Note: Descriptions are shown in the official language in which they were submitted.
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
1
Piscine Orthoreovirus Virulence Markers
The present invention relates to methods for determining virulence of Piscine
orthoreovirus (PRV), and primers and probes to be used in such a method,
according to the preamble of the independent patent claims.
Background
The aquaculture industry is an important food source and income, and Salmonids
in
particular are very popular farmed species in many regions of the world. Viral
diseases pose a significant threat to the productivity in aquaculture, and
thus impact
the future global aquaculture production. Heart and Skeletal Muscle
Inflammation
(HSMI) has become a serious disease in farmed salmonids in several
geographical
areas. It was discovered in salmon in the sea in Norway in 1999, and is now
reported
from fresh and seawater sites in for instance UK, Scotland, Canada and Chile.
The
causal relationship between the PRV and HSMI was described by (Wessel 0, et
al.
(2017) Infection with purified Piscine orthoreovirus demonstrates a causal
relationship with heart and skeletal muscle inflammation in Atlantic salmon.
PLoS
ONE 12(8):e0183781). The mortality during HSMI outbreaks varies from
negligible to
20%.
According to The National Veterinary Institute the virus has spread over the
years
and in 2014 the virus was delisted from notifiable diseases. The delisting was
done
because the PRV is ubiquitous in Atlantic salmon, and thus present also in
healthy
individuals not associated with clinical disease. Still, HSMI is a significant
health
problem for the aquaculture industry in Norway, but it is not yet possible to
differentiate between virulent and less virulent or non-virulent strains of
PRV.
Reoviruses are non-enveloped icosahedral viruses with double-stranded RNA
genomes comprising 10-12 segments and consistent with the genome organization
characteristic for members of the family Reoviridae, the genome of the PRV
comprises at least 10 RNA segments (GenBank Accession numbers GU994013-
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
2
GU994022). Palacios et al 2010, identified these 10 different segments as L1,
L2,
L3, M1, M2, M3, Si, S2, S3 and S4 (Palacios G, et al. (2010) Heart and
Skeletal
Muscle Inflammation of Farmed Salmon Is Associated with Infection with a Novel
Reovirus. PLoS ONE 5(7): e11487).
Viruses closely related to PRV from farmed Atlantic salmon have been
discovered
in association with diseases in other salmonid species. A virus called PRV-2
was
demonstrated to be the possible causative agent of erythrocytic inclusion body
syndrome (El BS), a disease that can cause mass mortality in Coho salmon
(Oncorhynchus kisutch). Another PRV-like virus was detected in association
with a
disease outbreak in rainbow trout (Oncorhynchus mykiss) in Norway; the fish
displayed signs of circulatory disturbance and histopathological changes
resembling
HSMI. Furthermore, a PRV strain closely related to the PRV from rainbow trout
was
found in association with HSMI-like lesions in Coho salmon in Chile. The
presence of
several PRV variants associated with diseases in salmonids suggests that
species
adaptation is important for pathogenesis (Wessel 2017).
Siah et al 2015 conducted a phylogenetic study of PRV strains from Norway,
Canada and Chile, and found that Norwegian strains differed in Si segment.
Wessel
et al have shown the genetic relationship of strains from different regions
and
species, and shows that strains from Atlantic salmon all belong to the same
group.
Parts of the genome of the Norwegian strain is sequenced, and known for
instance
from Genbank. However, also in Norway there are fish detected positive to PRV
without clinical symptoms, and fish detected positive to PRV developing HSMI.
Therefore it is important to have diagnostic tools to differentiate between
the strains
that can cause disease, and those that do not.
The current diagnostic methods are histology, immunohistochemistry, virus
propagation, serology, neutralizing assay, sequencing and PCR, wherein PCR
gives
the fastest result and is the preferred method. EP 2482825 describes a known
method for determining the presence or absence of piscine reovirus, by using
PCR.
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
3
The genomes of all organisms undergo spontaneous mutations during their
continuing evolution, forming variant forms of progenitor genetic sequences. A
mutation may result in an evolutionary advantage or disadvantage relative to a
progenitor form or may be neutral. A variant that result in an evolutionary
advantage
.. may eventually be incorporated in many members of the species and may thus
effectively become the progenitor form. Furthermore, often various variant
forms
survive and coexist in a species population. The coexistence of multiple forms
of a
genetic sequence gives rise to genetic polymorphism, including single-
nucleotide
polymorphisms (SNPs).
A single-nucleotide polymorphism (SNP) is a DNA sequence variation occurring
when a single nucleotide ¨ A, T, C or G ¨ in the genome (or other shared
sequence such as RNA) differs between members of a biological species or
paired
chromosomes in an organism. For example, two DNA fragments from different
.. individuals, AAGCCTA to AAGCTTA, contain a difference in a single
nucleotide,
commonly referred as two alleles. Almost all common SNPs have only two
alleles.
The genomic distribution of SNPs is not homogenous; SNPs usually occur in non-
coding regions more frequently than in coding regions or, in general, where
natural
selection is acting the allele of the SNP that constitutes the most favorable
genetic
.. adaptation is predominating.
