Note: Descriptions are shown in the official language in which they were submitted.
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
COOPERATIVE PRIMERS, PROBES, AND APPLICATIONS THEREOF
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims benefit of U.S. Provisional Application Nos
61/672,329,
filed July 17, 2012, and 61/732,537, filed December 3, 2012, both of which are
hereby
incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
The disclosed invention is generally in the field of nucleic acid
amplification in
its entirety.
BACKGROUND OF THE INVENTION
Nucleic acid testing often requires amplification of nucleic acids to achieve
a
sufficient concentration and/or purity to undergo subsequent testing.
Sometimes
amplification of nucleic acids is used as a surrogate in detection of non-
nucleic acids,
such as proteins. The majority of nucleic acid amplification/extension
reactions depend
on the presence of a primer comprised of modified or natural nucleic acids at
the 3' end
which allow extension in the presence of a polymerase.
A universal problem with such amplification reactions is the presence of
primer-dimers. Primer-dimers are formed when primers extend each other rather
than
the target nucleic acid. Primer-dimers use up primers, resulting in the
presence of
impurities in the reaction. Even worse, primer-dimers can use up enough
primers to
cause false negatives in some cases. Or, if interacting with a probe, primer-
dimers can
cause false positives.
A variety of hot starts have been developed to deal with the issue of primer-
dimers including suspending the polymerase in a wax material, inhibiting the
polymerase with antibodies, chemically modifying the polymerase, sequestering
primers, and a variety of other methods. The problem with all of these methods
is that
they are only effective prior to the first round of amplification/extension.
Any primer-
dimers that form thereafter are amplified at an exponential rate.
Other methods of dealing with primer-dimers include methods such as nested
PCR. However, this requires two separate reactions and increases the chances
of
contamination.
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Many amplification/extension reactions are also coupled with a detection
probe.
The principles often revolve around a labeled linear probe, such as Taqman or
a labeled
hairpin probe such as Molecular Beacons. Some methods achieve incredible
specificity
through the use of cooperatively linking two probes, such as Tentacle Probes.
However, each of these probe based methods is limited in detecting mutants in
a high
background of wild type. While they can achieve all or nothing detection of
single
nucleotide polymorphisms and other mutations, they can only pick out about one
mutant in a background of 10 to 20 wild type sequences. This is because the
primers
amplify both the wild type and the mutant and are depleted without being able
to detect
both. Methods like ARMS can be combined with the probe detection technologies
to
overcome this problem to an extent, but cannot be effectively multiplexed for
real-time
detection when more than one mutation occurs in the same general region.
Several primers have been developed which include a detection mechanism,
such as Amplifiuor primers, Rapid Detex primers and Scorpion primers. The
first two
are especially prone to false positives from primer-dimer problems because
they are not
sequence specific. The latter is a self-probing primer, where the probe binds
to the
primer extension product rather than the nucleic acid template. Because it has
a
sequence specific probe, it is less likely to result in false positives, but
is still subject to
primer-dimer associated problems.
BRIEF SUMMARY OF THE INVENTION
Disclosed herein is a cooperative nucleic acid molecule comprising: a) a first
nucleic acid sequence, wherein the first nucleic acid sequence is
substantially
complementary to a first region of a target nucleic acid, and wherein the
first nucleic
acid sequence is extendable on the 3' end; b) a second nucleic acid sequence,
wherein
the second nucleic acid sequence is substantially complementary to a second
region of
the target nucleic acid; wherein the first and second nucleic acid sequences
are attached
to each other; and wherein the second nucleic acid sequence hybridizes to the
target
nucleic acid sequence downstream from the 3' end of the first nucleic acid
sequence.
Further disclosed is a method for amplifying a target nucleic acid, the method
comprising: a) providing a cooperative nucleic acid molecule as disclosed
herein; b)
providing a target nucleic acid; and c) amplifying the target nucleic acid
under
appropriate conditions for amplification; thereby amplifying the target
nucleic acid.
2
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Also disclosed is a method for detecting a nucleic acid in a sample, the
method
comprising a) providing a cooperative nucleic acid molecule as disclosed
herein,
wherein the cooperative nucleic acid comprises a detectable label; b)
providing a target
nucleic acid; and c) detecting the target nucleic acid; thereby detecting the
target
nucleic acid.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows an embodiment of cooperative primers that has a linker internal
to the primer attached to the 5' end of the capture sequence. The capture
sequence
binds to the target nucleic acid, and the hybridized capture sequence holds
the primer in
close proximity to the target. The primer then extends, cleaving the capture
sequence.
Figure 2 shows another embodiment of cooperative primers that has a linker
attaching the 5' end of the primer to the 3' end of the capture sequence. The
capture
sequence binds to the target nucleic acid. The hybridized capture sequence
holds the
primer in close proximity to the target. The primer then extends, cleaving the
capture
sequence.
Figure 3 shows a preferred embodiment of a cooperative primer with the 5' end
of the capture sequence linked to the 5' end of the primer. The capture
sequence binds
to the target nucleic acid. The hybridized capture sequence holds the primer
in close
proximity to the target. The primer then extends, cleaving the capture
sequence.
Figure 4 shows examples of probes that can be linked to the primer include,
but
are not limited to, dual labeled probes, hairpin probes and single label
probes.
Figure 5 shows a preferred embodiment for detection of nucleic acid extension
using a cooperative primer linked to a dual labeled probe. The probe binds to
the target
nucleic acid, and the hybridized probe holds the primer in close proximity to
the target.
The primer extends, cleaving the probe, causing an increase in fluorescence.
Figure 6 shows gel of Cooperative Primers and Normal Primers. Normal
primers have some primer-dimer (P-D) formation even when no P-D are spiked in,
however, still have amplification of 60 starting copies of Malaria DNA. When
600 P-D
are spiked in, Malaria amplification products are eclipsed and only P-D are
amplified.
In contrast, Cooperative Primers have no primer-dimer amplification, even when
up to
3
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
600,000 P-D are spiked in. P-D do not interfere with cooperative primer
amplification
of the target nucleic acid.
Figure 7 shows some examples of primers with built in detection mechanisms
that can be used in cooperative primers.
Figure 8 shows cooperative primers with integrated probes. Labeled
cooperative primers or normal hybridization probes were used for real time
detection of
5,000,000, 50,000, 500 or 0 copies P. fakiparum template. Labeled capture
sequences
in cooperative primers had a fluorescent signal 2.5 x higher than normal
hybridization
probes, even though the capture sequence had a Tm below the reaction
temperature.
Figure 9 shows SNP differentiation with cooperative primers. Cooperative
Primers differentiate between Tuberculosis Complex with the rpoB D516V SNP
causing rifampicin resistance and without the SNP using probe based
differentiation
with the SNP under the capture sequence (9A) and the ARMS based method with
the
SNP under the 3' end of the primer (9B).
DETAILED DESCRIPTION OF THE INVENTION
The =disclosed method makes use of certain materials and procedures which
allow amplification of nucleic acid sequences and whole genomes or other
highly
complex nucleic acid samples. These materials and procedures are described in
detail
below.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have
the
same meaning as commonly understood by one of ordinary skill in the art to
which the
invention pertains. The following definitions supplement those in the art and
are
directed to the current application and are not to be imputed to any related
or unrelated
case, e.g., to any commonly owned patent or application. Although any methods
and
materials similar or equivalent to those described herein can be used in the
practice for
testing of the present invention, the preferred materials and methods are
described
herein. Accordingly, the terminology used herein is for the purpose of
describing
particular embodiments only, and is not intended to be limiting.
As used herein, "nucleic acid sequence" refers to the order or sequence of
nucleotides along a strand of nucleic acids. In some cases, the order of these
4
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
nucleotides may determine the order of the amino acids along a corresponding
polypeptide chain. The nucleic acid sequence thus codes for the amino acid
sequence.
The nucleic acid sequence may be single-stranded or double-stranded, as
specified, or
contain portions of both double-stranded and single-stranded sequences. The
nucleic
acid sequence may be composed of DNA, both genomic and cDNA, RNA, or a hybrid,
where the sequence comprises any combination of deoxyribo- and ribo-
nucleotides, and
any combination of bases, including uracil (U), adenine (A), thymine (T),
cytosine (C),
guanine (G), inoshie, xathanine hypoxathanine, isocytosine, isoguanine, etc.
It may
include modified bases, including locked nucleic acids, peptide nucleic acids
and others
known to those skilled in the art.
An "oligonucleotide" is a polymer comprising two or more nucleotides. The
polymer can additionally comprise non-nucleotide elements such as labels,
quenchers,
blocking groups, or the like. The nucleotides of the oligonucleotide can be
natural or
non-natural and can be unsubstituted, unmodified, substituted or modified. The
nucleotides can be linked by phosphodiester bonds, or by phosphorothioate
linkages,
methylphosphonate linkages, boranophosphate linkages, or the like.
A "peptide nucleic acid" (PNA) is a polymer comprising two or more peptide
nucleic acid monomers. The polymer can additionally comprise elements such as
labels, quenchers, blocking groups, or the like. The monomers of the PNA can
be
unsubstituted, unmodified, substituted or modified.
By "cooperative nucleic acid" is meant a nucleic acid sequence which
incorporates minimally a first nucleic acid sequence and a second nucleic acid
sequence, wherein the second nucleic acid sequence hybridizes to the target
nucleic
acid downstream of the 3' end of the first nucleic acid sequence. The 3' end
of the
nucleic acid can be extendable, as discussed elsewhere herein. In one example,
the first
nucleic acid is a primer, and the second nucleic acid is a capture sequence.
The first and
second nucleic acid sequences can be separated by a linker, for example.
A "primer" is a nucleic acid that contains a sequence complementary to a
region
of a template nucleic acid strand and that primes the synthesis of a strand
complementary to the template (or a portion thereof). Primers are typically,
but need
not be, relatively short, chemically synthesized oligonucleotides (typically,
deoxyribonucleotides). In an amplification, e.g., a PCR amplification, a pair
of primers
5
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
typically define the 5' ends of the two complementary strands of the nucleic
acid target
that is amplified.By "cooperative primer," or first nucleic acid sequence, is
meant a
primer attached via a linker to a second nucleic acid sequence, also referred
to as a
capture sequence. The second nucleic acid sequence, or capture sequence, can
hybridize to the template nucleic acid downstream of the 3' end of the primer,
or first
nucleic acid sequence.By "normal primer" is meant a primer which does not have
a
capture sequence, or second nucleic acid sequence, attached to it via a
linker.
By "capture sequence," which is also referred to herein as a "second nucleic
acid sequence" is meant a sequence which hybridizes to the target nucleic acid
and
allows the first nucleic acid sequence, or primer sequence, to be in close
proximity to
the target region of the target nucleic acid.
"Downstream" is relative to the action of the polymerase during nucleic acid
synthesis or extension. For example, when the Taq polymerase extends a primer,
it
adds bases to the 3' end of the primer and will move towards a sequence that
is
"downstream from the 3' end of the primer."
A "target region" is a region of a target nucleic acid that is to be
amplified,
detected or both.
The "Tm" (melting temperature) of a nucleic acid duplex under specified
conditions is the temperature at which half of the nucleic acid sequences are
disassociated and half are associated. As used herin, "isolated Tm" refers to
the
individual melting temperature of either the first or second nucleic acid
sequence in the
cooperative nucleic acid when not in the cooperative pair. "Effective Tm"
refers to the
resulting melting temperature of either the first or second nucleic acid when
linked
together.
The term "linker" means the composition joining the first and second nucleic
acids to each other. The linker comprises at least one non-extendable moiety,
but may
also comprise extendable nucleic acids, and can be any length. The linker may
be
connected to the 3' end, the 5' end, or can be connected one or more bases
from the end
("the middle") of both the first and second nucleic acid sequences. The
connection can
be covalent, hydrogen bonding, ionic interactions, hydrophobic interactions,
and the
like. The term "non-extendable" has reference to the inability of the native
Taq
polymerase to recognize a moiety and thereby continue nucleic acid synthesis.
A
6
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
variety of natural and modified nucleic acid bases are recognized by the
polymerase
and are "extendable." Examples of non-extendable moieties include among
others,
fluorophores, quenchers, polyethylene glycol, polypropylene glycol,
polyethylene,
polypropylene, polyamides, polyesters and others known to those skilled in the
art. In
some cases, even a nucleic acid base with reverse orientation (e.g. 5' ACGT 3'
3'A 5'
5' AAGT 3') or otherwise rendered such that the Taq polymerase could not
extend
through it could be considered "non-extendable."The term "non-nucleic acid
linker" as
used herein refers to a reactive chemical group that is capable of covalently
attaching a
first nucleic acid to a second nucleic acid, or more specifically, the primer
to the
capture sequence. Suitable flexible linkers are typically linear molecules in
a chain of at
least one or two atoms, more typically an organic polymer chain of 1 to 12
carbon
atoms (and/or other backbone atoms) in length. Exemplary flexible linkers
include
polyethylene glycol, polypropylene glycol, polyethylene, polypropylene,
polyamides,
polyesters and the like.
As used herein, "complementary" or "complementarity" refers to the ability of
a
nucleotide in a polynucleotide molecule to form a base pair with another
nucleotide in a
second polynucleotide molecule. For example, the sequence 5'-A-C-T-3' is
complementary to the sequence 3`-T-G-A-5'. Complementarity may be partial, in
which
only some of the nucleotides match according to base pairing, or complete,
where all
the nucleotides match according to base pairing. For purposes of the present
invention
"substantially complementary" refers to 90% or greater identity over the
length of the
target base pair region. The complementarity can also be 50, 60, 70, 75, 80,
85, 90, 91,
92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary, or any amount below or
in
between these amounts.
As used herein, "amplify, amplifying, amplifies, amplified, amplification"
refers to the creation of one or more identical or complementary copies of the
target
DNA. The copies may be single stranded or double stranded. Amplification can
be
part of a number of processes such as extension of a primer, reverse
transcription,
polymerase chain reaction, nucleic acid sequencing, rolling circle
amplification and the
like.
