Canadian Patents Database / Patent 2907535 Summary

Third-party information liability

Some of the information on this Web page has been provided by external sources. The Government of Canada is not responsible for the accuracy, reliability or currency of the information supplied by external sources. Users wishing to rely upon this information should consult directly with the source of the information. Content provided by external sources is not subject to official languages, privacy and accessibility requirements.

Claims and Abstract availability

Any discrepancies in the text and image of the Claims and Abstract are due to differing posting times. Text of the Claims and Abstract are posted:

  • At the time the application is open to public inspection;
  • At the time of issue of the patent (grant).
(12) Patent Application: (11) CA 2907535
(54) English Title: NOVEL COMPOUNDS
(54) French Title: NOUVEAUX COMPOSES
(51) International Patent Classification (IPC):
  • C07D 285/135 (2006.01)
  • A61K 31/381 (2006.01)
  • A61K 31/395 (2006.01)
  • A61K 31/40 (2006.01)
  • A61K 31/415 (2006.01)
  • A61K 31/421 (2006.01)
  • A61K 31/4245 (2006.01)
  • A61K 31/426 (2006.01)
  • A61K 31/433 (2006.01)
  • A61K 31/4418 (2006.01)
  • A61K 31/5386 (2006.01)
  • C07D 207/34 (2006.01)
  • C07D 213/75 (2006.01)
  • C07D 231/14 (2006.01)
  • C07D 263/34 (2006.01)
  • C07D 271/06 (2006.01)
  • C07D 277/46 (2006.01)
  • C07D 333/38 (2006.01)
  • C07D 401/12 (2006.01)
  • C07D 417/12 (2006.01)
  • C07D 487/08 (2006.01)
  • C07D 498/08 (2006.01)
(72) Inventors :
  • THEDE, KAI (Germany)
  • BENDER, ECKHARD (Germany)
  • SCOTT, WILLIAM J. (United States of America)
  • RICHTER, ANJA (Germany)
  • ZORN, LUDWIG (Germany)
  • LIU, NINGSHU (Germany)
  • MONNING, URSULA (Germany)
  • SIEGEL, FRANZISKA (Germany)
  • GOLZ, STEFAN (Germany)
  • HAGEBARTH, ANDREA (Germany)
  • LIENAU, PHILIP (Germany)
  • PUEHLER, FLORIAN (United States of America)
  • BASTING, DANIEL (Germany)
  • SCHNEIDER, DIRK (Germany)
  • MOWES, MANFRED (Germany)
(73) Owners :
  • BAYER PHARMA AKTIENGESELLSCHAFT (Not Available)
(71) Applicants :
  • BAYER PHARMA AKTIENGESELLSCHAFT (Germany)
(74) Agent: SMART & BIGGAR IP AGENCY CO.
(74) Associate agent:
(45) Issued:
(86) PCT Filing Date: 2014-03-17
(87) Open to Public Inspection: 2014-09-25
Examination requested: 2019-01-30
(30) Availability of licence: N/A
(30) Language of filing: English

(30) Application Priority Data:
Application No. Country/Territory Date
61/803,549 United States of America 2013-03-20
61/871,369 United States of America 2013-08-29
61/938,779 United States of America 2014-02-12

English Abstract

The present invention relates to substituted N-(phenyl-heteroaryl)-3-acetylamino-benzamides and N- [3-(acetylamino)phenyl]-phenyl-heteroaryl-carboxamides of general formula(I) as described and defined herein,to methods of preparing said compounds, to intermediate compounds useful for preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease.


French Abstract

La présente invention concerne des N-[3-(acétylamino)phényl]-phényl-hétéroaryl-carboxamides et des N-(phényl-hétéroaryl)-3-acétylamino-benzamides substitués de formule générale (I) tels que décrits et définis dans la description. L'invention porte également sur des procédés de préparation desdits composés, des composés intermédiaires utiles pour la préparation de ces composés, des compositions pharmaceutiques et des combinaisons comprenant lesdits composés et l'utilisation desdits composés pour la fabrication d'une composition pharmaceutique pour le traitement ou la prophylaxie d'une maladie.


Note: Claims are shown in the official language in which they were submitted.

Claims
1. A compound of general formula (l) :
Image
in which :
L A represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-
C3-alkyl-,
halo-C1-C3-alkoxy-, C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a C3-C6-
cycloalkyl- or 3- to 6-
membered heterocycloalkyl- ring; wherein said ring is optionally substituted
one or more
times, identically or differently, with a substituent selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
L B represents -N(H)-C(=O)- or -C(=O)-N(H)-;
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(R7)-(C1-C6-alkyl); wherein said 5- to 8-membered
heterocycloalkyl-, 4- to
10-membered heterocycloalkenyl-, aryl-, heteroaryl-, and -N(R7)-(C1-C6-alkyl)
group is
optionally substituted, one or more times, identically or differently, with a
substituent
selected from: halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-
C3-alkyl-, hydroxy-
C1-C3-alkyl-, halo-C1-C3-alkoxy-, C3-C7-cycloalkyl-;
R2 represents a group selected from:
376

Image
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to L B; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from:
halo-, hydroxy-, -N(R9)(R10), -N(H)C(=O)R9, cyano-, nitro-, C1-C3-alkyl-, C1-
C3-alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, amino-C1-C3-alkyl-,halo-C1-C3-alkoxy-
;
R4 represents a hydrogen atom or a C1-C3-alkyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-,
C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-,
heteroaryl-, -N(R9)(R10), - C(=O)-O-C1-C4-alkyl, -C(=O)-N(R9)(R10), R9-S-, R9-
S(=O)-, R9-S(=O)2-;
said C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-, aryl-, heteroaryl-, and C1-
C6-alkoxy- group
being optionally substituted, one or more times, identically or differently,
with a substituent
selected from: halo-, cyano-, nitro-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, C4-C7-cycloalkenyl-,
3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
377

aryl-, heteroaryl-, -C(=O)R9, -C(=O)O-(C1-C4-alkyl), -OC(=O)-R9, -N(H)C(=O)R9,
-N(R10)C(=O)R9,
-N(H)C(=O)NR10R9, -N(R11)C(=O)NR10R9, -N(H)R9, -NR10R9,
-C(=O)N(H)R9, -C(=O)NR10R9, R9-S-, R9-S(=O)-, R9-S(=O)2-,
-N(H)S(=O)R9, -N(R10)S(=O)R9, -S(=O)N(H)R9, -S(=O)NR10R9,
-N(H)S(=O)2R9, -N(R9)S(=O)2R10, -S(=O)2N(H)R9, -S(=O)2NR10R9,
-S(=O)(=NR10)R9, -N=S(=O)(R10)R9;
R7 represents a hydrogen atom or a C1-C3-alkyl- or C1-C3-alkoxy-C1-C3-alkyl-
group;
R9, R10, R11
represent, independently from each other, a hydrogen atom or a C1-C3-alkyl- or

C1-C3-alkoxy-C1-C3-alkyl- group;
or
R9R10 together with the atom or the group of atoms they are attached to, form
a 3- to
10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
m represents 0, 1, or 2;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
2. A compound according to claim 1, wherein :
L A represents -CH2-, -CH(CH3)- or
Image
3. A compound according to claim 1 or 2, wherein :
R1 represents a group selected from:
Image
-N(CH3)2, -N(H)-(CH2-CH2-O-CH3), -N(CH3)-(CH2-CH2-O-CH3); wherein * indicates
the point of
attachment to L A; and wherein R12 represents a methyl-, ethyl- or cyclopropyl-
group.
378

4. A compound according to claim 1, 2 or 3, wherein :
R2 represents a group selected from:
Image ; preferably R2 represents Image ;
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of attachment to
L B.
5. A compound according to claim 1, 2, 3 or 4, wherein :
R3 represents:
Image ; wherein " * " represents the point of attachment to R2;
R31, R32, R34 and R35 represent, independently from each other, a hydrogen
atom or a group selected
from: halo-, hydroxy-, -NH2, cyano-, nitro-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-
C1-C3-alkyl-, hydroxy-C1-C3-
alkyl-, halo-C1-C3-alkoxy-; and R33 represents a hydrogen atom or a
substituent selected from:
hydroxy-, -CHF2, -NH2, -NR10R9, -CH2NH2, -N(H)C(=O)CH3.
6. A compound according to claim 1, 2, 3, 4 or 5, wherein :
R4 represents a hydrogen atom; and R5 represents hydrogen.
7. A compound according to claim 1, 2, 3, 4, 5 or 6, wherein :
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-,
-C(=O)-O-C1-C4-alkyl, -C(=O)-N(R9)(R10), R9-S-, R9-S(=O)-, R9-S(=O)2-;
said C1-C6-alkyl-, and C1-C6-alkoxy- group being optionally substituted, one
or more times, identically
or differently, with a substituent selected from: halo-, C1-C3-alkoxy-,
C1-C3-alkoxy-C2-C3-alkoxy-, C3-C7-cycloalkyl-.
8. A compound according to claim 1, which is selected from the group
consisting of :
N-[6-(2-fluorophenyl)pyridin-3-yl]-4-methoxy-3-[(morpholin-4-
ylacetyl)amino]benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-4-methoxy-3-[(8-oxa-3-azabicyclo[3.2.1]oct-
3-
ylacetyl)amino]benzamide,
379

N-[6-(2-fluorophenyl)pyridin-3-yl]-4-methoxy-3-{[(18,48)-2-oxa-5-
azabicyclo[2.2.1]hept-5-
ylacetyl]amino}benzamide,
4-methoxy-3-[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yl)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-
ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[(28)-2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[(28)-2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(6-phenylpyridin-3-yl)-4-
(trifluoromethoxy)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[2-methyl-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3-thiazol-2-yl)-4-
(trifluoromethyl)benzamide,
3-[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yl)-4-
(trifluoromethyl)benzamide,
3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3-thiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
3-[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yl)-4-
(trifluoromethoxy)benzamide,
N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl}-5-phenyl-1,3-
thiazole-2-
carboxamide,
N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl}-5-
phenylthiophene-2-carboxamide,
N-{4-tert-butyl-3-[(morpholin-4-ylacetyl)amino]phenyl}-6-phenylnicotinamide,
N-{4-tert-butyl-3-[(morpholin-4-ylacetyl)amino]phenyl}-5-phenylthiophene-2-
carboxamide,
N-{4-methoxy-3-[(morpholin-4-ylacetyl)amino]phenyl}-5-phenyl-1,3-oxazole-2-
carboxamide,
N-{4-chloro-3-[(morpholin-4-ylacetyl)amino]phenyl}-5-phenylthiophene-2-
carboxamide,
N-{4-methyl-3-[(morpholin-4-ylacetyl)amino]phenyl}-5-phenylthiophene-2-
carboxamide,
N-{4-methoxy-3-[(morpholin-4-ylacetyl)amino]phenyl}-5-phenyl-1,3-thiazole-2-
carboxamide,
N-{4-methoxy-3-[(morpholin-4-ylacetyl)amino]phenyl}-5-phenyl-1H-pyrrole-2-
carboxamide,
380


N-{4-methoxy-3-[(morpholin-4-ylacetyl)amino]phenyl}-5-phenylthiophene-2-
carboxamide,
6-(2,3-difluorophenyl)-N-{3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)phenyl}nicotinamide,
6-(3,5-difluorophenyl)-N-{3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)phenyl}nicotinamide,
6-(3-fluorophenyl)-N-{3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)phenyl}nicotinamide,
6-(2,6-difluorophenyl)-N-{3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)phenyl}nicotinamide,
6-(2-fluorophenyl)-N-{3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)phenyl}nicotinamide,
6-(2-fluorophenyl)-N-{4-methoxy-3-[(morpholin-4-
ylacetyl)amino]phenyl}nicotinamide,
6-(3-fluorophenyl)-N-{4-methoxy-3-[(morpholin-4-
ylacetyl)amino]phenyl}nicotinamide,
N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl}-6-
phenylnicotinamide,
N-{4-methoxy-3-[(morpholin-4-ylacetyl)amino]phenyl}-6-phenylnicotinamide,
N-{4-methoxy-3-[(morpholin-4-ylacetyl)amino]phenyl}-5-(4-
methoxyphenyl)thiophene-2-
carboxamide,
5-(4-fluorophenyl)-N-{4-methoxy-3-[(morpholin-4-
ylacetyl)amino]phenyl}thiophene-2-carboxamide,
4-(difluoromethoxy)-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N-(5-
phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
3-({[1-(4-cyclopropylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-4-
(difluoromethoxy)-N-(5-phenyl-
1,3,4-thiadiazol-2-yl)benzamide,
4-(difluoromethoxy)-3-({[1-(4-methylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-
N-(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
4-(difluoromethoxy)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide,
3-{[(4-cyclopropylpiperazin-1-yl)acetyl]amino}-4-(difluoromethoxy)-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide,
4-(difluoromethoxy)-3-{[2-(4-methylpiperazin-1-yl)propanoyl]amino}-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide trifluoroacetate (1:1),
4-(methoxymethyl)-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N-(5-
phenyl-1,3,4-thiadiazol-
2-yl)benzamide,
3-({[1-(4-cyclopropylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-4-
(methoxymethyl)-N-(5-phenyl-
1,3,4-thiadiazol-2-yl)benzamide,
4-(methoxymethyl)-3-({[1-(4-methylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-N-
(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide hydrochloride (1:1),

381

4-(methoxymethyl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide,
4-[(methylsulfonyl)methyl]-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-
N-(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
3-({[1-(4-cyclopropylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-4-
[(methylsulfonyl)methyl]-N-(5-
phenyl-1,3,4-thiadiazol-2-yl)benzamide,
3-({[1-(4-methylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-4-
[(methylsulfonyl)methyl]-N-(5-phenyl-
1,3,4-thiadiazol-2-yl)benzamide,
3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
3-({[1-(4-cyclopropylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-N-(5-phenyl-
1,3,4-thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
3-({[1-(4-methylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
3-{[(4-cyclopropylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethoxy)benzamide,
3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-

(trifluoromethoxy)benzamide,
3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
2-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N4-(5-phenyl-1,3,4-
thiadiazol-2-
yl)terephthalamide,
3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
3-{[2-(4-methylpiperazin-1-yl)propanoyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethoxy)benzamide,
3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-

(trifluoromethyl)benzamide,
6-(3,5-difluorophenyl)-N-[3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-4-

(trifluoromethoxy)phenyl]nicotinamide,
N-[3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-4-
(trifluoromethoxy)phenyl]-6-
phenylnicotinamide,
6-(2-fluorophenyl)-N-[4-methoxy-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)phenyl]nicotinamide,
3-{[(4-cyclopropylpiperazin-1-yl)acetyl]amino}-N-[6-(2-fluorophenyl)pyridin-3-
yl]-4-
(trifluoromethoxy)benzamide,
382

N-{6-(2-fluorophenyl)pyridin-3-yl]-3-{[2-(4-methylpiperazin-1-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-3-{[(2S)-2-(4-methylpiperazin-1-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-3-{[(2R)-2-(4-methylpiperazin-1-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-3-{[(2S)-2-(4-methylpiperazin-1-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-3-{[(2R)-2-(4-methylpiperazin-1-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
3-({[1-(4-cyclopropylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-N-{6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)-4-
(trifluoromethoxy)benzamide,
N-{6-(3-fluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-(3-fluorophenyl)pyridin-3-yl]-3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-(3,5-difluorophenyl)pyridin-3-yl]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)-4-
(trifluoromethoxy)benzamide,
N-{6-(3,5-difluorophenyl)pyridin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
N-{6-(3,5-difluorophenyl)pyridin-3-yl]-3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-
ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethyl)benzamide,
N4-{6-(2-fluorophenyl)pyridin-3-yl]-2-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)terephthalamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-4-methyl-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)benzamide,
4-fluoro-N-{6-(2-fluorophenyl)pyridin-3-yl]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)benzamide,
4-fluoro-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide,
4-chloro-N-{6-(2-fluorophenyl)pyridin-3-yl]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)benzamide,
383

N-{6-(2-fluorophenyl)pyridin-3-yl]-4-methoxy-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl)amino)benzamide,
4-methoxy-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl)amino)-N-(6-
phenylpyridin-3-yl)benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-4-methoxy-3-({[1-(morpholin-4-
yl)cyclobutyl]carbonyl)amino)benzamide,
4-(methoxymethyl)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide ,
3-{[(4-cyclopropylpiperazin-1-yl)acetyl]amino}-4-(methoxymethyl)-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide,
3-{[N-(2-methoxyethyl)-N-methylglycyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethoxy)benzamide,
4-(difluoromethoxy)-3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-ylacetyl)amino]-N-(5-
phenyl-1,3,4-thiadiazol-
2-yl)benzamide,
4-[(methylsulfonyl)methyl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide,
34[2-(4-methylpiperazin-1-yl)propanoyl]amino}-4-[(methylsulfonyl)methyl]-N-(5-
phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
N45-(2-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl)amino)-4-
(trifluoromethoxy)benzamide,
N45-(4-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl)amino)-4-
(trifluoromethoxy)benzamide,
4-methoxy-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
4-(benzyloxy)-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl)amino)-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide,
4-hydroxy-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl)amino)-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide,
4-bromo-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide,
3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl)amino)-N-(5-phenylpyridin-2-yl)-4-
(trifluoromethoxy)benzamide,
N-[5-(3-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-

(trifluoromethoxy)benzamide,
3-[(morpholin-4-ylacetyl)amino]-N45-(4-nitrophenyl)-1,3,4-thiadiazol-2-yl]-4-
(trifluoromethoxy)benzamide,
N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-

(trifluoromethoxy)benzamide,
384

N-[5-(4-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-

(trifluoromethoxy)benzamide,
3-({[4-(2,2-difluoroethyl)piperazin-1-yl]acetyl}amino)-N-[6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
N-[5-(2-methoxyphenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(4-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
4-methyl-3-({[-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide,
3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-[(methylsulfonyl)methyl]-N-(5-
phenyl-1,3,4-thiadiazol-2-
yl)benzamide,
methyl 2-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-[(5-phenyl-1,3,4-thiadiazol-
2-
yl)carbamoyl]benzoate,
methyl 2-[(morpholin-4-ylacetyl)amino]-4-[(5-phenyl-1,3,4-thiadiazol-2-
yl)carbamoyl]benzoate,
N-(4-methoxy-3-{[2-(morpholin-4-yl)propanoyl]amino}phenyl)-2-phenyl-1,3-
thiazole-5-carboxamide,
N-[3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-4-
(trifluoromethoxy)phenyl]-2-phenyl-1,3-
thiazole-5-carboxamide,
N-[6-(2-fluoro-4-hydroxyphenyl)pyridin-3-yl]-3-{[2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[6-(3-fluoro-4-hydroxyphenyl)pyridin-3-yl]-3-{[2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[6-(4-aminophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-[4-(difluoromethyl)phenyl]pyridin-3-yl}-3-{[2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[6-(4-acetamidophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-

(trifluoromethoxy)benzamide,
N-{6-[4-(dimethylamino)phenyl]pyridin-3-yl}-3-{[2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-[4-(dimethylamino)phenyl]pyridin-3-yl}-3-{[(2S)-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-[4-(dimethylamino)phenyl]pyridin-3-yl}-3-{[(2R)-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,

385

N-{6-[4-(dimethylamino)phenyl]pyridin-3-yl)-3-{[(2S)-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-[4-(dimethylamino)phenyl]pyridin-3-yl}-3-{[(2R)-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-(4-aminophenyl)pyridin-3-yl]-3-{[(2R)-2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
N-{6-(4-aminophenyl)pyridin-3-yl]-3-{[(2S)-2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
N-{6-(4-aminophenyl)pyridin-3-yl]-3-{[(2R)-2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
N-{6-(4-aminophenyl)pyridin-3-yl]-3-{[(2S)-2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
N-{6-[4-(hydroxymethyl)phenyl]pyridin-3-yl)-3-{[(2S)-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-[4-(hydroxymethyl)phenyl]pyridin-3-yl)-3-{[(2R)-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-[4-(hydroxymethyl)phenyl]pyridin-3-yl)-3-{[(2S)-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{6-[4-(hydroxymethyl)phenyl]pyridin-3-yl)-3-{[(2R)-2-(morpholin-4-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl)-5-phenyl-1,2,4-
oxadiazole-3-
carboxamide,
3-[(morpholin-4-ylacetyl)amino]-N-(2-phenyl-1,3-thiazol-5-yl)-4-
(trifluoromethoxy)benzamide,
1-methyl-N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl}-5-
phenyl-1H-pyrazole-3-
carboxamide,
N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl)-5-phenyl-1H-
pyrazole-3-
carboxamide,
3-[(morpholin-4-ylacetyl)amino]-N-(3-phenyl-1,2,4-oxadiazol-5-yl)-4-
(trifluoromethoxy)benzamide,
N-{6-(4-aminophenyl)pyridin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
N-[5-(2-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-

(trifluoromethoxy)benzamide,
3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-
(trifluoromethyl)benzamide,
386

3-{[2-(4-methylpiperazin-1-yl)propanoyl]amino}{-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethyl)benzamide,
N-{4-methoxy-3-[(morpholin-4-ylacetyl)amino]phenyl)-5-phenyl-1,3,4-thiadiazole-
2-carboxamide,
3-[(morpholin-4-ylacetyl)amino]-N-(5-phenylpyridin-2-yl)-4-
(trifluoromethoxy)benzamide,
3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenylpyridin-2-yl)-4-
(trifluoromethoxy)benzamide
formiate,
4-(cyclopropyloxy)-N-{6-(2-fluorophenyl)pyridin-3-yl]-3-[(morpholin-4-
ylacetyl)amino]benzamide,
4-(cyclopropyloxy)-N-{6-(2-fluorophenyl)pyridin-3-yl]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)benzamide,
4-(cyclopropyloxy)-N-{6-(2-fluorophenyl)pyridin-3-yl]-3-({[1-(4-
methylpiperazin-1-
yl)cyclopropyl]carbonyl}amino)benzamide,
4-(cyclopropyloxy)-3-({[1-(4-cyclopropylpiperazin-1-
yl)cyclopropyl]carbonyl}amino)-N-{6-(2-
fluorophenyl)pyridin-3-yl]benzamide,
3-{[(3,4-dimethylpiperazin-1-yl)acetyl]amino}-N-{6-(2-fluorophenyl)pyridin-3-
yl]-4-
(trifluoromethoxy)benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-4-(methylsulfanyl)-3-[(morpholin-4-
ylacetyl)amino]benzamide,
N-{6-(2-fluorophenyl)pyridin-3-yl]-4-(methylsulfonyl)-3-[(morpholin-4-
ylacetyl)amino]benzamide,
4-(cyclopropyloxy)-3-({[1-(dimethylamino)cyclopropyl]carbonyl}amino)-N-{6-(2-
fluorophenyl)pyridin-
3-yl]benzamide,
4-(cyclopropyloxy)-N-{6-(2-fluorophenyl)pyridin-3-yl]-3-[(1H-pyrazol-1-
ylacetyl)amino]benzamide,
4-tert-butyl-N-{6-(2-fluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-
yl)propanoyl]amino}benzamide,
4 -tert-butyl-3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(5-phenyl-1,3-thiazol-2-
yl)benzamide,
N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(3-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(3-methoxyphenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(4-chlorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(2-chlorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
387

N-[5-(4-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(2-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(3-chlorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(3-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(3-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-

(trifluoromethoxy)benzamide,
N-[5-(3-chlorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-

(trifluoromethoxy)benzamide,
N1-(2-methoxyethyl)-2-{[(4-methylpiperazin-1-yl)acetyl]amino}-N4-(5-phenyl-
1,3,4-thiadiazol-2-
yl)terephthalamide,
N1-(2-methoxyethyl)-2-[(morpholin-4-ylacetyl)amino]-N4-(5-phenyl-1,3,4-
thiadiazol-2-
yl)terephthalamide,
4-methyl-3-({[1-(4-methylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-N-(5-
phenyl-1,3,4-thiadiazol-2-
yl)benzamide hydrochloride,
3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenylpyridin-2-yl)-4-
(trifluoromethoxy)benzamide,
4-(cyclopropyloxy)-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N-(5-
phenyl-1,3,4-thiadiazol-
2-yl)benzamide,
3-{[(3,4-dimethylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethoxy)benzamide,
3-({[(2R)-2,4-dimethylpiperazin-1-yl]acetyl}amino)-N-[6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
3-({[(2S)-2,4-dimethylpiperazin-1-yl]acetyl}amino)-N-[6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
3-({[(3S)-3,4-dimethylpiperazin-1-yl]acetyl}amino)-N-[6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
3-({[(3R)-3,4-dimethylpiperazin-1-yl]acetyl}amino)-N-[6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
3-{[(2,4-dimethylpiperazin-1-ypacetyl]aminol-N-[6-(2-fluorophenyl)pyridin-3-
yl]-4-
(trifluoromethoxy)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[(8-methyl-3,8-diazabicyclo[3.2.1]oct-3-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
388

3-{[(2,4-dimethylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethoxy)benzamide,
3-{[(4-methyl-1,4-diazepan-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethoxy)benzamide,
3-[(1,4-oxazepan-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
4-(cyclopropyloxy)-3-({[1-(4-methylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-
N-(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
3-{[(4-ethylpiperazin-1-yl)acetyl]aminol}N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
4-chloro-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
4-cyano-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide,
4-(difluoromethoxy)-N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-
methylpiperazin-1-
yl)acetyl]amino}benzamide,
4-(methoxymethyl)-N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-

ylacetyl)amino]benzamide,
4-(methoxymethyl)-N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-
methylpiperazin-1-
yl)acetyl]amino}benzamide hydrochloride,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
3-({[1-(dimethylamino)cyclopropyl]carbonyl}amino)-N-[6-(2-fluorophenyl)pyridin-
3-yl]-4-
(trifluoromethoxy)benzamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-({(2R*)-2-[(1S,4S)-2-oxa-5-
azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-(trifluoromethoxy)benzamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-({(2S*)-2-[(1S,4S)-2-oxa-5-
azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-(trifluoromethoxy)benzamide,
N-[6-(3-fluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[6-(3-fluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
6-(3,5-difluorophenyl)-N-[3-{[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-
ylacetyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
389

6-(3,5-difluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3,5-difluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3-fluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3-fluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3-fluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-oxadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
6-(3-fluorophenyl)-N-[3-({(2R*)-2-[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-
(trifluoromethoxy)phenyl]nicotinamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[6-(4-hydroxyphenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
3-{[2-(4-cyclopropylpiperazin-1-yl)propanoyl]aminol}N-[6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-

(trifluoromethoxy)benzamide,
6-(3,5-difluorophenyl)-N-[3-({(2R*)-2-[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-
4-(trifluoromethoxy)phenyl]nicotinamide,
6-(3,5-difluorophenyl)-N-[3-({2-[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3-fluorophenyl)-N-[3-({2-[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3-fluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3-fluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3,5-difluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3,5-difluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
390

6-(2-fluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(2-fluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(2-fluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethyl)benzamide,
3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(6-phenylpyridin-3-yl)-4-
(trifluoromethoxy)benzamide,
3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(6-phenylpyridin-3-yl)-4-
(trifluoromethoxy)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-

(trifluoromethyl)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethyl)benzamide,
6-(2-fluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(2-fluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-{[(1S,4S)-2-oxa-5-
azabicyclo[2.2.1]hept-5-ylacetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
6-(3,5-difluorophenyI)-N-{3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-ylacetyl)amino]-4-

(trifluoromethoxy)phenyl}nicotinamide,
6-(3,5-difluorophenyl)-N-[3-({(2S*)-2-[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3,5-difluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3,5-difluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
6-(3-fluorophenyl)-N-[3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino]-4-
(trifluoromethoxy)phenyl]nicotinamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
391

6-(3-fluorophenyl)-N-[3-({(2S*)-2-[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-
(trifluoromethoxy)phenyl]nicotinamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-({2-[(1S,4S)-2-oxa-5-
azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-(trifluoromethoxy)benzamide,
6-(2-fluorophenyl)-N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethoxy)phenyl]nicotinamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-4-
(trifluoromethyl)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-
ylacetyl]amino]-4-
(trifluoromethyl)benzamide,
3-{[(4-cyclopropylpiperazin-1-yl]acetyl]amino}-N-[6-(2-fluorophenyl)pyridin-3-
yl]-4-
(trifluoromethyl)benzamide,
3-[methyl(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yl)-4-
(trifluoromethoxy)benzamide,
6-(4-fluorophenyl)-N-{4-methoxy-3-[(morpholin-4-
ylacetyl)amino]phenyl}nicotinamide,
3-{[2-(4-methylpiperazin-1-yl)propanoyl]amino}-4-[(methylsulfonyl)methyl]-N-(5-
phenyl-1,3,4-
thiadiazol-2-yl)benzamide trifluoroacetate,
3-{[2-(4-methylpiperazin-1-yl)propanoyl]amino}-4-[(methylsulfonyl)methyl]-N-(5-
phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
3-{[2-(4-methylpiperazin-1-yl)propanoyl]amino}-4-[(methylsulfonyl)methyl]-N-(5-
phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-({[4-(2,2,2-trifluoroethyl)piperazin-1-
yl]acetyl}amino)-4-
(trifluoromethoxy)benzamide,
3-{[2-(4-cyclopropylpiperazin-1-yl)propanoyl]amino}-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
4-[(methylsulfonyl)methyl]-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide,
N-[6-(2-fluorophenyl)pyridin-3-yl]-3-({[1-(4-methylpiperazin-1-
yl)cyclopropyl]carbonyl}amino)-4-
(trifluoromethoxy)benzamide,
4-(difluoromethoxy)-N-[6-(2-fluorophenyl)pyridin-3-yl]-3-[(morpholin-4-
ylacetyl)amino]benzamide,
4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-yl]-3-[(pyridin-2-
ylacetyl)amino]benzamide,
4-(difluoromethoxy)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-ylacetyl)amino]-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
392

3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
3-{[2-(morpholin-4-yl)propanoyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
N-[6-(3-fluorophenyl)pyridin-3-yl]-3-({2-[(1S,4S)-2-oxa-5-
azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-(trifluoromethoxy)benzamide
N-[6-(3-fluorophenyl)pyridin-3-yl]-3-({(2R*)-2-[(1S,4S)-2-oxa-5-
azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-(trifluoromethoxy)benzamide,
N-[6-(3-fluorophenyl)pyridin-3-yl]-3-({(2S*)-2-[(1S,4S)-2-oxa-5-
azabicyclo[2.2.1]hept-5-
yl]propanoyl}amino)-4-(trifluoromethoxy)benzamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-{[2-(morpholin-4-yl)propanoyl]amino}-
4-
(trifluoromethoxy)benzamide,
N-[6-(3-fluorophenyl)pyridin-3-yl]-3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[6-(3-fluorophenyl)pyridin-3-yl]-3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yl)propanoyl]amino}-4-
(trifluoromethoxy)benzamide,
3-{[2-(4-cyclopropylpiperazin-1-yl)propanoyl]amino}-N-[6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
3-{[2-(4-cyclopropylpiperazin-1-yppropanoyl]amino}-N-[6-(2-
fluorophenyl)pyridin-3-yl]-4-
(trifluoromethoxy)benzamide,
N-[6-(3,5-difluorophenyl)pyridin-3-yl]-3-({[-
(dimethylamino)cyclopropyl]carbonyl}amino)-4-
(trifluoromethoxy)benzamide,
N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl}-2-phenyl-1,3-
thiazole-5-
carboxamide,
4-bromo-3-{[(4-cyclopropylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)benzamide,
3-{[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-ylacetyl]amino}-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
N-[3-{[2-(morpholin-4-yl)propanoyl]amino}-4-(trifluoromethoxy)phenyl]-2-phenyl-
1,3-thiazole-5-
carboxamide,
N-[4-methoxy-3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)phenyl]-6-
phenylnicotinamide,
N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyl}amino)-4-
(trifluoromethoxy)benzamide,
393

4-(methoxymethyl)-N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-({[1-(4-
methylpiperazin-1-
yl)cyclopropyl]carbonyl}amino)benzamide trifluoroacetate,
4-(cyclopropylmethoxy)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide,
3-{[2-(4-methylpiperazin-1-yl)propanoyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethoxy)benzamide trifluoroacetate,
3-[({1-[(2-methoxyethyl)(methyl)amino]cyclopropyl}carbonyl)amino]-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)-4-(trifluoromethoxy)benzamide,
4-chloro-3-({[1-(4-cyclopropylpiperazin-1-yl)cyclopropyl]carbonyl}amino)-N-(5-
phenyl-1,3,4-
thiadiazol-2-yl)benzamide trifluoroacetate,
N-[5-(4-aminophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
4-(cyclopropyloxy)-N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-
methylpiperazin-1-
yl)acetyl]amino}benzamide,
4-(cyclopropylmethoxy)-3-{[(4-cyclopropylpiperazin-1-ypacetyl]amino}-N-(5-
phenyl-1,3,4-thiadiazol-
2-yl)benzamide,
4-(cyclopropyloxy)-N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-
4-
ylacetyl)amino]benzamide,
N-[5-(3-cyanophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
4-(cyclopropylmethoxy)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide,
N-[5-(2-ethylphenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)-N-{5-[2-
(trifluoromethyl)phenyl]-
1,3,4-thiadiazol-2-yl}benzamide,
N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-({[1-(4-methylpiperazin-1-
yl)cyclopropyl]carbonyl}amino)-4-(trifluoromethoxy)benzamide,
3-{[(4-methylpiperazin-1-yl)acetyl]aminol-4-(trifluoromethoxy)-N-{5-[3-
(trifluoromethyl)phenyl]-
1,3,4-thiadiazol-2-yl}benzamide,
3-{[2-(4-methylpiperazin-1-yl)propanoyl]amino}-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)-4-
(trifluoromethoxy)benzamide trifluoroacetate,
3-{[(2R)-2-(4-methylpiperazin-1-yl)butanoyl]amino}-N-(5-phenyl-1,3,4-
thiadiazol-2-yl)-4-
(trifluoromethoxy)benzamide,
394


N-[5-(3,4-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(3,5-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide hydrochloride,
N-[5-(2,4-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-
ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
N-[5-(2,6-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide hydrochloride,
N-[5-(2,3-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-
ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
N-[5-(2,6-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-
ylacetyl)amino]-4-
(trifluoromethoxy)benzamide hydrochloride,
N-[5-(3,5-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-
ylacetyl)amino]-4-
(trifluoromethoxy)benzamide hydrochloride,
N-[5-(3,4-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-4-
ylacetyl)amino]-4-
(trifluoromethoxy)benzamide,
N-[5-(2-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-({[1-methylpiperazin-1-
yl)cyclopropyl]carbonyl}mino)-4-(trifluoromethoxy)benzamide hydrochloride,
3-{[(4-cyclopropylpiperazin-1-yl)acetyl]amino}-N-[5-(2-fluorophenyl)-1,3,4-
thiadiazol-2-yl]-4-
(trifluoromethoxy)benzamide,
N-[5-(2,3-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
N-[5-(2,5-difluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-methylpiperazin-1-
yl)acetyl]amino}-4-
(trifluoromethoxy)benzamide,
3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)-N-{5-[2-
(trifluoromethyl)phenyl]-1,3,4-
thiadiazol-2-yl}benzamide,
3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)-N-{5-[3-
(trifluoromethyl)phenyl]-1,3,4-
thiadiazol-2-yl}benzamide,
4-(cyclopropyloxy)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide,
4-(cyclopropyloxy)-N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-({[1-
(morpholin-4-
yl)cyclopropyl]carbonyl}amino)benzamide,
4-(cyclopropyloxy)-N-[5-(2-methylphenyl)-1,3,4-thiadiazol-2-yl]-3-({[1-(4-
methylpiperazin-1-
yl)cyclopropyl]carbonyl}amino)benzamide,

395


4-(difluoromethoxy)-N-[5-(2-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-{[(4-
methylpiperazin-1-
yl)acetyl]amino}benzamide,
3-{[(4-cyclopropylpiperazin-1-yl)acetyl]amino}-4-(difluoromethoxy)-N-[5-(2-
fluorophenyl)-1,3,4-
thiadiazol-2-yl]benzamide, and
4-(difluoromethoxy)-N-[5-(2-fluorophenyl)-1,3,4-thiadiazol-2-yl]-3-[(morpholin-
4-
ylacetyl)amino]benzamide;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
9. A compound of general formula (l), or a stereoisomer, a tautomer, an N
oxide, a hydrate, a
solvate, or a salt thereof, particularly a pharmaceutically acceptable salt
thereof, or a mixture of
same, according to any one of claims 1 to 8, for use in the treatment or
prophylaxis of a disease.
10. A pharmaceutical composition comprising a compound of general formula (I),
or a stereoisomer,
a tautomer, an N oxide, a hydrate, a solvate, or a salt thereof, particularly
a pharmaceutically
acceptable salt thereof, or a mixture of same, according to any one of claims
1 to 8, and a
pharmaceutically acceptable diluent or carrier.
11. A pharmaceutical combination comprising :
- one or more first active ingredients selected from a compound of general
formula (l)
according to any of claims 1 to 8, and
- one or more second active ingredients selected from chemotherapeutic anti
cancer agents.
12. Use of a compound of general formula (l), or a stereoisomer, a tautomer,
an N oxide, a hydrate,
a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt
thereof, or a mixture of
same, according to any one of claims 1 to 8, for the prophylaxis or treatment
of a disease.
13. Use of a compound of general formula (l), or a stereoisomer, a tautomer,
an N oxide, a hydrate,
a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt
thereof, or a mixture of
same, according to any one of claims 1 to 8, for the preparation of a
medicament for the prophylaxis
or treatment of a disease.
14. Use according to claim 9, 12 or 13, wherein said disease is a disease in
which aberrant Wnt
signalling is implicated in a patient.
15. Use according to claim 9, 12, 13 or 14, wherein the disease is a genetic
disease caused by
mutations in Wnt signaling components, wherein the genetic disease is chosen
from: polyposis coli,
osteoporosispseudoglioma syndrome, familial exudative vitreoretinopathy,
retinal angiogenesis,
early coronary disease, tetra-amelia syndrome, Müllerian-duct regression and
virilization, SERKAL

396


syndrome, diabetes mellitus type 2, Fuhrmann syndrome, Al-Awadi/Raas-
Rothschild/Schinzel
phocomelia syndrome, odonto-onycho-dermal dysplasia, obesity, splithand/foot
malformation,
caudal duplication syndrome, tooth agenesis, Wilms tumor, skeletal dysplasia,
focal dermal
hypoplasia, autosomal recessive anonychia, neural tube defects, alpha-
thalassemia (ATRX)
syndrome, fragile X syndrome, ICF syndrome, Angelman syndrome, Prader-Willi
syndrome, Beckwith-
Wiedemarm Syndrome and Rett syndrome.
16. Use according to claim 9, 12, 13 or 14, wherein the disease is a disease
of uncontrolled cell
growth, proliferation and/or survival, an inappropriate cellular immune
response, or an
inappropriate cellular inflammatory response, particularly in which the
uncontrolled cell growth,
proliferation and/or survival, inappropriate cellular immune response, or
inappropriate cellular
inflammatory response is mediated by the Wnt pathway, more particularly in
which the disease of
uncontrolled cell growth, proliferation and/or survival, inappropriate
cellular immune response, or
inappropriate cellular inflammatory response is a haematological tumour, a
solid tumour and/or
metastases thereof, e.g. leukaemias and myelodysplastic syndrome, malignant
lymphomas, head and
neck tumours including brain tumours and brain metastases, tumours of the
thorax including non
small cell and small cell lung tumours, gastrointestinal tumours, endocrine
tumours, mammary and
other gynaecological tumours, urological tumours including renal, bladder and
prostate tumours,
skin tumours, and sarcomas, and/or metastases thereof.
17. A method of preparing a compound of general formula (I) according to any
one of claims 1 to 8,
said method comprising the step of allowing an intermediate compound of
general formula (VI):
Image
in which R2, R3, R5, and R6 are as defined for the compounds of general
formula (I) in any one of
claims 1 to 8;
to react with a carboxylic acid HO2C-L A-R1 or the corresponding acyl chloride
CI-C(=O)-L A-R1, wherein
L A and R1 are as defined for the compounds of general formula (I) in any one
of claims 1 to 8; or
alternatively

397


to react with Cl-C(=O)-L A-LG, in which L A is as defined for the compounds of
general formula (l) in any
one of claims 1 to 8, and LG stands for a leaving group, preferably chloro or
bromo, and subsequently
with agents suitable for the introduction of R1, exemplified by but not
limited to cyclic secondary
amines;
thereby giving, upon optional deprotection, a compound of general formula
(la):
Image
in which L A, R1, R2, R3, R5, and R6 are as defined for the compounds of
general formula (l) in any one of
claims 1 to 8.
18. A method of preparing a compound of general formula (l) according to any
one of claims 1 to 8,
said method comprising the step of allowing an intermediate compound of
general formula (Xl):
Image
in which L A, R1, R5, and R6 are as defined for general formula (l) in any one
of claims 1 to 8;
to react with a compound of general formula R3R2NH2, in which R2 and R3 are as
defined for the
compounds of general formula (l) in any one of claims 1 to 8;
thereby giving, upon optional deprotection, a compound of general formula
(la):
Image

398


(Ia)
in which L A, R1, R2, R3, R5, and R6 are as defined for the compounds of
general formula (I) in any one of
claims 1 to 8.
19. A method of preparing a compound of general formula (I) according to any
one of claims 1 to 8,
said method comprising the step of allowing an intermediate compound of
general formula (XIa):
Image
in which L A, R1, R5, and R6 are as defined for general formula (I) in any one
of claims 1 to 8;
to react with a compound of general formula R3R2NH2, in which R2 and R3 are as
defined for the
compounds of general formula (I) in any one of claims 1 to 8;
thereby giving, upon optional deprotection, a compound of general formula
(Ia):
Image
in which L A, R1, R2, R3, R5, and R6 are as defined for the compounds of
general formula (I) in any one of
claims 1 to 8.
20. A method of preparing a compound of general formula (I) according to any
one of claims 1 to 8,
said method comprising the step of allowing an intermediate compound of
general formula (XVII):

399

Image
in which R2, R3, R5, and R6 are as defined for general formula (I) in any one
of claims 1 to 8;
to react with a carboxylic acid HO2C-L A-R1 or the corresponding acyl chloride
CI-C(=O)-L A-R1, wherein
L A and R' are as defined for the compounds of general formula (I) in any one
of claims 1 to 8; or
alternatively
to react with CI-C(=O)-L A-L G, in which L A is as defined for the compounds
of general formula (I) in any
one of claims 1 to 8, and L G stands for a leaving group, preferably chloro or
bromo, and subsequently
with agents suitable for the introduction of R1, exemplified by but not
limited to cyclic secondary
amines;
thereby giving, upon optional deprotection, a compound of general formula
(lb):
Image
in which L A, R1, R2, R3, R5, and R6 are as defined for the compounds of
general formula (I) in any one of
claims 1 to 8.
21. A method of preparing a compound of general formula (I) according to any
one of claims 1 to 8,
said method comprising the step of allowing an intermediate compound of
general formula (XXII):
Image
400

(XXII)
in which L A, R1, R5 and R6 are as defined for general formula (I) in any one
of claims 1 to 8;
to react with a carboxylic acid HO2C-R2-R3, wherein R2 and R3 are as defined
for the compounds of
general formula (I) in any one of claims 1 to 8; or alternatively
to react with a carboxylic acid X-R2-CO2H, in which R2 is as defined for the
compounds of general
formula (I) in any one of claims 1 to 8, and subsequently subjected to a
palladium catalysed coupling
reaction, such as a Suzuki coupling, with R3-X', in which R3 is as defined for
the compounds of general
formula (I) in any one of claims 1 to 8, and both X and X' represent groups
enabling palladium
catalysed coupling reactions, such as chloro, bromo, iodo,
trifluoromethylsulfonyloxy, nonaflyl or a
boronic acid or an ester thereof, with the proviso that if X represents a
boronic ester or an ester
thereof, X' stands for bromo, iodo, trifluoromethylsulfonyloxy or nonaflyl and
the like, or vice versa;
thereby giving, upon optional deprotection, a compound of general formula
(lb):
Image
in which L A, R1, R2, R3, R5, and R6 are as defined for the compounds of
general formula (I) in any one of
claims 1 to 8.
22. A method of preparing a compound of general formula (I) according to any
one of claims 1 to 8,
said method comprising the step of allowing an intermediate compound of
general formula (XXIV):
Image
in which R2, R3, R4, R5 and R6 are as defined for general formula (I) in any
one of claims 1 to 8;
401

to react with a carboxylic acid HO2C-L A-R1 or the corresponding acyl chloride
Cl-C(=O)-L A-R1, wherein
L A and R1 are as defined for the compounds of general formula (l) in any one
of claims 1 to 8;
thereby giving, upon optional deprotection, a compound of general formula
(lc):
Image
in which L A, R1, R2, R3, R A, R5 and R6 are as defined for the compounds of
general formula (l) in any
one of claims 1 to 8.
23. A method of preparing a compound of general formula (l) according to any
one of claims 1 to 8,
said method comprising the step of allowing an intermediate compound of
general formula (XXV):
Image
in which L A, R1, R2, R5 and R6 are as defined for general formula (l) in any
one of claims 1 to 8;
to react with a compound of general formula R3-X', wherein R3 is as defined
for the compounds of
general formula (l) in any one of claims 1 to 8;
wherein both, X and X' represent groups enabling palladium catalysed coupling
reactions, such as
chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonaflyl or a boronic acid or
an ester thereof, with
the proviso that if X represents a boronic ester or an ester thereof, X'
stands for chloro, bromo, iodo,
trifluoromethylsulfonyloxy or nonaflyl and the like, or vice versa.
thereby giving, upon optional deprotection, a compound of general formula
(la):
402

Image
in which L A, R1, R2, R3, R4, R5 and R6 are as defined for the compounds of
general formula (l) in any
one of claims 1 to 8.
24. Intermediate compounds of general formula (Vl):
Image
in which R2, R3, R5, and R6 are as defined for general formula (l) in any one
of claims 1 to 8.
25. Intermediate compounds of general formula (Xl):
Image
in which L A, R1, R5, and R6 are as defined for the compounds of general
formula (l) in any one of
claims 1 to 8.
26. Intermediate compounds of general formula (Xla):
403

Image
in which L A, R1, R5, and R6 are as defined for general formula (I) in any one
of claims 1 to 8.
27. Intermediate compounds of general formula (XVII):
Image
in which R2, R3, R5, and R6 are as defined for general formula (I) in any one
of claims 1 to 8.
28. Intermediate compounds of general formula (XXII):
Image
in which L A, R1, R5 and R6 are as defined for general formula (I) in any one
of claims 1 to 8.
29. Intermediate compounds of general formula (XXIV):
404

Image
in which R2, R3, R4, R5 and R6 are as defined for general formula (I) in any
one of claims 1 to 8.
30. Intermediate compound of general formula (XXV):
Image
in which L A, R1, R2, R5 and R6 are as defined for general formula (I) in any
one of claims 1 to 8, and X
represents a group enabling palladium catalysed coupling reactions, such as
chloro, bromo, iodo,
trifluoromethylsulfonyloxy, nonaflyl or a boronic acid or an ester thereof.
31. Use of the intermediate compounds of general formula (VI), (XI), (Xia),
(XVII), (XXII) or (XXIV) as
defined in the preceding claims for the preparation of a compound of general
formula (I) as defined
in any one of claims 1 to 8.

405

Note: Descriptions are shown in the official language in which they were submitted.

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Novel Compounds
The present invention relates to substituted N-(phenyl-heteroaryI)-3-
acetylamino-benzamides and N-
[3-(acetylamino)pheny1]-phenyl-heteroaryl-carboxamides of general formula (I)
as described and
defined herein, to methods of preparing said compounds, to intermediate
compounds useful for
preparing said compounds, to pharmaceutical compositions and combinations
comprising said
compounds and to the use of said compounds for manufacturing a pharmaceutical
composition for
the treatment or prophylaxis of a disease, in particular of a hyper-
proliferative disorder, as a sole
agent or in combination with other active ingredients.
BACKGROUND OF THE INVENTION
The Wnt signaling pathways are a group of signal transduction pathways made of
proteins that pass
signals from outside of a cell through cell surface receptors to the inside of
the cell.
Wnt proteins are secreted glycoproteins with a molecular weight in the range
of 39-46 kD, whereby
in total 19 different members of the Wnt protein family are known (McMahon et
al., Trends Genet.
8, 1992, 236 ¨ 242). They are the ligands of so-called Frizzled receptors,
which form a family of
seven-transmembrane spanning receptors comprising 10 distinct subtypes. A
certain Wnt ligand can
thereby activate several different Frizzled receptor subtypes and vice versa a
particular Frizzled
receptor can be activated by different Wnt protein subtypes (Huang et al.,
Genome Biol. 5, 2004,
234.1¨ 234.8).
Binding of a Wnt to its receptor can activate two different signaling
cascades, one is called the non-
canonical pathway, which involves CamK ll and PKC (Kuhl et al., Trends Genet.
16 (7), 2000, 279 ¨
283). The other, the so-called canonical pathway (Tamai et al., Mol. Cell 13,
2004, 149-156) regulates
the concentration of the transcription factor 13-catenin.
In the case of non-stimulated canonical Wnt signaling, 13-catenin is captured
by a destruction
complex consisting of adenomatous polyposis coli (APC), glycogen synthase
kinase 3-0 (GSK-313),
Axin-1 or -2 and Casein Kinase la. Captured 13-catenin is then phosphorylated,
ubiquitinated and
subsequently degraded by the proteasome.
However, when a canonical Wnt activates the membrane complex of a Frizzled
receptor and its
Lipoprotein 5 or 6 (LRP 5/6) co-receptor, this leads to the recruitment of
dishevelled (Dv!) by the
receptors and subsequent phosphorylation of LRP 5/6, followed by binding of
Axin-1 or Axin-2 to the
membrane complex as well. The deprivation of Axin from the 13-catenin
destruction complex leads to
the disassembly of the latter and 13-catenin can reach the nucleus, where it
together with TCF and LEF
transcription factors and other transcriptional coregulators like Pygopus,
BCL9/Legless, CDK8 module
1

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
of Mediator and TRRAP initiates transcription of genes with promoters
containing TCF elements
(Najdi, J. Carcinogenesis 2011; 10:5).
The Wnt signaling cascade can be constitutively activated by mutations in
genes involved in this
pathway. This is especially well documented for mutations of the APC and axin
genes, and also for
mutations of the 13-catenin phosphorylation sites, all of which are important
for the development of
colorectal and hepatocellular carcinomas (Polakis, EMBO J., 31, 2012, 2737-
2746).
The Wnt signaling cascade has important physiological roles in embryonal
development and tissue
homeostasis the latter especially for hair follicles, bones and the
gastrointestinal tract. Deregulation
of the Wnt pathway can activate in a cell and tissue specific manner a number
of genes known to be
important in carcinogenesis. Among them are c-myc, cyclin D1, Axin-2 and
metalloproteases (He et
al., Science 281, 1998, 1509-1512).
Deregulated Wnt activity can drive cancer formation, increased Wnt signaling
can thereby be caused
through autocrine Wnt signaling, as shown for different breast, ovarian,
prostate and lung
carcinomas as well as for various cancer cell lines (Bafico, Cancer Cell 6,
2004, 497-506; Yee, Mol.
Cancer 9, 2010, 162-176; Nguyen, Cell 138, 2009, 51-62).
For cancer stem cells (CSCs) it was shown that they have increased Wnt
signaling activity and that its
inhibition can reduce the formation of metastases (Vermeulen et al., Nature
Cell Biol. 12 (5), 2010,
468-476; Polakis, EMBO J. 31, 2012, 2737-2746; Reya, Nature, 434, 2005, 843-
850).
Furthermore, there is a lot of evidence supporting an important role of Wnt
signaling in
cardiovascular diseases. One aspect thereby is heart failure and cardiac
hypertrophy where deletion
of Dapper-1, an activator of the canonical 13-catenin Wnt pathway has been
shown to reduce
functional impairement and hypertrophy (Hagenmueller, M. et al.: Dapper-1
induces myocardial
remodeling through activation of canonical wnt signaling in cardiomyocytes;
Hypertension, 61 (6),
2013, 1177-1183).
Additional support for a role of Wnt signaling in heart failure comes from
animal experimental
models and clinical studies with patients, in which it was shown, that the
level of secreted frizzled
related protein 3 (5FRP3) is associated with the progression of heart failure
(Askevold, E.T. et al.: The
cardiokine secreted Frizzled-related protein 3, a modulator of Wnt signaling
in clinical and
experimental heart failure; J. Intern Med., 2014 (doi:10.1111/joim.12175)).
For cardiac remodeling
and infarct healing the expression of Fzd2 receptors on myofibroblasts
migrating into the infarct area
2

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
has been demonstrated (Blankesteijn, W.M. et al.: A homologue of Drosophila
tissue polarity gene
frizzled is expressed in migrating myofibroblasts in the infarcted rat heart;
Nat. Med. 3, 1997, 541-
544). The manifold effects of Wnt signaling in heart failure, fibrosis and
arrhythmias have been
recently reviewed by Dawson et al. (Dawson, K. et al.: Role of the Wnt-
Frizzled system in cardiac
pathophysiology: a rapidly developing, poorly understood area with enormous
potential; J. Physiol.
591 (6), 2013, 1409-1432).
For the vasculature, effects of Wnt signaling could be shown as well, mainly
in respect to restenosis
via enhancement of vascular smooth muscle cell proliferation (Tsaousi, A. et
al.: Wnt4/b-catenin
signaling induces VSMC proliferation and is associated with initmal
thickening; Circ. Res. 108, 2011,
427-436).
Besides the effects on heart and vasculature, dysregulated Wnt signaling is
also an important
component in chronic kidney disease as could be shown for upregulated Wnt
activity in immune cells
from corresponding patients (Al-Chaqmaqchi, H.A. et al.: Activation of Wnt/b-
catenin pathway in
monocytes derived from chronic kidney disease patients; PLoS One, 8 (7), 2013,
doi: 10.1371) and
altered levels of secreted Wnt inhibitor in patient sera (de Oliveira, R.B. et
al.: Disturbances of Wnt/b-
catenin pathway and energy metabolism in early CKD: effect of phosphate
binders; Nephrol. Dial.
Transplant. (2013) 28 (10): 2510-2517).
In adults, mis-regulation of the Wnt pathway also leads to a variety of
abnormalities and
degenerative diseases. An LRP mutation has been identified that causes
increased bone density at
defined locations such as the jaw and palate (Boyden LM et al.: High bone
density due to a mutation
in LDL-receptor-related protein 5; N Engl J Med. 2002 May 16; 346(20):1513-21,
Gong Y, et al.: LDL
receptor-related protein 5 (LRP5) affects bone accrual and eye development;
Cell 2001; 107:513-23).
The mutation is a single amino-acid substitution that makes LRP5 insensitive
to Dkk-mediated Wnt
pathway inhibition, indicating that the phenotype results from overactive Wnt
signaling in the bone.
Recent reports have suggested that Wnt signaling is an important regulator for
adipogenesis or
insulin secretion and might be involved in the pathogenesis of type 2
diabetes. It has been shown
that expression of the Wnt5B gene was detectable in several tissues, including
adipose, pancreas,
and liver. Subsequent in vitro experiments identified the fact that expression
of the Wnt5b gene was
increased at an early phase of adipocyte differentiation in mouse 3T3-L1
cells. Furthermore,
overexpression of the Wnt5b gene in preadipocytes resulted in the promotion of
adipogenesis and
the enhancement of adipocytokine-gene expression. These results indicate that
the Wnt5B gene may
contribute to conferring susceptibility to type 2 diabetes and may be involved
in the pathogenesis of
this disease through the regulation of adipocyte function (Kanazawa A, et al.:
Association of the gene
encoding wingless-type mammary tumor virus integration-site family member 58
(Wnt58) with type
2 diabetes; Am J Hum Genet. 2004 Nov; 75(5):832-43)
3

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Accordingly, identification of methods and compounds that modulate the Wnt -
dependent cellular
responses may offer an avenue for regulating physiological functions and
therapeutic treatment of
diseases associated with aberrant activity of the pathways.
Inhibitors of the Wnt signalling pathway are disclosed e.g. in US2008-
0075714(A1), US2011-
0189097(A1), US2012-0322717(A9), W02010/014948(A1),
W02012/088712(A1),
W02012/140274(A2,A3) and W02013/093508(A2).
WO 2005/084368(A2) discloses heteroalkyl-substituted biphenyl-4-carboxylic
acid arylamide
analogues and the use of such compounds for treating conditions related to
capsaicin receptor
activation, for identifying other agents that bind to capsaicin receptor, and
as probes for the
detection and localization of capsaicin receptors. The structural scope of the
compounds claimed in
claim 1 is huge, whereas the structural space spanned by the few examples is
much smaller. There is
no specific example which is covered by the formula (I) as described and
defined herein.
WO 2000/55120(A1) and WO 2000/07991 (Al) disclose amide derivatives and their
use for the
treatment of cytokine mediated diseases. The few specific examples disclosed
in WO
2000/55120(A1) and WO 2000/07991 (Al) are not covered by the formula (I) as
described and
defined herein.
WO 1998/28282 (A2) discloses oxygen or sulfur containing heteroaromatics as
factor Xa inhibitors.
The specific examples disclosed in WO 1998/28282 (A2) are not covered by the
formula (I) as
described and defined herein.
WO 2011/035321 (Al) discloses methods of treating Wnt/Frizzled-related
diseases, comprising
administering niclosamide compounds. According to the specification of WO
2011/035321 (Al)
libraries of FDA-approved drugs were examined for their utility as Frizzled
internalization modulators,
employing a primary imaged-based GFP-fluorescence assay that used Frizzled1
endocytosis as the
readout. It was discovered that the antihelminthic niclosamide, a drug used
for the treatment of
tapeworms, promotes Frizzled1 internalization (endocytosis), down regulates
Dishevelled-2 protein,
and inhibits Wnt3A-stimulated R-catenin stabilization and LEF/TCF reporter
activity. The specific
examples disclosed in WO 2011/035321 (Al) are not covered by the formula (I)
as described and
defined herein. Additionally, WO 2011/035321 (Al) does neither teach nor
suggest the compounds
4

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
of formula (I) as described and defined herein. The same is true for the
related publication WO
2004/006906 (A2) which discloses a method for treating a patient having a
cancer or other neoplasm
by administering to the patient a niclosamide.
JP 2010-138079 (A) relates to amide derivatives exhibiting insecticidal
effects. The specific examples
disclosed in JP 2010-138079 (A) are not covered by the formula (I) as
described and defined herein.
WO 2004/022536 (Al) relates to heterocyclic compounds that inhibit
phosphodiesterase type 4 (PDE
4) and their use for treating inflammatory conditions, diseases of the central
nervous system and
insulin resistant diabetes. The specific examples disclosed in WO 2004/022536
(Al) are not covered
by the formula (I) as described and defined herein.
SUMMARY of the INVENTION
The present invention relates to compounds of general formula (I) :
3
R 2
R...... B
L
R5 0SI
N\ A 1
L¨R
I
R6
R4
(I)
in which:
LA represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-
C3-alkyl-,
halo-C1-C3-alkoxy-, C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
5

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(W)-(C1-C6-alkyl);
wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered
heterocycloalkenyl-,
aryl-, heteroaryl-, and -N(W)-(C1-C6-alkyl) group is optionally substituted,
one or more times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-,
C3-C7-cycloalkyl-;
R2 represents a group selected from:
*e ** * ** ** * , **
N¨ ¨N 0
N¨N
** * **
**
N¨N N¨N O¨N N-0
* ** 0 * ** ** */..% **
=
wherein" * " indicates the point of attachment to R3, and " ** " indicates the
point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from:
halo-, hydroxy-, , -N(R9)(R10%) N(H)C(=0)R9, cyano-, nitro-, C1-
C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, amino-C1-C3-alkyl-, halo-C1-C3-alkoxy-
;
R4 represents a hydrogen atom or a C1-C3-alkyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected
from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
6

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-,
C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-,
heteroaryl-, -N(R9)(R19), -C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(R19), R9-S-, R9-
S(=0)-, R9-S(=0)2-;
said C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-, aryl-, heteroaryl-, and C1-
C6-alkoxy- group
being optionally substituted, one or more times, identically or differently,
with a substituent
selected from: halo-, cyano-, nitro-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, C4-C7-cycloalkenyl-,
3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-, heteroaryl-, -C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9,
-N(R19)C(=0)R9,
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S-, R9-S(=0)-, R9-S(=0)2-,
-N(H)S(=0)R9, -N(R19)S(=0)R9, -S(=0)N(H)R9, -S(=0)NR19R9,
-N(H)S(=0)2R9, -N(R9)S(=0)2R19, -S(=0)2N(H)R9, -S(=0)2NR19R9,
-S(=0)(=NR19)R9, -N=S(=0)(R19)R9;
R7 represents a hydrogen atom or a C1-C3-alkyl- or C1-C3-alkoxy-C1-C3-
alkyl- group;
R9, R19, Ril
represent, independently from each other, a hydrogen atom or a C1-C3-alkyl- or
C1-C3-alkoxy-C1-C3-alkyl- group;
or
R9R19 together with the atom or the group of atoms they are attached to, form
a 3- to
10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
The present invention further relates to a pharmaceutical composition
comprising a compound of
formula (I), supra.
The present invention further relates to the use of a compound of formula (I),
supra, for the
prophylaxis or treatment of a disease.
7

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The present invention further relates to the use of a compound of formula (I),
supra, for the
preparation of a medicament for the prophylaxis or treatment of a disease.
DETAILED DESCRIPTION of the INVENTION
The terms as mentioned in the present text have preferably the following
meanings:
The term "halogen atom" or "halo-" is to be understood as meaning a fluorine,
chlorine, bromine or
iodine atom.
The term "C1-C6-alkyl" is to be understood as preferably meaning a linear or
branched, saturated,
monovalent hydrocarbon group having 1, 2, 3, 4, 5 or 6 carbon atoms, e.g. a
methyl, ethyl, propyl,
butyl, pentyl, hexyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl, iso-
pentyl, 2-methylbutyl, 1-
methyl butyl, 1-ethyl propyl, 1,2-dimethylpropyl, neo-pentyl, 1,1-
dimethylpropyl, 4-methylpentyl, 3-
methylpentyl, 2-methylpentyl, 1-methylpentyl, 2-ethyl butyl, 1-ethyl butyl,
3,3-dimethyl butyl, 2,2-
dimethylbutyl, 1,1-dimethylbutyl, 2,3-dimethylbutyl, 1,3-dimethylbutyl, or 1,2-
dimethylbutyl group,
or an isomer thereof. Particularly, said group has 1, 2, 3 or 4 carbon atoms
("C1-C4-alkyl"), e.g. a
methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl
group, more particularly 1, 2 or
3 carbon atoms ("C1-C3-alkyl"), e.g. a methyl, ethyl, n-propyl- or iso-propyl
group.
The term "halo-C1-C6-alkyl" is to be understood as preferably meaning a linear
or branched,
saturated, monovalent hydrocarbon group in which the term "C1-C6-alkyl" is
defined supra, and in
which one or more of the hydrogen atoms is replaced, identically or
differently, by a halogen atom.
Particularly, said halogen atom is F. Said halo-C1-C6-alkyl group is, for
example, ¨CF3, -CHF2, -CH2F, -
CF2CF3, or -CH2CF3.
The term "C1-C6-alkoxy" is to be understood as preferably meaning a linear or
branched, saturated,
monovalent group of formula ¨0-(C1-C6-alkyl), in which the term "C1-C6-alkyl"
is defined supra, e.g. a
methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, iso-butoxy, tert-butoxy,
sec-butoxy, pentoxy, iso-
pentoxy, or n-hexoxy group, or an isomer thereof.
The term "halo-C1-C6-alkoxy" is to be understood as preferably meaning a
linear or branched,
saturated, monovalent C1-C6-alkoxy group, as defined supra, in which one or
more of the hydrogen
atoms is replaced, identically or differently, by a halogen atom.
Particularly, said halogen atom is F.
Said halo-C1-C6-alkoxy group is, for example, -0CF3, -OCHF2, -OCH2F, -0CF2CF3,
or -OCH2CF3.
8

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The term "C1-C6-alkoxy-C1-C6-alkyl" is to be understood as preferably meaning
a linear or branched,
saturated, monovalent C1-C6-alkyl group, as defined supra, in which one or
more of the hydrogen
atoms is replaced, identically or differently, by a C1-C6-alkoxy group, as
defined supra, e.g.
methoxyalkyl, ethoxyalkyl, propyloxyalkyl, iso-propoxyalkyl, butoxyalkyl, iso-
butoxyalkyl, tert-
butoxyalkyl, sec-butoxyalkyl, pentyloxyalkyl, iso-pentyloxyalkyl,
hexyloxyalkyl group, or an isomer
thereof.
The term "halo-C1-C6-alkoxy-C1-C6-alkyl" is to be understood as preferably
meaning a linear or
branched, saturated, monovalent C1-C6-alkoxy-C1-C6-alkyl group, as defined
supra, in which one or
more of the hydrogen atoms is replaced, identically or differently, by a
halogen atom. Particularly,
said halogen atom is F. Said halo-C1-C6-alkoxy-C1-C6-alkyl group is, for
example, -CH2CH2OCF3,
-CH2CH2OCHF2, -CH2CH2OCH2F, -CH2CH2OCF2CF3, or -CH2CH2OCH2CF3.
The term "C1-C6-alkoxy-C2-C6-alkoxy" is to be understood as preferably meaning
a saturated,
monovalent C2-C6-alkoxy group, as defined supra, in which one of the hydrogen
atoms is replaced by
a C1-C6-alkoxy group, as defined supra, e.g. methoxyalkoxy, ethoxyalkoxy,
pentoxyalkoxy,
hexoxyalkoxy group or methoxyethoxy, ethoxyethoxy, iso-propoxyhexoxy group, in
which the term
"alkoxy" is defined supra, or an isomer thereof.
The term "C2-C6-alkenyl" is to be understood as preferably meaning a linear or
branched, monovalent
hydrocarbon group, which contains one or more double bonds, and which has 2,
3, 4, 5 or 6 carbon
atoms, particularly 2 or 3 carbon atoms ("C2-C3-alkenyl"), it being understood
that in the case in
which said alkenyl group contains more than one double bond, then said double
bonds may be
isolated from, or conjugated with, each other. Said alkenyl group is, for
example, a vinyl, ally!,
(E)-2-methylvinyl, (Z)-2-methylvinyl, homoallyl, (E)-but-2-enyl, (Z)-but-2-
enyl, (E)-but-1-enyl,
(Z)-but-1-enyl, pent-4-enyl, (E)-pent-3-enyl, (Z)-pent-3-enyl, (E)-pent-2-
enyl, (Z)-pent-2-enyl,
(E)-pent-1-enyl, (Z)-pent-1-enyl, hex-5-enyl, (E)-hex-4-enyl, (Z)-hex-4-enyl,
(E)-hex-3-enyl,
(Z)-hex-3-enyl, (E)-hex-2-enyl, (Z)-hex-2-enyl, (E)-hex-1-enyl, (Z)-hex-1-
enyl, iso-propenyl,
2-methyl prop-2-enyl, 1-methyl prop-2-enyl, 2-
methyl prop-1-enyl, (E)-1-methylprop-1-enyl,
(Z)-1-methylprop-1-enyl, 3-methyl but-3-enyl,
2-methyl but-3-enyl, 1-methyl but-3-enyl,
3-methyl but-2-enyl, (E)-2-methyl but-2-enyl,
(Z)-2-methyl but-2-enyl, (E)-1-methyl but-2-enyl,
(Z)-1-methyl but-2-enyl, (E)-3-methyl but-1-enyl, (Z)-3-methyl but-1-enyl, (E)-
2-methyl but-1-enyl,
(Z)-2-methyl but-1-enyl, (E)-1-methyl but-1-enyl, (Z)-1-methyl but-1-enyl, 1,1-
dimethylprop-2-enyl,
1-ethylprop-1-enyl, 1-propylvinyl, 1-isopropylvinyl, 4-methylpent-4-enyl, 3-
methylpent-4-enyl,
9

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
2-methyl pent-4-enyl, 1-methyl pent-4-enyl,
4-methyl pent-3-enyl, (E)-3-methyl pent-3-enyl,
(Z)-3-methyl pent-3-enyl, (E)-2-methyl pent-3-enyl, (Z)-2-methyl pent-3-enyl,
(E)-1-methyl pent-3-enyl,
(Z)-1-methyl pent-3-enyl, (E)-4-methyl pent-2-enyl, (Z)-4-methyl pent-2-enyl,
(E)-3-methyl pent-2-enyl,
(Z)-3-methyl pent-2-enyl, (E)-2-methyl pent-2-enyl, (Z)-2-methyl pent-2-enyl,
(E)-1-methyl pent-2-enyl,
(Z)-1-methyl pent-2-enyl, (E)-4-methyl pent-1-enyl, (Z)-4-methyl pent-1-enyl,
(E)-3-methyl pent-1-enyl,
(Z)-3-methyl pent-1-enyl, (E)-2-methyl pent-1-enyl, (Z)-2-methyl pent-1-enyl,
(E)-1-methyl pent-1-enyl,
(Z)-1-methyl pent-1-enyl, 3-ethyl but-3-enyl,
2-ethyl but-3-enyl, 1-ethyl but-3-enyl,
(E)-3-ethyl but-2-enyl, (Z)-3-ethyl but-2-enyl,
(E)-2-ethyl but-2-enyl, (Z)-2-ethyl but-2-enyl,
(E)-1-ethyl but-2-enyl, (Z)-1-ethyl but-2-enyl,
(E)-3-ethyl but-1-enyl, (Z)-3-ethyl but-1-enyl,
2-ethyl but-1-enyl, (E)-1-ethyl but-1-enyl, (Z)-1-ethyl but-1-enyl, 2-
propyl prop-2-enyl,
1-propyl prop-2-enyl, 2-isopropyl prop-2-enyl,
1-isopropyl prop-2-enyl, (E)-2-propyl prop-1-enyl,
(Z)-2-propyl prop-1-enyl, (E)-1-propyl prop-1-enyl, (Z)-1-propyl prop-1-enyl,
(E)-2-isopropyl prop-1-enyl,
(Z)-2-isopropylprop-1-enyl, (E)-1-isopropylprop-1-
enyl, (Z)-1-isopropyl prop-1-enyl,
(E)-3,3-dimethylprop-1-enyl, (Z)-3,3-dimethyl prop-1-
enyl, 1-(1,1-dimethylethyl)ethenyl,
buta-1,3-dienyl, penta-1,4-dienyl, hexa-1,5-dienyl, or methylhexadienyl group.
Particularly, said
group is vinyl or ally!.
The term "C2-C6-alkynyl" is to be understood as preferably meaning a linear or
branched, monovalent
hydrocarbon group which contains one or more triple bonds, and which contains
2, 3, 4, 5 or 6
carbon atoms, particularly 2 or 3 carbon atoms ("C2-C3-alkynyl"). Said C2-C6-
alkynyl group is, for
example, ethynyl, prop-1-ynyl, prop-2-ynyl, but-1-ynyl, but-2-ynyl, but-3-
ynyl, pent-1-ynyl,
pent-2-ynyl, pent-3-ynyl, pent-4-ynyl, hex-1-ynyl, hex-2-ynyl, hex-3-ynyl, hex-
4-ynyl, hex-5-ynyl,
1-methyl prop-2-ynyl, 2-methyl but-3-ynyl, 1-methyl but-3-
ynyl, 1-methyl but-2-ynyl,
3-methyl but-1-ynyl, 1-ethyl prop-2-ynyl, 3-methylpent-4-ynyl, 2-methyl pent-4-
ynyl, 1-methyl-
pent-4-ynyl, 2-methyl pent-3-ynyl, 1-methylpent-3-ynyl, 4-methyl pent-2-ynyl,
1-methylpent-2-ynyl,
4-methyl pent-1-ynyl, 3-methyl pent-1-ynyl, 2-ethyl but-3-ynyl, 1-ethyl but-3-
ynyl, 1-ethyl but-2-ynyl,
1-propyl prop-2-ynyl, 1-isopropyl prop-2-ynyl,
2,2-dimethyl but-3-ynyl, 1,1-dimethyl but-3-ynyl,
1,1-dimethylbut-2-ynyl, or 3,3-dimethylbut-1-ynyl group. Particularly, said
alkynyl group is ethynyl,
prop-1-ynyl, or prop-2-ynyl.
The term "C3-C7-cycloalkyl" is to be understood as meaning a saturated,
monovalent, monocyclic
hydrocarbon ring which contains 3, 4, 5, 6 or 7 carbon atoms. Said C3-C7-
cycloalkyl group is for
example a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl
ring. Particularly, said ring
contains 3, 4, 5 or 6 carbon atoms ("C3-C6-cycloalkyl").
10

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The term "C4-C8-cycloalkenyl" is to be understood as preferably meaning a
monovalent, monocyclic
hydrocarbon ring which contains 4, 5, 6, 7 or 8 carbon atoms and one or two
double bonds, in
conjugation or not, as the size of said cycloalkenyl ring allows.
Particularly, said ring contains 4, 5 or 6
carbon atoms ("C4-C6-cycloalkenyl"). Said C4-C8-cycloalkenyl group is for
example a cyclobutenyl,
cyclopentenyl, or cyclohexenyl group.
The term "C3-C6-cycloalkoxy" is to be understood as meaning a saturated,
monovalent, monocyclic
group of formula -0-(C3-C6-cycloalkyl), in which the term "C3-C6-cycloalkyl"
is defined supra, e.g. a
cyclopropyloxy, cyclobutyloxy, cyclopentyloxy or cyclohexyloxy group.
The term "3- to 10-membered heterocycloalkyl", is to be understood as meaning
a saturated,
monovalent, mono- or bicyclic hydrocarbon ring which contains 2, 3, 4, 5, 6,
7, 8 or 9 carbon atoms,
and one or more heteroatom-containing groups selected from C(=0), 0, S, S(=0),
S(=0)2, NH ; it being
possible for said heterocycloalkyl group to be attached to the rest of the
molecule via any one of the
carbon atoms or, if present, a nitrogen atom.
Particularly, said 3- to 10-membered heterocycloalkyl can contain 2, 3, 4, 5
or 6 carbon atoms, and
one or more of the above-mentioned heteroatom-containing groups (a "3- to 7-
membered
heterocycloalkyl"), more particularly said heterocycloalkyl can contain 4, 5
or 6 carbon atoms, and
one or more of the above-mentioned heteroatom-containing groups (a "4- to 6-
membered
heterocycloalkyl").
Particularly, without being limited thereto, said heterocycloalkyl can be a 4-
membered ring, such as
an azetidinyl, oxetanyl, or a 5-membered ring, such as tetrahydrofuranyl,
dioxolinyl, pyrrolidinyl,
imidazolidinyl, pyrazolidinyl, pyrrolinyl, or a 6-membered ring, such as
tetrahydropyranyl, piperidinyl,
morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, or trithianyl, or a 7-
membered ring, such as a
diazepanyl ring, for example.
The term "4- to 10-membered heterocycloalkenyl", is to be understood as
meaning an unsaturated,
monovalent, mono- or bicyclic hydrocarbon ring which contains 3, 4, 5, 6, 7, 8
or 9 carbon atoms, and
one or more heteroatom-containing groups selected from C(=0), 0, S, S(=0),
S(=0)2, NH; it being
possible for said heterocycloalkenyl group to be attached to the rest of the
molecule via any one of
the carbon atoms or, if present, a nitrogen atom. Examples of said
heterocycloalkenyl may contain
one or more double bonds, e.g. 4H-pyranyl, 2H-pyranyl, 2,5-dihydro-1H-
pyrrolyl, [1,3]clioxolyl,
4H-[1,3,4]thiadiazinyl, 2,5-dihydrofuranyl, 2,3-
dihydrofuranyl, 2,5-dihydrothiophenyl,
2,3-dihydrothiophenyl, 4,5-dihydrooxazolyl, or 4H-[1,4]thiazinyl group.
11

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The term "aryl" is to be understood as preferably meaning a monovalent,
aromatic or partially
aromatic, mono-, or bi- or tricyclic hydrocarbon ring having 6, 7, 8, 9, 10,
11, 12, 13 or 14 carbon
atoms (a "C6-C14-aryl" group), particularly a ring having 6 carbon atoms (a
"C6-aryl" group), e.g. a
phenyl group; or a ring having 9 carbon atoms (a "C9-aryl" group), e.g. an
indanyl or indenyl group, or
a ring having 10 carbon atoms (a "C19-aryl" group), e.g. a tetralinyl,
dihydronaphthyl, or naphthyl
group, or a biphenyl group (a "C12-aryl" group), or a ring having 13 carbon
atoms, (a "C13-aryl" group),
e.g. a fluorenyl group, or a ring having 14 carbon atoms, (a "C14-aryl"
group), e.g. an anthracenyl
group. Preferably, the aryl group is a phenyl group.
The term "heteroaryl" is understood as preferably meaning a monovalent,
monocyclic- , bicyclic- or
tricyclic aromatic ring system having 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 ring
atoms (a "5- to
14-membered heteroaryl" group), particularly 5 or 6 or 9 or 10 atoms, and
which contains at least
one heteroatom which may be identical or different, said heteroatom being such
as oxygen, nitrogen
or sulfur, and in addition in each case can be benzocondensed. Particularly,
heteroaryl is selected
from thienyl, furanyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl,
isoxazolyl, isothiazolyl,
oxadiazolyl, triazolyl, thiadiazolyl, thia-4H-pyrazoly1 etc., and benzo
derivatives thereof, such as, for
example, benzofuranyl, benzothienyl, benzoxazolyl, benzisoxazolyl,
benzimidazolyl, benzotriazolyl,
indazolyl, indolyl, isoindolyl, etc.; or pyridinyl, pyridazinyl, pyrimidinyl,
pyrazinyl, triazinyl, etc., and
benzo derivatives thereof, such as, for example, quinolinyl, quinazolinyl,
isoquinolinyl, etc.; or
azocinyl, indolizinyl, purinyl, etc., and benzo derivatives thereof; or
cinnolinyl, phthalazinyl,
quinazolinyl, quinoxalinyl, naphthpyridinyl, pteridinyl, carbazolyl,
acridinyl, phenazinyl,
phenothiazinyl, phenoxazinyl, xanthenyl, or oxepinyl, etc..
In general, and unless otherwise mentioned, the heteroarylic or heteroarylenic
radicals include all
the possible isomeric forms thereof, e.g. the positional isomers thereof.
Thus, for some illustrative
non-restricting example, the term pyridyl includes pyridin-2-yl, pyridin-3-yl,
and pyridin-4-y1; or the
term thienyl includes thien-2-y1 and thien-3-yl. Preferably, the heteroaryl
group is a pyridinyl group.
The term "C1-C6", as used throughout this text, e.g. in the context of the
definition of "C1-C6-alkyl",
"C1-C6-haloalkyl", "C1-C6-alkoxy", or "C1-C6-haloalkoxy" is to be understood
as meaning an alkyl group
having a finite number of carbon atoms of 1 to 6, i.e. 1, 2, 3, 4, 5, or 6
carbon atoms. It is to be
understood further that said term "C1-C6" is to be interpreted as any sub-
range comprised therein,
e.g. C1-C6 , C2-05 , C3-C4 , C1-C2 , C1-C3 , C1-C4 , C1-05 , Cr-C6;
particularly C1-C2, C1-C3, C1-C4, CI-Cs , C1-C6,
more particularly C1-C4; in the case of "C1-C6-haloalkyl" or "C1-C6-
haloalkoxy" even more particularly
12

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Similarly, as used herein, the term "C2-C6", as used throughout this text,
e.g. in the context of the
definitions of "C2-C6-alkenyl" and "C2-C6-alkynyl", is to be understood as
meaning an alkenyl group or
an alkynyl group having a finite number of carbon atoms of 2 to 6, i.e. 2, 3,
4, 5, or 6 carbon atoms. It
is to be understood further that said term "C2-C6" is to be interpreted as any
sub-range comprised
therein, e.g. C2-C6 , C3-05 , C3-C4 , C2-C3 , C2-C4 , C2-05, particularly C2-
C3.
Further, as used herein, the term "C3-C7", as used throughout this text, e.g.
in the context of the
definition of "C3-C7-cycloalkyl", is to be understood as meaning a cycloalkyl
group having a finite
number of carbon atoms of 3 to 7, i.e. 3, 4, 5, 6 or 7 carbon atoms. It is to
be understood further that
said term "C3-C7" is to be interpreted as any sub-range comprised therein,
e.g. C3-C6, C4-05, C3-05, C3-
C4 C4-C6, C5-C7; particularly C3-C6.
The term "substituted" means that one or more hydrogens on the designated atom
is replaced with a
selection from the indicated group, provided that the designated atom's normal
valency under the
existing circumstances is not exceeded, and that the substitution results in a
stable compound.
Combinations of substituents and/or variables are permissible only if such
combinations result in
stable compounds.
The term "optionally substituted" means that the number of substituents can be
zero. Unless
otherwise indicated, optionally substituted groups may be substituted with as
many optional
substituents as can be accommodated by replacing a hydrogen atom with a non-
hydrogen
substituent on any available carbon or nitrogen atom. Commonly, the number of
optional
substituents (when present) ranges from 1 to 3.
Ring system substituent means a substituent attached to an aromatic or
nonaromatic ring system
which, for example, replaces an available hydrogen on the ring system.
As used herein, the term "one or more times", e.g. in the definition of the
substituents of the
compounds of the general formulae of the present invention, is understood as
meaning "one, two,
three, four or five times, particularly one, two, three or four times, more
particularly one, two or
three times, even more particularly one or two times".
As used herein, the term "leaving group" refers to an atom or a group of atoms
that is displaced in a
chemical reaction as stable species taking with it the bonding electrons.
Preferably, a leaving group is
selected from the group comprising: halo, in particular chloro, bromo or iodo,
methanesulfonyloxy,
p-toluenesulfonyloxy,
trifluoromethanesulfonyloxy, nonafluorobutanesulfonyloxy,
(4-bromo-benzene)sulfonyloxy, (4-nitro-benzene)sulfonyloxy,
(2-nitro-benzene)-sulfonyloxy,
(4-isopropyl-benzene)sulfonyloxy,
(2,4,6-tri-isopropyl-benzene)-sulfonyloxy,
13

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
(2,4,6-trimethyl-benzene)sulfonyloxy, (4-tertbutyl-benzene)sulfonyloxy,
benzenesulfonyloxy, and
(4-methoxy-benzene)sulfonyloxy.
Where the plural form of the word compounds, salts, polymorphs, hydrates,
solvates and the like, is
used herein, this is taken to mean also a single compound, salt, polymorph,
isomer, hydrate, solvate
or the like.
The compounds of this invention contain one or more asymmetric centres,
depending upon the
location and nature of the various substituents desired. Asymmetric carbon
atoms may be present in
the (R) or (S) configuration. In certain instances, asymmetry may also be
present due to restricted
rotation about a given bond, for example, the central bond adjoining two
substituted aromatic rings
of the specified compounds.
Substituents on a ring may also be present in either cis or trans form. It is
intended that all such
configurations are included within the scope of the present invention.
Preferred compounds are those which produce the more desirable biological
activity. Separated,
pure or partially purified isomers and stereoisomers or racemic or
diastereomeric mixtures of the
compounds of this invention are also included within the scope of the present
invention. The
purification and the separation of such materials can be accomplished by
standard techniques known
in the art.
The optical isomers can be obtained by resolution of the racemic mixtures
according to conventional
processes, for example, by the formation of diastereoisomeric salts using an
optically active acid or
base or formation of covalent diastereomers. Examples of appropriate acids are
tartaric,
diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid. Mixtures of
diastereoisomers can be
separated into their individual diastereomers on the basis of their physical
and/or chemical
differences by methods known in the art, for example, by chromatography or
fractional
crystallisation. The optically active bases or acids are then liberated from
the separated
diastereomeric salts. A different process for separation of optical isomers
involves the use of chiral
chromatography (e.g., chiral HPLC columns), with or without conventional
derivatisation, optimally
chosen to maximise the separation of the enantiomers. Suitable chiral HPLC
columns are
manufactured by Diacel, e.g., Chiracel OD and Chiracel OJ among many others,
all routinely
selectable. Enzymatic separations, with or without derivatisation, are also
useful. The optically
active compounds of this invention can likewise be obtained by chiral
syntheses utilizing optically
active starting materials.
14

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In order to limit different types of isomers from each other reference is made
to IUPAC Rules Section
E (Pure Appl Chem 45, 11-30, 1976).
The invention also includes all suitable isotopic variations of a compound of
the invention. An
isotopic variation of a compound of the invention is defined as one in which
at least one atom is
replaced by an atom having the same atomic number but an atomic mass different
from the atomic
mass usually or predominantly found in nature. Examples of isotopes that can
be incorporated into a
compound of the invention include isotopes of hydrogen, carbon, nitrogen,
oxygen, phosphorus,
sulphur, fluorine, chlorine, bromine and iodine, such as 2H (deuterium), 3H
(tritium), 11c, 13c, 14c, 15N,
170, 180, 321), 331), 33s, 34s, 35s, 36s, 18F, 36c1, 82Br, 1231, 1241, 1291
and 1i
3,1. respectively. Certain isotopic
variations of a compound of the invention, for example, those in which one or
more radioactive
isotopes such as 3H or 14C are incorporated, are useful in drug and/or
substrate tissue distribution
studies. Tritiated and carbon-14, i.e., 14."L.,
isotopes are particularly preferred for their ease of
preparation and detectability. Further, substitution with isotopes such as
deuterium may afford
certain therapeutic advantages resulting from greater metabolic stability, for
example, increased in
vivo half-life or reduced dosage requirements and hence may be preferred in
some circumstances.
Isotopic variations of a compound of the invention can generally be prepared
by conventional
procedures known by a person skilled in the art such as by the illustrative
methods or by the
preparations described in the examples hereafter using appropriate isotopic
variations of suitable
reagents.
The present invention includes all possible stereoisomers of the compounds of
the present invention
as single stereoisomers, or as any mixture of said stereoisomers, in any
ratio. Isolation of a single
stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound
of the present
invention may be achieved by any suitable state of the art method, such as
chromatography,
especially chiral chromatography, for example.
Further, the compounds of the present invention may exist as tautomers. For
example, any
compound of the present invention which contains a pyrazole moiety as a
heteroaryl group for
example can exist as a 1H tautomer, or a 2H tautomer, or even a mixture in any
amount of the two
tautomers, or a triazole moiety for example can exist as a 1H tautomer, a 2H
tautomer, or a 4H
tautomer, or even a mixture in any amount of said 1H, 2H and 4H tautomers,
viz. :

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN N N,
------ NH
'IN
N N=i
H
1H-tautomer 2H-tautomer 4H-tautomer.
The present invention includes all possible tautomers of the compounds of the
present invention as
single tautomers, or as any mixture of said tautomers, in any ratio.
Further, the compounds of the present invention can exist as N-oxides, which
are defined in that at
least one nitrogen of the compounds of the present invention is oxidised. The
present invention
includes all such possible N-oxides.
The present invention also relates to useful forms of the compounds as
disclosed herein, such as
metabolites, hydrates, solvates, prodrugs, salts, in particular
pharmaceutically acceptable salts, and
co-precipitates.
The compounds of the present invention can exist as a hydrate, or as a
solvate, wherein the
compounds of the present invention contain polar solvents, in particular
water, methanol or ethanol
for example as structural element of the crystal lattice of the compounds. The
amount of polar
solvents, in particular water, may exist in a stoichiometric or non-
stoichiometric ratio. In the case of
stoichiometric solvates, e.g. a hydrate, hemi-, (semi-), mono-, sesqui-, di-,
tri-, tetra-, penta- etc.
solvates or hydrates, respectively, are possible. The present invention
includes all such hydrates or
solvates.
Further, the compounds of the present invention can exist in free form, e.g.
as a free base, or as a
free acid, or as a zwitterion, or can exist in the form of a salt. Said salt
may be any salt, either an
organic or inorganic addition salt, particularly any pharmaceutically
acceptable organic or inorganic
addition salt, customarily used in pharmacy.
The present invention includes all possible salts of the compounds of the
present invention as single
salts, or as any mixture of said salts, in any ratio.
Furthermore, the present invention includes all possible crystalline forms, or
polymorphs, of the
compounds of the present invention, either as single polymorphs, or as a
mixture of more than one
polymorphs, in any ratio.
16

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In accordance with a first aspect, the present invention covers compounds of
general formula (I) :
3
R 2
R...... B
L
R5 0SI
N\ A 1
L¨R
I
R6
R4
(I)
in which :
LA represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-
C3-alkyl-,
halo-C1-C3-alkoxy-, C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(R7)-(C1-C6-alkyl);
wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered
heterocycloalkenyl-,
aryl-, heteroaryl-, and -N(R7)-(C1-C6-alkyl) group is optionally substituted,
one or more times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-,
C3-C7-cycloalkyl-;
R2 represents a group selected from:
17

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
* e * *
* * * *
N N 0
N
N - N
** * **
* **
N - N N - N 0 - N N - 0
** 0 * ** * ** *4/, **
=
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from:
halo-, hydroxy-, -N(R9)(K irs _
) N(H)C(=0)R9, cyano-, nitro-, C1-C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, amino-C1-C3-alkyl-,halo-C1-C3-alkoxy-
;
R4 represents a hydrogen atom or a C1-C3-alkyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected
from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-,
C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-,
heteroaryl-, -N(RB)(R _ ) C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(R10), R9-S-,
R9-S(=0)-, R9-5(=0)2-;
said C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-, aryl-, heteroaryl-, and C1-
C6-alkoxy- group
being optionally substituted, one or more times, identically or differently,
with a substituent
selected from: halo-, cyano-, nitro-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, C4-C7-cycloalkenyl-,
3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-, heteroaryl-, -C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9,
-N(R1 )C(=0)R9,
18

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S-, R9-S(=0)-, R9-S(=0)2-,
-N(H)S(=0)R9, -N(R19)S(=0)R9, -S(=0)N(H)R9, -S(=0)NR19R9,
-N(H)S(=0)2R9, -N(R9)S(=0)2R19, -S(=0)2N(H)R9, -S(=0)2NR19R9,
-S(=0)(=NR19)R9, -N=S(=0)(R19)R9;
R7 represents a hydrogen atom or a C1-C3-alkyl- or C1-C3-alkoxy-C1-C3-
alkyl- group;
R9, wo, Rn
represent, independently from each other, a hydrogen atom or a C1-C3-alkyl- or
C1-C3-alkoxy-C1-C3-alkyl- group;
or
R9,K10
together with the atom or the group of atoms they are attached to, form a 3-
to
10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In an embodiment, the present invention relates to compounds of the general
formula (I), supra, in
which:
LA represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-
C3-alkyl-, halo-C1-C3-
alkoxy-, C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
19

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LA represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, fluoro-C1-C3-alkyl-,
hydroxy-C1-C3-alkyl-, fluoro-C1-C3-alkoxy-, C3-C7-cycloalkyl-,
3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
LA represents a methylene group, said methylene group being optionally
substituted, one or
more times, identically or differently, with a substituent selected from:
cyano-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, fluoro-C1-C3-alkyl-,
hydroxy-C1-C3-alkyl-, C3-05-cycloalkyl-, 3- to 6-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-.
In another embodiment, the present invention relates to compounds of general
formula (I), supra, in
which:
LA represents a methylene group, said methylene group being optionally
substituted, one or
more times, identically or differently, with a substituent selected from:
hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, hydroxy-C1-C3-alkyl-,
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-.
20

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
In a preferred embodiment, the present invention relates to compounds of
general formula (I),
supra, in which:
LA represents methylene, said methylene group being optionally
substituted one or two times,
identically or differently, with C1-C3-alkyl-,
wherein, if said methylene is substituted with two C1-C3-alkyl- groups, these
may, together
with the carbon atom they are attached to, form a C3-C6-cycloalkyl- ring.
In a particularly preferred embodiment, the present invention relates to
compounds of general
formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)-, -C(CH3)2-, -CH(C2H5)-,
7C\
H2C CH2 /
µs,
H/C\., H2C ¨CH2 ;
or wherein the cyclobutyl- and the cycloproypl-
ring are
optionally substituted one or more times, identically or differently, with a
substituent
selected from: halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-.
In a particularly preferred embodiment, the present invention relates to
compounds of general
formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
H2C
CH2; wherein the cycloproypl- ring is optionally substituted one or more
times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-, C1-C3-
alkyl-, C1-C3-alkoxy-.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
/
H2C ¨CH,
z.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)-, or
21

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
/
H2C ¨ CH2.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2- or -CH(CH3)-.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2-.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH(CH3)-.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents
/
H2C ¨CH2, wherein the cycloproypl- ring is optionally substituted one or more
times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-, C1-C3-
alkyl-, C1-C3-alkoxy-.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents
/
H2C ¨
z .
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
LB represents -N(H)-C(=0)- or -C(=0)-N(H)-.
22

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In a preferred embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
LB represents *N(H)-C(=0)**;
wherein" * " indicates the point of attachment to R2, and" ** " indicates the
point of
attachment to the phenyl group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(W)-(C1-C6-alkyl);
wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered
heterocycloalkenyl-,
aryl-, heteroaryl-, and -N(W)-(C1-C6-alkyl) group is optionally substituted,
one or more times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-,
C3-C7-cycloalkyl-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R1 represents a group selected from:
/ /
--\ --\ H3C)_\
*N 0 *NI /0 *N NO *N N-R12
*N N-R12
\__/ \__/ \__/
/ , , , ,
CH
1, N
* N N-R - * N/CN-CH3 *
N'_..1 * /_
* N\ __ /0
\__/ \ N
*N
\ N-
/ CH3
, -N(CH3)2, -N(H)-(CH2-CH2-0-CH3), -N(CH3)-(CH2-CH2-0-CH3);
wherein * indicates the point of attachment to LA; and
wherein R12 represents a methyl-, ethyl-, trifluoroethyl-, difluoroethyl- or
cyclopropyl- group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
23

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
IR1 represents a group selected from:
HO
/ /
--\ --\ )_\
*N 0 *NI /0 *N NO ,,, N N-
R12
*N N-R12
\__/ \__/ \__/
/
/
/
/
/
OH3
*N N-R12 *NI /N-CH3
\__/
/
/
-N(CH3)2, -N(H)-(CH2-CH2-0-CH3), -N(CH3)-(CH2-CH2-0-CH3);
wherein * indicates the point of attachment to LA; and
wherein R12 represents a methyl-, ethyl-, trifluoroethyl-, difluoroethyl- or
cyclopropyl- group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R1 represents a 6-membered heterocycloalkyl- group; said group being
optionally substituted
with a C1-C3-alkyl-, -C1-C2-alkylene- (which means a bridging methylene or
ethylene group) or
C3-C6-cycloalkyl- group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
IR1 represents a group selected from:
/--\--\
*N 0 *NI /0 * NN /0 * N N-R12
\__/ \__/
/
/
/
/
-N(CH3)2, -N(H)-(CH2-CH2-0-CH3), -N(CH3)-(CH2-CH2-0-CH3);
wherein * indicates the point of attachment to LA; and
wherein R12 represents methyl, ethyl or cyclopropyl.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
IR1 represents a morpholino group, which is attached to LA via its
nitrogen atom, and which
may be optionally substituted one or two times, identically or differently,
with C1-C3-alkyl-,
or two of said C1-C3-alkyl groups together may form a C1-C3-alkylene group
(forming a
bridge between two different ring carbon atoms of said morpholino group);
or
24

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
R1 represents thiomorpholino, 4-cycloproylpiperazino, 4-
methylpiperazino or pyrazol-1-y1
group, said groups being attached to LA via their ring nitrogen atom.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R1 represents a
3
õ, N 2
1
group;
wherein * indicates the point of attachment to LA; wherein A represents a
group selected from:
-0-, -S-, -S(=0)2-, -NR12-; wherein R12 represents a hydrogen atom or group
selected from:
C1-C6-alkyl-, C3-C7-cycloalkyl-; and wherein the carbon atoms 1 and 4, 1 and
3, 2 and 3, or 2 and 4 are
optionally bridged via a methylene or ethylene group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R1 represents a
3
õ, N 2
1
group;
wherein * indicates the point of attachment to LA; wherein A represents a
group selected from:
-0- and -NR12-; wherein R12 represents a group selected from: C1-C3-alkyl-, C3-
C6-cycloalkyl-; and
wherein the carbon atoms 2 and 3, or 2 and 4 are optionally bridged via a
methylene or ethylene
group;
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
R1 represents a
3
R12
õ, N 2
1 group;

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein * indicates the point of attachment to LA; wherein Ft' represents a
methyl-, ethyl- or
cyclopropyl- group; and wherein the carbon atoms 1 and 4, 1 and 3, 2 and 3, or
2 and 4 are optionally
bridged via a methylene or ethylene group.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
IR1 represents a
N ,CH3
.,,, N
group;
wherein * indicates the point of attachment to LA.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
IR1 represents a
N
* N
group;
wherein * indicates the point of attachment to LA.
In a preferred embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
IR1 represents a morpholino group, which is attached to LA via its
nitrogen atom, and which
may be optionally substituted one or two times, identically or differently,
with C1-C3-alkyl-,
or two of said C1-C3-alkyl- groups together may form a C1-C3-alkylene group
(forming a
bridge between two different ring carbon atoms of said morpholino group).
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
IR1 represents a group selected from:
26

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
0 0
c0
, N õ N __ õ N
, , ,
wherein" * " indicates the point of attachment to LA.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
IV- represents a group selected from:
0 cCI
N ____________________ N
, ,
wherein" * " indicates the point of attachment to LA.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
IV- represents a group selected from:
0 0
, N õ N __
wherein" * " indicates the point of attachment to LA.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
Ft' represents
NC)
,
wherein" * " indicates the point of attachment to LA.
27

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
1V- represents
0
* N
.
,
wherein" * " indicates the point of attachment to L'.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
R' represents
i\O
*
,
wherein " * " indicates the point of attachment to L'.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
1V- represents a group selected from:
n C /A
._. N H3 N
* N * N * N
, , ,
wherein" * " indicates the point of attachment to L'.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents a group selected from:
28

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
ii \\
*e õ õ õõ *N/ ** õ * **
0 S
N N __ \ H
N - N
* ** * **
* c", ...., .,õ.\=-- \ **
S S
N - N N - N 0 - N N - 0
* 0 * /../.., )...\ ** */..õ. .3 ** *4/ N , ..,.... **
s N .
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of attachment to
12; wherein said group is optionally substituted, one or more times,
identically or differently, with a
Ci-C3-alkyl- group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents a group selected from:
*e . *e
H
N - N
** * **
N * **
* ====(....õ...1.,..) **
, , , , ,
*
../., )...\ **, * /IN ,...;\ ** * 1./.., )...\ ** * 4-.....:, _., ** *
-;:. **
S S S N N
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of attachment to
12; wherein said group is optionally substituted, one or more times,
identically or differently, with a
C1-C3-alkyl- group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents a group selected from:
¨
*e ** * **
N - N
N N
**
* * ** *
N **
H S S S
, , , ,
29

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
HO
N ¨ N H
N ¨ N 0 ¨ N N ¨ 0 \
N ¨ N
* ** S * N =====(...,:,..) ** * 4.:: ..-
** * 4-.1 * 0 **
_ N .
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of attachment to
LB.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents a group selected from:
* e ** * **
, .
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents a group selected from:
*e ** * **, * **, *0 ..,..., ,....,
N * *, * ..i., ,.....\ * *
S
, ,
*
.l.., ),.\ ** * 1../.., ....;\ ** * 1../.., .)...\ **
S S S .
, , ,
wherein" * " indicates the point of attachment to fe, and " ** " indicates the
point of attachment to
LB.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents a group selected from:
¨ ,
N _____________________________________ \ N N N
*e ** * **
,
* **, * S s " * " * **
N ¨ N _ S S .
, , ,
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of attachment to
LB.