The invention
The issues set out above are solved by methods, primers and probes according
to
the characterizing part of the enclosed independent claims. Further
advantageous
.. features are stated in the corresponding dependent claims.
The present invention relates to a method for determining virulence of Piscine
Orthoreovirus (PRV) in a biological sample from a fish, comprising a step for
detecting whether any of the following single nucleotide polymorphisms (SNPs)
are
.. present in the genomic material
S4-T3200 or S4-G754A in SEQ ID NO. 4,
CA 03126580 2021-07-12
WO 2020/159379 PCT/N02020/050017
4
M2-G5510, M2-T580A, M2-G784T, M2-A958G, or M2-A1108G in SEQ ID
NO. 5,
M3-A280T, M3-0371T, M3-01064T, M3-A1351G, M3-T14210 or M3-T16870
in SEQ ID NO. 6,
or the complementary oligonucleotides thereof, wherein the numbering of said
positions are in accordance with sequences 4, 5, and 6, respectively,
wherein presence of at least one SNP confirms that the virus is virulent and
will
cause morbidity and/or mortality of a fish upon infection.
The SNPs as mentioned above are to be understood as defined in table 1 below.
Table 1 SNPs related to the invention
SNP Position in DNA Nucleotide in reference Nucleotide in
non-virulent virus virulent virus
S4-T320C 320 in S4 segment
S4-G754A 754 in S4 segment G A
M2-G551C 551 in M2 segment
M2-T580A 580 in M2 segment T A
M2-G784T 784 in M2 segment
M2-A958G 958 in M2 segment A
M2-A1 108G 1108 in M2 segment A
M3-A280T 280 in M3 segment A
M3-C371T 371 in M3 segment
M3-C1064T 1064 in M3 segment
M3-A1351G 1351 in M3 segment A
M3-T1421C 1421 in M3 segment
M3-T1687C 1687 in M3 segment
The SNP 54-T3200 should thus be understood to mean a mutation from T to C in
position 320 of the S4 segment. The reference segment of S4 is shown in SEQ ID
NO. 4.
Virulence is a measure of the pathogenicity of an organism. The degree of
virulence
is related directly to the ability of the organism to cause disease despite
host
resistance mechanisms.
In one embodiment, the method further comprises a step for isolating the
genomic
material from the biological sample, and possibly a step for sequencing the
material
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
before detecting the SNPs. The step for detection of the SNPs may be performed
in
many ways which will be obvious to a skilled person, and the necessity of
isolating
and sequencing depends on the detection method.
5 In a preferred embodiment, any sequencing, is performed by a polymerase
chain
reaction and use of at least one primer. The sequencing may also be performed
by
Next Generation Sequencing Methods, such as a method selected from the group
consisting of IIlumina (Solexa) sequencing, Roche 454 sequencing, Ion Torrent
and
SOLiD sequencing.
The detection of SNPs may be performed by manual or automatic comparing the
sequenced genomic material from the sample with the reference.
In a preferred embodiment of the invention, the step of detecting comprises
use of a
polymerase chain reaction and use of at least one primer and/or probe.
In a preferred embodiment, each primer or probe used for sequencing or
detecting
comprise a sequence of at least 10 consecutive nucleotides selected from one
of the
sequences of a group consisting of SEQ ID NO. 24-26, 28-30, 32-34, 36-38, 40-
42,
44-46, 48-50, 52-54, 56-58 and 60-63.
In a preferred embodiment, the primers used for sequencing or detecting are
used
as primer pairs, selected from a group consisting of the following primer
pairs:
primers according to SEQ ID NO. 24 and 25,
primers according to SEQ ID NO. 28 and 29,
primers according to SEQ ID NO. 32 and 33,
primers according to SEQ ID NO. 36 and 37,
primers according to SEQ ID NO. 40 and 41,
primers according to SEQ ID NO. 44 and 45,
primers according to SEQ ID NO. 48 and 49,
primers according to SEQ ID NO. 52 and 53,
primers according to SEQ ID NO. 56 and 57, and
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
6
primers according to SEQ ID NO. 60 and 61.
In a preferred embodiment, the step of detecting comprises use of probes,
preferably
in a PCR reaction, wherein binding of a probe comprising a sequence of at
least 10
consecutive nucleotides from
SEQ ID NO. 26, confirms the virus to have SNP 54-T3200
SEQ ID NO. 30, confirms the virus to have SNP 54-G754A
SEQ ID NO. 34, confirms the virus to have SNP M2-G5510
SEQ ID NO. 38, confirms the virus to have SNP M2-T580A
SEQ ID NO. 42, confirms the virus to have SNP M2-G784T
SEQ ID NO. 46, confirms the virus to have SNP M2-A1108G
SEQ ID NO. 50, confirms the virus to have SNP M3-A280T
SEQ ID NO. 54, confirms the virus to have SNP M3-0371T
SEQ ID NO. 58, confirms the virus to have SNP M3-A1351G
SEQ ID NO. 62 or 63, confirms the virus to have SNP M3-T16870
The invention further relates to a method as described above, wherein the
presence
of mutation M3-A280T and/or M3-A1351G in SEQ ID NO. 6 confirms the virus to
cause high mortality.