As used herein, "purified" refers to a polynucleotide, for example a target
nucleic acid sequence, that has been separated from cellular debris, for
example, high
7
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
molecular weight DNA, RNA and protein. This would include an isolated RNA
sample
that would be separated from cellular debris, including DNA. It can also mean
non-
native, or non-naturally occurring nucleic acid.
As used herein, "protein," "peptide," and "polypeptide" are used
interchangeably to denote an amino acid polymer or a set of two or more
interacting or
bound amino acid polymers.
As used herein, "stringency" refers to the conditions, i.e., temperature,
ionic
strength, solvents, and the like, under which hybridization between
polynucleotides
occurs. Hybridization being the process that occurs between the primer and
template
DNA during the annealing step of the amplification process.
A variety of additional terms are defined or otherwise characterized herein.
Materials and Methods
The present invention relates to cooperative nucleic acids, such as primers
and
probes. A cooperative nucleic acid comprises an oligonucleotide primer linked
to a
second oligonucleotide which is complementary to a region of the template
downstream from the 3' end of the primer (as seen in Figure 1 for example).
This
second oligonucleotide serves as a capture sequence. In some embodiments, this
allows primers with low melting temperatures ("Tm") to hybridize efficiently
to the
target.
The capture sequence holds the primer in close proxiinity to the template
allowing extension/amplification to occur in spite of the low Tm. However,
nonspecific sequences that do not have a complementary sequence to the capture
sequence, such as primer-dimers, are not extended efficiently. Because the
capture
sequence uniquely hybridizes downstream from the 3 end of the primer, the
specificity
of amplification is achieved in every cycle. This is in contrast with
conventional hot
start methods, whose specificity wears off after the first cycle.
This is also in contrast with concepts such as the dual specificity primer (US
Patent Publication 20120135473, herein incorporated by reference in its
entirety for its
teaching concerning dual specificity primers). The dual specificity primer has
a capture
sequence linked to a short primer via Inosine residues where the capture
sequence
hybridizes to the target on the 5' side of the primer. The result is that the
dual
specificity primer is highly specific in the first round of amplification.
However, if the
8
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
dual specificity primers amplify each other, the polymerase extends all the
way through
to the 5' end, creating a high Trn primer-dimer that will be propagated in
every round
thereafter. This is in contrast to the cooperative nucleic acid where the
capture sequence
hybridizes to the target on the 3' side of the primer, preventing it from
being
incorporated into the primer-dimer in the order necessary to allow for
propagation of
the primer-dimer.
The cooperative nucleic acids and methods of using them are also different
than
"padlock probes" (Nilsson et al. 1994: "Padlock probes: circularizing
oligonucleotides
for localized DNA detection". Science 265 (5181): 2085-2088), Molecular
Inversion
Probes (MI:Ps) (Hardenbol et al 2003: "Multiplexed genotyping with sequence-
tagged
molecular inversion probes". Nat Biotechnol 21 (6): 673-678) and Connector
Inversion
Probes (CIPs) (Akhras et al. 2007: Hall, Neil. ed. "Connector inversion probe
technology: a powerful one-primer multiplex DNA amplification system for
numerous
scientific applications". PLoS ONE 2 (9): e195). For example, the probes
disclosed
herein can have a linker with at least one non-extendable moiety. Furthermore,
the
molecule disclosed herein is a primer, whereas the "padlock probes" are
ligated, and
the non-ligated padlock probes are digested or otherwise removed prior to
amplification
and cannot be used as primers.
Padlock probes are single stranded DNA molecules with two 20-nucleotide long
segments complementary to the target connected by a 40-nucleotide long linker
sequence. When the target complementary regions are hybridized to the DNA
target,
the padlock probes also become circularized_ However, unlike mrp, padlock
probes are
designed such that the target complementary regions span the entire target
region upon
hybridization, leaving no gaps. Thus, padlock probes are only useful for
detecting DNA
molecules with known sequences.
Molecular Inversion probes were developed to perform SNP genotyping, which
are modified padlock probes such that when the probe is hybridized to the
genomic
target, there is a gap at the SNP position. Gap filling using a nucleotide
that is
complementary to the nucleotide at the SNP location determines the identity of
the
polymorphism. This design brings numerous benefits over the more traditional
padlock
probe technique. Using multiple padlock probes specific to a plausible SNP
requires
9
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
careful balancing of the concentration of these allele specific probes to
ensure SNP
counts at a given locus are properly normalized.
Connector Inversion Probes make use of a modified design of MIP by extending
the gap delimited by the hybridized probe ends and named the design Connector
Inversion Probe (CIP). The gap corresponds to the genomic region of interest
to be
captured (e.g. exons). Gap filling reaction is achieved with DNA polymerase,
using all
four nucleotides. Identification of the captured regions can then be done by
sequencing
them using locus-specific primers that map to one of the target complementary
ends of
the probes.
A "primer dimer" (PD) is a potential by-product in PCR. As its name implies, a
PD consists of primer molecules that have attached (hybridized) to each other
because
of strings of complementary bases in the primers or through other nonspecific
interactions. As a result, the DNA polymerase amplifies the PD, leading to
competition
for PCR reagents, thus potentially inhibiting amplification of the DNA
sequence
targeted for PCR amplification. In real-time PCR, PDs may interfere with
accurate
quantification through signal dampening, false negatives, false positives and
the like.
The present invention also relates to cooperatively linked nucleic acids that
also
comprise a probe. This modified primer/probe is similar to the cooperative
nucleic
acid, but with the addition of one or more detectable labels to either the
capture
sequence or the primer, turning it into a probe. Because extension of the
cooperative
primer/probe is detectable, it can be useful in a variety of applications
including
multiplexing applications that require differentiation of SNP's using an ARMS
based
approach. In some embodiments, both the primer and the probe are designed with
Tm's below the melting temperature which is used in the amplification
reaction, so that
the primer will not amplify without the probe binding and the probe will not
have a
signal without the primer binding. This creates two points of specificity in
the same
primer/probe combination.
The cooperative nucleic acids, such as primers and probes, of this invention
are
useful in a variety of primer extension/amplification reactions known to those
skilled in
the art, including, but not limited to the polymerase chain reaction, rolling
circle
amplification, nucleic acid sequencing and others. The cooperative primers and
probes
of this invention can also be used in applications that have post
extension/amplification
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
steps, such as hybridization to an array. Because the cooperative
primers/probes in this
invention substantially reduce primer-dimers, they are of particular use in
multiplexed
and highly multiplexed reactions.
The use of a cooperative nucleic acid can decrease the amount of primer-dimer
present by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46,
47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,
66, 67, 68,69,
70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92,
93, 94, 95, 96, 97, 98, 99, or 100 percent compared to the amount of primer-
dimer
present when a normal primer (a non-cooperative nucleic acid) is used.
Therefore, disclosed herein is a cooperative nucleic acid molecule comprising:
a) a first nucleic acid sequence, wherein the first nucleic acid sequence is
substantially
complementary to a first region of a target nucleic acid, and wherein the
first nucleic
acid sequence is extendable on the 3' end; b) a second nucleic acid sequence,
wherein
the second nucleic acid sequence is substantially complementary to a second
region of
the target nucleic acid; wherein the first and second nucleic acid sequences
are attached
to each other; and wherein the second nucleic acid sequence hybridizes to the
target
nucleic acid sequence downstream from the 3' end of the first nucleic acid
sequence;
and wherein the effective melting temperature (Tm) of the first nucleic acid
molecule is
increased by at least 1 C as compared to the isolated Tm of the first nucleic
acid
sequence without the second nucleic acid sequence attached to it.
The cooperative nucleic acid may be linear or circularized.
By "extendable on the 3' end" is meant that the first nucleic acid is free on
this
end to be amplified, or extended. This iis meant to include heat activatable
primers such
as those described by Lebedev et al, among other technologies.
The first nucleic acid sequence is a primer, and the second nucleic acid
sequence is alternatively referred to as a "capture nucleic acid sequence."
Either the
first or the second sequence may have a detectable label, or a third sequence
may have
a detectable label. The first and second nucleic acid sequences can be
attached via a
linker, which can be a non-nucleic acid sequence. In one example, the linker
can attach
the 5' end of the first nucleic acid sequence to the 3' end of the second
nucleic acid
sequence. This can be seen, for instance, in Figure 2. Alternatively, the the
first nucleic
11
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
acid sequence is inverted such that the 5' end of the first nucleic acid
sequence is
attached to the 5' end of the second nucleic acid sequence. This can be seen,
for
instance, in Figure 3. In yet another example, the 5' end of the second
nucleic acid
sequence can be linked to the first nucleic acid sequence in the middle of the
sequence,
as seen in Figure 1. It is noted that by "middle of the sequence" is meant
that the linker
is not joined to the first nucleic acid sequence at either the 5' end or the
3' end of the
nucleic acid, but rather is attached to a nucleotide internal to the
nucleotides on the 5'
and 3' ends.
In one example, the cooperative nucleic acid comprises 75, 70, 65, 60, 55, 50,
45, 40, 35, 30, 25, 20, 15, 10, or less continuous nucleotides in the same
orientation. In
other words, this is the number of nucleotides that are part of a single,
unbroken nucleic
acid sequence and oriented in the same 5' to 3' direction, or the 3' to 5'
direction. By
way of example, if the linker is a nucleic acid sequence, it can include the
linker, if the
nucleotides in the linker are in the same orientation as either the first or
second nucleic
acid sequence to which it is directly connected.
The linker can be made of nucleic acids, non-nucleic acids, or some
combination of both. If the linker is made of nucleic acids, it can be 1, 2,
3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,
60, 70, 80, 90,
or 100 or more nucleotides in length, or any number in between. Types of
linkers are
discussed elsewhere herein. The linker can be any length, and can be longer or
shorter
than the combined length of the first and second nucleic acid sequences,
longer or
shorter than just the first nucleic acid sequence, or longer or shorter than
the second
nucleic acid sequence.
Furthermore, there can be a space on the target nucleic acid where the first
nucleic acid sequence and the second nucleic acid sequence hybridize. In other
words,
there are two distinct regions on the target nucleic acid, one which
hybridizes with the
first nucleic acid sequence, and the other which hybridizes to the second
nucleic acid
sequence. The distance between the first and second regions on the target can
be 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12,13, 14, 15, 16, 17,18, 19, 20, 21, 22, 23, 24,
25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
47, 48, 49, 50,
60, 70, 80, 90, or 100 or more nucleotides in length.
12
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Also disclosed herein is a kit comprising the cooperative nucleic acid
molecules
disclosed herein together with instructions for their use. In some
embodiments,
additional cooperative nucleic acid molecules are provided in the kit. In
still others,
reagents for performing the extension are included, such as polymerase,
dNTP's,
buffers and the like. In some embodiments, positive and negative controls may
be
included. In such embodiments, the reagents may all be packaged separately or
combined in a single tube or container.
Further disclosed is a method for amplifying a target nucleic acid, the method
comprising: a) providing a cooperative nucleic acid molecule as disclosed
herein; b)
providing a target nucleic acid; and c) amplifying the target nucleic acid
under
appropriate conditions for amplification; wherein the effective Tm of the
first nucleic
acid molecule is increased by at least rc as compared to the isolated Tm of
the first
nucleic acid sequence without the second nucleic acid sequence attached to it;
thereby
amplifying the target nucleic acid.
Methods of amplification are disclosed elsewhere herein. More than one
cooperative nucleic acid molecule can be provided, and they can have the same
or
different sequences. For example 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 or more nucleic
acid
molecules of different sequences can be provided.
Primer Design
In some embodiments, the isolated melting temperature "Tm" of the primer,
also referred to herein as the first nucleic acid sequence, is 1, 2, 3, 4, 5,
6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 or more
degrees
below the reaction temperature used during the annealing phase, of PCR, or the
extension phase of reactions with no annealing phase. Therefore, the melting
temperature of the primer sequence can be between about 1 C and 40 C, between
about
3 C and 20 C, between about 5 C and 15 C below the reaction temperature used
in the
PCR reaction. In a preferred embodiment, the isolated Tm is between about 7 C
and
13
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
12 C below the reaction temperature. This provides for less than 50%, and more
preferably less than 20% of the template to be hybridized to an isolated
primer.
One of skill in the art can design primers with a given melting temperature
based on many factors, such as length, and with increasing GC content. A
simple
formula for calculation of the (Tm) is:
Tin = 4(G + C) + 2(A + T) C
Furthermore, one of skill in the art will appreciate that the actual Tm is
influenced by the concentration of Mg2+, IC+, and cosolvents. There are
numerous
computer programs to assist in primer design.
To achieve the desired melting temperatures, the first nucleic acid sequence,
or
the primer, can be 4, 5, 6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20,
21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40 bases
in length. For
example, the primers can be between about 5 and 26, between about 7 and 22,
between
about 9 and 17 bases in length depending on GC content.
Any desired number of primers of different nucleotide sequence can be used,
but use of one or a few primers is preferred. The amplification reaction can
be
performed with, for example, one, two, three, four, five, six, seven, eight,
nine, ten,
eleven, twelve, thirteen, fourteen, fifteen, sixteen, or seventeen primers.
More primers
can be used. There is no fundamental upper limit to the number of primers that
can be
used. However, the use of fewer primers is preferred. When multiple primers
are used,
the primers should each have a different specific nucleotide sequence.