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents
/ ______________ N
s
,
wherein" * " indicates the point of attachment to R3, and" ** " indicates the
point of
attachment to LB.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents
N ______________
S
,
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R2 represents
*
S
,
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB.
In another preferred embodiment, the present invention relates to compounds of
the general
formula (I), supra, in which:
R2 represents
*e
N-
,
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB.
31

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another particular preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R2 represents
N-N
* 1../.., .),...\ **
S
,
wherein" * " indicates the point of attachment to fe, and " ** " indicates the
point of
attachment to LB.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
re represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from:
halo-, hydroxy-, -N(R9)( i), rl 0% _
N(H)C(=0)RB, cyano-, nitro-, C1-C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, amino-C1-C3-alkyl-, halo-C1-C3-alkoxy-
.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from: halo-, hydroxy-, -NH2, cyano-, C1-C3-alkyl-,
C1-C3-alkoxy-,
fluoro-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, fluoro-C1-C3-alkoxy-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
re represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from: halo-, hydroxy-, -NH2, cyano-, C1-C2-alkyl-,
C1-C2-alkoxy-,
fluoro-C1-C2-alkyl-, hydroxy-C1-C2-alkyl-, fluoro-C1-C2-alkoxy-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, identically
or differently,
with fluoro, chloro, -NH2 or methoxy.
32

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
1:0 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from: halo-, C1-C3-alkoxy-.
In a preferred embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
1:0 represents a phenyl-group,
said phenyl-group being optionally substituted one or two times, identically
or differently,
with fluoro or methoxy.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
1:0 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, with fluoro.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
1:0 represents an unsubstituted phenyl-group.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
1:0 represents a phenyl-group which is substituted in 2-, 3-, 5- and/or 6-
position to the point of
attachment of said phenyl-group to R2 with a substituent selected from: Cl, F,
-CH3, with the
proviso that the number of substituents is 1 or 2.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
1:0 represents:
R31
R32
* 40 R33
R35
R34
33

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein " * " represents the point of attachment to R2;
R31, R32, R34 and R33 represent, independently from each other, a hydrogen
atom or a group
selected from: halo-, hydroxy-, -N H2, cyano-, nitro-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-; and
R33 represents a hydrogen atom or a substituent selected from:
hydroxy-, -CHF2, -NH2, -NR1 R3, -CH2NH2, -N(H)C(=0)CH3.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R3 represents:
R31 R32
* . R33
R35 R34
wherein " * " represents the point of attachment to R2;
R31, R32, R34 and R33 represent, independently from each other, a hydrogen
atom or a group
selected from: halo-, hydroxy-, -N H2, nitro-, C1-C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkyl-; and
R33 represents a hydrogen atom or a substituent selected from:
fluoro-, hydroxy-, -CHF2, -N H2.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R3 represents:
R31 R32
* . R33
R35 R34
wherein " * " represents the point of attachment to R2;
R31, R32, R34 and R33 represent, independently from each other, a hydrogen
atom or a group
selected from: fluoro-, chloro, hydroxy-, nitro-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, -N H2;
R33 represents a hydrogen atom.
34

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R3 represents:
R31 R32
* . R33
R35 R34
wherein" * " represents the point of attachment to R2;
R31, R32, R34 and R33 represent, independently from each other, a hydrogen
atom or a group
selected from: fluoro-, chloro, methyl-, methoxy-, trifluoromethyl-;
R33 represents a hydrogen atom.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R3 represents:
R31 R32
* . R33
R35 R34
wherein " * " represents the point of attachment to R2;
R31, R32, R34 and R33 represent, independently from each other, a hydrogen
atom or a group
selected from: fluoro-, chloro, methyl-, methoxy-, trifluoromethyl-; with the
proviso that at
least two of R31, R32, R34 and R33 represent a hydrogen atom; and
R33 represents a hydrogen atom.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R3 represents an ortho-fluorophenyl-group.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R3 represents a meta-fluorophenyl-group.

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
1:0 represents a 2,3-difluorophenyl-group.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
1:0 represents a 3,5-difluorophenyl-group.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
1:0 represents a 2,6-difluorophenyl-group.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
1:0 represents a 2-methylphenyl-group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R4 represents a hydrogen atom or a C1-C3-alkyl- group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R4 represents a hydrogen atom or a methyl- group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R4 represents methyl-.
In a preferred embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R4 represents a hydrogen atom.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R5 represents a hydrogen atom or a halogen atom or a group selected from:
36

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R5 represents a group selected from: cyano-, C1-C3-alkyl-, C1-C3-alkoxy-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R5 represents a hydrogen atom or a halogen atom.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R5 represents hydrogen, fluoro or chloro.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R5 represents fluoro or chloro.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R5 represents chloro.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R5 represents fluoro.
In a preferred embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R5 represents hydrogen.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-,
C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-,
37

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
heteroaryl-, -N(R9)(R9, -C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(R19), R9-S-, R9-
S(=0)-, R9-S(=0)2-;
said C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-, aryl-, heteroaryl-, and C1-
C6-alkoxy- group
being optionally substituted, one or more times, identically or differently,
with a substituent
selected from: halo-, cyano-, nitro-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, C4-C7-cycloalkenyl-,
3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-, heteroaryl-, -C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9,
-N(R19)C(=0)R9,
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S-, R9-S(=0)-, R9-S(=0)2-,
-N(H)S(=0)R9, -N(R19)S(=0)R9, -S(=0)N(H)R9, -S(=0)NR19R9,
-N(H)S(=0)2R9, -N(R9)S(=0)2R19, -S(=0)2N(H)R9, -S(=0)2NR19R9,
-S(=0)(=NR19)R9, -N=S(=0)(R19)R9;
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-
C1-C6-alkoxy-, halo-, hydroxy-, halo-C1-C6-alkyl-, halo-C1-C6-alkoxy-, cyano-,
-aryl, -heteroaryl, -
N(R9)(R19), -C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(R19);
said C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-, aryl-, heteroaryl- or C1-C6-
alkoxy- group being
optionally substituted, one or more times, identically or differently, with
halo-, cyano-, nitro-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-
alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, C4-C7-cycloalkenyl-, 3- to 10-membered heterocycloalkyl-,
4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-,
-C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9, -N(R19)C(=0)R9,
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S-, R9-S(=0)-, R9-S(=0)2-,
-N(H)S(=0)R9, -N(R19)S(=0)R9, -S(=0)N(H)R9, -S(=0)NR19R9,
-N(H)S(=0)2R9, -N(R9)S(=0)2R19, -S(=0)2N(H)R9, -S(=0)2NR19R9,
-S(=0)(=NR19)R9,- S(=0)(=NR19)R9, -N=S(=0)(R19)R9.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
38

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, halo-, hydroxy-, fluoro-C1-C6-alkyl-, fluoro-C1-
C6-alkoxy-, phenyl-, 5-
to 6-membered heteroaryl-, cyano-, -C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(R1 );
said C1-C6-alkyl- or C1-C6-alkoxy- group being optionally substituted, one or
more times,
identically or differently, with
Ci-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-,
-C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9, -N(R1 )C(=0)R9,
-N(H)C(=0)NR1 R9, -N(R11)C(=0)NR1 R9, -N(H)R9, -NR1 R9,
-C(=0)N(H)R9, -C(=0)NR1 R9.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, fluoro-C1-C6-
alkyl-, fluoro-
C1-C6-alkoxy-, phenyl-, 5- to 6-membered heteroaryl-, cyano-, -C(=0)-0-C1-C4-
alkyl,
-C(=0)-N(R9)(R1 ), R9-S-, R9-S(=0)-, R9-S(=0)2-; said C1-C6-alkyl- or C1-C6-
alkoxy- group being
optionally substituted, one or more times, identically or differently, with
Ci-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-,
-C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9, -N(R1 )C(=0)R9,
-N(H)C(=0)NR1 R9, -N(R11)C(=0)NR1 R9, -N(H)R9, -NR1 R9,
-C(=0)N(H)R9, -C(=0)NR1 R9.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, halo-, hydroxy-, fluoro-C1-C6-alkyl-, fluoro-C1-
C6-alkoxy-, cyano-,
-C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(R1 );
said C1-C6-alkyl- or C1-C6-alkoxy- group being optionally substituted, one or
more times,
identically or differently, with
C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-,
-C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9, -N(R1 )C(=0)R9,
39

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
-N(H)C(=0)NR1 R9, -N(R11)C(=0)NR1 R9, -N(H)R9, -NR1 R9,
-C(=0)N(H)R9, -C(=0)NR19R9.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-,
-C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(R19), R9-S-, R9-S(=0)-, R9-S(=0)2-;
said C1-C6-alkyl-, and C1-C6-alkoxy- group being optionally substituted, one
or more times,
identically or differently, with a substituent selected from: halo-, cyano-,
nitro-, hydroxy-,
C1-C3-alkoxy-, halo-C1-C3-alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-,
-C(=0)R9, -C(=0)0-R9, -C(=0)0-(C1-C4-alkyl), -N(H)C(=0)R9, -N(R19)C(=0)R9,
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S-, R9-S(=0)-, R9-S(=0)2-,
-N(H)S(=0)R9, -N(R19)S(=0)R9, -S(=0)N(H)R9, -S(=0)NR19R9,
-N(H)S(=0)2R9, -N(R9)S(=0)2R19, -S(=0)2N(H)R9, -S(=0)2NR19R9,
-S(=0)(=NR19)R9, -N=S(=0)(R19)R9.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-,
-C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(R19), R9-S-, R9-S(=0)-, R9-S(=0)2-;
said C1-C6-alkyl-, and C1-C6-alkoxy- group being optionally substituted, one
or more times,
identically or differently, with a substituent selected from: halo-, C1-C3-
alkoxy-,
C1-C3-alkoxy-C2-C3-alkoxy-, C3-C7-cycloalkyl-, 3- to 10-membered
heterocycloalkyl-,
-C(=0)R9, -C(=0)0-R9, -C(=0)0-(C1-C4-alkyl), -N(H)C(=0)R9, -N(R19)C(=0)R9,
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S-, R9-S(=0)-, R9-S(=0)2-,
-N(H)S(=0)R9, -N(R19)S(=0)R9, -S(=0)N(H)R9, -S(=0)NR19R9,
-N(H)S(=0)2R9, -N(R9)S(=0)2R19, -S(=0)2N(H)R9, -S(=0)2NR19R9,
-S(=0)(=NR19)R9, -N=S(=0)(R19)R9.
40

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-,
-C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(Rio), Ro_s_, R9_s(=0)_, R9_s(=0)2_;
said C1-C6-alkyl-, and C1-C6-alkoxy- group being optionally substituted, one
or more times,
identically or differently, with a substituent selected from: halo-, C1-C3-
alkoxy-,
C1-C3-alkoxy-C2-C3-alkoxy-, C3-C7-cycloalkyl-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
C1-C3-alkyl-, C1-C3-alkoxy-, halo-, hydroxy-, cyano-, -N(R9)(Rio), -C(=O)-0-C1-
C4-alkyl,
-C(=0)-N(R9)(R19); said C1-C3-alkyl- and C1-C3-alkoxy- group being optionally
substituted, one
or more times, identically or differently, with halo-, cyano-, C1-C3-alkoxy-,
R9-S(=0)2-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents halo-, cyano-, C1-C4-alkyl-, fluoro-C1-C3-alkyl-, C1-C4-
alkoxy- or fluoro-C1-C3-
alkoxy-, -C(=0)NR9R19 or a 5-membered heteroaryl-,
wherein said C1-C4-alkyl- and C1-C4-alkoxy- group may be optionally
substituted by one
phenyl-group.
In a preferred embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents halogen, C1-C4-alkyl-, fluoro-C1-C3-alkyl-, C1-C4-alkoxy-
or fluoro-C1-C3-alkoxy-.
In a preferred embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R6 represents a group selected from:
methoxy-, difluoromethoxy-, trifluoromethoxy-, methyl-, trifluormethyl-, tert-
butyl-, chloro-,
bromo-, cyano-, methoxymethyl-, -C(=0)NH2, -CH2-S(=0)2-CH3.
In another preferred embodiment, the present invention relates to compounds of
the general
formula (I), supra, in which:
41

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
R6 represents halogen.
In another preferred embodiment, the present invention relates to compounds of
the general
formula (I), supra, in which:
R6 represents fluoro-C1-C3-alkyl-.
In another preferred embodiment, the present invention relates to compounds of
the general
formula (I), supra, in which:
R6 represents fluoro-C1-C3-alkoxy-.
In another preferred embodiment, the present invention relates to compounds of
the general
formula (I), supra, in which:
R6 represents C1-C4-alkoxy-.
In another preferred embodiment, the present invention relates to compounds of
the general
formula (I), supra, in which:
R6 represents cyclopropyloxy-.
In another preferred embodiment, the present invention relates to compounds of
the general
formula (I), supra, in which:
R6 represents cyclopropylmethoxy-.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
R6 represents chloro, C1-C4-alkyl-, methoxy-, difluoromethoxy-,
trifluoromethoxy-,
trifluoromethyl-, -C(=0)-NH2, -CH2-0-CH3 or -CH2-S(=0)2-CH3.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents difluoromethoxy- or trifluoromethoxy-.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents chloro, C1-C4-alkyl-, methoxy-, trifluoromethoxy- or
trifluoromethyl-.
42

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents chloro.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents C1-C4-alkyl-.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents methoxy.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents trifluoromethyl.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents trifluoromethoxy or tert-butyl;
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents tert-butyl.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents trifluoromethoxy.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
R6 represents difluoromethoxy-.
In another particularly preferred embodiment, the present invention relates to
compounds of the
general formula (I), supra, in which:
R6 represents -C(=0)-N(R9)(R3.0).
43

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
R6 represents -C(=0)-NH2.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
R6 represents -CH2-0-CH3.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
R6 represents -CH2-S(=0)2-CH3.
In a particularly preferred embodiment, the present invention relates to
compounds of the general
formula (I), supra, in which:
R6 represents a group selected from: R9-S-, R9-S(=0)-, R9-S(=0)2-,
wherein R9 represents a
C1-C3-alkyl- group, preferably a methyl- group.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R7 represents -H, C1-C3-alkyl- or C1-C3-alkoxy-C1-C3-alkyl-.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R7 represents -H or C1-C3-alkyl.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
R9 represents -H or C1-C3-alkyl.
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
Ri.o represents -H or C1-C3-alkyl.
44

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another embodiment, the present invention relates to compounds of the
general formula (I),
supra, in which:
Rn represents -H or C1-C3-alkyl-.
In another embodiment, the present invention relates to compounds of the
general formula (la):
H
2..N 0
R3/R
R5 10
0
N )L 1_1R1
H
R6
(la)
in which R1, R2, R3, R5, R5 and LA are as defined for general formula (I),
supra.
In another embodiment, the present invention relates to compounds of the
general formula (lb):
0
3 R2"'L N H
R
R5 40
0
N )'LLR1
H
R6
(lb)
in which R1, R2, R3, R5, R5 and LA are as defined for general formula (I),
supra.
In another embodiment, the present invention relates to compounds of the
general formula (lc):
0
02
j'L N H
R -
0
R5 101
N )LI_PR1
I A
R6
(I c)
in which R1, R2, R3, fe, R5, R5 and LA are as defined for general formula (I),
supra.

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
It is to be understood that the present invention relates also to any
combination of the preferred
embodiments described above.
Some examples of combinations are given hereinafter. However, the invention is
not limited to these
combinations.
In a preferred embodiment, the present invention relates to compounds of
general formula (I):
3
R 2
R...... B
L
R5 0SI
N\ A 1
L¨R
I
R6
R4
(I)
in which:
LA represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-
C3-alkyl-,
halo-C1-C3-alkoxy-, C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(R7)-(C1-C6-alkyl);
46

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered
heterocycloalkenyl-,
aryl-, heteroaryl-, and -N(W)-(C1-C6-alkyl) group is optionally substituted,
one or more times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-,
C3-C7-cycloalkyl-;
R2 represents a group selected from:
* e*
N N
**
* ** *
**
0
** * ** * **
=
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from:
halo-, hydroxy-, -N(R9)( )_ N(H)C(=0)R9, cyano-, nitro-, C1-C3-alkyl-, C1-
C3-alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, amino-C1-C3-alkyl-,halo-C1-C3-alkoxy-
;
R4 represents a hydrogen atom or a C1-C3-alkyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected
from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-
C1-C6-alkoxy-, halo-, hydroxy-, cyano-, aryl-,
heteroaryl-, -N(RB)(R _ ) C(=0)-0-R9, -C(=0)-N(R9)(Rio);
47

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
said C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-, aryl-, heteroaryl-, and C1-
C6-alkoxy- group
being optionally substituted, one or more times, identically or differently,
with
halo-, cyano-, nitro-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-
alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C1-C3-alkoxy-,
C3-C7-cycloalkyl-, C4-C7-cycloalkenyl-,
3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-, heteroaryl-, -C(=0)R9, -C(=0)0-R9, -0C(=0)-R9, -N(H)C(=0)R9, -
N(R19)C(=0)R9,
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S-, R9-S(=0)-, R9-S(=0)2-,
-N(H)S(=0)R9, -N(R19)S(=0)R9, -S(=0)N(H)R9, -S(=0)NR19R9,
-N(H)S(=0)2R9, -N(R9)S(=0)2R19, -S(=0)2N(H)R9, -S(=0)2NR19R9,
-S(=0)(=NR19)R9,- S(=0)(=NR19)R9, -N=S(=0)(R19)R9;
R7 represents -H or C1-C3-alkyl-;
R9, R19, Ril
represent, independently from each other, -H or C1-C3-alkyl-;
or
R9R19 together with the atom or the group of atoms they are attached to, form
a 3- to
10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another preferred embodiment, the present invention relates to compounds of
general formula
(I):
3
R 2
R, B
L
R5 0=N\ A 1
L-R
I 4
R6 F4
(I)
in which :
48

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LA represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-
C3-alkyl-,
halo-C1-C3-alkoxy-, C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(R7)-(C1-C6-alkyl);
wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered
heterocycloalkenyl-,
aryl-, heteroaryl-, and -N(R7)-(C1-C6-alkyl) group is optionally substituted,
one or more times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-,
C3-C7-cycloalkyl-;
R2 represents a group selected from:
* ¨ ) ** * **
N ¨ N
,
,
*
** ** õ
N * **
H S 0
,
,
,
N N N-N
*
S S S
=
, ,
/
49

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from:
halo-, hydroxy-, -N(R9)(R19), -N(H)C(=0)R9, cyano-, nitro-, C1-C3-alkyl-, C1-
C3-alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, amino-C1-C3-alkyl-,halo-C1-C3-alkoxy-
;
R4 represents a hydrogen atom or a C1-C3-alkyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected
from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-
C1-C6-alkoxy-, halo-, hydroxy-, cyano-, aryl-,
heteroaryl-, -N(R9)(R19), -C(=0)-0-R9, -C(=0)-N(R9)(R19);
said C1-C6-alkyl-, C2-C6-alkenyl-, C2-C6-alkynyl-, aryl-, heteroaryl- or C1-C6-
alkoxy- group being
optionally substituted, one or more times, identically or differently, with
halo-, cyano-, nitro-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-
alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, C4-C7-cycloalkenyl-,
3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-, heteroaryl-, -C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9,
-N(R19)C(=0)R9,
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S-, R9-S(=0)-, R9-S(=0)2-,
-N(H)S(=0)R9, -N(R19)S(=0)R9, -S(=0)N(H)R9, -S(=0)NR19R9,
-N(H)S(=0)2R9, -N(R9)S(=0)2R19, -S(=0)2N(H)R9, -S(=0)2NR19R9,
-S(=0)(=NR19)R9,- S(=0)(=NR19)R9, -N=S(=0)(R19)R9;
R7 represents -H or C1-C3-alkyl-;
R9, R19, Ril

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
represent, independently from each other, -H or C1-C3-alkyl-;
or
R9Rio together with the atom or the group of atoms they are attached to, form
a 3- to
10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another preferred embodiment, the present invention relates to compounds of
general formula
(I), supra, in which:
LA represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, fluoro-C1-C3-alkyl-,
hydroxy-C1-C3-alkyl-, fluoro-C1-C3-alkoxy-, C3-C7-cycloalkyl-,
3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(R7)-(C1-C6-alkyl);
wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered
heterocycloalkenyl-,
aryl-, heteroaryl-, and -N(R7)-(C1-C6-alkyl) group is optionally substituted,
one or more times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-,
C3-C7-cycloalkyl-;
R2 represents a group selected from:
51

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
õeN õõ N
** * * * /../.., ),\
**
N - S S H S =
,
,
,
,
,
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from: halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-
alkoxy-,
fluoro-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, fluoro-C1-C3-alkoxy-;
R4 represents a hydrogen atom or a methyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected
from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, halo-, hydroxy-, fluoro-C1-C6-alkyl-, fluoro-C1-
C6-alkoxy-, phenyl-, 5-
to 6-membered heteroaryl-, cyano-, -C(=0)-0-R9, -C(=0)-N(R9)(R3.0);
said C1-C6-alkyl- or C1-C6-alkoxy- group being optionally substituted, one or
more times,
identically or differently, with hydroxy-, Ci-C3-alkyl-, C1-C3-alkoxy-, halo-
C1-C3-alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-,
-C(=0)R9, -C(=0)0-R9, -C(=0)0-(C1-C4-alkyl), -N(H)C(=0)R9, -N(R1 )C(=0)R9,
-N(H)C(=0)NR1 R9, -N(R11)C(=0)NR1 R9, -N(H)R9, -NR1 R9,
-C(=0)N(H)R9, -C(=0)NR1 R9;
R7 represents -H or C1-C3-alkyl-;
R9, wo, Rn
represent, independently from each other, -H or C1-C3-alkyl-;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
52

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another preferred embodiment, the present invention relates to compounds of
general formula
(I), supra, in which:
LA represents a methylene group, said methylene group being optionally
substituted, one or
more times, identically or differently, with a substituent selected from:
cyano-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, fluoro-C1-C3-alkyl-,
hydroxy-C1-C3-alkyl-, C3-05-cycloalkyl-, 3- to 6-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3-to 6-membered heterocycloalkyl- ring; wherein said ring
is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(W)-(C1-C6-alkyl);
wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered
heterocycloalkenyl-,
aryl-, heteroaryl-, and -N(W)-(C1-C6-alkyl) group is optionally substituted,
one or more times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-,
C3-C7-cycloalkyl-;
R2 represents a group selected from:
, ____________________________________ N
õe õõ, õõ, ,,,
**
N ,- S S S S =
,
,
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB;
re represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from: halo-, hydroxy-, -NH2, cyano-, C1-C2-alkyl-,
C1-C2-alkoxy-,
fluoro-C1-C2-alkyl-, hydroxy-C1-C2-alkyl, fluoro-C1-C2-alkoxY-;
53

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
R4 represents a hydrogen atom or a methyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected
from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, halo-, hydroxy-, fluoro-C1-C6-alkyl-, fluoro-C1-
C6-alkoxy-, cyano-,
-C(=0)-0-R9, -C(=0)-N(R9)(R3.0);
said C1-C6-alkyl-, or C1-C6-alkoxy- group being optionally substituted, one or
more times,
identically or differently, with
C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-,
-C(=0)R9, -C(=0)0-R9, -0C(=0)-R9, -N(H)C(=0)R9, -N(R1 )C(=0)R9,
-N(H)C(=0)NR3.0-K9, _ N(R11)C(=0)NR1 R9, -N(H)R9, -NR1 R9,
-C(=0)N(H)R9, -C(=0)NR1 R9;
R9, wo, Rn
represent, independently from each other, -H or C1-C3-alkyl-;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another preferred embodiment, the present invention relates to compounds of
general formula
(I), supra, in which:
LA represents a methylene group, said methylene group being optionally
substituted, one or
more times, identically or differently, with a substituent selected from:
hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, hydroxy-C1-C3-alkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
54

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
R1 represents a morpholino group, which is attached to LA via its
nitrogen atom, and which may
be optionally substituted one or two times, identically or differently, with
C1-C3-alkyl-,
or two of said C1-C3-alkyl- groups together may form a C1-C3-alkylene group
(forming a bridge
between two different ring carbon atoms of said morpholino group);
or
R1 represents thiomorpholino, 4-cyclopropylpiperazino, 4-
methylpiperazino or pyrazol-1-y1
group, said groups being attached to LA via their ring nitrogen atom;
R2 represents a group selected from:
N N
N
-e ______________ ,,,, * õõ,, *H * 1../..,
.),...\ **
, , , , , .
,
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, identically
or differently,
with fluoro, chloro, -NH2 or methoxY;
RA represents hydrogen atom or a methyl- group;
R5 represents hydrogen, fluoro or chloro;
R6 represents halo-, cyano-, C1-C4-alkyl-, fluoro-C1-C3-alkyl-, C1-C4-
alkoxy- or fluoro-C1-C3-alkoxy-,
-C(=0)NR9R1 or 5-membered heteroaryl-,
wherein said C1-C4-alkyl- and C1-C4-alkoxy- group may be optionally
substituted by one
phenyl-group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another preferred embodiment, the present invention relates to compounds of
general formula
(I), supra, in which:
LA represents methylene, said methylene group being optionally
substituted one or two times,
identically or differently, with C1-C3-alkyl-,

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein, if said methylene is substituted with two C1-C3-alkyl- groups, these
may, together
with the carbon atom they are attached to, form a C3-C6-cycloalkyl- ring;
LB represents -N(H)-C(=0)- or
R1 represents a morpholino group, which is attached to LA via its
nitrogen atom, and which may
be optionally substituted one or two times, identically or differently, with
C1-C3-alkyl-,
or two of said C1-C3-alkyl- groups together may form a C1-C3-alkylene group
(forming a bridge
between two different ring carbon atoms of said morpholino group);
R2 represents a group selected from:
, ____________________________________ N
*e- õõ, * , & \\
........**, *
N **
* 1../.., .),...\ **
N S S H S .
,
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted one or two times, identically
or differently,
with fluoro or methoxy;
RA represents hydrogen;
R6 represents hydrogen;
R6 represents halogen, C3.-C4-alkyl-, fluoro-C1-C3-alkyl-, C1-C4-alkoxy-
or fluoro-C1-C3-alkoxy-;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another preferred embodiment, the present invention relates to compounds of
general formula
(I), supra, in which:
LA represents methylene, said methylene group being optionally
substituted one or two times,
identically or differently, with C1-C3-alkyl-,
56

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein, if said methylene is substituted with two C1-C3-alkyl- groups, these
may, together
with the carbon atom they are attached to, form a C3-C6-cycloalkyl- ring;
LB represents -N(H)-C(=0)- or
R1 represents a morpholino group, which is attached to LA via its
nitrogen atom, and which may
be optionally substituted one or two times, identically or differently, with
C1-C3-alkyl-,
or two of said C1-C3-alkyl- groups together may form a C1-C3-alkylene group
(forming a bridge
between two different ring carbon atoms of said morpholino group);
R2 represents a group selected from:
, ____________________________________ N
*e- õõ, * , & \\
........**, *
N **
* 1../.., .),...\ **
N S S H S .
,
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted one or two times, identically
or differently,
with fluoro or methoxy;
RA represents hydrogen;
R6 represents hydrogen;
R6 represents trifluoromethoxy;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In a particularly preferred embodiment, the present invention relates to
compounds of general
formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
57

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
/
H2C ¨CH2; wherein the cycloproypl- ring is optionally substituted one or more
times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-, C1-C3-
alkyl-, C1-C3-alkoxy-.
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
N N _______ N
wherein" * " indicates the point of attachment to LA;
R2 represents a group selected from:
e ** A
** * **
N _____________
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, with fluoro;
R4 represents hydrogen;
R6 represents hydrogen;
R6 represents chloro, C1-C4-alkyl-, methoxy-, trifluoromethoxy- or
trifluoromethyl-;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
58

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
H2C ¨CH2.
LB represents -N(H)-C(=0)- or
represents a group selected from:
N N _______ N
wherein" * " indicates the point of attachment to LA;
R2 represents a group selected from:
, ___________________________________ N
N - N
e ** A
** * **
N _____________
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, with fluoro;
RA represents hydrogen;
R5 represents hydrogen;
R6 represents trifluoromethoxy;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
59

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)- or
H2C ¨CH2.
LB represents -N(H)-C(=0)- or
R' represents a group selected from:
*N *
wherein" * " indicates the point of attachment to LA;
R2 represents a group selected from:
e N-N
*
N
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, with fluoro;
RA represents hydrogen;
R5 represents hydrogen;
R6 represents trifluoromethoxy or tert-butyl;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2- or -CH(CH3)-;
LB represents -N(H)-C(=0)- or
1V- represents a group selected from:
0 IC3I
* N * N __
,
wherein" * " indicates the point of attachment to LA;
R2 represents a group selected from:
* e N-N
**
N - S
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, with fluoro;
RA represents hydrogen;
R5 represents hydrogen;
R6 represents trifluoromethoxy;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
61

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LA represents a methylene or ethylene group, said methylene or ethylene
group being
optionally substituted, one or more times, identically or differently, with a
substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-, fluoro-C1-C3-alkyl-,
hydroxy-C1-C3-alkyl-, fluoro-C1-C3-alkoxy-, C3-C7-cycloalkyl-,
3- to 10-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-,
aryl-,
heteroaryl-, and -N(R7)-(C1-C6-alkyl);
wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered
heterocycloalkenyl-,
aryl-, heteroaryl-, and -N(R7)-(C1-C6-alkyl) group is optionally substituted,
one or more times,
identically or differently, with a substituent selected from: halo-, hydroxy-,
cyano-,
C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-
C3-alkoxy-,
C3-C7-cycloalkyl-;
R2 represents a group selected from:
, ____________________________________ N
*e õõ * & \\
........** *
N
* 1./.., .),...\ **
=
,
,
,
,
,
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
re represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from: halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-
alkoxy-, fluoro-C1-
C3-alkyl-, hydroxy-C1-C3-alkyl-, fluoro-C1-C3-alkoxy-;
62

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
RA represents a hydrogen atom or a methyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected
from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, halo-, hydroxy-, fluoro-C1-C6-alkyl-, fluoro-C1-
C6-alkoxy-, phenyl-, 5-
to 6-membered heteroaryl-, cyano-, -C(=0)-0-R9, -C(=0)-N(R9)(R3.0);
said C1-C6-alkyl- or C1-C6-alkoxy- group being optionally substituted, one or
more times,
identically or differently, with
fluoro-, cyano-, nitro-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, fluoro-C1-C3-
alkoxy-,
hydroxy-C1-C3-alkoxy-, C1-C3-alkoxy-C2-C3-alkoxy-,
C3-C7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-,
-C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9, -N(R19)C(=0)R9,
-N(H)C(=0)NR19R9, -N(Ril)C(=0)NR19R9, -N(H)R9, -NR19R9,
-C(=0)N(H)R9, -C(=0)NR19R9, R9-S(=0)2-;
R7 represents -H or C1-C3-alkyl-;
R9, wo, Rn
represent, independently from each other, -H or C1-C3-alkyl-;
or
R9,K10
together with the atom or the group of atoms they are attached to, form a 3-
to
10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents a methylene group, said methylene group being optionally
substituted, one or
more times, identically or differently, with a substituent selected from:
cyano-, hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, fluoro-C1-C3-alkyl-,
63

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
hydroxy-C1-C3-alkyl-, C3-05-cycloalkyl-, 3- to 6-membered heterocycloalkyl-;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
5- to 8-membered heterocycloalkyl-, or 5- to 6-membered heteroaryl-,
wherein each group is optionally substituted, one or more times, identically
or differently,
with a substituent selected from: halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-
alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, halo-C1-C3-alkoxy-, C3-C7-cycloalkyl-
;
R2 represents a group selected from:
, ____________________________________ N
*e- õõ, * , & \\
........**, *
N **
* 1./.., .)õ..\ **
N S S H S , =
,
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from: halo-, hydroxy-, cyano-, C1-C2-alkyl-, C1-C2-
alkoxy-, fluoro-C1-
C2-alkyl-, hydroxy-C1-C2-alkyl-, fluoro-C1-C2-alkoxY-;
R4 represents a hydrogen atom or a methyl- group;
R5 represents a hydrogen atom or a halogen atom or a group selected
from:
cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, halo-, hydroxy-, fluoro-C1-C6-alkyl-, fluoro-C1-
C6-alkoxy-, cyano-,
64

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
-C(=0)-0-R9, -C(=0)-N(R9)(Rio);
said C1-C6-alkyl- or C1-C6-alkoxy- group being optionally substituted, one or
more times,
identically or differently, with C1-C3-alkoxy-, C3-C7-cycloalkyl-,
3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-,
-C(=0)R9, -C(=0)0-(C1-C4-alkyl), -0C(=0)-R9, -N(H)C(=0)R9, -N(R1 )C(=0)R9,
-N(H)C(=0)NR1 R9, -N(R11)C(=0)NR1 R9, -N(H)R9, -NR1 R9,
-C(=0)N(H)R9, -C(=0)NR1 R9, R9-S(=0)2;
R9, wo, Rn
represent, independently from each other, -H or C1-C3-alkyl-;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents a methylene group, said methylene group being optionally
substituted, one or
more times, identically or differently, with a substituent selected from:
hydroxy-, C1-C3-alkyl-, C1-C3-alkoxy-, hydroxy-C1-C3-alkyl-,
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said
ring is optionally
substituted one or more times, identically or differently, with a substituent
selected from:
halo-, hydroxy-, cyano-, C1-C3-alkyl-, C1-C3-alkoxy-;
LB represents -N(H)-C(=0)- or
R1 represents a morpholino group, which is attached to LA via its
nitrogen atom, and which may
be optionally substituted one or two times, identically or differently, with
C1-C3-alkyl-,
or two of said C1-C3-alkyl- groups together may form a C1-C3-alkylene group,
or
R1 represents thiomorpholino, 4-cyclopropylpiperazino, 4-
methylpiperazino or pyrazol-1-yl-
group; said groups being attached to LA via their ring nitrogen atom;
R2 represents a group selected from:

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
, ____________________________________ N
*e- õõ * & \\
........** *
N **
* 1../.., .)õ..\ **
N S S H S =
,
,
,
,
,
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, identically
or differently,
with fluoro, chloro, -NH2 or methoxY;
RA represents a hydrogen atom or a methyl- group;
R5 represents a hydrogen atom, fluoro or chloro;
R6 represents halo-, cyano-, C1-C4-alkyl-, fluoro-C1-C3-alkyl-, C1-C4-
alkoxy-, fluoro-C1-C3-alkoxy-,
-C(=0)NRBR1 , C1-C3-alkoxy-C1-C3-alkyl-, R9-S(=0)2-C1-C3-alkyl-, 5-membered
heteroaryl-,
R9, K-19
represent, independently from each other, -H or C1-C3-alkyl-;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents methylene, said methylene group being optionally
substituted one or two times,
identically or differently, with C1-C3-alkyl-,
wherein, if said methylene is substituted with two C1-C3-alkyl- groups, these
may, together
with the carbon atom they are attached to, form a C3-C6-cycloalkyl- ring;
LB represents -N(H)-C(=0)- or
R1 represents a morpholino group, which is attached to LA via its
nitrogen atom, and which may
be optionally substituted one or two times, identically or differently, with
C1-C3-alkyl-,
or two of said C1-C3-alkyl groups together may form a C1-C3-alkylene group;
66

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
or
R1 represents thiomorpholino, 4-cyclopropylpiperazino, 4-
methylpiperazino or pyrazol-1-yl-
group; said groups being attached to LA via their ring nitrogen atom;
R2 represents a group selected from:
, ___________________________________ N
* e ** * A
** *
N - N
* **
N _____________
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB;
re represents a phenyl-group,
said phenyl-group being optionally substituted one or two times, identically
or differently,
with fluoro or methoxy;
RA represents hydrogen;
R5 represents hydrogen;
R6 represents halogen, C1-C4-alkyl-, fluoro-C1-C3-alkyl-, C1-C4-alkoxy-
, fluoro-C1-C3-alkoxy-,
-C(=0)NRBR1 , C1-C3-alkoxy-C1-C3-alkyl-, R9-S(=0)2-C1-C3-alkyl-,;
R9, K-10
represent, independently from each other, -H or C1-C3-alkyl-;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents a group selected from: -CH2-, -CH(CH3)-, -C(CH3)2-,
'C,
H2C - CH2 =
67

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
LB represents -N(H)-C(=0)- or
1V- represents a group selected from:
O O CO N=-=-=C H3 N
* N * N ____ * N * N N
*
, , , , .
,
wherein" * " indicates the point of attachment to LA;
R2 represents a group selected from:
* e ** * & A **
1../.., .),...\
õ...-- ** N * ** .
N - S S H S
, , , * ,
wherein" * " indicates the point of attachment to R3, and" ** " indicates the
point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, with fluoro;
RA represents hydrogen;
R5 represents hydrogen;
R6 represents a group selected from:
methoxy-, difluoromethoxy-, trifluoromethoxy-, methyl-, trifluormethyl-, tert-
butyl-, chloro-,
methoxymethyl-, -C(=0)-NH2, -CH2-S(=0)2-CH3;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
68

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
LA represents a group selected from: -CH2-, -CH(CH3)-,
\ de-
C
i \
H2C ¨CH2.
LB represents -N(H)-C(=0)- or
R' represents a group selected from:
N /A
0 0
O NCH3
* N * N ____ * N N N
* *
, , , , ,
wherein" * " indicates the point of attachment to LA;
R2 represents a group selected from:
* e. * & * 1../.., .),...\ **
.
N - S S S
, , ,
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or two times, with fluoro;
RA represents hydrogen;
R5 represents hydrogen;
R6 represents a group selected from:
methoxy-, difluoromethoxy-, trifluoromethoxy-, methyl-, trifluormethyl-, tert-
butyl-, chloro-,
methoxymethyl-, -C(=0)-NH2, -CH2-S(=0)2-CH3;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In a preferred embodiment, the present invention relates to compounds of
general formula (la):
69

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
2..N 0
3R
R
R5 10
0
N )L 1_1µ Ri
H
R6
(la)
in which:
LA represents a methylene group, said methylene group being optionally
substituted, one or
more times, identically or differently, with a C1-C3-alkyl- group;
or, when two substituents are present at the same carbon atom, the two
substituents,
together with the carbon atom they are attached to, may form a
C3-C6-cycloalkyl- ring;
R1 represents a 6-membered heterocycloalkyl- group; said group being
optionally substituted
with a C1-C3-alkyl-, -C1-C2-alkylene- or C3-C6-cycloalkyl- group;
R2 represents a group selected from:
* e - **, & ** * 1./.., .)õ..\ **
N S S
, =
,
wherein" * " indicates the point of attachment to R3, and" ** " indicates the
point of
attachment to LB;
R3 represents a phenyl-group, said phenyl-group being optionally
substituted, one or two times
with fluoro-;
R5 represents a hydrogen atom;
R6 represents a group selected from:
C1-C3-alkyl-, C1-C3-alkoxy-, -C(=0)-N(R9)(R10);
said C1-C3-alkyl- and C1-C3-alkoxy- group being optionally substituted, one or
more times,
identically or differently, with fluoro-, C1-C3-alkoxy-, R9-S(=0)2-;
R9, Rlo

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
represent, independently from each other, -H or C1-C3-alkyl-;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
N= .ef
C
i \
H2C ¨CH2.
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
/--\/--\
* N 0 *NI /0 *N NO *N N¨R12
\__/ \__/
,
,
,
/
H3O)__\
/¨(OH3
* N N¨R12 * N N¨R12 * N/CN¨CH3
\__/ \__/
,
,
,
-N(CH3)2, -N(H)-(CH2-CH2-0-CH3), -N(CH3)-(CH2-CH2-0-CH3);
wherein * indicates the point of attachment to LA; and
wherein R12 represents a methyl-, ethyl-, trifluoroethyl-, difluoroethyl- or
cyclopropyl- group;
R2 represents a group selected from:
* ** * * **
S , S S S =
,
/
/
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from:
halo-, hydroxy-, -N(R9)( 3,0,), _
n N(H)C(=0)R9, cyano-, nitro-, C1-C3-alkyl-, C1-
C3-alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, amino-C1-C3-alkyl-,halo-C1-C3-alkoxy-
;
71

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
R4 represents a hydrogen atom;
R5 represents a hydrogen atom;
R6 represents a group selected from:
C1-C3-alkyl-, C1-C3-alkoxy-, halo-, hydroxy-, cyano-,
) C(=0)-0-C1-C4-alkyl,
-C(=0)-N(R9)(
) cyclopropyloxy-, cyclopropylmethoxy-; said C1-C3-alkyl- and
C1-C3-alkoxy- group being optionally substituted, one or more times,
identically or differently,
with halo-, cyano-, C1-C3-alkoxy-, R9-S(=0)2-;
R9, R3.9
represent, independently from each other, a hydrogen atom or a C1-C3-alkyl- or

C1-C3-alkoxy-C1-C3-alkyl- group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another particularly preferred embodiment, the present invention relates to
compounds of
general formula (I), supra, in which:
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
/
H2C ¨CH2.
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
N 0 *NI NNO N N-R12
HO CH
3N)¨\N-R12 N N-
* R12 dCN-CH3
-N(CH3)2, -N(H)-(CH2-CH2-0-CH3), -N(CH3)-(CH2-CH2-0-CH3);
wherein * indicates the point of attachment to LA; and
wherein R12 represents a methyl-, ethyl-, trifluoroethyl-, difluoroethyl- or
cyclopropyl- group;
72

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
R2 represents a group selected from:
*e** * *.*.
N - - N
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents a phenyl-group,
said phenyl-group being optionally substituted, one or more times, identically
or differently,
with a substituent selected from:
halo-, hydroxy-, -N(R9)( 3.R), 0% _
N(H)C(=0)RB, cyano-, nitro-, C1-C3-alkyl-, C1-C3-alkoxy-,
halo-C1-C3-alkyl-, hydroxy-C1-C3-alkyl-, amino-C1-C3-alkyl-,halo-C1-C3-alkoxy-
;
RA represents a hydrogen atom;
R5 represents a hydrogen atom;
R6 represents a group selected from:
C1-C3-alkyl-, C1-C3-alkoxy-, halo-, hydroxy-, cyano-, -N(R9)(Ri.9), -C(=O)-0-
C1-C4-alkyl,
-C(=0)-N(R9)(R1 ), cyclopropyloxy-, cyclopropylmethoxy-; said C1-C3-alkyl- and
C1-C3-alkoxy- group being optionally substituted, one or more times,
identically or differently,
with halo-, cyano-, C1-C3-alkoxy-, R9-S(=0)2-;
R9, R3.9
represent, independently from each other, a hydrogen atom or a C1-C3-alkyl- or
C1-C3-alkoxy-C1-C3-alkyl- group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In a particularly preferred embodiment, the present invention relates to
compounds of general
formula (la), supra, in which:
LA represents a group selected from:
-CH2-, -C(CH3)(H)-,
73

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
\ /
C
/ \
H2C ¨CH2 .
1V- represents a group selected from:
O NC H 3 NA
* N * N * N
, , ,
wherein" * " indicates the point of attachment to LA;
R2 represents a group selected from:
N¨N
S .
,
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to the nitrogen;
R3 represents a phenyl-group;
R5 represents a hydrogen atom;
R6 represents a group selected from: trifluoromethoxy-, difluoromethoxy-
, -CH2-0-CH3,
-CH2-S(=0)2-CH3, -C(=0)-NH2;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another preferred embodiment, the present invention relates to compounds of
general formula
(I):
74

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
,,, 3
IA '.....r62
B
L
R5 0SI
N\ A 1
L¨R
I
R6 R4
(I)
in which:
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
\ ./
C
i \
H2C ¨CH2 .
LB represents -N(H)-C(=0)- or
R' represents a group selected from:
/--\ /--\ N
*N 0 *NI /0 * NN0 * N N¨R12
*N
\__/ \__/
'\....3.¨
,
,
,
, ,
-N(013)2, -N(H)-(012-012-o-cH3), -N(CH3)-(CH2-CH2-0-CH3);
wherein * indicates the point of attachment to LA;
R1-2 represents a methyl-, ethyl- or cyclopropyl- group;
R2 represents a group selected from:
* e** * **

N
, ** * \\ N
N
** , , / ** *
H 0 S S S
,
, ,
N¨N N¨N H
N¨N O¨N N-0
* 30 /..; ),\ * 0 ** * 4, .3 ** * / N ..% ,;:..-
.. **
s N .
,
,
,
,
,

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
R3 represents:
R31
R32
* 40 R33
R35
R34
wherein " * " represents the point of attachment to R2;
R31, R32, R34 and R35
represent, independently from each other, a hydrogen atom or a group selected
from: halo-,
hydroxy-, -N H2, cyano-, nitro-, C1-C3-alkyl-, C1-C3-alkoxy-, halo-C1-C3-alkyl-
,
hydroxy-C1-C3-alkyl-, halo-C1-C3-alkoxy-;
R33 represents a hydrogen atom or a substituent selected from: hydroxy-,
-CHF2, -NH2, -N(R1 )R9,
-CH2NH2, -N(H)C(=0)CH3;
R4 represents a hydrogen atom or a methyl- group;
R5 represents a hydrogen atom;
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-,
-C(=0)-0-C1-C4-alkyl, -C(=0)-N(R9)(Rio), R9-s-, R9_s(=0)_, R9_s(=0)2_;
said C1-C6-alkyl-, and C1-C6-alkoxy- group being optionally substituted, one
or more times,
identically or differently, with a substituent selected from: halo-, C1-C3-
alkoxy-,
C1-C3-alkoxy-C2-C3-alkoxy-, C3-C7-cycloalkyl-;
R9, Rio
represent, independently from each other, a hydrogen atom or a C1-C3-alkyl- or
C1-C3-alkoxy-C1-C3-alkyl- group;
or
76

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
R9¨Kio
together with the atom or the group of atoms they are attached to, form a 3-
to
10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another preferred embodiment, the present invention relates to compounds of
general formula
(I):
3
R 2
R., B
L
R5 0SI
N\ A 1
L-R
I
R6
R4
(I)
in which :
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
\S C/
C
i \
H2C ¨CH2.
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
/--\ /--\ N
*N 0 *NI /0 * NN0 * N N-R12 *N
\__/ \__/
, , ,
-N(013)2, -N(H)-(012-012-o-cH3), -N(CH3)-(CH2-CH2-0-CH3);
wherein * indicates the point of attachment to LA;
R12 represents a methyl-, ethyl- or cyclopropyl- group;
R2 represents a group selected from:
õe N-N
. * **
N- S .
, '
77

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein " * " indicates the point of attachment to R3, and " ** " indicates
the point of
attachment to 1_3;
R3 represents:
R31
R32
* 40 R33
R35
R34
wherein " * " represents the point of attachment to R2;
R31, K^32,
R34 and R35
represent, independently from each other, a hydrogen atom or a group selected
from:
fluoro-, chloro, methyl-, methoxy-; with the proviso that at least two of R31,
R32, R34 and R35
represent a hydrogen atom;
R33 represents a hydrogen atom;
R4 represents a hydrogen atom or a methyl- group;
R5 represents a hydrogen atom;
R6 represents a group selected from:
C1-C6-alkyl-, C1-C6-alkoxy-, C3-C6-cycloalkoxy-, halo-, hydroxy-, cyano-,
-C(=0)-0-C1-C4-alkyl, -C(=0)-N(R3)(R10), K ^9-
S-, R9-S(=0)-, R3-S(=0)2-;
said C1-C6-alkyl-, and C1-C6-alkoxy- group being optionally substituted, one
or more times,
identically or differently, with a substituent selected from: halo-, C1-C3-
alkoxy-,
C1-C3-alkoxy-C2-C3-alkoxy-, C3-C7-cycloalkyl-;
R9, Rlo
represent, independently from each other, a hydrogen atom or a C1-C3-alkyl- or
C1-C3-alkoxy-C1-C3-alkyl- group;
or
R9Rio together with the atom or the group of atoms they are attached to, form
a 3- to
10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
78

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
In another preferred embodiment, the present invention relates to compounds of
general formula
(I):
3
2
B
R5 0SI
N\ A 1
L¨R
I
R6 4
(I)
in which :
LA represents -CH2-, -CH(CH3)-, -C(CH3)2- or
H2C ¨CH2.
LB represents -N(H)-C(=0)- or
R1 represents a group selected from:
*N 0 *NI /0 * NN0 * N N¨R12
wherein * indicates the point of attachment to LA;
R12 represents a methyl-, ethyl- or cyclopropyl- group;
R2 represents a group selected from:
* e * *
*0 *
N¨ ¨N
N N¨N
, ** * **
79

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein " * " indicates the point of attachment to fe, and " ** " indicates
the point of
attachment to LB; wherein said group is optionally substituted, one or more
times, identically
or differently, with a C1-C3-alkyl- group;
re represents:
R31
R32
* 40 R33
R35
R34
wherein " * " represents the point of attachment to R2;
R31, K^32,
R34 and R35
represent, independently from each other, a hydrogen atom or a group selected
from:
fluoro-, chloro, methyl-, methoxy-; with the proviso that at least two of R31,
R32, R34 and R35
represent a hydrogen atom;
R33 represents a hydrogen atom;
R4 represents a hydrogen atom;
R5 represents a hydrogen atom;
R6 represents chloro, C1-C4-alkyl-, methoxy-, difluoromethoxy-,
trifluoromethoxy-,
trifluoromethyl-, -C(=0)-NH2, -CH2-0-CH3 or -CH2-S(=0)2-CH3;
or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a
mixture of same.
It is to be understood that the present invention relates also to any
combination of the preferred
embodiments described above.
More particularly still, the present invention covers compounds of general
formula (I) which are
disclosed in the Examples section of this text, infra.
80

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In accordance with another aspect, the present invention covers methods of
preparing compounds
of the present invention, said methods comprising the steps as described in
the Experimental Section
herein.
In a preferred embodiment, the present invention relates to a method of
preparing a compound of
general formula (I), supra, said method comprising the step of allowing an
intermediate compound of
general formula (VI):
H
2'N 0
R3 /R
R5 1
NH2
R6
(VI)
in which R2, fe, R5, and R5 are as defined for general formula (I), supra;
to react with a carboxylic acid HO2C-LA-Ri or the corresponding acyl chloride
CI-C(=0)-LA-Ri, wherein
L' and R' are as defined for the compounds of general formula (I), supra; or
alternatively
to react with suitable reagents, such as CI-C(=0)-LA-LG, in which L' is as
defined for the compounds of
general formula (I), and LG stands for a leaving group, preferably chloro or
bromo, and subsequently
with agents suitable for the introduction of R', exemplified by but not
limited to cyclic secondary
amines;
thereby giving, upon optional deprotection, a compound of general formula
(la):
H
2..N 0
R3/R
R5 10
0
)L
N I_PR1
H
R6
(la)
in which LA, R', R2, fe, R5, and R5 are as defined for the compounds of
general formula (I), supra.
In accordance with another embodiment, the present invention also relates to a
method of preparing
a compound of general formula (I), supra, said method comprising the step of
allowing an
intermediate compound of general formula (XI):
81

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
HO 0
0
R5 10I
N)L LA¨ R1
H
R6
(XI)
in which LA, R', R5, and R5 are as defined for general formula (I), supra;
to react with a compound of general formula R3R2NH2, in which R2 and R3 are as
defined for the
compounds of general formula (I), supra;
thereby giving, upon optional deprotection, a compound of general formula
(la):
H
2..N 0
R3/R
R5 10
0
N)LI_R1
H
R6
(la)
in which LA, R', R2, R3, R5, and R5 are as defined for the compounds of
general formula (I), supra.
In accordance with another embodiment, the present invention also relates to a
method of preparing
a compound of general formula (I), supra, said method comprising the step of
allowing an
intermediate compound of general formula (Xla):
Li0 0
0
R5 10I
N)L LA¨ R1
H
R6
(Xla)
in which LA, R', R5, and R5 are as defined for general formula (I), supra;
to react with a compound of general formula R3R2NH2, in which R2 and R3 are as
defined for the
compounds of general formula (I), supra;
thereby giving, upon optional deprotection, a compound of general formula
(la):
82

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
2..N 0
3/R
0
R5 10
R6
(la)
in which LA, R', R2, fe, R5, and R5 are as defined for the compounds of
general formula (I), supra.
In accordance with another embodiment, the present invention also relates to a
method of preparing
a compound of general formula (I), supra, said method comprising the step of
allowing an
intermediate compound of general formula (XVII):
0
NH
R5 40
NH2
R6
(xvii)
in which R2, fe, R5, and R5 are as defined for general formula (I), supra;
to react with a carboxylic acid HO2C-LA-Ri or the corresponding acyl chloride
CI-C(=0)-LA-Ri, wherein
L' and R' are as defined for the compounds of general formula (I), supra; or
alternatively
to react with suitable reagents, such as CI-C(=0)-LA-LG, in which L' is as
defined for the compounds of
general formula (I), and LG stands for a leaving group, preferably chloro or
bromo, and subsequently
with agents suitable for the introduction of R', exemplified by but not
limited to cyclic secondary
amines;
thereby giving, upon optional deprotection, a compound of general formula
(lb):
0
R2"'L NH
R5 40
0
N)LLR1
R6
(lb)
83

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
in which LA, R', R2, fe, R5, and R5 are as defined for the compounds of
general formula (I), supra.
In accordance with another embodiment, the present invention also relates to a
method of preparing
a compound of general formula (I), supra, said method comprising the step of
allowing an
intermediate compound of general formula (XXII):
NH2
R5 10
0
N)LLR1
H
R6
(XXII)
in which LA, R', R5 and R5 are as defined for general formula (I), supra;
to react with a carboxylic acid HO2C-R2-R3, wherein R2 and R3 are as defined
for the compounds of
general formula (I), supra; or alternatively
to react with a carboxylic acid X-R2-CO2H, in which R2 is as defined for the
compounds of general
formula (I), supra, and subsequently subjected to a palladium catalysed
coupling reaction, such as a
Suzuki coupling, with R3-X', in which R3 is as defined for the compounds of
general formula (I), supra.
In X-R2-CO2H and R3-X', both X and X represent groups enabling palladium
catalysed coupling
reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonaflyl
or a boronic acid or an
ester thereof, with the proviso that if X represents a boronic ester or an
ester thereof, X' stands for
bromo, iodo, trifluoromethylsulfonyloxy or nonaflyl and the like, or vice
versa;
thereby giving, upon optional deprotection, a compound of general formula
(lb):
0
R3R2jLNH
R5 40
0
N)LLR1
H
R6
(lb)
in which LA, R', R2, R3, R5, and R5 are as defined for the compounds of
general formula (I), supra.
In accordance with another embodiment, the present invention also relates to a
method of preparing
a compound of general formula (I), supra, said method comprising the step of
allowing an
intermediate compound of general formula (XXIV):
84

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
02
R -
R5 101
NH
I A
R6 R-
(XXIV)
in which R2, fe, RA, R5 and R5 are as defined for general formula (I), supra;
to react with a carboxylic acid HO2C-LA-Ri or the corresponding acyl chloride
CI-C(=0)-LA-Ri, wherein
LA and R' are as defined for the compounds of general formula (I), supra;
thereby giving, upon optional deprotection, a compound of general formula
(lc):
0
02'-\
R -
0
R5 .
N L A 1
-R
I
R6 R4
(lc)
in which LA, R', R2, fe, RA, R5 and R5 are as defined for the compounds of
general formula (I), supra.
In accordance with another embodiment, the present invention also relates to a
method of preparing
a compound of general formula (I), supra, said method comprising the step of
allowing an
intermediate compound of general formula (XXV):
H
2..N 0
R
X
R5 10
0
NLA¨R1
H
R6
(XXV)
in which LA, R', R2, R5 and R5 are as defined for general formula (I), supra;
to react with a compound of general formula R3-X', wherein R3 is as defined
for the compounds of
general formula (I), supra;

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
wherein both, X and X represent groups enabling palladium catalysed coupling
reactions, such as
chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonaflyl or a boronic acid or
an ester thereof, with
the proviso that if X represents a boronic ester or an ester thereof, X'
stands for chloro, bromo, iodo,
trifluoromethylsulfonyloxy or nonaflyl and the like, or vice versa.
thereby giving, upon optional deprotection, a compound of general formula
(la):
H
2'N 0
R3/R
R5 10
0
N)LI_R1
H
R6
(la)
in which LA, R', R2, fe, fe, R5 and R5 are as defined for the compounds of
general formula (I), supra.
In accordance with a further aspect, the present invention covers intermediate
compounds which are
useful in the preparation of compounds of the present invention of general
formula (I), particularly in
the method described herein. In particular, the present invention covers
intermediate compounds of
general formula (VI):
H
2'N 0
R3 /R
R5 1
NH2
R6
(VI)
in which R2, fe, R5, and R5 are as defined for general formula (I), supra.
The present invention also covers intermediate compounds of general formula
(XI):
HO 0
0
R5 10I
N)L LA¨ R1
H
R6
(XI)
86

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
in which L', R', R5, and R6 are as defined for the compounds of general
formula (I), supra.
The present invention also covers intermediate compounds of general formula
(Xla):
Li0 0
0
R5 10I
N)LLR1
R6
(Xla)
in which L', R', R5, and R6 are as defined for general formula (I), supra.
The present invention also covers intermediate compounds of general formula
(XVII):
0
R2 NH
R5 40
NH2
R6
(XVII)
in which R2, R3, R5, and R6 are as defined for general formula (I), supra.
The present invention also covers intermediate compounds of general formula
(XXII):
NH2
R5 10
0
N)LLR1
R6
(XXII)
in which L', R', R5 and R6 are as defined for general formula (I), supra.
The present invention also covers intermediate compounds of general formula
(XXIV):
87

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
02
R -
R5 101
NH
I A
R6 R-
(XXIV)
in which R2, fe, RA, R5 and R5 are as defined for general formula (I), supra.
The present invention also covers intermediate compounds of general formula
(XXV):
H
2..N 0
R
X
R5 10
0
N)L A 1
L¨R
H
R6
(XXV)
in which LA, R', R2, R5 and R5 are as defined for general formula (I), supra,
and X represents a group
enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo,
trifluoromethylsulfonyloxy, nonaflyl or a boronic acid or an ester thereof.
In accordance with yet another aspect, the present invention covers the use of
the intermediate
compounds of general formula (VI) :
H
2'N 0
R3 /R
R5 1
NH2
R6
(VI)
in which R2, fe, R5, and R5 are as defined for general formula (I) supra,
for the preparation of a compound of general formula (I) as defined supra.
88

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
In accordance with yet another aspect, the present invention covers the use of
the intermediate
compounds of general formula (XI) :
HO 0
R5 10
0
NLA¨R1
R6
(XI)
in which LA, R', R5, and R5 are as defined for the compounds of general
formula (I) supra,
for the preparation of a compound of general formula (I) as defined supra.
In accordance with yet another aspect, the present invention covers the use of
the intermediate
compounds of general formula (Xla) :
Li0 0
0
R5 10
N)LLA¨R1
R6
(Xla)
in which LA, R', R5, and R5 are as defined for general formula (I) supra,
for the preparation of a compound of general formula (I) as defined supra.
In accordance with yet another aspect, the present invention covers the use of
the intermediate
compounds of general formula (XVII) :
0
R2 NH
R5 40
NH2
R6
(XVII)
89

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
in which R2, fe, R5, and R5 are as defined for general formula (I) supra,
for the preparation of a compound of general formula (I) as defined supra.
In accordance with yet another aspect, the present invention covers the use of
the intermediate
compounds of general formula (XXII) :
NH2
R5 10
0
N)LLR1
H
R6
(XXII)
in which LA, R', R5 and R5 are as defined for general formula (I) supra,
for the preparation of a compound of general formula (I) as defined supra.
In accordance with yet another aspect, the present invention covers the use of
the intermediate
compounds of general formula (XXIV) :
0
02
R -
R5 101
NH
I A
R6 R-
(XXIV)
in which R2, fe, fe, R5 and R5 are as defined for general formula (I) supra,
for the preparation of a compound of general formula (I) as defined supra.
In accordance with yet another aspect, the present invention covers the use of
the intermediate
compounds of general formula (XXV) :
90

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
0
R5 10 )L
R6
(XXV)
in which L', R', R2, R5 and R6 are as defined for general formula (I), supra,
and X represents a group
enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo,
trifluoromethylsulfonyloxy, nonaflyl or a boronic acid or an ester thereof;
for the preparation of a compound of general formula (I) as defined supra.
GENERAL SYNTHESIS OF THE COMPOUNDS OF THE INVENTION
The following paragraphs outline a variety of synthetic approaches suitable to
prepare compounds of
formulae (la), (lb) and (lc), in which L', R', R2, R3, R5 and R6 are as
defined for the compounds of
general formula (I), supra. Formulae (la) and (lb), in which re represents
hydrogen, both constitute
subsets of formula (I) in that they feature different orientations of the
amide linker 12, which stands
for -NH-C(=0)- in formula (la) whilst representing -C(=0)-NH- in formula (lb),
as shown in Scheme A.
In formula (lc), 12 represents -C(=0)-NH-, alike formula (lb), and re is as
defined for the compounds of
general formula (I), supra, but different from hydrogen.
3
R 2
R, B
5 401 0
A
N L¨R1
6 1 4
R R
(I)
0 0
2N 0
R2 NH
R¨R21.NH
401 0
5
0
R5
R
A 1 1111110 A
N L¨R 5 ISO A. A 1 NA L¨R1
N L¨R
I
R6 H
(la) R6 H R6 R4
(lb) (lc)
91

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Scheme A: Formulae (I), (la), lb), and (lc).
In addition to the routes described below, also other routes may be used to
synthesise the target
compounds, in accordance with common general knowledge of a person skilled in
the art of organic
synthesis. The order of transformations exemplified in the following Schemes
is therefore not
intended to be limiting, and suitable synthesis steps from various schemes can
be combined to form
additional synthesis sequences. In addition, interconversion of any of the
substituents R1, R2, 1:13, R",
R5 and/or R6, can be achieved before and/or after the exemplified
transformations. These
modifications can be such as the introduction of protective groups, cleavage
of protective groups,
reduction or oxidation of functional groups, halogenation, metallation, metal
catalysed coupling
reactions, substitution or other reactions known to a person skilled in the
art. These transformations
include those which introduce a functionality allowing for further
interconversion of substituents.
Appropriate protective groups and their introduction and cleavage are well-
known to a person skilled
in the art (see for example T.W. Greene and P.G.M. Wuts in Protective Groups
in Organic Synthesis,
3rd edition, Wiley 1999). Specific examples are described in the subsequent
paragraphs. Further, it is
possible that two or more successive steps may be performed without work-up
being performed
between said steps, e.g. in a "one-pot" reaction, as it is well-known to a
person skilled in the art.
Scheme B outlines the preparation of compounds of the formula (la), in which
L', Ri., R2, -3,
K R5, and R6
are as defined for the compounds of general formula (I), supra, starting from
meta-nitrobenzoic acid
derivatives (II), in which R5 and R6 are as defined for the compounds of
general formula (I), which can
be converted into the corresponding benzoyl chlorides (III), by treatment with
a suitable chlorinating
agent, such as oxalyl chloride. Benzoic acid derivatives of the formula (II)
are well known to the
person skilled in the art, and are often commercially available. Said benzoyl
chlorides of the formula
(III) can be subsequently converted into amides of the general formula (V),
e.g. directly by aminolysis
with amines R3-R2-NH2, in which R2 and re are as defined for the compounds of
general formula (I).
Alternatively, amides of the formula (V) can be accomplished in two steps by
aminolysis of (III) using
an amine X-R2-NH2, in which R2 is as defined for the compounds of general
formula (I), giving rise to
amides of the formula (IV). Said amides can be subsequently coupled with I:0-
X', in which re is as
defined for the compounds of general formula (I), in a palladium catalysed
coupling reaction such as
a Suzuki coupling to furnish amides of general formula (V). In X-R2-NH2 and
I:0-X', both X and X'
represent groups enabling palladium catalysed coupling reactions, such as
chloro, bromo, iodo,
trifluoromethylsulfonyloxy, -S(=0)2C4F9 (nonafly1) or a boronic acid or an
ester thereof, with the
92

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
proviso that if X represents a boronic ester or an ester thereof, X stands for
bromo, iodo,
trifluoromethylsulfonyloxy or nonaflyl and the like, or vice versa.
The nitro group present in said amides (V) is then reduced by treatment with a
suitable reducing
agent, such as titanium(III)chloride, or hydrogenation in the presence of a
suitable catalyst, e.g.
palladium on charcoal, to give anilines of the formula (VI). Said anilines of
the formula (VI) are then
elaborated into compounds of the formula (la). This can be accomplished
directly by reacting a
compound of the formula (VI) with a carboxylic acid HO2C-LA-Ri, wherein LA and
Ft' are as defined for
the compounds of general formula (I), in an amide coupling reaction, for
example in the presence of
a tertiary aliphatic amine, such as N,N-diisopropylethylamine, and 2,4,6-
tripropy1-1,3,5,2,4,6-
trioxaphosphinane 2,4,6-trioxide (also known as T3P), in a suitable sovent
such as N,N-
dimethylformamide. Alternatively, the transformation of anilines (VI) into
compounds of the formula
(la) can be performed by reaction of anilines (VI) with suitable reagents such
as CI-C(=0)-LA-Fti, or, in
a two step synthesis firstly with CI-C(=0)-LA-LG, in which LA is as defined
for the compounds of general
formula (I), and LG stands for a leaving group, preferably chloro or bromo, to
give the corresponding
compounds of formula (VII), which are subsequently reacted with agents
suitable for the
introduction of Ft', exemplified by but not limited to cyclic secondary
amines, to give compounds of
the formula (la).
93

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
2...N 0
R
X
R5 40
NO2
X-R2-N H2R6 R3- X'
H
HO 0 CI 0 l' (IV) 2"
3.......R N 0
R
R3R2NH2
R5 SI ¨3.- R5 Oil R5 lb
NO2 NO2
NO2
R6 R6
(III) R6
(V)
(II)
/
H H
R2-N 0
R2-N 0
R3'...... R3'......
0
R5 0 A.

..e_
R5 SI
N i_pRi
NH2
R6 H
R6
(la) (VI)
\ /
H
2'N 0
R3.......R
0
R5 401 ).L A
N L¨LG
R6 H
(VII)
Scheme B: Preparation of compounds of the formula (la) from meta-nitrobenzoic
acid derivatives of
formula (II)
Alternatively, compounds of the formula (la) can be prepared starting from
meta-aminobenzoic acid
derivatives of formula (VIII), in which R6 and R6 are as defined for the
compounds of general formula
(I), supra, as outlined in Scheme C. Said meta-aminobenzoic acid derivatives
of formula (VIII) are well
known to the person skilled in the art and are commercially available in many
cases. Compounds of
formula (VIII) can be reacted with an amine R3R2NH2, in which R2 and R3 are as
defined for the
compounds of general formula (I), supra, in a standard amide coupling
reaction, to give amide
derivatives of formula (VI). Said compounds of formula (VI) can also be
obtained by coupling the
aformentioned acids of formula (VIII) with an amine X-R2-NH2, in which R2 is
as defined for the
compounds of general formula (I), supra, giving rise to amides of the formula
(IX). These are
94

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
subsequently subjected to a palladium catalysed coupling reaction, such as a
Suzuki coupling, with
R3-X', in which R3 is as defined for the compounds of general formula (1), in
order to furnish amides of
general formula (VI), respectively. In X-R2-NH2 and R3-X', both X and X
represent groups enabling
palladium catalysed coupling reactions, such as bromo, iodo,
trifluoromethylsulfonyloxy, nonaflyl or
a boronic acid or an ester thereof, with the proviso that if X represents a
boronic ester or an ester
thereof, X' stands for bromo, iodo, trifluoromethylsulfonyloxy or nonaflyl and
the like, or vice versa.
Amides of the formula (VI) are subsequently converted into compounds of
formula (la) as described
supra in context with Scheme B.
H
N 0 H
R2'
2'N 0
XR3.......R
R6 401NH2 0
R5 410
N)L A
L¨LG
R6 (IX) R6 H
X-R2-NH2 R3-X' (VII)
,...
,...
H H
HO 02..N 0
N 0 N 0
R R33 .......R..
R3R2N H2 0
R5 R5 R5 1110
NH2 NH2 NALA¨RI
R6 R6
(VI) R6 H
(VIII) (la)
Scheme C: Preparation of compounds of the formula (la) from meta-aminobenzoic
acid derivatives of
formula (VIII)
The sequence of synthetic steps can be varied as outlined in Scheme D, in
order to convert meta-
aminobenzoic acid derivatives of formula (VIII), in which R6 and R6 are as
defined for the compounds
of general formula (1), into compounds of the formula (la). Said benzoic acid
derivatives of the
formula (VIII) can be converted into compounds of the formula (X), in which LG
stands for a leaving
group, preferably chloro or bromo, followed e.g. by aminolysis of compounds of
the formula (X) using
reagents suitable for the introduction of R', exemplified by but not limited
to suitable cyclic
secondary amines, to give compounds of the formula (XI). Subsequently, the
carboxy group present
in compounds of the formula (XI) can be coupled with an amine R3R2NH2, in
which R2 and R3 are as
defined for the compounds of general formula (1), supra, in an amide coupling
reaction, for example
in the presence of a tertiary aliphatic amine, such as N,N-
diisopropylethylamine, and 2,4,6-tripropyl-

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1,3,5,2,4,6-trioxaphosphinane 2,4,6-trioxide (also known as T3P), in a
suitable solvent such as N,N-
dimethylformamide, to afford compounds of the formula (la).
HO 0 HO 0 HO 0
0 0
R5 40 _,... R5 lb
N R5 III
NH2 L¨LG
N/11\LiR1
R6 R6 H
R6 H
(VIII) .....R (X) (XI)
H H /
2'N 0
2'N 0
... R
R3 X
0 0
R5 40 ).L ..._
R5 401
N I_PR1 N/ILLA¨R1
R6 H
R6 H
(la)
Scheme D: Alternative preparation of compounds of the formula (la) from meta-
aminobenzoic acid
derivatives of formula (VIII)
Instead of said benzoic acid derivatives of formula (VIII), also the
corresponding ester analogues of
formula (XII), in which R5 and R6 are as defined for the compounds of general
formula (I), and in
which RE stands for a C1-C6-alkyl group, preferably methyl or ethyl, can be
employed in a similar
fashion in order to prepare compounds of the formula (la), as outlined in
Scheme E. Esters of the
formula (XII) are well known to the person skilled in the art, and are
commercially available in many
cases. Elaboration of said benzoic acid esters of formula (XII) into compounds
of formula (XIV), in
which R1 is as defined for the compounds of general formula (I), supra, can
proceed via compounds
of formula (XIII), in which LG stands for a leaving group, preferably chloro
or bromo, and can be
performed analogously as described in context with Scheme D. Subsequently, the
ester group
present in compounds of formula (XIV) can be saponified by reaction with e.g.
lithium hydroxide to
yield the lithium salt of the formula (Xla). Said lithium salt of formula
(Xla) or the corresponding
carboxylic acid is then converted into compounds of formula (la).
96

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
RE
RE
RE
0 0 0 0 0 0
0 0
R5 * R5 IP R5 IP
NA A
NH2 NALA¨LG L¨R1
R6
R6 H
R6 H
(XII) (XIII) (XIV)
0
R2'N Li0 0
0 0
R5 10 A R5
A 1
L¨R N = )LLA¨R1
R6 H
H
(la) R6
(Xla)
0 2 / HO 0
R-N
0
0
R5 ('L¨R R5 A
A 1 NALA¨R1
R6 H R6
Scheme E: Preparation of compounds of the formula (la) from meta-aminobenzoic
acid esters of
formula (XII)
A first approach to compounds of the formula (lb) from meta-nitroaniline
derivatives of formula (XV),
in which R5 and R6 are as defined for the compounds of general formula (I),
supra, is outlined in
Scheme F. Said meta-nitroaniline derivatives of formula (XV) are well known to
the person skilled in
the art, and are often commercially available. They can be converted into
amide derivatives of
formula (XVI) e.g. by a reacting with a carboxylic acid chloride R3-R2-
C(=0)C1, in which R2 and re are as
defined for the compounds of general formula (I), supra, in the presence of a
suitable base, such as
potassium carbonate, and in a suitable solvent, such as acetonitrile. Basic
solvents, such as pyridine,
can take over both the role of a base and of a solvent, respectively.
Alternatively, conversion of (XV)
into (XVI) can be performed via standard amide coupling reactions. The nitro
group present in
amides of the formula (XVI) can be subsequently reduced e.g. by hydrogenation
in the presence of a
suitable catalyst, e.g. palladium on charcoal, to give the corresponding
aniline derivatives of formula
(XVII). Said anilines of the formula (XVII) can then be elaborated into
compounds of the formula (lb).
This can be accomplished directly by reacting a compound of the formula (XVII)
with a carboxylic acid
97

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
HO2C-LA-Ri, wherein LA and Ft' are as defined for the compounds of general
formula (I), in an amide
coupling reaction, for example in the presence of a tertiary aliphatic amine,
such as N,N-
diisopropylethylamine, and 2,4,6-tripropy1-1,3,5,2,4,6-trioxaphosphinane 2,4,6-
trioxide (also known
as T3P), in a suitable sovent such as N,N-dimethylformamide. Alternatively,
the transformation of
anilines (XVII) into compounds of the formula (la) can be performed by
reaction of anilines (XVII) with
suitable reagents, such as CI-C(=0)-LA-LG, in which LA is as defined for the
compounds of general
formula (I), and LG stands for a leaving group, preferably chloro or bromo, to
give the corresponding
compounds of formula (XVIII), which are subsequently reacted with agents
suitable for the
introduction of Ft', exemplified by but not limited to cyclic secondary
amines, to give compounds of
the formula (lb).
0
,R2...ILN H
X
R5 .
NO2
/ R6
\ 0 0
NH2 R3 NH R 3R2j.LNH
R5 R5 OS _i... R5 01
NO2 NO2 NH2
R6
R6 R6
(XV) (XVI) (XVII)
0
3R2jLNH
R
0
R5 401 )L
0 N A
L¨LG
H 0
3RNH
R6
R (XVIII)
R2jLNH
R3
R5 0 _________________________________ a 0
NH2 R5 IP
N'...ILLA¨ R1
R6
H
(XVII) R6
(lb)
Scheme F: Preparation of compounds of the formula (lb) from meta-nitroaniline
derivatives of
formula (XV)
98

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Scheme G outlines an approach complimentary to Scheme F as an alternative
synthesis route for
compounds of the formula (lb), from meta-nitroaniline derivatives of formula
(XIX), in which R5 and
R5 are as defined for the compounds of general formula (I), supra, and which
differ from the
compounds of formula (XV) by the inverse arrangement of their nitro and amino
groups,
respectively. Said meta-nitroaniline derivatives of formula (XIX) are well
known to the person skilled
in the art, and are often commercially available. They can be converted into
amide derivatives of
formula (XX), in which LA is as defined for the compounds of general formula
(I), supra, and in which
LG stands for a leaving group, preferably chloro or bromo, by a reacting with
a carboxylic acid LG-LA-
CO2H, in a standard amide coupling reaction. Said amides of the formula (XX)
can be subsequently
converted into compounds of the formula (XXI), in which R' is as defined for
the compounds of
general formula (I), supra, using reagents suitable for the introduction of
R', exemplified by but not
limited to cyclic secondary amines. The nitro group present in amides of the
formula (XXI) is then
reduced e.g. by hydrogenation in the presence of a suitable catalyst, e.g.
palladium on charcoal, to
give the corresponding aniline derivatives of formula (XXII). Compounds of
formula (XXII) can be
reacted with a carboxylic acid FOR2CO2H, wherein R2 and re are as defined for
the compounds of
general formula (I), supra, in an amide coupling reaction, for example in the
presence of a tertiary
aliphatic amine, such as N,N-diisopropylethylamine, and 2,4,6-tripropy1-
1,3,5,2,4,6-
trioxaphosphinane 2,4,6-trioxide (also known as T3P), in a suitable sovent
such as N,N-
dimethylformamide, to give compounds of the formula (lb). The compounds of
formula (lb) can also
be obtained by coupling the aformentioned anilines of formula (XXII) with a
carboxylic acid X-R2-
CO2H, in which R2 is as defined for the compounds of general formula (I),
supra, giving rise to amides
of the formula (XXIII). These can be subsequently subjected to a palladium
catalysed coupling
reaction, such as a Suzuki coupling, with I:0-X', in which re is as defined
for the compounds of general
formula (I), in order to furnish compounds of the formula (lb), respectively.
In X-R2-CO2H and I:0-X',
both X and X represent groups enabling palladium catalysed coupling reactions,
such as chloro,
bromo, iodo, trifluoromethylsulfonyloxy, nonaflyl or a boronic acid or an
ester thereof, with the
proviso that if X represents a boronic ester or an ester thereof, X' stands
for chloro, bromo, iodo,
trifluoromethylsulfonyloxy or nonaflyl and the like, or vice versa.
99

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
NO2 NO2 NO2
0 0
R5 10 _a.. R5 ('N)LL¨LG R5 IP
NH2
NALA¨R1
R6 R6 H
R6 H
(XIX) (XX) (XXI)
0
,R21'N H
X
0
R5 * )L
N i_pRi
0
X-R2-CO2H_ny, R6 H R3-X'
NH2 / (XXIII) NH
3..õ...R
R 2
0 0
,-,5
-3' M = R3R2002H R5 .
N i_pRi __________ 1.
NA.LA¨R1
R6 H R6 H
(XXII) (lb)
Scheme G: Preparation of compounds of the formula (lb) from meta-nitroaniline
derivatives of
formula (XIX)
Scheme H illustrates the introduction of re groups different from hydrogen. In
order so to do,
primary anilines of the formula (XVII), in which LA, R1, R2,
R3, R5, and R6 are as defined for the
compounds of general formula (I), supra, and which can be prepared according
to Scheme F, can be
converted into secondary anilines of the formula (XXIV), in which R4 is as
defined for the compounds
of general formula (I), supra, but different from hydrogen. This can be
accomplished by various
methods known to the person skilled in the art, such as a reductive amination
with an aldehyde
suitable to confer R4, e.g. benzaldehyde for R4 = benzyl, in the presence of a
suitable borohydride
reagent, such as sodium triacetoxyborohydride, and in the presence of a
suitable acid, such as acetic
acid, in a suitable solvent, such as a chlorinated hydrocarbon, preferably
dichloromethane. The
resulting compounds of the formula (XXIV) are subsequently elaborated into
compounds of the
formula (lc), in which LA, R1, R2, R3, -4,
K R5 and R6 are as defined for the compounds of general formula
(I), supra, with the proviso that R4 is different from hydrogen.
100

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0 0 0
3......R21' NH 3......R21' NH 3......R21'
NH
R R R
0
R5
R5
R5 411101
N)L
NH2 NH i_AR1
R6
R64
R64
(XVII)
(XXIV) (IC)
Scheme H: Preparation of compounds of the formula (lc) from aniline
derivatives of formula (XVII)
Further details (reaction conditions, suitable solvents etc.) can be obtained
from the experimental
section below.
In the present text, in particular in the Experimental Section, for the
synthesis of intermediates and
of examples of the present invention, when a compound is mentioned as a salt
form with the
corresponding base or acid, the exact stoichiometric composition of said salt
form, as obtained by
the respective preparation and/or purification process, is, in most cases,
unknown.
Unless specified otherwise, suffixes to chemical names or structural formulae
such as
"hydrochloride", "trifluoroacetate", "sodium salt", or "x HCI", "x CF3COOH",
"x Na+", for example, are
to be understood as not a stoichiometric specification, but solely as a salt
form.
This applies analogously to cases in which synthesis intermediates or example
compounds or salts
thereof have been obtained, by the preparation and/or purification processes
described, as solvates,
such as hydrates with (if defined) unknown stoichiometric composition.
EXPERIMENTAL SECTION
The following table lists the abbreviations used in this paragraph, and in the
examples section.
Abbreviation Meaning
anh anhydrous
br. broad signal (in NMR data)
d day(s)
DAD Diode Array Detector
DCM dichloromethane
101

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
DME 1,2-dimethoxyethane
DMF N,N-dimethylformamide
DMSO dimethyl sulfoxide
ELSD Evaporative Light Scattering Detector
ESI electrospray ionisation
Et0Ac ethyl acetate
h hour
H PLC, LC high performance liquid chromatography
m/z mass-to-charge ratio (in mass spectrum)
mc multiplet centred
Me0H methanol
min Minute
MPLC medium pressure liquid chromatography
MS mass spectroscopy
neg negative
NMR nuclear magnetic resonance
PE petroleum ether
pos positive
ppm Chemical shift 6 in parts per million
PYBOP (1H-benzotriazol-1-yloxy)(tripyrrolidin-1-yl)phosphonium
hexafluorophosphate
Rt retention time
rt room temperature
THE tetrahydrofurane
TLC thin layer chromatography
Methods:
Method 1:
Instrument: Waters Acquity UPLC-MS SOD; column: Acquity UPLC BEH C18 1.7
50x2.1mm; Eluent A:
water + 0.05% vol. formic acid (98%), Eluent B: acetonitrile + 0.05% vol.
formic acid (98%); gradient:
0-1.6 min 1-99% B, 1.6-2.0 min 99% B; rate 0.8 mL/min; temperature: 60 C; DAD
scan: 210-400 nm;
ELSD.
Method 2:
102

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Instrument: Waters Autopurificationsystem SOD; column: Waters XBrigde C18 5
100x3Omm; water
+ 0.1% vol. formic acid (99%)! acetonitrile gradient; temperature: room
temperature; injection: 2500
L; DAD scan: 210-400 nm.
Method 3:
Instrument: Waters Acquity UPLC-MS SOD; column: Acquity UPLC BEH C18 1.7
50x2.1mm; Eluent A:
water + 0.2% vol. ammonia (32%), Eluent B: acetonitrile; gradient: 0-1.6 min 1-
99% B, 1.6-2.0 min
99% B; rate 0.8 mL/min; temperature: 60 C; DAD scan: 210-400 nm; ELSD.
Method 4:
Instrument: Waters Acquity UPLC-MS SOD; column: Acquity UPLC BEH C18 1.7
50x2.1mm; Eluent A:
water + 0.1% vol. formic acid (99%), Eluent B: acetonitrile; gradient: 0-1.6
min 1-99% B, 1.6-2.0 min
99% B; rate 0.8 mL/min; temperature: 60 C; DAD scan: 210-400 nm; ELSD.
Method 5:
Instrument: Waters Autopurificationsystem SOD; column: Waters XBrigde C18 5
100x3Omm; water
+ 0.2% vol. ammonia (32%)! acetonitrile gradient; temperature: room
temperature; injection: 2500
L; DAD scan: 210-400 nm.
Method 6:
Instrument: JASCO P2000 Polarimeter; wavelength 589 nm; temperature: 20 C;
integration time 10
s; path length 100 mm.
Method 7:
Instrument: Acquity UPLC from Waters; mass detector: LCT from Micromass (now
Waters); column:
Kinetex C18 from Phenomenex, 50 x 2.1 mm, 2.6 um particle, 60 C; solvent: A:
water + 0.05% formic
acid; B: acetonitrile + 0.05% formic acid; injection: 0.5 ul; rate: 1.3
mL/min; gradient 99% A, 1% B
until 1.9 min linear to 1% A, 99% B; 1.9 - 2.10 min unchanged; until 2.20 min
back to 99% A, 1% B.
Intermediates
Intermediate 1
5-phenyl-1,3-thiazole-2-carboxylic acid
103

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
N
OH
500 mg (2.14 mmol) of ethyl 5-phenyl-1,3-thiazole-2-carboxylate were provided
in 4.4 mL of dioxane,
a solution of 103 mg (4.29 mmol) of lithium hydroxide in 2.6 mL of water was
added at room
temperature and the mixture was stirred for 5 h at room temperature. Water and
a 2N aqueous
hydrogen chloride solution were then added until an acidic pH of 1.5 - 2 was
achieved. After stirring
for 15 minutes, the precipitate was filtered off, washed with water and dried.
360 mg of the title
compound were obtained as a mixture of the free acid and its lithium salt.
LC-MS (Method 4): Rt = 0.85 min; MS (ESIpos): rniz = 206 [m+H].
Intermediate 2
lithium 5-phenyl-1,3-thiazole-2-carboxylate
0
N Li
0
To a solution of ethyl 5-phenyl-1,3-thiazole-2-carboxylate (500 mg, 2.14 mmol)
in dioxane (4.4 mL)
was added a solution of lithium hydroxide (103 mg, 4.29 mmol, 2.0 equiv) in
water (2.6 mL) at room
temperature. The mixture was stirred for 4 h at room temperature. The
resulting mixture was
concentrated under reduced pressure, and washed with CH2Cl2 (10 mL). The
resulting aqueous layer
was concentrated to dryness under reduced pressure to give lithium 5-phenyl-
1,3-thiazole-2-
carboxylate, which was used without further purification.
Intermediate 3
4-methoxy-3-nitrobenzoyl chloride
104