The invention further relates to a method as described above, wherein the
presence
of mutations M3-A280T, M3-01064T, M3-A1351G, M3-T14210 and M3-T16870 in
SEQ ID NO. 6 confirm the virus to cause high mortality.
.. The invention further relates to a method as described above, wherein the
presence
of mutations 54-G754A, M2-G5510, M2-T580A, M2-G784T, M2-A958G, M2-
A1108G, M3-A280T, M3-01064T, M3-A1351G, M3-T14210, and M3-T16870 in
SEQ ID NO. 6 confirm the virus to cause high mortality.
The invention further relates to a method as described above, wherein the
presence
of mutation M3-0371T in SEQ ID NO. 6 confirms the virus to cause moderate to
low
mortality, and morbidity.
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
7
The invention further relates to a method as described above, wherein the
presence
of mutations M3-0371T, M3-01064T and M3-T14210 in SEQ ID NO. 6 confirm the
virus to cause moderate to low mortality, and morbidity.
The invention further relates to a method as described above, wherein the
presence
of mutations 54-G754A, M2-G5510, M2-G784T, M2-A958G, M2-A1108G, M3-
0371T, M3-01064T, and M3-T14210 in SEQ ID NO. 6 confirm the virus to cause
moderate to low mortality, and morbidity.
The invention further relates to a method as described above, wherein the
presence
of mutation 54-T3200 in SEQ ID NO. 4 confirms the virus to cause high
morbidity.
The invention further relates to a method as described above, wherein the
presence
of mutations 54-T3200, M2-G5510, M2-T580A, M2-G784T, M2-A958G, M2-
A1108G, M3-01064T, M3-T14210 and M3-T16870 in SEQ ID NO. 6 confirms the
virus to cause high morbidity.
The invention further relates to a method as described above, wherein the
presence
of mutation 54-G754A in SEQ ID NO. 4 confirms the virus to cause high to
moderate
mortality, and morbidity.
The invention further relates to a method as described above, wherein the
absence
of all SNPs mentioned in table 1 above, confirms the virus to be nonvirulent,
and not
cause mortality or morbidity. In order to prove the absence of all SNPs, a
method
according to the above may be carried out, comprising use of a primer and
probe
comprising a sequence of at least 10 consecutive nucleotides according to the
following
primers acc. to SEQ ID NO. 24 and 25, and probe acc. to SEQ ID NO. 27, confirm
the absence of SNP 54-T3200,
primers acc. to SEQ ID NO. 28 and 29, and probe acc. to SEQ ID NO. 31, confirm
the absence of SNP 54-G754A,
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
8
primers acc. to SEQ ID NO. 32 and 33, and probe acc. to SEQ ID NO. 35, confirm
the absence of SNP M2-G5510,
primers acc. to SEQ ID NO. 36 and 37, and probe acc. to SEQ ID NO. 39, confirm
the absence of SNP M2-T580A,
primers acc. to SEQ ID NO. 40 and 41, and probe acc. to SEQ ID NO. 43, confirm
the absence of SNP M2-G784T,
primers acc. to SEQ ID NO. 44 and 45, and probe acc. to SEQ ID NO. 47, confirm
the absence of SNP M2-A1108G,
primers acc. to SEQ ID NO. 48 and 49, and probe acc. to SEQ ID NO. 51, confirm
the absence of SNP M3-A280T,
primers acc. to SEQ ID NO. 52 and 53, and probe acc. to SEQ ID NO. 55, confirm
the absence of SNP M3-0371T,
primers acc. to SEQ ID NO. 56 and 57, and probe acc. to SEQ ID NO. 59, confirm
the absence of SNP M3-A1351G,
primers acc. to SEQ ID NO. 60 and 61, and probe acc. to SEQ ID NO. 64, confirm
the absence of SNP M3-T16870
The invention also relates to a primer or probe comprising a sequence of at
least 10
consecutive nucleotides selected from the group comprising SEQ ID NO. 24-26,
28-
30, 32-34, 36-38, 40-42, 44-46, 48-50, 52-54, 56-58 and 60-63. The primer or
probe
may comprise any 10 consecutive nucleotides from SEQ ID NO. 24, or from SEQ ID
NO. 25, or from SEQ ID NO. 26 etc. The primer or probe may also comprise, or
be
identical to, the mentioned sequences.
The invention further relates to a method for determining virulence of Piscine
Orthoreovirus (PRV) in a biological sample from a fish, comprising the
following
steps,
a) isolating amino acid sequences of the sample,
b) sequencing the amino acid sequence,
c) detecting whether any of the following amino acids are present in the amino
acid
sequences
- A in position 107 or N in position 252 of SEQ ID NO. 1
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
9
- T in position 184, I in position 194, S in position 262, A in position
320 or D in
position 370 of SEQ ID NO. 2, or
- L in position 94, V in position 124, L in position 355, V in position
451, Tin position
474 or P in position 563 of SEQ ID NO. 3
wherein the numbering of said positions are in accordance with the
sequences SEQ ID NO. 1,2 and 3, respectively,
wherein presence of at least one of the amino acids confirms that the virus is
virulent and will cause morbidity and/or mortality of the fish upon infection.