The amplification reaction can be performed with a single primer and, for
example, with no additional primers, with 1 additional primer, with 2
additional
primers, with 3 additional primers, with 4 additional primers, with 5
additional primers,
with 6 additional primers, with 7 additional primers, with 8 additional
primers, with 9
additional primers, with 10 additional primers, with 11 additional primers,
with 12
additional primers, with 13 additional primers, with 14 additional primers,
with 15
additional primers, with 16 additional primers, with 17 additional primers,
with 18
additional primers, with 19 additional primers, with 20 additional primers,
with 21
additional primers, with 22 additional primers, with 23 additional primers,
with 24
14
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
additional primers, with 25 additional primers, with 26 additional primers,
with 27
additional primers, with 28 additional primers, with 29 additional primers,
with 30
additional primers, with 31 additional primers, with 32 additional primers,
with 33
additional primers, with 34 additional primers, with 35 additional primers,
with 36
additional primers, with 37 additional primers, with 38 additional primers,
with 39
additional primers, with 40 additional primers, with 41 additional primers,
with 42
additional primers, with 43 additional primers, with 44 additional primers,
with 45
additional primers, with 46 additional primers, with 47 additional primers,
with 48
additional primers, with 49 additional primers, with 50 additional primers,
with 51
additional primers, with 52 additional primers, with 53 additional primers,
with 54
additional primers, with 55 additional primers, with 56 additional primers,
with 57
additional primers, with 58 additional primers, with 59 additional primers,
with 60
additional primers, with 61 additional primers, with 62 additional primers,
with 63
additional primers, with 64 additional primers, with 65 additional primers,
with 66
additional primers, with 67 additional primers, with 68 additional primers,
with 69
additional primers, with 70 additional primers, with 71 additional primers,
with 72
additional primers, with 73 additional primers, with 74 additional primers,
with 75
additional primers, with 76 additional primers, with 77 additional primers,
with 78
additional primers, with 79 additional primers, with 80 additional primers,
with 81
additional primers, with 82 additional primers, with 83 additional primers,
with 84
additional primers, with 85 additional primers, with 86 additional primers,
with 87
additional primers, with 88 additional primers, with 89 additional primers,
with 90
additional primers, with 91 additional primers, with 92 additional primers,
with 93
additional primers, with 94 additional primers, with 95 additional primers,
with 96
additional primers, with 97 additional primers, with 98 additional primers,
with 99
additional primers, with 100 additional primers, with 110 additional primers,
with 120
additional primers, with 130 additional primers, with 140 additional primers,
with 150
additional primers, with 160 additional primers, with 170 additional primers,
with 180
additional primers, with 190 additional primers, with 200 additional primers,
with 210
additional primers, with 220 additional primers, with 230 additional primers,
with 240
additional primers, with 250 additional primers, with 260 additional primers,
with 270
additional primers, with 280 additional primers, with 290 additional primers,
with 300
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
additional primers, with 310 additional primers, with 320 additional primers,
with 330
additional primers, with 340 additional piimers, with 350 additional primers,
with 360
additional primers, with 370 additional primers, with 380 additional primers,
with 390
additional primers, with 400 additional primers, with 410 additional primers,
with 420
additional primers, with 430 additional primers, with 440 additional primers,
with 450
additional primers, with 460 additional primers, with 470 additional primers,
with 480
additional primers, with 490 additional primers, with 500 additional primers,
with 550
additional primers, with 600 additional primers, with 650 additional primers,
with 700
additional primers, with 750 additional primers, with 800 additional primers,
with 850
additional primers, with 900 additional primers, with 950 additional primers,
with
1,000 additional primers, with 1,100 additional primers, with 1,200 additional
primers,
with 1,300 additional primers, with 1,400 additional primers, with 1,500
additional
primers, with 1,600 additional primers, with 1,700 additional primers, with
1,800
additional primers, with 1,900 additional primers, with 2,000 additional
primers, with
2,100 additional primers, with 2,200 additional primers, with 2,300 additional
primers,
with 2,400 additional primers, with 2,500 additional primers, with 2,600
additional
primers, with 2,700 additional primers, with 2,800 additional primers, with
2,900
additional primers, with 3,000 additional primers, with 3,500 additional
primers, or
with 4,000 additional primers.
The amplification reaction can be performed with a single primer and, for
example, with no additional primers, with fewer than 2 additional primers,
with fewer
than 3 additional primers, with fewer than 4 additional primers, with fewer
than 5
additional primers, with fewer than 6 additional primers, with fewer than 7
additional
primers, with fewer than 8 additional primers, with fewer than 9 additional
primers,
with fewer than 10 additional primers, with fewer than 11 additional primers,
with
fewer than 12 additional primers, with fewer than 13 additional primers, with
fewer
than 14 additional primers, with fewer than 15 additional primers, with fewer
than 16
additional primers, with fewer than 17 additional primers, with fewer than 18
additional
primers, with fewer than 19 additional primers, with fewer than 20 additional
primers,
with fewer than 21 additional primers, with fewer than 22 additional primers,
with
fewer than 23 additional primers, with fewer than 24 additional primers, with
fewer
than 25 additional primers, with fewer than 26 additional primers, with fewer
than 27
16
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
additional primers, with fewer than 28 additional primers, with fewer than 29
additional
primers, with fewer than 30 additional primers, with fewer than 31 additional
primers,
with fewer than 32 additional primers, with fewer than 33 additional primers,
with
fewer than 34 additional primers, with fewer than 35 additional primers, with
fewer
than 36 additional primers, with fewer than 37 additional primers, with fewer
than 38
additional primers, with fewer than 39 additional primers, with fewer than 40
additional
primers, with fewer than 41 additional primers, with fewer than 42 additional
primers,
with fewer than 43 additional primers, with fewer than 44 additional primers,
with
fewer than 45 additional primers, with fewer than 46 additional primers, with
fewer
than 47 additional primers, with fewer than 48 additional primers, with fewer
than 49
additional primers, with fewer than 50 additional primers, with fewer than 51
additional
primers, with fewer than 52 additional primers, with fewer than 53 additional
primers,
with fewer than 54 additional primers, with fewer than 55 additional primers,
with
fewer than 56 additional primers, with fewer than 57 additional primers, with
fewer
than 58 additional primers, with fewer than 59 additional primers, with fewer
than 60
additional primers, with fewer than 61 additional primers, with fewer than 62
additional
primers, with fewer than 63 additional primers, with fewer than 64 additional
primers,
with fewer than 65 additional primers, with fewer than 66 additional primers,
with
fewer than 67 additional primers, with fewer than 68 additional primers, with
fewer
than 69 additional primers, with fewer than 70 additional primers, with fewer
than 71
additional primers, with fewer than 72 additional primers, with fewer than 73
additional
primers, with fewer than 74 additional primers, with fewer than 75 additional
primers,
with fewer than 76 additional primers, with fewer than 77 additional primers,
with
fewer than 78 additional primers, with fewer than 79 additional primers, with
fewer
than 80 additional primers, with fewer than 81 additional primers, with fewer
than 82
additional primers, with fewer than 83 additional primers, with fewer than 84
additional
primers, with fewer than 85 additional primers, with fewer than 86 additional
primers,
with fewer than 87 additional primers, with fewer than 88 additional primers,
with
fewer than 89 additional primers, with fewer than 90 additional primers, with
fewer
than 91 additional primers, with fewer than 92 additional primers, with fewer
than 93
additional primers, with fewer than 94 additional primers, with fewer than 95
additional
primers, with fewer than 96 additional primers, with fewer than 97 additional
primers,
17
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
with fewer than 98 additional primers, with fewer than 99 additional primers,
with
fewer than 100 additional primers, with fewer than 110 additional primers,
with fewer
than 120 additional primers, with fewer than 130 additional primers, with
fewer than
140 additional primers, with fewer than 150 additional primers, with fewer
than 160
additional primers, with fewer than 170 additional primers, with fewer than
180
additional primers, with fewer than 190 additional primers, with fewer than
200
additional primers, with fewer than 210 additional primers, with fewer than
220
additional primers, with fewer than 230 additional primers, with fewer than
240
additional primers, with fewer than 250 additional primers, with fewer than
260
additional primers, with fewer than 270 additional primers, with fewer than
280
additional primers, with fewer than 290 additional primers, with fewer than
300
additional primers, with fewer than 310 additional primers, with fewer than
320
additional primers, with fewer than 330 additional primers, with fewer than
340
additional primers, with fewer than 350 additional primers, with fewer than
360
additional primers, with fewer than 370 additional primers, with fewer than
380
additional primers, with fewer than 390 additional primers, with fewer than
400
additional primers, with fewer than 410 =additional primers, with fewer than
420
additional primers, with fewer than 430 additional primers, with fewer than
440
additional primers, with fewer than 450 additional primers, with fewer than
460
additional primers, with fewer than 470 additional primers, with fewer than
480
additional primers, with fewer than 490 additional primers, with fewer than
500
additional primers, with fewer than 550 additional primers, with fewer than
600
additional primers, with fewer than 650 additional primers, with fewer than
700
additional primers, with fewer than 750 additional primers, with fewer than
800
additional primers, with fewer than 850 additional primers, with fewer than
900
additional primers, with fewer than 950 additional primers, with fewer than
1,000
additional primers, with fewer than 1,100 additional primers, with fewer than
1,200
additional primers, with fewer than 1,300 additional primers, with fewer than
fewer
than 1,400 additional primers, with fewer than 1,500 additional primers, with
fewer
than 1,600 additional primers, with fewer than 1,700 additional primers, with
fewer
than 1,800 additional primers, with fewer than 1,900 additional primers, with
fewer
than 2,000 additional primers, with fewer than 2,100 additional primers, with
fewer
18
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
than 2,200 additional primers, with fewer than 2,300 additional primers, with
fewer
than 2,400 additional primers, with fewer than 2,500 additional primers, with
fewer
than 2,600 additional primers, with fewer than 2,700 additional primers, with
fewer
than 2,800 additional primers, with fewer than 2,900 additional primers, with
fewer
than 3,000 additional primers, with fewer than 3,500 additional primers, or
with fewer
than 4,000 additional primers.
The __________ mplification reaction can be performed, for example, with
fewer than 2
primers, with fewer than 3 primers, with fewer than 4 primers, with fewer than
5
primers, with fewer than 6 primers, with fewer than 7 primers, with fewer than
8
primers, with fewer than 9 primers, with fewer than 10 primers, with fewer
than 11
primers, with fewer than 12 primers, with fewer than 13 primers, with fewer
than 14
primers, with fewer than 15 primers, with fewer than 16 primers, with fewer
than 17
primers, with fewer than 18 primers, with fewer than 19 primers, with fewer
than 20
primers, with fewer than 21 primers, with fewer than 22 primers, with fewer
than 23
primers, with fewer than 24 primers, with fewer than 25 primers, with fewer
than 26
primers, with fewer than 27 primers, with fewer than 28 primers, with fewer
than 29
primers, with fewer than 30 primers, with fewer than 31 primers, with fewer
than 32
primers, with fewer than 33 primers, with fewer than 34 primers, with fewer
than 35
primers, with fewer than 36 primers, with fewer than 37 primers, with fewer
than 38
primers, with fewer than 39 primers, with fewer than 40 primers, with fewer
than 41
primers, with fewer than 42 primers, with fewer than 43 primers, with fewer
than 44
primers, with fewer than 45 primers, with fewer than 46 primers, with fewer
than 47
primers, with fewer than 48 primers, with fewer than 49 primers, with fewer
than 50
primers, with fewer than 51 primers, with fewer than 52 primers, with fewer
than 53
primers, with fewer than 54 primers, with fewer than 55 primers, with fewer
than 56
primers, with fewer than 57 primers, with fewer than 58 primers, with fewer
than 59
primers, with fewer than 60 primers, with fewer than 61 primers, with fewer
than 62
primers, with fewer than 63 primers, with fewer than 64 primers, with fewer
than 65
primers, with fewer than 66 primers, with fewer than 67 primers, with fewer
than 68
primers, with fewer than 69 primers, with fewer than 70 primers, with fewer
than 71
primers, with fewer than 72 primers, with fewer than 73 primers, with fewer
than 74
primers, with fewer than 75 primers, with fewer than 76 primers, with fewer
than 77
19
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
primers, with fewer than 78 primers, with fewer than 79 primers, with fewer
than 80
primers, with fewer than 81 primers, with fewer than 82 primers, with fewer
than 83
primers, with fewer than 84 primers, with fewer than 85 primers, with fewer
than 86
primers, with fewer than 87 primers, with fewer than 88 primers, with fewer
than 89
primers, with fewer than 90 primers, with fewer than 91 primers, with fewer
than 92
primers, with fewer than 93 primers, with fewer than 94 primers, with fewer
than 95
primers, with fewer than 96 primers, with fewer than 97 primers, with fewer
than 98
primers, with fewer than 99 primers, with fewer than 100 primers, with fewer
than 110
primers, with fewer than 120 primers, with fewer than 130 primers, with fewer
than
140 primers, with fewer than 150 primers, with fewer than 160 primers, with
fewer
than 170 primers, with fewer than 180 primers, with fewer than 190 primers,
with
fewer than 200 primers, with fewer than 210 primers, with fewer than 220
primers,
with fewer than 230 primers, with fewer than 240 primers, with fewer than 250
primers, with fewer than 260 primers, with fewer than 270 primers, with fewer
than
280 primers, with fewer than 290 primers, with fewer than 300 primers, with
fewer
than 310 primers, with fewer than 320 primers, with fewer than 330 primers,
with
fewer than 340 primers, with fewer than 350 primers, with fewer than 360
primers,
with fewer than 370 primers, with fewer than 380 primers, with fewer than 390
primers, with fewer than 400 primers, with fewer than 410 primers, with fewer
than
420 primers, with fewer than 430 printers, with fewer than 440 primers, with
fewer
than 450 primers, with fewer than 460 primers, with fewer than 470 primers,
with
fewer than 480 primers, with fewer than 490 primers, with fewer than 500
primers,
with fewer than 550 primers, with fewer than 600 primers, with fewer than 650
primers, with fewer than 700 primers, with fewer than 750 primers, with fewer
than
800 primers, with fewer than 850 primers, with fewer than 900 primers, with
fewer
than 950 primers, with fewer than 1,000 primers, with fewer than 1,100
primers, with
fewer than 1,200 primers, with fewer than 1,300 primers, with fewer than fewer
than
1,400 primers, with fewer than 1,500 primers, with fewer than 1,600 primers,
with
fewer than 1,700 primers, with fewer than 1,800 primers, with fewer than 1,900
primers, with fewer than 2,000 primers, with fewer than 2,100 primers, with
fewer than
2,200 primers, with fewer than 2,300 primers, with fewer than 2,400 primers,
with
fewer than 2,500 primers, with fewer than 2,600 primers, with fewer than 2,700
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
primers, with fewer than 2,800 primers, with fewer than 2,900 primers, with
fewer than
3,000 primers, with fewer than 3,500 primers, or with fewer than 4,000
primers.
