Note: Descriptions are shown in the official language in which they were submitted.
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
SERINE PROTEASE VARIANTS AND POLYNUCLEOTIDES ENCODING SAME
REFERENCE TO A SEQUENCE LISTING
This application contains a Sequence Listing in computer readable form, which
is
incorporated herein by reference.
BACKGROUND OF THE INVENTION
Production of fermentation products, such as ethanol, from starch-containing
material is
well-known in the art. Generally, two different kinds of processes are used.
The most commonly
.. used process, often referred to as a "conventional process", includes
liquefying gelatinized
starch at high temperature using typically a bacterial alpha-amylase, followed
by simultaneous
saccharification and fermentation carried out in the presence of a
glucoamylase and a
fermenting organism. Another well-known process, often referred to as a "raw
starch hydrolysis"-
process (RSH process) includes simultaneously saccharifying and fermenting
granular starch
below the initial gelatinization temperature typically in the presence of an
acid fungal alpha-
amylase and a glucoamylase.
US Patent No. 5,231,017-A discloses the use of an acid fungal protease during
ethanol
fermentation in a process comprising liquefying gelatinized starch with an
alpha-amylase.
WO 2003/066826 discloses a raw starch hydrolysis process (RSH process) carried
out
on non-cooked mash in the presence of fungal glucoamylase, alpha-amylase and
fungal
protease.
WO 2007/145912 discloses a process for producing ethanol comprising contacting
a
slurry comprising granular starch obtained from plant material with an alpha-
amylase capable of
solubilizing granular starch at a pH of 3.5 to 7.0 and at a temperature below
the starch
.. gelatinization temperature for a period of 5 minutes to 24 hours; obtaining
a substrate comprising
greater than 20% glucose, and fermenting the substrate in the presence of a
fermenting
organism and starch hydrolyzing enzymes at a temperature between 10 C and 40 C
for a period
of 10 hours to 250 hours. Additional enzymes added during the contacting step
may include
protease.
WO 2014/037438 discloses serine proteases derived from Meripilus giganteus,
Trametes versicolor, and Dichomitus squalens and their use in animal feed.
US provisional application 62/232,903 discloses the use of the Meripilus
giganteus S53
protease in the saccharification and/or fermentation step in a starch to
ethanol process.
It is an object of the present invention to identify variants of the M.
giganteus S53
proteases that will result in increased storage stability, in particular an
increased thermo-stability
of the variant protease compared to the wild type parent enzyme.
1
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
The present invention provides protease variants with improved properties
compared to
its parent.
SUMMARY OF THE INVENTION
In a first aspect the present invention relates to a protease variant
comprising a
modification at one or more position corresponding to positions 39, 50, 57,
60, 74, 81, 84, 109,
110, 111, 115, 117, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209,
210, 212, 228, 267,
271, 272, 274, 278, 280, 294, 317, 318, 320, 321, 322, 328, 343, 348, 362 or
363 of the
polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and
wherein the variant
has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 96%, at least
97%, at least 98%, or at least 99%, but less than 100% sequence identity to
the mature
polypeptide of SEQ ID NO: 3, and wherein the variant has increased thermo-
stability compared
to the protease of SEQ ID NO: 3.
In a second aspect the present invention relates to protease variant
comprising a
modification at position corresponding to position 39, 60, 74, 81, 84, 109,
115, 117, 142, 145,
146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348
or 362 of the
polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and
wherein the variant
has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 96%, at least
97%, at least 98%, or at least 99%, but less than 100% sequence identity to
the polypeptide of
SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53
family and
wherein the variant has increased residual activity compared to the protease
of SEQ ID NO: 3
and wherein the increased thermo-stability is increased residual activity
measured after
incubation for 30 min at an elevated temperature in the range from 55 to 60
degrees Celsius.
In a third aspect the present invention relates to protease variant comprising
a
modification at position corresponding to position 50, 57, 60, 81, 84, 109,
110, 111, 124, 128,
142, 145, 146, 154, 182, 183, 207, 209, 210, 228, 267, 271, 272, 274, 278,
280, 294, 317, 318,
320, 321, 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3,
wherein the variant
has protease activity and wherein the variant has at least 75%, at least 80%,
at least 85%, at
least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least
99%, but less than
100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the
protease is a serine
protease belonging to the S53 family and wherein the protease is a serine
protease belonging
to the S53 family which has an improved property relative to the parent
wherein the improved
property is increased thermo-stability measured by TSA assay where Td is at
least 59 C.
The present invention also relates to polynucleotides encoding the variants;
nucleic acid
constructs, vectors, and host cells comprising the polynucleotides; and
methods of producing
the variants. In a further aspect the present invention relates to
compositions comprising the
variants of the invention.
2
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
The present invention also relates to a process for producing a fermentation
product
from starch-containing material comprising simultaneously saccharifying and
fermenting starch-
containing material using a carbohydrate-source generating enzymes and a
fermenting
organism at a temperature below the initial gelatinization temperature of said
starch-containing
material in the presence of a variant protease. In another aspect the present
invention relates to
a process for producing a fermentation product from starch-containing material
comprising the
steps of: (a) liquefying starch-containing material in the presence of an
alpha-amylase; (b)
saccharifying the liquefied material obtained in step (a) using a glucoamylse;
(c)
fermenting using a fermenting organism; wherein a variant protease of the
invention is
present during step b) and/or c).
DEFINITIONS
Protease: The term "protease" (also designated peptidases, proteinases,
peptide
hydrolases, or proteolytic enzymes) means a proteolytic activity (EC 3.4) that
catalyzes the
cleavage of peptide bonds. For purposes of the present invention, serine
protease activity is
determined according to the procedure described in the Examples. In one
aspect, the variants
of the present invention have at least 20%, e.g., at least 40%, at least 50%,
at least 60%, at least
70%, at least 80%, at least 90%, at least 95%, or at least 100% of the
protease activity of the
mature polypeptide of SEQ ID NO: 2.
Protease activity: The term "protease activity" means proteolytic activity (EC
3.4). There
are several protease activity types such as trypsin-like proteases cleaving at
the carboxyterminal
side of Arg and Lys residues and chymotrypsin-like proteases cleaving at the
carboxyterminal
side of hydrophobic amino acid residues. Proteases of the invention are serine
endopeptidases
(EC 3.4.21) with acidic pH-optimum (pH optimum < pH 7).
Protease activity can be measured using any assay, in which a substrate is
employed,
that includes peptide bonds relevant for the specificity of the protease in
question. Assay-pH and
assay-temperature are likewise to be adapted to the protease in question.
Examples of assay-
pH-values are pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. Examples of assay-
temperatures are 15,
20, 25, 30, 35, 37, 40, 45, 50, 55, 60, 65, 70, 80, 90, or 95 C. Examples of
general protease
substrates are casein, bovine serum albumin and haemoglobin. In the classical
Anson and
Mirsky method, denatured haemoglobin is used as substrate and after the assay
incubation with
the protease in question, the amount of trichloroacetic acid soluble
haemoglobin is determined
as a measurement of protease activity (Anson, M.L. and Mirsky, A.E., 1932, J.
Gen. Physiol. 16:
59 and Anson, M.L., 1938, J. Gen. Physiol. 22: 79).
For the purpose of the present invention, protease activity was determined
using assays
which are described in "Materials and Methods", such as the Kinetic Suc-AAPF-
pNA assay,
Protazyme AK assay, Kinetic Suc-AAPX-pNA assay and o-Phthaldialdehyde (OPA).
For the
3
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Protazyme AK assay, insoluble Protazyme AK (Azurine-Crosslinked Casein)
substrate liberates
a blue colour when incubated with the protease and the colour is determined as
a measurement
of protease activity. For the Suc-AAPF-pNA assay, the colourless Suc-AAPF-pNA
substrate
liberates yellow paranitroaniline when incubated with the protease and the
yellow colour is
determined as a measurement of protease activity.
Endo-protease/Exo-proteases: Polypeptides having protease activity, or
proteases,
are sometimes also designated peptidases, proteinases, peptide hydrolases, or
proteolytic
enzymes. Proteases may be of the exo-type (exopeptidases) that hydrolyse
peptides starting at
either end thereof, or of the endo-type that act internally in polypeptide
chains (endopeptidases).
S53 protease: The term "S53 " means a protease activity selected from:
(a) proteases belonging to the EC 3.4.21 enzyme group; and/or
(b) proteases belonging to the EC 3.4.14 enzyme group; and/or
(c) Serine proteases of the peptidase family S53 that comprises two
different
types of peptidases: tripeptidyl aminopeptidases (exo-type) and endo-
peptidases; as described
in 1993, Biochem. J. 290:205-218 and in MEROPS protease database, release, 9.4
(31 January
2011) (www.merops.ac.uk). The database is described in Rawlings, N.D.,
Barrett, A.J. and
Bateman, A., 2010, "MEROPS: the peptidase database", Nucl. Acids Res. 38: D227-
D233.
For determining whether a given protease is a Serine protease, and a family
S53
protease, reference is made to the above Handbook and the principles indicated
therein. Such
determination can be carried out for all types of proteases, be it naturally
occurring or wild-type
proteases; or genetically engineered or synthetic proteases.
Allelic variant: The term "allelic variant" means any of two or more
alternative forms of
a gene occupying the same chromosomal locus. Allelic variation arises
naturally through
mutation, and may result in polymorphism within populations. Gene mutations
can be silent (no
change in the encoded polypeptide) or may encode polypeptides having altered
amino acid
sequences. An allelic variant of a polypeptide is a polypeptide encoded by an
allelic variant of a
gene.
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse
transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic
or prokaryotic
cell. cDNA lacks intron sequences that may be present in the corresponding
genomic DNA. The
initial, primary RNA transcript is a precursor to mRNA that is processed
through a series of steps,
including splicing, before appearing as mature spliced mRNA.
Coding sequence: The term "coding sequence" means a polynucleotide, which
directly
specifies the amino acid sequence of a variant. The boundaries of the coding
sequence are
generally determined by an open reading frame, which begins with a start codon
such as ATG,
GTG or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding
sequence may
be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
4
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Control sequences: The term "control sequences" means nucleic acid sequences
necessary for expression of a polynucleotide encoding a variant of the present
invention. Each
control sequence may be native (i.e., from the same gene) or foreign (i.e.,
from a different gene)
to the polynucleotide encoding the variant or native or foreign to each other.
Such control
sequences include, but are not limited to, a leader, polyadenylation sequence,
propeptide
sequence, promoter, signal peptide sequence, and transcription terminator. At
a minimum, the
control sequences include a promoter, and transcriptional and translational
stop signals. The
control sequences may be provided with linkers for the purpose of introducing
specific restriction
sites facilitating ligation of the control sequences with the coding region of
the polynucleotide
encoding a variant.
Expression: The term "expression" includes any step involved in the production
of a
variant including, but not limited to, transcription, post-transcriptional
modification, translation,
post-translational modification, and secretion.
Expression vector: The term "expression vector" means a linear or circular DNA
molecule that comprises a polynucleotide encoding a variant and is operably
linked to control
sequences that provide for its expression.
Fragment: The term "fragment" means a polypeptide having one or more (e.g.,
several)
amino acids absent from the amino and/or carboxyl terminus of a mature
polypeptide; wherein
the fragment has protease activity.
High stringency conditions: The term "high stringency conditions" means for
probes of
at least 100 nucleotides in length, prehybridization and hybridization at 42 C
in 5X SSPE, 0.3%
SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50%
formamide,
following standard Southern blotting procedures for 12 to 24 hours. The
carrier material is finally
washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 65 C.
Host cell: The term "host cell" means any cell type that is susceptible to
transformation,
transfection, transduction, or the like with a nucleic acid construct or
expression vector
comprising a polynucleotide of the present invention. The term "host cell"
encompasses any
progeny of a parent cell that is not identical to the parent cell due to
mutations that occur during
replication.
Improved property: The term "improved property" means a characteristic
associated
with a variant that is improved compared to the parent. Such improved
properties include, but
are not limited to, increased stability under storage conditions, increased
thermo-stability, and
increased residual activity.
Isolated: The term "isolated" means a substance in a form or environment which
does
not occur in nature. Non-limiting examples of isolated substances include (1)
any non-naturally
occurring substance, (2) any substance including, but not limited to, any
enzyme, variant, nucleic
acid, protein, peptide or cofactor, that is at least partially removed from
one or more or all of the
5
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
naturally occurring constituents with which it is associated in nature; (3)
any substance modified
by the hand of man relative to that substance found in nature; or (4) any
substance modified by
increasing the amount of the substance relative to other components with which
it is naturally
associated (e.g., multiple copies of a gene encoding the substance; use of a
stronger promoter
than the promoter naturally associated with the gene encoding the substance).
An isolated
substance may be present in a fermentation broth sample.
Low stringency conditions: The term "low stringency conditions" means for
probes of
at least 100 nucleotides in length, prehybridization and hybridization at 42 C
in 5X SSPE, 0.3%
SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25%
formamide,
following standard Southern blotting procedures for 12 to 24 hours. The
carrier material is finally
washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 50 C.
Mature polypeptide: The term "mature polypeptide" means a polypeptide in its
final form
following translation and any post-translational modifications, such as N-
terminal processing,
C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the
mature polypeptide
is amino acids 199 to 564 of SEQ ID NO: 2. Amino acids 1 to 17 of SEQ ID NO: 2
are a signal
peptide, and amino acids 18 to 198 are a propeptide. The N-terminals of the
mature S53
polypeptides used according to the present invention were experimentally
confirmed based on
EDMAN N-terminal sequencing data and Intact MS data. The mature polypeptides
are also
included as SEQ ID NO: 3 (mature S53 protease 3 from Meripilus giganteus. It
is known in the
art that a host cell may produce a mixture of two of more different mature
polypeptides (i.e., with
a different C-terminal and/or N-terminal amino acid) expressed by the same
polynucleotide.
Mature polypeptide coding sequence: The term "mature polypeptide coding
sequence" means a polynucleotide that encodes a mature polypeptide having
protease activity.
In one aspect, the mature polypeptide coding sequence is nucleotides 595 to
1692 of SEQ ID
NO: 1. Nucleotides 1 to 51 of SEQ ID NO: 1 encode a signal peptide,
nucleotides 52 to 594
encode a propeptide.
Medium stringency conditions: The term "medium stringency conditions" means
for
probes of at least 100 nucleotides in length, prehybridization and
hybridization at 42 C in 5X
SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and
35%
formamide, following standard Southern blotting procedures for 12 to 24 hours.
The carrier
material is finally washed three times each for 15 minutes using 2X SSC, 0.2%
SDS at 55 C.
Medium-high stringency conditions: The term "medium-high stringency
conditions"
means for probes of at least 100 nucleotides in length, prehybridization and
hybridization at 42 C
in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm
DNA, and
35% formamide, following standard Southern blotting procedures for 12 to 24
hours. The carrier
material is finally washed three times each for 15 minutes using 2X SSC, 0.2%
SDS at 60 C.
6
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Modification: The term "modification(s)" is in the context of the present
invention to be
understood as a substitution, insertion, and/or deletion, at one or more
(e.g., several) positions.
A substitution means replacement of the amino acid occupying a position with a
different amino
acid; a deletion means removal of the amino acid occupying a position; and an
insertion means
adding an amino acid adjacent to and immediately following the amino acid
occupying a position.
Mutant: The term "mutant" means a polynucleotide encoding a variant.
Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid
molecule, either single- or double-stranded, which is isolated from a
naturally occurring gene or
is modified to contain segments of nucleic acids in a manner that would not
otherwise exist in
nature or which is synthetic, which comprises one or more control sequences.
In one
embodiment the one or more control sequences are heterologous (of different
origin/species) to
the coding sequence encoding the polypeptide of the invention.
Operably linked: The term "operably linked" means a configuration in which a
control
sequence is placed at an appropriate position relative to the coding sequence
of a polynucleotide
such that the control sequence directs expression of the coding sequence.
Parent or parent protease: The term "parent" or "parent protease" means any
polypeptide with protease activity to which an alteration is made to produce
the enzyme variants
of the present invention.
Sequence identity: The relatedness between two amino acid sequences or between
two nucleotide sequences is described by the parameter "sequence identity".
For purposes of the present invention, the sequence identity between two amino
acid
sequences is determined using the Needleman-Wunsch algorithm (Needleman and
Wunsch,
1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the
EMBOSS package
(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al.,
2000, Trends
Genet. 16: 276-277), preferably version 5Ø0 or later. The parameters used
are gap open
penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version
of
BLOSUM62) substitution matrix. The output of Needle labeled "longest identity"
(obtained using
the ¨nobrief option) is used as the percent identity and is calculated as
follows:
(Identical Residues x 100)/(Length of Alignment ¨ Total Number of Gaps in
Alignment)
For purposes of the present invention, the sequence identity between two
deoxyribonucleotide sequences is determined using the Needleman-Wunsch
algorithm
(Needleman and Wunsch, 1970, supra) as implemented in the Needle program of
the EMBOSS
package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et
al., 2000,
supra), preferably version 5Ø0 or later. The parameters used are gap open
penalty of 10, gap
extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCB! NUC4.4)
substitution
matrix. The output of Needle labeled "longest identity" (obtained using the
¨nobrief option) is
used as the percent identity and is calculated as follows:
7
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
(Identical Deoxyribonucleotides x 100)/(Length of Alignment ¨ Total Number of
Gaps in
Alignment)
Subsequence: The term "subsequence" means a polynucleotide having one or more
(e.g., several) nucleotides absent from the 5' and/or 3' end of a mature
polypeptide coding
sequence; wherein the subsequence encodes a fragment having protease activity.
In one
aspect, a subsequence contains at least 1098 nucleotides (e.g., nucleotides
595 to 1692 of SEQ
ID NO: 1).
Variant: The term "variant" means a polypeptide having protease activity
comprising a
modification(s) at one or more (e.g., several) positions. The variants of the
present invention
have at least 20%, e.g., at least 40%, at least 50%, at least 60%, at least
70%, at least 80%, at
least 90%, at least 95%, or at least 100% of the protease activity of the
mature polypeptide of
SEQ ID NO: 2, disclosed herein as SEQ ID NO: 3.
Very high stringency conditions: The term "very high stringency conditions"
means for
probes of at least 100 nucleotides in length, prehybridization and
hybridization at 42 C in 5X
SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and
50%
formamide, following standard Southern blotting procedures for 12 to 24 hours.
The carrier
material is finally washed three times each for 15 minutes using 2X SSC, 0.2%
SDS at 70 C.
Very low stringency conditions: The term "very low stringency conditions"
means for
probes of at least 100 nucleotides in length, prehybridization and
hybridization at 42 C in 5X
SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and
25%
formamide, following standard Southern blotting procedures for 12 to 24 hours.
The carrier
material is finally washed three times each for 15 minutes using 2X SSC, 0.2%
SDS at 45 C.
Wild-type protease: The term "wild-type" protease means a protease expressed
by a
naturally occurring microorganism, such as a bacterium, yeast, or filamentous
fungus found in
nature.
