Note: Descriptions are shown in the official language in which they were submitted.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
1
METHODS RELATED TO TREATMENT OF INFLAMMATORY DISEASES AND
DISORDERS
TECHNICAL FIELD
The present invention concerns methods within the field of diagnosis,
prognosis and
treatment optimization of inflammatory diseases and disorders aiming to
improve the
treatment options and regiments for patients by providing methods for
predicting
responsiveness to a therapeutic agent.
BACKGROUND
Inflammatory diseases and disorders and in particular auto-immune disease and
severely impact patient's well-being and treatments options are unsatisfactory
for a large
group of patients.
Rheumatoid arthritis (RA) is a clinically important, chronic systemic
autoimmune RA
is an autoimmune disorder of unknown etiology. Most RA patients suffer a
chronic course of
disease that, even with currently available therapies, may result in
progressive joint
destruction, deformity, disability and even premature death. Diagnosis of RA
typically relies
on clinical and laboratory evaluation of a patient's signs and symptoms.
Generally, laboratory
evaluation of a patient suspected of having RA may include determination of
the level of
certain antibodies in serum known as rheumatoid factor (RF) and antibodies to
cyclic
citrullinated peptide (anti-CCP). While these antibodies are often found in
the serum of RA
patients, not all RA patients have them. An additional blood test known as the
erythrocyte
sedimentation rate (ESR) may also be used. An elevated ESR indicates the
general
presence of an inflammatory process, although not necessarily RA. Further
blood tests may
be used to assess the level of other factors, such as C-reactive protein (CRP)
that has been
associated with RA. In addition, radiographic analysis of affected joints may
be performed. In
sum, such currently available laboratory tests to diagnose RA are imprecise
and imperfect.
The American College of Rheumatology (ACR) criteria are frequently used for
diagnosis and determination of severity (http://vvvwv.rheumatology.org)
Attempts has been made to improve diagnosis and prognosis based on biomarkers
(See e.g., Rioja et al., Arthritis and Rheum. 58(8):2257-2267 (2008);
Pyrpasopoulou et al,
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
2
Mol. Diagn. Ther. 14(I):43-48 (2010); WO 2004/0009479; WO 2007/0105133; WO
2007/038501; WO 2007/135568; WO 2008/104608; WO 2008/056198; WO 2008/132176;
and WO 2008/154423). Recently, methods for subgrouping RA patients and
identification of
patients groups which demonstrate a higher responsiveness to anti-CD20 therapy
based on
particular molecular profiles has been presented (W02011028945). However, no
clinically
validated diagnostic or prognostic markers, have been identified that enable
clinicians or
others to accurately define pathophysiological aspects of rheumatoid
arthritis, clinical activity,
response to therapy, prognosis, or risk of developing the disease.
Accordingly, as RA patients seek treatment, there is considerable trial and
error
involved in the search for therapeutic agent(s) effective for a particular
patient. Such trial and
error often involves considerable risk and discomfort the patient in order to
find the most
effective therapy. Thus, there is a need for more effective means for
determining which
patients will respond to which treatment and for incorporating such
determinations into more
effective treatment regimens for RA patients.
It would therefore be highly advantageous to have additional methods for
objectively
identify the presence of the disease in a patient, define pathophysiologic
aspects of
rheumatoid arthritis, clinical activity, response to therapy, including
response to treatment
with various RA therapeutic agents, prognosis, and/or risk of developing
rheumatoid arthritis.
Thus, there is a continuing need to identify new molecular diagnostic or
prognostic
markers associated with rheumatoid arthritis as well as other autoimmune
disorders.
SUMMARY
As described herein the inventor provides a number of methods useful for
improving
therapy of inflammatory diseases or disorder, auto-immune diseases and in
particular RA.
An aspect of the invention concerns a method for predicting the response of a
subject to an anti-inflammatory agent comprising; obtaining information on the
level of
expression of one or more gene(s) of Figure 1 in a biological sample from said
patient,
wherein altered expression of one or more of said gene(s) compared to a
reference level of
said gene(s), is predictive of a response of the subject to the anti-
inflammatory agent.
A further aspect of the invention relates to a method for predicting the
response of a
patient to an anti-inflammatory agent comprising;
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
3
a) measuring the level of expression of one or more gene(s) of Figure 1 in a
biological
sample from said patient and
b) comparing said level with a reference level of said gene(s)
wherein altered expression of one or more of said gene(s) compared to said
reference level,
is predictive of a response of the patient to the anti-inflammatory agent.
The invention further describes a method for identification of a subject with
an
increase probability of responding to anti-inflammatory agent comprising;
obtaining
information on the level of expression of one or more gene(s) of Figure 1 in a
biological
sample from said subject, wherein altered expression of one or more of said
gene(s)
compared to a reference level of said gene(s) indicates that a subject with an
increased
probability of responding to an anti-inflammatory agent has been identified.
In an aspect the invention relates to a method for identification of a patient
with an
increase probability of responding to anti-inflammatory agent comprising;
a. measuring the level of expression of one or more gene(s) of Figure 1 in a
biological
sample from said patient
b. comparing said level with a reference level of said gene(s),
wherein altered expression of one or more of said gene(s) compared to the
reference level of
said gene(s), indicates that a patient with an increased probability of
responding to an anti-
inflammatory agent has been identified.
The methods of the invention may concern situations where the altered
expression
is an increased expression of a gene of Figure 1A compared to the reference
level and/or
where the altered expression is a decreased expression of a gene of Figure 1B
compared to
the reference level.
The methods further describes that the level of expression may be determined
in a
blood sample based on mRNA using qRT-PCR or using micro array chip. In
specific
embodiments of the invention the level of expression of complement factor D
(CFD) is
determined and found to be above a reference level, which may be differently
defined
depending on the method applied for detection of said transcript.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
4
An aspect of the invention relates to an anti-inflammatory agent for treatment
of an
auto-immune disease or disorder, wherein the patient has an altered expression
of one or
more of the genes of Figure 1, compared to the reference level of said
gene(s).
A further aspect of the invention relates to method of treatment of a subject
suffering
from an inflammatory disease or where the expression levels of one or more of
the genes of
Figure 1 is altered compared to a reference level, comprising administering a
therapeutic
amount of an anti-inflammatory agent to said subject.
The method may include a further step comprising; considering if the
expression
level(s) of one or more of the genes of Figure 1, in said patient is altered
compared to a
reference level.
An aspect of the invention relates to a method for treating an inflammatory
disease
or disorder in a patient comprising;
a. measuring the levels of expression of one or more gene(s) of Figure 1 in
a biological
sample from said patient
b. comparing said levels with a reference level of said genes,
c. determine if the expression levels of one or more of the genes of Figure
1, is altered
compared to said reference level
d. administering a therapeutic amount of an anti-inflammatory agent to said
patient.
In some cases the information on gene expression with be used to determine if
the
patient is actually to be dosage with the anti-inflammatory agent and the
methods described
above may thus include the evaluation of the expression data e.g. concluding
that the level of
expression one or more of the genes of Figure 1, is altered in said biological
sample
compared to said reference level. It is considered relevant to consider if the
expression level
of one or more gene(s) of Table 1A is increased compared to the reference
level and/or if the
expression level of one or more gene(s) of Table 1B are decreased compared to
the
reference level
In a further aspect the invention relates to an article of manufacture
comprising,
packaged together, a pharmaceutical composition comprising an anti-
inflammatory agent
and a pharmaceutically acceptable carrier and a label stating that the
pharmaceutical
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
composition is useful for treating a patient suffering from an auto-immune
disease or disorder
with an altered expression of one or more of the genes of Figure 1.
An aspect of the invention concerns a kit comprising
5 a) one or more composition comprising at least one detecting agent for
determining the
expression level of one or more gene(s) from Table 1A and/or Table 1B and
b) instructions for use of the kit including how to correlate expression
level(s) with response
probability of a subject.
Based on the present data an improved treatment can be suggested to patients
and
the impact of trial and error can be minimized. It is clear to the skilled
person that the
invention may be performed with certain variation in addition to the specific
examples herein.
SEQENCE LISTING
The present application includes a sequence listing including the following
sequences
SEQ ID NO 1: CFD mRNA probe: CCTGCTGCTACAGCTGTCGGAGAAG
SEQ ID NO 2: 18S rRNA control probe: TGGAGGGCAAGTCTGGTGCCAGCAG
SEQ ID NO 3: rs1683565:
AGAGCCCAAAGCTCATGGAAAAGAGXATATAAAGGAGTCCCTGCAGTAGA
wherein X at position 26 is A or G
SEQ ID NO 4: rs1683591:
TCTGTCCACAGGCGGGGGTGGAGGGXATGGCCGGCCTCACACCATCTGCCA
wherein X at position 26 is A or G
SEQ ID NO 5: rs1683590:
AATATCTGAAATTTTCCCAGTTTACXAGCCTCTGACGTAACCGTCCTCTCT
wherein X at position 26 is A or G
SEQ ID NO 6: ACTB probe:
CCTTTGCCGATCCGCCGCCCGTCCA
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
6
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1 shows a list of positively (Table 1a) and a list negatively (Table 1b)
correlated
transcripts to Disease Activity Score of 28 joints ¨ C-reactive protein (DAS28-
CRP) changes
(at week 8) in anti-IL20 RA trials. Transcripts showing significant
correlation (False Discovery
Rate (FDR) = 5%) in dosed patients (excluding placebo controls) are included
in the lists
(ranked order with most significant correlation in the top of each list). The
genes listed in
Table 1A have been identified as relevant for use in methods of the invention
where a
relative high level of expression is of interest.
The genes listed in Table 1B have been identified as relevant for use in
methods of the
invention where a relative low level expression is of interest.
FIG. 2 shows Table 2 including a selection of genes from Table 1A and 1B which
are
considered relevant for use in methods of the invention and in particularly in
methods
applying multi-variate analysis. The selected transcript/genes are relevant
for a multivariate
based prediction of DA528-CRP.
FIG. 3 shows the distribution of transcript level of the CFD (complement
factor D) transcripts
in PaxGene whole blood samples from RA-patients in anti-IL20 trials. Robust
Multichip
Average (RMA) normalized values are shown on the Y-axis (log2 scale). Samples
from
individual patients are presented in alternating colours (black or white) and
individual patients
are arbitrarily numbered 1-82
FIG. 4 shows a Receiver Operating Characteristic (ROC) curve of CFD mRNA and
American
College of Rheumatology 50 % composite criteria (ACR50) responses in the phase-
2a anti-
1L20 trial. The threshold value of 10.32 (RMA normalized expression value) is
indicated by
the X on the ROC curve.
FIG. 5 shows a ROC curve of CFD mRNA and American College of Rheumatology 70 %
composite criteria (ACR70) responses in the phase-2a anti-IL20 trial.
FIG. 6 shows correlation of quantitative RT-PCR (qRT-PCR) detection of CFD
mRNA in pre-
dosage (Day 1) samples with the data from microarray based detection at more
time points.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
7
Microarray signals on a linear scale (Back transformed RMA data (Y-axis)) are
compared to
18S normalized CFD levels from the gRT-PCR analysis.
Fig. 7 shows the ACR20, ACR50 and ACR70 response rates in the anti-IL20 phase-
2a trial
(clinicaltrials.gov identifier NCT01282255) with two alternative tresholds of
CFD based
stratification. If a stratification of the patients based on the CFD mRNA
levels from the ROC
curve of Fig. 4 is applied (e.g. a threshold value of >10.32 (RMA normalized
expression
value) is used), a high responding patient population is obtained (bottom of
chart A). The
upper part of chart A displays the responses if only individuals with CFD
levels below the
threshold are included. When applying an alternative threshold for CFD (based
on absolute
quantification of CFD and beta actin (ACTB)) a similar enrichment in
responding patients is
obtained (lower part of chart B).
Fig. 8 shows the levels of Bb in synovial fluid from RA patients exhibiting
either high or low
CFD expression levels in PaxGene samples as evaluated by qPCR.
DESCRIPTION
The present invention is associated with a method for predicting therapeutic
effect of
an anti-inflammatory compound. As described in the background section the
treatment
presently available have, at least to some extent, a low success rate and
treatment
frequently involves some degree of trial and error. This invention provides a
method for
identification of a patient subgroup that have a high treatment success rate
whereby a large
number of patients can avoid the risk an discomfort associated with the
difficulties in finding
an effective therapy.
Definitions
For the purpose of interpretation of this application the following
definitions is to be
used on less otherwise explained herein.
The term "polynucleotide" or "nucleic acid," as used interchangeably herein,
refers
to polymers of nucleotides of any length, and include DNA and RNA. The
nucleotides can be
deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or
their
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
8
analogues, or any substrate that can be incorporated into a polymer by DNA or
RNA
polymerase. A polynucleotide may comprise modified nucleotides, such as
methylated
nucleotides and their analogues. If present, modification to the nucleotide
structure may be
imparted before or after assembly of the polymer. The sequence of nucleotides
may be
interrupted by non-nucleotide components. A polynucleotide may be further
modified after
polymerization, such as by conjugation with a labelling component and other
types of
modifications known in the art.
The term "oligonucleotide," as used herein, refers to short, single stranded
polynucleotides that are at least about seven nucleotides in length and less
than about 250
nucleotides in length. Oligonucleotides may be synthetic. The terms
"oligonucleotide" and
"polynucleotide" are not mutually exclusive. The description above for
polynucleotides is
equally and fully applicable to oligonucleotides.
The term "primer" refers to a single stranded polynucleotide that is capable
of
hybridizing to a nucleic acid and allowing the polymerization of a
complementary nucleic
acid, generally by providing a free 3' -OH group.
The term "array" or "microarray" refers to an ordered arrangement of
hybridisable
array elements, preferably polynucleotide probes (e.g., oligonucleotides), on
a substrate. The
substrate can be a solid substrate, such as a glass slide, or a semi-solid
substrate, such as
nitrocellulose membrane.
The term "amplification" refers to the process of producing one or more copies
of a
reference nucleic acid sequence or its complement. Amplification may be linear
or
exponential (e.g., PCR). A "copy" does not necessarily mean perfect sequence
complementarity or identity relative to the template sequence. For example,
copies can
include nucleotide analogues such as deoxyinosine, intentional sequence
alterations (such
as sequence alterations introduced through a primer comprising a sequence that
is
hybridisable, but not fully complementary, to the template), and/or sequence
errors that occur
during amplification.
The term "multiplex-PCR" refers to a single PCR reaction carried out on
nucleic acid
obtained from a single sample (e.g., one patient) using more than one primer
set for the
purpose of amplifying two or more DNA sequences in a single reaction.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
9
"Stringency" of hybridization reactions is readily determinable by one of
ordinary skill
in the art, and generally is an empirical calculation dependent upon probe
length, washing
temperature, and salt concentration. In general, longer probes require higher
temperatures
for proper annealing, while shorter probes need lower temperatures.