If none of the following amino acids are present, A in position 107 or N in
position
252 of SEQ ID NO. 1, Tin position 184, I in position 194, S in position 262, A
in
position 320 or D in position 370 of SEQ ID NO. 2, or L in position 94, V in
position
124, L in position 355, V in position 451, Tin position 474 or Pin position
563 of
SEQ ID NO. 3, then the virus is non-virulent.
The invention further relates to a method as described above, wherein the
presence
of amino acid L in position 94, and/or V in position 451 in SEQ ID NO. 3
confirms the
virus to cause high mortality.
The invention further relates to a method as described above, wherein the
presence
of L in position 94, L in position 355, V in position 451, T in position 474
and P in
position 563 of SEQ ID NO. 3 confirms the virus to cause high mortality.
The invention further relates to a method as described above, wherein the
presence
of N in position 252 of SEQ ID NO. 1, Tin position 184, I in position 194, S
in
position 262, A in position 320 and D in position 370 of SEQ ID NO. 2, and L
in
position 94, L in position 355, V in position 451, T in position 474 and P in
position
563 of SEQ ID NO. 3 confirms the virus to cause high mortality.
The invention further relates to a method as described above, wherein the
presence
of V in position 124 of SEQ ID NO. 3 confirms the virus to cause moderate
mortality,
high morbidity.
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
The invention further relates to a method as described above, wherein the
presence
of V in position 124, L in position 355, and T in position 474 of SEQ ID NO. 3
confirms the virus to cause moderate mortality, high morbidity.
5
The invention further relates to a method as described above, wherein the
presence
of - N in position 252 of SEQ ID NO. 1, and T in position 184, S in position
262, A in
position 320 and D in position 370 of SEQ ID NO. 2, and V in position 124, L
in
position 355, and T in position 474 of SEQ ID NO. 3 confirms the virus to
cause
10 moderate mortality, high morbidity.
The invention further relates to a method as described above, wherein the
presence
of A in position 107 of SEQ ID NO. 1, and Tin position 184, I in position 194,
Sin
position 262, A in position 320 and D in position 370 of SEQ ID NO. 2, and L
in
position 355, T in position 474 and P in position 563 of SEQ ID NO. 3
confirms the virus to cause high morbidity.
The invention further relates to a method as described above, wherein the
presence
of N in position 252 of SEQ ID NO. 1 confirms the virus to cause moderate
mortality,
high morbidity.
Figures
The invention will now be described in detail with reference to the enclosed
Figures
and sequences where
Fig. 1 shows an alignment of PRV protein S4, from GenBank AGR27923 (SEQ ID
NO. 1) and from a virulent virus strain (SEQ ID NO. 7-8), AGR27923 is cut 17
amino
acids at the end,
Fig. 2 shows an alignment of PRV Protein M2 (SEQ ID NO. 2), from GenBank
AGR27919 and from a virulent virus strain (SEQ ID NO. 9-10),
Fig. 3 shows an alignment of PRV Protein M3 (SEQ ID NO. 3), from GenBank
AGR27920 and from a virulent virus strain (SEQ ID NO. 11-13)
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
11
Fig. 4 shows an alignment of the nucleotide encoding S4, from GenBank K0715687
(SEQ ID NO. 4) and from a virulent virus strain (SEQ ID NO. 14-16) K0715687 is
cut
38 nucleotides at 5 end and 105 at 3 end,
Fig. 5 shows an alignment of the nucleotide encoding M2, from GenBank K0715683
(SEQ ID NO. 5) and from a virulent virus strain (SEQ ID NO. 17-20) K0715683 is
cut
with 26 nucleotides at 5 end and 87 at 3 end,
Fig. 6 shows an alignment of the nucleotide encoding M3, from GenBank K0715684
(SEQ ID NO. 6) and from a virulent virus strain (SEQ ID NO. 21-23) K0715684 is
cut with 83 nucleotides at 5 end and 60 at 3 end,
Fig. 7 shows a phylogenetic tree of S4,
Fig. 8. shows accumulated mortality associated with the PRV genotypes of
virulent
virus, wherein Fig 8.A shows HSMI mortality and Fig 8.B. shows mortality of
looser
fish also called morbidity.