Conventions for Designation of Variants
For purposes of the present invention, the mature polypeptide comprised in SEQ
ID NO:
2 is used to determine the corresponding amino acid residue in another
protease. The amino
acid sequence of another protease is aligned with the mature polypeptide
comprised in SEQ ID
NO: 2 (disclosed herein as SEQ ID NO: 3), and based on the alignment, the
amino acid position
number corresponding to any amino acid residue in the mature polypeptide
comprised in SEQ
ID NO: 2 is determined using the Needleman-Wunsch algorithm (Needleman and
Wunsch,
1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the
EMBOSS package
(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al.,
2000, Trends
Genet. 16: 276-277), preferably version 5Ø0 or later. The parameters used
are gap open
penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version
of
BLOSU M62) substitution matrix.
8
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Identification of the corresponding amino acid residue in another protease
than the
Meripilus giganteus S53 protease can be determined by an alignment of multiple
polypeptide
sequences using several computer programs including, but not limited to,
MUSCLE (multiple
sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004,
Nucleic Acids
Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002,
Nucleic Acids
Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-
518; Katoh and
Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in
Molecular Biology
537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS
EMMA
employing ClustalW (1.83 or later; Thompson et al., 1994, Nucleic Acids
Research 22: 4673-
4680), using their respective default parameters.
When the other enzyme has diverged from the mature polypeptide of SEQ ID NO: 2
such
that traditional sequence-based comparison fails to detect their relationship
(Lindahl and
Elofsson, 2000, J. Mol. Biol. 295: 613-615), other pairwise sequence
comparison algorithms can
be used. Greater sensitivity in sequence-based searching can be attained using
search
programs that utilize probabilistic representations of polypeptide families
(profiles) to search
databases. For example, the PSI-BLAST program generates profiles through an
iterative
database search process and is capable of detecting remote homologs (Atschul
et al., 1997,
Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if
the family or
superfamily for the polypeptide has one or more representatives in the protein
structure
databases. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-
815;
McGuffin and Jones, 2003, Bioinformatics 19: 874-881) utilize information from
a variety of
sources (PSI-BLAST, secondary structure prediction, structural alignment
profiles, and solvation
potentials) as input to a neural network that predicts the structural fold for
a query sequence.
Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919, can
be used to align a
sequence of unknown structure with the superfamily models present in the SCOP
database.
These alignments can in turn be used to generate homology models for the
polypeptide, and
such models can be assessed for accuracy using a variety of tools developed
for that purpose.
For proteins of known structure, several tools and resources are available for
retrieving
and generating structural alignments. For example the SCOP superfamilies of
proteins have
been structurally aligned, and those alignments are accessible and
downloadable. Two or more
protein structures can be aligned using a variety of algorithms such as the
distance alignment
matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension
(Shindyalov and
Bourne, 1998, Protein Engineering 11: 739-747), and implementation of these
algorithms can
additionally be utilized to query structure databases with a structure of
interest in order to
discover possible structural homologs (e.g., Holm and Park, 2000,
Bioinformatics 16: 566-567).
9
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
In describing the variants of the present invention, the nomenclature
described below is
adapted for ease of reference. The accepted IUPAC single letter or three
letter amino acid
abbreviation is employed.
Substitutions. For an amino acid substitution, the following nomenclature is
used:
Original amino acid, position, substituted amino acid. Accordingly, the
substitution of threonine
at position 226 with alanine is designated as "Thr226Ala" or "T226A". Multiple
mutations are
separated by addition marks ("+"), e.g., "Gly205Arg + Ser411Phe" or "G205R +
5411F",
representing substitutions at positions 205 and 411 of glycine (G) with
arginine (R) and serine
(S) with phenylalanine (F), respectively.
Deletions. For an amino acid deletion, the following nomenclature is used:
Original amino
acid, position, *. Accordingly, the deletion of glycine at position 195 is
designated as "Gly195*"
or "G195*". Multiple deletions are separated by addition marks ("+"), e.g.,
"Gly195* + Ser411*"
or "G195* + S411*.
Insertions. For an amino acid insertion, the following nomenclature is used:
Original
amino acid, position, original amino acid, inserted amino acid. Accordingly
the insertion of lysine
after glycine at position 195 is designated "Gly195GlyLys" or "G195GK". An
insertion of multiple
amino acids is designated [Original amino acid, position, original amino acid,
inserted amino acid
#1, inserted amino acid #2; etc.]. For example, the insertion of lysine and
alanine after glycine
at position 195 is indicated as "Gly195GlyLysAla" or "G195GKA".
In such cases the inserted amino acid residue(s) are numbered by the addition
of lower
case letters to the position number of the amino acid residue preceding the
inserted amino acid
residue(s). In the above example, the sequence would thus be:
Parent: Variant:
195 195 195a 195b
G G - K - A
Multiple modification. Variants comprising multiple modifications are
separated by
addition marks ("+"), e.g., "Arg170Tyr+Gly195Glu" or "R170Y+G195E"
representing a
substitution of arginine and glycine at positions 170 and 195 with tyrosine
and glutamic acid,
respectively.
Different modifications. Where different modification can be introduced at a
position, the
different modifications are separated by a comma, e.g., "Arg170Tyr,Glu"
represents a
substitution of arginine at position 170 with tyrosine or glutamic acid. Thus,
"Tyr167Gly,Ala +
Arg170Gly,Ala" designates the following variants:
"Tyr167Gly+Arg170Gly", "Tyr167Gly+Arg170Ala", "Tyr167Ala+Arg170Gly",
and
"Tyr167Ala+Arg170Ala".
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to protease variants, comprising a
modification(s) at one
or more (e.g., several) positions corresponding to specific positions of the
mature polypeptide
disclosed as SEQ ID NO: 3 (a parent protease), wherein the variant has
protease activity. As
explained herein the specific position numbers may change in case the mature
parent protease
is different from SEQ ID NO: 3. The improved properties of the variants of the
invention falls in
the following categories, e.g., increased stability, e.g., increased
thermostability (measured as
increase in thermal denaturation temperature, Td, and/or increased residual
activity by the Suc-
AAPF assay after incubation for 30 min at an elevated temperature in the range
from 55 to 60
degrees Celsius as described in detail in the examples).
Variants
The present invention provides a protease variant comprising a modification at
one or
more position corresponding to positions 39, 50, 57, 60, 74, 81, 84, 109, 110,
111, 115, 117,
124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267,
271, 272, 274, 278,
280, 294, 317, 318, 320, 321, 322, 328, 343, 348, 362 or 363 of the
polypeptide of SEQ ID NO:
3, wherein each modification is independently a substitution, insertion or
deletion. In one
embodiment, the modification is a substitution. In another embodiment, the
modification is a
deletion.
The present invention provides a protease variant comprising a modification at
one or
more position corresponding to positions 39, 50, 57, 60, 74, 81, 84, 109, 110,
111, 115, 117,
124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267,
271, 272, 274, 278,
280, 294, 317, 318, 320, 321, 322, 328, 343, 348, 362 or 363 of the
polypeptide of SEQ ID NO:
3, wherein the variant has protease activity and wherein the variant has at
least 75%, at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at
least 98%, or at
least 99%, but less than 100% sequence identity to the mature polypeptide of
SEQ ID NO: 3,
and wherein the variant has increased thermo-stability compared to the
protease of SEQ ID NO:
3.
In an embodiment, the variant has sequence identity of at least 80%, at least
85%, at
least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least
95%, at least 96%, at
least 97%, at least 98%, or at least 99%, but less than 100%, to the amino
acid sequence of the
mature parent protease.
In another embodiment, the variant has at least 80%, at least 85%, at least
90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, such as at least
96%, at least 97%,
at least 98%, or at least 99%, but less than 100%, sequence identity to the
polypeptide of SEQ
ID NO: 3.
11
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
In one aspect, the number of substitutions in the variants of the present
invention is 1-
20, e.g., 1-10 and 1-5, such as 1,2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions.
In one specific aspect the invention relates to a protease variant comprising
a
modification at position corresponding to positions 39, 60, 74, 81, 84, 109,
115, 142, 145, 146,
154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or
362 of the
polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and
wherein the variant
has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 96%, at least
97%, at least 98%, or at least 99%, but less than 100% sequence identity to
the polypeptide of
SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53
family and
wherein the variant has increased thermo-stability compared to the protease of
SEQ ID NO: 3.
More specifically the variant comprises a modification which is a substitution
at position
corresponding to positions 39, 50, 57, 60, 74, 81, 84, 109, 110, 111, 115,
117, 124, 128, 142,
145, 146, 154, 182, 183, 187, 207, 209, 212, 228, 267, 271, 272, 274, 278,
280, 294, 317, 318,
320, 321, 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3,
wherein the variant
has protease activity and wherein the variant has at least 75%, at least 80%,
at least 85%, at
least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least
99%, but less than
100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the
protease is a serine
protease belonging to the S53 family and wherein the variant has increased
thermo-stability
compared to the protease of SEQ ID NO: 3.
More specifically the variant comprises a modification which is a deletion at
position
corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3,
wherein the variant
has protease activity and wherein the variant has at least 75%, at least 80%,
at least 85%, at
least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least
99%, but less than
100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the
protease is a serine
protease belonging to the S53 family and wherein the variant has increased
thermo-stability
compared to the protease of SEQ ID NO: 3.
In a further specific embodiment the variant comprises or consists of at least
one
substitutions and/or deletions selected from the group consisting of: I39M,
I39R, I39L, I390,
5500, K57R, 560P, 560D, E74W , E81A, E81E, E81K, E81R, I840, D109N, D109P,
D110N,
F111P, N115D, N115L, E117D, N124Q, N124L, N124W, G128A, Q142R, Q142W, N145A,
N145D, N145E, N145G, N145K, N145Q, N145V, T146A, T146D, T146E, T146W, T146Y,
Q154R, Q154V, Q154W, Q154Y,Q182G, Q182R, 5183L, 5183P, 5187L, Q207R, V209L,
E212E, I228R, D267N,V2710, S2720, 5272R, 5272V, G274G, G2785, D280N, 5294A,
5317A,
5317G, 53175, 5318N, G3200, K321A, K321G, A3225,T3280, K3430, P348A, T362A,
A3630,
5318* and 5210* of the polypeptide of SEQ ID NO: 3, wherein the variant has
protease activity
and wherein the variant has at least 75%, at least 80%, at least 85%, at least
90%, at least 95%,
at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%
sequence identity
12
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease
belonging to the
S53 family and wherein the variant has increased thermo-stability compared to
the protease of
SEQ ID NO: 3.
In another aspect, the protease variant comprises a modification at position
corresponding to position 39, 60, 74, 81, 84, 109, 115, 117, 142, 145, 146,
154, 182, 183, 187,
209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the
polypeptide of SEQ ID NO:
3, wherein the variant has protease activity and wherein the variant has at
least 75%, at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at
least 98%, or at
least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID
NO: 3, wherein
the protease is a serine protease belonging to the S53 family, and wherein the
increased thermo-
stability is increased residual activity measured after incubation for 30 min
at an elevated
temperature in the range from 55 to 60 degrees Celsius.
More specifically the variant comprises a modification which is a deletion at
position
corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3
wherein the variant
has protease activity and wherein the variant has at least 75%, at least 80%,
at least 85%, at
least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least
99%, but less than
100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the
protease is a serine
protease belonging to the S53 family, and wherein the increased thermo-
stability is increased
residual activity measured after incubation for 30 min at an elevated
temperature in the range
from 55 to 60 degrees Celsius.
More specifically the variant comprises a modification which is a substitution
at position
corresponding to positions 39, 60, 74 81, 84, 109, 115, 142, 145, 146, 154,
182, 183, 187, 209,
212, 228, 267, 272, 280, 294, 317, 348 or 362 of the polypeptide of SEQ ID NO:
3, wherein the
variant has protease activity and wherein the variant has at least 75%, at
least 80%, at least
.. 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%,
or at least 99%, but
less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein
the protease is
a serine protease belonging to the S53 family, wherein the increased thermo-
stability is
increased residual activity measured after incubation for 30 min at a
temperature in the range
from 55 to 60 degrees Celsius.
In a further specific embodiment the variant comprises or consists of one or
more
substitutions and/or deletions selected from the group consisting of: I39M,
I39R, I39L, I39C,
560D, I84C N115D, N115L, E117D, N145G, N145Q, N145V, N145D, N145K, N145K,
N145A,
N145E, 5183L, 5183P, D280N, Q182G, Q182R, E81R, E81K, E81E, E81A, I84C, Q154V,
Q142W, Q142R, T146A, T146W, T146Y, T146E, T146D, I228R, D267N, 5272V, 5272R,
E212E, 5294A, T362A, E74W, 5187L, P348A, D109P, 5317A, 5317G, S317S, 5317A,
S318*
and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease
activity and
wherein the variant has at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, at
13
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%
sequence identity to
the polypeptide of SEQ ID NO: 3, and wherein the increased thermo-stability is
increased
residual activity measured after incubation for 30 min at a temperature in the
range from 55 to
60 degrees Celsius.
In a further specific embodiment the variant comprises at least one of the
following
modifications or combination of modifications:
N115L;
S183P;
D280N;
N115D;
N115L + Q182G;
N115L + Q182R;
E81R + 5183P;
E81K + 5183P;
5183P + Q154V;
5183P + Q142W;
Q142R + 5183P;
5183P + T146A;
5183P + T146W;
5183P + I228R;
5183P + D267N;
5183P + 5272V;
5183P + 5272R;
T146W + D280N;
T146Y + S183P;
5183P + E212E;
5183P + 5294A;
5183P + T362A;
5183P + 5294A;
5183P + E74W;
5183P + E81E;
5183P + E81A;
N115L + 5183L + 5187L;
5183L + V209L + S210*;
D109P + V209L + S210*;
N115D + V209L + S210*;
E81R + V209L + S210*;
14
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
D109P + V209L + S210*;
N115D + V209L + S210*;
E81R + V209L + S210*;
T146W + S183P + D280N;
I840 + S183P + S2720;
I39M + Q142R + S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
I390 + Q142R + S183P;
E117D + Q142R + S183P;
S6OD + Q142R + S183P;
N115L + S183L +S187L + P348A;
D109P + S183P + V209L + S210*;
N115D + S183P + V209L + S210*;
E81R + S183P + V209L +S210*;
V209L + S210* + S317A + S318*;
Q142R + N145G + T146E + S183P;
Q142R + N145Q + T146D + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N145A + T146D +S183P;
Q142R + N145E + T146E + S183P;
N115L + S183L + S187L + V209W + S210*;
N115L + S183L + S187L + V209L + S210*;
N115L + S183L + S187L + S317G + S318*;
N115L + S183L + S187L + S317S +S318*;
N115L +S183L + S187L + S317A + S318*;
E81R + V209L + S210* + S317A + S318*; and wherein the increased thermo-
stability is
increased residual activity measured after incubation for 30 min at a
temperature in the range
from 55 to 60 degrees Celsius. More particularly the variants have a residual
activity of at least
10%, particularly at least 12%, more particularly at least 15%, measured after
incubation for 30
minutes at 56 C.
In a further specific embodiment the variant comprises at least one of the
following
modifications or combination of modifications:
N115L + Q182G;
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
N115D;
Q142R +S183P;
Q142R +N145G +T146E +S183P;
Q142R +N145Q + T146D + S183P;
Q142R +N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R +N145K + T146E + S183P;
Q142R +N145A + T146D +S183P;
I39M + Q142R +S183P;
Q142R + N145E + T146E +S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
E117D + Q142R + S183P;
S6OD + Q142R + S183P; and wherein the variant has residual activity of at
least 30%
measured after incubation for 30 min at an elevated temperature of 57 degrees
Celsius.
In a further specific embodiment the variant comprises at least one of the
following modifications or combination of modifications:
Q142R+ S183P;
Q142R +N145G +T146E +S183P;
Q142R +N145Q +T146D +S183P;
Q142R + N145V + T146E +S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N145A + T146D +S183P;
I39M + Q142R + S183P;
Q142R + N145E + T146E + S183P;
I39R + Q142R + S183P;
I39L +Q142R +S183P;
E117D +Q142R S183P;
Q142R + S183P;
S6OD + Q142R + S183P;
Q142R +S183P; and wherein the variant has residual activity of at least 70%
measured
after incubation for 30 min at 57 degrees Celsius.
In a further specific embodiment the variant comprises at least one of the
following
modification or combination of modifications:
16
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Q142R + S183P;
I390 + Q142R + S183P;
E117D + Q142R + S183P;
Q142R + S183P;
S6OD + Q142R + S183P; and wherein the variant has residual activity of at
least 40%
measured after incubation for 30 min at 60 degrees Celsius.
In a further specific embodiment the variant comprises at least one of the
following
modification or combination of modifications:
Q142R + S183P;
I390 + Q142R +S183P; and wherein the variant has residual activity of at least
40%
measured after incubation for 30 minutes at 62 C.
The present invention relates to a variant comprising a modification at
position
corresponding to position 50, 57, 60, 81, 84, 109, 110, 111, 124, 128, 142,
145, 146, 154, 182,
183, 207, 209, 210, 228, 267, 271, 272, 274, 278, 280, 294, 317, 318, 320,
321, 322, 328, 343,
362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has
protease activity and
wherein the variant has at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, at
least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%
sequence identity to
the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease
belonging to the
S53 family.
More specifically the variant comprises a modification which is a substitution
at position
corresponding to positions 50, 57, 60, 81,84, 109, 110, 111, 124, 128, 142,
145, 146, 154, 182,
183, 207, 209, 228, 267, 271, 272, 274, 278, 280, 294, 317, 318, 320, 321,
322, 328, 343, 362,
or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease
activity and wherein
the variant has at least 75%, at least 80%, at least 85%, at least 90%, at
least 95%, at least
96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence
identity to the
polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease
belonging to the S53
family; and wherein the increase in thermo-stability is an increase in thermal
denaturation
temperature measured by TSA. In particular, the increased thermo-stability
measured as Td by
TSA assay is at least 59 C.
More specifically the variant comprises a modification which is a deletion at
position
corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3,
wherein the variant
has protease activity and wherein the variant has at least 75%, at least 80%,
at least 85%, at
least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least
99%, but less than
100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the
protease is a serine
protease belonging to the S53 family; and wherein the increase in thermo-
stability is an increase
17
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
in thermal denaturation temperature measured by TSA. In particular, the
increased thermo-
stability measured as Td by TSA assay is at least 59 C.
