Note: Descriptions are shown in the official language in which they were submitted.
CA 02979792 201.7.--14
- 1 -
,
Description
Title of Invention: METHOD FOR DIAGNOSING, PREVENTING AND
TREATING CANCER BRAIN METASTASIS, AND DRUG DELIVERY
SYSTEM FOR ENABLING PASSAGE THROUGH BLOOD-BRAIN BARRIER
Technical Field
[0001]
The present invention relates to the permeability
control of the blood-brain barrier and particularly to a
technique for increasing the permeability of the blood-
brain barrier. The present invention further relates to
the field of brain metastasis of cancer. More
specifically, the present invention relates to the fields
of diagnosis or risk assessment of brain metastasis and
treatment or prevention of brain metastasis.
Background Art
[0002]
Brain metastasis in cancer patient is known to
relate to poor prognoses. Moreover, it also is known
that passage of cancer cells through the blood-brain
barrier (BBB) is an important event in brain metastasis,
that main constituent cells of the BBB are brain
microvascular endothelial cells (BMECs), and that BMECs
are connected each other by tight junctions between cells
and thereby have very selective permeability. Moreover,
CA 02979792 2017-09-14
- 2 -
the proteins junctional adhesion molecules (JAM-1, JAM-2
and JAM-3), Occdudin, Claudins, and Zonula Occludin
proteins (Z0-1 and ZO-2) are known to constitute the
tight junction. Furthermore, cyclooxygenase -2 (COX -2),
the epidermal growth factor receptor (EGFR) ligand HB-EGF,
and a 2,6-sialyltransferase (ST6GALNAC5) have been
identified as mediators involved in the BBB invasion of
cancer cells. However, the early stage molecule
mechanisms of cancer cells passing through the BBB have
not been revealed (Non Patent Literature 1). A study
using a highly metastatic breast cancer cell line MDA-MB-
231 has shown that vascular endothelial growth factor
(VEGF) is highly expressed in breast cancer cells and
increases the permeability of endothelial cells as well
as adhesion of cancer cells onto endothelial cells, and
thus VEGF is involved in the brain metastasis (Non Patent
Literature 2). Although the expression of VEGF has been
reported to be necessary for brain metastasis, it has
been also reported that the expression of VEGF is not
sufficient for brain metastasis, and the destruction
mechanism of the BBB in brain metastasis has not been
sufficiently explained by VEGF (Non Patent Literature 3).
[0003]
A mechanism of BBB passage of Cryptococcus
neoformans which infects the central nervous system (CNS)
has been studied. It has been reported that the adhesion
of Cryptococcus to human BMECs causes dephosphorylation
CA 02979792 2017-09-14
- 3 -
of Cofilin, which results in actin rearrangement. This
report further indicates that the dephosphorylation of
Cofilin by Cryptococcus is controlled via the Rho kinase-
LIM kinase-Cofilin pathway (Non Patent Literature 4).
[0004]
Extracellular vesicles (EVs) including exosomes are
known to mediate communication between cells by
transporting protein, mRNA, and microRNA (miRNA)
contained therein (Non Patent Literature 5). Moreover,
it has been reported that extracellular vesicles released
from cancer cells are involved in the malignancy of
cancer cells in various ways (Non Patent Literature 8),
for example, they inhibit the function of natural killer
cells (Non Patent Literature 6) and increase the
expression of the oncogene protein MET in bone marrow
progenitor cells to change the bone marrow progenitor
cells toward a pro-metastatic phenotype (Non Patent
Literature 7). As seen above, the relation between EVs
and cancer metastasis has been suggested. However,
little was known about the relation between EVs (and
substances contained therein) and the BBB.
Citation List
Non Patent Literature
[0005]
Non Patent Literature 1: Arshad, F. et al, Patholog Res
Int 2011: 920509 (2010).
CA 02979792 2017-09-14
- 4 -
Non Patent Literature 2: Lee, T.H. et al, J Biol Chem
278: 5277-5284 (2003).
Non Patent Literature 3: Yano, S. et al, Cancer Res 60:
4959-4967 (2000).
Non Patent Literature 4: Chen, H.M.Steven, et al, Journal
of Medical Microbiology 52: 961-970 (2003).
Non Patent Literature 5: Valadi, H. et al, Nat Cell Biol
9:654-659 (2007).
Non Patent Literature 6: Liu, Cunren, et al, The Journal
of Immunology 176: 1375-1385 (2006):
Non Patent Literature 7: Peinado, H. et al, Nat Med 18:
883-891 (2012).
Non Patent Literature 8: Yang, C. et al, Clin Dev Immunol
2011: 842-849 (2011).
Summary of Invention
[0006]
An object of the present invention is to elucidate
mechanisms of the destruction of the BBB in brain
metastasis, and to provide new methods for diagnosis/risk
assessment and for treatment/prevention of brain
metastasis of cancer. Another object of the present
invention is to provide a novel method for agent delivery
into brain using the mechanism of the BBB destruction. A
further object of the present invention is to provide an
agent, a composition, and a kit to be used in these
methods.
CA 02979792 2017-09-14
- 5 -
[0007]
To elucidate the mechanism of brain metastasis, the
present inventors transplanted a highly metastatic human
breast cancer cell line to mice, and analyzed EVs
obtained from cancer cells metastasized to the brain. As
a result, it was found that cancer cell-derived EVs are
taken in brain microvascular endothelial cells and
destruct the blood-brain barrier (BBB). The present
inventors then searched for a substance related to the
destruction of the blood-brain barrier from the
substances contained in the EVs, and found that miR-181c,
a microRNA specifically contained in the EVs derived from
the brain metastatic cancer cells, has an effect to
destruct the blood-brain barrier. The present inventors
further examined the effect of miR-181c in brain
microvascular endothelial cells, and found that miR-181c
binds to a noncoding region of 3-phosphoinositide
dependent protein kinase-1 (hereinafter referred to as
"PDPK1") and decreases expression of PDPK1. The present
inventors further examined the relation between the
decreased expression of PDPK1 and the disruption of the
blood-brain barrier (BBB), and found that the inhibition
of PDPK1 expression changes the localization of tight
junction proteins. Thus, the present inventors have
found that cancer cell-derived EVs release miR-181c
contained therein in brain microvascular endothelial
cells, which inhibits the expression of PDPK1, and
CA 02979792 2017-09-14
- 6 -
thereby change the localization of tight junction
proteins to destruct the blood-brain barrier.
[0008]
miR-181c has been reported to be involved in the
aggravation of cells, but has not been known in relation
with the blood-brain barrier.
[0009]
Moreover, PDRK1 has been known to mainly target
protein kinase B (PKB/AKT1, PKB/AKT2, PKB/AKT3), p70
ribosomal protein S6 kinase (RPS6KB1), p90 ribosomal
protein S6 kinase (RPS6KA1, RPS6KA and RPS6KA3), cyclic
AMP-dependent protein kinase (PRKACA), protein kinase C
(PRKCD and PRKCZ), serum- and glucocorticoid-inducible
kinase (SGK1, SGK2 and SGK3), P21 activated kinase-1
(PAK1), and protein kinase PKN (PKN1 and PKN2), and known
to be involved in the regulation of cell proliferation
and survival as well as intake and storage of glucose and
amino acids. However, there has been no report on PDPK1
in relation with the blood-brain barrier.
[0010]
Accordingly, the present invention is based on the
elucidation of the mechanism for destruction of the
blood-brain barrier by brain metastatic cancer cells, and
specifically relates to the following inventions:
(1) A method for providing information for diagnosing
brain metastasis, comprising measuring miR-181c level in
a sample from a subject cancer patient.
CA 02979792 2017-09-14
- 7 -
(2) A method for providing information for diagnosing
brain metastasis in a subject cancer patient, comprising
the steps of:
determining miR-181c level in a sample from the
subject cancer patient, and
judging brain metastasis in the subject cancer
patient from the determined miR-181c level,
wherein when the miR-181c level of the sample from
the subject cancer patient is higher than that from a
negative control, information that the subject cancer
patient has brain metastasis is provided.
(3) The method of (1) or (2), wherein the subject cancer
patient is a Stage IV cancer patient.
(4) A method for providing information for diagnosing
brain metastasis, comprising measuring miR-181c level in
a sample from a subject cancer patient.
(5) A method for providing information for assessing risk
of brain metastasis in a subject cancer patient,
comprising the steps of:
determining miR-181c level in a sample from the
subject cancer patient,
assessing risk of brain metastasis in the subject
cancer patient from the determined miR-181c level,
wherein when the miR-181c level of the sample from
the subject cancer patient is higher than that from a
negative control, information that risk of brain
CA 02979792 2017-09-14
- 8 -
metastasis is high in the subject cancer patient is
provided.
(6) The method of (4) or (5), wherein the subject cancer
patient is a Stage I to III cancer patient.
(7) The method of any one of (1) to (6), wherein the
subject cancer patient is a breast cancer patient.
(8) The method of any one of (1) to (7), wherein the
negative control is a cancer patient with no brain
metastasis or a healthy subject.
(9) The method of any one of (1) to (8), wherein the
sample is blood.
(10) The method of any one of (1) to (9), wherein the
miR-181c in the sample is miR-181c extracted from EVs in
the sample.
(11) An in vitro diagnostic reagent or an in vitro
diagnostic measuring apparatus for diagnosis or risk
assessment of brain metastasis by measuring miR181c,
which is for use in a method of any one of (1) to (10).
(12) An agent for diagnosis or risk assessment of brain
metastasis, comprising a substance that specifically
binds to miR-181c.
(13) The agent of (12), wherein the substance that
specifically binds to miR-181c is a nucleic acid that
specifically binds to miR-181c.
(14) The agent of (13), wherein the nucleic acid that
specifically binds to miR-181c is a nucleic acid at least
partially having an artificially designed sequence.
CA 02979792 2017-09-14
- 9 -
(15) The agent of any one of (12) to (14), wherein the
substance that specifically binds to miR-181c is labelled.
(16) A pharmaceutical composition for suppressing brain
metastasis, comprising one or more agents selected from
the group consisting of an miR-181c expression inhibitor,
an miR-181c activity inhibitor, and an exosome secretion
inhibitor as an active ingredient.
(17) The pharmaceutical composition of (16), wherein the
one or more agents selected from the group consisting of
an miR-181c expression inhibitor, an miR-181c activity
inhibitor, and an exosome secretion inhibitor is an agent
selected from:
(i) an antisense oligonucleotide, aptamer, or siRNA
against pri-miR-181c or pre-miR-181c;
(ii) an antisense oligonucleotide to miR-181c, an aptamer
that specifically binds to miR-181c, siRNA against miR-
181c, or miRNA mimetics of miR-181c;
(iii) an antisense oligonucleotide, aptamer, or siRNA
against the nSMase2 and/or RAB27B gene; or
(iv) an antibody or an immunoreactive fragment thereof
against nSMase2 and/or RAB27B; peptide mimetics or an
aptamer that specifically binds to nSMase2 and/or RAB27B;
or an antagonist of nSMase2 and/or RAB27B.
(18) A pharmaceutical composition for increasing
permeability of blood-brain barrier, comprising a PDPK1
expression inhibitor or PDPK1 activity inhibitor as an
active ingredient.
CA 02979792 2017-09-14
1
- 10 -
(19) The pharmaceutical composition of (18), wherein the
PDPK1 expression inhibitor or activity inhibitor is an
antisense oligonucleotide against the PDPK1 gene, an
aptamer that specifically binds to the PDPK1 gene, siRNA
against the PDPK1 gene, or miRNA capable of suppressing
the PDPK1 gene expression; or an antibody against PDPK1
or the immunoreactive fragment thereof; peptide mimetics
or an aptamer that specifically binds to 0DPK1; or an
antagonist of PDPK1.
(20) The pharmaceutical composition of (19), wherein the
miRNA capable of suppressing the PDPK1 gene expression is
miR-181c.
(21) An agent-delivery composition for delivering a
desired active ingredient into brain, comprising a PDPK1
expression inhibitor or PDPK1 activity inhibitor as an
active ingredient.
(22) The agent-delivery composition of (21), comprising
the desired active ingredient in addition to the PDPK1
expression inhibitor or activity inhibitor.
(23) The agent-delivery composition of (21) or (22),
wherein the PDPK1 expression inhibitor or activity
inhibitor is an antisense oligonucleotide against the
PDPK1 gene, an aptamer that specifically binds to the
PDPK1 gene, siRNA against the PDPK1 gene, or miRNA
capable of suppressing the PDPK1 gene expression; or an
antibody against PDPK1 or the immunoreactive fragment
CA 02979792 2017-09-14
- 11 -
thereof; peptide mimetics or an aptamer that specifically
binds to PDPK1; or an antagonist of PDPK1.
(24) The agent-delivery composition of (23), wherein the
miRNA capable of suppressing the PDPK1 gene expression is
miR-181c.
(25) An apparatus for judging brain metastasis in a
subject cancer patient, comprising:
miR-181c-measuring means for measuring a
polynucleotide having a nucleotide sequence of miR-181c
or a part thereof in a sample from the subject cancer
patient,
miR-181c level-determining means for determining
miR-181c level in the sample from the measurement by the
miR-181c-measuring means, and
metastasis-judging means for judging brain
metastasis in the subject cancer patient from the
determined miR-181c level by the miR-181c level-
determining means;
wherein the metastasis-judging means judges that the
subject cancer patient has brain metastasis when the miR-
181c level in the sample from the subject cancer patient
is higher than the miR-181c level in a sample from a
negative control.
(26) An apparatus for assessing risk of brain metastasis
in a subject cancer patient, comprising:
miR-181c-measuring means for measuring a
polynucleotide having a nucleotide sequence of miR-181c
CA 02979792 2017-09-14
- 12 -
or a part thereof in a sample from the subject cancer
patient,
miR-181c level-determining means for determining
miR-181c level in the sample from the measurement by the
miR-181c-measuring means, and
risk-assessing means for assessing risk of brain
metastasis in the subject cancer patient from the
determined miR-181c level by the miR-181c level-
determining means;
wherein the risk-assessing means assesses that the
subject cancer patient has a high risk of brain
metastasis when the miR-181c level in the sample from the
subject cancer patient is higher than the miR-181c level
in a sample from a negative control.
(27) A computer program to be installed in an apparatus
for providing information for diagnosing brain metastasis
in a subject cancer patient,
wherein the computer program directs the apparatus
for diagnosing brain metastasis in a cancer patient to
execute:
an miR-181c-measuring procedure for measuring a
polynucleotide having a nucleotide sequence of miR-181c
or a part thereof in a sample from the subject cancer
patient,
an miR-181c level-determining procedure for
determining an miR-181c level in the sample from the
measurement by the miR-181c-measuring procedure,
CA 02979792 2017-09-14
- 13 -
a metastasis-judging procedure for judging brain
metastasis in the subject cancer patient from the
determined miR-181c level by the miR-181c level-
determining procedure, and
a judgment-output procedure of outputting the
judgment by the metastasis-judging procedure; and
the metastasis-judging procedure judges that the
subject cancer patient has brain metastasis when the miR-
181c level in the sample from the subject cancer patient
is higher than the miR-181c level in a sample from a
negative control.
(28) A computer program to be installed in an apparatus
for assessing risk of brain metastasis in a subject
cancer patient,
wherein the computer program directs the apparatus
for diagnosing brain metastasis in a cancer patient to
execute:
an miR-181c-measuring procedure for measuring a
polynucleotide having a nucleotide sequence of miR-181c
or a part thereof in a sample from the subject cancer
patient,
an miR-181c level-determining procedure for
determining an miR-181c level in the sample from the
measurement by the miR-181c-measuring procedure,
a risk-assessing procedure for assessing risk of
brain metastasis in the subject cancer patient from the
84005258
- 14 -
determined miR-181c level by the miR-181c level-determining
procedure;
an assessment-output procedure of outputting the
assessment by the risk-assessing procedure; and
the risk-assessing procedure assesses that the subject
cancer patient has a high risk of brain metastasis when the
miR-181c level in the sample from the subject cancer patient is
higher than the miR-181c level in a sample from a negative
control.
[0010A]
The present invention as claimed relates to:
[1] A method for diagnosing brain metastasis or risk thereof
in a cancer patient, comprising the step of assaying for
miR-181c level in a sample from the cancer patient, wherein a
level of miR-181c in the sample from the cancer patient that is
higher than that from a negative control indicates that the
cancer patient has brain metastasis or is at risk of brain
metastasis;
[2] The method of [1], wherein the cancer patient is a
Stage IV cancer patient;
[3] The method of [1], wherein the cancer patient is a Stage I
to III cancer patient;
[4] The method of any one of [1] to [3], wherein the cancer
patient is a breast cancer patient;
Date Recue/Date Received 2021-12-29
84005258
- 14a -
[5] The method of any one of [1] to [4], wherein the negative
control is a cancer patient with no brain metastasis or a
healthy subject;
[6] The method of any one of [1] to [5], wherein the sample is
blood;
[7] The method of any one of [1] to [6], wherein the miR-181c
in the sample is miR-181c extracted from extracellular vesicles
in the sample;
[8] An in vitro diagnostic reagent or an in vitro diagnostic
measuring apparatus comprising a nucleic acid that specifically
binds to miR-181c, for use in the method for diagnosing brain
metastasis or risk thereof according to any one of [1] to [7];
[9] The reagent or apparatus of [8], wherein the nucleic acid
that specifically binds to miR-181c has, at least partially, an
artificially designed sequence;
[10] The reagent or apparatus of [8] or [9], wherein the
nucleic acid that specifically binds to miR-181c is labelled;
[11] An agent comprising a nucleic acid that specifically
binds to miR-181c, for use in diagnosing brain metastasis or
risk thereof;
[12] The agent of [11], wherein the nucleic acid that
specifically binds to miR-181c has, at least partially, an
artificially designed sequence;
[13] The agent of [11] or [12], wherein the nucleic acid that
specifically binds to miR-181c is labelled;
Date Recue/Date Received 2021-12-29
84005258
- 14b -
[14] A pharmaceutical composition for suppressing brain
metastasis, comprising an isotonizing agent and one or more
inhibitors selected from the group consisting of an miR-181c
expression inhibitor and an miR-181c activity inhibitor;
[15] The pharmaceutical composition of [14], wherein the one or
more inhibitors are selected from the following: (i) an
antisense oligonucleotide, aptamer, or siRNA to pri-miR-181c or
pre-miR-181c; or (ii) an antisense oligonucleotide to miR-181c,
an aptamer that specifically binds to miR-181c, siRNA against
miR-181c, or miRNA mimetics of miR-181c;
[16] An apparatus for diagnosing brain metastasis or risk
thereof in a cancer patient, comprising: miR-181c-measuring
means for measuring a polynucleotide having a nucleotide
sequence of miR-181c or a part thereof in a sample from the
cancer patient, and miR-181c level-determining means for
determining an miR-181c level in the sample measured by the
miR-181c-measuring means, wherein the cancer patient is
diagnosed as having brain metastasis or being at risk thereof
when the miR-181c level in the sample from the cancer patient
is higher than the miR-181c level in a sample from a negative
control;
[17] A computer-implemented method for diagnosing brain
metastasis or risk thereof in a cancer patient, wherein a
computer is directed to execute: (a) a procedure for
measuring a polynucleotide having a nucleotide sequence of
miR-181c or a part thereof in a sample from the cancer patient,
Date Recue/Date Received 2021-12-29
84005258
- 14c -
(b) a procedure for determining an miR-181c level from the
measurement obtained in (a), and (c) a procedure for outputting
a diagnosis of brain metastasis or risk thereof when the
miR-181c level in the sample from the cancer patient as
determined in (b) is higher than the miR-181c level in a sample
from a negative control; and
[18] A computer readable memory having recorded thereon
statements and instructions for execution by a computer,
wherein the statements and instructions direct the computer to
execute: (a) a procedure for measuring a polynucleotide having
a nucleotide sequence of miR-181c or a part thereof in a sample
from the cancer patient, (b) a procedure for determining an
miR-181c level from the measurement obtained in (a), and (c) a
procedure for outputting a diagnosis of brain metastasis or
risk thereof when the miR-181c level in the sample from the
cancer patient as determined in (b) is higher than the miR-181c
level in a sample from a negative control.
