Note: Descriptions are shown in the official language in which they were submitted.
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
PLASMIDS
TECHNICAL FIELD
The invention relates to means for carrying out conjugation between bacteria,
and in particular the
.. invention relates to carrier (ie, donor) bacteria comprising antimicrobial
agents and methods of use. A
carrier bacterium is capable of conjugative transfer of DNA encoding the agent
to a target cell (ie,
recipient cell). The invention provides novel plasmids that are devoid a
functional hypC2 nucleotide
sequence for these purposes.
BACKGROUND
DNA sequences controlling extra-chromosomal replication (on) and transfer
(tra) are distinct from
one another; i.e., a replication sequence generally does not control plasmid
transfer, or vice- versa.
Replication and transfer are both complex molecular processes that make use of
both plasmid- and
host-encoded functions. Bacterial conjugation is the unidirectional and
horizontal transmission of
genetic information from one bacterium to another. The genetic material
transferred may be a plasmid
or it may be part of a chromosome. Bacterial cells possessing a conjugative
plasmid contain a surface
structure (the sex pilus) that is involved in the coupling of donor and
recipient cells, and the transfer
of the genetic information. Conjugation involves contact between cells, and
the transfer of genetic
traits can be mediated by many plasmids. Among all natural transfer
mechanisms, conjugation is the
most efficient. For example, F plasmid of E. coli, pCF10 plasmid of
Enterococcus faecalis and
pX016 plasmid of Bacillus thuringiensis employ different mechanisms for the
establishment of
mating pairs, the sizes of mating aggregates are different, and they have
different host ranges within
gram-negative (F) as well as gram-positive (pCF10 and pX016) bacteria. Their
plasmid sizes are also
different; 54, 100 and 200 kb, respectively. Remarkably, however, those
conjugation systems have
very important characteristics in common: they are able to sustain conjugative
transfer in liquid
medium and transfer efficiencies close to 100% are often reached in a very
short time. Thus, the
conjugative process permits the protection of plasmid DNA against
environmental nucleases, and the
very efficient delivery of plasmid DNA into a recipient cell. Conjugation
functions are naturally
plasmid encoded. Numerous conjugative plasmids (and transposons) are known,
which can transfer
associated genes within one species (narrow host range) or between many
species (broad host range).
Transmissible plasmids have been reported in numerous Gram-positive genera,
including but not
limited to pathogenic strains of Streptococcus, Staphylococcus, Bacillus,
Clostridium and Nocardia.
The early stages of conjugation generally differ in Gram-negative and Gram-
positive bacteria. The
role of some of the transfer genes in conjugative plasmids from Gram-negative
bacteria are to provide
1
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
pilus-mediated cell-to-cell contact, formation of a conjugation pore and
related morphological
functions. The pili do not appear to be involved in initiating conjugation in
Gram-positive bacteria.
SUMMARY OF THE INVENTION
The invention provides:-
In a First Configuration
A conjugative plasmid that is devoid of a hypC2 nucleotide sequence or a
homologue thereof.
In a Second Configuration
A bacterial cell that comprises a conjugative plasmid, wherein the cell does
not comprise a hypC2
protein or a homologue thereof.
In a third Configuration
Use of a plasmid according to the invention in the manufacture of a
composition comprising a first
population of cells comprising the plasmid, for enhancing the frequency of
plasmid conjugative
transfer from the first cells to cells of a second population when first and
second cells are in contact
with each other.
In a Fourth Configuration
A method of transferring a nucleic acid sequence of interest (NSI) from a
donor cell to a recipient cell,
wherein the NSI is comprised by a plasmid and the plasmid is comprised by the
donor cell, the
method comprising combining the cells to allow conjugative tranfer of the
plasmid from the donor
cell to the recipient cell, wherein the plasmid is according to the invention.
In a Fifth Configuration
A method of treating an infection in a human or animal subject, wherein the
infection is an infection
of a plurality of bacterial cells (recipient cells), the method comprising
(i) administering a plurality of donor bacterial cells to the subject whereby
recipient cells are
combined with a donor cells, wherein each donor cell comprises a plasmid
according to the invention;
(ii) and allowing conjugative transfer of plasmids from the donor cells to the
recipient cells, wherein
each transferred plasmid comprises a respective nucleic acid sequence of
interest (NSI) that comprises
or encodes an antibacterial agent or component thereof that is toxic to
recipient cells, whereby
recipient cells are killed or the growth or proliferation of recipient cells
is inhibited.
In a Sixth Configuration
A plasmid or cell of the invention for use in the method of the fifth
configuration.
In a Seventh Configuration
A method of producing a conjugative plasmid that is devoid of a functional
hypC2 nucleotide
sequence or a homologue thereof, the method comprising
2
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
(a) providing a first conjugative plasmid that comprises a first nucleotide
sequence which is a
hypC2 nucleotide sequence or a homologue thereof that is functional to express
a hypC2
protein; and
(b) deleting the first sequence from the first plasmid or mutating the first
sequence to render the
sequence non-functional for expression of said protein, thereby producing said
conjugative
plasmid.
In an Eighth Configuration
A conjugative plasmid that is an engineered version of a reference plasmid,
wherein the reference
plasmid comprises a first nucleotide sequence comprising a hypC2 nucleotide
sequence or a
homologue thereof that is functional to express a hypC2 protein, wherein the
engineering has deleted
or rendered non-functional the hypC2 nucleotide sequence or a homologue
thereof.
BRIEF DESCRIPTION OF FIGURES
Figure 1. The hypc2 KO (knock-out) plasmid mutant shows an approximately 1000x
higher
conjugation rate compared to the wildtype (WT). Showed is the number of
transconjugants (infected
cells) obtained from the same amount of donor and incubation time with the WT
and optimized
(mutant) plasmids.
Figure 2: A phylogram showing the relatedness of hypC2 found in individual
examples of plasmids
found in different bacterial host species.
Figure 3: (a) Shows the presence of hyp2C in multiple incX plasmids (a
sequence portion of which is
represented by a respective line in the figure). The Hyp2C gene can be located
via its location relative
to the hypC1 gene (a name we used for commonly-present ORF) (whose gene
arrangement is shown
schematically in (b) for the pX1 plasmid as well as three other incX plasmids)
and close proximity to
the stb type toxin-antitoxin genes. Furthermore, it is consistently found
upstream the conjugative
operon (starting with taxA or homologs hereof) see (a).
DETAILED DESCRIPTION
The invention is based on the surprising finding that inactivation of a
functional hypC2 gene in
conjugative plasmids massively enhances the efficiency of conjugation between
donor cells
harbouring a plasmid and recipient cells to which the plasmid is to be
transferred. Inactivation may,
for example, be achieved by deleting the gene or part thereof or by inserting
one or more exogenous
sequences into the gene such that the gene is non-functional for expressing
its cognage hypC2 protein.
Optionally, a promoter or other regulatory element of the gene may be
inactivated (eg, deleted) to
prevent gene expression.
3
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Additionally, the inventor has surveyed many different plasmids and has found
that this gene and its
homologues are widespread amongst conjugative plasmids. The invention,
therefore, provides a
generally applicable way of enhancing conjugative transfer of plasmids that
has many therapeutic and
non-therapeutic uses.
Herein, "donor cells" is used interchangeably with "first cells" or "carrier
cells"; and "recipient cells"
is used interchangeably with "second cells" or "target cells".
To this end, the invention provides a conjugative plasmid that is devoid of a
hypC2 nucleotide
sequence or a homologue thereof.
The invention also provides:-
A conjugative plasmid that is an engineered version of a reference plasmid,
wherein the reference
plasmid comprises a first nucleotide sequence comprising a hypC2 nucleotide
sequence or a
homologue thereof that is functional to express a hypC2 protein, wherein the
engineering has deleted
or rendered non-functional the hypC2 nucleotide sequence or a homologue
thereof.
Optionally, the the reference plasmid is selected from the plasmid of Genbank
accession number
HG963477.1, CP023137.2, CP005391.2, CP013972.1, CP017588.1 or CP026699.1; or a
homologue
of a said selected plasmid, wherein the homologue is capable of being
conjugatively transferred (i) to
an Enterobacteriaceae cell; or (ii) an E coli, Klebsiella, Salmonella,
Erwinia, Shigella, Pantoea,
Proteus or Citrobacter cell.
The invention also provides:-
A conjugative plasmid that is obtainable by the method of the seventh
configuration or method of
producing a plasmid as described below.
The invention provides:-
A method of producing a conjugative plasmid that is devoid of a functional
hypC2 nucleotide
sequence or a homologue thereof, the method comprising
(a) providing a first conjugative plasmid that comprises a first nucleotide
sequence which is a
hypC2 nucleotide sequence or a homologue thereof that is functional to express
a hypC2
protein; and
4
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
(b) deleting the first sequence from the first plasmid or mutating the first
sequence to render the
sequence non-functional for expression of said protein, thereby producing said
conjugative
plasmid.
Routine molecular biology techniques, such as recombinant DNA technology (eg,
recombineering) as
will be known by the skilled addressee, can be used to delete or render non-
functional the first
sequence. For example, the first sequence or part thereof may be deleted, such
as by using a DNA
vector in homologous recombination with the first plasmid wherein the
homologous recombination
event deletes the first sequence (or a part), thereby rendering the resulting
plasmid non-functional for
expression of a hypC2 protein. Additionally or alternatively, one or more
nucleic acid sequences may
be inserted into and/or adjacent to the first sequence, thereby rendering it
non-functional for expressin
of hypC2 protein.
Optionally, the first plasmid is selected from the plasmid of Genbank@
accession number
HG963477.1, CP023137.2, CP005391.2, CP013972.1, CP017588.1 or CP026699.1.
Optionally, the
first plasmid is an IncX plasmid, eg, a pX1.0 plasmid, pOLA52, pIS15_43,
pDSJO7 or R6K plasmid.
Optionally, the conjugative plasmid or plasmid of the invention is a modified
plasmid selected from
the plasmid of Genbank@ accession number HG963477.1, CP023137.2, CP005391.2,
CP013972.1,
CP017588.1 or CP026699.1.
Optionally, the conjugative plasmid or plasmid of the invention is an
engineered version of a
reference plasmid, wherein the reference plasmid is selected from the plasmid
of Genbank@ accession
number HG963477.1, CP023137.2, CP005391.2, CP013972.1, CP017588.1 or
CP026699.1, wherein
the reference plasmid comprises a first nucleotide sequence comprising a hypC2
nucleotide sequence
or a homologue thereof that is functional to express a hypC2 protein, wherein
the engineering has
deleted or rendered non-functional the hypC2 nucleotide sequence or a
homologue thereof.
In an example, the first nucleotide sequence comprises SEQ ID NO: 1 or a
nucleotide sequence that
is at least 70, 80, 85, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 1.
In an example, the first
nucleotide sequence comprises a sequence selected from SEQ ID NOs: 1 and 3-7
or a nucleotide
sequence that is at least 70, 80, 85, 90, 95, 96, 97, 98 or 99% identical to
said selected sequence.
In an example, the hypC2 protein comprises SEQ ID NO: 2 or a nucleotide
sequence that is at least
70, 80, 85, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 2.
5
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
As seen in figure 3, hyp2C is located in close proximity to stb type toxin-
antitoxin genes (within 1-
5kb of a stb gene). Furthermore, it is consistently found upstream the
conjugative operon (starting
with taxA or homologs hereof) (within 1-5kb of a taxA gene).
In an example, the homologue comprises a nucleotide sequence that is at least
75, 76, 77, 78, 79, 80,
85, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO:l. See Example 2 as an
illustration.
Additionally or alternatively, the homologue is at a position in the plasmid
that corresponds to
positions 20849-21064 in plasmid pX1Ø
Optionally, the plasmid is devoid of SEQ ID NO: 1 or a nucleotide sequence
that is at least 70%
identical to SEQ ID NO: 1. Optionally, the plasmid is devoid of SEQ ID NO: 1
or a nucleotide
sequence that is at least 60, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97,
98 or 99% identical to SEQ
ID NO: 1.
Preferably, the plasmid is an IncX plasmid, eg, a pX1.0 plasmid.
In an example, the plasmid comprises an OriT of a plasmid selected from an
IncX plasmid (eg, a
pX1.0 plasmid, pOLA52, pIS15_43, pDSJ07 or R6K plasmid).
In an example, the plasmid is a pI515_43, pCFSAN002069, pOLA52, R6K or pDSJ07
plasmid, ie,
comprises a backbone of such a plasmid. As is known to the skilled addressee,
a plasmid backbone
comprises an oriV. The backbone may further comprise one or genes required for
plasmid replication
and/or conjugation.
Optionally, the plasmid is an Enterobacteriaceae plasmid. In an example the
plasmid is anY coli,
Klebsiella, Salmonella, Erwinia, Shigella, Pantoea, Proteus or Citrobacter
plasmid.
In an example, the plasmid is capable of replicating in an E coli, Klebsiella,
Salmonella, Erwinia,
Shigella, Pantoea, Proteus or Citrobacter host cell. In an example, the
plasmid is capable of
replicating in a cell of a species or genus disclosed in Table 2.
Optionally, the plasmid is capable of being hosted in an Enterobacteriaceae
cell.
6
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optionally, the plasmid is capable of being hosted in an E coli, Klebsiella,
Salmonella, Erwinia,
Shigella, Pantoea, Proteus or Citrobacter cell.
Optionally, the plasmid is capable of being conjugatively transferred to an
Enterobacteriaceae cell,
eg, wherein the cell is of an Enterobacteriaceae species or genus disclosed in
Table 2.
In an example, the plasmid is capable of being conjugatively transferred to a
cell of a species or genus
disclosed in Table 2.
Optionally, the plasmid is capable of being conjugatively transferred to an E
coli, Klebsiella (eg, K
pneumoniae), Salmonella (eg, S typhimurium), Erwinia, Shigella, Pantoea,
Proteus or Citrobacter
cell.
The invention also provides a bacterial cell that comprises a conjugative
plasmid, wherein the cell
does not comprise a hypC2 protein or a homologue thereof.
For example, the cell does not comprise a protein comprising an amino acid
sequence that is at least
70, 75, 80, 85, 90, 95, 96, 97, 98 or 99 identical to SEQ ID NO: 2. For
example the cell does not
comprise a protein comprising SEQ ID NO: 2, eg, wherein the plasmid is an IncX
(eg, pX1.0)
plasmid. For example, the plasmid comprises an OriT of an IncX (eg, pX1.0)
plasmid. For example,
the plasmid is capable of being recognized with (ie, operable with) a
conjugation system of an IncX
plasmid.
The invention also provides a population of such bacterial cells. For example,
the population
comprises at least 103, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012,
10131or 014 of such cells.
Optionally, each cell comprises at least 2, 3, 4,5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20,
25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90 or 100 plasmids of the invention.
Optionally, all of the
plasmids of the invention comprised by a cell are identical. Alternatively, a
cell comprises two, three
or more different types of plasmids of the invention. For example, the
plasmids may be identical but
differ in NSIs.
Optionally, the cell is devoid of SEQ ID NO: 2 or an amino acid sequence that
is at least 60, 70, 75,
80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 2.
7
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optionally, the cell is an Enterobacteriaceae cell. Optionally, the the cell
is an E coli, Klebsiella,
Salmonella, Erwinia, Shigella, Pantoea, Proteus or Citrobacter cell.
In an embodiment, the plasmid comprises or encodes an antibacterial agent, or
a component of such
an agent. For example, the plasmid encodes an RNA that has antibacterial
activity (eg, a silencing
RNA). For example, the plasmid encodes a protein that has antibacterial
activity or wherein the
protein is a component of an antibactertial agent. Thus, once transferred into
a recipient cell (or target
cell or second cell ¨ both of which are used herein interchangeably with
"recipient cell") the plasmid
may express the agent or component inside the cell, wherein the agent kills
the cell or reduces the
growth or proliferation of the cell (or the component combines in the cell
with other component(s) to
form such an agent). In an example, the plasmid encodes a guide RNA or crRNA,
optionally wherein
the guide RNA or crRNA is capable of hybridising to a protospacer sequence of
a target cell. Thus,
the guide RNA or crRNA guides a Cas in the cell to modify (eg, cut) the
protospacer, whereby the cell
is killed or its growth or proliferation is inhibited. In an example the Cas
is Cas9 or Cas3. The Cas
may be a Type I, II, III, IV or V Cas. The Cas may be a nickase or may cut
dsDNA. The Cas may be
an RNAase.
Optionally, the target cell is selected from an E coli, Klebsiella (eg, K
pneumoniae), Salmonella (eg, S
typhimurium), Erwinia, Shigella, Pantoea, Proteus or Citrobacter cell. In an
example the target cell
is a Pseudomonas (eg, P aeruginosa) cell.
The invention further provides:-
Use of plasmids according to the invention in the manufacture of a composition
comprising a first
population of cells comprising the plasmids, for enhancing the frequency of
plasmid conjugative
transfer from the first cells (donor cells) to cells (recipient cells) of a
second population when first and
second cells are in contact with each other and are bacterial cells.
In an example, the recipient cells may be comprised by a surface (eg, on
medical equipmenmt or on
an apparatus), a gas (eg, air) or a liquid (eg, water or an aqueous liquid, or
a petrochemical liquid such
as liquid oil or gasolene).
In an example, the frequency is enhanced at least 10, 100 or 1000 times the
frequency of a control
plasmid that is identical to the plasmid of the invention but further
comprises a hypC2 gene that is
capable of expressing a hypC2 encoded protein. For example, the gene comprises
SEQ ID NO: 1 (or
a homologue thereof) and the protein comprises SEQ ID NO: 2 (or a homologue
thereof).
8
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optionally the second cells are comprised by a human or animal subject.
Alternatively, the second
cells are ex vivo or in vitro. In an example, the second cells are in an
environment (ie, not in a human
or animal), eg, the second cells are comprised by water, soil, a plant, a
field, a waterway, an oil field,
oil, a petroleum product, a foodstuff or ingredient thereof, a beverage or an
ingredient thereof, air, a
gas, or an air or liquid heating or cooling apparatus.
The invention further provides:-
A method of transferring a nucleic acid sequence of interest (NSI) from a
donor cell to a recipient cell,
wherein the NSI is comprised by a plasmid and the plasmid is comprised by the
donor cell, the
method comprising combining the cells to allow conjugative tranfer of the
plasmid from the donor
cell to the recipient cell, wherein the plasmid is according to the invention.
In an embodlment, the method is carried out with a plurality of donor and
recipient cells, wherein a
plurality of donor cells is combined with a plurality of recipient cells and
plasmids are transferred into
recipient cells.
Examples of NSIs are sequences encoding an antibacterial agent or component
thereof (eg, as
discussed above), an antibody domain (eg, a VH, VL, VHH or C domain), a
therapeutic protein, a
fertiliser, an herbicide, a pesticide, a metabolic enzyme, a peptide hormone
or a signalling (e.g.
quorum sensing) peptide. Optionally, in the method or use the NSI is or
encodes an antibacterial
agent, optionally wherein the agent is toxic to the recipient cell. Preferably
the agent is not toxic to
the donor cell, or is less toxic to the donor cell than the recipient cell.
Optionally, in the method or use the donor cell and/or recipient cell is
selected from the group
consisting of an E coli, Klebsiella, Salmonella, Erwinia, Shigella, Pantoea,
Proteus or Citrobacter
cell. For example, the donor cell is an E coli cell, eg, a strain selected
from Nissle (eg, Nissle 1917),
S17, DSM 17252, AO 34/86, MutaflorTM, SymbioflorTM and ColinfantTM. Optionally
in the method or
use the recipient cell is an Enterobacteriaceae cell.
The invention further provides:-
A method of treating an infection in a human or animal (e.g. pig, cow, horse,
dog, cat, sheep or
salmon) subject, wherein the infection is an infection of a plurality of
bacterial cells (recipient cells),
the method comprising
(i) administering a plurality of donor bacterial cells to the subject whereby
recipient cells are
9
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
combined with a donor cells, wherein each donor cell comprises a plasmid
according to the invention;
(ii) and allowing conjugative transfer of plasmids from the donor cells to the
recipient cells, wherein
each transferred plasmid comprises a respective nucleic acid sequence of
interest (NSI) that comprises
or encodes an antibacterial agent or component thereof that is toxic to
recipient cells, whereby
.. recipient cells are killed or the growth or proliferation of recipient
cells is inhibited.
In one embodiment, the plasmids are identical. In another embodiment different
plasmids are used,
eg, differing in their NSIs.
In an example, the administration is oral administration. In an example, the
administration is
intravenous administration. In an example, the administration is
administration through a catheter.
In an example, the recipient cells are pathogenic E coli cells, eg, E coli
ETEC, EPEC, EIEC, EHEC,
EAEC or AIEC cells.
The invention provides:-
A plasmid or cell of the invention for use in a method according to the
invention.
Optionally, in the method or use the donor cell is an E coli cell (eg, Nissle
strain) and the recipient
cell (eg, a cell that is pathogenic to humans or animals) is an E coli,
Klebsiella (eg, K pneumoniae),
Salmonella (eg, S typhimurium), Erwinia, Shigella, Pantoea, Proteus or
Citrobacter cell.
In an example, the target, second or recipient cell is a cell of a species or
strain of bacteria that is
pathogenic to humans or animals.
In some embodiments, the invention relates to carrier bacteria encoding
desired protein or RNA (eg,
encoding an antimicrobial agent) and methods of use. In embodiments, the agent
can be transferred
into target cells by conjugation between carrier cells (to which the agent is
not toxic) and the target
cells, whereby the agent is toxic to the target cells and kills the target
cells. In other embodiments, the
growth or proliferation of target cells is reduced (eg, by at least 40, 50,
60, 70, 80, or 90% compared
to growth in the absence of the agent). Each carrier cell comprises episomal
(ie, plasmid) DNA
encoding an antibacterial agent that is toxic to a target bacterial cell but
is not toxic (or is less toxic) to
the carrier cell. The invention finds application, for example, in controlling
or killing target bacteria
that are pathogenic to humans, animals or plants. The invention finds
application, for example, in
controlling or killing zoonotic target bacteria comprised by an animal (eg, a
livestock animal). For
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
example, the carrier cells may be comprised by a medicament for treating or
preventing a disease or
condition in a human or animal; a growth promoting agent for administration to
animals for
promoting growth theref; killing zoonositic bacteria in the animals; for
administration to livestock as a
pesticide; a pesticide to be applied to plants; or a plant fertilizer.