In a further specific embodiment the variant comprises or consists of one or
more
substitution(s) and/or deletion(s) selected from the group consisting of S500,
K57R, S60P,
E81R, 1840, D109P, D109N, D110N, F111P, N124L, N124W, N124Q, G128A, Q142R,
Q142W,
N145V, N145D, N145A, T146A, T146W, T146E, T146D, Q154V, Q154W, Q154,R, Q154Y,
Q182G, Q182R, Si 83P, Si 83L, Q207R, V209L, 1228R, D267N, V271 C, 5272V,
S2720, 5272R,
G274G, G2785, D280N, 5294A, S317A, S318N, G3200, K321G, K321A, A3225, T3280,
K3430, T362A, A363C, 5318* and 5210* of the polypeptide of SEQ ID NO: 3,
wherein the
variant has protease activity and wherein the variant has at least 75%, at
least 80%, at least
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99%, but
less than 100% sequence identity to the polypeptide of SEQ ID NO: 3 and
wherein the increased
thermo-stability measured as Td by TSA assay is at least 59 C
In a further specific embodiment, the variant comprises at least one of the
following
modifications or combination of modifications:
S183P;
D280N;
K57R +5183P;
D109P +S183P+ V209L +5210*;
E81R+ S183P +V209L +5210*;
E81R +V209L +5210*;
Q154V +5183P;
Q142W +5183P;
Q142R +5183P;
T146A +S183P;
Ti 46W +5183P;
S183P +I228R;
S183P +D267N;
S183P +5272V;
E81R +V209L +5210* +5317A +S318*;
S183P +T328C +K343C;
S183P +G3200+ A363C;
Ti 46W +D280N;
Ti 46W +S183L D+280N;
T146W;
Ti 46W +S183P +D280N;
T146Y +5183P;
18
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
S183P +Q207R;
S500 +S183P +V2710;
I840 +S183P+ S2720;
Q142W +T146W +S183P;
Q142W +T146W +S183P+ D280N;
S183P +S294A;
S183P +K321G;
S183P +T362A;
Q182G;
Q142W +T146W +Q182R;
S272V;
S272R;
S60P;
D109N +D110N;
F111P;
G128A;
G278S;
S318N +K321A +A322S;
E81R+ T146W;
E81R +Q142R +S183P;
E81R +Q142W +S183P
S183P +G274G;
E81R;
N124L +Q142R +S183P;
N124W +Q142R +S183P;
N124Q +Q142R +S183P;
Q142R + N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R + N145A +T146D +S183P; and wherein the increased thermo-stability
measured
as Td by TSA assay is at least 59 C.
In a further specific embodiment, the variant comprises at least one of the
following
modifications or combination of modifications:
D280N;
D109P + S183P + V209L + S210*;
E81R + S183P + V209L + S210*;
E81R + V209L +S210*;
Q154V + S183P;
19
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Q142W +S183P;
Q142R + S183P;
T146A + S183P;
T146W + S183P;
S183P + D267N;
S183P + S272V;
E81R + V209L + S210*+ S317A +S318*;
T146W + D280N;
T146W + S183L +D280N;
T146W;
T146W + S183P +D280N;
T146Y + S183P;
S183P + Q207R;
S500 + S183P + V2710;
I840 + S183P + S2720;
Q142W + T146W + S183P;
Q142W + T146W + S183P + D280N;
S183P + S294A;
Q142W + T146W + Q182R;
S272V;
S272R;
S60P;
E81R + T146W;
E81R + Q142R + S183P;
E81R + Q142W + S183P;
S183P + G274G;
E81R;
N124L + Q142R + S183P;
N124W + Q142R + S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E +S183P;
Q142R + N145D + T146E +S183P;
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability
measured as Td by TSA assay is at least 61 C.
In a further specific embodiment, the variant comprises at least one of the
following
modifications or combination of modifications:
E81R + S183P+ V209L +S210*;
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Q142R + S183P;
T146W + D280N;
T146W +S183L + D280N;
T146W + S183P+ D280N;
S500 + S183P + V2710;
I840 + S183P + S2720;
Q142W + T146W + S183P+ D280N;
S272V;
E81R +T146W;
E81R + Q142R + S183P;
N124L + Q142R +S183P;
N124W + Q142R +S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability
measured as Td by TSA assay is at least 63 C.
In a further specific embodiment, the variant comprises at least one of the
following
modifications or combination of modifications:
Q142R + S183P;
S500 + S183P + V2710;
E81R + Q142R + S183P;
N124L + Q142R + S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P; or
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability
measured as Td by TSA assay is at least 65 C.
The variants may further comprise one or more additional modification(s) at
one or more
(e.g., several) other positions. Such further modifications may preferably not
change the
properties of the protease variants of the present invention.
The amino acid changes may be of a minor nature, that is conservative amino
acid
substitutions or insertions that do not significantly affect the folding
and/or activity of the protein;
small deletions, typically of 1-30 amino acids; small amino- or carboxyl-
terminal extensions, such
as an amino-terminal methionine residue; a small linker peptide of up to 20-25
residues; or a
small extension that facilitates purification by changing net charge or
another function, such as
a poly-histidine tract, an antigenic epitope or a binding domain.
21
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Therefore even though the protease variants according to the invention may
only
comprise one specific substitution providing the improved property according
to the invention it
may still have addition modifications leading to a variant protease having at
least 80%, at least
85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence
identity, to the
amino acid sequence of the mature parent protease, e.g., the protease of SEQ
ID NO: 3. These
additional modification should preferably not significantly change the
improved properties of the
variant protease.
Examples of conservative substitutions are within the groups of basic amino
acids
(arginine, lysine and histidine), acidic amino acids (glutamic acid and
aspartic acid), polar amino
acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine
and valine),
aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino
acids (glycine,
alanine, serine, threonine and methionine). Amino acid substitutions that do
not generally alter
specific activity are known in the art and are described, for example, by H.
Neurath and R.L. Hill,
1979, In, The Proteins, Academic Press, New York. Common substitutions are
Ala/Ser, Val/Ile,
Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, AlaNal, Ser/Gly, Tyr/Phe,
Ala/Pro, Lys/Arg,
Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.
Essential amino acids in a polypeptide can be identified according to
procedures known
in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis
(Cunningham
.. and Wells, 1989, Science 244: 1081-1085). In the latter technique, single
alanine mutations are
introduced at every residue in the molecule, and the resultant mutant
molecules are tested for
protease activity to identify amino acid residues that are critical to the
activity of the molecule.
See also, Hilton etal., 1996, J. Biol. Chem. 271: 4699-4708. The active site
of the enzyme or
other biological interaction can also be determined by physical analysis of
structure, as
determined by such techniques as nuclear magnetic resonance, crystallography,
electron
diffraction, or photoaffinity labeling, in conjunction with mutation of
putative contact site amino
acids. See, for example, de Vos etal., 1992, Science 255: 306-312; Smith
etal., 1992, J. Mol.
Biol. 224: 899-904; Wlodaver etal., 1992, FEBS Lett. 309: 59-64.
In an embodiment, the variant has improved (increased) thermo-stability
compared to
.. the parent enzyme, e.g., the polypeptide of SEQ ID NO: 3.
In an embodiment, the variant has improved (increased) residual activity
compared to
parent enzyme, e.g., the polypeptide of SEQ ID NO: 3.
In an embodiment, the variant has improved (increased) thermal melting
temperature
compared to parent enzyme, e.g., the polypeptide of SEQ ID NO: 3.
22
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Parent proteases
The parent protease may be (a) a polypeptide having at least 80% sequence
identity to
the mature polypeptide of SEQ ID NO: 2; (b) a polypeptide encoded by a
polynucleotide that
hybridizes under high stringency conditions with (i) the mature polypeptide
coding sequence of
SEQ ID NO: 1, (ii) the cDNA sequence thereof, or (iii) the full-length
complement of (i) or (ii); or
(c) a polypeptide encoded by a polynucleotide having at least 80% sequence
identity to the
mature polypeptide coding sequence of SEQ ID NO: 1.
In an aspect, the parent has a sequence identity to the mature polypeptide of
SEQ ID
NO: 2 of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%,
at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%, or 100%, which
have protease activity. In one aspect, the amino acid sequence of the parent
differs by up to 10
amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, from the mature
polypeptide of SEQ ID NO: 2.
In another aspect, the parent comprises or consists of the amino acid sequence
of SEQ
ID NO: 3. In another aspect, the parent comprises or consists of amino acids
199 to 564 of SEQ
ID NO: 2.
In another aspect, the parent is encoded by a polynucleotide that hybridizes
under high
stringency conditions, or very high stringency conditions with (i) the mature
polypeptide coding
sequence of SEQ ID NO: 1, (ii) the cDNA sequence thereof, or (iii) the full-
length complement
of (i) or (ii) (Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual,
2d edition, Cold
Spring Harbor, New York).
The polynucleotide of SEQ ID NO: 1 or a subsequence thereof, as well as the
polypeptide
of SEQ ID NO: 2 or a fragment thereof, may be used to design nucleic acid
probes to identify
and clone DNA encoding a parent from strains of different genera or species
according to
methods well known in the art. In particular, such probes can be used for
hybridization with the
genomic DNA or cDNA of a cell of interest, following standard Southern
blotting procedures, in
order to identify and isolate the corresponding gene therein. Such probes can
be considerably
shorter than the entire sequence, but should be at least 15, e.g., at least
25, at least 35, or at
least 70 nucleotides in length. Preferably, the nucleic acid probe is at least
100 nucleotides in
length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400
nucleotides, at least
500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least
800 nucleotides, or
at least 900 nucleotides in length. Both DNA and RNA probes can be used. The
probes are
typically labeled for detecting the corresponding gene (for example, with 32P,
3H, 355, biotin, or
avidin). Such probes are encompassed by the present invention.
A genomic DNA or cDNA library prepared from such other strains may be screened
for
DNA that hybridizes with the probes described above and encodes a parent.
Genomic or other
DNA from such other strains may be separated by agarose or polyacrylamide gel
electrophoresis, or other separation techniques. DNA from the libraries or the
separated DNA
23
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
may be transferred to and immobilized on nitrocellulose or other suitable
carrier material. In order
to identify a clone or DNA that hybridizes with SEQ ID NO: 1 or a subsequence
thereof, the
carrier material is used in a Southern blot.
For purposes of the present invention, hybridization indicates that the
polynucleotide
hybridizes to a labeled nucleic acid probe corresponding to (i) SEQ ID NO: 1;
(ii) the mature
polypeptide coding sequence of SEQ ID NO: 1; (iii) the cDNA sequence thereof;
(iv) the full-
length complement thereof; or (v) a subsequence thereof; under high to very
high stringency
conditions. Molecules to which the nucleic acid probe hybridizes under these
conditions can be
detected using, for example, X-ray film or any other detection means known in
the art.
In one aspect, the nucleic acid probe is the mature polypeptide coding
sequence of SEQ
ID NO: 1. In another aspect, the nucleic acid probe is nucleotides 595 to 1692
of SEQ ID NO: 1.
In another aspect, the nucleic acid probe is a polynucleotide that encodes the
polypeptide of
SEQ ID NO: 2; the mature polypeptide thereof; or a fragment thereof. In
another aspect, the
nucleic acid probe is SEQ ID NO: 1 or the cDNA sequence thereof.
In another embodiment, the parent is encoded by a polynucleotide having a
sequence
identity to the mature polypeptide coding sequence of SEQ ID NO: 1 of at least
80%, at least
85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100%.
The polypeptide may be a hybrid polypeptide in which a region of one
polypeptide is
fused at the N-terminus or the C-terminus of a region of another polypeptide.
The parent may be a fusion polypeptide or cleavable fusion polypeptide in
which another
polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of
the present
invention. A fusion polypeptide is produced by fusing a polynucleotide
encoding another
polypeptide to a polynucleotide of the present invention. Techniques for
producing fusion
polypeptides are known in the art, and include ligating the coding sequences
encoding the
polypeptides so that they are in frame and that expression of the fusion
polypeptide is under
control of the same promoter(s) and terminator. Fusion polypeptides may also
be constructed
using intein technology in which fusion polypeptides are created post-
translationally (Cooper et
al., 1993, EMBO J. 12: 2575-2583; Dawson etal., 1994, Science 266: 776-779).
A fusion polypeptide can further comprise a cleavage site between the two
polypeptides.
Upon secretion of the fusion protein, the site is cleaved releasing the two
polypeptides. Examples
of cleavage sites include, but are not limited to, the sites disclosed in
Martin etal., 2003, J. Ind.
Microbiol. Biotechnol. 3: 568-576; Svetina etal., 2000, J. Biotechnol. 76: 245-
251; Rasmussen-
Wilson etal., 1997, App!. Environ. Microbiol. 63: 3488-3493; Ward etal., 1995,
Biotechnology
13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et
al., 1986,
Biochemistry 25: 505-512; Collins-Racie etal., 1995, Biotechnology 13: 982-
987; Carter etal.,
24
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens,
2003, Drug
Discovery World 4: 35-48.
In another aspect, the parent is a Meripilus giganteus S53 protease, e.g., the
protease
of SEQ ID NO: 2 or the mature polypeptide thereof, disclosed herein as SEQ ID
NO: 3.
Preparation of Variants
The variants can be prepared using any mutagenesis procedure known in the art,
such
as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene
construction,
random mutagenesis, shuffling, etc.
Site-directed mutagenesis is a technique in which one or more (e.g., several)
mutations
are introduced at one or more defined sites in a polynucleotide encoding the
parent.
Site-directed mutagenesis can be accomplished in vitro by PCR involving the
use of
oligonucleotide primers containing the desired mutation. Site-directed
mutagenesis can also be
performed in vitro by cassette mutagenesis involving the cleavage by a
restriction enzyme at a
site in the plasmid comprising a polynucleotide encoding the parent and
subsequent ligation of
an oligonucleotide containing the mutation in the polynucleotide. Usually the
restriction enzyme
that digests the plasmid and the oligonucleotide is the same, permitting
sticky ends of the
plasmid and the insert to ligate to one another. See, e.g., Scherer and Davis,
1979, Proc. Natl.
Acad. Sci. USA 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18:
7349-4966.
Site-directed mutagenesis can also be accomplished in vivo by methods known in
the
art. See, e.g., U.S. Patent Application Publication No. 2004/0171154; Storici
et al., 2001, Nature
Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and
Calissano and Macino,
1996, Fungal Genet. Newslett. 43: 15-16.
Any site-directed mutagenesis procedure can be used in the present invention.
There
are many commercial kits available that can be used to prepare variants.
Synthetic gene construction entails in vitro synthesis of a designed
polynucleotide
molecule to encode a polypeptide of interest. Gene synthesis can be performed
utilizing a
number of techniques, such as the multiplex microchip-based technology
described by Tian et
al. (2004, Nature 432: 1050-1054) and similar technologies wherein
oligonucleotides are
synthesized and assembled upon photo-programmable microfluidic chips.
Single or multiple amino acid substitutions, deletions, and/or insertions can
be made and
tested using known methods of mutagenesis, recombination, and/or shuffling,
followed by a
relevant screening procedure, such as those disclosed by Reidhaar-Olson and
Sauer, 1988,
Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-
2156;
WO 95/17413; or WO 95/22625. Other methods that can be used include error-
prone PCR,
phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; U.S.
Patent No.
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire etal.,
1986, Gene 46:
145; Ner et al., 1988, DNA 7: 127).
Mutagenesis/shuffling methods can be combined with high-throughput, automated
screening methods to detect activity of cloned, mutagenized polypeptides
expressed by host
cells (Ness etal., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA
molecules that
encode active polypeptides can be recovered from the host cells and rapidly
sequenced using
standard methods in the art. These methods allow the rapid determination of
the importance of
individual amino acid residues in a polypeptide.
Semi-synthetic gene construction is accomplished by combining aspects of
synthetic
gene construction, and/or site-directed mutagenesis, and/or random
mutagenesis, and/or
shuffling. Semi-synthetic construction is typified by a process utilizing
polynucleotide fragments
that are synthesized, in combination with PCR techniques. Defined regions of
genes may thus
be synthesized de novo, while other regions may be amplified using site-
specific mutagenic
primers, while yet other regions may be subjected to error-prone PCR or non-
error prone PCR
amplification. Polynucleotide subsequences may then be shuffled.
Polynucleotides
The present invention also relates to polynucleotides encoding a variant of
the present
invention.
Nucleic Acid Constructs
The present invention also relates to nucleic acid constructs comprising a
polynucleotide
encoding a variant of the present invention operably linked to one or more
control sequences
that direct the expression of the coding sequence in a suitable host cell
under conditions
compatible with the control sequences.
The polynucleotide may be manipulated in a variety of ways to provide for
expression of
a variant. Manipulation of the polynucleotide prior to its insertion into a
vector may be desirable
or necessary depending on the expression vector. The techniques for modifying
polynucleotides
utilizing recombinant DNA methods are well known in the art.
The control sequence may be a promoter, a polynucleotide which is recognized
by a host
cell for expression of the polynucleotide. The promoter contains
transcriptional control
sequences that mediate the expression of the variant. The promoter may be any
polynucleotide
that shows transcriptional activity in the host cell including mutant,
truncated, and hybrid
promoters, and may be obtained from genes encoding extracellular or
intracellular polypeptides
either homologous or heterologous to the host cell.
Examples of suitable promoters for directing transcription of the nucleic acid
constructs
of the present invention in a filamentous fungal host cell are promoters
obtained from the genes
26
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase,
Aspergillus niger
acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori
glucoamylase (glaA),
Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease,
Aspergillus oryzae
triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO
96/00787),
.. Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Dana
(WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei
lipase,
Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase,
Trichoderma
reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II,
Trichoderma reesei
endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei
endoglucanase III,
.. Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V,
Trichoderma
reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-
xylosidase, as well
as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-
amylase gene
in which the untranslated leader has been replaced by an untranslated leader
from an
Aspergillus those phosphate isomerase gene; non-limiting examples include
modified promoters
from an Aspergillus niger neutral alpha-amylase gene in which the untranslated
leader has been
replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus
oryzae triose
phosphate isomerase gene); and mutant, truncated, and hybrid promoters
thereof.
The control sequence may also be a transcription terminator, which is
recognized by a
host cell to terminate transcription. The terminator sequence is operably
linked to the 3'-terminus
.. of the polynucleotide encoding the variant. Any terminator that is
functional in the host cell may
be used.
Preferred terminators for filamentous fungal host cells are obtained from the
genes for
Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase,
Aspergillus niger
alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum
trypsin-like
protease.
The control sequence may also be an mRNA stabilizer region downstream of a
promoter
and upstream of the coding sequence of a gene which increases expression of
the gene.
The control sequence may also be a leader, a nontranslated region of an mRNA
that is
important for translation by the host cell. The leader sequence is operably
linked to the
5'-terminus of the polynucleotide encoding the variant. Any leader that is
functional in the host
cell may be used.
Preferred leaders for filamentous fungal host cells are obtained from the
genes for
Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate
isomerase.
The control sequence may also be a polyadenylation sequence, a sequence
operably
linked to the 3'-terminus of the variant-encoding sequence and, when
transcribed, is recognized
by the host cell as a signal to add polyadenosine residues to transcribed
mRNA. Any
polyadenylation sequence that is functional in the host cell may be used.
27
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Preferred polyadenylation sequences for filamentous fungal host cells are
obtained from
the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger
glucoamylase,
Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and
Fusarium
oxysporum trypsin-like protease.
The control sequence may also be a signal peptide coding region that encodes a
signal
peptide linked to the N-terminus of a variant and directs the variant into the
cell's secretory
pathway. The 5'-end of the coding sequence of the polynucleotide may
inherently contain a
signal peptide coding sequence naturally linked in translation reading frame
with the segment of
the coding sequence that encodes the variant. Alternatively, the 5'-end of the
coding sequence
may contain a signal peptide coding sequence that is foreign to the coding
sequence. A foreign
signal peptide coding sequence may be required where the coding sequence does
not naturally
contain a signal peptide coding sequence. Alternatively, a foreign signal
peptide coding
sequence may simply replace the natural signal peptide coding sequence in
order to enhance
secretion of the variant. However, any signal peptide coding sequence that
directs the expressed
variant into the secretory pathway of a host cell may be used.
