Note: Descriptions are shown in the official language in which they were submitted.
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
MODIFIED CELLS AND METHODS FOR THE TREATMENT OF
HEMOGLOBINOPATHIES
PRIORITY CLAIM
[0001] This application claims the benefit of U.S. Provisional Patent
Application No. 62/945,190,
filed December 8, 2019, and U.S. Provisional Patent Application No.
63/115,518, filed November 18,
2020, both of which are incorporated herein by reference in their entirety,
including drawings.
SEQUENCE LISTING
[0002] This application contains a Sequence Listing, which was submitted in
ASCII format via EFS-
Web, and is hereby incorporated by reference in its entirety. The ASCII copy,
created on December
8, 2020, is named SequenceListing.txt and is 699 KB in size.
FIELD
[0003] This disclosure relates to genome editing systems and methods for
altering a target nucleic
acid sequence, or modulating expression of a target nucleic acid sequence, and
applications thereof in
connection with the alteration of genes encoding hemoglobin subunits and/or
treatment of
hemoglobinopathies.
BACKGROUND
[0004] Hemoglobin (Hb) carries oxygen in erythrocytes or red blood cells
(RBCs) from the lungs to
tissues. During prenatal development and until shortly after birth, hemoglobin
is present in the form
of fetal hemoglobin (HbF), a tetrameric protein composed of two alpha (a)-
globin chains and two
gamma (y)-globin chains. HbF is largely replaced by adult hemoglobin (HbA), a
tetrameric protein in
which the y-globin chains of HbF are replaced with beta (13)-globin chains,
through a process known
as globin switching. The average adult makes less than 1% HbF out of total
hemoglobin (Thein
2009). The a-hemoglobin gene is located on chromosome 16, while the I3-
hemoglobin gene (HBB), A
gamma (Ay)-globin chain (HBG1, also known as gamma globin A), and G gamma (&y)-
globin chain
(HBG2, also known as gamma globin G) are located on chromosome 11 within the
globin gene cluster
(also referred to as the globin locus).
[0005] Mutations in HBB can cause hemoglobin disorders (i.e.,
hemoglobinopathies) including sickle
cell disease (SCD) and beta-thalassemia (13-Thal). Approximately 93,000 people
in the United States
are diagnosed with a hemoglobinopathy. Worldwide, 300,000 children are born
with
hemoglobinopathies every year (Angastiniotis 1998). Because these conditions
are associated with
HBB mutations, their symptoms typically do not manifest until after globin
switching from HbF to
HbA.
1
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0006] SCD is the most common inherited hematologic disease in the United
States, affecting
approximately 80,000 people (Brousseau 2010). SCD is most common in people of
African ancestry,
for whom the prevalence of SCD is 1 in 500. In Africa, the prevalence of SCD
is 15 million (Aliyu
2008). SCD is also more common in people of Indian, Saudi Arabian and
Mediterranean descent. In
those of Hispanic-American descent, the prevalence of sickle cell disease is 1
in 1,000 (Lewis 2014).
[0007] SCD is caused by a single homozygous mutation in the HBB gene, c.17A>T
(HbS mutation).
The sickle mutation is a point mutation (GAG>GTG) on HBB that results in
substitution of valine for
glutamic acid at amino acid position 6 in exon 1. The valine at position 6 of
the I3-hemoglobin chain
is hydrophobic and causes a change in conformation of the 13-globin protein
when it is not bound to
oxygen. This change of conformation causes HbS proteins to polymerize in the
absence of oxygen,
leading to deformation (i.e., sickling) of RBCs. SCD is inherited in an
autosomal recessive manner,
so that only patients with two HbS alleles have the disease. Heterozygous
subjects have sickle cell
trait, and may suffer from anemia and/or painful crises if they are severely
dehydrated or oxygen
deprived.
[0008] Sickle shaped RBCs cause multiple symptoms, including anemia, sickle
cell crises, vaso-
occlusive crises, aplastic crises, and acute chest syndrome. Sickle shaped
RBCs are less elastic than
wild-type RBCs and therefore cannot pass as easily through capillary beds and
cause occlusion and
ischemia (i.e., vaso-occlusion). Vaso-occlusive crisis occurs when sickle
cells obstruct blood flow in
the capillary bed of an organ leading to pain, ischemia, and necrosis. These
episodes typically last 5-7
days. The spleen plays a role in clearing dysfunctional RBCs, and is therefore
typically enlarged
during early childhood and subject to frequent vaso-occlusive crises. By the
end of childhood, the
spleen in SCD patients is often infarcted, which leads to autosplenectomy.
Hemolysis is a constant
feature of SCD and causes anemia. Sickle cells survive for 10-20 days in
circulation, while healthy
RBCs survive for 90-120 days. SCD subjects are transfused as necessary to
maintain adequate
hemoglobin levels. Frequent transfusions place subjects at risk for infection
with HIV, Hepatitis B,
and Hepatitis C. Subjects may also suffer from acute chest crises and infarcts
of extremities, end
organs, and the central nervous system.
[0009] Subjects with SCD have decreased life expectancies. The prognosis for
patients with SCD is
steadily improving with careful, life-long management of crises and anemia. As
of 2001, the average
life expectancy of subjects with sickle cell disease was the mid-to-late 50's.
Current treatments for
SCD involve hydration and pain management during crises, and transfusions as
needed to correct
anemia.
[0010] Thalassemias (e.g., 13-Thal, 6-Thal, and f3/-Thal) cause chronic
anemia. 13-Thal is estimated
to affect approximately 1 in 100,000 people worldwide. Its prevalence is
higher in certain
populations, including those of European descent, where its prevalence is
approximately 1 in 10,000.
2
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
13-Thal major, the more severe form of the disease, is life-threatening unless
treated with lifelong
blood transfusions and chelation therapy. In the United States, there are
approximately 3,000 subjects
with 13-Thal major. 13-Thal intermedia does not require blood transfusions,
but it may cause growth
delay and significant systemic abnormalities, and it frequently requires
lifelong chelation therapy.
Although HbA makes up the majority of hemoglobin in adult RBCs, approximately
3% of adult
hemoglobin is in the form of HbA2, an HbA variant in which the two y-globin
chains are replaced
with two delta (A)-globin chains. 6-Thal is associated with mutations in the A
hemoglobin gene
(HBD) that cause a loss of HBD expression. Co-inheritance of the HBD mutation
can mask a
diagnosis of f3-Thal (i.e., 13/6-Thal) by decreasing the level of HbA2 to the
normal range (Bouva
2006). 13/6-Thal is usually caused by deletion of the HBB and HBD sequences in
both alleles. In
homozygous (6o/6o 13o/I3o) patients, HBG is expressed, leading to production
of HbF alone.
[0011] Like SCD, 13-Thal is caused by mutations in the HBB gene. The most
common HBB
mutations leading to 13-Thal are: c.-136C>G, c.92+1G>A, c.92+6T>C, c.93-21G>A,
c.118C>T,
c.316-106C>G, c.25_26delAA, c.27_28insG, c.92+5G>C, c.118C>T, c.135delC,
c.315+1G>A, c.-
78A>G, c.52A>T, c.59A>G, c.92+5G>C, c.124_127delTTCT, c.316-197C>T, c.-78A>G,
c.52A>T,
c.124_127delTTCT, c.316-197C>T, c.-138C>T, c.-79A>G, c.92+5G>C, c.75T>A, c.316-
2A>G, and
c.316-2A>C. These and other mutations associated with f3-Thal cause mutated or
absent 13-globin
chains, which causes a disruption of the normal Hb a-hemoglobin to I3-
hemoglobin ratio. Excess a-
globin chains precipitate in erythroid precursors in the bone marrow.
[0012] In f3-Thal major, both alleles of HBB contain nonsense, frameshift, or
splicing mutations that
leads to complete absence ofI3-globin production (denotedIr/13 ). 13-Thal
major results in severe
reduction inI3-globin chains, leading to significant precipitation of a-globin
chains in RBCs and more
severe anemia.
[0013] 13-Thal intermedia results from mutations in the 5' or 3' untranslated
region of HBB,
mutations in the promoter region or polyadenylation signal of HBB, or splicing
mutations within the
HBB gene. Patient genotypes are denoted I3o/13+ or 13+/13+. I3o represents
absent expression of aI3-
globin chain; 13+ represents a dysfunctional but present 13-globin chain.
Phenotypic expression varies
among patients. Since there is some production ofI3-globin, 13-Thal intermedia
results in less
precipitation of a-globin chains in the erythroid precursors and less severe
anemia than f3-Thal major.
However, there are more significant consequences of erythroid lineage
expansion secondary to
chronic anemia.
[0014] Subjects with f3-Thal major present between the ages of 6 months and 2
years, and suffer from
failure to thrive, fevers, hepatosplenomegaly, and diarrhea. Adequate
treatment includes regular
transfusions. Therapy for 13-Thal major also includes splenectomy and
treatment with hydroxyurea.
If patients are regularly transfused, they will develop normally until the
beginning of the second
3
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
decade. At that time, they require chelation therapy (in addition to continued
transfusions) to prevent
complications of iron overload. Iron overload may manifest as growth delay or
delay of sexual
maturation. In adulthood, inadequate chelation therapy may lead to
cardiomyopathy, cardiac
arrhythmias, hepatic fibrosis and/or cirrhosis, diabetes, thyroid and
parathyroid abnormalities,
thrombosis, and osteoporosis. Frequent transfusions also put subjects at risk
for infection with HIV,
hepatitis B and hepatitis C.
[0015] I3-Thal intermedia subjects generally present between the ages of 2-6
years. They do not
generally require blood transfusions. However, bone abnormalities occur due to
chronic hypertrophy
of the erythroid lineage to compensate for chronic anemia. Subjects may have
fractures of the long
bones due to osteoporosis. Extramedullary erythropoiesis is common and leads
to enlargement of the
spleen, liver, and lymph nodes. It may also cause spinal cord compression and
neurologic problems.
Subjects also suffer from lower extremity ulcers and are at increased risk for
thrombotic events,
including stroke, pulmonary embolism, and deep vein thrombosis. Treatment of
I3-Thal intermedia
includes splenectomy, folic acid supplementation, hydroxyurea therapy, and
radiotherapy for
extramedullary masses. Chelation therapy is used in subjects who develop iron
overload.
[0016] Life expectancy is often diminished in I3-Thal patients. Subjects with
I3-Thal major who do
not receive transfusion therapy generally die in their second or third decade.
Subjects with I3-Thal
major who receive regular transfusions and adequate chelation therapy can live
into their fifth decade
and beyond. Cardiac failure secondary to iron toxicity is the leading cause of
death in I3-Thal major
subjects due to iron toxicity.
[0017] A variety of new treatments are currently in development for SCD and I3-
Thal. Delivery of an
anti-sickling HBB gene via gene therapy is currently being investigated in
clinical trials. However,
the long-term efficacy and safety of this approach is unknown. Transplantation
with hematopoietic
stem cells (HSCs) from an HLA-matched allogeneic stem cell donor has been
demonstrated to cure
SCD and I3-Thal, but this procedure involves risks including those associated
with ablation therapy,
which is required to prepare the subject for transplant, increases risk of
life-threatening opportunistic
infections, and risk of graft vs. host disease after transplantation. In
addition, matched allogeneic
donors often cannot be identified. Thus, there is a need for improved methods
of managing these and
other hemoglobinopathies.
SUMMARY
[0018] Provided herein in certain embodiments are first populations of
modified cells comprising a
plurality of modified CD34+ or hematopoietic stem cells with one or more
indels in an HBG gene
promoter. In certain of these embodiments, the plurality of modified cells
include an indel in a
CCAAT box target region.
4
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0019] In certain embodiments of the first populations of modified cells
provided herein, one or more
of the cells in the plurality of modified cells include a HBG1/2 c.-104 to -
121 deletion in a HBG1
promoter, an HBG2 promoter, or both. In certain of these embodiments, HBG1/2
c.-104 to -121
deletions make up 1% or more, 1.5% or more, 2% or more, 2.5% or more. 3% or
more, 3.5% or more,
4% or more, 4.5% or more, 5% or more, 5.5% or more, 6% or more, 6.5% or more,
7% or more, 7.5%
or more, 8% or more, 8.5% or more, 9% or more, 9.5% or more, 10% or more,
10.5% or more, 11%
or more, 11.5% or more, 12% or more, 12.5% or more, 13% or more, 13.5% or
more, 14% or more,
14.5% or more, 15% or more, or 15.5% or more of the indels in the plurality of
modified cells as a
whole. In certain of these embodiments, HBG1/2 c.-104 to -121 deletions make
up less than 25% of
the indels in the plurality of modified cells as a whole.
[0020] In certain embodiments of the first populations of modified cells
provided herein, 60% or
more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or
more, or 95% or
more of the indels in the plurality of modified cells as a whole are deletions
of at least 4 base pairs.
[0021] In certain embodiments of the first populations of modified cells
provided herein, 25% or
more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or
more, 60% or
more, or 65% or more of the indels in the plurality of modified cells as a
whole are deletions of at
least 4 base pairs introduced by a repair mechanism other than microhomology-
mediated end joining
(MMEJ) repair.
[0022] In certain embodiments of the first populations of modified cells
provided herein, 25% or
more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or
more, 60% or
more, or 65% or more of the indels in the plurality of modified cells as a
whole are deletions of at
least 4 base pairs introduced by non-homologous end joining (NHEJ) repair,
e.g., canonical NHEJ
repair.
[0023] In certain embodiments of the first populations of modified cells
provided herein, 50% or
more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or
more, 85% or
more, 90% or more, or 92% or more of the indels in the plurality of modified
cells as a whole are
deletions of 1 to 25 base pairs.
[0024] In certain embodiments of the first populations of modified cells
provided herein, 50% or
more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or
more, or 85% or
more of the indels in the plurality of modified cells as a whole are deletions
of 3 to 25 base pairs.
[0025] In certain embodiments of the first populations of modified cells
provided herein, 50% or
more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, or 80%
or more of the
indels in the plurality of modified cells as a whole are deletions of 4 to 25
base pairs.
[0026] In certain embodiments of the first populations of modified cells
provided herein, 50% or
more, 55% or more, 60% or more, 65% or more, 70% or more, or 72% or more of
the indels in the
plurality of modified cells as a whole are deletions of 5 to 25 base pairs.
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0027] In certain embodiments of the first populations of modified cells
provided herein, the
modified cells are produced by delivering a first RNP complex including a
first gRNA comprising a
first gRNA targeting domain and a Cpfl RNA-guided nuclease or a modified Cpfl
RNA-guided
nuclease to a first population of unmodified cells comprising a plurality of
unmodified CD34+ or
hematopoietic stem cells to generate indels. In certain of these embodiments,
the first RNP complex
is delivered to the first population of unmodified cells by electroporation.
In certain embodiments, the
first population of unmodified cells is from a subject having sickle cell
disease. In certain
embodiments, the first gRNA includes a 5' end and a 3' end, with a DNA
extension at the 5' end and
a 2'-0-methy1-3'-phosphorothioate modification at the 3' end. In certain of
these embodiments, the
DNA extension at the 5' end comprises a sequence set forth in any of SEQ ID
NOs:1235-1250. In
certain embodiments, the first gRNA targeting domain comprises the sequence
set forth in SEQ ID
NO:1254. In certain embodiments, the first gRNA comprises the sequence set
forth in SEQ ID
NO:1051. In certain embodiments, the modified Cpfl RNA-guided nuclease
comprises the sequence
set forth in SEQ ID NO:1097. In certain embodiments, the first population of
modified cells has
higher fetal hemoglobin (HbF) levels than the first population of unmodified
cells.
[0028] In certain embodiments of the first populations of modified cells
provided herein, one or more
of the cells in the plurality of modified cells include (a) a HBG1/2 c.-104 to
-121 deletion in a HBG1
promoter, an HBG2 promoter, or both; (b) a HBG1/2 c.-110 to -115 deletion in a
HBG1 promoter, an
HBG2 promoter, or both; (c) a HBG1/2 c.-112 to -115 deletion in a HBG1
promoter, an HBG2
promoter, or both; (d) a HBG1/2 c.-113 to -115 deletion in a HBG1 promoter, an
HBG2 promoter, or
both; (e) a HBG1/2 c.-111 to -115 deletion in a HBG1 promoter, an HBG2
promoter, or both; (f) a
HBG1/2 c.-111 to -117 deletion in a HBG1 promoter, an HBG2 promoter, or both;
(g) a HBG1/2 c.-
102 to -114 deletion in a HBG1 promoter, an HBG2 promoter, or both; (h) a
HBG1/2 c.-114 to -118
deletion in a HBG1 promoter, an HBG2 promoter, or both; (i) a HBG1/2 c.-112 to
-116 deletion in a
HBG1 promoter, an HBG2 promoter, or both; or (j) a HBG1/2 c.-113 to -117
deletion in a HBG1
promoter, an HBG2 promoter, or both.
[0029] In certain embodiments of the first populations of modified cells
provided herein, the plurality
of modified cells as a whole includes (a) a HBG1/2 c.-104 to -121 deletion in
a HBG1 promoter, an
HBG2 promoter, or both and (b) a HBG1/2 c.-110 to -115 deletion in a HBG1
promoter, an HBG2
promoter, or both. In certain embodiments, HBG1/2 c.-104 to -121 deletions
make up 1% or more,
1.5% or more, 2% or more, 2.5% or more. 3% or more, 3.5% or more, 4% or more,
4.5% or more, 5%
or more, 5.5% or more, 6% or more, 6.5% or more, 7% or more, 7.5% or more, 8%
or more, 8.5% or
more, 9% or more, 9.5% or more, 10% or more, 10.5% or more, 11% or more, 11.5%
or more, 12%
or more, 12.5% or more, 13% or more, 13.5% or more, 14% or more, 14.5% or
more, or 15% or more
of the indels in the plurality of modified cells as a whole. In certain
embodiments, HBG1/2 c.-104 to
-121 deletions make up 1% to 15.5% of the indels in the plurality of modified
cells as a whole. In
6
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
certain embodiments, HBG1/2 c.-110 to -115 deletions make up 0.5% or more, 1%
or more, 1.5% or
more, 2% or more, 2.5% or more. 3% or more, 3.5% or more, 4% or more, 4.5% or
more, 5% or
more, or 5.5% or more of the indels in the plurality of modified cells as a
whole. In certain
embodiments, HBG1/2 c.-110 to -115 deletions make up 0.5% to 6% of the indels
in the plurality of
modified cells as a whole.
[0030] In certain embodiments of the first populations of modified cells
provided herein, the plurality
of modified cells as a whole include (a) a HBG1/2 c.-104 to -121 deletion in a
HBG1 promoter, an
HBG2 promoter, or both; (b) a HBG1/2 c.-110 to -115 deletion in a HBG1
promoter, an HBG2
promoter, or both; (c) a HBG1/2 c.-112 to -115 deletion in a HBG1 promoter, an
HBG2 promoter, or
both; (d) a HBG1/2 c.-113 to -115 deletion in a HBG1 promoter, an HBG2
promoter, or both; (e) a
HBG1/2 c.-111 to -115 deletion in a HBG1 promoter, an HBG2 promoter, or both;
(f) a HBG1/2 c.-
111 to -117 deletion in a HBG1 promoter, an HBG2 promoter, or both; (g) a
HBG1/2 c.-102 to -114
deletion in a HBG1 promoter, an HBG2 promoter, or both; (h) a HBG1/2 c.-114 to
-118 deletion in a
HBG1 promoter, an HBG2 promoter, or both; (i) a HBG1/2 c.-112 to -116 deletion
in a HBG1
promoter, an HBG2 promoter, or both; and (j) a HBG1/2 c.-113 to -117 deletion
in a HBG1 promoter,
an HBG2 promoter, or both. In certain embodiments, the HBG1/2 c.-104 to -121
deletions make up
1% or more, 1.5% or more, 2% or more, 2.5% or more. 3% or more, 3.5% or more,
4% or more, 4.5%
or more, 5% or more, 5.5% or more, 6% or more, 6.5% or more, 7% or more, 7.5%
or more, 8% or
more, 8.5% or more, 9% or more, 9.5% or more, 10% or more, 10.5% or more, 11%
or more, 11.5%
or more, 12% or more, 12.5% or more, 13% or more, 13.5% or more, 14% or more,
14.5% or more,
or 15% or more of the indels in the plurality of modified cells as a whole. In
certain embodiments,
the HBG1/2 c.-104 to -121 deletions make up 1% to 15.5% of the indels in the
plurality of modified
cells as a whole. In certain embodiments, the HBG1/2 c.-110 to -115 deletions
make up 0.5% or
more, 1% or more, 1.5% or more, 2% or more, 2.5% or more. 3% or more, 3.5% or
more, 4% or
more, 4.5% or more, 5% or more, or 5.5% or more of the indels in the plurality
of modified cells as a
whole. In certain embodiments, HBG1/2 c.-110 to -115 deletions make up 0.5% to
6% of the indels
in the plurality of modified cells as a whole. In certain embodiments, the
HBG1/2 c.-112 to -115
deletions make up 0.5% or more, 1% or more, 1.5% or more, 2% or more, 2.5% or
more. 3% or more,
3.5% or more, 4% or more, 4.5% or more, 5% or more, or 5.5% or more of the
indels in the plurality
of modified cells as a whole. In certain embodiments, HBG1/2 c.-112 to -115
deletions make up
0.5% to 6% of the indels in the plurality of modified cells as a whole. In
certain embodiments, the
HBG1/2 c.-113 to -115 deletions make up 0.5% or more, 1% or more, 1.5% or
more, 2% or more,
2.5% or more. 3% or more, 3.5% or more, 4% or more, 4.5% or more, 5% or more,
or 5.5% or more
of the indels in the plurality of modified cells as a whole. In certain
embodiments, HBG1/2 c.-113 to
-115 deletions make up 0.5% to 6% of the indels in the plurality of modified
cells as a whole. In
certain embodiments, the HBG1/2 c.-111 to -115 deletions make up 0.5% or more,
1% or more, 1.5%
7
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
or more, 2% or more, 2.5% or more. 3% or more, 3.5% or more, 4% or more, 4.5%
or more, 5% or
more, or 5.5% or more of the indels in the plurality of modified cells as a
whole. In certain
embodiments, HBG1/2 c.-111 to -115 deletions make up 0.5% to 6% of the indels
in the plurality of
modified cells as a whole. In certain embodiments, the HBG1/2 c.-111 to -117
deletions make up
0.5% or more, 1% or more, 1.5% or more, 2% or more, 2.5% or more. 3% or more,
3.5% or more, 4%
or more, 4.5% or more, 5% or more, or 5.5% or more of the indels in the
plurality of modified cells as
a whole. In certain embodiments, HBG1/2 c.-111 to -117 deletions make up 0.5%
to 6% of the indels
in the plurality of modified cells as a whole. In certain embodiments, the
HBG1/2 c.-102 to -114
deletions make up 0.5% or more, 1% or more, 1.5% or more, 2% or more, 2.5% or
more. 3% or more,
3.5% or more, 4% or more, 4.5% or more, 5% or more, or 5.5% or more of the
indels in the plurality
of modified cells as a whole. In certain embodiments, HBG1/2 c.-102 to -114
deletions make up
0.5% to 6% of the indels in the plurality of modified cells as a whole. In
certain embodiments, the
HBG1/2 c.-114 to -118 deletions make up 0.5% or more, 1% or more, 1.5% or
more, 2% or more,
2.5% or more. 3% or more, 3.5% or more, 4% or more, 4.5% or more, 5% or more,
or 5.5% or more
of the indels in the plurality of modified cells as a whole. In certain
embodiments, HBG1/2 c.-114 to
-118 deletions make up 0.5% to 6% of the indels in the plurality of modified
cells as a whole. In
certain embodiments, the HBG1/2 c.-112 to -116 deletions make up 0.5% or more,
1% or more, 1.5%
or more, 2% or more, 2.5% or more. 3% or more, 3.5% or more, 4% or more, 4.5%
or more, 5% or
more, or 5.5% or more of the indels in the plurality of modified cells as a
whole. In certain
embodiments, HBG1/2 c.-112 to -116 deletions make up 0.5% to 6% of the indels
in the plurality of
modified cells as a whole. In certain embodiments, the HBG1/2 c.-113 to -117
deletions make up
0.5% or more, 1% or more, 1.5% or more, 2% or more, 2.5% or more. 3% or more,
3.5% or more, 4%
or more, 4.5% or more, 5% or more, or 5.5% or more of the indels in the
plurality of modified cells as
a whole. In certain embodiments, HBG1/2 c.-113 to -117 deletions make up 0.5%
to 6% of the indels
in the plurality of modified cells as a whole.
[0031] In certain embodiments of the first populations of modified cells
provided herein, the plurality
of modified cells as a whole includes the 108 deletions present in all 14
samples in Table 25.
[0032] In certain embodiments of the first populations of modified cells
provided herein, the plurality
of modified cells as a whole includes the indels identified as having an "Ave
% in Indel" of 0.1% or
more in Table 25. In certain of these embodiments, the plurality of modified
cells as a whole includes
all of the indels in Table 25.