.. The enclosed nucleotide sequences are
SEQ ID NO. 1 Amino acid of PRV segment S4 from fish (Modification of
GenBank
acc. AGR27923, with cut of 17 amino acids at 3 end)
SEQ ID NO. 2 Amino acid of PRV segment M2 from fish (GenBank acc. AGR27919 )
SEQ ID NO. 3 Amino acid of PRV segment M3 from fish (GenBank acc. AGR27920)
SEQ ID NO. 4 DNA of PRV segment S4 from fish (Modification of GenBank 10
acc.KC15687, with cut of 38 nucleotides at 5 end and 105 at 3 end)
SEQ ID NO. 5 DNA of PRV segment M2 from fish (Modification of GenBank 10
acc.KC15683, with cut of 26 nucleotides at 5 end and 87 at 3 end)
SEQ ID NO. 6 DNA of PRV segment M3 from fish (Modification of GenBank 10
acc.KC15684, with cut of 83 nucleotides at 5 end and 60 at 3 end)
SEQ ID NO. 7 Amino acid of virulent PRV segment S4 from Genogroup A and C
SEQ ID NO. 8 Amino acid of virulent PRV segment S4 from Genogroup B
SEQ ID NO. 9 Amino acid of PRV segment M2 from Genogroup A-2 and B
SEQ ID NO. 10 Amino acid of PRV segment M2 from Genogroup A and C
SEQ ID NO. 11 Amino acid of PRV segment M3 from Genogroup A
SEQ ID NO. 12 Amino acid of PRV segment M3 from Genogroup B
SEQ ID NO. 13 Amino acid of PRV segment M3 from Genogroup C
SEQ ID NO. 14 DNA of PRV segment S4, genotype A
SEQ ID NO. 15 DNA of PRV segment S4, genotype B
SEQ ID NO. 16 DNA of PRV segment S4, genotype C
SEQ ID NO. 17 DNA of PRV segment M2, genotype A
SEQ ID NO. 18 DNA of PRV segment M2, genotype A-2
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
12
SEQ ID NO. 19 DNA of PRV segment M2, genotype B
SEQ ID NO. 20 DNA of PRV A segment M2, genotype C
SEQ ID NO. 21 DNA of PRV segment M3, genotype A
SEQ ID NO. 22 DNA of PRV segment M3, genotype B
SEQ ID NO. 23 DNA of PRV segment M3, genotype C
SEQ ID NO. 24 Oligonucleotide (forward 1) primer for detecting SNP 54-T320C
SEQ ID NO. 25 Oligonucleotide (forward 2) primer for detecting SNP 54-T320C
SEQ ID NO. 26 Oligonucleotide probe P1 for detecting SNP 54-T320C
SEQ ID NO. 27 Oligonucleotide probe P2 for detecting absence of SNP 54-T320C
SEQ ID NO. 28 Oligonucleotide (forward 1) primer for detecting SNP 54-754A
SEQ ID NO. 29 Oligonucleotide (forward 2) primer for detecting SNP 54-G754A
SEQ ID NO. 30 Oligonucleotide probe P1 for detecting SNP 54-G754A
SEQ ID NO. 31 Oligonucleotide probe P2 for detecting absence of SNP 54-G754A
SEQ ID NO. 32 Oligonucleotide (forward 1) primer for detecting SNP M2-G551C
SEQ ID NO. 33 Oligonucleotide (forward 2) primer for detecting SNP M2-G551C
SEQ ID NO. 34 Oligonucleotide probe P1 for detecting SNP M2-G551C
SEQ ID NO. 35 Oligonucleotide probe P2 for detecting absence of SNP M2-G551C
SEQ ID NO. 36 Oligonucleotide (forward 1) primer for detecting SNP M2-T580A
SEQ ID NO. 37 Oligonucleotide (forward 2) primer for detecting SNP M2-T580A
SEQ ID NO. 38 Oligonucleotide probe P1 for detecting SNP M2-T580A
SEQ ID NO. 39 Oligonucleotide probe P2 for detecting absence of SNP M2-T580A
SEQ ID NO. 40 Oligonucleotide (forward 1) primer for detecting SNP M2-G784T
SEQ ID NO. 41 Oligonucleotide (forward 2) primer for detecting SNP M2-G784T
SEQ ID NO. 42 Oligonucleotide probe P1 for detecting SNP M2-G784T
SEQ ID NO. 43 Oligonucleotide probe P2 for detecting absence of SNP M2-G784T
SEQ ID NO. 44 Oligonucleotide (forward 1) primer for detecting SNP M2-A1108G
SEQ ID NO. 45 Oligonucleotide (forward 2) primer for detecting SNP M2-A1 108G
SEQ ID NO. 46 Oligonucleotide probe P1 for detecting SNP M2-A1108G
SEQ ID NO. 47 Oligonucleotide probe P2 for detecting absence of SNP M2-A1 108G
SEQ ID NO. 48 Oligonucleotide (forward 1) primer for detecting SNP M3-A280T
SEQ ID NO. 49 Oligonucleotide (forward 2) primer for detecting SNP M3-A280T
SEQ ID NO. 50 Oligonucleotide probe P1 for detecting SNP M3-A280T
SEQ ID NO. 51 Oligonucleotide probe P2 for detecting absence of SNP M3-A280T
SEQ ID NO. 52 Oligonucleotide (forward 1) primer for detecting SNP M3-C371T
SEQ ID NO. 53 Oligonucleotide (forward 2) primer for detecting SNP M3-C371T
SEQ ID NO. 54 Oligonucleotide probe P1 for detecting SNP M3-C371T
SEQ ID NO. 55 Oligonucleotide probe P2 for detecting absence of SNP M3-C371T
SEQ ID NO. 56 Oligonucleotide (forward 1) primer for detecting SNP M3-A1351G
SEQ ID NO. 57 Oligonucleotide (forward 2) primer for detecting SNP M3-A1351G
SEQ ID NO. 58 Oligonucleotide probe P1 for detecting SNP M3-A1351G
SEQ ID NO. 59 Oligonucleotide probe P2 for detecting absence of SNP M3-A1351G
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
13
SEQ ID NO. 60 Oligonucleotide (forward 1) primer for detecting SNP M3-T1687C
SEQ ID NO. 61 Oligonucleotide (forward 2) primer for detecting SNP M3-T1687C
SEQ ID NO. 62 Oligonucleotide probe P1a for detecting SNP M3-T1687C
SEQ ID NO. 63 Oligonucleotide probe P1b for detecting SNP M3-T1687C
SEQ ID NO. 64 Oligonucleotide probe P2 for detecting absence of SNP M3-T1687C
Description of preferred embodiments of the invention
Reference throughout the description to "an embodiment" signifies that a
particular
feature, structure or property specified in connection with an embodiment is
included
in the least in one embodiment. The expressions "in one embodiment", "in a
preferred embodiment" or "in an alternative embodiment" different places in
the
description does not necessarily point to the same embodiment. Further, the
different
features, structures or properties may be combined in any suitable way in one
or
more of the embodiments.