Hybridization generally
depends on the ability of denatured DNA to re-anneal when complementary
strands are
present in an environment below their melting temperature. The higher the
degree of desired
homology between the probe and hybridisable sequence, the higher the relative
temperature
should be. As a result, it follows that higher relative temperatures would
tend to make the
reaction conditions more stringent, while lower temperatures less so. For
additional details
and explanation of stringency of hybridization reactions, see Ausubel et al.,
Current Protocols
in Molecular Biology, Wiley lnterscience Publishers, (1995).
"Stringent conditions" or "high stringency conditions", as defined herein, can
be
identified by those that: (1) employ low ionic strength and high temperature
for washing, for
example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1 procent sodium
dodecyl
sulfate at 50 C; (2) employ during hybridization a denaturing agent, such as
formamide, for
example, 50 percent (v/v) formamide with 0.1 percent bovine serum albumin/0.1
percent
Fico11/0.1 percent polyvinylpyrrolidone/5 OmM sodium phosphate buffer at pH
6.5 with 750
mM sodium chloride, 75 mM sodium citrate at 42C; or (3) overnight
hybridization in a solution
that employs 50 percent formamide, 5 x SSC (0.75 M NaCI, 0.075 M sodium
citrate), 50 mM
sodium phosphate (pH 6.8), 0.1 percent sodium pyrophosphate, 5 x Denhardt's
solution,
sonicated salmon sperm DNA (50 micro g/m1), 0.1 percent SDS, and 10 percent
dextran
sulfate at 42C, with a 10 minute wash at 42C in 0.2 x SSC (sodium
chloride/sodium citrate)
followed by a 10 minute high- stringency wash consisting of 0.1 x SSC
containing EDTA at
55C.
"Moderately stringent conditions" can be identified as described by Sambrook
et al.,
Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press,
1989, and
include the use of washing solution and hybridization conditions (e.g.,
temperature, ionic
strength and percent SDS) less stringent that those described above. An
example of
moderately stringent conditions is overnight incubation at 37 degrees
centigrade in a solution
comprising: 20 percent formamide, 5 x SSC (150 mM NaCI, 15 mM trisodium
citrate), 50 mM
sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10 percent dextran
sulfate, and 20
mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1
x SSC at
about 37-50C. The skilled artisan will recognize how to adjust the
temperature, ionic
strength, etc. as necessary to accommodate factors such as probe length and
the like.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
The term "detection" includes any means of detecting, including direct and
indirect
detection.
The terms "level of expression" or "expression level" is generally used
interchangeably and refer to the amount of a polynucleotide or an amino acid
product or
5 protein in a biological sample. "Expression" generally refers to the
process by which gene-
encoded information is converted into the structures present and operating in
the cell.
Therefore, as used herein, "expression" of a gene may refer to transcription
into a
polynucleotide, translation into a protein, or even posttranslational
modification of the protein.
Fragments of the transcribed polynucleotide, the translated protein, or the
post-
10 translationally modified protein shall also be regarded as expressed
whether they originate
from a transcript generated by alternative splicing or a degraded transcript,
or from a
posttranslational processing of the protein, e.g., by proteolysis. "Expressed
genes" include
those that are transcribed into a polynucleotide as mRNA and then translated
into a protein,
and also those that are transcribed into RNA but not translated into a protein
(for example,
transfer and ribosomal RNAs).
The term "expression profile" can be used to define the level of expression of
a
group of genes providing a more composite picture of the transcriptional
activity in the
sample.
The term "biomarker" as used herein refers to an indicator of a state of a
patient; as
such biomarker can be useful for evaluating the disease state of a patient
including diagnosis
and evaluating response of treatment in an individual). A biomarker is a
molecular entity,
which can be detected in a biological sample from the patient. Biomarkers
include, but are
not limited to, DNA, RNA, protein, carbohydrate, and other biochemical
entities or moieties,
including combinations thereof, for example a glycolipid or a glycoprotein-
based molecular
marker. "Diagnostic marker" and "prognostic marker" is a specification of
"biomarkers" that
indicates that the presence or absence or level of a molecular entity can
provide information
on diagnosis and/or prognosis, including such as the response to one or more
types of
therapy. Some biomarkers may be suited for diagnostics, some are suited for
following
disease development and treatment response, whereas other are suited for
predictions of a
clinical response to a therapy.
The "amount" or "level" of a "prognostic marker" associated with an increased
clinical benefit to a patient is the detectable level in a biological sample
from said patient. The
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
11
expression level can be measured by methods known to one skilled in the art
and also
disclosed herein. The expression level or amount of biomarker assessed can be
used to
determine or predict the response of treatment.
The term "altered expression" refers to an increased or decreased expression
level
of a gene, usually measured at the mRNA or protein level.. The expression
level is
considered altered relative to a reference level, e.g. the level of expression
is "higher" or
"lower compared to a predetermined level of relevance. Altered expression
level of a gene,
may represent a gene which expression is "high" or "low" compared to other
genes and/or
relative to the level of expression in other individuals.
The term "increased expression" or "increased levels" refers to an elevated or
increased expression level of a gene, usually measured at the mRNA or protein
level. The
expression level is considered increased relative to a reference level, e.g.
the level of
expression is "higher" than a predetermined level of relevance. Increased
expression level of
a gene, may represent a gene which is expressed at "a high" level in an
individual, relative to
other genes and/or relative to the level of expression in other individuals.
The term "decreased expression" or "decrease levels" refers to a reduced or
decreased expression level of a gene, usually measured at the mRNA or protein
level. The
expression level is considered decreased relative to a reference level, e.g.
the level of
expression is "lower" that a predetermined level of relevance. Decreased
expression level of
a gene, may represent a gene which is expressed at "a low" level in an
individual, relative to
other genes and/or relative to the level of expression in other individuals.
The term "rheumatoid factor," or "RF," refers to IgM, IgG, or IgA isotypes,
singly or
in any combination, of antibodies detected in patient serum and directed to
antigenic
determinants present on human and animal IgG.
The term "positive for RF" refers to a result of an assay for RF, e.g., an
ELISA
assay, where the result is above a threshold or cut-off value for that assay
for samples that
are considered to reproducibly contain detectable levels of RF.
The term "negative for RF" refers to a result of an assay for RF, e.g., an
ELISA
assay, where the result is at or below a threshold or cut-off value for that
assay for samples
that are considered to reproducibly contain undetectable levels of RF.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
12
The term "sample" or "biological sample" as used herein refers to a
composition that
is obtained or derived from a subject of interest that contains one or more
molecular entities
that is/are detected, measured or identified. For example, the phrase "patient
sample",
"subject sample" and variations thereof refers to any sample obtained from a
patient or
subject of interest that would be expected or is known to contain the cellular
and/or molecular
entity that is to be characterized, including but not limited to a tissue
sample, a cell sample or
a blood sample.
The terms "tissue sample" or "cell sample" or "blood sample" are meant for
samples
including one or more cells obtained from a subject. The source of the tissue
or cell sample
may be solid tissue as from a fresh, frozen or preserved organ or tissue
sample or biopsy or
aspirate; bodily fluids such as cerebral spinal fluid, amniotic fluid,
peritoneal fluid, interstitial
fluid, or blood or any blood constituents. The tissue sample or cell sample
may also be
primary or cultured cells or cell lines. Optionally, the tissue or cell sample
is obtained from a
diseased tissue/organ (e.g., demonstrating a pathological characteristic). The
tissue sample
may contain compounds which are not naturally intermixed with the tissue in
nature such as
preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or
the like.
The term "serum sample" refers to any serum sample obtained from an
individual.
Methods for obtaining sera from mammals are well known in the art.
A "control sample", "control cell", or "control tissue", as used herein,
refers to a
biological sample, cell or tissue obtained from a source known, or believed,
not to be afflicted
with the disease or condition for which a method or composition of the
invention is being
used to identify. In one embodiment, a control sample, control cell, or
control tissue is
obtained from a seemingly unaffected part of the body of the same subject or
patient in
whom a disease or condition is being identified using a composition or method
of the
invention. In one embodiment, control sample, control cell, or control tissue
is obtained from
a part of the body of an individual who is not the subject or patient in whom
a disease or
condition is being identified using a composition or method of the invention.
The term "diagnosis" is used herein to refer to the identification or
classification of a
molecular or pathological state, disease or condition. For example,
"diagnosis" may refer to
identification of a particular type of inflammatory disease or disorder or a
specific
autoimmune disease, such as RA.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
13
The term "prediction", "predicting" or variations hereof are used to refer to
the
likelihood that a patient will respond either favourably or unfavourably to a
drug or set of
drugs. In one embodiment, the prediction relates to the extent of those
responses. In one
embodiment, the prediction relates to the probability that a patient will
improve following
treatment, for example treatment with a particular therapeutic agent, and for
a certain period
of time without disease recurrence. The predictive methods of the invention
can be used
clinically to make treatment decisions by choosing the appropriate treatment
modalities for
any particular patient. The predictive methods of the present invention are
valuable tools in
determining if a patient is likely to respond favourably to a treatment
regimen, such as a
given therapeutic regimen, including for example, administration of a given
medicament or
therapeutic agent or combinations hereof.
The term "indication", "indicative" or variations hereof are used to refer to
the
guidance obtained; as an "indication" based on an altered expression level of
a gene as
described herein provide information that the subject or patient is likely to
respond to an anti-
inflammatory treatment. Based on such guidance the methods of the invention
can be used
clinically to make treatment decisions by choosing the appropriate treatment
modalities for
any particular patient.
As used herein, "treatment" refers to clinical intervention in an attempt to
alter the
natural course of the individual being treated, and can be performed before or
during the
course of clinical pathology. Desirable effects of treatment include
preventing the occurrence
or recurrence of a disease or a condition or symptom thereof, alleviating a
condition or
symptom of the disease, diminishing any direct or indirect pathological
consequences of the
disease, decreasing the rate of disease progression, ameliorating or
palliating the disease
state, and/or achieving remission or improved prognosis. In some embodiments,
methods
and compositions of the invention are useful in attempts to delay development
of a disease
or disorder.
An "effective amount" refers to an amount effective, at dosages and for
periods of
time necessary, to achieve the desired therapeutic or prophylactic result. A
"therapeutically
effective amount" of a therapeutic agent may vary according to factors such as
the disease
state, age, sex, and weight of the individual, and the ability of the antibody
to elicit a desired
response in the individual. A therapeutically effective amount is also one in
which any toxic or
detrimental effects of the therapeutic agent are outweighed by the
therapeutically beneficial
effects. A "prophylactically effective amount" refers to an amount effective,
at dosages and
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
14
for periods of time necessary, to achieve the desired prophylactic result.
Typically but not
necessarily, since a prophylactic dose is used in subjects prior to or at an
earlier stage of
disease, the prophylactically effective amount will be less than the
therapeutically effective
amount.
The terms "individual," "subject" or "patient", as used herein, can be used
interchangeably and generally refers to a vertebrate. In certain embodiments,
the vertebrate
is a mammal. Mammals include, but are not limited to, primates (including
human and non-
human primates) and rodents (e.g., mice and rats). In certain embodiments, the
mammal is a
human. The term "patient" further indicates that the subject is not a healthy
subject. In one
embodiment a "patient" is an individual diagnosed or suffering from sign(s) or
symptom(s)
associated with inflammatory diseases or disorders. In one embodiment the
"patient" is
suffering from an autoimmune disease or disorders, such as RA.
A "control subject" refers to a seemingly healthy subject who has not been
diagnosed and/or who does not suffer from any sign or symptom associated with
inflammatory diseases or disorders.
By "correlate" or "correlating" is meant comparing, in any way, the
performance
and/or results of a first analysis or protocol with the performance and/or
results of a second
analysis or protocol. For example, one may use the results of a first analysis
or protocol in
carrying out a second protocols and/or one may use the results of a first
analysis or protocol
to determine whether a second analysis or protocol should be performed. With
respect to the
embodiment of gene expression analysis or protocol, one may use the results of
the gene
expression analysis or protocol to determine whether a specific therapeutic
regimen should
be performed.
The term "patient response" or "response" can be assessed using any endpoint
indicating a benefit to the patient, including, without limitation hereto, a)
inhibition of disease
progression, b) reduction in the number of disease episodes and/or symptoms;
c) reduction
in lesional size; d) inhibition of disease cell infiltration into adjacent
peripheral organs and/or
tissues; e) inhibition of disease spread; f) decrease of auto-immune response,
which may,
but does not have to, result in the regression or ablation of the disease
lesion; g) relief, to
some extent, of one or more symptoms associated with the disorder; h) increase
in the
length of disease-free presentation following treatment; and/or i) decreased
mortality at a
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
given point of time following treatment. For the purpose of patient response,
inhibition is
meant to cover; reduction, slowing down or complete arrest or symptom(s) of
relevance.
The expression "not responsive to," as it relates to the reaction of subjects
or
patients to one or more of the medicaments that were previously administered
to them,
5 describes those subjects or patients who, upon administration of such
medicament(s), did
not exhibit any or adequate signs of treatment of the disorder for which they
were being
treated, or they exhibited a clinically unacceptably high degree of toxicity
to the
medicament(s), or they did not maintain the signs of treatment after first
being administered
such medicament(s), with the word treatment being used in this context as
defined herein.
10 The phrase "not responsive" includes a description of those subjects who
are resistant and/or
refractory to the previously administered medication(s), and includes the
situations in which a
subject or patient has progressed while receiving the medicament(s) that he or
she is being
given, and in which a subject or patient has progressed within 12 months (for
example, within
six months) after completing a regimen involving the medicament(s) to which he
or she is no
15 longer responsive. The non-responsiveness to one or more medicaments
thus includes
subjects who continue to have active disease following previous or current
treatment
therewith. For instance, a patient may have active disease activity after
about one to three
months of therapy with the medicament(s) to which they are non-responsive.
Such
responsiveness may be assessed by a clinician skilled in treating the disorder
in question.
For purposes of non-response to medicament(s), a subject who experiences "a
clinically
unacceptably high level of toxicity" from previous or current treatment with
one or more
medicaments experiences one or more negative side-effects or adverse events
associated
therewith that are considered by an experienced clinician to be significant,
such as, for
example, serious infections, congestive heart failure, demyelination (leading
to multiple
sclerosis), significant hypersensitivity, neuropathological events, high
degrees of
autoimmunity, a cancer such as endometrial cancer, non-Hodgkin's lymphoma,
breast
cancer, prostate cancer, lung cancer, ovarian cancer, or melanoma,
tuberculosis (TB), and
the like.
The term "inadequate response" or "an inadequate responder" is used to
describe
patients that experience an unsatisfactory effect of a given treatment. This
may be
characterized by a low therapeutic effect and/or by substantial side effects.
The criteria is
considered equivalent to none-responsiveness. The "term inadequate response"
is used in
connection with therapeutics for where a given response is expected or aimed
at based on
previous trials. If after a certain period no "adequate response"is obtained,
the treatment is
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
16
usually discontinued and the patient is considered "an inadequate responder".
It may also be
that the patient continues the treatment, but in combination with further
treatment in order to
improve treatment response.
The term "adequate response" is used to describe the effect of a treatment in
a
patient when expectations to treatment efficacy are fulfilled.
A "medicament" is an active drug to treat a disease, disorder, and/or
condition. In
one embodiment, the disease, disorder, and/or condition is RA or its symptoms
or side
effects.