[0033] In certain embodiments of the first populations of modified cells
provided herein, the plurality
of modified cells as a whole include at least 10% more deletions of at least 4
base pairs than a second
population of modified cells comprising a plurality of modified CD34+ or
hematopoietic stem cells
comprising a plurality of modified CD34+ or hematopoietic stem cells with one
or more indels in an
HBG gene promoter, where the indels of the second population of modified cells
are generated by
8
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
delivering a second RNP complex including a second gRNA having a gRNA
targeting domain
comprising SEQ ID NO:339 and a Cas9 RNA-guided nuclease to a second population
of unmodified
cells comprising a plurality of unmodified CD34+ or hematopoietic stem cells.
In certain of these
embodiments, the second RNP complex is delivered to the second population of
unmodified cells by
electroporation. In certain embodiments, the second population of unmodified
cells is from a subject
having sickle cell disease. In certain embodiments, the first population of
modified cells has higher
HbF levels than the second population of modified cells. In certain of these
embodiments, the
plurality of modified cells in the second population include an indel in a
CCAAT box target region.
[0034] Provided herein in certain embodiments are methods of inducing
expression of HbF in a first
population of modified cells comprising a plurality of modified CD34+ or
hematopoietic stem cells
with one or more indels in an HBG gene promoter, the method comprising
delivering a first RNP
complex including a first gRNA comprising a first gRNA targeting domain and a
Cpfl RNA-guided
nuclease or a modified Cpfl RNA-guided nuclease to a first population of
unmodified cells
comprising a plurality of unmodified CD34+ or hematopoietic stem cells to
generate indels. In
certain embodiments, 60% or more, 65% or more, 70% or more, 75% or more, 80%
or more, 85% or
more, 90% or more, or 95% or more of the resultant indels in the plurality of
modified cells as a
whole are deletions of at least 4 base pairs. In certain embodiments, the
first population of modified
cells exhibits increased HbF levels versus the first population of unmodified
cells. In certain
embodiments, the first RNP complex is delivered to the first population of
unmodified cells by
electroporation.
[0035] Provided herein in certain embodiments are methods of decreasing
sickling in a first
population of red blood cells (RBCs) cultured from a first population of
modified cells comprising a
plurality of modified CD34+ cells with one or more indels in an HBG gene
promoter, the method
comprising delivering a first RNP complex including a first gRNA comprising a
first gRNA targeting
domain and a Cpfl RNA-guided nuclease or a modified Cpfl RNA-guided nuclease
to a first
population of unmodified cells comprising a plurality of unmodified CD34+
cells to generate indels,
then culturing the first population of RBCs from the first population of
modified cells. In certain
embodiments, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more,
85% or more,
90% or more, or 95% or more of the resultant indels in the plurality of
modified cells as a whole are
deletions of at least 4 base pairs. In certain embodiments, the first
population of RBCs exhibits
significantly decreased sickling upon deoxygenation versus a second population
of RBCs cultured
from the first population of unmodified cells. In certain embodiments, the
first population of RBCs
sickle at a significantly lower oxygen tension, for example as measured by
relative oxygen pressure,
than the second population of RBCs. In certain embodiments, the first
population of RBCs has a
significantly higher minimum elongation index upon deoxygenation than the
second population of
RBCs. In certain embodiments, the first population of RBCs has a significantly
higher velocity upon
9
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
deoxygenation than the second population of RBCs. In certain embodiments, the
first population of
RBCs has higher HbF levels than the second population of RBCs.
[0036] Provided herein in certain embodiments are methods of alleviating one
or more symptoms of
sickle cell disease in a subject in need thereof comprising delivering a first
RNP complex including a
first gRNA comprising a first targeting domain and a Cpfl RNA-guided nuclease
or a modified Cpfl
RNA-guided nuclease to a first population of unmodified cells comprising a
plurality of unmodified
CD34+ or hematopoietic stem cells to generate a first population of modified
cells comprising a
plurality of modified CD34+ or hematopoietic stem cells comprising one or more
indels in an HBG
gene promoter, and then administering the resultant first population of
modified cells to the subject to
alleviate one or more symptoms of sickle cell disease. In certain embodiments,
60% or more, 65% or
more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95%
or more of the
resultant indels in the resultant plurality of modified CD34+ or hematopoietic
stem cells as a whole
are deletions of at least 4 base pairs. In certain embodiments, the methods
further comprise detecting
a population of modified erythroid progeny cells comprising a plurality of
modified erythroid progeny
cells cultured from the first population of modified cells at about 1 week, 2
weeks, 3 weeks, 4 weeks,
weeks, 6 weeks, 7 weeks, 8 weeks, 10 weeks, 12 weeks. 16 weeks, 20 weeks, 1
month, 2 months, 3
months, 4 months, 5 months, 6 months, 8 months, 12 months, 1 year, 2 years, 3
years, 4 years, 5
years, or more than 5 years after administration. In certain embodiments, the
cultured cells may
include bone marrow (BM)-engrafted CD34+ hematopoietic stem cells or blood
cells derived
therefrom, e.g., myeloid progenitor or differentiated myeloid cells, e.g.,
erythrocytes, mast cells,
myoblasts; or lymphoid progenitors or differentiated lymphoid cells, e.g., T-
or B- lymphocytes or
NK cells. In certain embodiments, the method results in long-term engraftment
of a plurality of HSC
clones in bone marrow, e.g., at least 1 week, 2 weeks, 3 weeks, 4 weeks, 5
weeks, 6 weeks, 7 weeks, 8
weeks, 10 weeks, 12 weeks. 16 weeks, 20 weeks, 1 month, 2 months, 3 months, 4
months, 5 months,
6 months, 8 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, or
more than 5 years after
administration. In certain embodiments the method results in long-term
expression of at least 50%, at
least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least
99% of total hemoglobin
as compared to a healthy subject. In certain embodiments, the method results
in a reconstitution of all
hematopoietic cell lineages, e.g., without any differentiation bias, e.g.,
without an erythroid lineage
differentiation bias.
[0037] Provided herein in certain embodiments is a population of cells
comprising a plurality of red
blood cells (RBCs) cultured from a plurality of modified CD34+ cells from a
subject having sickle
cell disease, each modified cell comprising an indel in an HBG gene promoter.
In certain
embodiments, the plurality of modified cells as a whole includes the 108
deletions present in all 14
samples in Table 25. In certain embodiments, the population of cells is
generated by delivering an
RNP complex including a gRNA comprising a first targeting domain and a Cpfl
RNA-guided
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
nuclease or a modified Cpfl RNA-guided nuclease to a plurality of unmodified
CD34+ cells from a
subject having sickle cell disease to generate the indels; and culturing the
RBCs from the plurality of
modified CD34+ cells.
[0038] Provided herein in certain embodiments is a population of cells
comprising a plurality of red
blood cells (RBCs) cultured from a plurality of modified CD34+ cells from a
subject having sickle
cell disease, each modified cell comprising an indel in an HBG gene promoter.
In certain
embodiments, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more,
85% or more,
90% or more, or 95% or more of the indels in the HBG gene promoter are
deletions of at least 4 base
pairs. In certain embodiments, the population of cells is generated by
delivering an RNP complex
including a gRNA comprising a first targeting domain and a Cpfl RNA-guided
nuclease or a
modified Cpfl RNA-guided nuclease to a plurality of unmodified CD34+ cells
from a subject having
sickle cell disease to generate the indels; and culturing the RBCs from the
plurality of modified
CD34+ cells.
[0039] In certain embodiments of the population of cells comprising a
plurality of RBCs provided
herein, the plurality of RBCs sickle at a significantly lower oxygen tension,
e.g., as measured by
relative oxygen pressure, than a population of RBCs cultured from unmodified
CD34+ cells, of the
subject having sickle cell disease, have a significantly higher minimum
elongation index upon
deoxygenation than a population of RBCs cultured from unmodified CD34+ cells
of the subject
having sickle cell disease, and/or have a significantly higher velocity upon
deoxygenation than a
population of RBCs cultured from unmodified CD34+ cells of the subject having
sickle cell disease.
[0040] Provided herein are genome editing systems, ribonucleoprotein (RNP)
complexes, guide
RNAs, Cpfl proteins, including modified Cpfl proteins (Cpf1 variants), and
CRISPR-mediated
methods for altering the promoter region of one or more y¨globin genes (e.g.,
HBG1, HBG2, or HBG1
and HBG2) and increasing expression of fetal hemoglobin (HbF). In certain
embodiments, an RNP
complex may include a guide RNA (gRNA) complexed to a wild-type Cpfl or
modified Cpfl RNA-
guided nuclease (modified Cpfl protein). In certain embodiments, a gRNA may
comprise a sequence
set forth in Table 6, Table 12, or Table 13. In certain embodiments, a gRNA
may comprise a gRNA
targeting domain. In certain embodiments, a gRNA targeting domain may comprise
a sequence
selected from the group consisting of SEQ ID NOs:1002, 1254, 1258, 1260, 1262,
and 1264. In
certain embodiments, a gRNA may comprise a gRNA sequence set forth in Table
13. In certain
embodiments, a gRNA may comprise a sequence selected from the group consisting
of SEQ ID
NOs:1022, 1023, 1041-1105. In certain embodiments, the RNP complex may
comprise an RNP
complex set forth in Table 15. For example, an RNP complex may include a gRNA
comprising the
sequence set forth in SEQ ID NO:1051 and a modified Cpfl protein encoded by
the sequence set forth
in SEQ ID NO:1097 (RNP32, Table 15).
11
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0041] The inventors have discovered herein that delivery of an RNP complex
including a gRNA
complexed to a modified Cpfl protein may result in increased editing of a
target nucleic acid. In
certain embodiments, the modified Cpfl protein may contain one or more
modifications. In certain
embodiments, the one or more modifications may include, without limitation,
one or more mutations
in a wild-type Cpfl amino acid sequence, one or more mutations in a wild-type
Cpfl nucleic acid
sequence, one or more nuclear localization signals (NLS), one or more
purification tags (e.g., His tag),
or a combination thereof In certain embodiments, a modified Cpfl may be
encoded by a sequence
set forth in SEQ ID NOs:1000, 1001, 1008-1018, 1032, 1035-39, 1094-1097, 1107-
09 (Cpfl
polypeptide sequences) or SEQ ID NOs:1019-1021, 1110-17 (Cpfl polynucleotide
sequences). In
certain embodiments, the gRNA may be a modified or unmodified gRNA. In certain
embodiments,
the gRNA may comprise a sequence set forth in Table 6, Table 12, or Table 13.
In certain
embodiments, the RNP complex may comprise an RNP complex set forth in Table
15. For example,
the RNP complex may include a gRNA comprising the sequence set forth in SEQ ID
NO:1051 and a
modified Cpfl protein encoded by the sequence set forth in SEQ ID NO:1097
(RNP32, Table 15). In
certain embodiments, an RNP complex comprising a modified Cpfl protein may
increase editing of a
target nucleic acid. In certain embodiments, an RNP complex comprising a
modified Cpfl protein
may increase editing resulting in an increase of productive indels. In various
embodiments, an
increase in editing of the target nucleic acid may be assessed by any means
known to skilled artisans,
such as, but not limited to, PCR amplification of the target nucleic acid and
subsequent sequencing
analysis (e.g., Sanger sequencing, next generation sequencing).
[0042] The inventors have also discovered herein that delivery of an RNP
complex including a
modified gRNA complexed to an unmodified or modified Cpfl protein may result
in increased editing
of a target nucleic acid. In certain embodiments, the modified gRNA may
comprise one or more
modifications including a phosphorothioate linkage modification, a
phosphorodithioate (PS2) linkage
modification, a 2'-0-methyl modification, one or more or a stretch of
deoxyribonucleic acid (DNA)
bases (also referred to herein as a "DNA extension"), one or more or a stretch
of ribonucleic acid
(RNA) bases (also referred to herein as a "RNA extension"), or combinations
thereof In certain
embodiments, the DNA extension may comprise a sequence set forth in Table 18.
For example, in
certain embodiments, the DNA extension may comprise a sequence set forth in
SEQ ID NOs:1235-
1250. In certain embodiments, the RNA extension may comprise a sequence set
forth in Table 18.
For example, in certain embodiments, the RNA extension may comprise a sequence
set forth in SEQ
ID NOs:1231-1234, 1251-1253. In certain embodiments, the gRNA may comprise a
sequence set
forth in Table 6, Table 12, or Table 13. In certain embodiments, the RNP
complex may comprise an
RNP complex set forth in Table 15. For example, the RNP complex may include a
gRNA comprising
the sequence set forth in SEQ ID NO:1051 and a modified Cpfl protein encoded
by the sequence set
forth in SEQ ID NO:1097 (RNP32, Table 15). In certain embodiments, an RNP
complex comprising
12
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
a modified gRNA may increase editing of a target nucleic acid. In certain
embodiments, an RNP
complex comprising a modified gRNA may increase editing resulting in an
increase of productive
indels.
[0043] In certain embodiments, an RNP complex comprising a modified gRNA and a
modified Cpfl
protein may increase editing of a target nucleic acid. In certain embodiments,
an RNP complex
comprising a modified gRNA and a modified Cpfl protein may increase editing
resulting in an
increase of productive indels.
[0044] The inventors have also discovered that codelivery of an RNP complex
comprising a gRNA
complexed to a Cpfl molecule (e.g., "gRNA-Cpfl-RNP") with a "booster element"
may result in
increased editing of a target nucleic acid. In certain embodiments, the RNP
complex may comprise
an RNP complex set forth in Table 15. For example, the RNP complex may include
a gRNA
comprising the sequence set forth in SEQ ID NO:1051 and a modified Cpfl
protein encoded by the
sequence set forth in SEQ ID NO:1097 (RNP32, Table 15). As used herein, the
term "booster
element" refers to an element which, when co-delivered with a RNP complex
comprising a gRNA
complexed to an RNA-guided nuclease ("gRNA-nuclease-RNP"), increases editing
of a target nucleic
acid compared with editing of the target nucleic acid without the booster
element. In certain
embodiments, one or more booster elements may be codelivered with a gRNA-
nuclease-RNP
complex to increase editing of a target nucleic acid. In certain embodiments,
codelivery of a booster
element may increase editing resulting in an increase of productive indels. In
various embodiments,
an increase in editing of the target nucleic acid may be assessed by any means
known to skilled
artisans, such as, but not limited to, PCR amplification of the target nucleic
acid and subsequent
sequencing analysis (e.g., Sanger sequencing, next generation sequencing).
[0045] In certain embodiments, a gRNA-nuclease-RNP may comprise a gRNA-Cpfl-
RNP. In
certain embodiments, a Cpfl molecule of the gRNA-Cpfl-RNP complex may be a
wild-type Cpfl or
modified Cpfl. In certain embodiments, the Cpfl molecule of the gRNA-Cpfl-RNP
may be encoded
by a sequence set forth in SEQ ID NOs:1000, 1001, 1008-1018, 1032, 1035-39,
1094-1097, 1107-09
(Cpfl polypeptide sequences) or SEQ ID NOs:1019-1021, 1110-17 (Cpfl
polynucleotide sequences).
In certain embodiments, the gRNA-Cpfl-RNP complex may comprise a gRNA
comprising a targeting
domain set forth in Table 6 or Table 12. In certain embodiments, the gRNA-Cpfl-
RNP complex
may comprise a gRNA comprising a sequence set forth in Table 13. In certain
embodiments, the
gRNA may be a modified or unmodified gRNA.
[0046] In certain embodiments, a booster element may comprise a dead RNP
comprising a dead
gRNA molecule complexed with an RNA-guided nuclease molecule ("dead gRNA-
nuclease-RNP").
In certain embodiments, the dead gRNA-nuclease-RNP may comprise a dead gRNA
complexed with
a wild-type (WT) Cas9 molecule ("dead gRNA-Cas9-RNP"), a dead gRNA complexed
with a Cas9
nickase molecule ("dead gRNA-nickase-RNP") or a dead gRNA complexed with an
enzymatically
13
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
inactive (ei) Cas9 molecule ("dead gRNA-eiCas9-RNP"). In certain embodiments,
the dead gRNA-
nuclease-RNP complex may have decreased activity or lack nuclease activity. In
certain
embodiments, the dead gRNA of the dead gRNA-nuclease-RNP complex may comprise
any of the
dead gRNAs set forth herein. For example, the dead gRNA may comprise a
targeting domain may be
the same as or may differ by no more than 3 nucleotides from a dead gRNA
targeting domain set forth
in Table 8 or Table 9. In certain embodiments, the dead gRNA may include a
targeting domain
comprising a truncation of a gRNA targeting domain. In certain embodiments,
the gRNA targeting
domain to be truncated may be a gRNA targeting domain set forth in Table 8 or
Table 9. In certain
embodiments, the dead gRNA may be a modified or unmodified dead gRNA. As shown
herein,
codelivery of a gRNA-Cpfl-RNP with a dead gRNA-Cas9-RNP (i.e., an RNP
comprising a dead
gRNA complexed to a WT Cas9) or codelivery of a gRNA-Cpfl-RNP with a dead gRNA-
nickase-
RNP (i.e., an RNP comprising a dead gRNA complexed to a Cas9 nickase (i.e.,
the Cas9 DlOA
nickase)) resulted in an increase in total editing above levels observed
following delivery of gRNA-
Cpfl-RNP alone (see, e.g., Examples 5, 7, 8). Dead gRNA molecules may comprise
targeting
domains complementary to regions proximal to or within a target region (e.g.,
the CCAAT box target
region, 13 nt target region, proximal HBG1/2 promoter target sequence, and/or
the GATA1 binding
motif in BCL11Ae) in a target nucleic acid. In certain embodiments, "proximal
to" may denote the
region within 10, 25, 50, 100, or 200 nucleotides of a target region (e.g.,
the CCAAT box target
region, 13 nt target region, proximal HBG1/2 promoter target sequence, and/or
the GATA1 binding
motif in BCL11Ae). In certain embodiments, one or more booster elements may be
comprised of one
or more dead gRNA-nuclease-RNPs, e.g., dead gRNA-Cas9-RNP, dead gRNA-nickase-
RNP, dead
gRNA-eiCas9-RNP, to be codelivered with a gRNA-Cpfl-RNP. In certain
embodiments, codelivery
of a dead gRNA-nuclease-RNP does not alter the indel profile of a gRNA-Cpfl-
RNP.
[0047] In certain embodiments, a booster element may comprise an RNP complex
comprising a
gRNA molecule complexed with an RNA-guided nuclease nickase molecule ("gRNA-
nickase-RNP").
In certain embodiments, the RNA-guided nuclease nickase molecule may be a Cas9
nickase molecule,
e.g., Cas9 DlOA nickase. In certain embodiments, the gRNA of the gRNA-nickase-
RNP may
comprise any of the gRNAs set forth herein. For example, the gRNA may comprise
a gRNA
targeting domain set forth in Table 8 or Table 9. In certain embodiments, the
gRNA may be a
modified or unmodified gRNA. As shown herein, codelivery of gRNA-Cpfl-RNP with
a gRNA-
nickase-RNP complex (RNP comprising a guide RNA complexed to a Cas9D10A
nickase molecule)
resulted in an increase in total editing above levels observed following
delivery of gRNA-Cpfl-RNP
alone (see, e.g., Examples 4,5). Additionally, codelivery of a gRNA-nickase-
RNP complex with a
gRNA-Cpfl-RNP complex altered the directionality, length, and/or position of
the indel profile of
gRNA-Cpfl-RNP. In certain embodiments, a booster enhancer may be used to
provide a desired
editing outcome, for example, to increase the rate of productive indels. In
certain embodiments,
14
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
codelivery of a gRNA-nickase-RNP complex with a gRNA-Cpfl-RNP complex may
alter the indel
profile of the gRNA-Cpfl-RNP.
[0048] In certain embodiments, a booster element may comprise a single
stranded
oligodeoxynucleotide (ssODN) or a double stranded oligodeoxynucleotide
(dsODN). In certain
embodiments, the ssODN may be any ssODN disclosed herein. In certain
embodiments, an ssODN
may comprise a sequence set forth in Table 7. For example, in certain
embodiments, an ssODN may
comprise the sequence set forth in SEQ ID NO:1040.
[0049] In one aspect, the disclosure relates to an RNP complex comprising a
CRISPR from
Prevotella and Franciscella 1 (Cpfl) RNA-guided nuclease or a variant thereof
and a gRNA, wherein
the gRNA is capable of binding to a target site in a promoter of an HBG gene
in a cell. In certain
embodiments, the gRNA may be modified or unmodified. In certain embodiments,
the gRNA may
comprise one or more modifications including a phosphorothioate linkage
modification, a
phosphorodithioate (PS2) linkage modification, a 2'-0-methyl modification, a
DNA extension, an
RNA extension, or combinations thereof In certain embodiments, the DNA
extension may comprise
a sequence set forth in Table 18. In certain embodiments, the RNA extension
may comprise a
sequence set forth in Table 18. In certain embodiments, the gRNA may comprise
a sequence set forth
in Table 6, Table 12, or Table 13. In certain embodiments, the RNP complex may
comprise an RNP
complex set forth in Table 15. For example, the RNP complex may include a gRNA
comprising the
sequence set forth in SEQ ID NO:1051 and a Cpfl variant protein encoded by the
sequence set forth
in SEQ ID NO:1097 (RNP32, Table 15). In certain embodiments, the Cpfl variant
protein may
contain one or more modifications. In certain embodiments, the one or more
modifications may
include, without limitation, one or more mutations in a wild-type Cpfl amino
acid sequence, one or
more mutations in a wild-type Cpfl nucleic acid sequence, one or more nuclear
localization signals
(NLS), one or more purification tags (e.g., His tag), or a combination thereof
In certain
embodiments, a Cpfl variant protein may be encoded by a sequence set forth in
SEQ ID NOs:1000,
1001, 1008-1018, 1032, 1035-39, 1094-1097, 1107-09 (Cpfl polypeptide
sequences) or SEQ ID
NOs:1019-1021, 1110-17 (Cpfl polynucleotide sequences).
[0050] In one aspect, the disclosure relates to a method of altering a
promoter of an HBG gene in a
cell comprising contacting the cell with an RNP complex disclosed herein. In
certain embodiments,
the alteration may comprise an indel within one or more regions set forth in
Table 11. In certain
embodiments, the alteration may comprise an indel within a CCAAT box target
region of the
promoter of an HBG gene. For example, in certain embodiments, the alteration
may comprise an
indel within Chr 11 (NC 000011.10): 5,249,955 ¨ 5,249,987 (Table 11, Region
6), Chr 11
(NC 000011.10): 5,254,879 ¨ 5,254,909 (Table 11, Region 16), or a combination
thereof. In certain
embodiments, the RNP complex may comprise a gRNA and a Cpfl protein. In
certain embodiments,
the gRNA may comprise an RNA targeting domain set forth in Table 13. In
certain embodiments, the
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
gRNA targeting domain may comprise a sequence selected from the group
consisting of SEQ ID
NOs:1002, 1254, 1258, 1260, 1262, and 1264. In certain embodiments, the gRNA
may comprise a
gRNA sequence set forth in Table 13. In certain embodiments, the gRNA may
comprise a sequence
selected from the group consisting of SEQ ID NOs:1022, 1023, 1041-1105. In
certain embodiments,
a gRNA may be configured to provide an editing event at Chr11:5249973,
Chr11:5249977 (HBG1);
Chr11:5250042, Chr11:5250046 (HBG1); Chr11:5250055, Chr11:5250059 (HBG1);
Chr11:5250179,
Chr11:5250183 (HBG1); Chr11:5254897, Chr11:5254901 (HBG2); Chr11:5254897,
Chr11:5254901
(HBG2); Chr11:5254966, 5254970 (HBG2); Chr11:5254979, 5254983 (HBG2) (Table
16, Table 17).
In certain embodiments, the cell may be further contacted with a booster
element. In certain
embodiment, a booster element may comprise a single stranded
oligodeoxynucleotide (ssODN) or a
double stranded oligodeoxynucleotide (dsODN). In certain embodiments, the
ssODN may be any
ssODN disclosed herein. In certain embodiments, an ssODN may comprise a
sequence set forth in
Table 7. For example, in certain embodiments, an ssODN may comprise the
sequence set forth in
SEQ ID NO:1040.
[0051] In one aspect, the disclosure relates to an isolated cell comprising an
alteration in a promoter
of HBG gene generated by the delivery of an RNP complex to the cell. In
certain embodiments, the
RNP complex may comprise a gRNA and a Cpfl protein. In certain embodiments,
the gRNA may be
modified or unmodified. In certain embodiments, the gRNA may comprise one or
more
modifications including a phosphorothioate linkage modification, a
phosphorodithioate (PS2) linkage
modification, a 2'-0-methyl modification, a DNA extension, an RNA extension,
or combinations
thereof. In certain embodiments, the DNA extension may comprise a sequence set
forth in Table 18.
In certain embodiments, the RNA extension may comprise a sequence set forth in
Table 18. In
certain embodiments, the gRNA may comprise a sequence set forth in Table 6,
Table 12, or Table
13. In certain embodiments, the RNP complex may comprise an RNP complex set
forth in Table 15.