Example 1:
This study describes different genotypes of PRV isolates collected from farmed
Atlantic salmon in Norway.
Materials and methods
Tissue samples of heart, head or kidney from HSMI diseased farmed Atlantic
salmon
were collected from aquaculture farms in Norway and tested for PRV by RT-qPCR.
The samples were collected from 11 freshwater sites and 29 seawater sites
during
the years 2014 to 2016. The samples were collected aseptically on tubes
prefilled
with RNAlater (Ambion, USA). After sampling, the tubes containing tissue
samples
were shipped chilled to PatoGen AS with 24-hour delivery service.
The RT-qPCR assay targeting PRV were performed, the method is validated
according to IS017025 standards and is described elsewhere (Glover et al.
2013).
Amino acid changes can be detected by different methods, such as protein
sequencing, DNA or RNA sequencing, or by Real Time qPCR SNP assay. The two
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
14
last methods are easier and more cost effective than protein sequencing. In
this
example DNA/RNA sequencing by Sanger and by Real Time PCR were used.
PRV isolates from 3 freshwater sites and 17 seawater sites where the fish had
developed HSMI, were selected, the genomic material of the samples were
isolated,
and the genomic material was sequenced. Further, the amino acid sequences of
the
sample were isolated and sequenced.
A retrospective epidemiological study was performed to investigate whether
specific
PRV genotypes was associated with HSMI mortality and/or morbidity (including
looser fish). The data was collected from salmon farms in Norway. Looser fish
is fish
not developing and acting normal, it is often smaller than normal fish, has a
higher
mortality rate and it cannot be sent to the marked once slaughtered. In the
following,
virus causing looser fish will be referred to as virus causing morbidity.
Results
All samples confirmed positive to PRV in standard qPCR testing. The
phylogenetic
analyses generated 3 distinct groups shown as A, B and C in figure 7, in
addition to
the reference.
The genomic material and the amino acid sequences of the sample were compared
to a Canadian from Genbank named VT06062012-358 (herein called reference or
reference virus), defined as non-virulent, where
SEQ ID NO. 1 shows a truncated version of the amino acid sequence of S4, being
the outer fiber protein, and
SEQ ID NO. 4 shows a truncated version the nucleotide sequence of the S4
segment, encoding the outer fiber protein,
SEQ ID NO. 2 shows the amino acid sequence of M2 segment being the outer shell
protein, and
SEQ ID NO. 5 shows a truncated version of the nucleotide sequence of the M2
segment encoding the outer shell protein, and
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
SEQ ID NO. 3 shows the amino acid sequence of M3 segment, encoding a non-
structural factory protein, and
SEQ ID NO. 6 shows a truncated version of the nucleotide sequence of the M3
segment encoding the non-structural factory protein,
5 of the reference virus.
Sequences for both the proteins and the nucleotide sequences encoding the
proteins
were aligned with the reference. The alignments are enclosed as Figure 1 and
4,
regarding S4 segment, Figure 2 and 5 regarding M2 segment and Figure 3 and 6
10 regarding M3 segment. Genotype groups were established, named A, B and
C. In
the alignments both SNPs causing an amino acid change and silent mutations are
shown.
Regarding the S4 segment, the genotype groups A and C of the protein are
identical.
15 The sequences of A/C and B are enclosed as SEQ ID NO. 7 and 8
respectively. The
genotype groups A, B and C of the nucleotide sequence are unique, and enclosed
as SEQ ID NO. 14-16.
Regarding the M2 segment, there were 4 genotype groups, A, A-2, B and C, where
the proteins of A-2 and B, and A and C are identical, sequences of which are
enclosed as SEQ ID NO. 9 and 10, respectively. The groups A, A-2, B and C of
the
nucleotide sequence are unique, and enclosed as SEQ ID NO. 17-20,
respectively.
