complications of low and high blood sugar may occur, including seizure,
unconsciousness, and
long term damage to peripheral nerves and blood vessels.
In certain embodiments, compositions of the disclosure can be used in the
treatment of
type I diabetes and/or to increase IL-2 expression in a subject that has type
I diabetes. Without
being bound by theory, use of such compositions may help stem the autoimmune
attack on
pancreatic cells, thus helping to reduce or eliminate the dependence on
exogenous insulin. In
certain embodiments, compositions of the disclosure are used in combination
with insulin, but
-39-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
the use of such compositions reduces the frequency with which insulin
injections are required
and/or decreases the magnitude of spikes/dips in patient blood glucose levels.
The disease symptoms can be replicated in animal models, and such models are
readily
used to confirm efficacy of a therapy or combination therapy. Numerous animal
models of type
I diabetes exist, and many such available models are summarized in a recent
review (Rees (2005)
Diabetic Medicine 22: 359-370).
Rheumatoid Arthritis
Rheumatoid arthritis is a long-lasting disease that can affect joints in any
part of the body
but most commonly the hands, wrists, and knees. With rheumatoid arthritis, the
immune system
mistakenly attacks itself and causes the joint lining to swell. The
inflammation then spreads to
the surrounding tissues, and can eventually damage cartilage and bone. In more
severe cases,
rheumatoid arthritis can affect other areas of the body, such as the skin,
eyes, and nerves.
Symptoms of rheumatoid arthritis include, but are not limited to, fatigue,
fever, rash, joint
inflammation, pain, tenderness around the effected joints, stifthess, redness
and warmth around
the effected joints, and reduced range of motion.
Rheumatoid arthritis can occur at any age, but is commonly observed between
the ages of
and 55. It is 2-3 times more common in women than in men. It is the second
most common
form of arthritis, affecting 2.1 million people in the U.S. alone.
Rheumatoid arthritis in some people may eventually cause the hands and feet to
become
20 misshapen as muscles weaken, tendons shrink, and the ends of bones
become damaged. Current
therapies include medications intended to decrease pain, joint swelling, and
inflammation. These
medications include non-steroidal anti-inflammatory medicines,
corticosteroids, anti-mitotics
(methotrexate and cyclophosphamides), and anti-TNFa medications intended to
systemically
dampen the inflammatory response. Additional treatments include diet,
exercise, and physical
25 therapy intended to help maintain muscle strength and range of motion,
thereby slowing the
disabling effects of the disease.
The methods of the present disclosure can be used in the treatment of
rheumatoid arthritis
and/or to increase IL-2 expression in patients with rheumatoid arthritis. In
certain embodiments,
the methods of the disclosure are used to decrease one or more symptoms of
rheumatoid arthritis.
In other words, "treating" is meant to include decreasing or eliminating one
or more symptoms
of rheumatoid arthritis. Moreover, the disclosure contemplates that
compositions of the
-40-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
disclosure may be administered alone or as part of a therapeutic regimen with
other agents useful
in decreasing one or more symptoms of rheumatoid arthritis. For example,
compositions of the
disclosure may be used with analgesics, anti-inflammatories, and rheumatoid
arthritis biological
agents (e.g., Humira, Simponi, Remicade, etc.).
The disease symptoms can be replicated in animal models, and such models are
readily
used to confirm efficacy of a therapy or combination therapy. Numerous animal
models for
rheumatoid arthritis exist in the art. By way of non-limiting example,
BioMedCode Hellas SA
makes animal models for inflammatory conditions. Many of the company's models
are
approved by the FDA for testing potential treatments for RA. Their models
include Tg197 and
Tg5433 mice.
Additional animal models of arthritis and rheumatoid arthritis include, but
are not limited
to, the models described in the following publications: Hammer et al., 1990,
Cell 63: 1099-1112;
Haqqi et al., 1992, PNAS 89: 1253-1255; Keffer et al., 1991, EMBO Journal 10:
4025-4031;
Pelletier et al., 1997, Arthritis Rheum 40: 1012-1029; Trentham et al., 1977,
Journal of
Experimental Medicine 146: 857-868; Wooley et al., 1981, Journal of
Experimental Medicine
154: 688-700. Recently, Bina and Wilder reviewed numerous available animal
models for
Rheumatoid arthritis. Bina and Wilder, 1999, Molecular Medicine Today 5: 367-
369.
Autoimmune Thyroid Disease
Autoimmune thyroid diseases, such as autoimmune thyroiditis, which is also
known as
Hashimoto's thyroiditis or chronic lymphocytic thyroiditis, are conditions in
which the immune
system attacks the body's own thyroid gland. The thyroid gland, which is a
small gland at the
front of the neck, becomes chronically inflamed and decreases production of
the thyroid
hormones triiodothyronine and thyroxine. Because these hormones are used
almost everywhere
in the body, autoimmune thyroid diseases can have widespread, serious effects
and many
symptoms.
Mild autoimmune thyroiditis can be symptomless. In more serious cases,
however,
inflammation of the thyroid can lead to enlargement (goiter). Over time, the
thyroid can suffer
more damage, leading to symptoms of hypothyroidism (underactive thyroid), such
as fatigue,
weight gain, body aches, depression, and lethargy. Chronic autoimmune thyroid
diseases can
progress to significant hypothyroidism.
-41-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
The classification of autoimmune thyroid disease (AITD) includes Hashimoto '5
thyroiditis (HT) or chronic autoimmune thyroiditis and its variants, Graves'
disease (GD) and
autoimmune atrophic thyroiditis. HT is characterized by the presence of
goiter, thyroid
autoantibodies against thyroid peroxidase (TPO) and thyroglobulin (Tg) in
serum, and varying
degrees of thyroid dysfunction. During HT, self-reactive CD4+ T lymphocytes
(Th) recruit B
cells and CD8+ T cells (CTL) into the thyroid. Disease progression leads to
the death of thyroid
cells and hypothyroidism.
Both autoantibodies and thyroid-specific cytotoxic T lymphocytes (CTLs) have
been
proposed to be responsible for autoimmune thyrocyte depletion. In GD, the TSH-
R is the most
important autoantigen. Antibodies directed against it mimic the effects of the
hormone on
thyroid cells, stimulating autonomous production of thyroxine and
triiodothyronine and causing
hyperthyroidism.
The methods of the present disclosure can be used in the treatment of an
autoimmune
thyroid disease and/or to increase IL-2 expression in patients with an
autoimmune thyroid
disease. In certain embodiments, the methods of the disclosure are used to
decrease one or more
symptoms of an autoimmune thyroid disease. In other words, "treating" is meant
to include
decreasing or eliminating one or more symptoms of an autoimmune thyroid
disease. Moreover,
the disclosure contemplates that compositions of the disclosure may be
administered alone or as
part of a therapeutic regimen with other agents useful in decreasing one or
more symptoms of an
autoimmune thyroid disease.
The disease symptoms can be replicated in animal models, and such models are
readily
used to confirm efficacy of a therapy or combination therapy. Two exemplary
mouse models are
described in Volpe et al., 1993, Horm Metab Res 25: 623-627.
Scleroderma
Scleroderma is a chronic autoimmune disease characterized by fibrosis,
vascular
alterations, and autoantibodies. There are two major forms: limited systemic
scleroderma and
diffuse systemic scleroderma. The cutaneous symptoms of limited systemic
scleroderma affect
the hands, arms and face. Patients with this form of scleroderma frequently
have one or more of
the following complications: calcinosis, Raynaud's phenomenon, esophageal
dysfunction,
sclerodactyly, and telangiectasias.