An "anti-inflammatory agent" is a compound, medicament or agent, which can, or
is
expected to; decrease an inflammatory response or symptom(s) of inflammatory
diseases or
disorders.
A "RA therapeutic agent," a "therapeutic agent effective to treat RA," and
grammatical variations thereof, as used herein, refer to an agent that when
provided in an
effective amount is known, clinically shown, or expected by clinicians to
provide a therapeutic
response in a subject who has RA.
An "antagonist" refers to a molecule capable of neutralizing, blocking,
inhibiting,
abrogating, reducing or interfering with the activities of a particular or
specified protein,
including its binding to one or more receptors in the case of a ligand or
binding to one or
more ligands in case of a receptor. Antagonists include antibodies and antigen-
binding
fragments thereof, proteins, peptides, glycoproteins, glycopeptides,
glycolipids,
polysaccharides, oligosaccharides, nucleic acids, bioorganic molecules,
peptidomimetics,
pharmacological agents and their metabolites, transcriptional and translation
control
sequences, and the like. Antagonists also include small molecule inhibitors of
the protein,
and fusion proteins, receptor molecules and derivatives which bind
specifically to the protein
thereby sequestering its binding to its target, antagonist variants of the
protein, antisense
molecules directed to the protein, RNA aptamers, and ribozymes against the
protein.
DETAILED DESCRIPTION
The inventors of the present inventions have found that patients with a high
probability of a successful treatment can be identified based on examination
of the
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
17
expression profile of certain genes. The present invention is based on data
obtained as
described in the examples. The patient according to the invention typically
suffers from an
inflammatory diseases or disorder and in particular an auto-immune disease or
disorder.
Based on the obtained data the information can be used in various methods, as
patients with
an enhanced probability of responding to therapy can be selected.
One aspect of the invention relates to a method for predicting the response of
a
subject to an anti-inflammatory agent comprising obtaining information on the
level of
expression of one or more gene(s) of Figure 1 in a biological sample from said
subject,
wherein altered expression of one or more of said gene(s) compared to a
reference level of
said gene(s), is predictive of a response of the subject to the anti-
inflammatory agent.
Different wording may be used to explain the context of evaluating gene
expression
of the one or more genes of Figure 1. It is equally useful to obtain
information on the level of
expression, assess the level or expression or to consider the level of
expression. All of these
methods need not including obtaining the blood sample as that may have
occurred
previously and the methods thus specifies that information on gene expression
from a
biological sample for the purpose of prediction the clinical response or the
likelihood of a
clinical response, in a given patient, is used. This further indicates that
information regarding
the level of gene expression that has also been obtained previously may be
used in the
methods according to the invention.
One aspect of the invention relates to a method for identification of a
subject with an
increased probability of responding to an anti-inflammatory agent comprising
obtaining
information on the level of expression of one or more gene(s) of Figure 1 in a
biological
sample from said subject, wherein altered expression of one or more of said
gene(s)
compared to a reference level of said gene(s) in said sample, identifies a
subject with an
increased probability of responding to an anti-inflammatory agent.
As above alternative wording, such as assessing the level of expression or
consider
the level of expression may be used according to the methods of the invention
and
furthermore, as also described above, the methods do not necessarily include
the step of
obtaining the blood sample and assaying the level of expression in the blood
sample.
In further aspects of the invention the methods do include a step of measuring
the
levels of expression of one or more gene(s) of Figure 1 in a biological sample
from said
patient and comparing said levels with a reference level of said genes.
One aspect of the invention thus covers a method for predicting the response
of a
subject to an anti-inflammatory agent comprising;
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
18
a) measuring the level of expression of one or more gene(s) of Figure 1 in a
biological
sample from said subject and
b) comparing said level with a reference level of said gene(s)
wherein altered expression of one or more of said gene(s) compared to said
reference level,
is predictive of a response of the subject to the anti-inflammatory agent.
A further aspect relates to a method for identification of a subject with an
increased
probability of responding to anti-inflammatory agent comprising;
a) measuring the level of expression of one or more gene(s) of Figure 1 in a
biological
sample from said subject,
b) comparing said level with a reference level of said gene(s),
wherein altered expression of one or more of said gene(s) compared to the
reference level of
said gene(s), indicates that a subject with an increased probability of
responding to an anti-
inflammatory agent has been identified.
Gene Expression
The molecular background of many inflammatory diseases or disorders, including
auto-immune diseases or disorders is not well understood and therefore
diagnosis is
complicated and is prone to inaccuracies. The currently available therapies
are useful for
some patient but not for others, and the reason here fore has not yet been
clarified. In order
to increase the treatment success, attempts are made to subgroup patients
depending on
various parameters.
One option is to characterize the gene expression profile of patients and
group
patients based hereon. Usually gene expression is measured at the RNA level or
at the
protein level, as the level of a given mRNA or alternatively the translational
product is
determined.. Alternatively gene expression may be measured or determined
indirectly, such
as by correlation to other genes or makers, also including markers of
polymorphism such as
SNPs. SNPs are usually bi-allelic and easily assayed. Gene expression can thus
be
measured at various levels by multiple methods known by the person skilled in
the art.
The test used to measured gene expression by mRNA level may be based on PCR
technology, such as multiplex-PCR, where more than two primer sets are used
for the
purpose of amplifying two or more DNA sequence in a single reaction carried
out on nucleic
acid isolated from a biological sample, such as a blood sample from a patient.
The method
may be a two-step method also including a step of cDNA synthesis ahead of the
amplification. Microarray chips are also useful for analysing a large group of
genes, such
microarray chips can be specifically designed to include probes of relevance
or information
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
19
from standard chips on genes of interest can be collected to evaluate the gene
expression
profile for genes considered relevant.
The specificity of PCR and array technology is dependent on the hybridization
of
primers and probes to mRNA molecules in the sample analysed and the stringency
can be
adjusted by the parameters known to a person skilled in the art.
Measuring gene expression by correlation to other genes or markers may be
performed when there is evidence that the detection of said other genes or
said markers
correlates with the level of expression of the gene of interest. As described
in Example 4
herein the skilled person may perform expression quantitative trait loci
(eQTL) analyses for a
gene of interest and identify SNP correlations or associations to the
expression level of that
gene. In a further alternative the level of expression may thereby be
determined by
correlation with another gene(s) or marker(s).
Measuring gene expression at the protein level is also contemplated in so far
as the
translational product is a protein that is detectable in the sample obtained
from the patient.
Proteins may be detected using suitable techniques, which are frequently
antibody
based as an antibody with specificity for a given protein may be generated and
used based
on technologies known in the art. Antibody-based technologies are most usable
when gene
expression data from a low number of genes are used. More complex analysis of
gene
expression at the protein level can be made using proteome analysis.
For certain gene products a functional assay could equally well be applied
with the
purpose of determining expression level. A functional assay could be an assay
testing for
biological or enzymatic activity, depending on the functionality of the
protein and the
knowledge in the art about such a proteins activity.
As described above one embodiment of the invention relates to a method for
identification of a patient with an increased probability of responding to an
anti-inflammatory
agent comprising;
a) measuring the levels of expression of one or more gene(s) of Figure 1 in a
biological
sample from said patient
b) comparing said levels with a reference level of said genes,
wherein altered expression of one or more of said gene(s) compared to the
reference level of
said gene(s), is predictive of a response of the patient to the anti-
inflammatory agent.
The same criteria may be applied for identifying or selecting a patient for
treatment
using said anti-inflammatory agent based on the wish to identify patients that
have an
increased probability of responding to treatment using said inflammatory
agent.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
As can be seen in the example disclosed herein an altered expression level of
one
more genes of Figure 1 is indicative for a clinical response to the anti-
inflammatory agent. It
is furthermore attractive to focus on one or more gene(s) that are increased
compared to the
reference level. Alternatively emphasis could be on one or more gene(s) that
are decreased
5 compared to the reference level. Genes, for which, either of these
characteristics, have been
correlated with an improved response rate in patients are listed in Figure 1A
and Figure 1B,
respectively. In a further embodiment the methods described herein concerns
the situation
where the altered expression of a gene of Figure 1A is an increase compared to
the
reference level. In a further embodiment the methods described herein relates
to the case
10 where the altered expression of a gene of Figure 1B is decreased
compared to the reference
level. In further embodiments more genes may be included, such as one or more
gene(s) of
Figure 1A with an expression level above the reference level in combination
with one or more
gene(s) of Figure 1B with an expression level below the references level,
whereby
expression information on multiple genes is used. In one embodiment the
expression level of
15 at least two genes are compared with the individual reference levels. It
is further possible to
combine information that an altered expression of a gene of Figure 1A is
increased
compared to the reference level with information that an altered expression of
a gene of
Figure 1B is decreased compared to the reference level.
A combination of genes useful for multivariate based methods according to the
20 invention is exemplified in Table 2, in such methods information of
expression levels for one
or more genes may be used, such as at least two, at least three, at least
four.
As will be described further below the reference level is gene specific and
will
depend on the specific aim of the method.
Reference level
The reference level may be the expression level in an unaffected or healthy
subject,
which is most likely the case for genes where an altered expression of a gene
is
characteristic for an inflammatory disease or disorder, and such genes may be
useful as
diagnostic markers. In one embodiment the reference level may be the level of
expression in
an unaffected or healthy I individual.
As is apparent from the data herein, other biomarkers do not necessarily
display a
different expression in unaffected or healthy individuals compared to
patients. In one
embodiment the reference level may be an average of expression levels
determined in a
population of either healthy individuals or patients or a mixture thereof. In
other situations,
the level of gene expression of certain genes may provide information
predictive of the
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
21
treatability of a patient using an anti-inflammatory agent although the
expression profile
cannot be correlated with disease state or diagnostic criteria. This may be
due to the fact that
the disease diagnostic is not accurate as the tools for diagnosis do not
reflect the variability
of diseases. Such biomarkers may none the less have great value as they can be
used
Based on such information the reference level may be a pre-determined level,
an
arbitrarily level of expression useful for screening patients that response to
an anti-
inflammatory drug. In on embodiment according to the invention the reference
level is a
The examples herein demonstrate that the level of expression of a single gene
can
be used according to the methods of the invention. This predetermined level
may thus be an
expression level that is indicative a given response, such as a response
measured by
DA528-CRP, an ACR20, an ACR50 and/or an ACR70 response. The reference level or
In one embodiment the predetermined reference level may be based on a ROC
curve set to select an expression level that reaches a ACR50 response in at
least 40% or
In one embodiment the predetermined reference level may be based on a ROC
curve set to select an expression level that reaches a ACR70 response in at
least 25% or the
patients, such as 30%, such as 35 %, such as 40 %, such as, such as 45 %, such
as 50 % of
In one embodiment according to the invention the expression level of
complement
factor D (CFD), also known as adiposin, is used for selecting, identifying
and/or determining
if a patient has a higher probability of responding to an anti-inflammatory
drug. The gene is
listed in Figure 1A (and Figure 2), and exemplifies how a gene with an
increased expression
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
22
level is determined using microarray technology and gRT-PCR, but it is also
relevant
according to the present invention to consider alternative methods for
measuring the mRNA
level of CFD and methods in general for measuring the protein level or
activity of CFD.
Accordingly a method of the present invention may include that the level of
expression of complement factor D (CFD) is above 9.5 on a log2-scale of
normalized
expression values when determined by microarray technology. Based on the ROC
data
presented herein increasing the threshold to such as 9.8, 10.0, 10.2, 10.3,
10.4 or even 10.5
provides methods with higher specificity but also less sensitivity.
The level of expression may also be determined based on PCR measurements,
such as RT-PCR, either as gRT-PCR performed using internal controls or using
multiplex
PCR were more than one transcript can be assayed at a time, also frequently
including
internal controls.
Accordingly a method of the present invention may include methods wherein the
level of expression of complement factor D (CFD) is measured by gRT-PCR and
wherein the
transcript is detected with a Cycle Threshold Value (Ct) of 30 (using Assay
ID:
Hs00157263_m1(Applied Biosystems by Life technologies). In further such
embodiments the
CFD transcript may be detected within PCR cycle 28 or even 26. It is further
preferred that at
the same time, 18S RNA is detected with a Cycle Threshold Value (Ct) of 12.5
on the same
cDNA sample confirming that the quality of the PCR analysis.
The efficiency of the amplification reaction can also be measured and should
be
above 95 %, where 100 % indicates the theoretical doubling of amplicons per
cycle.
Alternatively the efficiency of the PCR amplification should be at least 1.9
or preferably at
least 1.93, where 2.0 represents the theoretical doubling of amplicons per
cycle.
In further embodiments the methods of the present invention include methods
wherein the level of expression of complement factor D (CFD) is measured
indirectly by SNP
detection. In such method one or more SNPs may be evaluated. Contrary to gene
expression, SNP detection provides a yes/yes, yes/no (=no/yes) or no/no
response and not a
relative scale of high or low expression and the evaluation must thus focus on
the genotype
corresponding to the altered expression of interest.
Depending on the selected SNP's the reference level may be "no/no" and to
correlate with altered expression at least one allele should provide a "yes".
In alternative
embodiment the reference level may be "yes/yes" or even "yes/no".
In the example of CFD, increased CFD expression would be correlated with
specific
"reference levels for each SNPs. Such method will thus include a method where
the level of
expression of complement factor D (CFD) is measured indirectly by detection of
one or more
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
23
of rs1683565, rs1683591, rs1683590, rs1683569, rs1683574, rs1651888,
rs2930894,
rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898.
As these SNPs all concerns a single nucleotide which is either A or G the
reference
level will be AA, AG, or GG.
For the SNP rs1683591 described in the example the reference level would be
the AA genotype (low CFD expression and the AG and GG genotypes would indicate
an
altered expression of CFD (high CFD expression).
Methods according to the invention thus include methods where the level of CFD
is
measured indirectly by the presence of the AG or GG genotypes of SNP
rs1683591.
As seen from the method using microarray data and RT-PCR data the specificity
of
the method can be increased by lowering the threshold although thereby losing
some
sensitivity.
If an increased expression of a gene is relevant for the method according to
the
invention, as for CFD, increasing the threshold will provide methods with
higher specificity
but also less sensitivity.
Vice versa, if a decreased expression of a gene is relevant for the method
according
to the invention decreasing the expression level threshold will provide a
method with higher
specificity but also less sensitivity. It is also clear that to fulfil the
threshold criteria in this case
the expression level to be below the threshold.
It is clear from the above, that other genes, as identified herein, may
likewise alone
or in combination, be used in methods for predicting the likelihood of a
clinical response in a
patient and thereby selection of patients for a given treatment base on a high
probability that
the selected patients will response to said treatment.
Biological sample
The starting point for any subgrouping or characterizing of an individual
patient,
beyond the initial diagnosis, is a biological sample or information based on a
biological
sample that has been obtained prior. The biological sample can according to
the invention be
any sample that is obtained from a patient prior to or in the cause of using
the present
invention. The sample is preferably a blood sample that can be easily obtained
by routine
methods but also other types of samples may be used. The sample may also be a
serum
sample. In some cases a tissue sample such as a synovial sample may be used.
