Note: Descriptions are shown in the official language in which they were submitted.
DETECTION OF NUCLEOTIDE VARIATION ON TARGET NUCLEIC ACID
SEQUENCE
to BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates to the detection of a nucleotide variation on a
target nucleic acid sequence using an amplification blocker and a VD-PTOCE
(Variation Detection by PTO Cleavage and Extension) assay.
DESCRIPTION OF THE RELATED ART
DNA hybridization is a fundamental process in molecular biology and is
affected
by ionic strength, base composition, length of fragment to which the nucleic
acid has
been reduced, the degree of mismatching, and the presence of denaturing
agents.
DNA hybridization-based technologies would be a very useful tool in specific
nucleic
acid sequence determination and clearly be valuable in clinical diagnosis,
genetic
research, and forensic laboratory analysis.
However, the conventional methods and processes depending mostly on
hybridization are very likely to produce false positive results due to non-
specific
hybridization between probes and non-target sequences. Therefore, there remain
problems to be solved for improving their reliability.
Besides probe hybridization processes, several approaches using additional
enzymatic reactions, for example, TaqMae probe method, have been suggested.
In TaqManTm probe method, the labeled probe hybridized with a target nucleic
CA 2913873 2017-09-25
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
acid sequence is cleaved by a 5' nuclease activity of an upstream primer-
dependent
DNA polymerase, generating a signal indicating the presence of a target
sequence
(U.S. Pat. Nos. 5,210,015, 5,538,848 and 6,326,145). The TaqManTm probe method
suggests two approaches for signal generation: polymerization-dependent
cleavage
and polymerization-independent cleavage. In polymerization-dependent cleavage,
extension of the upstream primer must occur before a nucleic acid polymerase
encounters the 5'-end of the labeled probe. As the extension reaction
continues, the
polymerase progressively cleaves the 5'-end of the labeled probe. In
polymerization-
independent cleavage, the upstream primer and the labeled probe are hybridized
with
a target nucleic acid sequence in close proximity such that binding of the
nucleic acid
polymerase to the 3'-end of the upstream primer puts it in contact with the 5'-
end of
the labeled probe to release the label. In addition, the TaqManT" probe method
discloses that the labeled probe at its 5'-end having a 5'-tail region not-
hybridizable
with a target sequence is also cleaved to form a fragment comprising the 5'-
tail region.
There have been reported some methods in which a probe having a 5'-tail
region non-complementary to a target sequence is cleaved by 5' nuclease to
release a
fragment comprising the 5'-tail region.
For instance, U.S. Pat. No. 5,691,142 discloses a cleavage structure to be
digested by 5' nuclease activity of DNA polymerase. The cleavage structure is
exemplified in which an oligonucleotide comprising a 5' portion non-
complementary to
and a 3' portion complementary to a template is hybridized with the template
and an
upstream oligonucleotide is hybridized with the template in close proximity.
The
cleavage structure is cleaved by DNA polymerase having 5' nuclease activity or
modified DNA polymerase with reduced synthetic activity to release the 5'
portion
non-complementary to the template. The released 5' portion is then hybridized
with
an oligonucleotide having a hairpin structure to form a cleavage structure,
thereby
inducing progressive cleavage reactions to detect a target sequence.
U.S. Pat. No. 7,381,532 discloses a process in which the cleavage structure
having the upstream oligonucleotide with blocked 3'-end is cleaved by DNA
2
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
polymerase having 5' nuclease activity or FEN nuclease to release non-
complementary
5' flap region and the released 5' flap region is detected by size analysis or
interactive
dual label. U.S. Pat. No 6,893,819 discloses that detectable released flaps
are
produced by a nucleic acid synthesis dependent, flap-mediated sequential
amplification method. In this method, a released flap from a first cleavage
structure
cleaves, in a nucleic acid synthesis dependent manner, a second cleavage
structure to
release a flap from the second cleavage structure and the release flaps are
detected.
U.S. Pat. No 7,309,573 disclose a method including formation of a released
flap
produced by a nucleic acid synthesis; extension of the released flap; cleavage
of an
to oligonucleotide during extension of the flap and detection of a signal
generated by the
cleavage of the oligonucleotide.
By hybridization of fluorescence-labeled probes in a liquid phase, a plurality
of
target nucleic acid sequences may be simultaneously detected using even a
single
type of a fluorescent label by melting curve analysis. However, the
conventional
technologies for detection of target sequences by 5' nuclease-mediated
cleavage of;
interactive-dual labeled probes require different types of fluorescent labels
for
different target sequences in multiplex target detection, which limits the
number of
target sequences to be detected due to limitation of the number of types of
fluorescent labels.
U.S. Pat. Appin. Pub. 2008-0241838 discloses a target detection method using
cleavage of a probe having a 5' portion non-complementary to a target nucleic
acid
sequence and hybridization of a capture probe. A label is positioned on the
non-
complementary 5' portion. The labeled probe hybridized with the target
sequence is
cleaved to release a fragment, after which the fragment is then hybridized
with the
capture probe to detect the presence of the target sequence. In this method,
it is
necessary that an uncleaved/intact probe is not hybridized with the capture
probe. For
that, the capture probe having a shorter length has to be immobilized onto a
solid
substrate. However, such a limitation results in lower efficiency of
hybridization on a
solid substrate and also in difficulties in optimization of reaction
conditions.
3
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
Therefore, there remain long-felt needs in the art to develop novel approaches
for detection of a target sequence, preferably multiple target sequences, in a
liquid
phase and on a solid phase by not only hybridization but also enzymatic
reactions
such as 5' nucleolytic reaction in a more convenient, reliable and
reproducible manner.
Furthermore, a novel target detection method not limited by the number of
types of
labels (particularly, fluorescent labels) is also needed in the art.
In the meantime, nucleotide variations are important in the research and
clinical fields. Of them, single nucleotide polymorphisms (SNPs) are most
commonly
found in a human genome and serve as markers for disease-related loci and
pharmacogenetics (Landegren et al., 1998; Roses, 2000). SNPs are found at the
rate
of approximately 1 per 1000 bp in a human genome and their total number is
estimated about three millions. For the detection of nucleotide variations
such as SNP,
deletion, insertion and translocation, various allelic discrimination
technologies have
been reported.
The allele-specific TaqMan probe is designed such that it is hybridized only
with'
perfectly matched target sequences in extension step of PCR. The TaqMan probe
has
a reporter molecule and a quencher molecule capable of quenching the
fluorescent
signal from the reporter molecule. The TaqMan probe hybridized with target
sequences is digested by 5' nuclease activity of Taq DNA polymerase and the
reporter
molecule and the quencher molecule are separated to generate a target signal.
For
allelic discrimination, 13-20 mer probes conjugated with minor groove binder
(MGB)
are used (Livak, et al., Genet. Anal. 14:143-149(1999)). Since the allelic
discrimination
method using the TaqMan probe employs not only hybridization reaction but also
enzymatic reactions of 5' nuclease activity, its specificity is enhanced.
However, the
method has serious troublesome such as difficulties in allelic-specific probe
design and
optimized reaction conditions which have to discriminate difference by one
mismatch.
In addition, the conjugate with MGB is one of troubleshootings in the allele-
specific
TaqMan probe.
PCR clamping methods are disclosed for detection of minority mutant
4
CA 2913873 2017-03-15
population by preferential amplification of Mutant allele with PNA or LNA
clamp. The
representative PCR clamping method using PNA is disclosed in Henrik et al.,
Nucleic
Acid Research 21:5332-5336(1993) and Luo et al., Nudeic Acid Research Vol. 34,
No
2 e12 (2006). However, the PCR clamping methods are likely not to perfectly
block
amplification of the wild-type allele.
Therefore, there remain long-felt needs in the art to develop novel approaches
for detection of a nucleotide variation in a more convenient, reliable and
reproducible
manner, which is capable of being free from shortcomings of the conventional
technologies.
15
SUMMARY OF THE INVENTION
The present inventors have made intensive researches to develop novel
approaches to detect a target nucleotide variation on a target nucleic acid in
low-
abundance with more improved accuracy and convenience, inter alia, in a
multiplex
manner. As a result, we have established novel protocols for detection of a
target
nucleotide variation on a target nucleic acid in low-abundance by improving a
VD-
PTOCE assay developed by the present inventors (see PCT/KR2013/001492). The
present protocols are well adopted to liquid phase reactions as well as solid
phase
reactions, and ensure detection of multiple nucleotide variations in low-
abundance
with more improved accuracy and convenience.
Therefore, it is an object of this invention to provide a method for detecting
a
target nucleotide variation on a target nucleic acid sequence using an
amplification
blocker and a VD-PTOCE assay.
5
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
It is another object of this invention to provide a kit for detecting a target
nucleotide variation on a target nucleic acid sequence using an amplification
blacker
and a VD-PTOCE assay.
Other objects and advantages of the present invention will become apparent
from the detailed description to follow taken in conjugation with the appended
claims
and drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows the schematic structures of PTO (Probing and Tagging
Oligonucleotide) and CTO (Capturing and Templating Oligonucleotide) used in
PTO
cleavage and extension assay (PTOCE assay). Preferably, the 3'-ends of the PTO
and
CTO are blocked to prohibit their extension. The PTO-NV is a modification of
the PTO, ,
further comprising a nucleotide variation discrimination site comprising a
complementary sequence to the target nucleotide variation on the target
nucleic acid, õ
positioned on a 5'-end part of the 3'-targeting portion.
Fig. 2 schematically represents the selective amplification of a target
nucleic acid
sequence containing a target nucleotide variation (i.e., target variation
containing
template) by using an amplification blocker.
Fig. 3 schematically represents the selective detection of a target nucleotide
variation by the AB-VD PTOCE of the present invention.
Fig. 4 schematically represents a co-working process of an amplification
blocker
and PTO-NV for detection of a target nucleotide variation on a target nucleic
acid
sequence. The amplification blocker and PTO-NV are designed to be located on
the
same strand of a target nucleic acid sequence.
Fig. 5 schematically represents the selective detection of a target nucleotide
variation by the AB-VD PTOCE of the present invention using the CTO labeled
with an
interactive dual label.
Fig. 6 schematically represents the selective detection of a target nucleotide
6
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
variation by the AB-VD PTOCE of the present invention using the SO (signaling
oligonucleotide).
Fig. 7 schematically represents the selective detection of a target nucleotide
variation by the AB-VD PTOCE of the present invention using the HO
(hybridizing
oligonucleotide).
Figs. 8A and 8B represent the results of the improvement of minority detection
limit by the AB-VD PTOCE of the present invention.
Figs. 9A and 9B represent the results of the improvement of minority detection
limit by the AB-VD PTOCE of the present invention using SO.
Figs. 10A and 10B represent the results of the improvement of minority
detection
limit by the AB-VD PTOCE of the present invention using HO.
DETAILED DESCRIPTION OF THIS INVENTION
In one aspect of the present invention, there is provided a method for
detecting a target nucleotide variation on a target nucleic acid sequence
using an
amplification blocker and a VD-PTOCE assay, comprising:
(a) hybridizing the target nucleic acid sequence with a primer pair comprising
an upstream primer and a downstream primer for amplification of the target
nucleic
acid, the amplification blocker having the resistance to 5' nuclease cleavage
and a
PTO-NV (Probing and Tagging Oligonucleotide for Nucleotide Variation); wherein
each
of the upstream primer and the downstream primer comprises a hybridizing
nucleotide sequence complementary to the target nucleic acid sequence; the
amplification blocker comprises a complementary sequence to a non-target
nucleotide
variation different from the target nucleotide variation on the target nucleic
acid
sequence and the PTO-NV comprises (i) a 3'-targeting portion comprising a
hybridizing nucleotide sequence complementary to the target nucleic acid
sequence,
(ii) a 5'-tagging portion comprising a nucleotide sequence non-complementary
to the
target nucleic acid sequence, and (iii) a nucleotide variation discrimination
site,
7
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
comprising a complementary sequence to the target nucleotide variation on the
target
nucleic acid, positioned on a 5'-end part of the 3'-targeting portion;
wherein the amplification blocker is hybridized with the target nucleic acid
sequence having the non-target nucleotide variation and not hybridized with
the
target nucleic acid sequence having the target nucleotide variation; wherein
the 3'-
targeting portion of the PTO-NV is hybridized with the target nucleic acid
sequence
and the 5'-tagging portion the PTO-NV is not hybridized with the target
nucleic acid
sequence;
wherein the upstream primer is located upstream of the PTO-NV; the
amplification blocker is located downstream of the upstream primer or the
downstream primer; and the amplification blocker and the PTO-NV are located
between the upstream primer and the downstream primer;
(b) contacting the resultant of the step (a) to an enzyme having a 5' nuclease
activity under conditions for cleavage of the PTO-NV; wherein the upstream
primer
induces through its extended strand the cleavage of the PTO-NV by the enzyme
having the 5' nuclease activity; wherein the hybridization of the
amplification blocker
with the target nucleic acid sequence having the non-target nucleotide
variation
inhibits the extension of the primer located upstream of the amplification
blocker,
thereby blocking the amplification of the target nucleic acid sequence having
the non-
target nucleotide variation;
wherein when the PTO-NV is hybridized with the target nucleic acid sequence
having the target nucleotide variation complementary to the nucleotide
variation
discrimination site, the 5'-end part of the 3'-targeting portion forms a
double strand
with the target nucleic acid sequence to induce cleavage from a first initial
cleavage
site and a first fragment is released; wherein when the PTO-NV is hybridized
with the
target nucleic acid sequence having the non-target nucleotide variation non-
complementary to the nucleotide variation discrimination site, the 5'-end part
of the
3'-targeting portion does not form a double strand with the target nucleic
acid
sequence to induce cleavage from a second initial cleavage site located
downstream
8
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
of the first initial cleavage site and a second fragment is released; wherein
the second
fragment comprises an additional 3'-end portion allowing the second fragment
different from the first fragment;
(c) hybridizing the fragment released from the PTO-NV with a CTO (Capturing
and Templating Oligonucleotide); wherein the CTO comprises in a 3' to 5'
direction (i)
a capturing portion comprising a nucleotide sequence complementary to the 5'-
tagging portion or a part of the 5'-tagging portion of the PTO-NV and (ii) a
templating
portion comprising a nucleotide sequence non-complementary to the 5'-tagging
portion and the 3'-targeting portion of the PTO-NV; wherein the first fragment
or the
second fragment released from the PTO-NV is hybridized with the capturing
portion of
the CTO;
(d) performing an extension reaction using the resultant of the step (c)
and a
template-dependent nucleic acid polymerase; wherein when the first fragment is
hybridized with the capturing portion of the CTO, it is extended to form an
extended
strand comprising a extended sequence complementary to the templating portion
of
the CTO; wherein when the second fragment is hybridized with the capturing
portion
of the CTO, it is not extended; and
(e) detecting the presence of the extended strand, whereby the presence of
the extended strand indicates the presence of the target nucleotide variation.
The present inventors have made intensive researches to develop novel
approaches to detect a target nucleotide variation on a target nucleic acid in
low-
abundance. As a result, we have established novel protocols for detection of a
target
nucleotide variation on a target nucleic acid in low-abundance by improving a
VD-
PTOCE assay developed by the present inventors (see PCT/KR2013/001492). The VD-
PTOCE assay is a particular embodiment of a PTOCE assay developed by the
present
inventors (see WO 2012/096523) for detecting nucleotide variations. The
present
protocols are well adopted to liquid phase reactions as well as solid phase
reactions,
and ensure detection of multiple nucleotide variations in low-abundance with
more
9
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
improved accuracy and convenience.
The present invention is aimed to effective detection of a target nucleotide
variation on a target nucleic acid in low-abundance by applying a preferential
amplification of certain sequence using an amplification blocker to a VD-PTOCE
assay
using a PTO-NV (Probing and Tagging Oligonucleotide for Nucleotide Variation).
The present invention employs successive events followed by an amplification
blocker and a PTO-NV hybridization; cleavage of PTO-NV (Probing and Tagging
Oligonucleotide for Nucleotide Variation) and extension; formation of a
nucleotide
variation-dependent extended strand; and detection of the extended strand.
Therefore, it is named as AB-VD PTOCE (Amplification Blocker-Involved
Variation
Detection by PTO Cleavage and Extension) assay.
Clinical samples frequently contain a low-amount of mutant allele in an excess
of wild-type allele. The excess of wild-type allele can exhaust essential
reagents
during amplification process and tends to mask the mutant allele's signal. To
overcome this problem, a multitude of methods have been suggested to
selectively
amplify mutant allele while suppressing the amplification of wild-type allele.
As representatives, the methods using oligonucleotides containing PNA or LNA
as an amplification blocker have been reported (US 2004/0014105, US 7,803,543,
US
8,206,929, H. Orum., Nucleic Acids Research 21:5332-5336(1993) A. Senescau et
al.,
Journal of Clinical Microbiology, 3304-3308(2005), Y. Nagai et al., Cancer Res
65:7276-7282(2005), Henrik et al., Nucleic Acid Research 21:5332-5336(1993)
and
Luo et al., Nucleic Acid Research Vol. 34, No 2 e12 (2006)).
In general, the amplification blockers are hybridized only with templates
having
perfectly complementary sequence to the amplification blockers under the same
condition, which are designed not to be hybridized with templates having even
single
mismatch. The template hybridized with the amplification blocker inhibiting
primer
annealing or chain elongation is not amplified and only that not hybridized
with the
amplification blocker is amplified. Nucleic acid analogues such as PNA and LNA
are
useful as amplification blockers in the senses that they show significant T,
differences
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
for even a single base difference.
Where polymerases used have nuclease activity, the amplification blocker is
required to possess the resistance to the nuclease activity.
Also, the methods usually demand additional probes for signal generation. The
amplification blocker may have labels.
Where a nucleotide variation region on a target nucleic acid sequence has two
distinct variants, the amplification blocker permits to effectively detect the
variant of
interest by amplifying the target nucleic acid sequence having the variant of
interest
but inhibiting amplification of the target nucleic acid sequence having the
other
to variant. In particular, the amplification blocker is very useful in
detection of low-
abundant mutant allele in clinical samples containing excess of wild-type
allele and
low-abundant mutant allele.
However, it is noteworthy that the amplification of wild-type allele may be
not
completely prevented by the amplification blocker. According to the present
invention
combining two technologies, i.e., the amplification blocker and the VD-PTOCE
assay
using the PTO-NV, it is possible to detect a very low-abundant mutant allele
that is not
detectable in conventional methods
The VD-PTOCE assay of the present invention uses the PTO-NV having the
nucleotide variation discrimination site positioned on the 5'-end part of the
3'-
targeting portion for selectivity of the PTO to a specific nucleotide
variation (see Fig.
1). Where the PTO-NV is hybridized with the target nucleic acid sequence
(i.e., match
template) having the nucleotide variation complementary to the nucleotide
variation
discrimination site, the 5'-end part of the 3'-targeting portion forms a
double strand
with the match template; however, where the PTO-NV is hybridized with a target
nucleic acid sequence (i.e., mismatch template) having a nucleotide variation
non-
complementary to the nucleotide variation discrimination site, the 5'-end part
of the
3'-targeting portion does not form a double strand with the mismatch template.
In the present application, a target nucleic acid sequence having a nucleotide
variation complementary to the nucleotide variation discrimination site of the
PTO-NV
11
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
is also described as "match template" for the PTO-NV. A target nucleic acid
sequence
having a nucleotide variation non-complementary to the nucleotide variation
discrimination site of the PTO is also described as "mismatch template" for
the PTO-
NV.