-42-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Diffuse systemic scleroderma is rapidly progressing and affects a large area
of the skin
and one or more internal organs, frequently the kidneys, esophagus, heart
and/or lungs.
Scleroderma affects the small blood vessels known as arterioles, in all
organs. First, the
endothelial cells of the arteriole die off apoptotically, along with smooth
muscle cells. These
cells are replaced by collagen and other fibrous material. Inflammatory cells,
particularly CD4+
helper T cells, infiltrate the arteriole, and cause further damage.
The skin manifestations of scleroderma can be painful, can impair use of the
affected area
(e.g., use of the hands, fingers, toes, feet, etc.) and can be disfiguring.
Skin ulceration may
occur, and such ulcers may be prone to infection or even gangrene. The
ulcerated skin may be
difficult or slow to heal. Difficulty in healing skin ulcerations may be
particularly exacerbated in
patients with impaired circulation, such as those with Raynaud's phenomenon.
In certain
embodiments, the methods of the present disclosure are used to treat
scleroderma and/or increase
IL-2 expression in patients, for example skin symptoms of scleroderma. In
certain embodiments,
treating scleroderma comprises treating skin ulceration, such as digital
ulcers. Administration of
a composition of the disclosure can be used to reduce the fibrotic and/or
inflammatory symptoms
of scleroderma in affected tissue and/or organs.
In addition to skin symptoms/manifestations, scleroderma may also affect the
heart,
kidney, lungs, joints, and digestive tract. In certain embodiments, treating
scleroderma includes
treating symptoms of the disease in any one or more of these tissues, such as
by reducing fibrotic
and/or inflammatory symptoms.
In certain embodiments, the methods of the present disclosure are used to
treat
scleroderma, for example lung fibrosis associated with scleroderma.
Administration of
compositions of the disclosure can be used to reduce the fibrotic symptoms of
scleroderma in
lung. For example, the methods can be used to improve lung function and/or to
reduce the risk
of death due to scleroderma.
In certain embodiments, the compositions of the disclosure are used to treat
scleroderma,
for example kidney fibrosis associated with scleroderma. Administration can be
used to reduce
the fibrotic symptoms of scleroderma in kidney. For example, the methods can
be used to
improve kidney function, to reduce protein in the urine, to reduce
hypertension, and/or to reduce
the risk of renal crisis that may lead to fatal renal failure.
-43-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
The methods and compositions of the present disclosure can be used in the
treatment of
scleroderma. Exemplary symptoms that can be treated include, but are not
limited to, pain
(including joint pain), swelling, skin ulceration, skin irritation, rash, loss
of range of motion, and
decreased ability to perform daily tasks. Further symptoms that can be treated
include lung
function (e.g., lung function can be improved) and kidney function.
Improvement in any of these
symptoms can be measured by, for example, decrease in the number of swollen
joints, decrease
in the number of painful joints, increased range of motion, increase in
healing of ulcerated tissue,
decrease in number and/or severity of skin ulcerations, increased ability to
perform daily tasks,
decreased skin involvement, decreased reliance on pain or other medication,
improvement in
patient self-assessment of pain or quality of life, increased lung function,
decreased
hypertension, decreased protein in urine, etc.
In certain embodiments, methods of treating scleroderma include administering
a
composition of the disclosure as part of a therapeutic regimen along with one
or more other
drugs, biologics, or therapeutic interventions appropriate for scleroderma. In
certain
embodiments, the additional drug, biologic, or therapeutic intervention is
appropriate for
particular symptoms associated with scleroderma. By way of example,
compositions of the
disclosure may be administered as part of a therapeutic regimen along with one
or more
immunosuppressive agents, such as methotrexate, cyclophosphamide,
azathioprine, and
mycopheno late.
Moreover, methods of treatment may include a treatment regimen including a
dietary
regimen, an exercise regimen, stress management, smoking cessation,
acupuncture, massage,
and/or physical therapy.
The disease symptoms can be replicated in animal models, and such models can
be
readily used to confirm efficacy of a therapy or combination therapy.
Exemplary models include
a rodent model in which scleroderma is induced by treatment with cyclosporine
A (Damoiseaux
et al., Cyclosporine A-Induced Autoimmunity: An Animal Model for Human
Scleroderma. J.
Experimental Animal Science, 2000, 41(1-2): 22-26) or bleomycin, as well as
transgenic mouse
models, and graft-versus-host models (Yamamoto, Characteristics of Animal
Models for
Scleroderma. Current Rheumatology Reviews, 2005, 1: 101-119; Clark, Animal
Models in
Scleroderma. Current Rheumatology Reports, 2005, 7(2): 150-155).
-44-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
The disclosure contemplates that any of the compositions of the disclosure may
be used
in the treatment (e.g., to reduce one or more symptoms of) any of the
foregoing conditions or in
the treatment of an autoimmune condition associated with dysregulation of IL-2
expression.
(v) Methods of Use
(a) Diagnostic Methods of Use
In certain embodiments, the disclosure provides diagnostic methods that may be
used in
vivo and/or in vitro to aid in the diagnosis, monitoring or prognosis of a
subject with an
autoimmune condition, or can even be used to help refine the dosage of a
medication (e.g.,
including, but not limited to, a medication comprising a composition of the
disclosure).
In an exemplary method, a biomarker selected from one or more (1, 2, 3) of
microRNA-
31, RhoA or IL-2 is assayed in a subject being treated with a compound (any
compound,
including a composition of the disclosure). The assay may be for the presence,
absence or
amount of a biomarker. Suitable assays include quantitative PCR, ELIZA, and
the like that are
suitable for detecting transcript or protein expression in samples. Assays may
be performed on
cells or on samples, such as blood sample. Based on the assay results, one may
determine
whether to adjust a subsequent dosage or dosing regimen of the compound. For
example, if
following administration of one or more doses of a microRNA-31 agonizing
agent, an increase in
IL-2 expression is not observed, it may be beneficial to increase the dosage
or frequency of
administration to achieve the desired increase in IL-2 expression.
By way of another example, the disclosure provides a method of diagnosing an
autoimmune condition, such as systemic lupus erythematosus. As part of such a
method, a
sample is obtained from a subject suspected of having an autoimmune condition,
such as SLE.
This sample may be, for example, a bone marrow sample, a blood sample, or a
sample of cells
separated from a blood sample. Sample may be isolated at a time when the
subject suspected of
having the condition is experiencing significant symptoms, as well as during
periods where
symptoms are less acute. Following obtaining of the sample, the sample is
assayed for
expression of microRNA-31 or RhoA, or any one or more of microRNA31, RhoA, or
IL-2.
Assays include assays of protein expression and transcript expression.
By way of another example, the disclosure provides a method of monitoring
treatment of
an autoimmune condition, such as systemic lupus erythematosus. To monitor
treatment,
-45-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
expression of microRNA-31, IL-2, and/or RhoA is detected in a sample of a
subject undergoing
treatment. This expression is compared to expression of the biomarker in a
sample that was
obtained from the same subject either prior to initiation of this particular
treatment regimen or at
an earlier time point during treatment. Comparison of microRNA-31 and/or RhoA
and/or IL-2
expression over one or more periods of time provides a way to monitor the
progress of the
treatment. An increase in microRNA-31 or a decrease in RhoA in a later sample
indicates
effectiveness of the treatment. Similarly an increase in IL-2 in a later
sample indicates
effectiveness of the treatment.