An advantage of the invention is that the carrier cells may be used as
producer cells in which plasmid
DNA encoding the antibacterial agent can be replicated. Additionally or
alternatively, the plasmid
and the conjugation system may also be separated, such that the cell carries
the conjugation system
(lacking hyp2C) on its chromosome to mobilize a (any) plasmid containing a
compatible oriT.
In certain embodiments, the invention uses sequence-specific killing of the
target cell to achieve
selectivity. To this end, in an example the plasmid encodes a guided nuclease
that is operable in the
target cell to recognize and cut a target sequence of a target cell
chromosome, thereby killing the cell
or wherein the growth or proliferation of the cell is reduced. This is
advantageous over the use of
other types of toxic agent, which are less discriminate in their action, being
able to kill several species
or strain (eg, potentially also being toxic to the carrier cell to some
degree). By using a guided
nuclease (eg, a TALEN or Cas nuclease), these can be programmed to recognize a
target sequence
that is present in the target cell genome (eg, comprised by a chromosome or
episome of the target
cell), but is absent in the genome of the carrier cell.
Thus, in this case replication of the plasmid DNA can freely happen in the
carrier cell without risk of
killing the cell or reducing its growth or proliferation due to the encoded
agent and replication of
sequences encoding the agent. Thus, in an example, where the plasmid DNA
encodes a guided
nuclease, the guided nuclease is capable of recognizing and cutting a target
nucleic acid sequence
comprised by the genome (eg, chromosome) of the target cell, wherein the
target cell is absent in the
carrier cell.
A particularly useful example is where the plasmid DNA encodes a Cas nuclease
(eg, a Cas9 or Cas3)
that is operable with a guide RNA or crRNA in the target cell, wherein the RNA
is operable to guide
the Cas to the target sequence, wherein the Cas modifies (eg, cuts) the target
sequence and the target
cell is killed or target cell growth or proliferation is inhibited. In one
embodiment, the plasmid DNA
encodes the Cas and the guide RNA or crRNA. In another embodiment, the plasmid
DNA encodes
the guide RNA or crRNA, but does not encode a cognate Cas. In this embodiment,
the RNA is
operable in the target cell with an endogenous Cas encoded by the target cell
genome, wherein the
RNA is operable to guide the Cas to the target sequence, wherein the Cas
modifies (eg, cuts) the
11
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
target sequence and the target cell is killed or target cell growth or
proliferation is inhibited. In this se
sense, the agent may comprise a component of a CRISPR/Cas system (eg, a Cas
nuclease, Cascade
Cas, crRNA, guide RNA or tracrRNA). Thus, the invention usefully recognizes
the benefit of using
antibacterial agents that act by target recognition in the target cell but not
in the carrier cell, which
opens up the ability for the plasmid DNA to freely replicated in the carrier
cell without significant
toxicity to the carrier cell.
In an example, the antibacterial agent comprises a guided nuclease that is
capable of recognizing and
cutting a target nucleic acid sequence comprised by the target cell genome,
wherein the target
sequence is not comprised by the carrier cell. In this sense, therefore, the
antibacterial agent is toxic
to a target bacterial cell but is not toxic to the carrier cell. For example,
the agent is a component of a
CRISPR/Cas system that is operable in the target cell to modify a target
nucleic acid sequence
comprised by the target cell genome (eg, comprised by the target cell
chromosome).
Optionally, the nuclease is a Cas nuclease, meganuclease, zinc finger nuclease
or TALEN.
Optionally, the nuclease is a Cas nuclease of a Type I, II, III, IV or V
CRISPR system.
In an aspect, the component of the antibacterial agent is a guide RNA or crRNA
that is capable of
hybridising to the target sequence of the target cell. They system may be a
Type I, II, III, IV or V
CRISPR system.
The protospacer sequence be comprised by a chromosome or episome (eg, plasmid)
of the carrier cell.
Advantageously, the donor cell(s) or plasmid(s) is (are) for treating or
preventing a target cell
infection in a human or an animal subject (eg, a chicken, cow, pig, fish or
shellfish). Advantageously,
the carrier cell is a cell of a species that is probiotic to said subject or
is probioitic to humans or
animals (eg, chickens). For example, the carrier cell is a probiotic E coli
cell. In an example, the
target cell is a cell of a species that is pathogenic to said subject, or is
pathogenic to humans or
animals (eg, chickens). Advantageously, the plasmid DNA encodes one or more
guide RNAs or one
or more crRNAs that are capable of hybridizing in the target cell to
respective target nucleic acid
.. sequence(s), wherein the target sequence(s) are comprised by an endogenous
chromosome and/or
endogenous episome of the target cell. For example, the plasmid DNA encodes 2,
3, 4, 5, 6, 7, 7, 9, or
10 (or more than 10) different gRNAs or different crRNAs that hybridise to a
respective target
sequence, wherein the target sequences are different from each other. For
example, 3 different
gRNAs or crRNAs are encoded by the plasmid DNA. For example, 2 different gRNAs
or crRNAs are
encoded by the plasmid DNA. For example, 3 different gRNAs or crRNAs are
encoded by the
12
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
plasmid DNA. For example, 4 different gRNAs or crRNAs are encoded by the
plasmid DNA. For
example, 3 different gRNAs or crRNAs are encoded by the plasmid DNA. For
example, 5 different
gRNAs or crRNAs are encoded by the plasmid DNA. For example, 6 different gRNAs
or crRNAs are
encoded by the plasmid DNA. For example, 7 different gRNAs or crRNAs are
encoded by the
plasmid DNA. For example, 8 different gRNAs or crRNAs are encoded by the
plasmid DNA. For
example, 9 different gRNAs or crRNAs are encoded by the plasmid DNA. For
example, 10 different
gRNAs or crRNAs are encoded by the plasmid DNA. For example, 11 different
gRNAs or crRNAs
are encoded by the plasmid DNA. For example, 12 different gRNAs or crRNAs are
encoded by the
plasmid DNA. For example, 13 different gRNAs or crRNAs are encoded by the
plasmid DNA. In an
example, the target cells are Salmonella cells (eg, wherein the subject is a
chicken). In an example,
the target cells are E coli, Pseudomonas, Klebsiella or C dificile cells. In
an example, the target cells
are Campylobacter cells (eg, wherein the subject is a chicken). In an example,
the target cells are
Edwardsiella cells (eg, wherein the subject is a fish or shellfish, eg, a
catfish or a shrimp or prawn).
In an example, the target cells are E coli cells.
In an alternative herein, the carrier and target cells are archaeal cells.
In a preferred example, the NSI encodes an antibacterial agent that is toxic
to a target bacterial cell but
is not toxic to the carrier cell. In an example, the NSI encodes an antibiotic
agent, an antibody, an
antibody chain or an antibody variable domain. In an example, the NSI encodes
a guide RNA or a
crRNA that is operable in the target cell with a cognate Cas (eg, a Cas
nuclease to target and cut a
protospacer sequence comprised by a chromosome or episome of the target cell).
In an example the
RNA is a siRNA that is capable of hybridizing to an endogenous target nucleic
acid sequence of the
target cell to silence transcription and/or translation thereof.
In an example, the plasmid comprises an expressible tral and/or tra2 module or
a homologue thereof.
Optionally, the carrier cell is an E coli (eg, Nissle, or S17 E coli strain)
or Lactobacillus cell or
Bacillus cell or Enterococcus cell. Optionally, the carrier cell is a cell of
a human, chicken pig, sheep,
cow, fish (eg, catfish or salmon) or shellfish (eg, shrimp or lobster)
commensal bacterial strain (eg, a
commensal E coli strain).
Optionally, the carrier cell or plasmid is for administration to a microbiota
of a human or animal
subject for medical use. For example, the medical use is for treating or
preventing a disease disclosed
herein. For example, the medical use is for treating or preventing a condition
disclosed herein. For
13
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
example, the medical use is for the treatment or prevention of a disease or
condition mediated by said
target cells. For example, the carrier cell or plasmid for administration to
an animal for enhancing
growth or weight of the animal.
In an example, the administration in the method of the invention is to a human
for enhancing the
growth or weight of the human. Optionally, the enhancing is not a medical
therapy. Optionally, the
enhancing is a medical therapy. Optionally, the method comprises the
administration of a plurality of
carrier cells to a microbiota (eg, a gut microbiota) of the subject, wherein
the microbiota comprises
target cells and plasmid DNA is transferred into target cells for expression
therein to produce the
antibacterial agent, thereby killing target cells in the subject or reducing
the growth or proliferation of
target cells.
Optionally, the use or method may be carried out to target cells (recipient
cells) comprised by a plant,
eg, to fertilise the plant or as a herbicide treatment. The plant may be any
plant disclosed herein. For
example a plant herein in any configuration or embodiment of the invention is
selected from a tomato
plant, a potato plant, a wheat plant, a corn plant, a maize plant, an apple
tree, a bean-producing plant,
a pea plant, a beetroot plant, a stone fruit plant, a barley plant, a hop
plant and a grass. For example,
the plant is a tree, eg, palm, a horse chestnut tree, a pine tree, an oak tree
or a hardwood tree. For
example the plant is a plant that produces fruit selected from strawberries,
raspberries, blackberries,
reducrrants, kiwi fruit, bananas, apples, apricots, avoocados, cherries,
oranges, clementines, satsumas,
grapefruits, plus, dates, figs, limes, lemons, melons, mangos, pears, olives
or grapes. Optionally, the
plant is a dicotyledon. Optionally, the plant is a flowering plant.
Optionally, the plant is a
monocotyledon.
In any configuration (eg, wherein applied to a plant), embodiment or example
herein, the target
bacteria are P syringae bacteria (eg, comprised by a plant). Pseudomonas
syringae pv. syringae is a
common plant-associated bacterium that causes diseases of both monocot and
dicot plants worldwide.
In an example the targt bacteria are P syringae bacteria of a pathovar
selected from P. s. pv. aceris, P.
s. pv. aptata, P. s. pv. atrofaciens, P. s. pv. dysoxylis, P. s. pv. japonica,
P. s. pv. lapsa, P.
s. pv. panici, P. s. pv. papulans, P. s. pv. pisi, P. s. pv. syringae and P.
s. pv. morsprunorum.
= P. s. pv. aceris attacks maple Acer species.
= P. s. pv. actinidiae attacks kiwifruit Actinidia deliciosa.
= P. s. pv. aesculi attacks horse chestnut Aesculus hippocastanum, causing
bleeding canker.
= P. s. pv. aptata attacks beets Beta vulgaris.
14
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
= P. s. pv. atrofaciens attacks wheat Triticum aestivum.
= P. s. pv. dysoxylis attacks the kohekohe tree Dysoxylum spectabile.
= P. s. pv. japonica attacks barley Hordeum vulgare.
= P. s. pv. lapsa attacks wheat Triticum aestivum.
= P. s. pv. panici attacks Panicum grass species.
= P. s. pv. papulans attacks crabapple Malus sylvestris species.
= P. s. pv. phaseolicola causes halo blight of beans.
= P. s. pv. pisi attacks peas Pisum sativum.
= P. s. pv. syringae attacks Syringa, Prunus, and Phaseolus species.
= P. s. pv. glycinea attacks soybean, causing bacterial blight of soybean.
In an example, the target bacteria are P syringae selected from a serovar
recited in a bullet point in the
immediately preceding paragraph and the bacteria are comprised by a plant also
mentioned in that
bullet point.
When the method or use is applied to a plant, the carrier cells may be
combined with a microbiota
comprising the recipient cells. The microbiota is comprised by a leaf, trunk,
root or stem of the plant.
In an example, the target bacteria (or taraget cell) is comprised by a
microbiota of a plant. In an
example, the microbiota is comprised by a leaf. In an example, the microbiota
is comprised by a
xylem. In an example, the microbiota is comprised by a phloem. In an example,
the microbiota is
comprised by a root. In an example, the microbiota is comprised by a tuber. In
an example, the
microbiota is comprised by a bulb. In an example, the microbiota is comprised
by a seed. In an
example, the microbiota is comprised by an exocarp, epicarp, mesocarp or
endocarp. In an example,
the microbiota is comprised by a fruit, eg, a simple fruits; aggregate fruits;
or multiple fruits. In an
example, the microbiota is comprised by a seed or embryo, eg, by a seed coat;
a seed leaf; cotyledons;
or a radicle. In an example, the microbiota is comprised by a flower, eg,
comprised by a peduncle;
sepal: petals; stamen; filament; anther or pistil. In an example, the
microbiota is comprised by a root;
eg, a tap root system, or a fibrous root system. In an example, the microbiota
is comprised by a leaf
or leaves, eg, comprised by a leaf blade, petiole or stipule. In an example,
the microbiota is
comprised by a stem, eg, comprised by bark, epidermis, phloem, cambium, xylem
or pith.
The invention provides:-
A method for reducing a biofilm comprised by a subject or comprised on a
surface, wherein the
biofilm comprises target cells (eg, Pseudomonas cells), wherein the method
comprises the
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
administration of a plurality of carrier cells according to the invention to
the biofilm, wherein plasmid
DNA is transferred from carrier cells into target cells for expression therein
to produce the
antibacterial agent, thereby killing target cells in the biofilm or reducing
the growth or proliferation of
target cells.
In an example "reducing a biofilm" comprises reducing the coverage area of the
biofilm. In an
example "reducing a biofilm" comprises reducing the proliferation of the
biofilm. In an example
"reducing a biofilm" comprises reducing the durability of the biofilm. In an
example "reducing a
biofilm" comprises reducing the spread of the biofilm (eg, in or on the
subject, eg, spread to the
environment containing the subject).
In an example, the subject is a human or animal. For example, the biofilm is
comprised by a lung of
the subject, eg, wherein the target cells are Pseudomonas (eg, P aeruginosa)
cells. This may be useful
wherein the subject is a human suffering from a lung disease or condition,
such as pneumonia or
cystic fibrosis. For example, the biofilm is comprised by an animal or human
organ. For example, the
biofilm is comprised by a microbiota of a human or animal.
In an example, the target bacteria (or taraget cell) is comprised by a biofilm
of a plant. In an example,
the biofilm is comprised by a leaf. In an example, the biofilm is comprised by
a xylem. In an
example, the biofilm is comprised by a phloem. In an example, the biofilm is
comprised by a root. In
an example, the biofilm is comprised by a tuber. In an example, the biofilm is
comprised by a bulb.
In an example, the biofilm is comprised by a seed. In an example, the biofilm
is comprised by an
exocarp, epicarp, mesocarp or endocarp. In an example, the biofilm is
comprised by a fruit, eg, a
simple fruits; aggregate fruits; or multiple fruits. In an example, the
biofilm is comprised by a seed or
embryo, eg, by a seed coat; a seed leaf; cotyledons; or a radicle. In an
example, the biofilm is
comprised by a flower, eg, comprised by a peduncle; sepal: petals; stamen;
filament; anther or pistil.
In an example, the biofilm is comprised by a root; eg, a tap root system, or a
fibrous root system. In
an example, the biofilm is comprised by a leaf or leaves, eg, comprised by a
leaf blade, petiole or
stipule. In an example, the biofilm is comprised by a stem, eg, comprised by
bark, epidermis,
phloem, cambium, xylem or pith.
Optionally, the surface is a surface ex vivo, such as a surface comprised by a
domestic or industrial
apparatus or container.
16
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optionally, the target cells are comprised by a biofilm, eg, a biofilm as
disclosed herein.
Optionally, the target bacteria are Salmonella, Pseudomonas, Escherichia,
Klebsiella, Campylobacter,
Helicobacter, Acinetobacter, Enterobacteriacea, Clostridium, Staphylococcus or
Streptococcus
bacteria. For example, the target bacteria are Salmonella enterica bacteria.
For example, the target
bacteria are selected from the group consisting of Salmonella enterica subsp.
enterica, serovars
Typhimurium, Enteritidis, Virchow, Montevideo, Hadar and Binza. For example,
the target bacteria
are Pseudomonas (eg, P syringae or P aeruginosa) bacteria.
In an embodiment, the target bacteria are E coli bacteria. Optionally, the
target bacteria are
enterohemorrhagic E. coli (EHEC), E. coli Serotype 0157:H7 or Shiga-toxin
producing E. coli
(STEC)). In an example, the taraget bacteria are selected from
= Shiga toxin-producing E. coli (STEC) (STEC may also be referred to as
Verocytotoxin-
producing E. coli (VTEC);
= Enterohemorrhagic E. coli (EHEC) (this pathotype is the one most commonly
heard about in
the news in association with foodborne outbreaks);
= Enterotoxigenic E. coli (ETEC);
= Enteropathogenic E. coli (EPEC);
= Enteroaggregative E. coli (EAEC);
= Enteroinvasive E. coli (EIEC); and
= Diffusely adherent E. coli (DAEC).
Enterohemorrhagic Escherichia coli (EHEC) serotype 0157:H7 is a human pathogen
responsible for
outbreaks of bloody diarrhoea and haemolytic uremic syndrome (HUS) worldwide.
Conventional
antimicrobials trigger an SOS response in EHEC that promotes the release of
the potent Shiga toxin
that is responsible for much of the morbidity and mortality associated with
EHEC infection. Cattle are
a natural reservoir of EHEC, and approximately 75% of EHEC outbreaks are
linked to the
consumption of contaminated bovine-derived products. EHEC causes disease in
humans but is
asymptomatic in adult ruminants. Characteristics of E. coli serotype 0157:H7
(EHEC) infection
includes abdominal cramps and bloody diarrhoea, as well as the life-
threatening complication
haemolytic uremic syndrome (HUS). Currently there is a need for a treatment
for EHEC infections
(Goldwater and Bettelheim, 2012). The use of conventional antibiotics
exacerbates Shiga toxin-
mediated cytotoxicity. In an epidemiology study conducted by the Centers for
Disease Control and
Prevention, patients treated with antibiotics for EHEC enteritis had a higher
risk of developing HUS
(Slutsker et al., 1998). Additional studies support the contraindication of
antibiotics in EHEC
17
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
infection; children on antibiotic therapy for hemorrhagic colitis associated
with EHEC had an
increased chance of developing HUS (Wong et al., 2000; Zimmerhackl, 2000;
Safdar et al., 2002;
Tan et al., 2005). Conventional antibiotics promote Shiga toxin production by
enhancing the
replication and expression of stx genes that are encoded within a
chromosomally integrated lambdoid
prophage genome. The approach of some configurations of present invention rely
on nuclease
cutting. Stx induction also promotes phage-mediated lysis of the EHEC cell
envelope, allowing for
the release and dissemination of Shiga toxin into the environment (Karch et
al., 1999; Matsushiro et
al., 1999; Wagner et al., 2002). Thus, advantageously, these configurations of
the invention provide
alternative means for treating EHEC in human and animal subjects. This is
exemplified below with
surprising results on the speed and duration of anti-EHEC action produced by
nuclease action (as
opposed to conventional antibiotic action).
In an example, the subject (eg, a human or animal) is suffering from or at
risk of haemolytic uremic
syndrome (HUS), eg, the subject is suffering from an E coli infection, such as
an EHEC E coli
infection.
The invention provides:-
A pharmaceutical composition, livestock growth promoting composition, soil
improver, herbicide,
plant fertilizer, food or food ingredient sterilizing composition, dental
composition, personal hygiene
composition or disinfectant composition (eg, for domestic or industrial use)
comprising a plurality of
carrier cells according to the invention.
Herein, a carrier cell is, eg, a probiotic cell for administration to a human
or animal subject. For
example, the carrier cell is commensal in a microbiome (eg, gut or blood
microbiome) of a human or
animal subject, wherein the carrier is for administration to the subject. In
an example, a carrier cell is
a bacterial cell (and optionally the target cell is a bacterial cell). In an
example, a carrier cell is an
archaeal cell (and optionally the target cell is an archaeal cell)
Optionally, the carrier cell is a gram-positive bacterial cell and the target
cell is a gram-positive
bacterial cell.
Optionally, the carrier cell is a gram-positive bacterial cell and the target
cell is a gram-negative
bacterial cell.
18
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optionally, the carrier cell is a gram-negative bacterial cell and the target
cell is a gram-positive
bacterial cell.
Optionally, the carrier cell is a gram-negative bacterial cell and the target
cell is a gram-negative
bacterial cell.
Optionally, the carrier cell is an E coli bacterial cell and the target cell
is a Pseudomonas bacterial
cell.
Optionally, the carrier cell is an E coli bacterial cell and the target cell
is a gram-positive bacterial
cell.
Optionally, the carrier cell is an E coli bacterial cell and the target cell
is a gram-netative bacterial
cell.
Optionally, the carrier cell is an E coli bacterial cell and the target cell
is a Salmonella bacterial cell.
Optionally, the carrier cell is an E coli bacterial cell and the target cell
is an E coli bacterial cell.
Optionally, the carrier cell is an E coli bacterial cell and the target cell
is a Pseudomonas bacterial
cell.
Optionally, the carrier cell is a probiotic or commensal E coli bacterial cell
for administration to a
human or animal subject.
Herein, optionally the plasmid comprises a closed circular DNA. In an
embodiment, in an example
the plasmid DNA is dsDNA. In an embodiment, in an example the plasmid DNA is
ssDNA.
Optionally, the target cell is a Salmonella cell (eg, wherein the carrier cell
is an E coli cell), eg, a
Salmonella enterica subsp. enterica, eg, a Salmonella enterica subsp. enterica
serovar Typhimurium,
Enteritidis, Virchow, Montevideo, Hadar or Binza.
For example, the target bacteria are selected from the group consisting of S
enterica; S typhimurium;
P aeruginosa; E coli; K pneumoniae; C jujeni; H pylori; A baumanii; C
difficile; S aureus; S
pyo genes or S the rmophilus.
19
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
In an example, the target cell is a cell of a species that causes nosocomial
infection in humans.
Optionally, the target cell is comprised by an animal (eg, poultry animal
(such as chicken), swine,
cow, fish (eg, catfish or salmon) or shellfish (eg, prawn or lobster))
microbiome. Optionally, the
microbiome is a gut microbiome. For example, the target cell is a Salmonella
cell comprised by a
chicken gut biofilm. For example, the target cell is a Salmonella cell
comprised by a chicken gut
biofilm sample ex vivo.