Unless otherwise indicated, the terms "match template" and "mismatch
template" used herein are determined with regard to the PTO-NV.
It is noteworthy that such distinct hybridization patterns on the nucleotide
variation of interest are responsible for differences in initial cleavage
sites of the PTO-
NV, thereby producing two types of PTO-NV fragments to give signal
differentiation
depending on the presence of the nucleotide variation of interest.
A first fragment is generated by cleavage of hybrid between the PTO-NV and
match template. A second fragment is generated by cleavage of hybrid between
the
PTO-NV and mismatch template. The second fragment comprises further
nucleotides
in its 3'-end portion than the first fragment.
The production of either the first fragment or the second fragment may be
distinctly detected by an extension reaction on the CTO.
Generally, the hybridization between a 3'-end part of primers and a template
is
very crucial to extension of primers in a stringent condition. In the present
invention,
the first fragment and the second fragment each is hybridized with the same
site of
the CTO. As described above, the second fragment comprises the additional 3'-
end
portion compared with the first fragment. By adjusting hybridization
conditions and a
sequence of the CTO opposed to the additional 3'-end portion of the second
fragment, only the first fragment may be permitted to extend.
The production of the extended strand by extension of the first fragment may
be detected by a variety of methods.
Figs. 2 and 3 schematically represent an embodiment of this invention. Figs. 2
and 3 are provided herein only for understanding the performance principle
underlying the present invention. Fig. 2 represents selective amplification of
the target
variation containing template with no amplification of the non-target
variation
12
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
containing template due to the amplification blocker. Fig. 3 represents
selective
formation of the extended strand. Actually, the selective formation of the
extended
strand may also occur during the amplification of the target variation
containing
template. As exemplified in Example 3, a detectable signal may be observed
after
several amplification cycles.
In Fig. 2, the upstream primer and the downstream primer amplify the target
variation containing template. However, the non-target variation containing
template
is not amplified due to the amplification blocker comprising a complementary
sequence to a non-target nucleotide variation. In Fig. 3, the nucleotide
variation
discrimination site of the PTO-NV comprises a complementary sequence to the
target
nucleotide variation. The PTO-NV are hybridized with the target variation
containing
template (match template), and the PTO-NV is cleaved at a first initial
cleavage site to
form a first fragment, along with the extension of the upstream primer,
thereby
forming the extended strand on the CTO. On the other hand, the PTO-NV
hybridized
with the non-target variation containing template (mismatch template) is
cleaved at a
second initial cleavage site to form a second fragment, along with the
extension of
the upstream primer, whereby the extended strand on the CTO is not formed.
As represented in Fig. 3, the PTO-NV may be hybridized with the two target
nucleic acid sequences each of which has a distinct variant. When the amount
of the
variant containing a non-target variation is significantly higher than that of
the variant
containing the target variation of interest, the PTO-NV is likely to be
uselessly cleaved
and consumed. The AB-VD PTOCE assay ensures the detection of multiple
nucleotide
variations in low-abundance with more improved accuracy and convenience by
improving the VD-PTOCE assay with adopting an amplification blocker.
The AB-VD PTOCE assay will be described in more detail as follows:
Step (a): Hybridization of a primer pair, an amplification blocker and a PTO-
NV with a target nucleic acid sequence
According to the present invention, a target nucleic acid sequence is first
13
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
hybridized with a primer pair, an amplification blocker and a PTO-NV (Probing
and
Tagging Oligonucleotide for Nucleotide Variation).
The term used herein "target nucleic acid", "target nucleic acid sequence" or
"target sequence" refers to a nucleic acid sequence of interest for detection,
which is
annealed to or hybridized with a probe or primer under hybridization,
annealing or
amplifying conditions.
The term "primer" as used herein refers to an oligonucleotide, which is
capable
of acting as a point of initiation of synthesis when placed under conditions
in which
synthesis of primer extension product which is complementary to a nucleic acid
strand
(template) is induced, i.e., in the presence of nucleotides and an agent for
polymerization, such as DNA polymerase, and at a suitable temperature and pH.
The term used herein "probe" refers to a single-stranded nucleic acid molecule
comprising a portion or portions that are substantially complementary to a
target
nucleic acid sequence.
Preferably, the probe and primer are single-stranded deoxyribonucleotide
molecules. The probes or primers used in this invention may be comprised of
naturally
occurring dNMP (i.e., dAMP, dGM, dCMP and dTMP), modified nucleotide, or non-
natural nucleotide. The probes or primers may also include ribonucleotides.
The primer must be sufficiently long to prime the synthesis of extension
products in the presence of the agent for polymerization. The exact length of
the
= primers will depend on many factors, including temperature, application,
and source
of primer. The term "annealing" or "priming" as used herein refers to the
apposition of
an oligodeoxynucleotide or nucleic acid to a template nucleic acid, whereby
the
apposition enables the polymerase to polymerize nucleotides into a nucleic
acid
molecule which is complementary to the template nucleic acid or a portion
thereof.
The term used "hybridizing" used herein refers to the formation of a double-
stranded nucleic acid from complementary single stranded nucleic acids. The
hybridization may occur between two nucleic acid strands perfectly matched or
substantially matched with some mismatches. The complementarity for
hybridization
14
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
may depend on hybridization conditions, particularly temperature.
The hybridization of a target nucleic acid sequence with a primer pair, an
amplification blocker and a PTO-NV may be carried out under suitable
hybridization
conditions routinely determined by optimization procedures. Conditions such as
temperature, concentration of components, hybridization and washing times,
buffer
components, and their pH and ionic strength may be varied depending on various
factors, including the length and GC content of oligonucleotide (primers and
PTO) and
the target nucleotide sequence. For instance, when a relatively short
oligonucleotide
is used, it is preferable that low stringent conditions are adopted. The
detailed
conditions for hybridization can be found in Joseph Sambrook, et al.,
Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.(2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-
Verlag
New York Inc. N.Y.(1999).
There is no intended distinction between the terms "annealing" and
"hybridizing", and these terms will be used interchangeably.
Each of the upstream primer and the downstream primer comprises a
hybridizing nucleotide sequence complementary to a target nucleic acid
sequence.
The 3'-targeting portion of the PTO-NV comprises a hybridizing nucleotide
sequence
complementary to a target nucleic acid sequence. The term "complementary" is
used
herein to mean that primers or probes are sufficiently complementary to
hybridize
selectively to a target nucleic acid sequence under the designated annealing
conditions or stringent conditions, encompassing the terms "substantially
complementary" and "perfectly complementary", preferably perfectly
complementary.
The 5'-tagging portion of the PTO-NV has a nucleotide sequence non-
complementary to the target nucleic acid sequence. The templating portion of
the
CTO (Capturing and Templating Oligonucleotide) has a nucleotide sequence non-
complementary to the 5'-tagging portion and the 3'-targeting portion of the
PTO. The
term "non-complementary" is used herein to mean that primers or probes are
sufficiently non-complementary not to hybridize selectively to a target
nucleic acid
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
sequence under the designated annealing conditions or stringent conditions,
encompassing the terms "substantially non-complementary" and "perfectly non-
complementary", preferably perfectly non-complementary.
For example, the term "non-complementary" in conjunction with the 5'-tagging
portion of the PTO-NV means that the 5'-tagging portion is sufficiently non-
complementary not to hybridize selectively to a target nucleic acid sequence
under
the designated annealing conditions or stringent conditions, encompassing the
terms
"substantially non-complementary" and "perfectly non-complementary",
preferably
perfectly non-complementary.
The amplification blocker comprises a complementary sequence to a non-target
nucleotide variation different from the target nucleotide variation on the
target nucleic
acid sequence. The amplification blocker is hybridized with the target nucleic
acid
sequence having the non-target nucleotide variation and not hybridized with
the
target nucleic acid sequence having the target nucleotide variation, thereby,
the
amplification blocker contributes the selective amplification of the target
nucleic acid
sequence having the target nucleotide variation.
The amplification blocker is located downstream of the upstream primer or the
downstream primer; and the amplification blocker and the PTO-NV are located
between the upstream primer and the downstream primer;
The term used herein "target nucleotide variation" with reference to a
nucleotide variation present in a variation-occurring region on a target
nucleic acid
sequence means a nucleotide variation to be identified by the present
invention. In
the present method, a nucleotide variation discrimination site of PTO-NV
comprises a
complementary sequence to the target nucleotide variation on the target
nucleic acid.
The term used herein "target nucleotide variation containing template" or
"target variation containing template" means a target nucleic acid molecule
comprising a nucleotide variation to be identified by the present invention.
The term used herein "non-target nucleotide variation" with reference to a
nucleotide variation present in a variation-occurring region on a target
nucleic acid
16
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
sequence means other nucleotide variations than the target nucleotide
variation.
The term used herein "non-target nucleotide variation containing template" or
"non-target variation containing template" means a target nucleic acid
molecule
comprising a nucleotide variation other than the target nucleotide variation.
For example, in the detection of low-abundance mutant allele in an excess of
wild-type allele by the present method, the wild-type allele is the target
nucleic acid
having non-target nucleotide variation and the mutant allele is the target
nucleic acid
having target nucleic variation. The term "nucleotide variation" includes a
wild type
and any mutant type at a particular location in a nucleic acid sequence.
In the present method, the amplification blocker comprises a complementary
sequence to the non-target nucleotide variation. The non-target nucleotide
variation
present in the variation-occurring region may be one or more. In such case,
the
amplification blocker comprises a complementary sequence to the non-target
nucleotide variation of which amplification is intended to be inhibited. For
inhibition of
a plurality of non-target nucleotide variations, a plurality of amplification
blocker may
be used.
The terms "target nucleotide variation" and "non-target nucleotide variation"
are used herein to clearly and concisely indicate a nucleic acid molecule to
be
hybridized with the PTO-NV and the amplification blocker.
The amplification blocker comprising a complementary sequence to a non-
target nucleotide variation whose amplification is intended to be inhibited is
hybridized
with a target nucleic acid sequence having the non-target nucleotide variation
and
inhibits the extension of a primer located upstream of the amplification
blocker,
thereby blocking the amplification of the target nucleic acid sequence.
Under the same conditions, the amplification blocker comprising a
complementary sequence to a non-target nucleotide variation is not hybridized
with a
target nucleic acid sequence having a target nucleotide variation because of
the
presence of a mismatch sequence, thereby not blocking the amplification of the
target
nucleic acid sequence.
17
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
According to an embodiment, the amplification blocker comprising a
complementary sequence to a wild-type DNA is hybridized with the wild-type DNA
to
inhibit the extension of primers, thereby suppressing the amplification of the
wild-type
DNA. The amplification blocker comprising a complementary sequence to a wild-
type
DNA is not hybridized with a mutant DNA, and the mutant DNA is amplified.
As the present invention employs the 5' nuclease activity, the amplification
blocker is required to have the resistance to the 5' nuclease activity so as
to prevent
cleavage of the amplification blocker. In certain embodiment, at least a site
of the
amplification blocker attacked by the 5' nuclease activity is designed to have
the
to resistance to the 5' nuclease activity.
In certain embodiment, the amplification blocker has the resistance to 5'
nuclease cleavage. In certain embodiment, the amplification blocker is an
oligonucleotide hybridizable with a nucleic acid sequence.
In an embodiment, the amplification blocker comprises a natural
nucleoside/nucleotide, a nucleoside/nucleotide analogue or a combination
thereof.
In an embodiment, the amplification blocker is an oligonucleotide having a
compound resistant to 5' nuclease such as a minor groove binder.
According to an embodiment, the amplification blocker comprises
nucleosides/nucleotides having a backbone resistant to the 5' nuclease
activity.
The nucleosides/nucleotides with a backbone resistant to the 5' nuclease
activity include any one known to one of skill in the art. For example, it
includes
various phosphorothioate linkages, phosphonate linkages, phosphoroamidate
linkages
and 21-carbohydrates modifications. According to a more preferred embodiment,
nucleotides having a backbone resistant to the 5' nuclease include
phosphorothioate
linkage, alkyl phosphotriester linkage, aryl phosphotriester linkage, alkyl
phosphonate
linkage, aryl phosphonate linkage, hydrogen phosphonate linkage, alkyl
phosphoroamidate linkage, aryl phosphoroamidate linkage, phosphoroselenate
linkage, 21-0-aminopropyl modification, 21-0-alkyl modification, 21-0-ally1
modification,
21-0-butyl modification, a-anomeric oligodeoxynucleotide and 1-(41-thio-13-D-
18
CA 02913873 2015-11-27
WO 2014/193071 PCT/KR2014/001529
ribofuranosyl) modification.
According to an embodiment, the amplification blocker comprises peptide
nucleic acid (PNA), locked nucleic acid (LNA), Morpholino, glycol nucleic acid
(GNA),
threose nucleic acid (TNA), bridged nucleic acids (BNA), N3'-P5'
phosphoramidate
(NP) oligomers, minor groove binder-linked-oligonucleotides (MGB-linked
oligonucleotides), phosphorothioate (PS) oligomers, C1-C4 alkylphosphonate
oligomers, phosphoramidates, B-phosphodiester oligonucleotides, a-
phosphodiester
oligonucleotides or combination thereof.
In a particular embodiment, the amplification blocker has the resistance to
the
5' nuclease and shows significant Tm value changes by even a single mismatch,
whose
representative is an amplification blocker containing PNA or LNA.
The amplification blocker may be in any lengths. For example, the
amplification blocker may be 5-100 nucleotides, 5-80 nucleotides, 5-50
nucleotides, 5- ,
40 nucleotides, 5-30 nucleotides, 10-100 nucleotides, 10-80 nucleotides, 10-50
nucleotides, 10-40 nucleotides, 10-30 nucleotides, 15-100 nucleotides, 15-80
nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 20-100
nucleotides, 20-80 nucleotides, 20-50 nucleotides, 20-40 nucleotides or 20-30
nucleotides in length.
According to an embodiment, the 3'-end of the amplification blocker is
"blocked" to prohibit its extension.
The nucleotide variation discrimination site (i.e., a complementary region to
the
non-target nucleotide variation) of the amplification blocker to be opposite
to the
nucleotide variation region on the target nucleic acid sequence may be located
on any
site of the amplification blocker, so long as it inhibits the amplification of
the target
nucleic acid sequence having the non-target nucleotide variation but does not
inhibit
the amplification of the target nucleic acid sequence having the target
nucleotide
variation.
In certain embodiment, the nucleotide variation discrimination site of the
amplification blocker may be located at its 5'-end portion, middle portion or
3'-end
19
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
portion.
The amplification blocker is located downstream of the upstream primer or the
downstream primer and the amplification blocker is located between the
upstream
primer and the downstream primer.
The distance between 5'-end of the amplification blocker and 3'-end of the
primer located upstream thereof may be not less than 300, 200, 100, 50, 30,
20, 10,
5, 2 or 1 nucleotide.
In certain embodiment, the present invention is conducted in accordance with
asymmetric PCR (Pierce KE et al., Methods Mol Med. Methods in Molecular
Medicine
132:65-85(2007)). Either the excess primer or limiting primer may be located
upstream of the amplification blocker. Particularly, the excess primer may be
located
upstream of the amplification blocker.
The PTO-NV and the amplification blocker may be designed to locate on the
same strand or different strands of the target nucleic acid sequence.
According to an embodiment, the nucleotide variation to be detected by the
present invention is a substitution variation, a deletion variation or an
insertion
variation.
According to an embodiment, the target nucleic acid sequence having
nucleotide variation(s) to be detected by the present invention includes the
genes
such as K-ras, H-ras, N-ras, p53 (TP53), CDKN2A (p16), PIC3K, PTEN, RB1,
epidermal
growth factor receptor gene, BRAF, BRCA1, BRCA2, STK11, and VHL; NF1, FBN1,
MSH2, MLH1 (autosomal dominant disorder-associated gene); CFTR, Hemoglobin
beta
gene, HEXA, SMN1, VAPB (autosomal recessive disorder-associated gene); PHEX (X-
linked dominant disorder-associated gene); factor VIII, dystrophin gene, CNGA
3,
CNGB3, GNAT2, androgen receptor (AR) gene (X-linked recessive disorder-
associated
gene); USP9Y (Y-linked disorder-associated gene); MT-ND1, MT-ND4, MT-ND4L, MT-
ND6 (mitochondrial disease-associated gene); the epithelial growth factor
receptor
(EGFR) gene which encodes EGFR in respect to the drug (gefitnib) for treatment
of
lung cancer, the multi-drug resistance-associated protein (MRP) gene encoding
MRP
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
- - -
in respect to the drug for treatment of ovarian cancer, and the lung
resistance protein
(LRP) gene in respect to the drug for treatment of ovarian cancer; and cagPAI,
vacA,
iceA, babA, erp, spvC, spuB, cnf1, cnf2, eaeA, eagg, einv, stx1, stx2, and
vt2e etc.
The term used herein "PTO-NV (Probing and Tagging Oligonucleotide for
Nucleotide Variation)" means an oligonucleotide comprising (i) a 3'-targeting
portion
serving as a probe, (ii) a 5'-tagging portion with a nucleotide sequence non-
complementary to the target nucleic acid sequence, and (iii) a nucleotide
variation
discrimination site, comprising a complementary sequence to the target
nucleotide
variation on the target nucleic acid, positioned on a 5'-end part of the 3'-
targeting
portion. The 5'-tagging portion is nucleolytically released from the PTO-NV
after
hybridization with the target nucleic acid sequence. The 5'-tagging portion
and the 3'-
targeting portion in the PTO-NV have to be positioned in a 5' to 3' order. The
PTO-NV
is schematically illustrated in Figs. 1 and 3. The PTO-NV may be appreciated
as one
application form of the PTO for detection of nucleotide variations, which is
constructed by introduction of the nucleotide variation discrimination site
into the 5'-
end part of the 3'-targting portion.
The PTO-NV comprises the nucleotide variation discrimination site comprising a
complementary sequence to the nucleotide variation positioned on a 5'-end part
of
the 3'-targeting portion.
Where the PTO-NV is hybridized with the target nucleic acid sequence having
the nucleotide variation complementary to the variation discrimination site,
the 5'-end
part of the 3'-targeting portion forms a double strand with the target nucleic
acid
sequence. Where the PTO-NV is hybridized with a target nucleic acid sequence
having
a nucleotide variation non-complementary to the variation discrimination site,
the 5'-
end part of the 3'-targeting portion does not form a double strand with the
target
nucleic acid sequence. Such distinct hybridization patterns on the nucleotide
variation
of interest are responsible for differences in cleavage sites of the PTO-NV,
thereby
producing two types of PTO-NV fragments to give signal differentiation
depending on
the presence of the nucleotide variation of interest. The 5'-end part of the
3'-targeting
21
CA 02913873 2015-11-27
WO 2014/193071
PCT/ICR2014/001529
portion of the PTO-NV may be also described as a single strand-forming 5'-end
portion of the 3'-targeting portion of the PTO-NV when hybridized with a
target
nucleic acid sequence having a nucleotide variation non-complementary to the
variation discrimination site.
The nucleotide variation discrimination site positioned on a 5'-end part of
the
3'-targeting portion of the PTO-NV comprises a complementary sequence to the
nucleotide variation.
According to an embodiment, the nucleotide variation discrimination site is
located within 10 nucleotides, more preferably 8 nucleotides, still more
preferably 6
DJ
nucleotides, still much more preferably 4 nucleotides, 3 nucleotides, 2
nucleotides, 1
nucleotide or 0 nucleotide apart from the 5'-end of the 3'-targeting portion
of the
PTO-NV. Preferably, the nucleotide variation discrimination site is located at
the 5'-end
of the 3'-targeting portion of the PTO-NV.