The disclosed primers can have one or more modified nucleotides. Such
primers are referred to herein as modified primers. Chimeric primers can also
be used.
Chimeric primers are primers having at least two types of nucleotides, such as
both
deoxyribonucleotides and ribonucleotides, ribonucleotides and modified
nucleotides,
two or more types of modified nucleotides, deoxyribonucleotides and two or
more
different types of modified nucleotides, ribonucleotides and two or more
different types
of modified nucleotides, or deoxyribonucleotides, ribonucleotides and two or
more
different types of modified nucleotides. One form of chimeric primer is
peptide nucleic
acid/nucleic acid primers. For example, 5'-PNA-DNA-3' or 5'-PNA-RNA-3' primers
may be used for more efficient strand invasion and polymerization invasion.
Other
forms of chimeric primers are, for example, 5'- (2'-0-Methyl) RNA-RNA-3' or 5'-
(2'-
0-Methyl) RNA-DNA-3'.
Many modified nucleotides (nucleotide analogs) are known and can be used in
oligonucleotides. A nucleotide analog is a nucleotide which contains some type
of
modification to either the base, sugar, or phosphate moieties. Modifications
to the base
moiety would include natural and synthetic modifications of A, C, G, and T/U
as well
as different purine or pyrirnidine bases, such as uracil-5-yl, hypoxanthin-9-
y1 (I), and
2-aminoadenin-9-yl. A modified base includes but is not limited to 5-
methylcytosine
. (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and
other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-
thiocytosine,
5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil,
cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-
thioalkyl,
8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly
5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-
methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-
deazaadenine
and 3-deazaguanine and 3-deazaadenine. Additional base modifications can be
found
for example in U.S. Pat. No. 3,687,808, Englisch et al., Angewandte Chemie,
International Edition, 1991, 30, 613, and Sanghvi, Y. S., Chapter 15,
Antisense
Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed.,
CRC
21
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Press, 1993. Certain nucleotide analogs, such as 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including
2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-
methylcytosine can
increase the stability of duplex formation. Other modified bases are those
that function
as universal bases. Universal bases include 3-nitropyrrole and 5-nitroindole.
Universal
bases substitute for the normal bases but have no bias in base pairing. That
is, universal
bases can base pair with any other base. A primer having one or more universal
bases
is not considered to be a primer having a specific sequence.
Base modifications often can be combined with for example a sugar
modification, such as 2'-0-methoxyethyl, to achieve unique properties such as
increased duplex stability. There are numerous United States patents such as
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187;
5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121,
5,596,091; 5,614,617; and 5,681,941, which detail and describe a range of base
modifications. Each of these patents is herein incorporated by reference.
Nucleotide analogs can also include modifications of the sugar moiety.
Modifications to the sugar moiety would include natural modifications of the
ribose and
deoxyribose as well as synthetic modifications. Sugar modifications include
but are not
limited to the following modifications at the 2' position: OH; F; 0-, S-, or N-
alkyl; 0-,
S-, or N-alkenyl; 0-, S- or N-alkynyl; or 0-alkyl-0-alkyl, wherein the alkyl,
alkenyl
and alkynyl may be substituted or unsubstituted Cl to C10, alkyl or C2 to C10
alkenyl
and alkynyl. 2' sugar modifications also include but are not limited to -
ORCH2)n OJm
CH3, -0(CH2)n OCH3, -0(CH/)n NH2, -0(CH2)n CH3, -0(CH2)n -0N112, and -
0(CH2)nONRCH2)n CH3)]2, where n and m are from 1 to about 10.
Other modifications at the 2' position include but are not limited to: Cl to
C10
lower alkyl, substituted lower alkyl, alkaryl, aralkyl, 0-alkaryl or 0-
ara1kyl, SH, SCH3,
OCN, CI, Br, CN, CF3, OCF3, SOCH3, SO2 CH3, 0NO2, NO2, N3, NH2,
heterocycloa1kyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino,
substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a group for
improving
the pharmacokinetic properties of an oligonucleotide, or a group for improving
the
pharmacodynamic properties of an oligonucleotide, and other substituents
having
similar properties. Similar modifications may also be made at other positions
on the
22
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide
or in 2'-5'
linked oligonucleotides and the 5' position of 5' terminal nucleotide.
Modified sugars
would also include those that contain modifications at the bridging ring
oxygen, such as
CH2 and S. Nucleotide sugar analogs may also have sugar mimetics such as
cyclobutyl
moieties in place of the pentofuranosyl sugar. There are numerous United
States
patents that teach the preparation of such modified sugar structures such as
4,981,957;
5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is
herein
incorporated by reference in its entirety.
Nucleotide analogs can also be modified at the phosphate moiety. Modified
phosphate moieties include but are not limited to those that can be modified
so that the
linkage between two nucleotides contains a phosphorothioate, chiral
phosphorothioate,
phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and
other alkyl
phosphonates including 3'-alkylene phosphonate and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates. It is understood that these
phosphate or modified phosphate linkages between two nucleotides can be
through a
3'-5' linkage or a 2'-5' linkage, and the linkage can contain inverted
polarity such as
3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid
forms are also
included. Numerous United States patents teach how to make and use nucleotides
containing modified phosphates and include but are not limited to, 3,687,808;
4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253;
5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by
reference.
It is understood that nucleotide analogs need only contain a single
modification,
but may also contain multiple modifications within one of the moieties or
between
different moieties.
23
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Nucleotide substitutes are molecules having similar functional properties to
nucleotides, but which do not contain a phosphate moiety, such as peptide
nucleic acid
(PNA). Nucleotide substitutes are molecules that will recogni7e and hybridize
to
complementary nucleic acids in a Watson-Crick or Hoogsteen manner, but which
are
linked together through a moiety other than a phosphate moiety. Nucleotide
substitutes
are able to conform to a double helix type structure when interacting with the
appropriate nucleic acid molecules.
Nucleotide substitutes are nucleotides or nucleotide analogs that have had the
phosphate moiety and/or sugar moieties replaced. Nucleotide substitutes do not
contain
a standard phosphorus atom. Substitutes for the phosphate can be for example,
short
chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl
or
cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or
heterocyclic intemucleoside linkages. These include those having morpholino
linkages
(formed in part from the sugar portion of a nucleoside); siloxane backbones;
sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones;
methylene
forrnacetyl and thioformacetyl backbones; alkene containing backbones;
sulfamate
backbones; methyleneirnino and methylenehydrazino backbones; sulfonate and
sulfonamide backbones; amide backbones; and others having mixed N, 0, S and
CH2
component parts. Numerous United States patents disclose how to make and use
these
types of phosphate replacements and include but are not limited to 5,034,506;
5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564;
5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704;
5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is
herein
incorporated by reference.
It is also understood in a nucleotide substitute that both the sugar and the
phosphate moieties of the nucleotide can be replaced, by for example an amide
type
linkage (aminoethylglycine) (PNA). United States patents 5,539,082; 5,714,331;
and
5,719,262 teach how to make and use PNA molecules, each of which is herein
incorporated by reference. (See also Nielsen et al., Science 254:1497-1500
(1991)).
Primers can be comprised of nucleotides and can be made up of different types
of nucleotides or the same type of nucleotides. For example, one or more of
the
24
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
nucleotides in a primer can be ribonucleotides, T-0-methyl ribonucleotides, or
a
mixture of ribonucleotides and 2t-0-methyl ribonucleotides; about 10% to about
50%
of the nucleotides can be ribonucleotides, 2t-0-methy1 ribonucleotides, or a
mixture of
ribonucleotides and 2t-0-methyl ribonucleotides; about 50% or more of the
nucleotides
can be ribonucleotides, 2t-0-methyl ribonucleotides, or a mixture of
ribonucleotides
and 2t-0-methyl ribonucleotides; or all of the nucleotides are
ribonucleotides, 2'-0-
methyl ribonucleotides, or a mixture of ribonucleotides and 2t-0-methyl
ribonucleotides. The nucleotides can be comprised of bases (that is, the base
portion of
the nucleotide) and can (and normally will) comprise different types of bases.
Capture Sequence Design
The capture sequence, also referred to herein as the "second nucleic acid
sequence," is complementary to the template such that it hybridizes to the
target nucleic
acid molecule downstream from the 3' end of the primer. In some embodiments,
resistance to mutations in the target nucleic acid is desired and the capture
sequence is
designed with a melting temperature greater than the reaction temperature. In
these
embodiments, the capture sequence is designed with an isolated Tm of 1, 2, 3,
4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or
50 or more
degrees above the reaction temperature. For example, the capture, or second,
sequence
is between about 0 C and 40 C, between about 5 C and 30 C, between about 7 C
and
C above the reaction temperature. In some embodiments, the predicted melting
temperature of the capture sequence is also made for expected mutants. In
these
embodiments, the isolated Tm of the capture sequence to the expected mutants
is
25 between about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 16, 17,
18, 19, 20, or more
degrees C below the reaction temperature, or 10, 11, 12, 13, 14,1 5, 16, 17,
18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43,
44, 45, 46, 47, 48, 49, and 50 or more degrees C above the reaction
temperature. For
example, it can be 10 C below the reaction temperature and 30 C above the
reaction
temperature, between about 3'C below the reaction temperature and about 10 C
above
the reaction temperature.
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
To achieve these melting temperatures, the capture sequence length can be 4,
5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53,
54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72,
73, 74, or 75 or
more bases in length. For example, it can be between about 20 and about 50,
between
about 22 and about 40, between about 23 and about 37 bases.
In some embodiments, an even higher resistance to mutations in the target
sequence is desired. In these embodiments, in addition to a capture sequence
with an
isolated Tm of between about 0 C and 40 C above the reaction temperature, the
cooperative primer is designed with an isolated Tm of between about 7 C below
and
about 20 C above, between about 5 C below and about 10 C above, between about
3 C
below and about 3 C above the reaction temperature. The cooperative
interaction
between the primer and the capture sequence will result in an even greater
effective Tm
for the cooperative primer, rendering it almost impervious to mutations in the
sequence.
By comparison, a normal primer might have to be an additional 5 to 30 bases in
length
to have an equivalent resistance to mutations in the target sequence, and
consequently,
would be much more susceptible to primer-dimer formation.
In other embodiments, a higher resistance to primer-dimers is preferred and
the
melting temperature of the isolated capture, or second, nucleic acid sequence
is
designed to be less than the reaction temperature. For example, the capture,
or second,
nucleic acid sequence is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43,
44, 45, 46, 47, 48, 49, or 50 or more degrees below the reaction temperature,
or
annealing phase, of PCR .In preferred embodiments, the Tm of the isolated
capture, or
second nucleic acid, sequence is between about 0 C and 12 C, between about 1 C
and
8 C, between about 2 C and 5 C below the reaction temperature. To achieve
these low
melting temperatures, the capture sequence length can be 4, 5, 6, 7, 8, 9, 10,
11, 12, 13,
14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 or more bases in
length. For
example, the capture, or second nucleic acid sequence, can be between about 5
and 30,
between about 8 and 25, and between about 10 and 22 bases.
26
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
In some embodiments, the capture sequence binds and releases the target
sequence rapidly such that the polymerase can extend underneath the capture
sequence,
leaving the capture sequence intact. In some embodiments, this is enhanced
using a
cooperative primer with the linker attached to the 5' end of the capture
sequence. In a
preferred embodiment, the polymerase is capable of cleaving the capture
sequence
during extension. In a preferred embodiment, this is enhanced using a
cooperative
primer with the linker attached to the 3' end of the capture sequence.
Linker
The number of bases between the 3' end of the first nucleic acid, or primer,
sequence and the 5' end of the second nucleic acid, or capture sequence
hybridization
locations in the template is important. In some embodiments, the number of
bases
between the primer and the capture sequence is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13,
14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. For example, they
can be
between about 0 and 30, between about 0 and 20, between about 0 and 10 bases.
The more bases that are between the two sites, the longer the linker needs to
be
if cleavage of the capture sequence is desired. The longer the linker, the
more entropy
that enters into the system, which lowers the effect of cooperative binding.
This is
expressed in the following equation:
Keil Kprzmer Kraptwv LCKprimerKcenature
Where Keff is the effective or cooperative equilibrium constant, Kprimer is
the
equilibrium constant of the primer in isolation, Kcapture is the equilibrium
constant of
the capture sequence in equilibrium and Lc is the local concentration defined
as:
Lc
L. 1
= 022E73)
4
-3 Irra
27
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Where r is the linker length in decimeters. This provides the effective local
concentration in molarity due to the cooperative interaction between the
primer and the
probe. Accordingly, linker length directly determines the cooperative
contribution
(LcKprimericapture) to the effective equilibrium constant.
Kprimer and Kcapture can be calculated by obtaining the enthalpy and entropy
values for the primer and the capture sequences using nearest neighbor or
other
calculations known to those skilled in the art.
The total amount of template bound by the primer can be calculated as follows:
primer Orprimer LCKprErnorkaptura3Po
I I+ Kr= -4- Kcar,..tEms- Lcic ri Icaptu )Pe
Where Tprimer is the template bound by primer, To is the total amount of
template and Po is the starting cooperative primer concentration. It can be
seen that the
cooperative effect is greatest when LeKpri,õõKcaptoõ is much greater than
Kper. For this
to occur the linker length should be as short as possible.
While the math shows that the linker length should be as short as possible,
there
are several limitations to how short the linker can actually be. When the
capture
sequence and the probe bind to the template, they form rigid double helices.
The linker
length must be sufficient to accommodate this structure.
In some embodiments, the linker attaches the 5' end of the primer to the 3'
end
of the capture sequence (Figure 2). In this embodiment, the linker is larger
than the
combined length of the primer and capture sequences. In a preferred embodiment
where the linker attaches to the 3' end of the capture sequence, the linker
comprises 6
hexaethylene glycols. In another embodiment, the primer is inverted such that
the 5'
end of the primer is attached to the 5' end of the capture sequence (Figure
3). In this
embodiment, the linker is longer than the primer. In a preferred embodiment
where the
linker attaches to the 5' end of the capture sequence, the linker comprises 3
hexaethylene glycols. In yet another embodiment, the 3' end of the capture
sequence is
linked to the middle of the primer (Figure 1). In this instance, the linker
may be shorter
than the length of the primer.