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Cl 0
40 NO2
0
H3C
3.00 g (15.2 mmol) of 4-methoxy-3-nitrobenzoic acid were stirred in 20 mL of
dichloromethane at
room temperature. 59 uL (0.76 mmol) of DMF and 2.66 mL (30.4 mmol) of oxalyl
chloride were
added and the mixture was stirred for additional 2 h at 50 C after the gas
formation had stopped.
1.33 mL (15.2 mmol) of oxalyl chloride were added and the mixture was stirred
for 6 h at 50 C. Then
the solvents were evaporated and the remaining material was provided in 20 mL
of dichloromethane
at room temperature. 59 uL (0.76 mmol) of DMF and 2.66 mL (30.4 mmol) of
oxalyl chloride were
added and the mixture was stirred for additional 2 h at 50 C after the gas
formation had stopped.
After concentration, 3.25 g of raw material were obtained, which were used
without further
purification.
Intermediate 4
N-(6-chloropyridin-3-yI)-4-methoxy-3-nitrobenzamide
H
N 0
I
CI /\ N% 0
NO2
0
HC
1.94 g (15.1 mmol) of 6-chloropyridin-3-amine and 3.15 mL (22.6 mmol) of
triethylamine in 100 mL of
THE were stirred at room temperature. A solution of 3.25 g (15.1 mmol) of the
compound from
intermediate 3 in 50 mL of THE and 50 mL of THE were added and the mixture was
stirred at room
temperature over night. The mixture was poured into water and ethyl acetate
was added. The
organic solvents were evaporated and the precipitate in the remaining aqueous
phase was filtered
off, washed with water and ethanol and dried. 4.30 g (87% of theory) of the
title compound were
obtained, which were used without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 4.03 (s, 3H), 7.55 (dd, 2H), 8.21 -
8.33 (m, 2H), 8.55 (d, 1H),
8.77 (d, 1H), 10.68 (s, 1H).
LC-MS (Method 4): Rt = 1.06 min; MS (ESIpos): m/z = 308 [M+H].
105

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Intermediate 5
N-[6-(2-fluorophenyl)pyridin-3-yI]-4-methoxy-3-nitrobenzamide
H
N 0
40
F
I
0 NO2
0
H3C
4.25 g (13.8 mmol) of the compound from intermediate 4 were provided in 140 mL
of degassed THE
under an argon atmosphere at room temperature. 2.90 g (20.7 mmol) of (2-
fluorophenyl)boronic
acid, 326 mg (0.41 mmol) of chloro(2-dicyclohexylphosphino-2',4',6'-
triisopropy1-1,r-bipheny1)[2-(2'-
amino-1,1'-biphenyppalladium(11) and 55.2 mL (27.6 mmol) of a 0.5M aqueous,
degassed solution of
potassium phosphate were added, and the mixture was stirred at room
temperature for 1 h. The
mixture was poured into water, and dichloromethane was added. The organic
solvents were
evaporated and the precipitate in the remaining aqueous phase was filtered
off, washed with water
and ethanol and dried. 5.07 g (98% of theory) of the title compound were
obtained, which were used
without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 4.03 (s, 3H), 7.29 - 7.38 (m, 2H),
7.41 - 7.52 (m, 1H), 7.56 (d,
1H), 7.84 (dd, 1H), 7.91 - 8.03 (m, 1H), 8.26 - 8.37 (m, 2H), 8.58 (d, 1H),
9.06 (d, 1H), 10.69 (s, 1H).
LC-MS (Method 1): Rt = 1.19 min; MS (ESIpos): m/z = 368 [M+H].
Intermediate 6
4-methoxy-3-nitro-N-(6-phenylpyridin-3-yl)benzamide
H
N 0
Ni I
0 NO2
0
H3C
2.55 g (15.0 mmol) of 6-phenylpyridin-3-amine and 3.13 mL (22.5 mmol) of
triethylamine in 100 mL
of THE were stirred at room temperature. A solution of 3.23 g (15.0 mmol) of
the compound from
106

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
intermediate 3 in 50 mL of THE was added and the mixture was stirred at room
temperature over
night. The mixture was poured into water and ethyl acetate was added. The
organic solvents were
evaporated and the precipitate in the remaining aqueous phase was filtered
off, washed with water
and ethanol and dried. 5.08 g (96% of theory) of the title compound were
obtained, which were used
without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 4.03 (s, 3H), 7.36 - 7.61 (m, 4H),
8.01 (d, 1H), 8.05 - 8.12 (m,
2H), 8.24 - 8.37 (m, 2H), 8.58 (d, 1H), 9.01 (d, 1H), 10.65 (s, 1H).
LC-MS (Method 4): Rt = 1.18 min; MS (ESIpos): m/z = 350 [M+H].
Intermediate 7
3-amino-N-[6-(2-fluorophenyl)pyridin-3-yI]-4-methoxybenzamide
H
N 0
40
F
I
0
NH2
0
H3C
5.00 g (13.6 mmol) of the compound from intermediate 5 were provided in 150 mL
of THE and
cooled to 0 C. 92.6 mL (109 mmol) of a 10% aqueous hydrogen chloride solution
containing 15% of
titanium(III) trichloride were added and the mixture was stirred at room
temperature over night. 200
mL of THE were added, and the mixture was stirred at room temperature for 2
days. 200 mL of THE
and 92.6 mL (109 mmol) of a 10% aqueous hydrogen chloride solution containing
15% of titanium(III)
trichloride were added, and the mixture was stirred at room temperature over
night. 92.6 mL (109
mmol) of a 10% aqueous hydrogen chloride solution containing 15% of
titanium(III) trichloride were
added, and the mixture was stirred at room temperature over night.
Dichloromethane was added,
the pH was adjusted to a value of 10 by addition of a 2N aqueous solution of
sodium hydroxide, and
the mixture was stirred for 2 h. After filtration and separation of the
organic and aqueous phase, the
aqueous phase was extracted with dichloromethane. The combined organic phases
were washed
with brine, dried over sodium sulfate, filtered and concentrated. 4.67 g of
the title compound were
obtained and used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.85 (s, 3H), 4.96 (s, 2H), 6.90 -
6.95 (m, 1H), 7.26 - 7.36 (m,
4H), 7.41 - 7.49 (m, 1H), 7.79 (dd, 1H), 7.91 - 8.01 (m, 1H), 8.30 (dd, 1H),
9.05 (d, 1H), 10.29 (s, 1H).
LC-MS (Method 1): Rt = 1.02 min; MS (ESIpos): m/z = 338 [M+H].
Intermediate 8
3-amino-4-methoxy-N-(6-phenylpyridin-3-yl)benzamide
107

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
I
40 0
NH2
0
H3C
5.00 g (14.3 mmol) of the compound from intermediate 6 were provided in 150 mL
of THE and
cooled to 0 C. 97.3 mL (115 mmol) of a 10% aqueous hydrogen chloride solution
containing 15% of
titanium(III) trichloride were added and after addition of further 200 mL of
THE the mixture was
stirred at room temperature over night. 200 mL of THE were added, and the
mixture was stirred at
room temperature for 2 days. 400 mL of THE and 48.7 mL (57.3 mmol) of a 10%
aqueous hydrogen
chloride solution containing 15% of titanium(III) trichloride were added, and
the mixture was stirred
at room temperature over night. The reaction mixture was neutralized by
addition of solid sodium
bicarbonate, saturated with sodium chloride and stirred with 600 mL of a 1:1
mixture of THE and
ethyl acetate for 2 h. The precipitate was filtered off. Dichloromethane was
added to the precipitate,
the pH was adjusted to a value of 10 by addition of a 2N aqueous solution of
sodium hydroxide, and
the mixture was stirred for 2 h. After filtration and separation of the
organic and aqueous phase, the
aqueous phase was extracted with dichloromethane. The combined organic phases
were washed
with brine, dried over sodium sulfate, filtered and concentrated. 1.90 g of
the title compound (42%
of theory) were obtained and used without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 3.85 (s, 3H), 4.98 (s, 2H), 6.89 -
6.97 (m, 1H), 7.23 - 7.31 (m,
2H), 7.35 - 7.44 (m, 1H), 7.44 - 7.53 (m, 2H), 7.96 (d, 1H), 8.02 - 8.12 (m,
2H), 8.29 (dd, 1H), 9.00 (d,
1H), 10.26 (s, 1H).
LC-MS (Method 1): Rt = 0.97 min; MS (ESIpos): m/z = 320 [M+H].
Intermediate 9
3-amino-N-(6-chloropyridin-3-yI)-4-(trifluoromethoxy)benzamide
H
N 0
I
CIN% 0
NH2
F 0
F>r
F
A mixture of 3-amino-4-(trifluoromethoxy)benzoic acid (10.2 g, 46.1 mmol)
which can be synthesized
according to the method disclosed on page 213 of W02008/75064A1 and 6-
chloropyridin-3-amine
108

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
(11.9 g, 92.3 mmol, 2.0 equiv) in DMF (325 mL) was treated with
propanephosphonic anhydride
(50%, 54 mL, 92.3 mmol, 2.0 equiv), followed by diisopropylethylamine (40 mL,
230.6 mmol, 5.0
equiv). The resulting mixture was allowed to stir at room temperature for 24
h. The resulting
solution was concentrated under reduced pressure until a precipitate began to
form (removal of
approximately 50 mL). The resulting mixture was treated with water (100 mL).
The resulting solids
were separated, washed with water, and dried at 50 C under reduced pressure
to give 3-amino-N-
(6-chloropyridin-3-y1)-4-(trifluoromethoxy)benzamide (10.0 g, 65%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 5.63 (br s, 2H), 7.09 (dd, J=2.3, 8.5
Hz, 1H), 7.23 (ddm, J=1.3,
8.5 Hz, 1H), 7.32 (d, J=2.1 Hz, 1H), 7.47 (d J=8.7 Hz, 1H), 8.18 (dd, J=2.6,
8.9 Hz, 1H), 8.72 (d, J=2.3 Hz,
1H), 10.47 (s, 1H).
LC-MS (Method 3): Rt = 1.11 min; MS (ESIpos): m/z = 332 ([M+H], 100%); MS
(ESIneg): m/z = 330
([M-H]-, 100%).
Intermediate 10
3-amino-N-[6-(2-fluorophenyl)pyridin-3-yI]-4-(trifluoromethoxy)benzamide
N 0
N
NH2
FO
To a flask was added 3-amino-N-(6-chloropyridin-3-yI)-4-
(trifluoromethoxy)benzamide (prepared in a
manner analogous to that described in intermediate 9, 5.0 g, 15.1 mmol), (2-
fluorophenyl)boronic
acid (3.2 g, 22.6 mmol, 1.5 equiv), potassium carbonate (4.2 g, 30.1 mmol, 2.0
equiv) and a DME /
water mixture (3:1, 150 mL). The resulting suspension was purged with argon,
treated with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 0.62 g,
0.75 mmol, 5.0 mol%) and sealed. The resulting mixture was stirred in a sealed
flask at 90 C for 12
h, then cooled to room temperature. In parallel, a second reaction was run
with 3-amino-N-(6-
chloropyridin-3-y1)-4-(trifluoromethoxy)benzamide (prepared in a manner
analogous to that
described in intermediate 9, 5.0 g, 15.1 mmol). The combined reaction mixtures
were poured onto
ice water (200 mL), and extracted with ethyl acetate (3 x 100 mL). The
combined organic phases
were washed with a saturated NaCI solution (100 mL), dried (Na2504 anh), and
concentrated under
reduced pressure. The resulting material was recrystallized from ethanol to
give 3-amino-N-[6-(2-
fluorophenyl)pyridin-3-y1]-4-(trifluoromethoxy)benzamide (3.5 g, 29%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 5.67 (s, 2H), 7.12 (dd, J=2.1, 8.3 Hz,
1H), 7.21-7.33 (m, 3H),
7.35 (d, J=2.1 Hz, 1H), 7.39-7.47 (m, 1H), 7.78 (dd, J=1.9, 8.5 Hz, 1H), 7.92
(td, J=1.7, 8.1 Hz, 1H), 8.25
(dd, J=2.5, 8.7 Hz, 1H), 9.00 (d, J=2.1 Hz, 1H), 10.50 (s, 1H).
109

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 1.23 min; MS (ESIpos): m/z = 392 ([M+H], 70%); MS
(ESIneg): m/z = 390 (W¨
HY, 100%).
The mother liquor from the recrystallization was concentrated to dryness under
reduced pressure to
give additional 3-amino-N-[6-(2-fluorophenyl)pyridin-3-yI]-4-
(trifluoromethoxy)benzamide
(approximately 92% pure (HPLC), 8.2 g, 69%). This material was used in
subsequent reactions
without further purification.
Intermediate 11
3-amino-N-(6-phenylpyridin-3-yI)-4-(trifluoromethoxy)benzamide
H
N 0
I
0 N 0
NH2
FO
F I
F
To a flask was added 3-amino-N-(6-chloropyridin-3-yI)-4-
(trifluoromethoxy)benzamide (prepared in a
manner analogous to that described in intermediate 9, 2.50 g, 7.5 mmol),
phenylboronic acid (1.38 g,
11.3 mmol, 1.5 equiv), potassium carbonate (2.1 g, 15,1 mmol, 2.0 equiv) and a
DME / water mixture
(3:1, 75 mL). The resulting suspension was purged with argon, treated with
[1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex (0.15 g,
0.19 mmol, 2.5
mol%) and sealed. The resulting mixture was stirred in a sealed flask at 90 C
for 16 h, then cooled to
room temperature. The reaction mixture was poured onto ice water (75 mL), and
extracted with
ethyl acetate (3 x 50 mL). The combined organic phases were washed with a
saturated NaCI solution
(50 mL), dried (Na2504 anh), and concentrated under reduced pressure. The
resulting material was
recrystallized from methanol to give 3-
amino-N-[6-(2-fluorophenyl)pyridin-3-yI]-4-
(trifluoromethoxy)benzamide (1.2 g, 41%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 5.71 (s, 2H), 7.15 (dd, 1H), 7.27 (dd,
1H), 7.34 - 7.53 (m, 4H),
7.98 (d, 1H), 8.02 - 8.11 (m, 2H), 8.28 (dd, 1H), 8.99 (d, 1H), 10.50 (s, 1H).
LC-MS (Method 3): Rt = 1.25 min; MS (ESIpos): m/z = 374 ([M+H], 100%); MS
(ESIneg): m/z = 372
([M¨H], 100%).
Intermediate 12
3-[(chloroacetyl)amino]-N-[6-(2-fluorophenyl)pyridin-3-y1]-4-methoxybenzamide
110

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F
I
101 /
N
0 0
)-CI
N
H
0
H3C
500 mg (1.48 mmol) of the compound from intermediate 7 were provided in 10 mL
of toluene, 0.24
mL (2.96 mmol) of chloroacetyl chloride were added, and the mixture was
stirred for 2 h at 100 C.
After concentration, 593 mg of raw material were obtained, which were used
without further
purification.
LC-MS (Method 1): Rt = 1.14 min; MS (ESIpos): m/z = 414 [M+1-1]+.
Intermediate 13
3-[(chloroacetypamino]-4-methoxy-N-(6-phenylpyridin-3-yObenzamide
H
N 0
I
101 Ni
0 0
C1
N
H
0 )J
.Cl 10
To a solution of 3-amino-4-methoxy-N-(6-phenylpyridin-3-yl)benzamide (prepared
in a manner
analogous to that described in intermediate 8, 0.50 g, 1.57 mmol) and pyridine
(0.27 mL, 3.29 mmol,
2.1 equiv) in CH2Cl2 (9 mL) at 0 C was added chloroacetyl chloride (0.13 mL,
1.64 mmol, 1.05 equiv)
dropwise. The resulting mixture was allowed to warm to room temperature and
was stirred at that
temperature for 5 h. The resulting material was concentrated under reduced
pressure to give
impure 3-[(chloroacetypamino]-4-methoxy-N-(6-phenylpyridin-3-yObenzamide (0.75
g). This
material was used in subsequent reactions without further purification.
Intermediate 14
3-[(chloroacetypamino]-N46-(2-fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
111

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F
I
0 0 0
)-CI
N
H
F 0
F>r
F
To a solution of 3-amino-N46-(2-fluorophenyppyridin-3-y1]-4-
(trifluoromethoxy)benzamide
(prepared in a manner analogous to that described in intermediate 10, 1.08 g,
2.76 mmol) and
pyridine (0.47 mL, 5.80 mmol, 2.1 equiv) in CH2Cl2 (20 mL) at 0 C was added
chloroacetyl chloride
(0.23 mL, 2.90 mmol, 1.05 equiv) dropwise. The resulting mixture was allowed
to warm to room
temperature and was stirred at that temperature for 12 h. The resulting
mixture was concentrated
under reduced pressure to give impure 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (1.75 g). This material was used in subsequent
reactions without
further purification.
LC-MS (Method 3): Rt = 1.28 min; MS (ESIpos): m/z = 468 ([M+H], 30%), 935
([2M+H], 10%); MS
(ESIneg): m/z = 466 (EM¨Hr, 100%).
Intermediate 15
3-[(2-chloropropanoyDamino]-N46-(2-fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
F
I
0 0
CI N)-y
H
F

>

(

0 CH3
F
F
To a solution of 3-amino-N46-(2-fluorophenyppyridin-3-y1]-4-
(trifluoromethoxy)benzamide
(prepared in a manner analogous to that described in intermediate 10, 0.50 g,
1.28 mmol) and
pyridine (0.22 mL, 2.68 mmol, 2.1 equiv) in CH2Cl2 (7.5 mL) at 0 C was added
2-chloropropanoyl
chloride (0.13 mL, 1.34 mmol, 1.05 equiv) dropwise. The resulting mixture was
allowed to warm to
room temperature and was stirred at that temperature for 12 h. The resulting
mixture was
concentrated under reduced pressure to give impure 3-[(2-chloropropanoyDamino]-
N46-(2-
fluorophenyl)pyridin-3-y1]-4-(trifluoromethoxy)benzamide (0.62 g). This
material was used in
subsequent reactions without further purification.
112

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 1.34 min; MS (ESIpos): m/z = 443 ([M+1-1]+, 20%); MS
(ESIneg): rniz = 480 (W¨
HY, 100%).
Intermediate 16
3-[(2-chloropropanoyDamino]-N-(6-phenylpyridin-3-y1)-4-
(trifluoromethoxy)benzamide
H
N 0
I
0 0
CI
N)Y
H
FO CH3
F I
F
To a solution of 3-amino-N-(6-phenylpyridin-3-yI)-4-
(trifluoromethoxy)benzamide (prepared in a
manner analogous to that described in intermediate 11, 535 mg, 1.43 mmol) and
pyridine (0.24 mL,
3.01 mmol, 2.1 equiv) in CH2Cl2 (8.4 mL) at 0 C was added 2-chloropropanoyl
chloride (0.15 mL, 1.51
mmol, 1.05 equiv) dropwise. The resulting mixture was allowed to warm to room
temperature and
was stirred at that temperature for 12 h. The resulting mixture was
concentrated under reduced
pressure to give impure 3-[(2-chloropropanoyl)amino]-N-(6-
phenylpyridin-3-y1)-4-
(trifluoromethoxy)benzamide (0.81 g). This material was used in subsequent
reactions without
further purification.
LC-MS (Method 1): Rt = 1.33 min; MS (ESIpos): m/z = 464 ([M+1-1]+, 100%), 927
([2M+1-1]+, 10%); MS
(ESIneg): m/z = 462 (EM¨Hr, 100%).
Intermediate 17
3-[(2-bromo-2-methylpropanoyDamino]-N46-(2-fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
F
I
I. 0
Br
H
FO H3C CH3
F I
F
113

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
500 mg (1.28 mmol) of the compound from intermediate 10 and 114 uL (1.41 mmol)
of pyridine were
provided in 5 mL of dichloromethane. 308 mg (1.34 mmol) of 2-bromo-2-
methylpropanoyl bromide
were added at 0 C, and the mixture was stirred at room temperature over
night. Water was added,
and the phases were separated. The aqueous phase was extracted twice with
dichloromethane, and
the combined organic phases were washed with brine, dried over sodium sulfate,
filtered and
concentrated. 720 mg of the title compound were obtained, which were used
without further
purification.
LC-MS (Method 4): Rt = 1.44 min; MS (ESIpos): m/z = 540 [m+H].
Intermediate 18
3-[(chloroacetypamino]-4-(trifluoromethyl)benzoic acid
HO 0
0
N
H
F F
F
To a solution of 3-amino-4-(trifluoromethyl)benzoic acid (2.50 g, 12.19 mmol)
and pyridine (2.07 mL,
25.6 mmol, 2.1 equiv) in CH2Cl2 (50 mL) at 0 C was added chloroacetyl
chloride (1.02 mL, 12.80
mmol, 1.05 equiv) dropwise. The resulting mixture was allowed to warm to room
temperature and
was stirred at that temperature for 5 h. The resulting solution was treated
with a CH2Cl2 /
isopropanol mixture (4:1, 50 mL). The resulting solution was washed with an
aqueous 1N HCI
solution (50 mL), dried (Mg504 anh), and concentrated under reduced pressure
to give impure 3-
[(chloroacetypamino]-4-(trifluoromethyl)benzoic acid (3.83 g). This material
was used in subsequent
reactions without further purification.
LC-MS (Method 3): Rt = 0.89 min; MS (ESIpos): m/z = 282 ([M+H], 100%); MS
(ESIneg): m/z = 280
(EM¨Hr, 100%).
Intermediate 19
3-[(chloroacetypamino]-4-(trifluoromethoxy)benzoic acid
114

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
HO 0
0
0 )-CI
N
H
F 0
F>r
F
To a solution of 3-amino-4-(trifluoromethoxy)benzoic acid (2.50 g, 11.3 mmol)
and pyridine (1.92 mL,
23.7 mmol, 2.1 equiv) in CH2Cl2 (50 mL) at 0 C was added chloroacetyl
chloride (0.95 mL, 11.9 mmol,
1.05 equiv) dropwise. The resulting mixture was allowed to warm to room
temperature and was
stirred at that temperature for 5 h. The resulting solution was treated with a
CH2Cl2 / isopropanol
mixture (4:1, 50 mL). The resulting solution was washed with an aqueous 1N HCI
solution (50 mL),
dried (MgSO4 anh), and concentrated under reduced pressure to give impure 3-
[(chloroacetyl)amino]-4-(trifluoromethyl)benzoic acid (3.52 g). This material
was used in subsequent
reactions without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 4.35 (s, 2H), 7.52 (ddm, J=1.5, 8.7
Hz, 1H), 7.80 (dd, J=2.1,
8.7 Hz, 1H), 8.47 (d, J=2.1 Hz, 1H), 10.17 (s, 1H), 13.28 (br s, 1H).
LC-MS (Method 3): Rt = 0.95 min; MS (ESIpos): m/z = 298 ([M+H], 100%); MS
(ESIneg): m/z = 296
([M-H]-, 100%), 593 ([2M-H]-, 100%).
Intermediate 20
3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethyl)benzoic acid
HO 0
0 r'0
0 N)- Nj
H
F F
F
To a solution of 3-[(chloroacetyl)amino]-4-(trifluoromethyl)benzoic acid
(prepared in a manner
analogous to that described in intermediate 18, 3.52 g, 11.0 mmol) in DMF (50
mL) was added
morpholine (2.0 mL, 23.1 mmol, 2.1 equiv), triethylamine (3.2 mL, 23.1 mmol,
2.1 equiv) and
potassium iodide (0.28 g, 1.71 mmol, 0.16 equiv). The reaction mixture was
stirred at room
temperature for 16 h. The resulting mixture was diluted with water (75 mL).
The aqueous solution
was extracted with a CH2Cl2 / isopropanol solution (4:1, 5 x 50 mL). The
combined organic phases
were washed with saturated brine (50 mL), dried (Na2504 anh), and concentrated
under reduced
pressure to give impure 3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethyl)benzoic acid (2.38 g).
This material was used in subsequent reactions without further purification.
115

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 0.55 min; MS (ESIpos): m/z = 333 ([M+H], 100%); MS
(ESIneg): m/z = 331
(EM¨Hr, 100%).
Intermediate 21
3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzoic acid
HO 0
0 rO
I:101 )-Nj
N
H
FO
FI
F
To a solution of 3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzoic acid
(prepared in a manner
analogous to that described in intermediate 19, 3.52 g, 11.8 mmol) in DMF (50
mL) was added
morpholine (2.2 mL, 24.8 mmol, 2.1 equiv), triethylamine (3.5 mL, 24.8 mmol,
2.1 equiv) and
potassium iodide (0.30 g, 1.83 mmol, 0.16 equiv). The reaction mixture was
stirred at room
temperature for 16 h. The resulting mixture was diluted with water (75 mL).
The aqueous solution
was extracted with a CH2Cl2 / isopropanol solution (4:1, 5 x 50 mL). The
combined organic phases
were washed with saturated brine (50 mL), dried (Na2504 anh), and concentrated
under reduced
pressure to give impure 3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)benzoic acid (2.87 g).
This material was used in subsequent reactions without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.54-2.59 (m, 4H), 3.20 (s, 2H), 3.61-
3.66 (m, 4H), 7.49-7.54
(m, 1H), 7.76 (dd, J=2.1, 8.6 Hz, 1H), 8.80 (d, J=2.1 Hz, 1H), 9.81 (s, 1H).
LC-MS (Method 3): Rt = 0.58 min; MS (ESIpos): m/z = 349 ([M+H], 100%); MS
(ESIneg): m/z = 347
(EM¨Hr, 100%).
Intermediate 22
2-chloro-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide
NO2
0
0 )-L.C1
N
H
FO
F I
F
116

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To a solution of 5-nitro-2-(trifluoromethoxy)aniline (17.3 g, 77.7 mmol) and
pyridine (6.60 mL, 81.5
mmol, 1.05 equiv) in CH2Cl2 (250 mL) at 0 C was added chloroacetyl chloride
(6.50 mL, 81.5 mmol,
1.05 equiv) dropwise. The resulting mixture was warmed to room temperature and
was stirred at
that temperature for 12 h. The resulting mixture was diluted with CH2Cl2 (250
mL), washed with
water (200 mL) followed by a saturated NaCI solution (250 mL), dried (MgSO4
anh), and concentrated
under reduced pressure to give impure 2-chloro-N-[5-nitro-2-
(trifluoromethoxy)phenyl]acetamide
(23.8 g). This material was used in subsequent reactions without further
purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 4.40 (s, 2H), 7.69 (dd, J=1.7, 9.0 Hz,
1H), 8.09 (dd, J=3.0, 9.2
Hz, 1H), 8.88 (d, J=2.8 Hz, 1H), 10.41 (s, 1H).
LC-MS (Method 3): Rt = 1.09 min; MS (ESIneg): m/z = 297 ([M-H]-, 100%).
Intermediate 23
N-(2-tert-butyl-5-nitropheny1)-2-chloroacetamide
NO2
0
100
N
H
H3C CH3 )-L.C1
CH3
To a solution of 2-tert-butyl-5-nitroaniline (2.55 g, 13.1 mmol) and pyridine
(2.20 mL, 27.6 mmol, 2.1
equiv) in CH2Cl2 (55 mL) at 0 C was added chloroacetyl chloride (1.10 mL,
13.8 mmol, 1.05 equiv)
dropwise. The resulting mixture was allowed to warm to room temperature and
was stirred at that
temperature for 12 h. The resulting solution was diluted with CH2Cl2 (50 mL),
washed with water (50
mL), dried (Na2504 anh), and concentrated under reduced pressure to afford
impure N-(2-tert-butyl-
5-nitrophenyI)-2-chloroacetamide (3.94 g). This material was used in
subsequent reactions without
further purification.
LC-MS (Method 3): Rt = 1.16 min; MS (ESIpos): m/z = 271 ([M+H], 40%); MS
(ESIneg): m/z = 469 ([M-
H], 100%).
Intermediate 24
2-chloro-N-(2-chloro-5-nitrophenyl)acetamide
117

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
NO2
0
(10 )-L.01
N
H
CI
To a solution of 2-chloro-5-nitroaniline (3.00 g, 17.4 mmol) and pyridine
(1.69 mL, 20.9 mmol, 1.2
equiv) in CH2Cl2 (60 mL) at 0 C was added chloroacetyl chloride (1.66 mL,
20.9 mmol, 1.2 equiv)
dropwise. The resulting mixture was allowed to warm to room temperature and
was stirred at that
temperature for 12 h. The resulting solution was diluted with CH2Cl2 (60 mL),
washed with water
(500 mL) followed by a saturated NaCI solution (50 mL), dried (MgSO4 anh), and
concentrated under
reduced pressure to afford 2-chloro-N-(2-chloro-5-nitrophenyl)acetamide (4.4
g, 100%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 4.42 (s, 2H), 7.80 (d J=8.8 Hz, 1H),
8.02 (dd, J=2.8, 8.8 Hz,
1H), 8.69 (d, J=2.5 Hz, 1H), 10.16 (s, 1H).
LC-MS (Method 3): Rt = 0.97 min; MS (ESIneg): m/z = 247 ([M-H]-, 100%).
Intermediate 25
2-chloro-N-(2-methyl-5-nitrophenyl)acetamide
NO2
0
0 )-CI
N
H
CH3
To a solution of 2-methyl-5-nitroaniline (2.00 g, 13.1 mmol) and pyridine
(1.28 mL, 15.8 mmol, 1.2
equiv) in CH2Cl2 (30 mL) at 0 C was added chloroacetyl chloride (1.1 mL, 13.8
mmol, 1.05 equiv)
dropwise. The resulting mixture was warmed to room temperature, and was
stirred at that
temperature for 12 h. The resulting solution was diluted with CH2Cl2 (30 mL),
washed with water (25
mL) followed by a saturated NaCI solution (25 mL), dried (Mg504 anh), and
concentrated under
reduced pressure to afford 2-chloro-N-(2-methyl-5-nitrophenyl)acetamide (2.2
g, 72%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.32 (s, 3H), 4.35 (s, 2H), 7.50 (d,
J=8.6 Hz, 1H), 7.94 (dd,
J=2.5, 8.3 Hz, 1H), 8.39 (d, J=2.5 Hz, 1H), 9.87 (s, 1H).
LC-MS (Method 3): Rt = 1.25 min; MS (ESIpos): m/z = 229 ([M+H], 70%); MS
(ESIneg): m/z = 227 ([M-
H], 100%).
Intermediate 26
2-chloro-N-(2-methoxy-5-nitrophenyl)acetamide
118

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
NO2
0
N
H
0
H3C
To a solution of 2-methoxy-5-nitroaniline (10.00 g, 59.5 mmol) and pyridine
(5.1 mL, 62.4 mmol, 1.05
equiv) in CH2Cl2 (175 mL) at 0 C was added chloroacetyl chloride (4.97 mL,
62.4 mmol, 1.05 equiv)
dropwise. The resulting mixture was warmed to room temperature, and was
stirred at that
temperature for 12 h. The resulting solution was concentrated under reduced
pressure. The
remaining solids were triturated with ethanol, filtered, washed with ethanol,
followed by water,
followed by ethanol, and dried at 50 C under reduced pressure to give 2-
chloro-N-(2-methoxy-5-
nitrophenyl)acetamide (14.1 g, 97%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.98 (s, 3H), 4.41 (s, 2H), 7.27 (d,
J=9.1 Hz, 1H), 8.04 (dd,
J=2.8, 9.1 Hz, 1H), 8.95 (d, J=2.8 Hz, 1H), 9.85 (s, 1H).
LC-MS (Method 3): Rt = 0.95 min; MS (ESIpos): m/z = 245 ([M+H], 100%); MS
(ESIneg): m/z = 243
([M-H]-, 100%).
Intermediate 27
2-(morpholin-4-yI)-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide
NO2
0 r'Nj0
101 N).L.
H
FO
F I
F
To a solution of 2-chloro-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide
(prepared in a manner
analogous to that described in intermediate 22, 20.6 g, 69.0 mmol) in DMF (300
mL) was added
morpholine (9.0 mL, 103.5 mmol, 1.5 equiv), triethylamine (14.4 mL, 103.5
mmol, 1.5 equiv) and
potassium iodide (1.78 g, 10.7 mmol, 0.16 equiv). The reaction mixture was
stirred at room
temperature for 16 h. The resulting mixture was poured onto water (300 mL).
The resulting mixture
was extracted with ethyl acetate (3 x 100 mL). The combined organic phases
were washed with half-
saturated NaCI solution, dried (Na2504 anh) and concentrated under reduced
pressure to give 2-
(morpholin-4-yI)-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide (20.0 g,
83%).
'H-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.53-2.56 (m, 4H), 3.22 (s, 2H), 3.59-
3.62 (m, 4H), 7.72 (dq,
J=1.7, 9.1 Hz, 1H), 8.05 (dd, J=2.8, 9.1 Hz, 1H), 9.11 (d, J=2.8 Hz, 1H),
10.05 (s, 1H).
119

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 1.15 min; MS (ESIpos): m/z = 350 ([M+H], 100%); MS
(ESIneg): rniz = 348
(EM-Hr, 100%).
Intermediate 28
N-(2-tert-butyl-5-nitropheny1)-2-(morpholin-4-yl)acetamide
NO2
0 r'0
N
H
H3C CH3
CH3
To a solution of N-(2-tert-butyl-5-nitropheny1)-2-chloroacetamide (prepared in
a manner analogous
to that described in intermediate 23, 3.94 g, 14.6 mmol) in DMF (60 mL) was
added morpholine (1.90
mL, 21.8 mmol, 1.5 equiv), triethylamine (3.04 mL, 21.8 mmol, 1.5 equiv) and
potassium iodide (0.37
g, 2.56 mmol, 0.16 equiv). The reaction mixture was stirred at room
temperature for 16 h. The
resulting mixture was poured onto water (75 mL). The resulting mixture was
extracted with ethyl
acetate (3 x 50 mL). The combined organic phases were dried (Na2504 anh) and
concentrated under
reduced pressure to give N-(2-tert-butyl-5-nitropheny1)-2-(morpholin-4-
yl)acetamide (1.61 g, 34%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.42 (s, 9H), 2.57-2.62 (m, 4H), 3.21
(s, 2H), 3.60-3.65 (m,
4H), 7.63 (d, J=9.0 Hz, 1H), 7.93 (dd, J=2.6, 8.9 Hz, 1H), 8.82 (d, J=2.5 Hz,
1H), 9.69 (s, 1H).
LC-MS (Method 3): Rt = 1.19 min; MS (ESIpos): m/z = 322 ([M+H], 100%); MS
(ESIneg): rniz = 320
(EM-Hr, 100%).
Intermediate 29
N-(2-chloro-5-nitrophenyI)-2-(morpholin-4-yl)acetamide
NO2
0 r'0
N
H
CI
To a solution of 2-chloro-N-(2-chloro-5-nitrophenyl)acetamide (prepared in a
manner analogous to
that described in intermediate 24, 4.40 g, 17.7 mmol) in DMF (75 mL) was added
morpholine (2.3 mL,
26.5 mmol, 1.5 equiv), triethylamine (3.7 mL, 26.5 mmol, 1.5 equiv) and
potassium iodide (0.45 g,
2.74 mmol, 0.16 equiv). The reaction mixture was stirred at room temperature
for 16 h. The
resulting mixture was poured onto water (75 mL). The resulting precipitate was
removed by
120

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
filtration, washed with water followed by ethanol, and dried at 50 C under
reduced pressure to give
N-(2-chloro-5-nitropheny1)-2-(morpholin-4-ypacetamide (4.8 g, 90%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.54-2.58 (m, 4H), 3.22 (s, 2H), 3.63-
3.66 (m, 4H), 7.82 (d,
J=8.8 Hz, 1H), 7.96 (dd, J=2.8, 8.8 Hz, 1H), 9.11 (d, J=2.5 Hz, 1H), 10.17 (s,
1H).
LC-MS (Method 3): Rt = 1.07 min; MS (ESIneg): m/z = 298 ([M-H]-, 100%).
Intermediate 30
N-(2-methyl-5-nitropheny1)-2-(morpholin-4-ypacetamide
NO2
0 r'0
40 )-Nj
N
H
CH3
To a solution of 2-chloro-N-(2-methyl-5-nitrophenyl)acetamide (prepared in a
manner analogous to
that described in intermediate 25, 2.16 g, 9.5 mmol) in DMF (35 mL) was added
morpholine (1.2 mL,
14.2 mmol, 1.5 equiv), triethylamine (2.0 mL, 14.2 mmol, 1.5 equiv) and
potassium iodide (0.24 g,
1.46 mmol, 0.16 equiv). The reaction mixture was stirred at room temperature
for 16 h. The
resulting mixture was poured onto water (35 mL). The resulting precipitate was
removed by
filtration, washed with water followed by ethanol, and dried at 50 C under
reduced pressure to give
N-(2-methyl-5-nitropheny1)-2-(morpholin-4-ypacetamide (2.1 g, 79%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.34 (s, 3H), 2.53-2.56 (m, 4H), 3.17
(s, 2H), 3.61-3.65 (m,
4H), 7.50 (d, J=8.8 Hz, 1H), 7.90 (dd, J=2.5, 8.3 Hz, 1H), 8.71 (d, J=2.5 Hz,
1H), 9.65 (s, 1H).
LC-MS (Method 3): Rt = 0.95 min; MS (ESIpos): m/z = 280 ([M+H], 50%); MS
(ESIneg): m/z = 278 ([M-
H]-, 100%).
Intermediate 31
N-(2-methoxy-5-nitropheny1)-2-(morpholin-4-ypacetamide
NO2
0 r'0
N
H
0
H3C
121

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To a solution of 2-chloro-N-(2-methoxy-5-nitrophenyl)acetamide (prepared in a
manner analogous to
that described in intermediate 26, 14.1 g, 57.6 mmol) in DMF (250 mL) was
added morpholine (7.5
mL, 66.5 mmol, 1.5 equiv), triethylamine (12.1 mL, 86.5 mmol, 1.5 equiv) and
potassium iodide (1.48
g, 8.93 mmol, 0.16 equiv). The reaction mixture was stirred at room
temperature for 16 h. The
resulting mixture was poured onto water (250 mL). The resulting mixture was
extracted with ethyl
acetate (3 x 100 mL). The combined organic phases were washed with a half-
saturated NaCI
solution, dried (Na2SO4 anh), and concentrated under reduced pressure. The
resulting material was
triturated with ethanol to give N-(2-methoxy-5-nitropheny1)-2-(morpholin-4-
ypacetamide as a
precipitate (15.5 g, 91%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.51-2.54 (m, 4H), 3.17 (s, 2H), 3.61-
3.64 (m, 4H), 4.02 (s,
3H), 7.26 (d, J=9.1 Hz, 1H), 8.00 (dd, J=2.8, 9.1 Hz, 1H), 9.08 (d, J=3.0 Hz,
1H), 9.89 (s, 1H).
LC-MS (Method 3): Rt = 0.96 min; MS (ESIpos): m/z = 296 ([M+H], 70%); MS
(ESIneg): m/z = 294 ([M-
H]-, 100%).
Intermediate 32
N45-amino-2-(trifluoromethoxy)pheny1]-2-(morpholin-4-ypacetamide
NH2
0 r'Nj0
101 N).L.
H
FO
F I
F
To a solution of 2-(morpholin-4-yI)-N-[5-nitro-2-
(trifluoromethoxy)phenyl]acetamide (prepared in a
manner analogous to that described in intermediate 27, 20.0 g, 57.1 mmol) in
ethyl acetate (500 mL)
was added 10% palladium on carbon (6.1 g, 5.72 mmol Pd, 10 mol% Pd). The
resulting slurry was
stirred under a hydrogen atmosphere for 3.25 h. The resulting slurry was
filtered and concentrated
under reduced pressure to afford N45-amino-2-(trifluoromethoxy)pheny1]-2-
(morpholin-4-
ypacetamide (17.8 g, 98%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.49-2.52 (m, 4H), 3.10 (s, 2H), 3.57-
3.60 (m, 4H), 5.37 (s,
2H), 6.26 (dd, J=2.5, 8.8 Hz, 1H), 6.99 (dd, J=1.3, 8.8 Hz, 1H), 7.51 (d,
J=2.5 Hz, 1H), 9.50 (s, 1H).
LC-MS (Method 4): Rt = 0.99 min; MS (ESIpos): m/z = 320 ([M+H], 90%); MS
(ESIneg): m/z = 318 ([M-
H], 100%).
Intermediate 33
N-(5-amino-2-tert-butylpheny1)-2-(morpholin-4-ypacetamide
122

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
NH2
0 r'0
N
H
H3C CH3
CH3
To a solution of N-(2-tert-butyl-5-nitropheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 28, 1.61 g, 5.01 mmol) in ethyl
acetate (50 mL) was
added 10% palladium on carbon (0.53 g, 0.50 mmol Pd, 10 mol% Pd). The
resulting slurry was stirred
under a hydrogen atmosphere for 4 h. The resulting slurry was filtered and
concentrated under
reduced pressure to afford N-(5-amino-2-tert-butylpheny1)-2-(morpholin-4-
ypacetamide (0.39 g,
27%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.28 (s, 9H), 2.52-2.56 (m, 4H), 3.07
(s, 2H), 3.58-3.63 (m,
4H), 4.89 (s, 2H), 6.27 (dd, J=2.5, 8.5 Hz, 1H), 6.95 (d, J=8.5 Hz, 1H), 7.02
(d, J=2.5 Hz, 1H), 9.18 (s, 1H).
LC-MS (Method 4): Rt = 0.98 min; MS (ESIpos): m/z = 292 ([M+H], 100%), 583
([2M+H], 10%); MS
(ESIneg): m/z = 290 ([M¨H]-, 100%).
Intermediate 34
N-(5-amino-2-chloropheny1)-2-(morpholin-4-ypacetamide
NH2
0 r'0
N
H
01
To a solution of N-(2-chloro-5-nitropheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 29, 1.00 g, 3.33 mmol) in methanol
(10 mL) at 0 C was
added tin(II) chloride dihydrate (3.76 g, 16.7 mmol, 5.0 equiv). The resulting
mixture was heated at
the reflux temperature for 16 h, was then cooled to room temperature. The
resulting mixture was
treated with ethanol (20 mL). The resulting precipitate was removed with
filtration, washed with a
saturated Na2CO3 solution, followed by water, followed by ethanol, then dried
at 50 C under
reduced pressure to give N-(5-amino-2-chloropheny1)-2-(morpholin-4-ypacetamide
(0.45 g, 50%).
LC-MS (Method 4): Rt = 0.87 min; MS (ESIpos): m/z = 270 ([M+H], 100%); MS
(ESIneg): m/z = 268
([M¨H]-, 60%).
Intermediate 35
123

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
N-(5-amino-2-methylpheny1)-2-(morpholin-4-ypacetamide
NH2
0 r'0
40 )'N j
N
H
CH3
To a solution of N-(2-methyl-5-nitropheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 30, 2.09 g, 7.47 mmol) in ethyl
acetate (80 mL) was
added 10% palladium on carbon (0.80 g, 0.75 mmol Pd, 10 mol% Pd). The
resulting slurry was stirred
under a hydrogen atmosphere for 1.5 h. The resulting slurry was filtered and
concentrated under
reduced pressure to afford N-(5-amino-2-methylpheny1)-2-(morpholin-4-
ypacetamide (1.80 g, 97%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.06 (s, 3H), 2.52-2.55 (m, 4H), 3.08
(s, 2H), 3.62-3.65 (m,
4H), 4.86 (s, 2H), 6.25 (dd, J=2.2, 7.9 Hz, 1H), 6.82 (d, J=8.2 Hz, 1H), 7.14
(d, J=2.2 Hz, 1H), 9.16 (s, 1H).
Intermediate 36
N-(5-amino-2-methoxypheny1)-2-(morpholin-4-ypacetamide
NH2
0 r'0
10 )-Nj
N
H
0
H3C
To a solution of N-(2-methoxy-5-nitropheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 31, 15.5 g, 52.5 mmol) in ethyl
acetate (500 mL) was
added 10% palladium on carbon (5.59 g, 5.25 mmol Pd, 10 mol% Pd). The
resulting slurry was stirred
under a hydrogen atmosphere for 2 h. The resulting slurry was filtered and
concentrated under
reduced pressure to afford N-(5-amino-2-methoxypheny1)-2-(morpholin-4-
ypacetamide (12.2 g,
88%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.05 (s, 2H), 3.59-3.63 (m, 4H), 3.70
(s, 3H), 4.68 (s, 2H), 6.19
(dd, J=2.6, 8.7 Hz, 1H), 6.71 (d, J=8.5 Hz, 1H), 7.54 (d, J=2.8 Hz, 1H), 9.56
(s, 1H), protons at 2.48-2.50
ppm partially obscured by solvent.
LC-MS (Method 4): Rt = 0.74 min; MS (ESIpos): m/z = 266 ([M+H], 100%); MS
(ESIneg): m/z = 264
([M¨H]-, 90%).
Intermediate 37
124

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
6-chloro-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide
0
).Li NH
I
N 0
CI 0 r0
N)-L-NJ
H
F 0
F>r
F
To a solution of N45-amino-2-(trifluoromethoxy)pheny1]-2-(morpholin-4-
ypacetamide (prepared in a
manner analogous to that described in intermediate 32, 1.92 g, 6.00 mmol) and
6-chloronicotinic
acid (1.23 g, 7.80 mmol, 1.3 equiv) in DMF (57.5 mL) was added (benzotriazol-1-

yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 4.06 g, 7.80 mmol,
1.30 equiv)
followed by diisopropylethylamine (3.13 mL, 18.0 mmol, 3.00 equiv). The
resulting mixture was
stirred at room temperature for 24 h, was then treated with water (50 mL). The
aqueous mixture
was extracted with ethyl acetate (100 mL). The organic phase was dried (Na2SO4
anh) and
concentrated under reduced pressure. The remaining material was purified using
MPLC (hexane /
ethyl acetate 1:1) to give
impure 6-chloro-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide (1.84 g). This material was used in
subsequent reactions
without further purification.
LC-MS (Method 3): Rt = 1.19 min; MS (ESIpos): m/z = 459 ([M+1-1]+, 30%); MS
(ESIneg): m/z = 457 ([M-
Hr, 100%).
Intermediate 38
6-chloro-N-{4-methoxy-3-[(morpholin-4-ylacetypamino]phenyllnicotinamide
0
).Li NH
I
N 0
CI 0 r0
N
H
0
H3C
To a solution of N-(5-amino-2-methoxypheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 36, 1.00 g, 3.77 mmol) and 6-
chloronicotinic acid (0.77 g,
4.90 mmol, 1.3 equiv) in DMF (30 mL) was added propanephosphonic acid cyclic
anhydride solution
(50% in ethyl acetate, 2.86 mL, 4.90 mmol, 1.30 equiv) followed by
diisopropylethylamine (1.97 mL,
11.3 mmol, 3.0 equiv). The resulting mixture was stirred at room temperature
for 24 h, was then
125

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
treated with water (50 mL). The resulting mixture was extracted with ethyl
acetate (50 mL). The
organic phase was dried (Na2SO4 anh), and concentrated under reduced pressure.
The residue was
crystalized from ethanol to give
6-chloro-N-{4-methoxy-3-[(morpholin-4-
ylacetyl)amino]phenyllnicotinamide (1.13 g, 74%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.49-2.54 (m, 4H), 3.12 (s, 2H), 3.61-
3.65 (m, 4H), 3.86 (s,
3H), 7.03 (d, J=8.9 Hz, 1H), 7.55 (dd, J=2.5, 8.9 Hz, 1H), 7.65 (d, J=8.3 Hz,
1H), 8.31 (dd, J=2.6, 8.3 Hz,
1H), 8.51 (d, J=2.6 Hz, 1H), 8.90 (d, J=2.3 Hz, 1H), 9.73 (s, 1H), 10.41 (s,
1H).
LC-MS (Method 3): Rt = 0.98 min; MS (ESIpos): m/z = 405 ([M+H], 100%), 809
([2M+H], 40%); MS
(ESIneg): m/z = 403 ([M¨H]-, 100%), 807 ([2M¨H]-, 10%).
Intermediate 39
5-bromo-N-{4-methoxy-3-[(morpholin-4-ylacetypamino]phenyllthiophene-2-
carboxamide
0
crL
NH
\ S 0
0 r'0
Br
N
H
0
H3C
To a solution of N-(5-amino-2-methoxyphenyI)-2-(morpholin-4-yl)acetamide
(prepared in a manner
analogous to that described in intermediate 36, 0.75 g, 2.83 mmol) and 5-
bromothiophene-2-
carboxylic acid (0.77 g, 4.90 mmol, 1.3 equiv) in DMF (30 mL) was added
propanephosphonic acid
cyclic anhydride solution (50% in ethyl acetate, 1.98 mL, 3.39 mmol, 1.2
equiv) followed by
diisopropylethylamine (1.48 mL, 8.48 mmol, 3.0 equiv). The resulting mixture
was stirred at room
temperature for 24 h, was then treated with water (50 mL). The resulting
mixture was extracted
with ethyl acetate (50 mL). The organic phase was dried (Na2504 anh), and
concentrated under
reduced pressure. The residue was crystalized from ethanol to give 5-bromo-N-
{4-methoxy-3-
[(morpholin-4-ylacetypamino]phenyllthiophene-2-carboxamide (0.48 g, 35%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.50-2.53 (m, 4H), 3.12 (s, 2H), 3.61-
3.65 (m, 4H), 3.85 (s,
3H), 7.01 (d, J=9.1 Hz, 1H), 7.31 (d, J=4.0 Hz, 1H), 7.49 (dd, J=2.8, 8.8 Hz,
1H), 7.83 (d, J=4.0 Hz, 1H),
8.44 (d, J=2.5 Hz, 1H), 9.71 (s, 1H), 10.21 (s, 1H).
LC-MS (Method 3): Rt = 1.16 min; MS (ESIpos): m/z = 454 ([M+H], 90%); MS
(ESIneg): m/z = 452 ([M¨
H], 70%).
Intermediate 40
3-amino-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-(trifluoromethoxy)benzamide
126

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
NINY
\ S
. 1 NH2
FO
FI
F
To a solution of 3-amino-4-(trifluoromethoxy)benzoic acid (known from
W02007/31791, 20.0 g, 90.4
mmol) and 5-phenyl-1,3,4-thiadiazol-2-amine (20.8 g, 118 mmol, 1.3 equiv) in
DMF (200 mL) was
added (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate
(PYBOP, 70.6 g, 136
mmol, 1.5 equiv) and diisopropylethylamine (47.3 mL, 271 mmol, 3.0 equiv). The
resulting mixture
was stirred at room temperature over night, was then treated with
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 70.6 g, 136 mmol,
1.5 equiv) and
diisopropylethylamine (47.3 mL, 271 mmol, 3.0 equiv). The resulting mixture
was stirred at room
temperature over night. The resulting mixture was concentrated under reduced
pressure, was then
triturated with dichloromethane and was concentrated under reduced pressure.
The remaining
solids were then triturated with a mixture of water (200 mL) and ethanol (600
mL), and the resulting
mixture was stirred for 30 minutes. The remaining solids were removed by
filtration, washed with
ethanol, and were dried at 50 C under reduced pressure to give the title
compound (29.4 g, 84%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 5.75 (s, 2H), 7.27 (dd, 1H), 7.35 (dd,
1H), 7.50 - 7.59 (m, 4H),
7.94 - 8.02 (m, 2H), 13.09 (s, 1H).
LC-MS (Method 1): Rt = 1.24 min; MS (ESIpos): rn/z = 381 [m+H].
Intermediate 41
3-[(chloroacetypamino]-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
H
N 0
NINY
\ S
0 )0,L.
. N
H CI
FO
FI
F
12.9 g (33.9 mmol) of the compound from intermediate 40 were provided in 430
mL of toluene, 4.05
mL (50.9 mmol) of chloroacetyl chloride were added, another 100 mL of toluene
were added, and
the mixture was stirred for 2 h at 100 C. After concentration, 15.5 g of raw
material were obtained,
which were used without further purification.
127

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 4.41 (s, 2H), 7.53 - 7.59 (m, 3H),
7.64 (dd, 1H), 7.96 - 8.02
(m, 2H), 8.08 (dd, 1H), 8.68 (d, 1H), 10.26 (s, 1H), 13.35 (s, 1H).
LC-MS (Method 4): Rt = 1.26 min; MS (ESIpos): m/z = 457 [M+1-1]+.
Intermediate 42
1-(4-methylpiperazin-1-ypcyclopropanecarboxylic acid hydrochloride (1:1)
r-NCH3
0
HO)cNJ
H-Cl
The title compound was prepared according to the following scheme by methods
which are known
to the person skilled in the art:
H-Cl
CIN
0 0 H-Cl Cl.) 0
HO
)-NH2 H3C 0)-=cNH 2
,.. -3.
Cl
C.1)
0 r'N 0 0 CH3 0 r'NH
Nj -3. Nj
H3C0-*-11....7c H3C0-.1-ic
2. Et0H
H-Cl
HCHO; r-NCH3 r-NCH3
10 NaBH3CN 0 HCI 0
H3C0-17c- H0).NJ
H-Cl
LC-MS methods for intermediates 42 and 43:
MS instrument type: Agilent 1956A; HPLC instrument type: Agilent 1200 Series;
UV DAD; column:
Agilent TC-C18, 2.1 x 50 mm, 5 um; mobile phase A: 0.0375% TEA in water,
mobile phase B: 0.0188%
128

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
TEA in acetonitrile; gradient: 0.0 min 100% A -> 1.0 min 100% A -> 3.4 min 20%
A -> 3.9 min 0% A ->
3.91 min 100% A -> 4.0 min 100% A -> 4.5 min 100% A; flow rate: 0.0 min 0.6
ml/min -> 1.0 min/3.4
min/3.9 min/3.91 min 0.6 ml/min -> 4.0 min/4.5 min 1.0 ml/min; column temp: 40
C; UV detection:
220 nm.
Step 1:
ethyl 1-aminocyclopropanecarboxylate hydrochloride (1:1)
0
H
3 C 0....."...... )1...x.NH2 H-Cl
Thionyl chloride (150 mL, 2.056 mol) was added slowly below 0 C to a
suspension of 1-
aminocyclopropanecarboxylic acid (100 g, 0.989 mol) in anhydrous ethanol (1
L). The mixture was
stirred at 70 C for 20 h. TLC (methanol, Rf = 0.4) showed that most of the
starting material was
consumed. Then the solution was concentrated to give 210 g of crude product.
The residue was
dissolved in water and adjusted to a pH between 9 and 10 with potassium
carbonate. The aqueous
layer was extracted with dichloromethane (1 L x 3). The combined organic
layers were concentrated
to dryness. The residue was dissolved in ethyl acetate (300 mL) and
hydrochloride in ethyl acetate
(250 mL, 4M) was added slowly to the solution below -30 C. It was stirred for
30 min at 0 C. A solid
precipitated and it was filtered under nitrogen atmosphere to give ethyl 1-
aminocyclopropanecarboxylate hydrochloride (132 g, 80.6% yield) as a white
solid.
The following 'H-N MR is from the free amine.
1H-NMR (400MHz, chloroform-di.): 6 [ppm] = 0.91-1.02 (m, 2H), 1.15-1.30 (m,
5H), 2.17 (s, 2H), 4.10
(d, 2H).
Step 2:
ethyl 1-(4-benzylpiperazin-1-yl)cyclopropanecarboxylate
0 rN
101
3 )-cNj
H C 0
A mixture of ethyl 1-aminocyclopropanecarboxylate hydrochloride (120 g, 0.725
mol), N,N-
diisopropylethylamine (942 g, 7.29 mol), N-benzy1-2-chloro-N-(2-
chloroethypethanamine
hydrochloride (213 g, 0.793 mol) in anhydrous ethanol (1.6 L) was stirred
under reflux for 16 h. TLC
(PE:Et0Ac = 5:1, Rf = 0.4) showed that most of the starting material was
consumed. Then the mixture
was concentrated. The residue was partitioned between dichloromethane (1 L)
and water (0.5 L). The
layers were separated and the aqueous layer was extracted with dichloromethane
(0.5 L x 2). The
combined organic layers were concentrated. The residue was purified by
chromatography on silica
gel (PE:Et0Ac = 20:1 to 10:1) to give ethyl 1-(4-benzylpiperazin-1-
yl)cyclopropanecarboxylate (100 g,
47.8%) as a light yellow oil.
129

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1H-NMR (400MHz, chloroform-d1): 6 [ppm] = 0.88-0.97 (m, 2H), 1.23-1.36 (m,
5H), 2.37 (br. S, 4H),
2.98 (br. S, 4H), 3.51 (s, 2H), 4.15 (q, 2H), 7.23-7.36 (m, 5H).
Step 3:
ethyl 1-(piperazin-1-yl)cyclopropanecarboxylate hydrochloride (1:1)
0 (NH H-Cl
H3C.õ...---...,0N j
To a solution of ethyl 1-(4-benzylpiperazin-1-yl)cyclopropanecarboxylate (83
g, 0.288 mol) in
anhydrous dichloromethane (700 mL) 1-chloroethyl carbonochloridate (60.4 g,
0.422 mol) was slowly
added below 0 C. After the addition, the mixture was stirred at 18 C for 1 h.
TLC (PE:Et0Ac = 4:1, Rf =
0.85) showed that the reaction was complete. Then it was concentrated to
dryness. The residue was
dissolved in ethanol (700 mL). It was stirred under reflux for 16 h. TLC
(PE:Et0Ac = 4:1, Rf = 0) showed
the reaction was complete. Then it was concentrated to dryness. The residue
was stirred with
ethanol:methyl-tert-butylether = 5:1 to give ethyl 1-(piperazin-1-
yl)cyclopropanecarboxylate
hydrochloride (1:1) (62 g, 92%) as a white solid.
1H-NMR (400MHz, methanol-d4): 6 [ppm] = 1.27 (t, 3H), 1.50-1.65 (m, 4H), 3.50
(mc, 4H), 3.65-3.85
(m, 4H), 4.21 (q, 2H).
Step 4:
ethyl 1-(4-methylpiperazin-1-yl)cyclopropanecarboxylate
0 r. CH3
N
H 3C..........õØ,.lt....Nj
To a solution of ethyl 1-(piperazin-1-yl)cyclopropanecarboxylate hydrochloride
(25 g, 0.107 mol) in
water (250 mL) was added solid sodium hydrogen carbonate (10 g, 0.119 mol) so
that a pH of 7-8 was
reached. Then formaldehyde (13.5 g, 0.166 mol, 37% in water) and sodium
cyanoborohydride (17.3
g, 0.275 mol) were added below 10 C. The mixture was stirred 18 h at 18 C.
TLC (PE:Et0Ac = 1:1, Rf
= 0.1) showed that most of the starting material was consumed. Then it was
extracted with DCM (50
mL x 3). The combined organic phases were concentrated to dryness. The residue
was purified by
chromatography on silica gel (PE:Et0Ac = 3:1 to dichloromwthane:methanol =
15:1) to give ethyl 1-
(4-methylpiperazin-1-yl)cyclopropanecarboxylate (12 g, 53%).
1H-NMR (400MHz, methanol-d4): 6 [ppm] = 0.98-1.04 (m, 2H), 1.24 (t, 3H), 1.26-
1.31 (m, 2H), 2.70 (s,
3H), 2.97 (mc, 4H), 3.20 (mc, 4H), 4.11 (q, 2H).
Step 5:
1-(4-methylpiperazin-1-yl)cyclopropanecarboxylic acid hydrochloride (1:1)
130

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0 r-NCH3
HO)cNJ
H-CI
To a round bottom flask containing ethyl 1-(4-methylpiperazin-1-
yl)cyclopropanecarboxylate (14 g,
65.9 mmol) was added aqueous hydrochloric acid (6M, 100 mL) slowly below 20
C. After the
addition, the mixture was stirred at 100-140 C for 24 h. TLC
(dichloromethane:methanol = 8:1,
Rf=0.0) showed that the reaction was complete. Then the reaction mixture was
concentrated to
dryness. The residue was stirred in ethanol and the solid was filtered off to
give 1-(4-
methylpiperazin-1-yl)cyclopropanecarboxylic acid hydrochloride (1:1) (6.4 g,
44%) as a white solid.
'H-NMR (400MHz, water-d2): 6 [ppm] = 1.27-1.37 (m, 2H), 1.45-1.56 (m, 2H),
2.88 (d, 3H), 3.08-3.23
(m, 2H), 3.45-3.53 (m, 2H), 3.55-3.68 (m, 2H), 3.72-3.87 (m, 2H).
ELSD: M/Z= 211.1 (M+1-1+).
Intermediate 43
1-(4-cyclopropylpiperazin-1-yl)cyclopropanecarboxylic acid hydrochloride (1:1)
rI\
0 N
H0).cNJ
H-CI
Step 1:
ethyl 1-(4-cyclopropylpiperazin-1-yl)cyclopropanecarboxylate
r'I\
0 N
H3
C 0
To a solution of ethyl 1-(piperazin-1-yl)cyclopropanecarboxylate hydrochloride
(12.8 g, 54.5 mmol) in
a mixture of anhydrous THE (68 mL) and methanol (68 mL) (1-
ethoxycyclopropoxy)trimethylsilane
(21.9 ml, 108.9 mmol) and acetic acid (10 mL) were added. Then sodium
cyanoborohydride (5.14 g,
81.8 mmol) was added in portions. After the addition, the mixture was stirred
at 60 C for 16 h. TLC
(dichloromethane:methanol = 4:1, Rf = 0.9) showed that the reaction was
complete. It was cooled to
18 C and quenched with water (5 mL). It was concentrated to dryness and the
residue was
partitioned between dichloromethane (100 mL) and aqueous saturated sodium
hydrogen carbonate
(20 mL). The layers were separated and the aqueous layer was extracted with
dichloromethane (100
mL). The combined organic layers were washed with water (15 mL) and
concentrated to dryness. The
131

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
residue was purified by column chromatography on silica gel (PE:Et0Ac = 20:1
to 8:1) to give ethyl 1-
(4-cyclopropylpiperazin-1-yl)cyclopropanecarboxylate (12 g, 92%) as a light
yellow oil.
'H-NMR (400MHz, methanol-d4): 6 [ppm] = 0.40-0.45 (m, 4H), 0.91-0.97 (m, 2H),
1.19-1.28 (m, 5H),
1.58-1.66 (m, 1H), 2.40-2.70 (m, 4H), 2.87-3.09 (m, 4H), 4.10 (q, 2H).
Step 2:
1-(4-cyclopropylpiperazin-1-yl)cyclopropanecarboxylic acid hydrochloride (1:1)
rI\
0 N
HO)cNJ
H-Cl
To a rond bottom flask containing ethyl 1-(piperazin-1-
yl)cyclopropanecarboxylate (12 g, 50.4 mmol)
was added aqueous hydrochloric acid (6M, 100 mL) below 0 C. After the
addition, the mixture was
stirred at 100 C for 16h. TLC (dichloromethane:methanol = 10:1, Rf=0.4)
showed that the reaction
was complete. Then the reaction mixture was concentrated under reduced
pressure and the residue
was stirred in ethanol (40 mL). The solid was filtered off to give 1-(4-
cyclopropylpiperazin-1-
yl)cyclopropanecarboxylic acid hydrochloride (1:1) (10.2 g, 82%) as a white
solid.
'H-NMR (400MHz, water-d2): 6 [ppm] = 0.87-0.98 (m, 4H), 1.25-1.33 (m, 2H),
1.45-1.53 (m, 2H), 2.77-
2.85 (m, 1H), 3.28-3.78 (m, 8H).
ELSD: M/Z= 211.1 (M+1-1+).
Intermediate 44
1-(morpholin-4-yl)cyclopropanecarboxylic acid hydrochloride (1:1)
0 r'0
HO)cN)
H-Cl
The title compound is known from W02010/136778.
Intermediate 45
3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-4-(trifluoromethoxy)benzoic
acid
132

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
HO 0
40:1 j=cNO)
N
H ____________________________________________
FO
FI
F
1.88 g (9.04 mmol, 2 equiv) of the compound of intermediate 44 were stirred in
10 mL of
dichloromethane at room temperature. 0.7 mL (9.04 mmol, 2 equiv) of DMF and
0.79 mL (9.04
mmol, 2 equiv) of oxalyl chloride were added and the mixture was stirred for
additional 0.5 h at room
temperature. 2.49 mL (22.6 mmol, 5 equiv) of 4-methylmorpholine and 1.00 g
(4.52 mmol) of 3-
amino-4-(trifluoromethoxy)benzoic acid (known from W02007/31791) were added
and the mixture
was stirred for additional 36 h at room temperature. The reaction mixture was
poured into water,
acidified with a 1M aqueous solution of hydrogen chloride and extracted with
dichloromethane. The
combined organic phases were dried (Na2SO4 anh), and concentrated under
reduced pressure.
Purification by HPLC (column: chromatorex C18, 10um, 195x51mm, mobile phase:
acetonitrile/water
+0.1% formic acid gradient) yielded 186 mg (11% of theory) of the title
compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.10 - 1.17 (m, 2H), 1.23 - 1.31 (m,
2H), 2.41 - 2.48 (m, 4H),
3.63 - 3.73 (m, 4H), 7.58 (dd, 1H), 7.76 (dd, 1H), 8.97 (d, 1H), 10.54 (s,
1H), 13.28 (s, 1H).
LC-MS (Method 1): Rt = 1.12 min; MS (ESIpos): rn/z = 375 [m+H].
Intermediate 46
3-amino-4-(difluoromethoxy)-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
N 0
NINY
\ S
. 1 NH2
FO
I
F
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 2.00 g (9.85 mmol) of 3-amino-4-(difluoromethoxy)benzoic acid
and 2.62 g (14.8 mmol,
1.5 equiv) of 5-phenyl-1,3,4-thiadiazol-2-amine. 2.78 g (78% of theory) of the
title compound were
obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 5.42 (s, 2H), 7.13 (d, 1H), 7.21 (t,
1H), 7.39 (dd, 1H), 7.48 (d,
1H), 7.51 - 7.60 (m, 3H), 7.93 - 8.03 (m, 2H), 13.00 (s, 1H).
133

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 4): Rt = 1.14 min; MS (ESIpos): rniz = 363 [m+H].
Intermediate 47
3-[(chloroacetypamino]-4-(difluoromethoxy)-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)benzamide
H
NN 0
i
N
\y S
0 L
.CI
N
H
FO
I
F
The title compound was prepared in a manner analogous to that described in
intermediate 41
starting from 1.00 g (2.76 mmol) of the compound of intermediate 46. 723 mg
(60% of theory) of the
title compound were obtained.
11-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 4.43 (s, 2H), 7.38 (t, 1H), 7.45 (d,
1H), 7.52 - 7.60 (m, 3H),
7.95 - 8.02 (m, 2H), 8.06 (dd, 1H), 8.71 (d, 1H), 9.99 (s, 1H), 13.24 (s, 1H).
LC-MS (Method 4): Rt = 1.19 min; MS (ESIpos): rniz = 439 [m+H].
Intermediate 48
3-[(2-chloropropanoyl)amino]-4-(difluoromethoxy)-N-(5-phenyl-1,3,4-thiadiazol-
2-yObenzamide
H
NN 0
i
N
\yS
. 40:1
N
H
FO CH3
I
F
The title compound was prepared in a manner analogous to that described in
intermediate 41
starting from 1.00 g (2.76 mmol) of the compound of intermediate 46 and 526 mg
(4.14 mmol, 1.5
equiv) of 2-chloropropanoyl chloride. 1.08 g (86% of theory) of the title
compound were obtained.
11-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.65 (d, 3H), 4.95 (q, 1H), 7.36 (t,
1H), 7.45 (d, 1H), 7.52 -
7.59 (m, 3H), 7.95 - 8.02 (m, 2H), 8.06 (dd, 1H), 8.66 (d, 1H), 10.02 (s, 1H),
13.25 (s, 1H).
134

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 4): Rt = 1.26 min; MS (ESIpos): rniz = 453 [m+H].
Intermediate 49
4-(methoxymethyl)-3-nitrobenzoic acid
HO 0
0 NO2
H3C
0
To a solution of 10.0 g (38.5 mmol) of 4-(bromomethyl)-3-nitrobenzoic acid in
200 mL of methanol
were added 231 mL (115 mmol, 3 equiv) of a 0.5M solution of sodium methanolate
in methanol. The
resulting mixture was stirred at 60 C for 1 h. After cooling to room
temperature, the reaction
mixture was poured into water and the organic solvents were evaporated under
reduced pressure. A
1N aqueous hydrogen chloride solution was then added until an acidic pH was
achieved. After stirring
for 5 minutes, the precipitate was filtered off, washed with water and dried.
5.96 g (73% of theory) of
the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.39 (s, 3H), 4.82 (s, 2H), 7.87 (d,
1H), 8.26 (dd, 1H), 8.48 (d,
1H).
LC-MS (Method 4): Rt = 0.87 min; MS (ESIneg): m/z = 210 [M¨H]-.
Intermediate 50
4-(methoxymethyl)-3-nitro-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
H
NN 0
/ --:.-zr
N
\ S 0
441 NO2
H3C
0
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 5.80 g (27.5 mmol, 2 equiv) of the compound of intermediate 49
and 2.43 g (13.7
mmol) of 5-phenyl-1,3,4-thiadiazol-2-amine. 5.20 g (95% of theory) of the
title compound were
obtained.
135

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.41 (s, 3H), 4.85 (s, 2H), 7.53 -
7.57 (m, 3H), 7.92 (d, 1H),
7.96 - 8.01 (m, 2H), 8.48 (dd, 1H), 8.83 (d, 1H), 13.53 (s, 1H).
LC-MS (Method 4): Rt = 1.25 min; MS (ESIpos): m/z = 371 [M+H].
Intermediate 51
3-amino-4-(methoxymethyl)-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
H
NN 0
/ -----zr
N
\ s
it 10 NH2
H3Co
5.20 g (14.0 mmol) of the compound from intermediate 50 were provided in a
mixture of 60 mL of
ethanol and 90 mL of THE. 0.80 g of palladium on charcoal (10% Pd, 50% water)
were added, and the
mixture was stirred under a hydrogen atmosphere at room temperature for 0.5 h.
0.80 g of
palladium on charcoal (10% Pd, 50% water) were added, and the mixture was
stirred under a
hydrogen atmosphere at room temperature for 1 h. A mixture of 300 mL of
ethanol and 450 mL of
THE and 2.00 g of palladium on charcoal (10% Pd, 50% water) were added, and
the mixture was
stirred under a hydrogen atmosphere at room temperature for 5.5 h. After
filtration, the solvents
were evaporated. 4.80 g (90% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.31 (s, 3H), 4.39 (s, 2H), 5.25 (s,
2H), 7.22 (d, 1H), 7.32 -
7.37 (m, 2H), 7.52 - 7.58 (m, 3H), 7.95 - 8.00 (m, 2H), 12.92 (s, 1H).
LC-MS (Method 4): Rt = 1.08 min; MS (ESIpos): m/z = 341 [M+H].
Intermediate 52
3-[(chloroacetypamino]-4-(methoxymethyl)-N-(5-phenyl-1,3,4-thiadiazol-2-
yl)benzamide
H
N N 0
/
N
\y s
it 10 )UC I
N
H
H3C
0
136

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The title compound was prepared in a manner analogous to that described in
intermediate 41
starting from 2.00 g (5.88 mmol) of the compound of intermediate 51. 2.30 g
(94% of theory) of the
title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 3.37 (s, 3H), 4.40 (s, 2H), 4.52 (s,
2H), 7.52 - 7.62 (m, 4H),
7.95 - 8.05 (m, 3H), 8.35 (s, 1H), 9.90 (s, 1H), 13.23 (s, 1H).
LC-MS (Method 4): Rt = 1.17 min; MS (ESIpos): m/z = 417 [M+H].
Intermediate 53
4-[(methylsulfonyl)methyl]-3-nitrobenzoic acid
HO 0
1001 NO2
H C
3 ,-
J
I/ \\
0 0
To a solution of 10.0 g (38.5 mmol) of 4-(bromomethyl)-3-nitrobenzoic acid in
100 mL of DMF were
added 19.6 g (192 mmol, 5 equiv) of sodium methanesulfinate. The resulting
mixture was stirred at
60 C for 1 h. After cooling to room temperature and concentration, water and
a 1N aqueous
hydrogen chloride solution were added until an acidic pH was achieved. The
resulting mixture was
extracted with ethyl acetate and the combined organic phases were dried
(Na2504 anh) and
concentrated under reduced pressure. The remaining solids were then triturated
with 100 mL of
ethanol, and the resulting mixture was stirred for 30 minutes. The remaining
solids were removed by
filtration, washed with ethanol, and were dried under reduced pressure. The
remaining solids were
then triturated with 200 mL of ethanol, and the resulting mixture was stirred
for 1 h. The remaining
solids were removed by filtration, washed with ethanol, and were dried under
reduced pressure to
give 7.72 g of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 3.03 (s, 3H), 5.07 (s, 2H), 7.82 (d,
1H), 8.28 (dd, 1H), 8.47 (d,
1H), 13.75 (s, 1H).
LC-MS (Method 4): Rt = 0.61 min; MS (ESIneg): m/z = 258 [M¨H]-.
Intermediate 54
4-[(methylsulfonyl)methyl]-3-nitro-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
137

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N N 0
/ -::-1/
N
\ S
NO2
Id30
S
I/ \\
00
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 5.00 g (15.4 mmol) of the compound of intermediate 53 and 3.56 g
(20.1 mmol, 1.3
equiv) of 5-phenyl-1,3,4-thiadiazol-2-amine. 4.86 g (75% of theory) of the
title compound were
obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.06 (s, 3H), 5.10 (s, 2H), 7.53 -
7.59 (m, 3H), 7.88 (d, 1H),
7.96 - 8.03 (m, 2H), 8.48 (dd, 1H), 8.82 (d, 1H), 13.63 (s, 1H).
LC-MS (Method 4): Rt = 1.08 min; MS (ESIpos): m/z = 419 [M+H].
Intermediate 55
3-amino-4-[(methylsulfonyl)methyl]-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
H
N N 0
/ '-:,-1/
N
\ S
lit i NH2
Id30
S
I/ \\
00
The title compound was prepared in a manner analogous to that described in
intermediate 51
starting from 4.83 g (11.5 mmol) of the compound of intermediate 54. Warm DMF
was used to
extract the title compound from the catalyst. The organic solvents were
evaporated under reduced
pressure and the remaining solids were triturated with 50 mL of ethanol. The
resulting mixture was
stirred for 0.5 h. The remaining solids were removed by filtration, washed
with ethanol, and were
dried under reduced pressure to give 3.56 g of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.95 (s, 3H), 4.51 (s, 2H), 5.57 (s,
2H), 7.27 (d, 1H), 7.35 -
7.43 (m, 2H), 7.51 - 7.59 (m, 3H), 7.93 - 8.02 (m, 2H), 13.00 (s, 1H).
LC-MS (Method 4): Rt = 0.97 min; MS (ESIpos): m/z = 389 [M+H].
138

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Intermediate 56
2-nitro-N4-(5-phenyl-1,3,4-thiadiazol-2-ypterephthalamide
H
NN 0
/ --:.;.-1
N
\S
I¨' 0 NO2
0 NH2
To a solution of 4-carbamoy1-3-nitrobenzoic acid (5.00 g, 23.8 mmol) in 30.0
mL of DMF were added
5-phenyl-1,3,4-thiadiazol-2-amine (5.06 8, 28.6 mmol),
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP, 14.9 g, 28.6 mmol)
followed by N,N-
diisopropylethylamine (12.4 mL, 71.4 mmol). The reaction mixture was stirred
at room temperature
overnight. The mixture was diluted with 150 mL of water. The resulting
precipitate was collected by
filtration and washed with water. The filtrate was suspended in 100 mL of
methanol and stirred for
30 min at 50 C. After filtration, the solid was washed with methanol and
dried to yield the desired
amide 56 (3.08 g, 7.92 mmol, 27%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 7.52 - 7.60 (m, 3 H), 7.79 - 7.90 (m,
2 H), 7.99 (dd, 2 H), 8.29
(s, 1 H), 8.45 (dd, 1 H), 8.75 (d, 1 H), 13.70 (br. s, 1 H).
LC-MS (Method 4): Rt = 0.95 min; MS (ESIpos): m/z = 370 [M+H].
Intermediate 57
2-amino-N4-(5-phenyl-1,3,4-thiadiazol-2-ypterephthalamide
H
NN 0
/
N
\y S
. 0 NH2
0 NH2
To a solution of intermediate 56 (3.50 g, 9.48 mmol) in 50.0 mL of 1-methyl-2-
pyrrolidon (NMP) were
added 10% palladium on carbon (605 mg, 10% Pd) and 10.0 mL methanol. The
resulting slurry was
stirred overnight at 60 C under a hydrogen atmosphere. Additionally 300 mg of
the catalyst and 5.0
mL of NMP were added to the mixture and it was stirred at 60 C under a
hydrogen atmosphere for 2
h. After addition of further 115 mg of the catalyst, the reaction mixture was
stirred at 60 C under a
hydrogen atmosphere until complete consumption of the starting material was
observed (2 days).
The mixture was diluted with 50.0 mL of DMF and stirred for 10 min at 60 C.
The resulting
139

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
suspension was filtered over a pad of celite, the DMF of the filtrate was
evaporated. Water (100 mL)
was added to the concentrated filtrate and the resulting precipitate was
collected by filtration and
washed with water; afterwards the precipitate was suspended in methanol (50.0
mL) and stirred
under reflux. After cooling to room temperature the suspension was filtrated,
the resulting solid was
washed with methanol. After drying the desired aniline derivative 57 (3.00 g,
8.57 mmol, 91%) was
obtained and used without any further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 6.76 - 6.85 (m, 2 H), 7.20 - 7.32 (m,
2 H), 7.35 - 7.43 (m, 1 H),
7.54 (d, 3 H), 7.66 - 7.70 (m, 1 H), 7.88 - 8.03 (m, 3 H), 12.88 - 13.33 (m, 1
H).
LC-MS (Method 1): Rt = 0.94 min; MS (ESIpos): rniz = 340 [m+H].
Intermediate 58
3-[(2-chloropropanoyDamino]-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
H
NN 0
/
N
\yS
= 1401 )UCI
N
H
FO
Fl
F
A solution of intermediate 40 (500 mg, 1.31 mmol) and 2-chloropropionyl
chloride (263 uL,
2.63mmol) in 6.6 mL of toluene was stirred for 4 h at 100 C and overnight at
room temperature. The
reaction mixture was taken to dryness to provide the crude desired product
(620 mg, 1.31 mmol,
quant.) which was used without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.65 (d, 3H), 4.91 (d, 1H), 7.60 -
7.50 (m, 3H), 7.65 (dd, 1H),
8.03 - 7.93 (m, 2H), 8.10 (dd, 1H), 8.62 (d, 1H), 10.31 (s, 1H), 13.55 - 13.26
(m, 1H).
LC-MS (Method 1): Rt = 1.33 min; MS (ESIpos): rniz = 471 [m+H].
Intermediate 59
3-nitro-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-(trifluoromethypbenzamide
140

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN 0
/ --::::r
N
\ S
= 0 NO2
F F
F
To a solution of 3-nitro-4-(trifluoromethyl)benzoic acid (10.0 g, 42.5 mmol)
and 5-phenyl-1,3,4-
thiadiazol-2-amine (10.6 g, 59.5 mmol) in 163 mL of DMF were added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP, 33.2 g, 63.8 mmol)
and N,N-
diisopropylethylamine (22.2 mL, 128 mmol). The mixture was stirred overnight
at room temperature
and poured into water. The resulting precipitate was collected by filtration,
washed with water and
dried at 60 C in vacuum to provide the crude desired product (13.2 g, 76%
pure, 60%), which was
used without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 7.40 - 7.34 (m, 1H), 7.50-7.41 (m,
1H), 7.59 - 7.51 (m, 2H),
7.78 - 7.71 (m, 1H), 8.03 - 7.97 (m, 1H), 8.29 - 8.22 (m, 1H), 8.62 - 8.53 (m,
1H), 8.84 - 8.78 (m, 1H).
LC-MS (Method 4): Rt = 1.34 min; MS (ESIpos): m/z = 395 [M+H].
Intermediate 60
3-amino-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-(trifluoromethyl)benzamide
H
NN 0
/
N
\y S
. 0
NH2
F F
F
To a solution of intermediate 59 (11.7 g, 22.6 mmol) in 169 mL of
tetrahydrofuran was added a 15%
solution of titanium(III) chloride in 10% hydrogen chloride dropwise (225 mL,
265 mmol) at 0 C. The
reaction mixture was allowed to warm up to room temperature and was stirred
overnight. The pH of
the mixture was adjusted under stirring with solid sodium bicarbonate to 7.
The suspension was
saturated with solid sodium chloride and stirred with 1 L of
tetrahydrofuran/ethyl acetate (1:1) for 2
h. The layers were separated and the organic layer was washed with brine,
dried over magnesium
sulfate and concentrated in vacuum. The residue was suspended in ethanol and
stirred at 40 C until
a fine suspension was obtained. The precipitate was collected by filtration
and dried to yield the
desired product 60 (6.59 g, 17.4 mmol, 77%).
141

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 5.93 (s, 2H), 8.03 - 7.95 (m, 2H),
7.59 - 7.47 (m, 5H), 7.33 (d,
1H), 13.30 - 13.02 (m, 1H).
LC-MS (Method 4): Rt = 1.23 min; MS (ESIpos): m/z = 365 [M+H].
Intermediate 61
3-[(chloroacetypamino]-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethypbenzamide
H
NN 0
/
N
\y S
. I. LCI
N
H
F F
F
A solution of intermediate 60 (2.00 g, 5.49 mmol) and chloroacetyl chloride
(892 uL, 10.98 mmol) in
27.5 mL of toluene was stirred for 4 h at 100 C. Two equivalents of
chloroacetyl chloride were added
to the mixture and it was stirred at 100 C until the starting material was
consumed (16 h). The
reaction mixture was concentrated to provide the desired compound 61 (2.37 g,
5.11 mmol, 93%) as
crude product which was used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 4.38 (s, 2H), 7.61 - 7.50 (m, 3H),
8.04 - 7.93 (m, 3H), 8.31 -
8.19 (m, 2H), 10.14 (s, 1H), 13.73 - 13.28 (m, 1H).
LC-MS (Method 4): Rt = 1.18 min; MS (ESIpos): m/z = 441 [M+H].
Intermediate 62
6-chloro-N-[3-nitro-4-(trifluoromethoxy)phenyl]nicotinamide
0
I
N 110
Cl
NO2
FO
F I
F
5.00 g (22.5 mmol) of 3-nitro-4-(trifluoromethoxy)aniline and 4.7 mL (33.8
mmol) of triethylamine in
250 mL of THE were stirred at room temperature. 4.36 g (24.8 mmol) of 6-
chloronicotinoyl chloride
142

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
were added and the mixture was stirred at room temperature over night. The
mixture was poured
into water and extracted with ethyl acetate. The combined organic phases were
washed with a
saturated, aqueous NH4CI solution and with a saturated, aqueous NaHCO3
solution, was dried
(Na2SO4 anh), and concentrated under reduced pressure. 7.99 g (96% of theory)
of the title
compound were obtained, which were used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 7.74 - 7.81 (m, 2H), 8.17 (dd, 1H),
8.38 (dd, 1H), 8.65 (d, 1H),
8.98 (d, 1H), 11.02 (s, 1H).
LC-MS (Method 1): Rt = 1.25 min; MS (ESIpos): m/z = 362 [M+H].
Intermediate 63
6-(3,5-difluoropheny1)-N43-nitro-4-(trifluoromethoxy)phenyl]nicotinamide
0
NH
F, IN/ 40
NO2
F FO
F I
F
To a pressure vessel were added 4.00 g (10.8 mmol) of the compound of
intermediate 62, 2.56 g
(16.2 mmol, 1.5 equiv) of (3,5-difluorophenyl)boronic acid, 2.99 g (21.7 mmol,
2.0 equiv) of
potassium carbonate and a DME / water mixture (3:1, 100 mL). The resulting
suspension was purged
with argon, treated with 442 mg (0.54 mmol, 5.0 mol%) of [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)C12=CH2C12), and
sealed. The resulting mixture was heated at 90 C over night, was then cooled
to room temperature.
The reaction mixture was poured onto ice water, and extracted with ethyl
acetate. The combined
organic phases were washed with a saturated NaCI solution, dried (Na2504 anh),
and concentrated
under reduced pressure. 4.99 g (94% of theory) of the title compound were
obtained, which were
used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 7.36 - 7.44 (m, 1H), 7.79 (dd, 1H),
7.89 - 7.98 (m, 2H), 8.21
(dd, 1H), 8.31 (d, 1H), 8.47 (dd, 1H), 8.70 (d, 1H), 9.23 (d, 1H), 11.03 (s,
1H).
LC-MS (Method 1): Rt = 1.44 min; MS (ESIpos): m/z = 440 [M+H].
Intermediate 64
N43-amino-4-(trifluoromethoxy)pheny1]-6-(3,5-difluorophenyl)nicotinamide
143

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
NH
F
I
I.
110 NH2
F F 0
F>r
F
To a solution of the compound of intermediate 63 (4.99 g, 10.2 mmol) in 170 mL
of tetrahydrofuran
was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride
dropwise (87 mL, 102
mmol, 10 equiv) at 0 C. The reaction mixture was allowed to warm up to room
temperature and was
stirred overnight. The pH of the mixture was adjusted under stirring with
solid sodium bicarbonate to
7. The suspension was saturated with solid sodium chloride and stirred with
200 mL of a mixture of
tetrahydrofuran/ethyl acetate for 2 h. The suspension was filtered and the
filtrate was washed with
brine, dried over sodium sulfate and concentrated under reduced pressure. 4.20
g (100% of theory)
of the title compound were obtained, which were used without further
purification.
LC-MS (Method 1): Rt = 1.30 min; MS (ESIpos): m/z = 410 [M+H].
Intermediate 65
N43-nitro-4-(trifluoromethoxy)pheny1]-6-phenylnicotinamide
0
NH
I
I. N
101
NO2
F 0
F>r
F
To a pressure vessel were added 3.26 g (8.74 mmol) of the compound of
intermediate 62, 1.60 g
(13.1 mmol, 1.5 equiv) of phenylboronic acid, 2.42 g (17.5 mmol, 2.0 equiv) of
potassium carbonate
and a DME / water mixture (3:1, 100 mL). The resulting suspension was purged
with argon, treated
with 357 mg (0.44 mmol, 5.0 mol%) of [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride
CH2Cl2 complex (Pd(dppf)C12=CH2C12), and sealed. The resulting mixture was
heated at 90 C over
night, was then cooled to room temperature. The reaction mixture was poured
onto ice water, and
extracted with ethyl acetate. The combined organic phases were washed with a
saturated NaCI
solution, dried (Na2504 anh), and concentrated under reduced pressure. The
residue was purified
144

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
using MPLC (Biotage !solera; silica gel; hexane / Et0Ac gradient). 3.17 g (90%
of theory) of the title
compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 7.47 - 7.61 (m, 3H), 7.74 - 7.84 (m,
1H), 8.15 - 8.27 (m, 4H),
8.43 (dd, 1H), 8.71 (d, 1H), 9.23 (d, 1H), 11.01 (s, 1H).
LC-MS (Method 1): Rt = 1.37 min; MS (ESIpos): m/z = 404 [M+H].
Intermediate 66
N43-amino-4-(trifluoromethoxy)pheny1]-6-phenylnicotinamide
0
NH
I
0 10
NH2
FO
F I
F
To a solution of the compound of intermediate 65 (2.35 g, 5.83 mmol) in 200 mL
of tetrahydrofuran
was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride
dropwise (50 mL, 58.3
mmol, 10 equiv) at 0 C. The reaction mixture was allowed to warm up to room
temperature and was
stirred overnight. The pH of the mixture was adjusted under stirring with
solid sodium bicarbonate to
7. The suspension was saturated with solid sodium chloride and stirred with
200 mL of a mixture of
tetrahydrofuran/ethyl acetate for 2 h. The suspension was filtered and the
filtrate was washed with
brine, dried over sodium sulfate and concentrated under reduced pressure. 2.07
g (95% of theory) of
the title compound were obtained, which were used without further
purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 5.44 (s, 2H), 6.94 (dd, 1H), 7.08 (dd,
1H), 7.38 (d, 1H), 7.47 -
7.59 (m, 3H), 8.11 - 8.22 (m, 3H), 8.36 (dd, 1H), 9.16 (d, 1H), 10.32 (s, 1H).
LC-MS (Method 1): Rt = 1.23 min; MS (ESIpos): m/z = 374 [M+H].
Intermediate 67
6-chloro-N-(4-methoxy-3-nitrophenyl)nicotinamide
145

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
).'NH
I
Cl/\N% I.
NO2
0
H3C
15.0g (89.2 mmol) of 4-methoxy-3-nitroaniline, 77.7 mL (446 mmol, 5 equiv) of
N,N-
diisopropylethyla mine and 28.1 g (178 mmol, 2 equiv) of 6-chloronicotinic
acid were provided in 300
mL of DMF at room temperature. 104 mL (178 mmol, 2 equiv) of a 50% solution of
2,4,6-tripropyl-
1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide (T3P) in DMF were added, and
the mixture was stirred
for 16 h at room temperature. The resulting mixture was concentrated to half
of the original volume,
poured onto water, and stirred for 15 minutes. The precipitate was filtered
off, washed with water
and dried. 34.1 g of the title compound were obtained, which were used without
further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 3.92 (s, 3H), 7.39 (d, 1H), 7.65 -
7.75 (m, 1H), 7.97 (dd, 1H),
8.31 - 8.43 (m, 2H), 8.97 (d, 1H), 10.81 (s, 1H).
LC-MS (Method 1): Rt = 1.02 min; MS (ESIpos): m/z = 308 [M+H].
Intermediate 68
6-(2-fluorophenyI)-N-(4-methoxy-3-nitrophenyl)nicotinamide
0
F
NH
I
I. N 40
NO2
0
H3C
To a pressure vessel were added 11.0 g (35.8 mmol) of the compound of
intermediate 67, 7.50 g
(53.6 mmol, 1.5 equiv) of (2-fluorophenyl)boronic acid, 9.88 g (71.5 mmol, 2.0
equiv) of potassium
carbonate and a DME / water mixture (3:1, 400 mL). The resulting suspension
was purged with
argon, treated with 1.46 g (1.79 mmol, 5.0 mol%) of [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)C12=CH2C12), and
sealed. The resulting mixture was heated at 90 C over night, was then cooled
to room temperature.
The reaction mixture was poured onto ice water, and extracted with ethyl
acetate. The combined
organic phases were washed with a saturated NaCI solution, dried (Na2504 anh),
and concentrated
146

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
under reduced pressure. 3.82 g (29% of theory) of the title compound were
obtained, which were
used without further purification.
LC-MS (Method 1): Rt = 1.19 min; MS (ESIpos): m/z = 368 [M+H].
Intermediate 69
N-(3-amino-4-methoxypheny1)-6-(2-fluorophenypnicotinamide
0
F \
NH
I
0 10
NH2
0
H3C
To a solution of the compound of intermediate 68 (3.82 g, 10.4 mmol) in 300 mL
of tetrahydrofuran
was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride
dropwise (88 mL, 104
mmol, 10 equiv) at 0 C. The reaction mixture was allowed to warm up to room
temperature and was
stirred for 3 days. The pH of the mixture was adjusted under stirring with
solid sodium bicarbonate to
7. The suspension was saturated with solid sodium chloride and stirred with
300 mL of a mixture of
tetrahydrofuran/ethyl acetate for 2 h. The suspension was filtered and the
filtrate was washed with
brine, dried over sodium sulfate and concentrated under reduced pressure. The
residue was purified
using MPLC (Biotage !solera; silica gel; hexane / Et0Ac gradient). 0.6 g (17%
of theory) of the title
compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 3.75 (s, 3H), 4.82 (s, 2H), 6.76 (d,
1H), 6.92 (dd, 1H), 7.14 (d,
1H), 7.34 - 7.43 (m, 2H), 7.49 - 7.60 (m, 1H), 7.90 - 8.04 (m, 2H), 8.37 (dd,
1H), 9.19 (d, 1H), 10.15 (s,
1H).
LC-MS (Method 1): Rt = 0.99 min; MS (ESIpos): m/z = 338 [M+H].
Intermediate 70
3-amino-N-[6-(3-fluorophenyl)pyridin-3-yI]-4-(trifluoromethoxy)benzamide
147

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
I
F 0Ni 0
NH2
F 0
F>r
F
To a pressure vessel were added 2.95 g (8.89 mmol) of the compound of
intermediate 9, 1.87 g (13.3
mmol, 1.5 equiv) of (3-fluorophenyl)boronic acid, 2.46 g (17.8 mmol, 2.0
equiv) of potassium
carbonate and a DME / water mixture (3:1, 100 mL). The resulting suspension
was purged with
argon, treated with 363 mg (0.45 mmol, 5.0 mol%) of [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)C12=CH2C12), and
sealed. The resulting mixture was heated at 90 C over night, was then cooled
to room temperature.
The reaction mixture was poured onto ice water, and extracted with ethyl
acetate. The combined
organic phases were washed with a saturated NaCI solution, dried (Na2SO4 anh),
and concentrated
under reduced pressure. 3.46 g (99% of theory) of the title compound were
obtained, which were
used without further purification.
LC-MS (Method 1): Rt = 1.25 min; MS (ESIpos): m/z = 392 [M+H].
Intermediate 71
3-[(2-chloropropanoyDamino]-N46-(3-fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
I
F 0 /
N 0
N)CIY
H
F