The location of the nucleotide variation discrimination site may be determined
in consideration of sequences to be detected, type of nucleases and reaction
conditions.
The term "site" with reference to either nucleotide variation discrimination
site
of probes or nucleotide variation site on target sequences is used herein to
encompass not only a single nucleotide but also a plurality of nucleotides.
Preferably, the hybridization in step (a) is preformed under stringent
conditions
that the 3'-targeting portion is hybridized with the target nucleic acid
sequence and
the 5'-tagging portion is not hybridized with the target nucleic acid
sequence.
The PTO-NV does not require any specific lengths. For example, the length of
the PTO-NV may be 15-150 nucleotides, 15-100 nucleotides, 15-80 nucleotides,
15-60
nucleotides, 15-40 nucleotides, 20-150 nucleotides, 20-100 nucleotides, 20-80
nucleotides, 20-60 nucleotides, 20-50 nucleotides, 30-150 nucleotides, 30-100
nucleotides, 30-80 nucleotides, 30-60 nucleotides, 30-50 nucleotides, 35-100
nucleotides, 35-80 nucleotides, 35-60 nucleotides, or 35-50 nucleotides. The
3'-
targeting portion of the PTO-NV may be in any lengths so long as it is
specifically
22
CA 02913873 2015-11-27
WO 2014/193071
PCT/ICR2014/001529
hybridized with target nucleic acid sequences. For example, the 3'-targeting
portion of
the PTO-NV may be 10-100 nucleotides, 10-80 nucleotides, 10-50 nucleotides, 10-
40
nucleotides, 10-30 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-50
nucleotides, 15-40 nucleotides, 15-30 nucleotides, 20-100 nucleotides, 20-80
nucleotides, 20-50 nucleotides, 20-40 nucleotides or 20-30 nucleotides in
length. The
5'-tagging portion may be in any lengths so long as it is specifically
hybridized with
the capturing portion of the CTO and then extended. For instance, the 5'-
tagging
portion of the PTO-NV may be 5-50 nucleotides, 5-40 nucleotides, 5-30
nucleotides,
5-20 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-
20
nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides or 15-20
nucleotides in length.
According to an embodiment, the PTO-NV is blocked at its 3'-end to prohibit
its
extension. The blocking may be achieved in accordance with conventional
methods.
For instance, the blocking may be performed by adding to the 3'-hydroxyl group
of
the last nucleotide a chemical moiety such as biotin, labels, a phosphate
group, alkyl
group, non-nucleotide linker, phosphorothioate or alkane-diol. Alternatively,
the
blocking may be carried out by removing the 3'-hydroxyl group of the last
nucleotide
or using a nucleotide with no 3'-hydroxyl group such as dideoxynucleotide.
Alternatively, the PTO may be designed to have a hairpin structure.
The upstream primer is located upstream of the PTO-NV. The upstream primer
induces through its extended strand the cleavage of the PTO-NV by an enzyme
having
a 5' nuclease activity.
In the present method, the term "the upstream primer" is determined with
reference to the location of the PTO-NV and therefore the upstream primer is
located
upstream of the PTO-NV.
According to an embodiment, the upstream primer, the downstream primer
and/or 5'-tagging portion of the PTO-NV have a dual priming oligonucleotide
(DPO)
structure developed by the present inventor. The oligonucleotides having the
DPO
structure show significantly improved target specificity compared with
conventional
23
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
primers and probes (see WO 2006/095981; Chun et al., Dual priming
oligonucleotide
system for the multiplex detection of respiratory viruses and SNP genotyping
of
CYP2C19 gene, Nucleic Acid Research, 35: 6e4C(2007)).
According to an embodiment, the 3'-targeting portion of the PTO-NV has a
modified dual specificity oligonucleotide (mDSO) structure developed by the
present
inventor. The modified dual specificity oligonucleotide (mDSO) structure shows
significantly improved target specificity compared with conventional probes
(see WO
2011/028041).
The PTO-NV and the amplification blocker may be designed to locate on the
same strand or different strands of the target nucleic acid sequence.
In Fig. 4, the PTO-NV and the amplification blocker are located on the same
strand of the target nucleic acid sequence. The nucleotide variation
discrimination site
of the PTO-NV comprises a complementary sequence to the target nucleotide
variation on the target nucleic acid and the amplification blocker comprises a
complementary sequence to the non-target nucleotide variation on the target
nucleic
acid. The PTO-NV is hybridized with target nucleotide variation containing
template,
and the PTO-NV is cleaved along with the extension of the upstream primer,
forming
the extended strand on the CTO. On the other hand, the amplification blocker
is
hybridized with the non-target nucleotide variation containing template, and
the
extension of the upstream primer is prevented by the amplification blocker.
Furthermore, the existence of the amplification blocker on the non-target
nucleotide
variation containing template inhibits hybridization of the PTO-NV, preventing
hybridization of PTO-NV with the non-target nucleotide variation containing
template
and its wasteful cleavage. By adjusting reaction conditions and sequences of
the
amplification blocker, the hybridization of the amplification blocker with the
wild-type
DNA may be rendered to be more favorable than that of the PTO-NV.
Alternatively, the PTO-NV and the amplification blocker may be designed to
locate on different strands of the target nucleic acid sequence from each
other.
24
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
Step (b): Release of a fragment from the PTO-NV
Afterwards, the resultant of the step (a) is contacted to an enzyme having a
5'
nuclease activity under conditions for cleavage of the PTO-NV. The upstream
primer
induces through its extended strand the cleavage of the PTO-NV by the enzyme
having the 5' nuclease activity.
The term used herein "conditions for cleavage of the PTO-NV" means
conditions sufficient to digest the PTO-NV hybridized with the target nucleic
acid
sequence by the enzyme having the 5' nuclease activity, such as temperature,
pH,
ionic strength, buffer, length and sequence of =oligonucleotides and enzymes.
For
example, when Taq DNA polymerase is used as the enzyme having the 5' nuclease
activity, the conditions for cleavage of the PTO include Tris-HCI buffer, KCI,
MgC12 and
temperature.
The hybridization of the amplification blocker with the target nucleic acid
sequence having the non-target nucleotide variation inhibits the extension of
the
primer located upstream of the amplification blocker, thereby blocking the
amplification of the target nucleic acid sequence having the non-target
nucleotide
variation.
Where the PTO-NV is hybridized with the target nucleic acid sequence (i.e.,
match template) having the target nucleotide variation complementary to the
variation discrimination site, and the 5'-end part of the 3'-targeting portion
forms a
double strand with the target nucleic acid sequence to induce cleavage from a
first
initial cleavage site, a first fragment is released.
Where the PTO-NV is hybridized with a target nucleic acid sequence
mismatch template) having a non-target nucleotide variation non-complementary
to
the variation discrimination site, and the 5'-end part of the 3'-targeting
portion does
not form a double strand with the target nucleic acid sequence to induce
cleavage
from a second initial cleavage site located downstream of the first initial
cleavage site,
a second fragment is released; wherein the second fragment comprises an
additional
3'-end portion allowing the second fragment different from the first fragment.
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
Where the target nucleic acid sequence is not present in a sample, the
cleavage of the PTO-NV does not occur.
As such, differences in cleavage sites and types of PTO-NV fragments
generated result in different extension patterns depending on the presence and
absence of the nucleotide variation of interest on the target nucleic acid
sequence,
contributing to differential detection of the nucleotide variation on the
target nucleic
acid sequence.
An initial cleavage site of the PTO-NV is affected by the type of 5'
nucleases,
the hybridization site of the upstream primer and cleavage conditions.
An initial cleavage site by template dependent polymerase having 5' nuclease
activity with extension of upstream primers is generally positioned in a 5' to
3'
direction at an initial nucleotide of a double strand (i.e., bifurcation site)
in structures
including a single strand and a double strand or at 1-2 nucleotides apart from
the
initial nucleotide. By the cleavage reaction, fragments comprising the 5'-
tagging
portion and a part of the 3'-targeting portion are produced.
The term used herein "a first initial cleavage site" in conjunction with the
PTO-
NV means to a cleavage site of the PTO-NV being firstly cleaved when the PTO-
NV is
hybridized with the target nucleic acid sequence having the nucleotide
variation
complementary to the variation discrimination site. The term used herein "a
second
initial cleavage site" in conjunction with the PTO-NV means to a cleavage site
of the
PTO-NV being firstly cleaved when the PTO-NV is hybridized with a target
nucleic acid
sequence having a nucleotide variation non-complementary to the variation
discrimination site.
The term used herein "a first fragment" refers to a fragment produced upon
cleavage at the first initial cleavage site. The term is used interchangeably
with "a first
segment" and "a PTO-NV first fragment". The term herein "a second fragment"
refers
to a fragment produced upon cleavage at the second initial cleavage site. The
term is
used interchangeably with "a second segment" and "a PTO-NV second fragment".
26
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
Particularly, the first fragment and the second fragment each comprises the 5'-
tagging portion or a part of the 5'-tagging portion.
The cleavage may successively occur after the cleavage of the first initial
cleavage site (or the second initial cleavage site) depending on cleavage
methods
used. For instance, where 5' nuclease cleavage reaction together with
extension of
upstream primers is used, the initial cleavage site and its successive
sequence are
cleaved.
According to an embodiment, an initial cleavage site dependent on extension of
upstream primers may be positioned in a 5' to 3' direction at an initial
nucleotide of a
double strand (i.e., bifurcation site).
As shown in Fig. 3 representing an example of the present invention, the
nucleotide variation discrimination site is positioned at the 5'-end of the 5'-
end part of
the 3'-targeting portion of the PTO-NV. In such case, the first initial
cleavage site is
positioned immediately adjacent, in a 5' to 3' direction, to the 5'-end part
of the 3'-
targeting portion. In other words, the first initial cleavage site is
positioned
immediately adjacent, in a 3' direction, to the nucleotide variation
discrimination site.
The second initial cleavage site is generally positioned at 1 nucleotide
apart, in a 3'
direction, from the nucleotide variation discrimination site.
Alternatively, the nucleotide variation discrimination site may be positioned
at 1
nucleotide apart from the 5'-end of the 5'-end part of the 3'-targeting
portion. In such
case, the first initial cleavage site is positioned immediately adjacent, in a
5' direction,
to the nucleotide variation discrimination site. The second initial cleavage
site is
generally positioned at 1 nucleotide apart, in a 3' direction, from the
nucleotide
variation discrimination site.
According to an embodiment, the PTO-NV has a blocker portion containing a
blocker resistant to cleavage by the enzyme having 5' nuclease activity and
the
blocker portion is used to control an initial cleavage site and/or successive
cleavages.
27
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
According to an embodiment, the PTO-NV has a blocker portion containing as a
blocker at least one nucleotide resistant to cleavage by the enzyme having 5'
nuclease
activity.
For example, to induce cleavage at the junction site between a hybridization
portion of the PTO-NV (3`-targeting portion) and a non-hybridization portion
(5'-
tagging portion), the 5'-end part of 3'-targeting portion of PTO-NV may be
blocked
with blockers.
The number of blockers contained in the blocker portion may be not limited,
preferably, 1-10, more preferably 2-10, still more preferably 3-8, most
preferably 3-6
blockers. The blockers present in the PTO may be in a continuous or
intermittent
manner, preferably a continuous manner. The nucleotides as blockers with a
backbone resistant to the 5' nuclease activity include any one known to one of
skill in
the art. For example, it includes various phosphorothioate linkages,
phosphonate
linkages, phosphoroamidate linkages and 2'-carbohydrates modifications.
According to
a more preferred embodiment, nucleotides having a backbone resistant to the 5'
nuclease include phosphorothioate linkage, alkyl phosphotriester linkage, aryl
phosphotriester linkage, alkyl phosphonate linkage, aryl phosphonate linkage,
hydrogen phosphonate linkage, alkyl phosphoroamidate linkage, aryl
phosphoroamidate linkage, phosphoroselenate linkage, 2'-0-aminopropyl
modification,
2'-0-alkyl modification, 2'-0-ally1 modification, 2'-0-butyl modification, a-
anomeric
oligodeoxynucleotide and 1-(4'-thio-f3-D-ribofuranosyl) modification.
According to an embodiment, a nucleotide as a blocker includes LNA (locked
nucleic acid).
The 5'-end part comprising the nucleotide variation discrimination site may be
composed of a hybridizable sequence with the target nucleic acid sequence.
Alternatively, the 5'-end part may partially comprise a non-hybridizable
sequence. The
introduction of a non-hybridizable sequence into the 5'-end part is very
advantageous
over single strand formation of the 5'-end part when the PTO-NV is hybridized
with a
28
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
target nucleic acid sequence having a nucleotide variation non-complementary
to the
nucleotide variation discrimination site.
According to an embodiment, the 5'-end part of the 3'-targeting portion of the
PTO-NV comprises a non-base pairing moiety located within 1-10 nucleotides
(more
preferably 1-5 nucleotides) apart from the nucleotide variation discrimination
site.
The non-base pairing moiety prevents the 5'-end part of the 3'-targeting
portion from formation of a double strand with the target nucleotide sequence
when
the PTO-NV is hybridized with the target nucleic acid sequence having the
nucleotide
variation non-complementary to the variation discrimination site.
According to an embodiment, the non-base pairing moiety does not inhibit the
formation of a double strand between the 5'-end part and the target nucleic
acid
sequence when the PTO-NV is hybridized with the target nucleic acid sequence
having
the nucleotide variation complementary to the nucleotide variation
discrimination site.
According to an embodiment, the non-base pairing moiety enhances
differentiation between the first initial cleavage site and the second initial
cleavage
site. For instance, where the cleavage sites do not become differentiated in a
match
template and mismatch template by difference in the variation discrimination
site due
to no difference in hybridization patterns of the 5'-end part of the 3'-
targeting portion
of the PTO-NV, the use of the non-base pairing moiety renders the
hybridization
patterns to become differentiated. In addition, even when the 5'-end part of
the 3'-
targeting portion of the PTO-NV shows different hybridization patterns in a
match
template and mismatch template by difference in the variation discrimination
site, the
use of the non-base pairing moiety enables to give much longer 3'-end portion
of the
second fragment than that of the first fragment, thereby completely preventing
extension of the second fragment on the CTO.
The use of the non-base paring moiety may improve AB-VD PTOCE assay.
According to an embodiment, the use of the non-base pairing moiety (e.g.,
artificial mismatch nucleotide) enhances discrimination potential of the PTO-
NV to
nucleotide variations.
29
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
According to an embodiment, the differential recognition by the enzyme having
the 5' nuclease activity between the first initial cleavage site and the
second initial
cleavage site is improved by the differentiation imposed by the non-base
pairing
moiety. The differentiation may be enhanced by the distance between the first
initial
cleavage site and the second initial cleavage site caused by the non-base
pairing
moiety. According to an embodiment, the non-base pairing moiety widens the
distance between the first initial cleavage site and the second initial
cleavage site.
According to an embodiment, the introduction of a non-base paring moiety
sequence enables the second initial cleavage site to be adjusted.
Preferably, the non-base pairing moiety is located downstream of the
nucleotide variation discrimination site.
For example, where a mismatch nucleotide as a non-base pairing moiety is
introduced into a position 2 nucleotides apart, in a 3' direction, from the
nucleotide
variation discrimination site, the second initial cleavage site is adjusted to
a position 2
nucleotides apart from the nucleotide variation discrimination site. In case
of not
using the mismatch nucleotide, the second initial cleavage site is positioned
1
nucleotide apart from the nucleotide variation discrimination site. That is to
say, the
non-base pairing moiety may widen the distance between the first initial
cleavage site
and the second initial cleavage site.
The non-base pairing moiety includes any moieties not forming a base pair
between target nucleic acid sequences. Preferably, the non-base pairing moiety
is (i) a
nucleotide comprising an artificial mismatch base, a non-base pairing base
modified to
be incapable of base pairing or a universal base, (ii) a non-base pairing
nucleotide
modified to be incapable of base pairing, or (iii) a non-base pairing chemical
compound.
For example, the non-base pairing moiety includes alkylene group,
ribofuranosyl naphthalene, deoxy ribofuranosyl naphthalene, metaphosphate,
phosphorothioate linkage, alkyl phosphotriester linkage, aryl phosphotriester
linkage,
alkyl phosphonate linkage, aryl phosphonate linkage, hydrogen phosphonate
linkage,
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
alkyl phosphoroamidate linkage and aryl phosphoroamidate linkage. Conventional
carbon spacers are also used as non-base pairing moieties. Universal bases as
non-
base pairing moieties are useful in adjusting cleavage sites of the PTO-NV.
As base pairs containing universal bases such as deoxyinosine, 1-(2'-deoxy-
beta-D-ribofuranosyl)-3-nitropyrrole and 5-nitroindole have a lower binding
strength
than those between natural bases, universal bases may be employed as non-base
pairing moieties under certain hybridization conditions.
The non-base pairing moiety introduced into the 5'-end part has preferably 1-
5,
more preferably 1-2 moieties. A plurality of non-base pairing moieties in the
5'-end
part may be present in a consecutive or intermittent manner. Preferably, the
non-base
pairing moiety has 2-5 consecutive moieties.
Preferably, the non-base pairing moiety is a non-base pairing chemical
compound.
According to an embodiment, the nucleotide variation discrimination site and
the non-base pairing moiety of the PTO-NV are located within 10 nucleotides
(more
preferably 8 nucleotides, 7 nucleotides, 6 nucleotides, 5 nucleotides, 4
nucleotides, 3
nucleotides, 2 nucleotides or 1 nucleotide, still more preferably 1
nucleotide) apart
from the 5'-end of the 3'-targeting portion.
According to an embodiment, where PTO-NV is hybridized with the mismatch
template, the second initial cleavage site comprises an initial site of a
double strand
bifurcation site) in structures including a single strand and a double strand.
According to an embodiment, the PTO-NV has a blocker portion containing as a
blocker at least one nucleotide resistant to cleavage by the enzyme having 5'
nuclease
activity and the blocker portion is positioned to control the initial cleavage
site or
prevent the cleavage at a site or sites.
The term "part" used in conjunction with the PTO-NV or CTO such as the part
of the 5'-tagging portion of the PTO-NV, the 5'-end part of the 3'-targeting
portion of
the PTO-NV and the 5'-end part of the capturing portion of the CTO refers to a
nucleotide sequence composed of 1-40, 1-30, 1-20, 1-15, 1-10 or 1-5
nucleotides,
31
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
particularly, 1, 2, 3 or 4 nucleotides.
According to an embodiment, the enzyme having the 5' nuclease activity is
DNA polymerase having a 5' nuclease activity or FEN nuclease, more preferably
a
thermostable DNA polymerase having a 5' nuclease activity.
A suitable DNA polymerase having a 5' nuclease activity in this invention is a
thermostable DNA polymerase obtained from a variety of bacterial species,
including
Thermus aquaticus (Taq), Thermus thermophllus (Tth), Thermus filiformis,
Thermis
flavus, Thermococcus literal/s1 Thermus antranikianii, Thermus caldophllus,
Thermus
chliarophilus, Thermus fiavus, Thermus igniterrae, Thermus lacteus, Thermus
oshimai, Thermus rube,; Thermus rubens, Thermus scotoductus, Thermus
silt/anus,
Thermus species Z05, Thermus species sps 17 Thermus thermophilus, Therm otoga
maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus
litoralis,
Thermococcus barossi; Thermococcus gorgonarius, Therm otoga maritima,
Therm otoga neapolitana, Thermosiphoafricanus, .Pyrococcus woesel, Pyrococcus
is horikosig
Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus and Aquifex
aeolieus. Most preferably, the thermostable DNA polymerase is Taq polymerase.