Regarding the M3 segment, the genotype groups of the proteins were unique, the
sequences are enclosed as SEQ ID NO. 11-13, showing genotype group A, B and C
respectively. The genotype groups A, B and C of the nucleotide sequence are
also
unique, and enclosed as SEQ ID NO. 21-23, respectively.
The three different genogroups identified 13 different unique changes in amino
acids
that are associated to virulence (Table 2). It is the amino acids that are the
basis for
the genogrouping. There were slight variations in silent mutations in
addition, that did
not cause any change in amino acid.
CA 03126580 2021-07-12
WO 2020/159379 PCT/N02020/050017
16
Table 2. Amino acid differences identified in PRV strains.
Segment AA AA ref AA nt nt ref nt SNP Geno-
position virulent position virulent
group
AGR27923 KC715687
S4 107 V A 320 T C 54-1320C B
S4 252 D N 754 G A 54-G754A A,C
AGR27919 KC715683
M2 184 S T 551 G C M2-G551C A,B,C
M2 194 F I 580 T A M2-1580A A,B
M2 262 A S 784 G T M2-G7841 A,B,C
M2 320 T A 958 A G M2-A958G A,B,C
M2 370 N D 1108 A G M2-A1108G A,B,C
AGR27920 KC715684
M3 94 M L 280 A T M3-A2801 A
M3 124 A V 371 C T M3-C3711 C
M3 355 P L 1064 C T M3-C10641 A,B,C
M3 451 I V 1351 A G M3-A1351G A
M3 474 I T 1421 T C M3-11421C A,B,C
M3 563 S P 1687 T C M3-11687C A, B
In the epidemiological study the accumulated mortality and morbidity (e.g.
looser
fish) were recorded. The mortality and morbidity observations correlated well
with the
3 genogroups A, B and C. The reference was not detected in any of the sites.
Six
PRV-isolates grouped into genogroup C, 9 PRV-isolates into the genogroup A and
5
PRV-isolates into the genogroup B (Table 3). Although several amino acid
changes
can be seen in several genogroups, these may also be important to predict the
strains' ability to induce mortality and or morbidity, relatively to the non-
virulent
reference.
Table 3. PRV isolates with data about HSMI mortality grouped into genotypes.
FW:
freshwater site. SW: seawater site.
Production type Site number Genotype HSMI
FW 2 A
SW 3 A
SW 3 A
SW 4 A
SW 5 A High HSMI
SW 5 A mortality
SW 5 A
SW 7 A
SW 8 A
FW 9 C
SW 10 C
SW 10 c Moderate to low
SW 11 c HSMI mortality
SW 12 c
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
17
SW 13
FW 14
SW 15 B No specific HSMI
SW 16 B mortality, but high
SW 17 B morbitidy
SW 17
The result from the epidemiological study showed that the PRV genotype A was
associated to higher level of HSMI mortality. The genogroup B was associated
with
high morbidity (looser fish) and less mortality. The genogroup C was
associated with
lower mortality and morbidity (looser fish). Accumulated mortality associated
with
the PRV genotypes is shown in Figure 8, where fig. 8A shows the HSMI mortality
and Fig 8.B. shows % mortality that is of looser fish, also called morbidity.
The figure
also show the the 25th and 75th percentiles. A correlation between the
genogroups
and the mortality from the epidemiological data were confirmed. Regarding
figure 8B,
the lower and upper border of boxes indicates the 25th and 75th percentiles,
respectively and the centerline indicates the 50th percentile. The upper and
lower
whiskers correspond to the highest and lowest value of the 1.5*IQR (inter-
quartile
range). The differences between genogroups, are reflected in the 13 amino acid
changes shown in Table 2.
Example 2:
In order to determine whether a fish is infected by a PRV virus causing
mortality
and/or morbidity, or a nonvirulent virus, primers and probes proving the
presence or
absence of the SNPs according to the present invention were developed. If one
or
more of the SNPs are present, then the virus is virulent and will cause
morbidity
and/or mortality of a fish upon infection. Based on this, 10 different Real
Time SNP
assays were designed to detect amino acid changes (Table 4). The probe 1
detect
the virulent mutation, and probe 2 detect the reference being nonvirulent.
All SNP's can also be detected by sequencing, for the virulence markers M2-
320,
M3-355 and M3-474 only sequencing are used.
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
18
Table 4 Primer pairs and probes (assays) for detection of the SNPs related to
the
invention. Probe 1 (P1) detect virulent strains of the virus, P2 detect the
reference
virus.
SEQ Primer/
Primer/probe Sequence 5'-3' Detects
ID NO. Probe
24 S4-107-F
GGTCCTGAGATTGACGACAAACT:::. ' ..............................iii iii-----
Primer::
25 S4-107-R AGTTCATGATTGTGAGCTGGTCAT aaS4-V107A
Primer
ii 26 S4-107-P1 CAGCTTAAGGCGCTG ntS4-T320C Probe
............................................................ 7
27 S4-107-P2 ACAGCTTAAGGTGCTG Probe .
28 S4-252-F GGAAGAAGCTGCCTCAAATGGTGAAAGG ' Primer
29 54-252-R TCACCACCACAGGAACTACATTG aa54-D252N
Primer
30 54-252-P1 ATGAGTCTGGTGAATTA nt54-G754A Probe
31 54-252-P2 AGTCTGGTGGATTATGA Probe
====
32 M2-184-F TCCCTCATTCAACTCCAATC d:. ............... Primer:,
.t't!... .