The person
skilled in the art will understand how to treat a given sample prior to
measuring the level of
expression of given set of genes. Full blood sample may be collected as
PaxGene samples.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
24
If the gene of interest is expressed in specific cell types this may reflect
the sample
used for expression studies. The biological sample may thus be a sample of
peripheral blood
mononuclear cell from a blood sample, also called a PBMC fraction, or even sub-
fractions
hereof including monocytes only, such as one or more of CD14+, CD4+ and/or
CD8+
In case the gene encodes a soluble protein marker the expression studies may
be
performed on a serum sample and the presence of the protein, not the
transcript, may be
evaluated. Soluble proteins in serum may be detected using a specific
antibody, such as by
an ELISA know in the art. If more proteins are evaluated more complex analysis
of gene
Patient and patient status
15 In one embodiment the subject is patient e.g. an individual diagnosed
or suffering
from sign(s) or symptom(s) associated with inflammatory diseases or disorders
as described
herein. In one embodiment the patient is suffering from an autoimmune disease
or disorders.
In a specific embodiment the patient is an RA patient or suffering from
symptoms of RA.
The sample may be obtained from a patient that is naive for treatment of the
30 Drugs that are used as first line drugs for treatment of the
inflammatory disease or
disorder will usually be administered to the patient before it is evaluated if
a therapy
according to the present invention has a high probability of success.
Drugs that a patient is being treated with or has previously been treated with
may
include one or more of the following: non-steroidal anti-inflammatory drugs
(NSAIDs) like
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
(DMARDs) like PlaquenilTM, AzulfidineTM, MethotrexateTM, etc, CopaxoneTM
(glatirimer
acetate), Gilneya TM (fingolimod), antibiotics like FlagylTM, Cipro TM ,
Topical (skin applied)
medications including topical corticosteroids, vitamin D analogue creams
(DovonexTm),
topical retinoids (TazoracTm), moisturizers, topical immunomodulators
(tacrolimus and
5 pimecrolimus), coal tar, anthralin, and others, Raptiva TM ,
UstekimumabTM, light therapy like
PUVA, UVB and CellCeptTM (mycophenolate mofetil). Also including biological
anti-
inflammatory agents including, but are not limited to, IFN-beta, Orencia TM
(CTLA4-Ig),
HumiraTM (anti-TNF), CimziaTM (anti-TNF, PEG Fab), TysabriTm (a4-integrin
mAb),
SimponiTM, Rituxan/MabThera TM , Actemra/RoActemraTM and KineretTM.
10 If a sample obtained prior to treatment is not used, the patient may
be treated using
one or more of a broad range of anti-inflammatory drugs including NSAIDs,
DMARDs and
TNF-alfa inhibitors as mentioned above. Frequently the patient will be treated
with
methotrexate (MTX).
It may also be that the treatment applied previously did not provide an
adequate
15 response in the patient, and thus the patient is no longer naïve to said
treatment but is
considered an inadequate responder. As for the diagnosis and clinical response
the criteria
applied to determine if a given patient is an inadequate responder will depend
on the disease
or disorder to be treated as described below.
The patient may thus be an inadequate responder to MTX treatment and/or to TNF-
20 alfa inhibitor treatment, where TNF-alfa inhibitor treatment is meant to
be one or more of the
drugs recognised as TNF-alfa inhibitors including both antibody drugs and
soluble receptor
drugs.
It is preferred that the expression of the genes selected for the
identification method
described herein are not affected by prior or concurrent treatment with any
anti-inflammatory
25 drug, before or at the time where the biological sample is obtained.
As mentioned above it may also be relevant to consider rheumatoid factor (RF)
status and anti-cyclic citrullinated protein antibodies (anti-CCP) status of
the patient. Assays
for determining RF and anti-CCP status is known in the art and the skilled
person can apply
any such assay without difficulties following the instructions from the
manufacture. Patients
positive for RF have a level of rheumatoid factor above a certain threshold
indicative of the
presence of RF in a sample. If negative, the level of rheumatoid factor is
below said
threshold, indicative of the absence of RF in said sample.
In one embodiment the patient RF status is positive or negative. In further
specific
embodiments the patient RF status is either positive or negative.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
26
In one embodiment the patient anti-CCP status is positive or negative. In
further
specific embodiments the patient anti-CCP status is either positive or
negative.
Indications
As described herein above, the present invention relates to treatment of a
variety of
diseases, particular including auto-immune and inflammatory diseases or
disorders.
The conditions or disorders of to be treated with the anti-inflammatory agent
are
rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic
arthritis, ankylosing
spondylitis, Sjogren's syndrome, multiple sclerosis, inflammatory bowel
diseases such as
ulcerative colitis and Crohn's disease, systemic lupus erythematosus, or lupus
nephritis, and
any combination thereof, as well as co-morbidities associated with these
diseases, with
cardiovascular disease being a non-limiting example of said comorbidities. In
a further
aspect, other exemplary conditions include, but are not limited to, juvenile
chronic arthritis,
osteoarthritis, other spondyloarthropathies than ankylosing spondylitis,
systemic sclerosis
(scleroderma), idiopathic inflammatory myopathies (dermatomyositis,
polymyositis),
vasculitis, systemic vasculitis, temporal arteritis, atherosclerosis,
sarcoidosis, myasthenia
gravis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal
hemoglobinuria), pernicious anemia, autoimmune thrombocytopenia (idiopathic
thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis
(Grave's
disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes
mellitus, Type 2 diabetes, immune-mediated renal disease (glomerulonephritis,
tubulointerstitial nephritis, autoimmune oophiritis), pancreatitis, autoimmune
orchitis,
autoimmune uveitis, anti- phospholipid syndrome, demyelinating diseases of the
central and
peripheral nervous systems in addition to multiple sclerosis, idiopathic
demyelinating
polyneuropathy or Guillain- Barre syndrome, and chronic inflammatory
demyelinating
polyneuropathy, hepatobiliary diseases such as infectious hepatitis (hepatitis
A, B. C, D, E
and other non-hepatotropic viruses), autoimmune chronic active hepatitis,
viral hepatitis,
primary biliary cirrhosis, granulomatous hepatitis, Wegener's granulomatosis,
Behcet's
disease, and sclerosing cholangitis, inflammatory bowel diseases such as
celiac disease,
gluten-sensitive enteropathy, and Whipple's disease, autoimmune or immune-
mediated skin
diseases including bullous skin diseases, erythema multiforme and contact
dermatitis, atopic
dermatitis, dermitis herpetiformis, pemphigus vulgaris, vitiligo (leukoderma),
allergic diseases
such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity
and urticaria, sepsis,
endotoxemia, immunologic diseases of the lung such as eosinophilic pneumonias,
idiopathic
pulmonary fibrosis and hypersensitivity pneumonitis, chronic obstructive
pulmonary disease,
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
27
and organ or bone marrow transplantation associated diseases including graft
rejection and
graft-versus-host disease.
The causes of inflammatory diseases are multiple and multiple pathways and
components are involved. Inflammation is a cascade of events involving
multiple
components, including the vasculature (e.g., endothelial cells, pericytes,
smooth muscle
cells), cells of the immune system (e.g., T and B lymphocytes;
polymorphonuclear leukocytes
or granulocytes, such as monocytes and neutrophils; dendritic cells,
macrophages, and NK
cells), cell-derived soluble mediators (cytokines, chemokines) and also
resident cells in the
targeted tissue (e.g., epithelial cells, synovial fibroblasts, neuronal
cells). Each of these
elements including regulators hereof may have role in disease development and
may
subsequently also be a target of therapy for the above mentioned diseases and
disorders.
Inflammatory diseases may thus also be characterized by the pathway affected,
e.g. as a B
or T- cell mediated disease or disorder, as a cytokine mediated disorder or a
receptor
mediated disorder etc. etc.
For the present invention the indication may thus be any disorder meliorated
by
treatment of an anti-inflammatory agent, such as a disorder mediated by down-
regulation of
signaling/activity of the IL-10 family e.g. receptors and ligands as described
herein below.
Indication which may be treated using modulators of the IL-10 family of
cytokines
and receptors include auto-immune diseases and disorders, such as Rheumatoid
arthritis
(RA), Systemic lupus erythematosus (SLE), Multiple sclerosis (MS),
Inflammatory Bowel
Disease (IBD), psoriasis or Psoriatic Arthritis (PSA).
Anti-inflammatory agent
As described herein above multiple pathways are involved in inflammation and
each
pathway may be targeted at multiple levels. Inhibition of receptor signalling
may be obtained
by blocking a receptor, by providing a soluble receptor fragment or by
preventing the ligand
from binding or signalling through the receptor as exemplified by targeted
biological
therapeutics for treatment of certain autoimmune diseases and/or cancer. For
example,
patients with cancer may be treated with an antibody against CD20 (anti-CD20);
patients with
rheumatoid arthritis may be treated with anti-CD20, a TNF antagonist (soluble
TNFR or anti-
TNF-a); patients with psoriasis may be treated with anti-CD11a; patients with
multiple
sclerosis may be treated with INF-beta; patients with ulcerative colitis may
be treated with
anti-TNF-a and patients with Crohn's disease may be treated with anti-TNF-a or
anti-a4
integrin. Unfortunately these treatments are not fully effective.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
28
It has previously been described that member of the IL-10 family are useful
targets
for treatment of inflammatory diseases or disorders (WO 2001/46261).
The IL-10 family include IL-10, IL19, IL-20, IL-22, IL-24 and IL-26, which
binds to the
following receptor heterodimers:
IL-10: Binds to IL-10R1 /IL-10R2
IL-19: Binds to IL-20R1 / IL-20R2
IL-20: Binds to IL-20R1 / IL-20R2 and IL-22R / IL-20R2
IL-22: Binds to IL-22R/ IL-10R2
IL-24: Binds to IL-20R1 / IL-20R2 and IL-22R / IL-20R2
IL-26: No known receptor
This receptor overlap suggests that, although some functionalities are
specific for each family
member there is also some shared effects. The exact role of each ligand and
receptor in
inflammatory diseases is not yet established but several have been linked to
diseases.
Examples include IL-20, that may be targeted by antibodies or receptor
fragments, for
treatment of certain inflammatory diseases (WO 2001/45261), IL-22 and IL- 19,
IL-17
(W010025369, W02010102251), that are all members of the IL-10 family of
cytokines.
Interleukin-19 (1L-19), IL-20, and interleukin-24 (1L-24) are members of the
interleukin-10 (1L-10) cytokine family. As seen from the above these three
interleukins bind
and signal through thelL-20R1/1L-20R2 heterodimeric receptor. IL-20 and IL-24
(but not IL-
19) are also ligands for the receptor complex composed of IL-20R2 and IL-22R1
(Parrish-
Novak et al., J Biol Chem 2002; 277: 47517- 47523; Dumoutier et al., J Immunol
2001;
167:3545-3549). It has been proposed that IL-19 and IL-20, along with other IL-
10 family
members, form a distinct subfamily of helical cytokines where at least IL-19
and IL-20 have
similar three-dimensional structures (Chang et al., J Biol Chem 2003; 278:
3308-13).
Antagonizing IL-20 activity using receptor fragments or monoclonal antibodies
has
therefore been described as a promising approach for treatment of various
inflammatory
conditions. Antigenic epitopes of human IL-20 (hIL-20), as well as rat or
murine monoclonal
antibodies binding hulL-20, have also been described (e.g., W02005052000,
US20060142550, and W02007081465). Anti-IL-20 monoclonal antibodies that can
reduce
IL-20-mediated activation of IL-20R1/1L-20R2 and IL-22R1/1L-20R2 receptor
complexes in
one or more species, including humans, have been described in WO 2010/000721.
The anti-inflammatory agent may accordingly be an antagonist of IL-20 capable
of
reducing IL-20 mediated activation of both the IL-20R1 / IL-20R2 and the IL-
22R / IL-20
receptor. The anti-inflammatory agent may be specific by not reducing receptor
activation
through the IL-19 or IL-24 receptor.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
29
Based on an at least shared mode of action targeting of each ligand and
receptor
may provide a similar biological effect. An anti-inflammatory agent according
to the invention
may thus be an antagonist of IL-10 family members and their receptors e.g. a
compound that
regulates signalling of the above mentioned receptors by binding either ligand
or receptor,
whereby the biological activity of the ligand or the receptor is decreased.
Assays for
determining antagonistic activity of IL-10 family members are known in the art
and also
described in WO 2010/000721.
The anti-inflammatory agent according to the invention may be in a
pharmaceutical
composition e.g. a pharmaceutical composition comprising an anti-inflammatory
agent and a
pharmaceutically acceptable carrier and a label. The anti-inflammatory agent
or
pharmaceutical composition may be suitable for oral, i.v. and/or s.c.
administration. The anti-
inflammatory agent or pharmaceutical composition may be for repeated
administration such
as once monthly or once weekly.
The methods herein may also take account of the administration route or
regime, as
the response may be dependent on the treatment regime applied. In one
embodiment, the
response prediction or indication is based on that an anti-IL-20 antibody is
administered,
once weekly. In one embodiment said antibody is administered subcutaneously.
Clinical response
Depending on the indication, diagnosis and clinical response may be determined
by
a variety of methods. Patients that do not, upon administration of given anti-
inflammatory
agent, exhibit any or adequate signs of treatment of the disorder for which
they are being
treated are considered non responsive. Patients that on the contrary do, upon
administration
of given anti-inflammatory agent, respond by exhibiting adequate signs of
treatment of the
disorder for which they are being treated, are considered responsive. Adequate
signs of
treatment vary from disease to disease and from patient to patient and do not
imply that the
patient experiences "full" treatment but solely that amelioration of one or
more clinical
parameters is observed. The responsiveness may be considered a different time
point after
dosage of the anti-inflammatory agent and patients may respond after one or
more dosage,
for a short period or for longer periods, but as long as a positive result is
obtained, that
patient is considered responsive.
The success rate (e.g. the frequency of administering an anti-inflammatory
agent to
a patient that will respond) may be increased based on the present invention,
furthermore the
frequency of reaching not only a high success rate but also a strong response
in the patient
administered by be obtained using the present invention.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
The clinical response may be determined by methods known in the art. Official
disease scores as approved by governmental authorities are preferably to be
used. It is to be
said that such disease scores evolve over time, so also future methods for
obtaining a
clinical score is considered relevant for the present invention.
5 It is contemplated that a persons skilled in the art is able to
identify relevant clinical
parameters for a given disease or disorder and only few key clinical
parameters are therefore
included herein. Auto-immune diseases are diagnosed based on variety of
criteria.
The methods herein are concerned with indications and predictions of a
response of
a patient to an anti-inflammatory agent, depending on the indication and
symptoms, the
10 expected response may be projected at different time points. In
individual embodiment the
indication and prediction relates to a response to be obtained within 12
months, within 10
months, within 8 months, within 6 months, within 5 months, within 4 months,
within 3 months,
or within 2 months.