Optionally, the plurality of carrier cells comprises a first sub-population of
carrier cells (first cells)
and a second sub-population of carrier cells (second cells) wherein the first
cells comprise indentical
plasmid DNAs and the second cells comprise indentical plasmid DNAs (which are
different from the
plasmid DNAs of the first cells). For example, the former DNAs comprise a NSI
that is different
from the NSI comprised by the other DNAs. For example, the plasmid DNAs encode
a first guide
RNA or crRNA and the second DNAs encode a second guide RNA or crRNA, wherein
the first guide
RNA/crRNA is capable of hybridizing to a first protospacer sequence in first
target cells; and the
second guide RNA/crRNA is capable of hybridizing to a second protospacer
sequence in second
target cells, wherein the protospacers are different. Optionally, the first
target cells are different from
the second target cells. Optionally, the first target cells are of the same
species or strain as the second
target cells. Alternatively, the first target cells are of species or strain
that is different from the species
or strain of the second target cells (in this way a cocktail of carrier cells
is provided, eg, for
administration to a human or animal or plant, to target and kill a plurality
of target cells of different
species or strains).
In an example, the or each plasmid DNA comprises a plurality (eg, a first and
a second) of
NSIs wherein a first NSI is different from a second NSI (eg, they encode
different proteins or RNAs,
such as different guide RNAs or crRNAs). In an example, the or each plasmid
DNA comprises 2, 3,
4, 5, 6, 7, 8, 9,10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 different types
of NSIs. In an example, the
or each plasmid DNA comprises NSIs encoding 2, 3,4, 5, 6, 7, 8, 9,10, 11, 12,
13, 14, 15, 16, 17, 18,
19 or 20 different guide RNAs. In an example, the or each plasmid DNA
comprises NSIs encoding 2,
3, 4, 5, 6, 7, 8, 9,10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 different
crRNAs. In an example, the or
each plasmid DNA comprises NSIs encoding at least 2, 3, 4, 5, 6,7, 8, 9,10,
11, 12, 13, 14, 15, 16, 17,
18, 19 or 20 different guide RNAs. In an example, the or each plasmid DNA
comprises NSIs
encoding at least 2, 3, 4, 5, 6, 7, 8, 9,10, 11, 12, 13, 14, 15, 16, 17, 18,
19 or 20 different crRNAs.
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optionally, the composition is comprised by a liquid (eg, an aqueous liquid or
in water), the
composition comprising the carrier cells at an amount of from 1 x 103to 1 x
1010 (eg, from 1 x 104to 1
x 1010; from 1 x 104to 1 x 109; from 1 x 104to 1 x 108; from 1 x 104to 1 x
107; from 1 x 103to 1 x
1010; from 1 x 103to 1 x 109; from 1 x 103to 1 x 108; from 1 x 103to 1 x 107;
from 1 x 105to 1 x 1010;
from 1 x 105to 1 x 109; from 1 x 105to 1 x 108; from 1 x 105to 1 x 10'; from 1
x 106to 1 x 1010; from
1 x 106 to 1 x 109; from 1 x 106 to 1 x 108; or from 1 x 106 to 1 x 107)
cfu/ml. For example, the liquid
is a beverage, such for human or animal consumption. For example, the beverage
is a livestock
beverage, eg, a poultry beverage (ie, a beverage for consumption by poultry,
such as chicken).
In an example, the composition is a dietary (eg, dietary supplement)
composition for consumption by
humans or animals. In an example, the composition is a slimming composition
for consumption by
humans or animals. In an example, the composition is a growth promotion
composition for
consumption by humans or animals. In an example, the composition is a body
buidling composition
for consumption by humans. In an example, the composition is a probiotic
composition for
consumption by humans or animals. In an example, the composition is a biocidal
composition for
consumption by humans or animals. In an example, the composition is a
pesticidal composition for
consumption by humans or animals. In an example, the composition is a zoonosis
control
composition for consumption by animals.
In an example, the composition comprises vitamins in addition to the carrier
cells. In an example, the
composition comprises vitamin A, B (eg, B12), C, D, E and/or K in addition to
the carrier cells. In an
example, the composition comprises lipids in addition to the carrier cells. In
an example, the
composition comprises carbohydrates in addition to the carrier cells. In an
example, the composition
comprises proteins and/or amino acids in addition to the carrier cells. In an
example, the composition
comprises minerals in addition to the carrier cells. In an example, the
composition comprises metal
ions (eg, Mg', Cu' and/or Zn') in addition to the carrier cells. In an
example, the composition
comprises sodium ions, potassium ions, magnesium ions, calcium ions, manganese
ions, iron
ions, cobalt ions, copper ions, zinc ions and/or molybdenum ions.
In an example, the composition is a plant fertilizer composition. In an
example, the composition is a
herbicide. In an example, the composition is a pesticide composition for
application to plants.
In any embodiment or example, where appropriate: The plants are, for example,
crop plants. The
plants are, for example, wheat. The plants are, for example, corn. The plants
are, for example, maize.
The plants are, for example, fruiting plants. The plants are, for example,
vegetable plants. The plants
21
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
are, for example, tomato plants. The plants are, for example, potato plants.
The plants are, for
example, grass plants. The plants are, for example, flowering plants. The
plants are, for example,
trees. The plants are, for example, shrubs.
In an example, the composition is for environmental application, wherein the
environment is an
outdoors environment (eg, application to a field or waterway or reservoir).
In an example, the composition is comprised by a food or food ingredient (eg,
for human or animal
consumption). In an example, the composition is comprised by a beverage or
beverage ingredient (eg,
for human or animal consumption).
In an example the target cell(s) are human biofilm cells, eg, wherein the
biofilm is a gut, skin, lung,
eye, nose, ear, gastrointestinal tract (GI tract), stomach, hair, kidney,
urethra, bronchiole, oral cavity,
mouth, liver, heart, anus, rectum, bladder, bowel, intestine, penis, vagina or
scrotum biofilm. In an
example the target cell(s) are animal biofilm cells, eg, wherein the biofilm
is a gut, skin, lung, eye,
nose, ear, gastrointestinal tract (GI tract), caecum, stomach, hair, feather,
scales, kidney, urethra,
bronchiole, oral cavity, mouth, liver, heart, anus, rectum, bladder, bowel,
intestine, penis, vagina or
scrotum biofilm. For example, the biofilm is a bird (eg, chicken) caecum
biofilm.
In an example, any method herein is ex vivo. In an example, a method herein is
in vivo. In an
example, a method herein is in vitro. In an example, a method herein is
carried out in an environment,
eg, in a domestic (such as in a house), industrial (such as in a factory) or
agricultural environment
(such as in a field). In an example, a method herein is carried out in or on a
container; or on a surface.
In an example, the NSI (or a RNA product thereof) is capable of recombination
with the target cell
chromosome or an episome comprised by the target cell to modify the chromosome
or episome.
Optionally, this is carried out in a method wherein the chromosome or episome
is cut (eg, at a
predetermined site using a guided nuclease, such as a Cas, TALEN, zinc finger
nuclease or
meganuclease) and simultaneously or sequentially the plasmid DNA is introduced
into the target cell
by conjugation with the carrier cell and the NSI or a sequence thereof is
inserted into the chromosome
or episome at or adjacent the cut site.
In an example the plasmid DNA comprises one or more components of a CRISPR/Cas
system
operable to perform protospacer cutting in the target cell (eg, wherein the
protospacer comprises 10-
22
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
20, 10-30, 10-40, 10-100, 12-15 or 12-20 consecutive nucleotides that are
capable of hybridizing in
the target cell with a crRNA or gRNA encoded by the NSI).
For example, the system is a Type I, II, III, IV or V CRISPR/Cas system.
In an example, the NSI encodes a Cas9 (and optionally a second, different,
Cas, such as a Cas3, Cas9,
Cpfl, Cas13a, Cas13b or Cas10). In an example, the NSI encodes a Cas3 (and
optionally a second,
different, Cas, such as a Cas3, Cas9, Cpfl, Cas13a, Cas13b or Cas10). In an
example, the NSI
encodes a Cas selected from a Cas3, Cas9, Cpfl, Cas13a, Cas13b and Cas10.
Additionally or
alternatively, the plasmid DNA (eg, the NSI) encodes a guide RNA or crRNA or
tracrRNA. For
example, the guide RNA or crRNA or tracrRNA is cognate to (ie, operable with
in the target cell) the
first Cas.
In an example, a Cas herein is a Cas9. In an example, a Cas herein is a Cas3.
The Cas may be
identical to a Cas encoded by the target bacteria.
In an embodiment, the presence in the target bacterium of the NSI or its
encoded protein or RNA
mediates target cell killing, or downregulation of growth or propagation of
target cells. In an
embodiment, the presence in the target bacterium of the NSI or its encoded
protein or RNA mediates
switching off of expression of one or more RNA or proteins encoded by the
target cell genome, or
downregulation thereof.
In an embodiment, the presence in the target bacterium of the NSI or its
encoded protein or RNA
mediates upregulation of growth or propagation of the target cell. In an
embodiment, the presence in
the target bacterium of the NSI or its encoded protein or RNA mediates
switching on of expression of
one or more RNA or proteins encoded by the target cell genome, or upregulation
thereof.
In an embodiment, the NSI encodes a component of a CRISPR/Cas system that is
toxic to the target
bacterium.
In an embodiment, the plasmid is a shuttle vector.
Optionally, the target cell is devoid of a functional endogenous CRISPR/Cas
system before transfer
therein of the plasmid DNA, eg, a plasmid DNA comprising component of an
exogenous
CRISPR/Cas system that is functional in the target cell and toxic to the
target cell. An embodiment
23
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
provides an antibacterial composition comprising a plurality of carrier cells
of the invention, wherein
each target cell is optionally according to this paragraph, for administration
to a human or animal
subject for medical use.
In an example, the composition of the invention is a herbicide, pesticide,
insecticide, plant fertilizer or
cleaning agent.
Optionally, target bacteria herein are comprised by a microbiome of the
subject, eg, a gut microbiome.
Altertnatively, the microbiome is a skin, scalp, hair, eye, ear, oral, throat,
lung, blood, rectal, anal,
vaginal, scrotal, penile, nasal or tongue microbiome.
In an example the subject (eg, human or animal) is further administered a
medicament simultaneously
or sequentially with the carrier cell administration. In an example, the
medicament is an antibiotic,
antibody, immune checkpoint inhibitor (eg, an anti-PD-1, anti-PD-Li or anti-
CTLA4 antibody),
adoptive cell therapy (eg, CAR-T therapy) or a vaccine.
In an embodiment, the NSI encodes a guided nuclease, such as a Cas nuclease,
TALEN, zinc finger
nuclease or meganuclease. Thus, the toxic agent may comprise a guided
nuclease, such as a Cas
nuclease, TALEN, zinc finger nuclease or meganuclease. Optionally, the NSI
encodes a restriction
nuclease that is capable of cutting the chromosome of the target cell.
Optionally, the composition is a pharmaceutical composition for use in
medicine practised on a
human or animal subject.
In an example, the animal is a livestock or companion pet animal (eg, a cow,
pig, goat, sheep, horse,
dog, cat or rabbit). In an example, the animal is an insect (an insect at any
stage of its lifecycle, eg,
egg, larva or pupa). In an example, the animal is a protozoan. In an example,
the animal is a
cephalopod.
Optionally, the composition is a herbicide, pesticide, food or beverage
processing agent, food or
beverage additive, petrochemical or fuel processing agent, water purifying
agent, cosmetic additive,
detergent additive or environmental (eg, soil) additive or cleaning agent.
The invention also provides:-
A target bacterial cell or a plurality of target bacterial cells each
comprising a said plasmid DNA.
24
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
For example the carrier bacteria are Lactobacillus (eg, L reuteri or L
lactis), E coli or Streptococcus
(eg, S thermophilus) bacteria. Usefully, the carrier can provide protection
for the plasmid DNA from
the surrounding environment. The use of a carrier may be useful for oral
administration or other
routes where the carrier can provide protection for the plasmid DNA from the
acid stomach or other
harsh environments in the subject. Furthermore, the carrier can be formulated
into a beverage, for
example, a probiotic drink, eg, an adapted Yakult (trademark), Actimel
(trademark), Kevita
(trademark), Activia (trademark), Jarrow (trademark) or similar drink for
human consumption.
Optionally, the carrier cell(s) or composition are for administration to a
human or animal subject for
medical use, comprising killing target bacteria using the agent or expression
product of the NSI,
wherein the target bacteria mediate as disease or condition in the subject. In
an example, when the
subject is a human, the subject is not an embryo. In an example, the carrier
cells are probiotic in the
subject.
The invention also provides:-
A method of killing target bacterial cells in an environment, optionally
wherein the method is not
practised on a human or animal body, wherein the method comprises exposing the
environment to the
carrier cell(s) or composition of the invention and allowing the product of
the NSI to be expressed in
the target cells, wherein the target bacteria are killed in the presence of
said product. For example, the
product encodes a CRISPR/Cas system or component thereof, such as a system or
component
disclosed herein. Thus, the system may be capable of recognisisng and cutting
a chromosomal
protopspacer sequence of the target cell, whereby the target cell is killed.
Optionally, in a further step
killed target cells are isolated.
The invention also provides:-
Use of the composition or cell(s) of the invention, in the manufacture of an
antibacterial agent that
kills target bacteria, for the treatement of a disease or condition in a human
or animal subject
comprising the target bacteria.
Optionally, the environment is a microbiome of soil; a plant, part of a part
(e.g., a leaf, fruit, vegetable
or flower) or plant product (e.g., pulp); water; a waterway; a fluid; a
foodstuff or ingredient thereof; a
beverage or ingredient thereof; a medical device; a cosmetic; a detergent;
blood; a bodily fluid; a
medical apparatus; an industrial apparatus; an oil rig; a petrochemical
processing, storage or transport
apparatus; a vehicle or a container.
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optionally, the environment is an ex vivo bodily fluid (e.g., urine, blood,
blood product, sweat, tears,
sputum or spit), bodily solid (e.g., faeces) or tissue of a human or animal
subject that has been
administered the composition.
Optionally, the environment is an in vivo bodily fluid (e.g., urine, blood,
blood product, sweat, tears,
sputum or spit), bodily solid (e.g., faeces) or tissue of a human or animal
subject that has been
administered the composition.
Optionally, the toxic agent comprises one or more components of a CRISPR/Cas
system, eg, a DNA
sequence encoding one or more components of Type I Cascade (eg, CasA).
Optionally, the toxic agent comprises a DNA sequence encoding guided nuclease,
such as a Cas
nuclease, TALEN, zinc finger nuclease or meganuclease.
In an example, the carrier cell(s) or composition are comprised by a medical
container, eg, a syringe,
vial, IV bag, inhaler, eye dropper or nebulizer. In an example, the carrier
cell(s) or composition are
comprised by a sterile container. In an example, the carrier cell(s) or
composition are comprised by a
medically-compatible container. In an example, the carrier cell(s) or
composition are comprised by a
fermentation vessel, eg, a metal, glass or plastic vessel. In an example, the
carrier cell(s) or
composition are comprised by an agricultural apparatus. In an example, the
carrier cell(s) or
composition are comprised by food production or processing apparatus. In an
example, the carrier
cell(s) or composition are comprised by a horticultural apparatus. In an
example, the carrier cell(s) or
composition are comprised by a farming apparatus. In an example, the carrier
cell(s) or composition
are comprised by petrochemicals recovery or processing apparatus. In an
example, the carrier cell(s)
or composition are comprised by a distillation apparatus. In an example, the
carrier cell(s) or
composition are comprised by cell culture vessel (eg, having a capacity of at
least 50, 100, 1000,
10000 or 100000 litres). Additionally or alternatively, the target cell(s) are
comprised by any of these
apparatus etc.
In an example, the carrier cell(s) or composition are comprised by a
medicament, e,g in combination
with instructions or a packaging label with directions to administer the
medicament by oral, IV,
subcutaneous, intranasal, intraocular, vaginal, topical, rectal or inhaled
administration to a human or
animal subject. In an example, the carrier cell(s) or composition are
comprised by an oral
medicament formulation. In an example, the carrier cell(s) or composition are
comprised by an
26
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
intranasal or ocular medicament formulation. In an example, the carrier
cell(s) or composition are
comprised by a personal hygiene composition (eg, shampoo, soap or deodorant)
or cosmetic
formulation. In an example, th the carrier cell(s) or composition are
comprised by a detergent
formulation. In an example, the carrier cell(s) or composition are comprised
by a cleaning
formulation, eg, for cleaning a medical or industrial device or apparatatus.
In an example, the carrier
cell(s) or composition are comprised by foodstuff, foodstuff ingredient or
foodstuff processing agent.
In an example, the carrier cell(s) or composition are comprised by beverage,
beverage ingredient or
beverage processing agent. In an example, the carrier cell(s) or composition
are comprised by a
medical bandage, fabric, plaster or swab. In an example, the carrier cell(s)
or composition are
comprised by a herbicide or pesticide. In an example, the carrier cell(s) or
composition are comprised
by an insecticide.
In an example, the CRISPR/Cas component(s) are component(s) of a Type I
CRISPR/Cas system. In
an example, the CRISPR/Cas component(s) are component(s) of a Type II
CRISPR/Cas system. In an
example, the CRISPR/Cas component(s) are component(s) of a Type III CRISPR/Cas
system. In an
example, the CRISPR/Cas component(s) are component(s) of a Type IV CRISPR/Cas
system. In an
example, the CRISPR/Cas component(s) are component(s) of a Type V CRISPR/Cas
system. In an
example, the CRISPR/Cas component(s) comprise a Cas9-encoding nucleotide
sequence (eg, S
pyogenes Cas9, S aureus Cas9 or S the rmophilus Cas9). In an example, the
CRISPR/Cas
component(s) comprise a Cas3-encoding nucleotide sequence (eg, E coli Cas3, C
dificile Cas3 or
Salmonella Cas3). In an example, the CRISPR/Cas component(s) comprise a Cpf-
encoding
nucleotide sequence. In an example, the CRISPR/Cas component(s) comprise a
CasX-encoding
nucleotide sequence. In an example, the CRISPR/Cas component(s) comprise a
CasY-encoding
nucleotide sequence.
In an example, each carrier cell encodes a CRISPR/Cas component or protein of
interest from a
nucleotide sequence (NSI) comprising a promoter that is operable in the target
bacteria.
Optionally, target bacteria are gram negative bacteria (eg, a spirilla or
vibrio). Optionally, target
bacteria are gram positive bacteria. Optionally, target bacteria are
mycoplasma, chlamydiae,
spirochete or mycobacterium bacteria. Optionally, target bacteria are
Streptococcus (eg, pyo genes or
thermophilus). Optionally, target bacteria are Staphylococcus (eg, aureus, eg,
MRSA). Optionally,
target bacteria are E. coli (eg, 0157: H7), eg, wherein the Cas is encoded by
the vecor or an
endogenous target cell Cas nuclease (eg, Cas3) activity is de-repressed.
Optionally, target bacteria are
Pseudomonas (eg, syringae or aeruginosa). Optionally, target bacteria are
Vibro (eg, cholerae (eg,
27
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
0139) or vulnificus). Optionally, target bacteria are Neisseria (eg,
gonnorrhoeae or meningitidis).
Optionally, target bacteria are Bordetella (eg, pertussis). Optionally, target
bacteria are Haemophilus
(eg, influenzae). Optionally, target bacteria are Shigella (eg, dysenteriae).
Optionally, target bacteria
are Brucella (eg, abortus). Optionally, target bacteria are Francisella host.
Optionally, target bacteria
are Xanthomonas. Optionally, target bacteria are Agrobacterium. Optionally,
target bacteria are
Erwinia. Optionally, target bacteria are Legionella (eg, pneumophila).
Optionally, target bacteria are
Listeria (eg, monocytogenes). Optionally, target bacteria are Campylobacter
(eg, jejuni). Optionally,
target bacteria are Yersinia (eg, pestis). Optionally, target bacteria are
Borelia (eg, burgdorferi).
Optionally, target bacteria are Helicobacter (eg, pylori). Optionally, target
bacteria are Clostridium
(eg, dificile or botulinum). Optionally, target bacteria are Erlichia (eg,
chaffeensis). Optionally,
target bacteria are Salmonella (eg, typhi or enterica, eg, serotype
typhimurium, eg, DT 104).
Optionally, target bacteria are Chlamydia (eg, pneumoniae). Optionally, target
bacteria are
Parachlamydia host. Optionally, target bacteria are Cotynebacterium (eg,
amycolatum). Optionally,
target bacteria are Klebsiella (eg, pneumoniae). Optionally, target bacteria
are Enterococcus (eg,
faecalis or faecim, eg, linezolid-resistant). Optionally, target bacteria are
Acinetobacter (eg,
baumannii, eg, multiple drug resistant).
Further examples of target cells are as one of the options that follow:-
Optionally the target bacteria are Staphylococcus aureus cells, eg, resistant
to an antibiotic
selected from methicillin, vancomycin, linezolid, daptomycin, quinupristin,
dalfopristin and
teicoplanin.
Optionally the target bacteria are Pseudomonas aeuroginosa cells, eg,
resistant to an
antibiotic selected from cephalosporins (eg, ceftazidime), carbapenems (eg,
imipenem or
meropenem), fluoroquinolones, aminoglycosides (eg, gentamicin or tobramycin)
and colistin.
Optionally the target bacteria are Klebsiella (eg, pneumoniae) cells, eg,
resistant to
carbapenem.
Optionally the target bacteria are Streptoccocus (eg, the rmophilus,
pneumoniae or pyogenes)
cells, eg, resistant to an antibiotic selected from erythromycin, clindamycin,
beta-lactam, macrolide,
amoxicillin, azithromycin and penicillin.
Optionally the target bacteria are Salmonella (eg, serotype Typhi) cells, eg,
resistant to an
antibiotic selected from ceftriaxone, azithromycin and ciprofloxacin.
Optionally the target bacteria are Shigella cells, eg, resistant to an
antibiotic selected from
ciprofloxacin and azithromycin.
28
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optionally the target bacteria are Mycobacterium tuberculosis cells, eg,
resistant to an
antibiotic selected from Resistance to isoniazid (INH), rifampicin (RMP),
fluoroquinolone, amikacin,
kanamycin and capreomycin and azithromycin.
Optionally the target bacteria are Enterococcus cells, eg, resistant to
vancomycin.
Optionally the target bacteria are Enterobacteriaceae cells, eg, resistant to
an antibiotic
selected from a cephalosporin and carbapenem.