28
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
A variety of linker types and compositions are known to those skilled in the
art.
Examples include, but are not limited to, polyethylene glycol and carbon
linkers.
Linkers can be attached through a variety of methods, including but not
limited to,
covalent bonds, ionic bonds, hydrogen bonding, polar association, magnetic
association, and van der wals association. A preferred method is covalent
bonding
through standard DNA synthesis methods.
The length of polyethylene glycol linkers is about 0.34 nm per monomer. In
some embodiments, the length of the polyethylene glycol linker is between
about 1 and
90, between about 2 and 50, between about 3 and 30 monomers (between about 1
and
10 nm fully extended).
Using the Capture Sequence as a Probe
In some embodiments, it is preferable to have the capture sequence also serve
as
a probe. In some embodiments, this is done through the addition of one or more
labels
to the capture sequence. In a preferred embodiment, the labels include a FRET
pair.
Various nucleic acid probe constructs are known to those skilled in the art.
These include, but are not limited to, dual labeled probes, hairpin probes,
and single
label probes (see Figure 4).
In some embodiments, a low background signal is desired for high signal to
noise ratios. In some embodiments, a hairpin probe is used to provide
increased contact
quenching to assist in providing high signal to noise.
In other embodiments, a shorter probe is desired to minimize primer-probe
dimers. In some embodiments requiring a shorter probe, a dual labeled probe is
used.
In embodiments that require an even greater emphasis on the reduction of
spurious
extension products, the melting temperature of the isolated probe target
complex is less
than the reaction temperature.
A variety of methods for detecting signal from labeled probes are known to
those skilled in the art. In some embodiments a polymerase is used that
cleaves the
probe, releasing a label that changes the signal. In other embodiments, a
polymerase is
used that does not cleave the probe. Rather the signal is modified by the
hybridization
of the probe to the template.
29
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Using a Primer with a built in detection mechanism
In some embodiments, the primer has a built in detection mechanism. In some
embodiments the detection mechanism includes one or more detectable labels. In
a
preferred embodiment, the detection mechanism includes a FRET pair. Examples
of
primers with built in detection mechanisms include, but are not limited to,
Amplifluor
primers, Rapid Detex primers, and others known to those skilled in the art. An
example
of this is seen in Figure 7.
Cooperative nucleic acids with built in detection mechanisms can be more
useful to assay designers than non-cooperative nucleic acids (normal primers)
with
built in detection mechanisms. Without being limited by theory, this is
because
cooperative nucleic acids are less prone to generate signal from nonspecific
products,
such as primer-dimers.
In some embodiments, a nucleic acid binding dye, such as SYBR Green, is used
to monitor the progress of the amplification reaction.
Fluorescent change probes and fluorescent change primers refer to all probes
and primers that involve a change in fluorescence intensity or wavelength
based on a
change in the form or conformation of the probe or primer and nucleic acid to
be
detected, assayed or replicated. Examples of fluorescent change probes and
primers
include molecular beacons, Amplifluors, FRET probes, cleavable FRET probes,
TaqMan probes, scorpion primers, fluorescent triplex oligos, fluorescent water-
soluble
conjugated polymers, PNA probes and QPNA probes.
Fluorescent change probes and primers can be classified according to their
structure and/or function. Fluorescent change probes include hairpin quenched
probes,
cleavage quenched probes, cleavage activated probes, and fluorescent activated
probes.
Fluorescent change primers include stem quenched primers and hairpin quenched
primers. The use of several types of fluorescent change probes and primers are
reviewed in Schweitzer and Kingsmore, Cu. Opin. Biotech.= 12:21-27 (2001).
Hall et
al., Proc. Natl. Acad. Sci. USA 97:8272-8277 (2000), describe the use of
fluorescent
change probes with Invader assays.
Hairpin quenched probes are probes that when not bound to a target sequence
form a hairpin structure (and, typically, a loop) that brings a fluorescent
label and a
quenching moiety into proximity such that fluorescence from the label is
quenched.
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
When the probe binds to a target sequence, the stem is disrupted, the
quenching moiety
is no longer in proximity to the fluorescent label and fluorescence increases.
Examples
of hairpin quenched probes are molecular beacons, fluorescent triplex oligos,
and
QPNA probes.
Cleavage activated probes are probes where fluorescence is increased by
cleavage of the probe. Cleavage activated probes can include a fluorescent
label and a
quenching moiety in proximity such that fluorescence from the label is
quenched.
When the probe is clipped or digested (typically by the 5'-3 exonuclease
activity of a
polymerase during amplification), the quenching moiety is no longer in
proximity to
the fluorescent label and fluorescence increases. TaqMan probes (Holland et
al., Proc.
Natl. Acad. Sci. USA 88:7276-7280 (1991)) are an example of cleavage activated
probes.
Cleavage quenched probes are probes where fluorescence is decreased or
altered by cleavage of the probe. Cleavage quenched probes can include an
acceptor
fluorescent label and a donor moiety such that, when the acceptor and donor
are in
proximity, fluorescence resonance energy transfer from the donor to the
acceptor
causes the acceptor to fluoresce. The probes are thus fluorescent, for
example, when
hybridized to a target sequence. When the probe is clipped or digested
(typically by the
51-3' exonuclease activity of a polymerase during amplification), the donor
moiety is no
longer in proximity to the acceptor fluorescent label and fluorescence from
the acceptor
decreases. If the donor moiety is itself a fluorescent label, it can release
energy as
fluorescence (typically at a different wavelength than the fluorescence of the
acceptor)
when not in proximity to an acceptor. The overall effect would then be a
reduction of
acceptor fluorescence and an increase in donor fluorescence. Donor
fluorescence in the
case of cleavage quenched probes is equivalent to fluorescence generated by
cleavage
activated probes with the acceptor being the quenching moiety and the donor
being the
fluorescent label. Cleavable FRET (fluorescence resonance energy transfer)
probes are
an example of cleavage quenched probes.
Fluorescent activated probes are probes or pairs of probes where fluorescence
=is
increased or altered by hybridization of the probe to a target sequence.
Fluorescent
activated probes can include an acceptor fluorescent label and a donor moiety
such that,
when the acceptor and donor are in proximity (when the probes are hybridized
to a
31
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
target sequence), fluorescence resonance energy transfer from the donor to the
acceptor
causes the acceptor to fluoresce. Fluorescent activated probes are typically
pairs of
probes designed to hybridize to adjacent sequences such that the acceptor and
donor are
brought into proximity. Fluorescent activated probes can also be single probes
containing both a donor and acceptor where, when the probe is not hybridized
to a
target sequence, the donor and acceptor are not in proximity but where the
donor and
acceptor are brought into proximity when the probe hybridized to a target
sequence.
This can be accomplished, for example, by placing the donor and acceptor on
opposite
ends a the probe and placing target complement sequences at each end of the
probe
where the target complement sequences are complementary to adjacent sequences
in a
target sequence. If the donor moiety of a fluorescent activated probe is
itself a
fluorescent label, it can release energy as fluorescence (typically at a
different
wavelength than the fluorescence of the acceptor) when not in proximity to an
acceptor
(that is, when the probes are not hybridized to the target sequence). When the
probes
hybridize to a target sequence, the overall effect would then be a reduction
of donor
fluorescence and an increase in acceptor fluorescence. FRET probes are an
example of
fluorescent activated probes.
Stem quenched primers are primers that when not hybridized to a
complementary sequence form a stem structure (either an intramolecular stem
structure
or an intermolecular stem structure) that brings a fluorescent label and a
quenching
moiety into proximity such that fluorescence from the label is quenched. When
the
primer binds to a complementary sequence, the stem is disrupted, the quenching
moiety
is no longer in proximity to the fluorescent label and fluorescence increases.
In the
disclosed method, stem quenched primers are used as primers for nucleic acid
synthesis
and thus become incorporated into the synthesized or amplified nucleic acid.
Examples
of stem quenched primers are peptide nucleic acid quenched primers and hairpin
quenched primers.
Peptide nucleic acid quenched primers are primers associated with a peptide
nucleic acid quencher or a peptide nucleic acid fluor to form a stem
structure. The
primer contains a fluorescent label or a quenching moiety and is associated
with either
a peptide nucleic acid quencher or a peptide nucleic acid fluor, respectively.
This puts
the fluorescent label in proximity to the quenching moiety. When the primer is
32
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
replicated, the peptide nucleic acid is displaced, thus allowing the
fluorescent label to
produce a fluorescent signal.
Hairpin quenched primers are primers that when not hybridized to a
complementary sequence form a hairpin structure (and, typically, a loop) that
brings a
fluorescent label and a quenching moiety into proximity such that fluorescence
from
the label is quenched. When the primer binds to a complementary sequence, the
stem is
disrupted, the quenching moiety is no longer in proximity to the fluorescent
label and
fluorescence increases. Hairpin quenched primers are typically used as primers
for
nucleic acid synthesis and thus become incorporated into the synthesized or
amplified
nucleic acid. Examples of hairpin quenched primers are Amplifluor primers
(Nazerenko et al., Nucleic Acids Res. 25:2516-2521 (1997)) and scorpion
primers
(Thelwell et al., Nucleic Acids Res. 28(19):3752-3761 (2000)).
Cleavage activated primers are similar to cleavage activated probes except
that
they are primers that are incorporated into replicated strands and are then
subsequently
cleaved. Little et al., Clin. Chem. 45:777-784 (1999), describe the use of
cleavage
activated primers.
Multiplexing with ARMS
In some embodiments, detection of multiple polymorphisms, insertions,
deletions or other mutations is desired. In some embodiments, the primer is
designed
such that the base on the 3' end is over the mutation. In some embodiments,
additional
intentional polymorphisms are designed into the primer. In one embodiment, the
presence of a probe attached to the primer allows for allele specific real-
time detection
of multiple polymorphisms in the same location.
Mutation differentiation with the Probe
In some embodiments the differentiation of polymorphisms is accomplished
using the capture sequence attached to the primer. In some embodiments the
capture
sequence has additional mutations intentionally added to improve
differentiation. In
some embodiments, the capture sequence will not bind when a polymorphism is
present, preventing efficient amplification round after around. In some
embodiments
33
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
where the capture sequence has a detectable label, even if some amplification
does
occur, the capture sequence does not bind sufficiently to generate a
detectable signal.
RNA and other reactions
In some embodiments, a polymerase other than a DNA polymerase is used. A
variety of polymerases and enzymes capable of adding one or more bases to a
nucleic
acid template are known to those skilled in the art. In some embodiments,
reverse
transcription is desired. In some embodiments, the probe has a sufficiently
low melting
temperature that the polymerase can extend underneath it. In other
embodiments, an
increase in the temperature after a time for initial polymerization removes
the capture
sequence from the template, allowing the polymerase to extend. In other
embodiments,
additional primer sequences are used that do not have a capture sequence,
allowing the
polymerase to make copies in an uninhibited fashion at lower reaction
temperatures.
Target Nucleic Acid Molecules
Nucleic acid molecules, which are the object of amplification, can be any
nucleic acid from any source. In general, the disclosed method is performed
using a
nucleic acid sample that contains (or is suspected of containing) nucleic acid
molecules
to be amplified.
A nucleic acid sample can be any nucleic acid sample of interest. The source,
identity, and preparation of many such nucleic acid samples are known. It is
preferred
that nucleic acid samples known or identified for use in amplification or
detection
methods be used for the method described herein. The nucleic acid sample can
be, for
example, a nucleic acid sample from one or more cells, tissue, or bodily
fluids such as
blood, urine, semen, lymphatic fluid, cerebrospinal fluid, or amniotic fluid,
or other
biological samples, such as tissue culture cells, buccal swabs, mouthwash,
stool, tissues
slices, biopsy aspiration, and archeological samples such as bone or mummified
tissue.
Types of useful nucleic acid samples include blood samples, urine samples,
semen
samples, lymphatic fluid samples, cerebrospinal fluid samples, amniotic fluid
samples,
biopsy samples, needle aspiration biopsy samples, cancer samples, tumor
samples,
tissue samples, cell samples, cell lysate samples, a crude cell lysate
samples, forensic
samples, archeological samples, infection samples, nosocomial infection
samples,
34
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
production samples, drug preparation samples, biological molecule production
samples,
protein preparation samples, lipid preparation samples, and/or carbohydrate
preparation
samples.
For whole genome amplification, preferred nucleic acid samples are nucleic
acid samples from a single cell. The nucleic acid samples for use in the
disclosed
method are preferably nucleic acid molecules and samples that are complex and
non-
repetitive. Where the nucleic acid sample is a genomic nucleic acid sample,
the genome
can be the genome from any organism of interest. For example, the genome can
be a
viral genome, a bacterial genome, a eubacterial genome, an archae bacterial
genome, a
fungal genome, a microbial genome, a eukaryotic genome, a plant genome, an
animal
genome, a vertebrate genome, an invertebrate genome, an insect genome, a
mammalian
genome, or a human genome. The target genome is preferably pure or
substantially
pure, but this is not required. For example, an genomic sample from an animal
source
may include nucleic acid from contaminating or infecting organisms.
The nucleic acid sample can be, or can be derived from, for example, one or
more whole genomes from the same or different organisms, tissues, cells or a
combination; one or more partial genomes from the same or different organisms,
tissues, cells or a combination; one or more whole chromosomes from the same
or
different organisms, tissues, cells or a combination; one or more partial
chromosomes
from the same or different organisms, tissues, cells or a combination; one or
more
chromosome fragments from the same or different organisms, tissues, cells or a
combination; one or more artificial chromosomes; one or more yeast artificial
chromosomes; one or more bacterial artificial chromosomes; one or more
cosmids; or
any combination of these.
Oligonucieotide Synthesis
Primers, detection probes, address probes, and any other oligonucleotides can
be synthesized using established oligonucleotide synthesis methods. Methods to
produce or synthesize oligonucleotides are well known in the art. Such methods
can
range from standard enzymatic digestion followed by nucleotide fragment
isolation (see
for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd
Edition
(Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) Chapters
5, 6)
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
to purely synthetic methods, for example, by the cyanoethyl phosphoramidite
method.