15 Rheumatoid arthritis (RA)
Rheumatoid arthritis may be diagnosed based on the criteria defined by the
America
college of Rheumatology (ACR) or the like. The responsiveness to a treatment
may be based
on degrease score when applying such criteria. Prevention or retardation of
radiographic
damage is also a goal for RA treatment. The America College of Rheumatology
(ACR) 20 %
20 composite criteria for improvement describes patents as "improved" if
there is 20 %
improvement in the tender and swollen joint counts and 20 % improvement in at
least three
of five additional measures (pain, physical function, patient global health
assessment,
physician global health assessment and acute phase reactant levels).
Similarly, the ACR50
and ACR70 represent even higher degrees of improvement for the patient.
25 The effectiveness of an anti-inflammatory agent as a therapeutic for
RA may thus be
quantified based on the number of patients or the fraction of patients that
obtains ACR20,
ACR50 and/or ACR70.
Alternative to the ACR scores, progression of rheumatoid arthritis can also be
followed using a Disease Activity Score of 28 joints (DA528). It is a combined
index that has
30 been developed in Nijmegen in the 1980's and has been widely used as an
indicator of RA
disease activity and response to treatment also in combination with the DAS
based
European League Against Rheumatism (EULAR) response criteria. The joints
included in
DA528 are (bilaterally): proximal interphalangeal joints (10 joints),
metacarpophalangeal
joints (10), wrists (2), elbows (2), shoulders (2) and knees (2). When looking
at these joints,
both the number of joints with tenderness upon touching (TJC28) and swelling
(5JC28) are
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
31
counted. Measurements of the level of C-reactive protein (CRP) (in mg/I) may
be included
and the patient also makes a subjective assessment (SA) of disease activity
during the
preceding 7 days on a scale between 0 and 100, where 0 is "no activity" and
100 is "highest
activity possible". Based herein DAS28 is calculated.
Using the DAS, several thresholds have been developed for high disease
activity,
low disease activity or even remission. The score can also be used as response
criteria,
when the DAS of a patient is measured at two time points (e.g. before the
start of a treatment
and after treatment), the clinical response in the patients can be assessed.
The present invention is concerned with improving the effectiveness of RA
treatment. Although several compound have been approved and are used for
treatment of
RA treatment outcome is rarely optimal for all patients and involves some
aspects of trial and
arrow as no method for predicting the effectiveness of an RA treatment is been
applied.
Recently, methods for increasing the effectiveness of RA treatment with
antibody
therapy against CD20 (Rituximab) have been described (W02011/028945,
Owczarczyk et al.
2011, Science translational medicine). In W02011/028945 different subgroups of
RA
patients are defined based on expression profiles of the patients and some
correlation with
clinical responses is also included by identifying a subgroup of RA patients
that are unlikely
to respond to anti-CD20 therapy. A high (above threshold) mRNA level of one or
more of
FcRH5 and CXCL13 increases the ARC50 rate of RA patients. A further
subgrouping
depending on RF status allowed further refinement, whereby the ARC50 criteria
is obtained
for about 40 % of the patients, which may reflect a subgroup dependent on the
B-cell
pathway which is the hallmark of the lymphoid subset and the target of
Rituximab.
The present invention demonstrates that an altered expression level of the
genes of
Figure 1 and 2, are indicative for a clinical response that is higher than the
average clinical
response in RA patients.
Systemic Lupus Erythematous (SLE)
As for RA, SLE treatment effect may be based on the basis of the American
College
of Rheumatology (ACR) classification criteria. These criteria were established
mainly for use
in scientific research and in clinical trial and not for diagnostic purposes,
so not all SLE
patients pass the full criteria.
Multiple sclerosis (MS)
Several subtypes of the disease exist and different prognosis and progression
is observed.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
32
The United States National Multiple Sclerosis Society in 1996 standardized
four subtype
definitions: as 1) relapsing remitting, 2) secondary progressive, 3) primary
progressive, and
4) progressive relapsing. Various criteria for diagnosing and evaluation are
used which
severely complicates testing of drugs potentially effective in treatment of
MS. Based on MS
being an auto-immune disease immune-modulators including anti-inflammatory
agents may
be useful for treatment or management of MS.
Psoriatic arthritis (PSA).
Psoriatic arthritis may be diagnosed based on the criteria defined by the
America
college of Rheumatology (ACR) or the like. The responsiveness to a treatment
may be based
on degrease score when applying such criteria. Prevention or retardation of
radiographic
damage is also a goal for PSA treatment. The America college of Rheumatology
(ACR) 20 %
composite criteria for improvement describes patents as "improved" if there is
20 %
improvement in the tender and swollen joint counts and 20 % improvement in at
least three
of five additional measures (pain, physical function, patient global health
assessment,
physician global health assessment and acute phase reactant levels).
Similarly, the ACR50
and ACR70 represent even higher degrees of improvement for the patient.
The effectiveness of an anti-inflammatory agent as a therapeutic for PSA may
thus
be quantified based on the number of patients or the fraction of patients that
obtains ACR20,
ACR50 and/or ACR70.
Alternative to the ACR scores, progression of psoriatic arthritis can also be
followed
using a Disease Activity Score of 28 joints (DA528). It is a combined index
that has been
developed in Nijmegen in the eighties and is has been widely used as an
indicator of PSA
disease activity and response to treatment also in combination with the EULAR
response
criteria. The joints included in DA528 are (bilaterally): proximal
interphalangeal joints (10
joints), metacarpophalangeal joints (10), wrists (2), elbows (2), shoulders
(2) and knees (2).
When looking at these joints, both the number of joints with tenderness upon
touching
(TJC28) and swelling (5JC28) are counted.
Measurements of the level of C-reactive protein (CRP) (in mg/I) may be
included
and the patient also makes a subjective assessment (SA) of disease activity
during the
preceding 7 days on a scale between 0 and 100, where 0 is "no activity" and
100 is "highest
activity possible". Based herein DA528 is calculated.
Using the DAS, several thresholds have been developed for high disease
activity,
low disease activity or even remission. The score can also be used as response
criteria,
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
33
when the DAS of a patient is measured at two time points (e.g. before the
start of a treatment
and after treatment), the clinical response in the patients can be assessed.
Skin psoriasis is a major aspect of PsA, although the extent of activity in
the skin
does not necessarily correlate with joint activity. A number of instruments to
assess skin
psoriasis have been developed. A widely used instrument is the psoriasis area
and severity
index (PAS!). The PASI assesses individual psoriatic lesions for erythema,
thickness/induration, and scale, and then uses a formula to account for the
overall extent of
the body surface area of skin involved, with scores ranging from 0-72.
The Psoriatic Arthritis Response Criteria (PsARC) was specifically developed
for
PSA clinical trials. The PsARC is composed of four measures: 1) patient global
assessment
of disease activity (improvement of 1 on a 5 point Likert scale is required
for a response), 2)
physician global assessment of disease activity (improvement of 1 on a 5 point
Likert scale is
required for a response), 3) joint pain (reduction of 30% or more in total
score, assessing
either 68 or 78 joints, using a 4 point scale is required for a response), and
4) joint swelling
(reduction of 30% or more in total score, assessing either 66 or 76 joints
using a 4 point
scoring scale, is required for a response). In order to be a `PsARC
responder', patients must
achieve improvement in 2 of 4 measures, one of which must be joint pain or
swelling, without
worsening in any measure.
Treatment
One aspect of the invention relates to methods of treatment based on the
information derived from the examples herein. The method for predicting
clinical success of
an anti-inflammatory agent, subsequently provides a method of treatment of
patients
identified with said method. As the method of identifying patients fulfilling
certain predefined
criteria can easily be performed separately from the actually treatment of the
patient the
method applied does not necessarily include a step of determining that the
patient fulfils a
certain predefined criteria, although it is a preferred embodiment of the
invention. When
applying the method of treatment according to the invention it is expected
that the patient will
respond with a high degree of certainty, which would not be the case without
the prior
knowledge of the fact that the patient fulfils certain predefined criteria.
One embodiment according to the invention relates to a method for treating an
inflammatory disease or disorder in a patient where the expression levels of
one or more of
the genes of Figure 1, is altered compared to a reference level, comprising
administering a
therapeutic amount of an anti-inflammatory agent to said patient.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
34
One further embodiment relates to a method for treating an inflammatory
disease or
disorder in a patient
a. considering if the expression levels of one or more of the genes of Figure
1, in
said patient is altered compared to a reference level,
b. comprising administering a therapeutic amount of an anti-inflammatory agent
to
said patient.
Furthermore the invention in one embodiment relates to a method for treating
an
inflammatory disease or disorder in a patient
a. measuring if the expression levels of one or more of the genes of Figure
1, in a
biological sample from said patient is altered compared to a reference level,
b. comprising administering a therapeutic amount of an anti-inflammatory agent
to
said patient.
Even further the invention in one embodiment relates to a method for treating
an
inflammatory disease or disorder in a patient comprising;
a. measuring the levels of expression of one or more gene(s) of Figure 1 in a
biological sample from said patient
b. comparing said levels with a reference level of said genes,
c. determine if the expression levels of one or more of the genes of
Figure 1, is
altered compared to said reference level
d. administering a therapeutic amount of an anti-inflammatory agent to said
patient.
In alternative to the above methods, the reference level may be a
predetermined level.
In further embodiments each of the methods may include that the level of
expression one or more of the genes of Figure 1, is altered in said biological
sample
compared to said reference level.
Reference is made to the description herein above, including further detailed
information of the method of prediction which is relevant to the method of
treatment of the
present invention.
An aspect of the invention relates to an anti-inflammatory agent for treatment
of an
inflammatory disease or disorder in a subject, wherein said subject display an
altered
expression of one or more of the genes of Figure 1, compared to a reference
level of said
genes.
As for the method of treatment reference is made to the description herein
above,
including further detailed information of the methods of prediction or
identification which is
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
obviously equally relevant to define the characteristics of the anti-
inflammatory agent and the
medical use hereof.
Article of manufacture
5 The present invention in a further aspect relates to an article of
manufacture
comprising, packaged together, a pharmaceutical composition comprising an anti-
inflammatory agent and a pharmaceutically acceptable carrier and a label
stating that the
pharmaceutical composition is for treating a patient suffering from an auto-
immune disease
or disorder with an altered expression of one or more of the genes of Figure
1.
Reference is made to the description herein above, including further detailed
information of the method of prediction which is relevant to the article of
manufacture of the
present invention.
Detecting agents and kits
The present invention further relates to a composition comprising at least one
detecting agent for determining the expression level of one or more gene(s)
from figure 1, in
particular one or more genes of figure 2 and specifically CFD. The detection
agent(s) may be
an antibody, a probe or a primer specific for each gene including mRNA and
protein encoded
thereby.
A further aspect of the invention relates to a kit comprising a detecting
agent or a
composition comprising said detecting agent, as described above, and
instructions for use. A
kit, may further comprise a reference gene composition, in case an internal
control is useful.
The kit may also include a detecting agent for expression normalization such a
detecting
agent for detecting a globulin gene. It is further part of the invention to
include a description
on how to correlate expression level(s) with response probability to an anti-
inflammatory
agent as described herein. In particular a kit, for determine the expression
level of
complement factor D (CFD) and evaluation hereof is contemplated.
Therapeutic targets
Anti-inflammatory agents are modulators of pathways essential for the
phenotype of
the inflammatory disease or disorder. As is apparent from the data herein the
selected genes
may individually be considered new therapeutic targets for treatment of
inflammatory
diseases or disorders, in so far, as they have not previously been described
in relation to
autoimmune diseases and in particular RA.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
36
Embodiments
The invention as described herein is summarized, but not limited, in the
following
embodiments.
1. A method for predicting the response of a subject to an anti-inflammatory
agent
comprising; obtaining information on the level of expression of one or more
gene(s) of
Figure 1 in a biological sample from said subject, wherein altered expression
level of one
or more of said gene(s) compared to a reference level of said gene(s), is
predictive of a
response of the subject to the anti-inflammatory agent.
2. A method for predicting the response of a patient to an anti-inflammatory
agent
comprising
a. measuring the level of expression of one or more gene(s) of Figure 1 in a
biological sample from said patient and
b. comparing said level with a reference level of said gene(s)
wherein altered expression of one or more of said gene(s) compared to said
reference
level, is predictive of a response of the patient to the anti-inflammatory
agent.
3. A method for identification of a subject with an increased probability of
responding to anti-
inflammatory agent comprising; obtaining information on the level of
expression of one or
more gene(s) of Figure 1 in a biological sample from said subject, wherein
altered
expression level of one or more of said gene(s) compared to a reference level
of said
gene(s) indicates that a subject with an increased probability of responding
to an anti-
inflammatory agent has been identified.
4. A method for identification of a patient with an increased probability of
responding to anti-
inflammatory agent comprising;
a. measuring the level of expression of one or more gene(s) of Figure 1 in a
biological sample from said patient
b. comparing said level of expression with a reference level of said gene(s),
wherein altered expression of one or more of said gene(s) compared to the
reference
level of said gene(s), indicates that a patient with an increased probability
of responding
to an anti-inflammatory agent has been identified.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
37
5. A method according to any of the previous embodiments, wherein the
expression of
complement factor D (CFD) is measured in a biological sample.
6. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and serpin peptidase inhibitor, clade B, member 9 (SERPINB9) is
measured in a biological sample.
7. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and/or serpin peptidase inhibitor, clade B, member 9 (SERPINB9)
and/or
zinc finger, CCHC domain containing 24 (ZCCHC24) is measured in a biological
sample.
8. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and/or fructosamine 3 kinase related protein (FN3KRP) and/or
mesenchyme homeobox 1 (MEOX1) is measured in a biological sample.
9. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and/or serpin peptidase inhibitor, clade B, member 9 (SERPINB9)
and/or
zinc finger, CCHC domain containing 24 (ZCCHC24) and/or fructosamine 3 kinase
related protein (FN3KRP) is measured in a biological sample.
10. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and/or serpin peptidase inhibitor, clade B, member 9 (SERPINB9)
and/or
zinc finger, CCHC domain containing 24 (ZCCHC24) and/or fructosamine 3 kinase
related protein (FN3KRP) and/or mesenchyme homeobox 1 (MEOX1) is measured in a
biological sample.
11. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and/or fibroblast growth factor 13 (FGF13) and/or tubulin, beta
2A
(TUBB2A) and/or solute carrier family 39 (metal ion transporter, member 11)
(SLC39A11)
and/or transmembrane channel-like 4 (TMC4) is measured in a biological sample.
12. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and/or nuclear pore complex interacting protein-like 2 (NPIPL2)
and/or
zinc finger protein 880 (ZNF880) and/or aldehyde dehydrogenase 5 family,
member Al
(ALDH5A1) is measured in a biological sample.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
38
13. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and/or fibroblast growth factor 13 (FGF13) and/or tubulin, beta
2A
(TUBB2A) and/or solute carrier family 39 (metal ion transporter, member 11)
(SLC39A11)
and/or transmembrane channel-like 4 (TMC4) and/or nuclear pore complex
interacting
protein-like 2 (NPIPL2) and/or zinc finger protein 880 (ZNF880) and/or
aldehyde
dehydrogenase 5 family, member Al (ALDH5A1) is measured in a biological
sample.