By way of further example, the disclosure provides a method of treating a
subject having
an autoimmune condition, such as systemic lupus erythematosus. The method
comprises
comparing expression of microRNA-31 or RhoA from a sample taken from a subject
prior to
initiation of a particular treatment to a standard range reflecting expression
in samples from
healthy subjects. If expression of microRNA-31 is below the standard range or
expression of
RhoA is above the standard range, the subject is identified as potentially
suitable for treatment
with a composition of the disclosure. The subject is then treated with an
effective amount of a
composition comprising microRNA-31, siNA that hybridizes to RhoA, IL-2
protein, or another
composition of the disclosure if the subject is determined to be susceptible
to treatment.
In certain embodiments, the method further comprises detecting expression of
microRNA-31 or RhoA in a post-treatment sample from the same subject, and
comparing
expression of microRNA-31 or RhoA in the post-treatment sample to expression
in the sample
taken prior to initiation of the particular treatment.
In certain embodiments, the particular treatment is a microRNA-31 mimic, such
as
microRNA-31, a siNA that hybridizes to RhoA, or a small molecule inhibitor of
RhoA.
More generally, diagnostic uses can be achieved, for example, by contacting a
sample to
be tested, optionally along with a control sample, with a reagent appropriate
for detecting nucleic
acid or protein.
In certain embodiments of any of the foregoing, the diagnostic assay is
performed on a
human patient or a sample from a human patient. Suitable diagnostic reagents
include, but are
not limited to, probes and primers suitable for detecting microRNA-31 or RhoA
expression, as
well as antibodies suitable for detecting RhoA protein expression. Reagents
may be labeled to
-46-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
facilitate detection and quantification in the assay, or detection may rely on
the use of secondary
reagents.
(b) Therapeutic Methods of Uses
In certain embodiments, the disclosure contemplates that compositions of the
disclosure
may be used therapeutically, for example, in the treatment of human or non-
human subjects.
Any of the compositions described herein may be used in the treatment of any
of the
autoimmune conditions described herein. Suitable compositions comprise, as an
active
ingredient, nucleic acids, polypeptide or small molecule. Other suitable
compositions comprise
cellular compositions, such as cells expressing microRNA-31.
Exemplary methods include methods comprising contacting cells or administering
to
subjects a composition that increases expression of microRNA-31 or decreases
expression of
RhoA. Such compositions can be used to, for example, increase IL-2 expression
in a subject
having an autoimmune condition. Exemplary compositions comprise a nucleic acid
comprising
a nucleotide sequence that increases expression of microRNA-31 or a nucleic
acid comprising a
nucleotide sequence that decreases expression of RhoA.
Exemplary conditions that can be treated include, but are not limited to
autoimmune
conditions, such as SLE or other autoimmune conditions that share a mechanism
of action or
etiology. In certain embodiments, the method comprises increasing IL-2
expression in the
subjects.
Suitable compositions comprise, for example, a nucleic acid comprising a
nucleotide
sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. Other suitable
compositions
comprise, for example, a nucleic acid comprising a siNA, a nucleic acid that
mimics microRNA-
31, or an siNA that hybridizes to RhoA. A nucleic acid composition may be
single standed,
partially double stranded or fully double stranded. In certain embodiments,
administration of the
composition increases expression of endogenous microRNA. In other embodiments,
administration of the composition comprises introduction of exogenous microRNA-
31
molecules, such as oligonucleotides that express microRNA-31 following
introduction into cells.
Regardless of the particular composition administered, an effective amount is
administered to patients. As used herein, the term "effective amount" refers
to the amount of a
therapy which is sufficient to reduce and/or ameliorate the severity and/or
duration of a disease
or disorder; prevent or delay the advancement of said disease or disorder;
cause regression of
-47-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
said disease or disorder; prevent or delay the recurrence, development, or
onset of one or more
symptoms associated with said disease or disorder, or enhance or improve the
effect(s) of
another therapy. It is understood that measurable signs of effectiveness may
not be observable
following a single dose.
"Treating" a condition or disease refers to curing as well as ameliorating at
least one
symptom of the condition or disease, and includes administration of a
composition which
reduces the frequency of, or delays the onset of, symptoms of a medical
condition in a subject.
In certain embodiments, progress and effectiveness of treatment is monitored
during
and/or following treatment. For example, autoimmune conditions can be
monitored using
methods suitable for the particular condition, such as blood tests, urine
samples, self-reports of
pain and fatigue, decrease in need for pain medication, X-ray, CT scan, and
the like. Moreover,
treatment may be monitored based on assessment of improvement in symptoms,
such as
decreased pain (e.g., patient requests/uses less pain medication), decreased
reliance on
supplemental oxygen, improvement in appetite, weight gain, decreased fatigue,
increased
mobility, and the like. Moreover, progress and effectiveness of treatment can
be monitored
using any one or more of the biomarkers microRNA-31, RhoA or IL-2, as detailed
above.
The disclosure provides that, in certain embodiments, the compositions of the
disclosure
are administered as part of a therapeutic regimen with one or more other
agents and/or one or
more other treatment modalities. The selection of suitable other agents and/or
treatment
modalities may depend on the particular disease, condition of the patient, age
of the patient,
symptoms, and the like. By way of example, other suitable treatment modalities
include, but are
not limited to, surgery, dialysis, insulin therapy, diet, physical therapy,
smoking cessation,
oxygen therapy, ventilatory support, acupuncture, and the like. By way of
example, other
suitable agents include, but are not limited to analgesics, narcotics (such
as, for pain
management), anti-inflammatories, immunosuppressants, corticosteroids,
antimalarials, and the
like. Any one or more of these agents and/or modalities can be used as part of
a therapeutic
regimen.
For any methods of treating involving administering a combination of agents
and/or
therapies, such conjoint treatment may be achieved by way of the simultaneous,
sequential or
separate dosing of the individual components of the treatment.
-48-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
In certain embodiments, a therapeutic method further includes an assay step in
which
expression of microRNA-31, RhoA and/or IL-2 is evaluated in the subject
following treatment
with a composition of the disclosure. Such assay steps may evaluate RNA or
protein expression
using suitable methods.
(vii) Dosage and Administration
Embodiments of the disclosure include sterile pharmaceutical formulations that
are useful
in the context of administration of compositions to a subject and/or for use
in a diagnostic
setting. Moreover, various administration and delivery routes and methods may
be useful. The
disclosure contemplates that any of the formulations and/or routes of
administration may be used
with any of the compositions of the disclosure. Moreover, the disclosure
contemplates that the
various formulations and routes of administration may also apply to other
agents, such as agents
administered as part of a therapeutic regimen.
Various delivery systems are known and can be used to administer a composition
of the
present disclosure. Methods of administering include, but are not limited to,
parenteral
administration (e.g., intradermal, intramuscular, intraperitoneal, intravenous
and subcutaneous),
epidural administration, topical administration, and mucosal administration
(e.g., intranasal and
oral routes). Administration can be systemic or local. Note that when the
formulations are
administered as part of a combination therapy, the disclosure contemplates
that other agents may
be administered by the same or different route of administration.
In a specific embodiment, the compositions of the disclosure comprise a
pharmaceutically acceptable carrier. In a preferred embodiment, the
pharmaceutically acceptable
carrier is water for injection, USP, 5% dextrose in water (D5W) or saline.
In certain formulations, a water-based formulation is employed while in
others, it may be
lipidbased. In particular embodiments, a composition comprising an active
pharmaceutical agent
or a nucleic acid encoding the same is in a water-based formulation. In other
embodiments, the
formulation is lipid based.