For example, the RNP complex may include a gRNA comprising the sequence set
forth in SEQ ID
NO:1051 and a Cpfl variant protein encoded by the sequence set forth in SEQ ID
NO:1097 (RNP32,
Table 15). In certain embodiments, the Cpfl variant protein may contain one or
more modifications.
In certain embodiments, the one or more modifications may include, without
limitation, one or more
mutations in a wild-type Cpfl amino acid sequence, one or more mutations in a
wild-type Cpfl
nucleic acid sequence, one or more nuclear localization signals (NLS), one or
more purification tags
(e.g., His tag), or a combination thereof In certain embodiments, a Cpfl
variant protein may be
encoded by a sequence set forth in SEQ ID NOs:1000, 1001, 1008-1018, 1032,
1035-39, 1094-1097,
1107-09 (Cpfl polypeptide sequences) or SEQ ID NOs:1019-1021, 1110-17 (Cpfl
polynucleotide
sequences). In certain embodiments, a booster element may be co-delivered with
the RNP complex.
In certain embodiment, a booster element may comprise a single stranded
oligodeoxynucleotide
(ssODN) or a double stranded oligodeoxynucleotide (dsODN). In certain
embodiments, the ssODN
16
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
may be any ssODN disclosed herein. In certain embodiments, an ssODN may
comprise a sequence
set forth in Table 7. For example, in certain embodiments, an ssODN may
comprise the sequence set
forth in SEQ ID NO:1040.
[0052] In one aspect, the disclosure relates to an ex vivo method of
increasing the level of fetal
hemoglobin (HbF) in a human cell by genome editing using an RNP complex
comprising a gRNA
and a Cpfl RNA-guided nuclease or a variant thereof to affect an alteration in
a promoter of an HBG
gene, thereby to increase expression of HbF. In certain embodiments, the gRNA
may be modified or
unmodified. In certain embodiments, the gRNA may comprise one or more
modifications including a
phosphorothioate linkage modification, a phosphorodithioate (P S2) linkage
modification, a 2'-0-
methyl modification, a DNA extension, an RNA extension, or combinations
thereof. In certain
embodiments, the DNA extension may comprise a sequence set forth in Table 18.
In certain
embodiments, the RNA extension may comprise a sequence set forth in Table 18.
In certain
embodiments, the gRNA may comprise a sequence set forth in Table 6, Table 12,
or Table 13. In
certain embodiments, the RNP complex may comprise an RNP complex set forth in
Table 15. For
example, the RNP complex may include a gRNA comprising the sequence set forth
in SEQ ID
NO:1051 and a Cpfl variant protein encoded by the sequence set forth in SEQ ID
NO:1097 (RNP32,
Table 15). In certain embodiments, the Cpfl variant protein may contain one or
more modifications.
In certain embodiments, the one or more modifications may include, without
limitation, one or more
mutations in a wild-type Cpfl amino acid sequence, one or more mutations in a
wild-type Cpfl
nucleic acid sequence, one or more nuclear localization signals (NLS), one or
more purification tags
(e.g., His tag), or a combination thereof In certain embodiments, a Cpfl
variant protein may be
encoded by a sequence set forth in SEQ ID NOs:1000, 1001, 1008-1018, 1032,
1035-39, 1094-1097,
1107-09 (Cpfl polypeptide sequences) or SEQ ID NOs:1019-1021, 1110-17 (Cpfl
polynucleotide
sequences). In certain embodiments, a booster element may be co-delivered with
the RNP complex.
In certain embodiment, a booster element may comprise a single stranded
oligodeoxynucleotide
(ssODN) or a double stranded oligodeoxynucleotide (dsODN). In certain
embodiments, the ssODN
may be any ssODN disclosed herein. In certain embodiments, an ssODN may
comprise a sequence
set forth in Table 7. For example, in certain embodiments, an ssODN may
comprise the sequence set
forth in SEQ ID NO:1040.
[0053] In one aspect, the disclosure relates to a population of CD34+ or
hematopoietic stem cells,
wherein one or more cells in the population comprises an alteration in a
promoter of an HBG gene,
which alteration is generated by delivering an RNP complex comprising a gRNA
and a Cpfl RNA-
guided nuclease or a variant thereof to the population of CD34+ or
hematopoietic stem cells. In
certain embodiments, the gRNA may be modified or unmodified. In certain
embodiments, the gRNA
may comprise one or more modifications including a phosphorothioate linkage
modification, a
phosphorodithioate (PS2) linkage modification, a 2'-0-methyl modification, a
DNA extension, an
17
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
RNA extension, or combinations thereof In certain embodiments, the DNA
extension may comprise
a sequence set forth in Table 18. In certain embodiments, the RNA extension
may comprise a
sequence set forth in Table 18. In certain embodiments, the gRNA may comprise
a sequence set forth
in Table 6, Table 12, or Table 13. In certain embodiments, the RNP complex may
comprise an RNP
complex set forth in Table 15. For example, the RNP complex may include a gRNA
comprising the
sequence set forth in SEQ ID NO:1051 and a Cpfl variant protein encoded by the
sequence set forth
in SEQ ID NO:1097 (RNP32, Table 15). In certain embodiments, the Cpfl variant
protein may
contain one or more modifications. In certain embodiments, the one or more
modifications may
include, without limitation, one or more mutations in a wild-type Cpfl amino
acid sequence, one or
more mutations in a wild-type Cpfl nucleic acid sequence, one or more nuclear
localization signals
(NLS), one or more purification tags (e.g., His tag), or a combination thereof
In certain
embodiments, a Cpfl variant protein may be encoded by a sequence set forth in
SEQ ID NOs:1000,
1001, 1008-1018, 1032, 1035-39, 1094-1097, 1107-09 (Cpfl polypeptide
sequences) or SEQ ID
NOs:1019-1021, 1110-17 (Cpfl polynucleotide sequences). In certain
embodiments, a booster
element may be co-delivered with the RNP complex. In certain embodiment, a
booster element may
comprise a single stranded oligodeoxynucleotide (ssODN) or a double stranded
oligodeoxynucleotide
(dsODN). In certain embodiments, the ssODN may be any ssODN disclosed herein.
In certain
embodiments, an ssODN may comprise a sequence set forth in Table 7. For
example, in certain
embodiments, an ssODN may comprise the sequence set forth in SEQ ID NO:1040.
[0054] In one aspect, the disclosure relates to a method of alleviating one or
more symptoms of
sickle cell disease in a subject in need thereof, the method comprising: a)
isolating a population of
CD34+ or hematopoietic stem cells from the subject; b) modifying the
population of isolated cells ex
vivo by delivering an RNP complex comprising a gRNA and a Cpfl RNA-guided
nuclease or a
variant thereof to the population of isolated cells, thereby to affect an
alteration in a promoter of an
HBG gene in one or more cells in the population; and c) administering the
modified population of
cells to the subject, thereby to alleviate one or more symptoms of sickle cell
disease in the subject. In
certain embodiments, the method may further comprise detecting
progeny/daughter cells of the
administered modified cells in the subject, e.g., in the form of BM-engrafted
CD34+ hematopoietic
stem cells or blood cells derived from those (e.g., myeloid progenitor or
differentiated myeloid cells
(e.g., erythrocyte, mast cells, myoblast); or lymphoid progenitors or
differentiated lymphoid cells
(e.g., T- or B- lymphocyte, or NK cell), e.g., at least [1, 2, 3, 4, 5, 6, 7,
8, 12, 16, or 201 weeks, or at
least [1, 2, 3, 4, 5, or 61 months, or at least [1, 2, 3, 4, or 5] years after
administration. In certain
embodiments, the method may result in a reconstitution of all hematopoietic
cell lineages, e.g.,
without any differentiation bias, e.g., without an erythroid lineage
differentiation bias. In certain
embodiments, the method may comprise administering a plurality of edited
cells, and the method may
result in long-term engraftment [e.g., at least [1, 2, 3, 4, 5, 6, 7, 8, 12,
16, or 201 weeks, or at least [1,
18
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
2, 3, 4, 5, or 61 months, or at least [1, 2, 3, 4, or 5] years after
administration] of a plurality of [at least
5, 10, 15, 20, 25, ... 1001 different HSC clones in the BM. In certain
embodiments, the method may
further comprise detecting the level of total hemoglobin expression in the
subject, at least [1, 2, 3, 4,
5, 6, 7, 8, 12, 16, or 201 weeks, or at least [1, 2, 3, 4, 5, or 61 months, or
at least [1, 2, 3, 4, or 5] years
after administration. In certain embodiments, the method may result in long-
term expression [e.g., at
least [1, 2, 3, 4, 5, 6, 7, 8, 12, 16, or 201 weeks, or at least [1, 2, 3, 4,
5, or 61 months, or at least [1, 2,
3, 4, or 5] years after administration] of [at least 50%, at least 60%... at
least 99%1 of total hemoglobin
as compared to a healthy subject (e.g., as total Hb (e.g., HbA and HbF (if
any) combined)). In certain
embodiments, the alteration may comprise an indel within a CCAAT box target
region of the
promoter of the HBG gene. In certain embodiments, the RNP complex may be
delivered using
electroporation. In certain embodiments, at least about 5%, at least about
10%, at least about 20%, at
least about 30%, at least about 40%, at least about 50%, at least about 60%,
at least about 70%, at
least about 80% or at least about 90% of the cells in the population of cells
comprise a productive
indel.
[0055] In one aspect, the disclosure relates to a gRNA comprising a 5' end and
a 3' end, and
comprising a DNA extension at the 5' end and a 2'-0-methy1-3'-phosphorothioate
modification at the
3' end, wherein the gRNA includes an RNA segment capable of hybridizing to a
target site and an
RNA segment capable of associating with a Cpfl RNA-guided nuclease. In certain
embodiments, the
DNA extension may comprise a sequence set forth in SEQ ID NOs:1235-1250. In
certain
embodiments, the gRNA may be modified or unmodified. In certain embodiments,
the gRNA may
comprise one or more modifications including a phosphorothioate linkage
modification, a
phosphorodithioate (PS2) linkage modification, a 2'-0-methyl modification, a
DNA extension, an
RNA extension, or combinations thereof In certain embodiments, the DNA
extension may comprise
a sequence set forth in Table 18. In certain embodiments, the RNA extension
may comprise a
sequence set forth in Table 18. In certain embodiments, the gRNA may comprise
a sequence set forth
in Table 6, Table 12, or Table 13.
[0056] In one aspect, the disclosure relates to an RNP complex comprising a
Cpfl RNA-guided
nuclease as disclosed herein and a gRNA as disclosed herein.
[0057] Also provided herein are genome editing systems, guide RNAs, and CRISPR-
mediated
methods for altering one or more y-globin genes (e.g., HBG1, HBG2, or HBG1 and
HBG2) and
increasing expression of fetal hemoglobin (HbF). In certain embodiments, one
or more gRNAs
comprising a sequence set forth in Table 12 or Table 13 may be used to
introduce alterations in the
promoter region of the HBG gene. In certain embodiments, genome editing
systems, guide RNAs,
and CRISPR-mediated methods may alter a 13 nucleotide (nt) target region that
is 5' of the
transcription site of the HBG1, HBG2, or HBG1 and HBG2 gene ("13 nt target
region"). In certain
embodiments, genome editing systems, guide RNAs, and CRISPR-mediated methods
may alter a
19
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
CCAAT box target region that is 5' of the transcription site of the HBG1,
HBG2, or HBG1 and HBG2
gene ("CCAAT box target region"). In certain embodiments, the CCAAT box target
region may be
the region that is at or near the distal CCAAT box and includes the
nucleotides of the distal CCAAT
box and 25 nucleotides upstream (5') and 25 nucleotides downstream (3') of the
distal CCAAT box
(i.e., HBG1/2 c.-86 to -140). In certain embodiments, the CCAAT box target
region may be the
region that is at or near the distal CCAAT box and includes the nucleotides of
the distal CCAAT box
and 5 nucleotides upstream (5') and 5 nucleotides downstream (3') of the
distal CCAAT box (i.e.,
HBG1/2 c.-106 to -120). In certain embodiments, the CCAAT box target region
may comprise a 18
nt target region, a 13 nt target region, a 11 nt target region, a 4 nt target
region, a 1 nt target region, a -
117G>A target region, or a combination thereof as disclosed herein. In certain
embodiments, the
alteration may be a 18 nt deletion, 13 nt deletion, 11 nt deletion, 4 nt
deletion, 1 nt deletion, a
substitution from G to A at c.-117 of the HBG1, HBG2, or HBG1 and HBG2 gene,
or a combination
thereof In certain embodiments, the alteration may be a non-naturally
occurring alteration or a
naturally occurring alteration.
[0058] Also provided herein in certain embodiments are the use of optional
genome editing system
components such as template nucleic acids (oligonucleotide donor templates).
In certain
embodiments, template nucleic acids for use in targeting the CCAAT target
region may include,
without limitation, template nucleic acids encoding alterations of the CCAAT
box target region. In
certain embodiments, the CCAAT box target region may comprise a 18 nt target
region, a 11 nt target
region, a 4 nt target region, a 1 nt target region, or a combination thereof
In certain embodiments, the
template nucleic acid may be a single stranded oligodeoxynucleotide (ssODN) or
a double stranded
oligodeoxynucleotide (dsODN). In certain embodiments, 5' and 3' homology arms,
and exemplary
full-length donor templates encoding alterations at the CCAAT box target
region are also presented
below (e.g., SEQ ID NOS: 974-995, 1040). In certain embodiments, the template
nucleic acid may be
a positive strand or a negative strand. In certain embodiments, the ssODN may
comprise a 5'
homology arm, a replacement sequence, and a 3' homology arm. In certain
embodiments, the 5'
homology arm may be about 25 to about 200 nucleotides or more in length, e.g.,
at least about 25, 50,
75, 100, 125, 150, 175, or 200 nucleotides in length; the replacement sequence
may comprise 0
nucleotides in length; and the 3' homology arm may be about 25 to about 200
nucleotides or more in
length, e.g., at least about 25, 50, 75, 100, 125, 150, 175, or 200
nucleotides in length. In certain
embodiments, the ssODN may comprise one or more phosphorothioates.
[0059] In certain embodiments, the genome editing systems, guide RNAs, and
CRISPR-mediated
methods for altering one or more y¨globin genes (e.g., HBG1, HBG2, or HBG1 and
HBG2), may
include an RNA-guided nuclease. In certain embodiments, the RNA-guided
nuclease may a Cpfl or
modified Cpfl as disclosed herein.
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0060] In one aspect, the disclosure relates to compositions including a
plurality of cells generated by
the methods disclosed above, in which at least 20%, 30%, 40%, 50%, 60%, 70%,
80% or 90% of the
cells include an alteration of a sequence of a 13 nt target region of the
human HBG1 or HBG2 gene or
a plurality of cells generated by the methods disclosed above, wherein at
least 20%, 30%, 40%, 50%,
60%, 70%, 80% or 90% of the cells include an alteration of a sequence of a 13
nt target region of the
human HBG1 or HBG2 gene. In certain embodiments, at least a portion of the
plurality of cells may
be within an erythroid lineage. In certain embodiments, the plurality of cells
may be characterized by
an increased level of fetal hemoglobin expression relative to an unmodified
plurality of cells. In
certain embodiments, the level of fetal hemoglobin may be increased by at
least 20%, 30%, 40%,
50%, 60%, 70%, 80% or 90%. In certain embodiments, the compositions may
further include a
pharmaceutically acceptable carrier.
[0061] The disclosure herein also relates to methods of altering a cells,
including contacting a cell
with any of the genome editing systems disclosed herein. In certain
embodiments, the step of
contacting the cell may comprise contacting the cell with a solution
comprising first and second
ribonucleoprotein complexes. In certain embodiments, the step of contacting
the cell with the
solution further comprises electroporating the cells, thereby introducing the
first and second
ribonucleoprotein complexes into the cell.
[0062] A genome editing system or method including any of all of the features
described above may
include a target nucleic acid comprising a human HBG1, HBG2 gene, or a
combination thereof. In
certain embodiments, the target region may be a CCAAT box target region of the
human HBG1,
HBG2 gene, or a combination thereof. In certain embodiments, the first
targeting domain sequence
may be complementary to a first sequence on a side of a CCAAT box target
region of the human
HBG1, HBG2 gene, or a combination thereof, in which the first sequence
optionally overlaps the
CCAAT box target region of the human HBG1, HBG2 gene, or a combination
thereof. In certain
embodiments, the second targeting domain sequence may be complementary to a
second sequence on
a side of a CCAAT box target region of the human HBG1, HBG2 gene, or a
combination thereof, in
which the second sequence optionally overlaps the CCAAT box target region of
the human HBG1,
HBG2 gene, or a combination thereof. In certain embodiments, the first
targeting domain may
comprise a truncation of a gRNA targeting domain. In certain embodiments, the
gRNA targeting
domain may include the gRNAs set forth in Table 8 or Table 9, and the gRNA
targeting domain has
been truncated from a 5' end of the gRNA targeting domain. In certain
embodiments, the first
targeting domain may be the same as or differs by no more than 3 nucleotides
from a dgRNA
targeting domain set forth in Table 8 or Table 9. In certain embodiments, the
second targeting
domain differs by no more than 3 nucleotides from a gRNA targeting domain set
forth in Table 8 or
Table 9. In certain embodiments, the indel may alter the CCAAT box target
region indel. In certain
embodiments, the indel may be a productive indel resulting in an increased
level of fetal hemoglobin
21
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
expression. In certain embodiments, the gRNA, dgRNA, or both may be in vitro
synthesized or
chemically synthesized.
[0063] In certain embodiments, a cell may include at least one modified allele
of the HBG locus
generated by any of the methods for altering a cell disclosed herein, in which
the modified allele of
the HBG locus comprises an alteration of the human HBG1 gene, HBG2, gene, or a
combination
thereof.
[0064] In certain embodiments, an isolated population of cells may be modified
by any of the
methods for altering a cells disclosed herein, wherein the population of cells
may include a
distribution of indels that may be different from an isolated population of
cells or their progenies of
the same cell type that have not been modified by the method.
[0065] In certain embodiments, a plurality of cells may be generated by any of
the methods for
altering a cells disclosed herein, in which at least 20%, 30%, 40%, 50%, 60%,
70%, 80%, or 90% of
the cells may include an alteration of a sequence in the CCAAT box target
region of the human HBG1
gene, HBG2 gene or a combination thereof.
[0066] In certain embodiments, the cells disclosed herein may be used for a
medicament. In certain
embodiments, the cells may be for use in the treatment of I3-hemoglobinopathy.
In certain
embodiments, I3-hemoglobinopathy may be selected from the group consisting of
sickle cell disease
and beta-thalassemia.
[0067] In one aspect, the disclosure relates to compositions including a
plurality of cells generated by
a method including a dgRNA disclosed above, in which at least 20%, 30%, 40%,
50%, 60%, 70%,
80% or 90% of the cells include an alteration of a sequence of a CCAAT box
target region of the
human HBG1 or HBG2 gene or a plurality of cells generated by the method
disclosed above, wherein
at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the cells include an
alteration of a sequence
of a CCAAT box target region of the human HBG1 or HBG2. In certain
embodiments, at least a
portion of the plurality of cells may be within an erythroid lineage. In
certain embodiments, the
plurality of cells may be characterized by an increased level of fetal
hemoglobin expression relative to
an unmodified plurality of cells. In certain embodiments, the level of fetal
hemoglobin may be
increased by at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In certain
embodiments, the
compositions may further include a pharmaceutically acceptable carrier.
[0068] In one aspect, the disclosure relates to a population of cells modified
by a genome editing
system including a dgRNA described above, wherein the population of cells
comprise a higher
percentage of a productive indel relative to a population of cells not
modified by the genome editing
system. The disclosure also relates to a population of cells modified by the
genome editing system
including a dgRNA described above, wherein a higher percentage of the
population of cells are
capable of differentiating into a population of cells of an erythroid lineage
that express HbF relative to
a population of cells not modified by the genome editing system. In certain
embodiments, the higher
22
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
percentage may be at least about 15%, at least about 20%, at least about 25%,
at least about 30%, or at
least about 40% higher. In certain embodiments, the cells may be hematopoietic
stem cells. In
certain embodiments, the cells may be capable of differentiating into an
erythroblast, erythrocyte, or a
precursor of an erythrocyte or erythroblast. In certain embodiments, the indel
may be created by a
repair mechanism other than microhomology-mediated end joining (MMEJ) repair.
[0069] The disclosure also relates to the use of any of the cells disclosed
herein in the manufacture of
a medicament for treating I3-hemoglobinopathy in a subject.
[0070] In one aspect, the disclosure relates to a method of treating a I3-
hemoglobinopathy in a subject
in need thereof, comprising administering to the subject the cells disclosed
herein. In certain
embodiments, a method of treating a I3-hemoglobinopathy in a subject in need
thereof, may include
administering a population of modified hematopoietic cells to the subject,
wherein one or more cells
have been altered according to the methods of altering a cell disclosed
herein. In certain
embodiments, the method may further comprise detecting progeny/daughter cells
of the administered
modified cells in the subject, e.g., in the form of BM-engrafted CD34+
hematopoietic stem cells or
blood cells derived from those (e.g., myeloid progenitor or differentiated
myeloid cells (e.g.,
erythrocyte, mast cells, myoblast); or lymphoid progenitors or differentiated
lymphoid cells (e.g., T-
or B- lymphocyte, or NK cell), e.g., at least [1, 2, 3, 4, 5, 6, 7, 8, 12, 16,
or 201 weeks, or at least [1, 2,
3, 4, 5, or 61 months, or at least [1, 2, 3, 4, or 5] years after
administration. In certain embodiments,
the method may result in a reconstitution of all hematopoietic cell lineages,
e.g., without any
differentiation bias, e.g., without an erythroid lineage differentiation bias.
In certain embodiments,
the method may comprise administering a plurality of edited cells, and the
method may result in long-
term engraftment [e.g., at least [1, 2, 3, 4, 5, 6, 7, 8, 12, 16, or 201
weeks, or at least [1, 2, 3, 4, 5, or 61
months, or at least [1, 2, 3, 4, or 5] years after administration] of a
plurality of [at least 5, 10, 15, 20,
25, ... 1001 different HSC clones in the BM. In certain embodiments, the
method may further
comprise detecting the level of total hemoglobin expression in the subject, at
least [1, 2, 3, 4, 5, 6, 7,
8, 12, 16, or 201 weeks, or at least [1, 2, 3, 4, 5, or 61 months, or at least
[1, 2, 3, 4, or 5] years after
administration. In certain embodiments, the method may result in long-term
expression [e.g., at least
[1, 2, 3, 4, 5, 6, 7, 8, 12, 16, or 201 weeks, or at least [1, 2, 3, 4, 5, or
61 months, or at least [1, 2, 3, 4,
or 5] years after administration] of [at least 50%, at least 60%... at least
99%1 of total hemoglobin as
compared to a healthy subject (e.g., as total Hb (e.g., HbA and HbF (if any)
combined)). In certain
embodiments, the alteration may comprise an indel within a CCAAT box target
region of the
promoter of the HBG gene.
[0071] In one aspect, the disclosure relates to a genome editing system,
comprising: an RNA-guided
nuclease; and a first guide RNA, in which the first guide RNA may comprise a
first targeting domain
that is complementary to a first sequence on a side of a CCAAT box target
region of a human HBG1,
HBG2 gene, or a combination thereof, in which the first sequence optionally
overlaps the CCAAT
23
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
box target region of the human HBG1, HBG2 gene, or a combination thereof In
certain
embodiments, the genome editing system may further comprise a template nucleic
acid encoding an
alteration of the CCAAT box target region of a human HBG1, HBG2 gene, or a
combination thereof
In certain embodiments, the template nucleic acid may be a single stranded
oligodeoxynucleotide
(ssODN) or a double stranded oligodeoxynucleotide (dsODN). In certain
embodiments, the ssODN
may comprise a 5' homology arm, a replacement sequence, and a 3' homology arm.