Solid phase chemical synthesis of DNA fragments is routinely performed using
protected nucleoside cyanoethyl phosphoramidites (S. L. Beaucage et al. (1981)
Tetrahedron Lett. 22:1859). In this approach, the 3'-hydroxyl group of an
initial 5'-
protected nucleoside is first covalently attached to the polymer support (R.
C. Pless et
al. (1975) Nucleic Acids Res. 2:773 (1975)). Synthesis of the oligonucleotide
then
proceeds by deprotection of the 5'-hydroxyl group of the attached nucleoside,
followed
by coupling of an incoming nucleoside-3`-phosphoramidite to the deprotected
hydroxyl
group (M. D. Matteucci et a. (1981) J. Am. Chem. Soc. 103:3185). The resulting
phosphite triester is finally oxidized to a phosphorotriester to complete the
intemucleotide bond (R. L. Letsinger et al. (1976) J. Am. Chem. Soc. 9:3655).
Alternatively, the synthesis of phosphorothioate linkages can be carried out
by
sulfurization of the phosphite triester. Several chemicals can be used to
perform this
reaction, among them 3H-1,2-benzodithiole-3-one, 1,1-dioxide (R.P. Iyer, W.
Egan,
J.B. Regan, and S.L. Beaucage, J. Am. Chem. Soc., 1990, 112, 1253-1254). The
steps
of deprotection, coupling and oxidation are repeated until an oligonucleotide
of the
desired length and sequence is obtained. Other methods exist to generate
oligonucleotides such as the H-phosphonate method (Hall et al, (1957) J. Chem.
Soc.,
3291-3296) or the phosphotriester method as described by Ikuta et al., Ann.
Rev.
Biochem. 53:323-356 (1984), (phosphotriester and phosphite-triester methods),
and
Narang et al., Methods Enzymol., 65:610-620 (1980), (phosphotriester method).
Protein nucleic acid molecules can be made using known methods such as those
described by Nielsen et al., Bioconjug. Chem. 5:3-7 (1994). Other forms of
oligonucleotide synthesis are described in U.S. Patent No. 6,294,664 and U.S.
Patent
No. 6,291,669.
The nucleotide sequence of an oligonucleotide is generally determined by the
sequential order in which subunits of subunit blocks are added to the
oligonucleotide
chain during synthesis. Each round of addition can involve a different,
specific
nucleotide precursor, or a mixture of one or more different nucleotide
precursors. For
the disclosed primers of specific sequence, specific nucleotide precursors
would be
added sequentially.
36
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Many of the oligonucleotides described herein are designed to be
complementary to certain portions of other oligonucleotides or nucleic acids
such that
stable hybrids can be formed between them. The stability of these hybrids can
be
calculated using known methods such as those described in Lesnick and Freier,
Biochemistry 34:10807-10815 (1995), McGraw et al., Biotechniques 8:674-678
(1990),
and Rychlik et al., Nucleic Acids Res. 18:6409-6412 (1990).
So long as their relevant function is maintained, primers, detection probes,
address probes, and any other oligonucleotides can be made up of or include
modified
nucleotides (nucleotide analogs). Many modified nucleotides are known and can
be
used in oligonucleotides, and are disclosed elsewhere herein.
Kits
The materials described above as well as other materials can be packaged
together in any suitable combination as a kit useful for performing, or aiding
in the
performance of, the disclosed method. It is useful if the kit components in a
given kit
are designed and adapted for use together in the disclosed method. For example
disclosed are kits for amplification of nucleic acid samples, the kit
comprising
cooperative nucleic acids and a DNA polymerase. The kits also can contain
nucleotides, buffers, detection probes, fluorescent change probes, lysis
solutions,
stabilization solutions, denaturation solutions, or a combination.
Uses
The disclosed method and compositions are applicable to numerous areas
including, but not limited to, analysis of nucleic acids present in cells (for
example,
analysis of genomic DNA in cells), disease detection, mutation detection, gene
discovery, gene mapping (molecular haplotyping), and agricultural research.
Particularly useful is whole genome amplification. Other uses include, for
example,
detection of nucleic acids in cells and on genomic DNA arrays; molecular
haplotyping;
mutation detection; detection of inherited diseases such as cystic fibrosis,
muscular
dystrophy, diabetes, hemophilia, sickle cell anemia; assessment of
predisposition for
cancers such as prostate cancer, breast cancer, lung cancer, colon cancer,
ovarian
cancer, testicular cancer, pancreatic cancer.
37
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Amplification
Amplification methods suitable for use with the present methods include, for
example, polymerase chain reaction (PCR), reverse transcription PCR(RT-PCR),
ligase
chain reaction (LCR), transcription-based amplification system (TAS), nucleic
acid
sequence based amplification (NASBA) reaction, self-sustained sequence
replication
(3 SR), strand displacement amplification (SDA) reaction, boomerang DNA
amplification (BDA), Q-beta replication: or isothermal nucleic acid sequence
based
amplification. These methods of amplification each described briefly below and
are
well-known in the art.
PCR is a technique for making many copies of a specific template DNA
sequence. The reaction consists of multiple amplification cycles and is
initiated using a
pair of primer oligonucleotides that hybridize to the 5' and 3' ends of the
sequence to be
copied. The amplification cycle includes an initial denaturation, and up to 50
cycles of
armealing, strand elongation (or extension) and strand separation
(denaturation). In each
cycle of the reaction, the DNA sequence between the primers is copied. Primers
can
bind to the copied DNA as well as the original template sequence, so the total
number
of copies increases exponentially with time. PCR can be performed as according
to
Whelan, et al, Journal of Clinical Microbiology, 33(3):556-561 (1995).
Briefly, a PCR
reaction mixture includes two specific primers, dNTPs, Taq polymerase, and 1X
PCR
Buffer, which is amplified using a thermal cycler. Cycling parameters can be
varied,
depending on, for example, the melting temperature of the primer or the length
of
nucleic acids to be extended. The skilled artisan is capable of designing and
preparing
primers that are appropriate for amplifying a target sequence. The length of
the
amplification primers for use in the present invention depends on several
factors
including the nucleotide sequence identity and the temperature at which these
nucleic
acids are hybridized or used during in vitro nucleic acid amplification. The
considerations necessary to determine a preferred length for an amplification
primer of
a particular sequence identity are well-known to a person of ordinary skill
and include
considerations described herein. For example, the length of a short nucleic
acid or
oligonucleotide can relate to its hybridization specificity or selectivity.
Real time PCR is PCR-based amplification method in which PCR products are
detected in real time, that is, the accumulation of PCR products can be
determined at
38
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
each cycle. An example of Real Time PCR is performed using TaqMan probes in
combination with a suitable amplification/analyzer such as Applied 13iosystems
(AIM)
Prism 7900HT Sequence Detection System, which is a high-throughput real-time
PCR
system. Briefly, TaqMan probes specific for the amplified target sequence are
included
in the PCR amplification reaction. These probes contain a reporter dye at the
5' end and
a quencher dye at the 3' end. Probes hybridizing to different target sequences
are
conjugated with a different fluorescent reporter dye. In this way, more than
one target
sequence can be assayed for in the same reaction vessel. During PCR, the
fluorescently
labeled probes bind specifically to their respective target sequences; the 5'
nuclease
activity of Taq polymerase cleaves the reporter dye from the probe and a
fluorescent
signal is generated. The increase in fluorescence signal is detected only if
the target
sequence is complementary to the probe and is amplified during PCR. A mismatch
between probe and target greatly reduces the efficiency of probe hybridization
and
cleavage. The ABI Prism 7700HT or 7900HT Sequence detection System measures
the
increase in fluorescence during PCR thermal cycling, providing "real time"
detection of
PCR product accumulation. Real Time detection on the AB1 Prism 7900HT or
7900HT
Sequence Detector monitors fluorescence and calculates Rn during each PCR
cycle.
The threshold cycle, or Ct value, is the cycle at which fluorescence
intersects the
threshold value. The threshold value is determined by the sequence detection
system
software or manually.
"RT-PCR" as used herein refers to the combination of reverse transcription and
PCR in a single assay. "Reverse transcription" is a process whereby an RNA
template
is transcribed into a DNA molecule by a reverse transcriptase enzyme. Thus,
"reverse
transcriptase" describes a class of polymerases characterized as RNA-dependent
DNA
polymerases, that is, such polymerases use an RNA template to synthesize a DNA
molecule. Historically, reverse transcriptases have been used to reverse-
transcribe
mRNA into cDNA. However, reverse transcriptases can be used to reverse-
transcribe
other types of RNAs such as viral genomic RNA or viral sub-genomic RNA.
Standard
reverse transcriptases include Maloney Murine Leukemia Virus Reverse
Transcriptase
(MoMuLV RT) and Avian myoblastosis virus (AMV). These enzymes have 5'->3'
RNA-dependent DNA polymerase activity, 5'->3' DNA-dependent DNA polymerase
activity, and RNase H activity. However, unlike many DNA-dependent DNA
39
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
polymerases, these enzymes lack 3'->5 exonuclease activity necessary for
"proofreading," (i.e., correcting errors made during transcription). After a
DNA copy of
an RNA has been prepared, the DNA copy may be subjected to various DNA
amplification methods such as PCR.
LCR is a method of DNA amplification similar to PCR, except that it uses four
primers instead of two and uses the enzyme ligase to ligate or join two
segments of
DNA. LCR can be performed as according to Moore et al., Journal of Clinical
Microbiology 36(4)1028-1031 (1998). Briefly, an LCR reaction mixture contains
two
pair of primers, dNTP, DNA ligase and DNA polymerase representing about 90 1,
to
which is added 100 d of isolated nucleic acid from the target organism.
Amplification
is performed in a thermal cycler (e.g., LCx of Abbott Labs, North Chicago,
TAS is a system of nucleic acid amplification in which each cycle is comprised
of a cDNA synthesis step and an RNA transcription step. In the cDNA synthesis
step, a
sequence recognized by a DNA-dependent RNA polymerase (i.e., a polymerase-
binding sequence or PBS) is inserted into the cDNA copy downstream of the
target or
marker sequence to be amplified using a two-domain oligonucleotide primer. In
the
second step, an RNA polymerase is used to synthesize multiple copies of RNA
from
the cDNA template. Amplification using TAS requires only a few cycles because
DNA-dependent RNA transcription can result in 10-1000 copies for each copy of
cDNA template. TAS can be performed according to Kwoh et al., PNAS 86:1173-7
(1989). Briefly, extracted RNA is combined with TAS amplification buffer and
bovine
serum albumin, dNTPs, NTPs, and two oligonucleotide primers, one of which
contains
a PBS. The sample is heated to denature the RNA template and cooled to the
primer
annealing temperature. Reverse transcriptase (RT) is added the sample
incubated at the
appropriate temperature to allow cDNA elongation. Subsequently T7 RNA
polymerase
is added and the sample is incubated at 37 C for approximately 25 minutes for
the
synthesis of RNA. The above steps are then repeated. Alternatively, after the
initial
cDNA synthesis, both RT and RNA polymerase are added following a 1 minute
1000C.
denaturation followed by an RNA elongation of approximately 30 minutes at 37
C.
TAS can be also be performed on solid phase as according to Wylie et al.,
Journal of
Clinical Microbiology, 36(12):3488-3491 (1998). In this method, nucleic acid
targets
are captured with magnetic beads containing specific capture primers. The
beads with
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
captured targets are washed and pelleted before adding amplification reagents
which
contains amplification primers, dNTF', NTP, 2500 U of reverse transcriptase
and 2500
U of T7 RNA polymerase. A 100 ul TMA reaction mixture is placed in a tube, 200
pi
oil reagent is added and amplification is accomplished by incubation at 42 C
in a
waterbath for one hour.
NASBA is a transcription-based amplification method which amplifies RNA
from either an RNA or DNA target. NASBA is a method used for the continuous
amplification of nucleic acids in a single mixture at one temperature. For
example, for
RNA amplification, avian mycloblastosis virus (AMV) reverse transcriptase,
RNase H
and T7 RNA polymerase are used. This method can be performed as according to
Heim, et al., Nucleic Acids Res., 26(9):2250-2251 (1998). Briefly, an NASBA
reaction
mixture contains two specific primers, dNTP, NTP, 6.4 U of AMV reverse
transcriptase, 0.08 U of Escherichia coli Rnase H, and 32 U of T7 RNA
polymerase.
The amplification is carried out for 120 min at 41 C in a total volume of 201.
In a related method, self-sustained sequence-replication (3SR) reaction,
isothermal amplification of target DNA or RNA sequences in vitro using three
enzymatic activities: reverse transcriptase, DNA-dependent RNA polymerase and
Escherichia coli ribonuclease H. This method may be modified from a 3-enzyme
system to a 2-enzyme system by using human immunodeficiency virus (HIV)-1
reverse
transcriptase instead of avian myeloblastosis virus (AMV) reverse
transcriptase to
allow amplification with T7 RNA polymerase but without E. coli ribonuclease H.
In the
2-enzyme 3SR, the amplified RNA is obtained in a purer form compared with the
3-
enzyme 3SR (Gebinoga & Oehlenschlager European Journal of Biochemistry,
235:256-
261, 1996).
SDA is an isothermal nucleic acid amplification method. A primer containing a
restriction site is annealed to the template. Amplification primers are then
annealed to
5' adjacent sequences (forming a nick) and amplification is started at a fixed
temperature. Newly synthesized DNA strands are nicked by a restriction enzyme
and
the polymerase amplification begins again, displacing the newly synthesized
strands.
SDA can be performed as according to Walker, et al., PNAS, 89:392-6 (1992).