>

(

0 CH3
F
F
3.46 g (8.84 mmol) of the compound of intermediate 70 were provided in 64 mL
of toluene, 1.72 mL
(17.7 mmol) of 2-chloropropanoyl chloride were added, and the mixture was
stirred for 1.5 h at 100
C. After concentration, 4.13 g of the title compound were obtained, which were
used without
further purification.
LC-MS (Method 1): Rt = 1.34 min; MS (ESIpos): m/z = 482 [M+H].
Intermediate 72
148

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
3-amino-N-[6-(3,5-difluorophenyl)pyridin-3-yI]-4-(trifluoromethoxy)benzamide
H
N 0
I
F 0Ni 0
NH2
F FO
F I
F
To a pressure vessel were added 3.30 g (8.95 mmol) of the compound of
intermediate 9, 2.12 g (13.4
mmol, 1.5 equiv) of (3,5-difluorophenyl)boronic acid, 2.48 g (17.9 mmol, 2.0
equiv) of potassium
carbonate and a DME / water mixture (3:1, 100 mL). The resulting suspension
was purged with
argon, treated with 366 mg (0.45 mmol, 5.0 mol%)
of [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)C12=CH2C12), and
sealed. The resulting mixture was heated at 90 C over night, was then cooled
to room temperature.
The reaction mixture was poured onto ice water, and extracted with ethyl
acetate. The combined
organic phases were washed with a saturated NaCI solution, dried (Na2SO4 anh),
and concentrated
under reduced pressure. The residue was purified using MPLC (Biotage !solera;
silica gel; hexane /
Et0Ac gradient). 3.62 g (92% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 5.69 (s, 2H), 7.15 (dd, 1H), 7.23 -
7.30 (m, 2H), 7.38 (d, 1H),
7.75 - 7.83 (m, 2H), 8.09 (d, 1H), 8.31 (dd, 1H), 9.01 (d, 1H), 10.55 (s, 1H).
LC-MS (Method 4): Rt = 1.32 min; MS (ESIpos): m/z = 410 [M+H].
Intermediate 73
3-[(chloroacetypamino]-N46-(3,5-difluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
I
F 0 / 0
N 0
)-
N CI
H
F FO
FI
F
600 mg (1.36 mmol) of the compound of intermediate 72 were provided in 8 mL of
toluene, 0.22 mL
(2.73 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 2 h at 100 C. After
concentration, 650 mg of the title compound were obtained, which were used
without further
purification.
149

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 1): Rt = 1.34 min; MS (ES1pos): rniz = 486 [m+H].
Intermediate 74
3-nitro-4-(trifluoromethyl)benzoyl chloride
Cl 0
0 NO2
F F
F
5.00 g (21.3 mmol) of 3-nitro-4-(trifluoromethyl)benzoic acid were stirred in
28 mL of
dichloromethane at room temperature. 0.08 mL (1.06 mmol) of DMF and 3.7 mL
(42.5 mmol) of
oxalyl chloride were added, and the mixture was stirred for additional 1.5 h
at 50 C after the gas
formation had stopped. The mixture was left at room temperature over night.
After concentration,
4.58 g of raw material were obtained, which were used without further
purification.
Intermediate 75
N-(6-chloropyridin-3-y1)-3-nitro-4-(trifluoromethyl)benzamide
H
N 0
I
Cl/\ N% 0
NO2
F F
F
1.78 g (13.8 mmol) of 6-chloropyridin-3-amine and 2.6 mL (18.9 mmol, 1.5
equiv) of triethylamine in
150 mL of THE were stirred at room temperature. 3.19 g (12.6 mmol) of the
compound of
intermediate 74 were added and the mixture was stirred at room temperature
over night. The
mixture was poured into water and extracted with ethyl acetate. The combined
organic phases were
washed with a saturated, aqueous NH4C1 solution and with a saturated, aqueous
NaHCO3 solution,
was dried (Na2504 anh), and concentrated under reduced pressure. 4.04 g (88%
of theory) of the title
compound were obtained, which were used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 7.57 (d, 1H), 8.23 - 8.30 (m, 2H),
8.44 - 8.48 (m, 1H), 8.67 -
8.70 (m, 1H), 8.78 (d, 1H), 11.02 (s, 1H).
150

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 1): Rt = 1.21 min; MS (ESIpos): rniz = 346 [m+H].
Intermediate 76
N-[6-(2-fluorophenyl)pyridin-3-y1]-3-nitro-4-(trifluoromethyl)benzamide
H
N 0
F
I
I. N 0
NO2
F F
F
4.04 g (11.1 mmol) of the compound of intermediate 75 were provided in 120 mL
of degassed THE
under an argon atmosphere at room temperature. 2.33 g (16.7 mmol) of (2-
fluorophenyl)boronic
acid, 262 mg (0.33 mmol) of chloro(2-dicyclohexylphosphino-2',4',6'-
triisopropy1-1,r-bipheny1)[2-(2'-
amino-1,1'-biphenyppalladium(11) and 44.4 mL (22.2 mmol) of a 0.5M aqueous,
degassed solution of
potassium phosphate were added, and the mixture was stirred at room
temperature for 16 h. The
mixture was poured into a mixture of water and tert-butyl methyl ether. After
separation of the
phases, the aqueous phase was extracted with tert-butyl methyl ether, and the
combined organic
phases were dried over sodium sulfate and concentrated. 4.49 g (94% of theory)
of the title
compound were obtained, which were used without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 7.29 - 7.39 (m, 2H), 7.43 - 7.53 (m,
1H), 7.87 (dd, 1H), 7.97
(td, 1H), 8.25 - 8.36 (m, 2H), 8.49 (d, 1H), 8.72 (s, 1H), 9.07 (d, 1H), 11.02
(s, 1H).
LC-MS (Method 4): Rt = 1.35 min; MS (ESIpos): rniz = 406 [m+H].
Intermediate 77
3-amino-N-[6-(2-fluorophenyl)pyridin-3-y1]-4-(trifluoromethyl)benzamide
H
N 0
F
I
0 0
NH2
F F
F
To a solution of the compound of intermediate 76 (4.49 g, 10.4 mmol) in 100 mL
of tetrahydrofuran
was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride
dropwise (71 mL, 83.3
151

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
mmol, 8 equiv) at 0 C. The reaction mixture was allowed to warm up to room
temperature and was
stirred for 16 hours. A 15% solution of titanium(III) chloride in 10% hydrogen
chloride was added
dropwise (71 mL, 83.3 mmol, 8 equiv) and the reaction mixture was stirred for
16 hours. The pH of
the mixture was adjusted under stirring with solid sodium bicarbonate to 7.
The suspension was
saturated with solid sodium chloride and stirred with 300 mL of a mixture of
tetrahydrofuran/ethyl
acetate for 2 h. The suspension was filtered and the filtrate was washed with
brine, dried over
sodium sulfate and concentrated under reduced pressure. The residue was
purified using MPLC
(Biotage !solera; silica gel; hexane / Et0Ac gradient). 3.40 g (87% of theory)
of the title compound
were obtained.
LC-MS (Method 4): Rt = 1.22 min; MS (ESIpos): m/z = 376 [M+H].
Intermediate 78
3-[(chloroacetypamino]-N46-(2-fluorophenyl)pyridin-3-y1]-4-
(trifluoromethyl)benzamide
H
N 0
F
I
0 N 0 0
N
H
F F
F
1.00 g (2.66 mmol) of the compound of intermediate 77 was provided in 20 mL of
toluene, 0.42 mL
(5.33 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 1.5 h at 100 C.
After concentration, 1.10 g of the title compound were obtained, which were
used without further
purification.
LC-MS (Method 1): Rt = 1.22 min; MS (ESIpos): m/z = 452 [M+H].
Intermediate 79
N446-(2-fluorophenyl)pyridin-3-y1]-2-nitroterephthalamide
H
N 0
F
I
I. 40
NO2
H2N 0
152

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1.79 g (9.52 mmol, 2 equiv) of 6-(2-fluorophenyl)pyridin-3-amine, 4.1 mL (23.8
mmol, 5 equiv) of
N,N-diisopropylethylamine and 1.00 g (4.76 mmol) of 4-carbamoy1-3-nitrobenzoic
acid were provided
in 25 mL of DMF at room temperature. 5.6 mL (9.52 mmol, 2 equiv) of a 50%
solution of 2,4,6-
tripropy1-1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide (T3P) in DMF were
added, and the mixture
was stirred for 16 h at room temperature. The resulting mixture was
concentrated and water and
saturated, aqueous sodium bicarbonate solution were added. The precipitate was
filtered off,
washed with water and dried. The residue was purified using MPLC (Biotage
!solera; silica gel;
dichloromethane / methanol gradient). 0.73 g (39% of theory) of the title
compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 7.30 - 7.38 (m, 2H), 7.44 - 7.51 (m,
1H), 7.80 - 7.89 (m, 3H),
7.94 - 8.00 (m, 1H), 8.27 (s, 1H), 8.30 - 8.40 (m, 2H), 8.61 (d, 1H), 9.08 (d,
1H), 10.90 (s, 1H).
LC-MS (Method 1): Rt = 0.99 min; MS (ESIpos): m/z = 381 [M+H].
Intermediate 80
2-amino-N446-(2-fluorophenyppyridin-3-yl]terephthalamide
H
N 0
F
I
1401 10
NH2
H2N 0
To a solution of the compound of intermediate 79 (0.70 g, 1.84 mmol) in 30 mL
of tetrahydrofuran
was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride
dropwise (15.6 mL, 18.4
mmol, 10 equiv) at 0 C. The reaction mixture was allowed to warm up to room
temperature and was
stirred overnight. The pH of the mixture was adjusted under stirring with
solid sodium bicarbonate to
7. The suspension was saturated with solid sodium chloride and stirred with 50
mL of a mixture of
tetrahydrofuran/ethyl acetate for 2 h. The suspension was filtered and the
filtrate was washed with
brine, dried over sodium sulfate and concentrated under reduced pressure. 589
mg (82% of theory)
of the title compound were obtained, which were used without further
purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 6.79 (s, 2H), 7.07 (dd, 1H), 7.18 -
7.29 (m, 2H), 7.29 - 7.37
(m, 2H), 7.43 - 7.50 (m, 1H), 7.69 (d, 1H), 7.82 (dd, 1H), 7.89 (s, 1H), 7.93 -
7.99 (m, 1H), 8.31 (dd, 1H),
9.06 (d, 1H), 10.52 (s, 1H).
LC-MS (Method 4): Rt = 0.93 min; MS (ESIpos): m/z = 351 [M+H].
Intermediate 81
153

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
methyl 4-methyl-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)benzoate
CH
I 3
0 0
N
H __________________________________________
CH3
To a solution of methyl 3-amino-4-methylbenzoate (3.00 g, 18.2 mmol) and 1-
(morpholin-4-
yl)cyclopropanecarboxylic acid hydrochloride (1:1) (intermediate 44, 7.54 g,
36.3 mmol, 2 equiv) in
DMF (50 mL) was added (benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate
(PYBOP, 18.9 g, 36.3 mmol, 2 equiv) and diisopropylethylamine (15.8 mL, 90.8
mmol, 5 equiv). The
resulting mixture was stirred at room temperature over night, was concentrated
under reduced
pressure, was then dissolved in dichloromethane, was washed with 1N aqueous
hydrogen chloride
solution and saturated, aqueous sodium bicarbonate solution, was dried over
sodium sulfate and
concentrated under reduced pressure. The remaining solids were then triturated
with ethanol (30
mL), and the resulting mixture was stirred for 30 minutes. The remaining
solids were removed by
filtration, washed with ethanol, and were dried at 50 C under reduced
pressure to give the title
compound (4.60 g, 80% of theory).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.08 - 1.16 (m, 2H), 1.17 - 1.24 (m,
2H), 2.39 (s, 3H), 2.44 -
2.49 (m, 4H), 3.67 - 3.74 (m, 4H), 3.83 (s, 3H), 7.39 (d, 1H), 7.63 (dd, 1H),
8.62 (d, 1H), 10.15 (s, 1H).
LC-MS (Method 4): Rt = 1.09 min; MS (ESIpos): m/z = 319 [M+H].
Intermediate 82
4-methyl-3-(0-(morpholin-4-yl)cyclopropyl]carbonyllamino)benzoic acid
HO 0
N
N
H ___________________________________________
CH3
4.57 g (14.4 mmol) of the compound of intermediate 81 were provided in 60 mL
of dioxane, a
solution of 690 mg (28.7 mmol) of lithium hydroxide in 25 mL of water was
added at room
temperature and the mixture was stirred for 5 h at room temperature. Water and
a 2N aqueous
hydrogen chloride solution were then added until an acidic pH of 1.5 - 2 was
achieved. After stirring
154

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
for 15 minutes, the precipitate was filtered off, washed with water and dried.
3.92 g (90% of theory)
of the title compound were obtained, which were used without further
purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.08 - 1.13 (m, 2H), 1.17 - 1.22 (m,
2H), 2.38 (s, 3H), 2.45 -
2.49 (m, 4H), 3.68 - 3.74 (m, 4H), 7.35 (d, 1H), 7.61 (dd, 1H), 8.56 (d, 1H),
10.10 (s, 1H), 12.82 (s, 1H).
LC-MS (Method 4): Rt = 0.90 min; MS (ESIpos): m/z = 305 [M+H].
Intermediate 83
methyl 4-fluoro-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)benzoate
H
C
I 3
0 0
0 j:-).c 0
N
H __________________________________________
F
4.67 g (22.5 mmol) of 1-(morpholin-4-yl)cyclopropanecarboxylic acid
hydrochloride (1:1)
(intermediate 44) were stirred in 90 mL of dichloromethane at room
temperature. 0.17 mL (2.25
mmol) of DMF and 3.9 mL (45.0 mmol) of oxalyl chloride were added, and the
mixture was stirred for
additional 2 h at 50 C after the gas formation had stopped. After
concentration, 4.80 g of raw
material were obtained, which were added to a solution of 3.00 g (17.7 mmol)
of methyl 3-amino-4-
fluorobenzoate and 12.4 mL (88.7 mmol) of triethylamine in a mixture of 42 mL
of dichloromethane
and 42 mL of THE. The resulting mixture was stirred at room temperature over
night, was washed
with water and 1N aqueous hydrogen chloride solution, was dried over sodium
sulfate and
concentrated under reduced pressure. The remaining solids were then triturated
with ethanol, and
the remaining solids were removed by filtration and were dried at 50 C under
reduced pressure to
give the title compound (4.55 g, 80% of theory).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.10 - 1.15 (m, 2H), 1.20 - 1.26 (m,
2H), 2.43 - 2.48 (m, 4H),
3.65 - 3.72 (m, 4H), 3.85 (s, 3H), 7.46 (dd, 1H), 7.75 (ddd, 1H), 8.77 (dd,
1H), 10.35 (s, 1H).
LC-MS (Method 4): Rt = 1.13 min; MS (ESIpos): m/z = 323 [M+H].
Intermediate 84
4-fluoro-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)benzoic acid
155

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
HO 0
N
H
F
4.55 g (14.1 mmol) of the compound of intermediate 83 were provided in 60 mL
of dioxane, 676 mg
(28.2 mmol) of lithium hydroxide and 25 mL of water were added at room
temperature and the
mixture was stirred at room temperature over night. Water and a 2N aqueous
hydrogen chloride
solution were then added until an acidic pH of 1.5 - 2 was achieved. After
stirring for 15 minutes, the
precipitate was filtered off, washed with water and dried. 3.02 g (66% of
theory) of the title
compound were obtained, which were used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.08 - 1.15 (m, 2H), 1.19 - 1.25 (m,
2H), 2.43 - 2.48 (m, 4H),
3.65 - 3.72 (m, 4H), 7.41 (dd, 1H), 7.72 (ddd, 1H), 8.73 (dd, 1H), 10.32 (s,
1H), 13.02 (s, 1H).
LC-MS (Method 4): Rt = 0.93 min; MS (ESIpos): rniz = 309 [m+H].
Intermediate 85
methyl 4-chloro-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)benzoate
CH
I 3
0 0
0 )0.,c a)
N
N
H
CI
To a solution of methyl 3-amino-4-chlorobenzoate (3.00 g, 16.2 mmol) and 1-
(morpholin-4-
yl)cyclopropanecarboxylic acid hydrochloride (1:1) (intermediate 44, 6.71 g,
32.3 mmol, 2 equiv) in
DMF (50 mL) was added (benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate
(PYBOP, 16.8 g, 32.3 mmol, 2 equiv) and diisopropylethylamine (14.1 mL, 80.8
mmol, 5 equiv). The
resulting mixture was stirred at room temperature for 3 days. (Benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 16.8 g, 32.3 mmol,
2 equiv) and
diisopropylethylamine (14.1 mL, 80.8 mmol, 5 equiv) were added and the
resulting mixture was
stirred at 60 C over night. The mixture was concentrated under reduced
pressure, was then
dissolved in dichloromethane, was washed with 1N aqueous hydrogen chloride
solution and
saturated, aqueous sodium bicarbonate solution, was dried over sodium sulfate
and concentrated
under reduced pressure. The remaining solids were then triturated with ethanol
(40 mL), and the
resulting mixture was stirred for 30 minutes. The remaining solids were
removed by filtration,
washed with ethanol, and were dried at 50 C under reduced pressure. The
remaining solids were
then triturated with ethanol (70 mL), and the resulting mixture was stirred
under reflux. After cooling
156

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
to room temperature, the remaining solids were removed by filtration, washed
with ethanol, and
were dried at 50 C under reduced pressure to give the title compound (3.60
g).
LC-MS (Method 4): Rt = 1.23 min; MS (ESIpos): m/z = 339 [M+H].
Intermediate 86
4-chloro-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)benzoic acid
HO 0
N
H
CI
3.60 g (10.6 mmol) of the compound of intermediate 85 were provided in 45 mL
of dioxane, 509 mg
(21.3 mmol) of lithium hydroxide and 19 mL of water were added at room
temperature and the
mixture was stirred at room temperature for 5 hours. Water and a 2N aqueous
hydrogen chloride
solution were then added until an acidic pH of 1.5 - 2 was achieved. After
stirring for 15 minutes, the
precipitate was filtered off, washed with water and dried. 2.67 g (77% of
theory) of the title
compound were obtained, which were used without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.10 - 1.18 (m, 2H), 1.23 - 1.31 (m,
2H), 2.43 - 2.49 (m, 4H),
3.68 - 3.77 (m, 4H), 7.61 - 7.70 (m, 2H), 8.97 (s, 1H), 10.75 (s, 1H), 13.17
(s, 1H).
LC-MS (Method 1): Rt = 1.01 min; MS (ESIpos): m/z = 325 [M+H].
Intermediate 87
3-[(2-chloropropanoyDamino]-4-[(methylsulfonyl)methyl]-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide
H
/N N 0
N----y'
\ s
41/' 40 jyc,
N
H
H3C CH3
S
I/ \\
00
1.50 g (3.86 mmol) of the compound from intermediate 55 were provided in 40 mL
of toluene, 0.56
mL (5.79 mmol) of 2-chloropropanoyl chloride were added, and the mixture was
stirred for 2 h at 100
157

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
C. After concentration, 1.85 g (100% of theory) of the title compound were
obtained, which were
used without further purification.
'H-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.67 (d, 3H), 2.95 (s, 3H), 4.65 - 4.75
(m, 2H), 4.84 (q, 1H),
7.53 - 7.58 (m, 3H), 7.67 (d, 1H), 7.96 - 8.02 (m, 2H), 8.06 (dd, 1H), 8.30 -
8.33 (m, 1H), 9.96 (s, 1H),
13.28 (s, 1H).
Intermediate 88
4-methoxy-3-nitro-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
H
NN 0
/ --*.r
N
\ S
4. 40 NO2
0
H3C
To a solution of 4-methoxy-3-nitrobenzoic acid (5.00 g, 25.4 mmol) and 5-
phenyl-1,3,4-thiadiazol-2-
amine (6.29 g, 35.5 mmol) in 110 mL of DMF were added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP, 19.8 g, 38.0 mmol)
and N,N-
diisopropylethylamine (13.3 mL, 76.1 mmol). The mixture was stirred overnight
at room
temperature. (Benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PyBOP, 6.60 g,
12.7 mmol) and N,N-diisopropylethylamine (4.4 mL, 25.4 mmol) were added, the
mixture was stirred
at room temperature for 2 hours and poured into water. The resulting
precipitate was collected by
filtration, washed with water and dried in vacuum to provide the crude desired
product (8.57 g),
which was used without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 4.04 (s, 3H), 7.51 - 7.59 (m, 4H),
7.92 - 8.02 (m, 2H), 8.44
(dd, 1H), 8.72 (d, 1H), 13.39 (s, 1H).
Intermediate 89
3-amino-4-methoxy-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
H
NN 0
/ --*.r
N
\ S
4. 110
NH2
0
H3C
158

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
8.50 g (23.9 mmol) of the compound of intermediate 88 were provided in a
mixture of 100 mL of
ethanol and 150 mL of THE. 2.54 g of palladium on charcoal (10% Pd, 50% water)
were added, and
the mixture was stirred under a hydrogen atmosphere at room temperature for
1.5 h. 4.00 g of
palladium on charcoal (10% Pd, 50% water) and 75 mL of ethanol and 100 mL of
THE were added,
and the mixture was stirred under a hydrogen atmosphere at room temperature
for 1 h. A mixture of
75 mL of ethanol and 100 mL of THE and 4.00 g of palladium on charcoal (10%
Pd, 50% water) were
added, and the mixture was stirred under a hydrogen atmosphere at room
temperature for 1.5 h.
3.00 g of palladium on charcoal (10% Pd) were added, and the mixture was
stirred under a hydrogen
atmosphere at room temperature for 5.25 h. After filtration, the solvents were
evaporated. 6.67 g
(86% of theory) of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 3.86 (s, 3H), 5.02 (s, 2H), 6.93 (d,
1H), 7.38 (d, 1H), 7.47 -
7.60 (m, 4H), 7.93 - 8.00 (m, 2H), 12.79 (s, 1H).
LC-MS (Method 4): Rt = 1.05 min; MS (ESIpos): m/z = 327 [M+H].
Intermediate 90
3-[(chloroacetyl)amino]-4-methoxy-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
NN 0
/
N
\y S
4. 40 )UCI
N
H
0
H3C
1.50 g (4.60 mmol) of the compound of intermediate 89 were provided in 40 mL
of toluene, 0.55 mL
(6.89 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 2 h at 100 C. After
concentration, 1.10 g of the title compound were obtained, which were used
without further
purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.97 (s, 3H), 4.43 (s, 2H), 7.26 (d,
1H), 7.52 - 7.59 (m, 3H),
7.96 - 8.00 (m, 2H), 8.05 (dd, 1H), 8.74 - 8.78 (m, 1H), 9.71 (s, 1H), 13.03
(s, 1H).
LC-MS (Method 4): Rt = 1.15 min; MS (ESIpos): m/z = 403 [M+H].
Intermediate 91
methyl 4-(benzyloxy)-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)benzoate
159

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
CH
I 3
0 0
(10 rO
Nj
N)'H
0
1401
To a solution of methyl 3-amino-4-(benzyloxy)benzoate (5.00 g, 19.4 mmol) and
1-(morpholin-4-
yl)cyclopropanecarboxylic acid hydrochloride (1:1) (intermediate 44, 4.84 g,
23.3 mmol) in DMF (50
mL) was added (benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PYBOP, 20.2
g, 38.9 mmol) and diisopropylethylamine (16.9 mL, 97.2 mmol). The resulting
mixture was stirred at
room temperature over night, was concentrated under reduced pressure, was then
dissolved in
dichloromethane, was washed with 1N aqueous hydrogen chloride solution and
saturated, aqueous
sodium bicarbonate solution, was dried over sodium sulfate and concentrated
under reduced
pressure. The remaining solids were then triturated with ethanol (100 mL), and
the resulting mixture
was stirred for 30 minutes. The remaining solids were removed by filtration,
washed with ethanol,
and were dried at 50 C under reduced pressure to give the title compound
(7.98 g, 100% of theory).
LC-MS (Method 4): Rt = 1.32 min; MS (ESIpos): m/z = 411 [M+1-1]+.
Intermediate 92
4-(benzyloxy)-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)benzoic acid
HO 0
110 0 rO
Nj
N).
H
0
1401
7.98 g (19.4 mmol) of the compound of intermediate 91 were provided in 80 mL
of dioxane, 931 mg
(38.9 mmol) of lithium hydroxide and 34 mL of water were added at room
temperature and the
mixture was stirred at room temperature for 22 hours. Water and a 2N aqueous
hydrogen chloride
solution were then added until an acidic pH of 1.5 - 2 was achieved. After
stirring for 15 minutes, the
160

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
precipitate was filtered off, washed with water and dried. 5.70 g (74% of
theory) of the title
compound were obtained, which were used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.04 - 1.09 (m, 2H), 1.10 - 1.16 (m,
2H), 2.21 - 2.29 (m, 4H),
3.14 - 3.23 (m, 4H), 5.25 (s, 2H), 7.29 (d, 1H), 7.38 - 7.47 (m, 3H), 7.54 -
7.59 (m, 2H), 7.67 (dd, 1H),
8.92 (d, 1H), 10.37 (s, 1H).
LC-MS (Method 1): Rt = 1.13 min; MS (ESIpos): m/z = 397 [M+H].
Intermediate 93
3-amino-4-bromo-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
N N 0
/ yN
it NH2
B
r
To a solution of 3-amino-4-bromobenzoic acid (10.0 g, 46.3 mmol) and 5-phenyl-
1,3,4-thiadiazol-2-
amine (6.84 g, 38.6 mmol) in DMF (140 mL) was added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 40.1 g, 77.2 mmol)
and
diisopropylethylamine (26.9 mL, 154 mmol). The resulting mixture was stirred
at room temperature
over night. (Benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PYBOP, 40.1 g,
77.2 mmol) and diisopropylethylamine (26.9 mL, 154 mmol) were added and the
resulting mixture
was stirred at room temperature for 3 days. The mixture was concentrated under
reduced pressure,
was then triturated with dichloromethane, and was concentrated under reduced
pressure. The
remaining solids were then triturated with ethanol (300 mL) and water (300
mL), and the resulting
mixture was stirred for 30 minutes. The remaining solids were removed by
filtration, washed with
ethanol, and were dried at 50 C under reduced pressure. The remaining solids
were then triturated
with ethanol (500 mL), and the resulting mixture was stirred under reflux.
After cooling to room
temperature, the remaining solids were removed by filtration, washed with
ethanol, and were dried
at 50 C under reduced pressure. The remaining solids were then triturated
with toluene (300 mL),
and the resulting mixture was stirred under reflux. After cooling to room
temperature, the remaining
solids were removed by filtration, washed with toluene, and were dried at 50
C under reduced
pressure to give the title compound (13.7 g).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 5.64 (s, 2H), 7.25 (dd, 1H), 7.47 (d,
1H), 7.50 - 7.58 (m, 4H),
7.94 - 8.01 (m, 2H), 13.05 (s, 1H).
LC-MS (Method 4): Rt = 1.18 min; MS (ESIpos): m/z = 375 [M+H].
Intermediate 94
161

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
4-bromo-3-[(chloroacetyl)amino]-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
N N
NN\(0
/ y
S
N
H
Br
4.00 g (10.7 mmol) of the compound of intermediate 93 were provided in 100 mL
of toluene, 1.27 mL
(16.0 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 2 h at 100 C. 20
mL of toluene were added and after concentration 4.80 g of the title compound
were obtained,
which were used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 4.42 (s, 2H), 7.51 - 7.59 (m, 3H),
7.89 - 8.02 (m, 4H), 8.40 (d,
1H), 10.03 (s, 1H), 13.31 (s, 1H).
LC-MS (Method 4): Rt = 1.21 min; MS (ESIpos): m/z = 451 [M+H].
Intermediate 95
3-amino-N-(5-phenylpyridin-2-yI)-4-(trifluoromethoxy)benzamide
H
N N 0
I
110 / 'NH
FO
FI
F
To a solution of 3-amino-4-(trifluoromethoxy)benzoic acid (known from
W02007/31791, 500 mg,
2.26 mmol) and 5-phenylpyridin-2-amine (654 mg, 3.84 mmol) in DMF (5 mL) was
added
(benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP,
2.35 g, 4.52 mmol)
and diisopropylethylamine (2.0 mL, 11.3 mmol). The resulting mixture was
stirred at room
temperature for 3 days. The mixture was triturated with water and extracted
with ethyl acetate. The
combined organic phases were dried over sodium sulfate and concentrated under
reduced pressure.
The residue was purified using MPLC (Biotage Isolera; silica gel; hexane /
Et0Ac gradient). 98.0 mg
(11% of theory) of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 5.65 (s, 2H), 7.17 - 7.29 (m, 2H),
7.35 - 7.45 (m, 2H), 7.46 -
7.55 (m, 2H), 7.69 - 7.79 (m, 2H), 8.15 (dd, 1H), 8.25 (d, 1H), 8.71 (d, 1H),
10.76 (s, 1H).
LC-MS (Method 4): Rt = 1.31 min; MS (ESIpos): m/z = 374 [M+H].
162

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Intermediate 96
3-amino-N-(5-bromo-1,3,4-thiadiazol-2-y1)-4-(trifluoromethoxy)benzamide
H
N 0
NIN:::'-:r
)S
Br
1401 NH2
FO
FI
F
To a solution of 3-amino-4-(trifluoromethoxy)benzoic acid (known from
W02007/31791, 2.00 g, 9.04
mmol) and 5-bromo-1,3,4-thiadiazol-2-amine (2.77 g, 15.4 mmol) in DMF (20 mL)
was added
(benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP,
9.41 g, 18.1 mmol)
and diisopropylethylamine (7.9 mL, 45.2 mmol). The resulting mixture was
stirred at room
temperature over night, was concentrated under reduced pressure, was then
triturated with water,
and was extracted with ethyl acetate. The combined organic phases were dried
over sodium sulfate
and concentrated under reduced pressure. The remaining solids were then
triturated with ethanol
(50 mL) and water (50 mL), and the resulting mixture was stirred for 15
minutes. The remaining solids
were removed by filtration, washed with water, and were dried at 50 C under
reduced pressure. The
residue was purified using MPLC (Biotage !solera; silica gel; hexane / Et0Ac
gradient). 310 mg (9% of
theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 5.74 (s, 2H), 7.27 (dd, 1H), 7.32 (dd,
1H), 7.49 (d, 1H), 13.29
(s, 1H).
LC-MS (Method 1): Rt = 1.14 min; MS (ESIpos): m/z = 383 [m+H].
Intermediate 97
3-[(chloroacetypamino]-4-[(methylsulfonyl)methyl]-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide
H
N 0
N/N--Y/
\ S
it I. )UCI
N
H
H C
3S
I/ \\
00
163

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1.50 g (3.86 mmol) of the compound of intermediate 55 were provided in 50 mL
of toluene, 0.46 mL
(5.79 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 2 h at 100 C. 20
mL of toluene were added and after concentration 1.80 g of the title compound
were obtained,
which were used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.96 (s, 3H), 4.40 (s, 2H), 4.71 (s,
2H), 7.53 - 7.58 (m, 3H),
7.67 (d, 1H), 7.96 - 8.02 (m, 2H), 8.06 (dd, 1H), 8.31 - 8.33 (m, 1H), 9.88
(s, 1H), 13.27 (s, 1H).
Intermediate 98
methyl 2-amino-4-[(5-phenyl-1,3,4-thiadiazol-2-yl)carbamoyl]benzoate
H
NN 0
/
N
\y s
it 0 NH2
H C
3
0 0
To a solution of 3-amino-4-(methoxycarbonyl)benzoic acid (5.00 g, 25.6 mmol)
and 5-phenyl-1,3,4-
thiadiazol-2-amine (6.81 g, 38.4 mmol) in DMF (150 mL) was added (benzotriazol-
1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 26.7 g, 51.2 mmol)
and
diisopropylethylamine (22.3 mL, 128 mmol). The resulting mixture was stirred
at room temperature
over night, was then triturated with water, and was stirred for 15 minutes.
The precipitate was
removed by filtration, washed with water, and was dried at 50 C under reduced
pressure. 2.87 g
(32% of theory) of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 3.83 (s, 3H), 6.88 (s, 2H), 7.23 (dd,
1H), 7.47 (d, 1H), 7.52 -
7.58 (m, 3H), 7.83 (d, 1H), 7.94 - 8.02 (m, 2H), 13.21 (s, 1H).
LC-MS (Method 1): Rt = 1.21 min; MS (ESIpos): m/z = 355 [M+H].
Intermediate 99
methyl 2-[(chloroacetyl)amino]-4-[(5-phenyl-1,3,4-thiadiazol-2-
yl)carbamoyl]benzoate
H
NN 0
/
N
\y s
II = )ucl
N
H
H3C
0 0
164

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To a suspension of the compound of the intermediate 98 (2.87 g, 8.10 mmol) and
pyridine (1.64 mL,
20.3 mmol) in CH2Cl2 (50 mL) at 0 C was added chloroacetyl chloride (0.77 mL,
9.72 mmol) dropwise.
The resulting mixture was allowed to warm to room temperature, was stirred at
that temperature
over night, was then concentrated and afterwards triturated with 100 mL of a
2/1 mixture of water
and ethanol. The precipitate was removed by filtration, washed with water, and
was dried at 50 C
under reduced pressure. 4.07 g of the title compound were obtained.This
material was used in
subsequent reactions without further purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 3.92 (s, 3H), 4.49 (s, 2H), 7.52 -
7.61 (m, 3H), 7.94 - 8.04 (m,
3H), 8.11 (d, 1H), 8.95 - 9.00 (m, 1H), 11.28 (s, 1H), 13.51 (s, 1H).
LC-MS (Method 1): Rt = 1.28 min; MS (ESIpos): m/z = 431 [M+H].
Intermediate 100
N-(4-methoxy-3-nitrophenyI)-2-phenyl-1,3-thiazole-5-carboxamide
0
N1)L
NH
\ s
1401
440 0 NO2
H3C
To a solution of 2-phenyl-1,3-thiazole-5-carboxylic acid (502 mg, 2.45 mmol)
in diisopropylethylamine
(1.25 mL, 7.19 mmol) and DMF (8.2 mL) were added 4-methoxy-3-nitroaniline (403
mg, 2.40 mmol)
and 2.10 mL of a 50 % solution of 2,4,6-tripropy1-1,3,5,2,4,6-
trioxatriphosphinane 2,4,6-trioxide (T3P)
in DMF (3.60 mmol). The mixture was stirred over night at room temperature.
Water was added and
the mixture was extracted three times with ethyl acetate. The combined organic
layers were dried
over Mg504 and concentrated in vacuum. After flash-chromatography of the
residue the product was
suspended in ethyl acetate and stirred with saturated NaHCO3 solution to
remove acidic impurities.
The layers were separated, the organic layer was dried over Mg504 and provided
after removal of
the solvent the desired product (202 mg, 23%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.93 (s, 3 H), 7.45 (s, 1 H), 7.52 -
7.61 (m, 3 H), 8.05 (s, 3 H),
8.33 (d, 1 H), 8.67 (s, 1 H), 10.69 (s, 1 H).
LC-MS (Method 4): Rt = 1.24 min; MS (ESIpos): m/z = 356 [M+H].
Intermediate 101
N-(3-amino-4-methoxyphenyI)-2-phenyl-1,3-thiazole-5-carboxamide
165

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
N1)L
NH
\ S
1401
110 0 NH2
H3C
The compound of intermediate 100 (88.0 mg, 248 mop was dissolved in THE (1.85
mL) and cooled
to 0 C. At that temperature 1.68 mL of a 10% aqueous hydrogen chloride
solution containing 15% of
titanium(III) trichloride (1.98 mmol) were added. The mixture was stirred over
night. Under ice bath
cooling 2 mL of the titanium(III) trichloride solution were added and the
mixture was stirred at 40 C
over night. Afterwards 2 mL of the titanium(III) trichloride solution were
added again under ice bath
cooling. The mixture was stirred additionally over night at 40 C. The
reaction mixture was
neutralized by addition of solid sodium bicarbonate, saturated with sodium
chloride and stirred with
50 mL of a 1:1 mixture of THE and ethyl acetate for 2 h. The precipitate was
filtered off. The filtrate
was washed with brine, dried over MgSO4 and concentrated in vacuum to yield
the desired
compound 101 (123 mg, quant.) as crude product, which was used in the next
step without any
further purification.
LC-MS (Method 1): Rt = 1.16 min; MS (ESIpos): m/z = 326 [M+H].
Intermediate 102
N-{3-[(2-chloropropanoyDamino]-4-methoxypheny11-2-phenyl-1,3-thiazole-5-
carboxamide
0
NH
N
\ S
0 jyCl
10 0 N
H
CH3
H3C
To a solution of the compound of intermediate 101 (123 mg, 380 mop in toluene
(1.90 mL) was
added under argon 2-chloropropionyl chloride (76 uL, 759 mop. The mixture was
stirred for 2 h at
100 C and was subsequently concentrated. The residue yielded the desired
product 102 (469 mg,
78% pure, 84%) as crude material which was used without further purification.
LC-MS (Method 1): Rt = 1.35 min; MS (ESIpos): m/z = 416 [M+H].
Intermediate 103
166

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
N-[3-nitro-4-(trifluoromethoxy)phenyI]-2-phenyl-1,3-thiazole-5-carboxamide
0
N1)L
NH
\ S
0
NO2
44111. FO
Fl
F
To a solution of 3-nitro-4-(trifluormethoxy)aniline (668 mg, 3.01 mmol) and 2-
phenyl-1,3-thiazole-5-
carboxylic acid (772 mg, 3.76 mmol) in DMF (7.0 mL) were added
diisopropylethylamine (1.57 mL,
9.03 mmol) and (benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PYBOP, 2.35
g, 4.51 mmol). The mixture was stirred for 3 d at 60 C. After cooling to room
temperature the
mixture was poured into water. The resulting precipitate was filtered off,
washed with water and
dried at 40 C under vacuum. The crude material was suspended in methanol,
stirred at room
temperature. Insoluble material was collected by filtration and dried to
provide the desired
intermediate 103 90% pure (1.16 g, 85%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 7.49 - 7.59 (m, 3H), 7.79 (d, 1H),
8.00 - 8.08 (m, 2H), 8.17
(dd, 1H), 8.61 (d, 1H), 8.72 (s, 1H), 11.02 (s, 1H).
LC-MS (Method 4): Rt = 1.43 min; MS (ESIpos): m/z = 410 [M+H].
Intermediate 104
N43-amino-4-(trifluoromethoxy)pheny1]-2-phenyl-1,3-thiazole-5-carboxamide
0
N((' NH
S
/,' F Si NH2
0
Fl
F
The compound of intermediate 103 (1.16 g, 2.83 mmol) was suspended in a
mixture of THE / Me0H
(15 mL/25 mL) and palladium on charcoal (10% Pd, 151 mg) was added. The
mixture was stirred over
night under hydrogen atmosphere. The mixture was filtered over a pad of
Celite. The filtrate was
concentrated and the residue was purified by flash-chromatography to provide
the desired
compound 104 72% pure (310 mg, 21 %).
167

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 5.46 (s, 2H), 6.88 (dd, 1H), 7.09 (dd,
1H), 7.28 (d, 1H), 7.49 -
7.60 (m, 3H), 7.96 - 8.10 (m, 2H), 8.66 (s, 1H), 10.33 (s, 1H).
LC-MS (Method 1): Rt = 1.28 min; MS (ESIpos): m/z = 380 [M+H].
Intermediate 105
ethyl 3-amino-4-(trifluoromethoxy)benzoate
H3C..,..........õ,0 0
1101 NH2
FO
Fl
F
3-Amino-4-(trifluormethoxy)benzoic acid (20.0 g, 90.4 mmol) were treated
carefully under argon
with thionyl chloride (38.0 mL, 520 mmol). The resulting suspension was
stirred for 15 min at room
temperature. Ethanol (136 mL, 2.33 mol) was added dropwise at 0 C into the
mixture. The reaction
mixture was stirred for 30 min at 0 C, over night at room temperature and
subsequently 5 h under
reflux. After cooling to room temperature the mixture was concentrated, the
residue was diluted
with water and extracted three times with ethyl acetate. The combined organic
layers were washed
with saturated NaHCO3-solution, dried over Mg504 and the solvent was removed
under reduced
pressure to provide the desired compound 105 (25.7 g, quant.) as crude product
which was used
without further purification.
'H-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.30 (t, 3H), 4.28 (q, 2H), 5.68 (s, 2H),
7.11 - 7.16 (m, 1H),
7.19 -7.23 (m, 1H), 7.45 (d, 1H).
LC-MS (Method 4): Rt = 1.22 min; MS (ESIpos): m/z = 250 [M+H].
Intermediate 106
ethyl 3-[(2-chloropropanoyl)amino]-4-(trifluoromethoxy)benzoate
168

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H3C0 0
1:10 N jyCl
H
FO CH3
Fl
F
A solution of the compound of intermediate 105 (25.5 g, 102 mmol) in toluene
(513 mL) was treated
with 2-chloropropionyl chloride (20.5 mL, 205 mmol). The resulting mixture was
stirred for 2 h at 100
C and concentrated after cooling to room temperature under reduced pressure to
provide the
desired compound 106 as crude product (34.9 g, 97%) which was used without
further purification.
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.32 (t, 3H), 1.62 (d, 3H), 4.34 (q, 2H),
4.89 (q, 1H), 7.59 (dd,
1H), 7.88 (dd, 1H), 8.46 (d, 1H), 10.28 (s, 1H).
LC-MS (Method 1): Rt = 1.30 min; MS (ESIpos): m/z = 340 [M+H].
Intermediate 107
ethyl 34[2-(morpholin-4-yppropanoyl]aminol-4-(trifluoromethoxy)benzoate
H3C0 0
N
N
H
FO CH3
Fl
F
To a solution of the compound of intermediate 106 (34.9 g, 103 mmol) in DMF
(442 mL) morpholine
(13.4 mL, 154 mmol), potassium iodide (2.64 g, 15.9 mmol) and triethylamine
(21.4 mL, 154 mmol)
were added. The mixture was stirred over night at room temperature and for 7 h
at 90 C. After
cooling to room temperature the mixture was poured into water and extracted
three times with
ethyl acetate. The combined organic layers were dried over Mg504 and
concentrated under reduced
pressure. The obtained desired product 107 (36.3 g, 80%) was used in the next
step without any
further purification.
1-1-1-NMR (300 MHz, DMSO-d6) 6 [ppm] = 1.21 (d, 3H), 1.32 (t, 3H), 2.52 - 2.58
(m, 4H), 3.40 (d, 1H),
3.61 - 3.68 (m, 4H), 4.34 (q, 2H), 7.59 (dd, 1H), 7.80 (dd, 1H), 8.81 (d, 1H),
10.05 (s, 1H).
LC-MS (Method 1): Rt = 1.05 min; MS (ESIpos): m/z = 391 [M+H].
169

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Intermediate 108
lithium 34[2-(morpholin-4-yppropanoyl]aminol-4-(trifluoromethoxy)benzoate
0 0
Li+
401 jyNO)
FO CH3
A solution of the compound of intermediate 107 (4.38 g, 11.2 mmol) in a
mixture of THE/methanol
(93 mL/24 mL) was treated with a 1M aqueous lithium hydroxide solution (13.5
mL, 13.5 mmol) and
was stirred for 2.5 h at room temperature. The mixture was concentrated under
reduced pressure to
provide the desired compound 108 as 85% pure material (4.76 g, 98%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.18 - 1.22 (m, 3H), 2.51 - 2.59 (m,
4H), 3.63 - 3.68 (m, 4H),
7.25 (dd, 1H), 7.67 (dd, 1H), 8.50 (d, 1H), 9.73 (s, 1H).
LC-MS (Method 4): Rt = 0.76 min; MS (ESIpos): m/z = 363 [M¨Li++1-1++H].
Intermediate 109
N-(6-chloropyridin-3-y1)-34[2-(morpholin-4-yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
0
I
110
CIN 0 r'CD
N)YNJ
FO CH3
Fl
To a solution of the compound of intermediate 108 (13.5 g, 37.2 mmol) and 5-
amino-2-
chloropyridine (9.57 g, 74.4 mmol) in DMF (273 mL) were added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 29.0 g, 55.8 mmol)
and
diisopropylethylamine (19.4 mL, 112 mmol). The reaction mixture was stirred
over night at 60 C.
After cooling to room temperature the mixture was added dropwise into water.
The water was
removed by decantation. The residue was dissolved in ethanol and was added
dropwise into water.
After stirring over night at room temperature, the precipitate was collected
by filtration and dried at
60 C under reduced pressure. The title compound 109 was obtained 93% pure
(12.9 g, 25.3 mmol,
68%).
170

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (300 MHz, DMSO-d6) 6 [ppm] = 1.22 (d, 3H), 2.53 - 2.57 (m, 4H), 3.35
- 3.44 (m, 1H), 3.63 -
3.68 (m, 4H), 7.54 (d, 1H), 7.62 - 7.68 (m, 1H), 7.82 (m, 1H), 8.20 - 8.28 (m,
1H), 8.75 (dd, 2H), 10.05
(s, 1H), 10.73 (s, 1H).
LC-MS (Method 4): Rt = 0.99 min; MS (ESIpos): m/z = 473 [M+1-1]+.
Intermediate 110
N-(6-chloropyridin-3-yI)-3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)benzamide
H
0
N
I
N 40
CI 0 r'CD
H
FO
Fl
F
To a solution of intermediate 21 (500 mg, 1.44 mmol) and 5-amino-2-
chloropyridine (277 mg, 2.15
mmol) in DMF (3.0 mL) were added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PYBOP, 1.21 g, 2.15 mmol) and diisopropylethylamine (750
uL, 4.31 mmol).
The reaction mixture was stirred for 3 d at 60 C. After cooling to room
temperature the mixture was
poured into water. The precipitate was collected by filtration and was dried
at 40 C under reduced
pressure to yield the desired crude intermediate 110 (349 mg, 52%).
1-1-1-NMR (300 MHz, DMSO-d6) 6 [ppm] = 2.54 - 2.62 (m, 4H), 3.23 (s, 2H), 3.61
- 3.68 (m, 4H), 7.54 (d,
1H), 7.63 - 7.69 (m, 1H), 7.79 - 7.87 (m, 1H), 8.20 - 8.28 (m, 1H), 8.77 (t,
2H), 9.93 (s, 1H), 10.74 (s,
1H).
LC-MS (Method 4): Rt = 1.16 min; MS (ESIpos): m/z = 459 [M+1-1]+.
Intermediate 111
3-[(2-chloropropanoyDamino]-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethyl)benzamide
H
N N 0
NI :.....::.-r
\ S
41/ 101 jyCl
N
H
CH3
F F
F
171

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To a solution of intermediate 60 (1.00 g, 2.75 mmol) in toluene (13.7 mL) was
added 2-
chloropropanoyl chloride under inert gas atmosphere. The reaction mixture was
stirred for 4 h at 100
C. The mixture was treated again with the same amount of chloropropanoyl
chloride and was stirred
over night at 100 C. After cooling to room temperature the mixture was
concentrated to obtain the
desired crude product (1.30 g, 99%) which was used in the next step without
further purification.
1-1-1-NMR (400 MHz, DMSO-d6) 6 [ppm] = 1.66 (d, 3H), 7.51 - 7.61 (m, 3H), 7.94
- 8.05 (m, 3H), 8.19 -
8.29 (m, 2H), 10.17 (s, 1H), 13.50 (br. s, 1H).
LC-MS (Method 4): Rt = 1.18 min; MS (ESIpos): m/z = 455 [M+H].
Intermediate 112
3-{[(4-methylpiperazin-1-ypacetyl]amino}-4-(trifluoromethoxy)benzoic acid
HO 0
r-NCH3
0
N
H
F.0
Fl
F
To a suspension of intermediate 19 (4.10 g, 13.8 mmol) in DMF (78.6 ml) was
added triethylamine
(2.88 ml, 20.7 mmol) to yield a clear solution. This solution was treated
under inert gas atmosphere
with potassium iodide (354 mg, 2.14 mmol) and 1-methylpiperazine (2.29 ml,
20.7 mmol). The
reaction mixture was stirred over night at room tempearture and filtrated
afterwards. The filtrate
was concentrated in vacuum to yield the desired product (7.90 g, 76% pure,
quant.) as crude material
with was used without any further purification.
1-1-1 NMR (400 MHz, DMSO-d6) 6 [ppm] = 2.28 (s, 3H), 2.57 - 2.58 (m, 4H), 3.22
(s, 2H), 7.55 (dd, 1H),
7.78 (dd, 1H), 8.84 (d, 1H), 9.89 (s, 1H).
LC-MS (Method 4): Rt = 0.57 min; MS (ESIneg): m/z = 360 [M-H].
Intermediate 113
2-(2-fluorophenyI)-5-nitropyridine
NO2
I
110
F N
172

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To 7.4 g (36.45 mmol) of 2-bromo-5-nitropyridine and 5.6 g (40.10 mmol) of (2-
fluorophenyl)boronic
acid in 222 mL of toluene and 55 mL of ethanol were added 409 mg (1.82 mmol)
of
palladium(I1)diacetate, 956 mg (3.65 mmol) of triphenylphosphine and 36.4 mL
(36.4 mmol) of an
aqueous sodium carbonate solution (1M). The reaction mixture was stirred for 5
h under reflux. The
reaction mixture was allowed to reach rt. The reaction mixture was
concentrated and elutriated in
water. Et0Ac was added, the layers were separated and the aqueous layer was
extracted twice with
Et0Ac. The combined organic phases were washed with water, dried over
magnesium sulfate and
concentrated. The residue was purified on silica gel (n-hexane/Et0Ac 7:3) to
provide 7.25 g (89%) of
the desired intermediate.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 7.36 - 7.48 (m, 2H), 7.55 - 7.66 (m,
1H), 7.98 - 8.13 (m, 2H),
8.69 (dd, 1H), 9.48 (d, 1H).
LC-MS (Method 4): Rt = 1.20 min; MS (ESIpos): m/z = 219 [M+H].
Intermediate 114
6-(2-fluorophenyl)pyridin-3-amine
NH2
I
01 N
F
To a suspension of 7.66 g (35.11 mmol) of 2-(2-fluorophenyI)-5-nitropyridine
(intermediate 113) in
500 mL of a mixture of THE/methanol 1:1 were added 2.3 g of palladium on
charcoal (10% Pd with
50% water). It was hydrogenated for 4.5 h at rt. The catalyst was filtered off
and washed with 100 mL
of THE and 100 mL of methanol. The filtrate was concentrated. The residue was
suspended twice in
toluene and concentrated again. 6.76 g (99%) of the desired product were
isolated.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 5.54 (br. s, 2H), 6.98 (dd, 1H), 7.18 -
7.26 (m, 2H), 7.28 - 7.35
(m, 1H), 7.45 - 7.50 (m, 1H), 7.86 (td, 1H), 8.05 (d, 1H).
LC-MS (Method 4): Rt = 0.56 min; MS (ESIpos): m/z = 189 [M+H].
Intermediate 115
4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-yI]-3-nitrobenzamide
173

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
I
Ol
F 0NO2
0
V
2.5 g (11.20 mmol) 4-(cyclopropyloxy)-3-nitrobenzoic acid was dissolved in 40
mL of anh DMF. 2.53 g
(13.44 mmol) of 6-(2-fluorophenyl)pyridin-3-amine (intermediate 114), 7.8 mL
(44.81mmol) of N-
ethyl-N-isopropylpropan-2-amine and 7.00 g (13.44 mmol) of PYBOP were added.
It was stirred at rt
over night. The volatile was removed under vacuum and the residue was
triturated with
water/methanol 7:3. The remaining solid was filtered off, washed with
water/methanol 7:3 and dried
under vacuum at 45 C yielding 4.4 g (95%) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.74 - 0.96 (m, 4H), 4.21 (mc, 1H),
7.27 - 7.38 (m, 2H), 7.41 -
7.52 (m, 1H), 7.76 - 7.88 (m, 2H), 7.92 - 8.00 (m, 1H), 8.28-8.38 (m, 2H),
8.56 (d, 1H), 9.05 (d, 1H),
10.68 (s, 1H).
LC-MS (Method 4): Rt = 1.30 min; MS (ESIpos): m/z = 394 [M+H].
Intermediate 116
3-amino-4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-yl]benzamide
H
N 0
I
. N
0
F NH2
V0
2.0 g (5.08 mmol) of 4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-yI]-3-
nitrobenzamide
(intermediate 115) were dissolved in 80 mL of a mixture of THE/methanol 1:1
and 0.325 g of
palladium on charcoal (10% Pd with 50% water) were added. It was hydrogenated
for 4 h at rt. The
catalyst was filtered off, washed with 30 mL of THE and 30 mL of methanol. The
filtrate was
concentrated and twice suspended in toluene and concentrated again. 1.64 g
(85%) of the title
compound was obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 0.65 - 0.86 (m, 4H), 3.87 - 3.96 (m,
1H), 4.90 (s, 2H), 7.14 -
7.36 (m, 5H), 7.40 - 7.50 (m, 1H), 7.79 (dd, 1H), 7.90 - 7.99 (m, 1H), 8.29
(dd, 1H), 9.04 (d, 1H), 10.30
(s, 1H).
174

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 4): Rt = 1.16 min; MS (ESIpos): rniz = 364 [m+H].
Intermediate 117
N-[6-(2-fluorophenyl)pyridin-3-y1]-4-(methylsulfany1)-3-nitrobenzamide
H
N 0
I
0
140:I
F NO2.
,S
H3C
5.296 g (28.148 mmol) of 6-(2-fluorophenyl)pyridin-3-amine (intermediate 114),
5.0 g (23.45 mmol)
of 4-(methylsulfanyI)-3-nitrobenzoic acid and 14.644 g (28.14 mmol) of PYBOP
were dissolved in 150
mL of anh DMF. 4.9 mL (28.14 mmol) of N-ethyl-N-isopropylpropan-2-amine were
added. It was
stirred at rt over night. The reaction mixture was concentrated to
approximately 50% of the original
volume. The reaction mixture was added dropwise into water. The solid material
was filtered off and
60 mL of Et0Ac were added. It was stirred under heat so that some material was
dissolved and then
it was allowed to reacht rt. The solid was filtered off yielding 8.57 g (75%)
of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 2.62 (s, 3H), 7.28 - 7.38 (m, 2H), 7.42
- 7.51 (m, 1H), 7.77 (d,
1H), 7.81 - 7.88 (m, 1H), 7.92 - 8.00 (m, 1H), 8.28 - 8.36 (m, 2H), 8.90 (d,
1H), 9.08 (d, 1H), 10.84 (s,
1H).
LC-MS (Method 4): Rt = 1.27 min; MS (ESIpos): rniz = 384 [m+H].
Intermediate 118
3-amino-N-[6-(2-fluorophenyl)pyridin-3-yI]-4-(methylsulfanyl)benzamide
H
N 0
I
0 N
0
F NH2
,S
H3C
8.07 g (21.04 mmol) of N-[6-(2-fluorophenyl)pyridin-3-y1]-4-(methylsulfany1)-3-
nitrobenzamide
(intermediate 117) were dissolved in 389 mL of methanol and 389 mL of THE.
1.277 g of 10%
palladium on charcoal (with 50% water) were added and the resulting mixture
was stirred at 60 C
175

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
over night under an atmosphere of hydrogen. This reaction was combined with a
reaction mixture of
a 0.5 g batch of the same material. The catalyst was filtered off. The
filtrate was concentrated to
yield 7.61 g (96%) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 2.43 (s, 3H), 5.33 (s, 2H), 7.18 - 7.36
(m, 5H), 7.41 - 7.50 (m,
1H), 7.80 (dd, 1H), 7.95 (td, 1H), 8.29 (dd, 1H), 9.05 (d, 1H), 10.43 (s, 1H).
LC-MS (Method 4): Rt = 1.14 min; MS (ESIpos): m/z = 344 [M+H].
Intermediate 119
4-tert-butyl-N-(6-chloropyridin-3-yI)-3-nitrobenzamide
0
I
CI
NO2
HO OH3
OH3
500 mg (2.24 mmol) of 4-tert-butyl-3-nitrobenzoic acid and 345 mg (2.69 mmol)
of 6-chloropyridin-3-
amine were dissolved in 13.8 mL of anh DMF. 1.83 mL (3.14 mmol) of 2,4,6-
tripropy1-1,3,5,2,4,6-
trioxatriphosphinane 2,4,6-trioxide (50% in DMF) and 1.95 mL (11.20 mmol) of N-
ethyl-N-
isopropylpropan-2-amine were added. It was stirred 24 h at rt. The reaction
mixture was poured into
water and extracted three times with Et0Ac. The combined organic phases were
dried over sodium
sulfate and concentrated affording 720 mg (96%) of the title compound.
LC-MS (Method 3): Rt = 1.31 min; MS (ESIpos): m/z = 334 [M+H].
Intermediate 120
4-tert-butyl-N46-(2-fluorophenyppyridin-3-y1]-3-nitrobenzamide
N 0
NO2
H C CH
3 CH3 3
176

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
720 mg (2.16 mmol) of 4-tert-butyl-N-(6-chloropyridin-3-yI)-3-nitrobenzamide
(intermediate 119),
453 mg (3.24 mmol) of (2-fluorophenyl)boronic acid and 596 mg (4.31 mmol) of
potassium carbonate
were suspended in 21.8 mL of a mixture of DME/water 3:1 and purged with argon.
88 mg (0.11
mmol) [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) complex with
dichloromethane
were added and the reaction tube was closed immediately. It was stirred for 1
h at 150 C in the
microwave reactor. The reaction mixture was poured into water and extracted
three times with a
mixture of dichloromethane/isopropanol 4:1. The combined organic phases were
washed with
aqueous saturated sodium chloride solution, dried over sodium sulfate and
concentrated. The solid
was triturated with ethanol yielding 402 mg (45%) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 1.36 (s, 9H), 7.25 - 7.34 (m, 2H), 7.39
- 7.48 (m, 1H), 7.78 -
7.83 (m, 1H), 7.85 (d, 1H), 7.89 - 7.97 (m, 1H), 8.09 - 8.17 (m, 2H), 8.27
(dd, 1H), 9.02 (d, 1H), 10.68 (s,
1H).
LC-MS (Method 3): Rt = 1.43 min; MS (ESIpos): m/z = 394 [M+H].
Intermediate 121
3-amino-4-tert-butyl-N-[6-(2-fluorophenyl)pyridin-3-yl]benzamide
H
N 0
I
0 N
0
F NH2
CH
H3C CH3 3
375 mg (0.95 mmol) of 4-tert-butyl-N-[6-(2-fluorophenyl)pyridin-3-y1]-3-
nitrobenzamide
(intermediate 120) were dissolved in 5 mL of THE. At 0 C 6.5 mL (7.63 mmol)
of titanium(III)chloride
(15% in 10% aqueous hydrochloride) were added. It was stirred over night at
rt. 3.25 mL (3.81 mmol)
of titanium(III)chloride (15% in 10% aqueous hydrochloride) were added and it
was stirred for 12 h at
rt and for 5 h at 50 C. The reaction mixture was cooled down and on an ice
bath the reaction was
neutralized with solid sodium hydrogen carbonate under vigorous stirring. The
suspension was
diluted with water and extracted with a mixture of Et0Ac/THF twice. The
combined organic layers
were dried over sodium sulfate and concentrated affording 280 mg (81%) of the
title compound.
LC-MS (Method 3): Rt = 1.28 min; MS (ESIpos): m/z = 364 [M+H].
Intermediate 122
4-tert-butyl-3-[(2-chloropropanoyl)amino]-N-[6-(2-fluorophenyl)pyridin-3-
yl]benzamide
177

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
I
0 N
0 NYyCl
F
H
CH3
H C CH
3 CH3 3
280 mg (0.77 mmol) of 3-amino-4-tert-butyl-N-[6-(2-fluorophenyl)pyridin-3-
yl]benzamide
(intermediate 121) were suspended in 5.0 mL of anh dichloromethane. 0.125 mL
(1.54 mmol) of anh
pyridine were added. On an ice bath 82 uL (0.85 mmol) of 2-chloropropanoyl
chloride were added. It
was stirred for 5 h at rt. 63 uL (0.78 mmol) of anh pyridine and 75 uL (0.77
mmol) of 2-
chloropropanoyl chloride were added. It was stirred for 12 h at rt. The
reaction mixture was
evaporated to dryness and used without further purification.
LC-MS (Method 3): Rt = 1.32 min; MS (ESIpos): m/z = 454 [M+H].
Intermediate 123
4 -tert-butyl-3-nitro-N-(5-phenyl-1,3-thiazol-2-yl)benzamide
H
NN 0
\ i
S 0
. NO2
H C CH
3 CH3 3
500 mg (2.24 mmol) of 4-tert-butyl-3-nitrobenzoic acid and 474 mg (2.69 mmol)
of 5-phenyl-1,3-
thiazol-2-amine were dissolved in 13.8 mL of anh DMF. 1.63 g (3.14 mmol) of
PYBOP and 1.17 mL
(6.72 mmol) of N-ethyl-N-isopropylpropan-2-amine were added. It was stirred
for 24 h at rt. The
reaction mixture was poured into water and extracted three times with Et0Ac.
The combined organic
phases were dried over sodium sulfate and concentrated affording 650 mg (73%)
of the title
compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 1.35 (s, 9H), 7.25 - 7.32 (m, 1H), 7.36
- 7.44 (m, 2H), 7.59 -
7.66 (m, 2H), 7.84 (d, 1H), 7.95 (s, 1H), 8.19 - 8.24 (m, 1H), 8.26 (d, 1H),
12.89 (s, 1H).
Intermediate 124
3-amino-4-tert-butyl-N-(5-phenyl-1,3-thiazol-2-yl)benzamide
178

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN 0
\ ...-.r
S 0
. NH2
H3C H
C CH3 3
565 mg (1.48 mmol) of 4-tert-butyl-3-nitro-N-(5-phenyl-1,3-thiazol-2-
yl)benzamide (intermediate
123) were dissolved in 7.5 mL of THE. At 0 C 4.6 mL (11.8 mmol) of
titanium(III)chloride (15% in 10%
aqueous hydrochloride) were added. It was stirred over night at rt. 1.15 mL
(2.95 mmol) of
titanium(III)chloride (15% in 10% aqueous hydrochloride) were added and it was
stirred at rt and 40
C till the starting material was consumed. The reaction mixture was cooled
down and on an ice bath
the reaction was neutralized with solid sodium hydrogen carbonate under
vigorous stirring. The
suspension was diluted with water and extracted with a mixture of Et0Ac/THF
twice. The combined
organic layers were dried over sodium sulfate and concentrated affording 700
mg of the title
compound.
LC-MS (Method 3): Rt = 1.26 min; MS (ESIpos): m/z = 352 [M+H].
Intermediate 125
4-tert-butyl-3-[(2-chloropropanoyDamino]-N-(5-phenyl-1,3-thiazol-2-
yl)benzamide
H
N N 0
\ ......r
S 0
1111P N)y CI
H
CH3
H C CH3
CH3
3
527 mg (1.50 mmol) of 3-amino-4-tert-butyl-N-(5-phenyl-1,3-thiazol-2-
yl)benzamide (intermediate
124) were suspended in 8.8 mL of anh dichloromethane. 0.255 mL (3.15 mmol) of
anh pyridine were
added. On an ice bath 153 uL (1.58 mmol) of 2-chloropropanoyl chloride were
added. It was stirred
for 5 h at rt. 121 uL (1.50 mmol) of anh pyridine and 146 uL (1.50 mmol) of 2-
chloropropanoyl
chloride were added. It was stirred for 12 h at rt. The reaction mixture was
evaporated to dryness
and used without further purification.
Intermediate 126
179

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
3-{[(4-methylpiperazin-1-ypacetyl]amino}-4-(trifluoromethoxy)benzoic acid
hydrochloride (1:1)
HO 0
H¨Cl
r-NCH3
0
N
H
F

r 0
F>
F
To a solution of intermediate 19 (1.50 g, 5.04 mmol) in DMF (45 mL) was added
triethylamine (1.05
mL, 7.56 mmol), potassium iodide (126 mg, 0.76 mmol) and 1-methylpiperazine
(0.84 mL, 7.56
mmol). The reaction mixture was stirred over night at room temperature. The
mixture was
concentrated. The remaining residue was triturated with water, and a 1M
aqueous solution of
hydrogen chloride was added until a pH of 4 was achieved. The mixture was
saturated with sodium
chloride and extracted three times with a mixture of DCM/isopropanol 4:1. The
combined organic
phases were dried over sodium sulfate and concentrated to yield the desired
crude material (1.62 g,
69%), which was used in the next step without further purification.
'H-NMR (300 MHz, DMSO-d6) 6 [ppm] = 2.60 (s, 3H), 2.70 - 2.85 (m, 4H), 2.90 -
3.03 (m, 4H), 3.31 (s,
2H), 7.50 - 7.60 (m, 1H), 7.81 (dd, 1H), 8.67 (d, 1H), 9.83 (s, 1H).
LC-MS (Method 4): Rt = 0.58 min; MS (ESIpos): m/z = 362 [M¨HCI+1-1]+.
Intermediate 127
2-{[(4-methylpiperazin-1-ypacetyl]amino}-4-[(5-phenyl-1,3,4-thiadiazol-2-
yl)carbamoyl]benzoic acid
hydrochloride (1:1)
H
N N 0
N
H¨Cl
IY
\ S .,...CH3
41, 0 LNON
N
H
HO 0
1.47 g (2.95 mmol) of the compound of example 105 were provided in a mixture
of 40 mL of THE and
20 mL of methanol, 5.9 mL (29.5 mmol) of a 5N aqueous solution of sodium
hydroxide was added at
room temperature and the mixture was stirred at room temperature over night.
The mixture was
diluted with ethyl acetate and water, and a 5N aqueous hydrogen chloride
solution was then added
until an acidic pH of 4 was achieved. The precipitate was filtered off, washed
with water and dried.
400 mg (28% of theory) of the title compound were obtained and used without
further purification.
180

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.67 - 2.90 (m, 6H), 2.94 - 3.22 (m,
5H), 3.36 (s, 2H), 7.51 -
7.61 (m, 3H), 7.90 (dd, 1H), 7.95 - 8.04 (m, 2H), 8.15 (d, 1H), 9.32 (s, 1H),
11.17 (s, 1H), 11.96 (s, 1H),
13.38 (s, 1H), 14.16 (s, 1H).
LC-MS (Method 4): Rt = 0.84 min; MS (ES1pos): m/z = 481 [M-HC1+H].
Intermediate 128
2-[(morpholin-4-ylacetypamino]-4-[(5-pheny1-1,3,4-thiadiazol-2-
yl)carbamoyl]benzoic acid
H
N 0
N/N-----;(
\ s
4111
N
H
HO 0
1.40 g (2.68 mmol) of the compound of example 106 were provided in a mixture
of 40 mL of THE and
20 mL of methanol, 5.5 mL (26.8 mmol) of a 5N aqueous solution of sodium
hydroxide was added at
room temperature and the mixture was stirred at room temperature over night.
The mixture was
diluted with ethyl acetate and water, and a 5N aqueous hydrogen chloride
solution was then added
until an acidic pH of 4 was achieved. The precipitate was filtered off, washed
with water and dried.
1.15 g (92% of theory) of the title compound were obtained and used without
further purification.
LC-MS (Method 4): Rt = 0.88 min; MS (ES1pos): m/z = 468 [M+H].
Intermediate 129
4-methyl-3-nitro-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
H
N 0
\
N/Nz---;(
s
It 10 N
CH3 O2
To a solution of 4-methyl-3-nitrobenzoic acid (2.00 g, 11.0 mmol) and 5-pheny1-
1,3,4-thiadiazol-2-
amine (2.54 g, 14.4 mmol, 1.3 equiv) in DMF (43 mL) was added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 11.5 g, 22.1 mmol,
2 equiv) and
diisopropylethylamine (7.7 mL, 44.2 mmol, 4 equiv). The resulting mixture was
stirred at room
temperature over night, then triturated with a mixture of water and ethanol.
The precipitate was
181

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
collected by filtration, washed with water and dried under reduced pressure at
50 C. 2.71 g (69% of
theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.62 (s, 3H), 7.52 - 7.60 (m, 3H),
7.72 (d, 1H), 7.95 - 8.03 (m,
2H), 8.35 (dd, 1H), 8.77 (d, 1H), 13.49 (s, 1H).
LC-MS (Method 4): Rt = 1.26 min; MS (ESIpos): m/z = 341 [M+H].
Intermediate 130
3-amino-4-methyl-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
NN 0
N\
/ y S
41, 10 NH2
CH3
2.71 g (7.96 mmol) of the compound of intermediate 129 were provided in a
mixture of 200 mL of a
mixture of THE and ethanol (3/2). 2.11 g of palladium on charcoal (10% Pd, 50%
water) were added,
and the mixture was stirred under a hydrogen atmosphere at room temperature
for 3 h. After
filtration, the solvents were evaporated yielding 2.36 g (86% of theory) of
the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.13 (s, 3H), 5.17 (s, 2H), 7.09 (d,
1H), 7.25 - 7.37 (m, 2H),
7.47 - 7.61 (m, 3H), 7.91 - 8.04 (m, 2H), 12.87 (s, 1H).
LC-MS (Method 3): Rt = 0.61 min; MS (ESIpos): m/z = 311 [M+H].
Intermediate 131
4-(cyclopropyloxy)-3-nitro-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
NN 0
/ :=-=,-;r
N
\ S
411. 1NO2
V0
2.00 g (8.96 mmol) of 4-(cyclopropyloxy)-3-nitrobenzoic acid were dissolved in
20 mL of anhydrous
DMF. 1.9 g (10.75 mmol) of 5-phenyl-1,3,4-thiadiazol-2-amine and 5.6 g (10.75
mmol) of PYBOP were
182

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
added. Finally, 4.7 mL (26.98 mmol) of N-ethyl-N-isopropylpropan-2-amine were
added. It was
stirred for 2 h at rt. 30 mL of water were added and the solid was filtered
off, washed three times
with water and dried at 45 C under vacuum yielding 4.27 g of the title
compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 0.75 - 0.96 (m, 4H), 4.18 - 4.27 (m,
1H), 7.50 - 7.59 (m, 3H),
7.81 (d, 1H), 7.94 - 8.02 (m, 2H), 8.45 (dd, 1H), 8.72 (d, 1H), 13.37 (br. s,
1H).
LC-MS (Method 4): Rt = 1.28 min; MS (ESIpos): m/z = 383 [M+H].
Intermediate 132
3-amino-4-(cyclopropyloxy)-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
NN 0
N\
/ y S
4. ______________________________________ 1401 N H2
0
\I
2.00 g (5.23 mmol) of 4-(cyclopropyloxy)-3-nitro-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide
(intermediate 131) were dissolved in a mixture of 200 mL of methanol / THF
1:1. 334 mg of 10%
palladium on charcoal and two drops of water were added. It was stirred for 6
h under an
atmosphere of hydrogen. 223 mg of 10% palladium on charcoal were added and it
was stirred under
an atmosphere of hydrogen over night. 111 mg of 10% palladium on charcoal were
added it was
stirred for 5 h under an atmosphere of hydrogen. The catalyst was filtered off
over celite and washed
with methanol. The filtrate was concentrated and and the residue was stirred
in a mixture of 400 mL
of methanol / water 1:1 at 50 C for 1 h. It was allowed to reach rt. The
solid was filtered off and
dried affording 1.12 g (61%) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 0.68 - 0.87 (m, 4H), 3.92 - 3.98 (m,
1H), 5.00 (s, 2H), 7.20 (d,
1H), 7.37 (d, 1H), 7.48 - 7.59 (m, 4H), 7.95 - 8.02 (m, 2H), 12.84 (s, 1H).
LC-MS (Method 4): Rt = 1.17 min; MS (ESIpos): m/z = 353 [M+H].
Intermediate 133
4-chloro-3-nitrobenzoyl chloride
183

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Cl 0
1 NO2
CI
4.40 g (21.8 mmol) of 4-chloro-3-nitrobenzoic acid were stirred in 110 mL of
dichloromethane at
room temperature. 0.17 mL (2.18 mmol) of DMF and 2.3 mL (26.2 mmol) of oxalyl
chloride were
added, and the mixture was stirred for additional 3 h at 50 C after the gas
formation had stopped.
1.1 mL (13.1 mmol) of oxalyl chloride were added, and the mixture was stirred
for additional 2 h at
50 C after the gas formation had stopped. After concentration, 4.4 g of raw
material were obtained,
which were used without further purification.
Intermediate 134
4-chloro-3-nitro-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
N N 0
/ ::-..--.--r
N
\ S 0
4. NO2
CI
To a suspension of 1.95 g (11.0 mmol, 1.1 equiv) of 5-phenyl-1,3,4-thiadiazol-
2-amine and 7.0 mL
(50.0 mmol, 5 equiv) of triethylamine in 80 mL of a 1:1 mixture of
THF/dichloromethane were added
2.20 g (10.0 mmol) of the compound of intermediate 133. The reaction mixture
was stirred at room
temperature over night. 7.0 mL (50.0 mmol, 5 equiv) of triethylamine, 100 mL
of a 1:1 mixture of
THF/dichloromethane and 2.20 g (10.0 mmol) of the compound of intermediate 133
were added and
the reaction mixture was stirred at room temperature over night. After
concentration, the remaining
solid was triturated with a mixture of 300 mL of a saturated, aqueous solution
of sodium bicarbonate
and 300 mL of ethanol, stirred for 30 minutes, collected by filtration and
dried. The remaining solid
was triturated with 500 mL of water, stirred for 30 minutes, collected by
filtration and dried. 2.55 g
(69% of theory) of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 7.51 - 7.62 (m, 3H), 7.94 - 8.06 (m,
3H), 8.39 (dd, 1H), 8.81
(d, 1H), 13.69 (s, 1H).
LC-MS (Method 4): Rt = 1.28 min; MS (ESIpos): m/z = 361 [M+H].
Intermediate 135
184

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
3-amino-4-chloro-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
NN 0
/ yN
\ S
44, 0 NH2
CI
To a suspension of the compound of intermediate 134 (2.50 g, 6.93 mmol) in 100
mL of
tetrahydrofuran was added a 15% solution of titanium(III) chloride in 10%
hydrogen chloride
dropwise (58.9 mL, 69.3 mmol, 10 equiv) at 0 C. The reaction mixture was
allowed to warm up to
room temperature and was stirred overnight. The pH of the mixture was adjusted
under stirring with
solid sodium bicarbonate to 7. The suspension was saturated with solid sodium
chloride and stirred
with 250 mL of a 1:1 mixture of tetrahydrofuran/ethyl acetate for 2 h. The
suspension was filtered
and the filtrate was washed with brine, dried over sodium sulfate and
concentrated under reduced
pressure. 1.15 g (50% of theory) of the title compound were obtained, which
were used without
further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 5.69 (s, 2H), 7.30 - 7.40 (m, 2H), 7.49
(d, 1H), 7.52 - 7.57 (m,
3H), 7.96 - 8.01 (m, 2H), 13.04 (s, 1H).
LC-MS (Method 1): Rt = 1.20 min; MS (ESIpos): m/z = 331 [M+H].
Intermediate 136
4-chloro-3-[(chloroacetyl)amino]-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
N N 0
/
N
\y S
N
H
CI
0.50 g (1.51 mmol) of the compound of intermediate 135 were provided in 20 mL
of toluene, 0.18 mL
(2.27 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 2 h at 100 C. After
concentration, 0.62 g of the title compound were obtained, which were used
without further
purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 4.43 (s, 2H), 7.50 - 7.61 (m, 3H), 7.75
(d, 1H), 7.94 - 8.05 (m,
3H), 8.51 (d, 1H), 10.10 (s, 1H), 13.36 (s, 1H).
LC-MS (Method 4): Rt = 1.19 min; MS (ESIpos): m/z = 407 [M+H].
185

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Intermediate 137
4-cyano-3-nitrobenzoyl chloride
Cl 0
1 NO2
I I
N
LOU g (5.20 mmol) of 4-cyano-3-nitrobenzoic acid was stirred in 25 mL of
dichloromethane at room
temperature. 0.04 mL (0.49 mmol) of DMF and 0.51 mL (5.82 mmol) of oxalyl
chloride were added,
and the mixture was stirred for additional 2 h at 50 C after the gas
formation had stopped. After
concentration, 1.02 g of raw material were obtained, which were used without
further purification.
Intermediate 138
4-cyano-3-nitro-N-(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide
H
NN 0
N(( --:-.-.-
S 0
= NO2
I I
N
To a suspension of 926 mg (5.22 mmol, 1.1 equiv) of 5-phenyl-1,3,4-thiadiazol-
2-amine and 3.3 mL
(23.7 mmol, 5 equiv) of triethylamine in 40 mL of a 1:1 mixture of
THF/dichloromethane was added
1.00 g (4.75 mmol) of the compound of intermediate 137. The reaction mixture
was stirred at room
temperature over night. The reaction mixture was diluted with dichloromethane
and was washed
with a diluted, aqueous solution of hydrogen chloride. The precipitate was
collected by filtration,
washed with water and dried. 0.45 g (27% of theory) of the title compound were
obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 7.52 - 7.59 (m, 3H), 7.94 - 8.03 (m,
2H), 8.37 (d, 1H), 8.61
(dd, 1H), 9.02 - 9.08 (m, 1H), 14.05 (s, 1H).
LC-MS (Method 4): Rt = 1.17 min; MS (ESIpos): m/z = 352 [M+H].
Intermediate 139
186

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
3-amino-4-cyano-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
H
NN 0
N\( S.
. NH2
I I
N
To a suspension of the compound of intermediate 138 (50 mg, 0.14 mmol) in 2 mL
of tetrahydrofuran
was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride
dropwise (1.2 mL, 1.42
mmol, 10 equiv) at 0 C. The reaction mixture was allowed to warm up to room
temperature and was
stirred for 2 h. To a suspension of the compound of intermediate 138 (400 mg,
1.14 mmol) in 16 mL
of tetrahydrofuran was added a 15% solution of titanium(III) chloride in 10%
hydrogen chloride
dropwise (9.7 mL, 11.4 mmol, 10 equiv) at 0 C. The reaction mixture was
allowed to warm up to
room temperature and was stirred for 2 h. Both reaction mixtures were combined
and the pH was
adjusted under stirring with solid sodium bicarbonate to 7. The suspension was
saturated with solid
sodium chloride and stirred with 30 mL of a 1:1 mixture of
tetrahydrofuran/ethyl acetate for 2 h. The
suspension was filtered and the filtrate was washed with brine, dried over
sodium sulfate and
concentrated under reduced pressure. 63.0 mg of the title compound were
obtained, which were
used without further purification. The precipitate from the extraction with a
1:1 mixture of
tetrahydrofuran/ethyl acetate was triturated with a 4:1 mixture of
dichloromethane and
isopropanol. The filtrate was washed with brine, dried over sodium sulfate and
concentrated under
reduced pressure. 40.0 mg of the title compound were obtained, which were used
without further
purification.
LC-MS (Method 4): Rt = 1.08 min; MS (ESIpos): m/z = 322 [M+H].
Intermediate 140
3-[(chloroacetypamino]-4-cyano-N-(5-phenyl-1,3,4-thiadiazol-2-yObenzamide
H
NN 0
/ --::::r
N
\ S,0
4.
H
I I
N
0.10 g (0.31 mmol) of the compound of intermediate 139 were provided in 3.6 mL
of toluene, 0.04
mL (0.47 mmol) of chloroacetyl chloride were added, and the mixture was
stirred for 2 h at 100 C.
187

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
After concentration, 120 mg of the title compound were obtained, which were
used without further
purification.
LC-MS (Method 1): Rt = 1.17 min; MS (ESIpos): m/z = 398 [M+H].
Intermediate 141
3-amino-4-(difluoromethoxy)benzoic acid
HO 0
1401 NH2
FO
I
F
2.50 g (10.7 mmol) of 4-(difluoromethoxy)-3-nitrobenzoic acid were provided in
50 mL of methanol.
0.57 g of palladium on charcoal (10% Pd, 50% water) were added, and the
mixture was stirred under
a hydrogen atmosphere at room temperature for 1.25 h. After filtration, the
solvents were
evaporated. 2.16 g (99% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 5.29 (s, 2H), 7.04 (d, 1H), 7.13 (dd,
2H), 7.14 (t, 1H), 7.38 (d,
1H), 12.69 (s, 1H).
LC-MS (Method 1): Rt = 0.76 min; MS (ESIpos): m/z = 204 [M+H].
Intermediate 142
3-amino-4-(difluoromethoxy)-N45-(2-methylpheny1)-1,3,4-thiadiazol-2-
yl]benzamide
H
NN 0
/
N
\y S
H3C
0
4. NH2
FO
I
F
To a solution of the compound of intermediate 141 (0.50 g, 2.46 mmol) and 5-(2-
methylphenyI)-
1,3,4-thiadiazol-2-amine (941 mg, 4.92 mmol, 2 equiv) in DMF (8 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 2.56 g, 4.92 mmol,
2 equiv) followed
188

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
by diisopropylethylamine (2.1 mL, 12.3 mmol, 5 equiv). The resulting mixture
was stirred at room
temperature over night and was then concentrated. The remaining solid was
triturated with 15 mL of
ethanol, stirred for 15 minutes, collected by filtration and dried. The
remaining solid was triturated
with 30 mL of ethanol, stirred for 15 minutes at 80 C, collected by
filtration at 55 C and dried. The
residue (0.25 g) was purified using HPLC (column: chromatorex C18, 10um,
195x51mm, mobile
phase: acetonitrile/water gradient) to give the title compound (404 mg, 42%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.53 (s, 3H), 5.42 (s, 2H), 7.13 (d,
1H), 7.21 (t, 1H), 7.33 - 7.45
(m, 4H), 7.48 (d, 1H), 7.70 (d, 1H), 12.97 (s, 1H).
LC-MS (Method 1): Rt = 1.26 min; MS (ESIpos): m/z = 377 [M+H].
Intermediate 143
3-[(chloroacetypamino]-4-(difluoromethoxy)-N45-(2-methylpheny1)-1,3,4-
thiadiazol-2-yl] benzamide
H
NN 0
/ ---zz.-r
N
\ S
H3C
4. 10 LCI
N
H
FO
I
F
200 mg (0.52 mmol) of the compound of intermediate 142 were provided in 4 mL
of toluene, 0.06 mL
(0.77 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 2 h at 100 C. The
precipitate was collected by filtration, washed with ethyl acetate and dried
to yield 121 mg of the
title compound, which were used without further purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.54 (s, 3H), 4.43 (s, 2H), 7.34 - 7.48
(m, 4H), 7.38 (t, 1H),
7.71 (d, 1H), 8.05 (dd, 1H), 8.71 (d, 1H), 9.99 (s, 1H), 13.22 (s, 1H).
LC-MS (Method 3): Rt = 0.74 min; MS (ESIpos): m/z = 453 [M+H].
Intermediate 144
4-(methoxymethyl)-N45-(2-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-nitrobenzamide
189

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N N
/
N\y 0
H3C S Si
4. NO2
0
I
CH3
To a solution of the compound of intermediate 49 (LOU g, 4.74 mmol) and 5-(2-
methylpheny1)-1,3,4-
thiadiazol-2-amine (755 mg, 3.95 mmol) in DMF (15 mL) was added (benzotriazol-
1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 4.11 g, 7.89 mmol,
2 equiv) followed
by diisopropylethylamine (3.4 mL, 19.7 mmol, 5 equiv). The resulting mixture
was stirred at room
temperature for 3 days. After concentration, the remaining solid was
triturated with a mixture of 100
mL of water and 70 mL of ethanol, stirred for 30 minutes, collected by
filtration and dried. The
remaining solid was triturated with 100 mL of ethanol, stirred under reflux,
collected by filtration and
dried to yield the title compound (1.27 g, 75% of theory).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.54 (s, 3H), 3.41 (s, 3H), 4.86 (s,
2H), 7.34 - 7.40 (m, 1H),
7.40 - 7.47 (m, 2H), 7.71 (d, 1H), 7.92 (d, 1H), 8.48 (dd, 1H), 8.84 (d, 1H),
13.64 (s, 1H).
LC-MS (Method 3): Rt = 0.71 min; MS (ESIpos): m/z = 385 [M+H].
Intermediate 145
3-amino-4-(methoxymethyl)-N45-(2-methylpheny1)-1,3,4-thiadiazol-2-yl]
benzamide
H
N N
NN\(0
/ y
S
H3C
1401
4. NH2
0
I
CH3
1.20 g (3.12 mmol) of the compound of intermediate 144 were provided in 80 ml
of a 1:1 mixture of
THE and ethanol and 10 ml of 2-methyltetrahydrofuran. 0.25 g of palladium on
charcoal (10% Pd,
50% water) were added, and the mixture was stirred under a hydrogen atmosphere
at room
temperature for 1 h. 0.5 g of palladium on charcoal (10% Pd, 50% water) were
added, and the
mixture was stirred under a hydrogen atmosphere at room temperature for 4 h.
The reaction
mixture was left under a nitrogen atmosphere over night. 0.25 g of palladium
on charcoal (10% Pd,
50% water) were added, and the mixture was stirred under a hydrogen atmosphere
at room
190

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
temperature for 2 h. The reaction mixture was left under a nitrogen atmosphere
over night. After
filtration, the solvents were evaporated. 1.06 g (86% of theory) of the title
compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 2.53 (s, 3H), 3.31 (s, 3H), 4.38 (s,
2H), 5.26 (s, 2H), 7.18 - 7.25
(m, 1H), 7.30 - 7.45 (m, 5H), 7.70 (d, 1H), 12.92 (s, 1H).
LC-MS (Method 1): Rt = 1.15 min; MS (ESIpos): m/z = 355 [M+H].
Intermediate 146
3-[(chloroacetypamino]-4-(methoxymethyl)-N45-(2-methylpheny1)-1,3,4-thiadiazol-
2-yl]benzamide
H
NN 0
/ ---zzr
N
\ S
H3C
446. 0 LCI
N
H
0
I
CH3
0.30 g (0.85 mmol) of the compound of intermediate 145 were provided in 12 mL
of toluene, 0.1 mL
(1.27 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 2 h at 100 C. After
concentration 360 mg of the title compound were obtained, which were used
without further
purification.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.54 (s, 3H), 3.37 (s, 3H), 4.40 (s,
2H), 4.52 (s, 2H), 7.33 - 7.47
(m, 3H), 7.59 (d, 1H), 7.71 (d, 1H), 8.02 (dd, 1H), 8.35 (s, 1H), 9.90 (s,
1H), 13.26 (s, 1H).
LC-MS (Method 1): Rt = 1.23 min; MS (ESIpos): m/z = 431 [M+H].
Intermediate 147
3-amino-4-(difluoromethoxy)-N45-(2-fluoropheny1)-1,3,4-thiadiazol-2-yl]
benzamide
H
NN 0
/ ---zzr
N\ S
F
1401
4. NH2
FO
I
F
191

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To a solution of the compound of intermediate 141 (0.80 g, 3.94 mmol) and 5-(2-
fluoropheny1)-
1,3,4-thiadiazol-2-amine (1.15 g, 5.91 mmol, 1.5 equiv) in DMF (12 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 3.07 g, 5.91 mmol,
1.5 equiv)
followed by diisopropylethylamine (2.1 mL, 11.8 mmol, 3 equiv). The resulting
mixture was stirred at
room temperature for 6 h. (Benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate
(PYBOP, 3.07 g, 5.91 mmol, 1.5 equiv) and diisopropylethylamine (2.1 mL, 11.8
mmol, 3 equiv) were
added, the resulting mixture was stirred at room temperature over night and
was then concentrated.
The remaining solid was triturated with a mixture of 100 mL of water and 70 mL
of ethanol, stirred
for 30 minutes, collected by filtration and dried. The remaining solid was
triturated with 100 mL of
ethanol, stirred at 80 C, collected by filtration at 40 C and dried to give
the title compound (965 mg,
64%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 5.44 (s, 2H), 7.13 (d, 1H), 7.21 (t,
1H), 7.37 - 7.53 (m, 4H),
7.58 - 7.66 (m, 1H), 8.23 - 8.33 (m, 1H), 13.06 (s, 1H).
LC-MS (Method 4): Rt = 1.15 min; MS (ESIpos): m/z = 381 [M+H].
Intermediate 148
3-[(chloroacetypamino]-4-(difluoromethoxy)-N45-(2-fluoropheny1)-1,3,4-
thiadiazol-2-yl]benzamide
H
NN 0
N
\ S
F
4. 0 )UCI
N
H
FO
I
F
0.70 g (1.84 mmol) of the compound of intermediate 147 were provided in 26 mL
of toluene, 0.22 mL
(2.76 mmol) of chloroacetyl chloride were added, and the mixture was stirred
for 2 h at 100 C. After
concentration 840 mg of the title compound were obtained, which were used
without further
purification.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 4.43 (s, 2H), 7.38 - 7.54 (m, 3H), 7.39
(t, 1H), 7.55 - 7.67 (m,
1H), 8.06 (dd, 1H), 8.25 - 8.34 (m, 1H), 8.72 (d, 1H), 10.01 (s, 1H), 13.34
(s, 1H).
LC-MS (Method 4): Rt = 1.20 min; MS (ESIpos): m/z = 457 [M+H].
Examples:
Example 1
192

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
N46-(2-fluorophenyl)pyridin-3-y1]-4-methoxy-3-[(morpholin-4-ylacetypamino]
benzamide
H
N 0
F
I
N 4 0 )0. NO
N
H
0
H3C
296 mg (715 mop of the compound from intermediate 12 were provided in 2 mL of
DMF. 150 uL
(1.07 mmol) of triethylamine, 93.5 mg (1.07 mmol) of morpholine and 18.4 mg
(111 mop of
potassium iodide were added and the mixture was stirred at room temperature
over night. After
filtration, purification by HPLC (method 2) yielded 63.0 mg (19% of theory) of
the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.54 - 2.61 (m, 4H), 3.19 (s, 2H),
3.65 - 3.72 (m, 4H), 4.00 (s,
3H), 7.24 (d, 1H), 7.28 - 7.37 (m, 2H), 7.42 - 7.50 (m, 1H), 7.77 - 7.85 (m,
2H), 7.92 - 8.00 (m, 1H), 8.30
(dd, 1H), 8.81 (d, 1H), 9.06 (d, 1H), 9.80 (s, 1H), 10.48 (s, 1H).
LC-MS (Method 1): Rt = 0.89 min; MS (ESIpos): m/z = 465 [M+H].
Example 2
N-[6-(2-fluorophenyl)pyridin-3-yI]-4-methoxy-3-[(8-oxa-3-azabicyclo[3.2.1]oct-
3-
ylacetyl)amino] benzamide
H
N 0
F
I
N 40 J0NicI3,
N
H
0
H3C
296 mg (715 mop of the compound from intermediate 12 were provided in 2 mL of
DMF. 0.25 mL
(1.79 mmol) of triethylamine, 161 mg (1.07 mmol) of 8-oxa-3-
azabicyclo[3.2.1]octane hydrochloride
and 18.4 mg (111 mop of potassium iodide were added and the mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (method 2)
yielded 81.0 mg (22% of
theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.84 - 1.93 (m, 2H), 2.04 - 2.12 (m,
2H), 2.43 - 2.49 (m, 2H),
2.62 - 2.69 (m, 2H), 3.11 (s, 2H), 3.99 (s, 3H), 4.26 - 4.32 (m, 2H), 7.26 (d,
1H), 7.29 - 7.36 (m, 2H), 7.42
- 7.50 (m, 1H), 7.77 - 7.84 (m, 2H), 7.93 - 8.00 (m, 1H), 8.30 (dd, 1H), 8.92
(d, 1H), 9.07 (d, 1H), 9.79 (s,
1H), 10.48 (s, 1H).
193