In certain
embodiments, the homology arms may be symmetrical in length. In certain
embodiments, the
homology arms may be asymmetrical in length. In certain embodiments, the ssODN
may comprise
one or more phosphorothioate modifications. In certain embodiments, the one or
more
phosphorothioate modifications may be at the 5' end, the 3' end or a
combination thereof In certain
embodiments, the ssODN may be a positive or negative strand. In certain
embodiments, the alteration
may be a non-naturally occurring alteration. In certain embodiments, the
alteration may comprise a
deletion of the CCAAT box target region. In certain embodiments, the deletion
may comprise a 18 nt
deletion, a 11 nt deletion, a 4 nt deletion, a 1 nt deletion, or a combination
thereof. In certain
embodiments, the CCAAT box target region may comprise a 18 nt target region, a
11 nt target region,
a 4 nt target region, a 1 nt target region, or a combination thereof In
certain embodiments, the 5'
homology arm may be about 25 to about 200 or more nucleotides in length, e.g.,
at about least 25, 50,
75, 100, 125, 150, 175, or 200 nucleotides in length; the replacement sequence
may comprise 0
nucleotides in length; and the 3' homology arm may be about 25 to about 200 or
more nucleotides in
length, e.g., at least about 25, 50, 75, 100, 125, 150, 175, or 200
nucleotides in length. In certain
embodiments, the 5' homology arm may comprise about 50 to 100 bp, e.g., 55 to
95, 60 to 90, 70 to
90, or 80 to 90 bp, homology 5' of the 18 nt target region and the 3' homology
arm may comprise
about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp,
homology 3' of the 18 nt target
region. In certain embodiments, the ssODN may comprise, may consist
essentially of, or may consist
of SEQ ID NO:974 or SEQ ID NO:975. In certain embodiments, the 5' homology arm
may comprise
about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp,
homology 5' of the 11 nt target
region and the 3' homology arm may comprise about 50 to 100 bp, e.g., 55 to
95, 60 to 90, 70 to 90,
or 80 to 90 bp, homology 3' of the 11 nt target region. In certain
embodiments, the ssODN may
comprise, may consist essentially of, or may consist of SEQ ID NO:976 or SEQ
ID NO:978. In
certain embodiments, the 5' homology arm may comprise about 50 to 100 bp,
e.g., 55 to 95, 60 to 90,
70 to 90, or 80 to 90 bp, homology 5' of the 4 nt target region and the 3'
homology arm may comprise
about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp,
homology 3' of the 4 nt target
region. In certain embodiments, the ssODN may comprise, may consist
essentially of, or may consist
of a sequence selected from the group consisting of SEQ ID NO:984, SEQ ID
NO:985, SEQ ID
NO:986, SEQ ID NO:987, SEQ ID NO:988, SEQ ID NO:989, SEQ ID NO:990, SEQ ID
NO:991,
SEQ ID NO:992, SEQ ID NO:993, SEQ ID NO:994, and SEQ ID NO:995. In certain
embodiments,
24
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
the 5' homology arm may comprise about 50 to 100 bp, e.g., 55 to 95, 60 to 90,
70 to 90, or 80 to 90
bp, homology 5' of the 1 nt target region and the 3' homology arm may comprise
about 50 to 100 bp,
e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp, homology 3' of the 1 nt
target region. In certain
embodiments, the homology arms may be symmetrical in length. In certain
embodiments, the ssODN
may comprise, may consist essentially of, or may consist of SEQ ID NO:982 or
SEQ ID NO:983. In
certain embodiments, the alteration may be a naturally occurring alteration.
In certain embodiments,
the alteration may comprise a deletion or mutation of the CCAAT box target
region. In certain
embodiments, the CCAAT box target region may comprise a 13 nt target region, -
117G>A target
region, or a combination thereof In certain embodiments, the alteration may
comprise a 13 nt
deletion at the 13 nt target region or a substitution from G to A at the -
117G>A target region, or a
combination thereof. In certain embodiments, the 5' homology arm may comprise
about 50 to 100
bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp, homology 5' of the 13
nt target region and the 3'
homology arm may comprise about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to
90, or 80 to 90 bp,
homology 3' of the 13 nt target region. In certain embodiments, the ssODN may
comprise, may
consist essentially of, or may consist of SEQ ID NO:977 or SEQ ID NO:979. In
certain
embodiments, the 5' homology arm may comprise about 50 to 100 bp, e.g., 55 to
95, 60 to 90, 70 to
90, or 80 to 90 bp, homology 5' of the 13 nt target region and the 3' homology
arm may comprise
about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp,
homology 3' of the 13 nt target
region. In certain embodiments, the ssODN may comprise, may consist
essentially of, or may consist
of SEQ ID NO:980 or SEQ ID NO:981. In certain embodiments, the RNA-guided
nuclease may be
an S. pyo genes Cas9. In certain embodiments, the RNA-guided nuclease may be a
Cpfl variant as
disclosed herein. In certain embodiments, the first targeting domain may
differ by no more than 3
nucleotides from a targeting domain listed in Table 12, Table 13 or a gRNA in
Table 13. In certain
embodiments, the genome editing system may further comprise a second guide
RNA, wherein the
second guide RNA may comprise a second targeting domain that may be
complementary to a second
sequence on a side of a CCAAT box target region of a human HBG1, HBG2 gene, or
a combination
thereof, wherein the second sequence optionally overlaps the CCAAT box target
region of the human
HBG1, HBG2 gene, or a combination thereof In certain embodiments, the RNA-
guided nuclease
may be a nickase, and optionally lacks RuvC activity. In certain embodiments,
the genome editing
system may comprise first and second RNA-guided nucleases. In certain
embodiments, the first and
second RNA-guided nucleases may be complexed with the first and second guide
RNAs, respectively,
forming first and second ribonucleoprotein complexes. In certain embodiments,
the genome editing
system may further comprise a third guide RNA; and optionally a fourth guide
RNA, wherein the
third and fourth guide RNAs may comprise third and fourth targeting domains
complimentary to third
and fourth sequences on opposite sides of positions of a GATA1 binding motif
in BCL11A erythroid
enhancer (BCL11Ae) of a human BCL11A gene, wherein one or both of the third
and fourth sequences
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
optionally overlaps the GATA1 binding motif in BCL11Ae of the human BCL11A
gene. In certain
embodiments, the genome editing system may further comprise a nucleic acid
template encoding a
deletion of the GATA1 binding motif in BCL11Ae. In certain embodiments, the
RNA-guided
nuclease may be an S. pyogenes Cas9. In certain embodiments, the RNA-guided
nuclease may be a
nickase, and optionally lacks RuvC activity. In certain embodiments, the third
targeting domain may
be complimentary to a sequence within 1000 nucleotides upstream of the GATA1
binding motif in
BCL11Ae. In certain embodiments, the third targeting domain may be
complimentary to a sequence
within 100 nucleotides upstream of the GATA1 binding motif in BCL11Ae. In
certain embodiments,
one of the third and fourth targeting domains may be complimentary to a
sequence within 100
nucleotides downstream of the GATA1 binding motif in BCL11Ae. In certain
embodiments, the
fourth targeting domain may be complimentary to a sequence within 50
nucleotides downstream of
the GATA1 binding motif in BCL11Ae. In certain embodiments, genome editing
system may
comprise first and second RNA-guided nucleases. In certain embodiments, the
first and second RNA-
guided nucleases may be complexed with the third and fourth guide RNAs,
respectively, forming
third and fourth ribonucleoprotein complexes.
[0072] In one aspect, the disclosure relates to a method of altering a cell
comprising contacting a cell
with a genome editing system. In certain embodiments, the step of contacting
the cell with the
genome editing system may comprise contacting the cell with a solution
comprising first and second
ribonucleoprotein complexes. In certain embodiments, the step of contacting
the cell with the
solution may further comprise electroporating the cells, thereby introducing
the first and second
ribonucleoprotein complexes into the cell. In certain embodiments, the method
of altering a cell may
further comprise contacting the cell with a genome editing system, wherein the
step of contacting the
cell with the genome editing system may comprise contacting the cell with a
solution comprising first,
second, third, and optionally, fourth ribonucleoprotein complexes. In certain
embodiments, the step
of contacting the cell with the solution may further comprise electroporating
the cells, thereby
introducing the first, second, third, and optionally, fourth ribonucleoprotein
complexes into the cell.
In certain embodiments, the cell may be capable of differentiating into an
erythroblast, erythrocyte, or
a precursor of an erythrocyte or erythroblast. In certain embodiments, the
cell may be a CD34+ cell.
[0073] In one aspect, the disclosure relates to a CRISPR-mediated method of
altering a cell,
comprising: introducing a first DNA single strand break (SSB) or double strand
break (DSB) within a
genome of the cell between positions c.-106 to -120 of a human HBG1 or HBG2
gene; and optionally
introducing a second SSB or DSB within the genome of the cell between
positions c.-106 to -120 of
the human HBG1 or HBG2 gene, wherein the first and second SSBs or DSBs may be
repaired by the
cell in a manner that alters a CCAAT box target region of the human HBG1 or
HBG2 gene. In certain
embodiments, the first and second SSBs or DSBs may be repaired by the cell in
a manner that results
in the alteration of a CCAAT box target region of the human HBG1 or HBG2 gene.
In certain
26
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
embodiments, the CRISPR-mediated method may further comprise a template
nucleic acid encoding
the alteration of the CCAAT box target region of a human HBG1, HBG2 gene, or a
combination
thereof. In certain embodiments, the template nucleic acid may be a single
stranded
oligodeoxynucleotide (ssODN). In certain embodiments, the ssODN may comprise a
5' homology
arm, a replacement sequence, and a 3' homology arm. In certain embodiments,
the ssODNs may be a
positive or negative strand. In certain embodiments, the alteration may be a
non-naturally occurring
alteration. In certain embodiments, the first and second SSBs or DSBs may be
repaired by the cell in
a manner that results in the formation of at least one of an indel, a
deletion, or an insertion in the
CCAAT box target region of the human HBG1 or HBG2 gene. In certain
embodiments, the CCAAT
box target region may comprise a 18 nt target region, a 11 nt target region, a
4 nt target region, a 1 nt
target region, or a combination thereof In certain embodiments, the 5'
homology arm may be about
25 to about 200 nucleotides or more in length, e.g., at least about 25, 50,
75, 100, 125, 150, 175, or
200 nucleotides in length; the replacement sequence may comprise 0 nucleotides
in length; and the 3'
homology arm may be about 25 to about 200 nucleotides or more in length, e.g.,
at least about 25, 50,
75, 100, 125, 150, 175, or 200 nucleotides in length. In certain embodiments,
the 5' homology arm
may comprise about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to
90 bp, homology 5' of the
18 nt target region, the 11 nt target region, the 4 nt target region, or the 1
nt target region and the 3'
homology arm may comprise about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to
90, or 80 to 90 bp,
homology 3' of 18 nt target region, the 11 nt target region, the 4 nt target
region, or the 1 nt target
region. In certain embodiments, the ssODN may comprise, may consist
essentially of, or may consist
of a sequence selected from the group consisting of SEQ ID NO:974, SEQ ID
NO:975, SEQ ID
NO:976, SEQ ID NO:978, SEQ ID NO:984, SEQ ID NO:985, SEQ ID NO:986, SEQ ID
NO:987,
SEQ ID NO:988, SEQ ID NO:989, SEQ ID NO:990, SEQ ID NO:991, SEQ ID NO:992, SEQ
ID
NO:993, SEQ ID NO:994, SEQ ID NO:995, SEQ ID NO:982 and SEQ ID NO:983. In
certain
embodiments, the alteration may be a non-naturally occurring alteration. In
certain embodiments, the
first and second SSBs or DSBs may be repaired by the cell in a manner that
results in the formation of
at least one of an indel, a deletion, or an insertion in the CCAAT box target
region of the human
HBG1 or HBG2 gene. In certain embodiments, the CCAAT box target region may
comprise a 13 nt
target region, -117G>A target region, or a combination thereof In certain
embodiments, the
alteration may comprise a 13 nt deletion at the 13 nt target region or a
substitution from G to A at the
-117G>A target region, or a combination thereof In certain embodiments, the 5'
homology arm may
comprise about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90
bp, homology 5' of the 13
nt target region or the -117G>A target region and the 3' homology arm may
comprise about 50 to 100
bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp, homology 3' of the 13
nt target region or the -
117G>A target region. In certain embodiments, the ssODN may comprise, may
consist essentially of,
27
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
or may consist of a sequence selected from the group consisting of SEQ ID
NO:977 or SEQ ID
NO:979. SEQ ID NO:980 or SEQ ID NO:981.
[0074] In one aspect, the disclosure relates to a composition that may
comprise a plurality of cells
generated by a method of altering a cell disclosed herein, wherein at least
20%, 30%, 40%, 50%, 60%,
70%, 80% or 90% of the cells may comprise an alteration of a sequence of a
CCAAT box target
region of the human HBG1 gene, HBG2 gene, or a combination thereof. In certain
embodiments, the
alteration may comprise a 18 nt deletion, a 11 nt deletion, a 4 nt deletion, a
1 nt deletion, a 13 nt
deletion, a substitution from G to A at the -117, of the human HBG1 gene, HBG2
gene, or a
combination thereof In certain embodiments, at least a portion of the
plurality of cells may be within
an erythroid lineage. In certain embodiments, the plurality of cells may be
characterized by an
increased level of fetal hemoglobin expression relative to an unmodified
plurality of cells. In certain
embodiments, the level of fetal hemoglobin may be increased by at least 20%,
30%, 40%, 50%, 60%,
70%, 80% or 90%. In certain embodiments, the composition may further comprise
a
pharmaceutically acceptable carrier.
[0075] In one aspect, the disclosure relates to a cell comprising a synthetic
genotype generated by a
method of altering a cell disclosed herein, wherein the cell may comprise a 18
nt deletion, a 11 nt
deletion, a 4 nt deletion, a 1 nt deletion, a 13 nt deletion, a substitution
from G to A at the -117, of the
human HBG1 gene, HBG2 gene, or a combination thereof
[0076] In one aspect, the disclosure relates to a cell comprising at least one
allele of the HBG locus
generated by a method of altering a cell disclosed herein, wherein the cell
may encode a 18 nt
deletion, a 11 nt deletion, a 4 nt deletion, a 1 nt deletion, a 13 nt
deletion, a substitution from G to A at
the -117, of the human HBG1 gene, HBG2 gene, or a combination thereof
[0077] In one aspect, the disclosure relates to an AAV vector that may
comprise a template nucleic
acid encoding a non-naturally occurring alteration of a CCAAT box target
region of a human HBG1,
HBG2 gene, or a combination thereof In certain embodiments, the template
nucleic acid may be a
single stranded oligodeoxynucleotide (ssODN). In certain embodiments, the
CCAAT box target
region may comprise a 18 nt target region, a 11 nt target region, a 4 nt
target region, a 1 nt target
region, or a combination thereof In certain embodiments, the ssODN may
comprise a 5' homology
arm, a replacement sequence, and a 3' homology arm. In certain embodiments,
the 5' homology arm
may be about 25 to about 200 or more nucleotides in length, e.g., at least
about 25, 50, 75, 100, 125,
150, 175, or 200 nucleotides in length; the replacement sequence may comprise
0 nucleotides in
length; and the 3' homology arm may be about 25 to about 200 or more
nucleotides in length, e.g., at
least about 25, 50, 75, 100, 125, 150, 175, or 200 nucleotides in length. In
certain embodiments, the
5' homology arm may comprise about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70
to 90, or 80 to 90 bp,
homology 5' of the 18 nt target region, the 11 nt target region, the 4 nt
target region, or the 1 nt target
region and the 3' homology arm may comprise about 50 to 100 bp, e.g., 55 to
95, 60 to 90, 70 to 90,
28
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
or 80 to 90 bp, homology 3' of 18 nt target region, the 11 nt target region,
the 4 nt target region, or the
1 nt target region. In certain embodiments, the ssODN may comprise, may
consist essentially of, or
may consist of a sequence selected from the group consisting of SEQ ID NO:974-
976, SEQ ID
NO:978, SEQ ID NO:982-995.
[0078] In one aspect, the disclosure relates to a nucleotide sequence
comprising a template nucleic
acid encoding a non-naturally occurring alteration of a CCAAT box target
region of a human HBG1,
HBG2 gene, or a combination thereof In certain embodiments, the template
nucleic acid may be a
single stranded oligodeoxynucleotide (ssODN) or a double stranded
oligodeoxynucleotide (dsODN)
comprising the alteration. In certain embodiments, the CCAAT box target region
may comprise a 18
nt target region, a 11 nt target region, a 4 nt target region, a 1 nt target
region, or a combination
thereof In certain embodiments, the ssODN may comprise a 5' homology arm, a
replacement
sequence, and a 3' homology arm. In certain embodiments, the 5' homology arm
may be about 25 to
about 200 or more nucleotides in length, e.g., at least about 25, 50, 75, 100,
125, 150, 175, or 200
nucleotides in length; the replacement sequence may comprise 0 nucleotides in
length; and the 3'
homology arm may be about 25 to about 200 or more nucleotides in length, e.g.,
at least about 25, 50,
75, 100, 125, 150, 175, or 200 nucleotides in length. In certain embodiments,
the 5' homology arm
may comprise about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to
90 bp, homology 5' of the
18 nt target region, the 11 nt target region, the 4 nt target region, or the 1
nt target region and the 3'
homology arm may comprise about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to
90, or 80 to 90 bp,
homology 3' of 18 nt target region, the 11 nt target region, the 4 nt target
region, or the 1 nt target
region. In certain embodiments, the ssODN may comprise, may consist
essentially of, or may consist
of a sequence selected from the group consisting of SEQ ID NO:974-976, SEQ ID
NO:978, SEQ ID
NO:982-995.
[0079] In one aspect, the disclosure relates to a cell comprising a synthetic
genotype, wherein the cell
may comprise a 18 nt deletion, a 11 nt deletion, a 4 nt deletion, a 1 nt
deletion, a 13 nt deletion, a
substitution from G to A at the -117, of the human HBG1 gene, HBG2 gene, or a
combination thereof
[0080] In one aspect, the disclosure relates to a composition, comprising a
population of cells
generated by a method of altering a cell disclosed herein, wherein the cells
comprise a higher
frequency of an alteration of a sequence of a CCAAT box target region of the
human HBG1 gene,
HBG2 gene, or a combination thereof relative to an unmodified population of
cells. In certain
embodiments, the higher frequency is at least about 10%, 20%, 30%, 40%, 50%,
60%, 70%, 80% or
90% higher. In certain embodiments, the alteration comprises a 18 nt deletion,
a 11 nt deletion, a 4 nt
deletion, a 1 nt deletion, a 13 nt deletion, a substitution from G to A at the
-117, of the human HBG1
gene, HBG2 gene, or a combination thereof. In certain embodiments, at least a
portion of the
population of cells are within an erythroid lineage.
29
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0081] This listing is intended to be exemplary and illustrative rather than
comprehensive and
limiting. Additional aspects and embodiments may be set out in, or apparent
from, the remainder of
this disclosure and the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0082] The accompanying drawings are intended to provide illustrative, and
schematic rather than
comprehensive, examples of certain aspects and embodiments of the present
disclosure. The
drawings are not intended to be limiting or binding to any particular theory
or model, and are not
necessarily to scale. Without limiting the foregoing, nucleic acids and
polypeptides may be depicted
as linear sequences, or as schematic two- or three-dimensional structures;
these depictions are
intended to be illustrative rather than limiting or binding to any particular
model or theory regarding
their structure.
[0083] Fig. 1 depicts, in schematic form, HBG1 and HBG2 gene(s) in the context
of the 13-globin
gene cluster on human chromosome 11. Fig. 1. Each gene in the 13-globin gene
cluster is
transcriptionally regulated by a proximal promoter. While not wishing to be
bound by any particular
theory, it is generally thought that Ay and/or Gy expression is activated by
engagement between the
proximal promoter with the distal strong erythroid-specific enhancer, the
locus control region (LCR).
Long-range transactivation by the LCR is thought to be mediated by alteration
of chromatin
configuration/confirmation. The LCR is marked by 4 erythroid specific Dnase I
hypersensitive sites
(HS1-4) and 2 distal enhancer elements (5' HS and 3' HSI). 13-like gene globin
gene expression is
regulated in a developmental stage-specific manner, and expression of globin
genes changes coincide
with changes in the main site of blood production.
[0084] Figs. 2A-2B depict HBG1 and HBG2 genes, coding sequences (CDS) and
small deletions and
point mutations in and upstream of the HBG1 and HBG2 proximal promoters that
have been identified
in patients and associated with elevation of fetal hemoglobin (HbF). Core
elements within the
proximal promoters (CAAT box, 13 nt sequence) that have been deleted in some
patients with
hereditary persistence of fetal hemoglobin (HPFH). The 'target sequence'
region of each locus, which
has been screened for gRNA binding target sites, is also identified.
[0085] Fig. 3 depicts gene editing of HBG of mPB CD34+ cells electroporated
with variants of
Acidaminococcus sp. Cpfl ("AsCpfl"), namely His-AsCpfl-nNLS (SEQ ID NO:1000)
and His-
AsCpfl-sNLS-sNL S (SEQ ID NO:1001) complexed with the guide RNA HBG1-1
(0LI13620)
(Table 6) ("His-AsCpfl-nNLS_HBG1-1 RNP" and "His-AsCpfl-sNLS-sNLS_HBG1-1
RNP"). The
RNP were electroporated at 5 itM or 20 M.
[0086] Figs. 4A-4C depict gene editing of HBG of mPB CD34+ cells
electroporated with His-
AsCpfl-sNLS-sNLS_HBG1-1 RNP alone or with various ssODNs. Fig. 4A depicts the
percentage
of indels detected by sequencing the HBG PCR product 72 hours after
electroporation with His-
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
AsCpfl-sNLS-sNLS_HBG1-1 RNP alone or with 011164324 ("-4nt - strand"),
01116430 ("-4 nt +
strand"), 01116410 ("-18 nt - strand"), or 01116409 ("-18 nt + strand") (Table
7). Fig. 4B depicts
the percentage of the precise 18 nucleotide deletion indels detected by
sequencing the HBG PCR
product 72 hours after electroporation with His-AsCpfl-sNLS-sNLS_HBG1-1 RNP
alone or with
01116410 ("-18 nt - strand") or 01116409 ("-18 nt + strand"). Fig. 4C depicts
the percentage of the
precise 18 nt deletion within all indels detected by sequencing the HBG PCR
product 72 hours after
electroporation with His-AsCpfl-sNLS-sNLS_HBG1-1 RNP alone or with 0LI16410 ("-
18 nt -
strand") or 01116409 ("-18 nt + strand").
[0087] Figs. 5A-5F depict schematics of the HBG1-1 target region and S.
Pyogenes Cas9 gRNA
pairs used in combination. Fig. 5A shows the target region of HBG1-1 gRNA
(comprising the RNA
targeting domain set forth in SEQ ID NO:1002, Table 9). The distal CCAAT box
of HBG promoter
(i.e., HBG1/2 c.-111 to -115) is indicated by a grey box. Fig. 5B shows the
target region of HBG1-1,
the distal CCAAT box of HBG, and the target region SpA gRNA (comprising the
targeting domain of
SEQ ID NO:941, Table 9). Fig. 5C shows the target region of HBG1-1, the distal
CCAAT box of
HBG, and the target region SpG gRNA (comprising the targeting domain of SEQ ID
NO:359, Table
9). Fig. 5D shows the target region of HBG1-1, the distal CCAAT box of HBG,
the target region of
tSpA dead gRNA ("dgRNA") (comprising the targeting domain of SEQ ID NO:326,
Table 9), and the
target region of Sp182 dgRNA (comprising the targeting domain of SEQ ID
NO:1028, Table 9). Fig.
5E shows the target region of HBG1-1, the distal CCAAT box of HBG, and tSpA
dgRNA
(comprising the targeting domain of SEQ ID NO:326, Table 9). Fig. 5F shows the
target region of
HBG1-1, the distal CCAAT box of HBG, and the target region of Sp182 dgRNA
(comprising the
targeting domain of SEQ ID NO:1028, Table 9).
[0088] Figs. 6A-6B depict HbF expression achieved by ex vivo editing of mPB
CD34+ cells using
HBG1-1-AsCpfl-RNP targeting the HBG promotor region. Fig. 6A shows results of
editing at the
HBG promoter region following delivery of 5 itM or 20 itM HBG1-1-AsCpfl-RNP (
"HBG-1-1") via
Amaxa electroporation in mPB CD34+ cells. Delivery of 20 itM HBG1-1-AsCpfl-RNP
via Amaxa
electroporation results in up to ¨43% editing, and 21% HbF induction (above
background levels).
HbF levels are represented by black circles depicting expression levels of
gamma-globin chains over
total beta-like globin chains (gamma chains/[gamma chains + beta chain]) as
measured by UPLC
analysis on the erythroid progeny of mPB CD34+ cells. Grey bars depict the
percentage of indels 72
hours post-electroporation detected by next generation sequencing (NGS) of the
HBG PCR product.
Fig. 6B shows results of editing at the HBG promoter region following delivery
of 5 itM or 20 itM
HBG1-1-AsCpfl-RNP ("HBG-1-1") via MaxCyte electroporation in mPB CD34+ cells.
Delivery of
20 itM HBG1-1-AsCpfl-RNP via MaxCyte electroporation results in up to ¨16%
editing, and 7%
HbF induction (above background levels). HbF levels are represented by black
circles depicting
expression levels of gamma-globin chains over total beta-like globin chains
(gamma chains/[gamma
31
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
chains + beta chain]) as measured by UPLC analysis on the erythroid progeny of
mPB CD34+ cells.
Grey bars depict the percentage of indels 72 hours post-electroporation
detected by NGS of the HBG
PCR product.
[0089] Fig. 7 depicts enhanced editing by HBG1-1-AsCpf1H800A-RNP at the HBG
promotor region
on the Maxcyte device by co-delivering various S. Pyogenes Cas9 WT or Cas9D10A
RNPs. "S.Py
DlOA" represents the Cas9 DlOA nickase protein and "S.Py WT" represents the
Cas9 WT protein.