Date Recue/Date Received 2021-12-29
84005258
- 14d -
[0011]
As used herein, the term "cancer" includes epithelial
malignant tumors, hematopoietic malignant tumors derived from
spinal cord, and the like, and particularly includes ovarian
cancer (non-mucinous ovarian cancers and the like), uterine
cancer, endometrial cancer, breast cancer, breast
adenocarcinoma, prostate cancer, testicular cancer (testicular
choriocarcinoma and the like), brain cancer (ependymoma and the
like), throat cancer, lung cancer, lung adenocarcinoma, kidney
cancer (renal cell cancer and the like), liver cancer, large
bowel cancer (colon cancer), pleural mesothelioma, sarcoma,
chronic and acute myeloid leukemia, and metastatic cancers such
as lung metastatic cancer. As used herein, a "cancer patient"
means a patient having cancer (at a site except the brain) with
or without metastasis and may be a patient with, for example,
hematopoietic cell malignant tumors such as
Date Recue/Date Received 2021-12-29
CA 02979792 201.7.--14
- 15 -
leukemia, lymphomas (Hodgkin's disease and non-Hodgkin's
lymphom, and the like), multiple myeloma; breast cancer;
endometrial cancer; cervical cancer; ovarian cancer;
esophageal cancer; gastric cancer; appendiceal cancer;
large bowel cancer (colon cancer, rectal cancer, and the
like); liver cancer (hepatocellular cancer, and the
like); gallbladder cancer; bile duct cancer; pancreatic
cancer; adrenal cancer; gastrointestinal stromal tumor;
mesothelioma; head and neck cancers such as laryngeal
cancer, oral cancers (oral floor cancer, gingival cancer,
tongue cancer, buccal mucosa cancer, and the like);
salivary gland cancer; nasal sinus cancers (maxillary
sinus cancer, frontal sinus cancer, ethmoid cancer,
sphenoidal sinus cancer, and the like); thyroid cancer;
kidney cancer; lung cancer; osteosarcoma; prostate
cancer; testicular tumor (testicular cancer); renal cell
cancer; bladder cancer; rhabdomyosarcoma; skin cancer; or
anal cancer.
[0012]
The stage of cancer is determined according to a
stage classification (clinical advanced stage
classification). The detailed criteria for the stage
classification of each cancer (organ) has been
established, based on, for example, the size of cancer
(T), metastasis to nearby lymph nodes (N) and metastasis
to a distant organ (M) (TNM classification), which has
been widely known in the art (see the website "Cancer
CA 02979792 2017-09-14
- 16 -
staging" of U.S. National Cancer Center,
http://www.cancer.gov/cancertopics/factsheet/detection/st
aging; the latest edition of AJCC Cancer Staging Manual
(American Joint Commitee on Cancer)). For example, the
staging criteria for breast cancer is as follows. Stage
0: non-invasive cancer: the breast cancer stays in the
mammary gland where it has developed (including the
Paget's disease); Stage I: lump size of 2 cm or smaller
without metastasis to the lymph nodes; Stage IIA: lump
size of 2 cm or smaller with metastasis to the axillary
lymph nodes, or lump size of 2.1-5 cm without metastasis
to the lymph nodes; Stage IIB: lump size of 2.1-5 cm with
metastasis to the axillary lymph, or lump size of 5.1 cm
or larger without metastasis to the lymph nodes; Stage
IIIA: lump size of 5.1 cm or larger with metastasis to
the axillary lymph, any size of lump with heavy
metastasis to the axillary lymph nodes, or any size of
lump without metastasis to the axillary lymph nodes but
with metastasis to parasternal lymph nodes; Stage MB:
any size of lump with infiltration to the chest wall
and/or skin; Stage IIIC: any size of lump with metastasis
spread to infraclavicular or supraclavicular lymph nodes;
Stage IV: metastasis to organs distant from the breast.
[0013]
Patients at Stage IV in the cancer staging usually
have metastasis to distant organs. Accordingly, in such
patients, cancer cells have already invaded into the
CA 02979792 2017-09-14
- 17 -
blood vessels, and therefore brain metastasis is very
highly possible if miR-181c level in blood (in EVs
contained in the blood) is high and the blood-brain
barrier is open. On the other hand, in Stage I to III
patients who do not have metastasis to distant organs,
since cancer cell is not likely to invade into blood
vessels, brain metastasis does not occur immediately even
if the miR-181c level in blood (in EVs contained in
blood) is high and the blood-brain barrier is open.
However, these Stage I to III patients have high
possibility (risk) of brain metastasis in the future
invasion of cancer cells into the blood. Accordingly,
whether a method, agent, apparatus, computer program or
the like according to the present invention is used for
diagnosis of brain metastasis or for risk assessment of
brain metastasis can be determined according to a state
of the patient from which the measured sample is derived.
When the cancer staging is employed as the state, risk
assessment of brain metastasis can be conducted for Stage
I to III patients, and diagnosis of brain metastasis can
be conducted for Stage IV patients. Instead of cancer
staging, the presence or absence of metastasis to a
distant organ or the presence or absence of infiltration
of cancer cell into the blood may be employed as the
state to select either of diagnosis of brain metastasis
or risk assessment of brain metastasis. In this case,
when there is metastasis to a distant organ or when there
CA 02979792 2017-09-14
- 18 -
is infiltration of cancer cell into the blood, the
present invention can be used for a diagnosis of brain
metastasis, while when there is no metastasis to a
distant organ or when there is no infiltration of cancer
cell into the blood, the present invention is used for
risk assessment of brain metastasis. Accordingly, as
used herein, the "Stage IV patients" may be replaced with
patients with metastasis to a distant organ or patients
with infiltration of cancer cell into the blood. Also,
the "Stage I to III patients" may be replaced with
patients with no metastasis to a distant organ or
patients with no infiltration of cancer cell into the
blood.
[0014]
As used herein, the "brain metastasis" and
"metastasis to the brain" mean that cancer cells leave
the primary lesion developed in other sites than brain,
infiltrate into the brain, and grow in the brain, or the
state that such infiltrated cancer cells have grown in
the brain. Whether there is brain metastasis or not in a
cancer patient having a primary lesion other than brain
can be determined by a method of diagnostic imaging well
known in the art. For example, when tumorigenesis in the
brain is confirmed in images such as CT or MRI image for
a cancer patient having a primary lesion other than brain
to which a gadolinium contrast agent or the like has been
CA 02979792 2017.--14
- 19 -
administered, it can be determined that there is brain
metastasis.
[0015]
As used herein, the "healthy subject" means a human
having no cancer development. The healthy subject herein
is not necessary to have no disease other than cancer,
but is preferably a healthy human having no disease even
which is not cancer.
[0016]
According to the present invention, miR-181c serves
to open the BBB and promote brain metastasis in cancer
patients. Accordingly, information about brain
metastasis in a cancer patient can be obtained by
measuring the miR-181c levels in the cancer patient. As
used herein, the "miR-181c" is a human miRNA consisting
of approximately 22 nucleotides (SEQ ID NO: 1) (Lim LP,
et al. (2003) Science, 299: 1540; Landgraf P, et al.
(2007) Cell, 129:1401-1414).
[0017]
The miR-181c levels are measured by using a
substance that specifically binds to miR-181c. As used
herein, the "substance that specifically binds to miR-
181c" is not particularly limited as long as it is a
substance that can specifically bind to miR-181c. Since
a nucleic acid usually bind specifically to a nucleic
acid having its complementary sequence, a preferable
CA 02979792 2017.--14
- 20 -
substance that specifically binds to miR-181c is a
nucleic acid that specifically binds to miR-181c.
[0018]
The "nucleic acid that specifically binds to miR-
181c" means a nucleic acid molecule that can specifically
bind to miR-181c. Such a nucleic acid molecule usually
has a complementary sequence to miR-181c. The "nucleic
acid" as used herein comprises a DNA, an RNA, or an
artificially generated nucleic acid (including bridged
nucleic acids such as locked nucleic acids (2',4'-BNA)),
or a combination thereof. For example, the nucleic acid
that specifically binds to miR-181c includes, but is not
limited to, a primer or a probe. The "primer" is usually
a nucleic acid molecule of 10-30 mer (preferably, 17-25
mer, 15-20 mer, or the like) that is used for the
amplification of nucleic acid and has, at least in a part
(preferably, 7 mer or more, 8 mer or more, 9 mer or more,
mer or more, 11 mer or more, 12 mer or more, 13 mer or
more, 14 mer or more, 15 mer or more, 20 mer or more, 25
mer or more, or 30 mer or more) thereof, a sequence
complementary to a sequence located at an end of the
sequence to be amplified. The "probe" is a nucleic acid
molecule of 10-200 mer (preferably 10-100 mer, 10-50 mer,
10-30 mer, 10-20 mer, and the like) that has a sequence
complementary to a target sequence, and can specifically
bind to a target sequence, and has a complementary to a
sequence, in at least a part (preferably, 7 mer or more,
CA 02979792 2017-09-14
- 21 -
8 mer or more, 9 mer or more, 10 mer or more, 11 mer or
more, 12 mer or more, 13 mer or more, 14 mer or more, 15
mer or more, 20 mer or more, 25 mer or more, 30 mer or
more, 50 mer or more, 100 mer or more) thereof. Methods
for designing primers and probes for a target sequence
are well known in the art. Preferably, the nucleic acid
that specifically binds to miR-181c comprises at least
partially an artificially designed sequence (for example,
sequences for labeling and tagging).
[0019]
As used herein, a substance "specifically binds"
means that the substance binds to the target sequence or
structure with a substantially higher affinity than
binding to other nucleotide sequences or amino acid
sequences or structures thereof. The "substantially
higher affinity" means a sufficiently high affinity to
allow the detection of the target sequence or structure
with distinguishing from other sequences or structures in
using a desired measuring apparatus or method. For
example, the substantially higher affinity may mean that
the molecules number of the (miR-181c specifically
binding) substances that bind to miR-181c is 3 times or
more, 4 times or more, 5 times or more, 6 times or more,
7 times or more, 8 times or more, 9 times or more, 10
times or more, 15 times or more, 20 times or more, 30
times or more, 50 times or more of the molecules number
of the (miR-181c specifically binding) substances that
CA 02979792 2017-09-14
- 22 -
bind to other sequences or structures. The binding
constant (Ka) in the binding between the miR-181c
specifically binding substance of the present invention
and miR-181c may be, for example, at least 107 M-1, at
least 108 M-1, at least 109 M-1, at least 1010 M-1, at least
1011 M-1, at least 1012 M-1, or at least 1013 M.
(0020]
The "substance that specifically binds to miR-181c
(miR-181c specifically binding substances)" (including
the nucleic acid that specifically binds to miR-181c)
herein may be labelled as needed. Examples of methods
for labeling include the radioisotope (RI) labeling,
fluorescent labeling, and enzymatic labeling. Examples
of a radioisotope used in the RI labelling include 32P,
1311, 35S, 45Ca, 3H, and 14C. Examples of a fluorescent
dye used in the fluorescent labeling include DAPI,
SYTOX(R) Green, SYTO(R) 9, TO-PRO(R)-3, Propidium Iodide,
Alexa Fluor(R) 350, Alexa Fluor(R) 647, Oregon Green(R),
Alexa Fluor(R) 405, Alexa Fluor(R) 680, Fluorescein
(FITC), Alexa Fluor(R) 488, Alexa Fluor(R) 750, Cy(R) 3,
Alexa Fluor(R) 532, Pacific Blue(TM), Pacific Orange(TM),
Alexa Fluor(R) 546, Coumarin, Tetramethylrhodamine
(TRITC), Alexa Fluor(R) 555, BODIPY(R) FL, Texas Red(R),
Alexa Fluor(R) 568, Pacific Green(TM), Cy(R) 5, and Alexa
Fluor(R) 594. Available enzymatic labeling include
biotin (biotin-16-dUTP, biotin-11-dUTP), digoxigenin
CA 02979792 2017-09-14
- 23 -
(DIG: a steroid based natural product) (deoxyuridine 5'-
triphosphate), and alkaline phosphatase.
[0021]
According to the present invention, PDPK1 is one of
the substances playing major roles in maintaining the
structure of the BBB. Therefore, the BBB can be opened
by suppressing the expression or inhibiting activity of
PDPK1. Accordingly, a PDPK1 expression inhibitor or a
PDPK1 activity inhibitor can be used as a DDS agent for
an agent intended to be delivered into the brain. As
used herein, "PDPK1" is an abbreviation of 3-
phosphoinositide dependent protein kinase-1. PDPK1 is a
serine/threonine kinase that phosphorylates and activates
the AGO family of protein kinases. It is known that
there are plural variants of the PDPK1 mRNA and protein.
The nucleotide sequence of the mRNA of PDPK1 vulariantl,
and the amino acid sequence of the PDPK1 vulariantl
protein are set forth in SEQ ID NO: 2 and SEQ ID NO: 3,
respectively. The nucleotide sequence of the mRNA of
PDPK1 vulariant2, and the amino acid sequence of the
PDPK1 vulariant2 protein are set forth in SEQ ID NO: 4
and SEQ ID NO: 5, respectively. The nucleotide sequence
of the mRNA of PDPK1 vulariant3, and the amino acid
sequence of the PDPK1 vulariant3 protein is set forth in
SEQ ID NO: 6 and SEQ ID NO: 7, respectively. The
nucleotide sequence of the mRNA of PDPK1 vulariantX1, and
the amino acid sequence of the PDPK1 vulariantX1 protein
CA 02979792 2017-09-14
- 24 -
is set forth in SEQ ID NO: 8 and SEQ ID NO: 9,
respectively. The PDPK1 herein may be any of these
variants or one of their mutants that may occur in the
body.
[0022]
The present inventors have also found that, in
cancer patients, miR-181c is contained in exosomes during
traveling through the blood, and when the exosomes have
reached the BBB, the exosomes are incorporated into the
BBB constituting cells and open the blood-brain barrier.
Accordingly, the inhibition of secretion of exosomes in
cancer patients can prevent the opening of the blood-
brain barrier and thereby can suppress brain metastasis.
Thus, in one aspect, the present invention relates to
suppression of brain metastasis using an exosome
secretion inhibitor. As used herein, the "exosome
secretion inhibitor" is not particularly limited as long
as it is an agent that can inhibit the exosome secretion
from cancer cells. It is known that neutral
sphingomyelinase (hereinafter, referred to as the
"nSMase2") (the cDNA sequence is set forth in SEQ ID NO:
and the amino acid sequence is set forth in SEQ ID NO:
11) and RAB27B (the cDNA sequence is set forth in SEQ ID
NO: 12 and the amino acid sequence is set forth in SEQ ID
NO: 13) are involved in the secretion of exosomes.
Accordingly, the secretion of exosomes can be inhibited
by suppressing the expression or inhibiting the activity
CA 02979792 2017-09-14
- 25 -
of nSMase2 or RAB27B. Thus, an expression or activity
inhibitor of nSMase2 or RAB27B can be used as an exosome
secretion inhibitor in the present invention.
[0023]
As used herein, the "expression inhibitor" of a gene,
a protein, or an miRNA is not particularly limited, as
long as it is an agent that suppresses the expression of
the gene, protein, or miRNA. It is well-understood in
the art that an expression inhibitor of a target gene can
be obtained and used by designing and/or selecting, for
example, an antisense to the gene sequence or to the mRNA
sequence generated by transcription of the gene, dsRNA to
the mRNA generated by the transcription of the gene, an
aptamer to the mRNA generated by the transcription of the
gene, or miRNA (including pri-miRNA and pre-miRNA) that
can bind to a nucleotide sequence which is located
upstream of a coding region and is essential for the
expression of the gene.
[0024]
It is well-understood in the art that an expression
inhibitor of a target protein can be obtained or used by
designing and/or selecting, for example, an antisense to
a gene sequence encoding the protein or to an mRNA
sequence generated by the transcription of the gene,
dsRNA to an mRNA generated by the transcription of a gene
encoding the protein, an aptamer to a gene sequence
encoding the protein or to an mRNA generated by the
CA 02979792 2017-09-14
- 26 -
transcription of the gene, or miRNA (including pri-miRNA
and pre-miRNA) that can bind to a nucleotide sequence
which is located upstream of a coding region and is
essential for the expression of a gene encoding the
protein.
[0025]
It is well-understood in the art that an expression
inhibitor of miRNA can be obtained or used by designing
and/or selecting, for example, an antisense to a gene
encoding the miRNA, pri-miR of the miRNA, or pre-miR of
the miRNA; dsRNA to pri-miR of the miRNA or pre-miR of
the miRNA; an aptamer to the pri-miR of the miRNA or pre-
miR of the miRNA; or another miRNA (including pri-miRNA
and pre-miRNA) that can bind to a nucleotide sequence
which is located upstream of a coding region and is
essential for the expression of a gene encoding the miRNA.
[0026]
For example, the present inventors have found that
expression inhibitors of PDPK1 include pri-miR-181c, pre-
miR-181c, miR-181c and derivatives thereof.
[0027]
As used herein, the derivatives of pri-miRNA, pre-
miRNA and miRNA are molecules that have at least a seed
sequence (the 7 nucleotides at positions 2 to 8 from the
5' end: ACUUACA) in the miRNA and that act to suppress
the expression of the gene (or protein) of interest
(PDPK1 in the case of miR-181c). The function of such a
CA 02979792 2017-09-14
- 27 -
derivative is not necessarily quantitatively same as that
of the original miRNA, but the derivative may have
stronger or weaker activity than the original miRNA as
long as it achieves an object of the present invention.
Furthermore, the derivatives have a nucleotide sequence
having an identity of about 70% or more and less than
100%, about 75% or more and less than 100%, about 80% or
more and less than 100%, about 85% or more and less than
100%, about 90% or more and less than 100%, about 95% or
more and less than 100% with the pri-miRNA, pre-miRNA and
miRNA. The higher sequence identity means the more
similarity in the structures between the pri-miRNA, pre-
miRNA, or miRNA and the derivative thereof. The
derivatives of the pri-miRNA, pre-miRNA, and miRNA may
have a sequence that the original pri-miRNA, pre-miRNA,
and miRNA do not have. Moreover, the nucleotide lengths
of the derivative of pri-miRNA, pre-miRNA, and miRNA may
be different from the original nucleotide length as long
as they can exhibit the function of the miRNA and may be,
for example, 10-50 mer, 15-30 mer, or 20-25 mer.
[0028]
Moreover, the derivatives of the pri-miRNA, pre-
miRNA, and miRNA include a nucleic acid molecule which
has a seed sequence of the pri-miRNA, pre-miRNA and miRNA,
and has one or more of addition, substitution, deletion,
and modification selected from the following (i) to (iv)
(at other than the seed sequence):
CA 02979792 2017-09-14
- 28 -
(i) addition of one or more (for example, 1-10, 1-5, 1-3,
1-2, or 1) nucleotide(s) to the wildtype sequence of pri-
miR-181c, pre-miR-181c, or miR-181c;
(ii) substitution of one or more (for example, 1-10, 1-5,
1-3, 1-2, or 1) nucleotide(s) in the wildtype sequence of
pri-miR-181c, pre-miR-181c, or miR-181c with other
nucleotide(s);
(iii) deletion of one or more (for example, 1-10, 1-5, 1-
3, 1-2, or 1) nucleotide(s) in the wildtype sequence of
pri-miR-181c, pre-miR-181c, or miR-181c; and
(iv) modification of one or more (for example, 1-10, 1-5,
1-3, 1-2, or 1) nucleotide(s) in the wildtype sequence of
pri-miR-181c, pre-miR-181c, or miR-181c.
[0029]
As used herein, the "activity inhibitor" of a
protein or miRNA is not particularly limited as long as
it is an agent that makes the protein or miRNA incapable
of exhibiting its activity. For example, the activity
inhibitor may be a substance that binds to the protein or
miRNA, or a substance that binds to a substance to which
the protein or miRNA binds. Known activity inhibitors of
proteins are mimetics, antibodies or immunoreactive
fragments thereof, aptamers, receptor derivatives, or
antagonists. Known activity inhibitors of miRNA are
mimetics, antisense DNA/RNA or dsRNA having a sequence
complementary to at least a partial sequence of the miRNA,
or aptamers to the miRNA.
CA 02979792 2017-09-14
- 29 -
[0030]
As used herein, the "antisense" is a nucleic acid
having a complementary sequence of the target sequence
(for example, the sequence of pri-miR-181c, pre-miR-181c,
or miR-181c or a DNA encoding pri-miR-181c) and may be
DNA or RNA. The antisense is not required to be 100%
complementary to the target sequence and may contain non-
complementary nucleotides as long as it can specifically
hybridize under stringent conditions (Sambrook et al.,
1989, Molecular Cloning, A Laboratory Manual, Cold Spring
Harbor Press, N.Y., and Ausubel et al. (eds.), 1995,
Current Protocols in Molecular Biology, (John Wiley &
Sons. N.Y.) at Unit 2.10). Once introduced into cells,
the antisense binds to the target sequence and inhibits
the transcription, the processing of RNA, the translation,
or the stability thereof. The antisense includes
antisense polynucleotides as well as polynucleotide
mimetics and those that contain a modified back bone.