Solutions of active pharmaceutical agents described herein can be prepared as
free base
or pharmacologically acceptable salts. Such agents also may be prepared in
water suitably mixed
with a surfactant, such as hydroxypropylcellulose, in some embodiments.
Dispersions may also
be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and in
oils. Under
-49-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
ordinary conditions of storage and use, these preparations can contain a
preservative to prevent
the growth of microorganisms. The pharmaceutical forms suitable for injectable
use include
sterile aqueous solutions or dispersions and sterile powders for the
extemporaneous preparation
of sterile injectable solutions or dispersions. The form is often sterile and
fluid to the extent that
easy syringability exists. It may be stable under the conditions of
manufacture and storage and
may be preserved against the contaminating action of microorganisms, such as
bacteria and
fungi. The prevention of the action of microorganisms can be brought about by
various
antibacterial and antifungal agents, for example, parabens, chlorobutanol,
phenol, sorbic acid,
thimerosal, and the like.
The precise dose to be employed and the dosing regimen will depend on the
route of
administration, the specific disease to be treated, the severity of the
patient's condition, the
particular composition used and the like. Effective doses may be extrapolated
from dose-
response curves derived from in vitro or animal model test systems.
In certain embodiments, particularly in the case of formulations intended for
administration to humans, the formulations are pyrogen-free formulations which
are substantially
free of endotoxins and/or related pyrogenic substances. Endotoxins include
toxins that are
confined inside a microorganism and are released only when the microorganisms
are broken
down or die. Pyrogenic substances also include fever-inducing, thermostable
substances
(glycoproteins) from the outer membrane of bacteria and other microorganisms.
Both of these
substances can cause fever, hypotension and shock if administered to humans.
Due to the
potential harmful effects, even low amounts of endotoxins must be removed from
intravenously
administered pharmaceutical drug solutions. The Food & Drug Administration
("FDA") has set
an upper limit of 5 endotoxin units (EU) per dose per kilogram body weight in
a single one hour
period for intravenous drug applications (The United States Pharmacopeial
Convention,
Pharmacopeial Forum 26 (1):223 (2000)). When therapeutic proteins are
administered in
amounts of several hundred or thousand milligrams per kilogram body weight, as
can be the case
with antibodies, even trace amounts of harmful and dangerous endotoxin must be
removed. In
certain specific embodiments, the endotoxin and pyrogen levels in the
composition are less than
10 EU/mg, or less then 5 EU/mg, or less than 1 EU/mg, or less than 0.1 EU/mg,
or less than 0.01
EU/mg, or less than 0.001 EU/mg.
-50-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
A compound (such as a composition of the disclosure or other drug) can be
administered
to any appropriate subject having a biomarker or needing treatment for a
condition described
herein. Non-limiting examples of a subject include mammal, human, ape, monkey,
ungulate
(e.g., equine, bovine, caprine, ovine, porcine, buffalo, camel and the like),
canine, feline, rodent
and the like. A subject may be male or female, and a drug can be administered
to a subject in a
particular age group, including, for example, juvenile, pediatric, adolescent,
adult, and the like.
A composition of the disclosure or other drug, in certain embodiments,
comprises as an active
ingredient an antibody, antibody fragment, single-chain antibody, small
molecule, a nucleic acid,
nucleic acid derivative, miRNA, siNA, peptide, polypeptide, and the like.
Various forms of
miRNA or siRNA may be delivered, including post-processed miRNA or siRNA, pre-
processed
miRNA or siRNA or vector that encodes pre-processed or post-processed miRNA or
siRNA.
Methods as presented herein include, without limitation, the delivery of an
effective
amount of a nucleic acid or an expression construct encoding the same. An
"effective amount"
of the pharmaceutical composition, generally, is defined as that amount
sufficient to detectably
and repeatedly achieve the stated desired result, for example, to ameliorate,
reduce, minimize or
limit the extent of the disease or its symptoms. In some embodiments there may
be a step of
monitoring the biomarkers to evaluate the effectiveness of treatment and to
control toxicity.
Drugs are administered in a manner compatible with the dosage formulation, and
in such
amount as may be therapeutically effective. Injection of nucleic acids may be
delivered by
syringe or any other method used for injection of a solution, as long as the
nucleic acid and any
associated components can pass through the particular gauge of needle required
for injection. A
syringe system has also been described for use in gene therapy that permits
multiple injections of
predetermined quantities of a solution precisely at any depth (U.S. Pat. No.
5,846,225).
In a specific embodiment, compositions of the disclosure comprise a nucleic
acid that
increases microRNA-31 expression or decreases RhoA expression. Such nucleic
acid based
compositions may, in certain embodiments, be administered by way of gene
therapy. Gene
therapy refers to therapy performed by the administration to a subject of an
expressed or
expressible nucleic acid. In this embodiment of the disclosure, the nucleic
acids (such as
antisense, siRNA or microRNA) are produced and mediate a prophylactic or
therapeutic effect.
Any of the methods for gene therapy available in the art can be used according
to the
present disclosure. Exemplary methods are described below. For general reviews
of the
-51-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
methods of gene therapy, see Goldspiel et al., 1993, Clinical Pharmacy 12:488;
Wu and Wu,
1991, Biotherapy 3:87; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573;
Mulligan,
1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem.
62:191;
May, 1993, TIBTECH 11:155. Methods commonly known in the art of recombinant
DNA
technology which can be used are described in Ausubel et al. (eds.), Current
Protocols in
Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer
and
Expression, A Laboratory Manual, Stockton Press, NY (1990).
In one embodiment, a nucleic acid based composition is presented as part of an
expression vector that expresses the nucleic acid in a suitable host. In
particular, such nucleic
acids have promoters, for example, heterologous promoters, said promoter being
inducible or
constitutive, and, optionally, tissue-specific.
Delivery of the nucleic acids into a subject may be either direct, in which
case the subject
is directly exposed to the nucleic acid or nucleic acid-carrying vectors, or
indirect, in which case,
cells are first transformed with the nucleic acids in vitro, then transplanted
into the subject.
Thus, in certain embodiments, a composition of the disclosure comprises a
cellular composition.
These two approaches are known, respectively, as in vivo or ex vivo gene
therapy. Suitable
vectors include viral vectors. In other embodiments, nucleic acids can be
administered as naked
nucleic acids. Moreover, nucleic acid based compositions may, in certain
embodiments, be
administered by way of transduction/infection, DEAE-dextran-mediated
transfection, lipofection,
electroporation, and iontophoresis.
(viii) Articles of Manufacture
The disclosure provides a pharmaceutical pack or kit comprising one or more
containers
filled with a composition of the disclosure. Similarly, the disclosure
provides a pharmaceutical
pack or kit suitable for laboratory and/or diagnostic use. The disclosure
contemplates that any of
the compositions described herein, such as compositions comprising a nucleic
acid comprising a
nucleotide sequence that increases expression of microRNA-31 or compositions
comprising a
nucleic acid comprising a nucleotide sequence that decreases expression of
RhoA, can be
packaged and sold as part of a kit. Exemplary such kits are pharmaceutical
kits.
The disclosure also provides a pharmaceutical pack or kit comprising in one or
more first
containers a formulation as described herein and in one or more second
containers one or more
-52-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
other prophylactic or therapeutic agents useful for the prevention, management
or treatment of an
autoimmune condition, such as SLE or an autoimmune condition that has a
mechanism of action
or etiology similar to SLE (e.g., a condition correlated with decreased
expression of IL-2 or a
condition that results from misregulation of T cells).