According to an embodiment, a template-dependent polymerase is used for
extension of the upstream and downstream primer.
According to an embodiment, the template-dependent polymerase for
extension of the primers is identical to the enzyme having the 5' nuclease
activity or
the template-dependent polymerase for extension of the primers is different
from the
enzyme having the 5' nuclease activity.
Step (c): Hybridization of the fragment released from the PTO-NV with CTO
The fragment released from the PTO-NV is hybridized with a CTO (Capturing
and Templating Oligonucleotide).
The CTO comprises in a 3' to 5' direction (i) a capturing portion comprising a
nucleotide sequence complementary to the 5'-tagging portion or a part of the
5`-
tagging portion of the PTO-NV and (ii) a templating portion comprising a
nucleotide
32
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
sequence non-complementary to the 5'-tagging portion and the 3'-targeting
portion of
the PTO-NV.
The first fragment and the second fragment have commonly a hybridizable
sequence with the capturing portion of the CTO and thus one of them is
hybridized
with the CTO.
The second fragment produced when hybridized with the mismatch template
comprises an additional 3'-end portion being different from the first fragment
produced when hybridized with the match template.
According to an embodiment, the CTO has a sequence selected such that the
to CTO is not hybridized with the additional 3'-end portion of the second
fragment to
prevent the second fragment from extension when the second fragment is
hybridized
with the capturing portion of the CTO. For example, the sequence of the CTO
may be
selected such that the 0-0 has a mismatch nucleotide(s) opposed to the
additional
3'-end portion of the second fragment. Alternatively, universal bases may be
used
Is instead of the mismatch nucleotide depending on reaction conditions.
The first initial cleavage site (or the second initial cleavage site) may not
be
fixed but rather multiple in a condition. For example, initial cleavage sites
may be
positioned in a 5' to 3' direction at an initial nucleotide of a double strand
(i.e.,
bifurcation site) in structures including a single strand and a double strand
and 1-2
20 nucleotides apart from the initial nucleotide. In such case, preferably,
the sequence of
the CTO is selected such that the shortest fragment released by the first
initial
cleavage is selectively extended in the present invention to generate the
extended
strand indicative of the presence of the nucleotide variation.
The templating portion of the CTO may comprise any sequence so long as it is
25 non-complementary to the 5'-tagging portion and the 3`-targeting portion
of the PTO-
NV. Furthermore, the templating portion may comprise any sequence so long as
it can
be acted as a template for extension of the first fragment released from the
PTO-NV.
The length of the CTO may be widely varied. For example, the CTO is 7-1000
nucleotides, 7-500 nucleotides, 7-300 nucleotides, 7-100 nucleotides, 7-80
33
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
nucleotides, 7-60 nucleotides, 7-40 nucleotides, 15-1000 nucleotides, 15-500
nucleotides, 15-300 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60
nucleotides, 15-40 nucleotides, 20-1000 nucleotides, 20-500 nucleotides, 20-
300
nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40
nucleotides, 30-1000 nucleotides, 30-500 nucleotides, 30-300 nucleotides, 30-
100
nucleotides, 30-80 nucleotides, 30-60 nucleotides or 30-40 nucleotides in
length. The
capturing portion of the CTO may have any length so long as it is specifically
hybridized with the fragment released from the PTO. For example, the capturing
portion of the CTO is 5-100 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-
30
to nucleotides, 5-20 nucleotides, 10-100 nucleotides, 10-60 nucleotides, 10-40
nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-60
nucleotides, 15-40 nucleotides, 15-30 nucleotides or 15-20 nucleotides in
length. The
templating portion of the CO may have any length so long as it can act as a
template in extension of the fragment released from the PTO. For example, the
templating portion of the CO is 1-900 nucleotides, 1-400 nucleotides, 1-300
nucleotides, 1-100 nucleotides, 1-80 nucleotides, 1-60 nucleotides, 1-40
nucleotides,
1-20 nucleotides, 2-900 nucleotides, 2-400 nucleotides, 2-300 nucleotides, 2-
100
nucleotides, 2-80 nucleotides, 2-60 nucleotides, 2-40 nucleotides, 2-20
nucleotides, 5-
900 nucleotides, 5-400 nucleotides, 5-300 nucleotides, 5-100 nucleotides, 5-80
nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 10-900
nucleotides,
10-400 nucleotides, 10-300 nucleotides, 15-900 nucleotides, 15-100
nucleotides, 15-
80 nucleotides, 15-60 nucleotides, 15-40 nucleotides or 15-20 nucleotides in
length.
The 3'-end of the CTO may have a 3'-OH terminal. According to an
embodiment, the 31-end of the CTO is blocked to prohibit its extension. The
non-
extendible blocking of the CTO may be achieved in accordance with conventional
methods.
The first fragment released from the PTO-NV is hybridized with the CTO,
providing a form suitable in extension of the first fragment. Although an
undigested
PTO-NV is also hybridized with the capturing portion of the CTO through its 5'-
tagging
34
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
portion, its 3'-targeting portion is not hybridized to the CTO which prohibits
the
formation of an extended duplex.
The hybridization in the step (c) can be described in detail with referring to
descriptions in the step (a).
Step (d): Extension of the fragment
The extension reaction is carried out using the resultant of the step (c) and
a
template-dependent nucleic acid polymerase.
When the first fragment is hybridized with the capturing portion of the CTO,
it
is extended to form an extended strand comprising an extended sequence
complementary to the templating portion of the CTO. When the second fragment
is
hybridized with the capturing portion of the CTO, it is not extended.
The term used herein "extended sequence" in conjunction with the extended
strand means only a newly extended sequence which is a portion of the extended
strand except the first fragment. The extended strand comprises the first
fragment
and the extended sequence.
In certain embodiment, the extended strand of the first fragment and the CTO
form an extended duplex in the step (d).
The term used herein "extended duplex" means a duplex formed by extension
reaction in which the first fragment hybridized with the capturing portion of
the CTO
is extended using the templating portion of the CTO as a template and the
template-
dependent nucleic acid polymerase.
The extended duplex has different Tm value from that of the hybrid between
the uncleaved PTO-NV and the CTO. Particularly, the extended duplex has higher
Tm
value than the hybrid between the uncleaved PTO and the CEO.
The Tm value of the extended duplex is adjustable by (i) a sequence and/or
length of the first fragment, (ii) a sequence and/or length of the CO or (iii)
the
sequence and/or length of the first fragment and the sequence and/or length of
the
CTO. The adjustable Tm value of the extended duplex may be employed to give a
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
target signal indicative of the presence of the extended strand by melting the
extended duplex in the step (e).
The term used herein 7," refers to a melting temperature at which half a
population of double stranded nucleic acid molecules are dissociated to single-
s stranded
molecules. The Tm value is determined by length and G/C content of
nucleotides hybridized. The Tm value may be calculated by conventional methods
such
as Wallace rule (R.B. Wallace, et al., Nucleic Acids Research, 6:3543-
3547(1979)) and
nearest-neighbor method (SantaLucia 3. Jr., et al., Biochemistry, 35:3555-
3562(1996)); Sugimoto N., et al., Nucleic Acids Res., 24:4501-4505(1996)).
According to an embodiment, the Tm value refers to actual Tm values under
reaction conditions actually practiced.
The template-dependent nucleic acid polymerase used in the step (d) may
include any nucleic acid polymerases, for example, Klenow fragment-of E coil
DNA
polymerase I, a thermostable nucleic acid polymerase and bacteriophage 17 DNA
polymerase. Preferably, the polymerase is a thermostable DNA polymerase which
may
be obtained from a variety of bacterial species, including Thermus aquaticus
(Taq),
Thermus thermophllus (Tth), Thermus fl//form/s1 Thermis fiavus, Thermococcus
literalis, Thermus antranikian4 Thermus caldophdus, Thermus chliaroplgus,
Thermus
fiavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus rubet;
Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05,
Thermus species sps 17 Thermus thermophllus, Thermotoga maritima, Therm otoga
neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus
barossi,
Thermococcus gorgonarius, Therm otoga maritima, Therm otoga neapolitana,
Thermosiphoafricanus, Pyrococcus furiosus(Pfu), Pyrococcus woesei, Pyrococcus
horkoshil, Pyrococcus abyss'', Pyrodictium occultum, Aquifex pyrophIlus and
Aquifex
aeolieus. Most preferably, the template-dependent nucleic acid polymerase is
Taq
polymerase.
According to an embodiment, the enzyme having the 5' nuclease activity used
in the step (b) is identical to the template-dependent nucleic acid polymerase
used in
36
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
the step (d). Particularly, the enzyme having the 5' nuclease activity used in
the step
(b), the template-dependent nucleic acid polymerase used for extension of the
upstream primer and the template-dependent nucleic acid polymerase used in the
step (d) are identical to one another.
Generally, the extension of primers may be controlled by hybridization between
a 3'-end part of primers and a template. By adjusting primer sequences and
reaction
conditions (e.g. annealing temperature), the extension of primers having at
their 3'-
end part 1-3 mismatch nucleotides is allowable. Alternatively, the extension
of primers
may be allowable only when they have perfectly complementary sequence to
target
sequences.
According to an embodiment, the sequence of the CT() is selected that either
the first fragment or the second fragment is selectively extended.
According to an embodiment, the extension of the fragment is carried out
under conditions such that the extension does not occur even when a single
mismatch
is present at the 3'-end part of the fragment.
Step (e): Detection of the Extended Strand
The extended strand is detected after the extension reaction. The presence of
the extended strand indicates the presence of the nucleotide variation
complementary
to the nucleotide discrimination site of the PTO-NV.
In the present invention, a hybrid between the uncleaved PTO-NV and the CTO
or between the second fragment and the CTO may be formed. The differentiation
the
extended duplex from the hybrid between the uncleaved PTO-NV and the CTO
described below may be also applied to the differentiation the extended duplex
from
the hybrid between the second fragment and the CTO.
Detection of Extended Duplex by Melting or Hybridization Analysis
According to an embodiment, the detection in the step (e) is carried out in
accordance with the PTOCE assay comprising a melting analysis using signals
from
37
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
the extended duplex between the extended strand and the CTO (see WO
2012/096523).
According to an embodiment, the extended strand of the first fragment and the
CTO form an extended duplex in the step (d); wherein the extended duplex has a
Tm
value adjustable by (i) a sequence and/or length of the first fragment, (ii) a
sequence
and/or length of the CTO or (iii) the sequence and/or length of the first
fragment and
the sequence and/or length of the CTO; wherein the extended duplex provides a
target signal by (i) at least one label linked to the first fragment and/or
CTO, (ii) a
label incorporated into the extended duplex during the extension reaction,
(iii) at least
to one label linked to the first fragment and/or CTO and a label
incorporated into the
extended duplex during the extension reaction or (iv) intercalating label; and
wherein
the presence of the extended strand is detected by measuring the target signal
from
the extended duplex in accordance with a melting analysis or a hybridization
analysis
for the extended duplex.
The term used herein "melting analysis" means a method in which a target
signal indicative of the presence of the extended strand is obtained by
melting of the
extended duplex, including a method to measure signals at two different
temperatures, melting curve analysis, melting pattern analysis and melting
peak
analysis. Preferably, the melting analysis is a melting curve analysis.
According to an embodiment, the detection of the presence of the extended
strand in the step (e) is carried out by a melting analysis in which the
extended
duplex is melted over a range of temperatures to give a target signal
indicative of the
presence of the extended strand.
Alternatively, the detection of the presence of the extended strand in the
step
(e) is carried out by a hybridization analysis. Preferably, the detection of
the presence
of the extended strand in the step (e) is carried out by a hybridization
analysis in
which the extended duplex is melted and the resultant is hybridized over a
range of
temperatures to give a target signal indicative of the presence of the
extended strand.
According to an embodiment, the melting of the step (e) is followed by
38
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
hybridization to give the target signal indicative of the presence of the
extended
strand. In that case, the presence of the extended strand is detected by
hybridization
curve analysis.
The melting curve or hybridization curve may be obtained by conventional
technologies, for example, as described in U.S. Pat Nos. 6,174,670 and
5,789,167,
Drobyshev et at, Gene 188: 45(1997); Kochinsky and Mirzabekov Human Mutation
19:343(2002); Livehits et al J. Biomol. Structure Dynam. 11:783(1994); and
Howell et
at Nature Biotechnology 17:87(1999). For example, a melting curve or
hybridization
curve may consist of a graphic plot or display of the variation of the output
signal with
o the
parameter of hybridization stringency. Output signal may be plotted directly
against the hybridization parameter. Typically, a melting curve or
hybridization curve
will have the output signal, for example fluorescence, which indicates the
degree of
duplex structure (le. the extent of hybridization), plotted on the Y-axis and
the ,
hybridization parameter on the X axis.
A plot of the first derivative of the fluorescence vs. temperature, i.e., a
plot of
the rate of change in fluorescence vs. temperature (dF/dT vs. T) or (¨dF/dT
vs. T)
provides melting peak.
The step (e) performed in accordance with the melting or hybridization
analysis
will be described in detail with varying a labeling system as follows:
(i) Label linked to the first fragment and/or the CTO
According to an embodiment, the target signal is provided by at least one
label
linked to the first fragment and/or the CTO. As the extended duplex is formed
between the first fragment and CTO, either the label on the first fragment or
on the
CTO is present on the extended duplex, providing the target signal in the
melting
step.
The label includes an interactive dual label and a single label.
(i-1) Interactive dual label
39
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
As a representative of the interactive label system, the FRET (fluorescence
resonance energy transfer) label system includes a fluorescent reporter
molecule
(donor molecule) and a quencher molecule (acceptor molecule). In FRET, the
energy
donor is fluorescent, but the energy acceptor may be fluorescent or non-
fluorescent.
In another form of interactive label systems, the energy donor is non-
fluorescent,
e.g., a chromophore, and the energy acceptor is fluorescent. In yet another
form of
interactive label systems, the energy donor is luminescent, e.g.
bioluminescent,
chemiluminescent, electrochemiluminescent, and the acceptor is fluorescent.
The
donor molecule and the acceptor molecule may be described as a reporter
molecular
to and a quencher molecule in the present invention, respectively.
Interactive dual label
includes the label pair providing detectable signal based on contact-mediated
quenching (Salvatore et al., Nucleic Acids Research, 2002 (30) no.21 e122 and
Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956). In the present
invention, the interactive label system includes any or all cases inducing
signal
changes by interaction between at least two molecules (e.g. dyes).
Particularly, the signal indicative of the presence of the extended strand
(i.e.,
the presence of the target nucleic acid sequence) is generated by interactive
label
systems, more preferably the FRET label system (i.e., interactive dual label
system).
First Embodiment (Intrastrand interactive-dual label)
In a first embodiment of an interactive dual label system, the first fragment
or
the CTO has an interactive dual label comprising a reporter molecule and a
quencher
molecule; wherein the melting of the extended duplex in the step (e) induces
change
of a signal from the interactive dual label to give the target signal in the
step (e). The
first embodiment of the interactive dual label system is illustrated in Fig.
5. The first
embodiment is named as an intrastrand interactive-dual label.
First Embodiment-1 (Intrastrand interactive-dual label on the CEO)
The exemplified embodiment is described with referring to Fig. 5. The
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
templating portion of the CTO has a reporter molecule and a quencher molecule.
The
PTO-NV hybridized with the target nucleic acid sequence is digested to release
the
first fragment and the first fragment is hybridized with the capturing portion
of the
CTO and extended to form the extended duplex.
When the extended duplex is formed in the step (d), the reporter molecule and
the quencher molecule on the CTO are conformationally separated to allow the
quencher molecule to unquench the signal from the reporter molecule; wherein
when
the extended duplex is melted in the step (e), the reporter molecule and the
quencher molecule are conformationally adjacent to each other to allow the
quencher
molecule to quench the signal from the reporter molecule, such that the target
signal
is given to indicate the presence of the extended strand in the step (e).
The expression used herein "the reporter molecule and the quencher molecule
are conformationally adjacent" means that the reporter molecule and the
quencher
molecule are three-dimensionally adjacent to each other by a conformational
structure of the first fragment or CTO such as random coil and hairpin
structure.
The expression used herein "the reporter molecule and the quencher molecule
are conformationally separated" means that the reporter molecule and the
quencher
molecule are three-dimensionally separated by change of a conformational
structure
of the first fragment or CTO upon the formation of a double strand.
Preferably, the target signal given in the step (e) includes melting curve, a
melting pattern or a Trn value that is obtained by measuring change of the
fluorescent
signal generated in the step (d).
According to an embodiment, the reporter molecule and the quencher molecule
may be located at any site on the CTO, so long as the signal from the reporter
molecule is quenched and unquenched depending on melting of the extended
duplex.
According to an embodiment, the reporter molecule and the quencher molecule
both are linked to the templating portion or to the capturing portion of the
CTO.
According to an embodiment, the reporter molecule and the quencher molecule
are positioned at 5'-end and 3'-end of CTO.
41
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
According to an embodiment, one of the reporter molecule and the quencher
molecule on the CTO is located at its 5'-end or at 1-5 nucleotides apart from
its 5'-end
and the other is located to quench and unquench the signal from the reporter
molecule depending on conformation of CTO
According to an embodiment, one of the reporter molecule and the quencher
molecule on the CTO is located at its 3'-end or at 1-5 nucleotides apart from
its 3'-end
and the other is located to quench and unquench the signal from the reporter
molecule depending on conformation of CTO.
According to an embodiment, the reporter molecule and the quencher molecule
are positioned at no more than 80 nucleotides, more preferably no more than 60
nucleotides, still more preferably no more than 30 nucleotides, still much
more
preferably no more than 25 nucleotides apart from each other. According to an
embodiment, the reporter molecule and the quencher molecule are separated by
at
least 4 nucleotides, more preferably at least 6 nucleotides, still more
preferably at
least 10 nucleotides, still much more preferably at least 15 nucleotides.
In the present invention, a hybrid between the uncleaved PTO-NV and the CTO
may be formed.
Where the templating portion of the CTO is labeled with an interactive dual
label as shown in Fig. 5, a signal change from the label on the hybrid between
the
uncleaved PTO-NV and the CTO is not induced. Therefore, the hybrid does not
provide a non-target signal.
Where the capturing portion of the CTO is labeled with an interactive dual
label, the hybrid between the uncleaved PTO and the CFO provides a non-target
signal in the melting step. In this case, the difference in Tm values of the
extended
duplex and the hybrid permits to discriminate the target signal of the
extended duplex
from the non-target signal of the hybrid.
First Embodiment-2 (Intrastrand interactive-dual label on the PTO-NV)
The 5'-tagging portion of the PTO-NV may have a reporter molecule and a
42
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
quencher molecule. The PTO-NV hybridized with the target nucleic acid sequence
is
digested to release the first fragment comprising the 5'-tagging portion with
the
reporter molecule and the quencher molecule. The first fragment is hybridized
with
the capturing portion of the CTO.
When the extended duplex is formed in the step (d), the reporter molecule and
the quencher molecule on the first fragment are conformationally separated to
allow
the quencher molecule to unquench the signal from the reporter molecule;
wherein
when the extended duplex is melted in the step (e), the reporter molecule and
the
quencher molecule are conformationally adjacent to each other to allow the
quencher
molecule to quench the signal from the reporter molecule, such that the target
signal
is given to indicate the presence of the extended strand in the step (e).