Effective signal peptide coding sequences for filamentous fungal host cells
are the signal
peptide coding sequences obtained from the genes for Aspergillus niger neutral
amylase,
Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola
insolens cellu lase,
Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor
miehei
aspartic proteinase.
The control sequence may also be a propeptide coding sequence that encodes a
propeptide positioned at the N-terminus of a variant. The resultant
polypeptide is known as a
proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is
generally
inactive and can be converted to an active polypeptide by catalytic or
autocatalytic cleavage of
the propeptide from the propolypeptide. The propeptide coding sequence may be
obtained from
the genes for Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor
miehei aspartic
proteinase.
Where both signal peptide and propeptide sequences are present, the propeptide
sequence is positioned next to the N-terminus of the variant and the signal
peptide sequence is
positioned next to the N-terminus of the propeptide sequence.
It may also be desirable to add regulatory sequences that regulate expression
of the
variant relative to the growth of the host cell. Examples of regulatory
systems are those that
cause expression of the gene to be turned on or off in response to a chemical
or physical
stimulus, including the presence of a regulatory compound. Regulatory systems
in prokaryotic
systems include the lac, tac, and trp operator systems. In yeast, the ADH2
system or GAL1
system may be used. In filamentous fungi, the Aspergillus niger glucoamylase
promoter,
Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae
glucoamylase
28
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
promoter may be used. Other examples of regulatory sequences are those that
allow for gene
amplification. In eukaryotic systems, these regulatory sequences include the
dihydrofolate
reductase gene that is amplified in the presence of methotrexate, and the
metallothionein genes
that are amplified with heavy metals. In these cases, the polynucleotide
encoding the variant
would be operably linked with the regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors
comprising a
polynucleotide encoding a variant of the present invention, a promoter, and
transcriptional and
translational stop signals. The various nucleotide and control sequences may
be joined together
to produce a recombinant expression vector that may include one or more
convenient restriction
sites to allow for insertion or substitution of the polynucleotide encoding
the variant at such sites.
Alternatively, the polynucleotide may be expressed by inserting the
polynucleotide or a nucleic
acid construct comprising the polynucleotide into an appropriate vector for
expression. In
creating the expression vector, the coding sequence is located in the vector
so that the coding
sequence is operably linked with the appropriate control sequences for
expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus)
that can
be conveniently subjected to recombinant DNA procedures and can bring about
expression of
the polynucleotide. The choice of the vector will typically depend on the
compatibility of the vector
with the host cell into which the vector is to be introduced. The vector may
be a linear or closed
circular plasmid.
The vector may be an autonomously replicating vector, i.e., a vector that
exists as an
extrachromosomal entity, the replication of which is independent of
chromosomal replication,
e.g., a plasmid, an extrachromosomal element, a minichromosome, or an
artificial chromosome.
The vector may contain any means for assuring self-replication. Alternatively,
the vector may be
one that, when introduced into the host cell, is integrated into the genome
and replicated together
with the chromosome(s) into which it has been integrated. Furthermore, a
single vector or
plasmid or two or more vectors or plasmids that together contain the total DNA
to be introduced
into the genome of the host cell, or a transposon, may be used.
The vector preferably contains one or more selectable markers that permit easy
selection
of transformed, transfected, transduced, or the like cells. A selectable
marker is a gene the
product of which provides for biocide or viral resistance, resistance to heavy
metals, prototrophy
to auxotrophs, and the like.
Selectable markers for use in a filamentous fungal host cell include, but are
not limited
to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar
(phosphinothricin
acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate
reductase), pyrG
(orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and
trpC (anthranilate
29
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
synthase), as well as equivalents thereof. Preferred for use in an Aspergillus
cell are Aspergillus
nidulans or Aspergillus otyzae niaD, niiA, amdS and pyrG genes and a
Streptomyces
hygroscopicus bar gene.
The vector preferably contains an element(s) that permits integration of the
vector into
the host cell's genome or autonomous replication of the vector in the cell
independent of the
genome.
For integration into the host cell genome, the vector may rely on the
polynucleotide's
sequence encoding the variant or any other element of the vector for
integration into the genome
by homologous or non-homologous recombination. Alternatively, the vector may
contain
additional polynucleotides for directing integration by homologous
recombination into the
genome of the host cell at a precise location(s) in the chromosome(s). To
increase the likelihood
of integration at a precise location, the integrational elements should
contain a sufficient number
of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs,
and 800 to 10,000
base pairs, which have a high degree of sequence identity to the corresponding
target sequence
to enhance the probability of homologous recombination. The integrational
elements may be any
sequence that is homologous with the target sequence in the genome of the host
cell.
Furthermore, the integrational elements may be non-encoding or encoding
polynucleotides. On
the other hand, the vector may be integrated into the genome of the host cell
by non-homologous
recombination.
For autonomous replication, the vector may further comprise an origin of
replication
enabling the vector to replicate autonomously in the host cell in question.
The origin of replication
may be any plasmid replicator mediating autonomous replication that functions
in a cell. The
term "origin of replication" or "plasmid replicator" means a polynucleotide
that enables a plasmid
or vector to replicate in vivo.
Examples of origins of replication useful in a filamentous fungal cell are
AMA1 and ANSI
(Gems etal., 1991, Gene 98: 61-67; Cullen etal., 1987, Nucleic Acids Res. 15:
9163-9175;
WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or
vectors comprising
the gene can be accomplished according to the methods disclosed in WO
00/24883.
More than one copy of a polynucleotide of the present invention may be
inserted into a
host cell to increase production of a variant. An increase in the copy number
of the polynucleotide
can be obtained by integrating at least one additional copy of the sequence
into the host cell
genome or by including an amplifiable selectable marker gene with the
polynucleotide where
cells containing amplified copies of the selectable marker gene, and thereby
additional copies
of the polynucleotide, can be selected for by cultivating the cells in the
presence of the
appropriate selectable agent.
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
The procedures used to ligate the elements described above to construct the
recombinant expression vectors of the present invention are well known to one
skilled in the art
(see, e.g., Sambrook etal., 1989, supra).
Host Cells
The present invention also relates to recombinant host cells, comprising a
polynucleotide
encoding a variant of the present invention operably linked to one or more
control sequences
that direct the production of a variant of the present invention. In a
particular embodiment, the
recombinant host cell comprises the polynucleotide encoding a trehalase
polypeptide of the
present invention, wherein the said polynucleotide is heterologous (of
different origin/species) to
the host cell. A construct or vector comprising a polynucleotide is introduced
into a host cell so
that the construct or vector is maintained as a chromosomal integrant or as a
self-replicating
extra-chromosomal vector as described earlier. The term "host cell"
encompasses any progeny
of a parent cell that is not identical to the parent cell due to mutations
that occur during
replication. The choice of a host cell will to a large extent depend upon the
gene encoding the
variant and its source.
The host cell may be any cell useful in the recombinant production of a
variant, e.g., a
prokaryote or a eukaryote.
The host cell may be a fungal cell. "Fungi" as used herein includes the phyla
Ascomycota,
Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all
mitosporic
fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary
of The Fungi, 8th
edition, 1995, CAB International, University Press, Cambridge, UK).
The fungal host cell may be a yeast cell. "Yeast" as used herein includes
ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast
belonging to
the Fungi lmperfecti (Blastomycetes). Since the classification of yeast may
change in the future,
for the purposes of this invention, yeast shall be defined as described in
Biology and Activities
of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol.
Symposium Series
No. 9, 1980).
The yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia,
Saccharomyces, Schizosaccharomyces, or Yarrowia cell such as a Kluyveromyces
lactis,
Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces
diastaticus,
Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis,
Saccharomyces oviformis, or Yarrowia lipolytica cell.
The fungal host cell may be a filamentous fungal cell. "Filamentous fungi"
include all
filamentous forms of the subdivision Eumycota and Oomycota (as defined by
Hawksworth etal.,
1995, supra). The filamentous fungi are generally characterized by a mycelial
wall composed of
chitin, cellulose, glucan, chitosan, mannan, and other complex
polysaccharides. Vegetative
31
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
growth is by hyphal elongation and carbon catabolism is obligately aerobic. In
contrast,
vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of
a unicellular
thallus and carbon catabolism may be fermentative.
The filamentous fungal host cell may be an Acremonium, Aspergillus,
Aureobasidium,
Bjerkandera, Ceriporiopsis, Chtysosporium, Coprinus, Coriolus, Ctyptococcus,
Filibasidium,
Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocaffimastix,
Neurospora,
Paecilomyces, Peniciffium, Phanerochaete, Phlebia, Piromyces, Pleurotus,
Schizophyllum,
Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma
cell.
For example, the filamentous fungal host cell may be an Aspergillus awamori,
Aspergillus
foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans,
Aspergillus niger,
Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis
caregiea,
Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa,
Ceriporiopsis
subrufa, Ceriporiopsis sub vermispora, Chrysosporium mops, Chtysosporium
keratinophilum,
Chtysosporium lucknowense, Chrysosporium merdarium, Chtysosporium pannicola,
Chtysosporium queenslandicum, Chtysosporium tropicum, Chtysosporium zona turn,
Coprinus
cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis,
Fusarium crookwellense,
Fusarium culmorum, Fusarium graminearum, Fusarium graminurn, Fusarium
heterosporum,
Fusarium negundi, Fusarium oxysporum, Fusarium reticula turn, Fusarium roseum,
Fusarium
sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium
sulphureum,
Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola
insolens,
Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora
crassa,
Peniciffium purpurogenum, Phanerochaete chtysosporium, Phlebia radiata,
Pleurotus etyngii,
Thiela via terrestris, Trametes villosa, Trametes versicolor, Trichoderma
harzianum,
Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or
Trichoderma viride
cell.
Fungal cells may be transformed by a process involving protoplast formation,
transformation of the protoplasts, and regeneration of the cell wall in a
manner known per se.
Suitable procedures for transformation of Aspergillus and Trichoderma host
cells are described
in EP 238023, YeIton etal., 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474,
and Christensen
etal., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming
Fusarium species
are described by Malardier etal., 1989, Gene 78: 147-156, and WO 96/00787.
Yeast may be
transformed using the procedures described by Becker and Guarente, In Abelson,
J.N. and
Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods
in Enzymology,
Volume 194, pp 182-187, Academic Press, Inc., New York; Ito etal., 1983, J.
Bacteriol. 153:
163; and Hinnen etal., 1978, Proc. Natl. Acad. Sci. USA 75: 1920.
32
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Methods of Production
The present invention also relates to methods of producing a variant,
comprising: (a)
cultivating a recombinant host cell of the present invention under conditions
suitable for
expression of the variant; and (b) recovering the variant.
The host cells are cultivated in a nutrient medium suitable for production of
the variant
using methods known in the art. For example, the cell may be cultivated by
shake flask
cultivation, or small-scale or large-scale fermentation (including continuous,
batch, fed-batch, or
solid state fermentations) in laboratory or industrial fermentors performed in
a suitable medium
and under conditions allowing the variant to be expressed and/or isolated. The
cultivation takes
place in a suitable nutrient medium comprising carbon and nitrogen sources and
inorganic salts,
using procedures known in the art. Suitable media are available from
commercial suppliers or
may be prepared according to published compositions (e.g., in catalogues of
the American Type
Culture Collection). If the variant is secreted into the nutrient medium, the
variant can be
recovered directly from the medium. If the variant is not secreted, it can be
recovered from cell
lysates.
The variant may be detected using methods known in the art that are specific
for the
variants. These detection methods include, but are not limited to, use of
specific antibodies,
formation of an enzyme product, or disappearance of an enzyme substrate. For
example, an
enzyme assay may be used to determine the activity of the variant.
The variant may be recovered using methods known in the art. For example, the
variant
may be recovered from the nutrient medium by conventional procedures
including, but not
limited to, collection, centrifugation, filtration, extraction, spray-drying,
evaporation, or
precipitation.
The variant may be purified by a variety of procedures known in the art
including, but not
limited to, chromatography (e.g., ion exchange, affinity, hydrophobic,
chromatofocusing, and
size exclusion), electrophoretic procedures (e.g., preparative isoelectric
focusing), differential
solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction
(see, e.g., Protein
Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to
obtain
substantially pure variants.
In an alternative aspect, the variant is not recovered, but rather a host cell
of the present
invention expressing the variant is used as a source of the variant.
Enzyme Compositions
The present invention also relates to compositions comprising variant protease
of the
invention. Preferably, the compositions are enriched in such a protease. The
term "enriched"
indicates that the pullulanase activity of the composition has been increased,
e.g., with an
enrichment factor of at least 1.1.
33
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
The compositions may comprise the variant S53 protease as the major enzymatic
component, e.g., a mono-component composition. Alternatively, the compositions
may comprise
multiple enzymatic activities, such as the variant S53 protease and one or
more (e.g., several)
enzymes selected from the group consisting of hydrolase, isomerase, ligase,
lyase,
oxidoreductase, or transferase, e.g., an alpha-galactosidase, alpha-
glucosidase,
aminopeptidase, alpha-amylase, beta-amylase, beta-galactosidase, beta-
glucosidase, beta-
xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase,
cellulase, chitinase,
cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase,
esterase,
glucoamylase, invertase, laccase, lipase, mannosidase, mutanase, oxidase,
pectinolytic
enzyme, peroxidase, phytase, polyphenoloxidase, protease, ribonuclease,
transglutaminase, or
xylanase. In one embodiment the composition comprises a variant S53 protease
of the invention
and a carbohydrate-source generating enzyme and optionally an alpha-amylase.
In one
particular embodiment the composition comprises a variant S53 protease and a
glucoamylase.
Preferably the enzyme activities comprised in the composition are selected
from the variant S53
protease of the invention and one or more enzymes selected from the group
consisting of
glucoamylase, fungal alpha-amylase.
In an embodiment the glucoamylase comprised in the composition is of fungal
origin,
preferably from a stain of Aspergillus, preferably A. niger, A. awamori, or A.
otyzae; or a strain
of Trichoderma, preferably T. reesei; or a strain of Talaromyces, preferably
T. emersonii or a
strain of Trametes, preferably T. cingulata, or a strain of Pycnoporus,
preferable P. sanguineus,
or a strain of Gloeophyllum, such as G. serpiarium or G. trabeum, or a strain
of the Nigrofomes.
In an embodiment the glucoamylase is derived from Trametes, such as a strain
of Trametes
cingulata, such as the one shown in SEQ ID NO: 4 herein.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 4 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%,
at least 70%,
e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99% identity
to the polypeptide of SEQ ID NO: 4 herein.
In an embodiment the glucoamylase is derived from Talaromyces, such as a
strain of
Talaromyces emersonii, such as the one shown in SEQ ID NO: 5 herein.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 5 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%,
at least 70%,
e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at
least 92%, at least
34
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99% identity
to the polypeptide of SEQ ID NO: 5 herein.
In an embodiment the glucoamylase is derived from a strain of the genus
Pycnoporus,
in particular a strain of Pycnoporus sanguineus described in WO 2011/066576
(SEQ ID NOs 2,
4 or 6), such as the one shown as SEQ ID NO: 4 in WO 2011/066576.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 6 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%,
at least 70%,
e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at SEQ ID NO: 6 herein.
In an embodiment the glucoamylase is derived from a strain of the genus
Gloeophyllum,
such as a strain of Gloeophyllum sepiarium or Gloeophyllum trabeum, in
particular a strain of
Gloeophyllum as described in WO 2011/068803 (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14
or 16). In a
preferred embodiment the glucoamylase is the Gloeophyllum sepiarium shown in
SEQ ID NO:
2 in WO 2011/068803 or SEQ ID NO: 7 herein.
In an embodiment the glucoamylase is derived from Gloeophyllum serpiarium,
such as
the one shown in SEQ ID NO: 7 herein. In an embodiment the glucoamylase is
selected from
the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 7 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%,
at least 70%,
e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99% identity
to the polypeptide of SEQ ID NO: 7 herein.
In another embodiment the glucoamylase is derived from Gloeophyllum trabeum
such
as the one shown in SEQ ID NO: 8 herein. In an embodiment the glucoamylase is
selected from
the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 8 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%,
at least 70%,
e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99% identity
to the polypeptide of SEQ ID NO: 8 herein.
In an embodiment the glucoamylase is derived from a strain of the genus
Nigrofomes,
in particular a strain of Nigrofomes sp. disclosed in WO 2012/064351.
Glucoamylases may in an embodiment be added to the saccharification and/or
fermentation in an amount of 0.0001-20 AGU/g DS, preferably 0.001-10 AGU/g DS,
especially
between 0.01-5 AGU/g DS, such as 0.1-2 AGU/g DS.
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Commercially available compositions comprising glucoamylase include AMG 200L;
AMG
300 L; SANTM SUPER, SANTM EXTRA L, SPIRIZYMETm PLUS, SPIRIZYMETm FUEL,
SPIRIZYMETm B4U, SPIRIZYMETm ULTRA, SPIRIZYMETm EXCEL and AMGTm E (from
Novozymes NS); OPTIDEXTm 300, GC480, GC417 (from DuPont.); AMIGASETm and
AMIGASETm PLUS (from DSM); G-ZYMETm G900, G-ZYMETm and G990 ZR (from DuPont).
In addition to a glucoamylase the composition may further comprise an alpha-
amylase.
Particularly the alpha-amylase is an acid fungal alpha-amylase. A fungal acid
stable alpha-
amylase is an alpha-amylase that has activity in the pH range of 3.0 to 7.0
and preferably in the
pH range from 3.5 to 6.5, including activity at a pH of about 4.0, 4.5, 5.0,
5.5, and 6Ø
Preferably the acid fungal alpha-amylase is derived from the genus
Aspergillus,
especially a strain of A. terreus, A. niger, A. otyzae, A. awamori, or
Aspergillus kawachii, or from
the genus Rhizomucor, preferably a strain the Rhizomucor push/us, or the genus
Meripilus,
preferably a strain of Meripilus giganteus.
In a preferred embodiment the alpha-amylase is derived from a strain of the
genus
Rhizomucor, preferably a strain the Rhizomucor pusillus, such as one shown in
SEQ ID NO: 3
in WO 2013/006756, such as a Rhizomucor pusillus alpha-amylase hybrid having
an Aspergillus
niger linker and starch-binding domain, such as the one shown in SEQ ID NO: 9
herein, or a
variant thereof.
In an embodiment the alpha-amylase is selected from the group consisting of:
(i) an alpha-amylase comprising the polypeptide of SEQ ID NO: 9 herein;
(ii)
an alpha-amylase comprising an amino acid sequence having at least 60%, at
least
70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least
91%, at least 92%, at
least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, or at least 99%
identity to the polypeptide of SEQ ID NO: 9 herein.