In an exemplary embodiment, the formulations of the disclosure are formulated
in single
dose vials as a sterile formulation. Optionally associated with such
container(s) can be a notice
in the form prescribed by a governmental agency regulating the manufacture,
use or sale of
pharmaceuticals or biological products, which notice reflects approval by the
agency of
manufacture, use or sale for human administration.
In the case of kits sold for laboratory and/or diagnostic use, the kit may
optionally contain
a notice indicating appropriate use, safety considerations, and any
limitations on use. Moreover,
in the case of kits sold for laboratory and/or diagnostic use, the kit may
optionally comprise one
or more other reagents, such as positive or negative control reagents, useful
for the particular
diagnostic or laboratory use.
The present disclosure provides kits that can be used in the above methods. In
one
embodiment, a kit comprises a composition as described herein, in one or more
containers. In
another embodiment, a kit comprises a composition as described herein, in one
or more
containers, and one or more other prophylactic or therapeutic agents useful
for the prevention,
management or treatment of SLE or an autoimmune condition, such as an
autoimmune condition
that has a mechanism of action or etiology similar to SLE (e.g., a condition
correlated with
decreased expression of IL-2 or a condition that results from misregulation of
T cells).
Preferably, the kit further comprises instructions for preventing, treating,
managing or
ameliorating a disorder (e.g., using the formulations of the description alone
or in combination
with another prophylactic or therapeutic agent), as well as side effects and
dosage information
for such use.
The present disclosure also encompasses a finished packaged and labeled
pharmaceutical
product. This article of manufacture includes the appropriate unit dosage form
in an appropriate
vessel or container such as a glass vial or other container that is
hermetically sealed. In the case
of dosage forms suitable for parenteral administration the active ingredient
is sterile and suitable
for administration. In certain embodiments, the formulation is suitable for
intravenous
administration.
-53-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
In a preferred embodiment, the unit dosage form is suitable for intravenous,
intramuscular, intranasal, oral, topical or subcutaneous delivery. Thus, the
disclosure
encompasses solutions, preferably sterile, suitable for each delivery route.
As with any pharmaceutical product, the packaging material and container are
designed
to protect the stability of the product during storage and shipment. Further,
the products of the
disclosure include instructions for use or other informational material that
advise the physician,
technician or patient on how to appropriately prevent or treat the condition
in question. In other
words, the article of manufacture includes instruction means indicating or
suggesting a dosing
regimen including, but not limited to, actual doses, monitoring procedures,
etc., and other
monitoring information.
Specifically, the disclosure provides an article of manufacture comprising
packaging
material, such as a box, bottle, tube, vial, container, sprayer, insufflator,
intravenous (i.v.) bag,
envelope and the like; and at least one unit dosage form of a pharmaceutical
agent contained
within said packaging material, wherein said pharmaceutical agent comprises a
composition of
the disclosure and wherein said packaging material includes instruction means
which indicate
that said composition can be used to prevent, manage, treat, and/or ameliorate
one or more
symptoms associated with SLE or another autoimmune condition, such as an
autoimmune
condition that has a mechanism of action or etiology similar to SLE (e.g., a
condition correlated
with decreased expression of IL-2 or a condition that results from
misregulation of T cells), or
one or more symptoms thereof by administering specific doses and using
specific dosing
regimens as described herein.
The disclosure also provides an article of manufacture comprising packaging
material,
such as a box, bottle, tube, vial, container, sprayer, insufflator,
intravenous (i.v.) bag, envelope
and the like; and at least one unit dosage form of each pharmaceutical agent
contained within
said packaging material, wherein one pharmaceutical agent comprises a
composition of the
disclosure and the other pharmaceutical agent comprises a prophylactic or
therapeutic agent
other than a composition of the disclosure, and wherein said packaging
material includes
instruction means which indicate that said agents can be used to treat,
prevent and/or ameliorate
one or more symptoms associated with SLE or another autoimmune condition, such
as an
autoimmune condition that has a mechanism of action or etiology similar to SLE
(e.g., a
condition correlated with decreased expression of IL-2 or a condition that
results from
-54-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
misregulation of T cells), or one or more symptoms thereof by administering
specific doses and
using specific dosing regimens as described herein.
In certain embodiments, particularly in the case of pharmaceutical kits
comprising
formulations intended for administration to humans, the formulations are
pyrogen-free
formulations which are substantially free of endotoxins and/or related
pyrogenic substances.
Endotoxins include toxins that are confined inside a microorganism and are
released only when
the microorganisms are broken down or die. Pyrogenic substances also include
fever-inducing,
thermostable substances (glycoproteins) from the outer membrane of bacteria
and other
microorganisms. Both of these substances can cause fever, hypotension and
shock if
administered to humans. Due to the potential harmful effects, even low amounts
of endotoxins
must be removed from intravenously administered pharmaceutical drug solutions.
The Food &
Drug Administration ("FDA") has set an upper limit of 5 endotoxin units (EU)
per dose per
kilogram body weight in a single one hour period for intravenous drug
applications (The United
States Pharmacopeial Convention, Pharmacopeial Forum 26 (1):223 (2000)). In
certain specific
embodiments, the endotoxin and pyrogen levels in the composition are less than
10 EU/mg, or
less than 5 EU/mg, or less than 1 EU/mg, or less than 0.1 EU/mg, or less than
0.01 EU/mg, or
less than 0.001 EU/mg.
Examples
The disclosure is now described with reference to the following examples.
These
examples are provided for the purpose of illustration only and the disclosure
should in no way be
construed as being limited to these examples but rather should be construed to
encompass any
and all variations which become evident as a result of the teachings provided
herein. In general
terms, the present disclosure employs, unless otherwise indicated,
conventional techniques of
molecular biology, chemistry, biochemistry, biophysics, recombinant DNA
technology, and
immunology. Of course, it will be appreciated that specific listing or
description of particular
equipment and reagents used, sizes, manufacturer, etc., is not to be
considered limiting on the
current disclosure unless specifically stated to be so. It will be further
appreciated that other
equipment and reagents which perform similarly may be readily substituted.
Example 1 ¨ Expression of microRNA-31
-55-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
We measured the expression levels of miR-31 in T cells, B cells and monocytes
isolated
from the PBMCs of three healthy volunteers. As shown in Figure 1A, miR-31 was
selectively
expressed in T cells, suggesting that it might play a role in T cell function.
We then investigated the expression of miR-31 in T cells obtained from 32 SLE
patients
and 11 normal controls (NC) and found that miR-31 was significantly down-
regulated in SLE
patients relative to controls as shown in Figure 1B (P<0.0001). Further
information regarding
the subjects used for these studies is provided in Table 1.
Table 1: Clinical features of patients with SLE
Characteristic Control (n = 11) SLE (n =32)
Sex,No. of male/female 1/10 3/29
Age (y) 30.1 1.080 36.7 3.134
Anti-dsDNA [P/N (n)a] NA 16/9
LN [P/N (n)]. NA 20/8
Medications
Steroids (n)b taking
<10 mg/d NA 13
10-40 mg/d NA 13
40 mg/d NA 6
Secondary agents' [P/N (n)] NA 22/10
Values are presented as mean SD, except where indicated otherwise.
a. Because some patients were not examined, the number listed for the feature
is less than the total number of patients.
b. The dose of steroids presented in this article is that of prednisone. If
other equivalent was taken, the dosage was
converted (e.g., 40 mg methylprednisolonewas equivalent to 50 mg prednisone).
c. Some patients were receiving secondary antirheumatic agents, including
chloroquine, cyclophosphamide,
methotrexate, and azathioprine.