Optionally the target bacteria are E. coli cells, eg, resistant to an
antibiotic selected from
trimethoprim, itrofurantoin, cefalexin and amoxicillin.
Optionally the target bacteria are Clostridium (eg, dificile) cells, eg,
resistant to an antibiotic
selected from fluoroquinolone antibiotic and carbapenem.
Optionally the target bacteria are Neisseria gonnorrhoea cells, eg, resistant
to an antibiotic
selected from cefixime (eg, an oral cephalosporin), ceftriaxone (an injectable
cephalosporin),
azithromycin and tetracycline.
Optionally the target bacteria are Acinetoebacter baumannii cells, eg,
resistant to an antibiotic
selected from beta-lactam, meropenem and a carbapenem.
Optionally the target bacteria are Campylobacter (eg, jejuni) cells, eg,
resistant to an
antibiotic selected from ciprofloxacin and azithromycin.
Optionally, the target cell(s) produce Beta (13)-lactamase (eg, ESBL-producing
E. coli or
ESBL-producing Klebsiella).
For example, the target cell(s) are bacterial cells that are resistant to an
antibiotic recited in any one of
these options above.
In an example, the target cell(s) is a cell of a species selected from
Shigella, E coli, Salmonella,
Serratia, Klebsiella, Yersinia, Pseudomonas and Enterobacter.
Optionally, the composition comprises carrier cells that are each or in
combination capable of
conjugative transfer of plasmid DNAs into target cells of species selected
from two or more of
Shigella, E coli, Salmonella, Serratia, Klebsiella, Yersinia, Pseudomonas and
Enterobacter.
In an example, the reduction in growth or proliferation of carrier cells is at
least 50, 60, 70, 80, 90 or
95%. Optionally, the composition or carrier cell(s) are administered
simultaneously or sequentially
with an an antibiotic that is toxic to the target cells. For example, the
antibiotic can be any antibiotic
disclosed herein.
29
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Optioanlly, the expression of the NSI is under the control of an inducible
promoter that is operable in
the target cell. Optioanlly, the expression of the NSI is under the control of
a constitutive
promoterthat is operable in the target cell.
In embodiments, the plasmid DNA contains a screenable or selectable marker
gene. For example, the
selectable marker gene is an antibiotic resistance gene.
The carrier bacteria can be bacteria of a species or genus selected from those
appearing in Table 2.
For example, the species is found in warm-blooded animals (eg, livestock
vertebrates). For example,
the species is found in humans. For example, the species is found in plants.
Preferably, non-
pathogenic bacteria that colonize the non-sterile parts of the human or animal
body (e.g., skin,
digestive tract, urogenital region, mouth, nasal passages, throat and upper
airway, ears and eyes) are
utilized as carrier cells, and in an example the methodology of the invention
is used to combat a target
cell bacterial infection of such a part of the body of a human or animal. In
another embodiment, the
infection is systemic infection. Examples of particularly preferred carrier
bacterial species include, but
are not limited to: non-pathogenic strains of Escherichia coli (E. coli F18
and E. coli strain Nissle),
various species of Lactobacillus (such as L. casei, L. plantarum, L paracasei,
L. acidophilus, L.
fermentum, L zeae and L gasseri), or other nonpathogenic or probiotic skin- or
GI colonizing
bacteria such as Lactococcus, Bifidobacteria, Eubacteria, and bacterial mini-
cells, which are
anucleoid cells destined to die but still capable of transferring plasmids
(see; e.g., Adler et al., Proc.
Natl. Acad. Sci. USA 57; 321-326, 1970; Frazer and Curtiss III, Current Topics
in Microbiology and
Immunology 69: 1-84, 1975; U.S. Patent No. 4,968,619 to Curtiss III). In some
embodiments, the
target recipient cells are pathogenic bacteria comprised by a human, animal or
plant, eg, on the skin or
in the digestive tract, urogenital region, mouth, nasal passage, throat and
upper airway, eye(s) and
ear(s). Of particular interest for targeting and eradication are pathogenic
strains of Pseudomonas
aeruginosa, Escherichia coli, Staphylococcus pneumoniae and other species,
Enterobacter spp., Enterococcus spp. and Mycobacterium tuberculosis. In an
example, the target cell
genus or species is any genus or species listed in Table 2.
The present invention finds use with a wide array of settings or environments,
eg, in therapeutic,
agricultural, or other settings, including, but not limited to, those
described in U.S. patents 6,271,359,
6,261,842, 6,221,582, 6,153,381, 6,106,854, and 5,627,275. Others are also
discussed herein, and still
others will be readily apparent to those of skill in the art.
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Numerous types of plasmids comprising the plasmid DNA are suitable for use in
the present
invention. In view of this, one of skill in the art will appreciate that a
single carrier bacterial strain
might harbor more than one type of such plasmid (eg, differing in the
antibacterial agent that they
encode). Further, in another example two or more different carrier bacterial
strains, each containing
one or more such plasmids, may be combined for a multi-target effect, ie, for
killing two or more
different target species or strains, or for killing the cells of the same
species or strain of target cell.
The present invention finds utility for treatment of humans and in a variety
of veterinary, agronomic,
horticultural and food processing applications. For human and veterinary use,
and depending on the
cell population or tissue targeted for protection, the following modes of
administration of the carrier
bacteria of the invention are contemplated: topical, oral, nasal, ocular,
aural, pulmonary (e.g., via an
inhaler), ophthalmic, rectal, urogenital, subcutaneous, intraperitoneal and
intravenous. The bacteria
may be supplied as a pharmaceutical composition, in a delivery vehicle
suitable for the mode of
administration selected for the patient being treated. The term "patient" or
"subject" as used here
refers to humans or animals (animals being particularly useful as models for
clinical efficacy of a
particular donor strain, for example, or being fanned or livestock animals).
Commercially-relevant
animals are chicken, turkey, duck, catfish, salmon, cod, herring, lobster,
shrimp, prawns, cows, sheep,
goats, pigs, goats, geese or rabbits.
For example, to deliver the carrier bacteria to the gastrointestinal tract or
to the nasal passages, the
preferred mode of administration may be by oral ingestion or nasal aerosol, or
by feeding (alone or
incorporated into the subject's feed or food and/or beverage, such as drinking
water). In this regard,
the carrier cells may be comprised by a food of livestock (or farmed or
companion animal), eg, the
carrier bacteria are comprised by a feed additive for livestock.
Alternatively, the additive is a
beverage (eg, water) additive for livestock. It should be noted that probiotic
bacteria, such as
Lactobacillus acidophilus, are sold as gel capsules containing a lyophilized
mixture of bacterial cells
and a solid support such as mannitol. When the gel capsule is ingested with
liquid, the lyophilized
cells are re-hydrated and become viable, colonogenic bacteria. Thus, in a
similar fashion, carrier
bacterial cells of the present invention can be supplied as a powdered,
lyophilized preparation in a gel
capsule, or in bulk, eg, for sprinkling onto food or beverages. The re-
hydrated, viable bacterial cells
will then populate and/or colonize sites throughout the upper and/or lower
gastrointestinal system, and
thereafter come into contact with the target bacteria.
For topical applications, the carrier bacteria may be formulated as an
ointment or cream to be spread
on the affected skin surface. Ointment or cream formulations are also suitable
for rectal or vaginal
31
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
delivery, along with other standard formulations, such as suppositories. The
appropriate formulations
for topical, vaginal or rectal administration are well known to medicinal
chemists.
The present invention will be of particular utility for topical or mucosal
administrations to treat a
variety of bacterial infections or bacterially related undesirable conditions.
Some representative
examples of these uses include treatment of (1) conjunctivitis, caused by
Haemophilus sp., and
corneal ulcers, caused by Pseudomonas aeruginosa; (2) otititis externa, caused
by Pseudomonas
aeruginosa; (3) chronic sinusitis, caused by many Gram-positive cocci and Gram-
negative rods, or for
general decontamination of bronchii; (4) cystic fibrosis, associated with
Pseudomonas aeruginosa; (5)
enteritis, caused by Helicobacter pylori (eg, to treat or prevent gastric
ulcers), Escherichia coli,
Salmonella typhimurium, Campylobacter or Shigella sp. ; (6) open wounds, such
as surgical or non-
surgical, eg, as a prophylactic measure; (7) burns to eliminate Pseudomonas
aeruginosa or other
Gram-negative pathogens; (8) acne, eg, caused by Propionobacter acnes; (9)
nose or skin infection,
eg, caused by metlncillin resistant Staphylococcus aureus (MSRA); (10) body
odor, eg, caused by
Gram-positive anaerobic bacteria (i.e., use of carrier cells in deodorants);
(11) bacterial vaginosis, eg,
associated with Gardnerella vaginalis or other anaerobes; and (12) gingivitis
and/or tooth decay
caused by various organisms.
In one example, the target cells are E coli cells and the disease or condition
to be treated in a human is
a uterine tract infection or a ventilator associated infection, eg, pneumonia.
In other embodiments, the carrier cells of the present invention find
application in the treatment of
surfaces for the removal or attenuation of unwanted target bacteria, for
example use in a method of
treating such a surface or an environment comprising target bacteria, wherein
the method comprises
contacting the surface or environment with carrier bacteria of the invention,
allowing conjugative
transfer of the plasmid DNA of the invention from the carrier to the target
bacteria, and allowing the
antibacterial agent to kill target cells. For example, surfaces that may be
used in invasive treatments
such as surgery, catheterization and the like may be treated to prevent
infection of a subject by
bacterial contaminants on the surface. It is contemplated that the methods and
compositions of the
present invention may be used to treat numerous surfaces, objects, materials
and the like (e.g.,
medical or first aid equipment, nursery and kitchen equipment and surfaces) to
control bacterial
contamination thereon.
Pharmaceutical preparations or other compositions comprising the carrier
bacteria may be formulated
in dosage unit form for ease of administration and uniformity of dosage.
Dosage unit form, as used
32
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
herein, refers to a physically discrete unit of the pharmaceutical preparation
appropriate for the patient
or plant or environment or surface undergoing treatment. Each dosage should
contain a quantity of the
carrier bacteria calculated to produce the desired antibacterial effect in
association with the selected
carrier. Procedures for determining the appropriate dosage unit are well known
to those skilled in the
art. Dosage units may be proportionately increased or decreased based on the
weight of a patient,
plant, surface or environment. Appropriate concentrations for achieving
eradication of pathogenic
target cells (eg, comprised by a tissue of the patient) may be determined by
dosage concentration
curve calculations, as known in the art.
Other uses for the carrier bacteria of the invention are also contemplated.
These include a variety
agricultural, horticultural, environmental and food processing applications.
For example, in
agriculture and horticulture, various plant pathogenic bacteria may be
targeted in order to minimize
plant disease. One example of a plant pathogen suitable for targeting is
Erwinia (eg, E amylovora, the
causal agent of fire blight). Similar strategies may be utilized to reduce or
prevent wilting of cut
flowers. For veterinary or animal farming, the carrier cells of the invention
may be incorporated into
animal feed (chicken, swine, poultry, goat, sheep, fish, shellfish or cattle
feed) to reduce bio-burden or
to eliminate certain pathogenic organisms (e.g., Salmonella, such as in
chicken, turkey or other
poultry). In other embodiments, the invention may be applied on meat or other
foods to eliminate
unwanted or pathogenic bacteria (e.g., E. coli 0157:H7 on meat, or Proteus
spp., one cause of "fishy
odour" on seafood).
Environmental utilities comprise, for example, engineering carrier bacteria to
deliver and
conditionally express an insecticidal agent in addition to or instead of an
antibacterial agent (e.g., for
the control of mosquitos that disseminate malaria or West Nile virus). In such
applications, as well as
in the agricultural and horticultural or other applications described above,
formulation of the carrier
bacteria as solutions, aerosols, or gel capsules are contemplated.
As used herein, the term "carrier cell", "first cell" or "donor cell" includes
dividing and/or non-
dividing bacterial cells (minicells and maxicells), or conditionally non-
functional cells.
In an example, the plasmid is an engineered RK2 or RP4 plasmid. In an example
the plasmid DNA is
comprised by an engineered RK2/RP4 plasmid (ie, a RK2 plasmid that has been
modified by
recombinant DNA technology or a progeny of such a modified plasmid). Plasmid
RK2 is a
promiscuous plasmid that can replicate in 29 (and probably many more) gram-
negative species
(Guiney and Lanka, 1989, p 27-54. In C. M. Thomas (ed) Promiscous plasmids in
gram-negative
33
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
bacteria. London, Ltd London United Kingdom.). Plasmid RK2 is a 60-kb self-
transmissible plasmid
with a complete nucleotide sequence known (Pansegrau et al., 1994, J. Mol.
Biol. 239, 623-663). A
minimal replicon derived from this large plasmid has been obtained that is
devoid of all its genes
except for a trfA gene, that encodes plasmid' s Rep protein called TrfA, and
an origin of vegetative
replication oliV For a review of RK2 replication and its control by TrfA
protein, see Helinski et al.,
1996 (In Escherichia coli and Salmonella Cellular and Molecular Biology, Vol.
2 (ed. F. Neidhardt, et
al., 2295-2324, ASM Press, Washington D.C.).
In an example the plasmid DNA is comprised by an engineered R6K plasmid (ie, a
R6K plasmid that
has been modified by recombinant DNA technology or a progeny of such a
modified plasmid).
The present invention is optionally for an industrial or domestic use, or is
used in a method for such
use. For example, it is for or used in agriculture, oil or petroleum industry,
food or drink industry,
clothing industry, packaging industry, electronics industry, computer
industry, environmental
industry, chemical industry, aeorspace industry, automotive industry,
biotechnology industry, medical
industry, healthcare industry, dentistry industry, energy industry, consumer
products industry,
pharmaceutical industry, mining industry, cleaning industry, forestry
industry, fishing industry, leisure
industry, recycling industry, cosmetics industry, plastics industry, pulp or
paper industry, textile
industry, clothing industry, leather or suede or animal hide industry, tobacco
industry or steel
industry.
The present invention is optionally for use in an industry or the environment
is an industrial
environment, wherein the industry is an industry of a field selected from the
group consisting of the
medical and healthcare; pharmaceutical; human food; animal food; plant
fertilizers; beverage; dairy;
meat processing; agriculture; livestock farming; poultry farming; fish and
shellfish farming;
veterinary; oil; gas; petrochemical; water treatment; sewage treatment;
packaging; electronics and
computer; personal healthcare and toiletries; cosmetics; dental; non-medical
dental; ophthalmic; non-
medical ophthalmic; mineral mining and processing; metals mining and
processing; quarrying;
aviation; automotive; rail; shipping; space; environmental; soil treatment;
pulp and paper; clothing
manufacture; dyes; printing; adhesives; air treatment; solvents; biodefence;
vitamin supplements; cold
storage; fibre retting and production; biotechnology; chemical; industrial
cleaning products; domestic
cleaning products; soaps and detergents; consumer products; forestry; fishing;
leisure; recycling;
plastics; hide, leather and suede; waste management; funeral and undertaking;
fuel; building; energy;
steel; and tobacco industry fields.
34
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
In an example, the plasmid DNA comprises a CRISPR array that targets target
bacteria, wherein the
array comprises one, or two or more different spacers (eg, 2, 3, 4, 5, 6, 7,
8, 9 ,10, 20, 30, 40, 50 or
more spacers) for targeting the genome of target bacteria.
.. In an example, the target bacteria are comprised by an environment as
follows. In an example, the
environment is a microbiome of a human, eg, the oral cavity microbiome or gut
microbiome or the
bloodstream. In an example, the environment is not an environment in or on a
human. In an example,
the environment is not an environment in or on a non-human animal. In an
embodiment, the
environment is an air environment. In an embodiment, the environment is an
agricultural
environment. In an embodiment, the environment is an oil or petroleum recovery
environment, eg, an
oil or petroleum field or well. In an example, the environment is an
environment in or on a foodstuff
or beverage for human or non-human animal consumption. In an example, the
environment is a
maritimeenvironment, eg, in seawater or on a boat (eg, in ship or boat ballast
water).
In an example, the environment is a a human or animal microbiome (eg, gut,
vaginal, scalp, armpit,
skin or oral cavity microbiome). In an example, the target bacteria are
comprised by a human or
animal microbiome (eg, gut, vaginal, scalp, armpit, skin or oral cavity
microbiome).
In an example, the carrier bacteria or composition of the invention are
administered intranasally,
topically or orally to a human or non-human animal, or is for such
administration. The skilled person
aiming to treat a microbiome of the human or animal will be able to determine
the best route of
administration, depending upon the microbiome of interest. For example, when
the microbiome is a
gut microbiome, administration can be intranasally or orally. When the
microbiome is a scalp or
armpit microbiome, administration can be topically. When the microbiome is in
the mouth or throat,
the administration can be orally.
In an example, the environment is harboured by a beverage or water (eg, a
waterway or drinking
water for human consumption) or soil. The water is optionally in a heating,
cooling or industrial
system, or in a drinking water storage container.
In an example, the carrier and/or target bacteraia are Firmicutes selected
from Anaerotruncus,
Acetanaerobacterium, Acetitomaculum, Ace tivibrio, Anaerococcus, Anaerofilum,
Anaerosinus,
Anaerostipes, Anaerovorax, Butyrivibrio, Clostridium, Capracoccus,
Dehalobacter, Dialister, Dorea,
Enterococcus, Ethanoligenens, Faecalibacterium, Fusobacterium, Gracilibacter,
Guggenheimella,
Hespellia, Lachnobacterium, Lachnospira, Lactobacillus, Leuconostoc,
Megamonas,
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Mitsuokella, Oribacterium, Oxobacter, Papillibacter,
Proprionispira,Pseudobutyrivibrio,
Pseudoramibacter, Roseburia, Ruminococcus, Sarcina, Seinonella,
Shuttleworthia, Sporobacter,
Sporobacterium, Streptococcus, Subdoligranulum, Syntrophococcus,
Thermobacillus, Turibacter and
Weisella.
In an example, the carrier bacteria, composition, use or method is for
reducing pathogenic infections
or for re-balancing gut or oral biofilm eg, for treating or preventing obesity
or disease in a human or
animal; or for treating or preventing a GI condition (such as Crohn's disease,
IBD or colitis). For
example, the DNA, carrier bacteria, composition, use or method is for knocking-
down Salmomnella,
Campylobacter, Erwinia, Xanthomonous, Edwardsiella, Pseudomonas, Klebsiella,
Pectobacterium,
Clostridium dificile or E coli bacteria in a gut biofilm of a human or animal
or a plant, preferably in a
human or animal.
In an example, the animal is a chicken, eg, and the target bacteria are
Salmomnella or Campylobacter.
In an example, the animal is a fish (eg, catfish or salmon) or shellfish (eg,
prawn or lobster), eg, and
the target bacteria are Edwardsiella. In an example, the plant is a potato
plant and, eg, the target
bacteria are Pectobacterium. In an example, the plant is a cabbage plant and,
eg, the target bacteria
are Xanthomonous (eg, X campestris). In an example, the plant is a marijuana
plant and, eg, the targt
bacteria are Pseudomonas (eg, P cannabina or P amygdali), Agrobacterium (eg, A
tumefaciens) or
Xanthomonas (eg, X campestris). In an example, the plant is a hemp plant and,
eg, the targt bacteria
are are Pseudomonas (eg, P cannabina or P amygdali), Agrobacterium (eg, A
tumefaciens) or
Xanthomonas (eg, X campestris).
In an example, the disease or condition is a cancer, inflammatory or
autoimmune disease or condition,
eg, obesity, diabetes IBD, a GI tract condition or an oral cavity condition.
Optionally, the environment is comprised by, or the target bacteria are
comprised by, a gut biofilm,
skin biofilm, oral cavity biofilm, throat biofilm, hair biofilm, armpit
biofilm, vaginal biofilm, rectal
biofilm, anal biofilm, ocular biofilm, nasal biofilm, tongue biofilm, lung
biofilm, liver biofilm, kidney
biofilm, genital biofilm, penile biofilm, scrotal biofilm, mammary gland
biofilm, ear biofilm, urethra
biofilm, labial biofilm, organ biofilm or dental biofilm. Optionally, the
environment is comprised by,
or the target bacteria are comprised by, a plant (eg, a tobacco, crop plant,
fruit plant, vegetable plant
or tobacco, eg on the surface of a plant or contained in a plant) or by an
environment (eg, soil or water
or a waterway or acqueous liquid).
36
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
In an example, the carrier cell(s) or composition is for treating a disease or
condition in an animal or
human. In an example, the disease or condition is caused by or mediated by an
infection of target
cells comprised by the subject or patient. In an example, the disease or
condition is associated with an
infection of target cells comprised by the subject or patient. In an example,
a symptom of the disease
or condition is an infection of target cells comprised by the subject or
patient.
Optionally, the disease or condition of a human or animal subject is selected
from
(a) A neurodegenerative disease or condition;
(b) A brain disease or condition;
(c) A CNS disease or condition;
(d) Memory loss or impairment;
(e) A heart or cardiovascular disease or condition, eg, heart attack,
stroke or atrial
fibrillation;
(0 A liver disease or condition;
(g) A kidney disease or condition, eg, chronic kidney disease (CKD);
(h) A pancreas disease or condition;
(i) A lung disease or condition, eg, cystic fibrosis or COPD;
(i) A gastrointestinal disease or condition;
(k) A throat or oral cavity disease or condition;
(1) An ocular disease or condition;
(m) A genital disease or condition, eg, a vaginal, labial, penile or
scrotal disease or
condition;
(n) A sexually-transmissible disease or condition, eg, gonorrhea, HIV
infection, syphilis
or Chlamydia infection;
(o) An ear disease or condition;
(13) A skin disease or condition;
(q) A heart disease or condition;
(r) A nasal disease or condition
(s) A haematological disease or condition, eg, anaemia, eg, anaemia of
chronic disease or
cancer;
(t) A viral infection;
(u) A pathogenic bacterial infection;
(v) A cancer;
(w) An autoimmune disease or condition, eg, SLE;
37
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
(x) An inflammatory disease or condition, eg, rheumatoid arthritis,
psoriasis, eczema,
asthma, ulcerative colitis, colitis, Crohn's disease or IBD;
(y) Autism;
(z) ADHD;
(aa) Bipolar disorder;
(bb) ALS [Amyotrophic Lateral Sclerosis];
(cc) Osteoarthritis;
(dd) A congenital or development defect or condition;
(cc) Miscarriage;
(ff) A blood clotting condition;
(gg) Bronchitis;
(hh) Dry or wet AMD;
(ii) Neovascularisation (eg, of a tumour or in the eye);
Common cold;
(kk) Epilepsy;
(11) Fibrosis, eg, liver or lung fibrosis;
(mm) A fungal disease or condition, eg, thrush;
(nn) A metabolic disease or condition, eg, obesity, anorexia,
diabetes, Type I or Type II
diabetes.