In a preferred embodiment the alpha-amylase is a variant of the alpha-amylase
shown
in SEQ ID NO: 9 having at least one of the following substitutions or
combinations of
substitutions: D165M; Y141W; Y141R; K136F; K192R; P224A; P224R; 5123H + Y141W;
G205
+ Y141W; A76G + Y141W; G128D + Y141W; G128D + D143N; P219C + Y141W; N142D +
D143N; Y141W + K192R; Y141W + D143N; Y141W + N383R; Y141W + P219C + A265C;
Y141W + N142D + D143N; Y141W + K192R V410A; G128D + Y141W + D143N; Y141W +
D143N + P219C; Y141W + D143N + K192R; G128D + D143N + K192R; Y141W + D143N +
K192R + P219C; G128D + Y141W + D143N + K192R; or G128D + Y141W + D143N + K192R
+ P219C (using SEQ ID NO: 9 for numbering).
In an embodiment the alpha-amylase is derived from a Rhizomucor pusillus with
an
Aspergillus niger glucoamylase linker and starch-binding domain (SBD),
preferably disclosed as
SEQ ID NO: 9 herein, preferably having one or more of the following
substitutions: G128D,
D143N, preferably G128D+D143N (using SEQ ID NO: 9 for numbering), and wherein
the alpha-
36
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
amylase variant has at least 75% identity preferably at least 80%, more
preferably at least 85%,
more preferably at least 90%, more preferably at least 91%, more preferably at
least 92%, even
more preferably at least 93%, most preferably at least 94%, and even most
preferably at least
95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but
less than 100%
identity to the polypeptide of SEQ ID NO: 9 herein.
In a preferred embodiment the ratio between glucoamylase and alpha-amylase
present
and/or added during saccharification and/or fermentation may preferably be in
the range from
500:1 to 1:1, such as from 250:1 to 1:1, such as from 100:1 to 1: 1, such as
from 100: 2 to
100:50, such as from 100:3 to 100:70.
The compositions may be prepared in accordance with methods known in the art
and
may be in the form of a liquid or a dry composition. For instance, the
composition may be in the
form of granulate or microgranulate. The variant may be stabilized in
accordance with methods
known in the art.
The compositions may be prepared in accordance with methods known in the art
and
may be in the form of a liquid or a dry composition. The compositions may be
stabilized in
accordance with methods known in the art.
The enzyme composition of the present invention may be in any form suitable
for use, such as,
for example, a crude fermentation broth with or without cells removed, a cell
lysate with or without
cellular debris, a semi-purified or purified enzyme composition, or a host
cell, as a source of the
enzymes.
The enzyme composition may be a dry powder or granulate, a non-dusting
granulate, a
liquid, a stabilized liquid, or a stabilized protected enzyme. Liquid enzyme
compositions may, for
instance, be stabilized by adding stabilizers such as a sugar, a sugar alcohol
or another polyol,
and/or lactic acid or another organic acid according to established processes.
Use of the variant proteases of the invention
Starch Processing
Native starch consists of microscopic granules, which are insoluble in water
at room
temperature. When aqueous starch slurry is heated, the granules swell and
eventually burst,
dispersing the starch molecules into the solution. At temperatures up to about
50 C to 75 C the
swelling may be reversible. However, with higher temperatures an irreversible
swelling called
"gelatinization" begins. During this "gelatinization" process there is a
dramatic increase in
viscosity. Granular starch to be processed may be a highly refined starch
quality, preferably at
least 90%, at least 95%, at least 97% or at least 99.5% pure or it may be a
more crude starch-
containing materials comprising (e.g., milled) whole grains including non-
starch fractions such
as germ residues and fibers. The raw material, such as whole grains, may be
reduced in particle
size, e.g., by milling, in order to open up the structure and allowing for
further processing. In dry
37
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
milling whole kernels are milled and used. Wet milling gives a good separation
of germ and meal
(starch granules and protein) and is often applied at locations where the
starch hydrolysate is
used in the production of, e.g., syrups. Both dry and wet milling is well
known in the art of starch
processing and may be used in a process of the invention. Methods for reducing
the particle size
of the starch containing material are well known to those skilled in the art.
As the solids level is 30-40% in a typical industrial process, the starch has
to be thinned
or "liquefied" so that it can be suitably processed. This reduction in
viscosity is primarily attained
by enzymatic degradation in current commercial practice.
Liquefaction is carried out in the presence of an alpha-amylase, preferably a
bacterial
alpha-amylase and/or acid fungal alpha-amylase. In an embodiment, a phytase is
also present
during liquefaction. In an embodiment, viscosity reducing enzymes such as a
xylanase and/or
beta-glucanase is also present during liquefaction.
During liquefaction, the long-chained starch is degraded into branched and
linear
shorter units (maltodextrins) by an alpha-amylase. Liquefaction may be carried
out as a three-
step hot slurry process. The slurry is heated to between 60-95 C (e.g., 70-90
C, such as 77-
86 C, 80-85 C, 83-85 C) and an alpha-amylase is added to initiate liquefaction
(thinning).
The slurry may in an embodiment be jet-cooked at between 95-140 C, e.g., 105-
125 C,
for about 1-15 minutes, e.g., about 3-10 minutes, especially around 5 minutes.
The slurry is then
cooled to 60-95 C and more alpha-amylase is added to obtain final hydrolysis
(secondary
liquefaction). The jet-cooking process is carried out at pH 4.5-6.5, typically
at a pH between 5
and 6. The alpha-amylase may be added as a single dose, e.g., before jet
cooking.
The liquefaction process is carried out at between 70-95 C, such as 80-90 C,
such as
around 85 C, for about 10 minutes to 5 hours, typically for 1-2 hours. The pH
is between 4 and
7, such as between 4.5 and 5.5. In order to ensure optimal enzyme stability
under these
conditions, calcium may optionally be added (to provide 1-60 ppm free calcium
ions, such as
about 40 ppm free calcium ions). After such treatment, the liquefied starch
will typically have a
"dextrose equivalent" (DE) of 10-15.
Generally liquefaction and liquefaction conditions are well known in the art.
Alpha-amylases for use in liquefaction are preferably bacterial acid stable
alpha-
amylases. Particularly the alpha-amylase is from an Exiguobacterium sp. or a
Bacillus sp. such
as e.g., Bacillus stearothermophilus or Bacillus licheniformis.
In an embodiment the alpha-amylase is from the genus Bacillus, such as a
strain of
Bacillus stearothermophilus, in particular a variant of a Bacillus
stearothermophilus alpha-
amylase, such as the one shown in SEQ ID NO: 3 in WO 99/019467 or SEQ ID NO:
10 herein.
In an embodiment the Bacillus stearothermophilus alpha-amylase has a double
deletion
of two amino acids in the region from position 179 to 182, more particularly a
double deletion at
38
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
positions 1181 + G182, R179 + G180, G180 + 1181, R179 + 1181, or G180 + G182,
preferably
1181 + G182, and optionally a N193F substitution, (using SEQ ID NO: 10 for
numbering).
In an embodiment the Bacillus stearothermophilus alpha-amylase has a
substitution at
position S242, preferably 5242Q substitution.
In an embodiment the Bacillus stearothermophilus alpha-amylase has a
substitution at position
E188, preferably E188P substitution.
In an embodiment the alpha-amylase is selected from the group of Bacillus
stearothermophilus alpha-amylase variants with the following mutations:
- 1181*+G182*+N193F+E129V+K177L+R179E;
- 1181*-FG182*+N193F+V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L
+Q254S;
- I181*+G182*+N193F +V59A Q89R+ E129V+ K177L+ R179E+ Q2545+ M284V; and
- 1181*+G182*+N193F+E129V+K177L+R179E+K220P+N224L+5242Q+Q2545 (using SEQ ID
NO: 10 for numbering).
In an embodiment the alpha-amylase variant has at least 75% identity
preferably at
least 80%, more preferably at least 85%, more preferably at least 90%, more
preferably at least
91%, more preferably at least 92%, even more preferably at least 93%, most
preferably at least
94%, and even most preferably at least 95%, such as even at least 96%, at
least 97%, at least
98%, at least 99%, but less than 100% identity to the polypeptide of SEQ ID
NO: 10.
It should be understood that when referring to Bacillus stearothermophilus
alpha-
amylase and variants thereof they are normally produced in truncated form. In
particular, the
truncation may be so that the Bacillus stearothermophilus alpha-amylase shown
in SEQ ID
NO: 3 in WO 99/19467 or SEQ ID NO: 10 herein, or variants thereof, are
truncated in the C-
terminal preferably to have around 490 amino acids, such as from 482-493 amino
acids.
Preferably the Bacillus stearothermophilus variant alpha-amylase is truncated,
preferably after
position 484 of SEQ ID NO: 10, particularly after position 485, particularly
after position 486,
particularly after position 487, particularly after position 488, particularly
after position 489,
particularly after position 490, particularly after position 491, particularly
after position 492, more
particularly after position 493.
Saccharification may be carried out using conditions well-known in the art
with a
carbohydrate-source generating enzyme, in particular a glucoamylase, or a beta-
amylase and
optionally a debranching enzyme, such as an isoamylase or a pullulanase. For
instance, a full
saccharification step may last from about 24 to about 72 hours. However, it is
common to do a
pre-saccharification of typically 40-90 minutes at a temperature between 30-65
C, typically about
60 C, followed by complete saccharification during fermentation in a
simultaneous
saccharification and fermentation (SSF) process. Saccharification is typically
carried out at a
39
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
temperature in the range of 20-75 C, e.g., 25-65 C and 40-70 C, typically
around 60 C, and at
a pH between about 4 and 5, normally at about pH 4.5.
The saccharification and fermentation steps may be carried out either
sequentially or
simultaneously. In an embodiment, saccharification and fermentation are
performed
simultaneously (referred to as "SSF"). However, it is common to perform a pre-
saccharification
step for about 30 minutes to 2 hours (e.g., 30 to 90 minutes) at a temperature
of 30 to 65 C,
typically around 60 C which is followed by a complete saccharification during
fermentation
referred to as simultaneous saccharification and fermentation (SSF). The pH is
usually between
4.2-4.8, e.g., pH 4.5. In a simultaneous saccharification and fermentation
(SSF) process, there
is no holding stage for saccharification, rather, the yeast and enzymes are
added together.
In a typical saccharification process, maltodextrins produced during
liquefaction are
converted into dextrose by adding a glucoamylase and a debranching enzyme,
such as an
isoamylase (U.S. Patent No. 4,335,208) or a pullulanase. The temperature is
lowered to 60 C,
prior to the addition of the glucoamylase and debranching enzyme. The
saccharification process
proceeds for 24-72 hours. Prior to addition of the saccharifying enzymes, the
pH is reduced to
below 4.5, while maintaining a high temperature (above 95 C), to inactivate
the liquefying alpha-
amylase. This process reduces the formation of short oligosaccharide called
"panose
precursors," which cannot be hydrolyzed properly by the debranching enzyme.
Normally, about
0.2-0.5% of the saccharification product is the branched trisaccharide panose
(Glc pa1-6GIc
.. pa1-4G1c), which cannot be degraded by a pullulanase. If active amylase
from the liquefaction
remains present during saccharification (i.e., no denaturing), the amount of
panose can be as
high as 1-2%, which is highly undesirable since it lowers the saccharification
yield significantly.
Other fermentation products may be fermented at conditions and temperatures
well
known to persons skilled in the art, suitable for the fermenting organism in
question.
The fermentation product may be recovered by methods well known in the art,
e.g., by
distillation. Examples of carbohydrate-source generating enzymes are disclosed
in the
"Enzymes" section below.
In a particular embodiment, the process of the invention further comprises,
prior to the
conversion of a starch-containing material to sugars/dextrins the steps of:
(x) reducing the particle size of the starch-containing material; and
(y) forming a slurry comprising the starch-containing material and
water.
In an embodiment, the starch-containing material is milled to reduce the
particle size. In an
embodiment the particle size is reduced to between 0.05-3.0 mm, preferably 0.1-
0.5 mm, or so
that at least 30%, preferably at least 50%, more preferably at least 70%, even
more preferably
at least 90% of the starch-containing material fits through a sieve with a
0.05-3.0 mm screen,
preferably 0.1-0.5 mm screen.
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
The aqueous slurry may contain from 10-55 wt. % dry solids (DS), preferably 25-
45 wt.
% dry solids (DS), more preferably 30-40 wt. % dry solids (DS) of starch-
containing material.
Conventional starch-conversion processes, such as liquefaction and
saccharification
processes are described, e.g., in U.S. Patent No. 3,912,590, EP 252730 and EP
063909, which
are incorporated herein by reference.
In an embodiment, the conversion process degrading starch to lower molecular
weight
carbohydrate components such as sugars or fat replacers includes a debranching
step.
In the case of converting starch into a sugar, the starch is depolymerized.
Such a
depolymerization process consists of, e.g., a pre-treatment step and two or
three consecutive
process steps, i.e., a liquefaction process, a saccharification process, and
depending on the
desired end-product, an optional isomerization process.
When the desired final sugar product is, e.g., high fructose syrup the
dextrose syrup
may be converted into fructose. After the saccharification process, the pH is
increased to a value
in the range of 6-8, e.g., pH 7.5, and the calcium is removed by ion exchange.
The dextrose
syrup is then converted into high fructose syrup using, e.g., an immobilized
glucose isomerase.
Production of Fermentation Products
Fermentable sugars (e.g., dextrins, monosaccharides, particularly glucose) are
produced from
enzymatic saccharification. These fermentable sugars may be further purified
and/or converted
to useful sugar products. In addition, the sugars may be used as a
fermentation feedstock in a
microbial fermentation process for producing end-products, such as alcohol
(e.g., ethanol, and
butanol), organic acids (e.g., succinic acid, 3-HP and lactic acid), sugar
alcohols (e.g., glycerol),
ascorbic acid intermediates (e.g., gluconate, 2-keto-D-gluconate, 2,5-diketo-D-
gluconate, and 2-
keto-L-gulonic acid), amino acids (e.g., lysine), proteins (e.g., antibodies
and fragment thereof).
In an embodiment, the fermentable sugars obtained during the liquefaction
process
steps are used to produce alcohol and particularly ethanol. In ethanol
production, an SSF
process is commonly used wherein the saccharifying enzymes and fermenting
organisms (e.g.,
yeast) are added together and then carried out at a temperature of 30-40 C.
The organism used in fermentation will depend on the desired end-product.
Typically,
if ethanol is the desired end product yeast will be used as the fermenting
organism. In some
preferred embodiments, the ethanol-producing microorganism is a yeast and
specifically
Saccharomyces such as strains of S. cerevisiae (U.S. Patent No. 4,316,956). A
variety of S.
cerevisiae are commercially available and these include but are not limited to
FALI
(Fleischmann's Yeast), SUPERSTART (Al!tech), FERMIOL (DSM Specialties), RED
STAR
(Lesaffre) and Angel alcohol yeast (Angel Yeast Company, China). The amount of
starter yeast
employed in the methods is an amount effective to produce a commercially
significant amount
of ethanol in a suitable amount of time, (e.g., to produce at least 10%
ethanol from a substrate
having between 25-40% DS in less than 72 hours). Yeast cells are generally
supplied in amounts
41
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
of about 104 to about 1012, and preferably from about 10 to about 1010 viable
yeast count per
mL of fermentation broth. After yeast is added to the mash, it is typically
subjected to
fermentation for about 24-96 hours, e.g., 35-60 hours. The temperature is
between about 26-
34 C, typically at about 32 C, and the pH is from pH 3-6, e.g., around pH 4-5.
The fermentation may include, in addition to a fermenting microorganisms
(e.g., yeast),
nutrients, and additional enzymes, including phytases. The use of yeast in
fermentation is well
known in the art.
In further embodiments, use of appropriate fermenting microorganisms, as is
known in
the art, can result in fermentation end product including, e.g., glycerol, 1,3-
propanediol,
gluconate, 2-keto-D-gluconate, 2,5-diketo-D-gluconate, 2-keto-L-gulonic acid,
succinic acid,
lactic acid, amino acids, and derivatives thereof. More specifically when
lactic acid is the desired
end product, a Lactobacillus sp. (L. casei) may be used; when glycerol or 1,3-
propanediol are
the desired end-products E. coli may be used; and when 2-keto-D-gluconate, 2,5-
diketo-D-
gluconate, and 2-keto-L-gulonic acid are the desired end products, Pantoea
citrea may be used
as the fermenting microorganism. The above enumerated list are only examples
and one skilled
in the art will be aware of a number of fermenting microorganisms that may be
used to obtain a
desired end product.
Processes for producing fermentation products from un-gelatinized starch-
containing material
The invention relates to processes for producing fermentation products from
starch-containing
material without gelatinization (i.e., without cooking) of the starch-
containing material (often
referred to as a "raw starch hydrolysis" process). The fermentation product,
such as ethanol, can
be produced without liquefying the aqueous slurry containing the starch-
containing material and
water. In one embodiment a process of the invention includes saccharifying
(e.g., milled) starch-
containing material, e.g., granular starch, below the initial gelatinization
temperature, preferably
in the presence of alpha-amylase and/or carbohydrate-source generating
enzyme(s) to produce
sugars that can be fermented into the fermentation product by a suitable
fermenting organism.
In this embodiment the desired fermentation product, e.g., ethanol, is
produced from un-
gelatinized (i.e., uncooked), preferably milled, cereal grains, such as corn.
Accordingly, in one aspect the invention relates to processes for producing a
fermentation product from starch-containing material comprising simultaneously
saccharifying
and fermenting starch-containing material using a carbohydrate-source
generating enzymes and
a fermenting organism at a temperature below the initial gelatinization
temperature of said
starch-containing material in the presence of a variant protease of the
invention. Saccharification
and fermentation may also be separate. Thus in another aspect the invention
relates to
processes of producing fermentation products, comprising the following steps:
42
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
(I) saccharifying a starch-containing material at a temperature below
the initial
gelatinization temperature using a carbohydrate-source generating enzyme,
e.g., a
glucoamylase; and
(ii) fermenting using a fermentation organism;
wherein step (i) is carried out using at least a glucoamylase, and a variant
protease of the
invention.
In one embodiment the fermenting organism expresses the variant protease of
the invention.
In one embodiment, an alpha amylase is also added in step (i). Steps (i) and
(ii) may
be performed simultaneously.
The fermentation product, e.g., ethanol, may optionally be recovered after
fermentation,
e.g., by distillation. Typically amylase(s), such as glucoamylase(s) and/or
other carbohydrate-
source generating enzymes, and/or alpha-amylase(s), is(are) present during
fermentation.
Examples of glucoamylases and other carbohydrate-source generating enzymes
include raw
starch hydrolyzing glucoamylases. Examples of alpha-amylase(s) include acid
alpha-amylases
such as acid fungal alpha-amylases. Examples of fermenting organisms include
yeast, e.g., a
strain of Saccharomyces cerevisiae. The term "initial gelatinization
temperature" means the
lowest temperature at which starch gelatinization commences. In general,
starch heated in water
begins to gelatinize between about 50 C and 75 C; the exact temperature of
gelatinization
depends on the specific starch and can readily be determined by the skilled
artisan. Thus, the
initial gelatinization temperature may vary according to the plant species, to
the particular variety
of the plant species as well as with the growth conditions. In the context of
this invention the
initial gelatinization temperature of a given starch-containing material may
be determined as the
temperature at which birefringence is lost in 5% of the starch granules using
the method
described by Gorinstein and Lii, 1992, Starch/Starke 44(12): 461-466. Before
initiating the
process a slurry of starch-containing material, such as granular starch,
having 10-55 w/w % dry
solids (DS), preferably 25-45 w/w % dry solids, more preferably 30-40 w/w %
dry solids of starch-
containing material may be prepared. The slurry may include water and/or
process waters, such
as stillage (backset), scrubber water, evaporator condensate or distillate,
side-stripper water
from distillation, or process water from other fermentation product plants.