Briefly,
an SDA reaction mixture contains four SDA primers, dGTP, dCTP, TTP, dATP, 150
U
of Hine II, and 5 U of exonuclease-deficient of the large fragment of E. coli
DNA
41
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
polymerase I (exo<sup>-</sup> Klenow polymerase). The sample mixture is heated 95 C
for 4
minutes to denature target DNA prior to addition of the enzymes. After
addition of the
two enzymes, amplification is carried out for 120 min. at 37 C in a total
volume of 50
1.11. Then, the reaction is terminated by heating for 2 minutes at 95 C.
Boomerang DNA amplification (BDA) is a method in which the polymerase
begins extension from a single primer-binding site and then makes a loop
around to the
other strand, eventually returning to the original priming site on the DNA.
BDA is
differs from PCR through its use of a single primer. This method involves an
endonuclease digestion of a sample DNA, producing discrete DNA fragments with
sticky ends, ligating the fragments to "adapter" polynucleotides (comprised of
a
ligatable end and first and second self-complementary sequences separated by a
spacer
sequence) thereby forming ligated duplexes. The ligated duplexes are denatured
to form
templates to which an oligonucleotide primer anneals at a specific sequence
within the
target or marker sequence of interest. The primer is extended with a DNA
polymerase
to form duplex products followed by denaturation of the duplex products.
Subsequent
multiple cycles of annealing, extending, and denaturing are performed to
achieve the
desired degree of amplification (U.S. Pat. No. 5,470,724).
The Q-beta replication system uses RNA as a template. Q-beta replicase
synthesizes the single-stranded RNA genome of the coliphage QP. Cleaving the
RNA
and ligating in a nucleic acid of interest allows the replication of that
sequence when
the RNA is replicated by Q-beta replicase (Kramer & Lizardi Trends Biotechnol.
1991
9(2):53-8, 1991).
A variety of amplification enzymes are well known in the art and include, for
example, DNA polymerase, RNA polymerase, reverse transcriptase, Q-beta
replicase,
thermostable DNA and RNA polymerases. Because these and other amplification
reactions are catalyzed by enzymes, in a single step assay that the nucleic
acid releasing
reagents and the detection reagents should not be potential inhibitors of
amplification
enzymes if the ultimate detection is to be amplification based.
Amplification of the nucleic acid molecules in a nucleic acid sample can
result
replication of at least 0.01% of the nucleic acid sequences in the nucleic
acid sample, at
least 0.1% of the nucleic acid sequences in the nucleic acid sample, at least
1% of the
nucleic acid sequences in the nucleic acid sample, at least 5% of the nucleic
acid
42
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
sequences in the nucleic acid sample, at least 10% of the nucleic acid
sequences in the
nucleic acid sample, at least 20% of the nucleic acid sequences in the nucleic
acid
sample, at least 30% of the nucleic acid sequences in the nucleic acid sample,
at least
40% of the nucleic acid sequences in the nucleic acid sample, at least 50% of
the
nucleic acid sequences in the nucleic acid sample, at least 60% of the nucleic
acid
sequences in the nucleic acid sample, at least 70% of the nucleic acid
sequences in the
nucleic acid sample, at least 80% of the nucleic acid sequences in the nucleic
acid
sample, at least 90% of the nucleic acid sequences in the nucleic acid sample,
at least
95% of the nucleic acid sequences in the nucleic acid sample, at least 96% of
the
nucleic acid sequences in the nucleic acid sample, at least 97% of the nucleic
acid
sequences in the nucleic acid sample, at least 98% of the nucleic acid
sequences in the
nucleic acid sample, or at least 99% of the nucleic acid sequences in the
nucleic acid
sample.
The various sequence representations described above and elsewhere herein can
be, for example, for 1 target sequence, 2 target sequences, 3 target
sequences, 4 target
sequences, 5 target sequences, 6 target sequences, 7 target sequences, 8
target
sequences, 9 target sequences, 10 target sequences, 11 target sequences, 12
target
sequences, 13 target sequences, 14 target sequences, 15 target sequences, 16
target
sequences, 17 target sequences, 18 target sequences, 19 target sequences, 20
target
sequences, 25 target sequences, 30 target sequences, 40 target sequences, 50
target
sequences, 75 target sequences, or 100 target sequences. The sequence
representation
can be, for example, for at least 1 target sequence, at least 2 target
sequences, at least 3
target sequences, at least 4 target sequences, at least 5 target sequences, at
least 6 target
sequences, at least 7 target sequences, at least 8 target sequences, at least
9 target
sequences, at least 10 target sequences, at least 11 target sequences, at
least 12 target
sequences, at least 13 target sequences, at least 14 target sequences, at
least 15 target
sequences, at least 16 target sequences, at least 17 target sequences, at
least 18 target
sequences, at least 19 target sequences, at least 20 target sequences, at
least 25 target
sequences, at least 30 target sequences, at least 40 target sequences, at
least 50 target
sequences, at least 75 target sequences, or at least 100 target sequences.
The sequence representation can be, for example, for 1 target sequence, 2
different target sequences, 3 different target sequences, 4 different target
sequences, 5
43
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
different target sequences, 6 different target sequences, 7 different target
sequences, 8
different target sequences, 9 different target sequences, 10 different target
sequences,
11 different target sequences, 12 different target sequences, 13 different
target
sequences, 14 different target sequences, 15 different target sequences, 16
different
target sequences, 17 different target sequences, 18 different target
sequences, 19
different target sequences, 20 different target sequences, 25 different target
sequences,
30 different target sequences, 40 different target sequences, 50 different
target
sequences, 75 different target sequences, or 100 different target sequences.
The
sequence representation can be, for example, for at least 1 target sequence,
at least 2
different target sequences, at least 3 different target sequences, at least 4
different target
sequences, at least 5 different target sequences, at least 6 different target
sequences, at
least 7 different target sequences, at least 8 different target sequences, at
least 9
different target sequences, at least 10 different target sequences, at least
11 different
target sequences, at least 12 different target sequences, at least 13
different target
sequences, at least 14 different target sequences, at least 15 different
target sequences,
at least 16 different target sequences, at least 17 different target
sequences, at least 18
different target sequences, at least 19 different target sequences, at least
20 different
target sequences, at least 25 different target sequences, at least 30
different target
sequences, at least 40 different target sequences, at least 50 different
target sequences,
at least 75 different target sequences, or at least 100 different target
sequences.
Detection
Products of amplification can be detected using any nucleic acid detection
technique. For real-time detection, the amplification products and the
progress of
amplification are detected during amplification. Real-time detection is
usefully
accomplished using one or more or one or a combination of fluorescent change
probes
and fluorescent change primers. Other detection techniques can be used, either
alone or
in combination with real-timer detection and/or detection involving
fluorescent change
probes and primers. Many techniques are known for detecting nucleic acids. The
nucleotide sequence of the amplified sequences also can be determined using
any
suitable technique.
44
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
For example, nucleic acid product may be detected by any of a variety of well-
known methods, for example, electrophoresis (e.g., gel electrophoresis or
capillary
electrophoresis). Amplified fragments may be subjected to further methods of
detecting, for example, variant sequences (e.g., single nucleotide
polymorphisms
(SNPs)). An exemplary method is single nucleotide primer extension (Lindblad-
Toh et
al., Large-scale discovery and genotyping of single-nucleotide polymorphisms
in the
mouse. Nature Genet. 2000 April; 24(4):381-6). In this reaction, an
oligonucleotide
primer is designed to have a 3' end that is one nucleotide 5' to a specific
mutation site.
In some embodiments, the extension primers are labeled with a tag or a member
of a
binding pair to allow the capture of the primer on solid phase. In particular
embodiments, the primers may be tagged with varying lengths of nonspecific
polynucleotides (e.g., poly-GACT) to allow multiplex detection of preferably 2
or
more, more preferably 3 or more, 4 or more, 5 or more, even 10 or more
different
mutations (polymorphisms) in a single reaction. The primer hybridizes to the
PCR
amplicon in the presence of one or more labeled ddNTPs and a DNA polymerase.
The
polymerase extends the primer by one nucleotide, adding a single, labeled
ddNTP to
the 3' end of the extension primer. The addition of a dideoxy nucleotide
terminates
chain elongation. If more than one dideoxynucleotide (e.g., ddATP, ddGTP,
ddCTP,
ddTTP, ddUTP, etc.) is used in a reaction, one or more can be labeled. If
multiple
labels are used, the labels can be distinguishable e.g., each is labeled with
a different
fluorescent colored dye. The products are labeled oligoiaucleotides, each one
of which
may be detected based on its label. Further methods of detecting variant
sequences
include the READIT SNP Genotyping System (Promega Corporation, Madison Wis.)
and oligonucleotide ligation assays.
Examples
Example I: Primers for Malaria
Capture sequences were designed with a Tm of 2 to 5 C below the reaction
temperature of 55 C. Primer sequences were designed with a Tm of around 10 C
below the reaction temperature. Linkers attaching the 5' end of the primer to
the 5' end
of the probe were used (see Figure 5).
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
3' TCGCTACGCA 5' (SEQ ID NO: 1) [Spacer 18][Spacer 18][Spacer 18] 5' [T(FAM)]
ACGGTGAACTCTCA [DABCYL] 3' (SEQ ID NO: 2)
3' TCGCTACGCA 5' (SEQ ID NO: 3) [Spacer 18][Spacer 18][Spacer 18][Spacer 18]
5'
[T(FAM)]
ACGGTGAACTCTCA [DABCYL] 3' (SEQ ID NO: 4)
3' TCGCTACGCA 5' (SEQ ID NO: 5) [Spacer 18][Spacer 18][ Spacer 18][Spacer 18]
5'
[T(FAM)]
TCTAACGGTGAACTC [DABCYL] 3' (SEQ ID NO: 6)
A regular primer was used for the reverse primer and a control using just a
regular primer for the forward primer and a Rapid Probe for detection was
used. The
primers were run in a real-time PCR reaction with GoTaq DNA master mix with
final
MgC12 concentration of 5 mM. Final primer concentration was 250 nM. Reaction
conditions were 95 C for 20s followed by 45 cycles of 95 C for ls and 55 C for
20s.
All three cooperative primers generated detectable amplicon and had a
detectable signal from the labeled capture sequence. The cooperative primer
with no
distance between the primer and capture sequence amplified less efficiently
than the
others.
The same real-time PCR reaction was repeated with an annealing/extension
temperature of 50 C. The signal generated from the labeled capture sequence
was
greater for all three cooperative primers. Real-time PCR efficiency did not
appear to
improve at the lower temperature.
Example 2: High Tm capture sequences
Labeled capture sequences were designed with a Tm of 7 to 10 C above the
reaction temperature of 55 C. The reverse cooperative primer was made with an
unlabeled capture sequence with a Tm of about 2 C less than the reaction
temperature.
Primer sequences were designed with a Tm of around 7 to 10 C below the
reaction
temperature.
46
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
3 TCGCTACGCA 5' (SEQ ID NO: 7) [Spacer 18][Spacer 18][Spacer 18] 5' [T(FAM)]
ACGGTGAACTCTCATTCCA [DABCYL] 3' (SEQ ID NO: 8)
3' TCGCTACGCA 5' (SEQ ID NO: 9) [Spacer 18][Spacer 18][Spacer 18] 5' [T(FAM)]
ACGGTGAACTCTCATTCCA CCG [DABCYL] 3' (SEQ ID NO: 10)
3' ATTGACATACCTGC 5'(SEQ ID NO: 11) [Spacer 18][Spacer 18][Spacer 181 5'
AGCAAGTGGAATGTT [Phos] 3' (SEQ ID NO: 12)
The primers were run in a real-time PCR reaction with GoTaq DNA master mix
with final MgC12 concentration of 5 mM. Final primer concentration was 250 nM.
Reaction conditions were 95 C for 20s followed by 50 cycles of 95 C for ls and
55 C
for 20s. The real-time PCR was also repeated with an extension step of 40s.
The cooperative primers with High Tm capture sequences had a similar
amplification efficiency and change in fluorescence to the low Tm capture
sequences
from Example 1. Increasing the extension time did not appear to increase
amplification
efficiency.
Example 3: Elimination of Primer-Dimers
Primer-dimers were synthesized for the cooperative primers and the normal
primers. Either 0, 600, 6,000 or 600,000 primer-dimers were spiked into a
reaction
containing 60 copies of Malaria DNA. The primers were run in a real-time PCR
reaction with GoTaq DNA master mix with final MgC12 concentration of 5 mM.
Final
primer concentration was 250 nM. Reaction conditions were 95 C for 20s
followed by
50 cycles of 95 C for ls and 55 C for 20s.
The control with normal primers had easily visible positives when no primer-
dimers were spiked in. However, with as few as 600 primer-dimers spiked in,
the signal
disappeared resulting in false negatives. In contrast, the cooperative primers
had no
signal dampening or loss of amplification product with even as many as 600,000
primer-dimers spiked in.
47
CA 02879421 2015-01-15
WO 2014/014988 PCT/US2013/050811
When a 2,2% Lonza flashgel was run with the PCR products, the gel confirmed
the fact that no primer-dirners were amplified for the cooperative primers_
However,
the normal primers clearly amplified the primer-dimers rather than the Malaria
DNA,
resulting in false negatives.