(oo) Ulcer(s), eg, gastric ulceration or skin ulceration;
(1313) Dry skin;
(qq) Sjogren's syndrome;
(rr) Cytokine storm;
(ss) Deafness, hearing loss or impairment;
(tt) Slow or fast metabolism (ie, slower or faster than average for the
weight, sex and age
of the subject);
(uu) Conception disorder, eg, infertility or low fertility;
(vv) Jaundice;
(ww) Skin rash;
(xx) Kawasaki Disease;
(YY) Lyme Disease;
(zz) An allergy, eg, a nut, grass, pollen, dust mite, cat or dog
fur or dander allergy;
(aaa) Malaria, typhoid fever, tuberculosis or cholera;
(bbb) Depression;
(ccc) Mental retardation;
38
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
(ddd) Microcephaly;
(eee) Malnutrition;
(fff) Conjunctivitis;
(ggg) Pneumonia;
(hhh) Pulmonary embolism;
(iii) Pulmonary hypertension;
(jji) A bone disorder;
(kkk) Sepsis or septic shock;
(111) Sinusitus;
(mmm) Stress (eg, occupational stress);
(nnn) Thalassaemia, anaemia, von Willebrand Disease, or haemophilia;
(000) Shingles or cold sore;
(PPP) Menstruation;
(qqq) Low sperm count.
NEURODEGENERATIVE OR CNS DISEASES OR CONDITIONS FOR TREATMENT OR
PREVENTION BY THE INVENTION
In an example, the neurodegenerative or CNS disease or condition is selected
from the group
consisting of Alzheimer disease, geriopsychosis, Down syndrome, Parkinson's
disease, Creutzfeldt-
jakob disease, diabetic neuropathy, Parkinson syndrome, Huntington's disease,
Machado-Joseph
disease, amyotrophic lateral sclerosis, diabetic neuropathy, and Creutzfeldt
Creutzfeldt- Jakob
disease. For example, the disease is Alzheimer disease. For example, the
disease is Parkinson
syndrome.
In an example, wherein the method of the invention is practised on a human or
animal subject for
treating a CNS or neurodegenerative disease or condition, the method causes
downregulation of Treg
cells in the subject, thereby promoting entry of systemic monocyte-derived
macrophages and/or Treg
cells across the choroid plexus into the brain of the subject, whereby the
disease or condition (eg,
Alzheimer's disease) is treated, prevented or progression thereof is reduced.
In an embodiment the
method causes an increase of IFN-gamma in the CNS system (eg, in the brain
and/or CSF) of the
subject. In an example, the method restores nerve fibre and//or reduces the
progression of nerve fibre
damage. In an example, the method restores nerve myelin and//or reduces the
progression of nerve
myelin damage. In an example, the method of the invention treats or prevents a
disease or condition
disclosed in W02015136541 and/or the method can be used with any method
disclosed in
W02015136541 (the disclosure of this document is incorporated by reference
herein in its entirety,
39
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
eg, for providing disclosure of such methods, diseases, conditions and
potential therapeutic agents that
can be administered to the subject for effecting treatement and/or prevention
of CNS and
neurodegenerative diseases and conditions, eg, agents such as immune
checkpoint inhibitors, eg, anti-
PD-1, anti-PD-L1, anti-TIM3 or other antibodies disclosed therein).
CANCERS FOR TREATMENT OR PREVENTION BY THE METHOD
Cancers that may be treated include tumours that are not vascularized, or not
substantially
vascularized, as well as vascularized tumours. The cancers may comprise non-
solid tumours (such as
haematological tumours, for example, leukaemias and lymphomas) or may comprise
solid tumours.
Types of cancers to be treated with the invention include, but are not limited
to, carcinoma, blastoma,
and sarcoma, and certain leukaemia or lymphoid malignancies, benign and
malignant tumours, and
malignancies e.g., sarcomas, carcinomas, and melanomas. Adult tumours/cancers
and paediatric
tumours/cancers are also included.
Haematologic cancers are cancers of the blood or bone marrow. Examples of
haematological (or
haematogenous) cancers include leukaemias, including acute leukaemias (such as
acute lymphocytic
leukaemia, acute myelocytic leukaemia, acute myelogenous leukaemia and
myeloblasts,
promyeiocytic, myelomonocytic, monocytic and erythroleukaemia), chronic
leukaemias (such as
chronic myelocytic (granulocytic) leukaemia, chronic myelogenous leukaemia,
and chronic
lymphocytic leukaemia), polycythemia vera, lymphoma, Hodgkin's disease, non-
Hodgkin's lymphoma
(indolent and high grade forms), multiple myeloma, Waldenstrom's
macroglobulinemia, heavy chain
disease, myeiodysplastic syndrome, hairy cell leukaemia and myelodysplasia.
Solid tumours are abnormal masses of tissue that usually do not contain cysts
or liquid areas. Solid
tumours can be benign or malignant. Different types of solid tumours are named
for the type of cells
that form them (such as sarcomas, carcinomas, and lymphomas). Examples of
solid tumours, such as
sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma,
chondrosarcoma,
osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumour,
leiomyosarcoma,
rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer,
breast cancer, lung
cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous
eel! carcinoma, basal
cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid
carcinoma, papillary
thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary
carcinoma, papillary
adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell
carcinoma, hepatoma,
bile duct carcinoma, choriocarcinoma, Wilms' tumour, cervical cancer,
testicular tumour, seminoma,
bladder carcinoma, melanoma, and CNS tumours (such as a glioma (such as
brainstem glioma and
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
mixed gliomas), glioblastoma (also known as glioblastoma multiforme)
astrocytoma. CNS lymphoma,
germinoma, medu!loblastoma, Schwannoma craniopharyogioma, ependymoma,
pineaioma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma,
neuroblastoma,
retinoblastoma and brain metastases).
AUTOIMMUNE DISEASES FOR TREATMENT OR PREVENTION BY THE METHOD
1. Acute Disseminated Encephalomyelitis (ADEM)
2. Acute necrotizing hemorrhagic leukoencephalitis
3. Addison's disease
4. Agammaglobulinemia
5. Alopecia areata
6. Amyloidosis
7. Ankylosing spondylitis
8. Anti-GBM/Anti-TBM nephritis
9. Antiphospholipid syndrome (APS)
10. Autoimmune angioedema
11. Autoimmune aplastic anemia
12. Autoimmune dysautonomia
13. Autoimmune hepatitis
14. Autoimmune hyperlipidemia
15. Autoimmune immunodeficiency
16. Autoimmune inner ear disease (AIED)
17. Autoimmune myocarclitis
18. Autoimmune oophoritis
19. Autoimmune pancreatitis
20. Autoimmune retinopathy
21. Autoimmune thrombocytopenic purpura (ATP)
22. Autoimmune thyroid disease
23. Autoimmune urticaria
24. Axonal & neuronal neuropathies
25. Balo disease
26. Behcet's disease
27. Bullous pemphigoid
28. Cardiomyopathy
29. Castleman disease
41
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
30. Celiac disease
31. Chagas disease
32. Chronic fatigue syndrome
33. Chronic inflammatory demyelinating polyneuropathy (CIDP)
34. Chronic recurrent multifocal ostomyelitis (CRMO)
35. Churg-Strauss syndrome
36. Cicatricial pemphigoid/benign mucosal pcmphigoid
37. Crohn's disease
38. Cogans syndrome
39. Cold agglutinin disease
40. Congenital heart block
41. Coxsackie mvocarditis
42. CREST disease
43. Essential mixed cryoglobulinemia
44. Demyelinating neuropathies
45. Dermatitis herpetiformis
46. Dermatomyositis
47. Devic's disease (neuromyelitis optica)
48. Discoid lupus
49. Dressler's syndrome
50. Endometriosis
51. Eosinophilic esophagitis
52. Eosinophilic fasciitis
53. Erythema nodosum
54. Experimental allergic encephalomyelitis
55. Evans syndrome
56. Fibromvalgia
57. Fibrosing alveolitis
58. Giant cell arteritis (temporal arteritis)
59. Giant cell mvocarditis
60. Glomerulonephritis
61. Goodpasture's syndrome
62. Granulomatosis with Polyangiitis (GPM (formerly called Wegener's
Granulomatosis)
63. Graves' disease
64. Guillain-Barre syndrome
42
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
65. Hashimoto's encephalitis
66. Hashimoto's thyroiditis
67. Hemolytic anemia
68. Henoch-Schonlein purpura
69. Herpes gestationis
70. Hypogammaglobulinemia
71. Idiopathic thrombocytopenic purpura (ITP)
72. IgA nephropathv
73. IgG4-related sclerosing disease
74. Immunoregulatory lipoproteins
75. Inclusion body myositis
76. Interstitial cystitis
77. Juvenile arthritis
78. Juvenile diabetes (Type 1 diabetes)
79. Juvenile myositis
80. Kawasaki syndrome
81. Lambert-Eaton syndrome
82. Leukocytoclastic vasculitis
83. Lichen planus
84. Lichen sclerosus
85. Ligneous conjunctivitis
86. Linear IgA disease (LAD)
87. Lupus (SLE)
88. Lyme disease, chronic
89. Meniere's disease
90. Microscopic polvangiitis
91. Mixed connective tissue disease (MCTD)
92. Mooren's ulcer
93. Mucha-Habermann disease
94. Multiple sclerosis
95. Myasthenia gravis
96. Myositis
97. Narcolepsy
98. Neuromyelitis optica (Devic's)
99. Neutropenia
43
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
100. Ocular cicatricial pemphigoid
101. Optic neuritis
102. Palindromic rheumatism
103. PANDAS (Pediatric Autoimmune Neuropsychiatric Disorders Associated
with
Streptococcus)
104. Paraneoplastic cerebellar degeneration
105. Paroxysmal nocturnal hemoglobinuria (PNH)
106. Parry Romberg syndrome
107. Parsonnage-Turner syndrome
108. Pars planitis (peripheral uveitis)
109. Pemphigus
110. Peripheral neuropathy
111. Perivenous encephalomyelitis
112. Pernicious anemia
113. POEMS syndrome
114. Polyarteritis nodosa
115. Type I. II, & Ill autoimmune polyglandular syndromes
116. Polymyalgia rheumatica
117. Polymyositis
118. Postmyocardial infarction syndrome
119. Postpericardiotomy syndrome
120. Progesterone dermatitis
121. Primary biliary cirrhosis
122. Primary sclerosing cholangitis
123. Psoriasis
124. Psoriatic arthritis
125. Idiopathic pulmonary fibrosis
126. Pyoderma gangrenosum
127. Pure red cell aplasia
128. Ravnauds phenomenon
129. Reactive Arthritis
130. Reflex sympathetic dystrophy
131. Reiter's syndrome
132. Relapsing polychondritis
133. Restless legs syndrome
44
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
134. Retroperitoneal fibrosis
135. Rheumatic fever
136. Rheumatoid arthritis
137. Sarcoidosis
138. Schmidt syndrome
139. Scleiitis
140. Scleroderma
141. Sjogren's syndrome
142. Sperm & testicular autoimmunity
143. Stiff person syndrome
144. Subacute bacterial endocarditis (SBE)
145. Susac's syndrome
146. Sympathetic ophthalmia
147. Takayasu's arteritis
148. Temporal arteritis/Giant cell arteritis
149. Thrombocytopenic purpura (TTP)
150. Tolosa-Hunt syndrome
151. Transverse myelitis
152. Type 1 diabetes
153. Ulcerative colitis
154. Undifferentiated connective tissue disease (UCTD)
155. Uveitis
156. Vasculitis
157. Vesiculobullous dermatosis
158. Vitiligo
159. Wegener's granulomatosis (now termed Granulomatosis with
Polyangiitis (GPA).
INFLAMMATORY DISEASES FOR TREATMENT OR PREVENTION BY THE METHOD
1. Alzheimer's disease
2. ankylosing spondylitis
3. arthritis (osteoarthritis, rheumatoid arthritis (RA), psoriatic arthritis)
4. asthma
5. atherosclerosis
6. Crohn's disease
7. colitis
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
8. dermatitis
9. diverticulitis
10. fibromyalgia
11. hepatitis
12. irritable bowel syndrome (IBS)
13. systemic lupus erythematous (SLE)
14. nephritis
15. Parkinson's disease
16. ulcerative colitis.
It will be understood that particular embodiments described herein are shown
by way of illustration
and not as limitations of the invention. The principal features of this
invention can be employed in
various embodiments without departing from the scope of the invention. Those
skilled in the art will
recognize, or be able to ascertain using no more than routine study, numerous
equivalents to the
specific procedures described herein. Such equivalents are considered to be
within the scope of this
invention and are covered by the claims. All publications and patent
applications mentioned in the
specification are indicative of the level of skill of those skilled in the art
to which this invention
pertains. All publications and patent applications and all US equivalent
patent applications and patents
are herein incorporated by reference to the same extent as if each individual
publication or patent
application was specifically and individually indicated to be incorporated by
reference. The use of the
word "a" or "an" when used in conjunction with the term "comprising" in the
claims and/or the
specification may mean "one," but it is also consistent with the meaning of
"one or more," "at least
one," and "one or more than one." The use of the term "or" in the claims is
used to mean "and/or"
unless explicitly indicated to refer to alternatives only or the alternatives
are mutually exclusive,
although the disclosure supports a definition that refers to only alternatives
and "and/or." Throughout
this application, the term "about" is used to indicate that a value includes
the inherent variation of
error for the device, the method being employed to determine the value, or the
variation that exists
among the study subjects.
As used in this specification and claim(s), the words "comprising" (and any
form of comprising, such
as "comprise" and "comprises"), "having" (and any form of having, such as
"have" and "has"),
"including" (and any form of including, such as "includes" and "include") or
"containing" (and any
form of containing, such as "contains" and "contain") are inclusive or open-
ended and do not exclude
additional, unrecited elements or method steps
46
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
The term "or combinations thereof" or similar as used herein refers to all
permutations and
combinations of the listed items preceding the term. For example, "A, B, C, or
combinations thereof is
intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order
is important in a
particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing
with this example,
.. expressly included are combinations that contain repeats of one or more
item or term, such as BB,
AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will
understand that typically there is no limit on the number of items or terms in
any combination, unless
otherwise apparent from the context.
Any part of this disclosure may be read in combination with any other part of
the disclosure, unless
otherwise apparent from the context.
All of the compositions and/or methods disclosed and claimed herein can be
made and executed
without undue experimentation in light of the present disclosure. While the
compositions and methods
of this invention have been described in terms of preferred embodiments, it
will be apparent to those
of skill in the art that variations may be applied to the compositions and/or
methods and in the steps or
in the sequence of steps of the method described herein without departing from
the concept, spirit and
scope of the invention. All such similar substitutes and modifications
apparent to those skilled in the
art are deemed to be within the spirit, scope and concept of the invention as
defined by the appended
claims.
EXAMPLES
Example 1: Knock-Out of hypC2 function Greatly Enhances Coniugtion Efficiency
Transposon library construction and enrichment of highly conjugative mutants
A transposon mutant library of plasmid pX1.0 (Genbank accession: HM114226.1)
was constructed
using the EZ-Tn5Tm kit (Lucigen, Middleton, USA) following the manufacturer's
protocol. E. coli
Top10 competent cells (ThermoFisher, Massachusetts, USA) were transformed via
electroporation
with 1 ill of the library and recovered for 2 h at 37 C with shaking. The
transformation mixture was
then diluted five-fold in 50ug/m1 Kanamycin to enrich for plasmids with
successful Tn5
transpositions.
47
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Determining conjugation efficiency
Overnight cultures of donor (E. coli MG1655 containing wildtype or mutant
plasmid) and
streptomycin resistant recipient E. coli MG1655 were mixed 1:1 and spotted on
the surface of an LB
agar plate. The conjugating mixture was incubated for 14 h after which the
colony, consisting of the
two strains, was scraped of the plate and diluted in PBS. Different dilutions
were plated on selective
plates to separate and quantify transconjugants, donors, and recipients.
The sequence of hypC2 and its protein are shown in Table 3.
Results of conjugation experiment:
See Figure 1. The hypc2 KO (knock-out) plasmid mutant shows an approximately
1000x higher
conjugation rate compared to the wildtype (WT). Showed is the number of
transconjugants (infected
cells) obtained from the same amount of donor and incubation time with the WT
and optimized
(mutant) plasmids.
Example 2: hypC2 is Widespread Amongst Plasmids
The pX1.0 plasmid is an archetypical IncX plasmid constructed from naturally
occurring IncX
plasmids to contain the core functionalities within the IncX plasmid group.
See PLoS One.
2011;6(5):e19912. doi: 10.1371/journal.pone.0019912. Epub 2011 May 18; "Design
and synthesis of
a quintessential self-transmissible IncX1 plasmid, pX1.0", Hansen LH et al.
IncX plasmids are
historically defined by their replication module, which is used in their
typing as described elsewhere.
See, for example, Plasmid. 2012 Jul;68(1):43-50. doi:
10.1016/j.plasmid.2012.03.001. Epub 2012 Mar
26; "Expansion of the IncX plasmid family for improved identification and
typing of novel plasmids
in drug-resistant Enterobacteriaceae", Johnson TJ et al.
A blast of the hypC2 gene reveals that identical (100% ID and coverage) genes
are present in 33
different plasmids in Genbank. Apart from these it is found in 68 sequenced
plasmids with more than
80% coverage and 80% ID, after which a steep drop in both ID and coverage (to
unrelated sequences)
is observed. The gene is found in E. coli and Salmonella species, but also in
Shigella and Klebsiella at
high identity.
As in pairwise alignment output:
% ID it the percentage of (perfect) matches in the aligment and (query)
coverage is the percentage (of
the length) of the query (hyp2C) sequence aligning to the target sequence.
48
CA 03148395 2022-01-21
WO 2021/037732
PCT/EP2020/073512
Table 1: Relatedness of hypC2 found in Individual examples of plasmids found
in different bacterial
host species:
Accession no ID % Coverage % Plasmid Species SEQ ID
NO:
HG963477.1 100 100 pIS15_43 E. coli 1
CP023137.2 96.7 98 Unnamed K pneumoniae 3
0P005391.2 96.6 100 pCFSAN002069 S. enterica 4
CP013972.1 79.6 99 Unnamed E. tracheiphila 5
CP017588.1 98.1 99 pDSJ07 P. stewartii 6
CP026699.1 78.5 88 Unamed C. koseri 7
And a phylogram to illustrate is shown in figure 2.
49
TABLE 2: Example Bacteria
0
t..)
Optionally, the carrier (donor or first) cells are selected from this Table
and/or the target (recipient or second) cells are selected from this Table
(eg, wherein o
t..)
1-,
the carrier and target cells are of a different species; or of the same
species but are a different strain or the carrier cells are engineered but the
target cells are 'a
--.1
wild-type or vice versa). For example the carrier cells are E coli cells and
the target cells are C dificile, E coli, Akkermansia, Enterobacteriacea, --
.1
t..)
Ruminococcus, Faecalibacterium, Firmicutes, Bacteroidetes, Salmonella,
Klebsiella, Pseudomonas, Acintenobacter or Streptococcus cells.
Abiotrophia Acidocella Actinomyces
Alkalilimnicola Aquaspirillum
Abiotrophia defectiva Acidocella aminolytica Actinomyces bovis
Alkalilimnicola ehrlichii Aquaspirillum polymorp hum
Acidocella facilis Actinomyces denticolens
Aquaspirillum
Acaricomes
Alkaliphilus
Actinomyces europaeus
putridiconchylium
P
Acaricomes phytoseiuli Acidomonas
Alkaliphilus oremlandii
Actinomyces georgiae
Aquaspirillum serpens o
,
..
Acidomonas methanolica
Alkaliphilus transvaalensis .3
vi Actinomyces gerencseriae
o Acetitomaculum
Aquimarina
Actinomyces
2'
Acetitomaculum ruminis Acidothermus
Allochromatium "
,
Aquimarina latercula
.
hordeovulneris
,
Acidothennus cellulolyticus
Allochromatium vinosum r:,
,
Acetivibrio Actinomyces howellii
Arcanobacterium
Acetivibrio cellulolyticus Acidovorax Actinomyces hyovaginalis
Alloiococcus
Arcanobacterium
lii i Actinomyces srae
Acetivibrio ethanolgignens Acidovorax anthurii Act
Alloiococcus otitis
haemolyticum
Acetivibrio multivorans Acidovorax caeni Actinomyces johnsonii
Arcanobacterium pyo genes
Actinomyces meyeri
Allokutzneria
Acidovorax cattleyae
Iv
n
Acetoanaerobium Actinomyces naeslundii
Allokutzneria albata 1-i
Acidovorax citrulli
Archangium t=1
1-d
Acetoanaerobium note rae Actinomyces neuii
t..)
Acidovorax defluvii
Archangium gephyra o
t..)
Acidovorax delafieldii Actinomyces odontolyticus
o
'a
--.1
vi
1-,
t..)
Acidovorax facilis Actinomyces oris
0
Acetobacter
Altererythrobacter Arcobacter t..)
o
Acidovorax konjaci Actinomyces radingae
t..)
1-,
Acetobacter aceti
Altereiythrobacter Arcobacter butzleri
Acidovorax temperans Actinomyces slackii
--.1
Acetobacter cerevisiae
ishigakiensis Arcobacter ciyaerophilus --.1
Acidovorax valerianellae Actinomyces turicensis
t..)