Because the process
of the invention is carried out below the initial gelatinization temperature,
and thus no significant
viscosity increase takes place, high levels of stillage may be used if
desired. In an embodiment
the aqueous slurry contains from about 1 to about 70 vol. %, preferably 15-60
vol. %, especially
from about 30 to 50 vol. % water and/or process waters, such as stillage
(backset), scrubber
water, evaporator condensate or distillate, side-stripper water from
distillation, or process water
from other fermentation product plants, or combinations thereof, or the like.
The starch-
43
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
containing material may be prepared by reducing the particle size, preferably
by dry or wet
milling, to 0.05 to 3.0 mm, preferably 0.1-0.5 mm. After being subjected to a
process of the
invention at least 85%, at least 86%, at least 87%, at least 88%, at least
89%, at least 90%, at
least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least
96%, at least 97%, at
least 98%, or preferably at least 99% of the dry solids in the starch-
containing material are
converted into a soluble starch hydrolyzate. A process in this aspect of the
invention is conducted
at a temperature below the initial gelatinization temperature, which means
that the temperature
typically lies in the range between 30-75 C, preferably between 45-60 C. In a
preferred
embodiment the process carried at a temperature from 25 C to 40 C, such as
from 28 C to
35 C, such as from 30 C to 34 C, preferably around 32 C. In an embodiment the
process is
carried out so that the sugar level, such as glucose level, is kept at a low
level, such as below 6
w/w %, such as below about 3 w/w %, such as below about 2 w/w %, such as below
about 1
w/w %., such as below about 0.5 w/w %, or below 0.25 w/w %, such as below
about 0.1 w/w %.
Such low levels of sugar can be accomplished by simply employing adjusted
quantities of
enzyme and fermenting organism. A skilled person in the art can easily
determine which
doses/quantities of enzyme and fermenting organism to use. The employed
quantities of enzyme
and fermenting organism may also be selected to maintain low concentrations of
maltose in the
fermentation broth. For instance, the maltose level may be kept below about
0.5 w/w %, such as
below about 0.2 w/w %. The process of the invention may be carried out at a pH
from about 3
and 7, preferably from pH 3.5 to 6, or more preferably from pH 4 to 5. In an
embodiment
fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
Processes for producing fermentation products from gelatinized starch-
containing material
In this aspect, the invention relates to processes for producing fermentation
products, especially
ethanol, from starch-containing material, which process includes a
liquefaction step and
sequentially or simultaneously performed saccharification and fermentation
steps.
Consequently, the invention relates to a process for producing a fermentation
product from
starch-containing material comprising the steps of:
(a) liquefying starch-containing material in the presence of an
alpha-amylase;
(b) saccharifying the liquefied material obtained in step (a) using a
carbohydrate-
source generating enzyme;
(c) fermenting using a fermenting organism;
wherein a variant protease of the invention is present during step b) and/or
c).
In one embodiment, the fermenting organism expresses the variant protease of
the invention.
44
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
The fermentation product, such as especially ethanol, may optionally be
recovered after
fermentation, e.g., by distillation. The fermenting organism is preferably
yeast, preferably a strain
of Saccharomyces cerevisiae. In a particular embodiment, the process of the
invention further
comprises, prior to step (a), the steps of:
x) reducing the particle size of the starch-containing material,
preferably by
milling (e.g., using a hammer mill);
y) forming a slurry comprising the starch-containing material
and water.
In an embodiment, the particle size is smaller than a # 7 screen, e.g., a # 6
screen. A #
7 screen is usually used in conventional prior art processes. The aqueous
slurry may contain
from 10-55, e.g., 25-45 and 30-40, w/w % dry solids (DS) of starch-containing
material. The
slurry is heated to above the gelatinization temperature and an alpha-amylase
variant may be
added to initiate liquefaction (thinning). The slurry may in an embodiment be
jet-cooked to further
gelatinize the slurry before being subjected to alpha-amylase in step (a).
Liquefaction may in an
embodiment be carried out as a three-step hot slurry process. The slurry is
heated to between
.. 60-95 C, preferably between 70-90 C, such as preferably between 80-85 Cat
pH 4-6, preferably
4.5-5.5, and alpha-amylase variant, optionally together with a pullulanase
and/or protease,
preferably metalloprotease, are added to initiate liquefaction (thinning). In
an embodiment the
slurry may then be jet-cooked at a temperature between 95-140 C, preferably
100-135 C, such
as 105-125 C, for about 1-15 minutes, preferably for about 3-10 minutes,
especially around
about 5 minutes. The slurry is cooled to 60-95 C and more alpha-amylase
variant and optionally
pullulanase variant and/or protease, preferably metalloprotease, is(are) added
to finalize
hydrolysis (secondary liquefaction). The liquefaction process is usually
carried out at pH 4.0-6,
in particular at a pH from 4.5 to 5.5. Saccharification step (b) may be
carried out using conditions
well known in the art. For instance, a full saccharification process may last
up to from about 24
to about 72 hours, however, it is common only to do a pre-saccharification of
typically 40-90
minutes at a temperature between 30-65 C, typically about 60 C, followed by
complete
saccharification during fermentation in a simultaneous saccharification and
fermentation process
(SSF process). Saccharification is typically carried out at temperatures from
20-75 C, preferably
from 40-70 C, typically around 60 C, and at a pH between 4 and 5, normally at
about pH 4.5.
The most widely used process to produce a fermentation product, especially
ethanol, is a
simultaneous saccharification and fermentation (SSF) process, in which there
is no holding
stage for the saccharification, meaning that a fermenting organism, such as
yeast, and
enzyme(s), may be added together. SSF may typically be carried out at a
temperature from 25 C
to 40 C, such as from 28 C to 35 C, such as from 30 C to 34 C, preferably
around about 32 C.
In an embodiment fermentation is ongoing for 6 to 120 hours, in particular 24
to 96 hours.
Glucoamylase Present And/Or Added In Saccharification And/Or Fermentation
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
The carbohydrate-source generating enzyme present during saccharification may
in one
embodiment be a glucoamylase. A glucoamylase is present and/or added in
saccharification
and/or fermentation, preferably simultaneous saccharification and fermentation
(SSF), in a
process of the invention (i.e., saccharification and fermentation of
ungelatinized or gelatinized
starch material).
In an embodiment the glucoamylase present and/or added in saccharification
and/or
fermentation is of fungal origin, preferably from a stain of Aspergillus,
preferably A. niger, A.
awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reesei; or a
strain of
Talaromyces, preferably T. emersonii or a strain of Trametes, preferably T.
cingulata, or a strain
of Pycnoporus, preferably P. sanguineus, or a strain of Gloeophyllum, such as
G. serpiarium or
G. trabeum, or a strain of the Nigrofomes.
In an embodiment the glucoamylase is derived from Trametes, such as a strain
of
Trametes cingulata, such as the one shown in SEQ ID NO: 4 herein.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 4 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%,
at least 70%,
e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99% identity
to the polypeptide of SEQ ID NO: 4 herein.
In an embodiment the glucoamylase is derived from Talaromyces, such as a
strain of
Talaromyces emersonii, such as the one shown in SEQ ID NO: 5 herein.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 5 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%,
at
least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at
least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, or at
least 99% identity to the polypeptide of SEQ ID NO: 5 herein.
In an embodiment the glucoamylase is derived from a strain of the genus
Pycnoporus,
in particular a strain of Pycnoporus sanguineus described in WO 2011/066576
(SEQ ID NOs 2,
4 or 6), such as the one shown as SEQ ID NO: 4 in WO 2011/066576.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 6 herein;
46
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
(ii)
a glucoamylase comprising an amino acid sequence having at least 60%, at
least 70%,
e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at 6 herein.
In an embodiment the glucoamylase is derived from a strain of the genus
Gloeophyllum,
such as a strain of Gloeophyllum sepiarium or Gloeophyllum trabeum, in
particular a strain of
Gloeophyllum as described in WO 2011/068803 (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14
or 16). In a
preferred embodiment the glucoamylase is the Gloeophyllum sepiarium shown in
SEQ ID NO:
2 in WO 2011/068803 or SEQ ID NO: 7 herein.
In an embodiment the glucoamylase is derived from Gloeophyllum serpiarium,
such as
the one shown in SEQ ID NO: 7 herein. In an embodiment the glucoamylase is
selected from
the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 7
herein;
(ii) a
glucoamylase comprising an amino acid sequence having at least 60%, at
least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at
least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, or at
least 99% identity to the polypeptide of SEQ ID NO: 7 herein.
In another embodiment the glucoamylase is derived from Gloeophyllum trabeum
such
as the one shown in SEQ ID NO: 8 herein. In an embodiment the glucoamylase is
selected from
the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 8 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%,
at
least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at
least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, or at
least 99% identity to the polypeptide of SEQ ID NO: 8 herein.
In an embodiment the glucoamylase is derived from a strain of the genus
Nigrofomes, in
particular a strain of Nigrofomes sp. disclosed in WO 2012/064351.
Glucoamylases may in an embodiment be added to the saccharification and/or
fermentation in an amount of 0.0001-20 AGU/g DS, preferably 0.001-10 AGU/g DS,
especially
between 0.01-5 AGU/g DS, such as 0.1-2 AGU/g DS.
Commercially available compositions comprising glucoamylase include AMG 200L;
AMG
300 L; SANTM SUPER, SANTM EXTRA L, SPIRIZYMETm PLUS, SPIRIZYMETm FUEL,
47
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
SPIRIZYMETm B4U, SPIRIZYMETm ULTRA, SPIRIZYMETm EXCEL and AMGTm E (from
Novozymes NS); OPTIDEXTm 300, GC480, GC417 (from DuPont.); AMIGASETm and
AMIGASETm PLUS (from DSM); G-ZYMETm G900, G-ZYMETm and G990 ZR (from DuPont).
According to a preferred embodiment of the invention the glucoamylase is
present and/or
added in saccharification and/or fermentation in combination with an alpha-
amylase. Examples
of suitable alpha-amylase are described below.
Alpha-Amylase Present and/or Added In Saccharification And/Or Fermentation
In an embodiment an alpha-amylase is present and/or added in saccharification
and/or
fermentation in the processes of the invention. In a preferred embodiment the
alpha-amylase is
of fungal or bacterial origin. In a preferred embodiment the alpha-amylase is
a fungal acid stable
alpha-amylase. A fungal acid stable alpha-amylase is an alpha-amylase that has
activity in the
pH range of 3.0 to 7.0 and preferably in the pH range from 3.5 to 6.5,
including activity at a pH
of about 4.0, 4.5, 5.0, 5.5, and 6Ø
In a preferred embodiment the alpha-amylase present and/or added in
saccharification
and/or fermentation is derived from a strain of the genus Rhizomucor,
preferably a strain the
Rhizomucor pusillus, such as one shown in SEQ ID NO: 3 in WO 2013/006756, such
as a
Rhizomucor push/us alpha-amylase hybrid having an Aspergillus niger linker and
starch-binding
domain, such as the one shown in SEQ ID NO: 9 herein, or a variant thereof.
In an embodiment the alpha-amylase present and/or added in saccharification
and/or
fermentation is selected from the group consisting of:
(i) an alpha-amylase comprising the polypeptide of SEQ ID NO: 9 herein;
(ii) an alpha-amylase comprising an amino acid sequence having at least
60%, at
least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at
least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, or at
least 99% identity to the polypeptide of SEQ ID NO: 9 herein.
In a preferred embodiment the alpha-amylase is a variant of the alpha-amylase
shown
in SEQ ID NO: 9 having at least one of the following substitutions or
combinations of
substitutions: D165M; Y141W; Y141R; K136F; K192R; P224A; P224R; 5123H + Y141W;
G205
+ Y141W; A76G + Y141W; G128D + Y141W; G128D + D143N; P219C + Y141W; N142D +
D143N; Y141W + K192R; Y141W + D143N; Y141W + N383R; Y141W + P219C + A265C;
Y141W + N142D + D143N; Y141W + K192R V410A; G128D + Y141W + D143N; Y141W +
D143N + P219C; Y141W + D143N + K192R; G128D + D143N + K192R; Y141W + D143N +
K192R + P219C; G128D + Y141W + D143N + K192R; or G128D + Y141W + D143N + K192R
+ P219C (using SEQ ID NO: 9 for numbering).
48
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
In an embodiment the alpha-amylase is derived from a Rhizomucor push/us with
an
Aspergillus niger glucoamylase linker and starch-binding domain (SBD),
preferably disclosed as
SEQ ID NO: 9 herein, preferably having one or more of the following
substitutions: G128D,
D143N, preferably G128D+D143N (using SEQ ID NO: 9 for numbering), and wherein
the alpha-
amylase variant present and/or added in saccharification and/or fermentation
has at least 75%
identity preferably at least 80%, more preferably at least 85%, more
preferably at least 90%,
more preferably at least 91%, more preferably at least 92%, even more
preferably at least 93%,
most preferably at least 94%, and even most preferably at least 95%, such as
even at least 96%,
at least 97%, at least 98%, at least 99%, but less than 100% identity to the
polypeptide of SEQ
ID NO: 9 herein.
In a preferred embodiment the ratio between glucoamylase and alpha-amylase
present
and/or added during saccharification and/or fermentation may preferably be in
the range from
500:1 to 1:1, such as from 250:1 to 1:1, such as from 100:1 to 1: 1, such as
from 100: 2 to
100:50, such as from 100:3 to 100:70.
Starch-Containing Materials
Any suitable starch-containing starting material may be used in a process of
the present
invention. The starting material is generally selected based on the desired
fermentation product.
Examples of starch-containing starting materials, suitable for use in the
processes of the present
invention, include barley, beans, cassava, cereals, corn, milo, peas,
potatoes, rice, rye, sago,
sorghum, sweet potatoes, tapioca, wheat, and whole grains, or any mixture
thereof. The starch-
containing material may also be a waxy or non-waxy type of corn and barley. In
a preferred
embodiment the starch-containing material is corn. In a preferred embodiment
the starch-
containing material is wheat.
Fermentation Products
The term "fermentation product" means a product produced by a method or
process
including fermenting using a fermenting organism. Fermentation products
include alcohols (e.g.,
ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid,
itaconic acid, lactic acid,
succinic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g.,
glutamic acid); gases
(e.g., H2 and CO2); antibiotics (e.g., penicillin and tetracycline); enzymes;
vitamins (e.g.,
riboflavin, B12, beta-carotene); and hormones. In a preferred embodiment the
fermentation
product is ethanol, e.g., fuel ethanol; drinking ethanol, i.e., potable
neutral spirits; or industrial
ethanol or products used in the consumable alcohol industry (e.g., beer and
wine), dairy industry
(e.g., fermented dairy products), leather industry and tobacco industry.
Preferred beer types
comprise ales, stouts, porters, lagers, bitters, malt liquors, happoushu, high-
alcohol beer, low-
49
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
alcohol beer, low-calorie beer or light beer. In an preferred embodiment the
fermentation product
is ethanol.
Fermenting Organisms
The term "fermenting organism" refers to any organism, including bacterial and
fungal
organisms, such as yeast and filamentous fungi, suitable for producing a
desired fermentation
product. Suitable fermenting organisms are able to ferment, i.e., convert,
fermentable sugars,
such as arabinose, fructose, glucose, maltose, mannose, or xylose, directly or
indirectly into the
desired fermentation product.
Examples of fermenting organisms include fungal organisms such as yeast.
Preferred yeast
include strains of Saccharomyces, in particular Saccharomyces cerevisiae or
Saccharomyces
uvarum; strains of Pichia, in particular Pichia stipitis such as Pichia
stipitis CBS 5773 or Pichia
pastoris; strains of Candida, in particular Candida arabinofermentans, Candida
boidinii, Candida
diddensii, Candida shehatae, Candida sonorensis, Candida tropicalis, or
Candida utilis. Other
fermenting organisms include strains of Hansenula, in particular Hansenula
anomala or
Hansenula polymorpha; strains of Kluyveromyces, in particular Kluyveromyces
fragilis or
Kluyveromyces marxianus; and strains of Schizosaccharomyces, in particular
Schizosaccharomyces pombe.
Preferred bacterial fermenting organisms include strains of Escherichia, in
particular Escherichia
co/l, strains of Zymomonas, in particular Zymomonas mobilis, strains of
Zymobacter, in particular
Zymobactor palmae, strains of Klebsiella in particular Klebsiella oxytoca,
strains of Leuconostoc,
in particular Leuconostoc mesenteroides, strains of Clostridium, in particular
Clostridium
butyricum, strains of Enterobacter, in particular Enterobacter aerogenes, and
strains of
Thermoanaerobacter, in particular Thermoanaerobacter BG1L1 (Appl. Microbiol.
Biotech. 77:
61-86), Thermoanarobacter ethanolicus, Thermoanaerobacter mathranii, or
Thermoanaerobacter thermosaccharolyticum. Strains of Lactobacillus are also
envisioned as
are strains of Cotynebacterium glutamicum R, Bacillus thermoglucosidaisus, and
Geobacillus
the rmoglucosidasius.
In an embodiment, the fermenting organism is a C6 sugar fermenting organism,
such as a strain
of, e.g., Saccharomyces cerevisiae.
In an embodiment, the fermenting organism is a C5 sugar fermenting organism,
such as a strain
of, e.g., Saccharomyces cerevisiae.
In one embodiment, the fermenting organism is added to the fermentation medium
so that the
viable fermenting organism, such as yeast, count per mL of fermentation medium
is in the range
from 105 to 1012, preferably from 107 to 1010, especially about 5x107.
Yeast is the preferred fermenting organism for ethanol fermentation. Preferred
are strains of
Saccharomyces, especially strains of the species Saccharomyces cerevisiae,
preferably strains
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
which are resistant towards high levels of ethanol, i.e., up to, e.g., about
10, 12, 15 or 20 vol. %
or more ethanol.
In an embodiment, the 05 utilizing yeast is a Saccharomyces cerevisea strain
disclosed in WO
2004/085627.
In an embodiment, the fermenting organism is a 05 eukaryotic microbial cell
concerned in WO
2010/074577 (Nedalco).
In an embodiment, the fermenting organism is a transformed 05 eukaryotic cell
capable of
directly isomerize xylose to xylulose disclosed in US 2008/0014620.
In an embodiment, the fermenting organism is a 05 sugar fermentating cell
disclosed in WO
2009/109633.
Commercially available yeast include LNF SA-1, LNF BG-1, LNF PE-2,and LNF CAT-
1
(available from LNF Brazil), RED STARTm and ETHANOL REDTM yeast (available
from
Fermentis/Lesaffre, USA), FALI (available from Fleischmann's Yeast, USA),
SUPERSTART and
THERMOSACCTm fresh yeast (available from Ethanol Technology, WI, USA), BIOFERM
AFT
and XR (available from NABC - North American Bioproducts Corporation, GA,
USA), GERT
STRAND (available from Gert Strand AB, Sweden), and FERMIOL (available from
DSM
Specialties).