Example 4: Cooperative Primers with Detection Mechanism on the Primer
Cooperative Primers with a detection mechanism on the primer were made:
3' [Spacer 3] TTGTAAGGTGAACGA 5' (SEQ ID NO: 13) 5' [Spacer 18][T(FAM)]
actgtatgg [T(BHQ-1)][Spacer 9] CGTCCATACAGTTA 3' (SEQ ID NO: 14)
3' [Spacer 3] TTGTAAGGTGAACGA 5' (SEQ ID NO: 15) 5' [Spacer 9][Spacer
18][T(FAM)] atggacg [T(BHQ-1)][Spacer 9] CGTCCATACAGTTA 3' (SEQ ID NO: 16)
3' [Spacer 3] TTGTAAGGTGAACGA 5' (SEQ ID NO: 17) 5' [T(FAM)][Spacer 3]
taactgtatg
[T(BHQ-1)][Spacer 18] CGTCCATACAGTTA 3' (SEQ ID NO: 18)
3' [Spacer 3] TTGTAAGGTGAACGA 5' (SEQ ID NO: 19) [Spacer 9][T(FAM)] actgtatgg
[T(BHQ-1)][Spacer 18] CGTCCATACAGTTA 3' (SEQ ID NO: 20)
3' [Spacer 3] AGATTGTAAGGTGAACGA 5' (SEQ ID NO: 21) 5' [Spacer 18][T(FAM)]
actgtatgg [T(BHQ-1)][Spacer 9] CGTCCATACAGTTA 3' (SEQ ID NO: 22)
3' [Spacer 3] TTGTAAGGTGAACGA 5' (SEQ ID NO: 23) 5' [Spacer 18][T(FAM)]
actgtatgg [T(BHQ-1)][Spacer 9] CGTCCATACAGTTAT 3' (SEQ ID NO: 24)
Example 5: Labeling the Capture Sequence
P. falciparum real-time PCR was run by making a master mix with 250 n/vI
final concentration of each primer (either PfcF inv, PfcF inv62, PfcF inv62HP
or PfcF
with PfcR), 5 mM final concentration of MgC12 and an additional 0.25
U/reaction of
GoTaq polymerase (Promega) in GoTaq Colorless Master Mix (Promega). 5,000,000,
600,000, 50,000, 500 or 0 copies of template were added to each reaction. The
reaction
48
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
was run on the ABI StepOne and included a 20 s denature step at 95 C followed
by 45
cycles of 95 C for 1 s and 55 C for 20 s. Each reaction was run in duplicate.
Having demonstrated that cooperative primers are capable of efficient
amplification and can eliminate interference from primer-dimers, we attempted
to
incorporate a probe into the primer. This was done by labeling the capture
sequence.
First, inverted primers were attached to the 5' end of capture sequences
having Tm's
both below and above the reaction temperature, including capture sequences
with
hairpin formation to encourage greater quenching of the fluorophore (Pf cF
inv, Pf cF
inv 62 and Pf cF inv 6211P). However, very little signal was observed from
these
primers and electrophoretic gels showed that very few of the primers were
cleaving the
capture sequence (Figure 8 ¨ the barely visible bands below the amplicon of
the
cooperative primers).
It was believed that conformational stain from the linker was lifting the 5'
end
of the capture sequence and causing the polymerase to displace the sequence
rather
than cleave it. Consequently, if the strain was moved from the 5' end to the
3' end (e.g.
by changing where the linker was attached), the polymerase might cleave the
capture
sequence with greater efficiency. Upon testing this hypothesis the fluorescent
signal
rose dramatically (Figure 8). Even though the labeled capture sequence had a
Tm below
the reaction temperature, the signal was still 2.5 times higher than the
signal from
normal hybridization probes.
Example 6: SNP Differentiation
M. tuberculosis real-time PCR for the D516V mutation in the tpoB gene
conferring rifampicin resistance was run by making a master mix with 250 nM
final
concentration of each primer/probe (MTb cF, MTb P, and one of MTb cR1, MTb
cR2,
MTb cR3, MTh cR4, MTh cR5, MTh cR6, MTh cR7, MTh cR8 or MTh cR9), 5 mM
final concentration of MgC12 and an additional 0.25 U/reaction of GoTaq
polymerase
(Promega) in GoTaq Colorless Master Mix (Promega). 50,000 copies of template
(MTh
WT or MTh D516V) were added to each reaction. Each reaction was run in
duplicate.
The reaction was run on the ABI 7500 and included a 20 s denature step at 95 C
followed by 45 cycles of 95 C for 3s and 55 C for 3 s. The Ct's were
automatically
49
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
determined by the machine with a threshold of 10,000 and the ARn was taken
from
cycle 45 of the exported data.
Finally, the ability of these efficient, primer-dimer free, cooperative
primers to
differentiate SNP's was analyzed. Cooperative Primers were designed to the
rpoB gene
D516V mutation, which is present in up to 7.4% of rifampicin resistant M
tuberculosis
isolates in India. Two different strategies were employed: 1) the ARMS method
and 2)
labeled capture sequence differentiation. Both methods resulted in the ability
to
differentiate SNP's similar to standard primers and probes (Figure 9 and data
summary
in Table 1).
For the probe based method, cooperative primer MTb cR6 gave the best ratio of
fluorescent signals between the mutant and wild type strains. For the ARMS
based
method, MTb cR8 gave the best difference in Ct values. Both are shown in
Figure 9.
TABLE 1
D516V primer Method Primer Probe ACt ARnVar/ARnWT
name ATm ATm
MTb cR1 Probe (4.1) 4.5 1.68 3.01
MTb cR2 Probe (4.1) (2.5) 4.79 3.35
MTb cR5 Probe (6.6) (2.5) 4.83 1.89
MTb cR6 Probe (4.1) (7.1) 3.83 3.67
MTb cR7 Probe (4.1) (11.7) 5.30 3.62
MTb cR3 ARMS (6.3) 4.3 4.43 n/a
MTb cR4 ARMS (10.2) 4.3 5.99 n/a
MTh cR8 ARMS (20.2) 4.3 7.57 n/a
MTb cR9 ARMS (25.5) 4.3 7.13 n/a
Table 1 shows a summary of SNP differentiation methods. Each primer is
listed together with whether it uses ARMS or probe (labeled capture sequence)
based
differentiation, the number of degrees the predicted Tm for the primer or
probe is above
or below the reaction temperature (values below the reaction temperature are
in red font
and in parenthesis), the difference between mutant and wild type Ct values,
and the
ratio of the mutant and wild type fluorescence.
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
Sequences 5' to 3'
Beta Actin (Amplification Efficiency)
Normal Primers/Probes
b-act P [FAM] TGTGGCCGAGGACTTTGAcggc [BHQ1] (SEQ ID NO: 25)
Cooperative
Primers
3' AGTGGCAAGGTC 5' (SEQ ID NO: 26) [Sp18][Sp18][Sp18]
b-act cF 5' GGTGACAGCAGTC [Sp3] 3'(SEQ ID NO: 27)
3' TAGGATTTTCGGTG 5' (SEQ ID NO: 28) [Sp18][Sp18][Sp18]
b-act cR 5' GCAAGGGACTTCC [Sp3] 3' (SEQ ED NO: 29)
Templates
Beta actin AGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGG
AGCGAGCATCCCCCAAAGTTCACAATGIGGCCGAGGACTTTGATTG
CACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTTGTT
ACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCA (SEQ ID NO: 30)
P. Falciparum (Impact of Primer-Dimers and Probe Selection)
Normal Primers/Probes
Pf nF CGCATCGCTTCTAACGGTGA (SEQ D NO: 31)
Pf nR GAAGCAAACACTAGCGGTGGAA (SEQ ID NO: 32)
Pf P [FAM] ACTCTCATTCCAATGGAACCTTGTTCAAGTTCAAAccattggaa [DABC]
(SEQ ID NO: 33)
Cooperative Primers/Probes
Pf cF inv 3' TCGCTACGCA (SEQ ID NO: 34) 5' [Sp18][Sp18][Sp18] 5' [FAM]
ACGGTGAACTCTCA [DABC] 3' (SEQ ID NO: 35)
Pf cF inv 3' TCGCTACGCA 5' (SEQ ID NO: 36) [Sp18][5p18][Sp18] 5' [T(FAM)] A
CGGTGAACTCTCATTCCA [DABC] 3' (SEQ ID NO: 37)
62
Pf cF inv 3' TCGCTACGCA 5' (SEQ ID NO: 38) [Sp18][Sp18][Sp18] 5' [T(FAM)]
ACGGTGAACTCTCATTCCA ccg [DABC] 3' (SEQ ID NO: 39)
62HP
Pf cF [FAM] ACGGTGAACTCTCA [DABC] [Sp18][Sp18][Sp18][Spl8j[Sp18][Sp18]
ACGCATCGCT (SEQ ID NO: 40)
Pf cR inv 3' ATTGACATACCTGC 5' [Sp18][Sp18][Sp18] 5' AGCAAGTGGAATGTT
[Phos] 3' (SEQ ID NO: 41)
Low Tm Primers minus Capture Sequence
Pf Low Tm
ACGCATCGCT (SEQ ID NO: 42)
Pf Low Tm
CGTCCATACAGTTA (SEQ ID NO: 43)
Templates
Normal GAAGCAAACACTAGCGGTGGAATCACCGTTAGAAGCGATGCG
Primer- (SEQ ID NO: 44)
Dimer
Cooperative CGTCCATACAGTTA AGCGATGCGT (SEQ JD NO: 45)
Primer-
Dimer
.P. CCAGCTCACGCATCGCTTCTAACGGTGAACTCTCATTCCAATGGAA
Fakiparum CCTTGTTCAAGTTCAAATAGATTGGTAAGGTATAGTGTTTACTATC
AAATGAAACAATGTGTTCCACCGCTAGTGTTTGCTCTAACATTCCAC
TTGCTTATAACTGTATGGACG (SEQ lD NO: 50)
M. Tuberculosis(SNP Differentiation)
Normal Primers/Probes
MTb P [FAM] CGCCGCGATCAAGGAGTTCgcg [BHQ1] (SEQ ID NO: 51)
51
CA 02879421 2015-01-15
WO 2014/014988 PCT/US2013/050811
Cooperative Primers/Probes
MTh cF 3' ACACTAGCGGAG 5' (SEQ ID NO: 52) [Sp18][Sp18][Sp18]
5' CGCAGACGTTGAT [Phos] 3'(SEQ lD NO: 53)
MTh cR1 [CF 560] TGGaCCATGAATTGGCT [BHQ1] [Sp18][Sp18][Sp18][Sp18]
[Sp18][Sp18]CAGCGGGTTGTT (SEQ ID NO: 54)
MTh cR2 [CF 560] TGGaCCATGAATTGG [BHQ1] [Sp18][Sp18][Sp18][Sp18]
[Sp18][Sp18]CAGCGGGTTGTT(SEQ ID NO: 55)
MTh cR3 [CF 560] CATGAATTGGCTCAGCTG [BHQ1] [Sp18][Sp18][Sp18][Sp18]
[Sp18][Sp18] GGGTTGTTCTGGa (SEQ ID NO: 56)
MTh cR4 [CF 560] CATGAATTGGCTCAGCTG [BHQ1] [Sp18] [ Sp18] [ Sp18][Sp18]
[Sp18][Sp18]CGrGGTTGTTCTaGa (SEQ ID NO: 57)
MTh cR5 [CF 560] TGGaCCATGAATTGG [BHQ1] [Sp18][Sp18][Sp18][Sp18]
[Sp18][Sp18] AGCGGGTTGTT (SEQ ID NO: 58)
MTh cR6 [CF 560] TGGaCCATGAATTG [BHQ1] [Sp18][Sp18][Sp18][Sp18]
[Sp18][Sp18] CAGCGGGTTGTT (SEQ ID NO: 59)
MTh cR7 [CF 560] TGGaCCATGAATT [BHQ1] [Sp18][Sp18][Sp18]
[Sp18][Sp18][Sp18] CAGCGGGTTGTT (SEQ ID NO: 60)
MTh cR8 [CF 560] CATGAATTGGCTCAGCTG [BHQ1] [Sp18][Sp18][Sp18][Sp18]
[Sp18][Sp18] GGGTTGTTCTcGa (SEQ ID NO: 61)
MTh cR9 [CF 560] CATGAATTGGCTCAGCTG [BHQ1] [Sp18][ Sp18][Sp18][Sp18]
[Sp18][Sp18] GGGTTcTTCTGGa(SEQ ID NO: 62)
Templates
MTh WT CGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGT
CGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCAT
GGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTC
GGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGT
CCGCGA (SEQ JD NO: 63)
MTh D516V CGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGT
CGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCA
TGGTCCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGT
CGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGG
TCCGCGA (SEQ 1D NO: 64)
It is understood that the disclosed method and compositions are not limited to
the particular methodology, protocols, and reagents described as these may
vary. It is
also to be understood that the terminology used herein is for the purpose of
describing
particular embodiments only, and is not intended to limit the scope of the
present
invention which will be limited only by the appended claims.
It must be noted that as used herein and in the appended claims, the singular
forms "a ", "an", and "the" include plural reference unless the context
clearly dictates
otherwise. Thus, for example, reference to "a primer" includes a plurality of
such
primers, reference to "the primer" is a reference to one or more primers and
equivalents
thereof known to those skilled in the art, and so forth.
"Optional" or "optionally" means that the subsequently described event,
circumstance, or material may or may not occur or be present, and that the
description
52
CA 02879421 2015-01-15
WO 2014/014988
PCT/US2013/050811
includes instances where the event, circumstance, or material occurs or is
present and
instances where it does not occur or is not present.
Ranges may be expressed herein as from "about" one particular value, and/or to
"about" another particular value. When such a range is expressed, also
specifically
contemplated and considered disclosed is the range from the one particular
value and/or
to the other particular value unless the context specifically indicates
otherwise.
Similarly, when values are expressed as approximations, by use of the
antecedent
"about," it will be understood that the particular value forms another,
specifically
contemplated embodiment that should be considered disclosed unless the context
specifically indicates otherwise. It will be further understood that the
endpoints of each
of the ranges are significant both in relation to the other endpoint, and
independently of
the other endpoint unless the context specifically indicates otherwise.
Finally, it should
be understood that all of the individual values and sub-ranges of values
contained
within an explicitly disclosed range are also specifically contemplated and
should be
considered disclosed miless the context specifically indicates otherwise. The
foregoing
applies regardless of whether in particular cases some or all of these
embodiments are
explicitly disclosed.
Unless defined otherwise, all technical and scientific terms used herein have
the
same meanings as commonly understood by one of skill in the art to which the
disclosed method and compositions belong. Although any methods and materials
similar or equivalent to those described herein can be used in the practice or
testing of
the present method and compositions, the particularly useful methods, devices,
and
materials are as described. Publications cited herein and the material for
which they are
cited are specifically incorporated by reference. Nothing herein is to be
construed as an
admission that the present invention is not entitled to antedate such
disclosure by virtue
of prior invention.
Those skilled in the art will recognize, or be able to ascertain using no more
than routine experimentation, many equivalents to the specific embodiments of
the
method and compositions described herein. Such equivalents are intended to be
encompassed by the following claims.
53