According to an embodiment, the reporter molecule and the quencher molecule
may be located at any site on the first fragment, so long as the signal from
the ,
reporter molecule is quenched and unquenched depending on melting of the
extended duplex.
According to an embodiment, one of the reporter molecule and the quencher
molecule on the first fragment is located at its 5'-end or at 1-5 nucleotides
apart from
its 5'-end and the other is located to quench and unquench the signal from the
reporter molecule depending on conformation of the first fragment.
According to an embodiment, the reporter molecule and the quencher molecule
are positioned at no more than 50 nucleotides, more preferably no more than 40
nucleotides, still more preferably no more than 30 nucleotides, still much
more
preferably no more than 20 nucleotides apart from each other. According to an
embodiment, the reporter molecule and the quencher molecule are separated by
at
least 4 nucleotides, more preferably at least 6 nucleotides, still more
preferably at
least 10 nucleotides, still much more preferably at least 15 nucleotides.
The hybrid between the uncleaved PTO-NV and the CTO may provide a non-
target signal in the melting step. In this case, the difference in Tm values
of the
extended duplex and the hybrid permits to discriminate the target signal of
the
43
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
extended duplex from the non-target signal of the hybrid.
Second Embodiment (Interstrand interactive-dual label)
In the second embodiment of the interactive label system, the first fragment
has one of an interactive dual label comprising a reporter molecule and a
quencher
molecule and the CTO has the other of the interactive dual label; wherein the
melting
of the extended duplex in the step (e) induces change of a signal from the
interactive
dual label to give the target signal in the step (e).
For example, when the extended duplex is formed in the step (d), the signal
lo from the
reporter molecule linked to the CTO is quenched by the quencher molecule
linked to the PTO-NV. When the extended duplex is melted in the step (e), the
reporter molecule and the quencher molecule are separated to allow the
quencher
molecule to unquench the signal from the reporter molecule, such that the
target
signal is given to indicate the presence of the extended strand in the step
(e).
Particularly, the target signal given in the step (e) includes a melting
curve, a
melting pattern or a Tm value that is obtained by measuring change of the
fluorescent
signal from the interactive dual label.
The reporter molecule and the quencher molecule may be located at any site
of the first fragment and the CTO, so long as the signal from the reporter
molecule is
quenched by the quencher molecule in the extended duplex.
According to an embodiment, the reporter molecule or the quencher molecule
on the PTO-NV fragment is located at the 5'-end of the 5'-tagging portion.
According to an embodiment, the reporter molecule or the quencher molecule
on the CTO is located at its 3'-end.
The hybrid between the uncleaved PTO and the CTO may provide a non-target
signal in the melting step. In this case, the difference in Tm values of the
extended
duplex and the hybrid permits to discriminate the target signal of the
extended duplex
from the non-target signal of the hybrid.
44
CA 02913873 2015-11-27
WO 2014/193071 PCT/KR2014/001529
The reporter molecule and the quencher molecule useful in the present
invention may include any molecules known in the art. Examples of those are:
Cy2TM
(506), YO-PRO"-1 (509), YOYOTm-1 (509), Calcein (517), FITC (518), FIuorXTM
(519),
AlexaTM (520), Rhodamine 110 (520), Oregon GreenTM 500 (522), Oregon GreenTM
488 (524), RiboGreenTM (525), Rhodamine GreenTm (527), Rhodamine 123 (529),
Magnesium Green"(531), Calcium Green" (533), TO-PROTm-1 (533), TOTO1 (533),
JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568
(568), BODIPY564/570 (570), Cy31m (570), AlexaTm 546 (570), TRITC (572),
Magnesium OrangeTm (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575),
Calcium Orange"(576), Pyronin Y (580), Rhodamine B (580), TAMRA (582),
Rhodamine RedTM (590), Cy3.51m (596), ROX (608), Calcium Crimson" (615),
AlexaTm
594 (615), Texas Red(615), Nile Red (628), YO-PROTm-3 (631), YOYOTm-3 (631), R-
phycocyanin (642), C-Phycocyanin (648), TO-PROTm-3 (660), TOTO3 (660), DiD
Di1C(5) ,
(665), Cy5TM (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET
(536),
Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559),
CAL .
Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM
(520),
Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667),
Quasar
670 (705) and Quasar 705 (610). The numeric in parenthesis is a maximum
emission
wavelength in nanometer. Particularly, the reporter molecule and the quencher
molecule include JOE, FAM, TAMRA, ROX and fluorescein-based label.
Suitable pairs of reporter-quencher are disclosed in a variety of publications
as
follows: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New
York,
1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel
Dekker, New
York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules,
2nd
Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of
Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators
(Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and
Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence
and
Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. R,
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular
Probes, Eugene, Oreg., 1996) U.S. Pat. Nos. 3,996,345 and 4,351,760.
It is noteworthy that a non-fluorescent black quencher molecule capable of
quenching a fluorescence of a wide range of wavelengths or a specific
wavelength
may be used in the present invention. Examples of those are BHQ and DABCYL.
In the FRET label adopted to the CTO, the reporter encompasses a donor of
FRET and the quencher encompasses the other partner (acceptor) of FRET. For
example, a fluorescein dye is used as the reporter and a rhodamine dye as the
quencher.
The labels may be linked to the CTO or PTO-NV by conventional methods.
Particularly, it is linked to the CTO or PTO-NV through a spacer containing
carbon
atoms (e.g., 3-carbon spacer, 6-carbon spacer or 12-carbon spacer).
(1-2) Single label
The present invention is also excellently executed using single label systems
for
providing signals indicating the presence of target nucleic acid sequences.
According to an embodiment, the first fragment or the CTO has a single label,
and the melting of the extended duplex in the step (e) induces change of a
signal
from the single label to give the target signal in the step (e).
First Embodiment (Single label system)
The templating portion of the CTO may have a single fluorescent label. The
PTO-NV hybridized with the target nucleic acid sequence is digested to release
the
first fragment. The first fragment is hybridized with the capturing portion of
the CTO
and extended to form the extended duplex. By the formation of the extended
duplex,
the fluorescent intensity from the single fluorescent label becomes increased.
When
the extended duplex is melted in the step (e), the fluorescent intensity from
the single
fluorescent label becomes decreased, such that the target signal is given to
indicate
the presence of the extended stand in the step (e).
46
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
According to an embodiment, the single label may be located at any site on the
CTO, so long as the signal level from the single label is changed depending on
melting
of the extended duplex.
According to an embodiment, the single label is linked to the templating
portion or to the capturing portion of the CTO.
Where the templating portion of the CTO is labeled with a single label, a
signal
change from the label on the hybrid between the uncleaved PTO-NV and the CTO
is
not induced. Therefore, the hybrid does not provide a non-target signal.
Where the capturing portion of the CTO is labeled with a single label, the
hybrid between the uncleaved PTO-NV and the CTO provides a non-target signal
in
the melting step. In this case, the difference in Tm values of the extended
duplex and
the hybrid permits to discriminate the target signal of the extended duplex
from the
non-target signal of the hybrid.
Second Embodiment (Single label system)
The 5'-tagging portion of the PTO-NV may have a single fluorescent label. The
PTO-NV hybridized with the target nucleic acid sequence is digested to release
the
first fragment comprising the 5'-tagging portion with the single fluorescent
label. By
the hybridization, the signal intensity from the single fluorescent label on
the 5'-
tagging portion is increased. When the extended duplex is melted in the step
(e), the
signal intensity from the single fluorescent label becomes decreased, such
that the
target signal is given to indicate the presence of the extended strand in the
step (e).
According to an embodiment, the single label may be located at any site on the
first fragment, so long as the signal level from the single label is changed
depending
on melting of the extended duplex.
The hybrid between the uncleaved PTO-NV and the CTO may provide a non-
target signal in the melting step. In this case, the difference in Tm values
of the
extended duplex and the hybrid permits to discriminate the target signal of
the
extended duplex from the non-target signal of the hybrid.
47
The single label used herein has to be capable of providing a different signal
depending on its presence on a double strand or single strand. The single
label
includes a fluorescent label, a luminescent label, a chemiluminescent label,
an
electrochemical label and a metal label. Preferably, the single label includes
a
fluorescent label.
The types and preferable binding sites of single fluorescent labels used in
this
invention are disclosed U.S. Pat. Nos. 7,537,886 and 7,348,141.
Preferably, the single
io fluorescent label includes JOE, FAM, TAMRA, ROX and fluorescein-based
label. The
labeled nucleotide residue is preferably positioned at internal nucleotide
residue within
the oligonucleotide rather than at the 5'-end or the 3'-end.
The single fluorescent label useful in the present invention may be described
with reference to descriptions for reporter and quencher molecules as
indicated above.
In particular, where the present invention on a solid phase is performed using
a
single label, it can utilize a general fluorescent label and does not require
a specific
fluorescent label capable of providing a fluorescent signal with different
intensities
depending on its presence on double strand or single strand. The target signal
provided on the solid substrate is measured.
When the CTO immobilized onto a solid substrate is used, chemical labels (e.g.
biotin) or enzymatic labels (e.g. alkaline phosphatase, peroxidase, 13-
galactosidase
and 8-gluocosidase) may be used.
In the labeling system using "label linked to the first fragment and/or the
CTO",
the labels may be positioned to the extent that when a hybrid between an
uncleaved
PTO-NV and the CTO is formed, the hybrid does not give a non-target signal in
the
step (e). Alternatively, the labels may be positioned to the extent that when
a hybrid
between an uncleaved PTO-NV and the CTO is formed, the hybrid gives a non-
target
signal in the step (e); wherein the T, value of the extended duplex is higher
than that
48
CA 2913873 2017-09-25
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
of the hybrid between the uncleaved PTO-NV and the CTO.
Particularly, where the labels are positioned to the extent that a hybrid
between an uncleaved PTO-NV and the CTO does not give a non-target signal, the
range including Trn value of the hybrid can be utilized to select Trn value of
the
extended duplex for detecting a target nucleic acid sequence.
(ii) Label incorporated into the extended duplex
The present invention may employ a label incorporated into the extended
duplex during the extension reaction for providing the target signal
indicative of the
presence of the extended strand.
Although the first fragment or CTO has no label, a label incorporated into the
extended duplex during the extension reaction is successfully used to allow
the
extended duplex to be labeled.
According to an embodiment, the target signal is provided by a single label
incorporated into the extended duplex during the extension reaction; wherein
the
incorporated single label is linked to a nucleotide incorporated during the
extension
reaction; wherein the melting of the extended duplex in the step (e) induces
change
of a signal from the single label to give the target signal in the step (e).
For example, the PTO-NV hybridized with the target nucleic acid sequence is
digested to release the first fragment. The first fragment is hybridized with
the
capturing portion of the CTO immobilized on a solid substrate and extended in
the
presence of nucleotides labeled with the single fluorescent label to form the
extended
duplex. The fluorescent signal from the extended duplex may be detected on
spot of
the solid substrate with immobilized CTO. When the extended duplex is melted,
a
strand having a fluorescent label is released and the fluorescent signal is no
longer
detected on the spot. Therefore, a signal change can be provided on the spot
by
melting of the extended duplex. In this regard, the target signal is given to
indicate
the presence of the extended strand in the step (e).
The target signal given in the step (e) includes a melting curve, a melting
49
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
pattern or a Tm value that is obtained by measuring change of the fluorescent
intensity on the CTO-immobilized spot.
According to an embodiment, a nucleotide incorporated during the extension
reaction is a ddNTP.
According to an embodiment, a nucleotide incorporated during the extension
reaction has a first non-natural base and the CTO has a nucleotide having a
second
non-natural base with a specific binding affinity to the first non-natural
base. The
nucleotide having the second non-natural base is preferably located at any
site on the
ternplating portion of the CTO.
to The term
used herein "non-natural base" refers to derivatives of natural bases
such as adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U),
which are
capable of forming hydrogen-bonding base pairs. The term used herein "non-
natural
base" includes bases having different base pairing patterns from natural bases
as
mother compounds, as described, for example, in U.S. Pat. Nos. 5,432,272,
5,965,364, 6,001,983, and 6,037,120. The base pairing between non-natural
bases
involves two or three hydrogen bonds as natural bases. The base pairing
between
non-natural bases is also formed in a specific manner.
Specific examples of non-natural bases include the following bases in base
pair
combinations: iso-C/iso-G, iso-dC/iso-dG, K/X, H/J, and M/N (see U.S. Pat. No.
7,422,850).
For example, the first fragment is hybridized with the CTO with a nucleotide
having a second non-natural base (e.g., iso-dC) with a specific binding
affinity to a
first non-natural base (e.g., iso-dG). The extension is carried out in the
presence of a
nucleotide having the first non-natural base labeled with a single fluorescent
label,
forming the extended duplex. In the extension reaction, the nucleotide having
the
first non-natural base is incorporated at an opposition site to the nucleotide
having
the second non-natural base.
The fluorescent signal from the extended duplex may be detected on spot of a
solid substrate with immobilized CTO. When the extended duplex is melted, a
strand
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
having a fluorescent label is released and the fluorescent signal is no longer
detected
on the spot. Therefore, a signal change can be provided on the spot by melting
of the
extended duplex. In this regard, the target signal is given to indicate the
presence of
the extended strand in the step (e).
Where the label incorporated into the extended duplex during the extension
reaction is employed, the label is not incorporated into the hybrid between
the
uncleaved PTO-NV and the CTO because the hybrid is not extended. Therefore,
the
hybrid does not provide a non-target signal.
The types and characteristics of the single labels used may be described with
reference to descriptions for the labeling system using "label linked to the
first
fragment and/or the CTO" as indicated hereinabove.
(iii) Label incorporated into the extended duplex and label linked to the
first fragment
or the CTO
The present invention may employ a labeling system using cooperation of a
label incorporated into the extended duplex during the extension reaction and
a label
linked to the first fragment and/or the CTO.
According to an embodiment, the target signal is provided by a label
incorporated into the extended duplex during the extension reaction and a
label linked
to the first fragment and/or the CTO, and the incorporated label is linked to
a
nucleotide incorporated during the extension reaction; wherein the two labels
are an
interactive dual label of a reporter molecule and a quencher molecule; wherein
the
melting of the extended duplex in the step (e) induces change of a signal from
the
interactive dual label to give the target signal in the step (e).
Particularly, the nucleotide incorporated during the extension reaction has a
first non-natural base and the CTO has a nucleotide having a second non-
natural base
with a specific binding affinity to the first non-natural.
For example, the first fragment is hybridized with the CTO comprising a
reporter or quencher molecule and a nucleotide having a second non-natural
base
51
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
(e.g., iso-dC) which is a specific binding affinity to a first non-natural
base (e.g., iso-
dG). The extension is carried out in the presence of a nucleotide having the
first non-
natural base labeled with a quencher or reporter molecule, forming the
extended
duplex in which the signal from the reporter molecule is quenched by the
quencher
molecule. In the extension reaction, the nucleotide having the first non-
natural base is
incorporated at an opposition site to the nucleotide having the second non-
natural
base.
When the extended duplex is melted in the step (e), the reporter molecule and
the quencher molecule are separated to allow the quencher molecule to unquench
the
signal from the reporter molecule, such that the target signal is given to
indicate the
presence of the extended strand in the step (e).
Particularly, the target signal given in the step (e) includes a melting
curve, a
melting pattern or a Tn, value that is obtained by measuring change of the
signal from
the interactive dual label.
The site of the label on the CTO and the incorporation site of the label
incorporated are determined to the extent that the two labels are acted as an
interactive dual label for inducing signal change in the melting step.
Particularly, the templating portion of the CTO has a reporter or quencher
molecule and a nucleotide having a second non-natural base. The extension
reaction
in the step (d) is performed in the presence of a nucleotide having a quencher
or
reporter molecule and a first non-natural base with a specific binding
affinity to the
second non-natural base in the CTO. The two non-natural bases in the extended
duplex in the step (d) form a base-pairing to quench a signal from the
reporter
molecule by the quencher molecule and to induce change of a signal, whereby
the
target signal is provided. Alternatively, the first fragment has a reporter or
quencher
molecule and the templating portion of the CTO has a nucleotide having a
second
non-natural base. The extension reaction in the step (d) is performed in the
presence
of a nucleotide having a quencher or reporter molecule and a first non-natural
base
with a specific binding affinity to the second non-natural base in the CTO.
The two
52
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
non-natural bases in the extended duplex in the step (d) form a base-pairing
to
induce change a signal from the reporter molecule by quenching, whereby the
target
signal is provided.
As another example, the first fragment having a reporter or quencher molecule
is hybridized with the CTO comprising a nucleotide having a second non-natural
base
(e.g., iso-dC) which is a specific binding affinity to a first non-natural
base (e.g., iso-
dG). The extension is carried out in the presence of a nucleotide having the
first non-
natural base labeled with a quencher or reporter molecule, forming the
extended
duplex in which the signal from the reporter molecule is quenched by the
quencher
molecule. In the extension reaction, the nucleotide having the first non-
natural base is
incorporated at an opposition site to the nucleotide having the second non-
natural
base.
When the extended duplex is formed in the step (d), the reporter molecule and
the quencher molecule are conformationally separated to allow the quencher
molecule
to unquench the signal from the reporter molecule; wherein when the extended
duplex is melted in the step (e), the reporter molecule and the quencher
molecule are
conformationally adjacent to each other to allow the quencher molecule to
quench the
signal from the reporter molecule, such that the target signal is given to
indicate the
presence of the extended strand in the step (e).
Particularly, the target signal given in the step (e) includes a melting
curve, a
melting pattern or a Tm value that is obtained by measuring change of the
signal from
the interactive dual label.
The site of the label on the PTO-NV and the incorporation site of the label
incorporated are determined to the extent that the two labels are acted as an
interactive dual label for inducing signal change in the melting step.
Where the label incorporated into the extended duplex during the extension
reaction is employed, the label is not incorporated into the hybrid between
the
uncleaved PTO-NV and the CTO because the hybrid is not extended. Therefore,
the
53
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
hybrid does not provide a non-target signal in the melting step.
(iv) Intercalating label
The present invention may employ an intercalating label for providing the
target signal indicative of the presence of the extended duplex. The
intercalating label
is more useful on a solid phase reaction using immobilized CTOs because double-
stranded nucleic acid molecules present in samples can generate signals.
Exemplified intercalating dyes useful in this invention include SYBRTM Green
I,
PO-PROTm-1, BO-PROTm-1, SYTOT"43, SYTOT"44, SYTOT"45, SYTOXT"Blue, POPOTm-1,
POPOTm-3, BOBOTm-1, BOBOTN-3, LO-PROTm-1, JO-PROTm-1, YO-PROT"1, TO-PROThl,
SYTOT"11, SYTOT"13, SYTOT"15, SYTOT"16, SYTOT"20, SYTOT"23, TOTOT"1-3,
Y0Y0T"3, GelStarTM and thiazole orange. The intercalating dyes intercalate
specifically
into double-stranded nucleic acid molecules to generate signals.
In certain embodiment, the first fragment is hybridized with the capturing
portion of the CO immobilized on a solid substrate. The extension is carried
out in
the presence of an intercalating dye (e.g., SYBRI" Green) and produces the
extended
duplex with intercalating dyes. The fluorescent signal from the extended
duplex on
spot of the solid substrate with immobilized CTO may be detected using
intercalating
fluorescent dyes. When the extended duplex is melted, intercalating
fluorescent dyes
are released and the fluorescent signal is no longer detected on the spot. In
this
regard, the target signal is given to indicate the presence of the extended
duplex in
the step (e).