14. A method according to any of embodiments 1-4, wherein the expression of
complement
factor D (CFD) and/or serpin peptidase inhibitor, clade B, member 9 (SERPINB9)
and/or
zinc finger, CCHC domain containing 24 (ZCCHC24) and/or fructosamine 3 kinase
related protein (FN3KRP) and/or mesenchyme homeobox 1 (MEOX1) and/or
fibroblast
growth factor 13 (FGF13) and/or tubulin, beta 2A (TUBB2A) and/or solute
carrier family
39 (metal ion transporter, member 11) (SLC39A11) and/or transmembrane channel-
like 4
(TMC4) and/or nuclear pore complex interacting protein-like 2 (NPIPL2) and/or
zinc finger
protein 880 (ZNF880) and/or aldehyde dehydrogenase 5 family, member Al
(ALDH5A1)
is measured in a biological sample.
15. The method according to any of the previous embodiments, wherein the
altered
expression of a gene of Figure 1A is an increase compared to the reference
level.
16. The method according to any of the previous embodiments, wherein the
altered
expression of a gene of Figure 1B is a decreased compared to the reference
level.
17. The method according to any of the previous embodiments, wherein the
expression level
of at least two genes are compared with the individual reference levels of the
at least two
genes.
18. The method according to any of the previous embodiments, wherein the
expression level
of at least two genes are compared with the individual reference levels of the
at least two
genes and wherein altered expression of a gene of Figure 1A is increased
compared to
the reference level and wherein altered expression of a gene of Figure 1B is
decreased
compared to the reference level.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
39
19. The methods according to any of the previous embodiments, wherein the
reference level
is a predetermined level.
20. The methods according to any of the previous embodiments, wherein the
predetermined
level is a threshold indicative for a response measured using DAS28-CRP,
ACR20,
ACR50 and/or ACR70.
21. The method according to any of the previous embodiments, wherein the
biological
sample is a blood sample or serum sample.
22. The method according to any of the previous embodiments, wherein the
biological
sample is a Paxgene full blood sample.
23. The method according to any of the previous embodiments, wherein the
biological
sample is the PBMC fraction from a blood sample.
24. The method according to any of the previous embodiments, wherein the
biological
sample is a subset of cells from a blood sample.
25. The method according to any of the previous embodiments, wherein the
biological
sample is a subset of cells from a blood sample, wherein in the subset maybe
one or
more of CD14+, CD4+ and CD8+ positive cells.
26. The method according to any of the above embodiments, wherein the level of
expression
is measured based on mRNA.
27. The method according to any of the above embodiments, wherein the level of
expression
is measured using PCR.
28. The method according to any of the above embodiments, wherein the PCR is
selected
from the group consisting of multi-plex PCR and qRT-PCR.
29. The method according to any of the above embodiments, wherein the level of
expression
is measured using microarray chip.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
30. The method according to any of the above embodiments, wherein the level of
expression
of complement factor D (CFD) is measured by qRT-PCR and wherein the transcript
is
detected with a Cycle Threshold Value (Ct) of 30 using Assay ID: Hs00157263_m1
(Applied Biosystems).
5
31. The method according to any of the above embodiments, wherein the level of
expression
of complement factor D (CFD) is measured by qRT-PCR and wherein the transcript
is
detected at absolute numbers of at least 0.03 copies of CFD pr. copy of beta-
actin mRNA
(gene symbol ACTB) using Assay ID: Hs00157263_m1 for CFD (Applied Biosystems/
10 Invitrogen).and Hs99999903_m1 for ACTB (Applied Biosystems/
lnvitrogen).
32. The method according to any of the above embodiments, wherein the level of
expression
of complement factor D (CFD) is measured by qRT-PCR and wherein the transcript
is
detected at absolute numbers of at least 0.04 copies of CFD pr. copy of beta-
actin mRNA
15 (gene symbol ACTB) using Assay ID: Hs00157263_m1 for CFD (Applied
Biosystems/
Invitrogen).and Hs99999903_m1 for ACTB (Applied Biosystems/ lnvitrogen).
33. The method according to any of the above embodiments, wherein the level of
expression
of complement factor D (CFD) is measured by qRT-PCR and wherein the transcript
is
20 detected at absolute numbers of at least 0.05 copies of CFD pr. copy of
beta-actin mRNA
(gene symbol ACTB) using Assay ID: Hs00157263_m1 for CFD (Applied Biosystems/
Invitrogen).and Hs99999903_m1 for ACTB (Applied Biosystems/ lnvitrogen).
34. The method according to any of the above embodiments, wherein the level of
expression
25 of complement factor D (CFD) is measured by qRT-PCR and wherein the
transcript is
detected at absolute numbers of at least 0.06 copies of CFD pr. copy of beta-
actin mRNA
(gene symbol ACTB) using Assay ID: Hs00157263_m1 for CFD (Applied Biosystems/
Invitrogen).and Hs99999903_m1 for ACTB (Applied Biosystems/ lnvitrogen).
30 35. The method according to any of the above embodiments, wherein the
level of expression
of complement factor D (CFD) is above 9.5 on a log2 scale of RMA or GC-RMA
normalized expression values when measured using micro array chip.
36. The method according to any of the above embodiments, wherein the level of
expression
35 is measured indirectly based on one or more SNPs.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
41
37. The method according to any of the above embodiments, wherein the level of
expression
of complement factor D (CFD) is measured indirectly based on one or more CFD
expression correlated SNPs.
38. The method according to any of the above embodiments, wherein the level of
expression
of complement factor D (CFD) is measured indirectly based on one or more SNPs
in the
CFD haploblock.
39. The method according to any of the above embodiments, wherein the level of
expression
of complement factor D (CFD) is measured indirectly based on one or more SNP's
selected from the group of; rs1683565, rs1683591, rs1683590, rs1683569,
rs1683574,
rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and
rs2930898.
40. The methods according to any of the above embodiments, wherein the level
of
expression of CFD is measured indirectly by the presence of the AG or the GG
genotype
of SNP rs1683591.
41. The method according to any of the above embodiments 1-25, wherein the
level of
expression is measured on protein level.
42. The method according to embodiment 41, wherein the level of expression is
measured
using antibody.
43. The method according to embodiment 41, wherein the level of expression is
measured
using a proteome analysis.
44. The method according to any of the above embodiments, wherein the subject
or patient
is a patient suffering from an inflammatory disease or disorder.
45. The method according to any of the above embodiments, wherein the patient
is suffering
from an auto-immune disease or disorder.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
42
46. The method according to embodiment 44 or 45, wherein the patient is
suffering from
Rheumatoid arthritis (RA), Systemic lupus erythematosus (SLE), Multiple
sclerosis (MS),
Inflammatory Bowel Disease (IBD), Psoriatic Arthritis (PSA) or Psoriatic
arthritis.
47. The method according to 46, wherein the patient is suffering from RA.
48. The method according to embodiments 44-47, wherein the patient is being
treated or has
been treated with MTX.
49. The method according to embodiments 44-48, wherein the patient is an
inadequate
responder to MTX treatment.
50. The method according to any of the above embodiments 44-49, wherein the
patient is
being treated with a TNF-alfa inhibitor.
51. The method according to embodiments 44-50, wherein the patient is naive to
TNF-alfa
inhibitor treatment.
52. The method according to embodiments 44-51, wherein the patient is an
inadequate
responder to TNF-alfa inhibitor treatment.
53. The method according to embodiments 44-52, wherein the patient is an
inadequate
responder to one or more therapies applicable for said inflammatory disease or
disorder.
54. The method according to embodiments 44-53, wherein the patient is an
inadequate
responder to MTX and TNF-alfa inhibitor treatment.
55. The method according to embodiments 44-54, wherein the patient is RF
positive.
56. The method according to embodiments 44-55, wherein the patient is RF
negative.
57. The method according to any of the above embodiments, wherein the anti-
inflammatory
agent is an antibody.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
43
58. The method according to any of the above embodiments, wherein the anti-
inflammatory
agent is a receptor antagonist.
59. The method according to any of the above embodiments wherein the anti-
inflammatory
agent is an antagonist of one or more members of the IL-10 family.
60. The method according to any of the above embodiments wherein the anti-
inflammatory
agent is an antagonist of one or more of IL-10, IL19, IL-20, IL-22, IL-24 and
IL-26.
61. The method according to any of the above embodiments wherein the anti-
inflammatory
agent is an antagonist of one or more of IL-19, IL-20 and IL-24.
62. The method according to any of the above embodiments wherein the anti-
inflammatory
agent is an antagonist of IL-20.
63. The method according to any of the above embodiments wherein the anti-
inflammatory
agent is an antagonist of IL-20, reducing IL-20 medicated activation of both
the IL-20R1 /
IL-20R2 and IL-22R / IL-20R2 receptors.
64. The method according to any of the above embodiments wherein the anti-
inflammatory
agent is an antagonist of IL-20, reducing IL-20 medicated activation of both
the IL-20R1 /
IL-20R2 and IL-22R / IL-20R2 receptors, but not the IL19 or IL24 medicate
receptor
activation.
65. The method according to any of the above embodiments wherein the anti-
inflammatory
agent is and anti-human IL-20 antibody.
66. A method for treating an inflammatory disease or disorder in a subject
where the
expression level of one or more of the genes of Figure 1 is altered compared
to a
reference level, comprising administering a therapeutic amount of an anti-
inflammatory
agent to said subject.
67. A method for treating an inflammatory disease or disorder in a patient
comprising;
a. considering if the expression levels of one or more of the genes of Figure
1, in
said patient is altered compared to a reference level,
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
44
b. administering a therapeutic amount of an anti-inflammatory agent to said
patient.
68. A method for treating an inflammatory disease or disorder in a patient
comprising
a. measuring if the expression levels of one or more of the genes of Figure
1, in a
biological sample from said patient is altered compared to a reference level,
b. administering a therapeutic amount of an anti-inflammatory agent to said
patient.
69. A method for treating an inflammatory disease or disorder in a patient
comprising;
a. measuring the levels of expression of one or more gene(s) of Figure 1 in a
biological sample from said patient.
b. comparing said levels with a reference level of said genes,
c. determine if the expression levels of one or more of the genes of Figure
1, is
altered compared to said reference level and
d. administering a therapeutic amount of an anti-inflammatory agent to said
patient.
70. The method according to any of the previous embodiments 68-69, wherein the
level of
expression one or more of the genes of Figure 1, is altered in said biological
sample
compared to said reference level.
71. The method according to any of the previous embodiments 68-70, wherein the
method is
characterized by any one or more of the features of previous embodiments 15-
65.
72. An article of manufacture comprising, packaged together, a pharmaceutical
composition
comprising an anti-inflammatory agent and a pharmaceutically acceptable
carrier and a
label stating that the pharmaceutical composition is for treating a patient
suffering from an
auto-immune disease or disorder with an altered expression of one or more of
the genes
of Figure 1.
73. The article of manufacture according to embodiment 72, wherein the article
is
characterized by any one or more of the features of previous embodiments 5-46.
74. An anti-inflammatory agent for treatment of an inflammatory disease or
disorder in a
subject, wherein said subject display an altered expression level of one or
more of the
genes of Figure 1, compared to a reference level of said genes.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
75. The anti-inflammatory agent according to embodiment 74, characterized by
any one or
more of the features of previous embodiments 15-65.
76. A composition comprising at least on detecting agent for determining the
expression level
5 of one or more gene(s) from Table 1.
77. The composition of embodiment 76, wherein the detecting agent is for
determining
expression of complement factor D (CFD).
10 78. The composition of embodiment 76, wherein the detecting agent is a
CFD probe.
79. The composition of embodiment 76, wherein the detecting agent is a CFD
primer.
80. The composition of embodiment 76, wherein the detecting agent is a primer
for detecting
15 a CFD expression correlated SNP's.
81. The composition of embodiment 76, wherein the detecting agent is one or
more primer
for detecting a CFD expression correlated SNP's, selected from rs1683565,
rs1683591,
rs1683590, rs1683569, rs1683574, rs1651888, rs2930894, rs2930891, rs4417648,
20 rs1651891, rs1651890, and rs2930898
82. A kit comprising a composition according to any of embodiments 76-81 and
instruction for
use.
25 83. The kit of embodiment 82, further comprising a reference sample.
84. The kit of embodiment 82-83, further comprising a detecting agent for
normalization.
85. The kit of embodiment 82-84, wherein the instructions for use include a
description on
30 how to correlate expression level(s) with response probability.
86. The kit of embodiment 82-85, wherein the kit is for determining the
probability that a
patient will respond to an anti-inflammatory agent.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
46
87. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, at least one
test has
shown that the expression levels of one or more of the genes of Figure 1, in a
biological
sample from said patient is altered compared to a reference level.
88. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, at least one
test has
shown that the expression levels of one or more of the genes of Figure 1, in a
biological
sample from said patient is altered compared to a reference level and wherein
altered
expression level of one or more of said gene(s) compared to a reference level
of said
gene(s), is predictive of a response of the subject to the anti-inflammatory
agent.
89. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, it has been
determined
that the expression levels of one or more of the genes of Figure 1, in a
biological sample
from said patient is altered compared to a reference level.
90. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, it has been
determined
that the expression levels of one or more of the genes of Figure 1, in a
biological sample
from said patient is altered compared to a reference level and wherein altered
expression
level of one or more of said gene(s) compared to a reference level of said
gene(s), is
predictive of a response of the subject to the anti-inflammatory agent.
91. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, at least one
test,
according to any of embodiments 1-43, has shown that the expression levels of
one or
more of the genes of Figure 1, in a biological sample from said patient is
altered
compared to a reference level.
92.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
47
93. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, at least one
test,
according to any of embodiments 1-43, has shown that the expression levels of
one or
more of the genes of Figure 1, in a biological sample from said patient is
altered
compared to a reference level and wherein altered expression level of one or
more of
said gene(s) compared to a reference level of said gene(s), is predictive of a
response of
the subject to the anti-inflammatory agent.
94. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, it has been
determined,
according to any of embodiments 1-43, that the expression levels of one or
more of the
genes of Figure 1, in a biological sample from said patient is altered
compared to a
reference level.
95. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, it has been
determined,
according to any of embodiments 1-43, that the expression levels of one or
more of the
genes of Figure 1, in a biological sample from said patient is altered
compared to a
reference level and wherein altered expression level of one or more of said
gene(s)
compared to a reference level of said gene(s), is predictive of a response of
the subject
to the anti-inflammatory agent.
96. The method according to embodiments 87-94, wherein the subject or patient
is a patient
suffering from an inflammatory disease or disorder.
97. The method according to embodiments 87-94, wherein the patient is
suffering from an
auto-immune disease or disorder.
98. The method according to embodiment 87-96, wherein the patient is suffering
from
Rheumatoid arthritis (RA), Systemic lupus erythematosus (SLE), Multiple
sclerosis (MS),
Inflammatory Bowel Disease (IBD), Psoriatic Arthritis (PSA) or Psoriatic
arthritis.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
48
99. The method according to 97, wherein the patient is suffering from RA.
100. The method according to embodiments 87-98, wherein the patient is
being treated
or has been treated with MTX.