Such an antisense can be designed and produced (for
example, chemically synthesized) appropriately using a
method well known in the art based on the target sequence
information.
[0031]
The "dsRNA" is RNA containing double strand RNA
structure that has at least partially a sequence
complementary to the target sequence. The dsRNA binds to
mRNA having the target sequence, and thereby degrades the
CA 02979792 2017.--14
- 30 -
mRNA to suppress the translation (expression) of the
target sequence by RNA interference (RNAi). The dsRNA
includes siRNA (short interfering RNA) and shRNA (short
hairpin RNA). The dsRNA is not required to have 100%
identity with the target sequence as long as it can
suppress the expression of the target gene. Moreover, a
part of the dsRNA may be substituted with DNA for
stabilization or another purpose. The siRNA is
preferably double strand RNA having 21-23 nucleotide each.
The siRNA can be obtained by a method well known in the
art, for example, by chemical synthesis or as an analog
of naturally occurring RNA. The shRNA is a RNA short
chain having a hairpin turn structure. The shRNA can be
obtained by a method well known in the art, for example,
by chemical synthesis or introducing a gene encoding the
shRNA into cells and expressing the gene.
[0032]
The "aptamer" are nucleic acids that bind to a
substance such as protein or nucleic acid. The aptamers
may be constituted of RNA or DNA. The form of the
nucleic acids may be a double strand or a single strand.
The length of the aptamer is not particularly limited as
long as it can specifically bind to the target molecule,
but is for example, 10-200 nucleotides, preferably 10-100
nucleotides, more preferably 15-80 nucleotides, or
further preferably 15-50 nucleotides. The aptamers can
be selected using a method well known in the art and, for
CA 02979792 2017-09-14
- 31 -
example, the SELEX (Systematic Evolution of Ligands by
Exponential Enrichment) method (Tuerk, C. and Gold, L.,
1990, Science, 219: 505-510).
[0033]
As used herein, the "mimetics" are substances that
have a structure similar to that of the protein or the
miRNA. The mimetics can bind to the binding partners of
the protein or the miRNA or can compete with the protein
or miRNA, without exhibiting the activity of the protein
or miRNA.
[0034]
The "antibody" as used herein may be polyclonal
antibody or monoclonal antibody and includes a non-human
animal antibody, antibody having both of an amino acid
sequence of a non-human animal antibody and an amino acid
sequence of a human antibody (chimeric antibody and
humanized antibody), and a human antibody. The immune
globulin class of the antibodies may be any immune
globulin class (isotype), IgG, IgM, IgA, IgE, IgD, or IgY,
and, in the case of IgG, may be any subclass (IgGl, IgG2,
IgG3, or IgG4). Furthermore, the antibody may be
monospecific, bispecific (bispecific antibody), or
trispecific (trispecific antibody) (for example,
W01991/003493). The immunoreactive fragments of an
antibody mean proteins or peptides containing a part
(partial fragment) of the antibody with maintaining the
antibody's activity (immunoreactivity, binding activity)
CA 02979792 2017-09-14
- 32 -
to the antigen. Examples of such immunoreactive fragment
includes F(ab1)2, Fab', Fab, Fab3, single strand Fv
(hereinafter, referred to as the "scFv"), (tandem)
bispecific single strand Fv (sc(Fv)2), single strand
triple bodies, nanobodies, divalent VHHs, pentavalent
VHHs, minibodies, (double strand) diabodies, tandem
diabodies, bispecific tribodies, bispecific bibodies,
dual affinity retargeting molecules (DART), triabodies
(or tribodies), tetrabodies (or [sc(Fv)2]2) or (scFv-SA)4),
disulfide linked Fv (hereinafter, referred to as "dsFv"),
compact IgGs, heavy chain antibodies or polymers thereof
(see Nature Biotechnology, 29 (1): 5-6 (2011); Maneesh
Jain et al., TRENDS in Biotechnology, 25 (7) (2007): 307-
316; and Christoph stein et al., Antibodies (1): 88-123
(2012)). As used herein, the immunoreactive fragments
may be any of monopecific, bispecific, trispecific, and
multispecific antibodies. The aptamers are nucleic acid
molecules capable of binding to a specific nucleic acid
or protein. The receptor derivative means a substance
having a binding region structure of a receptor to which
the protein of interest hinds. The receptor derivative
includes a conjugate of the constant region of an
antibody with a receptor and a membrane protein receptor
solubilized by deleting the transmembrane region. The
antagonist includes a wide range of substances that
competes with the protein or miRNA of interest and
inhibits the function thereof.
CA 02979792 2017-09-14
- 33 -
[0035]
Herein, when the activity inhibitor binds to the
protein or miRNA or when the activity inhibitor binds to
a substance to which the protein or miRNA binds to, the
binding is preferably specific and the binding constant
(Ka) thereof may be for example, at least 107 MI, at
least 108 at least 109 at least 101 M-
1, at least
1011 M-1, at least 1012 MI, or at least 1013
[0036]
As used herein, the "agent" is a substance mainly
used as an active ingredient, and includes a small
molecule, a nucleic acid molecule (DNA and/or RNA), a
protein, and a fusion thereof. As used herein, the
"composition" comprises at least an agent that serves as
an active ingredient and optionally comprises water, a
solvent, and other additives as needed. The composition
herein may comprise only one substance or 2 or more
substances as an active ingredient(s). As used herein,
the "active ingredient" is not particularly limited, as
long as it can exhibit a desired biological activity, and
includes a substance capable of exhibiting a therapeutic
effect or preventive effect as well as a substance
exhibiting a function as DDS. Whether a substance is an
active ingredient or not can be determined not only
depending on whether the substance has a biological
action or not, but also depending on whether the amount
CA 02979792 201.7.--14
- 34 -
of the substance contained in the composition can allow
the substance to exhibit the biological action.
[0037]
The "composition for diagnosis or risk assessment of
brain metastasis" is a composition to be used in a method
for diagnosing brain metastasis or a method for assessing
risk of brain metastasis as described below, and includes
a diagnostic composition (including an extracorporeal
diagnostic composition). The composition for diagnosis
or risk assessment of brain metastasis may be used for in
vivo, ex vivo, or in vitro diagnosis, but preferably is
for ex vivo or in vitro use. Compositions for in vivo
diagnosis or risk assessment may be formulated to be
administered to a patient in accordance with the
formulation of pharmaceutical compositions as described
below. Examples of the composition for diagnosis or risk
assessment herein include an X-ray contrast agent, a
reagent for general examination, a reagent for blood test,
a reagent for biochemical test, a reagent for
immunoserologic examination, an agent for bacteriological
examination, and a reagent for functional examination.
Since the composition for diagnosis or risk assessment
herein needs to determine miR-181c level in a sample, the
composition comprises the substance that specifically
binds to miR-181c described above.
[0038]
CA 02979792 2017-09-14
- 33 -
In another aspect, the composition for diagnosis or
risk assessment herein may be provided as a kit for
diagnosis or risk assessment comprising the composition
as an active ingredient. The kit can be constituted by
any materials as long as miRNA levels can be determined.
For example, the kit for diagnosis or risk assessment
herein may be a kit comprising a primer that can bind to
miR-181c (a kit for measuring miRNA levels by using gene
amplification technique such as PCR) or a kit comprising
a probe that can bind to miR-181c (a kit for measuring
miRNA levels by using a nucleic acid binding detection
technique such as hybridization).
[0039]
Alternatively, the kit for diagnosis or risk
assessment herein may be a kit which determines the miRNA
level utilizing an expression inhibitory effect of miRNA
as indicator. In this case, the kit may comprise, for
example, a nucleic acid encoding a label (luciferase, or
the like) having an mRNA 3'UTR that can specifically bind
to miR-181c (a kit for measuring miRNA levels by
detecting the expression of the label in the reporter
assay or the like).
[0040]
As used herein, the "pharmaceutical composition" is
a composition to be used for treatment or prevention and
comprises a therapeutic or preventive agent. The
pharmaceutical composition is preferably prepared into a
CA 02979792 2017-09-14
- 36 -
unit dosage form comprising a suitable dose of the active
ingredient. Moreover, any oral or parenteral formulation
may be employed as long as it can be administered to a
patient. Examples of compositions for parenteral
administration include injections, nasal drops,
suppositories, patches, ointments, and the like, and are
preferably injections. Examples of the dosage form of
the pharmaceutical composition of the present invention
include solutions or lyophilized formulations. When the
pharmaceutical composition of the present invention is
used as an injection, an excipient (see "Japanese
Pharmaceutical Excipients Directory" Yakuji Nippo
Limited.; "Handbook of Pharmaceutical Excipients Fifth
Edition" APhA Publications) including a solubilizing
agent such as propylene glycol or ethylenediamine, a
buffer such as phosphate, an isotonizing agent such as
sodium chloride or glycerin, a stabilizer such as sulfite,
a preservative such as phenol, or a soothing agent such
as lidocaine may be added as needed. Moreover, when the
pharmaceutical composition of the present invention is
used as an injection, a storage container therefor may be
an ampoule, a vial, a prefilled syringe, a cartridge for
pen type syringes, a bag for infusion, and the like. For
example, the pharmaceutical composition may usually
contain 5-500 mg, 5-100 mg, 10-250 mg of the active
ingredient per unit dosage form.
[0041]
CA 02979792 2017-09-14
- 37 -
As used herein, the pharmaceutical composition for
suppressing brain metastasis may comprise one or more
agents selected from an miR-181c expression inhibitor, an
miR-181c activity inhibitor, and an exosome secretion
inhibitor as an active ingredient. Moreover, the
pharmaceutical composition for suppressing brain
metastasis may comprise one or more agents selected from
an miR-181c expression inhibitor, an miR-181c activity
inhibitor, and an exosome secretion inhibitor as active
ingredient(s), or further comprise other agent(s) to be
used in combination as active ingredient(s). Examples of
such other agents include other cancer metastasis
inhibitors and anticancer agents.
[0042]
Examples of the other cancer metastasis inhibitors
or anticancer agents that can be included in the
pharmaceutical composition for suppressing brain
metastasis include alkylating agents including nitrogen
mustards such as cyclophosphamide, ifosfamide, melphalan,
busulfan, and thiotepa, and nitrosoureas such as
nimustine, ranimustine, Dacarbazine, procarbazine,
temozolomide, carmustine, Streptozotocin, bendamustine;
platinum compounds such as cisplatin, carboplatin,
oxaliplatin, and nedaplatin; antimetabolites such as
enocitabine, capecitabine, carmofur, cladribine,
gemcitabine, cytarabine, cytarabine ocfosphate, tegafur,
tegafur/uracil, tegafur/gimeracil/oteraci1 potassium,
CA 02979792 2017-09-14
- 38 -
doxifluridine, nelarabine, hydroxycarbamide, 5-
fluorouracil (5-FU), fludarabine, pemetrexed, pentostatin,
mercaptopurine, and methotrexate; plant alkaloids or
microtubule inhibitors such as irinotecan, etoposide,
eribulin, sobuzoxane, docetaxel, nogitecan, paclitaxel,
vinorelbine, vincristine, vindesine, and vinblastine:
antitumor antibiotics such as actinomycin D, aclarubicin,
amrubicin, idarubicin, epirubicin, zinostatin stimalamer,
daunorubicin, doxorubicin, pirarubicin, bleomycin,
peplomycin, mitomycin C, mitoxantrone, and liposomal
doxorubicin; cancer vaccines such as Sipuleucel-T;
molecular target drugs such as ibritumomab tiuxetan,
imatinib, everolimus, erlotinib, gefitinib, gemtuzumab
ozogamicin, sunitinib, cetuximab, sorafenib, dasatinib,
tamibarotene, trastuzumab, tretinoin, panitumumab,
bevacizumab, bortezomib, lapatinib, and rituximab;
hormone preparations such as anastrozole, exemestane,
estramustine, ethinyl estradiol, chlormadinone, goserelin,
tamoxifen, dexamethasone, toremifene, bicalutamide,
flutamide, predonisolone, fosfestrol, mitotane,
methyltestosterone, medroxyprogesterone, mepitiostane,
leuprorelin, and letrozole; biological response modifiers
such as interferon a, interferon p, interferon y,
interleukin, ubenimex, freeze-dried BCG, and lentinan.
[0043]
As used herein, the pharmaceutical composition for
increasing permeability of the blood-brain barrier may
CA 02979792 2017-09-14
=
- 39 -
comprise one or more PDPK1 expression inhibitors or PDPK1
activity inhibitors as an active ingredient(s). The
pharmaceutical composition for increasing permeability of
the blood-brain barrier may solely comprise the PDPK1
expression inhibitor and/or PDPK1 activity inhibitor as
active ingredient(s), or may further comprise another
agent to be used in combination as an active ingredient.
Examples of such another agent include drugs that act on
and increase the permeability of the blood-brain barrier
as well as agents intended to be delivered to the brain.
Herein, when the pharmaceutical composition for
increasing permeability of the blood-brain barrier is
used particularly for delivering a desired agent to the
brain, such a pharmaceutical composition is referred to
as the "agent-delivery composition". In the agent-
delivery composition herein, the "agent intended to be
delivered to the brain" may be referred to as the
"medicinal component" to be distinguished from the agent
(PDPK1 expression inhibitor or PDPK1 activity inhibitor)
intended to open the BBB.
[0044]
As used herein, the "agent-delivery composition"
comprises at least a PDPK1 expression inhibitor or
activity inhibitor as an active ingredient. The agent-
delivery composition is preferably prepared into a unit
dosage form comprising a suitable dose of the medicinal
component. An example of such a unit dosage form is an
CA 02979792 2017-09-14
A
- 40 -
injection (ampoule, vial, prefilled syringe). Usually 5-
500 mg, 5-100 mg, or 10-250 mg of the PDPK1 expression
inhibitor or activity inhibitor may be contained per unit
dosage form.
[0045]
Moreover, the agent-delivery composition may
comprise, in addition to the PDPK1 expression inhibitor
or activity inhibitor, an agent intended to be delivered
to the brain, a medicinal component. The PDPK1
expression inhibitor or activity inhibitor and the
medicinal component may be contained in one formulation
or provided as separate formulations to be used in
combination.
[0046]
As used herein, the "medicinal component" is a
medicine intended to be delivered into the brain, and
includes, for example, a therapeutic or preventive agent
for a target disease such as neurosurgical diseases such
as cerebrovascular disorders (such as cerebral
infarction/cerebral hemorrhage/cerebral aneurysm), brain
tumor (such as meningioma, pituitary adenoma, including
brain metastasis), infectious diseases (such as
meningitis), functional brain diseases (such as
trigeminal neuralgia), the spinal cord disease (such as
disc herniation, spinal stenosis); neurological diseases
such as Parkinson's disease, spinocerebellar degeneration,
and epilepsy; and mental diseases such as Alzheimer's
CA 02979792 201.7.--14
A
- 41 -
disease, non-Alzheimer type degenerative dementia,
insomnia, and depression. For example, when the target
disease is brain tumor, the anticancer agents described
above may be used and, particularly when it is glioma,
Avastin or Gliadel may be preferably used.
[0047]
In another aspect, the agent-delivery composition
herein may be provided as a kit for treatment or
prevention, comprising the composition as an active
ingredient. The constitution of the kit is not limited
as long as it comprises the PDPK1 expression inhibitor or
activity inhibitor, and the kit may comprise, for example,
the PDPK1 expression inhibitor or activity inhibitor and
the medicinal component. In this case, the PDPK1
expression inhibitor or activity inhibitor and the
medicinal component may be provided in a form to be
administered simultaneously or separately.
[0048]
Throughout the description, the "level" means a
numerical value indicating the quantity of miR-181c,
which includes, for example, the concentration, the
amount, or any alternative numerically value indicating
the quantity to be used instead thereof. Accordingly,
the level may be a measurement itself of such as
fluorescence or may be a value converted into the
concentration or the amount. The level may be absolute
numerical value (abundance, abundance per unit area) or a
CA 02979792 2017-09-14
=
- 42 -
numerical value relative to a control provided as needed.
The level may be the mean or median when the same sample
is measured plural times (at the same time or at
different times).
[0049]
As used herein, the "kit" may comprise, in addition
to the active ingredient, a package storing components of
the kit, such as a paper box or a plastic case, an
ampoule, a vial, a tube, a syringe, or the like storing
each component, an instruction manual, and the like.
[0050]
In another aspect, the present invention involves an
apparatus for judging brain metastasis in a cancer
patient, an apparatus for assessing risk of brain
metastasis in a cancer patient, and a computer program
used in these apparatuses (Figure 23). These apparatuses
provide information for diagnosis to a person (usually a
doctor) who diagnoses whether there is brain metastasis
or not. The apparatus for judging brain metastasis of
the present invention comprises miR-181c-measuring means.
The "miR-181c-measuring means" is an apparatus that
conducts the measurement of a polynucleotide having the
nucleotide sequence of or a part of miR-181c (SEQ ID NO:
1) in a sample derived from a subject, which processes
the sample from the subject cancer patient as prescribed
to convert information about the miR-181c levels in the
sample into digits or electrical signals. The miR-181c-
CA 02979792 2017-09-14
- 43 -
measuring means allows to contact the agent for diagnosis
or risk assessment of brain metastasis described above
and the sample from the subject cancer patient and to
react them if necessary, and measures generated
parameters such as a strength of a light (fluorescence,
luminescence) which reflects the miR-181c levels. The
contact between the agent for diagnosis or risk
assessment of brain metastasis and the sample from the
subject cancer patient usually takes place in a container
(reaction vessel) such as a plate or a tube.
[0051]
The computer program of the present invention
includes a computer program that can make an existing
apparatus to be used for judging brain metastasis or for
assessing risk of brain metastasis in a cancer patient by
installing, even if the existing apparatus is widely used
and can be used for other measurement or judgment. The
computer program of the present invention is not required
to be installed in the apparatus for judging brain
metastasis and the apparatus for assessing risk of brain
metastasis. The computer program of the present
invention may be provided, for example, in such a form to
be stored on a recording medium. The "recording medium"
is a medium that can carry a program without occupying
space, and includes a flexible disk, a hard disk, CD-R,
CD-RW, MO (magneto-optical disk), DVD-R, DVD-RW, a flash
memory, and the like. Moreover, the computer program of
CA 02979792 2017-09-14
- 44 -
the present invention can be transmitted from the
computer program storing computer to other computers or
other apparatuses through a communication line. The
computer program of the present invention includes those
stored on such a computer and being transmitted.
Advantageous Effects of Invention
[0052]
miR-181c contributes to brain metastasis by
destructing the BBB. Since expression of miR-181c is
specifically increased in cancer patients with brain
metastasis, miR-181c can be used as indicator for
diagnosis or risk assessment of brain metastasis. A
brain metastasis can be suppressed by inhibiting the
expression or activity of miR-181c or inhibiting
secretion of EVs (containing miR-181c). PDPK1 expression
inhibitors and PDPK1 activity inhibitors including miR-
181c increases the permeability of the BBB, and thus can
be used as DDS of agents desired to be delivered into the
brain.
Brief Description of Drawings
[0053]
[Figure 1] (a) Figure la illustrates the protocol for in
vivo-selection of brain metastatic derivatives. (b) The
left photograph shows bioluminescence imaging of a mouse
with BMD2a cell brain metastasis; and the right
CA 02979792 2017-09-14
- 45 -
photographs shows bioluminescence imaging of a mouse
brain with cancer cell metastasis. (c) Photographs of
hematoxylin and eosin (HE)-stained sections from a mouse
brain cerebral cortex and midbrain. The upper panels
show cerebral cortex and the lower panels show the
midbrain. The left panels (Normal) show sections from a
mouse without cancer cell metastasis, and the middle
panels (Metastasis) show sections from a mouse with
cancer cell metastasis. The arrowheads indicate
metastatic cancer cells. The right photographs are
higher magnification photographs. The bar at the lower
right corner in each photograph indicates 100 pm.
[Figure 2] (a) Figure 2a illustrates in vitro blood-brain
barrier model constructed from primary culture cells of
monkey brain capillary endothelial cells, pericytes, and
astrocytes. (b) Representative photographs of
endothelial cells, pericytes, and astrocytes. The
astrocytes were visualized using a fluorescence
microscope. The bar at the lower right corner in each
photograph indicates 100 pm. (c) Photographs of the
results of immunofluorescence staining of tight junction
proteins (Claudin-5, Occludin, and ZO-1) and the N-
cadherin. The bar at the lower right corner in each
photograph indicates 20 m. (d) A graph of the change of
TEER after thawing until the start of the experiment.
The value of TEER increased to a maximum of 869.55 n x
CA 02979792 2017-09-14
- 46 -
cm2 after thawing the BBB in vitro model. The error bars
represent standard deviation (SD).