The hybrid between the uncleaved PTO-NV and the CTO provides a non-target
signal in the melting step. In this case, the difference in Tm values of the
extended
duplex and the hybrid permits to discriminate the target signal of the
extended duplex
from the non-target signal of the hybrid.
Particularly, the target signal given in the step (e) includes a melting
curve, a
melting pattern or a Tm value that is obtained by measuring change of the
fluorescent
signal generated in the step (d).
54
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
Detection of Extended Duplex at Predetermined Temperature
According to an embodiment, the detection in the step (e) is carried out in
accordance with the PTOCE assay comprising detection at a pre-determined
temperature using signals from the extended duplex between the extended strand
and the CTO (see WO 2012/096523).
According to an embodiment, the extended strand of the first fragment and the
CTO form an extended duplex in the step (d); wherein the extended duplex has a
Tm
value adjustable by (i) a sequence and/or length of the first fragment, (ii) a
sequence
and/or length of the CTO or (iii) the sequence and/or length of the first
fragment and
the sequence and/or length of the CTO; wherein the extended duplex provides a
target signal by (i) at least one label linked to the first fragment and/or
CTO, (ii) a
label incorporated into the extended duplex during the extension reaction,
(iii) at least
one label linked to the first fragment and/or CTO and a label incorporated
into the
extended duplex during the extension reaction or (iv) intercalating label; and
wherein
the presence of the extended strand is detected by measuring the target signal
from
the extended duplex at a pre-determined temperature sufficient to maintain a
double
strand of the extended duplex.
The extended duplex per se can give signal capable of discriminating formation
from no-formation of the extended duplex and the signal is detected at a
predetermined temperature that the extended duplex maintains its double-
stranded
form, whereby the presence of a target nucleic acid sequence is determined.
The present invention is to measure a target signal in association with the
formation of the extended duplex, for detection of the presence of the target
nucleic
acid sequence.
In the present invention, the extended duplex has a label such that the
extended duplex provides a target signal.
The label system used for detection of the extended duplex by melting or
hybridization analysis can provide the target signal in the present method.
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
The working principle underlying a target signal from the extended duplex is
as
follows: (i) the extension of the first fragment induces change of a signal
from a label
to give the target signal; or (ii) the hybridization of the first fragment and
the CTO
induces change of a signal from a label to give the target signal and the
extended
duplex maintains the target signal.
For example, where immobilized CTOs are used, the present invention detects
a plurality of target nucleic acid sequences in much more effective manner.
The
templating portion of the immobilized CTO has a reporter molecule and a
quencher
molecule. The reporter molecule and the quencher molecule are conformationally
adjacent to each other to allow the quencher molecule to quench a signal from
the
reporter molecule. When the first fragment is hybridized with the capturing
portion of
the CTO, the quencher molecule quenches the signal from the reporter molecule.
By
the formation of the extended duplex, the reporter molecule and the quencher
molecule are conformationally separated to allow the quencher molecule to
unquench
the signal from the reporter molecule. The target signal is given in the
extension step.
In certain embodiment, the 5'-tagging portion of the PTO-NV has a reporter
molecule and a quencher molecule. The reporter molecule and the quencher
molecule
are conformationally adjacent to each other to allow the quencher molecule to
quench
a signal from the reporter molecule. The PTO-NV hybridized with the target
nucleic
acid sequence is digested to release the first fragment comprising the 5'-
tagging
portion with the reporter molecule and the quencher molecule, and the first
fragment
is hybridized with the capturing portion of the CTO. By the hybridization, the
reporter
molecule and the quencher molecule are conformationally separated to allow the
quencher molecule to unquench the signal from the reporter molecule. The
target
signal is given in the fragment hybridization step and the extended duplex
maintains
the target signal.
In such case that the 5'-tagging portion of the PTO-NV has a reporter molecule
and a quencher molecule, the hybrid between the uncleaved PTO and the CTO
provides non-target signal and it is necessary to dissociate the hybrid to
remove the
56
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
non-target signal. Therefore, the temperature for measuring the target signal
is
determined to dissociate the hybrid. According to an embodiment, the
temperature is
further determined in consideration of hybrid's Tm value.
According to an embodiment, the extended duplex may be detected at
temperatures that the hybrid is partially dissociated. According to an
embodiment, the
extended duplex may be detected at temperatures that the hybrid is
sufficiently
dissociated to remove the non-target signal.
According to an embodiment, the predetermined temperature is higher than
the hybrid's Tm value minus 10 C, preferably, higher than the hybrid's Tm
value minus
5 C, more preferably, higher than the hybrid's Tm value and still more
preferably,
higher than the hybrid's Tm value plus 5 C.
Detection Using Signaling Oligonucleotide
According to an embodiment, the extended strand of the first fragment may be
detected by using a signaling oligonucleotide (SO) as disclosed in
PCT/KR2012/005281.
The SO to be hybridized with the extended strand comprises a complementary
sequence to the extended strand. According to an embodiment, the SO comprises
a
complementary sequence to the extended sequence.
According to an embodiment, at least a portion of the SO comprises a
complementary sequence to the extended sequence. The portion of the SO
comprising a complementary sequence to the extended sequence is at least one,
two,
three, four, five or ten nucleotides in length.
When a portion of the SO is designed to comprise a complementary sequence
to a portion of the extended sequence newly synthesized, the Tm value of the
hybridization resultant of the SO and the extended strand becomes different
from that
of the hybridization resultant of the SO and the undigested PTO-NV. The
difference in
the Tm values ensures to differentiate signals from the two hybridization
resultants.
For example, non-target signals may be excluded in a real-time detection by
adjusting
57
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
temperature for detection in considering Tm values, or in a melting curve
analysis by
melting peaks.
The SO may comprise throughout its whole sequence a complementary
sequence to the extended sequence. Alternatively, the SO may comprise a
portion
having a complementary sequence to the extended sequence. For instance, one
portion of the SO may comprise a complementary sequence to the extended
sequence and the other portion may comprise a complementary sequence to the
fragment. Particularly, the SO comprises throughout its whole sequence a
complementary sequence to the extended sequence.
The SO may have any length, for example, 5-100 nucleotides, 5-80
nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-20 nucleotides, 5-10
nucleotides,
10-100 nucleotides, 10-80 nucleotides, 10-60 nucleotides, 10-40 nucleotides,
10-30
nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60
nucleotides, 15-40 nucleotides, 15-30 nucleotides, 15-20 nucleotides, 20-100
nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides or 20-30
nucleotides.
The SO may have a hairpin structure.
The 3'-end of the SO is blocked to prohibit its extension.
Alternatively, the
SO having a non-blocked 3'-OH end may be extended.
According to an embodiment, wherein the extended strand of the first
fragment is detected by using a signaling oligonucleotide (SO); wherein the SO
comprises a complementary sequence to the extended strand and at least one
label;
the SO provides a detectable signal by association with or dissociation from
the
extended strand.
The term "association with or dissociation from the extended strand" has the
same meaning as the term "hybridization with or denaturation from the extended
strand".
According to an embodiment, the detectable signal indicative of the presence
of the target nucleic acid sequence is provided by (i) the label linked to the
SO, (ii) a
58
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
combination of the label linked to the SO and a label linked to the fragment
from the
PTO-NV, (iii) a combination of the label linked to the SO and a label to be
incorporated
into the extended strand during the extension reaction of the step (d), or
(iv) a
combination of the label linked to the SO and an intercalating dye.
Briefly, the labeling systems useful in this invention will be described as
follows:
(i) Single label linked to the SO
The present invention may provide signal for formation of the extended strand
indicating the presence of the target nucleotide variation by using SO with a
single
label. According to an embodiment, the SO is labeled with a single label and
the
hybridization between the SO and the extended strand in the step (e) induces
change
in signal from the single label to provide the detectable signal.
In an embodiment, the single label used herein has to be capable of providing
a different signal depending on its presence on a double strand or single
strand.
(ii) Intrastrand interactive-dual label linked to SO
According to an embodiment, the SO is labeled with an interactive dual label
comprising a reporter molecule and a quencher molecule and the hybridization
between the SO and the extended strand in the step (e) induces change in
signal
from the interactive dual label to provide the detectable signal (see Fig. 6).
Prior to
hybridization of the SO, the reporter molecule and the quencher molecule on
the SO
are conformationally adjacent to each other to allow the quencher molecule to
quench
the signal from the reporter molecule. Upon hybridization, the reporter
molecule and
the quencher molecule on the SO are conformationally separated to allow the
quencher molecule to unquench the signal from the reporter molecule, causing
changes in signals-from the interactive dual label.
According to an embodiment of the present invention using the SO with an
interactive dual label, the first fragment released from the PTO-NV hybridized
with the
target nucleic acid sequence is hybridized with the capturing portion of the
CTO and
extended to form the extended strand. Upon hybridization of the extended
strand
59
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
with the SO, the reporter molecule and the quencher molecule on the SO are
conformationally separated to allow the quencher molecule to unquench the
signal
from the reporter molecule, giving rise to changes in signals from the
interactive dual
label (e.g., increase in signal from reporter molecules). The reporter
molecule and the
quencher molecule on the SO not involved in the hybridization are
conformationally
adjacent to each other to allow the quencher molecule to quench the signal
from the
reporter molecule.
According to an embodiment, the reporter molecule and the quencher molecule
are positioned at the 5'-end (or 3'-end) and 3'-end (or 5'-end) of the SO.
According to
an embodiment, one of the reporter molecule and the quencher molecule on the
SO
is located at its 5'-end or at 1-5 nucleotides apart from its 5'-end and the
other is
located to quench and unquench the signal from the reporter molecule depending
on
conformation of the SO.
According to an embodiment, one of the reporter molecule and the quencher
molecule on the SO is located at its 3'-end or at 1-5 nucleotides apart from
its 3'-end
and the other is located to quench and unquench the signal from the reporter
molecule depending on conformation of the SO.
(iii) Interstrand interactive-dual label
In the embodiment using the interstrand interactive-dual label, the extended
strand has one of an interactive dual label comprising a reporter molecule and
a
quencher molecule and the SO has the other of the interactive dual label.
The embodiment using the interstrand interactive-dual label may be conducted
in accordance with the following three fashions:
According to the first fashion, the SO comprises one label among a reporter
molecule and a quencher molecule of an interactive dual label, the fragment
from the
PTO-NV comprises the other label among the reporter molecule and the quencher
molecule; the extended strand comprises the label originated from the fragment
from
the PTO-NV, and wherein the hybridization between the SO and the extended
strand
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
induces change in signal from the interactive dual label to provide the
detectable
signal.
A label linked to the SO may be either a reporter molecule or a quencher
molecule, and a label to the fragment may be either a quencher molecule or a
reporter molecule.
The labeling site on the PTO-NV is determined in considering its cleavage
site,
so that the PTO-NV fragment may have the label.
The label may be linked to any site (e.g., the tagging portion of the PTO-NV)
on the PTO-NV fragment, so long as it interacts with the label to the SO upon
hybridization with the SO to induce change in signals. The label may be linked
to any
site (e.g., the 5'-end of the SO) on the SO, so long as it interacts with the
label on the
PTO-NV fragment upon hybridization with the PTO-NV fragment to induce change
in
signals.
According to the second fashion, the SO comprises one label among a reporter
molecule and a quencher molecule of an interactive dual label, and the
templating
portion of the CTO comprises a nucleotide having a first non-natural base;
wherein
the extension reaction in the step (d) is performed in the presence of a
nucleotide
having both a second non-natural base with a specific binding affinity to the
first non-
natural base and the other among the reporter molecule and the quencher
molecule,
thereby incorporating the label into the extended strand; wherein the
hybridization
between the SO and the extended strand induces change in signal from the
interactive dual label to provide the detectable signal.
The label incorporated during the extension is preferably linked to a
nucleotide,
more preferably to a nucleoside triphosphate. Preferably, the label is bound
to a base
of a nucleoside triphosphate.
The fragment is hybridized with the CTO with a nucleotide having a non-
natural base (e.g., iso-dC) with a specific binding affinity to a non-natural
base (e.g.,
iso-dG). The extension is carried out in the presence of a nucleotide having
the iso-dG
labeled with a quencher to form the extended strand. In the extension
reaction, the
61
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
nucleotide having iso-dG with a quencher is incorporated at an opposition site
to the
nucleotide having iso-dC. Following the hybridization of the extended strand
containing the quencher-iso-dG with the SO labeled with a reporter, the
quencher on
the extended strand quenches signal from the reporter on the SO to induce
changes
in signal, providing the detectable signal.
One of the interactive dual label is linked to the SO and the other is
incorporated into the extended strand from a reaction solution during the
extension
reaction.
A label linked to the SO may be either a reporter molecule or a quencher
11) molecule, and a label incorporated into the extended strand may be
either a quencher
molecule or a reporter molecule.
The label incorporated into the extended strand may be linked to any site on
the extended strand (e.g., the 3'-end of the extended strand), so long as it
interacts
with the label to the SO upon hybridization with the SO to induce change in
signals.
is The label may be linked to any site (e.g., the 5'-end of the SO) on the
SO, so long as
it interacts with the label incorporated into the extended strand upon
hybridization
with the extended strand to induce change in signals.
According to the third fashion, the SO comprises one label among a reporter
molecule and a quencher molecule of an interactive dual label, and the
extension
20 reaction in the step (d) is performed in the presence of a nucleotide
having the other
among the reporter molecule and the quencher molecule, thereby incorporating
the
label into the extended strand; wherein the hybridization between the SO and
the
extended strand induces change in signal from the interactive dual label to
provide
the detectable signal.
25 A label
linked to the SO may be either a reporter molecule or a quencher
molecule (preferably reporter molecule), and a label incorporated into the
extended
strand may be either a quencher molecule or a reporter molecule (preferably
quencher molecule).
62
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
(iv) Interactive-dual label using two SOs
In the embodiment of the interactive-dual label using two SOs, the method of
the present invention uses an additional SO comprising a complementary
sequence to
the extended strand, the two SOs are hybridized with the extended strand in an
adjacent manner, the two SOs each comprises one label among a reporter
molecule
and a quencher molecule of an interactive dual label; and the hybridization
between
the two SOs and the extended strand induces change in signal from the
interactive
dual label to provide the detectable signal.
Particularly, at least one of the two SOs comprises a portion hybridized to a
to newly extended sequence in the extension reaction.
The principle underlying the performance of the embodiment of the interactive-
dual label using two SOs are as follows: The first fragment released from the
PTO-NV
hybridized with the target nucleic acid sequence having the target nucleotide
variation,
is hybridized with the capturing portion of the CTO and extended to form the .
extended strand. Afterwards, the two SOs are hybridized with the extended
strand. In
the hybridization, since the two SOs are adjacently hybridized with the
extended
strand, the reporter molecule and the quencher molecule on the two SOs are
adjacent
to each other to allow the quencher molecule to quench the signal from the
reporter
molecule, resulting in change in signals from the interactive dual label
(e.g., increase
in signal from reporter molecules). The reporter molecule and the quencher
molecule
on the two SOs not involved in the hybridization are separated to each other
to
generate signal from the reporter molecule.
According to an embodiment, the two SOs may be hybridized with any sites of
the extended strand so long as their hybridization with the extended strand
permits
the quencher molecule to quench the signal from the reporter molecule.
Preferably,
the two SOs are positioned in an immediately adjacent manner or 1-5
nucleotides
apart from each other.
According to an embodiment, where the two SOs may be adjacently hybridized
with the extended strand, the reporter molecule and the quencher molecule may
be
63
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
linked to any sites of the two SOs so long as the quencher molecule quenches
the
signal from the reporter molecule. For example, the reporter molecule or the
quencher molecule is linked to the 5'-end of one SO or 1-5 nucleotides apart
from its
5'-end, and the quencher molecule or the reporter molecule to the 3'-end of
the other
SO or 1-5 nucleotides apart from its 3'-end.
(v) FRET label using intercalating dyes
According to the present invention, a FRET (fluorescence resonance energy
transfer) signaling becomes practical using intercalating dyes.
According to an embodiment, the SO comprises an acceptor of a FRET and the
hybridization in the step (e) is preformed in the presence of an intercalating
dye;
wherein the hybridization between the SO and the extended strand induces
change in
signal from the acceptor of the SO to provide the detectable signal.
The principle underlying the performance of the embodiment of the FRET label
using intercalating dyes are as follows: The first fragment released from the
PTO-NV
hybridized with the target nucleic acid sequence having the target nucleotide
variation
is hybridized with the capturing portion of the CTO and extended to form the
extended strand. Afterwards, the SO labeled with the acceptor is hybridized
with the
extended strand to form a double- stranded nucleic acid molecule and then the
intercalating dyes are bound to the double-stranded nucleic acid molecule. The
energy transfer occurs from the intercalating dyes serving as a donor molecule
to the
acceptor by illumination for donor excitation and induces change in signal
from the
acceptor to provide the detectable signal.
According to an embodiment, the acceptor linked to the SO includes various
single fluorescent labels described above, but not limited to.
The SO useful in the present invention includes any probes capable of
providing signals dependent on hybridization, for example, Molecular beaconTM
(US
Pat. No. 5,925,517), HybeaconsTM (D. J. French, et al., Molecular and Cellular
Probes
(2001) 13, 363-374 and US Pat. No. 7,348,141), Dual-labeled, self-quenched
probe
64
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
(US Pat. No. 5,876,930), LUXTM (I. A. Nazarenko, et al. Nucleic Acids Res
2002,
30:2089-2095. and US Pat. No. 7,537,886) and Hybridization probe (Bernard PS,
et
al., Clin Chem 2000, 46, 147-148 and Deepti Parashar et al., Indian 3 Med Res
124,
review article October 2006 385-398).
According to an embodiment, detection using SO may be carried out in a real-
time manner using labels proving signals detectable in a real-time fashion.
Alternatively, the detection using SO may be carried out by a melting analysis
or hybridization analysis because the labels used in the present invention are
capable
of providing detectable signals during melting of the hybridization resultant
or melting
and hybridization of the hybridization resultant.
According to an embodiment, the extended strand may be further amplified by
using a primer forming a pair of primers with the PTO-NV fragment.
According to an embodiment, the SO is blocked at its 3'-end to prohibit its
extension.
Detection Using Hybridizing Oligonucleotide
According to an embodiment, the extended strand of the first fragment is
detected by using a HO (hybridizing oligonucleotide); wherein the HO comprises
a
hybridizing nucleotide sequence complementary to the CTO and at least one
label;
wherein the extension of the first fragment induces the cleavage of the HO by
an
enzyme having a 5' nuclease activity to generate a detectable signal from the
label.
According to an embodiment, the HO is located downstream of the first
fragment on the CTO.
According to an embodiment, the HO comprises a hybridizing nucleotide
sequence complementary to the templating portion of the CTO.
According to an embodiment, the template-dependent nucleic acid polymerase
used for the extension of the fragment has a 5' nuclease activity.
The length of the HO may be widely varied. For example, the HO is 5-100
nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-20
nucleotides, 5-
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
nucleotides, 10-100 nucleotides, 10-80 nucleotides, 10-60 nucleotides, 10-40
nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-80
nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 15-20
nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40
5 nucleotides or 20-30 nucleotides in length.
In an embodiment of this invention, the HO is blocked at its 3'-end to
prohibit
its extension.
Briefly, the labeling systems useful in this invention will be described as
follows:
(i) Single label linked to the HO
10 The present
invention may provide signal for formation of the extended strand
indicating the presence of the target nucleotide variation by using HO with a
single
label.