The fermenting organism capable of producing a desired fermentation product
from fermentable
sugars is preferably grown under precise conditions at a particular growth
rate. When the
fermenting organism is introduced into/added to the fermentation medium the
inoculated
fermenting organism pass through a number of stages. Initially growth does not
occur. This
period is referred to as the "lag phase" and may be considered a period of
adaptation. During
the next phase referred to as the "exponential phase" the growth rate
gradually increases. After
a period of maximum growth the rate ceases and the fermenting organism enters
"stationary
phase". After a further period of time the fermenting organism enters the
"death phase" where
the number of viable cells declines.
Fermentation
The fermentation conditions are determined based on, e.g., the kind of plant
material, the
available fermentable sugars, the fermenting organism(s) and/or the desired
fermentation
product. One skilled in the art can easily determine suitable fermentation
conditions. The
fermentation may be carried out at conventionally used conditions. Preferred
fermentation
processes are anaerobic processes.
For example, fermentations may be carried out at temperatures as high as 75 C,
e.g., between
40-70 C, such as between 50-60 C. However, bacteria with a significantly lower
temperature
optimum down to around room temperature (around 20 C) are also known. Examples
of suitable
fermenting organisms can be found in the "Fermenting Organisms" section above.
51
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
For ethanol production using yeast, the fermentation may go on for 24 to 96
hours, in particular
for 35 to 60 hours. In an embodiment the fermentation is carried out at a
temperature between
20 to 40 C, preferably 26 to 34 C, in particular around 32 C. In an embodiment
the pH is from
pH 3 to 6, preferably around pH 4 to 5.
Other fermentation products may be fermented at temperatures known to the
skilled person in
the art to be suitable for the fermenting organism in question.
Fermentation is typically carried out at a pH in the range between 3 and 7,
preferably from pH
3.5 to 6, such as around pH 5. Fermentations are typically ongoing for 6-96
hours.
The processes of the invention may be performed as a batch or as a continuous
process.
Fermentations may be conducted in an ultrafiltration system wherein the
retentate is held under
recirculation in the presence of solids, water, and the fermenting organism,
and wherein the
permeate is the desired fermentation product containing liquid. Equally
contemplated are
methods/processes conducted in continuous membrane reactors with
ultrafiltration membranes
and where the retentate is held under recirculation in presence of solids,
water, and the
fermenting organism(s) and where the permeate is the fermentation product
containing liquid.
After fermentation the fermenting organism may be separated from the fermented
slurry and
recycled.
Fermentation Medium
The phrase "fermentation media" or "fermentation medium" refers to the
environment in which
fermentation is carried out and comprises the fermentation substrate, that is,
the carbohydrate
source that is metabolized by the fermenting organism(s).
The fermentation medium may comprise other nutrients and growth stimulator(s)
for the
fermenting organism(s). Nutrient and growth stimulators are widely used in the
art of
fermentation and include nitrogen sources, such as ammonia; vitamins and
minerals, or
combinations thereof.
Recovery
Subsequent to fermentation, the fermentation product may be separated from the
fermentation
medium. The fermentation medium may be distilled to extract the desired
fermentation product
or the desired fermentation product may be extracted from the fermentation
medium by micro or
membrane filtration techniques. Alternatively, the fermentation product may be
recovered by
stripping. Methods for recovery are well known in the art.
The present invention is further described in the following numbered
paragraphs.
Paragraph [1] A protease variant comprising a modification at one or more
positions
corresponding to positions 39, 50, 57, 60, 74, 81, 84, 109, 110, 111, 115,
117, 124, 128, 142,
52
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271, 272, 274,
278, 280, 294, 317,
318, 320, 321, 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO:
3, wherein the
variant has protease activity and wherein the variant has at least 75%, at
least 80%, at least
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99%, but
less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 3,
and wherein the
variant has increased thermo-stability compared to the protease of SEQ ID NO:
3.
Paragraph [2] The variant of paragraph 1, which comprises a modification which
is a substitution
at a position corresponding to positions 39, 50, 57, 60, 74, 81, 84, 109, 110,
111, 115, 117, 124,
128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 212, 228, 267, 271, 272,
274, 278, 280, 294,
317, 318, 320, 321, 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ
ID NO: 3, wherein
the variant has protease activity and wherein the variant has at least 75%, at
least 80%, at least
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99%, but
less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein
the protease is
a serine protease belonging to the S53 family and wherein the variant has
increased thermo-
stability compared to the protease of SEQ ID NO: 3.
Paragraph [3] The variant of paragraph 1, which comprises a modification which
is a deletion at
a position corresponding to position 318 or 210 of the polypeptide of SEQ ID
NO: 3, wherein the
variant has protease activity and wherein the variant has at least 75%, at
least 80%, at least
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99%, but
less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein
the protease is
a serine protease belonging to the S53 family and wherein the variant has
increased thermo-
stability compared to the protease of SEQ ID NO: 3.
Paragraph [4] The variant of any of the preceding paragraphs, wherein the
variant comprises or
consists of at least one substitution and/or deletion selected from the group
consisting of I39M,
I39R, I39L, I390, 5500, K57R, 560P, 560D, E74W , E81A, E81E, E81K, E81R, I840,
D109N,
D109P, D110N, F111P, N115D, N115L, E117D, N124Q, N124L, N124W,G128A, Q142R,
Q142W, N145A, N145D, N145E, N145G, N145K, N145Q, N145V, T146A, T146D, T146E,
T146W, T146Y, Q154R, Q154V, Q154W, Q154Y,Q182G, Q182R, 5183L, 5183P, 5187L,
Q207R, V209L, E212E, I228R, D267N, V2710, S2720, 5272R, 5272V, G274G, G2785,
D280N, 5294A, 5317A, 5317G, 53175, 5318N, G3200, K321A, K321G, A3225,T3280,
K3430, P348A, T362A, A3630, 5318* and 5210* of the polypeptide of SEQ ID NO:
3, wherein
the variant has protease activity and wherein the variant has at least 75%, at
least 80%, at least
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99%, but
less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein
the protease is
53
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
a serine protease belonging to the S53 family and wherein the variant has
increased thermo-
stability compared to the protease of SEQ ID NO: 3.
Paragraph [5] The variant according to any of the paragraphs 1-4, comprising a
modification at
a position corresponding to position 39, 60, 74, 81, 84, 109, 115, 117, 142,
145, 146, 154, 182,
183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the
polypeptide of
SEQ ID NO: 3, wherein the variant has protease activity and wherein the
variant has at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at
least 97%, at least
98%, or at least 99%, but less than 100% sequence identity to the polypeptide
of SEQ ID NO:
3, wherein the protease is a serine protease belonging to the S53 family.
Paragraph [6] The variant of paragraph 5, which comprises a modification which
is a deletion at
a position corresponding to position 318 or 210 of the polypeptide of SEQ ID
NO: 3 wherein the
variant has protease activity and wherein the variant has at least 75%, at
least 80%, at least
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99%, but
less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein
the protease is
a serine protease belonging to the S53 family.
Paragraph [7] The variant of paragraph 5, which comprises a modification which
is a substitution
at a position corresponding to positions 39, 60, 74 81, 84, 109, 115, 142,
145, 146, 154, 182,
183, 187, 209, 212, 228, 267, 272, 280, 294, 317, 348 or 362 of the
polypeptide of SEQ ID NO:
3, wherein the variant has protease activity and wherein the variant has at
least 75%, at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at
least 98%, or at
least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID
NO: 3, wherein
the protease is a serine protease belonging to the S53 family.
Paragraph [8] The variant of any of paragraphs 5-7, wherein the variant
comprises or consists
of one or more substitutions and/or deletions selected from the group
consisting of I39M, I39R,
I39L, I390, 560D, I840 N115D, N115L, E117D, N145G, N145Q, N145V, N145D, N145K,
N145K, N145A, N145E, 5183L, 5183P, D280N, Q182G, Q182R, E81R, E81K, E81E,
E81A,
I840, Q154V, Q142W, Q142R, T146A, T146W, T146Y, T146E, T146D, I228R, D267N,
5272V,
5272R, E212E, 5294A, T362A, E74W , 5187L, P348A, D109P, 5317A, 5317G, 53175,
5317A,
5318* and 5210* of the polypeptide of SEQ ID NO: 3, wherein the variant has
protease activity
and wherein the variant has at least 75%, at least 80%, at least 85%, at least
90%, at least 95%,
at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%
sequence identity
to the polypeptide of SEQ ID NO: 3, and wherein the increased thermo-stability
is increased
54
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
residual activity measured after incubation for 30 min at a temperature in the
range from 55 to
60 degrees Celsius.
Paragraph [9] The variant of any of paragraphs 5-8, wherein the variant
comprises at least one
of the following modifications or combination of modifications:
N115L;
S183P;
D280N;
N115D;
N115L + Q182G;
N115L + Q182R;
E81R + S183P;
E81K + S183P;
S183P + Q154V;
S183P + Q142W;
Q142R + S183P;
S183P + T146A;
S183P + T146W;
S183P + I228R;
S183P + D267N;
S183P + S272V;
S183P + S272R;
T146W + D280N;
T146Y + S183P;
S183P + E212E;
S183P + S294A;
S183P + T362A;
S183P + S294A;
S183P + E74W;
S183P + E81E;
S183P + E81A;
N115L + S183L + S187L;
S183L + V209L + S210*;
D109P + V209L + S210*;
N115D + V209L + S210*;
E81R + V209L + S210*;
D109P + V209L + S210*;
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
N115D + V209L + S210*;
E81R + V209L + S210*;
T146W + S183P + D280N;
I840 + S183P + S2720;
I39M + Q142R + S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
I390 + Q142R + S183P;
E117D + Q142R + S183P;
S6OD + Q142R + S183P;
N115L + S183L +S187L + P348A;
D109P + S183P + V209L + S210*;
N115D + S183P + V209L + S210*;
E81R + S183P + V209L +S210*;
V209L + S210* + S317A + S318*;
Q142R + N145G + T146E + S183P;
Q142R + N145Q + T146D + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N145A + T146D +S183P;
Q142R + N145E + T146E + S183P;
N115L + S183L + S187L + V209W + S210*;
N115L + S183L + S187L + V209L + S210*;
N115L + S183L + S187L + S317G + S318*;
N115L + S183L + S187L + S317S + S318*;
N115L +S183L + S187L + S317A + S318*;
E81R + V209L + S210* + S317A + S318*.
Paragraph [10] The variant of any of paragraphs 5-9, wherein the increased
thermo-stability is
increased residual activity measured after incubation for 30 min at a
temperature in the range
from 55 to 60 degrees Celsius.
Paragraph [11] The variant of any of paragraphs 5-10, wherein the variant has
a residual activity
of at least 10%, particularly at least 12%, more particularly at least 15%,
measured after
incubation for 30 minutes at 56 C.
56
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Paragraph [12] The variant of paragraphs 5-11, wherein the variant comprises
at least one of
the following modification or combination of modifications:
N115L + Q182G;
N115D;
Q142R +S183P;
Q142R +N145G +T146E +S183P;
Q142R +N145Q + T146D + S183P;
Q142R +N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R +N145K + T146E + S183P;
Q142R +N145A + T146D +S183P;
I39M + Q142R +S183P;
Q142R + N145E + T146E +S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
E117D + Q142R + S183P;
S6OD + Q142R + S183P;
and wherein the variant has residual activity of at least 30% measured after
incubation
for 30 minutes at 57 C.
Paragraph [13] The variant of paragraphs 5-12, wherein the variant comprises
at least one of
the following modifications or combination of modifications:
Q142R + S183P;
Q142R + N145G + T146E + S183P;
Q142R + N145Q + T146D + S183P;
Q142R + N145V + T146E +S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N145A + T146D +S183P;
I39M + Q142R + S183P;
Q142R + N145E + T146E + S183P;
I39R + Q142R + S183P;
I39L +Q142R +S183P;
E117D +Q142R S183P;
Q142R + S183P;
S6OD + Q142R + S183P;
57
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Q142R +S183P; and wherein the variant has residual activity of at least 70%
measured
after incubation for 30 minutes at 57 C.
Paragraph [14] The variant of paragraphs 5-13, wherein the variant comprises
at least one of
the following modifications or combination of modifications:
Q142R + S183P;
I390 + Q142R + S183P;
E117D + Q142R + S183P;
Q142R + S183P;
S6OD + Q142R + S183P; and wherein the variant has residual activity of at
least 40%
measured after incubation for 30 minutes at 60 C.
Paragraph [15] The variant of paragraphs 5-14, wherein the variant comprises
at least one of
the following modifications or combination of modifications:
Q142R + S183P;
I390 + Q142R +S183P; and wherein the variant has residual activity of at least
40%
measured after incubation for 30 minutes at an elevated temperature of 62 C.
Paragraph [16] The variant according to any of the paragraphs 1-4, comprising
a modification at
a position corresponding to position 50, 57, 60, 81, 84, 109, 110, 111, 124,
128, 142, 145, 146,
154, 182, 183, 207, 209, 210, 228, 267, 271, 272, 274, 278, 280, 294, 317,
318, 320, 321, 322,
328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant
has protease
activity and wherein the variant has at least 75%, at least 80%, at least 85%,
at least 90%, at
least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less
than 100%
sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is
a serine protease
belonging to the S53 family.
Paragraph [17] The variant of paragraph 16, which comprises a modification
which is a
substitution at a position corresponding to positions 50, 57, 60, 81, 84, 109,
110, 111, 124, 128,
142, 145, 146, 154, 182, 183, 207, 209, 228, 267, 271, 272, 274, 278, 280,
294, 317, 318, 320,
321, 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3.
Paragraph [18] The variant of paragraph 16, which comprises a modification
which is a deletion
at a position corresponding to position 318 or 210 of the polypeptide of SEQ
ID NO: 3.
Paragraph [19] The variant of paragraphs 16-18, wherein the variant comprises
or consists of
one or more substitutions and/or deletions selected from the group consisting
of S50C, K57R,
58
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
S60P, E81R, I840, D109P, D109N, D110N, F111P, N124L, N124W, N124Q, G128A,
Q142R,
Q142W, N145V, N145D, N145A, T146A, T146W, T146E, T146D, Q154V, Q154W, Q154,R,
Q154Y, Q182G, Q182R, S183P, S183L, Q207R, V209L, I228R, D267N, V2710, S272V,
S2720,
S272R, G274G, G278S, D280N, S294A, S317A, S318N, G3200, K321G, K321A, A322S,
T3280, K3430, T362A, A3630, S318* and S210* of the polypeptide of SEQ ID NO:
3, wherein
the variant has protease activity and wherein the variant has at least 75%, at
least 80%, at least
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or
at least 99%, but
less than 100% sequence identity to the polypeptide of SEQ ID NO: 3.
Paragraph [20] The variant of any of paragraphs 16-19, wherein the variant
comprises at least
one of the following modifications or combination of modifications:
S183P;
D280N;
K57R +5183P;
D109P +5183P+ V209L +S210*;
E81R+ 5183P +V209L +S210*;
E81R +V209L +S210*;
Q154V +5183P;
Q142W +5183P;
Q142R +5183P;
T146A +S183P;
T146W +5183P;
5183P +I228R;
5183P +D267N;
5183P +5272V;
E81R +V209L +S210* +5317A+5318*;
5183P +T3280 +K3430;
5183P +G3200+ A3630;
T146W +D280N;
T146W +5183L D+280N;
T146W;
T146W +5183P +D280N;
T146Y +5183P;
5183P +Q207R;
S500 +5183P +V2710;
I840 +5183P+ S2720;
Q142W +T146W +5183P;
59
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Q142W +T146W +S183P+ D280N;
S183P +S294A;
S183P +K321G;
S183P +T362A;
Q182G;
Q142W +T146W +Q182R;
S272V;
S272R;
S60P;
D109N +D110N;
F111P;
G128A;
G278S;
S318N +K321A +A322S;
E81R+ T146W;
E81R +Q142R +S183P;
E81R +Q142W +S183P
S183P +G274G;
E81R;
N124L +Q142R +S183P;
N124W +Q142R +S183P;
N124Q +Q142R +S183P;
Q142R + N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R + N145A +T146D +S183P; and wherein the increased thermo-stability
measured
as Td by TSA assay is at least 59 C.
Paragraph [21] The variant of any of paragraphs 16-20, wherein the variant
comprises at least
one of the following modifications or combination of modifications:
D280N;
D109P + S183P + V209L + S210*;
E81R + S183P + V209L + S210*;
E81R + V209L +S210*;
Q154V + S183P;
Q142W +S183P;
Q142R + S183P;
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
T146A + S183P;
T146W + S183P;
S183P + D267N;
S183P + S272V;
E81R + V209L + S210*+ S317A +S318*;
T146W + D280N;
T146W + S183L +D280N;
T146W;
T146W + S183P +D280N;
T146Y + S183P;
S183P + Q207R;
S500 + S183P + V2710;
I840 + S183P + S2720;
Q142W + T146W + S183P;
Q142W + T146W + S183P + D280N;
S183P + S294A;
Q142W + T146W + Q182R;
S272V;
S272R;
S60P;
E81R + T146W;
E81R + Q142R + S183P;
E81R + Q142W + S183P;
S183P + G274G;
E81R;
N124L + Q142R + S183P;
N124W + Q142R + S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability
measured as Td by TSA assay is at least 61 C.
Paragraph [22] The variant of any of paragraphs 16-21, wherein the variant
comprises at least
one of the following modifications or combination of modifications:
E81R + S183P+ V209L +S210*;
61
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Q142R + S183P;
T146W + D280N;
T146W +S183L + D280N;
T146W + S183P+ D280N;
S500 + S183P + V2710;
I840 + S183P + S2720;
Q142W + T146W + S183P+ D280N;
S272V;
E81R +T146W;
E81R + Q142R + S183P;
N124L + Q142R +S183P;
N124W + Q142R +S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability
measured as Td by TSA assay is at least 63 C.
Paragraph [23] The variant of any of paragraphs 16-22, wherein the variant
comprises at least
one of the following modifications or combination of modifications:
Q142R + S183P;
S500 + S183P + V2710;
E81R + Q142R + S183P;
N124L + Q142R + S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P; or
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability
measured as Td by TSA assay is at least 65 C.
Paragraph [24] The variant according to any one of the preceding paragraphs,
wherein said
variant comprises a substitution at 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
positions.
Paragraph [25] A polynucleotide encoding the variant of any of paragraphs 1-
24.
Paragraph [26] A nucleic acid construct comprising the polynucleotide of
paragraph 25.
Paragraph [27] An expression vector comprising the polynucleotide of paragraph
25.
62
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Paragraph [28] A recombinant host cell comprising the polynucleotide of
paragraph 25.
Paragraph [29] A method of producing a protease variant of any of paragraphs 1-
24, comprising:
cultivating the host cell of paragraph 28 under conditions suitable for
expression of the variant;
and optionally recovering the variant.
Paragraph [30] A composition comprising the variant according to any one of
paragraphs 1-24.
Paragraph [31] The composition of paragraph 30, further comprising a
glucoamylase and
optionally a fungal alpha-amylase.