[Figure 3] (a) Representative photographs showing
invasiveness of Matrigel by MDA-MB-231-D3H1 cells
(hereinafter, D3H1 cells) MDA-MB-231-D3H2LN cells
(hereinafter, D3H2LN cells), and BMD2a and BMD2b cells
which were established as brain metastasis cell lines.
The bar at the lower right corner in each photograph
indicates 100 gm. (b) A graph showing the ratio (folds)
of the number of D3H1 cells, BMD2a cells, and BMD2b cells
invaded Matrigel relative to the number of D3H2LN cells
invaded Matrigel. The error bar represents standard
deviation (SD), and ** indicates P < 0.01. (c)
Photographs of representative morphology of D3H1, D3H2LN,
BMD2a, and BMD2b cells. The bar at the lower right
corner in each photograph indicates 100 gm.
[Figure 4] (a) Figure 4a illustrates the invasive test of
PKH-67 labeled cancer cells using the in vitro BBB model.
(b) The left panel is a graph showing the ratio (folds)
of the number of D3H2LN, BMD2a, and BMD2b cells that
migrated across the in vitro BBB model relative to the
number of D3H1 cells that migrated across the BBB model.
The error bars represent standard deviation (SD), and *
indicates P < 0.01 and ** indicates P <0.01. The right
panel is photographs of D3H1, D3H2LN, BMD2a, and BMD2b
cells that migrated across the in vitro BBB model.
CA 02979792 2017-09-14
- 47 -
[Figure 5] (a) The upper panels are photographs of EVs
visualized with a phase-contrast electron microscope.
The bars represent 100 nm. The lower panels are graphs
of the results of measurements of the EV sizes with
NanoSight. The numerical values in the graphs are the
mean values of the size of all EVs. (b) A photograph of
the result of Western blotting to confirm the expression
of CD63 and CD9 as the EV markers and Cytochrome C. In
the photograph, from the left to the right, each lane
shows D3H1 derived EVs (lane 1), D3H2LN derived EVs (lane
2), BMD2a derived EVs (lane 3), and BMD2b derived EVs
(lane 4). (c) A graph of the result of measurement of
the number of EVs isolated from D3H1, D3H2LN, BMD2a, and
BMD2b cells with NanoSight. The horizontal axis
indicates, from the left to the right, D3H1 derived EVs,
D3H2LN derived EVs, BMD2a derived EVs, and BMD2b derived
EVs. The vertical axis represents the number of EV
particles per 1 mL (x109/mL).
[Figure 6] Graphs of the results of treatment of BMD2a
cells with siRNAs. In all graphs, the horizontal axis
indicates treated siRNAs, which are from the left to the
right, negative control cells (N.C.), RAB27B siRNA
(RAB27B), nSMase2 siRNA (nSMase2), and RAB27B siRNA and
nSMase2 siRNA (S+R). (a) A graph showing the number of
EVs released from siRNA-treated BMD2a cells. The
vertical axis represents the ratio (folds) of the number
of EV particles (unit/mL) from cells treated with siRNA
CA 02979792 201.7.--14
- 48 -
against the EV-release related protein relative to the
number of EV particles from the negative control cells.
(b) A graph of siRNA-treated BMD2a cells invaded Matrigel.
The vertical axis represents the ratio (%) of the number
of Matrigel invaded cells treated with siRNA against an
EV-release related protein relative to that of the
negative control cells. (c) A graph showing the result
of the in vitro BBB transmigration activity test of
siRNA-treated BMD2a cells. The vertical axis represents
the ratio (folds) of the number of BBB transmigrated
cells treated with siRNA against an EV-release related
protein relative to that of the negative control cells.
[Figure 7] A graph of the result of measurement of the
BBB transmigrating capacity of D3H1 cells on addition of
EVs derived from BMD2a, BMD2b, or D3H2LN cells using the
in vitro BBB model. The vertical axis represents the
ratio (folds) of the number of D3H1 cells that migrated
across the in vitro BBB model on addition of EVs derived
from BMD2a, BMD2b, or D3H2LN cells relative to that of
the negative control cells. The horizontal axis
indicates the cells from which the added EVs are derived,
which are from the left to the right, negative control
(N.C.), D3H2LN, BMD2a, and BMD2b cells.
[Figure 8] (a) A graph showing the result of TEER
measurement at 24 hours after the addition of EVs. The
vertical axis represents the measurement of TEER (acm2),
the horizontal axis indicates the cells from which the
CA 02979792 2017-09-14
- 49 -
added EVs are derived, which are from the left to the
right, negative control (N.C.), D3H1, D3H2LN, BMD2a, and
BMD2b cells. The error bars represent standard deviation
(SD), * indicates P < 0.05, and ** indicates P < 0.01.
(b) A graph showing changes of TEER between before and 24
hours after the EV addition. The horizontal axis
represents the ratio (folds) of the TEER value at 24
hours after the EV addition relative to that before the
EV addition. (c) A graph representing the result of the
permeability test of BBB measured by NaF. The vertical
axis represents the apparent permeability coefficient
(Papp) (10-6cms-1). The horizontal axis indicates the
cells from which the added EVs was derived, which are
from the left to right, negative control (N.C.), D3H1,
D3H2LN, BMD2a, and BMD2b cells.
[Figure 9] (a) A graph representing the result of
measurement of EV uptake to endothelial cells
constituting the in vitro BBB model. The vertical axis
represents the fluorescence intensity ratio (folds),
relative to D3H2LN cell-derived EVs, of other cell-
derived EVs taken up by endothelial cells. The
horizontal axis indicates the cells from which the EVs
used are derived, which are, from the left to the right,
D3H1, D3H2LN, BMD2a, and BMD2b cells. The error bars
represent standard deviation (SD), and ** indicates P <
0.01. (b) Photographs of Hoechst33342 staining (light
blue) of endothelial cells, pericytes, and the astrocytes
CA 02979792 2017-09-14
- 50 -
constituting the in vitro BBB model as well as PKH67
(green) of up-taken EVs, observed with a fluorescence
microscope. The cells from which the EVs derived are
indicated on the left of the photographs. The bars in
the photographs of endothelial cells and pericytes
indicate 20 gm. The bar in the photographs of astrocytes
indicates 100 gm.
[Figure 10] (a) Photographs of co-immunofluorescence of
tight junction proteins (Claudin-5, Occludin and ZO-1)
(red) and actin filaments (green) in vascular endothelial
cells constituting the in vitro BBB model after the
addition of EVs derived from D3H2LN, BMD2a, and BMD2b
cells. The bars indicate 20 gm. (b) Photographs of co-
immunofluorescence of N-cadherin (red) and actin
filaments (green) in blood vessel cells constituting the
in vitro BBB model after the addition of EVs derived from
D3H2LN, BMD2a or BMD2b cells. The bars indicate 20 gm.
(c) A photograph of Western blot analysis on tight
junction proteins, N-cadherin, Actin, and GAPDH (internal
control) in proteins recovered from endothelial cells
treated with PBS (negative control: N.C.) or EVs derived
from D3H2LN, BMD2a, or BMD2b cells.
[Figure 11] Fluorescence image photographs of a brain of
a mouse administered D3H2LN (control) or BMD2a cell
derived EVs. The fluorescence intensity of the upper
panels represents DiR-labelled EVs up-taken by a mouse
CA 02979792 2017-09-14
- 51 -
brain. The fluorescence intensity of the lower panels
represents the blood vessel permeability of a mouse brain.
[Figure 12] (a) A graph showing distribution of photon
intensity in the mouse brain. The vertical axis
represents photon intensity (x105). The horizontal axis
indicates each mouse group, which are from the left to
the right, negative control (N.C.), the D3H2LN-derived
EVs administrated group (D3H2LN), and the BMD2a-derived
EVs administrated group (BMD2a). * indicates P < 0.05
and ** indicates P < 0.01. (b) Photographs showing
bioluminescence image of cancer cell metastasis in mice
into which cancer cells were transplanted after
administration of PBS (negative control) (N.C.) (left),
EVs derived from D3H2LN (D3H2LN EVs) (middle), and EVs
derived from BMD2a (BMD2a EVs) (right). The upper panels
are bioluminescence images of the whole body of the mice,
and the lower panels are bioluminescence images of a
mouse brains. (c) Photographs of sections from a mouse
brain cerebral cortex. The upper panels are photographs
of hematoxylin and eosin (HE) staining and the arrowheads
indicate metastatic cancer cells. The bars at the lower
right corner in the photographs indicate 100 m. The
lower panels are image photographs of anti-human vimentin
immunofluorescence staining and the bars at the lower
right corner in the photographs indicate 20 m.
[Figure 13] (a) A heat map of expression levels of miR-
181c in cancer cell-derived EVs. (b) A graph showing the
CA 02979792 201.7.--14
- 52 -
ratio (folds) of the rate of an amount of miR-181c to an
amount of total RNA (miR-181c/(total exosome RNA)) in EVs
isolated from BMD2a and BMD2b cells as compared with the
rate of miR-181c/(total exosome RNA) in EVs derived from
D3H2LN cells. The vertical axis represents the ratio
(folds) of the rate of the amount of miR-181c to the
amount of total RNA in isolated EVs from each cell as
compared with the rate (which is set to be 1) of the
amount of miR-181c to the amount of total RNA in EVs
isolated from D3H2LN cells. For BMD2a cell and BMD2b
cell, the error bars represent standard deviation (SD)
and ** indicates P < 0.01 as compared with EVs derived
from D3H2LN cells.
[Figure 14] (a) A graph showing a change in amount of
miR-181c in vascular endothelial cells of in vitro BBB
model. The vertical axis indicates the ratio (folds) of
the amount of miR-181c in the RNAs recovered from
vascular endothelial cells of the in vitro BBB model
after adding cancer cell-derived EVs to the in vitro BBB
model, relative to the amount of miR-181c contained in
the vascular endothelial cells to which EVs derived from
D3H2LN cells were added, wherein the amounts of miR-181c
are corrected by that of RNU6. The horizontal axis
indicates the cells from which the EVs added to the in
vitro BBB model were derived from, which are D3H2LN,
BMD2a, and BMD2b cells from the left to the right. For
BMD2a and BMD2b cells, the error bars represent standard
CA 02979792 2017-09-14
- 53 -
deviation (SD) and ** indicates P < 0.01 as compared with
EVs derived from D3H2LN cells. (b) A graph of the TEER
measurement at 24 hours after transfecting the vascular
endothelial cells of the in vitro BBB model with miR-181c.
The vertical axis indicates the measurement of TEER
(C2.cm2) and the horizontal axis indicates the transfected
microRNAs, which are negative control (N.C.) and miR-181c,
from the left to the right. The error bars represent
standard deviation (S.D.), and ** indicates P < 0.01.
(c) Photographs of the co-immunofluorescence of tight
junction proteins (Claudin-5, Occludin, and ZO-1), N-
cadherin (red), and actin filaments (green) in vascular
endothelial cells constituting the in vitro BBB model
after the transfection with the negative control (N.C.)
or miR-181c. The bar indicates 20 m. (d) A photograph
illustrating Western blot analysis of tight junction
proteins, N-cadherin, actin, and GAPDH (internal control),
using proteins recovered from the vascular endothelial
cells constituting the in vitro BBB model, which had been
transfected with the negative control (N.C.) or miR-181c.
[Figure 15] A graph showing the amount of miR-181c
contained in serum EVs derived from patients. The
vertical axis indicates the ratio of the amount of miR-
181c relative to the amount of miR-16. The left in
horizontal axis indicates "without brain metastasis" (n
46) and the right indicates "Brain metastasis" (n = 10).
CA 02979792 2017-09-14
- 54 -
* indicates P < 0.05. The miR-181c levels were assessed
by t-test.
[Figure 16] A graph showing the distribution of the
amount of miR-181c contained in sera of breast cancer
patients. The vertical axis indicates the abundance of
miR-181c corrected by the abundance of miR-16 (AACt
value). The horizontal axis indicates the stage of
breast cancer using the TNM staging. * indicates
significant differences (P < 0.05) in Mann-Whitney U test
between the patient group with brain metastasis and the
patient groups in Stage 3 and in Stage 4 without brain
metastasis.
[Figure 17] (a) The ratio of PDPK1 expression amounts in
a microarray analysis. After transfecting vascular
endothelial cells constituting the in vitro BBB model
with the negative control (N.C.) or miR-181c, RNAs
recovered from the vascular endothelial cells were
analyzed with microarray. The vertical axis indicates a
ratio of an amount of PDPK1 expression by each cells
relative to an amount of PDPK1 expression by cells
transfected with the negative control (N.C.) which is set
to be 1. The horizontal axis indicates the micro RNA
used for the transfection, N.C. and miR-181c from the
left to the right. (b) The expression amount of PDPK1
mRNA expression in vascular endothelial cells
constituting the in vitro BBB model. After transfecting
the vascular endothelial cells with the negative control
CA 02979792 2017-09-14
- 55 -
(N.C.) or miR-181c, RNAs are recovered from the vascular
endothelial cells, and the amount of PDPK1 mRNA contained
in the RNA was analyzed by RT-PCR. The vertical axis
indicates the value of the amount of PDPK1 mRNA corrected
by the amount of GAPDH mRNA (AACt value) which is set to
be 1. The horizontal axis indicates the microRNAs used
for the transfection, N.C. and miR-181c from the left to
the right. ** indicates P < 0.01. (c) A photograph of
Western blot analysis on PDPK1 and GAPDH (internal
control), using proteins recovered from the vascular
endothelial cells constituting the in vitro BBB model
transfected with the negative control (N.C.) or miR-181c.
The graph indicates the value of the luminescence
intensity of PDPK1 corrected by the luminescence
intensity of GAPDH in Western blot analysis. (d) The
ratio of PDPK1 expression levels in a microarray analysis.
After adding negative control (N.C.), D3H2LN cell-derived
EVs, BMD2a cell-derived EVs, or BMD2b cell-derived EVs to
the vascular endothelial cells constituting the in vitro
BBB model, RNAs were recovered from the vascular
endothelial cells and analyzed by microarray analysis.
The vertical axis indicates the ratio of the expression
amount of PDPK1 relative to the expression amount of
PDPK1 by cells treated with the negative control (N.C.),
which is set to be 1. The horizontal axis indicates the
added EVs, negative control (N.C.), D3H2LN cell-derived
EVs, BMD2a cell-derived EVs, and BMD2b cell-derived EVs.
CA 02979792 2017-09-14
- 56 -
(e) The expression levels of PDPK1 mRNA in the vascular
endothelial cells constituting the in vitro BBB model.
After adding negative control (N.C.), D3H2LN cell-derived
EVs, BMD2a cell-derived EVs, or BMD2b cell-derived EVs to
the vascular endothelial cells constituting the in vitro
BBB model, the amount of PDPK1 mRNA contained in the RNA
recovered from the vascular endothelial cells was
analyzed by RT-PCR. The vertical axis indicates the
ratio of the value (AACt value) that is the amount of
PDPK1 mRNA corrected by the amount of GAPDH mRNA relative
to the value of the negative control which is set to be 1.
The horizontal axis indicates the added EVs, negative
control (N.C.), D3H2LN cell-derived EVs, BMD2a cell-
derived EVs, and BMD2b cell-derived EVs. ** indicates P
< 0.01. (f) A photograph of Western blot analysis of
PDPK1 and GAPDH (internal control) using the proteins
recovered from the vascular endothelial cells
constituting the in vitro BBB model after adding negative
control (N.C.), D3H2LN cell-derived EVs, BMD2a cell-
derived EVs, or BMD2b cell-derived EVs. The graph
indicates the value of the luminescence intensity of
PDPK1 corrected by the luminescence intensity of GAPDH in
Western blot analysis.
[Figure 18] (a) Photographs of the co-immunofluorescence
of tight junction proteins (Claudin-5, Occludin, and ZO-
1), N-cadherin (red), and actin filaments (green) in the
vascular endothelial cells constituting the in vitro BBB
CA 02979792 2017-09-14
- 57 -
model after transfecting with the negative control (N.C.)
or PDPK1 siRNA. The bar indicates 20 m. (b) A
photograph illustrating Western blot analysis of tight
junction proteins, N-cadherin, actin, and GAPDH (internal
control), using the proteins recovered from the vascular
endothelial cells constituting the in vitro BBB model
transfected with the negative control (N.C.) or PDPK1
siRNA. (c) A graph of the result of the TEER measurement
at 24 hours after the transfection of the vascular
endothelial cells of the in vitro BBB model with PDPK1
siRNA. The vertical axis represents the measurement of
TEER (D, cm2) and the horizontal axis indicates the
microRNAs used for the transfection, which are from the
left to the right, the negative control (N.C.) and PDPK1
siRNA. The error bars represent standard deviation
(S.D.), and ** indicates P < 0.01.
[Figure 19] (a) The result of 3'UTR reporter assay, using
the PDPK1 mRNA 3'UTR region derived from Human and Macaca.
The black bar indicates the result of the negative
control (N.C.), and the white bar indicates the result of
miR-181c. The values are the ratio relative to the
negative control (N.C.) which is set to he 1. **
indicates P < 0.01. (h) The PDPK1 mRNA 3'UTR region
sequences from Human (SEQ ID NO: 14) and Macaca (SEQ ID
NO: 15) and the miR-181c sequence (SEQ ID NO: 1) and the
binding region thereof.
CA 02979792 201.7.--14
- 58 -
[Figure 20] (a) A photograph of Western blot analysis of
PDPK1, Cofilin, phosphorylated Cofilin (P-cofilin), and
GAPDH (internal control) using the proteins recovered
from the vascular endothelial cells constituting the in
vitro BBB model after adding D3H2LN cell-derived EVs,
BMD2a cell-derived EVs, and BMD2b cell-derived EVs. (b)
A photograph of Western blot analysis of PDPK1, Cofilin,
phosphorylated Cofilin (P-cofilin), and GAPDH (internal
control) using the proteins recovered from the vascular
endothelial cells constituted the in vitro BBB model
transfected with the negative control (N.C.), miR-181c,
or PDPK1 siRNA.
[Figure 21] A schematic configuration diagram of an
apparatus for judging brain metastasis relating to an
embodiment of the present invention.
[Figure 22] A schematic configuration diagram of an
apparatus for assessing risk of brain metastasis relating
to an embodiment of the present invention.
[Figure 23] A flow of processing that the apparatus for
judging brain metastasis performs when the computer
program for the apparatus for judging brain metastasis is
executed.
[Figure 24] A flow of processing that the apparatus for
assessing risk of brain metastasis performs when the
computer program for the apparatus for assessing risk of
brain metastasis is executed.
CA 02979792 2017-09-14
- 59 -
[Figure 25] A schematic diagram of an apparatus of the
present invention and a method for judging brain
metastasis (solid line) or a method for assessing risk of
brain metastasis (dotted line) using the apparatus.
Description of Embodiments
[0054]
1. Method for diagnosis or risk assessment of brain
metastasis in cancer patient
In one aspect, the present invention relates to a
method for diagnosing brain metastasis or a method for
assessing risk of brain metastasis, comprising measuring
an miR-181c level in a sample from a subject cancer
patient. In one aspect, the present invention relates to
a method for diagnosing brain metastasis in a subject
cancer patient (or a method for assessing risk of brain
metastasis), comprising: determining an miR-181c level in
a sample from the subject cancer patient, and judging the
presence or absence of brain metastasis (or assessing
risk of brain metastasis) in the subject cancer patient
from the determined miR-181c level, wherein the subject
cancer patient is judged to have metastasis to brain (or
assessed to have a high risk of brain metastasis) when
the miR-181c level in the sample from the subject cancer
patient is higher than the miR-181c level in a sample
from a negative control.
[0055]
CA 02979792 201.7.--14
- 60 -
Alternatively, in one aspect, the present invention
relates to a method for providing information for
diagnosing brain metastasis, comprising measuring an miR-
181c level in a sample from a subject cancer patient.
The present invention relates to a method for providing
information for diagnosing brain metastasis (or for
assessing risk of brain metastasis) in a subject cancer
patient, comprising: a step of determining an miR-181c
level in a sample from the subject cancer patient, and a
step comprising providing information for judging the
presence or absence of brain metastasis (or assessing a
risk of brain metastasis) in the subject cancer patient
from the determined miR-181c level, wherein information
that the subject cancer patient has brain metastasis (or
has a high risk of brain metastasis) is provided when the
miR-181c level in the sample from the subject cancer
patient is higher than the miR-181c level in a sample
from a negative control.
[0056]
The step of determining an miR-181c level is
conducted by measuring a polynucleotide having the
nucleotide sequence or a part of miR-181c (SEQ ID NO: 1)
in the sample from the subject. The polynucleotide may
be measured by a method utilizing detection of nucleic
acid binding such as hybridization; a method utilizing
amplification of nucleic acids such as PCR; a method
utilizing the expression inhibitory activity of miR-181c
CA 02979792 2017-09-14
- 61 -
such as a reporter assay; or decoding the sequence of
miRNA or cDNA transcribed from miRNA.