RNPs tested include SpA-D10A-RNP, SpG-D10A-RNP, tSpA-Cas9-RNP, Sp182-Cas9-RNP,
and
tSpA-Cas9-RNP + Sp182-Cas9-RNP (Table 8). Total editing at the HBG promoter
region (grey bars)
and the associated HbF protein induction (black circles) following delivery of
HBG1-1-
AsCpf1H800A-RNP alone ("HBG1-1"), or in combination with S. Pyogenes Cas9 RNPs
or pairs of
RNP, is depicted. HbF levels are represented by black circles depicting
expression levels of gamma-
globin chains over total beta-like globin chains (gamma chains/[gamma chains +
beta chain]) as
measured by UPLC analysis on the erythroid progeny of mPB CD34+ cells. Grey
bars depict the
percentage of indels detected by NGS of the HBG PCR product.
[0090] Fig. 8 depicts viability of mPB CD34+ cells following MaxCyte delivery
of HBG1-1-
AsCpf1H800A-RNP alone ("HBG1-1") or in combination with various S. Pyogenes
Cas9 WT or
Cas9D10A RNPs. "S.Py DlOA" represents the Cas9 DlOA nickase protein and "S.Py
WT"
represents the Cas9 WT protein. RNPs tested include SpA-D10A-RNP, SpG-D10A-
RNP, tSpA-
Cas9-RNP, Sp182-Cas9-RNP, and tSpA-Cas9-RNP + Sp182-Cas9-RNP (Table 8).
Viability was
measured by DAPI staining and flow cytometry analysis at 24h post
electroporation.
[0091] Figs. 9A-9B depict the cleavage sites of HBG1-1-AsCpf1H800A-RNP and
D10A-Cas9 RNP
at the target region and the editing profile resulting from the co-delivery of
the HBG1-1-
AsCpf1H800A-RNP with a DlOA RNP. Fig. 9A depicts the position of the HBG1-1-
AsCpf1H800A-
RNP cut sites on each strand of the target region (light grey arrows), as well
as position of the nicking
site targeted by the SpG-D10A-RNP and SpA-D10A-RNP (dark arrows) (Table 8).
Fig. 9B depicts
the editing profile resulting from the co-delivery of the HBG1-1-AsCpf1H800A-
RNP ("HBG1-1
RNP") with either SpG-D10A-RNP ("spG RNP") or SpA-D10A-RNP ("spA RNP") in mPB
CD34+
at 72h post-electroporation as detected by NGS analysis of the HBG PCR product
(Table 8). The X-
axis represents genomic position of the center of the indel relative to the
HBG1-1-AsCpf1H800A-
RNP positive strand cleavage site. The Y axis represents the length of the
indel, where deletions are
represented as negative values and insertions are represented as positive
values. The total frequency
of each indel is represented by the area of the symbol. Indels occurring at
frequency equal or above
0.1% are depicted. The SpG and SpA target sites are indicated by dotted lines.
[0092] Figs. 10A-10B depict that the co-delivery of 5p182-Cas9-RNP with HBG1-1-
AsCpf1H800A-
RNP results in a boost in total indels and in distal CCAAT box disrupting
indels with no substantial
alteration of the indel profile, as detected by NGS analysis of the HBG PCR
product at 72h post-
32
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
electroporation. Fig. 10A shows the indel profiles following editing with HBG1-
1-AsCpf1H800A-
RNP ("HBG1-1 RNP") alone, or in combination with Sp182-Cas9-RNP ("sp182 RNP").
The X-axis
represents genomic position of the center of the indel relative to the HBG1-1-
AsCpf1H800A-RNP
positive strand cleavage site. The Y axis represents the length of the indel,
where deletions are
represented as negative values and insertions are represented as positive
values. The total frequency of
each indel is represented by the area of the symbol. Indels occurring at
frequency equal or above
0.1% are depicted. The Sp182 target site is indicated by a dotted line. Fig.
10B depicts the frequency
of indels disrupting either none, lnt, 2nt, 3nt, 4nt, or the entire 5nt of the
distal CCAAT box sequence.
[0093] Fig. 11 depicts that optimal doses of HBG1-1-AsCpf1H800A-RNP co-
delivered with Sp182-
Cas9-RNP result in an increase in total editing, and HbF production (Table 8).
Delivery of HBG1-1-
AsCpf1H800A-RNP ("HBG1-1") as an RNP pair alongside Sp182-Cas9-RNP ("Sp182"),
achieved
>92% editing (grey bars) at the HBG promoter region with up to 34% HbF
induction (above
background) (black circles). No editing was observed when Sp182-Cas9-RNP was
delivered alone at
1204. HbF levels are represented by black circles depicting expression levels
of gamma-globin
chains over total beta-like globin chains (gamma chains/[gamma chains + beta
chain]) as measured by
UPLC analysis on the erythroid progeny of mPB CD34+ cells. Grey bars depict
the percentage of
indels detected by NGS of the HBG PCR product.
[0094] Fig. 12 depicts the distribution of levels of gamma chain expression
over total beta-like
chains (gamma chains/[gamma chains + beta chain]) as measured by UPLC in the
clonal erythroid
progeny of single human mPB CD34+ cells edited at the HBG promotor region with
HBG1-1-
AsCpf1H800A-RNP in combination with Sp182-Cas9-RNP (Table 8). Each black
circle represents
the gamma-globin protein level detected in a clonal erythroid population
derived from a single cell,
isolated by FACS sorting at 48h post electroporation.
[0095] Figs. 13A-13C depicts total editing, HbF production, viability, and
colony forming potential
after co-delivery of RNP containing modified HBG1-1 gRNA (SEQ ID NO:1041,
Table 8)
complexed to His-AsCpfl-sNLS-sNLS H800A (SEQ ID NO:1032, Table 8) ("His-AsCpfl-
sNLS-
sNLS H800A_HBG1-1 RNP," represented as "HBG1-1" in Figs. 13A-C) with
increasing
concentrations of ssODN OLI16431 (SEQ ID NO:1040, Table 7) (represented as
"OLI16431" in
Figs. 13A-C) (Table 7). Fig. 13A depicts editing at the distal CAATT box (grey
bars) and HbF
induction (black circles) after co-delivery of 6 itM His-AsCpfl-sNLS-sNLS
H800A_HBG1-1 RNP
and increasing concentrations of ssODN 01116431. HbF levels are represented by
black circles
depicting expression levels of gamma-globin chains over total beta-like globin
chains (gamma
chains/[gamma chains + beta chain]) as measured by UPLC analysis on the
erythroid progeny of mPB
CD34+ cells. Grey bars depict the percentage of indels detected by NGS of the
HBG PCR product.
Fig. 13B depicts viability of mPB CD34+ cells following delivery of His-AsCpfl-
sNLS-sNLS
H800A_HBG1-1 RNP alone or in combination with increasing doses of ssODN
01116431. Viability
33
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
was measured by DAPI exclusion at 72 hours post electroporation. Fig. 13C
depicts the
hematopoietic activity of the "HBG1-1" RNP and ssODN OLI16431 treated and
donor matched
untreated control CD34+ cells in colony forming cell (CFC) assays. CFCs shown
are per 800 CD34+
cells plated. The number and subtype of colonies are indicated (GEMM:
granulocyte-erythroid-
monocyte-macrophage colony (black), GM: granulocyte-macrophage colony (dark
grey), E: erythroid
colony (light grey)).
[0096] Figs. 14A-14B depicts total editing, HbF production, and viability
results using different
concentrations of RNP containing unmodified HBG1-1 gRNA (SEQ ID NO:1022, Table
8)
complexed to His-AsCpfl-sNLS-sNLS H800A (SEQ ID NO:1032, Table 8) ("His-AsCpfl-
sNLS-
sNLS H800A_HBG1-1 RNP," represented as "HBG1-1" in Figs. 14A-B) co-delivered
with different
concentrations of ssODN OLI16431 (SEQ ID NO:1040, Table 7) (represented as
"OLI16431" in
Figs. 14A-B) (Table 7). Fig. 14A depicts editing at the distal CAATT box
(black bars (48 hours) and
light grey bars (14 days of erythroid culture)) and HbF induction (black
circles) after co-delivery of
His-AsCpfl-sNLS-sNLS H800A_HBG1-1 RNP ("HBG1-1") and ssODN 01116431 at varying
concentrations. HbF levels are represented by black circles depicting
expression levels of gamma-
globin chains over total beta-like globin chains (gamma chains/[gamma chains +
beta chain]) as
measured by UPLC analysis on the erythroid progeny of mPB CD34+ cells. Bars
depict the
percentage of indels detected by NGS of the HBG PCR product at 48 hours
(black) and 14 day
erythroid culture (light grey) timepoints. Fig. 14B depicts viability of mPB
CD34+ cells following
delivery of His-AsCpfl-sNLS-sNLS H800A_HBG1-1 RNP alone ("HBG1-1"), ssODN
OLI16431
alone, or in combination with varying doses of HBG1-1 and 01116431. Viability
was measured by
DAPI exclusion at 48 hours post electroporation and after 14 days in erythroid
culture. Following
the editing of mPB CD34+ cells, ex vivo differentiation into the erythroid
linage was performed for 18
days (Giarratana 2011). At day 14 of culture, a subset of cells were isolated
and viability (DAPI
exclusion) and editing (NGS of the HBG PCR product) measurements were taken.
[0097] Fig. 15 depicts editing by RNP in mPB CD34+ cells. RNPs included gRNA
complexed with
Cpfl protein as set forth in Table 15. Illumina sequencing was performed on
isolated genomic DNA
at 72 hours post electroporation.
[0098] Figs. 16A-16B depict editing in bulk CD34+ cell population (black
bars), progenitor cells
(light grey bars), and HSCs (dark grey bars), as determined by Illumina
sequencing 48 hours post
electroporation. Fig. 16A depicts RNP33 (Table 15) delivered alone or co-
delivered with ssODN
01116431 (SEQ ID NO:1040, Table 7). Fig. 16B depicts RNP33 (Table 15)
delivered alone or co-
delivered with Sp182 RNP (dead gRNA comprising SEQ ID NO:1027 (Table 8)
complexed with S.
pyogenes Cas9 (SEQ ID NO:1033)).
[0099] Fig. 17 depicts editing in bulk CD34+ cell population (black bars),
progenitor cells (light grey
bars), and HSCs (dark grey bars), as determined by Illumina sequencing 48
hours post
34
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
electroporation. RNP34, RNP33, and RNP43 (Table 15) were delivered alone or in
combination with
Sp182 RNP (dead gRNA comprising SEQ ID NO:1027 (Table 8) complexed with S.
pyogenes Cas9
(SEQ ID NO:1033)) or ssODN 01116431 (SEQ ID NO:1040, Table 7).
[0100] Fig. 18 depicts editing in CD34+ cells as determined by Illumina
sequencing 72 hours post
electroporation. RNP64, RNP63, and RNP45 (Table 15) were delivered at a
stoichiometry
(gRNA:Cpfl complexation ratio) of either 2, or 4, where the gRNA is in a molar
excess.
[0101] Fig. 19 depicts editing in CD34+ cells as determined by Illumina
sequencing 72 hours post
electroporation. RNP33, RNP64, RNP63, and RNP45 (Table 15) were delivered
alone or in
combination with Sp182 RNP (dead gRNA comprising SEQ ID NO:1027 (Table 8)
complexed with
S. pyogenes Cas9 (SEQ ID NO:1033)) or ssODN 01116431 (SEQ ID NO:1040, Table
7).
[0102] Fig. 20 depicts editing in CD34+ cells as determined by Illumina
sequencing. RNPs
comprising Cpfl (SEQ ID:1094) complexed to gRNAs with various 5' DNA
extensions (Table 15),
were delivered alone or in combination with 8 itM 01116431 (SEQ ID NO:1040,
Table 7).
[0103] Fig. 21 depicts editing in CD34+ cells, as determined by Illumina
sequencing. RNPs
comprising gRNAs with matched 5' ends (RNP49 vs RNP58 and RNP59 vs RNP60,
Table 15) were
delivered to CD34+ cells to assess the impact of 3' modifications. In both
comparisons, gRNAs with
3' PS-0Me outperformed the unmodified 3' version at 24 hours post
electroporation.
[0104] Figs. 22A-22B depict editing in CD34+ cells as determined by Illumina
sequencing 24 and 48
hours post electroporation. RNP58 (Table 15) was delivered to CD34+ cells at a
stoichiometry
(gRNA:Cpfl complexation ratio) of either 2:1, 1:1 or 0.5:1 molar ratios. At
all doses tested, editing
was best when RNP was complexed at 2:1 ratio.
[0105] Figs. 23A-23B depict editing in CD34+ cells as determined by Illumina
sequencing. Figs.
45A and 45B depict RNPs comprising gRNAs with matched 5' ends, but different
3' modifications
(Table 15) delivered to CD34+ cells to assess the impact of 3' modifications
or extensions.
[0106] Figs. 24A-24C depict editing in CD34+ cells and their erythroid
progeny, and HbF levels in
the erythroid progeny following delivery of RNPs targeting various cut sites
within the HBG locus.
Fig 24A depicts RNPs comprising guide RNAs containing an unmodified 5' and 1 x
PS-Ome at the 3'
end (Table 15). Fig 24B depicts RNPs comprising guide RNAs containing 2P5 +20
DNA extension
at the 5' and 1 x PS-Ome at the 3' end (Table 15). Fig 24C depicts RNPs
comprising guide RNAs
containing a 25 DNA extension at the 5' and 1 x PS-Ome at the 3' end (Table
15).
[0107] Fig. 25 depicts editing and HbF levels in erythroid progeny of CD34+
cells following
delivery of RNP58 at 1 M, 2 M, and 4 M.
[0108] Fig. 26 depicts editing in CD34+ cells following Maxcyte
electroporation of RNPs. RNP58,
RNP26, RNP27, and RNP28 comprising gRNA SEQ ID:1051 complexed to different
Cpfl proteins
(SEQ IDs: 1094, 1096, 1107, 1108) (Table 15) were delivered into CD34+ cells.
Editing was
determined by Illumina-sequencing 24 and 48 hours post electroporation.
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0109] Fig. 27 depicts editing in CD34+ cells following Maxcyte
electroporation of RNPs. RNP58,
RNP29, RNP30, and RNP31 comprising Cpfl protein SEQ ID: 1094 complexed to
guide RNAs with
various 5' extensions (Table 15) were delivered into CD34+ cells. Editing was
determined by
Illumina-seq 24 and 48 hours post electroporation. RNP30 was not tested (nt)
at 1 itM due to limiting
cell numbers.
[0110] Fig. 28 depicts editing in bulk CD34+ cell population (black bars),
progenitor cells (dark grey
bars), and HSCs (light grey bars), as determined by Illumina sequencing 48
hours post
electroporation. RNP58, RNP27, and RNP26 (Table 15) were delivered to CD34+
cells at 2 itM or 4
M.
[0111] Fig. 29 depicts editing in bulk CD34+ cell population (black bars),
progenitor cells (dark grey
bars), and HSCs (light grey bars), as determined by Illumina sequencing 48
hours post
electroporation. RNP61, RNP62, and RNP34 (Table 15) (8 M) were co-delivered
to CD34+ cells
with ssODN 01116431 (SEQ ID NO:1040, Table 7) (8 M).
[0112] Fig. 30 depicts editing in bulk CD34+ cell population (black bars),
progenitor cells (dark grey
bars), and HSCs (light grey bars), as determined by Illumina sequencing 48
hours post
electroporation. RNP58 and RNP32 (Table 15) were delivered to CD34+ cells at 2
M.
[0113] Fig. 31 depicts editing in bulk CD34+ cell population (black bars),
progenitor cells (dark grey
bars), and HSCs (light grey bars), as determined by Illumina sequencing 48
hours post
electroporation. RNP58 and RNP1 (Table 15) were delivered to CD34+ cells at 2
M, 4 M, or 8
M. The cells edited with RNP1 at 2 itM were not sorted (N.S), and thus editing
data is not
available.
[0114] Fig. 32 depicts the indels of engrafted mPB CD34+ cells from BM of
"NBSGW" mice 8
weeks post infusion of electroporated cells. RNP34 and RNP33 (Table 15) (8 M)
were co-delivered
to CD34+ cells with ssODN 01116431 (SEQ ID NO:1040, Table 7) (6 M).
[0115] Figs. 33A-33B depict the indels of engrafted mPB CD34+ cells and HbF
expression by
erythroid cells derived from chimeric BM of "NBSGW" mice 8 weeks post infusion
of electroporated
cells. RNP33 or RNP34 (Table 15) was co-delivered with Sp182 RNP (dead gRNA
comprising SEQ
ID NO:1027 (Table 8) complexed with S. pyogenes Cas9 (SEQ ID NO:1033)) (16 itM
total RNP) to
CD34+ cells. Fig. 33A depicts the indel frequency in unfractionated bone
marrow or flow-sorted
individual populations of CD15+, CD19+, GlyA+, and Lin-CD34+ cells in mock-
transfected (no RNP
added) or RNP transfected cells. Lin-CD34+ cells are defined as CD34+ cells
that are negative for
CD3, CD14, CD15, CD16, CD19, CD20, and CD56) from bone marrow (BM) of
nonirradiated
NOD,B6.SCID Il2ry-/- Kit(W41/W41) ("NBSGW") mice infused with mock (no RNP) or
RNP
transfected mPB CD34+ cells. Indels were determined for each cell population
by Illumina
sequencing. Fig. 33B depicts the HbF expression, calculated by UPLC as
gamma/beta-like (%) from
erythroid cell lysates following an 18-day erythroid differentiation culture
from total chimeric BM.
36
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0116] Figs. 34A-34B depict the indels of engrafted mPB CD34+ cells and HbF
expression by
erythroid cells derived from chimeric BM of "NBSGW" mice 8 weeks post infusion
of electroporated
cells. RNP61 or RNP62 (Table 15) (8 laM) was co-delivered with ssODN 01116431
(SEQ ID
NO:1040, Table 7) (8 laM) to CD34+ cells. Fig. 34A depicts the indels of
unfractionated bone
marrow or flow-sorted individual populations of CD15+, CD19+, GlyA+, and Lin-
CD34+ cells in
mock-transfected (no RNP added) or RNP transfected cells. Lin-CD34+ cells are
defined as CD34+
cells that are negative for CD3, CD14, CD15, CD16, CD19, CD20, and CD56) from
bone marrow
(BM) of nonirradiated NBSGW mice infused with mock (no RNP) or RNP transfected
mPB CD34+
cells. Indels were determined for each cell population by Illumina sequencing.
Fig. 34B depicts the
HbF expression, calculated by UPLC as gamma/beta-like (%) by erythroid cells
following an 18-day
erythroid differentiation culture from total chimeric BM.
[0117] Fig. 35 depicts human chimerism within bone marrow 8 weeks post
infusion with mock (no
RNP added) mPB CD34+ cells, or mPB CD34+ cells edited with RNP1 (4 or 8 laM)
or RNP58 (2, 4
or 8 laM ) (Table 15). Human chimerism and lineage reconstitution (CD45+,
CD14+, CD19+,
glycophorin A (GlyA, CD235a+), lineage, and CD34+, and mouse CD45+ marker
expression) in BM
was determined by flow cytometry.
[0118] Fig. 36 depicts indels within unsorted bulk bone marrow 8 weeks post
infusion with mock (no
RNP added) mPB CD34+ cells, or mPB CD34+ cells edited with RNP1 (4 or 8 laM)
or RNP58 (2, 4
or 8 laM ) (Table 15). Indels were determined by Illumina sequencing.
[0119] Fig. 37 depicts the indel frequency in unfractionated bone marrow or
flow-sorted individual
populations of CD15+, CD19+, GlyA+, and Lin-CD34+ cells in mock-transfected
(no RNP added) or
RNP transfected cells. Lin-CD34+ cells are defined as CD34+ cells that are
negative for CD3, CD14,
CD15, CD16, CD19, CD20, and CD56 from bone marrow (BM) of nonirradiated
NOD,B6.SCID
Il2ry-/- Kit(W41/W41) ("NBSGW") mice infused with mock (no RNP) or RNP
transfected mPB
CD34+ cells. Indels were determined for each cell population by Illumina
sequencing.
[0120] Fig. 38 depicts HbF from GlyA+ fraction isolated from bone marrow at 8
weeks post infusion
with mock (no RNP added) mPB CD34+ cells, or mPB CD34+ cells edited with RNP58
(2, 4 or 8
laM) (Table 15).
[0121] Fig. 39 depicts colony forming potential of cells from bone marrow
flushes taken 8 weeks
post infusion of mock or edited human mobilized CD34+ cells. The number and
subtype of colonies
are indicated (GEMM: granulocyte-erythroid-monocyte-macrophage colony (black),
GM:
granulocyte-macrophage colony (dark grey), E: erythroid colony (light grey)).
[0122] Fig. 40 depicts the sequences of Cpfl protein variants set forth in
Table 14. Nuclear
localization sequences are shown as bolded letters, six-histidine sequences
are shown as underlined
letters. Additional permutations of the identity and N-terminal/C-terminal
positions of NLS
sequences, e.g., appending two or more nNLS sequences or combinations of nNLS
and sNLS
37
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
sequences (or other NLS sequences) to either the N-terminal/C-terminal
positions, as well as
sequences with and without purification sequences, e.g., six-histidine
sequences, are within the scope
of the instantly disclosed subject matter.
[0123] Figs. 41A-41E depict editing in the HBG distal CCAAT box region. Fig.
41A shows a
schematic of the Cpfl (RNP34, Table 15) and SpCas9 (Sp35 RNP) cleavage sites
at the HBG distal
CCAAT box region. Sp35 RNP comprises Sp35 gRNA (comprising the targeting
domain of SEQ ID
NO:339 (i.e., CUUGUCAAGGCUAUUGGUCA (RNA)); SEQ ID NO:917 (i.e.,
CTTGTCAAGGCTATTGGTCA (DNA)) complexed with S. pyogenes wildtype (Wt) Cas9
protein.
The dark grey jagged line with arrows marks the expected 4 nucleotide 5'
overhang after cutting with
RNP34. The grey dotted line marks the expected cut site of RNP34. This is the
expected cut site for
any RNP containing a gRNA comprising the gRNA targeting domain sequence
UAAUUUCUACUCUUGUAGAUCCUUGUCAAGGCUAUUGGUC (SEQ ID NO:1022). The
Sp35 RNP expected cut site is indicated by the grey straight line with arrows.
Fig. 41B depicts the
percentage of indels derived from NHEJ and MMEJ repair in the CD34+ cell
population, progenitor
cells, and HSCs. MMEJ indels are represented by the black striped bar and NHEJ
indels are
represented by the white bar. Fig. 41C and Fig. 41D depicts the G-gamma chain
expression levels
(percentage of G-gamma chain/[total beta-like chains]) in erythroid cells
derived from mPB CD34+
cells electroporated with Sp35 RNP or RNP34+ Sp182RNP; carrying indels < 3 bp
or > 3 bp in length
on their HBG allele encoding for G-gamma. Only clones with a monoalleleic
4.9kb deletion
(resulting in no g-gamma expression from one of the chromosome) were analyzed
to ensure a single
HBG allele was driving the g-gamma expression. Thus, the expression level
shown represents the
level of g-gamma expression by a single HBG gene, depending on the indel
carried at the promoter, in
cells that have the g-gamma gene on the other chromosome deleted. Fig 41C
shows the results
grouped by indel < 3 bp or > 3 bp in length. Fig. 41D depicts the gamma chain
expression levels
(percentage of gamma chains/[total beta-like chains]) in erythroid cells
derived from mPB CD34+
cells electroporated with Sp35 RNP or RNP34 + Sp182 RNP producing indels < 3
bp or > 3 bp in
length. The position of the deletion is indicated on the X axis. Xs indicate
indels generated by Cas9
(Sp35 RNP) and circles indicate edits generated by Cpfl (RNP34). Fig. 41E
depicts the distribution
of levels of gamma chain expression over total beta-like chains (gamma
chains/[gamma chains + beta
chain]) as measured by UPLC in the clonal erythroid progeny of single human
mPB CD34+ cells
edited at the HBG promotor region with spCas9 RNP "sp35" or Cpfl RNP34 (HBG1-1-
AsCpf1H800A-RNP) in combination with "booster element" 5p182-Cas9-RNP (Table
8). Each
black circle represents the gamma-globin protein level detected in a clonal
erythroid population
derived from a single cell, isolated by FACS sorting at 48h post
electroporation. The error bars show
the median and interquartile range.
38
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0124] Figs. 42A-42J depict editing via Cpfl or SpCas9 enzyme cleavage. Fig.
42A depicts the
percentage of NHEJ mediated indels at the distal CCAAT box resulting from
RNP58 (Cpfl) (Table
15) or Sp35 RNP (SpCas9) editing. Indel size is indicated by the x-axis. Fig.
42B depicts the
percentage of > 3 bp NHEJ mediated indels, > 3 bp MMEJ mediated indels, and <
3 bp indels at the
distal CCAAT box resulting from editing by Cpfl or SpCas9 RNP. For Sp35 RNP
Cas9 indels in
Fig. 42B (left pie chart): NHEJ > 3 bp = 21.42%; < 3 bp = 48.84%; MMEJ > 3 bp
= 29.74%. For
RNP58 Cpfl indels in Fig. 42B (right pie chart): NHEJ > 3 bp = 64.86%; < 3 bp
= 11.11%; MMEJ >
3 bp = 24.02%. Fig. 42C shows the wild type (wt) allele and top 18 indels,
together with their
average percentages in indel for all the samples, and their corresponding
final sequences after the edit.