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 1): Rt = 1.13 min; MS (ESIpos): rniz = 491 [m+H].
Example 3
N46-(2-fluorophenyl)pyridin-3-y1]-4-methoxy-3-{[(15,45)-2-oxa-5-
azabicyclo[2.2.1]hept-5-
ylacetyl]aminolbenzamide
H
N 0
F
I
0 0 LIS)
N
H
0
H3C
The preparation of the title compound was conducted in analogy to the
synthesis of the compound
from example 1 starting with 253 mg (611 mop of the compound from
intermediate 12, 124 mg
(917 mop of (15,45)-2-oxa-5-azabicyclo[2.2.1]heptane hydrochloride and 256 uL
(1.83 mmol) of
triethylamine. 111 mg (37% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.64 - 1.71 (m, 1H), 1.81 - 1.87 (m,
1H), 2.68 - 2.74 (m, 1H),
2.85 - 2.92 (m, 1H), 3.40 (s, 2H), 3.57 - 3.65 (m, 2H), 3.84 (d, 1H), 3.97 (s,
3H), 4.44 (s, 1H), 7.24 (d,
1H), 7.29 - 7.37 (m, 2H), 7.43 - 7.50 (m, 1H), 7.81 (ddd, 2H), 7.93 - 7.99 (m,
1H), 8.30 (dd, 1H), 8.84 (d,
1H), 9.06 (d, 1H), 9.84 (s, 1H), 10.50 (s, 1H).
LC-MS (Method 4): Rt = 0.82 min; MS (ESIpos): rniz = 477 [m+H].
Example 4
4-methoxy-3-[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yl)benzamide
H
N 0
/ 1
1
0ro
= 0)-Nj
N
H
0
H3C
To a solution of 3-[(chloroacetyl)amino]-4-methoxy-N-(6-phenylpyridin-3-
yl)benzamide (prepared in
a manner analogous to that described in intermediate 13, 0.62 g, 1.56 mmol) in
DMF (20 mL) was
added morpholine (0.20 mL, 2.34 mmol, 1.5 equiv), triethylamine (0.33 mL, 2.34
mmol, 1.5 equiv)
and potassium iodide (0.040 g, 0.24 mmol, 0.16 equiv). The reaction mixture
was stirred at room
194

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
temperature for 16 h. The resulting mixture was diluted with water (25 mL).
The resulting solution
was extracted with a CH2Cl2 / isopropanol solution (4:1, 4 x 25 mL). The
combined organic phases
were concentrated under reduced pressure. The residue (0.45 g) was triturated
with methanol. The
resulting solids were washed with water, followed by methanol, then were dried
at 50 C to give 4-
methoxy-3-[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yl)benzamide
(0.52 g, 73%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.51-2.55 (m, 4H), 3.15 (s, 2H), 3.63-
3.66 (m, 4H), 3.96 (s,
3H), 7.20 (d, J=8.6 Hz, 1H), 7.37 (tt, J=2.0, 7.3 Hz, 1H), 7.45 (t, J=7.5 Hz,
2H), 7.77 (dd, J=2.3, 8.6 Hz,
1H), 7.94 (d, J=8.6 Hz, 1H), 8.03 (dm, J=7.1, 2H), 8.25 (dd, J=2.8, 8.6 Hz,
1H), 8.77 (d, J=2.3 Hz, 1H),
8.97 (d, J=2.5 Hz, 1H), 9.76 (s, 1H), 10.40 (s, 1H).
LC-MS (Method 3): Rt = 1.15 min; MS (ESIpos): m/z = 447 ([M+H], 90%), 893
([2M+H], 60%); MS
(ESIneg): m/z = 445 ([M¨H]-, 100%).
Example 5
N46-(2-fluorophenyl)pyridin-3-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
H
N 0
/ 1
I
0N 0 r'0
N
H
FO
F I
F
To a solution of 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (prepared in a manner analogous to that described
in intermediate 14,
1.29 g, 2.75 mmol) in DMF (15 mL) was added morpholine (0.36 mL, 4.13 mmol,
1.5 equiv),
triethylamine (0.58 mL, 4.13 mmol, 1.5 equiv) and potassium iodide (0.071 g,
0.43 mmol, 0.16 equiv).
The reaction mixture was stirred at room temperature for 16 h. The resulting
mixture was diluted
with water (25 mL). The resulting precipitate was washed with water followed
by ethanol, was then
dried at 50 C. The resulting solids were triturated with DMSO (10 mL) to give
N-[6-(2-
fluorophenyl)pyridin-3-yI]-3-[(morpholin-4-ylacetyl)amino]-4-
(trifluoromethoxy)benzamide (0.61 g,
43%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.53-2.57 (m, 4H), 3.20 (s, 2H), 3.60-
3.64 (m, 4H), 7.25-7.34
(m, 2H), 7.39-7.47 (m, 1H), 7.62 (d, J=8.3 Hz, 1H), 7.78-7.85 (m, 2H), 7.93
(t, J=8.2 Hz, 1H), 8.26 (dd,
J=2.5, 8.7 Hz, 1H), 8.75 (d, J=1.9 Hz, 1H), 9.02 (d, J=2.1, 1H), 9.89 (s, 1H),
10.69 (s, 1H).
LC-MS (Method 3): Rt = 1.30 min; MS (ESIpos): m/z = 519 ([M+H], 100%); MS
(ESIneg): m/z = 517
([M¨H]-, 100%).
195

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The DMSO mother liquor was concentrated under reduced pressure. The residue
was purified by
HPLC to give additional N-(biphenyl-4-y1)-4-methoxy-3-[(morpholin-4-
ylacetypamino]benzamide
(0.19 g, 13%).
Example 6
N46-(2-fluorophenyl)pyridin-3-y1]-3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-
ylacetypamino]-4-
(trifluoromethoxy)benzamide
H
N 0
/ 1
I
0 N0 Li\ST
F N
H
FO
F I
F
To a solution of 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (prepared in a manner analogous to that described
in intermediate 14,
0.15 g, 0.32 mmol) in DMF (1.5 mL) was added 8-oxa-3-azabicyclo[3.2.1]octane
HCI salt (0.072 g, 0.48
mmol, 1.5 equiv), triethylamine (0.13 mL, 0.96 mmol, 3.0 equiv) and potassium
iodide (8.2 mg, 0.050
mmol, 0.16 equiv). The reaction mixture was stirred at room temperature for 16
h, then
concentrated under reduced pressure. The residue was purified by HPLC (method
2). The resulting
solids (96 mg) were further purified by crystallization from methanol to give
N-[6-(2-
fluorophenyl)pyridin-3-yI]-3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-ylacetyl)amino]-
4-
(trifluoromethoxy)benzamide (55 mg, 30%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.76-1.81 (m, 2H), 1.93-1.98 (m, 2H),
2.41 (d, J=10.9 Hz, 2H),
2.63 (d, J=10.6 Hz, 2H), 3.14 (s, 2H), 4.20-4.26 (m, 2H), 7.27-7.32 (m, 2H),
7.41-7.47 (m, 1H), 7.62 (dd,
J=1.8, 8.6 Hz, 1H), 7.80 (dd, J=1.5, 8.8 Hz, 1H), 7.83 (dd, J=2.3, 8.8 Hz,
1H), 7.93 (td, J=2.0, 7.8 Hz, 1H),
8.27 (dd, J=2.5, 8.6 Hz, 1H), 8.82 (d, J=2.0 Hz, 1H), 9.02 (d, J=2.5, 1H),
9.56 (s, 1H), 10.69 (s, 1H).
LC-MS (Method 3): Rt = 1.35 min; MS (ESIpos): m/z = 545 ([M+H], 100%); MS
(ESIneg): m/z = 543
([M-H]-, 100%).
Example 7
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[2-(morpholin-4-yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
196

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F / 1
I
0 N r'0
. N3YN
H
FO CH3
F I
F
To a solution of 3-[(2-chloropropanoyDamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (prepared in a manner analogous to that described
in intermediate 15,
0.616 g, 1.28 mmol) in DMF (5.5 mL) was added morpholine (0.17 mL, 1.92 mmol,
1.5 equiv),
triethylamine (0.27 mL, 1.92 mmol, 1.5 equiv) and potassium iodide (32 mg,
0.20 mmol, 0.16 equiv).
The reaction mixture was stirred at room temperature for 16 h, then treated
with water (10 mL).
The resulting mixture was extracted with ethyl acetate (3 x 25 mL). The
combined organic phases
were dried (Na2SO4 anh) and concentrated under reduced pressure. The residue
(0.7 g) was purified
using MPLC (Biotage !solera; 25 g SNAP cartridge: 100% hexane 2.0 min.,
gradient to 70% hexane
/30% Et0Ac 4.0 min., 70% hexane /30% Et0Ac 2.5 min., gradient to 50% hexane
/50% Et0Ac 3.5
min., 50% hexane /50% Et0Ac 3.0 min., gradient to 24% hexane /74% Et0Ac 2.8
min., gradient to
100% Et0Ac 2.6 min., 100% Et0Ac 12.0 min.) to give racemic N46-(2-
fluorophenyl)pyridin-3-y1]-3-{[2-
(morpholin-4-yppropanoyl]aminol-4-(trifluoromethoxy)benzamide (0.41 g, 60%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.20 (d, J=6.8 Hz, 3H), 2.50-2.55 (m,
4H), 3.37 (q, J=7.1 Hz,
1H), 3.60-3.64 (m, 4H), 7.27-7.33 (m, 2H), 7.41-7.47 (m, 1H), 7.62 (dm, J=8.6
Hz, 1H), 7.81 (td, J=1.8,
8.6 Hz, 2H), 7.93 (td, J=1.5, 7.8 Hz, 1H), 8.27 (dd, J=2.5, 6.3 Hz, 1H), 8.71
(d, J=2.0 Hz, 1H), 9.02 (d,
J=2.5 Hz, 1H), 10.01 (s, 1H), 10.69 (s, 1H).
LC-MS (Method 3): Rt = 1.14 min; MS (ESIpos): m/z = 533 ([M+H], 80%); MS
(ESIneg): m/z = 531 ([M-
H]-, 100%).
Example 8
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[(25)-2-(morpholin-4-yppropanoyl]amino}-4-

(trifluoromethoxy)benzamide or
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[(2R)-2-(morpholin-4-yppropanoyl]amino}-4-

(trifluoromethoxy)benzamide
197

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F / 1
I
0 N r'0
. N5YNJ
H
FO CH3
F I
F
or
H
N 0
F / 1
I
0 N 0 r'0
N
H
FO OH3
F I
F
A sample of racemic N46-(2-fluorophenyppyridin-3-y1]-3-{[2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide (prepared as described in example 7, 0.39 g, 0.73
mmol) was separated
using chiral HPLC (System: Agilent Prep 1200, Column: Chiralpak IC Slim 250x30
mm, Solvent: hexane
/ ethanol / diethylamine 70:30:0.1 (v/v/v)) to give the second eluting
enantiomer of N46-(2-
fluorophenyl)pyridin-3-y1]-3-{[2-(morpholin-4-yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
(0.14 g, 34% from racemate).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.20 (d, J=7.1 Hz, 3H), 2.51-2.55 (m,
4H), 3.37 (q, J=7.1 Hz,
1H), 3.61-3.64 (m, 4H), 7.27-7.32 (m, 2H), 7.41-7.47 (m, 1H), 7.62 (dd, J=1.5,
8.8 Hz, 1H), 7.81 (td,
J=1.8, 8.6 Hz, 2H), 7.93 (td, J=2.0, 8.1 Hz, 1H), 8.27 (dd, J=2.5, 8.8 Hz,
1H), 8.71 (d, J=2.3 Hz, 1H), 9.02
(d, J=2.3 Hz, 1H), 10.01 (s, 1H), 10.69 (s, 1H).
LC-MS (Method 4): Rt = 1.15 min; MS (ESIpos): m/z = 533 [M+H].
Optical rotation (Method 6): [a] = + 6.4 (c = 1.00, CHCI3).
Chiral HPLC (System: Waters Alliance 2695 DAD 996 ESA: Corona, Column:
Chiralpak IC 3um 100x4.6
mm, Solvent: hexane / ethanol / diethylamine 70:30:0.1 (v/v/v)): Rt = 10.23
min, 94.6% enantiomeric
excess.
Example 9
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[(25)-2-(morpholin-4-yppropanoyl]amino}-4-

(trifluoromethoxy)benzamide or
198

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[(2R)-2-(morpholin-4-yppropanoyl]amino}-4-

(trifluoromethoxy)benzamide
H
N 0
F / 1
I
0 N r'0
. N5YNJ
H
FO CH3
F I
F
or
H
N 0
F / 1
I
0 N 0 r'0
0
N
H
FO OH3
F I
F
A sample of racemic N46-(2-fluorophenyppyridin-3-y1]-3-{[2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide (prepared as described in example 7, 0.39 g, 0.73
mmol) was separated
using chiral HPLC (System: Agilent Prep 1200, Column: Chiralpak IC Slim 250x30
mm, Solvent: hexane
/ ethanol / diethylamine 70:30:0.1 (v/v/v)) to give the first eluting
enantiomer of N-[6-(2-
fluorophenyl)pyridin-3-y1]-3-{[2-(morpholin-4-yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
(0.16 g, 39% from racemate).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.20 (d, J=7.1 Hz, 3H), 2.51-2.55 (m,
4H), 3.37 (q, J=7.1 Hz,
1H), 3.61-3.64 (m, 4H), 7.27-7.32 (m, 2H), 7.41-7.47 (m, 1H), 7.62 (dd, J=1.5,
8.8 Hz, 1H), 7.81 (td,
J=1.8, 8.6 Hz, 2H), 7.93 (td, J=2.0, 8.1 Hz, 1H), 8.27 (dd, J=2.5, 8.8 Hz,
1H), 8.71 (d, J=2.3 Hz, 1H), 9.02
(d, J=2.3 Hz, 1H), 10.01 (s, 1H), 10.69 (s, 1H).
LC-MS (Method 1): Rt = 1.16 min; MS (ESIpos): m/z = 533 [M+H].
Optical rotation (Method 6): [a] = ¨9.9 (c = 1.00, CHCI3).
Chiral HPLC (System: Waters Alliance 2695 DAD 996 ESA: Corona, Column:
Chiralpak IC 3um 100x4.6
mm, Solvent: hexane / ethanol / diethylamine 70:30:0.1 (v/v/v)): Rt = 9.03
min, 100% enantiomeric
excess.
Example 10
199

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
34[2-(morpholin-4-yppropanoyl]aminol-N-(6-phenylpyridin-3-y1)-4-
(trifluoromethoxy)benzamide
H
N 0
/ 1
I
0
N
H
FO CH3
F I
F
To a solution of 3-[(2-chloropropanoyDamino]-N-(6-
phenylpyridin-3-y1)-4-
(trifluoromethoxy)benzamide (prepared in a manner analogous to that described
in intermediate 16,
0.66 g, 1.43 mmol) in DMF (6 mL) was added morpholine (0.19 mL, 2.15 mmol, 1.5
equiv),
triethylamine (0.30 mL, 2.15 mmol, 1.5 equiv) and potassium iodide (37 mg,
0.22 mmol, 0.16 equiv).
The reaction mixture was stirred at room temperature for 16 h, then treated
with water (10 mL).
The resulting mixture was extracted with ethyl acetate (3 x 10 mL). The
combined organic phases
were dried (Na2SO4 anh) and concentrated under reduced pressure. The residue
(0.85 g) was
purified using MPLC (Biotage Isolera; 25 g SNAP cartridge: 100% hexane 2.0
min., gradient to 70%
hexane /30% Et0Ac 3.5 min., 70% hexane /30% Et0Ac 2.0 min., gradient to 49%
hexane /51% Et0Ac
2.1 min., gradient to 45% hexane /55% Et0Ac 0.2 min., 45% hexane /55% Et0Ac
8.5 min., gradient to
100% Et0Ac 4.5 min., 100% Et0Ac 5.5 min.) to give racemic N-[6-(2-
fluorophenyl)pyridin-3-yI]-3-{[2-
(morpholin-4-yl)propanoyl]amino}-4-(trifluoromethoxy)benzamide (0.48 g, 65%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.19 (d, J=7.2 Hz, 3H), 2.50-2.56 (m,
4H), 3.37 (q, J=7.0 Hz,
1H), 3.60-3.65 (m, 4H), 7.37 (t, J=7.2 Hz, 1H), 7.45 (t, J=7.7 Hz, 2H), 7.61
(dd, J=1.5, 8.5 Hz, 1H), 7.82
(dd, J=2.1, 8.7 Hz, 1H), 7.96 (d, J=8.7 Hz, 1H), 8.04 (dm, J=7.0 Hz, 2H), 8.25
(dd, J=2.6, 8.7 Hz, 1H), 8.70
(d, J=2.1 Hz, 1H), 8.96 (d, J=2.1 Hz, 1H), 10.00 (s, 1H), 10.65 (s, 1H).
LC-MS (Method 3): Rt = 1.34 min; MS (ESIpos): m/z = 515 ([M+H], 100%); MS
(ESIneg): m/z = 513
([M-H]-, 100%).
Example 11
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[2-methyl-2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
200

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F
I
0 N 0 r0
I1S N)(NJ
H
FO H3C CH3
F I
F
950 mg (1.33 mmol) of the compound from intermediate 17 were provided in 15 mL
of DMF. 278 uL
(1.99 mmol) of triethylamine and 347 uL (3.99 mmol) of morpholine were added
and the mixture
was stirred at 120 C for 6 h. After concentration, purification by HPLC (1.
column: chromatorex C18,
10um, 195x51mm, mobile phase: acetonitrile/water gradient; 2. Waters
Autopurificationsystem,
column: XBrigde C18 Sum 100x30 mm, solvent: water! acetonitrile + 0.1% formic
acid gradient, rate:
50 mL/min, temperature: room temperature) yielded 21.8 mg (3% of theory) of
the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.24 (s, 6H), 3.62 - 3.74 (m, 4H),
2.51 - 2.55 (m, 4H), 7.28 -
7.38 (m, 2H), 7.42 - 7.52 (m, 1H), 7.62 - 7.69 (m, 1H), 7.80 - 7.88 (m, 2H),
7.92 - 8.01 (m, 1H), 8.30 (dd,
1H), 8.76 (d, 1H), 9.06 (d, 1H), 10.01 (s, 1H), 10.75 (s, 1H).
LC-MS (Method 1): Rt = 1.34 min; MS (ESIpos): m/z = 547 [M+1-1]+.
Example 12
3-[(morpholin-4-ylacetypamino]-N-(5-phenyl-1,3-thiazol-2-y1)-4-
(trifluoromethyl)benzamide
H
NN 0
\ 1
S 0
0 r0
H
F F
F
63.0 mg (359 mop of 5-phenyl-1,3-thiazol-2-amine and 188 uL (1.08 mmol) of
N,N-
diisopropylethylamine were provided in 1.8 mL of DMF at room temperature. 143
mg (431 mop of
the compound from intermediate 20 and 251 uL (431 mop of a 50% solution of
2,4,6-tripropyl-
1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide (T3P) in DMF were added and
the mixture was stirred
for 3 days at room temperature. After filtration, purification by HPLC (method
2) yielded 62.0 mg
(33% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.53 - 2.70 (m, 4H), 3.60 - 3.77 (m,
4H), 7.30 - 7.37 (m, 1H),
7.40 - 7.49 (m, 2H), 7.62 - 7.73 (m, 2H), 7.94 (d, 1H), 8.01 (s, 1H), 8.08 (d,
1H), 8.82 (s, 1H), 10.02 (s,
1H), 12.93 (s, 1H).
201

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 1): Rt = 1.18 min; MS (ESIpos): rniz = 491 [m+H].
Example 13
3-[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yI)-4-
(trifluoromethyl)benzamide
H
N 0
/ 1
1
0N 0 r0
N
H
F F
F
To a solution of 3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethyl)benzoic
acid (prepared in a
manner analogous to that described in intermediate 20, 0.20 g, 0.48 mmol) and
6-phenylpyridin-3-
amine (0.098 g, 0.58 mmol, 1.2 equiv) in DMF (3.4 mL) was added (benzotriazol-
1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 0.30 g, 0.58 mmol,
1.2 equiv)
followed by diisopropylethylamine (0.34 mL, 1.93 mmol, 4.0 equiv). The
resulting mixture was
stirred at room temperature for 24 h, was then treated with water (5 mL). The
resulting mixture was
extracted with ethyl acetate (10 mL). The organic phase was dried (Na2504
anh), and concentrated
under reduced pressure. The residue (0.25 g) was purified using HPLC (method
2) to give 3-
[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yI)-4-
(trifluoromethyl)benzamide (0.069 g, 29%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.53-2.58 (m, 4H), 3.20 (s, 2H), 3.60-
3.65 (m, 4H), 7.38 (t,
J=7.2 Hz, 1H), 7.46 (t, J=7.3 Hz, 2H), 7.92 (s, 2H), 7.98 (d, J=8.7 Hz, 1H),
8.04 (d, J=7.2 Hz, 2H), 8.27
(dd, J=2.6, 8.5 Hz, 1H), 8.70 (s, 1H), 8.98 (d, J=2.3 Hz, 1H), 9.97 (s, 1H),
10.77 (s, 1H).
LC-MS (Method 3): Rt = 1.25 min; MS (ESIpos): rniz = 485 ([M+H], 30%), 969
([2M+H], 70%); MS
(ESIneg): m/z = 483 ([M-H]-, 100%).
Example 14
3-[(morpholin-4-ylacetypamino]-N-(5-pheny1-1,3-thiazol-2-y1)-4-
(trifluoromethoxy)benzamide
H
N.,..õ
4 N 0
\ I
S 0
0 r0
1100
H
FO
FI
F
202

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
63.0 mg (359 mop of 5-phenyl-1,3-thiazol-2-amine and 188 uL (1.08 mmol) of
N,N-
diisopropylethylamine were provided in 1.8 mL of DMF at room temperature. 150
mg (431 mop of
the compound from intermediate 21 and 251 uL (431 mop of a 50% solution of
2,4,6-tripropyl-
1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide (T3P) in DMF were added and
the mixture was stirred
over night at room temperature. 251 uL (431 mop of a 50% solution of 2,4,6-
tripropy1-1,3,5,2,4,6-
trioxatriphosphinane 2,4,6-trioxide (T3P) in DMF were added and the mixture
was stirred for 2 days
at room temperature. After filtration, purification by HPLC (method 2) yielded
52.4 mg (27% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.66 (m, 4H), 3.25 (s, 2H),
3.62 - 3.70 (m, 4H), 7.28 -
7.37 (m, 1H), 7.39 - 7.49 (m, 2H), 7.59 - 7.71 (m, 3H), 7.94 - 8.04 (m, 2H),
8.91 (d, 1H), 9.93 (s, 1H),
12.85 (s, 1H).
LC-MS (Method 4): Rt = 1.18 min; MS (ESIpos): m/z = 507 [M+H].
Example 15
3-[(morpholin-4-ylacetypamino]-N-(6-phenylpyridin-3-y1)-4-
(trifluoromethoxy)benzamide
H
N 0
/ 1
I
0 N 0 r'0
N
H
FO
F I
F
To a solution of 3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzoic
acid (prepared in a
manner analogous to that described in intermediate 21, 0.20 g, 0.46 mmol) and
6-phenylpyridin-3-
amine (0.094 g, 0.55 mmol, 1.2 equiv) in DMF (3.3 mL) was added (benzotriazol-
1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 0.29 g, 0.55 mmol,
1.2 equiv)
followed by diisopropylethylamine (0.32 mL, 1.84 mmol, 4.0 equiv). The
resulting mixture was
stirred at room temperature for 24 h, was then treated with water (5 mL). The
resulting mixture was
extracted with ethyl acetate (10 mL). The organic phase was dried (Na2504
anh), and concentrated
under reduced pressure. The residue (0.25 g) was purified using HPLC (method
2) to give 3-
[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridin-3-yI)-4-
(trifluoromethoxy)benzamide (0.085 g,
36%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.52-2.56 (m, 4H), 3.20 (s, 2H), 3.59-
3.64 (m, 4H), 7.37 (t,
J=7.1 Hz, 1H), 7.45 (t, J=7.3 Hz, 2H), 7.63 (dd, J=1.3, 8.5 Hz, 1H), 7.82 (dd,
J=2.3, 8.7 Hz, 1H), 7.97 (d,
J=8.7 Hz, 1H), 8.04 (d, J=7.2 Hz, 2H), 8.25 (dd, J=2.6, 8.7 Hz, 1H), 8.75 (d,
J=2.1 Hz, 1H), 8.96 (d, J=2.5
Hz, 1H), 9.90 (s, 1H), 10.66 (s, 1H).
LC-MS (Method 3): Rt = 1.27 min; MS (ESIpos): m/z = 501 ([M+H], 30%); MS
(ESIneg): m/z = 499 ([M-
H], 100%).
203

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Example 16
N-{3-[(morpholin-4-ylacetypamino]-4-(trifluoromethoxy)pheny11-5-phenyl-1,3-
thiazole-2-
carboxamide
0
N.1),L
NH
\ S 0
0 r'0
.H
FO
Fl
F
194 mg (609 mop of the compound from intermediate 32 and 318 uL (1.83 mmol)
of N,N-
diisopropylethylamine were provided in 3 mL of DMF at room temperature. 150 mg
(731 mop of
the compound from intermediate 1 and 427 uL (731 mop of a 50% solution of
2,4,6-tripropyl-
1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide (T3P) in DMF were added and
the mixture was stirred
for 3 days at room temperature. After filtration, purification by HPLC (method
2) yielded 219 mg
(70% of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.54 - 2.61 (m, 4H), 3.20 (s, 2H),
3.61 - 3.68 (m, 4H), 7.42 -
7.55 (m, 4H), 7.71 (dd, 1H), 7.80 - 7.86 (m, 2H), 8.52 (s, 1H), 8.84 (d, 1H),
9.79 (s, 1H), 11.04 (s, 1H).
LC-MS (Method 1): Rt = 1.24 min; MS (ESIpos): m/z = 507 [M+1-1]+.
Example 17
N-{3-[(morpholin-4-ylacetypamino]-4-(trifluoromethoxy)pheny11-5-
phenylthiophene-2-carboxamide
0
\ S 0
0 r'0
H
F,0
Fl
F
To a solution of N45-amino-2-(trifluoromethoxy)pheny1]-2-(morpholin-4-
ypacetamide (prepared in a
manner analogous to that described in intermediate 32, 0.075 g, 0.24 mmol) and
5-phenylthiophene-
2-carboxylic acid (0.097 g, 0.57 mmol, 1.0 equiv) in DMF (2.5 mL) was added
(benzotriazol-1-
204

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 0.18 g, 0.35 mmol,
1.5 equiv)
followed by diisopropylethylamine (0.16 mL, 0.94 mmol, 4.0 equiv). The
resulting mixture was
stirred at room temperature for 24 h, was then concentrated under reduced
pressure. The residue
was treated with water (10 mL). The resulting mixture was extracted with ethyl
acetate (10 mL). The
organic phase was dried (Na2SO4 anh), and concentrated under reduced pressure.
The residue (0.25
g) was purified using HPLC (method 2) to give N-{3-[(morpholin-4-
ylacetypamino]-4-
(trifluoromethoxy)pheny11-5-phenylthiophene-2-carboxamide (0.041 g, 33%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.51-2.56 (m, 4H), 3.18 (s, 2H), 3.59-
3.64 (m, 4H), 7.32-7.47
(m, 4H), 7.59 (d, J=4.0 Hz, 1H), 7.66-7.74 (m, 3H), 8.04 (d, J=4.0 Hz, 1H),
8.61 (d, J=2.6 Hz, 1H), 9.76 (s,
1H), 10.46 (s, 1H).
LC-MS (Method 3): Rt = 1.40 min; MS (ESIpos): m/z = 506 ([M+H], 100%); MS
(ESIneg): m/z = 504
([M-H]-, 100%).
Example 18
N-{4-tert-butyl-3-[(morpholin-4-ylacetypamino]pheny11-6-phenylnicotinamide
0
/ 1 NH
I
0 N 0 r'C)
N
H
H3C CH3
CH3
To a solution of N-(5-amino-2-tert-butylpheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 33, 0.090 g, 0.31 mmol) and 6-
phenylnicotinic acid HCI
salt (0.091 g, 0.39 mmol, 1.25 equiv) in DMF (2.4 mL) was added
propanephosphonic acid cyclic
anhydride solution (50% in ethyl acetate, 0.23 mL, 0.39 mmol, 1.25 equiv)
followed by
diisopropylethylamine (0.22 mL, 1.24 mmol, 4.0 equiv). The resulting mixture
was stirred at room
temperature for 24 h, was then concentrated under reduced pressure. The
residue was then treated
with water (50 mL). The resulting mixture was extracted with ethyl acetate (50
mL). The organic
phase was dried (Na2504 anh), and concentrated under reduced pressure. The
residue was purified
by HPLC (method 2) to give N-{4-tert-butyl-3-[(morpholin-4-
ylacetypamino]pheny11-6-
phenylnicotinamide (22 mg, 15%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.37 (s, 9H), 2.55-2.61 (m, 4H), 3.15
(s, 2H), 3.61-3.65 (m,
4H), 7.33 (d, J=8.9 Hz, 1H), 7.43-7.54 (m, 3H), 7.60 (dd, J=2.3, 8.7 Hz, 1H),
8.08-8.17 (m, 4H), 8.36 (dd,
J=2.5, 8.3 Hz, 1H), 9.15 (d, J=1.7 Hz, 1H), 9.39 (s, 1H), 10.43 (s, 1H).
205

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 1.28 min; MS (ESIpos): m/z = 473 ([M+H], 100%); MS
(ESIneg): rniz = 471
(EM¨Hr, 100%).
Example 19
N-{4-tert-butyl-3-[(morpholin-4-ylacetypamino]pheny11-5-phenylthiophene-2-
carboxamide
0
\ S 0
0 r'0
H
H3C CH3
CH3
To a solution of N-(5-amino-2-tert-butylphenyI)-2-(morpholin-4-yl)acetamide
(prepared in a manner
analogous to that described in intermediate 33, 0.090 g, 0.31 mmol) and 5-
phenylthiophene-2-
carboxylic acid (0.078 g, 0.39 mmol, 1.25 equiv) in DMF (2.4 mL) was added
propanephosphonic acid
cyclic anhydride solution (50% in ethyl acetate, 0.23 mL, 0.39 mmol, 1.25
equiv) followed by
diisopropylethylamine (0.16 mL, 0.93 mmol, 3.0 equiv). The resulting mixture
was stirred at room
temperature for 24 h, was then concentrated under reduced pressure. The
residue was then treated
with water (50 mL). The resulting mixture was extracted with ethyl acetate (50
mL). The organic
phase was dried (Na2504 anh), and concentrated under reduced pressure. The
residue was purified
by HPLC (method 2) to give N-{4-tert-butyl-3-[(morpholin-4-
ylacetypamino]pheny11-5-
phenylthiophene-2-carboxamide (28 mg, 18%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.36 (s, 9H), 2.55-2.60 (m, 4H), 3.14
(s, 2H), 3.60-3.65 (m,
4H), 7.29-7.38 (m, 2H), 7.43 (t, J=7.3 Hz, 2H), 7.54-7.59 (m, 2H), 7.71 (d,
J=7.2 Hz, 2H), 8.00-8.03 (m,
2H), 9.38 (s, 1H), 10.23 (s, 1H).
LC-MS (Method 3): Rt = 1.40 min; MS (ESIpos): m/z = 478 ([M+H], 100%), 955
([2M+H], 30%); MS
(ESIneg): m/z = 476 (EM¨Hr, 100%).
Example 20
N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-5-phenyl-1,3-oxazole-2-
carboxamide
206

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
NyL
NH
0 rO
H
0
CH3
To a solution of N-(5-amino-2-methoxypheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 36, 0.085 g, 0.32 mmol) and 5-
phenyl-1,3-oxazole-2-
carboxylic acid (0.075 g, 0.40 mmol, 1.25 equiv) in DMF (2.5 mL) was added
propanephosphonic acid
cyclic anhydride solution (50% in ethyl acetate, 0.23 mL, 0.39 mmol, 1.25
equiv) followed by
diisopropylethylamine (0.17 mL, 0.96 mmol, 3.0 equiv). The resulting mixture
was stirred at room
temperature for 24 h, was then concentrated under reduced pressure. The
residue was then treated
with water (50 mL). The resulting mixture was extracted with ethyl acetate (50
mL). The organic
phase was dried (Na2SO4 anh), and concentrated under reduced pressure. The
residue was purified
by HPLC (method 2) to give N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-
5-phenyl-1,3-
oxazole-2-carboxamide (23 mg, 16%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.50-2.55 (m, 4H), 3.12 (s, 2H), 3.62-
3.66 (m, 4H), 3.86 (s,
3H), 7.04 (d, J=8.9 Hz, 1H), 7.39-7.54 (m, 4H), 7.84 (d, J=7.2 Hz, 2H), 7.95
(s, 1H), 8.61 (d, J=2.6 Hz,
1H), 9.71 (s, 1H), 10.72 (s, 1H).
LC-MS (Method 3): Rt = 1.16 min; MS (ESIpos): m/z = 437 ([M+H], 100%), 873
([2M+H], 60%); MS
(ESIneg): m/z = 435 ([M-H]-, 100%).
Example 21
N-{4-chloro-3-[(morpholin-4-ylacetypamino]pheny11-5-phenylthiophene-2-
carboxamide
0
-..,. NH
\ S 0
0 r0
H
CI
To a solution of N-(5-amino-2-chloropheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 34, 0.13 g, 0.48 mmol) and 5-
phenylthiophene-2-
carboxylic acid (0.15 g, 0.72 mmol, 1.5 equiv) in DMF (5 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 0.38 g, 0.723
mmol, 1.5 equiv)
followed by diisopropylethylamine (0.34 mL, 1.93 mmol, 4.0 equiv). The
resulting mixture was
207

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
stirred at room temperature for 24 h, was then concentrated under reduced
pressure. The residue
was treated with water (10 mL). The resulting mixture was extracted with ethyl
acetate (10 mL). The
organic phase was dried (Na2SO4 anh), and concentrated under reduced pressure.
The residue (3.5 g)
was purified by HPLC (method 2) to give N-{4-chloro-3-[(morpholin-4-
ylacetypamino]pheny11-5-
phenylthiophene-2-carboxamide (37 mg, 16%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.53-2.58 (m, 4H), 3.18 (s, 2H), 3.62-
3.67 (m, 4H), 7.31-7.48
(m, 4H), 7.59 (d, J=4.0 Hz, 1H), 7.65 (dd, J=2.6, 8.7 Hz, 1H), 7.72 (d, J=7.0
Hz, 2H), 8.03 (d, J=4.1 Hz,
1H), 8.61 (d, J=2.5 Hz, 1H), 9.89 (s, 1H), 10.41 (s, 1H).
LC-MS (Method 3): Rt = 1.34 min; MS (ESIpos): m/z = 456 ([M+H], 100%), 911
([2M+H], 20%);
(ESIneg): m/z = 454 ([M¨H]-, 50%).
Example 22
N-{4-methyl-3-[(morpholin-4-ylacetypamino]pheny11-5-phenylthiophene-2-
carboxamide
0
---__ NH
\ S
= 0
N)'N-)
0 r0
H
CH3
To a solution of N-(5-amino-2-methylpheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 35, 0.085 g, 0.34 mmol) and 5-
phenyl-thiophene-2-
carboxylic acid (0.084 g, 0.41 mmol, 1.22 equiv) in DMF (2.7 mL) was added
propanephosphonic acid
cyclic anhydride solution (50% in ethyl acetate, 0.24 mL, 0.41 mmol, 1.20
equiv) followed by
diisopropylethylamine (0.18 mL, 1.02 mmol, 3.0 equiv). The resulting mixture
was stirred at room
temperature for 24 h, was then concentrated under reduced pressure. The
residue was then treated
with water (10 mL). The resulting mixture was extracted with ethyl acetate (10
mL). The organic
phase was dried (Na2504 anh), and concentrated under reduced pressure. The
residue was purified
by HPLC (method 2) to give N-{4-methyl-3-[(morpholin-4-ylacetypamino]pheny11-5-
phenylthiophene-
2-carboxamide (34 mg, 23%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.18 (s, 3H), 2.53-2.56 (m, 4H), 3.12
(s, 2H), 3.61-3.66 (m,
4H), 7.16 (d, J=8.3 Hz, 1H), 7.35 (t, J=7.2 Hz, 1H), 7.43 (t, J=7.5, 2H), 7.50
(dd, J=2.0, 8.3, 1H), 7.57 (d,
4.0 Hz, 1H), 7.71 (d, J=7.3 Hz, 2H), 8.01 (d, J=4.0 Hz, 1H), 8.10 (d, J=1.8
Hz, 1H), 9.38 (s, 1H), 10.21 (s,
1H).
LC-MS (Method 3): Rt = 1.23 min; MS (ESIpos): m/z = 436 ([M+H], 100%), 871
([2M+H], 70%); MS
(ESIneg): m/z = 434 ([M¨H]-, 100%), 869 ([2M¨H]-, 10%).
208

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Example 23
N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-5-phenyl-1,3-thiazole-2-
carboxamide
0
N.....7).
NH
\

. S,(
0 '0
H
0
H3C
To a solution of N-(5-amino-2-methoxypheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 36, 0.15 g, 0.57 mmol) and lithium
5-phenyl-1,3-thiazole-
2-carboxylate (prepared in a manner analogous to that described in
intermediate 2, 0.18 g, 0.85
mmol, 1.5 equiv) in DMF (4 mL) was added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PYBOP, 0.44 g, 0.85 mmol, 1.5 equiv) followed by
diisopropylethylamine (0.30
mL, 1.70 mmol, 3.0 equiv). The resulting mixture was stirred at room
temperature for 24 h, was then
concentrated under reduced pressure. The residue was treated with water (10
mL). The resulting
mixture was extracted with ethyl acetate (10 mL). The organic phase was dried
(Na2SO4 anh), and
concentrated under reduced pressure. The residue was purified by HPLC (method
2) to give N-{4-
methoxy-3-[(morpholin-4-ylacetypamino]pheny11-5-phenyl-1,3-thiazole-2-
carboxamide (48 mg, 19%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.51-2.54 (m, 4H), 3.12 (s, 2H), 3.62-
3.66 (m, 4H), 3.86 (s,
3H), 7.03 (d, J=9.1 Hz, 1H), 7.38-7.51 (m, 4H), 7.78 (d, J=7.3 Hz, 2H), 8.45
(s, 1H), 8.67 (d, J=2.5 Hz,
1H), 9.70 (s, 1H), 10.66 (s, 1H).
LC-MS (Method 3): Rt = 1.29 min; MS (ESIpos): m/z = 453 ([M+1-1]+, 100%), 905
([2M+1-1]+, 60%); MS
(ESIneg): m/z = 451 ([M¨H]-, 100%).
Example 24
N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-5-phenyl-1H-pyrrole-2-
carboxamide
0
\
.NH 0
0 r'0
H
0
H30
209

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To a solution of N-(5-amino-2-methoxypheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 36, 0.090 g, 0.34 mmol) and 5-
phenyl-1H-pyrrole-2-
carboxylic acid (0.076 g, 0.41 mmol, 1.20 equiv) in DMF (1.2 mL) was added
propanephosphonic acid
cyclic anhydride solution (50% in ethyl acetate, 0.24 mL, 0.41 mmol, 1.20
equiv) followed by
diisopropylethylamine (0.18 mL, 1.02 mmol, 3.0 equiv). The resulting mixture
was stirred at room
temperature for 24 h, was then concentrated under reduced pressure. The
residue was then treated
with water (10 mL). The resulting mixture was extracted with ethyl acetate (10
mL). The organic
phase was dried (Na2SO4 anh), and concentrated under reduced pressure. The
residue (0.16 g) was
purified by HPLC (method 2) to give N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]pheny11-5-phenyl-
1H-pyrrole-2-carboxamide (13 mg, 9%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.12 (s, 2H), 3.60-3.78 (m, 4H), 3.84
(s, 3H), 6.58-6.61 (m,
1H), 6.99-7.08 (m, 2H), 7.21 (t, J=7.3 Hz, 1H), 7.35 (t, J=7.6 Hz, 2H), 7.50-
7.56 (m, 1H), 7.79 (d, J=7.4
Hz, 2H), 8.53 (br s, 1H), 9.70 (s, 2H), 11.75 (s, 1H), peak at 2.4-2.6 ppm
partially obscured by solvent.
LC-MS (Method 3): Rt = 1.14 min; MS (ESIpos): m/z = 435 ([M+H], 100%), 869
([2M+H], 30%); MS
(ESIneg): m/z = 433 ([M-H]-, 100%).
Example 25
N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-5-phenylthiophene-2-
carboxamide
0
-...s. NH
\ S 0
0 r'0
.H
0
H3C
To a solution of N-(5-amino-2-methoxypheny1)-2-(morpholin-4-ypacetamide
(prepared in a manner
analogous to that described in intermediate 36, 0.075 g, 0.28 mmol) and 5-
phenylthiophene-2-
carboxylic acid (0.072 g, 0.35 mmol, 1.25 equiv) in DMF (3 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 0.18 g, 0.35 mmol,
1.25 equiv)
followed by diisopropylethylamine (0.19 mL, 1.13 mmol, 4.0 equiv). The
resulting mixture was
stirred at room temperature for 24 h, was then concentrated under reduced
pressure. The residue
was treated with water (10 mL). The resulting mixture was extracted with ethyl
acetate (10 mL). The
organic phase was dried (Na2504 anh), and concentrated under reduced pressure.
The residue (0.3 g)
was purified by HPLC (method 2) to give N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]pheny11-5-
phenylthiophene-2-carboxamide (62 mg, 49%).
'H-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.49-2.57 (m, 4H), 3.12 (br s, 2H), 3.61-
3.68 (m, 4H), 3.85 (s,
3H). 7.02 (d, J=9.0 Hz, 1H), 7.34 (t, J=7.8 Hz, 1H), 7.43 (t, J=7.3 Hz, 2H),
7.52 (br d, J=8.5 Hz, 1H), 7.57
(d, J=7.6 Hz, 1H), 7.71 (d, J=7.0 Hz, 2H), 8.00 (d, J=4.0 Hz, 1H), 8.47 (br s,
1H), 9.73 (br s, 1H), 10.19 (s,
1H).
210

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 1.23 min; MS (ESIpos): m/z = 452 ([M+H], 100%), 903
([2M+H], 30%); MS
(ESIneg): m/z = 450 (EM¨Hr, 100%), 901 ([2M¨H]-, 10%).
Example 26
6-(2,3-difluoropheny1)-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide
0
NH
SF
0
1401
FO
To a microwave vial was
added 6-chloro-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 37, 0.15 g, 0.33 mmol), (2,3-difluorophenyl)boronic acid (0.077
g, 0.49 mmol, 1.5
equiv), potassium carbonate (90 mg, 0.65 mmol, 2.0 equiv) and a DME / water
mixture (3:1, 3.3 mL).
The resulting suspension was purged with argon,
treated with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 0.013 g,
0.016 mmol, 5.0 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
150 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined
organic phases were
washed with a saturated NaCI solution, dried (Na2504 anh), and concentrated
under reduced
pressure. The resulting material was purified by HPLC (method 2) to give 6-
(2,3-difluorophenyI)-N-{3-
[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyllnicotinamide (8 mg,
4%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.52-2.56 (m, 4H), 3.18 (s, 2H), 3.59-
3.64 (m, 4H), 7.31-7.39
(m, 1H), 7.43 (dm, J=8.0 Hz, 1H), 7.50-7.60 (m, 1H), 7.70-7.80 (m, 2H), 7.95
(dm, J=7.5 Hz, 1H), 8.41
(dd, J=2.3, 8.3 Hz, 1H), 8.69 (d, J=2.5 Hz, 1H), 9.21 (d, J=1.7 Hz, 1H), 9.77
( s, 1H), 10.73 (s, 1H).
LC-MS (Method 3): Rt = 1.34 min; MS (ESIpos): m/z = 537 ([M+H], 100%); MS
(ESIneg): m/z = 535
(EM¨Hr, 100%).
Example 27
6-(3,5-difluoropheny1)-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide
211

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
NH
F
0
FO
To a microwave vial was
added 6-chloro-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 37, 0.15 g, 0.33 mmol), (3,5-difluorophenyl)boronic acid (0.077
g, 0.49 mmol, 1.5
equiv), potassium carbonate (90 mg, 0.65 mmol, 2.0 equiv) and a DME / water
mixture (3:1, 3.3 mL).
The resulting suspension was purged with argon,
treated with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(II) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 0.013 g,
0.016 mmol, 5.0 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
150 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined
organic phases were
washed with a saturated NaCI solution, dried (Na2SO4 anh), and concentrated
under reduced
pressure. The resulting material was purified by HPLC (method 2) to give 6-
(3,5-difluorophenyI)-N-{3-
[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyllnicotinamide (28 mg,
15%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.52-2.56 (m, 4H), 3.17 (s, 2H), 3.59-
3.63 (m, 4H), 7.37 (tt,
J=2.3, 10.9 Hz, 1H), 7.43 (dm, J=9.0 Hz, 1H), 7.72 (dd, J=2.5, 6.6 Hz, 1H),
7.90 (dm, J=9.0 Hz, 2H), 8.25
(d, J=8.1 Hz, 1H), 8.42 (dd, J=2.3, 8.3 Hz, 1H), 8.69 (d, J=2.6 Hz, 1H), 9.17
(d, J=1.7 Hz, 1H), 9.78 (s, 1H),
10.71 (s, 1H).
LC-MS (Method 3): Rt = 1.38 min; MS (ESIpos): m/z = 537 ([M+H], 100%); MS
(ESIneg): m/z = 535
([M¨H]-, 100%).
Example 28
6-(3-fluoropheny1)-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide
0
NH
0
1401
FO
212

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To a microwave vial was
added 6-chloro-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 37, 0.15 g, 0.33 mmol), (3-fluorophenyl)boronic acid (0.068 g,
0.49 mmol, 1.5 equiv),
potassium carbonate (90 mg, 0.65 mmol, 2.0 equiv) and a DME / water mixture
(3:1, 3.3 mL). The
resulting suspension was purged with argon, treated
with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 0.013 g,
0.016 mmol, 5.0 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
150 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined
organic phases were
washed with a saturated NaCI solution, dried (Na2SO4 anh), and concentrated
under reduced
pressure. The resulting material was purified by HPLC (method 2) to give 6-(3-
fluorophenyI)-N-{3-
[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyllnicotinamide (31 mg,
18%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.52-2.56 (m, 4H), 3.18 (s, 2H), 3.60-
3.63 (m, 4H), 7.31 (td,
J=2.5, 8.5 Hz, 1H), 7.43 (dd, J=1.5, 8.8 Hz, 1H), 7.53-7.59 (m, 1H), 7.73 (dd,
J=2.5, 9.1 Hz, 1H), 7.97
(dm, J=10.6 Hz, 2H), 8.18 (d, J=8.3 Hz, 1H), 8.39 (dd, J=2.3, 8.3 Hz, 1H),
8.69 (d, J=2.5 Hz, 1H), 9.17 (d,
J=1.5 Hz, 1H), 9.77 (s, 1H), 10.68 (s, 1H).
LC-MS (Method 3): Rt = 1.34 min; MS (ESIpos): m/z = 519 ([M+H], 100%); MS
(ESIneg): m/z = 517
([M¨H]-, 100%).
Example 29
6-(2,6-difluoropheny1)-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide
0
NH
SF
0
1401
FO
To a microwave vial was
added 6-chloro-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 37, 0.15 g, 0.33 mmol), (2,6-difluorophenyl)boronic acid (0.077
g, 0.49 mmol, 1.5
equiv), potassium carbonate (90 mg, 0.65 mmol, 2.0 equiv) and a DME / water
mixture (3:1, 3.3 mL).
The resulting suspension was purged with argon,
treated with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(II) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 0.013 g,
0.016 mmol, 5.0 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
150 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined
organic phases were
washed with a saturated NaCI solution, dried (Na2504 anh), and concentrated
under reduced
213

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
pressure. The resulting material was purified by HPLC (method 2) to give 6-
(2,6-difluorophenyI)-N-{3-
[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyllnicotinamide (6 mg,
3%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.55-2.59 (m, 4H), 3.20 (s, 2H), 3.62-
3.66 (m, 4H), 7.24-7.31
(m, 2H), 7.46 (dd, J=1.3, 9.0 Hz, 1H), 7.55-7.63 (m, 1H), 7.73-7.79 (m, 2H),
8.41 (dd, J=2.3, 8.3 Hz, 1H),
8.71 (d, J=2.5 Hz, 1H), 9.20 (d, J=1.5 Hz, 1H), 9.80 (s, 1H), 10.77 (s, 1H).
LC-MS (Method 3): Rt = 1.28 min; MS (ESIpos): m/z = 537 ([M+H], 100%); MS
(ESIneg): m/z = 535
([M¨H]-, 100%).
Example 30
6-(2-fluoropheny1)-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide
0
NH
SF
1401 jUIC)
FO
I
To a microwave vial was
added 6-chloro-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 37, 0.126 g, 0.28 mmol), (2-fluorophenyl)boronic acid (0.058 g,
0.41 mmol, 1.5 equiv),
potassium carbonate (76 mg, 0.54 mmol, 2.0 equiv) and a DME / water mixture
(3:1, 2.8 mL). The
resulting suspension was purged with argon, treated
with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 0.011 g,
0.014 mmol, 5.0 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
150 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined
organic phases were
washed with a saturated NaCI solution, dried (Na2504 anh), and concentrated
under reduced
pressure. The resulting material was purified by HPLC (method 2) to give a
precipitate (40 mg), which
was crystallized from ethanol to give the title compound (9 mg, 6%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.52-2.56 (m, 4H), 3.17 (s, 2H), 3.59-
3.64 (m, 4H), 7.31-7.39
(m, 2H), 7.43 (dd, J=1.5, 9.0 Hz, 1H), 7.48-7.56 (m, 1H), 7.72 (dd, J=2.6, 9.0
Hz, 1H), 7.90-8.01 (m, 2H),
8.38 (dd, J=2.5, 8.3 Hz, 1H), 8.69 (d, J=2.6 Hz, 1H), 9.20 (d, J=1.7 Hz, 1H),
9.77 (s, 1H), 10.71 (s, 1H).
LC-MS (Method 3): Rt = 1.35 min; MS (ESIpos): m/z = 519 ([M+H], 100%); MS
(ESIneg): m/z = 517
([M¨H]-, 100%).
Example 31
214

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
6-(2-fluoropheny1)-N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]phenyllnicotinamide
0
NH
0
1401 )-Nj
H3C
To a microwave vial was added
6-chloro-N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 38, 0.070 g, 0.17 mmol), (2-fluorophenyl)boronic acid (0.036 g,
0.26 mmol, 1.5 equiv),
potassium carbonate (48 mg, 0.35 mmol, 2.0 equiv) and a DME / water mixture
(3:1, 1.75 mL). The
resulting suspension was purged with argon, treated
with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(II) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 7.1 mg,
0.009 mmol, 5 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
150 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined
organic phases were
washed with a saturated NaCI solution, dried (Na2SO4 anh), and concentrated
under reduced
pressure. The resulting material was purified by HPLC (method 2) to give 6-(2-
fluorophenyI)-N-{4-
methoxy-3-[(morpholin-4-ylacetyl)amino]phenyllnicotinamide (32 mg, 40%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.51-2.54 (m, 4H), 3.13 (s, 2H), 3.62-
3.66 (m, 4H), 3.87 (s,
3H), 7.04 (d, J=8.8 Hz, 1H), 7.32-7.38 (m, 2H), 7.49-7.55 (m, 1H), 7.58 (dd,
J=2.5, 6.3 Hz, 1H), 7.90 (dd,
J=1.5, 8.3 Hz, 1H), 7.98 (td, J=1.8, 7.8 Hz, 1H), 8.37 (dd, J=2.3, 8.3 Hz,
1H), 8.55 (d, J=2.5 Hz, 1H), 9.19
(d, J=1.8 Hz, 1H), 9.72 (s, 1H), 10.42 (s, 1H).
LC-MS (Method 3): Rt = 1.14 min; MS (ESIpos): m/z = 465 ([M+H], 100%), 929
([2M+H], 20%); MS
(ESIneg): m/z = 463 ([M¨H]-, 100%).
Example 32
6-(3-fluoropheny1)-N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]phenyllnicotinamide
0
NH
0
)-Nj
H3C
215

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
To a microwave vial was added
6-chloro-N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 38, 0.070 g, 0.17 mmol), 3-fluorophenyl)boronic acid (0.036 g,
0.26 mmol, 1.5 equiv),
potassium carbonate (48 mg, 0.35 mmol, 2.0 equiv) and a DME / water mixture
(3:1, 1.75 mL). The
resulting suspension was purged with argon, treated
with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(II) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 7.1 mg,
0.009 mmol, 5 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
150 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined
organic phases were
washed with a saturated NaCI solution, dried (Na2SO4 anh), and concentrated
under reduced
pressure. The resulting material was purified by HPLC (method 2) to give the
title compound (49 mg,
60%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.51-2.55 (m, 4H), 3.12 (s, 2H), 3.63-
3.66 (m, 4H), 3.87 (s,
3H), 7.04 (d, J=8.8 Hz, 1H), 7.30 (td, J=2.3, 8.3 Hz, 1H), 7.52-7.60 (m, 2H),
7.96 (dm, J=10.6 Hz, 1H),
8.01 (d, J=8.1 Hz, 1H), 8.16 (d, J=8.3 Hz, 1H), 8.38 (dd, J=2.3, 8.3 Hz, 1H),
8.55 (d, J=2.5 Hz, 1H), 9.16
(d, J=1.8 Hz, 1H), 9.72 (s, 1H), 10.39 (s, 1H).
LC-MS (Method 3): Rt = 1.16 min; MS (ESIpos): m/z = 465 ([M+H], 100%); MS
(ESIneg): m/z = 463
([M¨H]-, 100%).
Example 33
N-{3-[(morpholin-4-ylacetypamino]-4-(trifluoromethoxy)pheny11-6-
phenylnicotinamide
0
NH
0
FO
To a microwave vial was
added 6-chloro-N-{3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 37, 0.126 g, 0.275 mmol), phenylboronic acid (0.050 g, 0.412
mmol, 1.5 equiv),
potassium carbonate (76 mg, 0.55 mmol, 2.0 equiv) and a DME / water mixture
(3:1, 2.8 mL). The
resulting suspension was purged with argon, treated
with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(II) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 11 mg,
0.014 mmol, 5 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
150 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with a CH2Cl2 / isopropanol mixture (4:1, 3 x 10
mL). The combined
organic phases were washed with a saturated NaCI solution, dried (Na2504 anh),
and concentrated
216

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
under reduced pressure. The resulting material was purified by HPLC (method 2)
to give N-{3-
[(morpholin-4-ylacetypamino]-4-(trifluoromethoxy)pheny11-6-phenylnicotinamide
(54 mg, 39%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.53-2.56 (m, 4H), 3.18 (s, 2H), 3.60-
3.63 (m, 4H), 7.41-7.54
(m, 4H), 7.73 (dd, J=2.5, 8.8 Hz, 1H), 8.10-8.17 (m, 3H), 8.37 (dd, J=2.3, 8.3
Hz, 1H), 8.69 (d, J=2.5 Hz,
1H), 9.17 (d, J=1.8 Hz, 1H), 9.77 (s, 1H), 10.66 (s, 1H).
LC-MS (Method 3): Rt = 1.28 min; MS (ESIpos): m/z = 501 ([M+H], 100%); MS
(ESIneg): m/z = 499
([M¨H]-, 100%).
Example 34
N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-6-phenylnicotinamide
0
NH
0
)-Nj
H3C
To a microwave vial was added
6-chloro-N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]phenyllnicotinamide (prepared in a manner analogous to that
described in
intermediate 38, 3.30 g, 8.15 mmol), phenylboronic acid (1.49 g, 12.2 mmol,
1.5 equiv), potassium
carbonate (2.25 g, 16.3 mmol, 2.0 equiv) and a DME / water mixture (3:1, 82.3
mL). The resulting
suspension was purged with argon, treated with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(II)
chloride CH2Cl2 complex (Pd(dppf)Cl2CH2C12, 0.332 g, 0.41 mmol, 5 mol%) and
sealed. The resulting
mixture was heated with a microwave apparatus at 150 C for 1 h, was then
cooled to room
temperature. The reaction mixture was poured onto ice water (100 mL), and
extracted with a CH2Cl2
/ isopropanol mixture (4:1, 3 x 50 mL). The combined organic phases were
washed with a saturated
NaCI solution, dried (Na2504 anh), and concentrated under reduced pressure.
The residue was
treated with DMF (50 mL). The resulting precipitate was removed by filtration
to give N-{4-methoxy-
3-[(morpholin-4-ylacetypamino]pheny11-6-phenylnicotinamide (1.07 g, 29%)
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.51-2.54 (m, 4H), 3.12 (s, 2H), 3.62-
3.66 (m, 4H), 3.86 (s,
3H), 7.04 (d, J=8.8 Hz, 1H), 7.44-7.53 (m, 3H), 7.58 (dd, J=2.5, 6.3 Hz, 1H),
8.09 (d, J=7.8 Hz, 1H), 8.15
(dm, J=8.8 Hz, 2H), 8.36 (dd, J=2.5, 8.3 Hz, 1H), 8.55 (d, J=2.5 Hz, 1H), 9.15
(d, J=1.8 Hz, 1H), 9.72 (s,
1H), 10.37 (s, 1H).
LC-MS (Method 3): Rt = 1.12 min; MS (ESIpos): m/z = 447 ([M+H], 100%), 893
([2M+H], 20%); MS
(ESIneg): m/z = 445 ([M¨H]-, 100%).
217

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The DMF mother liquor was concentrated under reduced pressure. The residue was
purified by HPLC
(method 2) to give additional N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]pheny11-6-
phenylnicotinamide (1.30 g, 36%).
Example 35
N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-5-(4-
methoxyphenyl)thiophene-2-
carboxamide
0
NH
S
0
40,
0 H3C
CH3
To a microwave vial was added
5-bromo-N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]phenyllthiophene-2-carboxamide (prepared in a manner analogous
to that described
in intermediate 39, 0.075 g, 0.165 mmol), (4-methoxyphenyl)boronic acid (0.050
g, 0.33 mmol, 2.0
equiv), a 2N sodium carbonate solution (0.25 mL, 0.50 mmol, 3.0 equiv) and
dioxane (1.0 mL). The
resulting suspension was purged with argon, treated
with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 0.013 g,
0.016 mmol, 10 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
105 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto ice
water (10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined
organic phases were
dried (Na2SO4 anh), and concentrated under reduced pressure. The resulting
material was purified
by HPLC (method 2) to give N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-
5-(4-
methoxyphenyl)thiophene-2-carboxamide (32 mg, 40%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.56-2.58 (m, 4H), 3.17 (s, 2H), 3.67-
3.70 (m, 4H), 3.82 (s,
3H), 3.90 (s, 3H), 7.03 (d, J=8.7 Hz, 2H), 7.06 (d, J=9.0 Hz, 1H), 7.48 (d,
J=3.8 Hz, 1H), 7.57 (dd, J=2.6,
8.7 Hz, 1H), 7.68 (d, J=8.6 Hz, 2H), 8.00 (d, J=4.1 Hz, 1H), 8.51 (d, J=2.6
Hz, 1H), 9.76 (s, 1H), 10.17 (s,
1H).
LC-MS (Method 3): Rt = 1.36 min; MS (ESIpos): m/z = 482 ([M+H], 100%); MS
(ESIneg): m/z = 480
([M¨H]-, 100%).
Example 36
5-(4-fluoropheny1)-N-{4-methoxy-3-[(morpholin-4-ylacetypamino]phenyllthiophene-
2-carboxamide
218

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
0
NH
S
0
H3C
To a microwave vial was added
5-bromo-N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]phenyllthiophene-2-carboxamide (prepared in a manner analogous
to that described
in intermediate 39, 0.075 g, 0.165 mmol), (4-fluorophenyl)boronic acid (0.046
g, 0.33 mmol, 2.0
equiv), a 2N sodium carbonate solution (0.25 mL, 0.50 mmol, 3.0 equiv) and
dioxane (1.0 mL). The
resulting suspension was purged with argon, treated
with [1,1'-
bis(diphenylphosphino)ferrocene]palladium(11) chloride CH2Cl2 complex
(Pd(dppf)Cl2CH2C12, 0.013 g,
0.016 mmol, 10 mol%) and sealed. The resulting mixture was heated with a
microwave apparatus at
105 C for 1 h, was then cooled to room temperature. The reaction mixture was
poured onto water
(10 mL), and extracted with ethyl acetate (3 x 10 mL). The combined organic
phases were dried
(Na2SO4 anh), and concentrated under reduced pressure. The resulting material
was purified by
HPLC (method 2) to
give 5-(4-fluorophenyI)-N-{4-methoxy-3-[(morpholin-4-
ylacetypamino]phenyllthiophene-2-carboxamide (41 mg, 53%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.50-2.55 (m, 4H), 3.12 (s, 2H), 3.61-
3.66 (m, 4H), 3.86 (s,
3H), 7.02 (d, J=8.9 Hz, 1H), 7.26 (t, J=8.9 Hz, 2H), 7.50-7.54 (m, 2H), 7.72-
7.78 (m, 2H), 7.99 (d, J=4.0
Hz, 1H), 8.47 (d, J=2.5 Hz, 1H), 9.72 (s, 1H), 10.17 (s, 1H).
LC-MS (Method 3): Rt = 1.40 min; MS (ESIpos): m/z = 470 ([M+H], 100%); MS
(ESIneg): m/z = 468
([M¨H]-, 100%).
Example 37
4-(difluoromethoxy)-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-
phenyl-1,3,4-
thiadiazol-2-yObenzamide
N 0
s
FO
219

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 100 mg (0.28 mmol) of the compound of intermediate 46 and 115 mg
(0.55 mmol, 2
equiv) of the compound of intermediate 44. 8.1 mg (5% of theory) of the title
compound were
obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.11 - 1.21 (m, 2H), 1.22 - 1.32 (m,
2H), 2.40 - 2.48 (m, 4H),
3.66 - 3.78 (m, 4H), 7.46 (d, 1H), 7.50 - 7.60 (m, 3H), 7.53 (t, 1H), 7.92 -
8.03 (m, 3H), 9.09 (d, 1H),
10.64 (s, 1H), 13.27 (s, 1H).
LC-MS (Method 4): Rt = 1.30 min; MS (ESIpos): m/z = 516 [M+H].
Example 38
3-(0-(4-cyclopropylpiperazin-1-ypcyclopropyl]carbonyllamino)-4-
(difluoromethoxy)-N-(5-phenyl-
1,3,4-thiadiazol-2-yl)benzamide
H
Nzz N 0
N/y'
\ s A
. N
H _____________________________________________
FO
I
F
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 150 mg (0.41 mmol) of the compound of intermediate 46 and 348 mg
of the compound
of intermediate 43. 32.6 mg (14% of theory) of the title compound were
obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 0.45 - 0.85 (m, 4H), 1.15 - 1.33 (m,
4H), 2.47 - 2.74 (m, 8H),
7.40 (t, 1H), 7.45 (d, 1H), 7.51 - 7.58 (m, 3H), 7.93 - 8.03 (m, 3H), 8.96 (s,
1H), 10.24 (s, 1H), 13.0 (s,
1H).
LC-MS (Method 4): Rt = 1.00 min; MS (ESIpos): m/z = 555 [M+H].
Example 39
4-(difluoromethoxy)-3-(0-(4-methylpiperazin-1-ypcyclopropyl]carbonyllamino)-N-
(5-phenyl-1,3,4-
thiadiazol-2-yObenzamide
220

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN 0
i yN
\ S
. 0 r-NCH3
. N).cNJ
H ______________________________________________
FO
I
F
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 150 mg (0.41 mmol) of the compound of intermediate 46 and 305 mg
of the compound
of intermediate 42. 50.7 mg (23% of theory) of the title compound were
obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.14 - 1.20 (m, 2H), 1.21 - 1.27 (m,
2H), 2.46 (s, 3H), 2.53 -
2.65 (m, 4H), 2.71 - 2.94 (m, 4H), 7.46 (d, 1H), 7.49 (t, 1H), 7.52 - 7.59 (m,
3H), 7.95 - 8.02 (m, 3H),
9.01 (d, 1H), 10.43 (s, 1H), 12.24 (s, 1H).
LC-MS (Method 4): Rt = 0.94 min; MS (ESIpos): m/z = 529 [M+1-1]+.
Example 40
4-(difluoromethoxy)-3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide
H
NN 0
i yN
\ S
. 0 r-NCH3
0
N
H
FO
I
F
The title compound was prepared in a manner analogous to that described in
example 53 starting
from 140 mg (0.32 mmol) of the compound of intermediate 47 and 71 uL (0.64
mmol, 2 equiv) 1-
methylpiperazine. 93.2 mg (58% of theory) of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.24 (s, 3H), 2.40 - 2.55 (m, 4H),
2.56 - 2.68 (m, 4H), 3.21 (s,
2H), 7.43 (d, 1H), 7.46 (t, 1H), 7.50 - 7.59 (m, 3H), 7.93 - 8.02 (m, 3H),
9.01 (d, 1H), 9.90 (s, 1H), 12.85
(s, 1H).
LC-MS (Method 4): Rt = 0.88 min; MS (ESIpos): m/z = 503 [M+1-1]+.
221

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Example 41
3-{[(4-cyclopropylpiperazin-1-ypacetyl]amino}-4-(difluoromethoxy)-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide
Nzz N 0
N/y'
s
NON A
FO
The title compound was prepared in a manner analogous to that described in
example 53 starting
from 140 mg (0.32 mmol) of the compound of intermediate 47. 90.3 mg (54% of
theory) of the title
compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.26 - 0.38 (m, 2H), 0.39 - 0.50 (m,
2H), 1.57 - 1.75 (m, 1H),
2.50 - 2.75 (m, 8H), 3.21 (s, 2H), 7.46 (d, 1H), 7.48 (t, 1H), 7.51 - 7.60 (m,
3H), 7.94 - 8.03 (m, 3H), 8.97
- 9.04 (m, 1H), 9.95 (s, 1H), 13.21 (s, 1H).
LC-MS (Method 4): Rt = 0.93 min; MS (ESIpos): m/z = 529 [M+1-1]+.
Example 42
4-(difluoromethoxy)-34[2-(4-methylpiperazin-1-yppropanoyl]aminol-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide trifluoroacetate (1:1)
0
FyL
N 0 OH
S
0
N)Y
FO CH3
The title compound was prepared in a manner analogous to that described in
example 53 starting
from 500 mg (1.10 mmol) of the compound of intermediate 48 and 250 uL (2.21
mmol, 2 equiv) 1-
methylpiperazine. The reaction mixture was stirred over night at 60 C.
Purification by HPLC under
the addition of trifluoroacetic acid yielded 40.0 mg (6% of theory) of the
title compound.
222

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.25 (d, 3H), 2.51 - 2.66 (m, 1H),
2.67 - 2.88 (m, 1H), 2.81 (s,
3H), 2.90 - 3.14 (m, 4H), 3.41 - 3.54 (m, 2H), 3.59 (q, 1H), 7.41 (t, 1H),
7.45 (d, 1H), 7.51 - 7.61 (m, 3H),
7.94 - 8.02 (m, 2H), 8.05 (dd, 1H), 8.74 (d, 1H), 9.70 (s, 1H), 9.78 (s, 1H),
13.25 (s, 1H).
LC-MS (Method 4): Rt = 0.95 min; MS (ESIpos): m/z = 517 [M¨CF3CO2H+H].
Example 43
4-(methoxymethyl)-3-(1[1-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-
phenyl-1,3,4-thiadiazol-
2-yObenzamide
H
NN 0
1\1/ :-.....::r
\ S
0 . )(:).crjo N
H __
H3C
0
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 250 mg (0.73 mmol) of the compound of intermediate 51 and 610 mg
(2.94 mmol, 4
equiy) of the compound of intermediate 44. 298 mg (80% of theory) of the title
compound were
obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.11 - 1.17 (m, 2H), 1.21 - 1.27 (m,
2H), 2.43 - 2.48 (m, 4H),
3.33 (s, 3H), 3.68 - 3.78 (m, 4H), 4.64 (s, 2H), 7.51 - 7.58 (m, 4H), 7.88
(dd, 1H), 7.94 - 8.02 (m, 2H),
8.86 (d, 1H), 10.63 (s, 1H), 13.20 (s, 1H).
LC-MS (Method 4): Rt = 1.27 min; MS (ESIpos): m/z = 494 [M+H]+.
Example 44
3-(1[1-(4-cyclopropylpiperazin-1-ypcyclopropyl]carbonyllamino)-4-
(methoxymethyp-N-(5-phenyl-
1,3,4-thiadiazol-2-yObenzamide
H
NN 0
1\1/ :-.....::r
\ S A
0 )0.cir:N
J
= N
H _____________________________________________
H3C
0
223

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 170 mg (0.50 mmol) of the compound of intermediate 51 and 210 mg
of the compound
of intermediate 43. 167 mg (61% of theory) of the title compound were
obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.24 - 0.31 (m, 2H), 0.38 - 0.46 (m,
2H), 1.08 - 1.15 (m, 2H),
1.15 - 1.21 (m, 2H), 1.61 - 1.70 (m, 1H), 2.35 - 2.46 (m, 4H), 2.64 - 2.74 (m,
4H), 3.37 (s, 3H), 4.63 (s,
2H), 7.51 - 7.58 (m, 4H), 7.87 (dd, 1H), 7.95 - 8.01 (m, 2H), 8.86 (d, 1H),
10.58 (s, 1H), 13.22 (s, 1H).
LC-MS (Method 3): Rt = 0.83 min; MS (ESIpos): m/z = 533 [M+H].
Example 45
4-(methoxymethyl)-3-(0-(4-methylpiperazin-1-ypcyclopropyl]carbonyllamino)-N-(5-
phenyl-1,3,4-
thiadiazol-2-yObenzamide hydrochloride (1:1)
H
N 0 H-CI
N/N----r
\ S 0 )c
0.,Nc.),CH3
. N
H
H3C
0
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 170 mg (0.50 mmol) of the compound of intermediate 51 and 368 mg
of the compound
of intermediate 42. 201 mg (79% of theory) of the title compound were
obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.18 - 1.25 (m, 4H), 2.45 - 3.65 (m,
8H), 2.80 (s, 3H), 3.32 (s,
3H), 4.66 (s, 2H), 7.53 - 7.59 (m, 4H), 7.95 (dd, 1H), 7.96 - 8.00 (m, 2H),
8.70 (d, 1H), 9.55 (s, 1H),
10.29 (s, 1H), 13.18 (s, 1H).
LC-MS (Method 3): Rt = 0.74 min; MS (ESIpos): m/z = 507 [M¨HCI+H].
Example 46
4-(methoxymethyl)-3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide
224

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N N 0
NI
\ S 0 0

oCH3
40 N
H
H3C
0
The title compound was prepared in a manner analogous to that described in
example 53 starting
from 200 mg (0.48 mmol) of the compound of intermediate 52 and 110 uL (0.96
mmol, 2 equiv) 1-
methylpiperazine. 154 mg (67% of theory) of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.23 (s, 3H), 2.42 - 2.65 (m, 8H),
3.18 (s, 2H), 3.39 (s, 3H),
4.55 (s, 2H), 7.47 - 7.60 (m, 4H), 7.89 (dd, 1H), 7.94 - 8.01 (m, 2H), 8.79 -
8.83 (m, 1H), 9.94 (s, 1H).
LC-MS (Method 1): Rt = 0.86 min; MS (ESIpos): m/z = 481 [M+1-1]+.
Example 47
4-[(methylsulfonyl)methyl]-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-
(5-phenyl-1,3,4-
thiadiazol-2-yObenzamide
H
NN 0
N/ ....:-.......r
\ S
0 3,cir:o
J
. N
H ________________________________________________
H3C
S
I/ \\
00
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 150 mg (0.39 mmol) of the compound of intermediate 55 and 320 mg
(1.54 mmol, 4
equiv) of the compound of intermediate 44. 193 mg (90% of theory) of the title
compound were
obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.11 - 1.18 (m, 2H), 1.21 - 1.27 (m,
2H), 3.09 (s, 3H), 3.70 -
3.79 (m, 4H), 4.70 (s, 2H), 7.51 - 7.58 (m, 3H), 7.65 (d, 1H), 7.94 - 8.01 (m,
3H), 8.50 - 8.55 (m, 1H),
10.48 (s, 1H), 13.21 (s, 1H).
LC-MS (Method 3): Rt = 0.64 min; MS (ESIpos): m/z = 542 [M+1-1]+.
Example 48
225

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
3-(0-(4-cyclopropylpiperazin-1-ypcyclopropyl]carbonyllamino)-4-
[(methylsulfonyl)methyl]-N-(5-
pheny1-1,3,4-thiadiazol-2-yl)benzamide
H
NN 0
N/ ....:-.......r
\ S
0 A
. N
H _____________________________________________
H3C
S
I/ \\
00
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 150 mg (0.39 mmol) of the compound of intermediate 55 and 573 mg
(2.31 mmol, 6
equiv) of the compound of intermediate 43. 59 mg (26% of theory) of the title
compound were
obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 0.22 - 0.31 (m, 2H), 0.37 - 0.45 (m,
2H), 1.08 - 1.15 (m, 2H),
1.15 - 1.23 (m, 2H), 1.63 - 1.71 (m, 1H), 2.37 - 2.48 (m, 4H), 2.69 - 2.79 (m,
4H), 3.09 (s, 3H), 4.67 (s,
2H), 7.52 - 7.59 (m, 3H), 7.66 (d, 1H), 7.94 - 8.03 (m, 3H), 8.56 (d, 1H),
10.46 (s, 1H), 13.25 (s, 1H).
LC-MS (Method 3): Rt = 0.71 min; MS (ESIpos): m/z = 581 [M+1-1]+.
Example 49
3-(0-(4-methylpiperazin-1-ypcyclopropyl]carbonyllamino)-4-
[(methylsulfonyl)methyl]-N-(5-phenyl-
1,3,4-thiadiazol-2-yl)benzamide
H
NN 0
N/ ...4.......r
\ S 0 (NCH3
H ______________________________________________
HC
S
I/ \\
00
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 150 mg (0.39 mmol) of the compound of intermediate 55 and 510 mg
(2.31 mmol, 6
equiv) of the compound of intermediate 42. 12.5 mg (6% of theory) of the title
compound were
obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.10 - 1.27 (m, 4H), 2.24 (s, 3H),
2.56 - 2.63 (m, 4H), 3.07 (s,
3H), 4.65 (s, 2H), 7.48 - 7.57 (m, 3H), 7.59 - 7.65 (m, 1H), 7.92 - 8.01 (m,
3H), 8.53 (d, 1H), 10.36 (s,
1H).
226

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 0.63 min; MS (ESIpos): rniz = 555 [m+H].
Example 50
3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-phenyl-1,3,4-thiadiazol-2-
y1)-4-
(trifluoromethoxy)benzamide
H
N 0
N11\1:-.Y
\ S
. N
H _________________________________________________
FO
F I
F
The title compound was prepared in a manner analogous to that described in
intermediate 40
starting from 180 mg (0.48 mmol) of the compound of intermediate 45 and 170 mg
(0.96 mmol, 2
equiv) of 5-phenyl-1,3,4-thiadiazol-2-amine. 35.0 mg (14% of theory) of the
title compound were
obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.13 - 1.21 (m, 2H), 1.26 - 1.34 (m,
2H), 2.44 - 2.50 (m, 4H),
3.63 - 3.76 (m, 4H), 7.51 - 7.60 (m, 3H), 7.67 (dd, 1H), 7.93 - 8.04 (m, 3H),
9.08 (d, 1H), 10.57 (s, 1H),
13.36 (s, 1H).
LC-MS (Method 1): Rt = 1.39 min; MS (ESIpos): rniz = 534 [m+H].
Example 51
3-(0-(4-cyclopropylpiperazin-1-ypcyclopropyl]carbonyllamino)-N-(5-pheny1-1,3,4-
thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
H
N 0
N11\1:-.Y
\ S A
J
= N
H _____________________________________________
FO
F I
F
To a suspension of 151 mg (0.61 mmol) of the compound from intermediate 43 in
8 mL of
dichloromethane were added 0.32 mL of 1-chloro-N,N,2-trimethylprop-1-en-1-
amine (2.45 mmol, 6
227

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
equiv). The reaction mixture was stirred at room temperature for 2 h. The
resulting mixture was
concentrated under reduced pressure, was then triturated with dichloromethane
and was
concentrated under reduced pressure. The remaining material was provided in 8
mL of
dichloromethane and 0.15 mL of pyridine (1.83 mmol, 4.5 equiv) and 155 mg of
the compound from
intermediate 40 were added. The resulting suspension was stirred at room
temperature over night.
The resulting mixture was concentrated under reduced pressure. Purification by
HPLC (Waters
Autopurificationsystem, column: XBrigde C18 Sum 100x30 mm, solvent: water /
methanol + 0.2%
ammonia (32%) gradient, rate: 70 mL/min, temperature: room temperature)
yielded 22.2 mg (9% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.24 - 0.33 (m, 2H), 0.38 - 0.50 (m,
2H), 1.11 - 1.19 (m, 2H),
1.20 - 1.28 (m, 2H), 1.55 - 1.64 (m, 1H), 2.35 - 2.47 (m, 4H), 2.60 - 2.71 (m,
4H), 7.48 - 7.60 (m, 3H),
7.61 - 7.69 (m, 1H), 7.92 - 8.03 (m, 3H), 9.14 (d, 1H), 10.63 (s, 1H), 13.4
(s, 1H).
LC-MS (Method 3): Rt = 0.88 min; MS (ESIpos): m/z = 573 [m+H].
Example 52
3-(0-(4-methylpiperazin-1-ypcyclopropyl]carbonyllamino)-N-(5-phenyl-1,3,4-
thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
H
NN 0
i yN
\ S .õCH3
... 0 0 r'N
N
H
F 0
F>r
F
To a suspension of 100 mg (0.45 mmol) of the compound from intermediate 42 in
6 mL of
dichloromethane were added 0.24 mL of 1-chloro-N,N,2-trimethylprop-1-en-1-
amine (1.81 mmol, 4
equiv). The reaction mixture was stirred at room temperature for 2 h. The
resulting mixture was
concentrated under reduced pressure, was then triturated with dichloromethane
and was
concentrated under reduced pressure. The remaining material was provided in 6
mL of
dichloromethane and 0.11 mL of pyridine (1.36 mmol, 3 equiv) and 172 mg of the
compound from
intermediate 40 were added. The resulting suspension was stirred at room
temperature over night.
The resulting mixture was concentrated under reduced pressure, was then
triturated with a mixture
of 5 mL of water and 5 mL of ethanol, and the resulting mixture was stirred
for 30 minutes. The
remaining solids were removed by filtration, washed with ethanol, and were
dried under reduced
pressure. Purification by HPLC (Waters Autopurificationsystem, column: XBrigde
C18 Sum 100x30
mm, solvent: water / methanol + 0.2% ammonia (32%) gradient, rate: 70 mL/min,
temperature:
room temperature) yielded 25.9 mg (10% of theory) of the title compound.
228

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.13 - 1.21 (m, 2H), 1.22 - 1.29 (m,
2H), 2.22 (s, 3H), 7.48 -
7.59 (m, 3H), 7.63 (dd, 1H), 7.91 - 8.02 (m, 3H), 9.12 (d, 1H), 10.55 (s, 1H),
13.15 (s, 1H).
LC-MS (Method 3): Rt = 0.79 min; MS (ESIpos): m/z = 547 [M+H].
Example 53
3-{[(4-cyclopropylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-
y1)-4-
(trifluoromethoxy)benzamide
H
N 0
N/Nzzy'
\ s
r'N A
0
= I. )-=L. N j
N
H
FO
F I
F
To a suspension of 120 mg (0.26 mmol) of the compound from intermediate 41 in
1.5 mL of DMF
were added 0.22 mL of triethylamine (1.58 mmol, 6 equiv), 105 mg of 1-
cyclopropylpiperazine
dihydrochloride (0.53 mmol, 2 equiv), and 9.0 mg of potassium iodide (0.05
mmol, 0.2 equiv). The
reaction mixture was stirred at room temperature over night. After filtration,
purification by HPLC
(method 2) yielded 86 mg (60% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.26 - 0.35 (m, 2H), 0.39 - 0.47 (m,
2H), 2.47 - 2.67 (m, 8H),
3.21 (s, 2H), 7.51 - 7.59 (m, 3H), 7.62 - 7.69 (m, 1H), 7.94 - 8.05 (m, 3H),
9.01 (d, 1H), 9.97 (s, 1H),
13.41 (s, 1H).
LC-MS (Method 1): Rt = 0.98 min; MS (ESIpos): m/z = 547 [M+H].
Example 54
3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
229

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN 0
N\
/ y S
. 0 r-NCH3
. N).L-N-)
H
FO
Fl
F
To a suspension of 15.5 g (33.9 mmol) of the compound from intermediate 41 in
250 mL of DMF
were added 9.5 mL of triethylamine (67.9 mmol, 2 equiv), 7.5 mL of 1-
methylpiperazine (67.9 mmol,
2 equiv), and 1.13 g of potassium iodide (6.79 mmol, 0.2 equiv). The reaction
mixture was stirred at
room temperature over night. The resulting mixture was concentrated under
reduced pressure, was
then triturated with a mixture of 500 mL of water and 300 mL of ethanol, and
the resulting mixture
was stirred for 30 minutes. The remaining solids were removed by filtration,
washed with ethanol,
and were dried at 50 C under reduced pressure. The remaining solids were
dissolved at 40 C in 480
mL of DMF, and the solution was added dropwise into 1580 mL of a 0.1M aqueous
solution of
sodium bicarbonate. The resulting suspension was stirred for 30 minutes, the
remaining solids were
removed by filtration, washed with water, and were dried at 50 C under
reduced pressure to give
13.6 g of the title compound (75% of theory).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.26 (s, 3H), 2.56 - 2.70 (m, 4H),
3.24 (s, 2H), 7.48 - 7.58 (m,
3H), 7.58 - 7.66 (m, 1H), 7.91 - 8.05 (m, 3H), 8.98 (d, 1H), 9.91 (s, 1H),
12.95 (s, 1H).
LC-MS (Method 4): Rt = 1.00 min; MS (ESIpos): m/z = 521 [M+1-1]+.
Example 55
3-[(morpholin-4-ylacetypamino]-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
H
NN 0
N' -----zr
\S
. . r'0
N)'0 N-)
H
F 0
F>r
F
To a suspension of 5.00 g (11.0 mmol) of the compound from intermediate 41 in
110 mL of DMF
were added 3.1 mL of triethylamine (21.9 mmol, 2 equiv), 1.9 mL of morpholine
(21.9 mmol, 2
equiv), and 363 mg of potassium iodide (2.19 mmol, 0.2 equiv). Another 50 mL
of DMF were added
and the reaction mixture was stirred at room temperature over night. The
resulting mixture was
concentrated under reduced pressure, was then triturated with a mixture of 100
mL of water and
230

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
100 mL of ethanol, and the resulting mixture was stirred for 30 minutes. The
remaining solids were
removed by filtration, washed with ethanol, and were dried at 50 C under
reduced pressure to give
5.13 g of the title compound (92% of theory).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.62 (m, 4H), 3.24 (s, 2H),
3.62 - 3.69 (m, 4H), 7.52 -
7.59 (m, 3H), 7.66 (dd, 1H), 7.95 - 8.06 (m, 3H), 8.95 (d, 1H), 9.93 (s, 1H),
13.43 (s, 1H).
LC-MS (Method 4): Rt = 1.12 min; MS (ESIpos): m/z = 508 [M+H].
Example 56
2-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N4-(5-phenyl-1,3,4-thiadiazol-
2-
yl)terephthalamide
H
N 0
NINY
\ S
0 )0.,c00
. N
H
0 NH2
To a suspension of the compound of intermediate 57 (116 mg, 280 mop in 5.0 mL
of
dichloromethane was added 1-chloro-N,N,2-trimethylpropenylamine (299 mg, 2.24
mmol). The
mixture was stirred for 2 h at room temperature. The resulting solution was
evaporated to dryness.
The residue was two times co-destilled with dichloromethane and finally
dissolved in 5.0 mL of
dichloromethane. To this solution pyridine (102 uL, 1.26 mmol) and 1-
(morpholin-4-
yl)cyclopropanecarboxylic acid hydrochloride (116 mg, 560 mop were added. The
reaction mixture
was stirred for 2 d at room temperature. The mixture was concentrated and the
residue was
dissolved in DMSO (1.5 mL) and stirred overnight to provide a fine suspension,
which was filtrated.
The precipitate was washed with water and dried at 45 C under vacuum to yield
the desired
compound 56 (115 mg, 220 mmol, 79%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.09 - 1.16 (m, 2 H), 1.18 - 1.25 (m,
2 H), 2.41 (br. s, 4 H),
3.81 (br. s, 4 H), 7.45 - 7.60 (m, 3 H), 7.80 - 8.06 (m, 5 H), 8.35 (s, 1 H),
9.26 (s, 1 H), 12.63 (s, 1 H),
13.31 (br. s, 1 H).
LC-MS (Method 1): Rt = 1.10 min; MS (ESIpos): m/z = 493 [M+H].
Example 57
34[2-(morpholin-4-yppropanoyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
231

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN 0
/
N
\y s
r0
= . ).0Nj
N
H
F 0
F>r
F
To a solution of intermediate 58 (590 mg, 1.25 mmol) and triethylamine (262
uL, 1.88 mmol) in 5.4
mL of DMF were added potassium iodide (32.2 mg, 194 mop and morpholine (164
uL, 1.88 mmol).
The reaction mixture was stirred over night under an inert gas atmosphere at
room temperature. The
same amount of potassium iodide and 1 equivalent of morpholine were added to
the mixture and it
was stirred at 50 C until complete consumption of the starting material was
observed. The reaction
mixture was taken onto water and extracted three times with
dichloromethane/isopropanol (4:1).
The combined organic layers were washed with brine, dried over a silicon
filter and taken to dryness.
The residue was suspended in ethanol (2.0 mL) and stirred at room temperature.
The resulting fine
suspension was filtrated to collect the precipitate. The same procedure was
repeated with 4.0 mL of
dichloromethane/ethanol 1:1 to yield the desired product 57 (232 mg, 430
limo!, 34%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H) , 2.62 - 2.53 (m, 4H),
3.41 (d, 1H), 3.66 (t, 4H),
7.55 (dd, 3H), 7.65 (dd, 1H), 8.07-7.93 (m, 3H), 8.90 (d, 1H), 10.05 (s, 1H),
13.54 - 13.32 (m, 1H).
LC-MS (Method 1): Rt = 1.14 min; MS (ESIpos): m/z = 522 [M+1-1]+.
Example 58
34[2-(4-methylpiperazin-1-yppropanoyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-
y1)-4-
(trifluoromethoxy)benzamide
H
NN 0
/ yN
\ S
. 0 rN
N
H
F 0
F>r
F
To a solution of intermediate 58 (250 mg, 531 mop and triethylamine (111 uL,
796 mop in 2.3 mL
of DMF were added potassium iodide (10.1 mg, 61 mop and 1-methylpiperazine
(79.8 mg, 796
mop. The reaction mixture was stirred overnight under an inert gas atmosphere
at 50 C. The
reaction mixture was diluted with water and filtered. The filtrate was three
times extracted with
dichloromethane/isopropanol 4:1. The combined organic phases were washed with
brine, dried over
232

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
a silicon filter and concentrated in vacuum. The residue was suspended in
ethanol and stirred. The
resulting fine suspension was filtrated to collect the precipitate, which
provided after drying the
desired compound 58 (119 mg, 210 limo!, 40%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.22 (d, 3H), 2.33-2.24 (s, 3H), 2.56 -
2.52 (m, 4H), 2.61 (br.
s, 4H), 3.45 (q, 1H), 7.57 - 7.48 (m, 3H), 7.61 (dd, 1H), 8.05 - 7.92 (m, 3H),
8.93 (d, 1H), 10.05 (s, 1H),
13.07 - 12.61 (m, 1H).
LC-MS (Method 1): Rt = 0.92 min; MS (ESIpos): m/z = 535 [M+H].
Example 59
3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethypbenzamide
H
N 0
N/Nzl"
\ s
N
. I. LNO
N
H
F F
F
To a solution of intermediate 61 (250 mg, 567 mop, 1-methylpiperazine (85.2
mg, 851 mop and
potassium iodide (14.6 mg, 87.9 mop in 2.44 mL of DMF was added triethylamine
(119 uL, 851
mop. The mixture was stirred for 36 h at 50 C and afterwards poured into
water. The resulting
precipitate was removed by filtration (contains 56% of the desired product).
The filtrate was three
times extracted with dichloromethane/isopropanol 4:1. Thereby a precipitate
occurred which was
filtrated off, washed with ethanol and provided the desired compound 59 (103
mg, 35%) as an
analytically pure sample.
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.34 (s, 3H), 2.65 (br. s, 8H), 3.25 (s,
2H), 7.58 - 7.49 (m, 3H),
8.01 - 7.87 (m, 3H), 8.07 (s, 1H), 8.86 (s, 1H), 9.91 (s, 1H).
LC-MS (Method 4): Rt = 0.90 min; MS (ESIpos): m/z = 505 [M+H].
Example 60
6-(3,5-difluoropheny1)-N43-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-4-
(trifluoromethoxy)phenyl]nicotinamide
233

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
NH
I
F 0
0 rO
H ____________________________________________________
F FO
FI
F
254 mg (1.22 mmol, 2 equiv) of the compound of intermediate 44 were stirred in
4 mL of
dichloromethane at room temperature. 0.12 mL (1.53 mmol, 2.5 equiv) of DMF and
0.11 mL (1.22
mmol, 2 equiv) of oxalyl chloride were added and the mixture was stirred for
additional 0.5 h at room
temperature. 0.34 mL (3.05 mmol, 5 equiv) of 4-methylmorpholine and 250 mg
(0.61 mmol) of the
compound of intermediate 64 were added and the mixture was stirred at room
temperature over
night. 0.27 mL (2.44 mmol, 4 equiv) of 4-methylmorpholine and 210 mg of 1-
(morpholin-4-
yl)cyclopropanecarbonyl chloride hydrochloride (1:1) (prepared as described
above) were added and
the mixture was stirred at room temperature for 3 days. The reaction mixture
was poured into water
and extracted with ethyl acetate. The combined organic phases were dried
(Na2SO4 anh), and
concentrated under reduced pressure. Purification by HPLC (method 2) yielded
24 mg (7% of theory)
of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.11 - 1.19 (m, 2H), 1.22 - 1.32 (m,
2H), 2.42 - 2.49 (m, 4H),
3.63 - 3.75 (m, 4H), 7.35 - 7.53 (m, 2H), 7.73 (dd, 1H), 7.87 - 7.99 (m, 2H),
8.28 (d, 1H), 8.45 (dd, 1H),
8.86 (d, 1H), 9.20 (d, 1H), 10.47 (s, 1H), 10.72 (s, 1H).
LC-MS (Method 1): Rt = 1.46 min; MS (ESIpos): m/z = 563 [M+1-1]+.
Example 61
N-[3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-4-(trifluoromethoxy)pheny1]-
6-
phenylnicotinamide
0
NH
I
0 N 0 r0
101 N)-cNJ
H ___________________________________________________
F.0
FI
F
2.30 g (11.1 mmol, 2 equiv) of the compound of intermediate 44 were stirred in
20 mL of
dichloromethane at room temperature. 0.85 mL (11.1 mmol, 2 equiv) of DMF and
0.97 mL (11.1
234