[0057]
Examples of the method utilizing hybridization
include Southern hybridization, Northern hybridization,
dot hybridization, fluorescence in situ hybridization
(FISH), microarray, and the ASO method.
[0058]
For example, the "step of determining an miR-181c
level" in the present invention may comprise the
following steps:
(a) a step of contacting a sample from a subject cancer
patient with at least one nucleic acid construct (probe)
that binds to the nucleotide sequence or a part of miR-
181c (SEQ ID NO: 1);
(b) a step of measuring the binding between the probe and
miR-181c in the sample; and
(c) a step of determining the miR-181c level in the
sample from the measured binding between the probe and
miR-181c.
[0059]
In the description above, the "binding between the
probe and miR-181c" to be measured may be a bound amount,
the number of binding, or a percentage of the bound
substances. The step of determining the miR-181c level
in the sample from the measured binding between the probe
and miR-181c may be conducted, for example, by the
CA 02979792 2017-09-14
=
- 62 -
following procedures. Binding between the probe and miR-
181c in a standard sample which is a serial dilution
series of miR-181c is measured to generate a standard
curve. The miR-181c level in a sample from a subject
cancer patient can be calculated by comparing a
measurement of the binding between the probe and miR-181c
measured in the sample from the subject cancer patient
with the standard curve. The standard curve may be
determined by measuring standard samples simultaneously
with the sample from the subject cancer patient, or
alternatively by measuring standard samples separately
from (at different time from) the samples from the
subject cancer patient. Accordingly, the standard curve
may be pre-obtained from the measurements of standard
samples which is measured before the measurement of a
sample from a subject cancer patient. Instead of
directly binding the miRNA with the probe, cDNA may be
synthesized from miRNA in a sample from a patient, and
the binding of the synthesized cDNA and probe may be
measured.
[0060]
Examples of the method utilizing PCR include ARMS
(amplification refractory mutation system), RT-PCR
(reverse transcriptase-PCR), and nested PCR.
[0061]
CA 02979792 2017-09-14
- 63 -
For example, the determination of a miR-181c level
in the present invention may comprise the following
steps:
(a) a step of amplifying a nucleic acid molecule having
miR-181c (SEQ ID NO: 1) or a part thereof in a sample
from a subject cancer patient by using at least one
nucleic acid construct (primer) that binds to a part of
the nucleotide sequence of miR-181c (SEQ ID NO: 1);
(b) a step of measuring the amount of the amplified
nucleic acid molecule; and
(c) a step of determining the miR-181c level in the
sample from the measured amount of the amplified nucleic
acid.
[0062]
The above step of determining the miR-181c level in
the sample from the measured amount of the amplified
nucleic acid may be conducted, for example, by the
following procedures. As standard samples, pre-
determined copy number of nucleic acids are used to
obtain the amplified amount, from which a standard curve
is generated. The miR-181c level in a sample from a
subject cancer patient can be calculated by comparing the
measurement of the amplified nucleic acid in the sample
from the subject cancer patient with the standard curve.
The standard curve may be determined by measuring
standard samples simultaneously with the sample from the
subject cancer patient, or alternatively by measuring
CA 02979792 2017-09-14
- 64 -
standard samples separately from (at different time from)
the sample from the subject cancer patient. The standard
curve may be pre-obtained by measuring standard samples
before the measurement of a sample from a subject cancer
patient. Instead of directly amplifying the miRNA, cDNA
may be synthesized using miRNA obtained from a patient
sample, which can be used for amplification.
[0063]
As a method for determining the level of miRNA
utilizing the expression inhibitory function of miR-181c,
a method involving a marker gene of a fluorescence
protein (such as luciferase) or the like is widely known.
For example, the miR-181c level can be determined by
designing a marker gene which generates mRNA having a
3'UTR sequence (for example, SEQ ID NO: 14 or SEQ ID NO:
15) that can bind to the seed sequence (ACUUACA) of miR-
181c, and treating the gene transformed cells with a
sample under the conditions that allow the expression of
the gene.
[0064]
For example, the determination of a miR-181c level
in the present invention may comprise the following
steps:
(a) a step of contacting a sample from a subject cancer
patient with cells transformed with a polynucleotide
encoding the following (i) and (ii):
(i) a marker gene,
CA 02979792 201.7.--14
- 65 -
(ii) a 3'UTR sequence that binds to the seed sequence
(ACUUACA) of miR-181c in mRNA;
(b) a step of expressing the polynucleotide in the cells;
and
(c) a step of determining the miR-181c level in the
sample from the amount of the expressed marker gene
product.
[0065]
In the above method, the step of determining the
miR-181c level in the sample from the amount of the
expressed marker gene product can be conducted by, for
example, generating a standard curve from the
measurements of standard samples which contain the pre-
determined amount of the marker gene product, and
calculating the miR-181c level by applying the
measurements for the amount of the marker gene product to
the standard curve.
[0066]
When the sequence of miRNA or cDNA is decoded, the
level of miR-181c can be determined by synthesizing cDNA
from the RNA as needed, decoding the sequence of
synthesized cDNA with a sequencer, and determining the
level of miR-181c from the amount of the decoded miR-181c.
[0067]
When cDNA is synthesized from miRNA in the
description above, it may be conducted with a cDNA
CA 02979792 2017-09-14
- 66 -
synthesis kit (RNA-Quant cDNA Synthesis Kit, System
Biosciences, LLC, San Francisco, USA) or the like.
[0068]
The "step of judging or assessing" and the "step
comprising providing information for judging or
assessing" (collectively, referred to as the "judging
step" in this paragraph) in the method for diagnosis of
the present invention and the like can be conducted using
the determined miR-181c level. The judging step can be
conducted by comparing the determined miR-181c level of
the subject with the miR-181c level of a negative control.
When the miR-181c level in the sample from the subject is
higher than the miR-181c level in the sample from the
negative control, the miR-181c level is determined to be
high and the subject can be judged possibly to have brain
metastasis (or assessed possibly to have a high risk of
brain metastasis). When the miR-181c level in the sample
from the subject is not higher than (that is, equal to or
lower than) the miR-181c level in the sample from the
negative control, the miR-181c level is determined not
high and the subject can be judged possibly not to have
brain metastasis (or assessed possibly to have a low risk
of brain metastasis).
[0069]
As used herein, the "negative control" means healthy
subjects or cancer patients having no brain metastasis
(for example, Stage 1 and/or Stage 2 cancer patients
CA 02979792 2017-09-14
- 67 -
and/or Stage 3 and/or Stage 4 cancer patients having no
brain metastasis). The "miR-181c level of the negative
control" can be obtained by measuring the miR-181c level
in such a negative control according to the method
described above. Alternatively, when there is
predetermined information about the miR-181c level
already measured for such a negative control, such a
level can be used as the miR-181c level of the "negative
control". Moreover, a standard comparative sample
containing the same amount of miR-181c as the miR-181c
level of the "negative control" may be measured
simultaneously with the sample from the subject cancer
patient.
[0070]
Throughout the description, whether the miR-181c
level in a subject sample is higher than the miR-181c
level in a sample to be compared or not can be determined
by a statistical analysis. The statistical significance
can be determined by comparing 2 or more samples and
determining a confidence interval and/or a p value (Dowdy
and Wearden, Statistics for Research, John Wiely & Sons,
NewYord, 1983). The confidence interval of the present
invention may be, for example, 90%, 95%, 98%, 99%, 99.5%,
99.9%, or 99.99%. Moreover, the p value of the present
invention may be, for example, 0.1, 0.05, 0.025, 0.02,
0.01, 0.005, 0.001, 0.0005, 0.0002, or 0.0001.
[0071]
CA 02979792 2017-09-14
A
- 68 -
Throughout the description, the "method for
diagnosis" and the "method for assessing risk" comprises
a method for monitoring the state or change of brain
metastasis or a method for monitoring the risk of brain
metastasis unless such interpretation is inconsistent.
Accordingly, the word of "diagnosis" or "risk assessment",
as used herein, may be interpreted as monitoring the
state or change of brain metastasis or the risk of brain
metastasis unless such interpretation in particular is
inconsistent. Moreover, when the method for diagnosis or
the method for risk assessment herein means monitoring,
the diagnosis or risk assessment may be conducted
continually or intermittently. Moreover, the method for
diagnosis and the method for assessing risk of the
present invention may be conducted in vivo, ex vivo, or
in vitro, but preferably conducted ex vivo or in vitro.
[0072]
As used herein, the "sample" may be selected
depending on the purpose of use as appropriate. For
example, the sample may be a cell culture supernatant, a
cell lysate, a tissue specimen collected from a subject
as biopsy, or a liquid collected from a subject.
Examples of the sample include tissue, blood, plasma,
serum, lymph fluid, urine, stool, serosity, spinal fluid,
cerebrospinal fluid, synovial fluid, aqueous humor,
lacrimal fluid, saliva, or a fraction or processed
CA 02979792 201.7.--14
- 69 -
product thereof. The sample is preferably blood, plasma,
serum, or lymph fluid.
[0073]
The risk assessment of brain metastasis means a
method for predicting the progress or outcome of the
condition of a patient thereby and does not mean that the
progress or outcome of the condition can be predicted at
100% of accuracy. The result of assessment of risk of
brain metastasis indicates whether the risk of a certain
progress or outcome is increased or not, but does not
indicates that the certain progress or outcome is more
likely to occur as compared with that the certain
progress or outcome is not occurring. Thus, the
assessment of risk of brain metastasis indicates that the
progress or outcome of brain metastasis is more likely to
occur in patients with increased the miR-181c level
compared to patients exhibiting no such characteristics.
[0074]
In the method for diagnosis and the method for risk
assessment herein, the "subject cancer patient" is not
particularly limited as long as the patient is the cancer
patient as described above. The subject cancer patient
in the method for diagnosis of brain metastasis is
preferably a Stage IV cancer patient, a patient with
metastasis to distant organs, or a patient with
infiltration of cancer cells into the blood, since brain
metastasis occurs mainly on late stages of cancer as
CA 02979792 201.7.--14
A
- 70 -
described above. On the other hand, the subject in the
method for assessing risk of brain metastasis is
preferably a Stage I to III patient in which the risk of
brain metastasis is high but metastasis itself is not yet
likely to occur, a patient with no metastasis to distant
organs, or a patient with no infiltration of cancer cells
into the blood. Moreover, the subject cancer patient is
preferably a breast cancer patient.
[0075]
2. Method for treatment or prevention of brain metastasis
in cancer patient
According to the mechanism of cancer metastasis
found by the present inventors, miR-181c contained in EVs
(including exosomes) secreted by cancer cells contributes
to brain metastasis. Therefore, in another aspect, the
present invention relates to a method for treating or
preventing brain metastasis in a cancer patient,
comprising inhibiting the expression or activity of miR-
181c in the cancer patient. In this method, the
inhibition of the expression or activity of miR-181c may
be conducted by administering an miR-181c expression
inhibitor or activity inhibitor to a patient in need
thereof. Accordingly, in a certain embodiment, the
present invention relates to a method for treating or
preventing brain metastasis in a cancer patient,
comprising administering an miR-181c expression inhibitor
or activity inhibitor to the cancer patient.
CA 02979792 2017-09-14
- 71 -
[0076]
Alternatively, the inhibition of the expression or
activity of miR-181c can be accomplished indirectly by
inhibiting the secretion of EVs containing miR-181c.
Accordingly, in one aspect, the present invention relates
to a method for treating or preventing brain metastasis
in a cancer patient, comprising inhibiting secretion of
EVs containing miR-181c in the cancer patient. The
inhibition of secretion of EVs can be accomplished, for
example, by inhibiting the expression or activity of
protein (nSMase2 and RAB27B) essential for the secretion
of EVs. Accordingly, in another aspect, the present
invention relates to a method for treating or preventing
brain metastasis in a cancer patient, comprising
administering an exosome secretion inhibitor to the
cancer patient. In a specific aspect, the present
invention relates to a method for treating or preventing
brain metastasis in a cancer patient, comprising
administering an nSMase2 expression or activity inhibitor
and/or an RAB27B expression or activity inhibitor to the
cancer patient.
[0077]
The administration of the pharmaceutical composition
(therapeutic or preventive agent for brain metastasis)
may be local or systemic. The mode of administration is
not particularly limited and is parenteral or oral
administration as described above. Examples of
CA 02979792 201.7.--14
- 72 -
parenteral route of administration include subcutaneous,
intraperitoneal, in blood (intravenous or intraarterial),
injection or infusion into spinal fluid, or the like and
a preferable route is administration into blood.
Moreover, the pharmaceutical composition (therapeutic or
preventive agent) may be administered at once or
administered continuously or intermittently. For example,
the administration may be a continuous administration for
1 minute to 2 weeks.
[0078]
The dose of the pharmaceutical composition
(therapeutic or preventive agent for brain metastasis) is
not particularly limited as long as it can exert desired
therapeutic effect or preventive effect, and may be
determined depending on the stage of the cancer, the
presence or absence of brain metastasis, symptoms, sex,
age, or the like as appropriate. The dose of the
pharmaceutical composition according to the present
invention may be determined, for example, by referring a
therapeutic effect or preventive effect on brain
metastasis as indicator. For example, the pharmaceutical
composition may be administered by intravenous injection
at a dose of the active ingredient of usually about 0.01-
20 mg/kg body weight, preferably about 0.1-10 mg/kg of
body weight, further preferably about 0.1-5 mg/kg of body
weight as one dose, at about 1-10 times a month,
preferably about 1-5 times a month. An amount referring
CA 02979792 2017-09-14
- 73 -
the above may be administered when administered
parenterally via another route or orally. When symptoms
are particularly severe, the dose or frequency of
administration may be increased according to the symptoms.
[0079]
3. Method for increasing permeability of blood-brain
barrier and method for delivering desired active
ingredient across blood-brain barrier into brain
The present inventors have found that the
permeability of the blood-brain barrier is improved by
decreasing the expression or activity of PDPK1.
Accordingly, in another aspect, the present invention
relates to a method for increasing permeability of blood-
brain barrier, comprising inhibiting expression or
activity of PDPK1 in vascular endothelial cells. In a
further aspect, the present invention relates to a method
for delivering a desired medicinal component across
blood-brain barrier into brain, comprising administering
the medicinal component with a PDPK1 expression inhibitor
or activity inhibitor.
[0080]
For example, the method for increasing permeability
of blood-brain barrier of the present invention comprises
the following method: a method for increasing
permeability of blood-brain barrier in a patient,
comprising suppressing the expression or inhibiting the
activity of PDPK1 in brain microvascular endothelial
CA 02979792 2017-09-14
- 74 -
cells (BMECs) in the patient. The suppression of the
expression or inhibition of the activity of PDPK1 can be
accomplished by administering a PDPK1 expression
inhibitor or activity inhibitor. Accordingly, in another
aspect, the present invention relates to a method for
increasing the permeability of the blood-brain barrier in
a patient, comprising administering a PDPK1 expression
inhibitor or activity inhibitor.
[0081]
The method for delivering desired medicinal
component across blood-brain barrier into brain comprises
the following method: a method for delivering a desired
medicinal component across the blood-brain barrier of a
patient into the brain, comprising suppressing the
expression or inhibiting the activity of PDPK1 in brain
microvascular endothelial cells (BMECs) in the patient,
and administering the desired medicinal component to the
patient. In this method, the inhibition of expression or
activity of PDPK1 may be conducted by administering a
PDPK1 expression inhibitor or activity inhibitor to a
patient in need thereof. For example, the inhibition of
expression of PDPK1 can be accomplished by administering
miR-181c or EVs containing miR-181c. Accordingly, in
another aspect, the present invention relates to a method
for delivering a desired medicinal component across the
blood-brain barrier of a patient into the brain,
comprising administering the desired medicinal component
CA 02979792 2017-09-14
A A
- 75 -
and a PDPK1 expression inhibitor or activity inhibitor.
Alternatively, the present invention may be a method for
delivering a desired medicinal component across the
blood-brain barrier of a patient into the brain,
comprising increasing the permeability of the blood-brain
barrier of the patient by administering a PDPK1
expression inhibitor or activity inhibitor to the
patient; and administering the desired medicinal
component to the blood-brain barrier permeability
increased patient to deliver the medicinal component
across the blood-brain barrier into the brain. The
desired medicinal component may be administered
simultaneously with the PDPK1 expression inhibitor or
activity inhibitor or administered separately (for
example, before or after the administration of the PDPK1
expression inhibitor or activity inhibitor).
[0082]
The administration of the PDPK1 expression inhibitor
or activity inhibitor or the agent-delivery composition
of the present invention may be local or systemic. The
route of administration is not particularly limited and
can be parenteral or oral administration as described
above. Examples of parenteral route of administration
include subcutaneous, intraperitoneal, in blood
(intravenous or intraarterial), injection or infusion
into spinal fluid, or the like and a preferable route is
administration into blood. Moreover, the PDPK1
4 CA 02979792 201.7.--14
- 76 -
expression inhibitor or activity inhibitor or the agent-
delivery composition may be administered temporarily or
administered continuously or intermittently. For example,
the administration may be a continuous administration for
1 minute to 2 weeks. Moreover, the PDPK1 expression
inhibitor or activity inhibitor or the agent-delivery
composition may be administered simultaneously with or
separately from the medicinal component, and preferably
administered before the administration of the medicinal
component or simultaneously with the medicinal component.
[0083]
The dose of the PDPK1 expression inhibitor or
activity inhibitor or the agent-delivery composition is
not particularly limited as long as it is a dose at which
a desired permeability of the blood-brain barrier or an
intracerebral delivery effect of a desired medicinal
component is obtained, and can be determined depending on
the disease to be treated or prevented; the type, amount,
and route of administration of the desired medicinal
component to be administered; the symptoms, sex, and age
of the patient; and the like as appropriate. The dose
can be determined, for example, by using the amount of
medicinal component delivered to the brain or the
therapeutic or preventive effect thereby as an indicator.
The active ingredient at a dose of usually about 0.01-20
mg/kg body weight, preferably about 0.1-10 mg/kg of body
weight, further preferably about 0.1-5 mg/kg of body
CA 02979792 2017-09-14
A
4
- 77 -
weight is conveniently administered by intravenous
injection about 1-10 times a month, preferably about 1-5
times a month. The above amount may be applied to
parenteral administration via another route or oral
administration. When symptoms are particularly severe,
the dose or frequency of administration may be increased
according to the symptoms.
[0084]
4. Apparatus for judging brain metastasis/apparatus for
assessing risk of brain metastasis
(Apparatus for judging brain metastasis)
In one aspect, the present invention relates to an
apparatus for judging brain metastasis that measures an
miR-181c level. As illustrated in FIG. 21, an apparatus
for judging brain metastasis 1 relating to this
embodiment is an apparatus for judging brain metastasis
in a subject cancer patient. More specifically, the
apparatus for judging brain metastasis 1 is an apparatus
for judging whether a cancer patient with suspected brain
metastasis (usually Stage IV patient) has brain
metastasis. The apparatus for judging brain metastasis 1
comprises a measuring unit 21, a level determination unit
31, and a metastasis judgment unit 32, described below.
In this embodiment, the apparatus for judging brain
metastasis 1 comprises an input device 2 comprising at
least the measuring unit 21, an information processing
device 3 comprising at least the level determination unit
CA 02979792 2017-09-14
- 78 -
31 and the metastasis judgment unit 32, and an output
device 4. However, the input device 2, the information
processing device 3, and the output device 4 does not
need to be separate devices and two or more of these
devices 2, 3, and 4 may be configured as one device.
[0085]
The input device 2 comprises the measuring unit 21
that functions as an miR-181c-measuring means and
preferably further comprises a preparation entry/exit
unit 22, but the preparation entry/exit unit 22 may be
separate from the input device 2. The input device 2 is,
for example, a computer comprising a central processing
unit (CPU), a read-only memory (ROM), a random access
memory (RAM) and a hard disk drive (HDD) or an apparatus
containing a computer. Processing in the measuring unit
21 is mainly performed by the CPU reading a computer
program in the HDD. The computer program may be, for
example, stored in the RAM or the ROM, but not stored in
the HDD.
[0086]
The measuring unit 21 is a component having
functions as miR-181c-measuring means that measures a
polynucleotide having the nucleotide sequence of miR-181c
or a part thereof in a sample 23. The preparation
entry/exit unit 22 preferably comprises a preparation
holder 26 for holding a preparation 25 containing the
sample 23 and a reagent 24, an illuminator 27 for
. CA 02979792 2017.--14
A
- 79 -
irradiating excitation light to the preparation 25, and a
photodetector 29 for detecting fluorescence 28 emitted
from the preparation 25 irradiated by the excitation
light. When the preparation 25 itself can emit light
without irradiating excitation light from the outside,
the preparation entry/exit unit 22 does not need to
comprise the illuminator 27 and the photodetector 29
detects the emitted light but not fluorescence.