Dashes represent deleted bases and the vertical line is the cut site (see also
Fig. 55A). The long dark
grey line above the wt allele marks the DNA sequence of the gRNA targeting
domain of the gRNA of
RNP58 (i.e., CCUUGUCAAGGCUAUUGGUCA (SEQ ID NO:1254)), and the shorter black
line
marks the distal CCAAT box (appearing reverse complemented here). Base
distances with respect to
TSS are marked by arrows. The grey boxes respresent regions of homology which
indicate MMEJ
repair. Fig. 42D shows the wild type (wt) allele and top 18 indels, together
with their average
percentages in indel for all the samples, and their corresponding final
sequences after the edit. Dashes
represent deleted bases and the vertical line is the cut site (see also Fig.
55A). The long dark grey line
above the wt allele marks the DNA sequence of the gRNA targeting domain of the
gRNA of Sp35
RNP (i.e., CUUGUCAAGGCUAUUGGUCA SEQ ID NO:339), and the short black line marks
the
distal CCAAT box (appearing reverse complemented here). Base distances with
respect to TSS are
marked by arrows. The grey boxes respresent regions of homology which indicate
MMEJ repair.
Fig. 42E shows the percentage of bases deleted along the target region in
samples edited with RNP58
or Sp35 RNP. The black line represents RNP58 editing and the dashed line
represents 5p35 RNP
editing. The target region DNA sequence is shown on the x axis. The grey line
marks the DNA
sequence of the gRNA targeting domain of the gRNA of Sp35 RNP (i.e.,
CUUGUCAAGGCUAUUGGUCA SEQ ID NO:339), and the short black line marks the distal
CCAAT box (appearing reverse complemented here). Fig. 42F shows the normalized
profiles (each
with a maximum value of 1) for the detected deletions at each base on the
target region in samples
edited with RNP58 or Sp35 RNP. The black line represents RNP58 editing and the
dashed line
represents 5p35 RNP editing. The target region DNA sequence is shown on the x
axis. The grey line
marks the DNA sequence of the gRNA targeting domain of the gRNA of Sp35 RNP
(i.e.,
CUUGUCAAGGCUAUUGGUCA SEQ ID NO:339), and the short black line marks the distal
CCAAT box (appearing reverse complemented here). Fig. 42G shows the percentage
of detected
indels as a function of the deletion size (negative values on the x axis) or
insertion (positive values in
the x axis). The black line represents RNP58 editing and the dashed line
represents 5p35 RNP
editing. Fig. 4211 shows the percentage of detected indels at each position in
the target region. Sp35
39
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
RNP is represented by the dashed line. RNP58 is represented by the solid line.
The target region DNA
sequence is shown on the x axis. The gray line marks the DNA sequence of the
gRNA targeting
domain of the gRNA of Sp35 RNP (i.e., CUUGUCAAGGCUAUUGGUCA SEQ ID NO:339), and
the short black line marks the distal CCAAT box (appearing reverse
complemented here). Fig. 421
shows the frequency correlation for shared indels detected at > 0.1% in either
5p35 RNP or RNP58
edited cells. Fig. 42J frequency correlation for all indels detected in at
least one of the samples.
Indels not detected in 5p35 RNP-edited cells are shown to the left of the
vertical line at 1E-5. Indels
not detected in RNP58-edited cells are shown to the bottom of the horizontal
line at 1E-5. Triangles
represent deletions < 3 bp and circles represent deletions > 3bp.
101251 Figs. 43A-430 depict RNP32 editing resulting in long term engraftment,
indel maintenance,
and high HbF induction in vivo. Fig. 43A depicts the percentage of > 3 bp NHEJ
mediated indels, >
3 bp MMEJ mediated indels, and < 3 bp indels at the distal CCAAT box resulting
from editing by
RNP32 24 hours following electroporation: NHEJ > 3 bp = 66.10%; < 3 bp =
12.60%; MMEJ > 3 bp
= 27.10%. Fig. 43B depicts the percentage of > 3 bp NHEJ mediated indels, >3
bp MMEJ mediated
indels, and <3 bp indels at the distal CCAAT box resulting from editing by
RNP32 48 hours
following electroporation: NHEJ > 3 bp = 65.30%; < 3 bp = 12.70%; MMEJ > 3 bp
= 27.80%. Fig.
43C depicts the percentage of > 3 bp NHEJ mediated indels, > 3 bp MMEJ
mediated indels, and < 3
bp indels at the distal CCAAT box resulting from editing by RNP32 72 hours
following
electroporation: NHEJ > 3 bp = 64.70%; < 3 bp = 11.90%; MMEJ > 3 bp = 29.20%.
Fig. 43D depicts
the percentage of indels at the distal CCAAT box mediated via NHEJ repair
resulting from editing by
RNP32 24, 48, and 72 hours following electroporation and preinfusion. Fig. 43E
depicts the
percentage of indels at the distal CCAAT box mediated via NHEJ repair
resulting from editing by
RNP32 24 hours following electroporation and preinfusion. Fig. 43F depicts the
percentage of indels
at the distal CCAAT box mediated via NHEJ repair resulting from editing by
RNP32 48 hours
following electroporation and preinfusion. Fig. 43G depicts the percentage of
indels at the distal
CCAAT box mediated via NHEJ repair resulting from editing by RNP32 72 hours
following
electroporation and preinfusion. Fig. 4311 depicts the percentage of all
indels at the distal CCAAT
box resulting from editing by RNP32 24, 48, and 72 hours following
electroporation and preinfusion.
Fig. 431 depicts the percentage of all indels at the distal CCAAT box from
editing by RNP32 24 hours
following electroporation and preinfusion. Fig. 43J depicts the percentage of
all indels at the distal
CCAAT box resulting from editing by RNP32 48 hours following electroporation
and preinfusion.
Fig. 43K depicts the percentage of all indels at the distal CCAAT box
resulting from editing by
RNP32 72 hours following electroporation and preinfusion. Fig. 43L depicts the
percentage of indels
in pre-infused RNP32 edited mPB CD34+ cells ("Preinfusion") and long-term
repopulating CD34+
cells from NBSGW mice following infusion of RNP32 edited mPB CD34+ cells and
16 weeks
engraftment ("BM"). Fig. 43M depicts human chimerism within bone marrow 16
weeks post
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
infusion with mock (no RNP added) mPB CD34+ cells or mPB CD34+ cells edited
with RNP32
(Table 15). Human chimerism and lineage reconstitution (CD19+, CD15+,
CD235A+), lineage, and
CD34+, and mouse CD45+ marker expression) in BM was determined by flow
cytometry. Fig. 43N
depicts the percentage of F positive cells in mock (no RNP added) and CD235a+
(GlyA+) erythroid
cells, derived from RNP32 edited CD34+ cells. Fig. 430 depicts the percentage
of HbF shown by
expression levels of gamma-globin chains over total beta-like globin chains
(gamma chains/[gamma
chains + beta chain]) as measured by UPLC analysis of CD235a+ (GlyA+)
erythroid cells.
[0126] Figs. 44A-44B depict high polyclonality in NBSGW mice infused with
RNP32 edited CD34+
cells. Fig. 44A shows high polyclonality over a 20 week period (8, 12, 16, and
20 weeks post-
infusion) in the blood of mice (Mouse A, Mouse B, Mouse C, Mouse D) infused
with RNP32 edited
CD34+ cells. "0" represents data from pre-infused RNP32 edited mPB CD34+
cells. Fig. 44B shows
high polyclonality in the bone marrow (BM) of NBSGW mice infused with RNP32
edited CD34+
cells at 20 weeks post-engraftment. In Figs. 44A and 44B, each shade of grey
within the graphical
depiction represents a different indel signature, with the most frequent indel
type located near the x-
axis and the least frequent indel type located near the top of the plot.
[0127] Fig. 45 shows a schematic of the 13-globin locus. "CD34+ cellsa" means
CD34+
hematopoietic stem and progenitor cells, "HS" means hypersensitive site, "LCR"
means locus control
region, "TSS" means transcriptional start site.
[0128] Fig. 46A shows viability of normal and SCD CD34+ cells at Days 1 to 3
post electroporation
with 6 itM of RNP32 compiled from two independent experiments. Individual data
points and mean
for each treatment group are shown. N=4 for normal donors; N=5 for sickle
donors (CEL238-001
[normal CD34+ cells] and CEL211-001 [SCD CD34+ cells] were each tested twice).
Fig. 46B shows
CD34+ cell viability post-electroporation with RNP32. a indicates only
applicable to RNP32-
electroporated cells. b indicates insufficient number of cells available and
thus viability was not
assessed.
[0129] Fig. 47A shows indel levels of normal and SCD CD34+ cells at Days 1 to
3 post
electroporation with 6 itM of RNP32 compiled from two independent experiments.
Individual data
points and mean for each treatment group are shown. N=4 for normal donors; N=5
for sickle donors.
(CEL238-001 [normal CD34+ cells] and CEL211-001 [SCD CD34+ cells] were each
tested twice.
Indel=insertions and/or deletions. Fig. 47B shows comparable and efficient
editing in RNP32 edited
CD34+ cells from normal donors and patients with SCD. The percentage of indels
was evaluated in
unedited and RNP32 edited CD34+ cells from normal donors (n=3) and from
unedited and RNP32
edited CD34+ cells from patients with SCD (n=4). Unedited cells did not
undergo electroporation.
Fig. 47C shows indel levels of CD34+ cells post-electroporation with RNP32. ND
= Not Determined
(Insufficient sample to run sequencing analysis).
41
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0130] Figs. 48A-48D depict PCR Primers and mixes for digital droplet
polymerase chain reaction
(ddPCR). Fig. 48A depicts a schematic representation of ddPCR primers and
probe positions relative
to RNP32 cut sites. Fig. 48B shows the primers and probe sequences for 4.9 kb
fragment deletion
assessment. Fig. 48C shows the Master Mix 1 and 2 compositions for ddPCR Assay
6 and 9. Fig.
48D shows the Master Mix 3 composition.
[0131] Fig. 49A shows the frequency of 4.9 kb fragment deletion of normal and
SCD CD34+ cells at
Day 1 post electroporation with 6 laM of RNP32. Data are from 1 study
(SCD014). Each dot
represents 1 sample. Untreated cells did not undergo electroporation. Fig. 49B
shows the frequency
of 4.9 kb deletion in CD34+ cells post-electroporation with RNP32. NA=data not
available as digital
droplet polymerase chain reaction assays failed. Untreated cells did not
undergo electroporation.
[0132] Fig. 50A shows fold expansion of erythroid progeny of CD34+ cells.
Normal and SCD
CD34+ cells, either untreated or electroporated with 6 laM of RNP32, were
placed in erythroid-
inducing conditions for 18 days. Data were compiled from 2 independent
experiments. Each dot
represents 1 sample. Fig. 50B shows enucleation frequency of erythroid progeny
of CD34+ cells.
Normal and SCD CD34+ cells, either untreated or electroporated with 6 laM of
RNP32, were placed
in erythroid-inducing conditions for 18 days. Data were compiled from 2
independent experiments.
Each dot represents 1 sample.
[0133] Fig. 51A shows an assessment of HbF induction in erythroid progeny in
two experiments.
Normal and SCD CD34+ cells, either untreated or electroporated with 6 laM of
RNP32, were placed
in erythroid-inducing conditions for 18 days. The relative abundance of globin
chains in erythroid
lysate was analyzed by RP-UPLC and HbF levels were calculated as HbF (%) = (Ay
+ &y)/(Ay + Gy
+13) (%). Fig. 51B shows the frequency of HbF+ RBCs evaluated by flow
cytometry in one
independent experiment. For Fig. 51A and Fig. 51B, each dot represents 1
sample. Paired T test was
performed to determine whether the differences between RNP32-treated samples
and untreated
samples were statistically significant. * p<0.05, ** p<0.01, **** p<0.0001. RP-
UPLC=reverse phase
ultra-performance liquid chromatography. Untreated cells did not undergo
electroporation. Fig. 51C
shows comparable and robust ex vivo HbF expression in RNP32 edited CD34+ cells
from normal
donors and patients with SCD. The percentage of HbF is shown by expression
levels of gamma-
globin chains over total beta-like globin chains (gamma chains/[gamma chains +
beta chain]) in
unedited and RNP32 edited CD34+ cells from normal donors (n=3) and in unedited
and RNP32
edited CD34+ cells from patients with SCD (n=4). Unedited cells did not
undergo electroporation.
[0134] Fig. 52 shows RNP32 edited CD34+ derived red blood cells (RBCs) from
SCD patients have
reduced sickling versus unedited RBCs from SCD patients when exposed to sodium
metabisulfite and
examined under a microscope. The percentage of sickled RBCs is shown for
unedited SCD-derived
RBCs and RNP32 edited SCD-derived RBCs. The mean HbF percentage is also shown
for unedited
SCD-derived RBCs and RNP32 edited SCD-derived RBCs.
42
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0135] Fig. 53A shows a graphic representation of the measured loss of
deformability, the point-of-
sickling of SCD RBCs, as a result of oxygen-depletion in time, followed by
subsequent gain of
deformability of RBC's during reoxygenation, as is visualized on the
Oxygenscan. EImax represents
RBC deformability at normoxia and EImin represents deformability upon
deoxygenation. The point
of sickling (PoS) reflects p02 at which sickling begins and a >5% decrease in
El is observed during
deoxygenation. EI=elongation index. Figs. 53B-53E shows the assessment of RBC
deformability.
Cultured RBCs from three batches of untreated normal CD34+ cells (Fig. 53B)
and four batches of
untreated or RNP32-edited SCD CD34+ cells (Fig. 53C) were analyzed on the
Lorrca ektacytometer
to measure deformability under shear stress, expressed as elongation index,
when subjected to
decreasing level of 02. In Fig. 53C, RBCs cultured from CD34+ cells that did
not undergo
electroporation with RNP32 (untreated) are represented by the black line
(bottom line in all plots until
at least 25 mmHg) and RBCs cultured from RNP32-edited SCD CD34+ cells are
repsented by a dark
gray line (top line in all plots until at least 25 mmHg). The point of
sickling, representing the relative
oxygen pressure when the SCD RBCs started to sickle during deoxygenation was
plotted for each
SCD RBC sample (Fig. 53D). The minimum elongation index of each SCD RBC
sample,
approximating the flexibility of RBC when deoxygenated is shown in (Fig. 53E).
Each line connects
the RBCs cultured from untreated and RNP32 edited cells from the same donor in
the same
experiment. CEL211-001 was tested twice in two independent experiments. A
paired T test was
performed to determine whether the differences between RBCs cultured from
RNP32-treated samples
and untreated samples were statistically significant. ** p<0.01, *** p<0.001.
[0136] Fig. 54A shows a rheology assessment of cultured RBCs. Untreated CD34+
cells and
untreated or RNP32-electroporated SCD CD34+ cells were placed in erythroid-
inducing conditions
for 18 days to generate erythroid cells. Rheological behavior of cultured RBCs
under varying
concentrations of oxygen were evaluated using a microfluidic platform. The
percentage velocity drop
was calculated based on the differences between velocity at specified oxygen
concentration and at
atmospheric levels of oxygen (21%). Data shown are mean standard deviation.
N= 5: untreated
SCD samples, N= 5: RNP32 treated SCD samples, N= 4: untreated normal samples.
Paired T test was
used to compare the means between RBCs cultured from untreated and
corresponding RNP32-edited
SCD samples. *p<0.05, ***p<0.001, ****p<0.0001. Fig. 54B shows a summary of
percentage
velocity drop by varying oxygen concentration. b indicates samples clogged
during assessment and
experiments were aborted. Only data collected prior to the blockage formation
are reported. Data are
not plotted in Fig. 54A. Fig. 54C shows that RBCs cultured from RNP32-edited
CD34+ cells from
SCD patients have improved rheological properties, closer to RBCs from normal
donors, compared to
RBCs cultured from unedited CD34+ cells from SCD patients when placed in
microfluidic channels
that mimic blood flow in capillaries, in a range of oxygen levels. The
percentage of normalized
velocity was evaluated for RBCs cultured from unedited normal donor-derived
CD34+ cells
43
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
(diamonds), RBCs cultured from unedited SCD-donor derived CD34+ cells
(triangles), and RBCs
cultured from RNP32-edited SCD-derived CD34+ cells (circles) at varying
percentages of oxygen.
Typical oxygen levels observed in the venous circulation are between ¨4% to 6
% oxygen. Fig. 54D
shows the correlation between HbF induction and rheology behavior. The level
of HbF expressed by
SCD samples (x-axis) was plotted against the corresponding percentage velocity
drop (y-axis) at 0%,
2%, 4% and 6% oxygen concentration. Simple linear regression analysis was
performed and the
coefficient of determination is shown in each panel. Fig. 54E shows HbF levels
correlate with
velocity for RBCs cultured from unedited SCD-derived CD34+ cells (triangles)
and RBCs from
RNP32-edited SCD-derived CD34+ cells (circles) when placed in microfluidic
channels mimicking
blood flow in capillaries at an oxygen level of 4%. The percentage of HbF is
shown by expression
levels of gamma-globin chains over total beta-like globin chains (gamma
chains/[gamma chains +
beta chain]).
[0137] Fig. 55A shows a schematic of the distal CCAAT box region with 0-based
hg38 coordinates
chr11:5,249,949-5,249,987 (+) in HBG1 and chrll :5,254,873-5,254,911 (+) in
HBG2. The black line
marks the DNA sequence of the gRNA targeting domain of the gRNA of RNP32
(i.e.,
CCUUGUCAAGGCUAUUGGUCA (SEQ ID NO:1254)). The black box marks the distal CCAAT
box. The dark grey jagged line with arrows marks the expected 4 nucleotide 5'
overhang after cutting
with RNP32. The grey dotted line marks the expected cut site of RNP32. The
base before the cut site
is marked with a black arrow at position -118 bases with respect to the TSS.
The distances for the
bases at the boundaries to the TSS are marked by black arrows at the end of
the sequences (TSS: -93
and -130). Fig. 55B shows the oligonucleotides used for sequencing the indel
profiles generated by
RNP32. Fig. 55C shows the amplicon used for analysis of RNP32 editing. Fig.
55D shows an
example of an indel =id used to characterize the indel profile of RNP32. The
Indel_id is a string
identifying the indel, shown as indel_start_position + _ + indeliength + _ +
ID. Where ID is NA for
deletions and for insertions is the sequence inserted.
[0138] Fig. 56 depicts the percentage of > 3 bp NHEJ mediated indels, > 3 bp
MMEJ mediated
indels, and < 3 bp indels at the distal CCAAT box resulting from editing by
RNP32: NHEJ > 3 bp =
65.9%; < 3 bp = 8.6%; MMEJ > 3 bp =25.5%.
[0139] Fig. 57 shows the wild type (wt) allele and top 20 indels, together
with their average
percentages in indel for all the samples, and their corresponding final
sequences after the edit. Dashes
represent deleted bases and the vertical line is the cut site (see also Fig.
55A). The black line marks
the DNA sequence of the gRNA targeting domain of the gRNA of RNP32 (i.e.,
CCUUGUCAAGGCUAUUGGUCA (SEQ ID NO:1254)), and shorter black line marks the
distal
CCAAT box (appearing reverse complemented here). Base distances with respect
to TSS are marked
by arrows.
44
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0140] Fig. 58 shows the percentage of detected deletions as a function of the
distance between the
deletion center and the cut site, represented by the vertical dashed grey line
taken as the middle of the
5' overhang. The highest peak is at position ¨6 bp relative to the cut site
(TSS: ¨113) zand towards
the TSS (see also Fig. 55A). Profiles are shown as black for normal donor
samples (Normal, N = 4,),
light grey for sickle cell donor samples (SCD, N = 5) and dark grey for an
additional set of normal
donor samples (Normal = 5, SCD1) samples. The second set of Normal samples are
from study
SCD1 and were mobilized with G-CSF and plerixafor and generated using the
large-scale process.
The black line marks the DNA sequence of the gRNA targeting domain of the gRNA
of RNP32 (i.e.,
CCUUGUCAAGGCUAUUGGUCA (SEQ ID NO:1254)), and short black line marks the distal
CCAAT box (appearing reverse complemented here).
[0141] Fig. 59 shows the percentage of detected indels as a function of the
deletion size (negative
values on the x axis) or insertion (positive values in the x axis). The
vertical line separates insertions
and deletions. The highest peak is the deletion of size 18 corresponding to
the indel 159_-18_NA.
Profiles are shown as black for normal donor samples (Normal, N = 4), light
grey for sickle cell donor
samples (SCD, N = 5) and dark grey for an additional set of normal donor
samples (Normal = 5,
SCD1) samples. The second set of Normal samples are from study SCD1 and were
mobilized with
G-CSF and plerixafor and generated using the large-scale process.
[0142] Fig. 60 shows the average percentages for indel lengths between 50 and -
50. Positive values
indicate insertions. Negative values indicate deletions.
[0143] Fig. 61 shows the percentage of bases deleted along the target region
in samples edited with
RNP32. Profiles are shown as black for normal donor samples (Normal, N = 4),
light grey for sickle
cell donor samples (SCD, N = 5) and dark grey for an additional set of normal
donor samples (Normal
= 5, SCD1) samples. The second set of Normal samples are from study SCD1 and
were mobilized
with G-CSF and plerixafor and generated using the large-scale process. The
target region DNA
sequence is shown on the x axis. The black line marks the DNA sequence of the
gRNA targeting
domain of the gRNA of RNP32 (i.e., CCUUGUCAAGGCUAUUGGUCA (SEQ ID NO:1254)),
and
short black line marks the distal CCAAT box (appearing reverse complemented
here). Vertical
dashed grey line represents the cut site, taken as the middle of the 5'
overhang (see also Fig. 55A).
[0144] Fig. 62 shows the normalized profiles (each with a maximum value of 1)
for the detected
deletions at each base on the target region in samples edited with RNP32.
Profiles are shown as black
for normal donor samples (Normal, N = 4), light grey for sickle cell donor
samples (SC The second
set of Normal samples are from study SCD1 and were mobilized with G-CSF and
plerixafor and
generated using the large-scale process. The target region sequence is shown
in the x axis. The black
line marks the DNA sequence of the gRNA targeting domain of the gRNA of RNP32
(i.e.,
CCUUGUCAAGGCUAUUGGUCA (SEQ ID NO:1254)), and short black line marks the distal
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
CCAAT box (appearing reverse complemented here). Vertical dashed grey line
represents the cut
site, taken as the middle of the 5' overhang (see also Fig. 55A).
[0145] Fig. 63 shows the number of indels detected across multiple samples.
Shown are the counts
for the number of indels as a function of the number of samples in which the
indel was detected.
[0146] Fig. 64 shows the indel reproducibility across all 14 samples as a
function of their average
percentage in indels. Shown are the average percentages in indel (y-axis)
grouped by the number of
samples in which the indel was detected (x-axis). Grey horizontal line at
0.22% marks the lowest
percentage in indel of the top 55 indels.
[0147] Figs. 65A and 65B show on-target indel levels of CD34+ cells based on
RNP32 concentration
at electroporation. Total on-target editing indel level was determined via
Illumina sequencing at day
1 (Fig. 65A) and day 2 (Fig. 65B) after CD34+ cells were electroporated with
RNP32 at the
concentrations indicated. Data were compiled from eight independent
experiments. A total of five
RNP batches and four lots of normal donor CD34+ cells were tested across
eleven concentrations of
RNP32 ranging from 0.125 M to 8 M. Each dot represents an individual
electroporation.
Indel=insertions and/or deletions.
[0148] Fig. 66 shows a summary of cell viability at day 1 electroporation with
RNP32. Data marked
with an * indicates RNP32 found to be poorly complexed based on differential
scanning fluorimetry
and thus data were excluded.
[0149] Fig. 67 shows a summary of on-target indel levels at day 1 post-
electroporation with RNP32.
Data marked with an * indicates RNP32 found to be poorly complexed based on
differential scanning
fluorimetry and thus data were excluded.
[0150] Fig. 68 shows a summary of on-target indels at day 2 post-
electroporation. Data marked with
an * indicates RNP32 found to be poorly complexed based on differential
scanning fluorimetry and
thus data were excluded.
[0151] Figs. 69A and 69B shows the frequency of 4.9 kb fragment deletion in
edited CD34+ cells at
day 1 and day 2 post-electroporation. Frequency of 4.9kb fragment deletion
between two RNP32 cut
sites in CD34+ cells was assessed by ddPCR assays at Day 1 and Day 2 post
electroporation with
RNP at the concentration indicated (Fig. 69A). The 4.9 kb deletion to indel
ratio was calculated by
dividing levels of deletion with levels of indels for each sample (Fig. 69B).