33 M2-184-R AACATCCTCAGAATGGAATGCA aaM2-S184T
Primer
!,!,!i!i!i== ..
ii 34 M2-184-P1 TAGTCTGACCGCTGAC ..........................
ntM2-G551C Probe
=
35 M2-184-P2 TAGTCTGAGCGCTGAC
.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:n.:.:.:.:.:.:.:.:.:.:
.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:., Probe
. 36 M2-194-F GACCGCTGACATGCATTCC Primer
37 M2-194-R GCACACATTGGTTGGCTTGA aaM2-F1941
Primer
38 M2-194-P1 TTCTGAGGATGATTTCC ntM2-T580AProbe
39 M2-194-P2 TTCTGAGGATGTTTTCC Probe
========
.:.= By sequenzing
...:::::::::::.=
40 M2-262-F TCAACCTCCACTGACTGATCAGA :........... Primer
..
41 M2-262-R AGCCAGAGATGCATCAGACCTT M2 A262S Primer
4: ..
42 M2-262-P1 CGAAGTCCGTTCAAT ntM2-G784T Probe
................................................................
.................................................................. .
ii.... 43 M2-262-P2 CGAAGTTCGCGCAAT Probe
44 M2-370-F GCATCTGGATGACATCACCAGTA Primer
45 M2-370-R AAACTGTTGATCCTGAATCTGCC aaM2-N370D
Primer
ntM2-
46 M2-370-P1 TAGCGAACGACGC Probe
Al 108G
47 M2-370-P2 TCGCGAACAACGC Probe
7.= .
4. 48 M3-94-F TGCTATACGTAGTATGATTTCTCCTCTTG ' Primer
49 M3-94-R CACTGCTTCTCAACAACATCAACA aaM3-M94L
Primer:
50 M3-94-P1 ATTTGGAGTGTTGCGC ntM3-A2801 Probe
::::. = .=
a... 51 M3-94-P2
ATTTGGAGTGATGCGC Probe ..
===
52 M3-1 24-F CTCTTGAAAGACGTGGGATGTTG Primer
53 M3-124-R TCAGTGACATCCAATTGAAGAGGTA aaM3-A124V
Primer
54 M3-124-P1 AGGATGCGGCTGTTGA ntM3-C371T Probe
55 M3-124-P2 GATGCGGCTGCTGAAT Probe
1
....
:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:
:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.==
By sequenzing
.....
.=:n:n:.=
56 M3-451-F TGCGAGATCGTCAAGTAACGA aaM3-I451V
Primer
t== .
W.,.: .. M3-451 -
13:::.:.:.:.:.:.:.:
.TCCTTCATGTTGGCGACATP.........................................................*
:::.................p0A..................,..Primek.
CA 03126580 2021-07-12
WO 2020/159379
PCT/N02020/050017
19
SEQ Primer/
Primer/probe Sequence 5'-3 Detects
ID NO. Probe
58 M3-451-P1 TCCACCGTTCAC-T¨C.. '' A1351 Probe
59 nA3-451-P2 TTCCACCATTCACTC Probe,d
By sequenzing
60 M3-563-F CTCAGCTCTGACTTCCTGATGGT Primer
61 M3-563-R CAGCGGCACAGGACATTG Primer
aaM3-S563P
62 M3-563-P1a ACCACTTCCTGAGCACA Probe
ntM3-T1687C
63 M3-563-P1b ACCACTTCCTGAACACA Probe
64 M3-563-P2 AAACCACTTTCTGAGCACAA Probe
Example 3:
Test of assays. To validate that the Real Time PCR SNP assays (Example 2) can
differentiate between the different groups, 3 assays was tested on field
samples from
Example 1. The assays SNP S4-T3200, M3-0371T and M3-A1351G, detecting B, C
and A respectively, were used.
The assays give a differentiation in Ct values and the probe giving the lowest
Ct
values indicates which SNP mutation that is most frequent in the biologic
sample.
The detected SNPs are marked in Bold in table 5 below.
Table 5: Three assays tested on biological samples, and Ct values from PCR.
Assay S4-T320C M3-C371T M3-A1351G
aa detection Probe 2 Probe 1 Probe 2 Probe 1 Probe 2
Probe 1
27 25,3 18,5 21,8 22,5 23,8
15,8 19,1 19,4 16,4 23,6 24,8
A 14,7 17,4 16,8 19,8 ND* 15,5
*ND = Not Detected.
This shows that if the P1 probe has the lowest Ct value, when using the SNP
assay
S4-T3200, the virus is of genotype B. The same is shown for the SNP assays M3-
0371T and M3-A1351G; if P1 has the lowest Ct value, the sample is of genotypes
C
and A respectively.