101. The method according to embodiments 87-99, wherein the patient is an
inadequate
responder to MTX treatment.
102. The method according to any of the above embodiments 87-100, wherein
the
patient is being treated with a TNF-alfa inhibitor.
103. The method according to embodiments 87-101, wherein the patient is
naive to TNF-
alfa inhibitor treatment.
104. The method according to embodiments 87-103, wherein the patient is an
inadequate
responder to TNF-alfa inhibitor treatment.
105. The method according to embodiments 87-103, wherein the patient is an
inadequate
responder to one or more therapies applicable for said inflammatory disease or
disorder.
106. The method according to embodiments 87-104, wherein the patient is an
inadequate
responder to MTX and TNF-alfa inhibitor treatment.
107. The method according to embodiments 87-105, wherein the patient is RF
positive.
108. The method according to embodiments 87-106, wherein the patient is RF
negative.
109. The method according to embodiments 87-107, wherein the anti-
inflammatory agent
is an antibody.
110. The method according to embodiments 87-108, wherein the anti-
inflammatory agent
is a receptor antagonist.
111. The method according to embodiments 87-109, wherein the anti-
inflammatory agent
is an antagonist of one or more members of the IL-10 family.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
49
112. The method according to embodiments 87-110, wherein the anti-
inflammatory agent
is an antagonist of one or more of IL-10, IL19, IL-20, IL-22, IL-24 and IL-26.
113. The method according to embodiments 87-111, wherein the anti-
inflammatory agent
is an antagonist of one or more of IL-19, IL-20 and IL-24.
114. The method according to embodiments 87-112, wherein the anti-
inflammatory agent
is an antagonist of IL-20.
115. The method according to embodiments 87-113, wherein the anti-
inflammatory agent
is an antagonist of IL-20, reducing IL-20 medicated activation of both the IL-
20R1 / IL-
20R2 and IL-22R / IL-20R2 receptors.
116. The method according to embodiments 87-114, wherein the anti-
inflammatory agent
is an antagonist of IL-20, reducing IL-20 medicated activation of both the IL-
20R1 / IL-
20R2 and IL-22R / IL-20R2 receptors, but not the IL19 or IL24 medicate
receptor
activation.
117. The method according to embodiments 87-115, wherein the anti-
inflammatory agent
is an anti-human IL-20 antibody.
118. A method of treating an inflammatory disease comprising administering
a
pharmaceutically effective amount of an anti-inflammatory agent to a patient
with an
inflammatory disease that has an expression profile in which expression of a
first
biomarker is increased relative to expression of the first biomarker in a
person that does
not respond to the anti-inflammatory agent, wherein the first biomarker is
complement
factor D (CFD).
119. The method of embodiment 118, wherein expression of CFD of in the
patient with
the inflammatory disease is at least one standard deviation higher than
expression of
CFD in the person that does not respond to the anti-inflammatory agent.
120. The method of embodiment 118, wherein the inflammatory disease is an
autoimmune disease or disorder.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
121. The method of embodiment 120, wherein the autoimmune disease or
disorder is
selected from the group consisting of rheumatoid arthritis (RA), systemic
lupus
erythematosus (SLE), multiple sclerosis (MS), inflammatory bowel disease
(IBD), and
5 psoriatic arthritis (PSA).
122. The method according to embodiment 121, wherein the autoimmune disease
is RA.
123. The method of embodiment 118, wherein the patient with an inflammatory
disease
10 has an expression profile in which expression of a second biomarker is
increased relative
to expression of the second biomarker in a person that does not respond to the
anti-
inflammatory agent, wherein the second biomarker is SERPINB9 (serpin peptidase
inhibitor and clade B (ovalbumin), member 9).
15 124. The method of embodiment 118, wherein the patient with an
inflammatory disease
has an expression profile in which expression of a second biomarker is
increased relative
to expression of the second biomarker in a person that does not respond to the
anti-
inflammatory agent, wherein the second biomarker is selected from one or more
of the
group consisting of SERPINB9 (serpin peptidase inhibitor, clade B (ovalbumin)
member
20 9) and ZCCHC24 (zinc finger, CCHC domain containing 24).
125. The method of embodiment 118, wherein the patient with an inflammatory
disease
has an expression profile in which expression of a second biomarker is
increased relative
to expression of the second biomarker in a person that does not respond to the
anti-
25 inflammatory agent, wherein the second biomarker is selected from one or
more of the
group consisting of SERPINB9 (serpin peptidase inhibitor, clade B (ovalbumin)
member
9), ZCCHC24 (zinc finger, CCHC domain containing 24), FN3KRP (fructosamine 3
kinase related protein), FN3KRP (fructosamine 3 kinase related protein), MEOX1
(mesenchyme homeobox 1), FGF13 (fibroblast growth factor 13), TUBB2A (tubulin,
beta
30 2A), SLC39A11 (solute carrier family 39 (metal ion transporter), member
11), TMC4
(transmembrane channel-like 4), NPIPL2 (nuclear pore complex interacting
protein-like
2), ZNF880 (zinc finger protein 880), and ALDH5A1 (aldehyde dehydrogenase 5
family,
member Al).
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
51
126. The method according to embodiments 118-125, wherein the anti-
inflammatory
agent is an antagonist of one or more of IL-10, IL-19, IL-20, IL-22, IL-24 and
IL-26.
127. The method according to embodiments 118-126, wherein the anti-
inflammatory
agent is an antagonist of one or more of IL-19, IL-20 and IL-24.
128. The method according to a embodiments 118-127, wherein the anti-
inflammatory
agent is an antagonist of IL-20.
129. A method of treating an autoimmune disease comprising:
identifying a patient with an autoimmune disease;
determining that the patient expresses a first biomarker, wherein the first
biomarker is complement factor D (CFD);
selecting an anti-inflammatory agent as a treatment for the patient based on a
recognition that the anti-inflammatory agent is effective in patients with the
autoimmune disease in which an expression profile of the first biomarker is
increased relative to expression of the first biomarker in a subject that does
not
respond to the anti-inflammatory agent; and
administering the anti-inflammatory agent to the patient.
130. The method of embodiment 129, wherein the autoimmune disease or
disorder is
selected from the group consisting of rheumatoid arthritis (RA), systemic
lupus
erythematosus (SLE), multiple sclerosis (MS), inflammatory bowel disease
(IBD), and
psoriatic arthritis (PSA).
131. The method according to embodiment 130, wherein the autoimmune disease
is RA.
132. The method of embodiment 129, wherein the selecting an anti-
inflammatory agent
as a treatment for the patient further comprises a recognition that the anti-
inflammatory
agent is effective in patients with the autoimmune disease in which an
expression profile
of a second biomarker is increased relative to expression of the second
biomarker in a
subject that does not respond to the anti-inflammatory agent; and wherein the
second
biomarker is selected from one or more of the group consisting of SERPINB9
(serpin
peptidase inhibitor, clade B (ovalbumin) member 9), ZCCHC24 (zinc finger, CCHC
domain containing 24), FN3KRP (fructosamine 3 kinase related protein), FN3KRP
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
52
(fructosamine 3 kinase related protein), MEOX1 (mesenchyme homeobox 1), FGF13
(fibroblast growth factor 13), TUBB2A (tubulin, beta 2A), SLC39A11 (solute
carrier family
39 (metal ion transporter), member 11), TMC4 (transmembrane channel-like 4),
NPIPL2
(nuclear pore complex interacting protein-like 2), ZNF880 (zinc finger protein
880), and
ALDH5A1 (aldehyde dehydrogenase 5 family, member Al).
133. The method according to any of embodiments 129-132, wherein the anti-
inflammatory agent is an antagonist of one or more of IL-10, IL-19, IL-20, IL-
22, IL-24 and
IL-26.
134. The method according to any of embodiments 129-133, wherein the anti-
inflammatory agent is an antagonist of one or more of IL-19, IL-20 and IL-24.
135. The method according to any of embodiments 129-134, wherein the anti-
inflammatory agent is an antagonist of IL-20.
136. The method of embodiment 129, wherein the determining that the patient
expresses
a first biomarker comprises measurement of mRNA.
137. The method of embodiment 136, wherein the measurement of mRNA involves
multi-
plex PCR and gRT-PCR.
138. The method of embodiment 129, wherein the level of expression of
complement
factor D (CFD) is measured indirectly based on one or more CFD expression
correlated
SNPs.
139. The method of embodiment 129, wherein the level of expression of
complement
factor D (CFD) is measured indirectly based on one or more SNPs in the CFD
haploblock.
140. The method of embodiments 138-139, wherein the level of expression of
complement factor D (CFD) is measured indirectly based on one or more SNP's
selected
from the group of; rs1683565, rs1683591, rs1683590, rs1683569, rs1683574,
rs1651888,
rs2930894, rs2930891, rs4417648, rs1651891, rs1651890 and rs2930898.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
53
141. The methods of embodiment 140, wherein the level of expression of CFD
is
measured indirectly by the presence of the AG or the GG genotype of SNP
rs1683591.
142. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, at least one
test has
shown that the expression levels of one or more of the genes of Figure 1, in a
biological
sample from said patient is altered compared to a reference level.
143. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, at least one
test has
shown that the expression levels of one or more of the genes of Figure 1, in a
biological
sample from said patient is altered compared to a reference level and wherein
altered
expression level of one or more of said gene(s) compared to a reference level
of said
gene(s), is predictive of a response of the subject to the anti-inflammatory
agent.
144. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, it has been
determined
that the expression levels of one or more of the genes of Figure 1, in a
biological sample
from said patient is altered compared to a reference level.
145. A method for treating an inflammatory disease or disorder in a patient
comprising
administering a therapeutic amount of an anti-inflammatory agent to said
patient,
wherein, prior to administration of said anti-inflammatory agent, it has been
determined
that the expression levels of one or more of the genes of Figure 1, in a
biological sample
from said patient is altered compared to a reference level and wherein altered
expression
level of one or more of said gene(s) compared to a reference level of said
gene(s), is
predictive of a response of the subject to the anti-inflammatory agent.
General Methods
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
54
Total RNA purification
Total RNA may be obtained from any type of biological sample by various
methods
known by the person skilled in the art.
The Examples herein are based on data obtained using the PaxGene blood RNA
KIT IVD (QIAGEN), which are particularly suited for samples that are collected
overtime and
to be analysed subsequently. The PaxGene blood samples were handled following
the
instructions of the manufacturer (Qiagen) and total RNA was isolated following
the protocol
for the PaxGene PAXgene Blood RNA Kit (QIAGEN).
Globin mRNA reduction
A reduction of Globin mRNA in a total RNA sample can be obtained using the
GLOBINClear kit (Applied Biosystems, Foster City, CA, USA) following the
instructions of the
manufacturer.
RNA integrity confirmation
It is advisable to confirm the integrity of RNA samples before further
analyses are
performed.
The Agilent 2100 Bioanalyzer and total RNA Nano chips (Agilent Technologies,
Santa Clara, CA, USA) can be used following the manufacturer's instructions.
Generally a
sample giving an RNA integrity number (RIN-score) above 7 is considered
acceptable for
further analysis.
AffyMetrix GeneChip hybridization, scanning and analysis
Using a total RNA sample, labelled cRNA (targets) is/are prepared from fifty
nanograms of total RNA by 3' IVT Express Kit (Affymetrix, Santa Clara, Ca,
USA) following
the instructions of the manufacturer. Hybridization cocktails are prepared as
described by the
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
manufacturer and hybridised onto Human Genome U133 Plus 2.0 GeneChips
(Affymetrix)
at 45 C for 17h (60 RPM) in a Hybridization Oven 640 (Affymetrix). After
hybridization, the
GeneChips are washed and stained in a GeneChip fluidics station 450 using the
fluidics
protocol "EukGE-WS2v5_450" (Affymetrix). The GeneChips are scanned in a
GeneChip
5 scanner 3000 (Affymetrix). The out-put, the "*.cel files" are used for
RMA (Robust Multiarray
Average) normalization of GeneChip data by using the R environment and the
Bioconductor
package "Affy" which can be found at the URL: cran.r-project.org &
bioconductor.org.
Statistical analysis of the microarray data is performed with the open-source
tools
10 available in the statistical programming environment, R (available at
the URL: cran.r-
project.org) as well as with QluCore Omics explorer 2.2 (Q1uCore AB, Sweden).
Microarrays
are normalized by RMA (Robust Multiarray Average) using the Affy package
(available at the
URL: cran.r-project.org) and the custom Chip Definition File
(HGU133Plu52_Hs_ENSG)
available at the URL: brainarray.mbni.med.umich.edu)
Multivariate predictions are carried out using the Simca-P +11 software
(Umetrics,
Umea, Sweden), and the Partial Least Squares (PLS) tool.
ROC (receiver operating characteristic) curves are prepared using Graph Pad
Prism
5 (GraphPad Software, CA, USA).
Quantitative RT-PCR
Quantative RT-PCR analysis is performed by preparing 25 microliters of cDNA
from
200 ng total RNA using random primers and TaqMan Reverse Transcription
reagents
(Applied Biosystems, Foster City, CA, USA) according to the manufacturer's
instructions.
The qPCR analysis is perfomed in a total volume of 25 microliters in
duplicates on
each sample (6,95 microliters of a 10-fold dilution of cDNA), using TaqMan PCR
core
reagents (Applied Biosystems) and the ABI PRISM 7900HT Sequence Detection
System
(Applied Biosystems).
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
56
Expression levels of CFD mRNA, ACTB mRNA, and 18S rRNA is determined using
primers and FAM-labelled-probes for CFD mRNA and 18S rRNA. The primers and
probes
were ordered as Assays-on-Demand (Applied Biosystems). Probe sequences for
these
assays were as follows: CFD (CCTGCTGCTACAGCTGTCGGAGAAG (Assay ID:
Hs00157263_m1)), ACTB (CCTTTGCCGATCCGCCGCCCGTCCA (Assay ID: Hs
Hs99999903_m1), and 18S rRNA (TGGAGGGCAAGTCTGGTGCCAGCAG; assay
Hs99999901_s1). Data were analysed using ABI Prism SDS 2.2 software (Applied
Biosystems), and expression levels were normalized to 18S rRNA or ACTB mRNA.
A reliable assay the PCR product should be detectable within cycle (Ct-value)
26 in
the CFD assay (ID: Hs00157263_m1), and detection of 18S rRNA (assay
ID Hs99999901_s1) should be obtained at Ct=12,5. Normalization could also be
done by
calculating a delta-Ct value, or by using standard curves of diluted plasmid
encoding CFD,
ACTB, and 18S, and relating quantitated number of CFD copies to number of
quantitated
number of ACTB or 18S copies.
In the above, the official Gene Symbol identifiers are used for the analysed
transcripts.