Acetobacter cibinongensis
Arcobacter halophilus
Actinomyces viscosus
Altermonas
Acetobacter estunensis Acinetobacter
Arcobacter nitrofigilis
Altermonas haloplanktis
Acetobacter fabarum Acinetobacter baumannii Actinoplanes
Arcobacter ski rrowii
Altermonas macleodii
Acetobacter ghanensis Acinetobacter baylyi Actinoplanes auranticolor
Arhodomonas
Acetobacter indonesiensis Acinetobacter bouvetii Actinoplanes
brasiliensis
Alysiella
Arhodomonas aquaeolei P
Acetobacter lovaniensis Acinetobacter calcoaceticus Actinoplanes
consettensis
Alysiella crassa
2
..'-'
Acetobacter malorum Acinetobacter gemeri Actinoplanes deccanensis
2
vi
Alysiella filiformis Arsenophonus
,-,
LI
Acetobacter nitrogenifigens Acinetobacter haemolyticus Actinoplanes
derwentensis
Arsenophonus nasoniae
ir:
Acetobacter oeni Acinetobacter johnsonii Actinoplanes digitatis
,
Aminobacter
N)
Acetobacter orientalis Acinetobacter junii Actinoplanes durhamensis
,
Aminobacter aganoensis
Acetobacter orleanensis Acinetobacter lwoffi Actinoplanes ferrugineus
Aminobacter aminovorans
Acetobacter pasteurianus Acinetobacter parvus Actinoplanes globisporus
Arthrobacter
Aminobacter niigataensis
Acetobacter pomorum Acinetobacter radioresistens Actinoplanes humidus
Arthrobacter agilis
Acetobacter senegalensis Acinetobacter schindleri
Actinoplanes italicus Aminobacterium Arthrobacter albus
Iv
Acetobacter xylinus Acinetobacter soli Actinoplanes liguriensis
Aminobacterium mobile Arthrobacter aurescens n
m
Acinetobacter tandoii Actinoplanes lobatus
Arthrobacter Iv
t..)
Acetobacterium
Aminomonas o
t..)
Acinetobacter tjembergiae Actinoplanes missouriensis
chlorophenolicus o
Acetobacterium bakii
Aminomonas paucivorans --.1
Arthrobacter citreus
c,.)
vi
1-,
t..)
Acetobacterium carbinolicum Acinetobacter towneri Actinoplanes
palleronii Arthrobacter custallopoietes o
s hilu
t..)
o
Acetobacterium dehalogenans Acinetobacter ursingii Actinoplanes
philippinensis Ammonip Arthrobacter cumminsii t..)
1-,
'a
Acetobacterium fimetarium Acinetobacter venetianus
Actinoplanes rectilineatus Ammoniphilus oxalaticus
Arthrobacter globiformis c,.)
--.1
hilus oxalivorans
--.1
Acetobacterium malicum Actinoplanes regularis
Ammonip Arthrobacter t..)
oraosp
Acetobacterium paludosum Acrocarp Actinoplanes
histidinolovorans
Amphibacillus
Acrocarpospora corrugata
Acetobacterium tundrae teichomyceticus
Arthrobacter ilicis
Amphibacillus xylanus
Acetobacterium wieringae Acrocarpospora Actinoplanes utahensis
Arthrobacter luteus
l haa
Acetobacterium woodii macrocep
Arthrobacter methylotrophus
Amphritea
Acrocarpospora Actinopolyspora
Arthrobacter mysorens
Amphritea balenae
P
Acetofilamentum pleiomorpha Actinopolyspora halophila
Arthrobacter nicotianae o
Amphritea japonica
,
Acetofilamentum rigidum Actinopolyspora
ot
vi
Arthrobacter nicotinovorans
t..) Actibacter
LI
mortivallis
Amycolatopsis
Arthrobacter oxydans r.,0
Acetohalobium Actibacter sediminis
"
,
.
Amycolatopsis alba
Arthrobacter pascens ,
Acetohalobium arabaticum Actinosynnema
r:,
,
Actinoalloteichus
Amycolatopsis albidoflavus Arthrobacter
Actinosynnema mirum
Acetomicrobium Actinoalloteichus
Amycolatopsis azurea phenanthrenivorans
Acetomicrobium faecale cyanogriseus Actinotalea
Amycolatopsis coloradensis Arthrobacter
Acetomicrobium flavidum Actinoalloteichus Actinotalea fermentans
Amycolatopsis lurida polychromo genes
Amycolatopsis mediterranei
Atrhrobacter protophormiae
hymeniacidonis
Iv
n
Acetonema Aerococcus
Amycolatopsis rifamycinica Arthrobacter
Actinoalloteichus spitiensis
t=1
Iv
Acetonema longum Aerococcus sanguinicola
Amycolatopsis rubida psychrolactophilus t..)
o
t..)
Aerococcus urinae
Arthrobacter ramosus o
'a
--.1
vi
1-,
t..)
Aerococcus urinaeequi
Amycolatopsis sulphurea Arthrobacter sulfonivorans 0
Acetothermus Actinobaccillus
t..)
o
Aerococcus urinaehominis Amycolatopsis tolypomycina
Arthrobacter sulfureus t..)
1-,
Acetothermus paucivorans Actinobacillus capsulatus
Aerococcus viridans
Arthrobacter uratoxydans c,.)
--.1
Actinobacillus delphinicola
Anabaena --.1
Arthrobacter ureafaciens
t..)
Acholeplasma
Actinobacillus hominis Aeromicrobium
Anabaena cylindrica Arthrobacter viscosus
Acholeplasma axanthum
Actinobacillus indolicus Aeromicrobium euthreum
Anabaena flos-aquae Arthrobacter woluwensis
Acholeplasma brassicae
Actinobacillus lignieresii
Anabaena variabilis
Acholeplasma cavigenitalium Aeromonas
Actinobacillus minor
Asaia
Acholeplasma equifetale Aeromonas
Anaeroarcus
Actinobacillus muris
Asaia bogorensis
Acholeplasma granularum Actinobacillus allosaccharophila
Anaeroarcus burkinensis P
2
Acholeplasma hippikon Aeromonas bestiarum
Asanoa
pleuropneumoniae
u,
m lu
Acholeplasma laidlawii Actinobacillus porcinus
Aeromonas caviae Anaerobacu Asanoa ferruginea
,,,
.
Ablbile
Acholeplasma modicum Actinobacillus rossii Aeromonas encheleia
naeroacuum mobile r.,"
,
,9
Asticcacaulis
,
Acholeplasma morum Aeromonas
N),
Actinobacillus scotiae
Anaerobiospirillum
Asticcacaulis biprosthecium
Acholeplasma multilocale enteropelo genes
Actinobacillus seminis Anaerobiospirillum
Asticcacaulis excentricus
Acholeplasma oculi Aeromonas eucrenophila
Actinobacillus succinogenes
succiniciproducens
Acholeplasma palmae Aeromonas ichthiosmia
Actinobaccillus suis
Anaerobiospirillum thomasii Atopobacter
Acholeplasma parvum Aeromonas jandaei
Actinobacillus ureae
Atopobacter phocae Iv
Acholeplasma pleciae Aeromonas media
n
Anaerococcus
Acholeplasma vituli Actinobaculum Aeromonas popoffii
t=1
Anaerococcus hydrogenalis
Atopobium 1-d
t..)
o
Actinobaculum massiliense Aeromonas sobria
r..)
Anaerococcus lactolyticus
Atopobium fossor o
Actinobaculum schaalii Aeromonas veronii
--.1
Anaerococcus prevotii
Atopobium minutum c,.)
vi
1-,
t..)
Actinobaculum suis
Anaerococcus tetradius Atopobium parvulum 0
Achromobacter Agrobacterium
t..)
o
Actinomyces urinale
Anaerococcus vaginalis Atopobium rimae t..)
1-,
Achromobacter denitrificans Agrobacterium
Atopobium vaginae
c,.)
--.1
Achromobacter insolitus Actinocatenispora gelatinovorum
Anaerofustis --.1
t..)
Achromobacter piechaudii Actinocatenispora rupis
Anaerofustis stercorihominis Aureobacterium
Agrococcus Achromobacter ruhlandii Actinocatenispora
Aureobacterium barkeri
Achromobacter spanius thailandica Agrococcus citreus
Anaeromusa
Agrococcus jenensis
Anaeromusa acidaminophila Aurobacterium
Actinocatenispora sera
Acidaminobacter
Aurobacterium liquefaciens
t b Anaeromyxoacer
Acidaminobacter Actinocorallia Agromonas
P
Agromonas oligotrophica Anaeromyxobacter
Avibacterium 2
hydrogenoformans Actinocorallia aurantiaca
..'-'
vi
dehalogenans Avibacterium avium
.6. Actinocorallia aurea
,,,
Agromyces Acidaminococcus
Avibacterium gallinarum 2
Actinocorallia cavemae
N)
,
Agromyces fucosus
Anaerorhabdus
Acidaminococcus fermentans
Avibacterium paragallinarum ,
Actinocorallia glomerata
"
,
Agromyces hippuratus
Anaerorhabdus furcosa
Acidaminococcus intestini
Avibacterium volantium
Actinocorallia herbida
Agromyces luteolus
Actinocorallia libanotica
Anaerosinus
Acidicaldus Agromyces mediolanus
Azoarcus
Actinocorallia longicatena
Anaerosinus glycerini
Acidicaldus organivorans Agromyces ramosus Azoarcus indigens
Actinomadura
Agromyces rhizospherae
Azoarcus tolulyticus
Acidimicrobium
1-d
Anaerovirgula
n
Actinomadura alba
Azoarcus toluvorans
ula multivorans
t=1
Acidimicrobium ferrooxidans Akkermansia
Anaerovirg 1-d
t..)
Actinomadura atramentaria
o
Akkermansia muciniphila
t..)
o
Actinomadura
- 4
u ,
w
bangladeshensis
0
Acidiphilium Albidiferax
Ancalomicrobium Azohydromonas t..)
o
Actinomadura catellatispora
r..)
1-,
Acidiphilium acidophilum Albidiferax ferrireducens
Ancalomicrobium ade turn Azohydromonas austral
Actinomadura chibensis
--.1
Acidiphilium angustum
Azohydromonas lata --.1
Actinomadura chokoriensis
t..)
Acidiphilium cuptum Albidovulum
Ancylobacter
Actinomadura citrea
Acidiphilium multivorum Albidovulum inexpectatum
Ancylobacter aquaticus Azomonas
Actinomadura coerulea
Acidiphilium organovorum
Azomonas agilis
Actinomadura echinospora Alcaligenes
Aneurinibacillus Azomonas insignis
Acidiphilium rubrum
Actinomadura fibrosa Alcaligenes denitrificans
Aneurinibacillus Azomonas macrocyto genes
Actinomadura formosensis Alcaligenes faecalis
aneurinilyticus
Acidisoma
P
Actinomadura hibisca
Aneurinibacillus migulanus Azorhizobium 2
Acidisoma sibiricum
..'-'
vi Acidisoma tundrae Actinomadura kijaniata Alcanivorax
neur um cau Aneurinibacillus Azorhizobilinodans
vi
LI
r.,
Actinomadura latina Alcanivorax borkumensis
0
thermoaerophilus
r.,"
,
Acidisphaera Actinomadura livida Alcanivorax jadensis
Azorhizophilus '7
N)
,
Acidisphaera rubrifaciens Actinomadura
Angiococcus Azorhizophilus paspali
luteofluorescens Algicola
Angiococcus disciformis
A
Acidithiobacillus Actinomadura macra lgicola bacteriolytica
Azospirillum
Acidithiobacillus albertensis Actinomadura madurae
Angulomicrobium Azospirillum brasilense
Alicyclobacillus
Acidithiobacillus caldus Actinomadura oligospora
Angulomicrobium tetraedrale Azospirillum halopraeferens
Iv
Alicyclobacillus
n
Acidithiobacillus ferrooxidans Actinomadura pelletieri
Azospirillum irakense
disulfidooxidans
Anoxybacillus t=1
1-d
Acidithiobacillus thiooxidans Actinomadura rubrobrunea
r..)
Alicyclobacillus
Anoxybacillus pushchinoensis Azotobacter o
t..)
o
Actinomadura rugatobispora
Azotobacter beijerinckii
--.1
vi
1-,
t..)
Actinomadura umbrina sendaiensis
Azotobacter chroococcum 0
Acidobacterium
Aquabacterium t..)
o
Actinomadura Alicyclobacillus
vulcanalis Azotobacter nigricans t..)
1-,
Acidobacterium capsulatum
Aquabacterium commune 'a
verrucosospora
Azotobacter salinestris c,.)
--.1
Alishewanella
Aquabacterium parvum --.1
Actinomadura vinacea
Azotobacter vinelandii t..)
Alishewanella fetalis
Actinomadura viridilutea
Actinomadura viridis
Alkalibacillus
Actinomadura yumaensis
Alkalibacillus
haloalkaliphilus
P
.
,
Bacillus Bacteroides Bibersteinia
Borrelia Brevinema .3
u,
o,
LI
[see below] Bacteroides caccae Bibersteinia trehalosi
Borrelia afzelii Brevinema andersonii ''
N)
N)
,
.
Bacteroides coagulans
Borrelia americana ,
N)
Bifidobacterium
Brevundimonas ,
Bacteroides eggerthii
Borrelia burgdorferi
Bifidobacterium ado lescentis
Brevundimonas alba
Bacteroides fragilis
Borrelia carolinensis
Bacteriovorax
Bifidobacterium angulatum
Brevundimonas aurantiaca
Bacteroides galacturonicus
Borrelia coriaceae
Bacteriovorax stolpii
Bifidobacterium animalis
Brevundimonas diminuta
Bacteroides helco genes
Borrelia garinii
Bacteroides ovatus
Bifidobacterium asteroides
Borrelia japonica Brevundimonas intermedia
Iv
Bacteroides pectinop Bifidobacterium bifidum
Brevundimonas subvibrio ides
n
hilus
1-i
t=1
Bifidobacterium boum
Bosea Brevundimonas vancanneytii Iv
Bacteroides pyo genes
t..)
o
Bifidobacterium breve
Bosea minatitlanensis Brevundimonas variabilis t..)
Bacteroides salyersiae
o
'a
Bifidobacterium catenulatum Bosea thiooxidans
Brevundimonas vesicularis --.1
vi
1-,
t..)
Bacteroides stercoris Bifidobacterium choerinum
0
t..)
o
Bacteroides suis Bifidobacterium cou
Brachybacterium Brochothrix
neforme
t..)
1-,
Brachybacterium
Brochothrix campestris 'a
Bacteroides tectus Bifidobacterium cuniculi
--.1
alimentarium
Brochothrix the rmosphacta --.1
Bacteroides thetaiotaomicron Bifidobacterium dentium
t..)
Bacteroides uniformis Bifidobacterium gallicum
Brachybacterium faecium
Brucella
Bacteroides ureolyticus Bifidobacterium gallinarum
Brachybacterium
BruceIla canis
Bacteroides vulgatus Bifidobacterium indicum
paraconglomeratum
BruceIla neotomae
Bifidobacterium ion gum
Brachybacterium rhamnosum
Balnearium
Brachybacterium
Bifidobacterium
Bryobacter
P
Balnearium lithotrophicum
tyrofermentans
magnumBifidobacterium
o
Biyobacter aggregatus
,-,
.3
vi melycicum
--.1 Balneatrix
Brachyspira LI
Bifidobacterium minimum
Burkholderia 10;
N)
Balneatrix alpica
Brachyspira alvinipulli "
,
Bifidobacterium
Burkholderia ambifaria ,D
,-,
Brachyspira hyodysenteriae
,:,
,-,
Balneola pseudocatenulatum
Burkholderia andropogonis
Brachyspira innocens
Balneola vulgaris Bifidobacterium
Burkholderia anthina
Brachyspira murdochii
pseudolongum Burkholderia caledonica
Brachyspira pilosicoli
Barnesiella Bifidobacterium pullorum
Burkholderia caiyophylli
Bamesiella viscericola Bifidobacterium ruminantium
Burkholderia cenocepacia Iv
n
Bifidobacterium saeculare
Burkholderia cepacia
t=1
Bartonella
1-d
Bifidobacterium subtile
Bradyrhizobium Burkholderia cocovenenans t..)
o
Bartonella alsatica
t..)
Bradyrhizobium canariense Burkholderia dolosa
o
'a
Bartonella bacilliformis
--.1
vi
1-,
t..)
Bartonella clarridgeiae Bifidobacterium
Bradyrhizobium elkanii Burkholderia fungorum o
t..)
Bartonella doshiae the rmophilum
Bradyrhizobium japonicum Burkholderia glathei o
t...)
1-,
'a
Bartonella elizabethae
Bradyrhizobium liaoningense Burkholderia glumae c,.)
--.1
hila
--.1
Bartonella grahamii Bilop
Burkholderia graminis t..)
Bilophila wadsworthia
Brenneria
Bartonella henselae
Burkholderia kururiensis
Brenneria alni
Bartonella rochalimae
Burkholderia multivorans
Biostraticola
Brenneria nigrifluens
Bartonella vinsonii
Burkholderia phenazinium
Biostraticola tofi
Brenneria quercina
Burkholderia plantarii
Bavariicoccus
Brenneria quercina
Bizionia
Burkholderia pyrrocinia
P
Bavariicoccus seileri
Brenneria salicis
Burkholderia silvatlantica
o
Bizionia argentinensis
,-,
.3
vi
Burkholderia stabilis
oe Bdellovibrio
Brevibacillus LI
"
Blastobacter
Burkholderia thailandensis 2'
Bdellovibrio bacteriovorus
Brevibacillus agri N)
,
,D
Blastobacter capsulatus
Burkholderia tropica
Bdellovibrio exovorus
Brevibacillus borstelensis ,:,
,-,
Blastobacter denitrificans Burkholderia unamae
Brevibacillus brevis
Beggiatoa
Burkholderia vietnamiensis
Brevibacillus centrosporus
Blastococcus
Beggiatoa alba
Brevibacillus choshinensis
Blastococcus aggregatus
Buttiauxella
Brevibacillus invocatus
Blastococcus saxobsidens
Buttiauxella agrestis
Beijerinckia
1-d
Brevibacillus laterosporus
n
utt Biauxella brennerae
Beijerinckia derxii
1-i
Blastochloris
Brevibacillus parabrevis t=1
utt Biauxella ferragutiae
Iv
Beijerinckia fluminensis
t..)
Blastochloris viridis
Brevibacillus reuszeri o
t..)
Buttiauxella gaviniae
o
'a
--.1
vi
1-,
t..)
Beijerinckia indica
Buttiauxella izardii 0
Blastomonas
Brevibacterium t..)
o
Beijerinckia mobilis
Buttiauxella noackiae t..)
1-,
Blastomonas natatoria
Brevibacterium abidum 'a
Buttiauxella warmboldiae
c,.)
--.1
Belliella
Brevibacterium album --.1
t..)
irellula
Belliella baltica Blastop
Brevibacterium aurantiacum Butyrivibrio
Blastopirellula marina
Brevibacterium celere
Butyrivibrio fibrisolvens
Bellilinea
Brevibacterium epidermidis Butyrivibrio hungatei
Blautia
Bellilinea caldifistulae
Brevibacterium
Butyrivibrio proteoclasticus
Blautia coccoides
frigoritolerans
Belnapia Blautia hansenii
P
Brevibacterium halotolerans
.
Belnapia moabensis Blautia producta
,
Brevibacterium iodinum
.3
vi Blautia wexlerae
LI
Brevibacterium linens
Bergeriella
2'
N)
Brevibacterium lyticum
,
Bergeriella denitrificans Bogoriella
,
N)
Brevibacterium mcbrellneri
,
Bogoriella caseilytica
Beutenbergia
Brevibacterium otitidis
Beutenbergia cavemae Bordetella
Brevibacterium oxydans
Bordetella avium
Brevibacterium paucivorans
Bordetella bronchiseptica
Brevibacterium stationis
Iv
Bordetella hinzii
n
,-i
m
Bordetella holmesii
Iv
t..)
o
Bordetella parapertussis
t..)
o
'a
Bordetella pertussis
--.1
vi
1-,
t..)
Bordetella petrii
0
t..)
o
Bordetella trematum
t..)
1-,
'a
--.1
--.1
t..)
Bacillus
B. acidiceler B. aminovorans B. glucanolyticus
B. taeanensis B. lautus
B. acidicola B. amylolyticus B. gordonae
B. tequilensis B. lehensis
B. acidiproducens B. andreesenii B. gottheilii
B. the rmantarcticus B. lentimorbus
B. acidocaldarius B. aneurinilyticus B. graminis
B. thermoaerophilus B. lentus
P
B. acidoterrestris B. anthracis B. halmapalus
B. the rmoamylovorans B. licheniformis
,
.3
cA B. aeolius B. aquimaris B. haloalkaliphilus
B. the rmocatenulatus B. ligniniphilus LI
o
r.,
B. aerius B. arenosi B. halochares
B. the rmocloacae B. litoralis 2
r.,
,
,
B. aerophilus B. arseniciselenatis B. halodenitrificans
B. the rmocopriae B. locisalis ,
r.,
,
B. agaradhaerens B. arsenicus B. halodurans
B. thermodenitrificans B. luciferensis
B. agri B. aurantiacus B. halophilus
B. the rmoglucosidasius B. luteolus
B. aidingensis B. arvi B. halosaccharovorans
B. the rmolactis B. luteus
B. akibai B. aryabhattai B.
hemicellulosilyticus B. the rmoleovorans B. macauensis
B. alcalophilus B. asahii B. hemicentroti
B. thermophilus B. macerans Iv
n
,-i
B. algicola B. atrophaeus B. herbersteinensis
B. the rmoruber B. macquariensis t=1
Iv
B. alginolyticus B. axarquiensis B. horikoshii
B. thermosphaericus B. macyae t..)
o
t..)
o
B. alkalidiazotrophicus B. azotofixans B. homeckiae
B. thiaminolyticus B. malacitensis 'a
--.1
un
1-,
t..)
B. alkalinitrilicus B. azotoformans B. horti
B. thioparans B. mannanilyticus o
t..)
B. alkalisediminis B. badius B. huizhouensis
B. thuringiensis B. marisflavi o
t..)
1-,
'a
B. alkalitelluris B. barbaricus B. humi
B. tianshenii B. marismortui c,.)
--.1
--.1
B. altitudinis B. bataviensis B. hwajinpoensis
B. tupoxylicola B. marmarensis c,.)
t..)
B. alveayuensis B. beijingensis B. idriensis
B. tusciae B. massiliensis
B. alvei B. benzoevorans B. indicus
B. validus B. megaterium
B. amyloliquefaciens B. beringensis B. infantis
B. vallismortis B. mesonae
B. berkeleyi B. infemus
B. vedderi B. methanolicus
= B.
B. beveridgei B. insolitus
B. velezensis B. methylotrophicus
P
a. subsp. amyloliquefaciens B. bogoriensis B. invictae
B. vietnamensis B. migulanus .
,
..