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
mmol, 2 equiv) of oxalyl chloride were added and the mixture was stirred for
additional 0.5 h at room
temperature. 3.1 mL (27.7 mmol, 5 equiv) of 4-methylmorpholine and 2.07 g
(5.55 mmol) of the
compound of intermediate 66 were added and the mixture was stirred at room
temperature over
night. The reaction mixture was poured into water and extracted with
dichloromethane. The
combined organic phases were dried (Na2SO4 anh), and concentrated under
reduced pressure. The
residue was purified using MPLC (Biotage !solera; silica gel; hexane / Et0Ac
gradient). The obtained
material was dissolved in ethyl acetate and washed with saturated, aqueous
sodium bicarbonate
solution. The organic phase was dried over sodium sulfate and concentrated
under reduced pressure.
Purification by HPLC (column: chromatorex C18, 10um, 195x51mm, mobile phase:
acetonitrile/water
+0.1% formic acid gradient) yielded 123 mg (4% of theory) of the title
compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.11 - 1.18 (m, 2H), 1.23 - 1.30 (m,
2H), 2.42 - 2.48 (m, 4H),
3.65 - 3.73 (m, 4H), 7.44 - 7.58 (m, 4H), 7.71 (dd, 1H), 8.12 - 8.22 (m, 3H),
8.40 (dd, 1H), 8.85 (d, 1H),
9.19 (d, 1H), 10.46 (s, 1H), 10.67 (s, 1H).
LC-MS (Method 1): Rt = 1.38 min; MS (ESIpos): m/z = 527 [M+H].
Example 62
6-(2-fluoropheny1)-N44-methoxy-3-(0-(morpholin-4-
ypcyclopropyl]carbonyllamino)phenyl]nicotinamide
0
F
NH
I
0 N 0
l 1 N)cN
ro
J
H
0
H3C
To a solution of the compound of intermediate 69 (200 mg, 0.59 mmol) and the
compound of
intermediate 44 (246 mg, 1.19 mmol, 2 equiv) in DMF (2 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 617 mg, 1.19 mmol,
2 equiv) and
diisopropylethylamine (0.52 mL, 2.96 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (column:
chromatorex C18, 10um,
195x51mm, mobile phase: acetonitrile/water +0.1% formic acid gradient) yielded
149 mg (51% of
theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.08 - 1.15 (m, 2H), 1.16 - 1.23 (m,
2H), 2.40 - 2.48 (m, 4H),
3.67 - 3.77 (m, 4H), 3.94 (s, 3H), 7.08 (d, 1H), 7.34 - 7.42 (m, 2H), 7.51 -
7.61 (m, 2H), 7.94 (dd, 1H),
8.01 (td, 1H), 8.40 (dd, 1H), 8.67 (d, 1H), 9.22 (d, 1H), 10.42 (s, 1H), 10.59
(s, 1H).
LC-MS (Method 1): Rt = 1.25 min; MS (ESIpos): m/z = 491 [M+H].
235

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Example 63
3-{[(4-cyclopropylpiperazin-1-ypacetyl]aminol-N46-(2-fluorophenyl)pyridin-3-
y1]-4-
(trifluoromethoxy)benzamide
H
N 0
F
0 0
I\
I
(N N
)-NjN
H
FO
F I
F
5 To a solution of 150 mg (0.32 mmol) of the compound of intermediate 14 in
1.8 mL of DMF were
added 0.20 mL of triethylamine (1.44 mmol, 4.5 equiv), 96.0 mg of 1-
cyclopropylpiperazine
dihydrochloride (0.48 mmol, 1.5 equiv), and 8.3 mg of potassium iodide (0.05
mmol, 0.16 equiv). The
reaction mixture was stirred at room temperature over night. After filtration,
purification by HPLC
(method 2) yielded 62.8 mg (33% of theory) of the title compound.
10 1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.20 - 0.38 (m, 2H), 0.38 - 0.56
(m, 2H), 1.49 - 1.70 (m, 1H),
2.45 - 2.76 (m, 8H), 3.22 (s, 2H), 7.26 - 7.39 (m, 2H), 7.42 - 7.53 (m, 1H),
7.61 - 7.71 (m, 1H), 7.79 -
7.90 (m, 2H), 7.91 - 8.02 (m, 1H), 8.30 (dd, 1H), 8.84 (s, 1H), 9.06 (d, 1H),
9.95 (s, 1H), 10.72 (s, 1H).
LC-MS (Method 4): Rt = 1.04 min; MS (ESIpos): m/z = 558 [M+1-1]+.
Example 64
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[2-(4-methylpiperazin-1-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
F
I
10 N* r= CH3
N N5YNJ
H
FO CH3
FI
F
To a solution of 250 mg (0.52 mmol) of the compound of intermediate 15 in 3 mL
of DMF were
added 0.22 mL of triethylamine (1.56 mmol, 3 equiv), 0.17 mL of 1-
methylpiperazine (1.56 mmol, 3
equiv), and 13.4 mg of potassium iodide (0.08 mmol, 0.16 equiv). The reaction
mixture was stirred at
room temperature over night. After filtration, purification by HPLC (method 2)
yielded 155 mg (54%
of theory) of the title compound.
236

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.22 (d, 3H), 2.18 (s, 3H), 2.32 - 2.64
(m, 8H), 3.43 (q, 1H),
7.27 - 7.39 (m, 2H), 7.42 - 7.52 (m, 1H), 7.60 - 7.70 (m, 1H), 7.79 - 7.89 (m,
2H), 7.91 - 8.02 (m, 1H),
8.30 (dd, 1H), 8.84 (d, 1H), 9.06 (d, 1H), 10.09 (s, 1H), 10.72 (s, 1H).
LC-MS (Method 4): Rt = 1.04 min; MS (ESIpos): m/z = 546 [M+H].
Example 65
N46-(2-fluorophenyl)pyridin-3-y1]-3-1[(25)-2-(4-methylpiperazin-1-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide or
N46-(2-fluorophenyppyridin-3-y1]-3-1[(2R)-2-(4-methylpiperazin-1-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
0
)0.N
FO CH3
or
0
0 r-NCH3
FO CH3
120 mg of the racemate of the compound of example 64 were separated using
chiral HPLC (System:
Agilent Prep 1200, Column: Chiralpak IC Slim 250x20 mm, Solvent: hexane / 2-
propanol /
diethylamine 50:50:0.1 (v/v/v)) to give the first eluting enantiomer of N46-(2-
fluorophenyppyridin-3-
y1]-3-1[2-(4-methylpiperazin-1-yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide (36 mg).
'H-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.22 (d, 3H), 2.18 (s, 3H), 2.29 - 2.62
(m, 8H), 3.43 (q, 1H),
7.30 - 7.37 (m, 2H), 7.43 - 7.51 (m, 1H), 7.65 (dd, 1H), 7.80 - 7.87 (m, 2H),
7.93 - 8.00 (m, 1H), 8.30
(dd, 1H), 8.85 (d, 1H), 9.06 (d, 1H), 10.09 (s, 1H), 10.72 (s, 1H).
LC-MS (Method 4): Rt = 1.01 min; MS (ESIpos): m/z = 546 [M+H].
237

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Chiral HPLC (System: Waters Alliance 2695 DAD 996 ESA: Corona, Column:
Chiralpak IC 3um 100x4.6
mm, Solvent: hexane / 2-propanol / diethylamine 50:50:0.1 (v/v/v)): Rt = 11.08
min, 99.7%
enantiomeric excess.
Example 66
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[(25)-2-(4-methylpiperazin-1-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide or
N46-(2-fluorophenyppyridin-3-y1]-3-{[(2R)-2-(4-methylpiperazin-1-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
F
I
N0
40
N
H
FO CH3
FI
F
or
H
N 0
F
I
10 40 0 r-NCH3
N
H z
FO CH3
FI
F
120 mg of the racemate of the compound of example 64 were separated using
chiral HPLC (System:
Agilent Prep 1200, Column: Chiralpak IC Slim 250x20 mm, Solvent: hexane / 2-
propanol /
diethylamine 50:50:0.1 (v/v/v)) to give the second eluting enantiomer of N46-
(2-
fluorophenyl)pyridin-3-y1]-3-{[2-(4-methylpiperazin-1-yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide (35 mg).
'H-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.22 (d, 3H), 2.18 (s, 3H), 2.30 - 2.63
(m, 8H), 3.43 (q, 1H),
7.29 - 7.37 (m, 2H), 7.44 - 7.50 (m, 1H), 7.65 (dd, 1H), 7.79 - 7.89 (m, 2H),
7.93 - 8.00 (m, 1H), 8.30
(dd, 1H), 8.85 (d, 1H), 9.06 (d, 1H), 10.09 (s, 1H), 10.72 (s, 1H).
Chiral HPLC (System: Waters Alliance 2695 DAD 996 ESA: Corona, Column:
Chiralpak IC 3um 100x4.6
mm, Solvent: hexane / 2-propanol / diethylamine 50:50:0.1 (v/v/v)): Rt = 14.57
min, 92.3%
enantiomeric excess.
238

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Example 67
3-(0-(4-cyclopropylpiperazin-1-ypcyclopropyl]carbonyllamino)-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
F
I
(NI\
N 0
N)cN-)
H ________________________________________________
FO
F>(
F
5
To a suspension of 150 mg (0.61 mmol) of the compound of intermediate 43 in 8
mL of
dichloromethane were added 0.32 mL of 1-chloro-N,N,2-trimethylprop-1-en-1-
amine (2.43 mmol, 6
equiv). The reaction mixture was stirred at room temperature for 2 h. The
resulting mixture was
concentrated under reduced pressure, was then triturated with dichloromethane
and was
10 concentrated under reduced pressure. The remaining material was provided
in 8 mL of
dichloromethane and 0.15 mL of pyridine (1.82 mmol, 4.5 equiv) and 159 mg of
the compound from
intermediate 10 were added. The resulting solution was stirred at room
temperature over night. The
resulting mixture was concentrated under reduced pressure. Purification by
HPLC (Waters
Autopurificationsystem, column: XBrigde C18 Sum 100x30 mm, solvent: water /
acetonitrile + 0.2%
ammonia (32%) gradient, rate: 70 mL/min, temperature: room temperature)
yielded 109 mg (46% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.24 - 0.33 (m, 2H), 0.40 - 0.48 (m,
2H), 1.11 - 1.19 (m, 2H),
1.19 - 1.28 (m, 2H), 1.54 - 1.65 (m, 1H), 2.36 - 2.46 (m, 4H), 2.60 - 2.71 (m,
4H), 7.28 - 7.38 (m, 2H),
7.42 - 7.52 (m, 1H), 7.67 (dd, 1H), 7.78 - 7.87 (m, 2H), 7.91 - 8.01 (m, 1H),
8.29 (dd, 1H), 8.99 (d, 1H),
9.05 (d, 1H), 10.64 (s, 1H), 10.72 (s, 1H).
LC-MS (Method 3): Rt = 1.55 min; MS (ESIpos): m/z = 584 [m+H].
Example 68
N46-(2-fluorophenyl)pyridin-3-y1]-3-(0-(morpholin-4-
ypcyclopropyl]carbonyllamino)-4-
(trifluoromethoxy)benzamide
239

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F
I
0 N 0 r0
N)-cNJ
H ___________________________________________________
FO
FI
F
200 mg (0.96 mmol, 2 equiv) of the compound of intermediate 44 were stirred in
4 mL of
dichloromethane at room temperature. 0.09 mL (1.20 mmol, 2.5 equiv) of DMF and
0.08 mL (0.96
mmol, 2 equiv) of oxalyl chloride were added and the mixture was stirred for
additional 0.5 h at room
5 temperature. 0.27 mL (2.41 mmol, 5 equiv) of 4-methylmorpholine and 188
mg (0.48 mmol) of the
compound of intermediate 10 were added and the mixture was stirred at room
temperature over
night. The reaction mixture was poured into water and extracted with ethyl
acetate. The combined
organic phases were dried over sodium sulfate, and concentrated under reduced
pressure.
Purification by HPLC (method 2) yielded 25 mg (9% of theory) of the title
compound.
10 1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.11 - 1.20 (m, 2H), 1.25 - 1.34
(m, 2H), 2.39 - 2.50 (m, 4H),
3.64 - 3.78 (m, 4H), 7.27 - 7.39 (m, 2H), 7.41 - 7.53 (m, 1H), 7.63 - 7.73 (m,
1H), 7.78 - 7.90 (m, 2H),
7.91 - 8.01 (m, 1H), 8.30 (dd, 1H), 8.93 (d, 1H), 9.05 (d, 1H), 10.57 (s, 1H),
10.73 (s, 1H).
LC-MS (Method 1): Rt = 1.39 min; MS (ESIpos): m/z = 545 [M+1-1]+.
Example 69
N46-(3-fluorophenyl)pyridin-3-y1]-3-{[2-(morpholin-4-yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
H
N 0
I
F 0 /
N 0 r0
(10 N)yJ
H
FO CH3
FI
F
To a solution of 500 mg (1.04 mmol) of the compound of intermediate 71 in 6 mL
of DMF were
added 0.43 mL of triethylamine (3.11 mmol, 3 equiv), 0.27 mL of morpholine
(3.11 mmol, 3 equiv),
and 34.5 mg of potassium iodide (0.21 mmol, 0.2 equiv). The reaction mixture
was stirred at 50 C
over night. After filtration, purification by HPLC (column: chromatorex C18,
10um, 195x51mm,
240

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
mobile phase: acetonitrile/water +0.1% formic acid gradient) yielded 214 mg
(38% of theory) of the
title compound.
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.22 (d, 3H), 2.51 - 2.59 (m, 4H), 3.40
(q, 1H), 3.57 - 3.74 (m,
4H), 7.24 (td, 1H), 7.46 - 7.58 (m, 1H), 7.65 (dd, 1H), 7.79 - 7.97 (m, 3H),
8.06 (d, 1H), 8.31 (dd, 1H),
8.74 (d, 1H), 9.01 (d, 1H), 10.05 (s, 1H), 10.73 (s, 1H).
LC-MS (Method 1): Rt = 1.15 min; MS (ESIpos): m/z = 533 [M+H].
Example 70
N46-(3-fluorophenyl)pyridin-3-y1]-3-{[2-(8-oxa-3-azabicyclo[3.2.1]oct-3-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
H
N 0
I
F 0
0
10 N)Y
H
FO CH3
F I
F
To a solution of 500 mg (1.04 mmol) of the compound of intermediate 71 in 6 mL
of DMF were
added 0.58 mL of triethylamine (4.15 mmol, 4 equiv), 466 mg of 8-oxa-3-
azabicyclo[3.2.1]octane
hydrochloride (3.11 mmol, 3 equiv), and 34.5 mg of potassium iodide (0.21
mmol, 0.2 equiv). The
reaction mixture was stirred at 50 C over night. 0.58 mL of triethylamine
(4.15 mmol, 4 equiv), 466
mg of 8-oxa-3-azabicyclo[3.2.1]octane hydrochloride (3.11 mmol, 3 equiv), and
34.5 mg of potassium
iodide (0.21 mmol, 0.2 equiv) were added and the reaction mixture was stirred
at 50 C over night.
After filtration and concentration, purification by HPLC (Waters
Autopurificationsystem, column:
Reprospher C18-DE Sum 125x30 mm, solvent: water! acetonitrile + 0.1% formic
acid (99%) gradient,
rate: 70 mL/min, temperature: room temperature) yielded 288 mg (48% of theory)
of the title
compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.19 (d, 3H), 1.71 - 1.88 (m, 2H),
1.89 - 2.05 (m, 2H), 2.40 -
2.47 (m, 2H), 2.56 - 2.64 (m, 2H), 3.32 (q, 1H), 4.20 - 4.33 (m, 2H), 7.25
(td, 1H), 7.47 - 7.58 (m, 1H),
7.65 (dd, 1H), 7.81 - 7.99 (m, 3H), 8.07 (d, 1H), 8.31 (dd, 1H), 8.77 (d, 1H),
9.02 (d, 1H), 9.69 (s, 1H),
10.73 (s, 1H).
LC-MS (Method 4): Rt = 1.36 min; MS (ESIpos): m/z = 559 [M+H].
Example 71
241

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
N46-(3,5-difluorophenyl)pyridin-3-y1]-3-(0-(morpholin-4-
ypcyclopropyl]carbonyllamino)-4-
(trifluoromethoxy)benzamide
H
N 0
I
F 0
0 r'0
1.1 N)cN-)
H ____________________________________________________
F FO
FI
F
189 mg (0.91 mmol, 2 equiv) of the compound of intermediate 44 were stirred in
2 mL of
dichloromethane at room temperature. 0.07 mL (0.91 mmol, 2 equiv) of DMF and
0.08 mL (0.91
mmol, 2 equiv) of oxalyl chloride were added and the mixture was stirred for
additional 0.5 h at room
temperature. 0.25 mL (2.27 mmol, 5 equiv) of 4-methylmorpholine and 200 mg
(0.45 mmol) of the
compound of intermediate 72 were added and the mixture was stirred at room
temperature over
night. The reaction mixture was poured into water and extracted with
dichloromethane. The
combined organic phases were dried over sodium sulfate, and concentrated under
reduced pressure.
Purification by HPLC (method 2) yielded 65 mg (25% of theory) of the title
compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.14 - 1.19 (m, 2H), 1.26 - 1.31 (m,
2H), 2.44 - 2.48 (m, 4H),
3.65 - 3.75 (m, 4H), 7.23 - 7.32 (m, 1H), 7.67 (dd, 1H), 7.75 - 7.86 (m, 3H),
8.11 (d, 1H), 8.32 (dd, 1H),
8.93 (d, 1H), 9.02 (d, 1H), 10.56 (s, 1H), 10.75 (s, 1H).
LC-MS (Method 1): Rt = 1.46 min; MS (ESIpos): m/z = 563 [M+1-1]+.
Example 72
N46-(3,5-difluorophenyl)pyridin-3-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
H
N 0
I
F 0 /
N 0
10 )-Nj
N
H
F FO
FI
F
To a solution of 100 mg (0.21 mmol) of the compound of intermediate 73 in 1.5
mL of DMF were
added 0.06 mL of triethylamine (0.41 mmol, 2 equiv), 0.04 mL of morpholine
(0.41 mmol, 2 equiv),
and 6.8 mg of potassium iodide (0.04 mmol, 0.2 equiv). The reaction mixture
was stirred at room
242

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
temperature over night. After filtration, purification by HPLC (method 2)
yielded 54 mg (48% of
theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.61 (m, 4H), 3.23 (s, 2H),
3.62 - 3.69 (m, 4H), 7.24 -
7.32 (m, 1H), 7.63 - 7.69 (m, 1H), 7.76 - 7.84 (m, 2H), 7.86 (dd, 1H), 8.12
(d, 1H), 8.33 (dd, 1H), 8.79
(d, 1H), 9.02 (d, 1H), 9.93 (s, 1H), 10.75 (s, 1H).
LC-MS (Method 1): Rt = 1.24 min; MS (ESIpos): m/z = 537 [M+H].
Example 73
N46-(3,5-difluorophenyl)pyridin-3-y1]-3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-
ylacetypamino]-4-
(trifluoromethoxy)benzamide
H
N 0
I
F 0
11101)1,.........
0 0 ....1 r I
N
H
F F.0
FI
F
To a solution of 100 mg (0.21 mmol) of the compound of intermediate 73 in 1.5
mL of DMF were
added 0.09 mL of triethylamine (0.62 mmol, 3 equiv), 61.6 mg of 8-oxa-3-
azabicyclo[3.2.1]octane
hydrochloride (0.41 mmol, 2 equiv), and 6.8 mg of potassium iodide (0.04 mmol,
0.2 equiv). The
reaction mixture was stirred at room temperature over night. After filtration,
purification by HPLC
(method 2) yielded 67 mg (57% of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.78 - 1.86 (m, 2H), 1.96 - 2.03 (m,
2H), 2.41 - 2.47 (m, 2H),
2.64 - 2.69 (m, 2H), 3.18 (s, 2H), 4.24 - 4.29 (m, 2H), 7.24 - 7.32 (m, 1H),
7.63 - 7.69 (m, 1H), 7.76 -
7.83 (m, 2H), 7.86 (dd, 1H), 8.12 (d, 1H), 8.33 (dd, 1H), 8.85 (d, 1H), 9.02
(d, 1H), 9.59 (s, 1H), 10.75 (s,
1H).
LC-MS (Method 1): Rt = 1.37 min; MS (ESIpos): m/z = 563 [M+H].
Example 74
N46-(2-fluorophenyl)pyridin-3-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethypbenzamide
243

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F
I
0 N 0
0 )-Nj
N
H
F F
F
To a solution of 220 mg (0.49 mmol) of the compound of intermediate 78 in 2 mL
of DMF were
added 0.1 mL of triethylamine (0.73 mmol, 1.5 equiv), 0.06 mL of morpholine
(0.73 mmol, 1.5 equiv),
and 12.1 mg of potassium iodide (0.07 mmol, 0.15 equiv). The reaction mixture
was stirred at room
temperature for 3 days. After filtration, purification by HPLC (method 2)
yielded 49 mg (20% of
theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.62 (m, 4H), 3.23 (s, 2H),
3.62 - 3.70 (m, 4H), 7.29 -
7.38 (m, 2H), 7.44 - 7.51 (m, 1H), 7.85 (dd, 1H), 7.93 - 8.00 (m, 3H), 8.32
(dd, 1H), 8.74 (s, 1H), 9.07 (d,
1H), 9.99 (s, 1H), 10.83 (s, 1H).
LC-MS (Method 4): Rt = 1.12 min; MS (ESIpos): m/z = 503 [M+1-1]+.
Example 75
N446-(2-fluorophenyl)pyridin-3-y1]-2-(0-(morpholin-4-
ypcyclopropyl]carbonyllamino)terephthalamide
H
N 0
F
I
1401 0 ro
H ___________________________________________________
H2N 0
118 mg (0.57 mmol, 2 equiv) of the compound of intermediate 44 were stirred in
1.9 mL of
dichloromethane at room temperature. 0.04 mL (0.57 mmol, 2 equiv) of DMF and
0.05 mL (0.57
mmol, 2 equiv) of oxalyl chloride were added and the mixture was stirred for
additional 0.5 h at room
temperature. 0.16 mL (1.43 mmol, 5 equiv) of 4-methylmorpholine and 100 mg
(0.29 mmol) of the
compound of intermediate 80 were added and the mixture was stirred at room
temperature over
night. The reaction mixture was poured into water and extracted with
dichloromethane. The
combined organic phases were dried over sodium sulfate, and concentrated under
reduced pressure.
Purification by HPLC (column: chromatorex C18, 10um, 125x3Omm, mobile phase:
acetonitrile/water
+0.1% formic acid gradient) yielded 15 mg (10% of theory) of the title
compound.
244

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.09 - 1.16 (m, 2H), 1.18 - 1.24 (m,
2H), 2.38 - 2.45 (m, 4H),
3.77 - 3.86 (m, 4H), 7.30 - 7.37 (m, 2H), 7.43 - 7.50 (m, 1H), 7.67 - 7.72 (m,
1H), 7.83 (d, 1H), 7.87 -
7.92 (m, 2H), 7.93 - 8.00 (m, 1H), 8.28 - 8.33 (m, 2H), 9.07 (d, 1H), 9.14 (s,
1H), 10.68 (s, 1H), 12.68 (s,
1H).
LC-MS (Method 4): Rt = 1.11 min; MS (ESIpos): m/z = 504 [M+H].
Example 76
N46-(2-fluorophenyl)pyridin-3-y1]-4-methyl-3-(1[1-(morpholin-4-
ypcyclopropyl]carbonyllamino)benzamide
H
N 0
F \
I
0 * 0
N )'µc Nj
H ___________________________________________________
CH3
To a solution of the compound of intermediate 82 (150 mg, 0.49 mmol) and 6-(2-
fluorophenyl)pyridin-3-amine (intermediate 114, 111 mg, 0.59 mmol, 1.2 equiv)
in DMF (1.8 mL) was
added (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate
(PYBOP, 513 mg, 0.99
mmol, 2 equiv) and diisopropylethylamine (0.34 mL, 1.97 mmol, 4 equiv). The
resulting mixture was
stirred at room temperature over night. After filtration, purification by HPLC
(method 2) yielded 27
mg (11% of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.12 - 1.15 (m, 2H), 1.19 - 1.26 (m,
2H), 2.40 (s, 3H), 3.69 -
3.76 (m, 4H), 7.29 - 7.36 (m, 2H), 7.41 - 7.50 (m, 2H), 7.72 (dd, 1H), 7.82
(dd, 1H), 7.93 - 8.00 (m, 1H),
8.31 (dd, 1H), 8.54 (d, 1H), 9.07 (d, 1H), 10.13 (s, 1H), 10.53 (s, 1H).
LC-MS (Method 1): Rt = 1.22 min; MS (ESIpos): m/z = 475 [M+H].
Example 77
4-fluoro-N46-(2-fluorophenyl)pyridin-3-y1]-3-(1[1-(morpholin-4-
ypcyclopropyl]carbonyllamino)benzamide
245

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F
I
0 N 0 r0
11 N)cNJ
H
F
To a solution of the compound of intermediate 84 (170 mg, 0.55 mmol) and 6-(2-
fluorophenyl)pyridin-3-amine (intermediate 114, 125 mg, 0.66 mmol, 1.2 equiv)
in DMF (2.0 mL) was
added (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate
(PYBOP, 574 mg, 1.10
mmol, 2 equiv) and diisopropylethylamine (0.38 mL, 2.21 mmol, 4 equiv). The
resulting mixture was
stirred at room temperature for 2 days. After filtration, purification by HPLC
(method 2) yielded 140
mg (52% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.10 - 1.19 (m, 2H), 1.19 - 1.29 (m,
2H), 3.65 - 3.76 (m, 4H),
7.28 - 7.39 (m, 2H), 7.42 - 7.57 (m, 2H), 7.77 - 7.87 (m, 2H), 7.96 (td, 1H),
8.30 (dd, 1H), 8.71 (dd, 1H),
9.06 (d, 1H), 10.35 (s, 1H), 10.64 (s, 1H).
LC-MS (Method 4): Rt = 1.26 min; MS (ESIpos): m/z = 479 [M+H].
Example 78
4-fluoro-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide
H
NN 0
N/ y
\ S
SIC?
4, N
H ________________________________________________
F
To a solution of the compound of intermediate 84 (150 mg, 0.49 mmol) and 5-
phenyl-1,3,4-
thiadiazol-2-amine (172 mg, 0.97 mmol, 2 equiv) in DMF (1.9 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 506 mg, 0.97 mmol,
2 equiv) and
diisopropylethylamine (0.42 mL, 2.43 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After concentration, the remaining solids were then
triturated with ethanol
and water. The precipitate was removed by filtration and dried under reduced
pressure. The
remaining solids were then triturated with DMSO and water. The precipitate was
removed by
filtration and dried under reduced pressure to give 91.6 mg (40% of theory) of
the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.10 - 1.19 (m, 2H), 1.20 - 1.29 (m,
2H), 3.64 - 3.76 (m, 4H),
7.48 - 7.60 (m, 4H), 7.93 - 8.03 (m, 3H), 8.82 - 8.90 (m, 1H), 10.36 (s, 1H),
13.24 (s, 1H).
246

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 4): Rt = 1.27 min; MS (ESIpos): rniz = 468 [m+H].
Example 79
4-chloro-N-[6-(2-fluorophenyl)pyridin-3-yI]-3-({[1-(morpholin-4-
ypcyclopropyl]carbonyllamino)benzamide
H
N 0
F
I
0 N 0 r0
11 N)cNJ
H
CI
To a solution of the compound of intermediate 86 (150 mg, 0.46 mmol) and 6-(2-
fluorophenyl)pyridin-3-amine (104 mg, 0.55 mmol, 1.2 equiv) in DMF (1.8 mL)
was added
(benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP,
481 mg, 0.92 mmol,
2 equiv) and diisopropylethylamine (0.32 mL, 1.85 mmol, 4 equiv). The
resulting mixture was stirred
at room temperature over night. After filtration, purification by HPLC (method
2) yielded 60.3 mg
(26% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.11 - 1.23 (m, 2H), 1.23 - 1.34 (m,
2H), 3.67 - 3.82 (m, 4H),
7.27 - 7.39 (m, 2H), 7.41 - 7.53 (m, 1H), 7.74 - 7.78 (m, 2H), 7.83 (dd, 1H),
7.91 - 8.01 (m, 1H), 8.30
(dd, 1H), 8.94 (s, 1H), 9.06 (d, 1H), 10.69 (s, 1H), 10.78 (s, 1H).
LC-MS (Method 1): Rt = 1.30 min; MS (ESIpos): rniz = 495 [m+H].
Example 80
N46-(2-fluorophenyl)pyridin-3-y1]-4-methoxy-3-(0-(morpholin-4-
ypcyclopropyl]carbonyllamino)benzamide
H
N 0
F
I
1401 0 r0
40 N).'cNJ
H ___________________________________________________
0
H3C
To a solution of the compound of intermediate 7 (100 mg, 0.30 mmol) and the
compound of
intermediate 44 (123 mg, 0.59 mmol, 2 equiv) in DMF (1.5 mL) was added
(benzotriazol-1-
247

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 308 mg, 0.59 mmol,
2 equiv) and
diisopropylethylamine (0.26 mL, 1.48 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (method 2)
yielded 46.0 mg (28% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.09 - 1.17 (m, 2H), 1.18 - 1.27 (m,
2H), 2.40 - 2.49 (m, 4H),
3.67 - 3.78 (m, 4H), 4.04 (s, 3H), 7.21 - 7.39 (m, 3H), 7.41 - 7.52 (m, 1H),
7.75 - 7.84 (m, 2H), 7.91 -
8.00 (m, 1H), 8.30 (dd, 1H), 8.89 (d, 1H), 9.06 (d, 1H), 10.49 (s, 1H), 10.65
(s, 1H).
LC-MS (Method 4): Rt = 1.27 min; MS (ESIpos): m/z = 491 [M+H].
Example 81
4-methoxy-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(6-phenylpyridin-3-
yObenzamide
H
N 0
I
1401 0 r0
H ___________________________________________________
0
H3C
To a solution of the compound of intermediate 8 (100 mg, 0.31 mmol) and the
compound of
intermediate 44 (97.5 mg, 0.47 mmol, 1.5 equiv) in DMF (1.7 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 326 mg, 0.63 mmol,
2 equiv) and
diisopropylethylamine (0.27 mL, 1.57 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (method 2)
yielded 39.0 mg (26% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.08 - 1.18 (m, 2H), 1.18 - 1.27 (m,
2H), 2.40 - 2.49 (m, 4H),
3.67 - 3.79 (m, 4H), 4.04 (s, 3H), 7.25 (d, 1H), 7.35 - 7.44 (m, 1H), 7.44 -
7.53 (m, 2H), 7.77 (dd, 1H),
7.98 (d, 1H), 8.03 - 8.11 (m, 2H), 8.28 (dd, 1H), 8.88 (d, 1H), 9.00 (d, 1H),
10.45 (s, 1H), 10.65 (s, 1H).
LC-MS (Method 4): Rt = 1.23 min; MS (ESIpos): m/z = 473 [M+H].
Example 82
N46-(2-fluorophenyl)pyridin-3-y1]-4-methoxy-3-(0-(morpholin-4-
ypcyclobutyl]carbonyllamino)benzamide
248

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
F
I
1401 40 ).5.0 r0
N
J
N
H
0
H3C
To a solution of the compound of intermediate 7 (100 mg, 0.30 mmol) and 1-
(morpholin-4-
yl)cyclobutanecarboxylic acid (110 mg, 0.59 mmol, 2 equiv) in DMF (1.5 mL) was
added (benzotriazol-
1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 309 mg, 0.59
mmol, 2 equiv) and
diisopropylethylamine (0.26 mL, 1.48 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (method 2)
yielded 38.0 mg (23% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.61 - 1.80 (m, 1H), 1.83 - 2.02 (m,
1H), 2.08 - 2.23 (m, 2H),
2.32 - 2.44 (m, 2H), 3.62 - 3.77 (m, 4H), 3.99 (s, 3H), 7.23 (d, 1H), 7.28 -
7.39 (m, 2H), 7.41 - 7.52 (m,
1H), 7.75 - 7.86 (m, 2H), 7.92 - 8.01 (m, 1H), 8.31 (dd, 1H), 8.82 (d, 1H),
9.07 (d, 1H), 9.79 (s, 1H),
10.51 (s, 1H).
LC-MS (Method 4): Rt = 1.28 min; MS (ESIpos): m/z = 505 [M+H].
Example 83
4-(methoxymethyl)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide
H
NN 0
1\1 / -Y
\ S
0 r0
it 40 N ),LNJ
H
H3C
0
To a solution of 200 mg (0.48 mmol) of the compound of intermediate 52 in 1.8
mL of DMF were
added 0.13 mL of triethylamine (0.96 mmol, 2 equiv), 0.08 mL of morpholine
(0.96 mmol, 2 equiv),
and 16.0 mg of potassium iodide (0.10 mmol, 0.2 equiv). The reaction mixture
was stirred at room
temperature for 3 days. After filtration, purification by HPLC (method 2)
yielded 126 mg (56% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.54 - 2.61 (m, 4H), 3.18 (s, 2H),
3.37 (s, 3H), 3.65 - 3.72 (m,
4H), 4.55 (s, 2H), 7.45 - 7.57 (m, 4H), 7.86 - 7.92 (m, 1H), 7.95 (dd, 2H),
8.78 (s, 1H), 9.96 (s, 1H).
LC-MS (Method 1): Rt = 0.95 min; MS (ESIpos): m/z = 468 [M+H].
249

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Example 84
3-{[(4-cyclopropylpiperazin-l-ypacetyl]amino}-4-(methoxymethyl)-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide
H
NN 0
1\1/ -Y
\ S
0
It
rN}\ [10 )==LNJ
N
H
H3C0
To a solution of 200 mg (0.48 mmol) of the compound of intermediate 52 in 1.8
mL of DMF were
added 0.4 mL of triethylamine (2.88 mmol, 6 equiv), 191 mg of 1-
cyclopropylpiperazine
dihydrochloride (0.96 mmol, 2 equiv), and 16.0 mg of potassium iodide (0.10
mmol, 0.2 equiv). The
reaction mixture was stirred at room temperature over night. After filtration,
purification by HPLC
(method 2) yielded 117 mg (48% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.25 - 0.33 (m, 2H), 0.38 - 0.46 (m,
2H), 1.59 - 1.68 (m, 1H),
2.60 - 2.68 (m, 4H), 3.16 (s, 2H), 3.41 (s, 3H), 4.56 (s, 2H), 7.48 - 7.60 (m,
4H), 7.85 - 7.91 (m, 1H), 7.94
- 8.02 (m, 2H), 8.82 (d, 1H), 9.98 (s, 1H), 13.12 (s, 1H).
LC-MS (Method 1): Rt = 0.90 min; MS (ESIpos): m/z = 507 [M+1-1]+.
Example 85
3-{[N-(2-methoxyethyl)-N-methylglycyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-
y1)-4-
(trifluoromethoxy)benzamide
H
N 0
N1NY
\ S CH3
0 LCe3 0
111 N
H J
FO
Fl
F
To a solution of 120 mg (0.26 mmol) of the compound of intermediate 41 in 1.5
mL of DMF were
added 0.07 mL of triethylamine (0.53 mmol, 2 equiv), 0.06 mL of 2-methoxy-N-
methylethanamine
(0.53 mmol, 2 equiv), and 9.0 mg of potassium iodide (0.05 mmol, 0.2 equiv).
The reaction mixture
250

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
was stirred at room temperature over night. After filtration, purification by
HPLC (method 2) yielded
58 mg (43% of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.40 (s, 3H), 2.73 (t, 2H), 3.23 (s,
3H), 3.30 (s, 2H), 3.48 (t,
2H), 7.52 - 7.59 (m, 3H), 7.61 - 7.68 (m, 1H), 7.95 - 8.04 (m, 3H), 8.97 (d,
1H), 9.99 (s, 1H), 13.38 (s,
1H).
LC-MS (Method 1): Rt = 0.97 min; MS (ESIpos): m/z = 510 [M+H].
Example 86
4-(difluoromethoxy)-3-[(8-oxa-3-azabicyclo[3.2.1]oct-3-ylacetypamino]-N-(5-
pheny1-1,3,4-thiadiazol-
2-yl)benzamide
H
N N 0
/ yN
\ S
le 0
01 jUN ___________________________________________________ I
N
H
FO
I
F
To a solution of 140 mg (0.32 mmol) of the compound of intermediate 47 in 2 mL
of DMF were
added 0.13 mL of triethylamine (0.96 mmol, 3 equiv), 95.5 mg of 8-oxa-3-
azabicyclo[3.2.1]octane
hydrochloride (0.64 mmol, 2 equiv), and 10.6 mg of potassium iodide (0.06
mmol, 0.2 equiv). The
reaction mixture was stirred at room temperature over night. After filtration,
purification by HPLC
(method 2) yielded 4.2 mg (2% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.75 - 1.89 (m, 2H), 2.01 - 2.13 (m,
2H), 2.39 - 2.47 (m, 2H),
2.62 - 2.71 (m, 2H), 3.16 (s, 2H), 4.21 - 4.32 (m, 2H), 7.42 (d, 1H), 7.50 (t,
1H), 7.51 - 7.60 (m, 3H), 7.90
- 8.03 (m, 3H), 9.09 (d, 1H), 9.58 (s, 1H), 13.21 (s, 1H).
LC-MS (Method 4): Rt = 1.19 min; MS (ESIpos): m/z = 516 [M+H].
Example 87
4-[(methylsulfonyl)methyl]-3-{[2-(morpholin-4-yppropanoyl]aminol-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide
251

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
\ S
jyr0
1_13c
CH3
0 0
To a solution of 500 mg (1.04 mmol) of the compound of intermediate 87 in 10
mL of DMF were
added 0.44 mL of triethylamine (3.13 mmol, 3 equiv), 0.27 mL of morpholine
(3.13 mmol, 3 equiv),
and 35.0 mg of potassium iodide (0.21 mmol, 0.2 equiv). The reaction mixture
was stirred at 60 C
over night. After concentration, the remaining solids were then triturated
with ethanol and water.
The precipitate was removed by filtration and dried under reduced pressure.
Purification by HPLC
(Waters Autopurificationsystem, column: YMC Triart, C18, Slim, 100x30 mm,
solvent: water /
acetonitrile + 0.1% trifluoroacetic acid (99%) gradient, rate: 70 mL/min,
temperature: room
temperature) yielded 255 mg of the trifluoroacetic acid salt of the title
compound. The material was
triturated with water and a pH 7 hydrogen phosphate buffer solution and
stirred for 30 minutes. The
precipitate was removed by filtration, washed with water and dried under
reduced pressure to yield
192 mg (35% of theory) of the title compound.
'H-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.24 (d, 3H), 2.53 - 2.64 (m, 4H), 3.06
(s, 3H), 3.30 (q, 1H),
3.66 - 3.73 (m, 4H), 4.63 (d, 1H), 4.70 (d, 1H), 7.53 - 7.58 (m, 3H), 7.65 (d,
1H), 7.95 - 8.02 (m, 3H),
8.50 (d, 1H), 10.02 (s, 1H), 13.24 (s, 1H).
LC-MS (Method 4): Rt = 0.90 min; MS (ESIpos): m/z = 530 [m+H].
Example 88
34[2-(4-methylpiperazin-1-yppropanoyl]amino}-4-[(methylsulfonyl)methyl]-N-(5-
phenyl-1,3,4-
thiadiazol-2-yObenzamide
0
N\ S
0 (N'3
11 1 N)YNJ
H3C CH3
\\
00
To a solution of 500 mg (1.04 mmol) of the compound of intermediate 87 in 10
mL of DMF were
added 0.44 mL of triethylamine (3.13 mmol, 3 equiv), 0.35 mL of
methylpiperazine (3.13 mmol, 3
equiv), and 35.0 mg of potassium iodide (0.21 mmol, 0.2 equiv). The reaction
mixture was stirred at
252

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
60 C over night. After concentration, the remaining solids were then
triturated with ethanol and
water. The precipitate was removed by filtration and dried under reduced
pressure to yield 351 mg
(46% of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.33 (s, 3H), 2.55 -
2.73 (m, 8H), 3.05 (s, 3H),
3.38 (q, 1H), 4.58 - 4.71 (m, 2H), 7.51 - 7.57 (m, 3H), 7.63 (d, 1H), 7.96 -
8.02 (m, 3H), 8.48 (d, 1H),
9.92 (s, 1H), 12.55 (s, 1H).
LC-MS (Method 4): Rt = 0.87 min; MS (ESIpos): m/z = 543 [M+H].
Example 89
N45-(2-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-(0-(morpholin-4-
ypcyclopropyl]carbonyllamino)-4-
(trifluoromethoxy)benzamide
H
NN 0
/ yN
\ S
F0
N5cNJ
H ________________________________________________
FO
Fl
F
To a solution of the compound of intermediate 45 (200 mg, 0.53 mmol) and 5-(2-
fluoropheny1)-1,3,4-
thiadiazol-2-amine (209 mg, 1.07 mmol, 2 equiv) in DMF (2.0 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 556 mg, 1.07 mmol,
2 equiv) and
diisopropylethylamine (0.47 mL, 2.67 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After concentration, the remaining solids were then
triturated with DMSO
and water. The precipitate was removed by filtration and dried under reduced
pressure to give 211
mg (72% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.12 - 1.21 (m, 2H), 1.25 - 1.33 (m,
2H), 2.41 - 2.50 (m, 4H),
3.63 - 3.76 (m, 4H), 7.38 - 7.54 (m, 2H), 7.57 - 7.65 (m, 1H), 7.68 (dd, 1H),
8.00 (dd, 1H), 8.23 - 8.33
(m, 1H), 9.09 (d, 1H), 10.58 (s, 1H), 13.43 (s, 1H).
LC-MS (Method 1): Rt = 1.41 min; MS (ESIpos): m/z = 552 [M+H].
Example 90
N45-(4-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-(0-(morpholin-4-
ypcyclopropyl]carbonyllamino)-4-
(trifluoromethoxy)benzamide
253

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
NINY
\ S
111 N
H ________________________________________________
FO
F Fl
F
To a solution of the compound of intermediate 45 (200 mg, 0.53 mmol) and 5-(4-
fluoropheny1)-1,3,4-
thiadiazol-2-amine (209 mg, 1.07 mmol, 2 equiv) in DMF (2.0 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 556 mg, 1.07 mmol,
2 equiv) and
diisopropylethylamine (0.47 mL, 2.67 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After concentration, the remaining solids were then
triturated with DMSO
and water, and were extracted with ethyl acetate. The combined organic phases
were dried over
sodium sulfate and and concentrated under reduced pressure. The remaining
material was purified
by HPLC (column: chromatorex C18, 10um, 195x51mm, mobile phase:
acetonitrile/water gradient) to
yield 20.8 mg (7% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.12 - 1.20 (m, 2H), 1.25 - 1.33 (m,
2H), 2.43 - 2.50 (m, 4H),
3.65 - 3.74 (m, 4H), 7.33 - 7.44 (m, 2H), 7.66 (dd, 1H), 7.95 - 8.09 (m, 3H),
9.08 (d, 1H), 10.56 (s, 1H),
13.40 (s, 1H).
LC-MS (Method 4): Rt = 1.41 min; MS (ESIpos): m/z = 552 [M+1-1]+.
Example 91
4-methoxy-3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-pheny1-1,3,4-
thiadiazol-2-yObenzamide
H
N 0
N1NY
\ S 0 (NCH3
46. ISI ).'N)
H
0
H3C
To a solution of 120 mg (0.30 mmol) of the compound of intermediate 90 in 1.2
mL of DMF were
added 0.07 mL of methylpiperazine (0.60 mmol, 2 equiv), 0.08 mL of
triethylamine (0.60 mmol, 2
equiv), and 9.9 mg of potassium iodide (0.06 mmol, 0.2 equiv). The reaction
mixture was stirred at
room temperature over night and then triturated with water. The precipitate
was removed by
filtration and dried under reduced pressure to yield 85.5 mg (62% of theory)
of the title compound.
254

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.27 (s, 3H), 2.56 - 2.65 (m, 4H),
3.19 (s, 2H), 4.00 (s, 3H),
7.24 (d, 1H), 7.52 - 7.59 (m, 3H), 7.94 - 8.03 (m, 3H), 8.94 (d, 1H), 9.80 (s,
1H), 12.34 (s, 1H).
LC-MS (Method 3): Rt = 0.73 min; MS (ESIpos): m/z = 467 [M+H].
Example 92
4-(benzyloxy)-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide
H
N 0
N/Nzl"
\
.s
0 o
N
H
0
I.
To a solution of the compound of intermediate 92 (1.50 g, 3.78 mmol) and 5-
phenyl-1,3,4-thiadiazol-
2-amine (805 mg, 4.54 mmol, 1.2 equiv) in DMF (14 mL) was added (benzotriazol-
1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 3.94 g, 7.57 mmol,
2 equiv) and
diisopropylethylamine (2.6 mL, 15.1 mmol, 4 equiv). The resulting mixture was
stirred at room
temperature over night. After concentration, the remaining solids were then
triturated with 70 mL of
water and 40 mL of ethanol and stirred for 30 minutes. The precipitate was
removed by filtration,
washed with ethanol, and dried under reduced pressure. The remaining solids
were then triturated
with ethanol and stirred under reflux. The precipitate was removed by
filtration and dried under
reduced pressure to give 1.38 g (60% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.97 - 1.27 (m, 4H), 2.20 - 2.35 (m,
4H), 3.10 - 3.27 (m, 4H),
5.31 (s, 2H), 7.36 - 7.50 (m, 4H), 7.51 - 7.63 (m, 5H), 7.94 - 8.04 (m, 3H),
9.07 (d, 1H), 10.44 (s, 1H),
13.10 (s, 1H).
LC-MS (Method 4): Rt = 1.42 min; MS (ESIpos): m/z = 556 [M+H].
Example 93
4-hydroxy-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide
255

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN 0
\
N y/
S
SIC?
4, N
H ________________________________________________
OH
LOU g (2.48 mmol) of the compound of example 92 was provided in 105 mL of a
mixture of THE and
methanol (3/2). 500 mg of palladium on charcoal (10% Pd, 50% water) were
added, and the mixture
was stirred under a hydrogen atmosphere at room temperature. Palladium on
charcoal (10% Pd, 50%
water) was added several times, and the mixture was stirred under a hydrogen
atmosphere at room
temperature till the starting material was consumed. After filtration, the
solvents were evaporated.
Purification by HPLC (Waters Autopurificationsystem, column: Reprospher Slim
100x30 mm, solvent:
water / acetonitrile + 0.2% ammonia (32%) gradient, rate: 70 mL/min,
temperature: room
temperature) yielded 54.0 mg (4% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.09 - 1.16 (m, 2H), 1.18 - 1.26 (m,
2H), 2.42 - 2.49 (m, 4H),
3.67 - 3.76 (m, 4H), 6.99 (d, 1H), 7.49 - 7.60 (m, 3H), 7.81 (dd, 1H), 7.91 -
8.01 (m, 2H), 8.95 (d, 1H),
10.55 (s, 1H).
LC-MS (Method 3): Rt = 0.58 min; MS (ESIpos): m/z = 466 [m+H].
Example 94
4-bromo-3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-
2-yObenzamide
H
NN 0
N/ y
\ S 4, r CH 3
0 L NN
J N
H
Br
To a solution of 500 mg (1.11 mmol) of the compound of intermediate 94 in 12
mL of DMF were
added 0.31 mL of triethylamine (2.21 mmol, 2 equiv), 0.24 mL of
methylpiperazine (2.21 mmol, 2
equiv), and 37 mg of potassium iodide (0.22 mmol, 0.2 equiv). The reaction
mixture was stirred at
room temperature over night. After concentration, the remaining material was
triturated with 10 mL
of water and 10 mL of ethanol and stirred for 30 minutes. The precipitate was
removed by filtration,
washed with ethanol and dried under reduced pressure to yield 513 mg (90% of
theory) of the title
compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.35 (s, 3H), 2.56 - 2.72 (m, 8H),
3.25 (s, 2H), 7.51 - 7.58 (m,
3H), 7.82 - 7.90 (m, 2H), 7.94 - 7.99 (m, 2H), 8.94 (d, 1H), 9.98 (s, 1H).
256

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 4): Rt = 0.94 min; MS (ESIpos): rn/z = 515 [m+H].
Example 95
3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-phenylpyridin-2-y1)-4-
(trifluoromethoxy)benzamide
H
N N 0
I
40 /
0
NcN
H ____________________________________________________ ro
)
J
FO
Fl
F
66.5 mg (0.32 mmol) of 1-(morpholin-4-yl)cyclopropanecarboxylic acid
hydrochloride (1:1)
(intermediate 44) were stirred in 1.5 mL of dichloromethane at room
temperature. 2.5 uL (32 mop
of DMF and 55.8 uL (0.64 mmol) of oxalyl chloride were added, and the mixture
was stirred for
additional 2 h at 50 C after the gas formation had stopped. After
concentration, 71.0 mg of raw
material were obtained, of which 64.2 mg (0.28 mmol) were added to a solution
of 94.0 mg (0.24
mmol) of the compound of intermediate 95 and 0.17 mL (1.18 mmol) of
triethylamine in a mixture of
1 mL of dichloromethane and 1 mL of THE. The resulting mixture was stirred at
room temperature
over night and for 24 h at 60 C. 0.17 mL (1.18 mmol) of triethylamine and 2
equivalents of 1-
(morpholin-4-yl)cyclopropanecarbonyl chloride hydrochloride (1:1) (prepared as
described above)
were added and the resulting mixture was stirred at room temperature over
night. After
concentration, the remaining solids were then triturated with 5 mL of ethanol
and stirred for 20
minutes. The remaining solids were removed by filtration and were dried at 50
C under reduced
pressure. Purification by HPLC (column: chromatorex C18, 10um, 125x3Omm,
mobile phase:
acetonitrile/water +0.1% formic acid gradient) yielded 17 mg (13% of theory)
of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.13 - 1.19 (m, 2H), 1.26 - 1.31 (m,
2H), 2.44 - 2.49 (m, 4H),
3.67 - 3.73 (m, 4H), 7.37 - 7.44 (m, 1H), 7.48 - 7.54 (m, 2H), 7.61 (dd, 1H),
7.73 - 7.77 (m, 2H), 7.89
(dd, 1H), 8.14 - 8.21 (m, 1H), 8.27 (d, 1H), 8.73 (d, 1H), 8.96 (d, 1H), 10.53
(s, 1H), 11.05 (s, 1H).
LC-MS (Method 1): Rt = 1.44 min; MS (ESIpos): rn/z = 527 [m+H].
Example 96
N45-(3-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
257

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
N/N:-)"
\ s
I.)UNO
H3C 4. N H
FO
F>(
F
To a solution of the compound of intermediate 21 (150 mg, 0.43 mmol) and 5-(3-
methylpheny1)-
1,3,4-thiadiazol-2-amine (165 mg, 0.86 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 448 mg, 0.86 mmol,
2 equiv) and
diisopropylethylamine (0.38 mL, 2.15 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature for 3 days, then triturated with ethanol and water and stirred for
15 minutes. The
precipitate was collected by filtration and dried under reduced pressure.
Purification by HPLC
(method 2) yielded 6.0 mg (3% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.41 (s, 3H), 2.56 - 2.63 (m, 4H),
3.24 (s, 2H), 3.61 - 3.71 (m,
4H), 7.32 - 7.38 (m, 1H), 7.39 - 7.48 (m, 1H), 7.65 (dd, 1H), 7.73 - 7.84 (m,
2H), 8.02 (dd, 1H), 8.94 (d,
1H), 9.92 (s, 1H), 13.37 (s, 1H).
LC-MS (Method 3): Rt = 0.79 min; MS (ESIpos): m/z = 522 [M+H].
Example 97
3-[(morpholin-4-ylacetypamino]-N45-(4-nitropheny1)-1,3,4-thiadiazol-2-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
N/NY'
_\s
4 1401 )UNO
N
H
FO
02N F I
F
To a solution of the compound of intermediate 21 (250 mg, 0.72 mmol) and 5-(4-
nitropheny1)-1,3,4-
thiadiazol-2-amine (319 mg, 1.44 mmol, 2 equiv) in DMF (3.0 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 747 mg, 1.44 mmol,
2 equiv) and
diisopropylethylamine (0.63 mL, 3.59 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night, then triturated with ethanol and water and stirred for
15 minutes. The
258

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
precipitate was collected by filtration and dried under reduced pressure.
Purification by HPLC
(method 2) yielded 34.8 mg (9% of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.57 - 2.65 (m, 4H), 3.26 (s, 2H),
3.62 - 3.71 (m, 4H), 7.67
(dd, 1H), 8.04 (dd, 1H), 8.23 - 8.32 (m, 2H), 8.34 - 8.42 (m, 2H), 8.95 (d,
1H), 9.95 (s, 1H), 13.56 (s, 1H).
LC-MS (Method 4): Rt = 1.16 min; MS (ESIpos): m/z = 553 [M+H].
Example 98
N45-(2-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
H
N 0
N/NY'
\
H3c s
. 1401 LNO
N
H
FO
F>(
F
To a solution of the compound of intermediate 21 (150 mg, 0.43 mmol) and 5-(2-
methylpheny1)-
1,3,4-thiadiazol-2-amine (165 mg, 0.86 mmol, 2 equiv) in DMF (2 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 448 mg, 0.86 mmol,
2 equiv) and
diisopropylethylamine (0.38 mL, 2.15 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature for 3 days, then triturated with ethanol and water and stirred for
15 minutes. The
precipitate was collected by filtration and dried under reduced pressure.
Purification by HPLC
(method 2) yielded 10.3 mg (5% of theory) of the title compound.
1-1-1-NMR (500 MHz, DMSO-d6): 6 [ppm] = 2.54 (s, 3H), 2.56 - 2.61 (m, 4H),
3.24 (s, 2H), 3.63 - 3.68 (m,
4H), 7.34 - 7.39 (m, 1H), 7.40 - 7.46 (m, 2H), 7.65 (d, 1H), 7.71 (d, 1H),
8.02 (dd, 1H), 8.95 (d, 1H), 9.93
(s, 1H), 13.34 (s, 1H).
LC-MS (Method 4): Rt = 1.22 min; MS (ESIpos): m/z = 522 [M+H].
Example 99
N45-(4-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
259

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
N/N:-)"
_\s
0 r-0
N
H
FO
F F>(
F
To a solution of the compound of intermediate 21 (150 mg, 0.43 mmol) and 5-(4-
fluoropheny1)-1,3,4-
thiadiazol-2-amine (151 mg, 0.78 mmol, 1.8 equiv) in DMF (1.9 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 448 mg, 0.86 mmol,
2 equiv) and
diisopropylethylamine (0.38 mL, 2.15 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (method 2)
yielded 133 mg (59% of
theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.56 - 2.63 (m, 4H), 3.24 (s, 2H),
3.62 - 3.69 (m, 4H), 7.35 -
7.44 (m, 2H), 7.62 - 7.68 (m, 1H), 7.99 - 8.09 (m, 3H), 8.94 (d, 1H), 9.93 (s,
1H), 13.43 (s, 1H).
LC-MS (Method 3): Rt = 0.77 min; MS (ESIpos): m/z = 526 [M+H].
Example 100
3-({[4-(2,2-difluoroethyl)piperazin-1-yl]acetyllamino)-N-[6-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
F /
0I 0 r'NF
10 )-Nj F
N
H
FO
F I
F
To a suspension of 102 mg (0.22 mmol) of the compound of intermediate 14 in
1.3 mL of DMF were
added 0.06 mL of triethylamine (0.44 mmol, 2 equiv), 0.06 mL of 1-(2,2-
difluoroethyl)piperazine (0.44
mmol, 2 equiv), and 7.0 mg of potassium iodide (0.04 mmol, 0.2 equiv). The
reaction mixture was
stirred at room temperature over night. After filtration, purification by HPLC
(method 2) yielded 71.3
mg (54% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.67 (m, 8H), 2.75 (dt, 2H),
3.22 (s, 2H), 6.14 (tt, 1H),
7.27 - 7.39 (m, 2H), 7.41 - 7.52 (m, 1H), 7.66 (dd, 1H), 7.79 - 7.90 (m, 2H),
7.91 - 8.01 (m, 1H), 8.30
(dd, 1H), 8.82 (d, 1H), 9.06 (d, 1H), 9.91 (s, 1H), 10.72 (s, 1H).
260

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 1.37 min; MS (ESIpos): rn/z = 582 [m+H].
Example 101
N45-(2-methoxypheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
N' 0
H3C-0
0
FO
To a solution of the compound of intermediate 112 (150 mg, 0.32 mmol) and 5-(2-
methoxypheny1)-
1,3,4-thiadiazol-2-amine (133 mg, 0.64 mmol, 2 equiv) in DMF (2 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night, then triturated with 20 mL of a 9/1 mixture of water
and ethanol. The
precipitate was collected by filtration, washed with water and dried under
reduced pressure at 50 C.
The remaining material was triturated with 2 mL of DMSO. The precipitate was
collected by filtration,
washed with water and dried under reduced pressure at 50 C. 72 mg (40% of
theory) of the title
compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.21 (s, 3H), 2.32 - 2.47 (m, 4H),
2.56 - 2.69 (m, 4H), 3.23 (s,
2H), 4.04 (s, 3H), 7.15 (t, 1H), 7.29 (d, 1H), 7.50 - 7.57 (m, 1H), 7.64 (dd,
1H), 8.02 (dd, 1H), 8.30 (dd,
1H), 9.01 (d, 1H), 9.95 (s, 1H), 13.09 (s, 1H).
LC-MS (Method 3): Rt = 0.78 min; MS (ESIpos): rn/z = 551 [m+H].
Example 102
N45-(4-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
261

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N N
N/\ 0
0 d r.,..,cH3
1 0 )uN jl
N
H
FO
H3C
F I
F
To a solution of the compound of intermediate 112 (265 mg, 0.67 mmol) and 5-(4-
methylpheny1)-
1,3,4-thiadiazol-2-amine (255 mg, 1.33 mmol, 2 equiv) in DMF (3 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 693 mg, 1.33 mmol,
2 equiv) and
diisopropylethylamine (0.58 mL, 3.33 mmol, 5 equiv). The precipitate was
collected by filtration and
dried under reduced pressure at 50 C. The remaining material was triturated
with 2.5 mL of DMSO.
The precipitate was collected by filtration and dried under reduced pressure
at 50 C. 83.6 mg (23%
of theory) of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.28 (s, 3H), 2.38 (s, 3H), 2.47 -
2.58 (m, 4H), 2.60 - 2.70 (m,
4H), 3.25 (s, 2H), 7.32 - 7.38 (m, 2H), 7.63 (dd, 1H), 7.82 - 7.89 (m, 2H),
8.01 (dd, 1H), 8.96 (d, 1H),
9.93 (s, 1H), 12.85 (s, 1H).
LC-MS (Method 1): Rt = 1.04 min; MS (ESIpos): m/z = 535 [M+H].
Example 103
4-methyl-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-phenyl-1,3,4-
thiadiazol-2-
yObenzamide
H
N N
N/
0
\
S
0 0
slit 0 N)cNJ
H _________________________________________________
CH3
To a solution of the compound of intermediate 82 (150 mg, 0.49 mmol) and 5-
phenyl-1,3,4-
thiadiazol-2-amine (105 mg, 0.59 mmol, 1.2 equiv) in DMF (1.8 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 513 mg, 0.99 mmol,
2 equiv) and
diisopropylethylamine (0.34 mL, 1.97 mmol, 4 equiv). The resulting mixture was
stirred at room
temperature over night. (Benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate
(PYBOP, 513 mg, 0.99 mmol, 2 equiv) and diisopropylethylamine (0.34 mL, 1.97
mmol, 4 equiv) were
added and the resulting mixture was stirred at room temperature over night.
After filtration,
purification by HPLC (1. method 2; 2. Waters Autopurificationsystem, column:
XBrigde C18 Slim
262

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
100x30 mm, solvent: water / acetonitrile + 0.2% ammonia (32%) gradient, rate:
70 mL/min,
temperature: room temperature) yielded 5.5 mg (2% of theory) of the title
compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.08 - 1.28 (m, 4H), 2.40 (s, 3H),
3.66 - 3.80 (m, 4H), 7.41 (d,
1H), 7.47 - 7.59 (m, 3H), 7.86 (dd, 1H), 7.91 - 8.01 (m, 2H), 8.62 - 8.71 (m,
1H), 10.11 (s, 1H), 13.10 (s,
1H).
LC-MS (Method 4): Rt = 1.25 min; MS (ESIpos): m/z = 464 [M+H].
Example 104
3-{[(4-methylpiperazin-1-ypacetyl]amino}-4-[(methylsulfonyl)methyl]-N-(5-
pheny1-1,3,4-thiadiazol-2-
yl)benzamide
H
NN 0
/ yN
\ S
441 0 r-NCH3
0 )==L.Nj
N
H
H3C
S
I/ \\
00
To a suspension of 150 mg (0.32 mmol) of the compound of intermediate 97 in
1.7 mL of DMF were
added 0.09 mL of triethylamine (0.65 mmol, 2 equiv), 0.07 mL of 1-
methylpiperazine (0.65 mmol, 2
equiv), and 11 mg of potassium iodide (0.07 mmol, 0.2 equiv). The reaction
mixture was stirred at
room temperature over night. After concentration, the remaining solids were
then triturated with 10
mL of ethanol and 10 mL of water and stirred for 30 minutes. The precipitate
was removed by
filtration, washed with ethanol and dried under reduced pressure to yield 98.0
mg (55% of theory) of
the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.30 (s, 3H), 2.55 - 2.71 (m, 8H),
3.05 (s, 3H), 3.19 (s, 2H),
4.66 (s, 2H), 7.51 - 7.57 (m, 3H), 7.63 (d, 1H), 7.95 - 7.99 (m, 2H), 8.01
(dd, 1H), 8.50 (d, 1H), 9.87 (s,
1H).
LC-MS (Method 4): Rt = 0.84 min; MS (ESIpos): m/z = 529 [M+H].
Example 105
methyl 2-{[(4-methylpiperazin-1-ypacetyl]amino}-4-[(5-phenyl-1,3,4-thiadiazol-
2-
yl)carbamoyl]benzoate
263

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
N 0
s ,CH,
)uN
41,
0 0
CH3
To a suspension of 2.00 g (4.64 mmol) of the compound of intermediate 99 in 25
mL of DMF were
added 0.97 mL of triethylamine (6.96 mmol, 1.5 equiv), 0.77 mL of 1-
methylpiperazine (6.96 mmol,
1.5 equiv), and 119 mg of potassium iodide (0.72 mmol, 0.16 equiv). The
reaction mixture was stirred
at room temperature over night, was then poured into 100 mL of a 5/1 mixture
of ethanol and water
and stirred for 15 minutes. The precipitate was removed by filtration, washed
with water and dried
under reduced pressure to yield 1.51 g (65% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.31 (s, 3H), 2.56 - 2.66 (m, 8H),
3.22 (s, 2H), 3.94 (s, 3H),
7.48 - 7.58 (m, 3H), 7.88 - 7.99 (m, 3H), 8.09 (d, 1H), 9.30 (d, 1H), 11.72
(s, 1H), 12.81 (s, 1H).
LC-MS (Method 3): Rt = 0.71 min; MS (ESIpos): m/z = 495 [M+H].
Example 106
methyl 2-[(morpholin-4-ylacetyl)amino]-4-[(5-phenyl-1,3,4-thiadiazol-2-
yl)carbamoyl]benzoate
N 0
s
4111 )uNO
0 0
CH3
To a suspension of 2.00 g (4.64 mmol) of the compound from intermediate 99 in
25 mL of DMF were
added 0.97 mL of triethylamine (6.96 mmol, 1.5 equiv), 0.61 mL of morpholine
(6.96 mmol, 1.5
equiv), and 119 mg of potassium iodide (0.72 mmol, 0.16 equiv). The reaction
mixture was stirred at
room temperature over night, was then poured into 100 mL of a 5/1 mixture of
ethanol and water
and stirred for 15 minutes. The precipitate was removed by filtration, washed
with water and dried
under reduced pressure to yield 1.44 g (59% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.54 - 2.61 (m, 4H), 3.21 (s, 2H),
3.70 - 3.78 (m, 4H), 3.94 (s,
3H), 7.47 - 7.57 (m, 3H), 7.88 - 8.00 (m, 3H), 8.09 (d, 1H), 9.32 (d, 1H),
11.84 (s, 1H), 13.48 (s, 1H).
264

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 0.70 min; MS (ESIpos): rniz = 482 [m+H].
Example 107
N-(4-methoxy-34[2-(morpholin-4-yppropanoyl]aminolpheny1)-2-phenyl-1,3-thiazole-
5-carboxamide
0
Nr NH s:...........1).L
\ 0
.S C0
J
N
H
0 CH3
H3C
To a solution of the compound of intermediate 102 (169 mg, 407 mop in DMF
(1.75 mL) were
added morpholine (53.1 uL, 610 mop, potassium iodide (10.5 mg, 63.0 mop and
triethylamine
(85.0 uL, 610 mop. The mixture was stirred over night at room temperature.
Water was added to
the mixture and it was extracted three times with ethyl acetate. The combined
organic layers were
dried over Mg504 and concentrated in vacuum. The residue was purified by
preparative HPLC
(Methode 2) to yield the desired product 107 (11.7 mg, 6%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.20 (d, 3H), 3.32 (m, 1H), 3.64 -
3.72 (m, 4H), 3.90 (s, 3H),
7.06 (d, 1H), 7.44 - 7.55 (m, 4H), 7.78 - 7.85 (m, 2H), 8.49 (s, 1H), 8.71 (d,
1H), 9.90 (s, 1H), 10.66 (s,
1H).
LC-MS (Method 4): Rt = 1.05 min; MS (ESIpos): rniz = 467 [m+H].
Example 108
N-[3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-4-(trifluoromethoxy)pheny1]-
2-phenyl-1,3-
thiazole-5-carboxamide
0
N1-- )L NH
\ S
J
. N
H
FO
F I
F
265

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-(Morpholin-4-yl)cyclopropanecarboxylic acid hydrochloride (intermediate 44,
67 mg, 324 mop
was treated with diisopropylethylamine (188 uL, 1.08 mmol). Subsequently a
solution of the
compound of intermediate 104 (82 mg, 216 mop in DMF (1.5 mL) and
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 169 mg, 324 mop
was added. The
reaction mixture was stirred over night at 50 C. After cooling to room
temperature additional 0.75
eq of diisopropylethylamine and 1.5 eq of 1-(morpholin-4-
yl)cyclopropanecarboxylic acid
hydrochloride were added. The mixture was stirred over night at 80 C. After
cooling to room
temperature 1.0 eq of diisopropylethylamine, 1.5 eq of 1-(morpholin-4-
yl)cyclopropanecarboxylic
acid hydrochloride and 1.5 eq of PYBOP were added. The mixture was again
stirred at 50 C over
night. The reaction mixture was diluted with water and extracted three times
with DCM. The
combined organic layers were washed with brine, dried over a silicon filter
and concentrated. The
residue was purified by flash chromatography and additionally by preparative
TLC to provide the
desired compound 108 (12.5 mg, 10%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.10 - 1.19 (m, 2H), 1.24 - 1.32 (m,
2H), 2.40 - 2.51 (m, 4H),
3.67 - 3.70 (m, 4H), 7.56 (d, 4H), 7.64 - 7.73 (m, 1H), 7.97 - 8.09 (m, 2H),
8.72 (s, 1H), 8.75 - 8.81 (m,
1H), 10.41 - 10.51 (m, 1H), 10.64 - 10.74 (m, 1H).
LC-MS (Method 4): Rt = 1.43 min; MS (ESIpos): m/z = 533 [M+H].
Example 109
N46-(2-fluoro-4-hydroxyphenyl)pyridin-3-y1]-3-{[2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
H
N 0
I
0 0 r'0
N)YNJ
HO F
H
F

>

(

0 CH3
F
F
Argon was bubbled through a suspension of the compound of intermediate 109
(198 mg, 419 mop,
2-fluoro-4-hydroxyphenylboronic acid (98.0 mg, 628 mop and potassium
carbonate (116 mg, 837
mop in 1,2-dimethoxyethane (3.26 mL) and water (1.1 mL) for several minutes.
Afterwards 1,1'-
bis(diphenylphosphino)ferrocene-palladium(II)dichloride (153 mg, 209 mop was
added to the
mixture, the tube was sealed and the reaction mixture was stirred over night
at 90 C. After cooling
to room temperature, the mixture was diluted with water and extracted three
times with ethyl
acetate. The combined organic layers were washed with brine, dried over Mg504
and concentrated
under reduced pressure. The residue was purified by preparative HPLC (Methode
2) to provide the
title compound 109 (34.3 mg, 23%).
266

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 1.23 (d, 3H), 2.56 (d, 4H), 3.37 - 3.48
(m, 1H), 3.65 - 3.67 (m,
4H), 6.68 - 6.81 (m, 2H), 7.66 (d, 1H), 7.86 (d, 1H), 8.05 (t, 1H), 8.22 (d,
1H), 8.35 (d, 1H), 8.75 (d, 1H),
9.00 (d, 1H), 10.06 (s, 1H), 10.81 (s, 1H), 14.28 (s, 1H).
LC-MS (Method 4): Rt = 1.27 min; MS (ESIneg): m/z = 547 EM¨Hr.
Example 110
N46-(3-fluoro-4-hydroxyphenyl)pyridin-3-y1]-3-1[2-(morpholin-4-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
I
F

HO' 0 r'0 N)yNJ
H
FO CH3
F I
F
The title compound was prepared in a manner analogous to that described in
example 109 starting
from 198 mg (419 mop of intermediate 109 and 97.9 mg (628 mop of 3-fluoro-4-
hydroxyphenylboronic acid. 32.2 mg (16%) of the desired compound 110 were
obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.53 - 2.60 (m, 4H),
3.35 - 3.47 (m, 1H), 3.65 -
3.67 (m, 4H), 6.93 - 7.08 (m, 1H), 7.20 - 7.44 (m, 1H), 7.62 - 7.68 (m, 1H),
7.72 - 7.77 (m, 1H), 7.82 -
1.93 (m, 3H), 8.15 - 8.26 (m, 1H), 8.73 (d, 1H), 8.93 (d, 1H), 10.03 (s, 1H),
10.63 (s, 1H).
LC-MS (Method 4): Rt = 0.98 min; MS (ESIneg): m/z = 547 EM¨Hr.
Example 111
N46-(4-aminophenyppyridin-3-y1]-3-1[2-(morpholin-4-yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
I ,
. N- (10 j0y(0)
H2N N
H
FO CH3
F I
F
267

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Argon was bubbled through a suspension of the compound of intermediate 109
(210 mg, 444 mop,
4-aminophenylboronic acid (91.2 mg, 666 mop and potassium carbonate (123 mg,
888 mop in 1,2-
diethoxyethane (3.46 mL) and water (1.1 mL) for several minutes. Afterwards
1,1'-
bis(diphenylphosphino)ferrocene-palladium(II)dichloride-DCM-complex (36.3 mg,
44 mop was
added to the mixture, the tube was sealed and the reaction mixture was stirred
over night at 90 C.
After cooling to room temperature, the mixture was diluted with water and
extracted three times
with ethyl acetate. The combined organic layers were washed with brine, dried
over MgSO4 and
concentrated under reduced pressure. The residue was purified by preparative
HPLC to provide the
title compound 111 (30.8 mg, 13%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.54 - 2.61 (m, 4H),
3.37 - 3.48 (m, 1H), 3.62 -
3.71 (m, 4H), 5.37 (s, 2H), 6.61 - 6.65 (m, 2H), 7.58 - 7.70 (m, 1H), 7.73 -
7.88 (m, 4H), 8.12 - 8.18 (m,
1H), 8.72 (s, 1H), 8.82 - 8.92 (m, 1H), 9.96 - 10.08 (m, 1H), 10.54 (s, 1H).
LC-MS (Method 4): Rt = 0.82 min; MS (ESIneg): m/z = 528 [M¨H].
Example 112
N-{644-(difluoromethypphenyl]pyridin-3-y11-3-{[2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
H
N 0
I
0 N (10 NjO
F:Nr0
H
F FO CH3
F I
F
The title compound was prepared in a manner analogous to that described in
example 111 starting
from 197 mg (417 mop of the compound of intermediate 109 and 107 mg (626 mop
of 4-
difluoromethylphenylboronic acid. 29.7 mg (30%) of the desired compound 112
were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.54 - 2.58 (m, 4H),
3.36 - 3.49 (m, 1H), 3.65 -
3.68 (m, 4H), 7.10 (s, 1H), 7.63 - 7.70 (m, 3H), 7.82 - 7.91 (m, 1H), 8.09 (s,
1H), 8.22 (d, 2H), 8.29 - 8.36
(m, 1H), 8.75 (d, 1H), 9.04 (d, 1H), 10.04 (s, 1H), 10.72 (s, 1H).
LC-MS (Method 4): Rt = 1.18 min; MS (ESIpos): m/z = 563 [M¨H].
Example 113
N46-(4-acetamidophenyl)pyridin-3-y1]-3-{[2-(morpholin-4-yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
268

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
I
/
I 0 N 0 r'0
H3C N lei N)YNJ
H H
FO CH3
F I
F
Argon was bubbled through a suspension of the compound of intermediate 109
(150 mg, 317 mop,
[4-(acetylamino)phenyl]boronic acid (85.2 mg, 476 mop and potassium carbonate
(87.7 mg, 634
mop in 1,2-diethoxyethane (2.47 mL) and water (429 L) for several minutes.
Afterwards 1,1-
bis(diphenylphosphino)ferrocene-palladium(I1)dichloride (116 mg, 159 mop was
added to the
mixture, the tube was sealed and the reaction mixture was stirred over night
at 90 C. After cooling
to room temperature, the mixture was filtered over a pad of Celite. The
filtrate was concentrated in
vacuum and the residue was purified by preparative HPLC (method 5) and
preparative TLC to provide
the title compound 113 (16.7 mg, 9.2%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.07 (s, 3H), 2.54 -
2.59 (m, 4H), 3.36 - 3.45 (m,
1H), 3.65 - 3.68 (m, 4H), 7.61 - 7.72 (m, 3H), 7.81 - 7.88 (m, 1H), 7.91 -
7.95 (m, 1H), 7.98 - 8.05 (m,
2H), 8.21 - 8.27 (m, 1H), 8.71 - 8.76 (m, 1H), 8.93 - 8.98 (m, 1H), 10.00 -
10.08 (m, 2H), 10.61 - 10.69
(m, 1H).
LC-MS (Method 4): Rt = 0.91 min; MS (ESIneg): m/z = 570 [M-H].
Example 114
N-{644-(dimethylamino)phenyl]pyridin-3-y11-3-{[2-(morpholin-4-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
I
/
N
H3C (00 40 N jy0
N
I H
CH3 FO CH3
F I
F
Argon was bubbled through a suspension of the compound of intermediate 109
(218 mg, 461 mop,
[4-(dimethylamino)phenyl]boronic acid (114 mg, 692 mop and potassium
carbonate (191 mg, 1.38
mmol) in 1,2-dimethoxyethane (3.6 mL) and water (360 L) for several minutes.
Afterwards 1,1'-
bis(diphenylphosphino)ferrocene-palladium(II)dichloride-DCM-complex (37.6 mg,
46 mop was
added to the mixture, the tube was sealed and the reaction mixture was stirred
over night at 90 C.
269

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
After cooling to room temperature, the mixture was concentrated under reduced
pressure. The
residue was purified by preparative HPLC (method 5) to provide the title
compound 114 (134 mg,
230 limo!, 50%).
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.52 - 2.61 (m, 4H), 2.97
(s, 6H), 3.39 (q, 1H),
3.65 - 3.68 (m, 4H), 6.77 - 6.82 (m, 2H), 7.45 - 7.70 (m, 1H), 7.82 - 7.86 (m,
2H), 7.91 - 7.94 (m, 2H),
8.14 - 8.24 (m, 1H), 8.73 (d, 1H), 8.89 (d, 1H), 10.04 (s, 1H), 10.58 (s, 1H).
LC-MS (Method 4): Rt = 1.36 min; MS (ESIpos): m/z = 558 [M+1-1]+.
Example 115
N-{644-(dimethylamino)phenyl]pyridin-3-y11-3-{[(25)-2-(morpholin-4-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide or
N-{644-(dimethylamino)phenyl]pyridin-3-y11-3-{[(2R)-2-(morpholin-4-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
/ 1
I
0
N
H3C I. ro NjyNJ
N
I H
CH3 FO CH3
F I
F
or
H
N 0
/ 1
I
H3C I. N 0 ro
N N
I H =
CH3 FO CH3
F I
F
A sample of racemic
N-{644-(dimethylamino)phenyl]pyridin-3-y11-3-{[2-(morpholin-4-
yppropanoyl]amino}-4-(trifluoromethoxy)benzamide (prepared as described in
example 114, 70 mg,
126 mop was separated using chiral HPLC (system: Agilent Prep 1200, column:
Chiralpak IC Slim
250x20 mm, solvent: hexane / ethyl acetate 50:50 (v/v)) to give the first
eluting enantiomer of N-{6-
[4-(dimethylamino)phenyl]pyridin-3-y11-3-{[2-(morpholin-4-yppropanoyl]amino}-4-

(trifluoromethoxy)benzamide (16 mg, 21% from racemate).
270

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.52 - 2.61 (m, 4H), 2.97
(s, 6H), 3.39 (q, 1H),
3.65 - 3.68 (m, 4H), 6.77 - 6.82 (m, 2H), 7.45 - 7.70 (m, 1H), 7.82 - 7.86 (m,
2H), 7.91 - 7.94 (m, 2H),
8.14 - 8.24 (m, 1H), 8.73 (d, 1H), 8.89 (d, 1H), 10.04 (s, 1H), 10.58 (s, 1H).
LC-MS (Method 4): Rt = 1.36 min; MS (ESIpos): m/z = 558 [M+1-1]+.
Chiral HPLC (system: Waters Alliance 2695 DAD 996 ESA: Corona, column:
Chiralpak IC 3um 100x4.6
mm, solvent: hexane / ethyl acetate 50:50 (v/v)): Rt = 7.50 min, 97.8%
enantiomeric excess.
Example 116
N-{644-(dimethylamino)phenyl]pyridin-3-y11-3-{[(25)-2-(morpholin-4-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide or
N-{644-(dimethylamino)phenyl]pyridin-3-y11-3-{[(2R)-2-(morpholin-4-
yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
/ 1
I
0
N
H3C I. ro NjyNJ
N
I H
CH3 FO CH3
F I
F
or
H
N 0
/ 1
I
H3C I. N 0 ro )-L.Nj
N N
I H =
CH3 FO CH3
F I
F
A sample of racemic N-{644-(dimethylamino)phenyl]pyridin-3-y11-
3-{[2-(morpholin-4-
yppropanoyl]amino}-4-(trifluoromethoxy)benzamide (prepared as described in
example 114, 70 mg,
126 mop was separated using chiral HPLC (system: Agilent Prep 1200, column:
Chiralpak IC Slim
250x20 mm, solvent: hexane / ethyl acetate 50:50 (v/v)) to give the second
eluting enantiomer of N-
{644-(dimethylamino)phenyl]pyridin-3-y11-3-{[2-(morpholin-4-yppropanoyl]amino}-
4-
(trifluoromethoxy)benzamide (12 mg, 16% from racemate).
271

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.52 - 2.61 (m, 4H), 2.97
(s, 6H), 3.39 (q, 1H),
3.65 - 3.68 (m, 4H), 6.77 - 6.82 (m, 2H), 7.45 - 7.70 (m, 1H), 7.82 - 7.86 (m,
2H), 7.91 - 7.94 (m, 2H),
8.14 - 8.24 (m, 1H), 8.73 (d, 1H), 8.89 (d, 1H), 10.04 (s, 1H), 10.58 (s, 1H).
LC-MS (Method 4): Rt = 1.36 min; MS (ESIpos): m/z = 558 [M+H].
Chiral HPLC (system: Waters Alliance 2695 DAD 996 ESA: Corona, column:
Chiralpak IC 3um 100x4.6
mm, solvent: hexane / ethyl acetate 50:50 (v/v)): Rt = 8.14 min, 91.8%
enantiomeric excess.
Example 117
N46-(4-aminophenyppyridin-3-y1]-3-{[(2R)-2-(morpholin-4-yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide or
N46-(4-aminophenyppyridin-3-y1]-3-{[(25)-2-(morpholin-4-yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
I
. 0 r'0
lei N)YNJ
H2N
H
FO CH3
F I
F
or
H
N 0
I
. [10
)-Nj
H2N N
H
FO OH3
F I
F
A sample of racemic N46-(4-aminophenyppyridin-3-y1]-3-{[2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide (prepared as described in example 111, 111 mg, 209
mop was
separated using chiral HPLC (system: Agilent Prep 1200, column: Chiralpak IC
Slim 250x30 mm,
solvent: ethanol / methanol / diethylamine 50:50:0.1 (v/v/v)) to give the
first eluting enantiomer of
N46-(4-aminophenyppyridin-3-y1]-3-{[2-(morpholin-4-yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide (40 mg, 36% from racemate) which was purified
again by preparative
HPLC to obtain the desired pure enantiomer (18 mg, 16% from racemate).
272

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.54 - 2.58 (m, 4H),
3.37 - 3.48 (m, 1H), 3.62 -
3.71 (m, 4H), 5.37 (s, 2H), 6.63 (d, 2H), 7.58 - 7.70 (m, 1H), 7.73 - 7.88 (m,
4H), 8.12 - 8.18 (m, 1H),
8.72 (s, 1H), 8.82 - 8.92 (m, 1H), 9.96 - 10.08 (m, 1H), 10.54 (s, 1H).
Optical rotation (Method 6): [a] = ¨ 4.1 (c = 1.00, CHCI3).
LC-MS (Method 4): Rt = 0.82 min; MS (ESIneg): m/z = 528 [M¨H].
Chiral HPLC (system: Waters Alliance 2695 DAD 996 ESA: Corona, column:
Chiralpak IC 3um 100x4.6
mm, solvent: ethanol / methanol / diethylamine 50:50:0.1 (v/v/v)): Rt = 3.30
min, 93.4%
enantiomeric excess.
Example 118
N46-(4-aminophenyppyridin-3-y1]-3-{[(2R)-2-(morpholin-4-yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide or
N46-(4-aminophenyppyridin-3-y1]-3-{[(25)-2-(morpholin-4-yppropanoyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
I ,
. N- (10 j0(r(0)
H2N N
H
FO CH3
F I
F
or
H
N 0
I
(10 0 r'0 Nj
H2N N
H
FO OH3
F I
F
A sample of racemic N46-(4-aminophenyppyridin-3-y1]-3-{[2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide (prepared as described in example 111, 111 mg, 209
mop was
separated using chiral HPLC (system: Agilent Prep 1200, column: Chiralpak IC
Slim 250x30 mm,
solvent: ethanol / methanol / diethylamine 50:50:0.1 (v/v/v)) to give the
second eluting enantiomer
of N46-(4-aminophenyppyridin-3-y1]-3-{[2-(morpholin-4-
yppropanoyl]aminol-4-
273

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
(trifluoromethoxy)benzamide (38 mg, 34% from racemate) which was purified
again by preparative
HPLC (Method 2) to obtain the desired pure enantiomer (28 mg, 25% from
racemate).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.54 - 2.58 (m, 4H),
3.37 - 3.48 (m, 1H), 3.62 -
3.71 (m, 4H), 5.37 (s, 2H), 6.63 (d, 2H), 7.58 - 7.70 (m, 1H), 7.73 - 7.88 (m,
4H), 8.12 - 8.18 (m, 1H),
8.72 (s, 1H), 8.82 - 8.92 (m, 1H), 9.96 - 10.08 (m, 1H), 10.54 (s, 1H).
Optical rotation (Method 6): [a] = + 3.4 (c = 1.00, CHCI3).
LC-MS (Method 4): Rt = 0.82 min; MS (ESIneg): m/z = 528 [M¨H].
Chiral HPLC (system: Waters Alliance 2695 DAD 996 ESA: Corona, column:
Chiralpak IC 3um 100x4.6
mm, solvent: ethanol / methanol / diethylamine 50:50:0.1 (v/v/v)): Rt = 4.85
min, 88.3%
enantiomeric excess.
Example 119
N-{644-(hydroxymethypphenyl]pyridin-3-y11-3-{[(25)-2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide or
N-{644-(hydroxymethypphenyl]pyridin-3-y11-3-{[(2R)-2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
H
N 0
I
N
HO N j(r00
H
FO CH3
F I
F
or
H
N 0
I
HO . N= 0 r'0
N
H
FO OH3
F I
F
Argon was bubbled through a suspension of the compound of intermediate 109
(250 mg, 529 mop,
[4-(hydroxymethyl)phenyl]boronic acid (121 mg, 793 mop and potassium
carbonate (146 mg, 1.06
274

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
mmol) in 1,2-diethoxyethane (4.12 mL) and water (714 L) for several minutes.
Afterwards 1,1'-
bis(diphenylphosphino)ferrocene-palladium(II)dichloride (193 mg, 264 mop was
added to the
mixture, the tube was sealed and the reaction mixture was stirred over night
at 90 C. After cooling
to room temperature, the mixture was filtered over a pad of Celite. The
filtrate was concentrated in
vacuum and the residue was purified by preparative HPLC (method 5) to provide
the racemic title
compound (52.6 mg, 18.3%). The racemic mixture was separated using chiral HPLC
(system: Agilent
Prep 1200, column: Chiralpak IC Slim 250x30 mm, solvent: ethanol / methanol /
diethylamine
50:50:0.1 (v/v/v)) to give the first eluting enantiomer of N-{644-
(hydroxymethyl)phenyl]pyridin-3-y11-
3-{[2-(morpholin-4-yppropanoyl]amino}-4-(trifluoromethoxy)benzamide (14 mg,
27% from
racemate).
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.54 - 2.58 (m, 4H), 3.41
(q, 1H), 3.65 - 3.68 (m,
4H), 4.55 (s, 2H), 5.08 - 5.48 (m, 1H), 7.41 - 7.44 (m, 2H), 7.65 (d, 1H),
7.84 (d, 1H), 7.94 - 8.11 (m,
3H), 8.27 (dd, 1H), 8.74 (d, 1H), 8.98 (d, 1H), 10.05 (s, 1H), 10.69 (s, 1H).
Optical rotation (Method 6): [a] = ¨3.1 (c = 1.00, CHCI3).
LC-MS (Method 4): Rt = 0.91 min; MS (ESIpos): m/z = 543 [M¨H].
Chiral HPLC (system: Waters Alliance 2695 DAD 996 ESA: Corona, column:
Chiralpak IC 3um 100x4.6
mm, solvent: ethanol / methanol / diethylamine 50:50:0.1 (v/v/v)): Rt = 4.11
min, 100% enantiomeric
excess.
Example 120
N-{644-(hydroxymethypphenyl]pyridin-3-y11-3-{[(25)-2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide or
N-{644-(hydroxymethypphenyl]pyridin-3-y11-3-{[(2R)-2-(morpholin-4-
yppropanoyl]aminol-4-
(trifluoromethoxy)benzamide
H
N 0
I
N
HO . * N j(r00
H
FO CH3
F I
F
or
275

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
I
HO . N (10 ).0 NO0
N
H =
_
FO CH3
FI
F
Argon was bubbled through a suspension of the compound of intermediate 109
(250 mg, 529 mop,
[4-(hydroxymethyl)phenyl]boronic acid (121 mg, 793 mop and potassium
carbonate (146 mg, 1.06
mmol) in 1,2-diethoxyethane (4.12 mL) and water (714 L) for several minutes.
Afterwards 1,1-
bis(diphenylphosphino)ferrocene-palladium(I1)dichloride (193 mg, 264 mop was
added to the
mixture, the tube was sealed and the reaction mixture was stirred over night
at 90 C. After cooling
to room temperature, the mixture was filtered over a pad of Celite. The
filtrate was concentrated in
vacuum and the residue was purified by preparative HPLC (Method 5) to provide
the racemic title
compound (52.6 mg, 18.3%). The racemic mixture was separated using chiral HPLC
(system: Agilent
Prep 1200, column: Chiralpak IC Slim 250x30 mm, solvent: ethanol / methanol /
diethylamine
50:50:810.1 (v/v/v)) to give the second eluting enantiomer of N-{644-
(hydroxymethypphenyl]pyridin-
3-y11-3-{[2-(morpholin-4-yppropanoyl]aminol-4-(trifluoromethoxy)benzamide (14
mg, 27% from
racemate).
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.23 (d, 3H), 2.54 - 2.58 (m, 4H), 3.41
(q, 1H), 3.65 - 3.68 (m,
4H), 4.55 (s, 2H), 5.08 - 5.48 (m, 1H), 7.41 - 7.44 (m, 2H), 7.65 (d, 1H),
7.84 (d, 1H), 7.94 - 8.11 (m,
3H), 8.27 (dd, 1H), 8.74 (d, 1H), 8.98 (d, 1H), 10.05 (s, 1H), 10.69 (s, 1H).
Optical rotation (Method 6): [a] = +0.2 (c = 1.00, CHCI3).
LC-MS (Method 4): Rt = 0.91 min; MS (ESIneg): m/z = 543 [M-H].
Chiral HPLC (system: Waters Alliance 2695 DAD 996 ESA: Corona, column:
Chiralpak IC 3um 100x4.6
mm, solvent: ethanol / methanol / diethylamine 50:50:0.1 (v/v/v)): Rt = 5.43
min, 94.9%
enantiomeric excess.
Example 121
N-{3-[(morpholin-4-ylacetypamino]-4-(trifluoromethoxy)pheny11-5-pheny1-1,2,4-
oxadiazole-3-
carboxamide
276

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
NH
0
-- N (10
4
0 r'-)0 1, N)'N
H
FO
Fl
F
To a solution of the compound of intermediate 32 (150 mg, 470 mop and 5-
phenyl-1,2,4-
oxadiazole-3-carboxylic acid (98.3 mg, 517 mop in DMF (3.0 mL) were added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 367 mg, 705 mop
and N,N-
diisopropylethylamine (245 uL, 1.41 mmol). The reaction mixture was stirred
over night at 60 C.
After cooling to room temperature the mixture was poured into water. The
resulting precipitate was
collected by filtration, washed with water and dried at 60 C under reduced
pressure. After
purification by preparative HPLC (Method 2) the titled compound 121 was
obtained (21.6 mg, 9%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.53 - 2.62 (m, 4H), 3.21 (s, 2H),
3.56 - 3.71 (m, 4H), 7.43 -
7.56 (m, 1H), 7.63 - 7.83 (m, 4H), 8.17 - 8.29 (m, 2H), 8.76 (s, 1H), 9.83 (m,
1H), 11.22 (m, 1H).
LC-MS (Method 4): Rt = 1.10 min; MS (ESIpos): m/z = 492 [M+1-1]+.
Example 122
3-[(morpholin-4-ylacetypamino]-N-(2-phenyl-1,3-thiazol-5-y1)-4-
(trifluoromethoxy)benzamide
H
N/y N 0
\ S
[10 LNO)
411. N
H
F.0
Fl
F
To a solution of the compound of intermediate 21 (200 mg, 459 mop and 2-
phenyl-1,3-thiazol-5-
amine (98.3 mg, 517 mop in DMF (1.8 mL) were added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 359 mg, 689 mop
and N,N-
diisopropylethylamine (240 uL, 1.34 mmol). The reaction mixture was stirred
over night at room
temperature. The mixture was poured into water. The resulting precipitate was
collected by
filtration, washed with water and dried at 60 C under reduced pressure. The
resulting crude product
was purified by crystallization from DMSO to obtain the title compound 122
(109 mg, 47%).
277

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.62 (m, 4H), 3.24 (s, 2H),
3.57 - 3.69 (m, 4H), 7.42 -
7.52 (m, 3H), 7.68 (d, 1H), 7.82 (s, 1H), 7.87 - 7.94 (m, 3H), 8.83 (s, 1H),
9.94 (br. s, 1H), 11.99 (s, 1H).
LC-MS (Method 4): Rt = 1.15 min; MS (ESIpos): m/z = 507 [M+H].
Example 123
1-methyl-N-{3-[(morpholin-4-ylacetypamino]-4-(trifluoromethoxy)pheny11-5-
phenyl-1H-pyrazole-3-
carboxamide
0
H3u-N NH
0
).L.Nj
FO
A solution of the compound of intermediate 32 (150 mg, 470 mop and 1-methyl-5-
phenyl-1H-
pyrazole-3-carboxylic acid (114 mg, 564 mop in DMF (3.0 mL) was treated with
a 50% solution of
2,4,6-tripropy1-1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide (T3P) in DMF
(164 uL, 1.41 mmol) and
N,N-diisopropylethylamine (245 uL, 1.41 mmol). The reaction mixture was
stirred for 3 d at room
temperature and over night at 90 C. After cooling to room temperature the
same amounts of T3P
and N,N-diisopropylethylamine were added to the mixture again and it was
stirred additionally for 16
h at 90 C. After cooling the mixture was poured into water and extracted
three times with ethyl
acetate. The combined organic layers were washed with brine, dried and
concentrated in vacuum.
The residue was purified by preparative HPLC (method 2) to obtain the title
compound 123 (16.8 mg,
7%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.51 - 2.62 (m, 4H), 3.19 (s, 2H),
3.58 - 3.71 (m, 4H), 3.97 (s,
3H), 6.94 (s, 1H), 7.38 - 7.72 (m, 7H), 8.76 (d, 1H), 9.76 (s, 1H), 10.36 (s,
1H).
LC-MS (Method 4): Rt = 1.12 min; MS (ESIpos): m/z = 504 [M+H].
Example 124
N-{3-[(morpholin-4-ylacetypamino]-4-(trifluoromethoxy)pheny11-5-phenyl-1H-
pyrazole-3-
carboxamide
278