[0087]
The information processing device 3 comprises at
least the level determination unit 31 and the metastasis
judgment unit 32. The information processing device 3 is
preferably a computer with a CPU, a ROM, a RAM, and an
HDD. Processing in both of the level judgment unit 31
and the metastasis judgment unit 32 is mainly performed
by the CPU reading a computer program in the HDD. The
computer program may not be stored in the HDD, for
example, but stored in the RAM or the ROM. The input
device 2 and the information processing device 3 may
comprise a common CPU, common ROM, common RAM, or a
common HDD. In this case, the computer program may be
stored in an HDD, a RAM, or a ROM that is common to the
input device 2 and the information processing device 3.
[0088]
The level determination unit 31 is a component that
functions as miR-181c level-determining means that
receives electrical signals from the measuring unit 21 in
CA 02979792 2017.--14
/
- 80 -
the input device 2 and determines the miR-181c level in
the measured sample 23. The metastasis judgment unit 32
is a component that functions as metastasis-judging means
for judging brain metastasis in the subject cancer
patient from the miR-181c level determined in the level
determination unit 31. The metastasis judgment unit 32
uses a sample obtained from the subject cancer patient as
the sample 23, and judges that the subject cancer patient
has brain metastasis if the miR-181c level in the sample
is higher than the miR-181c level in a sample from a
negative control. The determination by the level
determination unit 31 is preferably performed by the CPU
reading the information (for example, standard curve
data) stored in a memory such as the HDD or the RAM
beforehand, and referring to the information. However,
the information may not be stored in a memory beforehand,
and can be sequentially accumulated by measuring a
polynucleotide having the nucleotide sequence of miR-181c
or a part thereof with using a concentration
predetermined control sample (for example, a sample in a
series of serial dilution) as the sample 23. The
judgment by the metastasis judgment unit 32 is preferably
performed by the CPU reading the information (that is,
information on the miR-181c level in the sample from the
negative control) stored beforehand in a memory such as
the HDD or the RAM and referring to the information.
However, the information may not be stored in the memory
CA 02979792 201.7.--14
- 81 -
beforehand, and can be sequentially accumulated by
measuring a polynucleotide having the nucleotide sequence
of miR-181c or a part thereof in the sample from the
negative control used as the sample 23.
[0089]
The output device 4 is an apparatus for outputting
the judgment by the metastasis judgment unit 32 and, for
example, can be a monitor for outputting still image or
an animation. The output device 4 may be a computer
comprising, for example, a CPU, a ROM, a RAM and an HDD
or an apparatus containing the computer, like as the
input device 2 or the information processing device 3.
In that case, the computer program may be stored in an
HDD, a RAM, or ROM which is common to the input device 2,
the information processing device 3, and the output
device 4, or common to the input device 2 and the output
device 4, or common to the information processing device
3 and the output device 4.
[0090]
The output device 4 is not limited to a monitor and
may be a device that outputs the judgment in any output
form such as a speaker that outputs the judgment with
sound, a printer that prints the judgment onto a medium
such as paper, or a luminescent device that outputs the
judgment in the form of luminescence.
[0091]
(Apparatus for assessing risk of brain metastasis)
CA 02979792 201.7.--14
- 82 -
In another aspect, the present invention relates to
an apparatus for assessing risk of brain metastasis by
measuring an miR-181c level. As illustrated in FIG. 22,
an apparatus for assessing risk of brain metastasis la of
this embodiment is an apparatus for assessing the risk of
brain metastasis of a subject cancer patient (usually a
Stage I, II, or III patient) who does not yet have brain
metastasis. The apparatus for assessing risk of brain
metastasis la comprises a measuring unit 21, a level
determination unit 31, and a risk assessment unit 33
described below. In this embodiment, the apparatus for
assessing risk of brain metastasis la has a configuration
similar to that of the apparatus for judging brain
metastasis 1 described above, and comprises an input
device 2, an information processing device 3, and the
output device 4. However, the apparatus for assessing
risk of brain metastasis la does not need to be an
apparatus in such a form that the input device 2, the
information processing device 3, and the output device 4
are separated, like the apparatus for judging brain
metastasis 1. Two or more of the devices 2, 3, and 4 may
be configured as one device.
[0092]
The apparatus for assessing risk of brain metastasis
la comprises a risk assessment unit 33 instead of the
metastasis judgment unit 32 in the apparatus for judging
brain metastasis 1. The other configuration of the
CA 02979792 2017-09-14
- 83 -
apparatus for assessing risk of brain metastasis la is
common with the configuration of the apparatus for
judging brain metastasis 1 except for the metastasis
judgment unit 32. Therefore, the redundant descriptions
are omitted.
[0093]
The risk assessment unit 33 is a component that
functions as risk assessment means for judging the risk
of brain metastasis in the subject cancer patient from
the miR-181c level determined in the level determination
unit 31. The risk assessment unit 33 judges that the
subject cancer patient has a high risk of brain
metastasis if the miR-181c level in a sample 23 from the
subject cancer patient is higher than the miR-181c level
in a sample from a negative control. The judgment by the
risk assessment unit 33 is preferably performed by the
CPU reading the information (that is, information on the
miR-181c level in the sample from the negative control)
stored beforehand in a storage device such as the HDD or
the RAM and referring to the information. However, the
information may not be stored in the memory beforehand
and can be sequentially accumulated by measuring a
polynucleotide having the nucleotide sequence of miR-181c
or a part thereof in the sample from the negative control
used as the sample 23,.
[0094]
CA 02979792 2017-09-14
V
- 84 -
5. Computer program for brain metastasis judgment or
brain metastasis risk assessment
In one aspect, the present invention relates to a
computer program used in the apparatus for judging brain
metastasis or the apparatus for assessing risk of brain
metastasis.
[0095]
(Computer program for apparatus for judging brain
metastasis)
A computer program of this embodiment is a computer
program to be installed in an apparatus for providing
information for diagnosing brain metastasis in a subject
cancer patient, that is, the above described apparatus
for judging brain metastasis 1. The computer program
directs the apparatus for judging brain metastasis 1,
which is an apparatus for diagnosing brain metastasis in
a cancer patient, to execute: an miR-181c-measuring
procedure of measuring a polynucleotide having the
nucleotide sequence of miR-181c or a part thereof using a
sample 23 from the subject cancer patient, an miR-181c
level-determining procedure of determining the miR-181c
level in the sample 23 measured by the miR-181c-measuring
procedure, an metastasis-judging procedure of judging
brain metastasis in the subject cancer patient from the
miR-181c level determined in the miR-181c level-
determining procedure, and a judgement-output procedure
of outputting the judgement by the metastasis-judging
CA 02979792 2017-09-14
- 85 -
procedure; wherein the metastasis-judging procedure
judges that the subject cancer patient has brain
metastasis if the miR-181c level in the sample 23 from
the subject cancer patient is higher than the miR-181c
level in a sample from a negative control.
[0096]
The miR-181c-measuring procedure is executed by the
measuring unit 21 in the apparatus for Judging brain
metastasis 1. The miR-181c level-determining procedure
is executed by the level determination unit 31 in the
apparatus for judging brain metastasis 1. The
metastasis-judging procedure is executed by the
metastasis judgment unit 32 in the apparatus for judging
brain metastasis 1. The judgment-output procedure is
executed by the output device 4. These procedures are
executed, for example, by a CPU reading the computer
program stored in an HDD. This computer program may be a
program that executes, by being read by processing of the
CPU, the miR-181c-measuring procedure, the miR-181c
level-determining procedure, and the metastasis-judging
procedure, but not the subsequent judgment-output
procedure.
[0097]
This computer program cannot occupy space by itself,
but can be circulated in the market by being stored in an
information recording medium. The "information recording
medium" is for example, a flexible disk, a hard disk, CD-
CA 02979792 2017-09-14
- 86 -
ROM, CD-R, CD-RN, MO (magneto-optical disk), MD, DVD-R,
DVD-RW, a flash memory, a chip card, or the like. By
connecting these information recording mediums to a data
input and output unit (not illustrated) in the apparatus
for judging brain metastasis 1, the computer program can
be installed in a memory such as an HDD in the apparatus
for judging brain metastasis 1. It is also possible to
transmit this computer program to the apparatus for
judging brain metastasis 1 from a different computer
storing the computer program through a communication line
and install it in a memory such as an HDD in the
apparatus.
[0098]
Figure 23 illustrates a flow of processing that the
apparatus for judging brain metastasis performs when the
computer program for the apparatus for judging brain
metastasis is executed. The CPU in the apparatus for
judging brain metastasis 1 reads the computer program for
the apparatus for judging brain metastasis stored in a
memory such as an HDD in the apparatus 1 and measures the
polynucleotide having the nucleotide sequence of miR-181c
or a part thereof using a sample 23 from a subject cancer
patient (STEP 101: miR-181c-measuring procedure). Then,
the CPU reads the computer program and determines the
miR-181c level in the sample 23 measured (STEP 102: miR-
181c level-determining procedure). Then, the CPU reads
the computer program and judges the presence or absence
CA 02979792 201.7.--14
- 87 -
of brain metastasis in the subject cancer patient from
the miR-181c level determined in the miR-181c level-
determining procedure (STEP 103: metastasis-judging
procedure). Then, the CPU reads the computer program and
outputs the result of judgement that there is brain
metastasis or that there is no brain metastasis from the
output device 4 (STEP 104: judgment-output procedure).
[0099]
(Computer program for apparatus for assessing risk of
brain metastasis)
A computer program relating to another embodiment is
a computer program to be installed in an apparatus for
assessing risk of brain metastasis in a subject cancer
patient, that is, the apparatus for assessing risk of
brain metastasis la. The computer program directs the
apparatus for assessing risk of brain metastasis la,
which is an apparatus for assessing brain metastasis in a
cancer patient, to execute: an miR-181c-measuring
procedure of measuring a polynucleotide having the
nucleotide sequence of miR-181c or a part thereof using a
sample 23 from the subject cancer patient, an miR-181c
level-determining procedure of determining the miR-181c
level in the sample 23 measured by the miR-181c-measuring
procedure, a risk-assessing procedure of assessing risk
of brain metastasis in the subject cancer patient from
the miR-181c level determined in the miR-181c level-
determining procedure; an assessment-output procedure of
CA 02979792 2017-09-14
- 88 -
outputting the assessment by the risk-assessing
procedure; wherein the risk-assessing procedure judges
that the subject cancer patient has a high risk of brain
metastasis if the miR-181c level in the sample 23 from
the subject cancer patient is higher than the miR-181c
level in a sample from a negative control.
[0100]
The risk-assessing procedure is executed by the risk
assessment unit 33 in the apparatus for assessing risk of
brain metastasis la. The miR-181c-measuring procedure,
the miR-181c level-determining procedure, and the
assessment-output procedure are respectively executed by
the measuring unit 21, the level determination unit 31,
and the output device 4 as the same manner with the
computer program for the apparatus for judging brain
metastasis described above. These procedures are
executed, for example, by a CPU reading the computer
program stored in an HDD. This computer program may be a
program that executes, by being read by processing of the
CPU, the miR-181c-measuring procedure, the miR-181c
level-determining procedure, and the risk-assessing
procedure, but not the subsequent assessment-output
procedure.
[0101]
This computer program can be also stored in an
information recording medium illustrated above. By
connecting these information recording mediums to a data
CA 02979792 2017-09-14
- 89 -
input and output unit (not illustrated) in the apparatus
for assessing risk of brain metastasis la, the computer
program can be installed in a memory such as an HDD in
the apparatus for assessing risk of brain metastasis la.
It is also possible to transmit this computer program to
the apparatus for assessing risk of brain metastasis la
from a different computer storing the computer program
through a communication line and install it in a memory
such as an HDD in the apparatus.
[0102]
Figure 24 illustrates a flow of processing that the
apparatus for assessing risk of brain metastasis performs
when the computer program for the apparatus for assessing
risk of brain metastasis is executed. The CPU in the
apparatus for assessing risk of brain metastasis la reads
the computer program for the apparatus for assessing risk
of brain metastasis stored in a memory such as an HDD in
the apparatus la and measures the polynucleotide having
the nucleotide sequence of miR-181c or a part thereof
using a sample 23 from a subject cancer patient (STEP
201: miR-181c-measuring procedure). Then, the CPU reads
the computer program and determines the miR-181c level in
the sample 23 measured (STEP 202: miR-181c level-
determining procedure). Then, the CPU reads the computer
program and assesses whether the risk of brain metastasis
in the subject cancer patient is high or low from the
miR-181c level determined in the miR-181c level-
CA 02979792 201.7.--14
- 90 -
determining procedure (STEP 203: risk-assessing
procedure). Then, the CPU reads the computer program and
outputs the result of assessment that the risk of brain
metastasis is high or that the risk of brain metastasis
is low from the output device 4 (STEP 204: judgment-
output procedure).
[0103]
Although the present invention will be hereinafter
described in detail with reference to Examples, the
present invention is not intended to be limited thereto.
The all documents cited throughout the present
application are incorporated as it is into the present
application by reference.
Examples
[0104]
In the experiments described in Examples below, all
experiments using animals were conducted according to the
protocols approved by the Institutional Animal Care and
Use Committee of National Cancer Center (Independent
Administrative Institution). In experiments described
below, all numerical values are expressed as mean +/-
standard deviation (S.D.). P values less than 0.05 by
Student's t-test or Mann-Whitney U test were considered
to be statistically significant.
[0105]
(Cell culture)
CA 02979792 2017-09-14
- 91 -
In the experiments described in the Examples, MDA-
MB-231-luc-D3H1 cells, MDA-MB-231-luc-D3H2LN cells, BMD2a
cells, and BMD2b cells were cultured in the RPMI 1640
medium containing 10% heat inactivated fetal bovine serum
(Invitrogen) and antimicrobial-antifungal agents at 37 C,
5% CO2.
[0106]
(Example 1) Establishment of brain metastasis breast
cancer cell line
Brain metastasized cell lines were newly generated
using highly tumorigenic and metastatic human breast
cancer cells, MDA-MB-231-luc-D3H2LN cells (hereinafter,
referred to as the "D3H2LN cells") (Bos, P.D. et al.,
Nature, 459:1005-1009 (2009)) (Figure la). Specifically,
100 L of a cell suspension containing 2x105 D3H2LN cells
was administered by intracardiac injection to the left
ventricle in 7 week-old female C.B-17/Icr-scid/scid
immunodeficient mice. The mice were observed every week
for tumorigenesis by brain metastasis by bioluminescence
in vivo imaging after intraperitoneal injection of
luciferin using IVIS Spectrum (Caliper Life Science,
Hopkinton, MA, USA). 26-30 days later, brain metastasis
of cancer cells was observed (Figure lb).
[0107]
The brain metastasis sites were examined by
histologic analysis after dissection. Cancer cell
colonization in brain tissue was confirmed by fixation of
CA 02979792 2017-09-14
- 92 -
half of the tissue with 4% para-formaldehyde and
histologic analysis with hematoxylin-eosin (HE) staining
(Figure 1c).
[0108]
To collect and culture brain metastatic cancer cells,
the remaining half of the tissue was ground and added to
the RPMI 1640 medium (Gibco) containing antimicrobial-
antifungal agents and 10% FBS. After centrifugation for
a short time, the cells were resuspended with 0.025%
trypsin- EDTA (Gibco) and incubated at 37 C for 10
minutes. The cells were resuspended in a medium
containing 50 g/mL of Zeocin (Gibco), then seeded in a
10cm dish, and cultured and grown to confluent for
approximately 30 days.
[0109]
Using the grown cell population (brain metastatic
derivative la, hereinafter, referred to as the
"BMD1cells"), the second in vivo selection was conducted
in the way same as that described above and two brain
metastatic derivative cell populations 2a and 2b
(hereinafter, respectively referred to as the "BMD2a
cells" and the "BMD2b cells") were obtained.
[0110]
The obtained BMD2a and BMD2b cells were administered
to mice like the D3H2LN cells and examined their brain
metastasis activities. As a result, while brain
metastasis was observed only 1 mouse (6.7%) out of the 15
CA 02979792 2017-09-14
- 93 -
mice in which the D3H2LN cells were injected into the
left ventricle, 60% (3 out of 5) of the mice in which the
BMDla cells are injected into the left ventricle had
brain metastasis. Accordingly, it was demonstrated that
the BMD2a and BMD2b cells have a markedly increased brain
metastasis activity compared to the parental D3H2LN cells.
[0111]
(Example 2) Construction of in vitro blood-brain barrier
(BBB) model
(1) In vitro blood-brain barrier model
An in vitro BBB culture system was constructed to
measure effects on BBB easily. Conventional in vitro
blood-brain barrier models use monolayer cell culture
systems (Zhou, W. at al, J. Biol. Chem., 288:10849-10859).
However, BBB consists of three different types of cells
and these cells cooperate with each other to maintain the
structure of BBB. Therefore, BBB kit (TM) (# MTB-24H,
PharmaCo-Cell Company Ltd., Nagasaki, Japan), which is a
BBB model system that consists of primary cultures of
brain capillary endothelial cells, brain pericytes and
astrocytes (Figure 2a) was used. Brain capillary
endothelial cells, brain pericytes, and astrocytes were
confirmed by Hoechst33342 staining. As a result, the
presence of brain capillary endothelial cells, brain
pericytes, and astrocytes in the constructed in vitro
blood-brain barrier model was confirmed as illustrated in
Figure 2b.
CA 02979792 2017-09-14
- 94 -
[0112]
(2) Confirmation of localization of tight junction
proteins and the like in endothelial cells
Tight junctions are known to regulate the low
permeability of BBB and are formed by specific proteins
in endothelial cells (such as Claudin-5, Occludin, and
ZO-1). Meanwhile, N-cadherin, which is a calcium-
dependent cell-cell adhesion glycoprotein and has five
extracellular cadherin repeats to mediate strong cell-
cell adhesion, is mostly expressed on the apical and
basal membranes. Tight junction proteins and N-cadherin
regulate cell polarity through their intimate association
with the actin cytoskeletal network. Therefore, the
formation of tight junction and adherens junction were
confirmed by fluorescently immunostaining Claudin-5,
Occludin, ZO-1, or N-cadherin in the endothelial cells in
the in vitro BBB model to confirm their localization.
[0113]
Specifically, the endothelial cells collected from
the in vitro BBB model were fixed with PBS containing 3%
PFA at room temperature for 10 minutes, washed with PBS
containing Mg2+ and Ca24, and then treated with PBS
containing 0.1% Triton-X100 for 10 minutes to
permeabilize the cells. After fixation, the cells were
incubated with PBS containing 3% BSA for 1 hour to block
nonspecific binding of antibody. Subsequently, the
endothelial cells were incubated at 37 C with a rabbit
CA 02979792 2017-09-14
- 95 -
polyclonal antibody to Claudin-5 (Z43.JK, Invitrogen, CA,
USA), Occludin (ZMD.467, Invitrogen), ZO-1 (ZMD.437,
Invitrogen), or N-cadherin (3B9, Invitrogen) for 1 hour.
After washing with PBS containing Mg2+ and Ca2+, the cells
were incubated at 37 C with 594 Alexa Fluor-fused
antirabbit IgG (Invitrogen) for 1 hour. Actin was
stained with ActinGreen (TM) 488 ReadyProbes (TN) Reagent
(R37110, Molecular Probes). The stained cells were
washed with Mg2+ and Ca2' free PBS, then mounted with
VECTASHIELD Mounting Medium (H-1200, Vector Laboratories,
CA, USA), and observed with a cofocal microscope
(FluoViewFV1000, Olympus, Tokyo, Japan).
[0114]
It was demonstrated that all of the tight junction
proteins (Claudin-5, Occludin, and ZO-1) and N-cadherin
bind to the surface of the cell membrane and constitute
intercellular tight junction and adherens junction as
illustrated in Figure 2c.
[0115]
(3) Measurement of transendothelial electrical resistance
(TEER)
The formation of tight junction by brain capillary
endothelial cells was measured by transendothelial
electrical resistance (TEER) (Gaillard, P.J. et al., Eur.
J. Pharm. Sci., 12:215-222 (2001), Wilhelm, I. et al.,
Acta. Neurobiol. Exp. (Wars), 71:113-128 (2011)). The
resistance values (1)) were measured by an ohmmeter
CA 02979792 2017-09-14
- 96 -
(Millicell ERS-2, Millipore). The transendothelial
electrical resistance (TEER) values were calculated by
means of the unit area resistance by the following
calculating formula. R = (A - B) *0.33 cm2, wherein R
denotes TEER (0.*cm2), A denotes measurement resistance
value (a), and B denotes blank resistance value (Q). It
was done for n = 12.