In an embodiment, the single label used herein has to be capable of providing
a different signal depending on its presence on a double strand or single
strand (e.g.
the HO and the fragment of HO).
According to an embodiment, it is necessary to detect signal at temperature to
allow for hybridization between the HO and the CTO.
(ii) Interactive dual label linked to the HO
According to an embodiment, the detectable signal is provided by an
interactive dual label linked to the HO.
As illustrated in Fig. 7, the first fragment released from the PTO-NV is
hybridized with the capturing portion of the CTO and the HO labeled with an
interactive dual label comprising a reporter molecule and a quencher molecule
is
hybridized with the templating portion of the CEO. The extension of the first
fragment
induces cleavage of the HO to separate the reporter molecule from the quencher
molecule, thereby providing a signal indicating the presence of the extended
strand.
,
In such embodiment, where the dual label-linked nucleotides are relatively
adjacent to each other, signal changes between before and after the HO
cleavage
66
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
may be utilized for signal detection.
Where the dual label-linked nucleotides are relatively distal to each other,
the
hybridization between the HO and the CTO induces conformational separation of
the
interactive dual label to unquench the signal from the reporter molecule even
with no
HO cleavage, thereby generating a signal change. In this case, the signal from
a
cleaved fragment of the HO may be detected at higher temperatures (e.g., 95 C)
to
allow for prevention of hybridization between the HO and the CTO.
According to an embodiment, the reporter molecule and the quencher molecule
may be located at any site on the HO, so long as the cleaved HO and the
uncleaved
to HO can provide discriminative signals.
In certain embodiment, the reporter molecule and the quencher molecule each
is located at both ends of the HO.
(iii) Interactive dual label linked to the HO and the CTO
According to an embodiment, the detectable signal is provided by one of an
interactive dual label comprising a reporter molecule and a quencher molecule
linked
to the HO and the other linked to the CTO.
In certain embodiment, the reporter molecule and the quencher molecule are
positioned on the HO and the CTO such that a signal from the reporter molecule
is
quenched by the quencher molecule when the HO is hybridized to CTO. The
cleavage
of the HO induced by extension of the first fragment allows to release the HO
from
the CTO and separate the reporter molecule from the quencher molecule and then
the quencher molecule to unquench the signal from the reporter molecule,
thereby
providing a signal indicating the presence of the extended strand.
According to an embodiment, it is necessary to detect signal at temperatures
to allow for hybridization between the HO and the CTO.
In an embodiment, the HO may be designed to have a hairpin structure.
In certain embodiment, one of the reporter molecule and the quencher
molecule is linked to the 3'-end of the HO and the' other is linked to the 5'-
end of the
67
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
CTO.
According to an embodiment, the label system such as interactive-dual label
using two HOs may be employed in the present method using HO. The interactive-
dual label may be located at any site on the two HOs, so long as the cleaved
HO and
the uncleaved HO can provide discriminative signals. The types and locations
of labels
may be described with reference to descriptions for the SO.
According to an embodiment, the label system such as FRET label using
intercalating dyes may be employed in the present method using HO. The FRET
label
may be located at any site on the HO, so long as the cleaved HO and the
uncleaved
to HO can
provide discriminative signals in the presence of the intercalating dye. The
types and locations of labels may be described with reference to descriptions
for the
SO.
Detection by Size or Sequence of Extended Strand
According to an embodiment, the extended strand of the first fragment may be
=
detected on the basis of either the size or sequence of the extended strand.
For
example, the extended strand can be detected by using an electrophoresis or a
mass
analysis (e.g., electron impact (El), chemical ionization (CI), Field
Desoption (FD),
252Cf-Plasma desoprtion (PD), desoprtion chemical ionization (DCI), secondary
ion
mass spectrometry (SIMS), fast atom bombardment (FAB), electrospray ionization
(ESI), matrix-assisted laser desoprtion ionization (MALDI) and Tandem Mass
Spectrometry).
The PTO-NV and CTO may be comprised of naturally occurring dNMPs.
Alternatively, the PTO-NV and CTO may be comprised of modified nucleotide or
non-
natural nucleotide such as PNA (peptide nucleic acid, see PCT Publication No.
WO
92/20702) and LNA (locked nucleic acid, see PCT Publication Nos. WO 98/22489,
WO
98/39352 and WO 99/14226). The PTO-NV and CTO may comprise universal bases
such as deoxyinosine, inosine, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-
nitropyrrole and 5-
68
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
nitroindole. The term "universal base" refers to one capable of forming base
pairs
with each of the natural DNA/RNA bases with little discrimination between
them.
According to an embodiment, the method further comprises repeating all or
some of the steps (a)-(e) with denaturation between repeating cycles. The
reaction
repetition is accompanied with amplification of the target nucleic acid
sequence.
Preferably, the amplification is performed in accordance with PCR (polymerase
chain
reaction) which is disclosed in U.S. Pat. Nos. 4,683,195, 4,683,202, and
4,800,159.
According to an embodiment, the method further comprises repeating the
steps (a)-(b), (a)-(d) or (a)-(e) with denaturation between repeating cycles.
For
example, the method may be carried out by repeating the steps (a)-(b), (a)-(d)
or
(a)-(e) for several cycles, e.g., 2-80 cycles, 2-50 cycles, 2-40 cycles, 10-80
cycles, 10-
50 cycles, 10-40 cycles, 20-80 cycles, 20-50 cycles, 20-40 cycles, 30-60
cycles or 40-
60 cycles with denaturation between repeating cycles, and then performing the
step
(e). For example, the method may be also carried out by repeating the steps
(a)-(b)
for several cycles, e.g., 2-80 cycles, 2-50 cycles, 2-40 cycles, 10-80 cycles,
10-50
cycles, 10-40 cycles, 20-80 cycles, 20-50 cycles, 20-40 cycles, 30-60 cycles
or 40-60
cycles with denaturation between repeating cycles, and then performing the
steps (c)-
(e).
The denaturation may be carried out by conventional technologies, including,
but not limited to, heating, alkali, formamide, urea and glycoxal treatment,
enzymatic
methods (e.g., helicase action), and binding proteins. For instance, the
melting can be
achieved by heating at temperature ranging from 80 C to 105 C. General methods
for
accomplishing this treatment are provided by Joseph Sambrook, et al.,
Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.(2001).
According to an embodiment, the steps (a)-(e) are performed in a reaction
vessel or in separate reaction vessels. For example, the steps (a)-(b), (c)-
(d) or (e)
may be performed in separate reaction vessels.
According to an embodiment, the steps (a)-(e) may be simultaneously or
69
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
separately even in a reaction vessel depending on reaction conditions
(particularly,
temperature). For example the steps (a)-(b) and (c)-(e) may be simultaneously
or
separately even in a reaction vessel depending on reaction conditions
(particularly,
tern peratu re).
According to an embodiment, the selective amplification using the
amplification
blocker and the primer pair comprising the upstream primer and the downstream
primer, and the detection of the target nucleotide variation using cleavage of
the PTO-
NV may be separately performed in separate reaction vessels or even in a
reaction
vessel depending on reaction conditions (particularly, temperature).
Where conducted in separate reaction vessels, the PTO-NV may be cleaved
independent on an upstream oligonucleotide, or dependent on an upstream probe.
The present invention does not require that target nucleic add sequences to be
detected and/or amplified have any particular sequence or length, including
any DNA
(gDNA and cDNA) and RNA molecules.
Where a mRNA is employed as starting material, a reverse transcription step is
necessary prior to performing annealing step, details of which are found in
Joseph
Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.(2001); and Noonan, K. F. et al.,
Nucleic
Acids Res. 16:10366 (1988). For reverse transcription, a random hexamer or an
oligonucleotide dT primer hybridizable to mRNA can be used.
The target nucleic acid sequences which may be detected and/or amplified
include any naturally occurring prokaryotic, eukaryotic (for example,
protozoans and
parasites, fungi, yeast, higher plants, lower and higher animals, including
mammals
and humans) or viral (for example, Herpes viruses, HIV, influenza virus,
Epstein-Barr
virus, hepatitis virus, polio virus, etc.) or viroid nucleic acid.
The target nucleic acid sequence to be detected by the present invention
includes a wide variety of nucleic acid sequences, e.g., sequences in a
genome,
artificially isolated or fragmented sequences and synthesized sequences (e.g.,
cDNA
sequences and barcode sequences). For instance, the target nucleic acid
sequence
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
includes nucleic acid marker sequences for Immuno-PCR (IPCR). IPCR employs
conjugates between nucleic acid marker sequences and antibodies together with
PCR,
which is widely applied for detecting various types of targets including
proteins (see
Sano et al., Science 258 pp:120-122(1992), U.S. Pat. No. 5,665,539, Niemeyer
et al.,
Trends in Biotechnology 23 pp:208-216(2005), U.S. Pat. Pub. No. 2005/0239108
and
Ye et al., Journal of Environmental Science 22 pp:796-800(2010)).
The advantages of the present invention may be highlighted in the
simultaneous (multiplex) detection of at least two types of nucleotides
variations.
According to an embodiment, the method is performed to detect at least two
types (more preferably, at least three types, still more preferably at least
five types) of
nucleotides variations; wherein the upstream primer and the downstream primer
comprise at least two types (more preferably, at least three types, still more
preferably at least five types) of upstream primers and downstream primers,
the
amplification blocker comprises at least two types (more preferably, at least
three
types, still more preferably at least five types) of amplification blockers,
and the PTO-
NV comprises at least two types (more preferably, at least three types, still
more
preferably at least five types) of PTO-NVs.
Nucleotide Variation Detection Using Immobilized Oligonucleotide on a Solid
Phase
The present invention is also effective in detection of nucleotide variations
on a
solid phase such as microarray.
According to an embodiment, the present invention is performed on the solid
phase and an oligonucleotide (e.g. CTO, SO or HO) is immobilized through its
5'-end
or 3'-end onto a solid substrate. In a solid phase, the target signal provided
on the
solid substrate is measured.
The immobilization of the CTO, SO or HO may be done in two fashions.
In the first fashion, the CTO, SO or HO having been already immobilized on the
solid substrate is involved in the reaction steps. In the second fashion, the
CTO, SO or
HO is involved in a non-immobilized form then immobilized on the solid
substrate
71
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
during the reaction steps.
According to an embodiment, in the solid phase reaction, the single label is
not
required to possess the capability of generating signals different intensities
depending
on whether nucleic acid sequences having the single label is in a single
strand or a
double strand. The single label includes, but not limited to, a chemical label
(e.g.,
biotin), an enzymatic label (e.g., alkaline phosphatase, peroxidase, 13-
galactosidase
and 13-glucosidase), a radioisotope label (e.g., 1125 and C'4), a fluorescent
label, a
luminescent label, a chemiluminescent label, and a metal label (e.g., gold).
For the solid phase reaction, the CTO, SO or HO is immobilized directly or
to indirectly
(preferably indirectly) through its 5'-end or 3'-end (preferably the 3'-end)
onto the surface of the solid substrate. Furthermore, the CTO, SO or HO may be
immobilized on the surface of the solid substrate in a covalent or non-
covalent manner.
Where the immobilized oligoncleotides are immobilized indirectly onto the
surface of
the solid substrate, suitable linkers are used. The linkers useful in this
invention may
include any linkers utilized for probe immobilization on the surface of the
solid
substrate. For example, alkyl or aryl compounds with amine functionality, or
alkyl or
aryl compounds with thiol functionality serve as linkers for immobilization.
In addition,
poly (T) tail or poly (A) tail may serve as linkers and significantly decrease
space
hindrance that is an inhibitory factor to enzymatic actions (e.g., enzymatic
cleavage
reactions), contributing to increase in hybridization efficiency. The poly (T)
tail or poly
(A) tail as linkers is not considered a sequence of probes.
According to an embodiment, the CIO, SO or HO may be immobilized on the
solid substrate via interaction between binding partners (e.g.,
biotin/streptavidin). For
example, the CTO, SO or HO with one of binding partners (biotin and
streptavidin)
may be immobilized on the solid substrate whose surface is modified with the
other
binding partner.
According to an embodiment, the CTO, SO or HO may be immobilized on the
solid substrate by a nucleotide sequence for immobilization. For example, the
solid
substrate whose surface is modified with the nucleotide sequence for
immobilization
72
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
may be used to immobilize the CTO, SO or HO with additional sequence
complementary to the nucleotide sequence for immobilization.
According to an embodiment, the solid substrate used in the present invention
is a microarray. The microarray to provide a reaction environment in this
invention
may include any those known to one of skill in the art. All processes of the
present
invention, i.e., hybridization to target nucleic acid sequences, cleavage,
extension,
melting and fluorescence detection, are carried out on the microarray. The
immobilized oligonucleotides on the microarray serve as hybridizable array
elements.
The solid substrate to fabricate microarray includes, but not limited to,
metals (e.g.,
gold, alloy of gold and copper, aluminum), metal oxide, glass, ceramic,
quartz, silicon,
semiconductor, Si/Si02 wafer, germanium, gallium arsenide, carbon, carbon
nanotube,
polymers (e.g., polystyrene, polyethylene, polypropylene and polyacrylamide),
sepharose, agarose and colloids. The solid substrate may be in the form of a
dipstick,
a plate, a particle (e.g., bead), an affinity column and a membrane. A
plurality of
immobilized oligonucleotides in this invention may be immobilized on an
addressable
region or two or more addressable regions on a solid substrate that may
comprise 2-
1,000,000 addressable regions. Immobilized oligonucleotides may be fabricated
to
produce array or arrays for a given application by conventional fabrication
technologies such as photolithography, ink-jetting, mechanical microspotting,
and
derivatives thereof.
The present invention performed on the solid phase can detect simultaneously
a plurality of target nucleic acid sequences even using a single type of a
label because
the labels on the oligonucleotides immobilized are physically separated. In
this regard,
the number of target nucleic acid sequences to be detected by the present
invention
on the solid phase is not limited.
Using confocal detection devices, the signal only on the solid substrate may
be
detected without influence of labels suspended in a liquid phase.
Kits for Detection of Target Nucleotide Variation
73
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
In another aspect of this invention, there is provided a kit for detecting a
target
nucleotide variation on a target nucleic acid sequence using amplification
blocker and
VD-PTOCE assay, comprising:
(a) a primer pair comprising an upstream primer and a downstream primer for
amplification of the target nucleic acid; wherein each of the upstream primer
and
the downstream primer comprise a hybridizing nucleotide sequence
complementary to the target nucleic acid sequence;
(b) an amplification blocker having the resistance to 5' nuclease cleavage;
wherein
the amplification blocker comprises a complementary sequence to a non-target
nucleotide variation which is different from the target nucleotide variation
on the
target nucleic acid sequence; and
(c) a PTO-NV (Probing and Tagging Oligonucleotide for Nucleotide Variation);
wherein and the PTO-NV comprises (i) a 3'-targeting portion comprising a
hybridizing nucleotide sequence complementary to the target nucleic acid
sequence, (ii) a 5'-tagging portion comprising a nucleotide sequence non-
complementary to the target nucleic acid sequence, and (iii) a nucleotide
variation
discrimination site, comprising a complementary sequence to the target
nucleotide
variation on the target nucleic acid, positioned on a 5'-end part of the 3'-
targeting
portion;
(d) a CTO (Capturing and Templating Oligonucleotide); wherein the CTO
comprises
in a 3' to 5' direction (i) a capturing portion comprising a nucleotide
sequence
complementary to the 5'-tagging portion or a part of the 5'-tagging portion of
the
PTO-NV and (ii) a templating portion comprising a nucleotide sequence non-
complementary to the 5'-tagging portion and the 3'-targeting portion of the
PTO-
NV; wherein the first fragment or the second fragment released from the PTO-NV
is hybridized with the capturing portion of the CTO;
wherein the amplification blocker is hybridized with the target nucleic acid
sequence having the non-target nucleotide variation and not hybridized with
the
target nucleic acid sequence having the target nucleotide variation; wherein
the 3'-
74
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
targeting portion of the PTO-NV is hybridized with the target nucleic acid
sequence
and the 5'-tagging portion the PTO-NV is not hybridized with the target
nucleic
acid sequence;
wherein the upstream primer is located upstream of the PTO-NV; the
amplification blocker is located downstream of the upstream primer or the
downstream primer; ; and the amplification blocker and the PTO-NV are located
between the upstream primer or the downstream primer;
wherein the upstream primer induces through its extended strand the
cleavage of the PTO-NV by the enzyme having the 5' nuclease activity; wherein
the hybridization of the amplification blocker to the target nucleic acid
sequence
having the non-target nucleotide variation inhibits the extension of the
primer
located upstream of the amplification blocker, resulting in blocking the
amplification of the target nucleic acid sequence having the non-target
nucleotide
variation;
wherein when the PTO-NV is hybridized with the target nucleic acid
sequence having the target nucleotide variation complementary to the
nucleotide
variation discrimination site, the 5'-end part of the 3'-targeting portion
forms a
double strand with the target nucleic acid sequence to induce cleavage from a
first
initial cleavage site and a first fragment is released; wherein when the PTO-
NV is
hybridized with the target nucleic acid sequence having the non-target
nucleotide
variation non-complementary to the nucleotide variation discrimination site,
the 5'-
end part of the 3'-targeting portion does not form a double strand with the
target
nucleic acid sequence to induce cleavage from a second initial cleavage site
located downstream of the first initial cleavage site and a second fragment is
released; wherein the second fragment comprises an additional 3'-end portion
allowing the second fragment different from the first fragment;
wherein when the first fragment is hybridized with the capturing portion
of the CTO, it is extended to form an extended strand comprising a extended
sequence complementary to the templating portion of the CTO; wherein when the
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
second fragment is hybridized with the capturing portion of the CTO, it is not
extended.
Since the kit of this invention is constructed to perform the detection method
of the present invention described above, the common descriptions between them
are
omitted in order to avoid undue redundancy leading to the complexity of this
specification.
According to an embodiment, the kit further comprises the enzyme having the
5' nuclease activity, a template-dependent nucleic acid polymerase or their
combination.
According to an embodiment, the amplification blocker comprises
nucleosides/nucleotides having a backbone resistant to the 5' nuclease
activity.
According to an embodiment, the amplification blocker comprises peptide
nucleic acid (PNA), locked nucleic acid (LNA), Morpholino, glycol nucleic acid
(GNA),
threose nucleic acid (TNA) ), bridged nucleic acids (BNA), N3'-P5'
phosphoramidate
(NP) oligomers, minor groove binder-linked-oligonucleotides (MGB-linked
oligonucleotides), phosphorothioate (PS) oligomers, C1-C4 alkylphosphonate
oligomers, phosphoramidates, B-phosphodiester oligonucleotides, a-
phosphodiester
oligonucleotides or combination thereof.
According to an embodiment, the CTO has a sequence selected such that the
CTO is not hybridized with the additional 3'-end portion of the second
fragment to
prevent the second fragment from extension when the second fragment is
hybridized
with the capturing portion of the CTO.
According to an embodiment, the nucleotide variation discrimination site is
located within 10 nucleotides apart from the 5'-end of the 3'-targeting
portion of the
PTO-NV.
According to an embodiment, the 5'-end part of the 3'-targeting portion of the
PTO-NV comprises a non-base pairing moiety located within 1-5 nucleotides
apart
from the nucleotide variation discrimination site; wherein the non-base
pairing moiety
76
CA 02913873 2015-11-27
WO 2014/193071
PCT/ICR2014/001529
enhances differentiation between the first initial cleavage site and the
second initial
cleavage site.