Data were compiled from
three independent experiments. A total of two RNP batches and two lots of
normal donor CD34+
cells were tested across eight concentrations of RNP32 ranging from 0.125 M
to 8 M. Each dot
represents an individual electroporation. Indel = insertions and/or deletions.
[0152] Fig. 70 shows the summary of 4.9 kb fragment deletion frequency at day
1 and day 2 post-
electroporation with RNP32.
[0153] Figs. 71A and 71B show on-target indel levels of subpopulations of
hematopoietic stem and
progenitor cells. CD34+ cells were sorted 2 days post-electroporation into
subpopulations of CMP,
46
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
MPP, and LT-HSC based on surface immunophenotype. Fig. 71A shows on-target
indel levels
determined via Illumina sequencing. The ratio of on-target indel levels within
the phenotypic LT-
HSC population to the total CD34+ cells is depicted in Fig. 71B. A ratio of 1
(dotted line) illustrates
that the LT-HSCs have the same on-target indel levels as total CD34+ cells.
CMP=common myeloid
progenitors; Indel=insertions and/or deletions; LT-HSC=long-term hematopoietic
stem cells;
MPP=multipotent progenitors.
[0154] Fig. 72 shows a summary of on-target indel levels in total CD34+ cells
and sorted
subpopulations at day 2 post-electroporation. CMP=common myeloid progenitors;
Indel=insertions
and/or deletions; LT-HSC=long-term hematopoietic stem cells; MPP=multipotent
progenitors.
[0155] Figs. 73A and 73B show the frequency of 4.9 kb fragment deletion in
total CD34+ cells and
sorted hematopoietic stem and progenitor cell subpopulations. CD34+ cells were
sorted 2 days post
electroporation into subpopulations of CMP, MPP, and LT HSC based on surface
immunophenotype.
Fig. 73A shows the frequency of 4.9 kb deletion determined via ddPCR. The 4.9
kb deletion to indel
ratio was calculated by dividing levels of deletion with levels of indels for
each sample (Fig. 73B). A
lower ratio depicts a lower propensity of 4.9kb deletions to occur within a
population. Multiple
comparison was performed using Friedman test. *p=0.01, ****p <0.0001.
CMP=common myeloid
progenitors; Indel=insertions and/or deletions; LT HSC=long-term hematopoietic
stem cells;
MPP=multipotent progenitors.
[0156] Fig. 74 shows a summary of 4.9 kb fragment deletion frequency in total
CD34+ cells and
sorted subpopulations at day 2 post-electroporation with RNP32. CD34+=cluster
of differentiation
34; CMP=common myeloid progenitors; Indel=insertions and/or deletions; LT-
HSC=long-term
hematopoietic stem cells; MPP=multipotent progenitors; RNP=ribonucleoprotein.
DETAILED DESCRIPTION
Definitions and Abbreviations
[0157] Unless otherwise specified, each of the following terms has the meaning
associated with it in
this section.
[0158] The indefinite articles "a" and "an" refer to at least one of the
associated noun, and are used
interchangeably with the terms "at least one" and "one or more." For example,
"a module" means at
least one module, or one or more modules.
[0159] The conjunctions "or" and "and/or" are used interchangeably as non-
exclusive disjunctions.
[0160] "Domain" is used to describe a segment of a protein or nucleic acid.
Unless otherwise
indicated, a domain is not required to have any specific functional property.
47
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0161] The term "exogenous trans-acting factor" refers to any peptide or
nucleotide component of a
genome editing system that both (a) interacts with an RNA-guided nuclease or
gRNA by means of a
modification, such as a peptide or nucleotide insertion or fusion, to the RNA-
guided nuclease or
gRNA, and (b) interacts with a target DNA to alter a helical structure thereof
Peptide or nucleotide
insertions or fusions may include, without limitation, direct covalent
linkages between the RNA-
guided nuclease or gRNA and the exogenous trans-acting factor, and/or non-
covalent linkages
mediated by the insertion or fusion of RNA/protein interaction domains such as
MS2 loops and
protein/protein interaction domains such as a PDZ, Lim or SH1, 2 or 3 domains.
Other specific RNA
and amino acid interaction motifs will be familiar to those of skill in the
art. Trans-acting factors may
include, generally, transcriptional activators.
[0162] The term "booster element" refers to an element which, when co-
delivered with a
ribonucleoprotein (RNP) complex comprising a gRNA complexed to an RNA-guided
nuclease
("gRNA-nuclease-RNP"), increases editing of a target nucleic acid compared
with editing of the
target nucleic acid without the booster element. In certain embodiments, co-
delivery may be
sequential or simultaneous. In certain embodiments, a booster element may be
an RNP complex
comprised of a dead guide RNA complexed with a WT Cas9 protein, a Cas9 nickase
protein (e.g.,
Cas9 DlOA protein), or an enzymatically inactive Cas9 (eiCas9) protein. In
certain embodiments, a
booster element may be an RNP complex comprised of a guide RNA complexed with
a Cas9 nickase
protein (e.g., Cas9 DlOA protein) or an enzymatically inactive Cas9 (eiCas9)
protein. In certain
embodiments, a booster element may be a single-or double stranded donor
template DNA. In certain
embodiments, one or more booster elements may be codelivered with a gRNA-
nuclease-RNP to
increase editing of a target nucleic acid. In certain embodiments, a booster
element may be co-
delivered with an RNP comprising a gRNA complexed to a Cpfl molecule ("gRNA-
Cpfl-RNP") to
increase editing of a target nucleic acid.
[0163] "Productive indel" refers to an indel (deletion and/or insertion) that
results in HbF expression.
In certain embodiments, a productive indel may induce HbF expression. In
certain embodiments, a
productive indel may result in an increased level of HbF expression.
[0164] An "indel" is an insertion and/or deletion in a nucleic acid sequence.
An indel may be the
product of the repair of a DNA double strand break, such as a double strand
break formed by a
genome editing system of the present disclosure. An indel is most commonly
formed when a break is
repaired by an "error prone" repair pathway such as the NHEJ pathway described
below.
101651 "Gene conversion" refers to the alteration of a DNA sequence by
incorporation of an
endogenous homologous sequence (e.g. a homologous sequence within a gene
array). "Gene
correction" refers to the alteration of a DNA sequence by incorporation of an
exogenous homologous
sequence, such as an exogenous single-or double stranded donor template DNA.
Gene conversion
48
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
and gene correction are products of the repair of DNA double-strand breaks by
HDR pathways such
as those described below.
[0166] Indels, gene conversion, gene correction, and other genome editing
outcomes are typically
assessed by sequencing (most commonly by "next-gen" or "sequencing-by-
synthesis" methods,
though Sanger sequencing may still be used) and are quantified by the relative
frequency of numerical
changes (e.g., 1, 2 or more bases) at a site of interest among all
sequencing reads. DNA samples
for sequencing may be prepared by a variety of methods known in the art, and
may involve the
amplification of sites of interest by polymerase chain reaction (PCR), the
capture of DNA ends
generated by double strand breaks, as in the GUIDEseq process described in
Tsai 2016 (incorporated
by reference herein) or by other means well known in the art. Genome editing
outcomes may also be
assessed by in situ hybridization methods such as the FiberCombTM system
commercialized by
Genomic Vision (Bagneux, France), and by any other suitable methods known in
the art.
[0167] "Alt-HDR," "alternative homology-directed repair," or "alternative HDR"
are used
interchangeably to refer to the process of repairing DNA damage using a
homologous nucleic acid
(e.g., an endogenous homologous sequence, e.g., a sister chromatid, or an
exogenous nucleic acid,
e.g., a template nucleic acid). Alt-HDR is distinct from canonical HDR in that
the process utilizes
different pathways from canonical HDR, and can be inhibited by the canonical
HDR mediators,
RAD51 and BRCA2. Alt-HDR is also distinguished by the involvement of a single-
stranded or
nicked homologous nucleic acid template, whereas canonical HDR generally
involves a double-
stranded homologous template.
[0168] "Canonical HDR," "canonical homology-directed repair" or "cHDR" refer
to the process of
repairing DNA damage using a homologous nucleic acid (e.g., an endogenous
homologous sequence,
e.g., a sister chromatid, or an exogenous nucleic acid, e.g., a template
nucleic acid). Canonical HDR
typically acts when there has been significant resection at the double strand
break, forming at least
one single stranded portion of DNA. In a normal cell, cHDR typically involves
a series of steps such
as recognition of the break, stabilization of the break, resection,
stabilization of single stranded DNA,
formation of a DNA crossover intermediate, resolution of the crossover
intermediate, and ligation.
The process requires RAD51 and BRCA2, and the homologous nucleic acid is
typically double-
stranded.
[0169] Unless indicated otherwise, the term "HDR" as used herein encompasses
both canonical HDR
and alt-HDR.
[0170] "Non-homologous end joining" or "NHEJ" refers to ligation mediated
repair and/or non-
template mediated repair including canonical NHEJ (cNHEJ) and alternative NHEJ
(altNHEJ), which
49
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
in turn includes microhomology-mediated end joining (MMEJ), single-strand
annealing (SSA), and
synthesis-dependent microhomology-mediated end joining (SD-MMEJ).
101711 "Replacement" or "replaced," when used with reference to a modification
of a molecule (e.g.
a nucleic acid or protein), does not require a process limitation but merely
indicates that the
replacement entity is present.
101721 "Subject" means a human, mouse, or non-human primate. A human subject
can be any age
(e.g., an infant, child, young adult, or adult), and may suffer from a
disease, or may be in need of
alteration of a gene.
101731 "Treat," "treating," and "treatment" mean the treatment of a disease in
a subject (e.g., a
human subject), including one or more of inhibiting the disease, i.e.,
arresting or preventing its
development or progression; relieving the disease, i.e., causing regression of
the disease state;
relieving one or more symptoms of the disease; and curing the disease.
101741 "Prevent," "preventing," and "prevention" refer to the prevention of a
disease in a subject,
including (a) avoiding or precluding the disease; (b) affecting the
predisposition toward the disease; or
(c) preventing or delaying the onset of at least one symptom of the disease.
101751 A "kit" refers to any collection of two or more components that
together constitute a
functional unit that can be employed for a specific purpose. By way of
illustration (and not
limitation), one kit according to this disclosure can include a guide RNA
complexed or able to
complex with an RNA-guided nuclease, and accompanied by (e.g. suspended in, or
suspendable in) a
pharmaceutically acceptable carrier. In certain embodiments, the kit may
include a booster element.
The kit can be used to introduce the complex into, for example, a cell or a
subject, for the purpose of
causing a desired genomic alteration in such cell or subject. The components
of a kit can be packaged
together, or they may be separately packaged. Kits according to this
disclosure also optionally
include directions for use (DFU) that describe the use of the kit e.g.,
according to a method of this
disclosure. The DFU can be physically packaged with the kit, or it can be made
available to a user of
the kit, for instance by electronic means.
101761 The terms "polynucleotide", "nucleotide sequence", "nucleic acid",
"nucleic acid molecule",
nucleic acid sequence", and "oligonucleotide" refer to a series of nucleotide
bases (also called
nucleotides") in DNA and RNA, and mean any chain of two or more nucleotides.
The
polynucleotides, nucleotide sequences, nucleic acids etc. can be chimeric
mixtures or derivatives or
modified versions thereof, single-stranded or double-stranded. They can be
modified at the base
moiety, sugar moiety, or phosphate backbone, for example, to improve stability
of the molecule, its
hybridization parameters, etc. A nucleotide sequence typically carries genetic
information, including,
but not limited to, the information used by cellular machinery to make
proteins and enzymes. These
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
terms include double- or single-stranded genomic DNA, RNA, any synthetic and
genetically
manipulated polynucleotide, and both sense and antisense polynucleotides.
These terms also include
nucleic acids containing modified bases.
[0177] Conventional IUPAC notation is used in nucleotide sequences presented
herein, as shown in
Table 1, below (see also Cornish-Bowden A, Nucleic Acids Res. 1985 May 10;
13(9):3021-30,
incorporated by reference herein). It should be noted, however, that "T"
denotes "Thymine or Uracil"
in those instances where a sequence may be encoded by either DNA or RNA, for
example in gRNA
targeting domains.
Table 1: IUPAC nucleic acid notation
Character Base
A Adenine
Thymine or Uracil
Guanine
Cytosine
Uracil
G or T/U
A or C
A or G
C or T/U
C or G
A or T/U
C, G or T/U
V A, C or G
A, C or T/U
A, G or T/U
A, C, G or T/U
[0178] The terms "protein," "peptide" and "polypeptide" are used
interchangeably to refer to a
sequential chain of amino acids linked together via peptide bonds. The terms
include individual
proteins, groups or complexes of proteins that associate together, as well as
fragments or portions,
variants, derivatives and analogs of such proteins. Peptide sequences are
presented herein using
conventional notation, beginning with the amino or N-terminus on the left, and
proceeding to the
carboxyl or C-terminus on the right. Standard one-letter or three-letter
abbreviations can be used.
[0179] The notation "CCAAT box target region" and the like refer to a sequence
that is 5' of the
transcription start site (TSS) of the HBG1 and/or HBG2 gene. CCAAT boxes are
highly conserved
motifs within the promoter region of a-like and f3-like globin genes. The
regions within or near the
CCAAT box play important roles in globin gene regulation. For example, the y-
globin distal CCAAT
51
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
box is associated with hereditary persistence of fetal hemoglobin. A number of
transcription factors
have been reported to bind to the duplicated CCAAT box region of the y-globin
promoter, e.g., NF-Y,
COUP-TFII (NF-E3), CDP, GATA1/NF-E1 and DRED (Martyn 2017). While not wishing
to be
bound by theory, it is believed that the binding sites of the transcriptional
activator NF-Y overlaps
with transcriptional repressors at the y-globin promoter. HPFH mutations
present within the distal y-
globin promoter region, e.g., within or near the CCAAT box, may alter the
competitive binding of
those factors and thus contribute to the increased y-globin expression and
elevated levels of HbF.
Genomic locations provided herein for HBG1 and HBG2 are based on the
coordinates provided in
NCBI Reference Sequence NC 000011, "Homo sapiens chromosome 11, GRCh38.p12
Primary
Assembly," (Version NC_000011.10). The distal CCAAT box of HBG1 and HBG2 is
positioned at
HBG1 and HBG2 c.-111 to -115 (Genomic location is Hg38 Chr11:5,249,968 to
Chr11:5,249,972 and
Hg38 Chr11:5,254,892 to Chr11:5,254,896, respectively). The HBG1 c.-111 to -
115 region is
exemplified in SEQ ID NO:902 (HBG1) at positions 2823-2827, and the HBG2 c.-
111 to -115 region
is exemplified in SEQ ID NO:903 (HBG2) at positions 2747-2751. In certain
embodiments, the
"CCAAT box target region" denotes the region that is at or near the distal
CCAAT box and includes
the nucleotides of the distal CCAAT box and 25 nucleotides upstream (5') and
25 nucleotides
downstream (3') of the distal CCAAT box (i.e., HBG1/2 c.-86 to -140) (Genomic
location is Hg38
Chr11:5249943 to Hg38 Chr11:5249997 and Hg38 Chr11:5254867 to Hg38
Chr11:5254921,
respectively). The HBG1 c.-86 to -140 region is exemplified in SEQ ID NO:902
(HBG1) at positions
2798-2852, and the HBG2 c.-86 to -140 region is exemplified in SEQ ID NO:903
(HBG2) at positions
2723-2776. In other embodiments, the "CCAAT box target region" denotes the
region that is at or
near the distal CCAAT box and includes the nucleotides of the distal CCAAT box
and 5 nucleotides
upstream (5') and 5 nucleotides downstream (3') of the distal CCAAT box (i.e.,
HBG1/2 c.-106 to -
120 (Genomic location is Hg38 Chr11:5249963 to Hg38 Chr11:5249977 (HGB1 and
Hg38
Chr11:5254887 to Hg38 Chr11:5254901, respectively)). The HBG1 c.-106 to -120
region is
exemplified in SEQ ID NO:902 (HBG1) at positions 2818-2832, and the HBG2 c.-
106 to -120 region
is exemplified in SEQ ID NO:903 (HBG2) at positions 2742-2756. The term "CCAAT
box target site
alteration" and the like refer to alterations (e.g., deletions, insertions,
mutations) of one or more
nucleotides of the CCAAT box target region. Examples of exemplary CCAAT box
target region
alterations include, without limitation, the 1 nt deletion, 4 nt deletion,
lint deletion, 13 nt deletion,
and 18 nt deletion, and -117 G>A alteration. As used herein, the terms "CCAAT
box" and "CAAT
box" can be used interchangeably.
[0180] The notations "c.-114 to -102 region," "c.-102 to -114 region," "-102:-
114," "13 nt target
region" and the like refer to a sequence that is 5' of the transcription start
site (TSS) of the HBG1
and/or HBG2 gene at the genomic location Hg38 Chr11:5,249,959 to Hg38
Chr11:5,249,971 and
Hg38 Chr11:5,254,883 to Hg38 Chr11:5,254,895, respectively. The HBG1 c.-102 to
-114 region is
52
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
exemplified in SEQ ID NO:902 (HBG1) at positions 2824-2836 and the HBG2 c.-102
to -114 region
is exemplified in SEQ ID NO:903 (HBG2) at positions 2748-2760. The term "13 nt
deletion" and the
like refer to deletions of the 13 nt target region.
[0181] The notations "c.-121 to -104 region," "c.-104 to -121 region," "-104:-
121," "18 nt target
region," and the like refer to a sequence that is 5' of the transcription
start site (TSS) of the HBG1
and/or HBG2 gene at the genomic location Hg38 Chr11:5,249,961 to Hg38
Chr11:5,249,978 and
Hg38 Chr11:5,254,885 to Hg38 Chrll: 5,254,902, respectively. The HBG1 c.-104
to -121 region is
exemplified in SEQ ID NO:902 (HBG1) at positions 2817-2834, and the HBG2 c.-
104 to -121 region
is exemplified in SEQ ID NO:903 (HBG2) at positions 2741-2758. The term "18 nt
deletion" and the
like refer to deletions of the 18 nt target region.
[0182] The notations "c.-105 to -115 region," "c.-115 to -105 region," "-105:-
115," "11 nt target
region," and the like refer to a sequence that is 5' of the transcription
start site (TSS) of the HBG1
and/or HBG2 gene at the genomic location Hg38 Chr11:5,249,962 to Hg38
Chr11:5,249,972 and
Hg38 Chr11:5,254,886 to Hg38 Chr11:5,254,896, respectively. The HBG1 c.-105 to
-115 region is
exemplified in SEQ ID NO:902 (HBG1) at positions 2823-2833, and the HBG2 c.-
105 to -115 region
is exemplified in SEQ ID NO:903 (HBG2) at positions 2747-2757. The term "11 nt
deletion" and the
like refer to deletions of the 11 nt target region.
[0183] The notations "c.-115 to -112 region," "c.-112 to -115 region," "-112:-
115," "4 nt target
region," and the like refer to a sequence that is 5' of the transcription
start site (TSS) of the HBG1
and/or HBG2 gene at the genomic location Hg38 Chr11:5,249,969 to Hg38
Chr11:5,249,972 and
Hg38 Chr11:5,254,893 to Hg38 Chr11:5,254,896, respectively. The HBG1 c.-112 to
-115 region is
exemplified in SEQ ID NO:902 at positions 2823-2826, and the HBG2 c.-112 to -
115 region is
exemplified in SEQ ID NO:903 (HBG2) at positions 2747-2750. The term "4 nt
deletion" and the
like refer to deletions of the 4 nt target region.
[0184] The notations "c.-116 region," "HBG-116," "1 nt target region," and the
like refer to a
sequence that is 5' of the transcription start site (TSS) of the HBG1 and/or
HBG2 gene at the genomic
location Hg38 Chr11:5,249,973 and Hg38 Chr11:5,254,897, respectively. The HBG1
c.-116 region is
exemplified in SEQ ID NO:902 at position 2822, and the HBG2 c.-116 region is
exemplified in SEQ
ID NO:903 (HBG2) at position 2746. The term "1 nt deletion" and the like refer
to deletions of the 1
nt target region.
[0185] The notations "c.-117 G>A region," "HBG-117 G>A," "-117 G>A target
region" and the like
refer to a sequence that is 5' of the transcription start site (TSS) of the
HBG1 and/or HBG2 gene at the
genomic location Hg38 Chr11:5,249,974 to Hg38 Chr11:5,249,974 and Hg38
Chr11:5,254,898 to
Hg38 Chr11:5,254,898, respectively. The HBG1 c.-117 G>A region is exemplified
by a substitution
53
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
from guanine (G) to adenine (A) in SEQ ID NO:902 at position 2821, and the
HBG2 c.-117 G>A
region is exemplified by a substitution from G to A in SEQ ID NO:903 (HBG2) at
position 2745. The
term "-117 G>A alteration" and the like refer to a substitution from G to A at
the -117G>A target
region.
[0186] The term "proximal HBG1/2 promoter target sequence" denotes the region
within 50, 100,
200, 300, 400, or 500 bp of a proximal HBG1/2 promoter sequence including the
13 nt target region.
Alterations by genome editing systems according to this disclosure facilitate
(e.g. cause, promote or
tend to increase the likelihood of) upregulation of HbF production in
erythroid progeny.
[0187] The term "GATA1 binding motif in BCL11Ae" refers to the sequence that
is the GATA1
binding motif in the erythroid specific enhancer of BCL11A (BCL11Ae) that is
in the +58 DNase I
hypersensitive site (DHS) region of intron 2 of the BCL11A gene. The genomic
coordinates for the
GATA1 binding motif in BCL11Ae are chr2: 60,495,265 to 60,495,270. The +58 DHS
site comprises
a 115 base pair (bp) sequence as set forth in SEQ ID NO:968. The +58 DHS site
sequence, including
¨500 bp upstream and ¨200 bp downstream is set forth in SEQ ID NO:969.
[0188] Where ranges are provided herein, endpoints are included. Furthermore,
it is to be understood
that unless otherwise indicated or otherwise evident from the context and/or
the understanding of one
of ordinary skill in the art, values that are expressed as ranges can assume
any specific value within
the stated ranges in different embodiments of the invention, to the tenth of
the unit of the lower limit
of the range, unless the context clearly dictates otherwise. It is also to be
understood that unless
otherwise indicated or otherwise evident from the context and/or the
understanding of one of ordinary
skill in the art, values expressed as ranges can assume any subrange within
the given range, wherein
the endpoints of the subrange are expressed to the same degree of accuracy as
the tenth of the unit of
the lower limit of the range.
Overview
[0189] The various embodiments of this disclosure generally relate to genome
editing systems
configured to introduce alterations (e.g., a deletion or insertion, or other
mutation) into chromosomal
DNA that enhance transcription of the HBG1 and/or HBG2 genes, which encode the
Ay and Gy
subunits of hemoglobin, respectively. In certain embodiments, increased
expression of one or more
y¨globin genes (e.g., HBG1, HBG2) using the methods provided herein results in
preferential
formation of HbF over HbA and/or increased HbF levels as a percentage of total
hemoglobin. In
certain embodiments, the disclosure generally relates to the use of RNP
complexes comprising a
gRNA complexed to a Cpfl molecule. In certain embodiments, the gRNA may be
unmodified or
modified, the Cpfl molecule may be a wild-type Cpfl protein or a modified Cpfl
protein. In certain
embodiments, the gRNA may comprise a sequence set forth in Table 6, Table 12,
or Table 13. In
certain embodiments, a modified Cpfl may be encoded by a sequence set forth in
SEQ ID NOs:1000,
54
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
1001, 1008-1018, 1032, 1035-39, 1094-1097, 1107-09 (Cpfl polypeptide
sequences) or SEQ ID
NOs:1019-1021, 1110-17 (Cpfl polynucleotide sequences). In certain
embodiments, the RNP
complex may comprise an RNP complex set forth in Table 15. For example, the
RNP complex may
include a gRNA comprising the sequence set forth in SEQ ID NO:1051 and a
modified Cpfl protein
encoded by the sequence set forth in SEQ ID NO:1097 (RNP32, Table 15).
[0190] It has previously been shown that patients with the condition
Hereditary Persistence of Fetal
Hemoglobin (HPFH) contain mutations in an y-globin regulatory element that
results in fetal y-globin
expression throughout life, rather than being repressed around the time of
birth (Martyn 2017). This
results in elevated fetal hemoglobin (HbF) expression. HPFH mutations may be
deletional or non-
deletional (e.g., point mutations). Subjects with HPFH exhibit lifelong
expression of HbF, i.e., they
do not undergo or undergo only partial globin switching, with no symptoms of
anemia.
[0191] HbF expression can be induced through point mutations in an y-globin
regulatory element
that is associated with a naturally occurring HPFH variant, including, for
example, HBG1 c.-114
C>T; c.-117 G>A; c.-158 C>T; c.-167 C>T; c.-170 G>A; c.-175 T>G; c.-175 T>C;
c.-195 C>G; c.-
196 C>T; c.-197 C>T; c.-198 T>C; c.-201 C>T; c.-202 C>T; c.-211 C>T, c.-251
T>C; or c.-499 T>A;
or HBG2 c.-109 G>T; c.-110 A>C; c.-114 C>A; c.-114 C>T; c.-114 C>G; c.-157
C>T; c.-158 C>T;
c.-167 C>T; c.-167 C>A; c.-175 T>C; c.-197 C>T; c.-200+C; c.-202 C>G; c.-211
C>T; c.-228 T>C;
c.-255 C>G; c.-309 A>G; c.-369 C>G; or c.-567 T>G.