[0116]
Figure 2d illustrates the result of measuring the
formation of tight junction by the brain capillary
endothelial cells by transendothelial electrical
resistance (TEER). The transendothelial electrical
resistance (TEER) exceeded 150, which indicates that this
system can be used as an in vitro BBB model.
[0117]
(4) Permeability assay
NaF does not pass BBB in spite of having a low
molecular weight (molecular weight: 376.27) (Nakagawa, S,
et al., Neurochem. Int. 54: 253-263 (2009)). Accordingly,
permeability of BBB was measured by measuring the
concentration of NaF with a fluorescence monochromator.
Specifically, a permeability assay modified from a
previously described method (B. Kis et al.,
Adrenomedullin regulates blood-brain barrier functions in
vitro. Neuroreport 12, 4139-4142 (2001)) was used. 200
L of NaF (10 g/mL, Sigma Aldrich) was added to the
upper chamber and 900 L of DPBS-H (Dulbecco's PBS (Mg+,
CA 02979792 2017-09-14
- 97 -
Ca+) containing 10 mM HEPES and 4.5 mg/mL D-glucose) was
added to the lower chamber. The plate was cultured with
shaking at 37 C. After 30 min, the DPBS-H of the lower
chamber was dispensed into a black plate (n=8) and
measured with a multi detection monochrometer microplate
reader (485/535nm, SAFIRE, Tecan). The apparent
permeability coefficient (Papp) was calculated by the
following calculating formula:
Papp = (VA x [C]A) x A-1 x [C]Luminal-1 x t-1
The abbreviations in the formula denote the
following:
VA: volume of abluminal chamber (0.9 cm3)
A: membrane surface area (0.33 cm2)
[C]Luminal: initial luminal tracer concentration
( g/mL)
[C]A: abluminal tracer concentration ( g/mL)
t: time of experiment (min)
[0118]
The permeability assay conducted by the method
described above demonstrated, as a result, that the
permeability of NaF is very low.
[0119]
(Example 3) Examination of invasive capacity of brain
metastatic cancer cell using Matrigel(TM)
Brain metastatic cancer cells are also considered to
be highly invasive. Therefore, invasion chamber assays
using Matrigel(TM) were used to confirm the pathological
CA 02979792 2017.--14
- 98 -
implications of the metastatic potential of established
cell lines. BMD2a, BMD2b, D3H2LN, and D3H1 cells were
trypsinized and labelled with PKH26 (Sigma Aldrich).
2x104 cells of each cancer cell line were suspend in
serum-free RPMI1640 medium and plated in the top chamber
with a Matrigel(R)-coated membrane (24-well insert, BD
Biosciences, NJ, USA). RPMI1640 medium containing 10%
serum was added to the lower chamber as a chemoattractant.
The cells were cultured for 24 hours and cells that did
not migrate or invade through the membrane pores were
removed using a cotton swab. Cells on the lower surface
of the membrane were stained with the Diff-Quick Staining
Set (Sysmex, Hyogo, Japan) and counted. All assays were
performed in triplicate. The data were expressed as
percentage of the number of cells migrating through the
Matrigel(TM) matrix and membrane relative to the number
of cells migrating through the control membrane,
according to the manufacturer's instructions.
[0120]
BMD2a and BMD2b cells were more invasive than D3H2LN
cells and low-metastatic D3H1 cells (Figure 3a and 3b).
However, the morphology of BMD2a and BMD2b cells did not
differ from that of D3H2LN cells (Figure 3c).
[0121]
(Example 4) Examination of invasive capacity of brain
metastatic cancer cells using BBB model
CA 02979792 2017-09-14
- 99 -
To confirm the entry of BMD2a and BMD2b cells into
the brain parenchyma cell side, BMD2a, BMD2b, D3H2LN and
D3H1 cells were trypsinized and labelled with PKH26
(Sigma Aldrich). Subsequently, 2x104 cancer cells were
suspended in serum-free Ham's F-12 medium (Gibco) and
added to the upper chamber of the in vitro BBB model
prepared in Example 2 and cultured. After 2 days (48
hours), non-invading cells were removed with cotton swabs
and the nuclei were stained with Hoechst 33342 (Do]indo
Laboratories, Kumamoto, Japan). Subsequently, the PKH26
fluorescence of invading cells that had migrated to the
lower surface side was counted with a fluorescence
microscope (Figure 4a). All cells were assayed in
triplicate.
[0122]
BMD2a and BMD2b cells were more invasive than D3H2LN
and D3H1 cells (Figure 4b). Accordingly, it was
confirmed that the established BMD2a and BMD2b cells have
a high potential for entry into the brain parenchymal
cell side across BBB.
[0123]
(Example 5) Preparation of EVs
D3H1, D3H2LN, BMD2a, and BMD2b cells were washed
three times with Advanced RPMI medium containing
antibiotic-antimycotic agents and 2 mM L-glutamine
(hereinafter, referred to as the "medium A"). Fresh
medium A was added to the washed cells and cultured for 2
CA 02979792 2017-09-14
- 100 -
days, and then the medium was collected and centrifuged
at 2000*g for 10 min at 4 C. To thoroughly remove
cellular debris, the culture supernatant was filtered
with a 0.22- m Stericup(R)(Millipore, MA, USA). The
resultant conditioned medium was ultracentrifuged at
110,000*g for 70 min at 4 C. The resultant pellets were
washed with 11 mL of phosphate buffered saline (PBS) and
resuspended in PBS.
[0124]
The fraction containing the EVs was measured for its
protein content using the Micro BCA protein assay kit
(Thermo Scientific, MA, USA). The obtained EVs was
observed by phase contrast microscopy. Furthermore, the
size and the number of the EVs were measured with
NanoSight.
[0125]
The expression of the standard exosomal markers CD63
and CD9 and the expression of the mitochondrial
intermembrane protein Cytochrome C, which is known to be
lacking in EVs, was measured by Western blotting.
Samples were obtained from each cell line using M-PER
(Thermo Scientific, MA, USA) and loaded in Mini-
PROTEAN(R) TGX Gel (4-12%) (Bio-Rad) at 500 ng/lane (CD63
and CD9) or 3 g/lane (Cytochrome C) and proteins were
separated and then electrotransferred onto PVDF membranes
(Millipore). The resultant membranes were blocked in
Blocking One (Nacalai Tesque, Kyoto, Japan) and then
CA 029797922017-09-14
- 101 -
incubated for 1 hour at room temperature with a primary
antibody, anti-CD63 antibody (purified mouse anti-human
CD63, H5C6, 1/200, BD), anti-CD9 antibody (ALB6, sc-59140,
1/200, BD), or anti-cytochrome C antibody (purified mouse
anti-cytochrome C, 7H8.2C12, 1/200, BD). An HRP-linked
anti-mouse IgG secondary antibody (NA931, GE Healthcare)
or HRP-linked anti-rabbit IgG secondary antibody (NA934,
GE Healthcare) was used at a dilution of 1/2000. The
membranes were then made luminescent with ImmunoStar(R)
LD (Wako, Osaka, Japan).
[0126]
As for the protein content, there was no difference
in protein concentration among the EVs derived from D3H1
cells, the EVs derived from D3H2LN cells, the EVs derived
from BMD2a cells, and the EVs derived from BMD2b cells.
Figure 5a illustrates photographs resulted from the phase
contrast microscope observation and the result of the
analysis of EV size. The average particle sizes of the
EVs derived from D3H1 cells, D3H2LN cells, BMD2a cells,
and BMD2b cells were 149 nm, 157 nm, 136 nm, and 148 nm,
respectively. All these EVs expressed the standard
exosomal markers CD63 and CD9 but not Cytochrome C
(Figure 5b). Furthermore, the number of EV release did
not differ among the cells (Figure 5c).
[0127]
(Example 6) Examination of correlation between secretion
of EVs and invasive capacity of cancer cells
CA 02979792 2017-09-14
- 102 -
To examine the involvement of EVs in the invasion of
brain metastatic cells, the invasive capacity of BMD2a
cells in which the EVs secretion was inhibited by siRNAs
(Kosaka, N. et al., J. Biol. Chem., 288:10849-10859
(2013); Ostrowski, M et al., Nat. Cell Biol., 12:19-30
(2010)) against nSMase2 and RAB27B, which are proteins
involved in the EVs secretion, was assessed in the in
vitro BBB model
[0128]
(1) siRNA transfection
25 nM each of either or both of RAB27B siRNA and
nSMase2 siRNA or control siRNA was introduced into PKH26-
labelled BMD2a cells using the DharmaFECT transfection
reagent (Thermo Scientific) according to the
manufacturer's protocol. Cells 24 hours after the
transformation were used in assay.
[0129]
(2) Confirmation of expression of nSMase2 and RAB27B at
mRNA level in siRNA-introduced cells
Total RNA was extracted from cells using QIAzol
reagent and RNeasy Mini Kit (both Qiagen). RNU6 was used
as an internal control according to a described method
(Kosaka, N. et al., Net.Med., 18:883-891 (2012)). The
expression level of each mRNA and RNU6 was measured with
gRT-PCR performed in 96-well plates using Platinum
Quantitative PCR SuperMix (Applied Biosystems) with the
7300 Real-Time PCR System (all Applied Biosystems, CA,
CA 02979792 2017-09-14
- 103 -
USA). All reactions were performed in triplicate. The
primers and probes were defined as follows: PAB27B (assay
ID: Hs01072206 ml), nSMase2 (assay ID: Hs00920354 m1).
[0130]
(3) Confirmation of expression of nSMase2 at protein
level in siRNA-introduced cells
Expression of nSMase2 in siRNA-introduced cell was
confirmed at the protein level by Western blotting.
Samples were obtained from each cell line using M-PER
(Thermo Scientific, MA, USA) and loaded in Mini-
PROTEAN(R) TGX Gel (4-12%) (Bio-Rad) and proteins were
separated and then electrotransferred onto PVDF membranes
(Millipore). The resultant membranes were blocked in
Blocking One (Nacalai Tesque, Kyoto, Japan) and then
incubated for 1 hour at room temperature with a primary
antibody, anti-nSMase2 antibody (H-195, sc-67305, 1/200,
Santa Cruz Biotechnology Inc.). An HRP-linked anti-mouse
IgG secondary antibody (NA931, GE Healthcare) or HRP-
linked anti-rabbit IgG secondary antibody (NA934, GE
Healthcare) was used at a dilution of 1/2000. The
membranes were then made luminescent with ImmunoStar(R)
LD (Wako, Osaka, Japan).
[0131]
(4) Measurement of number of EV release from siRNA-
introduced cells
The number of EV release from siRNA-introduced cells
were measured with NanoSight.
CA 02979792 2017-09-14
- 104 -
[0132]
(5) Examination of invasive capacity of brain metastatic
cancer cell using BBB model
The Matrigel invasion capacity of generated
transformation cells and migration across BBB were
examined according to the methods in Example 3 and
Example 4, respectively.
[0133]
(6) Results
The cells into which either of nSMase2 siRNA and
RAB27B siRNA was introduced and the cells into which both
of the siRNAs were introduced had a reduced expression of
nSMase2 and RAB27B at both mRNA and protein levels
compared to the control siRNA-introduced cells (not
shown). According to the result of measurement of the
number of EV release from siRNA-introduced cells, the
cells into which either of nSMase2 siRNA and RAB27B siRNA
was introduced and the cells into which both of the
siRNAs were introduced had a reduced number of EV release
compared to the control siRNA-introduced cells (Figure
6a). According to the result of test on capacity to
migrate across BBB, while the cells treated with control
siRNA migrated to the lower side across BBB, the cells in
which the production of EVs was inhibited were not found
on the lower side (Figure 6c). In the invasive capacity
assay using Matrigel, the inhibition of EVs secretion did
not affect the invasive capacity of the cells (Figure 6b).
CA 02979792 2017-09-14
- 105 -
From this, it was suggested that extravasation is not
only dependent on the cells' invasive capacity.
[0134]
(Example 7) Examination of correlation between EVs and
BBB invasive capacity of cancer cells
Furthermore, to investigate whether EVs are involved
in the extravasation of cancer cells to the brain
parenchymal cell side, whether low-metastatic D3H1 cells
migrate across BBB and extravasate after the addition of
BMD2a cell-, BMD2b cell-, or D3H2LN cell-derived EVs or
not was examined.
[0135]
The EVs derived from BMD2a, BMD2b, or D3H2LN cells
were added to each well and then incubated for 24 hours.
Subsequently, PKH26-labelled D3H1 cells were added.
After 2 days, the number of cells migrated across the
filter was counted.
[0136]
The result is illustrated in Figure 7. D3H1 cells
could not migrate across BBB without the addition of EVs.
However, the number of cells that migrated across BBB to
the lower side was significantly increased by the
addition of BMD2a cell- and BMD2b cell-derived EVs. The
addition of D3H2LN cell-derived EVs did not efficiently
promote the migration of low-metastatic D3H1 cells across
BBB compared to BMD2a- and BMD2b cell-derived EVs. These
results indicated that the EVs derived from brain
CA 02979792 2017-09-14
- 106 -
metastasis breast cancer cells affected the extravasation
of cancer cells to the brain parenchyma side across BBB.
[0137]
(Example 8) Examination of effect of EVs on permeability
of BBB
To determine whether EVs derived from brain
metastatic cancer cells directly affects BBB disruption,
whether addition of EVs in the in vitro BBB model
disrupts BBB or not was examined. EVs were prepared
according to the description in Example 5. Four days
after thawing the in vitro BBB model, purified EVs
derived from D3H2LN, BMD2a, and BMD2b cells or PBS
(negative control) was added. Before the addition of the
EVs and 24 hours after the addition, transendothelial
electrical resistance (TEER) was measured to measure the
strength of tight junction of the brain capillary
endothelial cells, according to the method described in
Example 2. All assays were performed in triplicate.
[0138]
Furthermore, a permeability test using NaF was
conducted according to the method described in Example 2
(2) to measure the permeability of BBB. 24 hours after
the addition of purified EVs derived from D3H2LN, BMD2a,
and BMD2b cells, NaF was added. NaF moved across BBB was
measured with a fluorocytometer. The apparent
permeability coefficient (Papp) (10-6cms-1) was calculated
CA 02979792 2017-09-14
- 107 -
according to the calculating formula described in Example
2 (2). All assays were performed in triplicate.
[0139]
The measured TEER values are illustrated in Figure
8a and the relative changes in TEER between before and
after the addition of EVs are illustrated in Figure 8b.
TEER values in the BMD2a and BMD2b cell-derived EVs
administrated groups were significantly decreased
compared to that in the D3H2LN cell-derived EVs
administrated group (P <0.05) and the D3H1 cell-derived
EVs administrated group (P <0.01).
[0140]
The result of the permeability test is illustrated
in Figure Bc. Both BMD2a and BMD2b cell-derived EVs
administrated groups exhibited a clearly high (P <0.01)
permeability coefficient (Papp) compared to the D3H2LN
cell-derived EVs administrated group (P <0.05) and the
D3H1 cell-derived EVs administrated group (P <0.01).
[0141]
(Example 9) Analysis of uptake of EV to BBB constituent
cells
To confirm that EVs are taken up to BBB
configuration cell, EVs were added to the in vitro BBB
model and examined the uptake by the BBB constituent
cells. All assays were performed in triplicate.
[0142]
(1) Labeling of EV with PKH67
CA 02979792 2017-09-14
- 108 -
Purified EVs derived from D3H1, D3H2LN, BMD2a, and
BMD2b cells prepared by the method in Example 4 were
labelled with PKH67 green fluorescent labeling kit (Sigma
Aldrich, MO, USA). EVs were reacted with 2 M PKH67 for
minutes and washed using a 100 kDa filter (Microcon YM-
100, Millipore) five times to remove excess dye.
[0143]
(2) Uptake of EVs into cells in in vitro BBB model
According to the method described in Example 8, the
labelled EVs or PBS (negative control) was added to the
upper surface side in the in vitro BBB model, which was
cultured at 37 C, 5% 002 for 24 hours. Brain capillary
endothelial cells, brain pericytes, and astrocytes were
confirmed by Hoechst33342 staining.
[0144]
(3) Result
The result of measurements of uptake of EVs to BBB
constituent cells is illustrated in Figure 9a and Figure
9b. All cancer cell-derived EVs were taken up by the
endothelial cells, but little uptake to pericytes and
astrocyte was observed. The observation that EVs derived
from END led to the highest fluorescence intensity in
endothelial cells revealed the tropism of EVs derived
from BMD cells to the cerebrovascular endothelial cells.
[0145]
(Example 10) Analysis of mechanisms of BBB destruction by
EVs
CA 02979792 2017-09-14
4 A
- 109 -
To examine the mechanisms of BBB destruction by EVs,
EVs were added to the in vitro BBB model and examined the
change of molecular behaviors in BBB constituent cells.
All assays were performed in triplicate.
[0146]
(1) Localization of tight junction proteins in
endothelial cells after the EV addition
Purified EVs derived from D3H1, D3H2LN, BMD2a, and
BMD2b cells prepared by the method in Example 4 or PBS
(negative control) was added and, 24 hours later,
Claudin-5, Occludin, ZO-1, or N-cadherin in the
endothelial cells in the in vitro BBB model was
fluorescently immunostained with actin filaments to
examine whether the localization is changed using a
method similar to that in Example 2 (2).
[0147]
(2) Change of tight junction protein levels etc. in
endothelial cells after EV addition
Proteins were isolated from each cell line using M-
PER (Thermo Scientific, MA, USA), separated in Mini-
PROTEAN(R) TGX Gel (4-12%) (Bio-Rad), and
electrotransferred onto PVDF membranes (Millipore). The
resultant membranes were blocked in Blocking One (Nacalai
Tesque, Kyoto, Japan) and then incubated for 1 hour at
room temperature with a primary antibody, anti-Claudin-5
antibody (Z43.JK, 1/200, Invitrogen), anti-Occludin
antibody (ZMD.481, 1/200, Invitrogen), anti-ZO-1 antibody
CA 029797922017-09-14
=
- 110 -
(H-300, sc-10804, 1/100, Santa Cruz Biotechnology), anti-
N-cadherin antibody(3B9, 1/500, Invitrogen), or anti-
GAPDH antibody (6C5, 1/1000, Millipore). An HRP-linked
anti-mouse IgG secondary antibody (NA931, GE Healthcare)
or HRP-linked anti-rabbit IgG secondary antibody (NA934,
GE Healthcare) was used at a dilution of 1/2000. The
membranes were then made luminescent with ImmunoStar(R)
LD (Wako, Osaka, Japan).
[0148]
(3) Results
The results of localization of the tight junction
proteins in the endothelial cells in the in vitro BBB
model are illustrated in Figure 10a and Figure 10b. The
tight junction proteins and the N-cadherin were localized
on the cell membrane surface of the endothelial cells
treated with PBS or the EVs derived from D3H2LN cells.
However, the tight junction proteins and the N-cadherin
were found in the cytoplasm in the cells treated with the
EVs derived from BMD2a and BMD2b,. Moreover, the
treatment of cerebrovascular endothelial cells with the
EVs derived from BMD2a and BMD2b had no effect on the
expression of the tight junction proteins, N-cadherin,
and actin (Figure 10c). Thus, it was revealed that
cancer-derived EVs changes the localization of tight
junction proteins, N-cadherin, and actin filament without
affecting the expression thereof.
[0149]
CA 029797922017-09-14
- 111 -
(Example 11) Examination of effect on blood-brain barrier
permeability of EVs in in vivo
Since the results of the in vitro BBB model tests
demonstrated that cancer cell-derived EVs are taken up by
endothelial cells and increase the permeability of BBB,
in vivo permeability tests were conducted to examine
whether they also have the effect on the blood ability
barrier in vivo. Purified EVs derived from D3H2LN cells
(control) and BMD2a cells were labelled by XenoLight DiR
fluorescent staining. The labelled EVs were injected
into the tail vein of mice and, 6 hours later, Tracer-653,
a dye for in vivo blood vessel permeability tests, was
injected into the mice for monitoring BBB disruption.
[0150]
The upper panels in Figure 11 illustrate the intake
of EVs and the lower panels illustrate the permeability
of brain blood vessels. As illustrated in the upper
panels of Figure 11, BMD2a cell-derived EVs were more
incorporated within the brains of mice than were D3H2LN
cell-derived EVs. As illustrated in the lower panels of
Figure 11, BMD2a cell-derived EV-treated mice exhibited
greater permeability of brain blood vessels compared to
D3H2LN cell-derived EV-treated mice.