According to an embodiment, the non-base pairing moiety is (i) a nucleotide
comprising an artificial mismatch base, a non-base pairing base modified to be
incapable of base pairing or a universal base, (ii) a non-base pairing
nucleotide
modified to be incapable of base pairing, or (iii) a non-base pairing chemical
compound.
According to an embodiment, the nucleotide variation is a substitution
variation, a deletion variation or an insertion variation.
According to an embodiment, the extended strand of the first fragment and
the CTO form an extended duplex; wherein the extended duplex has a Tm value
adjustable by (i) a sequence and/or length of the first fragment, (ii) a
sequence
and/or length of the CTO or (iii) the sequence and/or length of the first
fragment and
the sequence and/or length of the CTO; wherein the extended duplex provides a
target signal by (i) at least one label linked to the first fragment and/or
CTO, (ii) a
label incorporated into the extended duplex during the extension reaction,
(iii) at least
one label linked to the first fragment and/or CTO and a label incorporated
into the
extended duplex during the extension reaction or (iv) intercalating label; and
wherein
the presence of the extended strand is detected by measuring the target signal
from
the extended duplex in accordance with a melting analysis or a hybridization
analysis
for the extended duplex.
According to an embodiment, the extended strand of the first fragment and
the CTO form an extended duplex; wherein the extended duplex has a Tm value
adjustable by (i) a sequence and/or length of the first fragment, (ii) a
sequence
and/or length of the CTO or (iii) the sequence and/or length of the first
fragment and
the sequence and/or length of the CTO; wherein the extended duplex provides a
target signal by (i) at least one label linked to the first fragment and/or
CTO, (ii) a
label incorporated into the extended duplex during the extension reaction,
(iii) at least
one label linked to the first fragment and/or CTO and a label incorporated
into the
77
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
extended duplex during the extension reaction or (iv) intercalating label; and
wherein
the presence of the extended strand is detected by measuring the target signal
from
the extended duplex at a pre-determined temperature sufficient to maintain a
double
strand of the extended duplex.
According to an embodiment, the kit further comprises a signaling
oligonucleotide (SO) to detect the extended strand of the first fragment;
wherein the
SO comprises a complementary sequence to the extended strand and at least one
label; the SO provides a detectable signal by association with or dissociation
from the
extended strand. According to an embodiment, the detectable signal is provided
by (i)
the label linked to the SO, (ii) a combination of the label linked to the SO
and a label
linked to the fragment from the PTO-NV, (iii) a combination of the label
linked to the
SO and a label to be incorporated into the extended strand during the
extension
reaction, or (iv) a combination of the label linked to the SO and an
intercalating dye.
According to an embodiment, the kit uses an additional SO comprising a
complementary sequence to the extended strand, the two SOs are hybridized with
the
extended strand in an adjacent manner, the two SOs each comprises one label
among
a reporter molecule and a quencher molecule of an interactive dual label.
According to an embodiment, the kit further comprises a HO (hybridizing
oligonucleotide) to detect the extended strand of the first fragment; wherein
the HO
comprises a hybridizing nucleotide sequence complementary to the CTO and at
least
one label; wherein the extension of the first fragment induces the cleavage of
the HO
by an enzyme having a 5' nuclease activity to generate a detectable signal
from the
label. According to an embodiment, the detectable signal is provided by (i) an
interactive dual label linked to the HO, or (ii) one of an interactive dual
label
comprising a reporter molecule and a quencher molecule linked to the HO and
the
other linked to the CTO.
According to an embodiment, the amplification blocker, PTO-NV, CTO, SO
and/or HO is blocked at its 3'-end to prohibit its extension.
According to an embodiment, the kit is performed to detect at least two
78
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
types of nucleotides variations; wherein the upstream primer and the
downstream
primer comprise at least two types of upstream primers and downstream primers,
the
amplification blocker comprises at least two types of amplification blockers,
and the
PTO-NV comprises at least two types of PTO-NVs.
According to an embodiment, the template-dependent nucleic acid
polymerase is the same as the enzyme having the 5' nuclease activity.
According to an embodiment, the enzyme having the 5' nuclease activity is a
thermostable DNA polymerase having a 5' nuclease activity or FEN nuclease.
All of the present kits described hereinabove may optionally include the
reagents required for performing target amplification PCR reactions (e.g., PCR
reactions) such as buffers, DNA polymerase cofactors, and decowribonucleotide-
5-
triphosphates. Optionally, the kits may also include various polynucleotide
molecules,
reverse transcriptase, various buffers and reagents, and antibodies that
inhibit DNA
polymerase activity. The kits may also include reagents necessary for
performing
is positive
and negative control reactions. Optimal amounts of reagents to be used in a
given reaction can be readily determined by the skilled artisan having the
benefit of
the current disclosure. The kits, typically, are adopted to contain the
constituents
afore-described in separate packaging or compartments.
The features and advantages of this invention will be summarized as follows:
(a) The present invention is an improvement of a VD-PTOCE assay developed
by the present inventors, which aims to effective detection of minor alleles
in low-
abundance.
(b) The present invention is significantly effective in the detection of a
minority
mutation in an excess of wild-type DNA. The amplification blocker may restrict
the
consumption of the PTO-NV on the wild-type DNA by the selective amplification
of the
mutant DNA. Or, the amplification blocker may compete with the PTO-NV for the
hybridization to the wild-type DNA, which prevent the cleavage of the PTO-NV
on the
wild-type DNA.
79
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
(c) According to the present invention, the probe (PTO-NV) shows distinctly
different hybridization patterns depending on the presence of the nucleotide
variation
of interest.
(d) Such distinct hybridization patterns on the nucleotide variation of
interest
are responsible for differences in initial cleavage sites of the PTO-NV,
thereby
producing two types of PTO-NV fragments to give signal differentiation
depending on
the presence of the nucleotide variation of interest.
(e) It is noteworthy that the sequence of the 5'-tagging portion of PTO-NV and
the sequence of CTO can be selected with no consideration of target nucleic
acid
sequences. This makes it possible to pre-design a pool of sequences for the 5'-
tagging
portion of PTO-NV and CTO. Although the 3'-targeting portion of the PTO-NV has
to
be prepared with considering target nucleic acid sequences, the CTO can be
prepared
in a ready-made fashion with no consideration or knowledge of target nucleic
acid
sequences. Such features provide prominent advantages in multiple target
detection,
Is inter al/a, on a microarray assay using CTOs immobilized onto a solid
substrate.
The present invention will now be described in further detail by examples. It
would be obvious to those skilled in the art that these examples are intended
to be
more concretely illustrative and the scope of the present invention as set
forth in the
appended claims is not limited to or by the examples.
EXAMPLES
EXAMPLE 1: Detection of a minority mutation by a VD-PTOCE assay with an
amplification blocker.
We examined whether the combination of the amplification blocker and the
VD-PTOCE assay allows identifying a minority mutation in an excess of wild-
type DNA.
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
Taq DNA polymerase having a 5' nuclease activity was used for the extension
of upstream primer and downstream primer, the cleavage of PTO-NV and the
extension of PTO-NV fragment. The PTO-NV, amplification blocker and CTO are
blocked with a carbon spacer at their 3'-ends to prohibit their extension.
BRAF (V600E)
wild-type (T) and mutant (A) human genomic DNAs were used as target nucleic
acid
sequences. The mutant DNA was corresponding to a target nucleic acid sequence
having the target nucleotide variation and the wild-type DNA to a target
nucleic acid
sequence having the non-target nucleotide variation. A series of mixtures
having
different ratios of mutant and wild-type BRAF DNAs were prepared (mutant 100%,
10%, 1%, 0.1% and 0%) to examine the effect of amplification blocker.
PTO-NV has no labels. The nucleotide variation discrimination site of PTO-NV
has a nucleotide (T) complementary to mutant (A) DNA of sense strand (SEQ ID
NO:
3). The amplification blocker includes LNA nucleotides and the nucleotide
variation
discrimination site of the amplification blocker has a nucleotide (T)
complementary to
wild-type (A) DNA of anti-sense strand (SEQ ID NO: 4).
In VD-PTOCE assay of this Example, the presence of the extended strand
produced depending on the presence of the target nucleotide variation (i.e.,
mutant
DNA) was detected by melting analysis of the extended duplex formed with the
extended strand and CTO.
CTO is labeled with a quencher molecule (BHQ-2) and a fluorescent reporter
molecule (Cal Fluor Red 610) in its templating portion (SEQ ID NO: 5).
The sequences of upstream primer, downstream primer, PTO-NV,
amplification blocker and CTO used in this Example are:
BRAF-F 5'-C1ICATAATGC1TGCTCTGATAGGIIIIIGAGATCTACT-3' (SEQ ID NO: 1)
BRAF-R 5cATAGCCTCAATTC1TACCATCCAIIIIITGGATCCAGA-3' (SEQ ID NO: 2)
BRAF-PTO-NV 5'-GGTGGACTTGCGGICTGTAGCTAGACCAAAATCACCTAI I I I IACTGTG[C3
spacer]-3'
(SEQ ID NO: 3)
81
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
Amplification blocker 5'- CAGTGAAATCTOGATGG[C3 spacer]-3' (SEQ ID NO: 4)
BRAF-CTO-1 5'- [BHQ-2]iiiiiiii GAGCCAGAGTTA[T(Cal Fluor Red
610)]GGTCACCGCAAGTCCACC[C3
spacer] -3' (SEQ ID NO: 5)
(I: Deoxyinosine)
(Underlined letters indicate the 5'-tagging portion of PTO-NV)
(Bold letter indicates the nucleotide discrimination site)
(Boxed letters indicate LNA nucleotides)
The reaction was conducted in the final volume of 20 pl containing 100 ng of
different mixture ratios of BRAF (V600E) mutant (A) and wild-type (T) human
genomic DNAs (mutant 100%, 10%, 1%, 0.1% and 0%), 10 pmole of upstream
primer (SEQ ID NO: 1), 10 pmole of downstream primer (SEQ ID NO: 2), 5 pmole
of
PTO-NV (SEQ ID NO: 3), 5 pmole of amplification blocker (SEQ ID NO: 4), 1
pmole of
CTO (SEQ ID NO: 5), and 10 pl of 2X Master Mix [containing 2.5 mM MgCl2, 200
pM
of dNTPs and 1.6 units of Taq DNA polymerase (Solgent, Korea)]; the tube
containing
the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-
Rad); the
reaction mixture was denatured for 15 min at 95 C and subjected to 50 cycles
of 30
sec at 95 C, 60 sec at 60 C. After the reaction, melting curve was obtained by
cooling
the reaction mixture to 55 C, holding at 55 C for 10 min, and heating slowly
at 55 C
to 85 C. The fluorescence was measured continuously during the temperature
rise to
monitor dissociation of double-stranded DNAs. Melting peak was derived from
the
melting curve data.
=
As shown Figures 8A and 8B, in the presence of the target nucleic acid
sequences, the peaks corresponding to the expected Tm value of the extended
duplexes were detected up to 10% of mutant ratio in VD-PTOCE assay without the
amplification blocker, but up to 0.1% of mutant ratios with the amplification
blocker.
No peaks were detected in the absence of any targets.
This results show that the use of the amplification blocker improves the
82
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
ability of VD-PTOCE assay to identify a minority mutation in an excess of wild-
type
DNA.
EXAMPLE 2: Detection of a minority mutation by a VD-PTOCE assay using a
signaling oligonucleotide with an amplification blocker.
We further examined whether the combination of the amplification blocker and
the VD-PTOCE assay using signaling oligonucleotide (SO) allows identifying a
minority
mutation in an excess of wild-type DNA.
In VD-PTOCE assay of this Example, the presence of the extended strand
produced depending on the presence of the target nucleotide variation (i.e.,
mutant
DNA) was detected by using the signaling oligonucleotide (SO) which
specifically
hybridized with the extended strand. The hybrid between the extended strand
and the
SO was used for melting analysis.
Primers, amplification blocker, PTO-NV, BRAF human genomic DNA and Taq
DNA polymerase were used as Example 1.
CTO has no label (SEQ ID NO: 6). SO has a quencher molecule (BHQ-2) at its
5'-end and has a fluorescent reporter molecule (Cal Fluor Red 610) at its 3'-
end (SEQ
ID NO: 7)
The sequences of upstream primer, downstream primer, PTO-NV, amplification
blocker, CTO and SO used in this Example are:
BRAF-F 5'-C1TCATAATGC1TGCTCTGATAGGIIIIIGAGATCTACT-3' (SEQ ID NO: 1)
BRAF-R 5'-ATAGCCTCAA1TC1TACCATCCAIIIIITGGATCCAGA-3' (SEQ ID NO: 2)
BRAF-PTO-NV 5'-GGTGGACTTGCGGTCTGTAGCTAGACCAAAATCACCTATTTITACTGTG[C3 spacer]-3'
(SEQ ID NO: 3)
Amplification blocker 5'- CAGT1OTffOGATGG[C3 spacer]-3' (SEQ ID NO: 4)
BRAF-CTO-2 5'-1 111111 1GAGCCAGAGTTATGGTCACCGCAAGTCCACC[C3 spacer]-3' (SEQ
ID NO: 6)
83
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
BRAF-SO 5'-[BHQ-2] I 11111 I GAGCCAGAGTTATGGTC[Cal Fluor Red 610]-3' (SEQ
ID NO: 7)
(I: Deoxyinosine)
(Underlined letters indicate the 5'-tagging portion of PTO-NV)
(Bold letter indicates the nucleotide discrimination site)
(Boxed letters indicate LNA nucleotides)
The reaction was conducted in the final volume of 20 pl containing 100 ng of
different mixture ratios of BRAF (V600E) mutant (A) and wild type (T) human
genomic DNAs (mutant 100%, 10%, 1% and 0%), 10 pmole of upstream primer
to (SEQ ID NO: 1), 10 pmole of downstream primer (SEQ ID NO: 2), 5 pmole of
PTO-NV
(SEQ ID NO: 3), 5 pmole of amplification blocker (SEQ ID NO: 4), 0.1 pmole of
CTO
(SEQ ID NO: 6), 3 pmole of SO (SEQ ID NO: 7) and 10 pl of 2X Master Mix
[containing 2.5 mM MgC12, 200 pM of dNTPs and 1.6 units of Taq DNA polymerase
(Solgent, Korea)]; the tube containing the reaction mixture was placed in the
real-
time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 15
min
at 95 C and subjected to 50 cycles of 30 sec at 95 C, 60 sec at 60 C. After
the
reaction, melting curve was obtained by cooling the reaction mixture to 40 C,
holding
at 40 C for 10 min, and heating slowly at 40 C to 85 C. The fluorescence was
measured continuously during the temperature rise to monitor dissociation of
an
extended strand-SO hybrid. Melting peak was derived from the melting curve
data.
As shown Figures 9A and 9B1 in the presence of the target nucleic acid
sequences, the peak corresponding to the expected Tm value of the extended
strand/SO hybrid was detected at 100% of mutant ratio but not at 10% of mutant
ratio in VD-PTOCE assay using SO without the amplification blocker. However,
the
peaks were detected up to 1% of mutant ratio with the amplification blocker.
No
peaks were detected in the absence of any targets.
This results show that the use of the amplification blocker improves the
ability of VD-PTOCE assay using SO to identify a minority mutation in an
excess of
84
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
wild-type DNA.
EXAMPLE 3: Detection of a minority mutation by a VD-PTOCE assay using a
hybridization oligonucleotide with an amplification blocker.
We further examined whether the combination of the amplification blocker
and the VD-PTOCE assay using hybridization oligonucleotide (HO) allows
identifying a
minority mutation in an excess of wild-type DNA.
In VD-PTOCE assay of this Example, the presence of the extended strand
produced depending on the presence of the target nucleotide variation (i.e.,
mutant
DNA) was detected by using the hybridization oligonucleotide (HO) which
specifically
hybridized with the CTO in downstream position than the PTO-NV fragment.
During
the extension of the PTO-NV fragment on the CTO, the HO is cleaved and
provides a
signal. The signal generated by the cleavage of HO was detected by real-time
detection at a pre-determined temperature in each cycle.
Primers, amplification blocker, PTO-NV, BRAF human genomic DNA and Tag
DNA polymerase were used as Example 1.
CTO has no label (SEQ ID NO: 8). HO has a quencher molecule (BHQ-2) at its
5'-end and has a fluorescent reporter molecule (Cal Fluor Red 610) at its 3'-
end (SEQ
ID NO: 9)
The sequences of upstream primer, downstream primer, PTO-NV, amplification
blocker, CTO and HO used in this Example are:
BRAF-F 5'-CTTCATAATGCTTGCTCTGATAGGIIIIIGAGATCTACT-3' (SEQ ID NO: 1)
BRAF-R 5'-ATAGCCTCAA1TCTTACCATCCAIIIIITGGATCCAGA-3' (SEQ ID NO: 2)
BRAF-PTO-NV 5'-GGTGGACTTGCGGTCTGTAGCTAGACCAAAATCACCTATITTTACTGTG[C3 spacer]-3'
(SEQ ID NO: 3)
Amplification blocker 5'- CAGItGAAA CTOGATGG[C3 spacer]-3' (SEQ ID NO: 4)
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
BRAF-CTO-3 5'-TCCGTCCGAGCCAGAGTGATGGICACCTCACCGCAAGTCCACC[C3 spacer]-3' (SEQ
ID
NO: 8)
BRAF-HO 5'-[BHQ-2]GACCATCACTCTGGCTCGGACGGA[Cal Fluor Red 6101-3' (SEQ ID NO:
9)
(I: Deoxyinosine)
(Underlined letters indicate the 5'-tagging portion of PTO-NV)
(Bold letter indicates the nucleotide discrimination site)
(Boxed letters indicate LNA nucleotides)
The reaction was conducted in the final volume of 20 pl containing 100 ng of
different mixture ratios of BRAF (V600E) mutant (A) and wild type (T) human
genomic DNAs (mutant 100%, 10%, 1%, 0.1% and 0%), 10 pmole of upstream
primer (SEQ ID NO: 1), 10 pmole of downstream primer (SEQ ID NO: 2, 5 pmole of
PTO-NV (SEQ ID NO: 3), 5 pmole of amplification blocker (SEQ ID NO: 4), 1
pmole of
CTO (SEQ ID NO: 8), 3 pmole of HO (SEQ ID NO: 9) and 10 pl of 2X Master Mix
is [containing 2.5 mM MgCl2, 200 pM of dNTPs and 1.6 units of Taq DNA
polymerase
(Solgent, Korea)]; the tube containing the reaction mixture was placed in the
real-
time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 15
min
at 95t and subjected to 50 cycles of 30 sec at 95 C, 60 sec at 55 C. Detection
of the
generated signal was performed at the denaturation step (95 C) of each cycle.
The
detection at the denaturation temperature (95 C) supports that the detected
signal is
provided from the labeled fragment generated by the cleavage of HO.
As shown in Figures 10A and 10B, in the presence of the target nucleic acid
sequences, the fluorescent signal was detected up to 10% of mutant ratio in VD-
PTOCE assay using HO without the amplification blocker, but up to 0.1% of
mutant
ratio with the amplification blocker. No signal was detected in the absence of
any
targets.
This results show that the use of the amplification blocker improves the
ability
of VD-PTOCE assay using HO to identify a minority mutation in an excess of
wild-type
86
CA 02913873 2015-11-27
WO 2014/193071
PCT/KR2014/001529
DNA.
Having described a preferred embodiment of the present invention, it is to be
understood that variants and modifications thereof falling within the spirit
of the
invention may become apparent to those skilled in this art, and the scope of
this
invention is to be determined by appended claims and their equivalents.
87