Examples
Example 1 - Identification of predictive transcripts
Blood samples from a phase-1b and phase-2a trial examining the safety,
tolerability,
and efficacy of anti-IL-20 in patients with rheumatoid arthritis (RA)
(clinicaltrials.org
identifiers: NCT01038674 and NCT01282255) were collected from patients at
following time
points: pre-dose (day 1) and after dosage at day 8, 15, 29, 43, and day 99 in
the phase-1b
trial and at predose (day 1) and after dosage at day 15, 36 in the phase-2a
trial. Patients
were dose once weekly during a 6 week period (in total 7 doses) and during an
11 week
period (in total 12 doses) , respectively.
Total RNA was obtained as described above. After Globin mRNA reduction and
confirmation of RNA integrity the RNA samples were analysed by AfifyMetrix
GeneChip
hybridizations following the above described procedure.
To identify transcripts in full blood PaxGene samples that correlate to
changes in
DAS28-CRP and other disease score measures like ACR20, ACR50, and ACR 70, we
performed regression analyses of expression profiles from individual patients
enrolled in the
Phase-1b and Phase-2a trials examining the effect of anti-IL20 antibody in RA
patients.
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
57
Based on samples primarily obtained at pre-dose (base-line) and at day 8, 15,
29, 36, and
43, transcripts exhibiting relative stability over time, and thus suitable as
pre-dosing
stratification markers, were selected.
A multivariate approach for correlating the obtained microarray data points to
the
clinical efficacy, was also pursued. By using Partial Least Squares (PLS)
projection to latent
structures the best combination of transcripts for predicting clinical effect
in individual
patients dosed with anti-IL20 were identified. The identified PLS model was
cross validated
by a permutation test (reducing the R2-coefficients for the correlation
between the observed
and predicted data from 0.8 to 0.1). This indicated that the PLS model was
valid and not
over-fitted. A PLS based prediction can be done with any multivariate analyses
software tool
(Like Simca-P +11 (Umetrics) or Unscrambler (CAMO software AS, Oslo, Norway).
Initially
the multivariate prediction was done using 18954 data points from the
AffyMetrix
microarrays. An example of a set of 14 predictive transcripts is shown in
figure 2.
A gene of interest in the multivariate based prediction model was Complement
Factor D (CFD) also known as Adipsin. The level of the CFD transcript among
the RA
patients is shown in figure 3. The mRNA expression level in individual
patients is stable over
time, but with a pronounced variation between patients. The difference between
the patient
with the lowest level of CFD mRNA to the patient with the highest level was
approximately 8-
fold.
As shown in figure 1, CFD was also among the positively correlated transcripts
in
the univariate regression analysis. Together, these findings prompted
examination of the
usefulness of CFD as a high response predictor in anti-IL20 antibody dosed RA-
patients.
This was done by preparing Receiver Operating Characteristics (ROC)-curves as
shown in
Figure 4 (ACR50 response), and Figure 5 (ACR70 response). The area under curve
(AUC)
for ACR50 response, was found to be 0,81 (p=0,00068) indicative of a good
prediction of
ACR50 responses based on CFD mRNA levels.
For testing whether CFD mRNA could be a predictor of high responses in the
anti-
1L20 RA-trials, the thresholds for an optimal classification of the patients
were defined in
either ACR50 responders and non-responders, as well as for ACR70 responders
and non-
responders. This was done with an average CFD-mRNA level obtained from the
four
samples collected at day 1 (pre-dose), and after dosing at day 15 and 36. As
previously
described the CFD mRNA level was found to be stable over time at these visits.
For ACR50
classification a CFD mRNA threshold of 10.32 (log2 scale of RMA normalized
AffyMetrix
microarray levels) was found (indicated by the X in Figure 4).
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
58
When applying this threshold (10.32 or above) in the RA patients dosed with
anti-
1L20 antibody in the phase 2a trial data, the ACR50 response rate was found to
be
significantly increased from 37% to 65% (Figure 7). Approximately half of the
patients
enrolled in the phase 2a trial would be included when applying an inclusion
threshold of
10.32 or above. Likewise for ACR70 responses, a threshold of 10.32 in the
dosed RA
patients was found to increase the response rate from 25% to 45%. The
enrichment of
response rates when applying a threshold of 10.32 is visualized in Figure 7.
In placebo dosed individuals from the phase2a trial the ACR50 response rate in
patients having a CFD mRNA level of 10.32 or above was 17% compared toll in
patients
with a CFD mRNA level below 10.32. For ACR70 the response rates in placebo
dosed
patients having a CFD mRNA level of 10.32 or above was 8 % compared to 0 % in
patients
with a CFD mRNA level below 10.32
Based on the above analysis it was concluded the CFD mRNA level was a good
predictor of high response to anti-IL-20 in RA patients, and that significant
increases in
especially ACR50 and ACR70 responses could be obtained if only including RA
patients with
a CFD mRNA level of 10.32 or above.
Example 2 - Correlation of qRT-PCR with array data
To examine if the CFD mRNA baseline (pre-dose) measurement alone correlates
with the CFD mRNA levels from the different time points evaluated in the
microarray
analysis, gRT-PCR was performed on CFD mRNA on available pre-dose samples and
correlated these to the recorded CFD levels from the microarrays. Quantitative
RT-PCR
analyses were performed as described herein above and data obtained from
duplicate
analysis of each of the cDNA samples. The CFD mRNA levels from the gRT-PCR
platform
were normalised to 18S rRNA levels which were also determined by gRT-PCR. For
correlating the microarray levels to the gRT-PCR levels the RNA normalized
microarray
levels were transformed to a linear scale. As shown in Figure 6, a high degree
of correlation
(R2 =0,86) was found between the gRT-PCR measurements at base-line and the
microarray
measurements from several visits. This indicates that a CFD based
stratification of RA-
patients at base-line (before dosing) is feasible, Since the other predictive
transcripts
described in Figure 1 and Figure 2 like CFD were identified not only by
correlating to base-
line samples but to several time points in the phase 2a trial, these have also
been selected to
display stability over time (as exemplified by the CFD correlations in Figure
6). The
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
59
transcripts described herein are therefore especially suited for a pre-dose
predictive
stratification of highly responding patients.
To obtain a stratification based on gRT-PCR data resembling the stratification
obtained with a threshold of 10.32 using the micro array data, the PCR product
should be
detected within cycle (Ct-value) 26 in the CFD assay (ID: Hs00157263_m1)), and
detection
of 18S rRNA (assay Hs99999901_s1) should be obtained with a Ct=12,5. These
values
correspond to approximately 10.25 on the RMA scale of microarray values as
estimated
based on samples from an individual patient for which two array detections are
close to
10.32, with an average of 10.24. Using the gRT-PCR assay, detection of CFD in
this patient
is obtained with a Ct-value of 26 and with the 18S control having a Ct value
of 12.5).
It is also possible to measure the level of expression of complement factor D
(CFD)
level by gRT-PCR, wherein absolute numbers of at least 0.04 copies for CFD pr.
copy of
beta-acting mRNA (gene symbol ACTB) using Assay ID: Hs00157263_m1 for CFD
(Applied
Biosystems/ Invitrogen).and Hs99999903_m1 for ACTB (Applied Biosystems/
lnvitrogen) is
the threshold value for improved response.
Example 3 ¨ Disease relevance of CFD mRNA levels in PaxGene samples
To evaluate whether the CFD levels in peripheral blood from RA patients could
correlate to relevant activity markers in the local joint, paired PaxGene
(full blood) and
synovial fluid samples were collected. Complement factor D is the initiating
serine protease
in the alternative complement pathway activation, and cleaves C3b complexed
with factor B
into C3bBb and Ba. C3bBb is a C3 convertase which will cleave additional C3
molecules into
C3a and C3b. Since the Bb molecule is unique to the alternative complement
activation, Bb
protein levels serve as an activity marker of this pathway. There is strong
evidence
supporting both the classical and alternative complement activation to be
involved in the
pathophysiology of rheumatoid arthritis.
A Bb plus EIA (MicroVue cat# A027) assay (an assay that measures the amount of
complement fragment Bb in human plasma or serum) was prepared according to kit
protocol.
A wash buffer (x20) was diluted in deionized water. 1% HBR1 (A Heterophilic
Blocking Reagent (HBR1) 18,42mg/mlfrom Scantibodies Lab. Part 3KC533) was
added to
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
the hydrating reagent and 1% HBR was added to the complement specimen diluent
(80p1
HBR1 + 7,92m1). Reconstitute std and controls were diluted in 1m1 of Hydrating
Reagent
/HBR1 and let sit for 15min. Samples were diluted 10 (45p1+405p1) and 20 times
(22p1+418p1) in Complement Specimen Diluent +1% HBR1.
5 The samples were pre-washed 3 times and incubated with 100p1 std for
30 min,
washed 5 times, incubated for 30 min with 50p1 conjugate, washed 5 times,
incubated 15 min
with 100p1 substrate and finally stopped with 100p1 stop solution.
The absorbance was determined by an ELISA reader set at reader set at 450 nm
10 (ref at 600-690nm) with linear curve fit.
By using the MicroVue Bb Plus ETA assay and HBR1, we were able to measure
the levels of Bb in synovial fluid from RA patients. When plotting these
levels against the
CFD mRNA levels in paired PaxGene samples from the same patients, a
significant
15 correlation was found, as shown in figure 8.
This finding shows that the CFD mRNA levels in full blood from RA patients,
are
indicative of the activation state of the alternative complement pathway in
the local joint.
20 Since CFD mRNA levels in full blood from RA patients correlates to the
activation
state of the alternative complement pathway in the local joint (correlation
between CFD
mRNA in PaxGene samples and Bb levels in paired synovial fluid levels), it is
tempting to
speculate that CFD mRNA levels in PaxGene samples from RA patients could also
be a
predictor of therapies targeting the complement activation.
Example 4¨ Analysis using single nucleotide polymorphisms (SNPs)
As an alternative to measure CFD mRNA levels in PaxGene samples, the analyses
of certain single nucleotide polymorphisms (SNPs) in the CFD haploblock could
provide a
convenient method of predicting response. The bimodal distribution of CFD mRNA
in
PaxGene and other samples clearly indicate that genetic polymorphisms could be
an
underlying explanation for the CFD mRNA expression pattern. A person skilled
in the art can
perform expression quantitative trait loci (eQTL) analyses for CFD, and
identify SNP
correlations or associations to CFD expression levels. An example of a SNP
showing strong
associations to CFD mRNA expression levels in the haploblock of CFD and its
neighbour
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
61
genes has the identity rs1683565. Measurement of this SNP, or other SNPs
showing strong
linkage disequilibrium to rs1683565 can be done by a number of different
methods including,
but not limited to, hybridization based methods (e.g. SNP microarrays) and
enzyme based
methods (e.g. PCR and restriction fragment length polymorphism methods). Other
SNPs
which show strong linkage disequilirium to rs1683565 include, but are not
limited to, SNPs
with identities: rs1683591, rs1683590, rs1683569, rs1683574, rs1651888,
rs2930894,
rs2930891, rs4417648, rs1651891, rs1651890, and rs2930898.
As an example the SNP rs1683591 provides the AA, AG, or GG genotypes. Based
on the correlation with CFD expression the AA genotype corresponding to low
CFD
expression (with a rather low response rates), while the AG and GG genotypes
corresponds
to a higher level of CFD expression and thus a high probability of responding
to anti-
inflammatory agents.
The above mentioned SNPs, combinations of them, or other SNPs showing strong
linkage to the mentioned SNPs (rs1683565, rs1683591, rs1683590, rs1683569,
rs1683574,
rs1651888, rs2930894, rs2930891, rs4417648, rs1651891, rs1651890, and
rs2930898) can
be detected by a number of well described methodologies including, but not
limited to,
hybridization based methods (e.g. SNP microarrays) and enzyme based methods
(e.g. PCR
and restriction fragment length polymorphism methods).
In one example, a blood sample is drawn from a patient, and genomic DNA
is isolated by the reagent DNAzol0 (Becton Dickinson) following the
instructions by the
manufacturer. Briefly, mix 1 ml of DNAzol0 with 0.5 ml of whole blood by
vortexing or hand
mixing. Precipitate DNA from the sample by adding 0.4 ml of isopropanol to the
DNAzol0
BD-blood lysate. Vortex or the resulting mixture and store it for 5 min at
room temperature.
Spin down the precipitated DNA by centrifugation at 6,000 x g for 6 min.
Remove the
supernatant and add 0.5 ml of DNAzol to the DNA pellet. Vortex or shake the
DNA pellet until
it is completely dissolved. Centrifuge the resulting mixture at 6,000 x g for
5 min. Next,
remove supernatant and wash the DNA pellet by mixing with 1 ml of 75% ethanol
and
centrifuge at 6,000 x g for 5 min. Remove the ethanol and without drying, add
to the DNA
pellet 200 pl of 8 mM NaOH and solubilize DNA by incubation at room
temperature for 3-5
min followed by vortexing. Neutralize the alkaline DNA solution with 0.1 M
HEPES. From the
isolated DNA, prepare a quantitative polymerase chain reaction (qPCR) with a
specific assay
for the desired SNP. The qPCR setup could be based on TaqMan probes designed
to
specifically detect the desired SNP. As an example the SNP with identity
rs1683565 would
be detected by any probe and/or primer combination which can discriminate the
sequence:
AGAGCCCAAAGCTCATGGAAAAGAG[A/G]ATATGAAAGGAGTCCCTGCAGTAGA. This
CA 02864133 2014-08-08
WO 2013/117751 PCT/EP2013/052629
62
could be done by the commercially available assay from lnvitrogen (Catalog #:
4351379 ID:
C 9612061_10). In another example the SNP with identity rs1683591 would
be detected
by any probe and/or primer combination which can discriminate the
sequence TCTGTCCACAGGCGGGGGTGGAGGG[A/qATGGCCGGCCTCACACCATCTG
CCA. This could be done by the commercially availabe assay from lnvitrogen
(Catalog #:
4351379 ID: C 9612100_10). In a third example the SNP with identity
rs1683590 would
be detected by any probe and/or primer combination which can discriminate the
sequence
AATATCTGAAATTTTCCCAGTTTAC[A/G]AGCCTCTGACGTAACCGTCCTCTCT. This
could be done by the commercially availabe assay from lnvitrogen (Catalog
#4351379
ID: C 3153459_10). For a TaqMan genotyping assay, you must add the
equivalent of 1 to 10 ng of DNA template per reaction well. To quantitate
genomic DNA, use
a reliable method such as A260 measurements. Thoroughly mix TaqMan GTXpress
TM
Master Mix (Invitrogen (Catalog #4403311)) by swirling the bottle and mix with
the TaqMan
genotyping assay and genomic DNA template as described by the manufacturer.
Run the
PCR in a compatible PCR instrument (e.g. ABI PRISM 7900HT Sequence Detection
System with a FAST block) for 40 cycles (first 95 C for 20 sec, and then 40
cycles with
primer annealing and extend at 60 C for 20 seconds and subsequently
denaturation at 95
C for 3 seconds. After PCR amplification, you perform an endpoint plate read
on a real-time
PCR. With the SDS software from lnvitrogen which uses the fluorescence
measurements
from each well made during the plate read, then plot signal values. The
software determines
which alleles are in each sample for later allelic discrimination analysis.