[0151]
(Example 12) Effect of EVs on cancer metastasis in vivo
To examine whether increase in in vivo brain blood
vessel permeability by EVs, confirmed in Examples above,
CA 02979792 2017-09-14
- 112 -
actually has an effect on brain metastasis, cancer cells
were injected into EV-treated mice and whether brain
metastasis occurs or not was examined. Purified EVs (5
rig/animal for each) derived from D3H2LN cells (control)
or BMD2a cells or PBS (negative control) were injected in
the tail vein of 9 animals per group of C.B-17/Icr-
scid/scid mice (Day 0). 24 hours later (Day 1), the
D3H2LN breast cancer cell line (2x105 cells) was injected
in the left cardiac ventricle of each mice. 18 days
later (Day 19), brain metastasis of cancer cells was
observed by intraperitoneal luciferin injection and
bioluminescence in vivo imaging using IVIS Spectrum
(Caliper Life Science, Hopkinton, MA, USA). Evaluation
was made by measuring photon intensity in the brain from
the obtained images. Significant difference was
evaluated by Mann Whitney one-tailed testing. Brain
metastasis was also confirmed by hematoxylin and eosin
(HE) staining and immunofluorescence staining for human
vimentin.
[0152]
In the BMD2a-derived EVs administrated group, brain
metastasis in 5 out of 9 animals (55.6%), which is
clearly higher than brain metastasis in the D3H2LN cell-
derived EVs administrated group (brain metastasis in 1
out of 9 animals: 11.1%) and the PBS administrated group
(brain metastasis in 0 out of 9 animals: 0%), was found.
According to the result of fluorescence intensity
CA 02979792 2017-09-14
- 113 -
measurement, there were clearly more invading and
metastasizing cancer cells in brains in the BMD2a-derived
EVs administrated group compared to those in other groups
(Figure 12a, b, p <0.05). HE staining also confirmed
brain metastasis (Figure 12c). As indicated by these
results, it was revealed that increase of the brain blood
vessel permeability by EVs increases brain metastasis
[0153]
(Example 13) Elucidation of molecule responsible for
change of blood-brain barrier permeability by EVs
To elucidate the molecular mechanisms by which EVs
changed the permeability of the blood-brain barrier,
miRNA contained in EVs derived from D3H2LN, BMD2a, and
BMD2b cells was analyzed.
[0154]
Total RNA was extracted from EVs using the QIAzol
reagent and the miRNeasy Mini Kit (both Qiagen). The
quality and quantity of the RNA were determined using
NanoDrop ND-1000 spectrophotometer (Thermo Fisher
Scientific Inc.) and Agilent Bioanalyzer (Agilent
Technologies) according to the recommended methods. The
obtained total RNA was labelled with cyanine 3 (Cy3)
using miRNA Complete Labeling and Hyb Kit (Agilent
Technologies) according to the manufacturer's
instructions. More specifically, 100 ng of total RNA was
dephosphorylated by reacting for 30 minutes at 37 C using
Calf Intestinal Alkaline Phosphatase (CIP) Master Mix.
CA 02979792 2017-09-14
- 114 -
The dephosphorylated RNA was denatured with DMSO by
incubation for 5 minutes at 100 C. The RNA was then
immediately transferred on ice and incubated for 2
minutes. The resultant reaction products were mixed with
Ligation master mix for T4 RNA Ligase and Cy3-pCp
(Cyanine 3-Cytidine biphosphate) and incubated for 2
hours at 16 C. The labelled RNA was dried using vacuum
concentrator at 55 C for 1.5 hours. Cy3-pCp-labelled RNA
was hybridized on Agilent SurePrint G3 Human miRNA 8 x
60K Rel. 19 microarray (design ID: 046064) at 55 C for 20
hours. There are a total of 2,006 miRNA probes on the
microarray without control probes. After washing, the
microarray was scanned using an Agilent DNA microarray
scanner. Intensity values of each scanned feature were
quantified using Agilent Feature Extraction software
version 10.7.3.1, which performs background subtractions.
Only using features that were flagged as no errors
(Detected flags), the expression analysis was performed
with Agilent GeneSpring GX version 12.6.1. Features that
were not positive, not significant, not uniform, not
above background, saturated and population outliers (not
detected flags) were excluded. In this experiment, the
significant differences of gene expression were
identified by applying more than 2-fold change in signal
intensity.
[0155]
CA 02979792 2017-09-14
- 115 -
In addition to miRNA, proteins contained in EVs
derived from D3H2LN, BMD2a, and BMD2b cells were analyzed.
However, any candidate protein characteristic of BMD2a
and BMD2b cells was not found (not illustrated). As a
result of the miRNA analysis, miR-181c was found to be
significantly upregulated in BMD2a cell- and BMD2b cell-
derived EVs compared to EVs derived from D31-I2LN cells
(Figure 13a, Figure 13b). Therefore, to confirm whether
miR-181c is expressed in D3H2LN, BMD2a, and BMD2b cells,
intracellular miR-181c was detected. As a result, any
significant difference in expression of miR-181c was not
confirmed in any of D3H2LN cells, BMD2a cells, and BMD2b
cells (not illustrated).
[0156]
(Example 14) Evaluation of effect of miR-181c on BBB
The foregoing results suggested that the BBB
destruction by cancer cell-derived EVs involves miR-181c
contained in EVs taken up by the endothelial cells.
Therefore, the abundance of miR-181c in the endothelial
cells after the addition of the EVs was examined to study
the effect of miR-181c on BBB. Changes of permeability
and behaviors of tight junction proteins were also
examined using the in vitro BBB model containing the
endothelial cells into which miR-181c had been introduced.
[0157]
(1) Change of miR-181c abundance in endothelial cells by
addition of EVs
CA 02979792 2017-09-14
- 116 -
To evaluate the effect of miR-181c on BBB, EVs
isolated from BMD2a and BMD2b was added to endothelial
cells and the change of miR-181c abundance was examined.
EVs were prepared according to the description in Example
5. Four days after thawing the in vitro BBB model,
purified EVs derived from D3H2LN, BMD2a, and BMD2b cells
or PBS (negative control) were added. 24 hours after the
addition of EVs, the expression of miR-181c in
endothelial cells was measured. All assays were
performed in triplicate.
[0158]
(2) Effect of change of miR-181c abundancein in
endothelial cells
To further examine the effect of change of miR-181c
abundance on endothelial cells, synthetic miR-181c was
introduced into the endothelial cells constituting the in
vitro BBB model. Transendothelial electrical resistance
(TEER) was measured according to the method described in
Example 2 (3). The localization and expression levels of
tight junction proteins, N-cadherin, and actin were
detected according to the method described in Example 10.
Endothelial cells into which miR-181c was not introduced
was used as a negative control.
[0159]
(3) Results
The abundance of miR-181c in the endothelial cells
was significantly increased by the addition of EVs
CA 02979792 2017-09-14
- 117 -
derived from BMD2a and RMD2b (Figure 14a). The
transfection of miR-181c significantly decreased the
value of TEER in the in vitro BBB model (Figure 14b).
While tight junction proteins, N-cadherin and actin
localized on the membrane in the negative control group,
the localization had been changed to the cytoplasm in
miR-181c-transfected cells (Figure 14c). Furthermore, it
was found that the expression of tight junction proteins,
N-cadherin, and actin was not affected by the
transfection of miR-181c into brain blood vessel
endothelial cells (Figure 14d).
[0160]
(Example 15) Measurement of serum miR-181c in brain
metastasis breast cancer patients
To confirm whether there is actually miR-181c in EVs
in the blood of brain metastasis breast cancer patients
or not, EVs were purified from sera from brain metastasis
breast cancer patients and the expression of miR-181c was
examined. Sera from 56 breast cancer patients (10 brain
metastasis patients, 46 non-brain metastasis patients)
were collected at National Cancer Center Japan (No. 2013-
111). Informed consent was obtained from all the
patients. Serum was aliquoted and stored at -80 C until
used, and freeze-thawing was avoided as much as possible
after that. EVs were isolated from the sera using Total
Exosome Isolation (from sera) (Invitrogen), The total RNA
was then isolated from the obtained EVs using the RNeasy
CA 02979792 2017-09-14
- 118 -
Mini Kit (Qiagen). The expression of miRNA was measured
by gRT-PCT using RNU6 as an internal control by an
already reported method (Kosaka, N. et al. Net. Med.,
18:883-891 (2012)). More specifically, the expression
levels of miR-181c and RNU6 were measured in a 96-well
plate by c1RT-PCR using TaqMan(R) MicroRNA Assays and
TagMan(R) Universal PCR Master Mix in 7300 Real-Time PCR
System (all from Applied Biosystems, CA, USA). All
reactions were performed in triplicate.
[0161]
Significantly more miR-181was present in the EVs
obtained from sera from the brain metastasis patients
compared to the non-brain metastasis patients (P < 0.05,
T test; Figure 15). There was no difference in the serum
miR-181c abundance among stages in the non-brain
metastasis breast cancer patients (Figure 16). In the
comparison between same IV patients, there was a
significant difference between the brain metastasis and
the non-brain metastasis patients (P < 0.05) and the miR-
181c level was clearly higher in EVs derived from the
sera from brain metastasis patients. This suggested that
the secretion of miR-181c to blood contributes to brain
metastasis in real patients as well.
[0162]
The foregoing results indicated that EVs derived
from brain metastatic cancer cells induce the abnormal
localization of tight junction proteins by transferring
CA 02979792 201.7.--14
- 119 -
miR-181c into endothelial cells, which results in the
destruction of the cell-cell contact.
[0163]
(Example 16) Search of target of miR-181c in endothelial
cells
To elucidate the mechanisms of BBB destruction by
miR-181c, search for the target of miR-181c in the
endothelial cells was conducted. The gene expression in
endothelial cells transfected with a negative control or
miR-181c and the gene expression in endothelial cells
after the addition of EVs derived from in BMD2a, BMD2b,
or D3H2LN cells were analyzed.
[0164]
The total RNA from respective endothelial cells was
isolated using the QIAzol reagent and the mirRNeasy Mini
Kit (both Qiagen). The quality and quantity of the RNA
were determined using NanoDrop ND-1000 spectrophotometer
(Thermo Fisher Scientific Inc.) and Agilent Bioanalyzer
(Agilent Technologies) according to the recommended
methods. The obtained total RNA was labelled with
cyanine 3 (Cy3) during amplification using Low Input
Quick Amp Labeling Kit, one-color (Agilent Technologies)
according to the manufacturer's instructions. More
specifically, 100 ng of total RNA was reverse-
transcripted into double strand complementary DNA (cDNA)
using poly dT-T7 promoter primers. The primers, the
template RNA, and a quality control transcription product
CA 02979792 2017-09-14
- 120 -
of known concentration and quality were first denatured
at 65 C for 10 minutes and then incubated for 2 hours at
40 C with 5 x first strand buffer, 0.1 M dithiothreitol,
mM deoxynucleotide triphosphate mixture, and
AffinityScript RNase Block Mix, which was then incubated
with AffinityScript enzyme at 70 C for 15 minutes. Using
the cDNA product as template, fluorescent complementary
RNA (cRNA) was produced by in vitro transcription. The
cDNA product was mixed with transcription master mix in
the presence of T7 RNA polymerase and Cy3-labeled CTP
(cytidine 5'-triphosphate) and incubated at 40 C for 2
hours. The labelled cRNA was purified using RNeasy Mini
Spin Columns (Qiagen) and eluted with 30 mL of nuclease-
free water. After the amplification and labeling, the
quantity of the cRNA and incorporation of cyanine were
determined using NanoDrop ND-1000 spectrophotometer
(Thermo Fisher Scientific Inc.) and Agilent Bioanalyzer
(Agilent Technologies). In each hybridization, 0.6 g of
Cy3-labeled cRNA was fragmented and hybridized with
Agilent Cynomolgus macaque Gene Expression Profiling
Array (design ID: 028520) at 65 C for 17 hours. There
are a total of 12,243 miRNA probes on the microarray
without control probes. After washing, the microarray
was scanned using an Agilent DNA microarray scanner.
Intensity values of each scanned feature were quantified
using Agilent Feature Extraction software version
10.7.3.1, which performs background subtractions. Only
CA 02979792 2017-09-14
- 121 -
using features that were flagged as no errors (Detected
flags), the normalization was performed with Agilent
GeneSpring GX version 12.6.1 (for each tip: normalization
for third quartile shift; for each gene: normalization
for the median of all samples). Features that were not
positive, not significant, not uniform, not above
background, saturated and population outliers
(Compromised and not detected flags) were excluded.
Changed transcription products were quantified by using
the comparison method. In this experiment, the
significant differences of gene expression were
identified by applying 2-fold change in signal intensity.
[0165]
It was confirmed at both mRNA and protein levels
that the expression of 3-phosphoinositide dependent
protein kinase-1 (PDPK1) is suppressed in the brain blood
vessel endothelial cells transfected with miR-181c
compared to the negative control (Figure 17a-c).
Furthermore, it was confirmed at both mRNA and protein
levels that the expression of PDPK1 is suppressed
compared to the control (endothelial cells treated with
EVs derived from D3H2LN cells) in the endothelial cells
treated with EVs derived from BMD2a and BMD2b cells
(Figure 17d-f). These results indicated that miR-181c
suppresses the expression of PDPK1 in brain blood vessel
endothelial cells.
[0166]
CA 02979792 2017-09-14
- 122 -
(Example 17) Effect of PDPK1 on localization of tight
junction proteins etc.
To examine the effect of PDPK1 on brain blood vessel
endothelial cells, transendothelial electrical resistance
(TEER) and the localization and expression of tight
junction proteins, N-cadherin, and actin filaments after
treatment with PDPK1 siRNA were examined.
[0167]
25 nM of PDPK1 siRNA (Ambion, ID: S10275) or 25 nM
of control siRNA was introduced into brain blood vessel
endothelial cells using DharmaFECT transfection reagent
(Thermo Scientific) according to the manufacturer'
protocol. Transendothelial electrical resistance (TEER)
of the in vitro BBB model using the transfected cells
after 24 hours was measured according to the method
described in Example 2 (3). Moreover, the localization
and expression of tight junction proteins, N-cadherin,
and actin filaments in the transfected cells after 24
hours were measured according to the method described in
Example 10.
[0168]
The introduction of PDPK1 siRNA reduced the
expression of PDPK1 protein (see Figure 20b). While
tight junction proteins and N-cadherin were located on
the cell membrane in the cells treated with the control
siRNA, the localization on the cell membrane had been
lost in the PDPK1 siRNA-treated cells (Figure 18a).
CA 02979792 201.7.--14
- 123 -
Tight junction proteins, N-cadherin, and actin were found
in cytoplasm, which is consistent with the results of the
observation of the cells treated with BMD2a cell- or
BMD2b cell-derived EVs or the miR-181c-transfected cells.
Actin condensation was observed in the PDPK1 siRNA-
treated endothelial cells. This phenomenon is also
consistent with the results of the cells treated with
BMD2a cell- or BMD2b cell-derived EVs or the miR-181c-
transfected cells (Figure 10a, Figure 10b, Figure 14c,
and Figure 18a). The expression of tight junction
proteins, N-cadherin, and actin was not changed with or
without PDPK1 siRNA treatment (Figure 18b). The
transendothelial electrical resistance (TEER) was
decreased by the introduction of PDPK1 siRNA (Figure 18c).
These results revealed that the inhibition of PDPK1
changes the localization of tight junction proteins and
the N-cadherin and increases the permeability of BBB.
[0169]
The foregoing results demonstrated that after EVs
secreted from brain metastatic cancer cells are taken up
by endothelial cells, miR-181c enclosed in the EVs
suppresses the expression of PDPK1 in the endothelial
cells, thereby changes the localization of tight junction
proteins and the N-cadherin, and increases the
permeability of BBB.
[0170]
CA 02979792 2017-09-14
- 124 -
(Example 18) Confirmation of suppression of PDPK1
expression by miR-181c
Furthermore, whether miR-181c can directly suppress
the expression of PDPK1 in endothelial cells or not is
examined by 3'-untranslated region (3' UTR) luciferase
reporter assay using the 3' UTR of the PDPK1 gene
(Macaca: SEQ ID NO: 14; Human: SEQ ID NO: 15).
[0171]
The 3' UTR for PDPK1 was obtained by PCR
amplification using total RNA extracted from brain blood
vessel endothelial cells of the Macaca fascicularis as
template. The PCR primers used for the 3'UTR
amplification are as follows:
Forward: AACTCGAGAATGCTGGCTATTGTTGGCCTC (SEQ ID NO: 16)
Reverse: AAGCGGCCGCAAGATTAAATCACTGACCCAATAG (SEQ ID NO:
17)
The PCR products were cloned and incorporated into a
pGEM-T Easy Vector (Promega, WI, USA). The amplified 3'
UTR was cloned downstream of the Renilla luciferase
coding region in the psiCHECK-2(TM) (Promega). An
alignment analysis confirmed that there is a sequence
complementary to miR-181c in the 3' UTR of PDPK1 (Figure
19b).
[0172]
HEK293 cells were seeded at 5x104 cells/well in 96-
well plates and cultured overnight. 100 ng of a reporter
plasmid along with 100 nM of pre-miR-181c was co-
CA 02979792 2017-09-14
- 125 -
transfected using DharmaFECT Duo transfection reagent
(Thermo Scientific).
[0173]
Cells were collected 24 hours after the transfection
and assayed for luciferase activity using EnVision
(PerkinElmer, MA, USA). To examine the effect of
endogenous miRNA, synthetic precursor miRNA (pre-miR;
Ambion(R), Invitrogen) was co-transfected as a negative
control. All experiments were performed in triplicate.
[0174]
According to the results obtained by using HEK293
cells, the expression of luciferase, a reporter gene, was
decreased by miR-181c (Figure 19a). These results
revealed that PDPK1 is a direct target of miR-181c.
[0175]
(Example 19) Effect on Cofilin phosphorylation
PDPK1 is known to be one of the proteins positioning
upstream of the pathway that controls Cofilin
phosphorylation (Lyle, A.N, et al., Physiology (Bethesda),
21:269-280 (2006); Higuchi, M., et al., Nat. Cell Biol.,
10:1356-1364 (2008)). Cofilin is a family of actin-
binding proteins, which disassembles actin filaments,
that is activated with dephosphorylation. Since actin
condensation was observed in the PDPK1 siRNA-treated
endothelial cells, whether Cofilin is involve in BBB
destruction by miR-181c or not was examined.
[0176]
CA 02979792 2017-09-14
- 126 -
Brain blood vessel endothelial cells were treated
with EVs derived from D3H2LN, BMD2a, or BMD2b cells.
Moreover, miR-181c was introduced into brain blood vessel
endothelial cells. Furthermore, brain blood vessel
endothelial cells were treated with PDPK1 siRNA according
to the method described in Example 17. The expression of
phosphorylated Cofilin in each of these cells was
analyzed by Western blot analysis.
[0177]
Samples were obtained from each cell line using M-
PER (Thermo Scientific, MA, USA) and loaded in Mini-
PROTEAN(R) TGX Gel (4-12%) (Bio-Rad) and proteins were
separated and then electrotransferred onto a PVDF
membrane (Millipore). The resultant membranes were
blocked in Blocking One (Nacalai Tesque, Kyoto, Japan)
and then incubated for 1 hour at room temperature with a
primary antibody, anti-PDPK1 antibody (43062, 1/500, Cell
Signaling), anti-Cofilin antibody (D3F9, 45157, 1/1000,
Cell Signaling), anti-Phospho-Cofilin antibody (5er3)
(43311, 1/500, Cell Signaling), or anti-GAPDH antibody
(605, 1/1000, Millipore). An HRP-linked anti-mouse IgG
secondary antibody (NA931, GE Healthcare) or HRP-linked
anti-rabbit IgG secondary antibody (NA934, GE Healthcare)
was used at a dilution of 1/2000. The membranes were
then made luminescent with ImmunoStar(R)LD (Wako, Osaka,
Japan).
[0178]
CA 02979792 2017-09-14
- 127 -
Phosphorylation of Cofilin in BMD2a cell- or BMD2b
cell-derived EVs-treated cells was decreased compared to
that in D3H2LN cell-derived EVs-treated cells (Figure
20a). Furthermore, phosphorylation of Cofilin in miR-
181c or PDPK1 siRNA-treated brain endothelial cells was
decreased compared to that in control siRNA treated cells
(Figure 20b). These results revealed that miR-181c in
EVs reduces the expression of PDPK1 in brain blood vessel
endothelial cells and, as a result, phosphorylation of
Cofilin is inhibited, which changes behaviors of actin
and causes actin condensation and thereby increases
permeability of the blood-brain barrier.