Paragraph [32] A process for producing a fermentation product from starch-
containing material
comprising simultaneously saccharifying and fermenting starch-containing
material using a
carbohydrate-source generating enzymes and a fermenting organism at a
temperature below
the initial gelatinization temperature of said starch-containing material in
the presence of a
variant protease of any of the paragraphs 1-24.
Paragraph [33] A process for producing a fermentation product from starch-
containing material
comprising the steps of: a) liquefying starch-containing material in the
presence of an alpha-
amylase; b) saccharifying the liquefied material obtained in step (a) using a
glucoamylse; c)
fermenting using a fermenting organism; wherein a variant protease of any of
the paragraphs 1-
24 is present during step b) and/or c).
Paragraph [34] The process of any of the paragraphs 32-33, wherein the
fermentation product
is ethanol and the fermenting organism is Saccharomyces cerevisiae.
Paragraph [35] The host cell of paragraph 28 expressing the variants of any of
paragraphs 1-
24, wherein the host cell is a yeast cell, particularly a Saccharomyces, such
as Saccharomyces
cerevisiae.
Paragraph [36] The process of any of the paragraphs 32-33, wherein the host
cell of paragraph
35, is applied as the fermenting organism in the fermentation step and the
fermentation product
is ethanol.
The present invention is further described by the following examples.
EXAMPLES
Enzymes
Enzymes for DNA manipulations (e.g. restriction endonucleases, ligases etc.)
were obtained
from New England Biolabs, Inc. and were used according to the manufacturer's
instructions.
63
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Media and reagents
The following media and reagents were used unless otherwise specified:
Chemicals used for buffers and substrates were commercial products of
analytical grade. Cove:
342.3 g/L Sucrose, 20 ml/L COVE salt solution, 10mM Acetamide, 30 g/L noble
agar.
Cove top agar: 342.3 g/L Sucrose, 20 ml/L COVE salt solution, 10mM Acetamide,
10 g/L low
melt agarose. Cove-N plates are composed of 30 g sucrose, 20 ml Cove salt
solution, 3g NaNO3,
and 30 g noble agar and water to 1 litre. COVE salt solution are composed of
26 g KCI, 26 g
MgSat 7H20, 76 g KH2PO4 and 50m1 Cove trace metals and water to 1 litre. Trace
metal solution
for COVE are composed of 0.04 g Na13407 10H20, 0.4 g CuSO4 5H20, 1.2 g
FeS047H20, 1.0 g
MnSat H20, 0.8 g Neutral amylase 11 Mo022H20, and 10.0 g ZnSat 7H20 and water
to 1 litre.
1/4 YPM composed of 2.5 g yeast extract, 5 g pepton and 5 g maltose (pH 4.5)
and water to 1
litre. STC buffer was composed of 0.8 M sorbitol, 25 mM Tris (pH 8), and 25 mM
CaCl2 and
water to llitre. STPC buffer composed of 40% PEG4000 in STC buffer. MLC
composed of 40 g
Glucose, 50 g Soybean powder, 4 g/ Citric acid (pH 5.0) and water to 1 litre.
Purchased material (E.coli, plasmid and kits)
E.coli DH5-alpha (Toyobo) was used for plasmid construction and amplification.
Amplified
plasmids were recovered with Qiagen Plasmid Kit (Qiagen). QIAquickTM Gel
Extraction Kit
(Qiagen) was used for the purification of PCR fragments and extraction of DNA
fragment from
agarose gel.
Strains
The expression host strain Aspergillus niger described is a derivative of
NN059203. NN059203
was isolated by Novozymes and described in W012160093 and is a derivative of
Aspergillus
niger NN049184 which was isolated from soil.
Transformation of Aspergillus
Transformation of Aspergillus species can be achieved using the general
methods for
yeast transformation. The preferred procedure for the invention is described
below. The
Aspergillus niger host strain was inoculated into 100 ml YPG medium
supplemented with 10 mM
uridine and incubated for 16 hrs at 32 C at 80 rpm. Pellets were collected and
washed with 0.6
M KCI, and resuspended in 20 ml 0.6 M KCI containing a commercial glucanase
product
(GLUCANEXTM, Novozymes NS, Bagsvrd, Denmark) at a final concentration of 20 mg
per ml.
The suspension was incubated at 32 C with shaking (80 rpm) until protoplasts
were formed, and
then washed twice with STC buffer. The protoplasts were counted with a
hematometer and
resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final
concentration of
64
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
2.5x107 protoplasts/ml. Approximately 4pg of plasmid DNA was added to 100 pl
of the protoplast
suspension, mixed gently, and incubated on ice for 30 minutes. One ml of SPTC
was added and
the protoplast suspension was incubated for 20 minutes at 37 C. After the
addition of 10 ml of
50 C Cove top agarose, the reaction was poured onto Cove agar plates and the
plates were
incubated at 32 C for 5 days.
PCR amplification
PrimeSTARO HS (Premix) 10 pl
Template DNA (50-100 ng/ pl) 1 pl
Forward primer (100pM) 1 pl
Reverse primer (100 pM) 1 pl
Distilled water to 20 pl
PCR conditions
1. 94 C 2 min
2. 94 C 10 sec
3. 57 C 5 sec
4. 72 C 20 sec
Repeat 2-4, 30 cycles
5. 72 C 30 sec
MTP cultivation for enzyme production
Spores of Aspergillus libraries were inoculated in 0.5-1m1 of 1/4YPM media in
96 deep well plate
and cultivated at 30 C for 2-3 days at 600rpm.
Enzyme assay
Zein plate assay
Culture supernatants were applied on 0.05-0.1% of zein (Sigma) plate (20mM
sodium acetate
buffer, pH4.5) and incubated at appropriate temperatures (30-60 degree C).
Suc-AAPF-pna analysis
Culture supernatants pre-incubated at appropriate temperatures (50 to 60
degree C and 4
degree C as a control) are measured for protease activity by AAPF assay using
N-Succinyl-Ala-
Ala-Pro-Phe p-nitroanilide (SIGMA-ALDRICH).
Assay:
1) Add 25p1 samples to wells of 384 microtiterplate (MTP)
2) Add 25p1 pNA substrate working soln. to 384 MTP
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
3) Read 405nm (zero point)
4) Incubate 37 C, 60min (if the color is not developed well, continue
incubation)
5) Read 405nm (zero point)
DNA isolation from Aspergillus clones
Inserted DNAs of Aspergillus strains were recovered by direct PCR method
described below or
PCR on the isolated DNA by chromosomal DNA purification kit (FastDNA SPIN Kit
for Soil, MP
biomedicals, #6560-200) using a primer pair, insert rescue F and R.
insert rescue F (SEQ ID NO: 11)AATCTCAGAACACCAATATC
.. insert rescue R (SEQ ID NO: 12)AACACTATGCGTTATCGTAC
The amplified DNAs were purified by agarose gel electrophoresis followed to
QIAquick Gel
Extraction kit (Qiagen) for sequencing analysis to check the quality of
constructed libraries.
Colony PCR was carried out as following:
Conidias from strains were transferred to a 1.5 ml tube and 500p1 of TE-buffer
was added and
mixed briefly.
It was diluted 10-20 times in water and one pl of the dilution was used as
template for PCR.
Purification
Purification of the variants of Meripilus giganteus serine protease belonging
to family 53 herein
denoted as MgProt!!l variants was carried out by two steps, desalting column
and cation
exchange chromatography column. Finally, the sample was buffer exchanged and
concentrated
in 20 mM succinate buffer pH 4.0 using a 30 kDa centrifugal concentrator
(Sartorius AG).
TSA (Thermal Shift Assay)
Purified enzyme was diluted with 50 mM sodium acetate buffer pH 4.5 to 0.75
mg/ml and 10 pl
of that were mixed with 15 pl of SYPRO Orange (lnvitrogen) diluted with Milli-
Q water and 5 pl
of 30 mM bacitracin solution dissolved in 50 mM sodium acetate buffer pH 4.5.
Thirty microliters
of mixture solution was transfer to LightCycler 480 Multiwell Plate 96 (Roche
Diagnostics) and
the plate was sealed.
Equipment parameters of TSA:
Apparatus: LightCycler 480 Real-Time PCR System (Roche Applied Science)
Scan rate: 0.02 C/sec
Scan range: 37 - 96 C
Integration time: 1.0 sec
Excitation wave length 465 nm
Emission wave length 580 nm
66
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
The obtained fluorescence signal was normalized into a range of 0 and 1. The
Thermal
denaturation temperature, Td, was defined as the temperature where the
normalized value is
closest to 0.5.
EXAMPLE 1: Library construction
Plasmid library construction using 1n-fusion cloning (Clontech)
An expression vector, pFLP-MgProlll disclosed in W01260093 Figure 5, which
contains the
target protease gene (shown as SEQ 1) instead of glucoamylase gene and amd S
marker gene
instead of pyr G marker gene, was digested with appropriate restriction
enzymes (Xhol BsiW1
for pFRT-GIAMG) to cut out the protease gene.
Two PCRs were carried out for a library construction using 2 primer pairs, a
forward degenerated
primer and a primer having more than 15bp overlapping with an expression
vector (vector F
described below), and vector F primer and a reverse primer having 15bp
overlapping with the
degenerated primer using the expression vector as a template.
Vector R 25mer (SEQ ID NO: 13) TAAGTGGAGGGAAAAACACTATGCG
Vector F 32mer (SEQ ID NO: 14) GCTTGGAGCAACAATCTCAGAACACCAATATC
One of the examples of primers for a library is shown below:
F111X F 27mer (SEQ ID NO: 15) ATCTCCGTCGGCGACGACNNKCAGGAT
F111X R 20mer (SEQ ID NO: 16) GTCGCCGACGGAGATGAACG
The digested vector and PCR fragments were mixed with In-Fusion mix and
transformed into
E.coli DH5alpha. Obtained E.coli transformants were pooled and plasmids were
extracted to
use for Aspergillus library construction.
Aspergillus transformation to construct a library in Aspergillus
One pg of each plasmid library was transformed into A. niger host strain.
Aspergillus
transformants were isolated in a 96 well-MTP containing COVE-N gly agar
(100u1/well), cultivate
at 32 C for 1 week to have enough sporulation. 100pl/well of 0.01% tween 20
was added to the
each well, suspended with spores and the suspension was inoculated in a 96
well-MTP
containing YPG and cultivated for 3 days at 30 C with shaking to have
Aspergillus culture library.
They were used for further library screening works.
Library screening
Constructed Aspergillus libraries were cultivated in 96 well MTP and the
culture supernatants
were spotted on zein plates at appropriate temepratures. Positive variants
were tested by Suc-
AAPF-pna analysis and variants having higher residual activities were
identified. Positive
67
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
variants were cultivated in shake flasks and samples were used for further
purification and
characterization.
DNA isolation from Aspergillus clones
Inserted DNAs of Aspergillus strains were recovered by direct PCR method
described below or
PCR on the isolated DNA by chromosomal DNA purification kit (FastDNA SPIN Kit
for Soil, MP
biomedicals, #6560-200) using a primer pair, insert rescue F and R.
insert rescue F (SEQ ID NO: 11)AATCTCAGAACACCAATATC
insert rescue R (SEQ ID NO: 12)AACACTATGCGTTATCGTAC
The amplified DNAs were purified by agarose gel electrophoresis followed to
QIAquick Gel
Extraction kit (Qiagen) for sequencing analysis to check the quality of
constructed libraries.
RESULTS
Table 1 lists the positive variants identified by Suc-AAPF-pna analysis.
Samples were incubated
at certain temperatures for 30 minutes and their remaining activities were
measured by AAPF
assay. The residual activities in tables below are described as relative
activity to ones incubated
at 4 degree C.
<Residual activity (%)>
JMgP ID Modification 57 C, 30min 58 C, 30min
WT - 8 8
JMgP006 N115L 10 9
JMgP019 N115L S183L S187L 18 15
JMgP033 N115L Q182G 36 4
JMgP076 N115D 45 4
JMgP071 N115L S183L S187L P348A 22 11
JMgP ID - 55 C, 30min 56 C, 30min
WT - 19 4
JMgP009 5183P 31 10
JMgP033 N115L Q182G 38 17
JMgP034 N115L Q182R 60 35
JMgP058 N115L S183L S187L V209W S210* 47 19
JMgP059 N115L S183L S187L V209L S210* 39 20
JMgP064 N115L S183L S187L S317G S318* 51 37
JMgP065 N115L S183L S187L S317S S318* 47 22
68
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
JMgP066 N115L S183L S187L S317A S318* 47 33
JMgP075 S183L V209L S210* 49 41
JMgP ID 55 C, 30min 56 C, 30min
JMgP009 S183P 39.4 19
lib19-4 S183P E74W 32.1 13.7
lib22-2 S183P E81A 46.1 23.5
JMgP083 E81R S183P 70.9 53.5
JMgP084 E81K S183P 73.5 55.6
lib22-11 S183P E81E 36.8 15.3
JMgP ID 55 C, 30min 56 C, 30min
JMgP009 S183P 46.8 24.7
JMgP094 S183P Q154V 67.4 49.4
JMgP095 S183P Q142W 66.1 50.6
JMgP096 Q142R S183P 99 100
JMgP097 S183P T146A 65.8 47.4
JMgP098 S183P T146W 83.8 78.1
JMgP099 S183P I228R 67 49.5
JMgP100 S183P D267N 81.9 76.6
JMgP101 S183P S272V 81.8 77.5
JMgP103 S183P S272R 88.6 83.2
JMgP120 T146Y S183P 64 52
JMgP ID 55 C, 30min 56 C, 30min
JMgP009 S183P 48 27
JMgP030 D280N 62 49
JMgP087 D109P S183P V209L S210* 63 49
JMgP089 E81R S183P V209L S210* 69 62
JMgP091 D109P V209L S210* 47 28
JMgP092 N115D V209L S210* 54 36
JMgP093 E81R V209L S210* 56 42
JMgP104 V209L S210* S317A S318* 58 45
JMgP106 E81R V209L S210* S317A S318* 65 55
JMgP115 T146W D280N 60 50
JMgP118 T146W S183P D280N 73 29
JMgP120 T146Y S183P 81 37
JMgP134 S183P S294A 85 58
JMgP137 S183P T362A 53 32
JMgP140 S183P S294A 73 56
69
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
55 C, 30min 56 C, 30min
JMgP009 S183P 50 29
JMgP088 N115D S183P V209L S210* 41 34
JMgP096 Q142R S183P 73 71
JMgP123 S183P E212E 48 32
JMgP127 I84C S183P S272C 71 67
57 C, 30min 58 C, 30min
JMgP096 Q142R S183P 78 76
JMgP229 Q142R N145G T146E S183P 86 87
JMgP230 Q142R N145Q T146D S183P 92 92
JMgP231 Q142R N145V T146E S183P 92 91
JMgP232 Q142R N145D T146E S183P 89 90
JMgP233 Q142R N145K T146E S183P 92 94
JMgP234 Q142R N145A T146D S183P 84 82
JMgP236 I39M Q142R S183P 88 92
JMgP235 Q142R N145E T146E S183P 90 87
JMgP237 I39R Q142R S183P 82 82
JMgP238 I39L Q142R S183P 91 98
60 C, 30min 62 C, 30min
JMgP096 Q142R S183P 84 45
JMgP245 I39C Q142R S183P 125 105
57 C, 30min 60 C, 30min
JMgP252 E117D Q142R S183P 90 61
JMgP096 Q142R S183P 88 43
57 C, 30min 60 C, 30min
lib81-1 S6OD Q142R S183P 96 99
JMgP096 Q142R S183P 96 60
EXAMPLE 2: Purification and Thermal shift assay (TSA) analysis
Purification
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
Purification of MgProt!!l variants was carried out by two steps, desalting
column and cation
exchange chromatography column. Finally, the sample was buffer exchanged and
concentrated
in 20 mM succinate buffer pH 4.0 using a 30 kDa centrifugal concentrator
(Sartorius AG).
TSA
Purified enzyme was diluted with 50 mM sodium acetate buffer pH 4.5 to 0.75
mg/ml and 10 pl
of that were mixed with 15 pl of SYPRO Orange (lnvitrogen) diluted with Milli-
Q water and 5 pl
of 30 mM bacitracin solution dissolved in 50 mM sodium acetate buffer pH 4.5.
Thirty microliters
of mixture solution was transfer to LightCycler 480 Multiwell Plate 96 (Roche
Diagnostics) and
the plate was sealed.
Equipment parameters of TSA:
Apparatus: LightCycler 480 Real-Time PCR System (Roche Applied Science)
Scan rate: 0.02 C/sec
Scan range: 37 - 96 C
Integration time: 1.0 sec
Excitation wave length 465 nm
Emission wave length 580 nm
The obtained fluorescence signal was normalized into a range of 0 and 1. The
Td was defined
as the temperature where the normalized value is closest to 0.5.
Result: The TSA data are listed in TABLE 2.
Sample Modification Td [ C]
MgProt!!! (wt) 58.67
JMgP009 5183P 60.28
JMgP030 D280N 61.15
JMgP081 K57R S183P 59.67
JMgP087 D109P 5183P V209L S210* 62.37
JMgP089 E81R S183P V209L S210* 63.03
JMgP093 E81R V209L S210* 62.01
JMgP094 Q154V S183P 61.06
JMgP095 Q142W S183P 61.39
JMgP096 Q142R S183P 65.77
JMgP097 T146A5183P 61.18
JMgP098 T146W S183P 62.34
JMgP099 5183P 1228R 60.59
JMgP100 5183P D267N 62.43
JMgP101 5183P 5272V 61.06
JMgP106 E81R V209L S210* S317A S318* 62.15
JMgP108 5183P T328C K343C 60.59
JMgP110 5183P G320C A363C 59.71
JMgP115 T146W D280N 63.33
71
CA 03028875 2018-12-20
WO 2018/015304
PCT/EP2017/067883
JMgP116 T146W S183L D280N 63.27
JMgP117 T146W 62.46
JMgP118 T146W S183P D280N 63.72
JMgP120 T146Y S183P 62.13
JMgP122 S183P Q207R 61.36
JMgP126 S500 S183P V271C 66.92
JMgP127 1840 S183P S2720 64.44
JMgP130 Q142W T146W S183P 61.94
JMgP132 Q142W T146W S183P D280N 63.00
JMgP134 S183P S294A 61.61
JMgP136 S183P K321G 60.63
JMgP137 S183P T362A 60.87
JMgP141 Q182G 59.88
JMgP144 Q142W T146W Q182R 62.13
JMgP147 S272V 63.18
JMgP148 S272R 61.67
JMgP157 S6OP 61.74
JMgP167 D109N D110N 60.64
JMgP173 F111P 59.43
JMgP175 G128A 59.95
JMgP203 G278S 59.95
JMgP206 S318N K321A A322S 60.23
JMgP214 E81R T146W 64.02
JMgP215 E81R Q142R S183P 66.08
JMgP216 E81R Q142W S183P 62.81
JMgP218 S183P G274G 61.03
JMgP220 E81R 62.34
JMgP223 N124L Q142R S183P 65.69
JMgP224 N124W Q142R S183P 64.09
JMgP225 N124Q Q142R S183P 65.38
JMgP231 Q142R N145V T146E S183P 65.79
JMgP232 Q142R N145D T146E S183P 65.37
JMgP234 Q142R N145A T146D S183P 65.52
72