=
B. a. subsp. plantarum .3
cA B. boroniphilus B. iranensis
B. vireti B. mojavensis
1-,
LI
N)
B. borstelensis B. isabeliae
B. vulcani B. mucilaginosus 2'
N)
,
.
B. brevis Migula B. isronensis
B. wakoensis B. muralis ,
B. dipsosauri
r:,
,
B. butanolivorans B. jeotgali
B. weihenstephanensis B. murimartini
B. drentensis
B. canaveralius B. kaustophilus
B. xiamenensis B. myco ides
B. edaphicus
B. carboniphilus B. kobensis
B. xiaoxiensis B. naganoensis
B. ehimensis
B. cecembensis B. kochii
B. zhanjiangensis B. nanhaiensis
B. eiseniae
B. cellulosilyticus B. kokeshiiformis
B. nanhaiisediminis Iv
B. enclensis
n
B. peoriae
B. centrosporus B. koreensis
B. nealsonii
B. endophyticus
t=1
B. persepolensis
Iv
B. cereus B. korlensis
B. neidei r..)
o
B. endoradicis
t..)
B. chagannorensis B. kribbensis
B. persicus B. neizhouensis o
'a
B. farraginis
--.1
un
1-,
t..)
B. fastidiosus B. chitinolyticus B. krulwichiae
B. pervagus B. niabensis 0
r..)
B. fengqiuensis B. chondroitinus B. laevolacticus
B. plakortidis B. niacini o
t..)
1-,
'a
B. firmus B. choshinensis B. larvae
B. pocheonensis B. novalis c,.)
--.1
--.1
B. flexus B. chungangensis B. laterosporus
B. polygoni B. oceanisediminis c,.)
t..)
B. foraminis B. cibi B. salexigens
B. polymyxa B. odysseyi
B. fordii B. circulans B. saliphilus
B. popilliae B. okhensis
B. formosus B. clarkii B. schlegelii
B. pseudalcalophilus B. okuhidensis
B. fortis B. clausii B. sediminis
B. pseudofirmus B. oleronius
B. fumarioli B. coagulans B. selenatarsenatis
B. pseudomycoides B. olyzaecorticis
P
B. funiculus B. coahuilensis B. selenitireducens
B. psychrodurans B. oshimensis .
,
..
cA B. fusiformis B. cohnii B. seohaeanensis
B. psychrophilus B. pabuli .3
r.,
B. galactophilus B. composti B. shacheensis
B. psychrosaccharolyticus B. pakistanensis 2
r.,
,
B. galactosidilyticus B. curdlanolyticus B. shackletonii
B. psychrotolerans B. pallidus .
,
,
B. galliciensis B. cycloheptanicus B. siamensis
B. pulvifaciens B. pallidus
B. gelatini B. cytotoxicus B. silvestris
B. pumilus B. panacisoli
B. gibsonii B. daliensis B. simplex
B. purgationiresistens B. panaciterrae
B. ginsengi B. decisifrondis B. siralis
B. pycnus B. pantothenticus
B. ginsengihumi B. decolorationis B. smithii
B. qingdaonensis B. parabrevis Iv
n
B. ginsengisoli B. deserti B. soli
B. qingshengii B. paraflexus
t=1
Iv
B. globisporus (eg, B. B. solimangrovi
B. reuszeri B. pasteurii t..)
o
t..)
B. solisalsi
B. rhizosphaerae o
'a
--.1
un
1-,
t..)
g. subsp. Globisporus; or B. B. songklensis
B. rigui B. patagoniensis 0
t..)
g. subsp. Marinus) B. sonorensis
B. runs o
t..)
1-,
B. sphaericus
B. safensis c,.)
--.1
--.1
B. sporothennodurans
B. salarius c,.)
r..)
B. stearothermophilus
B. stratosphericus
B. subterraneus
B. subtilis (eg, B.
s. subsp. Inaquosorum; or B.
P
s. subsp. Spizizeni; or B.
2
..'-'
cA s. subsp. Subtilis)
N)
N)
Caenimonas Campylobacter Cardiobacterium
Catenuloplanes Curtobacterium r.,
,
Caenimonas koreensis Camp ylobacter coli Cardiobacterium
hominis Catenuloplanes atrovinosus Curtobacterium r:,
,
Camp ylobacter concisus
Catenuloplanes castaneus albidum
Caldalkalibacillus Carnimonas
Camp ylobacter curvus
Catenuloplanes crisp us Curtobacterium citreus
Caldalkalibacillus uzonensis Camimonas nigrificans
Camp ylobacter fetus
Catenuloplanes indicus
Camp ylobacter gracilis
Catenuloplanes japonicus
Caldanaerobacter Carnobacterium
Iv
Camp ylobacter helveticus
Catenuloplanes nepalensis n
Caldanaerobacter subterraneus Camobacterium
Camp ylobacter hominis
Catenuloplanes niger t=1
alterfitnditum
Iv
t..)
Campylobacter hyointestinalis
o
Caldanaerobius
t..)
Camobacterium divergens
=
Camp ylobacter jejuni
--.1
Caldanaerobius fijiensis
vi
1-,
t..)
Caldanaerobius Camp ylobacter lari Camobacterium
funditum 0
Chryseobacterium
t..)
o
polysaccharolyticus Camp ylobacter mucosalis Camobacterium
gallinarum t..)
1-,
erium
m
Chuseobact
Caldanaerobius zeae Camp ylobacter rectus Ca obacterium
--.1
balustinum
--.1
Camp ylobacter showae maltaromaticum
t..)
Caldanaerovirga
Camp ylobacter sputo rum Camobacterium mobile
Caldanaerovirga acetigignens
Citrobacter
Campylobacter upsaliensis Camobacterium
viridans
C. amalonaticus
Caldicellulosiruptor
C. braakii
Capnocytophaga Caryophanon
Caldicellulosiruptor bescii
C. diversus
Capnocytophaga canimorsus Cauophanon latum
Caldicellulosiruptor kristjanssonii
C. farmeri p
Capnocytophaga cynodegmi Cauophanon tenue
2
Caldicellulosiruptor owensensis C. freundii
Capnocytophaga gingivalis
cA
.6. Catellatospora
C. gillenii LI
Capnocytophaga granulosa
r.,
N,0
Catellatospora citrea
C. koseri "
'
Capnocytophaga haemolytica
,9
Catellatospora
C. murliniae r:,
,
Capnocytophaga ochracea
methionotrophica
C. pasteurii"1
Capnocytophaga sputigena
C. rodentium
Catenococcus
C. sedlakii
Catenococcus thiocycli
C. werkmanii
Iv
C. youngae
n
m
, - o
Clostridium
t..)
o
t..)
o
(see below)
- 4
u ,
w
C
Coccochloris
t..)
o
t..)
,-,
Coccochloris elabens
-a 5
- 4
- 4
t..)
Corynebacterium
Counebacterium flavescens
Counebacterium variabile
Clostridium
Clostridium absonum, Clostridium aceticum, Clostridium ace tireducens,
Clostridium ace tobutylicum, Clostridium acidisoli, Clostridium aciditolerans,
P
Clostridium acidurici, Clostridium aerotolerans, Clostridium aestuarii,
Clostridium akagii, Clostridium aldenense, Clostridium aldrichii, Clostridium
2
..'-'
algidicami, Clostridium algidixylanolyticum, Clostridium algifaecis,
Clostridium algoriphilum, Clostridium alkalicellulosi, Clostridium
aminophilum, 2
cA
vi
LI
Clostridium aminovalericum, Clostridium amygdalinum, Clostridium amylolyticum,
Clostridium arbusti, Clostridium arcticum, Clostridium argentinense,
2
r.,
,
Clostridium asparagiforme, Clostridium aurantibutyricum, Clostridium
autoethanogenum, Clostridium baratii, Clostridium barkeri, Clostridium
bartlettii, ,2
,
Clostridium beijerinckii, Clostridium bifermentans, Clostridium bolteae,
Clostridium bomimense, Clostridium botulinum, Clostridium bowmanii,
Clostridium
biyantii, Clostridium butyricum, Clostridium cadaveris, Clostridium caenicola,
Clostridium caminithermale, Clostridium carboxidivorans, Clostridium camis,
Clostridium cavendishii, Clostridium celatum, Clostridium celerecrescens,
Clostridium cellobioparum, Clostridium cellulofermentans, Clostridium
cellulolyticum, Clostridium cellulosi, Clostridium cellulovorans, Clostridium
chartatabidum, Clostridium chauvoei, Clostridium chromiireducens, Clostridium
citroniae, Clostridium clariflavum, Clostridium clostridioforme, Clostridium
cocco ides, Clostridium cochlearium, Clostridium colletant, Clostridium
colicanis,
Iv
n
Clostridium colinum, Clostridium collagenovorans, Clostridium cylindrosporum,
Clostridium difficile, Clostridium diolis, Clostridium disporicum,
t=1
Clostridium drakei, Clostridium durum, Clostridium estertheticum, Clostridium
estertheticum estertheticum, Clostridium estertheticum laramiense, Iv
t..)
o
t..)
Clostridium fallax, Clostridium felsineum, Clostridium fervidum, Clostridium
fimetarium, Clostridium formicaceticum, Clostridium frigidicamis, Clostridium
=
-a 5
- 4
u ,
w
frigoris, Clostridium ganghwense, Clostridium gasigenes, Clostridium ghonii,
Clostridium glycolicum, Clostridium glycyrrhizinilyticum, Clostridium grantii,
0
t..)
Clostridium haemolyticum, Clostridium halophilum, Clostridium hastiforme,
Clostridium hathewayi, Clostridium herbivorans, Clostridium hiranonis, o
t..)
1-,
-a-,
Clostridium histolyticum, Clostridium homopropionicum, Clostridium huakuii,
Clostridium hungatei, Clostridium hydrogeniformans, Clostridium c,.)
--.1
--.1
hydroxybenzoicum, Clostridium hylemonae, Clostridium jejuense, Clostridium
indolis, Clostridium innocuum, Clostridium intestinale, Clostridium
irregulare, 'tt
Clostridium isatidis, Clostridium josui, Clostridium kluyveri, Clostridium
lactatifermentans, Clostridium lacusfryxellense, Clostridium laramiense,
Clostridium
lavalense, Clostridium lentocellum, Clostridium lentoputrescens, Clostridium
leptum, Clostridium limosum, Clostridium litorale, Clostridium lituseburense,
Clostridium ljungdahlii, Clostridium lortetii, Clostridium lundense,
Clostridium magnum, Clostridium malenominatum, Clostridium mangenotii,
Clostridium
mayombei, Clostridium methoxybenzovorans, Clostridium methylpentosum,
Clostridium neopropionicum, Clostridium nexile, Clostridium nitrophenolicum,
Clostridium novyi, Clostridium oceanicum, Clostridium orbiscindens,
Clostridium oroticum, Clostridium oxalicum, Clostridium papyrosolvens,
Clostridium
P
paradoxum, Clostridium paraperfringens (Alias: C. welchii), Clostridium
paraputrificum, Clostridium pascui, Clostridium pasteurianum, Clostridium 2
..'-'
cA peptidivorans, Clostridium perenne, Clostridium perfringens, Clostridium
pfennigii, Clostridium phytofermentans, Clostridium piliforme, Clostridium
2
cA
LI
r.,
polysaccharolyticum, Clostridium populeti, Clostridium propionicum,
Clostridium proteoclasticum, Clostridium proteolyticum, Clostridium
psychrophilum, 2
r.,
Clostridium puniceum, Clostridium purinilyticum, Clostridium putrefaciens,
Clostridium putrificum, Clostridium quercicolum, Clostridium quinii,
Clostridium ,
,
ramosum, Clostridium rectum, Clostridium roseum, Clostridium
saccharobutylicum, Clostridium saccharogumia, Clostridium saccharolyticum,
Clostridium
saccharoperbutylacetonicum, Clostridium sardiniense, Clostridium sartagoforme,
Clostridium scatolo genes, Clostridium schirmacherense, Clostridium
scindens, Clostridium septicum, Clostridium sordellii, Clostridium sphenoides,
Clostridium spiroforme, Clostridium sporo genes, Clostridium
sporosphaeroides, Clostridium stercorarium, Clostridium stercorarium
leptospartum, Clostridium stercorarium stercorarium, Clostridium stercorarium
the rmolacticum, Clostridium sticklandii, Clostridium straminisolvens,
Clostridium subterminale, Clostridium sufflavum, Clostridium sulfidigenes,
Clostridium .0
n
symbiosum, Clostridium tagluense, Clostridium tepidiprofundi, Clostridium
termitidis, Clostridium tertium, Clostridium tetani, Clostridium tetanomorp
hum,
t=1
Iv
Clostridium thermaceticum, Clostridium thermautotrophicum, Clostridium
thermoalcaliphilum, Clostridium thermobutyricum, Clostridium the rmocellum,
t...)
o
t..)
Clostridium thermocopriae, Clostridium the rmohydrosulfuricum, Clostridium
thennolacticum, Clostridium the rmopalmarium, Clostridium o
-a-,
-4
u,
w
thermopapyrolyticum, Clostridium the rmosaccharolyticum, Clostridium
thermosuccinogenes, Clostridium thermosulfurigenes, Clostridium 0
t..)
thiosulfatireducens, Clostridium tyrobutyricum, Clostridium uliginosum,
Clostridium ultunense, Clostridium villosum, Clostridium vincentii,
Clostridium o
t..)
1-,
'a
viride, Clostridium xylanolyticum, Clostridium xylanovorans
c,.)
--.1
--.1
t..)
Dactylosporangium Deinococcus Delftia
Echinicola
Dactylosporangium aurantiacum Deinococcus aerius Delftia acidovorans
Echinicola pacifica
Dactylosporangium fulvum Deinococcus apachensis Desulfovibrio
Echinicola vietnamensis
Dactylosporangium matsuzakiense Deinococcus aquaticus Desulfovibrio
desulfuricans
Dactylosporangium roseum Deinococcus aquatilis Diplococcus
Dactylosporangium thailandense Deinococcus caeni Diplococcus
pneumoniae P
Dactylosporangium vinaceum Deinococcus radiodurans
,
..
.3
cA
--.1 Deinococcus radiophilus
LI
r.,
2
r.,
,
Enterobacter Enterobacter kobei Faecalibacterium
Flavobacterium .
,
,
E. aero genes E. ludwigii Faecalibacterium
prausnitzii Flavobacterium antarcticum
E. amnigenus E. mori Fangia
Flavobacterium aquatile
E. agglomerans E. nimipressuralis Fangia hongkongensis
Flavobacterium
E. arachidis E. olyzae Fastidiosipila
aquidurense
E. asburiae E. pulveris Fastidiosipila
sanguinis Flavobacterium balustinum
Iv
n
E. cancerogenous E. pyrinus Fusobacterium
Flavobacterium croceum
t=1
E. cloacae E. radicincitans Fusobacterium
nucleatum Flavobacterium cucumis Iv
t..)
o
t..)
E. cowanii E. taylorae
Flavobacterium o
'a
--.1
vi
1-,
t..)
E. dissolvens E. turicensis
daejeonense 0
t..)
E. gergoviae E. sakazakii Enterobacter soli
Flavobacterium defluvii o
t..)
1-,
E. helveticus Enterococcus
Flavobacterium degerlachei c,.)
--.1
--.1
E. hormaechei Enterococcus durans
Flavobacterium c,.)
t..)
E. intermedius Enterococcus faecalis
denitrificans
Enterococcus faecium
Flavobacterium filum
Erwinia
Flavobacterium flevense
Erwinia hapontici
Flavobacterium frigidarium
Escherichia
Flavobacterium mizutaii
P
Escherichia coli
Flavobacterium 2
..'-'
cA
okeanokoites 2
oe
LI
N)
N)
N)
,I,
,
N)
,
Gaetbulibacter Haemophilus Ideonella
Janibacter
Gaetbulibacter saemankumensis Haemophilus aegyptius Ideonella
azotifigens Janibacter anophelis
Gallibacterium Haemophilus aphrophilus Idiomarina
Janibacter corallicola
Gallibacterium anatis Haemophilus felis Idiomarina abyssalis
Janibacter limosus
Gallicola Haemophilus gallinarum Idiomarina baltica
Janibacter melonis Iv
n
Gallicola bamesae Haemophilus haemolyticus Idiomarina
fontislapidosi Janibacter terrae
t=1
Iv
Garciella Haemophilus influenzae Idiomarina
loihiensis Jannaschia t..)
o
t..)
o
Garciella nitratireducens Haemophilus paracuniculus Idiomarina
ramblicola Jannaschia cystaugens
- 4
u ,
w
Geobacillus Haemophilus parahaemolyticus Idiomarina
seosinensis Jannaschia helgolandensis
0
t..)
Geobacillus the rmoglucosidasius Haemophilus parainfluenzae
Idiomarina zobellii Jannaschia pohangensis o
t..)
1-,
Geobacillus stearothermophilus Haemophilus Ignatzschineria
Jannaschia rubra c,.)
--.1
--.1
Geobacter paraphrohaemolyticus Ignatzschineria
larvae c,.)
t..)
Geobacter bemidjiensis Haemophilus parasuis
Janthinobacterium
Geobacter bremensis Haemophilus pittmaniae Ignavigranum
Janthinobacterium
Geobacter chapellei Hafnia Ignavigranum ruoffiae
agaricidamnosum
Geobacter grbiciae Hafnia alvei Ilumatobacter
Janthinobacterium lividum
Geobacter hydrogenophilus Hahella Ilumatobacter
fluminis Jejuia
P
Geobacter lovleyi Hahella ganghwensis Ilyobacter
Jejuia pallidilutea 2
..'-'
cA Geobacter metallireducens Halalkalibacillus Ilyobacter
delafieldii Jeotgalibacillus
LI
Geobacter pelophilus Halalkalibacillus halophilus
Ilyobacter insuetus Jeotgalibacillus
2
r.,
,
Geobacter pickeringii Helicobacter Ilyobacter polytropus
alimentarius ,2
,
Geobacter sulfurreducens Helicobacter pylori Ilyobacter tartaricus
Jeotgalicoccus
Geodermatophilus
Jeotgalicoccus halotolerans
Geodermatophilus obscurus
Gluconacetobacter
Gluconacetobacter xylinus
Iv
n
Gordonia
m
1-d
Gordonia rubripertincta
t..)
o
t..)
o
- 4
u ,
w
Kaistia Labedella Listeria ivanovii
Micrococcus Nesterenkonia 0
t..)
Kaistia adipata Labedella gwakjiensis L. marthii
Micrococcus luteus Nesterenkonia holobia o
t..)
1-,
'a
Kaistia soli Labrenzia L. monocyto genes
Micrococcus lylae Nocardia c,.)
--.1
--.1
Kangiella Labrenzia aggregata L. newyorkensis
Moraxella Nocardia argentinensis c,.)
t..)
Kangiella aquimarina Labrenzia alba L. riparia
Moraxella bovis Nocardia corallina
Kangiella koreensis Labrenzia alexandrii L. rocourtiae
Moraxella nonliquefaciens Nocardia
Labrenzia marina L. seeligeri
Moraxella osloensis otitidiscaviarum
Kerstersia Labrys L. weihenstephanensis
Nakamurella
Kerstersia gyiorum Labus methylaminiphilus L. welshimeri
Nakamurella multipartita
P
Kiloniella Labus miyagiensis Listonella
Nannocystis o
,
.3
--.1 Kiloniella laminariae Labus monachus Listonella
anguillarum Nannocystis pusilla
o LI
r.,
Klebsiella Labus okinawensis Macrococcus
Natranaerobius 2
rõ
,
K. granulomatis Labus portucalensis Macrococcus bovicus
Natranaerobius ,
,
K. oxytoca Marinobacter
the rmophilus
K. pneumoniae Lactobacillus Marinobacter algicola
Natranaerobius trueperi
K. terrigena [see below] Marinobacter
buozoorum Naxibacter
K. variicola Laceyella Marinobacter
flavimaris Naxibacter alkalitolerans
Kluyvera Laceyella putida Meiothermus
Neisseria 1-d
n
Kluyvera ascorbata Lechevalieria Meiothennus ruber
Neisseria cinerea
t=1
Iv
Lechevalieria aerocolonigenes
Neisseria denitrificans t..)
o
t..)
Legionella
Neisseria gonorrhoeae o
'a
--.1
vi
1-,
t..)
Kocuria [see below] Methylophilus
Neisseria lactamica 0
t..)
Kocuria roasea Listeria Methylophilus
Neisseria mucosa o
t..)
1-,
'a
Kocuria varians L. aquatica methylotrophus
Neisseria sicca c,.)
--.1
--.1
Kurthia L. booriae Microbacterium
Neisseria subflava c,.)
t..)
Kurthia zopfii L. comellensis Microbacterium
Neptunomonas
L. fleischmannii ammoniaphilum
Neptunomonas japonica
L. floridensis Microbacterium
arborescens
L. grandensis Microbacterium
liquefaciens
L. grayi Microbacterium
oxydans
P
L. innocua
o
,
..
.3
--.1
r.,
2
Lactobacillus
" ,
,D
,
L. acetotolerans L. catenaformis L. mali
L. parakefiri L. sakei
,
L. acidifarinae L. ceti L. manihotivorans
L. paralimentarius L. salivarius
L. acidipiscis L. coleohominis L. mindensis
L. paraplantarum L. sanfranciscensis
L. acidophilus L. collinoides L. mucosae
L. pentosus L. satsumensis
Lactobacillus agilis L. composti L. murinus
L. perolens L. secaliphilus
L. algidus L. concavus L. nagelii
L. plantarum L. sharpeae Iv
n
,-i
L. alimentarius L. couniformis L. namurensis
L. pontis L. siliginis t=1
Iv
t..)
L. amylolyticus L. crispatus L. nantensis
L. protectus L. spicheri o
t..)
o
L. amylophilus L. crustorum L. oligofermentans
L. psittaci L. suebicus 'a
--.1
un
1-,
t..)
L. amylotrophicus L. curvatus L. oris
L. rennini L. thailandensis 0
t..)
L. amylovorus L. delbrueckii subsp. L. panis
L. reuteri L. ultunensis o
t..)
1-,
'a
L. animalis bulgaricus L. pantheris
L. rhamnosus L. vaccinostercus c,.)
--.1
--.1
L. antri L. delbrueckii subsp. L. parabrevis
L. rimae L. vaginalis c,.)
t..)