LN, lupus nephritis; P/N, positive/negative (for the feature listed).
Example 2 ¨ Correlation Between Expression of microRNA-31 and IL-2
T cells from lupus patients display numerous signaling abnormalities which may
contribute to the pathogenesis of SLE (Kong et al., 2003; Moulton et al.
2011). The following
experiments investigated the role of miR-31 in the skewed expression of T cell-
related cytokines
in SLE. As part of these experiments, a microRNA-31 mimic was designed and
used to mimic
expression of microRNA-31 and an antagomir-31 was designed and used to
decrease expression
-56-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
of microRNA-31. Appropriate control oligonucleotides were also used. As
reflected in Figure
2A and 2B, transfection of these constructs into primary T cells effectively
increased (for the
mimic) or decreased (for the antagomir) expression of microRNA-31. Successful
ectopic
expression or silencing of miR-31 in primary T cells was verified with TaqMan
quantitative
PCR, which showed that the overexpression or inhibition of miR-31 following
transfection
resulted in a 50-fold increase or 25-fold decrease in miR-31 expression,
respectively (Figure 2).
Given the efficacy of these reagents in modulating expression of miR-31, they
were used to
further study signaling in these cells.
To evaluate whether TCR engagement affects miR-31 expression, CD3 ' T
lymphocytes
freshly purified from healthy donors were stimulated with PMA and ionomycin in
a time course
study. As shown in Figure 3A, miR-31 expression was induced after stimulation,
reaching a
peak around 12 hours.
Given that T cell activation through TCR results in enhanced induction of IL-
2, the
potential modulation of IL-2 production by miR-31 was evaluated. To address
this question,
human primary T cells were transfected with miR-31 mimics or control mimics
and then
activated with PMA and ionomycin for 24 hours. IL-2 mRNA levels in the cells
and IL-2
protein levels in the supernant were measured by RT-PCR and ELISA,
respectively. As shown
in Figure 3B and 3C, the miR-31 mimic increased IL-2 expression at both the
mRNA and protein
levels, while silencing of the endogenous miR-31 via transfection with the
inhibitory
oligonucleotide antagomir-31 decreased IL-2 production. Consistent with these
results, a
positive correlation between the expression levels of miR-31 and IL-2 in
activated lupus T cells
(n=15) was also observed, as shown in Figure 3D.
A luciferase reporter assay was performed to ask whether miR-31 regulated IL-2
promoter activity. The IL-2 promoter was cloned into a luciferase reporter
vector (named IL-2-
luc). Jurkat cells co-transfected with IL-2-luc and miR-31 mimic or control,
were stimulated
with PMA and ionomycin. As shown in Figure 3E, miR-31 increased IL-2 promoter
activity and
did so in a dose-dependent manner (Figure 3F). Taken together, the above data
suggest that
miR-31 promotes IL-2 production through enhancing the activity of the IL-2
promoter.
Additionally, the relationship between IL-2 and miR-31 was consistently
observed in samples
from lupus patients.
-57-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Example 3 - RhoA in T cells
To gain insights into the molecular mechanism of how miR-31 regulates IL-2
production,
bioinformatic tools were used to identify potential targets of miR-31. The
miRGen database
(www.diana.pcbi. upenn.edu/miRGen/v3/miRGen.html), which integrates analysis
from
TargetScan, PicTar and MiRanda, generated a list of predicted miR-31 targets.
RhoA, which has
been reported to modulate IL-2 gene expression in T cell activation (Helms et
al., 2007), was a
candidate target of miR-31 in this system.
To evaluate whether miR-31 inhibits the expression of RhoA in T cells, primary
T cells
were transfected with miR-31 mimic or control, and the expression of RhoA was
measured by
both RT-PCR and western blotting. RT-PCR demonstrated that miR-31 inhibited
the expression
of RhoA mRNA (Figure 4A). Western blotting analysis revealed that transfection
of miR-31
resulted in a reduction of RhoA protein (Figure 4B). Given that miR-31
expression level in SLE
samples was significantly lower than in samples from NC, we investigated
whether RhoA
expression was increased in SLE T cells. T cells from 32 SLE patients and 11
NC showed that
RhoA mRNA was significantly up-regulated in SLE T cells (Figure 4C).
Furthermore, a linear
correlation analysis demonstrated that the expression of RhoA mRNA correlated
negatively with
the expression of miR-31 in primary T cells of patients with lupus (Figure
4D). Taken together,
the above data suggest that miR-31 targets RhoA in human primary T cells and
RhoA mRNA
expression is significantly higher in lupus T cells compared to NC.
Example 4 ¨ Inhibition of RhoA Expression
To test the hypothesis that miR-31 regulates IL-2 expression in T cells via
RhoA, the
effects of inhibition of RhoA were examined in this system to evaluate whether
such inhibition
would have the equivalent effect as the over-expression of miR-31. RNA
interference
techniques were used to knockdown RhoA expression. Transfection with RhoA
siRNA for 48
hours significantly reduced RhoA mRNA and protein levels, as reflected in
Figures 5A and 5B,
in a manner similar to that observed following over-expression of the miR-31
mimic.
Primary T cells were then transfected with siRNA to RhoA or with the miR-31
mimic for
48 hours, and stimulated by PMA and ionomycin for 24 hours. After transfection
and
stimulation, IL-2 expression was measured. In agreement with the effect of the
miR-31 mimic,
knockdown of RhoA resulted in marked increase of expression of both IL-2 mRNA
and its
-58-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
protein (Figures 6A and 6B). Further evaluation supports the conclusion that
knockdown of
RhoA enhanced the activity of the IL-2 promoter (Figure 6C).
Example 5 ¨ Elevated Expression Levels of IL-2 in Activated Lupus T cells
Considering that miR-31 was induced in activated T cells and regulated IL-2
production
by targeting RhoA, we investigated the expression levels of miR-31, RhoA, and
IL-2 in activated
T cells isolated from 15 SLE patients and 10 normal controls (NC). Further
information
regarding the subjects used for these studies is provided in Table 2. The
results revealed that
miR-31 and IL-2 expression in activated T cells from SLE patients were lower
than that
observed in NC, while the expression of RhoA was higher (Figures 7A, B, and
C).
To further explore this relationship, miR-31 levels were manipulated to
evaluate any
affects on IL-2 production in T cells from SLE patients. Lupus T cells were
transfected with
miR-31 mimic or control mimic. After 24 hour stimulation by PMA and ionomycin,
enhanced
IL-2 protein expression was observed in activated lupus T cells transfected
with miR-31 as
shown in Figure 7D. This is consistent with using miR-31 levels to rescue the
defects in IL-2
production observed in T cells of lupus patients.
Table 2: Clinical features of patients with SLE
Characteristic Control (n = 10) SLE (n = 15)
Sex,No. of male/female 1/9 1/14
Anti-dsDNA [P/N (n)a] NA 6/5
LN [P/N (n)]. NA 9/6
Medications
Steroids (n)b taking
<10 mg/d NA 2
10-40 mg/d NA 7
>40 mg/d NA 6
Secondary agents' [P/N (n)]. NA 10/5
Values are presented as mean SD, except where indicated otherwise.
a. Because some patients were not examined, the number listed for the feature
is less than the total number of patients.
b. The dose of steroids presented in this article is that of prednisone. If
other equivalent was taken, the dosage was
converted (e.g., 40 mg methylprednisolonewas equivalent to 50 mg prednisone).
c. Some patients were receiving secondary antirheumatic agents, including
chloroquine, cyclophosphamide,
methotrexate, and azathioprine.