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
0
N
/ --.... N
HN H
....--
41, I 0 I )U NO
N
H
FO
Fl
F
A solution of the compound of intermediate 32 (150 mg, 470 mop and 5-phenyl-
1H-pyrazole-3-
carboxylic acid (106 mg, 564 mop in DMF (3.0 mL) was treated with a 50%
solution of 2,4,6-
tripropy1-1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide (T3P) in DMF (164
uL, 1.41 mmol) and N,N-
diisopropylethylamine (245 uL, 1.41 mmol). The mixture was stirred for 24 h at
room temperature
and over night at 90 C. After cooling to room temperature the same amounts of
T3P and N.N-
diisopropylethylamine were added to the mixture again and it was additionally
stirred for 16 h at 90
C. After cooling the mixture was poured into water. The resulting suspension
was stirred for some
minutes; the precipitate was collected by filtration and was washed several
times with water. After
drying, the crude product was crystallized from methanol to give the final
product (81.9 mg, 35%).
1-1-1-NMR (500 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.61 (m, 4H), 3.21 (s, 2H),
3.63 - 3.68 (m, 4H), 7.23 (br.
s, 1H), 7.35 - 7.50 (m, 4H), 7.72 (d, 1H), 7.84 (d, 2H), 8.74 (br. s, 1H),
9.78 (br. s, 1H), 10.36 (br. s, 1H),
13.81 (br. s, 1H).
LC-MS (Method 1): Rt = 1.04 min; MS (ESIpos): m/z = 490 [M+H].
Example 125
3-[(morpholin-4-ylacetypamino]-N-(3-phenyl-1,2,4-oxadiazol-5-y1)-4-
(trifluoromethoxy)benzamide
H
0._N 0
N li
411. _\N, LNO
N
H
F.0
Fl
F
To a solution of the compound of intermediate 21 (200 mg, 459 mop and 3-
phenyl-1,2,4-oxadiazol-
5-amine (107 mg, 643 mop in DMF (1.8 mL) were added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 359 mg, 689 mop
and N,N-
diisopropylethylamine (240 uL, 1.34 mmol). The reaction mixture was stirred
over night at room
temperature. The mixture was poured into water. The resulting precipitate was
collected by
279

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
filtration, washed with water and dried at 60 C under reduced pressure to
yield the title compound
125 (53.8 mg, 24%).
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.62 (m, 4H), 3.23 (s, 2H),
3.58 - 3.69 (m, 4H), 7.53 -
7.61 (m, 3H), 7.65 (s, 1H), 7.88 - 7.93 (m, 1H), 7.99 - 8.01 (m, 2H), 8.84 (d,
1H), 9.92 (s, 1H), 12.84 (m,
1H).
LC-MS (Method 4): Rt = 1.04 min; MS (ESIpos): m/z = 492 [M+H].
Example 126
N46-(4-aminophenyppyridin-3-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
H
N 0
I
0 [10 0 r0
H2N N
H
FO
F I
F
The title compound was prepared in a manner analogous to that described in
example 111 starting
from 150 mg (327 mop of the compound of intermediate 110 and 67.2 mg (626
mop of 4-
aminophenylboronic acid. To work up the reaction, the mixture was poured into
water. The resulting
precipitate was collected by filtration and subsequently purified by
preparative HPLC (method 5) to
yield 8.2 mg (20 limo!, 5%) of the desired compound 126.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.66 (m, 4H), 3.23 (s, 2H),
3.57 - 3.71 (m, 4H), 5.37 (s,
2H), 6.61 - 6.64 (m, 2H), 7.59 - 7.68 (m, 1H), 7.73 - 7.88 (m, 4H), 8.08 -
8.18 (m, 1H), 8.77 (d, 1H), 8.86
(d, 1H), 9.91 (s, 1H), 10.54 (s, 1H).
LC-MS (Method 1): Rt = 0.82 min; MS (ESIpos): m/z = 516 [M+H].
Example 127
N45-(2-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
280

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN 0
/ yN\ S
F
41, N
H
F.0
Fl
F
The title compound was prepared in a manner analogous to that described in
example 125 starting
from 500 mg (1.43 mmol) of the compound of intermediate 21 and 392 mg (2.01
mmol) of 5-(2-
fluoropheny1)-1,3,4-thiadiazol-2-amine to obtain 340 mg (45%) of the desired
compound 127.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.63 (m, 4H), 3.24 (s, 2H),
3.61 - 3.71 (m, 4H), 7.40 -
7.52 (m, 2H), 7.58 - 7.70 (m, 2H), 8.04 (dd, 1H), 8.28 (d, 1H), 8.95 (d, 1H),
9.94 (s, 1H), 13.47 (m, 1H).
LC-MS (Method 4): Rt = 1.15 min; MS (ESIpos): m/z = 526 [M+H].
Example 128
34[2-(morpholin-4-yl)propanoyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethypbenzamide
H
NN 0
/ yN\ S
. 0
N
H
CH3
F F
F
Triethylamine was added to a solution of the compound of intermediate 111 (250
mg, 550 mop,
morpholine (72 uL, 824 mop and potassium iodide (14.1 mg, 85.2 mop. The
reaction mixture was
stirred for 36 h at 50 C. After cooling to room temperature the same amounts
of morpholine and
potassium iodide were added again. The mixture was stirred over night at 90
C. After cooling to
room temperature the mixture was poured into water. The aqueous phase was
extracted three times
with a mixture of DCM/isopropanol 8:2. The combined organic layers were washed
with brine, dried
over Mg504 and its volume was reduced under reduced pressure. The precipitate
was removed by
filtration. The filtrate was concentrated and the remaining residue was
purified by preparative HPLC
(method 5) yielding the desired compound 128 (53.4 mg, 101 limo!, 18%).
'H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.25 (d, 3H), 2.52 - 2.59 (m, 4H), 3.38
(q, 1H), 3.65 - 3.68 (m,
4H), 7.52 - 7.57 (m, 3H), 7.91 - 8.02 (m, 3H), 8.07 (s, 1H), 8.82 (s, 1H),
10.07 (s, 1H), 13.55 (m, 1H).
281

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 3): Rt = 0.79 min; MS (ES1pos): rniz = 506 [m+H].
Example 129
34[2-(4-methylpiperazin-l-yppropanoyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-
y1)-4-
(trifluoromethyl)benzamide
H
NN 0
/ yN\ S
. 0 rNCH3
I1S N)YNJ
H
CH3
F F
F
The title compound was prepared in a manner analogous to that described in
example 128 starting
from 250 mg (550 mop of the compound of intermediate 111 and 82.6 mg (824
mop of 1-
methylpiperazine to obtain 57.1 mg (19%) of the desired compound 129.
1-H-NMR (300 MHz, DMSO-d6): 6 [ppm] = 1.24 (d, 3H), 2.36 (s, 3H), 2.58 - 2.70
(m, 8H), 3.44 (q, 1H),
7.58 - 7.48 (m, 3H), 7.90 (d, 1H), 7.93 - 7.96 (m, 2H), 8.09 (d, 1H), 8.75 (s,
1H), 9.97 (s, 1H), 12.37 (s,
br. 1H).
LC-MS (Method 3): Rt = 0.78 min; MS (ES1pos): rniz = 519 [m+H].
Example 130
N-{4-methoxy-3-[(morpholin-4-ylacetypamino]pheny11-5-pheny1-1,3,4-thiadiazole-
2-carboxamide
0
NNH
µ
\

1 S
r0
41. 0
I:101 )-Nj
N
H
0
H3C
The title compound was prepared in a manner analogous to that described in
example 125 starting
from 200 mg (154 mop of the compound of intermediate 36 and 171 mg (829 mop
of 5-phenyl-
1,3,4-thiadiazole-2-carboxylic acid to obtain 262 mg (520 limo!, 69%) of the
desired compound 130.
11-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.53 - 2.60 (m, 4H), 3.16 (s, 2H), 3.60
- 3.75 (m, 4H), 3.90 (s,
3H), 7.09 (d, 1H), 7.46 - 7.66 (m, 4H), 8.08 - 8.11 (m, 2H), 8.73 (d, 1H),
9.76 (s, 1H), 11.17 (s, 1H).
282

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
LC-MS (Method 4): Rt = 0.92 min; MS (ESIpos): rn/z = 454 [m+H].
Example 131
3-[(morpholin-4-ylacetyl)amino]-N-(5-phenylpyridin-2-yI)-4-
(trifluoromethoxy)benzamide
H
N N 0
I
0 / I.
0 r'0
N
H
FO
F I
F
To a solution of intermediate 21 (150 mg, 431 mop and 5-phenylpyridin-2-amine
(103 mg, 603
mop in DMF (1.66 mL) was added (benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PYBOP, 336 mg, 646 mop and diisopropylethylamine (225
uL, 1.29 mmol).
The resulting mixture was stirred at 50 C over night. After cooling to room
temperature the reaction
mixture was poured into water. The aqueous phase was extracted three times
with a mixture of
DCM/isopropanol 8:2. The combined organic layers were dried over Mg504 and the
solvent was
removed under reduced pressure. The residue was purified by preparative HPLC
(eluent:
acetonitrile/water + 0.1% HCOOH, gradient) to obtain the desired product 131
(60.3 mg, 28%).
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.62 (m, 4H), 3.23 (s, 2H),
3.61 - 3.70 (m, 4H), 7.37 -
7.45 (m, 1H), 7.45 - 7.55 (m, 2H), 7.56 - 7.63 (m, 1H), 7.72 - 7.79 (m, 2H),
7.88 - 7.95 (m, 1H), 8.20 (s,
1H), 8.26 (s, 1H), 8.73 (d, 1H), 8.83 (d, 1H), 9.90 (s, 1H), 11.09 (s, 1H).
LC-MS (Method 1): Rt = 1.16 min; MS (ESIneg): m/z = 499 [M¨H].
Example 132
3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenylpyridin-2-y1)-4-
(trifluoromethoxy)benzamide
formiate
H
N N 0
I
0 r'NCE13
)'L.Nj 0
H)LOH
N
H
FO
F I
F
283

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The title compound was prepared in a manner analogous to that described in
example 131 starting
from 150 mg (415 mop of the compound of intermediate 112 and 99.0 mg (581
mop of 5-
phenylpyridin-2-amine to obtain 8.20 mg (3%) of the desired compound 132.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.72 - 2.84 (m, 4H), 3.38 (s, 3H),
7.35 - 7.60 (m, 5H), 7.73 -
7.77 (m, 2H), 7.98 (dd, 1H), 8.11 - 8.31 (m, 2H), 8.59 (s, 1H), 8.73 (d, 1H),
9.38 (br. s, 1H), 9.80 (s, 1H),
11.06 (s, 1H).
LC-MS (Method 4): Rt = 1.03 min; MS (ESIpos): m/z = 514 [M-HCO0H+H].
Example 133
4-(cyclopropyloxy)-N46-(2-fluorophenyl)pyridin-3-y1]-3-[(morpholin-4-
ylacetypamino] benzamide
H
N 0
I
0 N1 0 r'0 401 )-Nj
F N
H
0
V
60 mg (0.17 mmol) of 3-amino-4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-
yl]benzamide
(intermediate 116) were dissolved in 3 mL of anh DMF. 28.8 mg (0.20 mmol) of
morpholin-4-ylacetic
acid, 86 uL (0.50 mmol) of N-ethyl-N-isopropylpropan-2-amine and 111.7 mg
(0.22 mmol) of PYBOP
were added. It was stirred for 3 h at 40 C. It was concentrated and the
residue was purified by HPLC
(method 5) yielding 47 mg (57%) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.72 - 0.82 (m, 2H), 0.88 - 0.97 (m,
2H), 2.52 - 2.58 (m, 4H),
3.16 (s, 2H), 3.61 - 3.71 (m, 4H), 4.07 - 4.16 (m, 1H), 7.26 - 7.38 (m, 2H),
7.41 - 7.51 (m, 2H), 7.75 -
7.86 (m, 2H), 7.91 - 8.00 (m, 1H), 8.26 - 8.33 (m, 1H), 8.80 (d, 1H), 9.05 (d,
1H), 9.70 (s, 1H), 10.49 (s,
1H).
LC-MS (Method 3): Rt = 1.23 min; MS (ESIpos): m/z = 491 [M+H].
Example 134
4-(cyclopropyloxy)-N46-(2-fluorophenyl)pyridin-3-y1]-3-(0-(morpholin-4-
ypcyclopropyl]carbonyllamino)benzamide
284

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N 0
I
0F N 0 r0
11 NA(N)
H ___
0
70 mg (0.19 mmol) of 3-amino-4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-
yl]benzamide
(intermediate 116) were dissolved in 3.5 mL of anh DMF. 48.0 mg (0.23 mmol) of
1-(morpholin-4-
yl)cyclopropanecarboxylic acid hydrochloride (intermediate 44), 134 uL (0.77
mmol) of N-ethyl-N-
isopropylpropan-2-amine and 130.3 mg (0.25 mmol) of PYBOP were added. It was
stirred for 3 h at
40 C and for 5 h at 50 C. It was concentrated and the residue was purified
by HPLC (Waters
Autopurificationsystem SOD; column: YMC-Triart C18 Si 100x30mm; eluent A:
water + 0.1% vol.
formic acid (99%), eluent B: acetonitrile; gradient: 0-0.50 min 30% B, 25
mL/min; 0.51-5.5 min 60-
85% B, 70 mL/min; temperature: room temperature) yielding 37.5 mg (37%) of the
title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.76 - 0.86 (m, 2H), 0.91 - 1.00 (m,
2H), 1.07 - 1.16 (m, 2H),
1.16 - 1.25 (m, 2H), 2.39 - 2.45 (m, 4H), 3.67 - 3.76 (m, 4H), 4.10 - 4.18 (m,
1H), 7.27 - 7.37 (m, 2H),
7.41 - 7.51 (m, 2H), 7.74 - 7.83 (m, 2H), 7.91 - 7.99 (m, 1H), 8.29 (dd, 1H),
8.89 (d, 1H), 9.05 (d, 1H),
10.45 - 10.52 (m, 2H).
LC-MS (Method 3): Rt = 1.34 min; MS (ESIpos): rniz = 517 [m+H].
Example 135
4-(cyclopropyloxy)-N46-(2-fluorophenyl)pyridin-3-y1]-3-(0-(4-methylpiperazin-1-

ypcyclopropyl]carbonyllamino)benzamide
H
N 0
I
0 N0 CH
N- 3
F N
H ________________________________________________
0
70 mg (0.19 mmol) of 3-amino-4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-
yl]benzamide
(intermediate 116) were dissolved in 3.5 mL of anh DMF. 42.6 mg (0.23 mmol) of
1-(4-
methylpiperazin-1-yl)cyclopropanecarboxylic acid hydrochloride (intermediate
42), 101 uL (0.58
mmol) of N-ethyl-N-isopropylpropan-2-amine and 130.3 mg (0.25 mmol) of PYBOP
were added. It
was stirred for 3 h at 40 C and for 5 h at 50 C. It was concentrated and the
residue was purified by
285

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H PLC (Waters Autopurificationsystem SOD; column: YMC-Triart C18 Si' 100x3Omm;
eluent A: water +
0.2% vol. ammonia (32%), eluent B: acetonitrile; gradient: 0-0.50 min 25% B,
25 mL/min; 0.51-5.5
min 50-70% B, 70 mL/min; temperature: room temperature) affording 15.5 mg
(14%) of the title
compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.76 - 0.86 (m, 2H), 0.91 - 1.00 (m,
2H), 1.07 - 1.16 (m, 2H),
1.16 - 1.25 (m, 2H), 2.39 - 2.45 (m, 4H), 3.67 - 3.76 (m, 4H), 4.10 - 4.18 (m,
1H), 7.27 - 7.37 (m, 2H),
7.41 - 7.51 (m, 2H), 7.74 - 7.83 (m, 2H), 7.91 - 7.99 (m, 1H), 8.29 (dd, 1H),
8.89 (d, 1H), 9.05 (d, 1H),
10.45 - 10.52 (m, 2H).
LC-MS (Method 3): Rt = 1.32 min; MS (ESIpos): rniz = 530 [m+H].
Example 136
4-(cyclopropyloxy)-3-(1[1-(4-cyclopropylpiperazin-1-
ypcyclopropyl]carbonyllamino)-N46-(2-
fluorophenyl)pyridin-3-yl]benzamide
H
N 0
I

A
0 N 0 r'N N )cNJ
F
H
0
V
70 mg (0.19 mmol) of 3-amino-4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-
yl]benzamide
(intermediate 116) were dissolved in 3.5 mL of anh DMF. 48.6 mg (0.23 mmol) of
1-(4-
cyclopropylpiperazin-1-ypcyclopropanecarboxylic acid hydrochloride
(intermediate 43), 101 uL (0.58
mmol) of N-ethyl-N-isopropylpropan-2-amine and 130.3 mg (0.25 mmol) of PYBOP
were added. It
was stirred for 3 h at 40 C. It was concentrated and the residue was purified
by HPLC (Waters
Autopurificationsystem SOD; column: XBridge C18 Si' 100x3Omm; eluent A: water
+ 0.2% vol.
ammonia (32%), eluent B: acetonitrile; gradient: 0-0.50 min 24% B, 25 mL/min;
0.51-5.5 min 48-86%
B, 70 mL/min; temperature: room temperature) affording 15.5 mg (14%) of the
title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 0.26 - 0.34 (m, 2H), 0.41 - 0.50 (m,
2H), 0.83 - 1.01 (m, 4H),
1.03 - 1.21 (m, 4H), 1.62 - 1.71 (m, 1H), 2.32 - 2.44 (m, 4H), 2.60 - 2.77 (m,
4H), 4.10 - 4.19 (m, 1H),
7.27 - 7.37 (m, 2H), 7.41 - 7.51 (m, 2H), 7.72 - 7.84 (m, 2H), 7.91 - 8.00 (m,
1H), 8.28 (dd, 1H), 8.92 (d,
1H), 9.05 (d, 1H), 10.43 - 10.54 (m, 2H).
LC-MS (Method 3): Rt = 1.47 min; MS (ESIpos): rniz = 556 [m+H].
Example 137
286

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
3-{[(3,4-dimethylpiperazin-1-ypacetyl]aminol-N46-(2-fluorophenyppyridin-3-y1]-
4-
(trifluoromethoxy)benzamide
H
N 0
CH
I
0 (003
0NCH3
F N
H
FO
F I
F
100 mg (0.19 mmol) of 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (intermediate 14) were dissolved in 1 mL of anh
DMF. 94 uL (0.67
mmol) of N,N-diethylethanamine, 54 mg (0.29 mmol) of 1,2-dimethylpiperazine
dihydrochloride, and
5 mg (0.03 mmol) of potassium iodide were added. It was stirred for 2 h at rt
and over night at 50 C.
It was concentrated and the residue was purified by HPLC (method 5) giving
19.5 mg (16%) of the
title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 0.96 (d, 3H), 1.99 - 2.11 (m, 2H), 2.13
- 2.29 (m, 4H), 2.33 -
2.43 (m, 1H), 2.67 - 2.82 (m, 3H), 3.18 (s, 2H), 7.26 - 7.38 (m, 2H), 7.41 -
7.52 (m, 1H), 7.61 - 7.70 (m,
1H), 7.77 - 7.88 (m, 2H), 7.90 - 8.00 (m, 1H), 8.24 - 8.33 (m, 1H), 8.84 (s,
1H), 9.05 (s, 1H), 9.92 (s, 1H),
10.71 (s, 1H).
LC-MS (Method 3): Rt = 1.38 min; MS (ESIpos): m/z = 546 [M+H].
Example 138
N46-(2-fluorophenyl)pyridin-3-y1]-4-(methylsulfany1)-3-[(morpholin-4-
ylacetypamino] benzamide
H
N 0
I
1401 40 0 ro
F N
H
H3C
S
6.61 g (18.70 mmol) of 3-amino-N46-(2-fluorophenyl)pyridin-3-y1]-4-
(methylsulfanypbenzamide
(intermediate 118), 3.095 g (21.32 mmol) of morpholin-4-ylacetic acid and
14.794 g (28.43 mmol) of
PYBOP were dissolved in 178 mL of anh DMF. 4.64 mL (26.65 mmol) of N-ethyl-N-
isopropylpropan-2-
amine were added. It was stirred at 55 C over night. 1 g (1.92 mmol) of PYBOP
was added and it was
287

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
stirred for 2 h at 55 C. The reaction mixture was allowed to reach rt. It was
combined with a 1 g
batch. It was poured into water. The solid material was filtered off and was
triturated with a little
Et0Ac under heating. The solid material was filtered off. The solid material
was crystallized from
methanol/Et0Ac 8:2 obtaining 5.5 g (53%) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.56 (s, 3H), 2.58 - 2.62 (m, 4H), 3.20
(s, 2H), 3.67 - 3.73 (m,
4H), 7.28 - 7.35 (m, 2H), 7.43 - 7.49 (m, 1H), 7.56 (d, 1H), 7.79 - 7.84 (m,
2H), 7.93 - 7.98 (m, 1H), 8.30
(dd, 1H), 8.55 (d, 1H), 9.06 (d, 1H), 9.87 (s, 1H), 10.57 (s, 1H).
LC-MS (Method 4): Rt = 1.00 min; MS (ESIpos): m/z = 481 [M+H].
Example 139
N-[6-(2-fluorophenyl)pyridin-3-y1]-4-(methylsulfony1)-3-[(morpholin-4-
ylacetyl)amino]benzamide
H
N 0
I
001 40 0 ro
F N
H
S=0
H C II
3 0
200 mg (0.42 mmol) of N-[6-(2-fluorophenyl)pyridin-3-y1]-4-(methylsulfany1)-3-
[(morpholin-4-
ylacetyl)amino]benzamide and 256 mg (0.83 mmol) of Oxone were suspended in 7
mL of methanol.
2 mL of water were added and it was stirred for 3 h at rt. 256 mg (0.83 mmol)
of Oxone were added
and it was stirred over night at rt. The solid material was filtered off and
washed with a lot of water.
The aqueous filtrate was extracted three times with dichloromethane. The
extract and the solid
residue were combined and concentrated. The residue was triturated with
methanol. The solid
residue was filtered off. The filtrate was concentrated, dissolved in
dichloromethane and washed
with saturated aqueous sodium hydrogen sulfite solution. The organic layer was
concentrated and
purified by HPLC (method 5) to yield 20.1 mg (9%) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.57 - 2.62 (m, 4H), 3.23 (s, 2H), 3.35
(s, 3H), 3.67 - 3.72 (m,
4H), 7.29 - 7.36 (m, 2H), 7.43 - 7.50 (m, 1H), 7.82 - 7.86 (m, 1H), 7.90 (dd,
1H), 7.93 - 7.99 (m, 1H),
8.06 (d, 1H), 8.31 (dd, 1H), 9.06 (d, 1H), 9.08 (d, 1H), 10.84 (s, 1H), 11.03
(s, 1H).
LC-MS (Method 4): Rt = 0.85 min; MS (ESIpos): m/z = 513 [M+H].
Example 140
4-(cyclopropyloxy)-3-(0-(dimethylamino)cyclopropyl]carbonyllamino)-N46-(2-
fluorophenyl)pyridin-
288

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
3-yl] benzamide
H
N 0
I
0 NN5 CH
c13CH
F .
H _________________________________________________________ 3
0
70 mg (0.19 mmol) of 3-amino-4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-
yl]benzamide
(intermediate 116), 29.9 mg (0.23 mmol) of 1-
(dimethylamino)cyclopropanecarboxylic acid, 130.3 mg
(0.25 mmol) of PYBOP and 101 uL (0.58 mmol) of N-ethyl-N-isopropylpropan-2-
amine in 3.5 mL of
anh DMF were stirred 5 h at 50 C. The reaction mixture was concentrated and
purified by HPLC
(Waters Autopurificationsystem SOD; column: YMC-Triart C18 5 100x3Omm; eluent
A: water + 0.1%
vol. formic acid (99%), eluent B: acetonitrile; gradient: 0-0.50 min 29% B, 25
mL/min; 0.51-5.5 min
58-82% B, 70 mL/min; temperature: room temperature) to obtain 16 mg (17%) of
the title
compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 0.70 - 0.78 (m, 2H), 0.85 - 0.94 (m,
2H), 1.05 - 1.16 (m, 4H),
2.24 (s, 6H), 4.10 - 4.19 (m, 1H), 7.27 - 7.37 (m, 2H), 7.40 - 7.51 (m, 2H),
7.73 - 7.84 (m, 2H), 7.90 -
8.00 (m, 1H), 8.25 - 8.32 (m, 1H), 8.78 (d, 1H), 9.05 (d, 1H), 10.22 (s, 1H),
10.48 (s, 1H).
LC-MS (Method 3): Rt = 1.43 min; MS (ESIpos): rniz = 475 [m+H].
Example 141
4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-y1]-3-[(1H-pyrazol-1-
ylacetyl)amino] benzamide
H
N 0
I
0 0 0
NOm
F N).' ......µ
H
0
V
70 mg (0.19 mmol) of 3-amino-4-(cyclopropyloxy)-N-[6-(2-fluorophenyl)pyridin-3-
yl]benzamide
(intermediate 116), 29.2 mg (0.23 mmol) of 1H-pyrazol-1-ylacetic acid, 130.3
mg (0.25 mmol) of
PYBOP and 101 uL (0.58 mmol) of N-ethyl-N-isopropylpropan-2-amine in 3.5 mL of
anh DMF were
289

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
stirred for 5 h at 50 C. The reaction mixture was concentrated and purified
by HPLC (Waters
Autopurificationsystem SOD; column: YMC-Triart C18 Si' 100x3Omm; eluent A:
water + 0.1% vol.
formic acid (99%), eluent B: acetonitrile; gradient: 0-0.50 min 24% B, 25
mL/min; 0.51-5.5 min 48-
66% B, 70 mL/min; temperature: room temperature) to yield 33 mg (36%) of the
title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 0.70 - 0.78 (m, 2H), 0.83 - 0.91 (m,
2H), 4.01 - 4.09 (m, 1H),
5.13 (s, 2H), 6.33 (t, 1H), 7.27 - 7.37 (m, 2H), 7.41 - 7.50 (m, 2H), 7.55 (d,
1H), 7.76 - 7.86 (m, 3H), 7.90
- 7.99 (m, 1H), 8.25 - 8.31 (m, 1H), 8.62 (d, 1H), 9.03 (d, 1H), 9.26 (s, 1H),
10.48 (s, 1H).
LC-MS (Method 3): Rt = 1.20 min; MS (ESIpos): rn/z = 472 [m+H].
Example 142
4-tert-butyl-N46-(2-fluorophenyppyridin-3-y1]-3-{[2-(morpholin-4-
yl)propanoyl]aminolbenzamide
H
N 0
I
0 0 ro
110 N)-yNJ
F
H
H3C CH3 CH3
CH3
To 350 mg (0.77 mmol) of 4-tert-butyl-3-[(2-chloropropanoyl)amino]-N-[6-(2-
fluorophenyl)pyridin-3-
yl]benzamide (intermediate 122) in 2.5 mL of anh DMF were added 400 uL (4.62
mmol) of
morpholine, 322 uL (2.31 mmol) of N,N-diethylethanamine and 64 mg (0.39 mmol)
of potassium
iodide. It was stirred over night at rt. 100 uL (1.16 mmol) of morpholine and
32 mg (0.19 mmol) of
potassium iodide were added. It was stirred for 28 h at 50 C. The reaction
was allowed to reach rt
and poured into water. It was extracted three times with Et0Ac. The combined
organic phases were
dried over sodium sulfate and concentrated. The residue was purified by HPLC
(method 2) and silica
gel chromatography (hexane/Et0Ac 1:1 to Et0Ac) providing 23 mg (6%) of the
title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 1.22 (d, 3H), 1.40 (s, 9H), 2.51 - 2.65
(m, 4H), 3.28 - 3.37 (m,
1H, with water signal), 3.58 - 3.68 (m, 4H), 7.25 - 7.34 (m, 2H), 7.39 - 7.48
(m, 1H), 7.53 (d, 1H), 7.74 -
7.81 (m, 2H), 7.89 - 7.96 (m, 1H), 8.13 (d, 1H), 8.26 (dd, 1H), 9.03 (d, 1H),
9.50 (s, 1H), 10.51 (s, 1H).
LC-MS (Method 4): Rt = 1.12 min; MS (ESIpos): rn/z = 505 [m+H].
Example 143
4 -tert-butyl-34[2-(morpholin-4-yppropanoyl]aminol-N-(5-phenyl-1,3-thiazol-2-
290

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
yl)benzamide
H
0
i
\ S, )01\r0
J
41, N
H
CH3
H3C CH3
CH3
To 663 mg (1.50 mmol) of 4-tert-butyl-3-[(2-chloropropanoyl)amino]-N-(5-phenyl-
1,3-thiazol-2-
yl)benzamide (intermediate 125) in 4.9 mL of anh DMF were added 523 uL (6.00
mmol) of
morpholine, 627 uL (4.50 mmol) of N,N-diethylethanamine and 62 mg (0.38 mmol)
of potassium
iodide. It was stirred over night at rt. 196 uL (2.25 mmol) of morpholine and
15.5 mg (0.09 mmol) of
potassium iodide were added. It was stirred for 28 h at 50 C. The reaction
was allowed to reach rt
and poured into water. It was extracted three times with Et0Ac. The combined
organic phases were
dried over sodium sulfate and concentrated. The solid residue was triturated
with methanol and
filtered off. The solid material was purified by HPLC (method 2) providing 20
mg (3%) of the title
compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.23 (d, 3H), 1.39 (s, 9H), 2.52 - 2.65
(m, 4H), 3.28 - 3.34 (m,
1H and water signal), 3.59 - 3.69 (m, 4H), 7.26 - 7.31 (m, 1H), 7.37 - 7.43
(m, 2H), 7.52 (d, 1H), 7.60 -
7.64 (m, 2H), 7.90 (dd, 1H), 7.93 (s, 1H), 8.25 (d, 1H), 9.48 (s, 1H), 12.68
(br s, 1H).
LC-MS (Method 4): Rt = 1.18 min; MS (ESIpos): m/z = 493 [M+1-1]+.
Example 144
N45-(2-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
H
,I\IN 0
N
H30 \r-NCH3
0
40 0
N
H
FO
F I
F
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(2-
methylpheny1)-
1,3,4-thiadiazol-2-amine (123 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
291

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night and was then concentrated. Purification by HPLC (Waters

Autopurificationsystem, column: XBrigde C18 Sum 100x30 mm, solvent: water /
methanol + 0.2%
ammonia (32%) gradient, rate: 70 mL/min, temperature: room temperature)
yielded 65.0 mg (34% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.23 (s, 3H), 2.53 (s, 3H), 2.55 -
2.67 (m, 5H), 3.23 (s, 2H),
7.31 - 7.47 (m, 3H), 7.63 (d, 1H), 7.70 (d, 1H), 8.01 (dd, 1H), 8.99 (d, 1H),
9.93 (s, 1H), 13.09 (s, 1H).
LC-MS (Method 3): Rt = 0.77 min; MS (ESIpos): m/z = 535 [m+H].
Example 145
N45-(3-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
H
,I\IN 0
N
\r= CH3
0 N
H3C 100
N
H
FO
F I
F
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(3-
methylphenyI)-
1,3,4-thiadiazol-2-amine (123 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night and was then concentrated. Purification by HPLC (Waters

Autopurificationsystem, column: XBrigde C18 Slim 100x30 mm, solvent: water /
methanol + 0.2%
ammonia (32%) gradient, rate: 70 mL/min, temperature: room temperature)
yielded 71.0 mg (41% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.26 (s, 3H), 2.40 (s, 3H), 2.57 -
2.69 (m, 5H), 3.24 (s, 2H),
7.33 (d, 1H), 7.42 (t, 1H), 7.63 (d, 1H), 7.71 - 7.84 (m, 2H), 8.01 (dd, 1H),
8.97 (d, 1H), 9.92 (s, 1H),
12.90 (s, 1H).
LC-MS (Method 3): Rt = 0.80 min; MS (ESIpos): m/z = 535 [m+H].
Example 146
N45-(3-methoxypheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
292

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N N
N'
0
\r-NCE13
H C 0
3 \ 4IN
H
FO
FI
F
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(3-
methoxypheny1)-
1,3,4-thiadiazol-2-amine (132 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night and was then poured into a mixture of water and ethanol
(9/1). The
precipitate was collected by filtration, washed with water and dried.
Purification by HPLC (Waters
Autopurificationsystem, column: XBrigde C18 Sum 100x30 mm, solvent: water /
methanol + 0.2%
ammonia (32%) gradient, rate: 70 mL/min, temperature: room temperature)
yielded 13.0 mg (7% of
theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.27 (s, 3H), 2.57 - 2.70 (m, 5H),
3.24 (s, 2H), 3.86 (s, 3H),
7.05 - 7.13 (m, 1H), 7.40 - 7.55 (m, 3H), 7.62 (d, 1H), 8.01 (dd, 1H), 8.97
(d, 1H), 9.92 (s, 1H), 12.86 (s,
1H).
LC-MS (Method 3): Rt = 0.76 min; MS (ESIpos): m/z = 551 [m+H].
Example 147
N45-(4-chloropheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
H
N N
N'
0
\......CH3
0 r'N
N
H
FO
Cl
FI
F
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(4-
chloropheny1)-
1,3,4-thiadiazol-2-amine (136 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
293

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
temperature over night. After filtration, purification by HPLC (method 5)
yielded 55.5 mg (31% of
theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.29 (s, 3H), 2.48 - 2.59 (m, 4H),
2.59 - 2.71 (m, 4H), 3.25 (s,
2H), 7.57 - 7.64 (m, 3H), 7.96 - 8.03 (m, 3H), 8.96 (d, 1H), 9.91 (s, 1H),
12.70 (s, 1H).
LC-MS (Method 3): Rt = 0.86 min; MS (ESIpos): m/z = 555 [M+H].
Example 148
N45-(2-chloropheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
Nçy 0
Cl
0
FO
I
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(2-
chloropheny1)-
1,3,4-thiadiazol-2-amine (136 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (1. method 5;
2. Waters
Autopurificationsystem, column: XBrigde C18 Slim 100x30 mm, solvent: water /
acetonitrile + 0.1%
formic acid gradient, rate: 70 mL/min, temperature: room temperature) provided
a solid, which was
triturated with ethanol, collected by filtration and dried. 31.2 mg (17% of
theory) of the title
compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.28 (s, 3H), 2.59 - 2.69 (m, 5H),
3.25 (s, 2H), 7.49 - 7.71 (m,
4H), 8.02 (dd, 1H), 8.08 - 8.17 (m, 1H), 8.97 (d, 1H), 9.92 (s, 1H), 12.85 (s,
1H).
LC-MS (Method 4): Rt = 1.04 min; MS (ESIpos): m/z = 555 [M+H].
Example 149
N45-(4-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
294

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N N
N'
0
\

. 10 .....-CH3
0 r'N
N
H
FO
F
F I
F
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(4-
fluoropheny1)-
1,3,4-thiadiazol-2-amine (125 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night and was then poured into a mixture of water and ethanol
(9/1). The
precipitate was collected by filtration, washed with water and dried. The
remaining material was
triturated with DMSO, collected by filtration, washed with water and dried.
38.0 mg (22% of theory)
of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.27 (s, 3H), 2.58 - 2.69 (m, 4H),
3.24 (s, 2H), 7.33 - 7.43 (m,
2H), 7.62 (dd, 1H), 7.98 - 8.07 (m, 3H), 8.97 (d, 1H), 9.91 (s, 1H), 12.83 (s,
1H).
LC-MS (Method 3): Rt = 0.77 min; MS (ESIpos): m/z = 539 [M+1-1]+.
Example 150
N45-(2-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
H
N N
N\ 0
'
F r-NCH3
0
. I.
N
H
FO
F I
F
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(2-
fluoropheny1)-
1,3,4-thiadiazol-2-amine (125 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night and was then poured into a mixture of water and ethanol
(9/1). The
precipitate was collected by filtration, washed with water and dried.
Purification by HPLC (1. method
295

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
5, 2. Waters Autopurificationsystem, column: XBrigde C18 Slim 100x30 mm,
solvent: water /
acetonitrile + 0.1% formic acid (99%) gradient, rate: 70 mL/min, temperature:
room temperature)
yielded 31.0 mg (18% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.27 (s, 3H), 2.57 - 2.69 (m, 5H),
3.24 (s, 2H), 7.35 - 7.52 (m,
2H), 7.54 - 7.68 (m, 2H), 8.02 (dd, 1H), 8.26 (td, 1H), 8.98 (d, 1H), 9.92 (s,
1H), 12.85 (s, 1H).
LC-MS (Method 4): Rt = 0.98 min; MS (ESIpos): m/z = 539 [m+H].
Example 151
N45-(3-chloropheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
H
N N
N'
0
\ S
Cl . 0 r= C H3
N
N
H
FO
F I
F
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(3-
chloropheny1)-
1,3,4-thiadiazol-2-amine (136 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night and was then poured into a mixture of water and ethanol
(1/1). The
precipitate was collected by filtration, washed with water and dried.
Purification by HPLC (method 5)
yielded 10.0 mg (6% of theory) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm] = 2.31 (s, 3H), 2.50 - 2.70 (m, 8H),
3.25 (s, 2H), 7.51 - 7.66 (m,
3H), 7.88 - 7.93 (m, 1H), 7.97 - 8.06 (m, 2H), 8.95 (d, 1H), 9.90 (s, 1H),
12.61 (s, 1H).
LC-MS (Method 3): Rt = 0.79 min; MS (ESIpos): m/z = 555 [m+H].
Example 152
N45-(3-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-methylpiperazin-1-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
296

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
,I\IN 0
N
\

F r= CH3
0 N
40
N
H
FO
F I
F
To a solution of the compound of intermediate 126 (150 mg, 0.32 mmol) and 5-(3-
fluoropheny1)-
1,3,4-thiadiazol-2-amine (125 mg, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was
added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (method 5)
provided a solid, which was
triturated with ethanol, collected by filtration and dried. 43.0 mg (25% of
theory) of the title
compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.31 (s, 3H), 2.50 - 2.71 (m, 8H),
3.25 (s, 2H), 7.33 - 7.39 (m,
1H), 7.55 - 7.64 (m, 2H), 7.77 - 7.82 (m, 2H), 8.02 (dd, 1H), 8.95 (d, 1H),
9.90 (s, 1H), 12.67 (s, 1H).
LC-MS (Method 3): Rt = 0.81 min; MS (ESIpos): m/z = 539 [M+1-1]+.
Example 153
N45-(3-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
H
N\
,NN 0
0 r'0
F 40 . i )-L.Nj
N
H
FO
F I
F
To a solution of the compound of intermediate 21 (220 mg, 0.57 mmol) and 5-(3-
fluoropheny1)-1,3,4-
thiadiazol-2-amine (200 mg, 1.02 mmol, 1.8 equiv) in DMF (2.5 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 592 mg, 1.14 mmol,
2 equiv) and
diisopropylethylamine (0.5 mL, 2.84 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night and was then poured into a mixture of ethanol and
water. The precipitate
was collected by filtration and dried. 161 mg (49% of theory) of the title
compound were obtained.
297

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.63 (m, 4H), 3.24 (s, 2H),
3.62 - 3.69 (m, 4H), 7.35 -
7.44 (m, 1H), 7.56 - 7.64 (m, 1H), 7.64 - 7.69 (m, 1H), 7.79 - 7.86 (m, 2H),
8.03 (dd, 1H), 8.95 (d, 1H),
9.94 (s, 1H), 13.47 (s, 1H).
LC-MS (Method 4): Rt = 1.16 min; MS (ESIpos): m/z = 526 [M+H].
Example 154
N45-(3-chloropheny1)-1,3,4-thiadiazol-2-y1]-3-[(morpholin-4-ylacetypamino]-4-
(trifluoromethoxy)benzamide
H
N N
N' 0
\ S
Cl 41 0 r'0
I. .Nj
N)-L
H
FO
F I
F
To a solution of the compound of intermediate 21 (220 mg, 0.57 mmol) and 5-(3-
chloropheny1)-1,3,4-
thiadiazol-2-amine (217 mg, 1.02 mmol, 1.8 equiv) in DMF (2.5 mL) was added
(benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 592 mg, 1.14 mmol,
2 equiv) and
diisopropylethylamine (0.5 mL, 2.84 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night and was then poured into a mixture of ethanol and
water. The precipitate
was collected by filtration and dried. The remaining material was purified by
HPLC (column:
chromatorex C18, mobile phase: acetonitrile/water + 0.1% formic acid gradient)
to yield 20.6 mg (6%
of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 3.24 (s, 2H), 3.62 - 3.69 (m, 4H),
7.53 - 7.66 (m, 3H), 7.87 -
7.95 (m, 1H), 7.99 - 8.06 (m, 2H), 8.95 (s, 1H), 9.91 (s, 1H), 13.45 (s, 1H).
LC-MS (Method 4): Rt = 1.24 min; MS (ESIpos): m/z = 542 [M+H].
Example 155
N'-(2-methoxyethyl)-2-{[(4-methylpiperazin-1-ypacetyl]aminol-N4-(5-pheny1-
1,3,4-thiadiazol-2-
yl)terephthalamide
298

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N,\NyN 0
S CH3
0 r'N
. I. )-L.Nj
N
H
FIN 0
H
0
H3C
To a solution of the compound of intermediate 127 (150 mg, 0.31 mmol) and 2-
methoxyethanamine
(54 uL, 0.62 mmol, 2 equiv) in DMF (2.0 mL) was added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 325 mg, 0.62 mmol,
2 equiv) and
diisopropylethylamine (0.27 mL, 1.56 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (method 2)
yielded 45.5 mg (26% of
theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.33 (s, 3H), 2.53 - 2.70 (m, 8H),
3.17 (s, 2H), 3.30 (s, 3H),
3.45 - 3.54 (m, 4H), 7.50 - 7.58 (m, 3H), 7.78 (d, 1H), 7.91 (dd, 1H), 7.95 -
8.00 (m, 2H), 8.87 (t, 1H),
9.17 (d, 1H), 11.66 (s, 1H).
LC-MS (Method 4): Rt = 0.84 min; MS (ESIpos): m/z = 538 [M+1-1]+.
Example 156
1\11--(2-methoxyethyl)-2-[(morpholin-4-ylacetypamino]-N4-(5-phenyl-1,3,4-
thiadiazol-2-
yl)terephthalamide
H
N,\NyN 0
S
I.)-Nj
0 r'0
40
N
H
HN 0
H
0
H3C
To a solution of the compound of intermediate 128 (150 mg, 0.33 mmol) and 2-
methoxyethanamine
(56 uL, 0.64 mmol, 2 equiv) in DMF (2.0 mL) was added (benzotriazol-1-
299

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 334 mg, 0.64 mmol,
2 equiv) and
diisopropylethylamine (0.28 mL, 1.60 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After filtration, purification by HPLC (method 2)
provided a solid, which was
triturated with ethanol, collected by filtration and dried. 9.2 mg (6% of
theory) of the title compound
were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.50 - 2.56 (m, 4H), 3.17 (s, 2H),
3.29 (s, 3H), 3.44 - 3.53 (m,
4H), 3.70 - 3.76 (m, 4H), 7.52 - 7.59 (m, 3H), 7.80 (d, 1H), 7.92 (dd, 1H),
7.96 - 8.02 (m, 2H), 8.88 - 8.93
(m, 1H), 9.18 (d, 1H), 11.77 (s, 1H), 13.35 (s, 1H).
LC-MS (Method 4): Rt = 0.91 min; MS (ESIpos): m/z = 525 [M+H].
Example 157
4-methyl-3-(0-(4-methylpiperazin-1-ypcyclopropyl]carbonyllamino)-N-(5-phenyl-
1,3,4-thiadiazol-2-
yl)benzamide hydrochloride (1:1)
H
N N
N 0 H-Cl
/
\ 0 )0.,cNoCH3
. N
H _______________________________________________
CH3
To a suspension of 213 mg (0.97 mmol) of the compound from intermediate 42 in
6 mL of
dichloromethane were added 0.51 mL of 1-chloro-N,N,2-trimethylprop-1-en-1-
amine (3.87 mmol, 4
equiv). The reaction mixture was stirred at room temperature for 2 h. The
resulting mixture was
concentrated under reduced pressure, was then triturated with dichloromethane
and was
concentrated under reduced pressure. The remaining material was provided in 6
mL of
dichloromethane and 0.24 mL of pyridine (2.90 mmol, 3 equiv) and 300 mg (0.97
mmol) of the
compound of intermediate 130 were added. The resulting suspension was stirred
at room
temperature for 3 days. The resulting mixture was concentrated under reduced
pressure, was then
triturated with a mixture of 5 mL of water and 5 mL of ethanol, and the
resulting mixture was stirred
for 30 minutes. After partial concentration, the suspension was allowed to
stand at room
temperature over night. The precipitate was removed by filtration and dried
under reduced pressure
to yield 152 mg (30% of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 1.13 - 1.23 (m, 4H), 2.36 (s, 3H),
2.64 - 2.82 (m, 5H), 2.91 -
3.02 (m, 2H), 3.14 - 3.28 (m, 2H), 7.47 (d, 1H), 7.53 - 7.59 (m, 3H), 7.91 -
8.03 (m, 3H), 8.33 (d, 1H),
9.76 (s, 1H), 10.39 (s, 1H), 13.13 (s, 1H).
LC-MS (Method 4): Rt = 0.87 min; MS (ESIpos): m/z = 477 [M-HCI+H].
300

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Example 158
3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenylpyridin-2-y1)-4-
(trifluoromethoxy)benzamide
H
N N 0
I
1:101 / 0 )uNr,.).,...cH3
N
H
FO
F I
F
To a solution of the compound of intermediate 126 (300 mg, 0.64 mmol) and 5-
phenylpyridin-2-
amine (218 mg, 1.28 mmol, 2 equiv) in DMF (2.0 mL) was added (benzotriazol-1-
yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 667 mg, 1.28 mmol,
2 equiv) and
diisopropylethylamine (0.56 mL, 3.21 mmol, 5 equiv). The resulting mixture was
stirred at room
temperature over night. After concentration, the remaining material was
triturated with water and
extracted with dichloromethane. The combined organic phases were dried over
sodium sulfate and
concentrated. Purification (1. MPLC: Biotage !solera; silica gel; hexane /
Et0Ac gradient; 2. HPLC:
column: chromatorex C18, 10um, 125x30mm, mobile phase: acetonitrile/water
gradient) yielded
83.0 mg (24% of theory) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.18 (s, 3H), 2.28 - 2.50 (m, 4H),
2.52 - 2.64 (m, 4H), 3.21 (s,
2H), 7.38 - 7.43 (m, 1H), 7.48 - 7.53 (m, 2H), 7.59 (dd, 1H), 7.73 - 7.77 (m,
2H), 7.90 (dd, 1H), 8.18 (dd,
1H), 8.28 (d, 1H), 8.72 - 8.74 (m, 1H), 8.89 (d, 1H), 9.92 (s, 1H), 11.08 (s,
1H).
LC-MS (Method 3): Rt = 1.33 min; MS (ESIpos): m/z = 514 [M+1-1]+.
Example 159
4-(cyclopropyloxy)-3-(0-(morpholin-4-ypcyclopropyl]carbonyllamino)-N-(5-phenyl-
1,3,4-thiadiazol-
2-yl)benzamide
H
N 0
NINY
\ S
0 )0.,cr0
J
41, N
H
0
V
301

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
100 mg (0.28 mmol) of 3-amino-4-(cyclopropyloxy)-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide
(intermediate 132) were dissolved in 1 mL of anh DMF and 0.15 mL (0.86 mmol)
of N-ethyl-N-
isopropylpropan-2-amine. 71 mg (0.34 mmol) of 1-(morpholin-4-
yl)cyclopropanecarboxylic acid
hydrochloride and 177 mg (0.34 mmol) of PYBOP were added. It was stirred
overnight at rt. The
precipitate was filtered off and washed with methanol. It was dried and 65 mg
(45%) of the title
compound was isolated.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 0.78 - 0.86 (m, 2H), 0.91 - 1.01 (m,
2H), 1.07 - 1.16 (m, 2H),
1.18 - 1.26 (m, 2H), 2.43 (br. s, 4H, partly DMSO signal), 3.71 (br. s, 4H),
4.11 - 4.20 (m, 1H), 7.45 -
7.59 (m, 4H), 7.92 - 8.02 (m, 3H), 8.99 - 9.04 (m, 1H), 10.48 (s, 1H), 13.07
(br. s, 1H).
LC-MS (method 3): Rt = 0.87 min; MS (ESIpos): m/z = 506 [M+H].
Example 160
3-{[(3,4-dimethylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-
y1)-4-
(trifluoromethoxy)benzamide
H
/N N 0
N .:--y'
\ s 0 0
i\r2)cH3
41, N
H CH3
FO
Fl
F
100 mg (0.21 mmol)
of 3-[(chloroacetypamino]-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide (intermediate 41) and 116.7 mg (0.62 mmol) of 1,2-
dimethylpiperazine
dihydrochloride were dissolved in 0.9 mL of anh DMF. 5.4 mg (0.033 mmol) of
potassium iodide and
0.054 mL (0.31 mmol) of N-ethyl-N-isopropylpropan-2-amine were added. It was
stirred at rt
overnight. The reaction mixture was poured into ten volumes of water. The
precipitate was filtered
off and washed three times with water. The solid material was purified by HPLC
(method 5) to give
23.7 mg (20%) of the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 1.00 (d, 3H), 2.07 - 2.17 (m, 1H), 2.18
- 2.38 (m, 5H), 2.39 -
2.46 (m, 1H), 2.74 - 2.88 (m, 3H), 3.19 - 3.23 (m, 2H), 7.47 - 7.58 (m, 3H),
7.58 - 7.64 (m, 1H), 7.91 -
8.04 (m, 3H), 8.96 (d, 1H), 9.89 (s, 1H), 12.66 - 13.03 (m, 1H).
LC-MS (method 3): Rt = 0.79 min; MS (ESIpos): m/z = 535 [M+H].
Example 161
302

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
3-({[(2R)-2,4-dimethylpiperazin-l-yl]acetyllamino)-N46-(2-fluorophenyl)pyridin-
3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
I
I. 0H3Cõ,,NCH3
F N
H
FO
Fl
F
75 mg (0.16 mmol) of 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (intermediate 14) were dissolved in 0.69 mL of anh
DMF. 4.1 mg (0.025
mmol) of potassium iodide, 0.112 mL (0.64 mmol) of N-ethyl-N-isopropylpropan-2-
amine and 45.0
5 mg (0.24 mmol) of (3R)-1,3-dimethylpiperazine dihydrochloride were added.
It was stirred at rt
overnight. 0.112 mL (0.64 mmol) of N-ethyl-N-isopropylpropan-2-amine were
added. It was stirred
for 2 h at rt. The reaction mixture was concentrated to dryness and purified
by HPLC (method 2) to
afford 20.2 mg (23%) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.01 (d, 3H), 1.82 - 2.04 (m, 1H), 2.10
- 2.39 (m, 3H), 2.59 -
10 2.93 (m, 4H, partly overlapping with the DMSO signal), 3.09 - 3.20 (m,
1H), 3.42 - 3.51 (m, 1H), 7.30 -
7.39 (m, 2H), 7.44 - 7.52 (m, 1H), 7.64 - 7.73 (m, 1H), 7.81 - 7.89 (m, 2H),
7.94 - 8.01 (m, 1H), 8.31 (dd,
1H), 8.81 - 8.92 (m, 1H), 9.04 - 9.09 (m, 1H), 10.08 (s, 1H), 10.75 (s, 1H).
LC-MS (method 4): Rt = 1.01 min; MS (ESIpos): m/z = 546 [M+H].
Example 162
3-({[(25)-2,4-dimethylpiperazin-1-yl]acetyllamino)-N-[6-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
I
0H3CNC H3
110 )-Nj
F N
H
FO
Fl
F
75 mg (0.16 mmol) of 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (intermediate 14) were dissolved in 0.69 mL of anh
DMF. 4.1 mg (0.025
303

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
mmol) of potassium iodide, 0.042 mL (0.24 mmol) of N-ethyl-N-isopropylpropan-2-
amine and 27.5
mg (0.24 mmol) of (35)-1,3-dimethylpiperazine were added. It was stirred at rt
overnight. The
volatiles were removed under vacuum. The residue was purified by HPLC (method
2) to afford 26.3
mg (30%) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.02 (d, 3H), 1.91 - 2.09 (m, 1H), 2.23
- 2.38 (m, 3H), 2.58 -
2.92 (m, 5H, partly overlapping with the DMSO signal), 3.12 - 3.22 (m, 1H),
3.44 - 3.51 (m, 1H), 7.31 -
7.38 (m, 2H), 7.45 - 7.51 (m, 1H), 7.65 - 7.70 (m, 1H), 7.82 - 7.89 (m, 2H),
7.94 - 8.00 (m, 1H), 8.31 (dd,
1H), 8.83 (br. s, 1H), 9.05 - 9.08 (m, 1H), 10.06 (s, 1H), 10.75 (s, 1H).
LC-MS (method 4): Rt = 1.01 min; MS (ESIpos): m/z = 546 [M+H].
Example 163
3-({[(35)-3,4-dimethylpiperazin-1-yl]acetyllamino)-N-[6-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
CH3
I
10 10 r'.. C H3 L N 3
F N
H
FO
Fl
F
75 mg (0.16 mmol)
of 3-[(chloroacetypamino]-N46-(2-fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (intermediate 14) were dissolved in 0.69 mL of anh
DMF. 4.1 mg (0.025
mmol) of potassium iodide, 0.042 mL (0.24 mmol) of N-ethyl-N-isopropylpropan-2-
amine and 27.5
mg (0.24 mmol) of (25)-1,2-dimethylpiperazine were added. It was stirred at rt
overnight. The
reaction mixture was concentrated to dryness under vacuum. The residue was
purified by HPLC
(method 2) yielding 34.5 mg (39%) of the title compound.
'H-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.01 - 1.12 (m, 3H), 2.09 - 2.45 (m, 5H,
partly overlapping
with the DMSO signal), 2.77 - 3.02 (m, 3H), 3.25 (br. s, 2H), 7.30 - 7.39 (m,
2H), 7.44 - 7.52 (m, 1H),
7.64 - 7.70 (m, 1H), 7.82 - 7.91 (m, 2H), 7.94 - 8.00 (m, 1H), 8.31 (dd, 1H),
8.75 - 8.81 (m, 1H), 9.07 (d,
1H), 9.91 (s, 1H), 10.75 (s, 1H).
LC-MS (method 4): Rt = 0.99 min; MS (ESIpos): m/z = 546 [M+H].
Example 164
304

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
3-({[(3R)-3,4-dimethylpiperazin-l-yl]acetyllamino)-N46-(2-fluorophenyl)pyridin-
3-y1]-4-
(trifluoromethoxy)benzamide
H
N 0
OH3
I
jua CE13
F N
H
FO
Fl
F
75 mg (0.16 mmol) of 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (intermediate 14) were dissolved in 0.69 mL of anh
DMF. 4.1 mg (0.025
mmol) of potassium iodide, 0.112 mL (0.64 mmol) of N-ethyl-N-isopropylpropan-2-
amine and 45.0
mg (0.24 mmol) of (2R)-1,2-dimethylpiperazine dihydrochloride were added. It
was stirred at rt
overnight. The reaction mixture was concentrated to dryness under vacuum. The
residue was
purified by HPLC (method 2) affording 31.2 mg (36%) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.08 (d, 3H), 2.16 - 2.30 (m, 1H), 2.39
(br. s, 3H), 2.80 - 2.92
(m, 2H), 2.92 - 3.06 (m, 1H), 3.26 (br. s, 2H), 7.30 - 7.38 (m, 2H), 7.44 -
7.52 (m, 1H), 7.63 - 7.69 (m,
1H), 7.82 - 7.91 (m, 2H), 7.97 (dt, 1H), 8.31 (dd, 1H), 8.76 (s, 1H), 9.07 (d,
1H), 9.90 (s, 1H), 10.75 (s,
1H).
LC-MS (method 4): Rt = 1.01 min; MS (ESIpos): m/z = 546 [M+1-1]+.
Example 165
3-{[(2,4-dimethylpiperazin-1-ypacetyl]aminol-N46-(2-fluorophenyppyridin-3-y1]-
4-
(trifluoromethoxy)benzamide
H
N 0
I
0E13CN CE13
110 )-Nj
F N
H
FO
Fl
F
305

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
75 mg (0.16 mmol) of 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (intermediate 14) were dissolved in 0.69 mL of anh
DMF. 4.1 mg (0.025
mmol) of potassium iodide, 0.042 mL (0.24 mmol) of N-ethyl-N-isopropylpropan-2-
amine and 27.5
mg (0.24 mmol) of 1,3-dimethylpiperazine were added. It was stirred at rt
overnight. The volatiles
were removed under vacuum. The residue was purified by HPLC (method 2) to
afford 25.7 mg (29%)
of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.03 (d, 3H), 1.96 - 2.18 (m, 1H), 2.33
(br. s, 3H), 2.61 - 2.79
(m, 2H, partly overlapping with the DMSO signal), 2.79 - 2.95 (m, 2H), 3.14 -
3.23 (m, 1H), 3.44 - 3.52
(m, 1H), 7.30 - 7.38 (m, 2H), 7.45 - 7.51 (m, 1H), 7.65 - 7.70 (m, 1H), 7.82 -
7.90 (m, 2H), 7.97 (dt, 1H),
8.31 (dd, 1H), 8.82 (br. s, 1H), 9.07 (d, 1H), 10.05 (s, 1H), 10.76 (s, 1H).
LC-MS (method 4): Rt = 1.01 min; MS (ESIpos): m/z = 546 [M+H].
Example 166
N46-(2-fluorophenyl)pyridin-3-y1]-3-{[(8-methyl-3,8-diazabicyclo[3.2.1]oct-3-
ypacetyl]amino}-4-
(trifluoromethoxy)benzamide
H
N 0
I
101 =F I. )u CH3
N
N
H
FO
Fl
F
75 mg (0.16 mmol) of 3-[(chloroacetypamino]-N46-(2-
fluorophenyl)pyridin-3-y1]-4-
(trifluoromethoxy)benzamide (intermediate 14) were dissolved in 0.69 mL of anh
DMF. 4.1 mg (0.025
mmol) of potassium iodide, 0.112 mL (0.64 mmol) of N-ethyl-N-isopropylpropan-2-
amine and 47.9
mg (0.24 mmol) of 8-methyl-3,8-diazabicyclo[3.2.1]octane dihydrochloride were
added. It was stirred
at rt overnight. The reaction mixture was concentrated to dryness and the
residue was purified by
HPLC (method 2) to yield 37.5 mg (42%) of the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): d [ppm]= 2.46 (s, 3H), 2.66 - 2.73 (m, 2H), 2.74
- 2.81 (m, 2H), 3.27 (s,
2H), 3.47 - 3.55 (m, 2H), 7.31 - 7.38 (m, 2H), 7.44 - 7.51 (m, 1H), 7.64 -
7.69 (m, 1H), 7.82 - 7.87 (m,
1H), 7.90 (dd, 1H), 7.94 - 8.00 (m, 1H), 8.32 (dd, 1H), 8.80 (d, 1H), 9.07 (d,
1H), 9.63 (s, 1H), 10.75 (s,
1H).
LC-MS (method 4): Rt = 1.01 min; MS (ESIpos): m/z = 558 [M+H].
Example 167
306

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
3-{[(2,4-dimethylpiperazin-l-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-
y1)-4-
(trifluoromethoxy)benzamide
H
NN 0
/ yN
\ S H3C..CH3
41, 0 N)UN j1
H
FO
Fl
F
75 mg (0.16 mmol) of 3-[(chloroacetypamino]-N-(5-
phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide (intermediate 41) were dissolved in 0.71 mL of anh
DMF. 4.2 mg (0.025
mmol) of potassium iodide, 0.043 mL (0.25 mmol) of N-ethyl-N-isopropylpropan-2-
amine and 28.1
mg (0.25 mmol) of 1,3-dimethylpiperazine were added. It was stirred at rt
overnight. The reaction
mixture was concentrated and purified by HPLC (method 2) to obtain 25.2 mg
(28%) of the title
compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.02 (d, 3H), 1.94 - 2.08 (m, 1H), 2.30
(s, 3H), 2.59 - 2.75 (m,
3H, partly overlapping with the DMSO signal), 2.76 - 2.93 (m, 3H), 3.14 - 3.21
(m, 1H), 3.44 - 3.51 (m,
1H), 7.52 - 7.60 (m, 3H), 7.63 - 7.69 (m, 1H), 7.95 - 8.05 (m, 3H), 8.97 -
9.00 (m, 1H), 10.06 (s, 1H),
12.47 - 13.11 (m, 1H).
LC-MS (method 3): Rt = 0.77 min; MS (ESIpos): m/z = 535 [M+H].
Example 168
3-{[(4-methyl-1,4-diazepan-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-
y1)-4-
(trifluoromethoxy)benzamide
H
NN 0
/ yN
\ S
10 N)Ui
N -CH3
4
\-r----i 11.
H
FO
Fl
F
100 mg (0.21 mmol) of 3-[(chloroacetypamino]-N-(5-
phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide (intermediate 41), 35.6 mg (0.31 mmol) of 1-methyl-
1,4-diazepane and
5.4 mg (0.032 mmol) of potassium iodide were dissolved in 0.9 mL of anh DMF.
0.054 mL (0.31
307

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
mmol) of N-ethyl-N-isopropylpropan-2-amine were added. It was stirred at rt
overnight. The crude
reaction mixture was purified by HPLC (method 5) obtaining 24 mg (21%) of the
title compound.
'H-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.84 - 1.92 (m, 2H), 2.53 (br. s, 3H,
partly overlapping with
the DMSO signal), 2.81 - 2.87 (m, 2H), 2.88 - 2.99 (m, 6H), 3.41 (s, 2H), 7.44
- 7.58 (m, 4H), 7.90 - 7.95
(m, 2H), 8.03 (dd, 1H), 8.86 (d, 1H), 9.82 (s, 1H).
LC-MS (method 4): Rt = 0.97 min; MS (ESIpos): m/z = 535 [M+H].
Example 169
3-[(1,4-oxazepan-4-ylacetypamino]-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
H
NN 0
/ yN
.\ S101-----\
4 ),U10
H
FO
Fl
F
100 mg (0.21 mmol) of 3-[(chloroacetypamino]-N-(5-phenyl-
1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide (intermediate 41), 42.9 mg (0.31 mmol) of 1,4-
oxazepane
hydrochloride and 5.4 mg (0.032 mmol) of potassium iodide were dissolved in
0.9 mL of anh DMF.
0.116 mL (0.67 mmol) of N-ethyl-N-isopropylpropan-2-amine were added. It was
stirred at rt
overnight. The crude reaction mixture was purified by HPLC (method 5) giving
45 mg (39%) of the
title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 1.85 - 1.93 (m, 2H), 2.79 - 2.86 (m,
4H), 3.40 (s, 2H), 3.65 -
3.70 (m, 2H), 3.75 (t, 2H), 7.52 - 7.60 (m, 3H), 7.63 - 7.68 (m, 1H), 8.03
(dd, 2H), 8.02 (dd, 1H), 8.97 (d,
1H), 9.97 (s, 1H), 13.30 - 13.57 (m, 1H).
LC-MS (method 3): Rt = 0.75 min; MS (ESIpos): m/z = 522 [M+H].
Example 170
4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenyl-1,3,4-
thiadiazol-2-
yl)benzamide
308

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
/N N 0
N -z-z---r
\ s
41, . LO
N
H
0
100 mg (0.28 mmol) of 3-amino-4-(cyclopropyloxy)-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide
(intermediate 132) were dissolved in 2 mL of anh DMF. 0.20 mL (1.14 mmol) of N-
ethyl-N-
isopropylpropan-2-amine, 74 mg (0.41 mmol) of morpholin-4-ylacetic acid
hydrochloride and 177 mg
(0.34 mmol) of PYBOP were added. It was stirred overnight at rt. The
precipitate was filtered off and
washed once with methanol. It was dried at 45 C under vacuum affording 17 mg
(12%) of the title
compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 0.73 - 0.98 (m, 4H), 2.52 - 2.58 (m,
4H), 3.16 (s, 2H), 3.61 -
3.71 (m, 4H), 4.08 - 4.17 (m, 1H), 7.44 - 7.59 (m, 4H), 7.93 - 8.04 (m, 3H),
8.94 (d, 1H), 9.71 (s, 1H),
12.98 - 13.23 (m, 1H).
LC-MS (method 3): Rt = 0.78 min; MS (ESIpos): m/z = 480 [M+H].
Example 171
4-(cyclopropyloxy)-3-(0-(4-methylpiperazin-1-ypcyclopropyl]carbonyllamino)-N-
(5-phenyl-1,3,4-
thiadiazol-2-yObenzamide
H
N 0
N'N-y/
\ s rNcH3
0
. le N)cNJ
H ______________________________________________
0
100 mg (0.28 mmol) of 3-amino-4-(cyclopropyloxy)-N-(5-phenyl-1,3,4-thiadiazol-
2-yl)benzamide
(intermediate 132) were dissolved in 2 mL of anh DMF. 0.099 mL (0.57 mmol) of
N-ethyl-N-
isopropylpropan-2-amine, 63 mg (0.28 mmol) of 1-(4-methylpiperazin-1-
yl)cyclopropanecarboxylic
acid hydrochloride and 177 mg (0.34 mmol) of PYBOP were added. It was stirred
overnight at rt. The
precipitate was filtered off and washed three times with water. The solid
material was purified by
HPLC (method 5) giving a solid material, which was triturated in DMF at 45 C
and then filtered off.
309

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The solid was triturated twice with ethyl acetate and dried under vacuum
yielding 31.8 mg (22%) of
the title compound.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 0.86 - 1.01 (m, 4H), 1.09 - 1.22 (m,
4H), 2.25 (s, 3H), 2.39 -
2.48 (m, 4H, partly overlapping with the DMSO signal), 4.13 - 4.19 (m, 1H),
7.47 - 7.59 (m, 4H), 7.94 -
8.01 (m, 3H), 9.05 (d, 1H), 10.48 (s, 1H).
LC-MS (method 3): Rt = 0.87 min; MS (ESIpos): m/z = 519 [M+H].
Example 172
3-{[(4-ethylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide
H
NN 0
/
N
\y S ....."......
411. 0 LNOI
N
H CH3
FO
Fl
F
To a suspension of 120 mg (0.26 mmol) of the compound from intermediate 41 in
1.5 mL of DMF
were added 0.07 mL of triethylamine (0.53 mmol, 2 equiv), 0.07 mL of 1-
ethylpiperazine (0.53 mmol,
2 equiv), and 9.0 mg of potassium iodide (0.05 mmol, 0.2 equiv). The reaction
mixture was stirred at
room temperature over night. After filtration, purification by HPLC (method 2)
provided a solid,
which was triturated with ethanol, collected by filtration and dried. 49.8 mg
(35% of theory) of the
title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 1.02 (t, 3H), 2.42 (m, 2H), 2.45 - 2.56
(m, 4H), 2.57 - 2.70 (m,
4H), 3.23 (s, 2H), 7.44 - 7.57 (m, 3H), 7.57 - 7.64 (m, 1H), 7.90 - 8.05 (m,
3H), 8.98 (d, 1H), 9.92 (s, 1H),
12.90 (s, 1H).
LC-MS (method 4): Rt = 1.01 min; MS (ESIpos): m/z = 535 [M+H].
Example 173
4-chloro-3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-
2-yObenzamide
310

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
NI/N.: N 0
1"
S ,CH,
LN
41,
CI
To a suspension of 310 mg (0.76 mmol) of the compound from intermediate 136 in
6 mL of DMF
were added 0.21 mL of triethylamine (1.52 mmol, 2 equiv), 0.17 mL of 1-
methylpiperazine (1.52
mmol, 2 equiv), and 25.0 mg of potassium iodide (0.15 mmol, 0.2 equiv). The
reaction mixture was
stirred at room temperature over night. After concentration, the remaining
solid was triturated with
a mixture of 15 mL of water and 10 mL of ethanol, stirred for 30 minutes,
collected by filtration and
dried. 244 mg (64% of theory) of the title compound were obtained.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 2.30 (s, 3H), 2.54 - 2.70 (m, 8H), 3.25
(s, 2H), 7.48 - 7.58 (m,
3H), 7.72 (d, 1H), 7.89 - 8.01 (m, 3H), 8.95 (d, 1H), 9.99 (s, 1H), 12.60 (s,
1H).
LC-MS (method 4): Rt = 0.85 min; MS (ESIpos): m/z = 471 [M+H].
Example 174
4-cyano-3-{[(4-methylpiperazin-1-ypacetyl]aminol-N-(5-phenyl-1,3,4-thiadiazol-
2-yObenzamide
N 0
S Lc.)CH3
=
To a suspension of 120 mg (0.30 mmol) of the compound from intermediate 140 in
3 mL of DMF
were added 0.08 mL of triethylamine (0.60 mmol, 2 equiv), 0.07 mL of 1-
methylpiperazine (0.60
mmol, 2 equiv), and 10.0 mg of potassium iodide (0.06 mmol, 0.2 equiv). The
reaction mixture was
stirred at room temperature over night. After concentration, the remaining
solid was triturated with
a mixture of 15 mL of water and 10 mL of ethanol, stirred for 30 minutes,
collected by filtration and
dried. 61.0 mg (42% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.40 (s, 3H), 2.65 - 2.80 (m, 8H), 3.29
(s, 2H), 7.48 - 7.56 (m,
3H), 7.92 - 7.98 (m, 3H), 8.01 - 8.05 (m, 1H), 8.67 - 8.73 (m, 1H), 10.22 (s,
1H).
LC-MS (method 4): Rt = 0.89 min; MS (ESIpos): m/z = 462 [M+H].
311

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Example 175
4-(difluoromethoxy)-N45-(2-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-
methylpiperazin-1-
ypacetyl]aminolbenzamide
H
N
N/N:----y' 0
\ s
H3C L .,...CH3
41, (00 NON
N
H
FO
I
F
To a suspension of 116 mg (0.24 mmol) of the compound of intermediate 143 in 2
mL of DMF were
added 0.07 mL of triethylamine (0.49 mmol, 2 equiv), 0.05 mL of 1-
methylpiperazine (0.49 mmol, 2
equiv), and 8.1 mg of potassium iodide (0.05 mmol, 0.2 equiv). The reaction
mixture was stirred at
room temperature for 4 h. 3 mL of water and 3 mL of ethanol were added and the
mixture was
stirred for 10 minutes. The precipitate was collected by filtration, washed
with water and dried. The
remaining solid was triturated with 10 mL of ethanol, stirred for 30 minutes
at 75 C, collected by
filtration at 55 C and dried. Purification by HPLC (column: chromatorex C18,
10um, 195x51mm,
mobile phase: acetonitrile/water gradient) yielded 18.5 mg (14% of theory) of
the title compound.
1-1-1-NMR (300 MHz, DMSO-d6): 6 [ppm]= 2.23 (s, 3H), 2.43 - 2.54 (m, 4H), 2.53
(s, 3H), 2.55 - 2.68 (m,
4H), 3.21 (s, 2H), 7.33 - 7.47 (m, 4H), 7.46 (t, 1H), 7.67 - 7.74 (m, 1H),
7.99 (dd, 1H), 9.01 (d, 1H), 9.91
(s, 1H), 13.06 (s, 1H).
LC-MS (method 3): Rt = 0.77 min; MS (ESIpos): m/z = 517 [M+H].
Example 176
4-(methoxymethyl)-N45-(2-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-[(morpholin-4-
ylacetyl)amino] benzamide
312

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
N N 0
1\1 /Y
\
H3C S
41, 110 LNO
N
H
0
I
CH3
To a suspension of 180 mg (0.42 mmol) of the compound of intermediate 146 in 4
mL of DMF were
added 0.12 mL of triethylamine (0.84 mmol, 2 equiv), 0.07 mL of morpholine
(0.84 mmol, 2 equiv),
and 14.0 mg of potassium iodide (0.08 mmol, 0.2 equiv). The reaction mixture
was stirred at room
temperature over night. After concentration, the remaining solid was
triturated with 15 mL of water
and 10 mL of ethanol, stirred for 30 minutes, collected by filtration and
dried. The remaining solid
was triturated with 10 mL of ethanol and stirred under reflux, collected by
filtration and dried. 137
mg (65% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.54 (s, 3H), 2.55 - 2.60 (m, 4H), 3.19
(s, 2H), 3.38 (s, 3H),
3.64 - 3.72 (m, 4H), 4.58 (s, 2H), 7.33 - 7.47 (m, 3H), 7.53 (d, 1H), 7.71 (d,
1H), 7.87 - 7.93 (m, 1H),
8.79 (s, 1H), 10.01 (s, 1H), 13.23 (s, 1H).
LC-MS (method 4): Rt = 1.03 min; MS (ESIpos): m/z = 482 [M+H].
Example 177
4-(methoxymethyl)-N45-(2-methylpheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-
methylpiperazin-1-
ypacetyl]aminolbenzamide hydrochloride (1:1)
H
/N-: N 0
N --z-ir
H3C
411. . LO
N
H
0
I H-Cl
CH3
To a suspension of 180 mg (0.42 mmol) of the compound of intermediate 146 in 4
mL of DMF were
added 0.12 mL of triethylamine (0.84 mmol, 2 equiv), 0.09 mL of 1-
methylpiperazine (0.84 mmol, 2
equiv), and 14.0 mg of potassium iodide (0.08 mmol, 0.2 equiv). The reaction
mixture was stirred at
room temperature over night. After concentration, the remaining solid was
triturated with 15 mL of
water and 10 mL of ethanol, stirred for 30 minutes, collected by filtration
and dried. The remaining
313

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
solid was triturated with 10 mL of ethanol and stirred under reflux, collected
by filtration and dried.
78 mg (34% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm]= 2.54 (s, 3H), 2.65 - 2.95 (m, 4H), 2.75
(s, 3H), 3.03 - 3.27 (m,
4H), 3.36 (s, 3H), 4.59 (s, 2H), 7.33 - 7.49 (m, 4H), 7.55 (d, 1H), 7.71 (d,
1H), 7.95 (dd, 1H), 8.66 (s, 1H),
9.88 (s, 1H).
LC-MS (method 4): Rt = 0.95 min; MS (ESIpos): m/z = 495 [M+H¨HCl].
314

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The following examples were prepared in analogy to the described methods,
supra.
Table 1
Rt
Example
Structure IUPAC Name [min]
No
method
0-----c N-[6-(3,5-
N difluorophenyl)pyridin-3-yI]-3-
)¨CH3
0 f[2-(8-oxa-3- 1.31
178
NH azabicyclo[3.2.1]oct-3- 7
F _ 0 *
0 yppropanoyl]amino}-4-
IF \N / ri VF
F F (trifluoromethoxy)benzamide
F
/CH3
H3C-N 3-({[1-
0).<1 (dimethylamino)cyclopropyl]car
NH 1.29
179 bonyllamino)-N-[6-(2-
. N_ 4104
0 fluor hen I ridin-3- 1]-4-
0
P Y )PY Y 7
F F (trifluoromethoxy)benzamide
F
(07\
\41/ N-[6-(3,5-
)
¨CH3
difluorophenyl)pyridin-3-yI]-3-
0.87
180 NH
F azabicyclo[2.2.1]hept-5- 7
0 *
0 l yl]propanoyllamino)-4-
i \ / VF
N F F (trifluoromethoxy)benzamide
F
107\
N-[6-(3,5-
)¨CH3 difluorophenyl)pyridin-3-yI]-3-
0
NH ,45)-2-oxa-5- 0.88
181
F azabicyclo[2.2.1]hept-5- 7
0 m
0
11/ \/ N \WI )\¨F yl]propanoyllamino)-4-
N H F F
F (trifluoromethoxy)benzamide
315

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
/0¨

\¨N
)¨CH3 N-[6-(3-fluorophenyl)pyridin-3-
0
NH yI]-3-{[2-(morpholin-4- LOU
182
0 . yppropanoyl]amino}-4- 7
0
410' \ / h' VF (trifluoromethoxy)benzamide
N F F
F
/0¨

\¨N
)¨CH3 N-[6-(3-fluorophenyl)pyridin-3-
0
NH yI]-3-{[2-(morpholin-4- LOU
183
0 . yppropanoyl]amino}-4- 7
0
410' \ / h' VF (trifluoromethoxy)benzamide
N F F
F
0¨\
d
eN 6-(3,5-difluorophenyI)-N-[3-
{[(15,45)-2-oxa-5-
0
NH azabicyclo[2.2.1]hept-5- 0.88
184
F H ylacetyl]amino}-4-
7
N = 0
)7F (trifluoromethoxy)phenyl]nicoti
F namide
a6-(3,5-difluorophenyI)-N-[3-
)--CH3

0\
NH azabicyclo[2.2.1]hept-5- 0.87
185 0
F . * N\ I ro ano I amino -4-
(:)c... Y )10 P Y 1 ) 7 /
-- N
H F FF (trifluoromethoxy)phenyl]nicoti
F namide
316

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
CD
N 6-(3,5-difluorophenyI)-N-[3-{[2-
)¨CH3
(8-oxa-3-azabicyclo[3.2.1]oct-3-
CD\ 1.31
186 NH yppropanoyl]amino}-4-
0 7
N \
4. 0
)%---F
F .
(trifluoromethoxy)phenyl]nicoti
..-- N
H F F namide
F
0---
C--N 6-(3,5-difluorophenyI)-N-[3-{[2-
0\ (morpholin-4-
NH 1.07
187 0 yppropanoyl]amino}-4-
o)c....F (trifluoromethoxy)phenyl]nicoti 7
_¨ N
H F F namide
F
CD
N 6-(3-fluorophenyI)-N-[3-{[2-(8-
)¨CH3 oxa-3-azabicyclo[3.2.1]oct-3-
1.26
188 0\ yppropanoyl]amino}-4-
NH 7
F = N \ 0
(trifluoromethoxy)phenyl]nicoti
1
_¨ N
. 0
)\--F
namide
H F F
0*---
C--N 6-(3-fluorophenyI)-N-[3-{[2-
)¨CH3
(morpholin-4-
0d1 1.01
189 NH yppropanoyl]amino}-4-
F N \ 0 7
. /
_¨ N
. 0
')Fc-F
F F
(trifluoromethoxy)phenyl]nicoti
H
namide
317

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
CH3
p-
\--
6-(3-fluorophenyI)-N-[3-{[2-
N
)--
(morpholin-4-
0\ 1.01
190 NH yppropanoyl]amino}-4-
F N \ 0 7
. /
.--
H . 0
)c-F
F F
(trifluoromethoxy)phenyl]nicoti
N
namide
0
( )
N 0 3-[(morpholin-4-
\
191 L.r0 )....z... ,N
HN N ylacetyl)amino]-N-(5-phenyl- 0.80
HN 0 0 1,3,4-oxadiazol-2-y1)-4- 7
(trifluoromethoxy)benzamide
0
FkF
F
0¨)
).-CH3 N-[6-(3-fluorophenyl)pyridin-3-
0\ y1]-3-({2-[(15,45)-2-oxa-5-
NH 0.83
192 N e H azabicyclo[2.2.1]hept-5-
41#
..--
0 7
\ /
')-FN 0 s-F
F F yl]propanoyllamino)-4-
(trifluoromethoxy)benzamide
F
a6-(3-fluoropheny1)-N-[3-({(2R1-
)-CH3 2-[(15,45)-2-oxa-5-
0\ azabicyclo[2.2.1]hept-5- 0.84
193 NH
F N \ 0 yl]propanoyllamino)-4- 7
. /
..-- N . )c--F
(trifluoromethoxy)phenyl]nicoti
H F F
namide
318

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
0
L=6
N N-[6-(3,5-
)¨CH3 difluorophenyl)pyridin-3-yI]-3-
CD\ {[2-(8-oxa-3- 1.31
194 NH
F -- H
, N 0 )c¨ azabicyclo[3.2.1]oct-3- 7
. \ / . F yppropanoyl]amino}-4-
N 0 F F
(trifluoromethoxy)benzamide
F
/0¨

\¨N
N-[6-(4-hydroxyphenyl)pyridin-
-CH3
0 3-yI]-3-{[2-(morpholin-4- 0.73
195 NH
yppropanoyl]amino}-4- 7
0
: * )7F (trifluoromethoxy)benzamide
A
Q3-{[2-(4-cyclopropylpiperazin-1-
).¨CH3
yppropanoyl]aminol-N46-(2- 0.86
196 1:)\
NH fluorophenyl)pyridin-3-yI]-4- 7
F
N \ EN1 .
0 (trifluoromethoxy)benzamide
.
..-- )c¨F
0 F F
H3c.
QN-[6-(2-fluorophenyl)pyridin-3-
yI]-3-{[(4-methylpiperazin-1- 0.78
197 1)
NH ypacetyl]amino}-4- 7
F
0 (trifluoromethoxy)benzamide
.
..-- )c-F
0 F F
319

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
0
oN 6-(3,5-difluorophenyI)-N-[3-({2-
)¨CH3 [(15,45)-2-oxa-5-
0
NH azabicyclo[2.2.1]hept-5- 0.87
198
F H yl]propanoyllamino)-4- 7
N * 0
''p \
)7F (trifluoromethoxy)phenyl]nicoti
¨ 0 F F
F namide
0¨\
6-(3-fluorophenyI)-N-[3-({2-
iti\ist/
)¨CH3 [(15,45)-2-oxa-5-
0 azabicyclo[2.2.1]hept-5- 0.83
199 NH
F H yl]propanoyllamino)-4- 7
. P \ N = 0)7F (trifluoromethoxy)phenyl]nicoti
¨ 0 F F namide
0
'--6 6-(3-fluorophenyI)-N-[3-{[2-(8-
N
)¨CH3 oxa-3-azabicyclo[3.2.1]oct-3-
0 1.26
200 yppropanoyl]amino}-4-
NH 7
F H (trifluoromethoxy)phenyl]nicoti
. 1 N1\1 \
410
)7F namide
¨ 0 F F
0 6-(3-fluorophenyI)-N-[3-{[2-
)¨CH3
(morpholin-4-
0 1.01
201 NH yppropanoyl]amino}-4-
F
H41 0 (trifluoromethoxy)phenyl]nicoti 7
ik IN \
\¨F namide
¨ 0 F F
320

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
0
N 6-(3,5-difluorophenyI)-N-[3-{[2-
-CH3 (8-oxa-3-azabicyclo[3.2.1]oct-3-
0 1.31
202 NH yppropanoyl]amino}-4-
F H (trifluoromethoxy)phenyl]nicoti 7
4. 1 N1\1 \
.0
)7F namide
¨ 0 F F
F
0 6-(3,5-difluorophenyI)-N-[3-{[2-
¨CH3
0 (morpholin-4-
1.07
NH
203 yppropanoyl]amino}-4-
F
I- 7
1\1 41 0 (trifluoromethoxy)phenyl]nicoti IN \
\¨F
¨ 0 F F namide
F
0
6-(2-fluorophenyI)-N-[3-{[2-(8-
N
)¨CH3
oxa-3-azabicyclo[3.2.1]oct-3-
0 1.23
204 NH yppropanoyl]amino}-4-
0 7
N \
= 0 (trifluoromethoxy)phenyl]nicoti
4lit / '
N )\---F
-- namide
H F F
F
0 6-(2-fluorophenyI)-N-[3-{[2-(8-
N
)¨CH3 oxa-3-azabicyclo[3.2.1]oct-3-
1.23
205 CD\ yppropanoyl]amino}-4-
NH 7
0 (trifluoromethoxy)phenyl]nicoti
N \
4lit * 0
N )\--F namide
--
H F F
F
321

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
p¨)
6-(2-fluorophenyI)-N-[3-{[2-
\--N
¨CH3
(morpholin-4-
0\ 0.98
206 NH
yppropanoyl]amino}-4-
0 7
N \ 44k 0 (trifluoromethoxy)phenyl]nicoti
411
4i / _`
N )\---F
H F F namide
F
?¨)
\--N
)---CH3 N-[6-(2-fluorophenyl)pyridin-3-
207 0\
NH yI]-3-{[2-
(morpholin-4- 0.95
F
4
N \ ri = F yppropanoyl]amino}-4- 7 41,
F (trifluoromethyl)benzamide
_---
0
F
?¨)
\_N
)_cH3 3-{[2-(morpholin-4-
0\ yppropanoyl]aminol-N-(6- 0.93
208 NH
N r
phenylpyridin-3-yI)-4- 7
\ i 0
O . )\--F (trifluoromethoxy)benzamide
_---
0 F F
i0¨
\-1\1
)¨CH3 3-{[2-(morpholin-4-
0 yppropanoyl]aminol-N-(6- 0.93
209 NH
phenylpyridin-3-yI)-4- 7
0 .
0)7F (trifluoromethoxy)benzamide
F F
322

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
H3c,
0 N-[6-(2-fluorophenyl)pyridin-3-
210 0 yI]-3-{[(4-methylpiperazin-1-
0.76
NH ypacetyl]amino}-4- 7
N
410, / \ 0 . FF
N F (trifluoromethyl)benzamide
¨ H
F
10¨
\-1\1
CH3 N-[6-(2-fluorophenyl)pyridin-3-
0
NH yI]-3-{[2-(morpholin-4- 0.95
211
N
41 / \ 0 * FF
F
N yppropanoyl]amino}-4-
7
(trifluoromethyl)benzamide
¨ H
F
0
6-(2-fluorophenyI)-N-[3-{[2-(8-
N
)¨CH3 oxa-3-azabicyclo[3.2.1]oct-3-
0 1.23
212 yppropanoyl]amino}-4-
NH 7
Fn . H (trifluoromethoxy)phenyl]nicoti
. 1;1 \ N
41 0
)7F namide
¨ 0 F F 0 6-(2-fluorophenyI)-N-[3-{[2-

)¨CH3
(morpholin-4-
0 0.98
213 NH yppropanoyl]amino}-4-
F. 7
I-
1\1 1\1 0
(trifluoromethoxy)phenyl]nicoti
'' /
namide
¨\ \¨F
0 F F
323

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
OTh.
41-f!'N-ssNs N-[6-(3,5-
difluorophenyl)pyridin-3-yI]-3-
0
NH {[(15,45)-2-oxa-5- 0.88
214
F ..-- H
, N .
N I 0 0 azabicyclo[2.2.1]hept-5- 7
fk \ )µ--F
F F ylacetyl]amino}-4-
F (trifluoromethoxy)benzamide
C',1-----c
N-[6-(3,5-
N
¨CH3 )
difluorophenyl)pyridin-3-yI]-3-
0 {[2-(8-oxa-3- 1.31
215 NH
F 0 sm azabicyclo[3.2.1]oct-3- 7
0 yppropanoyl]amino}-4-
* \ / N
N H F F (trifluoromethoxy)benzamide
F
0
'--6N 6-(3,5-difluorophenyI)-N-{3-[(8-
oxa-3-azabicyclo[3.2.1]oct-3-
0 1.27
216 NH ylacetyl)amino]-4-
7
F H
(trifluoromethoxy)phenyllnicoti
'I, N
41 0
)7F namide
¨ 0 F F
F
N 6-(3,5-difluorophenyI)-N-[3-
0\ azabicyclo[2.2.1]hept-5- 0.88
217 NH
F N \ 0 yl]propanoyllamino)-4- 7
. /
N * o)c....F (trifluoromethoxy)phenyl]nicoti
--
H F F namide
F
324

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
0
N 6-(3,5-difluorophenyI)-N-[3-{[2-
)¨CH3
(8-oxa-3-azabicyclo[3.2.1]oct-3-
CD\ 1.31
218 NH yppropanoyl]amino}-4-
0 7
F N \
4. 0
)%---F (trifluoromethoxy)phenyl]nicoti
..-- N
H F F namide
F
C )¨ 6-(3,5-difluorophenyI)-N-[3-{[2-
CH3
O (morpholin-4-
1.07
NH
219 yppropanoyl]amino}-4-
F 7
N I-1\1 00 0 (trifluoromethoxy)phenyl]nicoti
''\
VF
¨ 0 F F namide
F
0
N 6-(3-fluorophenyI)-N-[3-{[2-(8-
)¨CH3 oxa-3-azabicyclo[3.2.1]oct-3-
1.26
220 0\ yppropanoyl]amino}-4-
NH 7
F N \ 0 (trifluoromethoxy)phenyl]nicoti
/
_¨ N
. *0
)\--F
namide
H F F
\--N
?'"'
)¨CH3
difluorophenyl)pyridin-3-yI]-3-
Od\ 1.08
221 NH {[2-(morpholin-4-
7
F -- H
1i N . 0\¨F yppropanoyl]amino}-4-
fk \N 0 F F (trifluoromethoxy)benzamide
F
325

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
a
).¨ CH 2-[(15,45)-2-oxa-5-
C)\ azabicyclo[2.2.1]hept-5- 0.83
222 NH
F N \ 0 yl]propanoyllamino)-4- 7
. /
..-- N . )c--F (trifluoromethoxy)phenyl]nicoti
H F F
namide
0---)
i-f!µ-ssNs N-[6-(3,5-
difluorophenyl)pyridin-3-yI]-3-
0\
NH ({2-[(15,45)-2-oxa-5- 0.87
223
F -- H
, N . 0 azabicyclo[2.2.1]hept-5- 7
fk \N 1 0 )\--F
F F yl]propanoyllamino)-4-
F (trifluoromethoxy)benzamide
p-)
\--
CH3
6-(2-fluorophenyI)-N-[3-{[2-
N

(morpholin-4-
0\ 0.98
224 NH yppropanoyl]amino}-4-
0 7
N
411i 0
)\--F trifluoromethox hen I
( Y)P nicoti Y ]
4411i \ / '
H F F namide
F
n
\____N
)__cH3 N-[6-(2-fluorophenyl)pyridin-3-
0\
N H yI]-3-{[2-(morpholin-4- 0.95
225
F
N \ kli ilk F yppropanoyl]amino}-4- 7
441,
..--
0 F (trifluoromethyl)benzamide
F
326

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
0
N-[6-(2-fluorophenyl)pyridin-3-
N
yI]-3-[(8-oxa-3-
1.13
0
226 azabicyclo[3.2.1]oct-3-
NH 7
0 F ylacetyl)amino]-4-
410
N 0 / \ ''N FF (trifluoromethyl)benzamide
¨ H
F
<\
\-1\1 3-{[(4-cyclopropylpiperazin-1-
C:1 ypacetyl]aminol-N-[6-(2- 0.81
227
NH fluorophenyl)pyridin-3-yI]-4- 7
0 410 . FF
N (trifluoromethyl)benzamide
¨ H
F
i0¨
\¨N
3-[methyl(morpholin-4-
CD ylacetyl)amino]-N-(6- 0.78
228 N-CH3
0 mi phenylpyridin-3-yI)-4- 7
0 N 0 (trifluoromethoxy)benzamide
¨)¨N i\WI \¨F
10¨

\¨N 6-(4-fluorophenyI)-N-{4-
methoxy-3-[(morpholin-4- 0.77
229 0
NH ylacetypamino]phenyllnicotina 7
F-{)__()
H
0
N . ,CH3 mide
(
0
327

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
0
11-0
Q.
CH3 H cH3
rN-rN 3-{[2-(4-methylpiperazin-1-
,N) 0 1101 yppropanoyl]amino}-4-
H3C
[(methylsulfonyl)methyI]-N-(5- 0.70
230 0 NH
0 ,L phenyl-1,3,4-thiadiazol-2- 7
N' s
F yl)benzamide trifluoroacetate
F.>OH N¨

(1:1 )
F
.
H3QN
0
N 3-{[2-(4-methylpiperazin-1-
)---CH3
0 yppropanoyl]amino}-4-
0.70
231 NH [(methylsulfonyl)methyI]-N-(5-
0 7
N¨N phenyl-1,3,4-thiadiazol-2-
I ,---N 41
0 S H Sz0 H3 yl)benzamide
C 0
/ 0
H3QN
0
N 3-{[2-(4-methylpiperazin-1-
)---CH3
0 yppropanoyl]amino}-4-
0.70
232 NH [(methylsulfonyl)methyI]-N-(5-
0 7
N¨N phenyl-1,3,4-thiadiazol-2-
I ,---N 41
0 S H S;=0 yl)benzamide
H3C/ 0
328