L. apodemi delbrueckii L. parabuchneri
L. rogosae L. versmoldensis
L. aviarius L. delbrueckii subsp. lactis
L. paracasei L. rossiae L. vini
L. bifermentans L. dextrinicus L. paracollinoides
L. ruminis L. vitulinus
L. brevis L. diolivorans L. parafarraginis
L. saerimneri L. zeae
L. buchneri L. equi L. homohiochii
L. jensenii L. zymae
P
L. came iliac L. equigenerosi L. iners
L. johnsonii L. gastricus o
,
..
--.1 L. casei L. farraginis L. ingluviei
L. kalixensis L. ghanensis .3
r.,
L. kitasatonis L. farciminis L. intestinalis
L. kefiranofaciens L. graminis 2
r.,
,
L. kunkeei L. fennentum L. fuchuensis
L. kefiri L. hammesii .
,
,
L. leichmannii L. fomicalis L. gallinarum
L. kimchii L. hamsteri
L. lindneri L. fructivorans L. gasseri
L. helveticus L. harbinensis
L. malefermentans L. frumenti
L. hilgardii L. hayakitensis
Iv
n
,-i
Legionella
m
1-d
t..)
Legionella adelaidensis Legionella drancourtii Candidatus
Legionella jeonii Legionella quinlivanii o
t..)
o
'a
Legionella anisa Legionella dresdenensis Legionella jordanis
Legionella rowbothamii --.1
un
1-,
t..)
Legionella beliardensis Legionella drozanskii Legionella
lansingensis Legionella rubrilucens 0
t..)
Legionella birminghamensis Legionella dumoffii Legionella
londiniensis Legionella sainthelensi o
t..)
1-,
-a 5
Legionella bozemanae Legionella euthra Legionella
longbeachae Legionella santicrucis c,.)
--.1
--.1
Legionella brunensis Legionella fairfieldensis Legionella lytica
Legionella shakespearei c,.)
t..)
Legionella busanensis Legionella fallonii Legionella
maceachemii Legionella spiritensis
Legionella cardiaca Legionella feeleii Legionella
massiliensis Legionella steelei
Legionella cherrii Legionella geestiana Legionella micdadei
Legionella steigerwaltii
Legionella cincinnatiensis Legionella genomospecies Legionella
monrovica Legionella taurinensis
Legionella clemsonensis Legionella gormanii Legionella moravica
Legionella tucsonensis
P
Legionella donaldsonii Legionella gratiana Legionella
nagasakiensis Legionella tunisiensis 2
..'-'
--.1 Legionella gresilensis Legionella nautarum
Legionella wadsworthii 2
Legionella hackeliae Legionella
norrlandica Legionella waltersii 0"
,
Legionella impletisoli Legionella
oakridgensis Legionella worsleiensis ,9
,
Legionella israelensis Legionella
parisiensis Legionella yabuuchiae
Legionella jamestowniensis Legionella
pittsburghensis
Legionella pneumophila
Legionella quateirensis
Iv
n
Oceanibulbus Paenibacillus Prevotella
Quadrisphaera m
1-d
t..)
Oceanibulbus indolifex Paenibacillus thiaminolyticus
Prevotella albensis Quadrisphaera granulo rum o
t..)
o
-a 5
Prevotella amnii
--.1
vi
1-,
t..)
Oceanicaulis Pantoea Prevotella bergensis
Quatrionicoccus 0
t..)
Oceanicaulis alexandrii Pantoea agglomerans Prevotella bivia
Quatrionicoccus o
t..)
1-,
Oceanicola Prevotella brevis
australiensis c,.)
--.1
--.1
Oceanicola batsensis Paracoccus Prevotella biyantii
c,.)
t..)
Oceanicola granulosus Paracoccus alcaliphilus Prevotella buccae
Quinella
Oceanicola nanhaiensis Paucimonas Prevotella buccalis
Quinella ovalis
Oceanimonas Paucimonas lemoignei Prevotella copri
Oceanimonas baumannii Pectobacterium Prevotella dentalis
Ralstonia
Oceaniserpentilla Pectobacterium aroidearum Prevotella
denticola Ralstonia eutropha
P
Oceaniserpentilla haliotis Pectobacterium atrosepticum
Prevotella disiens Ralstonia insidiosa 2
..'-'
--.1 Oceanisphaera Pectobacterium Prevotella histicola
Ralstonia mannitolilytica 2
r.,
Oceanisphaera don ghaensis betavasculorum Prevotella intermedia
Ralstonia pickettii 2
r.,
,
Oceanisphaera litoralis Pectobacterium cacticida Prevotella
maculosa Ralstonia ,2
,
Oceanithermus Pectobacterium camegieana Prevotella
marshii pseudosolanacearum
Oceanithermus desulfurans Pectobacterium carotovorum
Prevotella melaninogenica Ralstonia syzygii
Oceanithermus profundus Pectobacterium chusanthemi Prevotella micans
Ralstonia solanacearum
Oceanobacillus Pectobacterium cypripedii Prevotella
multiformis Ramlibacter
Oceanobacillus caeni Pectobacterium rhapontici Prevotella
nigrescens Ramlibacter henchirensis
Iv
n
Oceanospirillum Pectobacterium wasabiae Prevotella oralis
Ramlibacter tataouinensis
t=1
Iv
Oceanospirillum linum Planococcus Prevotella oris
t..)
o
t..)
Planococcus citreus Prevotella oulorum
o
- 4
u ,
w
Planomicrobium Prevotella pallens
Raoultella 0
t..)
Planomicrobium okeanokoites Prevotella salivae
Raoultella omithinolytica o
t..)
1-,
'a
Plesiomonas Prevotella stercorea
Raoultella planticola c,.)
--.1
--.1
Plesiomonas shigelloides Prevotella tannerae
Raoultella terrigena c,.)
t..)
Proteus Prevotella timonensis
Rathayibacter
Proteus vulgaris Prevotella veroralis
Rathayibacter caricis
Providencia
Rathayibacter festucae
Providencia stuartii
Rathayibacter iranicus
Pseudomonas
Rathayibacter rathayi
P
Pseudomonas aeruginosa
Rathayibacter toxic us o
,
.3
--.1 Pseudomonas
alcaligenes Rathayibacter tritici
vi
LI
r.,
Pseudomonas anguillispetica Rhodobacter
2
rõ
,
Pseudomonas fluorescens
Rhodobacter sphaeroides ,
,
Pseudoalteromonas
Ruegeria
haloplanktis
Rue geria gelatinovorans
Pseudomonas mendocina
Pseudomonas
pseudoalcaligenes
Iv
n
Pseudomonas putida
t=1
Iv
Pseudomonas tutzeri
t..)
o
t..)
o
Pseudomonas syringae
'a
--.1
vi
1-,
t..)
Psychrobacter
0
t..)
Psychrobacter faecalis
o
t..)
1-,
Psychrobacter
c,.)
--.1
--.1
phenylpyruvicus
c,.)
t..)
Saccharococcus Sagittula Sanguibacter
Stenotrophomonas Tatlockia
Saccharococcus the rmophilus Sagittula stellata Sanguibacter
keddieii Stenotrophomonas Tatlockia maceachemii
Sanguibacter suarezii
maltophilia Tatlockia micdadei
Saccharomonospora Salegentibacter
P
Streptococcus
Tenacibaculum 2
Saccharomonospora azurea Sale gentibacter sale gens
Saprospira ..'-'
Tenacibaculum
--.1
cA
LI
Saccharomonospora cyanea Sap rospira grandis
[also see below] amylolyticum " .
Salimicrobium
""
Saccharomonospora viridis
,
Tenacibaculum discolor
Salimicrobium album Sarcina
r:,
Streptomyces
,
Tenacibaculum
Saccharophagus Sarcina maxima
Streptomyces
Salinibacter
gallaicum
Saccharophagus degradans Sarcina ventriculi
achromo genes
Tenacibaculum
Salinibacter ruber
Streptomyces cesalbus
Saccharopolyspora Sebaldella
lutimaris
Salinicoccus
Streptomyces cescaepitosus
Tenacibaculum
Saccharopolyspora elythraea Sebaldella
termitidis Iv
Streptomyces cesdiastaticus
n
Salinicoccus alkaliphilus
mesophilum
Saccharopolyspora gregorii
Streptomyces cesexfoliatus
t=1
Salinicoccus hispanicus
Tenacibaculum Iv
Saccharopolyspora hirsuta
t..)
o
Streptomyces fimbriatus
t..)
Salinicoccus roseus
skagerrakense o
Saccharopolyspora hordei
Streptomyces fradiae
--.1
vi
1-,
t..)
Saccharopolyspora rectivirgula
Streptomyces fulvissimus Tepidanaerobacter 0
Salinispora Serratia
t..)
o
Saccharopolyspora spinosa
Streptomyces griseoruber Tepidanaerobacter t..)
1-,
Salinispora arenicola Serratia fonticola
Saccharopolyspora taberi
Streptomyces griseus syntrophicus c,.)
--.1
Salinispora tropica Serratia marcescens
--.1
Streptomyces lavendulae
Tepidibacter t..)
Saccharothrix
Streptomyces
Tepidibacter
Salinivibrio Sphaerotilus
Saccharothrix australiensis
phaeochromo genes
formicigenes
Salinivibrio costicola Sphaerotilus natans
Saccharothrix coeruleofusca
Streptomyces
Tepidibacter
Saccharothrix espanaensis
the rmodiastaticus
thalassicus
Salmonella Sphingobacterium
Saccharothrix longispora
Streptomyces tube rcidicus Thermus
Salmonella bongori Sphingobacterium
multivo rum
P
Saccharothrix mutabilis
cus The rmus aquatic
Salmonella enterica
2
..'-'
Saccharothrix syringae Staphylococcus
Thermus filiformis 2
--.1 Salmonella subterranea
--.1
LI
Saccharothrix tangerinus [see below]
The thermophilus ''
Salmonella typhi
r.,"
Saccharothrix texasensis
,
N)
,
Staphylococcus
S. arlettae S. microti
S. equorum
S. schleiferi
S. agnetis S. muscae
S.
S. sciuri
felis S. nepalensis S.
aureus
S. fleurettii
S. simiae
S. auricularis S. pasteuri
Iv
n
S. gallinarum
S. simulans
S. cap itis
S. petrasii
t=1
S. haemolyticus
S. stepanovicii Iv
S. caprae S. pettenkoferi
t..)
o
t..)
S. hominis
S. succinus =
S. camosus S. piscifermentans
- 4
u ,
w
S. caseolyticus S. hyicus S. pseudintennedius
S. vitulinus 0
t..)
S. chromo genes S. intermedius S. pseudolugdunensis
S. wameri o
t..)
1-,
S. cohnii S. kloosii S. pulvereri
S. xylosus 'a
--.1
--.1
S. condimenti S. leei S. rostri
c,.)
t..)
S. delphini S. lentus S. saccharolyticus
S. devriesei S. lugdunensis S. sap rophyticus
S. epidermidis S. lutrae
S. lyticans
S. massiliensis
P
Streptococcus
,
.3
--.1
oe Streptococcus agalactiae Streptococcus infantarius
Streptococcus orisratti Streptococcus the rmophilus
LI
r.,
2
Streptococcus anginosus Streptococcus iniae Streptococcus
parasanguinis Streptococcus sanguinis
,
,
Streptococcus bovis Streptococcus intermedius Streptococcus
peroris Streptococcus sobrinus
,
Streptococcus canis Streptococcus lactarius Streptococcus
pneumoniae Streptococcus suis
Streptococcus constellatus Streptococcus milleri Streptococcus
Streptococcus uberis
Streptococcus downei Streptococcus mitis pseudopneumoniae
Streptococcus vestibularis
Streptococcus dysgalactiae Streptococcus mutans Streptococcus pyo
genes Streptococcus viridans
Iv
Streptococcus equines Streptococcus oralis Streptococcus ratti
Streptococcus n
,-i
Streptococcus faecalis Streptococcus tigurinus Streptococcus
salivariu zooepidemicus t=1
Iv
t..)
Streptococcus ferus
o
t..)
o
'a
--.1
vi
1-,
t..)
C
t..)
o
t..)
,-,
'a
Uliginosibacterium Vagococcus Vibrio
Virgibacillus Xanthobacter c,.)
--.1
--.1
Vagococcus camiphilus Vibrio aero genes
Virgibacillus Xanthobacter agilis t..)
Uliginosibacterium gangwonense Vagococcus elongatus Vibrio aestuarianus
halodenitrificans Xanthobacter
Ulvibacter Vagococcus fessus Vibrio albensis
Virgibacillus aminoxidans
Ulvibacter litoralis Vagococcus fluvialis Vibrio alginolyticus
pantothenticus Xanthobacter
Umezawaea Vagococcus lutrae Vibrio campbellii
autotrophicus
Weissella
Umezawaea tan gerina Vagococcus salmoninarum Vibrio cholerae
Xanthobacter flavus
P
Weissella cibaria
.
Undibacterium Vibrio
cincinnatiensis Xanthobacter tagetidis
,
Variovorax
Weissella confusa .3
--.1 Undibacterium pigrum Vibrio
coralliilyticus Xanthobacter viscosus
LI
Variovorax boronicumulans
Weissella halotolerans
Ureaplasma Vibrio
cyclitrophicus Xanthomonas 2'
N)
,
Variovorax dokdonensis
Weissella hellenica ,
Ureaplasma urealyticum Vibrio
diazotrophicus Xanthomonas ,
N)
,
Variovorax paradoxus
Vibrio fluvialis
Weissella kandleri
albilineans
Variovorax soli
Weissella koreensis
Ureibacillus Vibrio fumissii
Xanthomonas alfalfae
Weissella minor
Ureibacillus composti Vibrio gazo genes
Xanthomonas
Veillonella
Weissella
Ureibacillus suwonensis Vibrio halioticoli arboricola
Veillonella atypica
Ureibacillus terrenus Vibrio harveyi
paramesenteroides
Xanthomonas
Iv
Veillonella caviae
n
Weissella soli
Ureibacillus the rmophilus Vibrio ichthyoenteri
axonopodis
t=1
Veillonella criceti
Weissella thailandensis Iv
Ureibacillus thermosphaericus Vibrio mediterranei
Xanthomonas t..)
o
Veillonella dispar
t..)
Weissella viridescens
=
Vibrio metschnikovii
campestris 'a
Veillonella montpellierensis
--.1
vi
1-,
t..)
Veillonella parvula Vibrio mytili
Xanthomonas citri 0
Williamsia
t..)
o
Veillonella ratti Vibrio natriegens
Xanthomonas codiaei t..)
1-,
Williamsia marianensis
'a
Veillonella rodentium Vibrio navarrensis
Xanthomonas c,.)
--.1
Williamsia mans
--.1
Vibrio nereis
cucurbitae t..)
Venenivibrio
Williamsia serinedens
Vibrio nigripulchritudo
Xanthomonas
Venenivibrio stagnispumantis
Vibrio ordalii
euvesicatoria
Winogradskyella
Vibrio orientalis Xanthomonas fragariae
Winogradskyella
Vibrio parahaemolyticus Xanthomonas fitscans
thalassocola
Verminephrobacter Vibrio pectenicida
Xanthomonas gardneri
P
Vibrio penaeicida
Xanthomonas horto rum
o
Verminephrobacter eiseniae
Wolbachia
,
.3
oe Vibrio proteolyticus
Wolbachia persica Xanthomonas hyacinthi
o LI
Vibrio shilonii
Xanthomonas perforans r.,
2'
N)
,
Vibrio splendidus
Xanthomonas phaseoli .
,
N)
Verrucomicrobium
,
Vibrio tubiashii
Xanthomonas pisi
Verrucomicrobium spinosum
Wolinella
Vibrio vulnificus Xanthomonas populi
Wolinella succino genes
Xanthomonas theicola
Xanthomonas
translucens
Iv
n
Zobellia
m
1-d
Zobellia galactanivorans
Xanthomonas t..)
o
t..)
Zobellia uliginosa
vesicatoria o
'a
--.1
vi
1-,
t..)
C
Zoogloea
Xylella t..)
o
t..)
Zoo gloea gloea ramigera
Xylella fastidiosa
- 4
Zoo gloea resiniphila
Xylophilus --.1
t..)
Xylophilus ampelinus
Xenophilus Yangia Yersinia mollaretii
Zooshikella Zobellella
Xenophilus azovorans Yangia pacifica Yersinia
philomiragia Zooshikella ganghwensis Zobellella denitrifi cans
Xenorhabdus Yersinia pestis
Zobellella taiwanensis
P
Yaniella
Zunongwangia
Xenorhabdus beddingii Yersinia
pseudotuberculosis 2
..'-'
Yaniella flava
Zunongwangia profunda 2
oe Xenorhabdus bovienii Yersinia rohdei
1-,
LI
Yaniella halotolerans
Xenorhabdus cabanillasii Yersinia ruckeri
2'
N)
Zymobacter
Zeaxanthinibacter ,
Xenorhabdus doucetiae
,
r.,
Yeosuana Yokenella
Zymobacter palmae Zeaxanthinibacter ,
Xenorhabdus griffiniae
Yeosuana aromativorans
enoshimensis
eiensburg
Xenorhabdus hominickii Yokenella reg
Zymomonas
Xenorhabdus koppenhoeferi Yersinia
Zymomonas mobilis Zhihengliuella
Yonghaparkia
Xenorhabdus nematophila Yersinia aldovae
Zhihengliuella
Yonghaparkia alkaliphila
Xenorhabdus poinarii
Zymophilus 1-d
Yersinia bercovieri
halotolerans n
Xylanibacter
Zymophilus paucivorans
Yersinia enterocolitica Zavarzinia
Xylanibacterium t=1
1-d
Xylanibacter olyzae
Zymophilus raffinosivorans t..)
Yersinia entomophaga Zavarzinia
compransoris Xylanibacterium ulmi 2
o
Yersinia frederiksenii
- 4
u ,
w
Yersinia intermedia
0
t..)
Yersinia kristensenii
o
t..)
1-,
'a
--4
--4
Table 3: Sequences:
hypC2 is at position 20849-21064 in the pX1.0 backbone.
Seq Sequence
Position in plasmid
Name
SEQ ID ATGCAGAATAAACCTACACCTGAAGAAGTAAAGAATGCGCGGGTTGCGGCAGGTCTTACTCTTA
20849 to 21064 P
NO: 1 AAGAAGCTGCTGATATTTTTGGTTATCAACTGAATTCCTGGCAGATGAAAGAAAGTGCAGGTAAG
0
,
hypC2 GCCAGTCGTTCTTTATCTATTGGTGAATATCAGTATTTATTGTTATTAGCAAATATGCATCCGTCTTA
..
.3
oe
.
sequen CAGGCTGGTAAAAAAATAA
u,
ce#
.
,,
,
.
,
,
SEQ ID M QN KPTP EEVK NARVAAG LTLKEAAD I FGYQLNSWQM KESAG KAS RS LS IG
EYQYLLLLAN M H PSYRLVKK ,
NO: 2
Protein
sequen
ce
SEQ ID ATGCAGAATAAACCTACACCTGAAGAAGTAAAGAATGCGCGGGTTGCGGCAGGTCTTACTCTTAAAGAAG
Complement* (41318 to 41533)
NO: 3 CTGCTGATATTTTTGGTTATCAACTGAATTCCTGGCAGATGAAAGAAAGTGCAGGTAAGGCCAGTCGTTC
1-d
n
TTTATCTATTGGTGAATATCAGTATTTATTGTTATTAGCAAATATGCATCCGTCTTACAGGCTGGTAAAA
1-3
AAATAA
t=1
1-d
SEQ ID ATGGATAAAGATAAGATAATTAAGAAAAACAGAGGTAATTACTCCTATGTAATCAGAACGATGGATGAAG
3200 to 32247 =
NO: 4 ATGGGGATACGGTTTTTCACGTCTTAAAATATGTTAAGACGATTGATAAAACTAAAAGCAGGAAAACAGT
o
'a
--4
AAGAAAATTGATAATGGACGAAAAACTCAACCTGGCATCATTGATGCTTCTGGATAATGGGGTTTTGTGT
c,.)
vi
1¨
t,.)
GATTGTCTGACAAAAGGGAATGAAAATGCAGAATAA
0
SEQ ID
ATGAAGAGTAAACCAACGCCAGAACAGGTTAAAACCGCTCGCATTGCTGCTGGTCTTTCTTTAAAAGAAGCCGC
Complement* (9946 to 10161) t,.)
o
NO: 5
TGATACTTTTGGTTATCAGTTAAATTCATGGCAAATGAAAGAAAGTGCAGGTAAAGCAAGTCGTTCTTTATCTA
1¨
'a
TTGGAGAATACGAGTATTTACTGCTGTTAGCGAATCAACATCCAGAATATAAGATAGTGAAAAAATAG
c,.)
--4
--4
SEQ ID
ATGAAGAGTAAACCAACGCCAGAACAGGTTAAAGCCGCTCGCATTGCTGCTGGCCTTTCTTTAAAAGAAGCCG
Complement (60794 to 61009) c,.)
NO: 6
CTGATACTTTTGGTTATCAGTTAAATTCATGGCAAATGAAAGAAAGTGCAGGTAAAGCAAGTCGTTCTTTATCT
ATTGGAGAATACGAGTATTTACTTCTGTTAGCGAATCAACATCCAGAATATAAGATAGTGAGAAAATAG
SEQ ID
ATGAAGAGTAAACCAACACCAGAGCAAGTTAAAGCAGCTCGCATTGCTGCTGGCCTTTCTTTGAAAGAAGCTG
38158 to 38373
NO: 7
CTGCTACTTTTGGTTATCAGCTAAATTCATGGCAGATGAAAGAAAGCGCAGGTAAAGCAAGTCGTTCTTTATCT
ATTGGAGAATACGAGTATTTACTGCTGTTAGCGAATCAACATCCAGAATACAAAATAGTAAAAAAATAG
#the transposon was inserted between the underlined A and G, thereby
inactivating function of the gene to produce hypC2 KO.
P
.
*the sequence is on the reverse strand in the source sequence (i.e. the
orientation is right to left, of the gene. ,
..
.3
oe
.
,)
.
,,
,,
,
.
,
,
,,
,
1-d
n
,-i
m
,-o
t..)
=
t..)
=
'a
-4
u,
t..)