-59-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
LN, lupus nephritis; P/N, positive/negative (for the feature listed).
Materials and Methods
The following summarizes certain materials and methods utilized in conducting
the
foregoing examples 1-5.
Patients and healthy controls. All SLE patient samples were obtained from the
Department of Rheumatology of Renji Hospital (Shanghai, China) and met at
least four of the
American College of Rheumatology 1982 revised criteria for SLE. SLE activity
was assessed
with the SLE Disease Activity Index (SLEDAI). The healthy controls from
healthy volunteers
had no history of autoimmune diseases or immunosuppressive therapy and were
matched with
the patients for age, sex, and race. All participants were from the Chinese
Han population.
Peripheral blood samples (10 mL) obtained from each subject were collected in
tubes containing
acid citrate dextrose formula A (ACD-A). The study was approved by the
Research Ethics Board
of Renji Hospital, Shanghai JiaoTong University, School of Medicine.
Isolation of CD3 ' T cells. Peripheral blood mononuclear cells (PBMCs) were
separated
from the heparinized whole blood by density gradient centrifugation on
Lymphoprep Ficoll-
PaqueTM PLUS (GEHealthcare, Chalfont, UK). CD3 + T cells were purified from
the fresh
PBMCs by positive selection using magnetic CD3 microbeads (Miltenyi Biotec)
according to the
manufacturer's protocol. T lymphocyte purity was > 95% analyzed by FACSCalibur
(Becton
Dickinson).
Cell culture and stimulation condition. Purified T lymphocytes were cultured
in RPMI
1640 medium supplemented with 10% fetal bovine serum (FBS) and 1%
penicillin/streptomycin,
stimulated with PMA (50ng/ml, Sigma-Aldrich) and ionomycin (11.tg/m1, Sigma-
Aldrich) for
different time at 37 C under 5% CO2. Jurkat, a T cell leukemia line, was
grown in RPMI 1640
medium (Life Technologies, Rockville, MD) containing 10% FBS and 1%
penicillin/
streptomycin at 37 C under 5% CO2. Jurkat cells also were stimulated with PMA
(50ng/m1) and
ionomycin (11..tg/m1).
miRNA mimics, small interfering RNA and antagomirs. Small interfering RNA
(siRNA)
and miRNA mimics were synthesized by Genepharma (Shanghai, China). RhoA siRNA
sequences referred to in (Ahmed et al., 2005), are as follows: RhoA¨siRNA-1:
5'-
AAGATTATGACCGTCTGAGGC-3' (SEQ ID NO: 1); RhoA¨siRNA-2: 5'-
-60-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
AAGGATCTTCGGA ATGATGAG-3' (SEQ ID NO: 2). The miRNA-31 mimic sequence is as
follows: mimic: 5'- AGGCAAGAUGCUGGCAUAGCU-3' (SEQ ID NO: 3). Antagomir-31
and control constructs were ordered from Ribo biology (Guang dong, China). The
antagomir-31
sequence is as follows: antagomir: 5'- AGCUAUGCCAGCAUCUUGCCU -3' (SEQ ID NO:
4).
The combination of gain-of-function (mimic-induced downregulation of target
genes normally
inhibited by miRNA-31) and loss-of-function (antagomir-induced upregulation of
target genes
normally inhibited by miRNA-31) experiments demonstrated the miRNA-target
relationships
and allowed miRNAs functional analysis. For the foregoing oligonucleotides,
the siRNAs and
miRNA-31 mimic used were double stranded molecules and the antagomir was a
single stranded
molecule. The oligonucleotides were exogenously expressed in cells by
transfecting the cells
using Lipofectamine 2000 (Invitrogen).
Transfection. Human primary T cells were rested in RPMI 1640 for 2 hours, then
transfected with miRNA or siRNA oligonucleotides using Lipofectamine 2000
(Invitrogen)
according to the manufacturer's protocol. Six hours after transfection, T
cells were added to
fresh complete medium (RPMI 1640 medium supplemented with 10% FBS). After 24
hours,
cells were stimulated with PMA and ionomycin for up to 24 hours at 37 C under
5% CO2. For
inhibition of miR-31, human primary T cells were resuspended in serum-free
opti-DMEM
medium (GIBCO) and transfected with 500 nM antagomir-31 or control scrambled
antagomir.
After six hours of transfection, RPMI medium supplemented with 500nM antagomir
was added
and cells were stimulated 24 hours later as described above.
Quantitative PCR. Total RNA was isolated with TRIzol reagent (Invitrogen). To
quantify miRNA, the RNA (20ng) samples were reverse transcribed using the
TaqMan
MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA).
TaqMan
MicroRNA assays were used according to the manufacturer's recommendations
(Applied
Biosystems) for real-time PCR. RNU48 (U48) was used as endogenous control for
normalization of expression values. For quantitative RT-PCR analysis of mRNA,
50Ong total
RNA was reverse-transcribed with the PrimeScript RT reagent Kit (Takara,
Shiga, Japan). The
cDNA was amplified by real-time PCR with SYBR Green (SYBR Premix Ex Taq RT-PCR
kit;
Takara, Shiga, Japan), and ribosomal protein Li 3A (RPL13A) was used as the
internal control to
normalize the amounts of cDNA. The TaqMan and SYBR Green assays were performed
in
duplicate on a 7900HT Fast Real-Time PCR instrument (Applied Biosystems). The
relative
-61-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
expression levels were calculated using the 2-AAct method. The following
custom primers were
used for SYBR Green¨based real-time PCR: RPL13A, forward 5'-
CCTGGAGGAGAAGAGGAAAGAGA-3' (SEQ ID NO: 5), reverse 5'-
TTGAGGACCTCTGTGTATTTGTCAA-3' (SEQ ID NO: 6). RhoA, forward 5'-
TCTTCGGAATGATGAGCAC-3' (SEQ ID NO: 7), reverse 5'-
CTTTGGTCTTTGCTGAACAC-3' (SEQ ID NO: 8). IL-2, forward 5'-
TGCCACAATGTACAGGATGC-3' (SEQ ID NO: 9), reverse 5'-
GCCTTCTTGGGCATGTAAAA-3' (SEQ ID NO: 10). Other primers were commercially
available and/or correspond to published sequences. Alternative primers can be
readily
generated.
Cloning of reporter constructs, transient transfection and luciferase assays.
pGL3-Basic
Luciferase Reporter Vector (Promega) was used for generation of IL-2 promoter
reporter
constructs. Briefly, the 884bp promoter region (-59 to +825bp bases) was
amplified by PCR
from genomic DNA, the primers used were: forward 5'-CAT TCATAGTGTCCCAGGTG-3'
(SEQ ID NO: 11), reverse 5'-CATTGTGGCAGGAGTTGAG-3' (SEQ ID NO: 12).
The forward and reverse primers created Mlu I and Xho I sites respectively,
and PCR
products were ligated into the pGL3-Basic plasmid according to manufacturer's
instructions.
Jurkat cells were seeded at 1x106 cells/well in a 24-well plate and
transfected 2 hours later.
pGL3-basic luciferase reporter plasmids (lug) containing IL-2 promoter
described above,
miRNA oligonucleotides or siRNA and with a 5Ong pRL-basic-luc vector used for
normalization
of transfection efficiency, were co-transfected into Jurkat cells using
Lipofectamine 2000
(Invitrogen). After 24 hour recovery period, transfected cells were either
left untreated or
stimulated for 24 hours with PMA and ionomycin. Then, luciferase activity was
assessed using
the Dual-Luciferase Reporter Assay System (Promega, Madison, WI), performed on
a CENTRO
X53 LB 960 (Berthold Technologies) instrument according to the manufacturer's
protocol. The
ratio of Renilla luciferase to firefly luciferase was obtained for each well.