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
F F
F
INI¨

N-[6-(2-fluorophenyl)pyridin-3-
\¨N
1.11
233 0 trifluoroethyl)piperazin-1-
NH 7
yl]acetyllamino)-4-
N 0 * 0 / \ N VF (trifluoromethoxy)benzamide
F
F
)e
CH3 H 0 F
rN-rN 0
NJ 0 3-{[2-(4-cyclopropylpiperazin-1-
V yppropanoyl]aminol-N-(5- 0.87
234 0 NH
phenyl-1,3,4-thiadiazol-2-y1)-4- 7
N'S
\ (trifluoromethoxy)benzamide


=
0
..-0
H
rN-rN S:CH3
Oj 0 0 4-
[(methylsulfonyl)methyI]-3-
[(morpholin-4-ylacetyl)amino]- 0.71
235
0 NH N-(5-phenyl-
1,3,4-thiadiazol-2- 7
NLS yl)benzamide
\
N-
=
329

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
H3C,N
0
N
N-[6-(2-fluorophenyl)pyridin-3-
CD)<1 yI]-3-({[1-(4-methylpiperazin-1- 0.84
236 NH
0 . ypcyclopropyl]carbonyllamino)- 7
=
F \/
())7F 4-(trifluoromethoxy)benzamide h'
N F F
ID¨

\¨N
4-(difluoromethoxy)-N-[6-(2-
0
NH fluorophenyl)pyridin-3-yI]-3- 0.86
237
0* [(morpholin-4- 7
N_
0
= \ / il )¨F
F ylacetyl)amino]benzamide
F
\N / 4-(cyclopropyloxy)-N-[6-(2-
0 fluorophenyl)pyridin-3-yI]-3-
1.01
238 NH
F H [(pyridin-2- 7
/ \ N 4ilt 0
ylacetyl)amino]benzamide
ilk N ¨ 0
330

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
FTF
0 1101 0
NH
4-(difluoromethoxy)-3-
[(morpholin-4-ylacetyl)amino]- 0.87
239 NNH
C)j N\N-(5-phenyl-1,3,4-thiadiazol-2- 7
. 1
S N yl)benzamide
. Cn)
¨
0
(4
3-[(8-oxa-3-
HNµc31 azabicyclo[3.2.1]oct-3-
F \õ....0
240 F-1 0 ylacetyl)amino]-N-(5-phenyl-
F
1,3,4-thiadiazol-2-y1)-4-
0
(trifluoromethoxy)benzamide
II i 41
N-N
F
)F
CH3H 0 F
rN)rN
0 3-{[2-(morpholin-4-
0) 0
yppropanoyl]aminol-N-(5- 0.98
241
0 NH phenyl-1,3,4-
thiadiazol-2-y1)-4- 7
/L S 'N
(trifluoromethoxy)benzamide
/
¨N
*
331

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
F
)F
OH3 H F
rN),N
0) 0 0 3-{[2-(morpholin-4-
yppropanoyl]aminol-N-(5- 0.98
242
0 NH phenyl-1,3,4-thiadiazol-2-y1)-4- 7
/
S 'N (trifluoromethoxy)benzamide
/
-IV
*
107\
N-[6-(3-fluorophenyl)pyridin-3-
)¨CH3

0 0.83
243 NH azabicyclo[2.2.1]hept-5-
F 7
0 .
0 yl]propanoyllamino)-4-
. \ / hl F\¨F (trifluoromethoxy)benzamide
N F
107\
N-[6-(3-fluorophenyl)pyridin-3-
)¨CH3
0 0.83
244 NH azabicyclo[2.2.1]hept-5-
F 7
0 .
0 yl]propanoyllamino)-4-
. \ / hl F\¨F (trifluoromethoxy)benzamide
N F
332

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
10¨
\-1\1 N-[6-(3,5-
)¨CH3
0 difluorophenyl)pyridin-3-yI]-3-
1.08
NH
245 {[2-(morpholin-4-
F 0 7
0 4 yppropanoyl]amino}-4-
N F F
H (trifluoromethoxy)benzamide
F
10¨
\-1\1 )¨ N-[6-(3,5-
CH3
0 difluorophenyl)pyridin-3-yI]-3-
1.08
NH
246 {[2-(morpholin-4-
F 0 7
0 4 yppropanoyl]amino}-4-
N F F
H (trifluoromethoxy)benzamide
F
0-----c
N-[6-(3-fluorophenyl)pyridin-3-
N
)¨CH3 yI]-3-{[2-(8-oxa-3-
0 1.24
247 azabicyclo[3.2.1]oct-3-
NH 7
Fyppropanoyl]amino}-4-
0
* \/ 171 11 VF (trifluoromethoxy)benzamide
N H F F
0-----c N-[6-(3-fluorophenyl)pyridin-3-

N yI]-3-{[2-(8-oxa-3-
CH3 1.24
248 0 azabicyclo[3.2.1]oct-3-
7
NH yppropanoyl]amino}-4-
F 0
0 (trifluoromethoxy)benzamide
*
N H F F
333

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
<\
\-1\1 3-{[2-(4-cyclopropylpiperazin-1-
)¨CH3
yppropanoyl]aminol-N46-(2- 0.86
0
249
NH fluorophenyl)pyridin-3-yI]-4- 7
0
F lik 0
VF (trifluoromethoxy)benzamide
<\
11¨
\¨N
3-{[2-(4-cyclopropylpiperazin-1-
)¨CH3 yppropanoyl]aminol-N46-(2-
250 0
NH fluorophenyl)pyridin-3-yI]-4-
N
. / \ 0 . 0
N VF (trifluoromethoxy)benzamide
¨ H F F
F
,CH3
H3C-N N-[6-(3,5-
0)<1 difluorophenyl)pyridin-3-yI]-3-
NH (0- 1.41
251 F 0 =
0 (dimethylamino)cyclopropyl]car 7
. \ / N H F F \¨F bonyllamino)-4-
N
F (trifluoromethoxy)benzamide
334

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
0
Ilk
C )
N N-{3-[(morpholin-4-
y S \ ylacetyl)amino]-4-
1.01
252 (trifluoromethoxy)pheny11-2-
HNNH
0 7
phenyl-1,3-thiazole-5-
carboxamide
0
FF
F
0


/ 4-bromo-3-{[(4-
NNir S
I cyclopropylpiperazin-1- 0.80
253 HN 0 ypacetyl]aminol-N-(5-phenyl- 7
/A 01,3,4-thiadiazol-2-yObenzamide 0 rN
N)cN)
Br H
.
/ S
N. 3-{[(15,45)-2-oxa-5-
N NH
azabicyclo[2.2.1]hept-5-
0.81
254 0 0 F ylacetyl]aminoI-N-(5-phenyl-
)F 7
0 F 1,3,4-thiadiazol-2-y1)-4-
c3yNH (trifluoromethoxy)benzamide
id3N)
335

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
F
)F
CH3H 0 F
rN).rN
0 N-[34[2-(morpholin-4-
0)
yppropanoyl]amino}-4-
1.03
255 HN 0 (trifluoromethoxy)phenyI]-2-
7
phenyl-1,3-thiazole-5-
S/ carboxamide
¨N
*
01
N-[4-methoxy-3-({[1-
04 (morpholin-4- 1.16
256 NH
0
. ypcyclopropyl]carbonyllamino) 7
N \
/ '
N 0sCH3 phenyl]-6-phenylnicotinamide
--
H
CH3 NI¨NA H
I 7¨N 0
00) S N-[5-(2-methylphenyI)-1,3,4-
0 0 r0 thiadiazol-2-y1]-3-(0-
1.38
257
1
N)LAN) ypcyclopropyl]carbonyllamino)-
(morpholin-4-
H ____________________________
FO
Fl 4-(trifluoromethoxy)benzamide
F
o 4-(methoxymethyl)-N45-(2-
CH3 NI¨N H
I ,¨N 0 F>1)0H methylphenyI)-1,3,4-thiadiazol-
0 S F
F
0 rWCH3 2-yI]-3-({[1-(4-methylpiperazin-
0.95
2581-
1.1 N)LAN') 1
ypcyclopropyl]carbonyllamino)
H3C.0 H _____________ benzamide trifluoroacetate
(1:1)
336

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
H
N, N 0
N= 'T
\ s0 i\i,CH3 4-
(cyclopropylmethoxy)-3-{[(4-
114 I. NJ.,11,) methylpiperazin-1-
0.97
ypacetyl]aminol-N-(5-phenyl-
259
4
H
(0 1,3,4-
thiadiazol-2-yObenzamide
A
0
NI--N,\NH 0 FF>IAOH 3-{[2-(4-methylpiperazin-1-
260 1.1 s F
r_
01 )0rN j yppropanoyl]aminol-N-(5-
phenyl-1,3,4-thiadiazol-2-y1)-4- 0.95
NCH3 ph
1
N
(trifluoromethoxy)benzamide
H
FO CH3 trifluoroacetate (1:1)
F'l
F
H
N
,Nf 0 3-[({1-[(2-
\ S methoxyethyl)(methyl)amino]c
0 0 OH3 0.84
261
=
N No,CH3 yclopropylIcarbonypamino]-N-
3
(5-phenyl-1,3,4-thiadiazol-2-y1)-
F H,0 4-(trifluoromethoxy)benzamide
F'l
F
o 4-chloro-3-({[1-(4-
N¨NA H
I N 0 FF>IAOH cyclopropylpiperazin-1-
262 0 S F 0 rNA ypcyclopropyl]carbonyllamino)- 0.97
N-(5-phenyl-1,3,4-thiadiazol-2- 1
yl)benzamide trifluoroacetate
H
CI (1:1)
,N H
N\ )--N 0
S N-[5-(4-aminophenyI)-1,3,4-
. 0 r0 thiadiazol-2-y1]-3-
[(morpholin-
lel ),N,) 0.93
263
N 4-ylacetypamino]-4- 4
H2N H
FC)
(trifluoromethoxy)benzamide
F'l
F
337

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
H
,NN
N '1", 0 4-(cyclopropyloxy)-N-[5-(2-
H3C \ S
o ('N_CH3 methylphenyI)-1,3,4-thiadiazol- 0.84
264
. 0 NNj
2-yI]-3-{[(4-methylpiperazin-1-
3
ypacetyl]aminolbenzamide
H
V
H
N. .-..,..1
NN 0
\ S 0 NA 4-(cyclopropylmethoxy)-3-{[(4-
0 r
265
N cyclopropylpiperazin-1-
0.98
ypacetyl]aminol-N-(5-phenyl-
4
H
ro 1,3,4-thiadiazol-2-yObenzamide
A
H
,1\1, 0
N i
H3C \ Si 4-(cyclopropyloxy)-N-[5-(2-
methylphenyI)-1,3,4-thiadiazol- 0.84
266 0
4 N
=
H N 2-yI]-3-[(morpholin-4- 3
ylacetyl)amino]benzamide
V
H
,N,N
N -1- 0 N-[5-(3-cyanophenyI)-1,3,4-
\ S
0 N-C1-13 thiadiazol-2-y1]-3-{[(4-
AI ( 0.76
267 N= 40, WI J-N) methylpiperazin-1-
N 3
H ypacetyl]amino}-4-
F0
F-1 (trifluoromethoxy)benzamide
F
H
NN 0
N. i
\ s ro 4-(cyclopropylmethoxy)-3-
LN [(morpholin-4-ylacetyl)amino]-
0.80
268 == N N-(5-phenyl-1,3,4-thiadiazol-2- 3
H
r0 yl)benzamide
A
338

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
H3C ,,,,N H
1 )¨N 0
0 S N-[5-(2-ethylphenyI)-1,3,4-
0 ro thiadiazol-2-y1]-3-[(morpholin- 1.25
269
N N j 4-ylacetyl)amino]-4- 1
F0 H
(trifluoromethoxy)benzamide
F'l,
F
H
F F N 3-{[(4-methylpiperazin-1-
\
F S
0 rN-cH3 ypacetyl]amino}-4-
270
410 lel N------
..)(trifluoromethoxy)-N-{5-[2- 0.80
3
H
(trifluoromethyl)phenyI]-1,3,4-
F0
F'1 thiadiazol-2-
yllbenzamide
F
CH3 N-NA H
I 7¨N 0 N-[5-(2-
methylphenyI)-1,3,4-
0 S
0 rN-cH3 thiadiazol-2-y1]-3-(0-(4-
1.03
271
1.1 N)L/cNJ methylpiperazin-1-
1
H ypcyclopropyl]carbonyllamino)-
FC)
F'1 4-(trifluoromethoxy)benzamide
F
H
,N õN 0
S
N 3-{[(4-methylpiperazin-1-
CI-13
\ S ypacetyl]amino}-4-
F CL rN- 0.82
272 F 11 WI N N)
(trifluoromethoxy)-N-{5-[3-
3
F H
(trifluoromethyl)phenyI]-1,3,4-
F0
Fl thiadiazol-2-
yllbenzamide
F
0
N¨NA H F
I 7¨N 0 >1)0H 3-{[2-(4-
methylpiperazin-1-
0 S F F
y)propanoyl]aminol-N-(5-
273 =0 rN-CH3 0.95
N( pheny1-1,3,4-thiadiazol-2-y1)-4-
(trifluoromethoxy)benzamide 1
FO HCH3 trifluoroacetate (1:1)
F'l
F
339

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
H
I\1.,,N NO
N. --'I
\ S
40 0 rN,CH3 3-{[(2R)-2-(4-methylpiperazin-1-
274 afr )Nj
N : yl)butanoyl]aminol-N-(5- 1.03
H z phenyl-1,3,4-thiadiazol-2-y1)-4- 4
FO --CH3
Fl (trifluoromethoxy)benzamide
F
N H
"I ,¨N 0 N-[5-(3,4-difluorophenyI)-1,3,4-
S thiadiazol-2-y1]-3-{[(4-
275 F 4 0 v NN_CH3
methylpiperazin-1- 1.01
1
F 2. ypacetyl]amino}-4-
H
F.,0
(trifluoromethoxy)benzamide
F>
F
,,,,N, H N145-(3,5-difluoropheny1)-1,3,4-
0 HO thiadiazol-2-y1]-3-{[(4-
S
276 F . 0 v Na_CH3 methylpiperazin-1-
1.01
ypacetyl]amino}-4-
1
N2.
F H (trifluoromethoxy)benzamide
F.,0
Fl hydrochloride (1:1)
F
.1\I H
F NI )¨N 0
S N-[5-(2,4-difluorophenyI)-1,3,4-
277 = 0 r0
I. ).L.,N j thiadiazol-2-y1]-3-[(morpholin-
1.17
F N 4-ylacetyl)amino]-4- 1
H
FO (trifluoromethoxy)benzamide
Fl
F
-N H
F 11 )¨N 0 HCI N-[5-(2,6-difluorophenyI)-1,3,4-
S thiadiazol-2-y1]-3-{[(4-
278 4110 F 0 0 rN'CH3
methylpiperazin-1- 0.93
ypacetyl]amino}-4- 1
FO H (trifluoromethoxy)benzamide
Fl hydrochloride (1:1)
F
340

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
,,,N1 H
F 1 ,¨N 0
S 4 N-[5-(2,3-
difluorophenyI)-1,3,4-
1111 0 J.L.%Nrjo
thiadiazol-2-y1]-3-[(morpholin- 1.15
279 F
N 4-ylacetyl)amino]-4- 4
H
FC) (trifluoromethoxy)benzamide
Fl
F
.I\1 H
F NI ,¨N 0 HCI
S N-[5-(2,6-
difluorophenyI)-1,3,4-
280 0 F : . thiadiazol-2-
y1]-3-[(morpholin-
0 1.10
1101 L.NC) 4-ylacetyl)amino]-4-
Nj1
H (trifluoromethoxy)benzamide
FO
Fl hydrochloride (1:1)
F
NA H
1 ,¨N 0 HCI
S N-[5-(3,5-
difluorophenyI)-1,3,4-
At 0 ro thiadiazol-2-y1]-3-
[(morpholin-
1.21
F
281 110 N)NJ 4-ylacetyl)amino]-4-
1
F H (trifluoromethoxy)benzamide
F,0
Fl hydrochloride (1:1)
F
õ,,N1 H
11 ,¨N 0
S N-[5-(3,4-
difluorophenyI)-1,3,4-
282
F
At 0 JO.L..)0
thiadiazol-2-y1]-3-[(morpholin- 1.19
F NN 4-ylacetyl)amino]-4- 1
H
F,0 (trifluoromethoxy)benzamide
Fl
F
H
N N 0 HCI N-[5-(2-fluorophenyI)-1,3,4-
N= ---====.r
F \ S
0 r NrcH3 thiadiazol-2-y1]-3-(0-(4-
methylpiperazin-1- 0.98
283 11
11 Nj.LANJ ypcyclopropyl]carbonyllamino)- 4
FO H ________________________________________________________ 4-
(trifluoromethoxy)benzamide
Fl hydrochloride (1:1)
F
341

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
H
,N N 0 3-{[(4-cyclopropylpiperazin-1-
N'(
\
F S00 ypacetyl]aminol-N-[5-(2-
:1 0 rNA 1.01
284 ii
N)N) fluorophenyI)-1,3,4-thiadiazol-
4
FO H (trifluoromethoxy)benzamide
F'l
F
,,,,N H
F 1 ,¨N 0 N-[5-(2,3-difluorophenyI)-1,3,4-
S thiadiazol-2-y1]-3-{[(4-
285 F 4 0 v No,CH3
methylpiperazin-1- 0.99
4
N9 ypacetyl]amino}-4-
F H
C::,
(trifluoromethoxy)benzamide
F>
F
F 1 ,¨N 0 N-[5-(2,5-difluorophenyI)-1,3,4-
S
0
thiadiazol-2-y1]-3-{[(4-
0 rN-CH3 0.99
286 41
N)LNIJ methylpiperazin-1-
4
F FO H ypacetyl]amino}-4-
Fl (trifluoromethoxy)benzamide
F
F F ,N H
F NI )¨N 0
I. S 3-[(morpholin-4-
0 r0 ylacetyl)amino]-4-
1.16
287 110 N)-Nj (trifluoromethoxy)-N-{5-[2-
1
F(:) H
(trifluoromethyl)phenyI]-1,3,4-
Fl thiadiazol-2-yllbenzamide
F
õ ,....N ¨NH
F F IN1 ) 0 3-[(morpholin-4-
F 00 S ylacetyl)amino]-4-
288 0 0 r0
N)LNJ (trifluoromethoxy)-N-{5-[3- 1.28
1
(trifluoromethyl)phenyI]-1,3,4-
H
FO thiadiazol-2-yllbenzamide
Fl
F
342

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Rt
Example
Structure IUPAC Name [min]
No
method
N,N
'T 4-(cyclopropyloxy)-3-{[(4-
\ S 0 rN-cH3 methylpiperazin-1- 0.87
289 N)LNJ ypacetyl]aminol-N-(5-phenyl-
4
1,3,4-thiadiazol-2-yObenzamide
V
0
N
`7- 4-(cyclopropyloxy)-N-[5-(2-
\
H3C methylphenyI)-1,3,4-thiadiazol-
0 0.92
290
= N)LAN)
2-yI]-3-({[1-(morpholin-4-
yl)cyclopropyl]carbonyllamino) 3
0 benzamide
V
4-(cyclopropyloxy)-N-[5-(2-
,NõN 0
N methylphenyI)-1,3,4-thiadiazol-
H3C =0 r
N' H3 2-yI]-3-({[1-(4-methylpiperazin- 0.95 1-
291
N)LAN.)
ypcyclopropyl]carbonyllamino) 3
V benzamide
Example 292
4-(difluoromethoxy)-N45-(2-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-{[(4-
methylpiperazin-1-
ypacetyl]aminolbenzamide
N,NN 0
S
LNr2)N
FO
To a suspension of 300 mg (0.66 mmol) of the compound of intermediate 148 in 6
mL of DMF were
added 0.18 mL of triethylamine (1.31 mmol, 2 equiv), 0.15 mL of 1-
methylpiperazine (1.31 mmol, 2
equiv), and 22.0 mg of potassium iodide (0.13 mmol, 0.2 equiv). The reaction
mixture was stirred at
343

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
room temperature over night. After concentration, the remaining solid was
triturated with 10 mL of
water and 5 mL of ethanol, stirred for 30 minutes, collected by filtration and
dried. The remaining
solid was triturated with 8 mL of ethanol and stirred under reflux, collected
by filtration and dried.
217 mg (62% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.24 (s, 3H), 2.56 - 2.69 (m, 4H),
3.21 (s, 2H), 7.37 - 7.51 (m,
3H), 7.45 (t, 1H), 7.56 - 7.65 (m, 1H), 8.00 (dd, 1H), 8.27 (dt, 1H), 9.01 (d,
1H), 9.89 (s, 1H).
LC-MS (Method 4): Rt = 0.92 min; MS (ESIpos): m/z = 521 [M+H].
Example 293
3-{[(4-cyclopropylpiperazin-1-ypacetyl]amino}-4-(difluoromethoxy)-N45-(2-
fluoropheny1)-1,3,4-
thiadiazol-2-yl]benzamide
H
,NN 0
N
F \
r'N}\
0
N
H
FO
I
F
To a suspension of 150 mg (0.33 mmol) of the compound of intermediate 148 in 3
mL of DMF were
added 0.28 mL of triethylamine (1.97 mmol, 6 equiv), 131 mg of 1-
cyclopropylpiperazine
dihydrochloride (0.66 mmol, 2 equiv), and 11.0 mg of potassium iodide (0.07
mmol, 0.2 equiv). The
reaction mixture was stirred at room temperature over night. After
concentration, the remaining
solid was triturated with 8 mL of water and 4 mL of ethanol, stirred for 30
minutes, collected by
filtration and dried. The remaining solid was triturated with 5 mL of ethanol
and stirred under reflux,
collected by filtration and dried. 89 mg (50% of theory) of the title compound
were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 0.14 - 0.95 (m, 4H), 1.50 - 2.00 (m,
1H), 2.55 - 3.03 (m, 6H),
3.18 - 3.30 (m, 2H), 7.38 - 7.54 (m, 3H), 7.46 (t, 1H), 7.58 - 7.67 (m, 1H),
8.04 (d, 1H), 8.28 (td, 1H),
8.92 (s, 1H), 9.86 (s, 1H), 13.34 (s, 1H).
LC-MS (Method 4): Rt = 0.95 min; MS (ESIpos): m/z = 547 [M+H].
Example 294
4-(difluoromethoxy)-N45-(2-fluoropheny1)-1,3,4-thiadiazol-2-y1]-3-[(morpholin-
4-
ylacetyl)amino] benzamide
344

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
H
NN 0
N'\
F S
40 0 r'0
N
H
F 0
Y
F
To a suspension of 150 mg (0.33 mmol) of the compound of intermediate 148 in 3
mL of DMF were
added 0.09 mL of triethylamine (0.66 mmol, 2 equiv), 0.06 mL of morpholine
(0.66 mmol, 2 equiv),
and 11.0 mg of potassium iodide (0.07 mmol, 0.2 equiv). The reaction mixture
was stirred at room
temperature over night. After concentration, the remaining solid was
triturated with 8 mL of water
and 4 mL of ethanol, stirred for 30 minutes, collected by filtration and
dried. The remaining solid was
triturated with 5 mL of ethanol and stirred under reflux, collected by
filtration and dried. 117 mg
(70% of theory) of the title compound were obtained.
1-1-1-NMR (400 MHz, DMSO-d6): 6 [ppm] = 2.55 - 2.63 (m, 4H), 3.22 (s, 2H),
3.61 - 3.72 (m, 4H), 7.38 -
7.54 (m, 3H), 7.46 (t, 1H), 7.57 - 7.67 (m, 1H), 8.01 (dd, 1H), 8.28 (t, 1H),
8.99 (d, 1H), 9.91 (s, 1H),
13.35 (s, 1H).
LC-MS (Method 4): Rt = 1.01 min; MS (ESIpos): m/z = 508 [M+H].
Further, the compounds of formula (I) of the present invention can be
converted to any salt as
described herein, by any method which is known to the person skilled in the
art. Similarly, any salt of
a compound of formula (I) of the present invention can be converted into the
free compound, by any
method which is known to the person skilled in the art.
Pharmaceutical compositions of the compounds of the invention
This invention also relates to pharmaceutical compositions containing one or
more compounds of
the present invention. These compositions can be utilised to achieve the
desired pharmacological
effect by administration to a patient in need thereof. A patient, for the
purpose of this invention, is a
mammal, including a human, in need of treatment for the particular condition
or disease. Therefore,
the present invention includes pharmaceutical compositions that are comprised
of a
pharmaceutically acceptable carrier and a pharmaceutically effective amount of
a compound, or salt
thereof, of the present invention. A pharmaceutically acceptable carrier is
preferably a carrier that is
relatively non-toxic and innocuous to a patient at concentrations consistent
with effective activity of
345

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
the active ingredient so that any side effects ascribable to the carrier do
not vitiate the beneficial
effects of the active ingredient. A pharmaceutically effective amount of
compound is preferably that
amount which produces a result or exerts an influence on the particular
condition being treated. The
compounds of the present invention can be administered with pharmaceutically-
acceptable carriers
well known in the art using any effective conventional dosage unit forms,
including immediate, slow
and timed release preparations, orally, parenterally, topically, nasally,
ophthalmically, optically,
sublingually, rectally, vaginally, and the like.
For oral administration, the compounds can be formulated into solid or liquid
preparations such as
capsules, pills, tablets, troches, lozenges, melts, powders, solutions,
suspensions, or emulsions, and
may be prepared according to methods known to the art for the manufacture of
pharmaceutical
compositions. The solid unit dosage forms can be a capsule that can be of the
ordinary hard- or
soft-shelled gelatine type containing, for example, surfactants, lubricants,
and inert fillers such as
lactose, sucrose, calcium phosphate, and corn starch.
In another embodiment, the compounds of this invention may be tableted with
conventional tablet
bases such as lactose, sucrose and cornstarch in combination with binders such
as acacia, corn starch
or gelatine, disintegrating agents intended to assist the break-up and
dissolution of the tablet
following administration such as potato starch, alginic acid, corn starch, and
guar gum, gum
tragacanth, acacia, lubricants intended to improve the flow of tablet
granulation and to prevent the
adhesion of tablet material to the surfaces of the tablet dies and punches,
for example talc, stearic
acid, or magnesium, calcium or zinc stearate, dyes, colouring agents, and
flavouring agents such as
peppermint, oil of wintergreen, or cherry flavouring, intended to enhance the
aesthetic qualities of
the tablets and make them more acceptable to the patient. Suitable excipients
for use in oral liquid
dosage forms include dicalcium phosphate and diluents such as water and
alcohols, for example,
ethanol, benzyl alcohol, and polyethylene alcohols, either with or without the
addition of a
pharmaceutically acceptable surfactant, suspending agent or emulsifying agent.
Various other
materials may be present as coatings or to otherwise modify the physical form
of the dosage unit.
For instance tablets, pills or capsules may be coated with shellac, sugar or
both.
Dispersible powders and granules are suitable for the preparation of an
aqueous suspension. They
provide the active ingredient in admixture with a dispersing or wetting agent,
a suspending agent
and one or more preservatives. Suitable dispersing or wetting agents and
suspending agents are
exemplified by those already mentioned above. Additional excipients, for
example those sweetening,
flavouring and colouring agents described above, may also be present.
346

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The pharmaceutical compositions of this invention may also be in the form of
oil-in-water emulsions.
The oily phase may be a vegetable oil such as liquid paraffin or a mixture of
vegetable oils. Suitable
emulsifying agents may be (1) naturally occurring gums such as gum acacia and
gum tragacanth, (2)
naturally occurring phosphatides such as soy bean and lecithin, (3) esters or
partial esters derived
form fatty acids and hexitol anhydrides, for example, sorbitan monooleate, (4)
condensation
products of said partial esters with ethylene oxide, for example,
polyoxyethylene sorbitan
monooleate. The emulsions may also contain sweetening and flavouring agents.
Oily suspensions may be formulated by suspending the active ingredient in a
vegetable oil such as,
for example, arachis oil, olive oil, sesame oil or coconut oil, or in a
mineral oil such as liquid paraffin.
The oily suspensions may contain a thickening agent such as, for example,
beeswax, hard paraffin, or
cetyl alcohol. The suspensions may also contain one or more preservatives, for
example, ethyl or
n-propyl p-hydroxybenzoate ; one or more colouring agents; one or more
flavouring agents; and
one or more sweetening agents such as sucrose or saccharin.
Syrups and elixirs may be formulated with sweetening agents such as, for
example, glycerol,
propylene glycol, sorbitol or sucrose. Such formulations may also contain a
demulcent, and
preservative, such as methyl and propyl parabens and flavouring and colouring
agents.
The compounds of this invention may also be administered parenterally, that
is, subcutaneously,
intravenously, intraocularly, intrasynovially, intramuscularly, or
interperitoneally, as injectable
dosages of the compound in preferably a physiologically acceptable diluent
with a pharmaceutical
carrier which can be a sterile liquid or mixture of liquids such as water,
saline, aqueous dextrose and
related sugar solutions, an alcohol such as ethanol, isopropanol, or hexadecyl
alcohol, glycols such as
propylene glycol or polyethylene glycol, glycerol
ketals such as
2,2-dimethy1-1,1-dioxolane-4-methanol, ethers such as poly(ethylene glycol)
400, an oil, a fatty acid,
a fatty acid ester or, a fatty acid glyceride, or an acetylated fatty acid
glyceride, with or without the
addition of a pharmaceutically acceptable surfactant such as a soap or a
detergent, suspending agent
such as pectin, carbomers, methylcellulose,
hydroxypropylmethylcellulose, or
carboxymethylcellulose, or emulsifying agent and other pharmaceutical
adjuvants.
Illustrative of oils which can be used in the parenteral formulations of this
invention are those of
petroleum, animal, vegetable, or synthetic origin, for example, peanut oil,
soybean oil, sesame oil,
cottonseed oil, corn oil, olive oil, petrolatum and mineral oil. Suitable
fatty acids include oleic acid,
stearic acid, isostearic acid and myristic acid. Suitable fatty acid esters
are, for example, ethyl oleate
and isopropyl myristate. Suitable soaps include fatty acid alkali metal,
ammonium, and
triethanolamine salts and suitable detergents include cationic detergents, for
example dimethyl
347

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
dialkyl ammonium halides, alkyl pyridinium halides, and alkylamine acetates;
anionic detergents, for
example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and
monoglyceride sulfates, and
sulfosuccinates ; non-ionic detergents, for example, fatty amine oxides, fatty
acid alkanolamides, and
poly(oxyethylene-oxypropylene)s or ethylene oxide or propylene oxide
copolymers; and amphoteric
detergents, for example, alkyl-beta-aminopropionates, and 2-alkylimidazoline
quarternary
ammonium salts, as well as mixtures.
The parenteral compositions of this invention will typically contain from
about 0.5% to about 25% by
weight of the active ingredient in solution. Preservatives and buffers may
also be used
advantageously. In order to minimise or eliminate irritation at the site of
injection, such compositions
may contain a non-ionic surfactant having a hydrophile-lipophile balance (HLB)
preferably of from
about 12 to about 17. The quantity of surfactant in such formulation
preferably ranges from about
5% to about 15% by weight. The surfactant can be a single component having the
above HLB or can
be a mixture of two or more components having the desired HLB.
Illustrative of surfactants used in parenteral formulations are the class of
polyethylene sorbitan fatty
acid esters, for example, sorbitan monooleate and the high molecular weight
adducts of ethylene
oxide with a hydrophobic base, formed by the condensation of propylene oxide
with propylene
glycol.
The pharmaceutical compositions may be in the form of sterile injectable
aqueous suspensions. Such
suspensions may be formulated according to known methods using suitable
dispersing or wetting
agents and suspending agents such as, for example, sodium
carboxymethylcellulose, methylcellulose,
hydroxypropylmethyl-cellulose, sodium alginate, polyvinylpyrrolidone, gum
tragacanth and gum
acacia; dispersing or wetting agents which may be a naturally occurring
phosphatide such as lecithin,
a condensation product of an alkylene oxide with a fatty acid, for example,
polyoxyethylene stearate,
a condensation product of ethylene oxide with a long chain aliphatic alcohol,
for example,
heptadeca-ethyleneoxycetanol, a condensation product of ethylene oxide with a
partial ester derived
form a fatty acid and a hexitol such as polyoxyethylene sorbitol monooleate,
or a condensation
product of an ethylene oxide with a partial ester derived from a fatty acid
and a hexitol anhydride,
for example polyoxyethylene sorbitan monooleate.
The sterile injectable preparation may also be a sterile injectable solution
or suspension in a
non-toxic parenterally acceptable diluent or solvent. Diluents and solvents
that may be employed
are, for example, water, Ringer's solution, isotonic sodium chloride solutions
and isotonic glucose
solutions. In addition, sterile fixed oils are conventionally employed as
solvents or suspending media.
348

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
For this purpose, any bland, fixed oil may be employed including synthetic
mono- or diglycerides. In
addition, fatty acids such as oleic acid can be used in the preparation of
injectables.
A composition of the invention may also be administered in the form of
suppositories for rectal
administration of the drug. These compositions can be prepared by mixing the
drug with a suitable
non-irritation excipient which is solid at ordinary temperatures but liquid at
the rectal temperature
and will therefore melt in the rectum to release the drug. Such materials are,
for example, cocoa
butter and polyethylene glycol.
Another formulation employed in the methods of the present invention employs
transdermal
delivery devices ("patches"). Such transdermal patches may be used to provide
continuous or
discontinuous infusion of the compounds of the present invention in controlled
amounts. The
construction and use of transdermal patches for the delivery of pharmaceutical
agents is well known
in the art (see, e.g., US Patent No. 5,023,252, issued June 11, 1991,
incorporated herein by
reference). Such patches may be constructed for continuous, pulsatile, or on
demand delivery of
pharmaceutical agents.
Controlled release formulations for parenteral administration include
liposomal, polymeric
microsphere and polymeric gel formulations that are known in the art.
It may be desirable or necessary to introduce the pharmaceutical composition
to the patient via a
mechanical delivery device. The construction and use of mechanical delivery
devices for the delivery
of pharmaceutical agents is well known in the art. Direct techniques for, for
example, administering a
drug directly to the brain usually involve placement of a drug delivery
catheter into the patient's
ventricular system to bypass the blood-brain barrier. One such implantable
delivery system, used for
the transport of agents to specific anatomical regions of the body, is
described in US Patent No.
5,011,472, issued April 30, 1991.
The compositions of the invention can also contain other conventional
pharmaceutically acceptable
compounding ingredients, generally referred to as carriers or diluents, as
necessary or desired.
Conventional procedures for preparing such compositions in appropriate dosage
forms can be
utilized.
Such ingredients and procedures include those described in the following
references, each of which
is incorporated herein by reference: Powell, M.F. et al., "Compendium of
Excipients for Parenteral
Formulations" PDA Journal of Pharmaceutical Science & Technology 1998, 52(5),
238-311; Strickley,
R.G "Parenteral Formulations of Small Molecule Therapeutics Marketed in the
United States
(1999)-Part-1" PDA Journal of Pharmaceutical Science & Technology 1999, 53(6),
324-349; and
349

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Nema, S. et al., "Excipients and Their Use in Injectable Products" PDA Journal
of Pharmaceutical
Science & Technology 1997, 51(4), 166-171.
Commonly used pharmaceutical ingredients that can be used as appropriate to
formulate the
composition for its intended route of administration include:
acidifying agents (examples include but are not limited to acetic acid, citric
acid, fumaric acid,
hydrochloric acid, nitric acid) ;
alkalinizing agents (examples include but are not limited to ammonia solution,
ammonium
carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium
borate, sodium
carbonate, sodium hydroxide, triethanolamine, trolamine) ;
adsorbents (examples include but are not limited to powdered cellulose and
activated charcoal) ;
aerosol propellants (examples include but are not limited to carbon dioxide,
CCI2F2, F2CIC-CCIF2 and
CCI F3)
air displacement agents (examples include but are not limited to nitrogen and
argon) ;
antifungal preservatives (examples include but are not limited to benzoic
acid, butylparaben,
ethylparaben, methylparaben, propylparaben, sodium benzoate) ;
antimicrobial preservatives (examples include but are not limited to
benzalkonium chloride,
benzethonium chloride, benzyl alcohol, cetylpyridinium chloride,
chlorobutanol, phenol, phenylethyl
alcohol, phenylmercuric nitrate and thimerosal) ;
antioxidants (examples include but are not limited to ascorbic acid, ascorbyl
palmitate, butylated
hydroxyanisole, butylated hydroxytoluene, hypophosphorus acid,
monothioglycerol, propyl gallate,
sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium
metabisulfite) ;
binding materials (examples include but are not limited to block polymers,
natural and synthetic
rubber, polyacrylates, polyurethanes, silicones, polysiloxanes and styrene-
butadiene copolymers) ;
buffering agents (examples include but are not limited to potassium
metaphosphate, dipotassium
phosphate, sodium acetate, sodium citrate anhydrous and sodium citrate
dihydrate)
carrying agents (examples include but are not limited to acacia syrup,
aromatic syrup, aromatic elixir,
cherry syrup, cocoa syrup, orange syrup, syrup, corn oil, mineral oil, peanut
oil, sesame oil,
bacteriostatic sodium chloride injection and bacteriostatic water for
injection)
350

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
chelating agents (examples include but are not limited to edetate disodium and
edetic acid)
colourants (examples include but are not limited to FD&C Red No. 3, FD&C Red
No. 20, FD&C Yellow
No. 6, FD&C Blue No. 2, D&C Green No. 5, D&C Orange No. 5, D&C Red No. 8,
caramel and ferric
oxide red) ;
clarifying agents (examples include but are not limited to bentonite) ;
emulsifying agents (examples include but are not limited to acacia,
cetomacrogol, cetyl alcohol,
glyceryl monostearate, lecithin, sorbitan monooleate, polyoxyethylene 50
monostearate) ;
encapsulating agents (examples include but are not limited to gelatin and
cellulose acetate
phthalate)
flavourants (examples include but are not limited to anise oil, cinnamon oil,
cocoa, menthol, orange
oil, peppermint oil and vanillin) ;
humectants (examples include but are not limited to glycerol, propylene glycol
and sorbitol) ;
levigating agents (examples include but are not limited to mineral oil and
glycerin) ;
oils (examples include but are not limited to arachis oil, mineral oil, olive
oil, peanut oil, sesame oil
and vegetable oil) ;
ointment bases (examples include but are not limited to lanolin, hydrophilic
ointment, polyethylene
glycol ointment, petrolatum, hydrophilic petrolatum, white ointment, yellow
ointment, and rose
water ointment) ;
penetration enhancers (transdermal delivery) (examples include but are not
limited to
monohydroxy or polyhydroxy alcohols, mono-or polyvalent alcohols, saturated or
unsaturated fatty
alcohols, saturated or unsaturated fatty esters, saturated or unsaturated
dicarboxylic acids, essential
oils, phosphatidyl derivatives, cephalin, terpenes, amides, ethers, ketones
and ureas)
plasticizers (examples include but are not limited to diethyl phthalate and
glycerol) ;
solvents (examples include but are not limited to ethanol, corn oil,
cottonseed oil, glycerol,
isopropanol, mineral oil, oleic acid, peanut oil, purified water, water for
injection, sterile water for
injection and sterile water for irrigation) ;
stiffening agents (examples include but are not limited to cetyl alcohol,
cetyl esters wax,
microcrystalline wax, paraffin, stearyl alcohol, white wax and yellow wax) ;
351

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
suppository bases (examples include but are not limited to cocoa butter and
polyethylene glycols
(mixtures)) ;
surfactants (examples include but are not limited to benzalkonium chloride,
nonoxynol 10, oxtoxynol
9, polysorbate 80, sodium lauryl sulfate and sorbitan mono-palmitate) ;
suspending agents (examples include but are not limited to agar, bentonite,
carbomers,
carboxymethylcellulose sodium, hydroxyethyl cellulose, hydroxypropyl
cellulose, hydroxypropyl
methylcellulose, kaolin, methylcellulose, tragacanth and veegum) ;
sweetening agents (examples include but are not limited to aspartame,
dextrose, glycerol, mannitol,
propylene glycol, saccharin sodium, sorbitol and sucrose) ;
tablet anti-adherents (examples include but are not limited to magnesium
stearate and talc) ;
tablet binders (examples include but are not limited to acacia, alginic acid,
carboxymethylcellulose
sodium, compressible sugar, ethylcellulose, gelatin, liquid glucose,
methylcellulose, non-crosslinked
polyvinyl pyrrolidone, and pregelatinized starch) ;
tablet and capsule diluents (examples include but are not limited to dibasic
calcium phosphate,
kaolin, lactose, mannitol, microcrystalline cellulose, powdered cellulose,
precipitated calcium
carbonate, sodium carbonate, sodium phosphate, sorbitol and starch) ;
tablet coating agents (examples include but are not limited to liquid glucose,
hydroxyethyl cellulose,
hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose,
ethylcellulose, cellulose
acetate phthalate and shellac) ;
tablet direct compression excipients (examples include but are not limited to
dibasic calcium
phosphate) ;
tablet disintegrants (examples include but are not limited to alginic acid,
carboxymethylcellulose
calcium, microcrystalline cellulose, polacrillin potassium, cross-linked
polyvinylpyrrolidone, sodium
alginate, sodium starch glycollate and starch) ;
tablet glidants (examples include but are not limited to colloidal silica,
corn starch and talc) ;
tablet lubricants (examples include but are not limited to calcium stearate,
magnesium stearate,
mineral oil, stearic acid and zinc stearate) ;
tablet/capsule opaquants (examples include but are not limited to titanium
dioxide) ;
352

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
tablet polishing agents (examples include but are not limited to carnuba wax
and white wax) ;
thickening agents (examples include but are not limited to beeswax, cetyl
alcohol and paraffin) ;
tonicity agents (examples include but are not limited to dextrose and sodium
chloride) ;
viscosity increasing agents (examples include but are not limited to alginic
acid, bentonite,
carbomers, carboxymethylcellulose sodium, methylcellulose, polyvinyl
pyrrolidone, sodium alginate
and tragacanth) ; and
wetting agents (examples include but are not limited to heptadecaethylene
oxycetanol, lecithins,
sorbitol monooleate, polyoxyethylene sorbitol monooleate, and polyoxyethylene
stearate).
Pharmaceutical compositions according to the present invention can be
illustrated as follows:
Sterile IV Solution: A 5 mg/ml solution of the desired compound of this
invention can be made using
sterile, injectable water, and the pH is adjusted if necessary. The solution
is diluted for administration
to 1 ¨ 2 mg/ml with sterile 5% dextrose and is administered as an IV infusion
over about 60 minutes.
Lyophilised powder for IV administration: A sterile preparation can be
prepared with (i) 100 - 1000
mg of the desired compound of this invention as a lyophilised powder, (ii) 32-
327 mg/ml sodium
citrate, and (iii) 300 ¨ 3000 mg Dextran 40. The formulation is reconstituted
with sterile, injectable
saline or dextrose 5% to a concentration of 10 to 20 mg/ml, which is further
diluted with saline or
dextrose 5% to 0.2 ¨ 0.4 mg/ml, and is administered either IV bolus or by IV
infusion over 15 ¨ 60
minutes.
Intramuscular suspension: The following solution or suspension can be
prepared, for intramuscular
injection:
50 mg/ml of the desired, water-insoluble compound of this invention
5 mg/ml sodium carboxymethylcellulose
4 mg/ml TWEEN 80
9 mg/ml sodium chloride
9 mg/ml benzyl alcohol
Hard Shell Capsules: A large number of unit capsules are prepared by filling
standard two-piece hard
galantine capsules each with 100 mg of powdered active ingredient, 150 mg of
lactose, 50 mg of
353

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
cellulose and 6 mg of magnesium stearate.
Soft Gelatin Capsules: A mixture of active ingredient in a digestible oil such
as soybean oil,
cottonseed oil or olive oil is prepared and injected by means of a positive
displacement pump into
molten gelatin to form soft gelatin capsules containing 100 mg of the active
ingredient. The capsules
are washed and dried. The active ingredient can be dissolved in a mixture of
polyethylene glycol,
glycerin and sorbitol to prepare a water miscible medicine mix.
Tablets: A large number of tablets are prepared by conventional procedures so
that the dosage unit
is 100 mg of active ingredient, 0.2 mg. of colloidal silicon dioxide, 5 mg of
magnesium stearate, 275
mg of microcrystalline cellulose, 11 mg. of starch, and 98.8 mg of lactose.
Appropriate aqueous and
non-aqueous coatings may be applied to increase palatability, improve elegance
and stability or
delay absorption.
Immediate Release Tablets/Capsules: These are solid oral dosage forms made by
conventional and
novel processes. These units are taken orally without water for immediate
dissolution and delivery of
the medication. The active ingredient is mixed in a liquid containing
ingredient such as sugar, gelatin,
pectin and sweeteners. These liquids are solidified into solid tablets or
caplets by freeze drying and
solid state extraction techniques. The drug compounds may be compressed with
viscoelastic and
thermoelastic sugars and polymers or effervescent components to produce porous
matrices
intended for immediate release, without the need of water.
Methods of Treatment
The compounds and compositions provided herein can be used as inhibitors of
one or more
members of the Wnt pathway, including one or more Wnt proteins, and thus can
be used to treat a
variety of disorders and diseases in which aberrant Wnt signaling is
implicated, such as cancer and
other diseases associated with abnormal angiogenesis, cellular proliferation,
and cell cycling.
Accordingly, the compounds and compositions provided herein can be used to
treat cancer, to
reduce or inhibit angiogenesis, to reduce or inhibit cellular proliferation
and correct a genetic
disorder due to mutations in Wnt signaling components. Non-limiting examples
of diseases which
can be treated with the compounds and compositions provided herein include a
variety of cancers,
diabetic retinopathy, neovascular glaucoma, rheumatoid arthritis, psoriasis,
mycotic and viral
infections, osteochondrodysplasia, Alzheimer's disease, osteoarthritis,
polyposis coli, osteoporosis-
pseudoglioma syndrome, familial exudative vitreoretinopathy, retinal
angiogenesis, early coronary
disease, tetra-amelia syndrome, MOIlerian-duct regression and virilization,
SERKAL syndrome,
354

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
diabetes mellitus type 2, Fuhrmann syndrome, Al-Awadi/Raas-Rothschild/Schinzel
phocomelia
syndrome, odonto-onycho-dermal dysplasia, obesity, split-hand/foot
malformation, caudal
duplication syndrome, tooth agenesis, Wilms tumor, skeletal dysplasia, focal
dermal hypoplasia,
autosomal recessive anonychia, neural tube defects, alpha-thalassemia (ATRX)
syndrome, fragile X
syndrome, ICE syndrome, Angelman syndrome, Prader-Willi syndrome, Beckwith-
Wiedemarm
Syndrome and Rett syndrome.
In accordance with another aspect therefore, the present invention covers a
compound of general
formula (I), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate,
or a salt thereof,
particularly a pharmaceutically acceptable salt thereof, or a mixture of same,
as described and
defined herein, for use in the treatment or prophylaxis of a disease, as
mentioned supra.
Another particular aspect of the present invention is therefore the use of a
compound of general
formula (I), described supra, or a stereoisomer, a tautomer, an N-oxide, a
hydrate, a solvate, or a salt
thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture
of same, for the
prophylaxis or treatment of a disease.
Another particular aspect of the present invention is therefore the use of a
compound of general
formula (I) described supra for manufacturing a pharmaceutical composition for
the treatment or
prophylaxis of a disease.
The term "pharmaceutically acceptable salt" refers to a relatively non-toxic,
inorganic or organic acid
addition salt of a compound of the present invention. For example, see S. M.
Berge, et al.
"Pharmaceutical Salts," J. Pharm. Sci. 1977, 66, 1-19.
A suitable pharmaceutically acceptable salt of the compounds of the present
invention may be, for
example, an acid-addition salt of a compound of the present invention bearing
a nitrogen atom, in a
chain or in a ring, for example, which is sufficiently basic, such as an acid-
addition salt with an
inorganic acid, such as hydrochloric, hydrobromic, hydroiodic, sulfuric,
bisulfuric, phosphoric, or
nitric acid, for example, or with an organic acid, such as formic, acetic,
acetoacetic, pyruvic,
trifluoroacetic, propionic, butyric, hexanoic, heptanoic, undecanoic, lauric,
benzoic, salicylic,
2-(4-hydroxybenzoyI)-benzoic, camphoric, cinnamic,
cyclopentanepropionic, digluconic,
3-hydroxy-2-naphthoic, nicotinic, pamoic, pectinic, persulfuric, 3-
phenylpropionic, picric, pivalic,
2-hydroxyethanesulfonate, itaconic, sulfamic,
trifluoromethanesulfonic, dodecylsulfuric,
ethansulfonic, benzenesulfonic, para-toluenesulfonic, methansulfonic, 2-
naphthalenesulfonic,
naphthalinedisulfonic, camphorsulfonic acid, citric, tartaric, stearic,
lactic, oxalic, malonic, succinic,
355

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
malic, adipic, alginic, maleic, fumaric, D-gluconic, mandelic, ascorbic,
glucoheptanoic,
glycerophosphoric, aspartic, sulfosalicylic, hemisulfuric, or thiocyanic acid,
for example.
Further, another suitably pharmaceutically acceptable salt of a compound of
the present invention
which is sufficiently acidic, is an alkali metal salt, for example a sodium or
potassium salt, an alkaline
earth metal salt, for example a calcium or magnesium salt, an ammonium salt or
a salt with an
organic base which affords a physiologically acceptable cation, for example a
salt with
N-methyl-glucamine, dimethyl-glucamine, ethyl-glucamine,
lysine, dicyclohexylamine,
1,6-hexadiamine, ethanolamine, glucosamine, sarcosine,
serinol,
tris-hydroxy-methyl-aminomethane, aminopropandiol, sovak-base, 1-amino-2,3,4-
butantriol.
Additionally, basic nitrogen containing groups may be quaternised with such
agents as lower alkyl
halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and
iodides; dialkyl sulfates like
dimethyl, diethyl, and dibutyl sulfate; and diamyl sulfates, long chain
halides such as decyl, lauryl,
myristyl and strearyl chlorides, bromides and iodides, aralkyl halides like
benzyl and phenethyl
bromides and others.
Those skilled in the art will further recognise that acid addition salts of
the claimed compounds may
be prepared by reaction of the compounds with the appropriate inorganic or
organic acid via any of a
number of known methods. Alternatively, alkali and alkaline earth metal salts
of acidic compounds of
the invention are prepared by reacting the compounds of the invention with the
appropriate base via
a variety of known methods.
Method of treating hyper-proliferative disorders
The present invention relates to a method for using the compounds of the
present invention and
compositions thereof, to treat mammalian hyper-proliferative disorders.
Compounds can be utilized
to inhibit, block, reduce, decrease, etc., cell proliferation and/or cell
division, and/or produce
apoptosis. This method comprises administering to a mammal in need thereof,
including a human, an
amount of a compound of this invention, or a pharmaceutically acceptable salt,
isomer, polymorph,
metabolite, hydrate, solvate or ester thereof; etc. which is effective to
treat the disorder.
Hyper-proliferative disorders include but are not limited, e.g., psoriasis,
keloids, and other
hyperplasias affecting the skin, benign prostate hyperplasia (BPH), solid
tumours, such as cancers of
the breast, respiratory tract, brain, reproductive organs, digestive tract,
urinary tract, eye, liver, skin,
head and neck, thyroid, parathyroid and their distant metastases. Those
disorders also include
lymphomas, sarcomas, and leukaemias.
356

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Examples of breast cancer include, but are not limited to invasive ductal
carcinoma, invasive lobular
carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.
Examples of cancers of the respiratory tract include, but are not limited to
small-cell and
non-small-cell lung carcinoma, as well as bronchial adenoma and
pleuropulmonary blastoma.
Examples of brain cancers include, but are not limited to brain stem and
hypophtalmic glioma,
cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as
neuroectodermal
and pineal tumour.
Tumours of the male reproductive organs include, but are not limited to
prostate and testicular
cancer. Tumours of the female reproductive organs include, but are not limited
to endometrial,
cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the
uterus.
Tumours of the digestive tract include, but are not limited to anal, colon,
colorectal, oesophageal,
gallbladder, gastric, pancreatic, rectal, small-intestine, and salivary gland
cancers.
Tumours of the urinary tract include, but are not limited to bladder, penile,
kidney, renal pelvis,
ureter, urethral and human papillary renal cancers.
Eye cancers include, but are not limited to intraocular melanoma and
retinoblastoma.
Examples of liver cancers include, but are not limited to hepatocellular
carcinoma (liver cell
carcinomas with or without fibrolamellar variant), cholangiocarcinoma
(intrahepatic bile duct
carcinoma), and mixed hepatocellular cholangiocarcinoma.
Skin cancers include, but are not limited to squamous cell carcinoma, Kaposi's
sarcoma, malignant
melanoma, Merkel cell skin cancer, and non-melanoma skin cancer.
Head-and-neck cancers include, but are not limited to laryngeal,
hypopharyngeal, nasopharyngeal,
oropharyngeal cancer, lip and oral cavity cancer and squamous cell. Lymphomas
include, but are not
limited to AIDS-related lymphoma, non-Hodgkin's lymphoma, cutaneous T-cell
lymphoma, Burkitt
lymphoma, Hodgkin's disease, and lymphoma of the central nervous system.
Sarcomas include, but are not limited to sarcoma of the soft tissue,
osteosarcoma, malignant fibrous
histiocytoma, lymphosarcoma, and rhabdomyosarcoma.
Leukemias include, but are not limited to acute myeloid leukemia, acute
lymphoblastic leukemia,
chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell
leukemia.
357

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
These disorders have been well characterized in humans, but also exist with a
similar etiology in
other mammals, and can be treated by administering pharmaceutical compositions
of the present
invention.
The term "treating" or "treatment" as stated throughout this document is used
conventionally, e.g.,
the management or care of a subject for the purpose of combating, alleviating,
reducing, relieving,
improving the condition of, etc., of a disease or disorder, such as a
carcinoma.
Dose and administration
Based upon standard laboratory techniques known to evaluate compounds useful
for the treatment
of hyper-proliferative disorders and angiogenic disorders, by standard
toxicity tests and by standard
pharmacological assays for the determination of treatment of the conditions
identified above in
mammals, and by comparison of these results with the results of known
medicaments that are used
to treat these conditions, the effective dosage of the compounds of this
invention can readily be
determined for treatment of each desired indication. The amount of the active
ingredient to be
administered in the treatment of one of these conditions can vary widely
according to such
considerations as the particular compound and dosage unit employed, the mode
of administration,
the period of treatment, the age and sex of the patient treated, and the
nature and extent of the
condition treated.
The total amount of the active ingredient to be administered will generally
range from about 0.001
mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01
mg/kg to about 20
mg/kg body weight per day. Clinically useful dosing schedules will range from
one to three times a
day dosing to once every four weeks dosing. In addition, "drug holidays" in
which a patient is not
dosed with a drug for a certain period of time, may be beneficial to the
overall balance between
pharmacological effect and tolerability. A unit dosage may contain from about
0.5 mg to about 1500
mg of active ingredient, and can be administered one or more times per day or
less than once a day.
The average daily dosage for administration by injection, including
intravenous, intramuscular,
subcutaneous and parenteral injections, and use of infusion techniques will
preferably be from 0.01
to 200 mg/kg of total body weight. The average daily rectal dosage regimen
will preferably be from
0.01 to 200 mg/kg of total body weight. The average daily vaginal dosage
regimen will preferably be
from 0.01 to 200 mg/kg of total body weight. The average daily topical dosage
regimen will
preferably be from 0.1 to 200 mg administered between one to four times daily.
The transdermal
concentration will preferably be that required to maintain a daily dose of
from 0.01 to 200 mg/kg.
358

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
The average daily inhalation dosage regimen will preferably be from 0.01 to
100 mg/kg of total body
weight.
Of course the specific initial and continuing dosage regimen for each patient
will vary according to
the nature and severity of the condition as determined by the attending
diagnostician, the activity of
the specific compound employed, the age and general condition of the patient,
time of
administration, route of administration, rate of excretion of the drug, drug
combinations, and the
like. The desired mode of treatment and number of doses of a compound of the
present invention or
a pharmaceutically acceptable salt or ester or composition thereof can be
ascertained by those
skilled in the art using conventional treatment tests.
Preferably, the diseases of said method are haematological tumours, solid
tumour and/or metastases
thereof.
The compounds of the present invention can be used in particular in therapy
and prevention, i.e.
prophylaxis, of tumour growth and metastases, especially in solid tumours of
all indications and
stages with or without pre-treatment of the tumour growth.
Methods of testing for a particular pharmacological or pharmaceutical property
are well known to
persons skilled in the art.
The example testing experiments described herein serve to illustrate the
present invention and the
invention is not limited to the examples given.
Combination therapies
The term "combination" in the present invention is used as known to persons
skilled in the art and
may be present as a fixed combination, a non-fixed combination or kit-of-
parts.
A "fixed combination" in the present invention is used as known to persons
skilled in the art and is
defined as a combination wherein the said first active ingredient and the said
second active
ingredient are present together in one unit dosage or in a single entity. One
example of a "fixed
combination" is a pharmaceutical composition wherein the said first active
ingredient and the said
second active ingredient are present in admixture for simultaneous
administration, such as in a
formulation. Another example of a "fixed combination" is a pharmaceutical
combination wherein the
359

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
said first active ingredient and the said second active ingredient are present
in one unit without
being in admixture.
A non-fixed combination or "kit-of-parts" in the present invention is used as
known to persons skilled
in the art and is defined as a combination wherein the said first active
ingredient and the said second
active ingredient are present in more than one unit. One example of a non-
fixed combination or
kit-of-parts is a combination wherein the said first active ingredient and the
said second active
ingredient are present separately. The components of the non-fixed combination
or kit-of-parts may
be administered separately, sequentially, simultaneously, concurrently or
chronologically staggered.
The compounds of this invention can be administered as the sole pharmaceutical
agent or in
combination with one or more other pharmaceutical agents where the combination
causes no
unacceptable adverse effects. The present invention relates also to such
combinations. For example,
the compounds of this invention can be combined with known chemotherapeutic
agents or
anti-cancer agents, e.g. anti-hyper-proliferative or other indication agents,
and the like, as well as
with admixtures and combinations thereof. Other indication agents include, but
are not limited to,
anti-angiogenic agents, mitotic inhibitors, alkylating agents, anti-
metabolites, DNA-intercalating
antibiotics, growth factor inhibitors, cell cycle inhibitors, enzyme
inhibitors, toposisomerase
inhibitors, biological response modifiers, or anti-hormones.
The term "(chemotherapeutic) anti-cancer agents", includes but is not limited
to 131I-chTNT,
abarelix, abiraterone, aclarubicin, aldesleukin, alemtuzumab, alitretinoin,
altretamine,
aminoglutethimide, amrubicin, amsacrine, anastrozole, arglabin, arsenic
trioxide, asparaginase,
azacitidine, basiliximab, BAY 80-6946, BAY 1000394, belotecan, bendamustine,
bevacizumab,
bexarotene, bicalutamide, bisantrene, bleomycin, bortezomib, buserelin,
busulfan, cabazitaxel,
calcium folinate, calcium levofolinate, capecitabine, carboplatin, carmofur,
carmustine,
catumaxomab, celecoxib, celmoleukin, cetuximab, chlorambucil, chlormadinone,
chlormethine,
cisplatin, cladribine, clodronic acid, clofarabine, crisantaspase,
cyclophosphamide, cyproterone,
cytarabine, dacarbazine, dactinomycin, darbepoetin alfa, dasatinib,
daunorubicin, decitabine,
degarelix, denileukin diftitox, denosumab, deslorelin, dibrospidium chloride,
docetaxel, doxifluridine,
doxorubicin, doxorubicin + estrone, eculizumab, edrecolomab, elliptinium
acetate, eltrombopag,
endostatin, enocitabine, epirubicin, epitiostanol, epoetin alfa, epoetin beta,
eptaplatin, eribulin,
erlotinib, estradiol, estramustine, etoposide, everolimus, exemestane,
fadrozole, filgrastim,
fludarabine, fluorouracil, flutamide, formestane, fotemustine, fulvestrant,
gallium nitrate, ganirelix,
gefitinib, gemcitabine, gemtuzumab, glutoxim, goserelin, histamine
dihydrochloride, histrelin,
hydroxycarbamide, 1-125 seeds, ibandronic acid, ibritumomab tiuxetan,
idarubicin, ifosfamide,
imatinib, imiquimod, improsulfan, interferon alfa, interferon beta, interferon
gamma, ipilimumab,
360

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
irinotecan, ixabepilone, lanreotide, lapatinib, lenalidomide, lenograstim,
lentinan, letrozole,
leuprorelin, levamisole, lisuride, lobaplatin,
lomustine, lonidamine, masoprocol,
medroxyprogesterone, megestrol, melphalan, mepitiostane, mercaptopurine,
methotrexate,
methoxsalen, Methyl aminolevulinate, methyltestosterone, mifamurtide,
miltefosine, miriplatin,
mitobronitol, mitoguazone, mitolactol, mitomycin, mitotane, mitoxantrone,
nedaplatin, nelarabine,
nilotinib, nilutamide, nimotuzumab, nimustine, nitracrine, ofatumumab,
omeprazole, oprelvekin,
oxaliplatin, p53 gene therapy, paclitaxel, palifermin, palladium-103 seed,
pamidronic acid,
panitumumab, pazopanib, pegaspargase, PEG-epoetin beta (methoxy PEG-epoetin
beta),
pegfilgrastim, peginterferon alfa-2b, pemetrexed, pentazocine, pentostatin,
peplomycin,
perfosfamide, picibanil, pirarubicin, plerixafor, plicamycin, poliglusam,
polyestradiol phosphate,
polysaccharide-K, porfimer sodium, pralatrexate, prednimustine, procarbazine,
quinagolide, radium-
223 chloride, raloxifene, raltitrexed, ranimustine, razoxane, refametinib ,
regorafenib, risedronic acid,
rituximab, romidepsin, romiplostim, sargramostim, sipuleucel-T, sizofiran,
sobuzoxane, sodium
glycididazole, sorafenib, streptozocin, sunitinib, talaporfin, tamibarotene,
tamoxifen, tasonermin,
teceleukin, tegafur, tegafur + gimeracil + oteracil, temoporfin, temozolomide,
temsirolimus,
teniposide, testosterone, tetrofosmin, thalidomide, thiotepa, thymalfasin,
tioguanine, tocilizumab,
topotecan, toremifene, tositumomab, trabectedin, trastuzumab, treosulfan,
tretinoin, trilostane,
triptorelin, trofosfamide, tryptophan, ubenimex, valrubicin, vandetanib,
vapreotide, vemurafenib,
vinblastine, vincristine, vindesine, vinflunine, vinorelbine, vorinostat,
vorozole, yttrium-90 glass
microspheres, zinostatin, zinostatin stimalamer, zoledronic acid, zorubicin.
Generally, the use of cytotoxic and/or cytostatic agents in combination with a
compound or
composition of the present invention will serve to:
(1) yield better efficacy in reducing the growth of a tumor or even
eliminate the tumor as
compared to administration of either agent alone,
(2) provide for the administration of lesser amounts of the administered
chemotherapeutic
agents,
(3) provide for a chemotherapeutic treatment that is well tolerated in
the patient with fewer
deleterious pharmacological complications than observed with single agent
chemotherapies
and certain other combined therapies,
(4) provide for treating a broader spectrum of different cancer types in
mammals, especially
humans,
(5) provide for a higher response rate among treated patients,
361

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
(6) provide for a longer survival time among treated patients compared to
standard
chemotherapy treatments,
(7) provide a longer time for tumor progression, and/or
(8) yield efficacy and tolerability results at least as good as those of
the agents used alone,
compared to known instances where other cancer agent combinations produce
antagonistic
effects.
Biological assays
Examples were tested in selected biological assays one or more times. When
tested more than once,
data are reported as either average values or as median values, wherein
= the average value, also referred to as the arithmetic mean value,
represents the sum of the
values obtained divided by the number of times tested, and
= the median value represents the middle number of the group of values when
ranked in
ascending or descending order. If the number of values in the data set is odd,
the median is the
middle value. If the number of values in the data set is even, the median is
the arithmetic mean
of the two middle values.
Examples were synthesized one or more times. When synthesized more than once,
data from
biological assays represent average values or median values calculated
utilizing data sets obtained
from testing of one or more synthetic batch.
Measurement of the inhibitory activity of selected compounds on the Wnt
signaling cascade
In order to discover and characterize small molecules which inhibit the
constitutive active colorectal
cancer cell (CRC) Wnt pathway, a cellular reporter assay was employed. The
corresponding assay cell
was generated by transfection of the colorectal cancer cell line HCT116 (ATCC,
#CCL-247) with the
Super TopFlash vector (Morin, Science 275, 1997, 1787-1790; Molenaar et al.,
Cell 86 (3), 1996, 391-
399). The HCT116 cell line is cultivated at 37 C and 5% CO2 in DMEM/F-12 (Life
Technologies,
#11320-074), supplemented with 2 mM glutamine, 20 mM HEPES, 1.4 mM pyruvate,
0.15% Na-
bicarbonate and 10% foetal bovine serum (GIBCO, #10270), this cancer cell line
is pathophysiological
relevant since it carries a deletion of position S45 in the 13-catenin gene,
leading to constitutive active
362

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Wnt signaling. Stable transfectants were generated by cotransfection with
pcDNA3 and selection of
stable transfected cells with 1 mg/ml G418.
In a parallel approach, HCT116 cells were cotransfected with the FOP control
vector and pcDNA3.
The FOP vector is identical to the TOP construct, but it contains instead of
functional TCF elements a
randomized, non-functional sequence. For this transfection a stable
transfected cell line was
generated as well.
In preparation of the assay, the two cell lines were plated 24 hours before at
10000 cells per well of a
384 micro titre plate (MTP) in 30 uL growth medium. Selective inhibitory
activity for small molecules
on the mutated Wnt pathway was determined after parallel incubation of both
(TOP and FOP)
HCT116 reporter cell lines with a compound dilution series from 50 uM to 15 nM
in steps of 3.16-fold
dilutions in CAFTY buffer (130 mM NaCI, 5 mM KCI, 20 mM HEPES, 1 mM MgC12, 5
mM NaHCO3, pH
7.4) containing 2 mM Ca2+ and 0.01% BSA. The compounds were thereby serially
prediluted in 100%
DMSO and thereafter in addition 50 fold into the CAFTY compound dilution
buffer (described above).
From this dilution 10 uL were added to the cells in 30 uL growth medium and
incubated for 36 hours
at 37 C and 5% CO2. Thereafter luciferase assay buffer (1:1 mixture of
luciferase substrate buffer (20
mM Tricine, 2.67 mM Mg504, 0.1 mM EDTA, 4 mM DTT, 270 uM Coenzyme A, 470 uM
Luciferin, 530
uM ATP, ph adjusted to pH 7.8 with a sufficient volume of 5M NaOH) and Triton
buffer (30 mL Triton
X-100, 115 mL glycerol, 308 mg Dithiothreitol, 4.45 g Na2HPO4 = 2 H20, 3.03 g
TRIS HCI, ad 11 H20, pH
7.8) was added as equal volume to the compound solution on the cells to
determine luciferase
expression as a measure of Wnt signaling activity in a luminometer.
In order to determine the inhibitory activity of compounds for the WT Wnt
signaling pathway, the
Super TopFlash vector respectively FOP vector were cotransfected with pcDNA3
into HEK293 and
stable transfected HEK293 cells were isolated by antibiotic selection. In
preparation of compound
testing, a dose response curve for the Wnt dependent luciferase expression was
recorded by
stimulating the assay cells with human recombinant Wnt-3a (R&D, #5036-WN-010)
at different
concentrations for 16 hours at 37 C and 5% CO2 followed by subsequent
luciferase measurement as
described above to determine the Wnt-3a EC50 for the HEK293 TOP cell line on
the day of testing.
The recombinant human Wnt-3a was thereby used between 2500 and 5 ng/ml in two-
fold dilution
steps. To determine the inhibitory activity of compounds on the WT Wnt pathway
they were
prepared and diluted as described above for the constitutive active Wnt
pathway and coincubated
with the EC30 concentration of Wnt-3a for 16 hours at 37 C and 5% CO2 on the
HEK293 TOP
respectively control HEK293 FOP cells. Measurement of luciferase expression
was done as described
for the constitutive active Wnt assay.
Table 2
363

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
HCT116 TOPFlash ICso HCT116 FOPFlash ICso
Example No
[mo1/11 [mo1/11
1 1.14E-6 5.00E-5
2 1.33E-7 5.00E-5
3 1.80E-6 5.00E-5
4 3.00E-7 5.00E-5
4.03E-8 5.00E-5
6 6.00E-8 8.90E-6
7 2.37E-8 5.00E-5
8 5.10E-8 8.35E-6
9 1.42E-8 2.02E-5
1.12E-8 1.50E-5
11 7.27E-7 5.00E-5
12 5.30E-7 5.00E-5
13 3.62E-7 5.00E-5
14 1.90E-7 5.00E-5
1.37E-7 5.00E-5
16 1.78E-8 5.00E-5
17 4.30E-8 5.00E-5
18 4.44E-7 9.90E-6
19 2.62E-8 1.10E-5
2.46E-6 5.00E-5
21 2.85E-7 9.20E-6
22 6.95E-7 5.00E-5
23 9.80E-8 5.00E-5
24 1.11E-6 5.00E-5
3.26E-7 5.00E-5
26 1.18E-7 5.00E-5
27 6.57E-8 5.00E-5
28 5.23E-8 5.00E-5
29 1.56E-7 5.00E-5
9.01E-8 5.00E-5
31 8.05E-7 3.60E-5
32 9.25E-7 5.00E-5
33 1.11E-7 5.00E-5
34 1.22E-6 5.00E-5
1.25E-6 5.00E-5
36 1.20E-6 2.20E-5
37 2.08E-8 5.00E-5
38 2.75E-8 5.00E-5
39 3.38E-8 3.20E-5
5.24E-8 5.00E-5
364

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
HCT116 TOPFlash ICso HCT116 FOPFlash ICso
Example No
[mo1/11 [mo1/11
41 1.49E-7 5.00E-5
42 2.42E-7 5.00E-5
43 4.91E-8 5.00E-5
44 3.66E-7 5.00E-5
45 1.98E-7 2.65E-5
46 1.64E-7 5.00E-5
47 3.98E-8 5.00E-5
48 7.37E-8 5.00E-5
49 4.66E-8 5.00E-5
50 4.60E-8 5.00E-5
51 1.19E-7 5.00E-5
52 2.65E-8 5.00E-5
53 1.81E-7 5.00E-5
54 1.04E-7 2.80E-5
55 1.50E-7 5.00E-5
56 1.04E-7 5.00E-5
57 1.24E-7 5.00E-5
58 8.30E-8 2.00E-5
59 3.85E-7 5.00E-5
60 2.02E-8 5.00E-5
61 2.65E-8 5.00E-5
62 6.73E-8 5.00E-5
63 5.08E-8 5.00E-5
64 2.30E-8 5.00E-5
65 5.20E-9 5.00E-5
66 1.10E-8 5.00E-5
67 2.96E-8 5.00E-5
68 7.72E-9 5.00E-5
69 1.48E-8 5.00E-5
70 2.40E-8 4.60E-6
71 2.92E-8 4.50E-5
72 1.06E-7 8.00E-6
73 9.85E-8 5.00E-5
74 8.58E-8 4.22E-5
75 1.85E-8 5.00E-5
76 3.14E-8 5.00E-5
77 3.70E-7 1.40E-5
78 5.08E-7 5.00E-5
79 2.04E-8 5.00E-5
80 2.70E-8 5.00E-5
365

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
HCT116 TOPFlash ICso HCT116 FOPFlash ICso
Example No
[mo1/11 [mo1/11
81 2.31E-8 5.00E-5
82 2.55E-6 5.00E-5
83 5.15E-7 5.00E-5
84 4.53E-7 5.00E-5
85 1.50E-7 5.00E-5
86 8.90E-7 5.00E-5
87 8.58E-7 4.80E-5
88 4.17E-7 5.00E-5
89 2.16E-7 4.40E-5
90 1.73E-7 5.00E-5
91 6.50E-7 4.40E-5
92 3.60E-7 5.00E-5
93 2.40E-7 5.00E-5
94 4.33E-7 5.00E-5
95 5.81E-8 5.00E-5
96 8.55E-7 5.00E-5
97 1.93E-6 5.00E-5
98 8.70E-8 2.64E-5
99 9.35E-7 9.30E-6
100 8.58E-7 5.00E-5
101 3.20E-6 5.00E-5
102 4.58E-7 1.95E-5
103 7.52E-7 2.10E-5
104 2.03E-6 5.00E-5
105 6.40E-8 5.00E-5
106 2.85E-7 5.00E-5
107 2.09E-7 5.00E-5
108 4.63E-7 5.00E-5
109 2.08E-7 2.99E-5
110 4.50E-7 4.20E-5
111 3.22E-8 5.00E-5
112 2.70E-7 5.00E-5
113 2.30E-8 5.00E-5
114 4.60E-8 5.00E-5
115 8.80E-9 2.20E-6
116 8.40E-8 8.10E-6
117 1.80E-8 4.45E-5
118 1.26E-8 5.00E-5
119 6.50E-7 5.00E-5
120 1.05E-7 5.00E-5
366

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
HCT116 TOPFlash ICso HCT116 FOPFlash ICso
Example No
[mo1/11 [mo1/11
121 8.25E-7 5.00E-5
122 2.02E-7 5.00E-5
123 5.60E-7 5.00E-5
124 7.25E-8 5.00E-5
125 1.70E-6 5.00E-5
126 5.25E-8 5.00E-5
127 8.85E-7 5.00E-5
128 7.10E-7 5.00E-5
129 9.00E-7 5.00E-5
130 3.18E-7 5.00E-5
131 5.10E-8 5.00E-5
132 3.55E-8 2.00E-5
133 5.46E-8 5.00E-5
134 1.66E-8 5.20E-6
135 8.48E-8 5.00E-5
136 2.14E-8 5.00E-5
137 2.72E-7 2.00E-5
138 1.50E-7 5.00E-5
139 5.00E-7 2.50E-5
140 2.93E-7 1.00E-5
141 6.80E-7 5.00E-5
142 1.18E-7 7.15E-6
143 2.04E-7 5.00E-5
144 1.95E-7 5.00E-5
145 1.52E-7 5.00E-5
146 3.65E-7 5.00E-5
147 2.20E-6 5.00E-5
148 2.05E-7 3.65E-5
149 7.04E-7 4.75E-5
150 7.60E-8 5.00E-5
151 7.10E-8 5.00E-5
152 2.00E-7 5.00E-5
153 1.32E-7 3.00E-5
154 4.20E-7 5.00E-5
155 5.92E-7 3.25E-5
156 5.42E-7 5.00E-5
157 9.66E-8 5.00E-5
158 7.36E-8 2.18E-5
159 4.14E-8 5.00E-5
160 9.48E-7 2.80E-5
367

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
HCT116 TOPFlash ICso HCT116 FOPFlash ICso
Example No
[mo1/11 [mo1/11
161 3.25E-7 1.00E-5
162 8.55E-8 5.00E-5
163 5.70E-8 5.00E-5
164 2.20E-7 5.00E-5
165 5.10E-8 7.20E-6
166 1.48E-7 3.90E-6
167 6.85E-7 5.00E-5
168 1.08E-6 1.20E-5
169 6.60E-8 5.00E-5
170 1.18E-7 5.00E-5
171 1.02E-7 5.00E-5
172 8.55E-7 5.00E-5
173 5.20E-7 5.00E-5
174 3.80E-6 5.00E-5
175 2.15E-7 7.10E-6
176 3.15E-7 5.00E-5
177 4.60E-7 3.50E-5
178 4.24E-8 3.80E-6
179 3.62E-7 5.00E-5
180 1.48E-7 9.80E-6
181 5.30E-8 5.00E-5
182 2.88E-7 4.40E-5
183 2.90E-8 5.00E-5
184 1.96E-7 1.10E-5
185 1.60E-7 1.00E-5
186 9.55E-8 5.40E-6
187 1.75E-7 4.20E-5
188 1.20E-7 5.50E-6
189 1.38E-7 1.00E-5
190 8.70E-8 9.50E-6
191 4.10E-6 5.00E-5
192 1.35E-7 1.24E-5
193 1.48E-7 8.80E-6
194 3.99E-8 3.50E-5
195 2.22E-7 5.00E-5
196 1.43E-7 5.00E-5
197 1.20E-6 3.40E-5
198 1.44E-7 1.50E-5
199 7.17E-8 8.80E-6
200 1.90E-7 6.40E-6
368

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
HCT116 TOPFlash ICso HCT116 FOPFlash ICso
Example No
[mo1/11 [mo1/11
201 1.06E-7 2.86E-5
202 2.00E-7 5.80E-6
203 1.24E-7 1.52E-5
204 7.65E-8 3.28E-5
205 2.02E-8 1.82E-5
206 8.76E-8 3.65E-5
207 1.53E-7 8.55E-6
208 1.04E-8 9.70E-6
209 1.12E-7 1.10E-5
210 1.52E-7 2.95E-5
211 4.02E-8 2.46E-5
212 1.80E-7 5.00E-5
213 1.40E-7 5.00E-5
214 3.75E-7 6.30E-6
215 2.45E-7 3.30E-6
216 2.60E-7 3.60E-6
217 4.38E-7 5.00E-5
218 3.30E-7 1.50E-5
219 2.45E-7 5.00E-5
220 3.75E-7 1.30E-5
221 2.35E-7 1.22E-5
222 2.63E-7 1.52E-5
223 2.38E-7 1.71E-5
224 3.82E-7 5.00E-5
225 2.37E-7 1.12E-5
226 2.45E-7 6.50E-6
227 2.45E-7 1.02E-5
228 2.87E-6 2.90E-5
229 2.30E-6 5.00E-5
230 7.20E-7 5.00E-5
231 1.02E-6 5.00E-5
232 2.20E-6 5.00E-5
233 9.85E-7 5.00E-5
234 6.35E-7 4.05E-5
235 1.31E-6 5.00E-5
236 2.76E-7 5.00E-5
237 1.39E-7 1.30E-5
238 1.75E-6 5.00E-5
239 2.89E-6 5.00E-5
240 1.18E-6 5.00E-5
369

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
HCT116 TOPFlash ICso HCT116 FOPFlash ICso
Example No
[mo1/11 [mo1/11
241 1.82E-6 5.00E-5
242 7.53E-7 5.00E-5
243 2.80E-8 7.70E-6
244 1.20E-7 5.00E-5
245 7.85E-9 5.20E-6
246 4.75E-8 2.78E-5
247 1.10E-8 7.20E-6
248 3.40E-7 5.00E-5
249 1.98E-7 3.80E-5
250 1.92E-7 3.10E-5
251 2.20E-7 1.60E-5
252 2.30E-6 5.00E-5
253 4.04E-6 5.00E-5
254 4.34E-6 5.00E-5
255 2.10E-6 5.00E-5
256 2.40E-7 5.00E-5
257 1.70E-8 5.00E-5
258 4.55E-8 2.40E-5
259 1.19E-7 5.00E-5
260 1.23E-7 9.80E-6
261 1.50E-7 5.00E-5
262 1.95E-7 5.00E-5
263 2.50E-7 5.00E-5
264 2.55E-7 5.00E-5
265 3.20E-7 5.00E-5
266 3.45E-7 5.00E-5
267 3.65E-7 5.00E-5
268 3.65E-7 5.00E-5
269 3.75E-7 5.00E-5
270 3.90E-7 5.00E-5
271 4.80E-7 5.00E-5
272 5.45E-7 5.00E-5
273 9.30E-7 2.70E-5
274 3.02E-6 5.00E-5
Ref. 1.38E-6 3.10E-6
"Ref." in Table 2 means the compound niclosamide disclosed in prior art
(compound 1-8 on page 36
of W02011/035321A1) which is less selective than the compounds of the present
invention.
370

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Some of the compounds of general formula (I) show low solubility in aqueous
media and organic
solvents. This can affect the possibility to assess the activity of such
compounds with the described
assays. For example, the ICso value we determined for 4-methoxy-3-[(morpholin-
4-ylacetypamino]-N-
(5-phenyl-1,3,4-thiadiazol-2-yl)benzamide in the HCT116 TOPFlash assay was
higher than expected.
But it turned out that the solubility of this compound was determined to be
lower than 0.1 mg/L or
0.22 umol/L, respectively in a buffer at pH6.5. Therefore, the high ICso value
of the compound might
be a result of the low solubility.
Measurement of the inhibitory activity of selected compounds on the Wildtype
Wnt signaling
cascade
In order to discover and characterize small molecules which inhibit the
wildtype Wnt pathway, a
cellular reporter assay was employed. The corresponding assay cell was
generated by transfection of
the mammalian cell line HEK293 (ATCC, #CRL-1573) with the Super TopFlash
vector (Morin, Science
275, 1997, 1787-1790; Molenaar et al., Cell 86 (3), 1996, 391-399). The HEK293
cell line is cultivated
at 37 C and 5% CO2 in DMEM (Life Technologies, #41965-039), supplemented with
2 mM glutamine,
mM HEPES, 1.4 mM pyruvate, 0.15% Na-bicarbonate and 10% foetal bovine serum
(GIBCO,
#10270). Stable transfectants were generated by selection with 300 ug/m1
Hygromycin.
In a parallel approach, HEK293 cells were cotransfected with the FOP control
vector and pcDNA3.
The FOP vector is identical to the TOP construct, but it contains instead of
functional TCF elements a
20 randomized, non-functional sequence. For this transfection a stable
transfected cell line was
generated as well, based on selection with Geneticin (1 mg/m!).
In preparation of the assay, the two cell lines were plated 24 hours before
beginning the test at
10000 cells per well in a 384 micro titre plate (MTP) in 30 ul growth medium.
Before compound
testing a dose response curve for the Wnt dependent luciferase expression was
recorded by
stimulating the assay cell line with human recombinant Wnt-3a (R&D, #5036-WN-
010) at different
concentrations for 16 hours at 37 C and 5% CO2 followed by subsequent
luciferase measurement, to
determine the Wnt-3a ECso for the HEK293 TOP cell line on the day of testing.
The recombinant
human Wnt-3a was thereby applied between 2500 and 5 ng/ml in two-fold dilution
steps.
Selective inhibitory activity for small molecules on the wildtype Wnt pathway
was determined after
parallel incubation of both (TOP and FOP) HEK293 reporter cell lines with a
compound dilution series
from 50 uM to 15 nM in steps of 3.16-fold dilutions in CAFTY buffer (130 mM
NaCI, 5 mM KCI, 20 mM
HEPES, 1 mM MgC12, 5 mM NaHCO3, pH 7.4) containing 2 mM Ca2+ and 0.01% BSA.
The compounds were thereby serially prediluted in 100% DMSO and thereafter 50
fold into the
CAFTY compound dilution buffer (described above). From this dilution 10 ul
were added in
combination with the ECso concentration of recombinant Wnt3a to the cells in
30 ul growth medium
371

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
and incubated for 16 hours at 37 C and 5% CO2. Thereafter luciferase assay
buffer (1:1 mixture of
luciferase substrate buffer (20 mM Tricine, 2.67 mM MgSO4, 0.1 mM EDTA, 4 mM
DTI, 270 uM
Coenzyme A, 470 uM Luciferin, 530 uM ATP, ph adjusted to pH 7.8 with a
sufficient volume of 5M
NaOH) and Triton buffer (30 ml Triton X-100, 115 ml glycerol, 308 mg
Dithiothreitol, 4.45 g Na2H PO4
2 H20, 3.03 g TRIS HCI (CAS Number 1185-53-1), ad 11 H20, pH 7.8) was added in
an equal volume to
determine luciferase expression as a measure of Wnt signaling activity in a
luminometer. The Wnt
inhibitory activity was determined as ICso of resulting dose response curves.
Table 3
HEK TOP OncoFlash ICso HEK FOP ICso
Example No
[mo1/14 [mo1/14
1 3.30E-6 5.00E-5
2 1.20E-7 6.90E-6
6 1.30E-8 2.80E-6
7 3.80E-8 7.40E-6
8 1.30E-7 8.10E-6
9 9.00E-9 8.20E-6
9.20E-8 1.90E-5
11 7.00E-7 8.10E-6
14 5.50E-7 5.00E-5
4.80E-8 5.00E-5
16 9.20E-8 5.00E-5
17 3.30E-8 5.00E-5
19 9.90E-7 5.00E-5
2.20E-6 5.00E-5
21 1.40E-7 5.80E-6
22 1.10E-6 2.40E-5
24 6.50E-7 1.70E-5
9.00E-8 1.00E-5
26 3.50E-7 5.00E-5
27 1.00E-6 5.00E-5
28 8.00E-7 2.00E-5
1.40E-6 5.00E-5
32 2.60E-7 4.00E-6
33 3.70E-7 7.40E-6
9.10E-7 5.00E-5
37 2.80E-7 5.00E-5
372

CA 02907535 2015-09-17
WO 2014/147021 PCT/EP2014/055300
38 2.00E-7 5.00E-5
40 5.30E-7 5.00E-5
41 7.20E-7 5.00E-5
42 1.06E-7 5.00E-5
43 1.10E-7 5.00E-5
44 1.96E-007 5.00E-5
45 1.90E-7 5.00E-5
46 6.90E-7 5.00E-5
47 9.00E-8 5.00E-5
48 1.30E-7 5.00E-5
49 4.50E-8 5.00E-5
50 9.70E-8 5.00E-5
51 3.73E-7 5.00E-5
53 8.20E-7 5.00E-5
54 1.30E-7 5.00E-5
56 1.90E-7 5.00E-5
57 5.00E-7 5.00E-5
58 2.70E-7 5.00E-5
60 2.90E-7 4.10E-5
61 1.20E-7 5.00E-5
62 1.80E-7 5.00E-5
63 1.40E-7 5.00E-5
64 3.70E-8 5.00E-5
65 1.50E-7 5.00E-5
66 1.30E-7 5.00E-5
67 1.30E-8 5.00E-5
68 5.17E-9 5.00E-5
70 8.50E-8 6.30E-6
71 1.60E-7 5.00E-5
75 2.70E-8 5.00E-5
76 5.40E-8 5.00E-5
79 6.40E-8 1.50E-5
80 1.50E-7 1.00E-5
81 1.50E-8 5.00E-5
95 5.00E-8 5.00E-5
105 3.00E-7 5.00E-5
373

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
111 5.80E-008 5.00E-5
113 8.90E-7 5.00E-5
115 5.20E-8 4.70E-6
117 1.40E-8 1.00E-5
118 5.70E-8 1.60E-5
124 8.40E-8 1.30E-5
126 3.60E-8 5.00E-5
131 1.00E-7 1.30E-5
132 7.00E-8 1.10E-5
133 1.30E-7 5.00E-5
134 3.10E-8 1.20E-5
136 7.50E-8 5.00E-5
151 2.50E-7 5.00E-5
159 5.40E-8 5.00E-5
QPCR protocol
Real-time RT-PCR using a TaqMan fluorogenic detection system is a simple and
sensitive assay for
quantitative analysis of gene transcription. The TaqMan fluorogenic detection
system can monitor
PCR in real time using a dual-labeled fluorogenic hybridization probe (TaqMan
probe) and a
polymerase with 5'-3 exonuclease activity.
Cells from different cancer cell lines (as HCT116, but not limited to) were
grown at 500-1000
cells/well in 384 well cell culture plates. For cell lysis the cell medium was
carefully removed. The
cells were washed carefully once with 50 uL/well PBS. Then 9.75 uL/well cell
lysis buffer (50 mM TRIS
HCI pH 8,0, 40 mM NaCI, 1,5 mM MgC12, 0,5 % IGEPAL CA 630, 50mM Guanidium
thiocyanate) and
0.25 uL RNASeOUT (40 U/ul, Invitrogen, 10777-019)) per well were added. The
plate was incubated
for 5 min at room temperature. Then 30 uL DNAse/RNAse-free water per well
added and the lysates
were mixed. For the One-Step RT-PCR 2 uL lysate (each) was transferred to a
384 well PCR plate. The
PCR reaction was composed by 5 uL 2x One Step RT qPCR MasterMix Plus, 0.05 uL
Euroscript
RT/RNAse Inhibitor (50 U/ul, 20 U/ 1) and 200 nM of the appropriate
Primer/Hydrolysis Probe mix
(primer sequences of forward, reverse and probe are given below for each
analysed gene of interest
or house keeping gene). 10 uL water were added per well. Seal the plate with
an adhesive optical
film. The RT-PCR protocol was setup with 30 min 48 C, then 10 min 95 C
followed by 50 cycles of 15
sec 95 C/1 min 60 C and a cooling step of 40 C for 30 sec using a Lightcycler
L5440 from Roche.
374

CA 02907535 2015-09-17
WO 2014/147021
PCT/EP2014/055300
Relative expression was calculated using CP values from the gene of interest
(e.g. AXIN2, but not
limited to) and a house keeping gene (L32).
Used primers
L32 (forward primer: AAGTTCATCCGGCACCAGTC; reverse primer:
TGGCCCTTGAATCTTCTACGA;
probe: CCCAGAGGCATTGACAACAGGG)
AXI N2 (forward primer: AGGCCAGTGAGTTGGTTGTC; reverse primer:
AGCTCTGAGCCTTCAGCATC;
probe: TCTGTGGGGAAGAAATTCCATACCG)
Sequence Listings
SEQ ID NO
1 AAGTTCATCCGGCACCAGTC
2 TGGCCCTTGAATCTTCTACGA
3 CCCAGAGGCATTGACAACAGGG
4 AGGCCAGTGAGTTGGTTGTC
5 AGCTCTGAGCCTTCAGCATC
6 TCTGTGGGGAAGAAATTCCATACCG
375

A single figure which represents the drawing illustrating the invention.

For a clearer understanding of the status of the application/patent presented on this page, the site Disclaimer , as well as the definitions for Patent , Administrative Status , Maintenance Fee  and Payment History  should be consulted.

Admin Status

Title Date
Forecasted Issue Date Unavailable
(86) PCT Filing Date 2014-03-17
(87) PCT Publication Date 2014-09-25
(85) National Entry 2015-09-17
Examination Requested 2019-01-30

Abandonment History

There is no abandonment history.

Maintenance Fee

Description Date Amount
Last Payment 2019-03-07 $200.00
Next Payment if small entity fee 2020-03-17 $100.00
Next Payment if standard fee 2020-03-17 $200.00

Note : If the full payment has not been received on or before the date indicated, a further fee may be required which may be one of the following

  • the reinstatement fee set out in Item 7 of Schedule II of the Patent Rules;
  • the late payment fee set out in Item 22.1 of Schedule II of the Patent Rules; or
  • the additional fee for late payment set out in Items 31 and 32 of Schedule II of the Patent Rules.

Payment History

Fee Type Anniversary Year Due Date Amount Paid Paid Date
Filing $400.00 2015-09-17
Maintenance Fee - Application - New Act 2 2016-03-17 $100.00 2016-03-07
Maintenance Fee - Application - New Act 3 2017-03-17 $100.00 2017-03-13
Maintenance Fee - Application - New Act 4 2018-03-19 $100.00 2018-03-08
Request for Examination $800.00 2019-01-30
Maintenance Fee - Application - New Act 5 2019-03-18 $200.00 2019-03-07
Current owners on record shown in alphabetical order.
Current Owners on Record
BAYER PHARMA AKTIENGESELLSCHAFT
Past owners on record shown in alphabetical order.
Past Owners on Record
None
Past Owners that do not appear in the "Owners on Record" listing will appear in other documentation within the application.

To view selected files, please enter reCAPTCHA code :




Filter Download Selected in PDF format (Zip Archive)
Document
Description
Date
(yyyy-mm-dd)
Number of pages Size of Image (KB)
Abstract 2015-09-17 2 94
Claims 2015-09-17 30 977
Description 2015-09-17 375 11,674
Representative Drawing 2015-10-19 1 2
Cover Page 2016-01-07 2 56
Patent Cooperation Treaty (PCT) 2015-09-17 9 329
Patent Cooperation Treaty (PCT) 2015-09-17 2 90
International Preliminary Report Received 2015-09-17 9 304
International Search Report 2015-09-17 6 181
National Entry Request 2015-09-17 5 159
Voluntary Amendment 2015-09-17 3 73
Acknowledgement of National Entry Correction 2015-12-30 2 68
Request for Examination 2019-01-30 2 69
Description 2015-09-18 375 12,291
Examiner Requisition 2020-02-25 7 373

Choose a BSL submission then click the button to download the file.

If you have any difficulty accessing content, you can call the Client Service Centre at 1-866-997-1936 or send them an e-mail at CIPO Client Service Centre.

Please note that files with extensions .pep and .seq that were created by CIPO as working files might be incomplete and are not to be considered official communication.

BSL Files

To view selected files, please enter reCAPTCHA code :