All experiments were
performed in triplicate.
Enzyme-linked immunosorbent assay (ELISA). ELISA for IL-2 protein secreted
into the
cell culture supernatant was quantified using commercially available kits (Xi
Tang Biology,
Shanghai, China) according to the manufacturer's protocol.
-62-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Western blotting. In a 6-well plate, T cells were seeded at 5x106 cells/well
and
transfected with miRNA oligonucleotides per well for 100nM final concentration
of miR-31
mimics or control mimics and 100nM final concentration of siRNA RhoA or
controls. Six hours
after transfection, T cells were added to fresh complete medium. Two days
after transfection,
cells were lysed and proteins were extracted. Supernatants were then subjected
to sodium
dodecylsulfate¨polyacrylamide gel electrophoresis, blotted with the indicated
antibodies, and
detected with Luminol/Enhancer Solution (Pierce, Rockford, IL). Western
blotting of RhoA and
Tublin were performed using mouse anti-RhoA antibody (Santa Cruz, CA,1:200)
and rabbit anti-
Tublin antibody (Santa Cruz, CA, 1:5,000). The volume tools of the software
Quantity One
(Bio-Rad) were used to quantitate the protein bands, according to the
manufacturer's manual.
Data analysis. Data were analyzed using Prism 4 software, version 4.03
(GraphPad
Software, San Diego, CA). The nonparametric Mann¨Whitney test was used to
compare gene
expression between 2 groups, while an unpaired Student's t-test was used to
compare reporter
gene activity. P values (2-tailed) less than 0.05 were considered
statistically significant.
Sequence Listing
SEQ ID NO: 1 (RhoA ¨ siRNA-1) - AAGATTATGACCGTCTGAGGC
SEQ ID NO: 2 (RhoA ¨ siRNA-2) - AAGGATCTTCGGAATGATGAG
SEQ ID NO: 3 (miRNA-31 mimic) - AGGCAAGAUGCUGGCAUAGCU
SEQ ID NO: 4 (miRNA-31 antagomir) - AGCUAUGCCAGCAUCUUGCCU
SEQ ID NO: 5 (RPL13A forward primer) - CCTGGAGGAGAAGAGGAAAGAGA
SEQ ID NO: 6 (RPL13A reverse primer) - TTGAGGACCTCTGTGTATTTGTCAA
SEQ ID NO: 7 (RhoA forward primer) - TCTTCGGAATGATGAGCAC
SEQ ID NO: 8 (RhoA reverse primer) - CTTTGGTCTTTGCTGAACAC
SEQ ID NO: 9 (IL-2 forward primer) - TGCCACAATGTACAGGATGC
SEQ ID NO: 10 (IL-2 reverse primer) - GCCTTCTTGGGCATGTAAAA
SEQ ID NO: 11 (promoter forward primer) - CAT TCATAGTGTCCCAGGTG
SEQ ID NO: 12 (promoter reverse primer) - CATTGTGGCAGGAGTTGAG
-63-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
References
Fairhurst et al. (2006) Adv Immunol 92: 1-69.
Anders et al. (2009) Trends Mol Med 15(12): 553-561.
Nambiar et al. (2004) Methods Mol Med 102: 31-47.
Fujii et al. (2006) Autoimmune Rev 5(2): 143-144.
Kong et al. (2003) Ann NY Acad Sci 987: 60-67.
Moulton et al. (2011) Arthritis Res Ther 13(2): 207.
Lieberman et al. (2010) J Biomed Biotechnol Article ID 740619 (6 pages) [doi:
10.1155/2010/740619]
Tenbrock et al. (2004) Int Rev Immunol 23(3-4): 333-345.
Katsiari et al. (2005) J Clin Invest 115(11): 3193-3204.
Juang et al. (2005) J Clin Invest 115(4): 996-1005.
Herndon et al. (2002) Clin Immunol 103(2): 145-153.
Solomou et al. (2001) J Immunol 166(6): 4216-4222.
Denli et al. (2004) Nature 432(7014): 231-235.
Gregory et al. (2004) Nature 432(7014): 235-240.
Ambros. (2004) Nature 431(7006): 350-355.
Pauley et al. (2009) J Autoimmun 32(3-4): 189-194.
Lu et al. (2010) Cell 142(6): 914-929.
O'Connell et al. (2010) Immunity 33(4): 607-619.
Pauley et al. (2008) Ann NY Acad Sci 1143: 226-239.
Tang et al. (2009) Arthritis Rheum 60(4): 1065-1075.
Pan et al. (2010) J Immunol 184(12): 6773-6781.
Zhao et al. (2011) Arthritis Rheum 63(5): 1376-1386.
Yu et al. (2010) Cell Mol Immunol 7(3): 198-203.
Stittrich et al. (2010) Nat Immunol 11(11): 1057-1062.
Yu et al. (2009) Development 136(9): 1497-1507.
Curtale et al. (2010) Blood 115(2): 265-273.
Thai et al. (2007) Science 316 (5824): 604-608.
Rodriguez et al. (2007) Science 316(5824): 608-611.
Ahmed et al. (2005) Mol Cell Neurosci 28(3): 509-523.
Helms et al. (2007) J Leukoc Biol 82(2): 361-369.
Valastyan et al. (2009) Cee 137(6): 1032-1046.
Katsiari et al. (2006) Autoimmune Rev 5(2): 118-121.
Setoguchi et al. (2005) J Exp Med 201(5): 723-735.
Fontenot et al. (2005) Nat Immunol 6(11): 1142-1151.
Crispin et al. (2009) autoimmune Rev 8(3): 190-195.
Gomez-Martin et al. (2009) Autoimmune Rev 9(1): 34-39.
Nambiar et al. (2003) J Immunol 170(6): 2871-2876.
Nambiar et al. (2003) Arthritis Rheum 48(7): 1948-1955.
Bodor et al. (2007) J Leukoc Biol 81(1): 161-167.
Bodor et al. (2000) J Leukoc Biol 67(6): 774-779.
Bodor et al. (1998) J Biol Chem 273(16): 9544-9551.
Garcia et al. (2005) J Proteome Res 4(6): 2032-2042.
Hu et al. (2008) J Rheumatol 35(5): 804-810.
Creighton et al. (2010) Cancer Res 70(5): 1906-1915.
-64-
CA 02841158 2013-12-20
WO 2013/003346
PCT/US2012/044197
Schmidt et al. (2004) Lupus 13(5): 348-352.
Hagiwara et al. (2000) Cytokine 12(7): 1035-1041.
Blenman et al. (2006) Lab Inves 86(11): 1136-1148.
Prud'homme. (2000) J Gene Med 2(4): 222-232.
Incorporate by Reference
All publications and patents mentioned herein are hereby incorporated by
reference in
their entirety as if each individual publication or patent was specifically
and individually
indicated to be incorporated by reference.
While specific aspects of the subject disclosure have been discussed, the
above
specification is illustrative and not restrictive. Many variations of the
disclosure will become
apparent to those skilled in the art upon review of this specification and the
claims below. The
full scope of the disclosure should be determined by reference to the claims,
along with their full
scope of equivalents, and the specification, along with such variations.
-65-