[0192] Naturally occurring mutations at the distal CCAAT box motif found
within the promoter of
the HBG1 and/or HBG2 genes (i.e., HBG1/2 c.-111 to -115) have also been shown
to result in
continued y-globin expression and the HPFH condition. It is thought that
alteration (mutation or
deletion) of the CCAAT box may disrupt the binding of one or more
transcriptional repressors,
resulting in continued expression of the y-globin gene and elevated HbF
expression (Martyn 2017).
For example, a naturally occurring 13 base pair del c.-114 to -102 ("13 nt
deletion") has been shown
to be associated with elevated levels of HbF (Martyn 2017). The distal CCAAT
box likely overlaps
with the binding motifs within and surrounding the CCAAT box of negative
regulatory transcription
factors that are expressed in adulthood and repress HBG (Martyn 2017).
[0193] A gene editing strategy disclosed herein is to increase HbF expression
by disrupting one or
more nucleotides in the distal CCAAT box and/or surrounding the distal CCAAT
box. In certain
embodiments, the "CCAAT box target region" may be the region that is at or
near the distal CCAAT
box and includes the nucleotides of the distal CCAAT box and 25 nucleotides
upstream (5') and 25
nucleotides downstream (3') of the distal CCAAT box (i.e., HBG1/2 c.-86 to -
140). In other
embodiments, the "CCAAT box target region" may be the region that is at or
near the distal CCAAT
box and includes the nucleotides of the distal CCAAT box and 5 nucleotides
upstream (5') and 5
nucleotides downstream (3') of the distal CCAAT box (i.e., HBG1/2 c.-106 to -
120). Unique, non-
naturally occurring alterations of the CCAAT box target region are disclosed
herein that induce HBG
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
expression including, without limitation, HBG del c. -104 to -121 ("18 nt
deletion"), HBG del c.-105
to -115 ("11 nt deletion"), HBG del c.-112 to -115 ("4 nt deletion"), and HBG
del c.-116 ("1 nt
deletion"). In certain embodiments, genome editing systems disclosed herein
may be used to
introduce alterations into the CCAAT box target region of HBG1 and/or HBG2. In
certain
embodiments, the genome editing systems may include one or more of a DNA donor
template that
encodes an alteration (such as a deletion, insertion, or mutation) in the
CCAAT box target region. In
certain embodiments, the alterations may be non-naturally occurring
alterations or naturally occurring
alterations. In certain embodiments, the donor templates may encode the 1 nt
deletion, 4 nt deletion,
11 nt deletion, 13 nt deletion, 18 nt deletion, or c.-117 G>A alteration. In
certain embodiments, the
genome editing systems may include an RNA guided nuclease including a Cas9,
modified Cas 9, a
Cpfl, or modified Cpfl. In certain embodiments, the genome editing systems may
include an RNP
comprising a gRNA and a Cpfl molecule. In certain embodiments, a gRNA may be
unmodified or
modified, the Cpfl molecule may be a wild-type Cpfl protein or a modified Cpfl
protein, or a
combination thereof. In certain embodiments, the gRNA may comprise a sequence
set forth in Table
6, Table 12, or Table 13. In certain embodiments, a modified Cpfl may be
encoded by a sequence
set forth in SEQ ID NOs:1000, 1001, 1008-1018, 1032, 1035-39, 1094-1097, 1107-
09 (Cpfl
polypeptide sequences) or SEQ ID NOs:1019-1021, 1110-17 (Cpfl polynucleotide
sequences). In
certain embodiments, the RNP complex may comprise an RNP complex set forth in
Table 15. For
example, the RNP complex may include a gRNA comprising the sequence set forth
in SEQ ID
NO:1051 and a modified Cpfl protein encoded by the sequence set forth in SEQ
ID NO:1097
(RNP32, Table 15).
[0194] The genome editing systems of this disclosure can include an RNA-guided
nuclease such as
Cpfl and one or more gRNAs having a targeting domain that is complementary to
a sequence in or
near the target region, and optionally one or more of a DNA donor template
that encodes a specific
mutation (such as a deletion or insertion) in or near the target region,
and/or an agent that enhances
the efficiency with which such mutations are generated including, without
limitation, a random
oligonucleotide, a small molecule agonist or antagonist of a gene product
involved in DNA repair or a
DNA damage response, or a peptide agent.
101951 A variety of approaches to the introduction of mutations into the CCAAT
box target region,
13 nt target region, and/or proximal HBG1/2 promoter target sequence may be
employed in the
embodiments of the present disclosure. In one approach, a single alteration,
such as a double-strand
break, is made within the CCAAT box target region, 13 nt target region, and/or
proximal HBG1/2
promoter target sequence, and is repaired in a way that disrupts the function
of the region, for example
by the formation of an indel or by the incorporation of a donor template
sequence that encodes the
deletion of the region. In a second approach, two or more alterations are made
on either side of the
56
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
region, resulting in the deletion of the intervening sequence, including the
CCAAT box target region
and/or 13 nt target region.
[0196] The treatment of hemoglobinopathies by gene therapy and/or genome
editing is complicated
by the fact that the cells that are phenotypically affected by the disease,
erythrocytes or RBCs, are
enucleated, and do not contain genetic material encoding either the aberrant
hemoglobin protein (Hb)
subunits nor the Ay or Gy subunits targeted in the exemplary genome editing
approaches described
above. This complication is addressed, in certain embodiments of this
disclosure, by the alteration of
cells that are competent to differentiate into, or otherwise give rise to,
erythrocytes. Cells within the
erythroid lineage that are altered according to various embodiments of this
disclosure include, without
limitation, hematopoietic stem and progenitor cells (HSCs), erythroblasts
(including basophilic,
polychromatic and/or orthochromatic erythroblasts), proerythroblasts,
polychromatic erythrocytes or
reticulocytes, embryonic stem (ES) cells, and/or induced pluripotent stem
(iPSC) cells. These cells
may be altered in situ (e.g. within a tissue of a subject) or ex vivo.
Implementations of genome editing
systems for in situ and ex vivo alteration of cells is described under the
heading "Implementation of
genome editing systems: delivery, formulations, and routes of administration"
below.
[0197] In certain embodiments, alterations that result in induction of Ay
and/or Gy expression are
obtained through the use of a genome editing system comprising an RNA-guided
nuclease and at least
one gRNA having a targeting domain complementary to a sequence within the
CCAAT box target
region ofHBG1 and/or HBG2 or proximate thereto (e.g., within 10, 20, 30, 40,
or 50, 100, 200, 300,
400 or 500 bases of the CCAAT box target region). As is discussed in greater
detail below, the RNA-
guided nuclease and gRNA form a complex that is capable of associating with
and altering the
CCAAT box target region or a region proximate thereto. Examples of suitable
gRNAs and gRNA
targeting domains directed to the CCAAT box target region of HBG1 and/or HBG2
or proximate
thereto for use in the embodiments disclosed herein include those set forth
herein.
[0198] In certain embodiments, alterations that result in induction of Ay
and/or Gy expression are
obtained through the use of a genome editing system comprising an RNA-guided
nuclease and at least
one gRNA having a targeting domain complementary to a sequence within the 13
nt target region of
HBG1 and/or HBG2 or proximate thereto (e.g., within 10, 20, 30, 40, or 50,
100, 200, 300, 400 or 500
bases of the 13 nt target region). As is discussed in greater detail below,
the RNA-guided nuclease
and gRNA form a complex that is capable of associating with and altering the
13 nt target region or a
region proximate thereto. Examples of suitable gRNAs and gRNA targeting
domains directed to the
13 nt target region ofHBG1 and/or HBG2 or proximate thereto for use in the
embodiments disclosed
herein include those set forth herein.
[0199] The genome editing system can be implemented in a variety of ways, as
is discussed below in
detail. As an example, a genome editing system of this disclosure can be
implemented as a
57
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
ribonucleoprotein complex or a plurality of complexes in which multiple gRNAs
are used. This
ribonucleoprotein complex can be introduced into a target cell using art-known
methods, including
electroporation, as described in commonly-assigned International Patent
Publication No. WO
2016/182959 by Jennifer Gori ("Gori"), published Nov. 17, 2016, which is
incorporated by reference
in its entirety herein.
[0200] The ribonucleoprotein complexes within these compositions are
introduced into target cells
by art-known methods, including without limitation electroporation (e.g. using
the NucleofectionTM
technology commercialized by Lonza, Basel, Switzerland or similar technologies
commercialized by,
for example, Maxcyte Inc. Gaithersburg, Maryland) and lipofection (e.g. using
LipofectamineTM
reagent commercialized by Thermo Fisher Scientific, Waltham Massachusetts).
Alternatively, or
additionally, ribonucleoprotein complexes are formed within the target cells
themselves following
introduction of nucleic acids encoding the RNA-guided nuclease and/or gRNA.
These and other
delivery modalities are described in general terms below and in Gori.
[0201] Cells that have been altered ex vivo according to this disclosure can
be manipulated (e.g.
expanded, passaged, frozen, differentiated, de-differentiated, transduced with
a transgene, etc.) prior
to their delivery to a subject. The cells are, variously, delivered to a
subject from which they are
obtained (in an "autologous" transplant), or to a recipient who is
immunologically distinct from a
donor of the cells (in an "allogeneic" transplant).
[0202] In some cases, an autologous transplant includes the steps of
obtaining, from the subject, a
plurality of cells, either circulating in peripheral blood, or within the
marrow or other tissue (e.g.
spleen, skin, etc.), and manipulating those cells to enrich for cells in the
erythroid lineage (e.g. by
induction to generate iPSCs, purification of cells expressing certain cell
surface markers such as
CD34, CD90, CD49f and/or not expressing surface markers characteristic of non-
erythroid lineages
such as CD10, CD14, CD38, etc.). The cells are, optionally or additionally,
expanded, transduced
with a transgene, exposed to a cytokine or other peptide or small molecule
agent, and/or
frozen/thawed prior to transduction with a genome editing system targeting the
CCAAT box target
region, the 13 nt target region, and/or proximal HBG1/2 promoter target
sequence. The genome
editing system can be implemented or delivered to the cells in any suitable
format, including as a
ribonucleoprotein complex, as separated protein and nucleic acid components,
and/or as nucleic acids
encoding the components of the genome editing system.
[0203] In certain embodiments, CD34+ hematopoietic stem and progenitor cells
(HSPCs) that have
been edited using the genome editing methods disclosed herein may be used for
the treatment of a
hemoglobinopathy in a subject in need thereof In certain embodiments, the
hemoglobinopathy may
be severe sickle cell disease (SCD) or thalassemia, such as 13-thalassemia, 6-
thalassemia, or
thalassemia. In certain embodiments, an exemplary protocol for treatment of a
hemoglobinopathy
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
may include harvesting CD34+ HSPCs from a subject in need thereof, ex vivo
editing of the
autologous CD34+ HSPCs using the genome editing methods disclosed herein,
followed by
reinfusion of the edited autologous CD34+ HSPCs into the subject. In certain
embodiments,
treatment with edited autologous CD34+ HSPCs may result in increased HbF
induction.
[0204] Prior to harvesting CD34+ HSPCs, in certain embodiments, a subject may
discontinue
treatment with hydroxyurea, if applicable, and receive blood transfusions to
maintain sufficient
hemoglobin (Hb) levels. In certain embodiments, a subject may be administered
intravenous
plerixafor (e.g., 0.24 mg/kg) to mobilize CD34+ HSPCs from bone marrow into
peripheral blood. In
certain embodiments, a subject may undergo one or more leukapheresis cycles
(e.g., approximately
one month between cycles, with one cycle defined as two plerixafor-mobilized
leukapheresis
collections performed on consecutive days). In certain embodiments, the number
of leukapheresis
cycles performed for a subject may be the number required to achieve a dose of
edited autologous
CD34+ HSPCs (e.g., > 2 x 106 cells/kg, > 3 x 106 cells/kg, > 4 x 106 cells/kg,
> 5 x 106 cells/kg, 2 x
106 cells/kg to 3 x 106 cells/kg, 3 x 106 cells/kg to 4 x 106 cells/kg, 4 x
106 cells/kg to 5 x 106 cells/kg)
to be reinfused back into the subject, along with a dose of unedited
autologous CD34+ HSPCs/kg for
backup storage (e.g., > 1.5 x 106 cells/kg). In certain embodiments, the CD34+
HSPCs harvested
from the subject may be edited using any of the genome editing methods
discussed herein. In certain
embodiments, any one or more of the gRNAs and one or more of the RNA-guided
nucleases disclosed
herein may be used in the genome editing methods.
[0205] In certain embodiments, the treatment may include an autologous stem
cell transplant. In
certain embodiments, a subject may undergo myeloablative conditioning with
busulfan conditioning
(e.g., dose-adjusted based on first-dose pharmacokinetic analysis, with a test
dose of 1 mg/kg). In
certain embodiments, conditioning may occur for four consecutive days. In
certain embodiments,
following a three-day busulfan washout period, edited autologous CD34+ HSPCs
(e.g., > 2 x 106
cells/kg, > 3 x 106 cells/kg, > 4 x 106 cells/kg, > 5 x 106 cells/kg, 2 x 106
cells/kg to 3 x 106 cells/kg, 3
x 106 cells/kg to 4 x 106 cells/kg, 4 x 106 cells/kg to 5 x 106 cells/kg) may
be reinfused into the subject
(e.g., into peripheral blood). In certain embodiments, the edited autologous
CD34+ HSPCs may be
manufactured and cryopreserved for a particular subject. In certain
embodiments, a subject may
attain neutrophil engraftment following a sequential myeloablative
conditioning regimen and infusion
of edited autologous CD34+ cells. Neutrophil engraftment may be defined as
three consecutive
measurements of ANC > 0.5 x 109/L.
[0206] However it is implemented, a genome editing system may include, or may
be co-delivered
with, one or more factors that improve the viability of the cells during and
after editing, including
without limitation an aryl hydrocarbon receptor antagonist such as StemRegenin-
1 (SR1), UM171,
LGC0006, alpha-napthoflavone, and CH-223191, and/or an innate immune response
antagonist such
as cyclosporin A, dexamethasone, reservatrol, a MyD88 inhibitory peptide, an
RNAi agent targeting
59
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Myd88, a B18R recombinant protein, a glucocorticoid, OxPAPC, a TLR antagonist,
rapamycin,
BX795, and a RLR shRNA. These and other factors that improve the viability of
the cells during and
after editing are described in Gori, under the heading "I. Optimization of
Stem Cells" from page 36
through page 61, which is incorporated by reference herein.
[0207] The cells, following delivery of the genome editing system, are
optionally manipulated e.g. to
enrich for HSCs and/or cells in the erythroid lineage and/or for edited cells,
to expand them,
freeze/thaw, or otherwise prepare the cells for return to the subject. The
edited cells are then returned
to the subject, for instance in the circulatory system by means of intravenous
delivery or delivery or
into a solid tissue such as bone marrow.
[0208] Functionally, alteration of the CCAAT box target region, the 13 nt
target region, and/or
proximal HBG1/2 promoter target sequence using the compositions, methods and
genome editing
systems of this disclosure results in significant induction, among hemoglobin-
expressing cells, of Ay
and/or Gy subunits (referred to interchangeably as HbF expression), e.g. at
least 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50% or greater induction of Ay and/or Gy subunit
expression relative to
unmodified controls. This induction of protein expression is generally the
result of alteration of the
CCAAT box target region, 13 nt target region, and/or proximal HBG1/2 promoter
target sequence
(expressed, e.g. in terms of the percentage of total genomes comprising indel
mutations within the
plurality of cells) in some or all of the plurality of cells that are treated,
e.g. at least 5%, 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50% of the plurality of cells comprise at least
one allele comprising
a sequence alteration, including, without limitation, an indel, insertion, or
deletion in or near the
CCAAT box target region, 13 nt target region, and/or proximal HBG1/2 promoter
target sequence.
[0209] The functional effects of alterations caused or facilitated by the
genome editing systems and
methods of the present disclosure can be assessed in any number of suitable
ways. For example, the
effects of alterations on expression of fetal hemoglobin can be assessed at
the protein or mRNA level.
Expression of HBG1 and HBG2 mRNA can be assessed by digital droplet PCR
(ddPCR), which is
performed on cDNA samples obtained by reverse transcription of mRNA harvested
from treated or
untreated samples. Primers for HBG1, HBG2, HBB, and/or HBA may be used
individually or
multiplexed using methods known in the art. For example, ddPCR analysis of
samples may be
conducted using the QX200TM ddPCR system commercialized by Bio Rad (Hercules,
CA), and
associated protocols published by BioRad. Fetal hemoglobin protein may be
assessed by high
pressure liquid chromatography (HPLC), for example, according to the methods
discussed on pp. 143-
44 in Chang 2017 (incorporated by reference herein), or fast protein liquid
chromatography (FPLC),
using ion-exchange and/or reverse phase columns to resolve HbF, HbB and HbA
and/or Ay and Gy
globin chains as is known in the art.
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0210] It should be noted that the rate at which the CCAAT box target region
(e.g., 18 nt, 11 nt, 4 nt,
1 nt, c.-117 G>A target regions), 13 nt target region, and/or proximal HBG1/2
promoter target
sequence is altered in the target cells can be modified by the use of optional
genome editing system
components such as oligonucleotide donor templates. Donor template design is
described in general
terms below under the heading "Donor template design." Donor templates for use
in targeting the 13
nt target region may include, without limitation, donor templates encoding
alterations (e.g., deletions)
of HBG1 c.-114 to -102 (corresponding to nucleotides 2824-2836 of SEQ ID NO:
902), HBG1 c.-225
to -222 (corresponding to nucleotides 2716-2719 of SEQ ID NO:902)), and/or
HBG2 c.-114 to -102
(corresponding to nucleotides 2748-2760 of SEQ ID NO:903). Exemplary 5' and 3'
homology arms,
and exemplary full-length donor templates encoding deletions such as c. -114
to -102 are also
presented below. In certain embodiments, donor templates for use in targeting
the 18 nt target region
may include, without limitation, donor templates encoding alterations (e.g.,
deletions) of HBG1 c.-
104 to -121, HBG2 c.-104 to -121, or a combination thereof. Exemplary full-
length donor templates
encoding deletions such as c.-104 to -121 include SEQ ID NOs:974 and 975. In
certain embodiments,
donor templates for use in targeting the 11 nt target region may include,
without limitation, donor
templates encoding alterations (e.g., deletions) of HBG1 c.-105 to -115, HBG2
c.-105 to -115, or a
combination thereof. Exemplary full-length donor templates encoding deletions
such as c.-105 to -
115 include SEQ ID NOs:976 and 978. In certain embodiments, donor templates
for use in targeting
the 4 nt target region may include, without limitation, donor templates
encoding alterations (e.g.,
deletions) of HBG1 c.-112 to -115, HBG2 c.-112 to -115, or a combination
thereof Exemplary full-
length donor templates encoding deletions such as c.-112 to -115 include SEQ
ID NOs:984-995. In
certain embodiments, donor templates for use in targeting the 1 nt target
region may include, without
limitation, donor templates encoding alterations (e.g., deletions) of HBG1 c.-
116, HBG2 c.-116, or a
combination thereof. Exemplary full-length donor templates encoding deletions
such as c.-116
include SEQ ID NOs:982 and 983. In certain embodiments, donor templates for
use in targeting the
c.-117 G>A target region may include, without limitation, donor templates
encoding alterations (e.g.,
deletions) of HBG1 c.-117 G>A, HBG2 c.-117 G>A, or a combination thereof
Exemplary full-
length donor templates encoding deletions such as c.-117 G>A include SEQ ID
NOs:980 and 981. In
certain embodiments, the donor template may be a positive strand or a negative
strand.
[0211] Donor templates used herein may be non-specific templates that are non-
homologous to
regions of DNA within or near the target sequence. In certain embodiments,
donor templates for use
in targeting the 13 nt target region may include, without limitation, non-
target specific templates that
are nonhomologous to regions of DNA within or near the 13 nt target region.
For example, a non-
specific donor template for use in targeting the 13 nt target region may be
non-homologous to the
regions of DNA within or near the 13 nt target region and may comprise a donor
template encoding
the deletion of HBG1 c.-225 to -222 (corresponding to nucleotides 2716-2719 of
SEQ ID NO:902).
61
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0212] The embodiments described herein may be used in all classes of
vertebrate including, but not
limited to, primates, mice, rats, rabbits, pigs, dogs, and cats.
[0213] This overview has focused on a handful of exemplary embodiments that
illustrate the
principles of genome editing systems and CRISPR-mediated methods of altering
cells. For clarity,
however, this disclosure encompasses modifications and variations that have
not been expressly
addressed above, but will be evident to those of skill in the art. With that
in mind, the following
disclosure is intended to illustrate the operating principles of genome
editing systems more generally.
What follows should not be understood as limiting, but rather illustrative of
certain principles of
genome editing systems and CRISPR-mediated methods utilizing these systems,
which, in
combination with the instant disclosure, will inform those of skill in the art
about additional
implementations and modifications that are within its scope.
RNA-guided helicases, guide RNAs and dead guide RNAs
[0214] In certain embodiments of the approaches and methods described above,
the alteration of
DNA helical structure is achieved through the action of an "RNA-guided
helicase," which term is
generally used to refer to a molecule, typically a peptide, that (a) interacts
(e.g., complexes) with a
gRNA, and (b) together with the gRNA, associates with and unwinds a target
site. RNA-guided
helicases may, in certain embodiments, comprise RNA-guided nucleases
configured to lack nuclease
activity. However, the inventors have observed that even a cleavage-competent
RNA-guided
nuclease may be adapted for use as an RNA-guided helicase by complexing it to
a dead gRNA having
a truncated targeting domain of 15 or fewer nucleotides in length. Complexes
of wild-type RNA-
guided nucleases with dead gRNAs exhibit reduced or eliminated RNA-cleavage
activity, but appear
to retain helicase activity. RNA-guided helicases and dead gRNAs are described
in greater detail
below.
[0215] Regarding RNA-guided helicases, according to the present disclosure an
RNA-guided
helicase may comprise any of the RNA-guided nucleases disclosed herein and
infra under the heading
entitled "RNA-guided nucleases," including, without limitation, a Cas9 or Cpfl
RNA-guided
nuclease. The helicase activity of these RNA-guided nucleases allow for
unwinding of DNA,
providing increased access of genome editing system components (e.g., without
limitation,
catalytically active RNA-guided nuclease and gRNAs) to the desired target
region to be edited (e.g.,
the CCAAT box target region, 13 nt target region, and/or proximal HBG1/2
promoter target
sequence). In certain embodiments, the RNA-guided nuclease may be a
catalytically active RNA-
guided nuclease with nuclease activity. In certain embodiments, the RNA-guided
helicase may be
configured to lack nuclease activity. For example, in certain embodiments, the
RNA-guided helicase
may be a catalytically inactive RNA-guided nuclease that lacks nuclease
activity, such as a
catalytically dead Cas9 molecule, which still provides helicase activity. In
certain embodiments, an
62
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
RNA-guided helicase may form a complex with a dead gRNA, forming a dead RNP
that cannot
cleave nucleic acid. In other embodiments, the RNA-guided helicase may be a
catalytically active
RNA-guided nuclease complexed to a dead gRNA, forming a dead RNP that cannot
cleave nucleic
acid. In certain embodiments, the RNA-guided nuclease is not configured to
recruit an exogenous
trans-acting factor to the desired target region to be edited (e.g., the CCAAT
box target region, 13 nt
target region, and/or proximal HBG1/2 promoter target sequence).
[0216] Turning to dead gRNAs, these include any of the dead gRNAs discussed
herein and infra
under the heading entitled "Dead gRNA molecules." Dead gRNAs (also referred to
herein as
"dgRNAs") may be generated by truncating the 5' end of a gRNA targeting domain
sequence,
resulting in a targeting domain sequence of 15 nucleotides or fewer in length.
Dead guide RNA
molecules according to the present disclosure include dead guide RNA molecules
that have reduced,
low, or undetectable cleavage activity. The targeting domain sequences of dead
guide RNAs may be
shorter in length by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides compared to
the targeting domain
sequence of active guide RNAs. Dead gRNA molecules may comprise targeting
domains
complementary to regions proximal to or within a target region (e.g., the
CCAAT box target region,
13 nt target region, proximal HBG1/2 promoter target sequence, and/or the
GATA1 binding motif in
BCL11Ae) in a target nucleic acid. In certain embodiments, "proximal to" may
denote the region
within 10, 25, 50, 100, or 200 nucleotides of a target region (e.g., the CCAAT
box target region, 13 nt
target region, proximal HBG1/2 promoter target sequence, and/or the GATA1
binding motif in
BCL11Ae). In certain embodiments, dead gRNAs comprise targeting domains
complementary to the
transcription strand or non-transcription strand of DNA. In certain
embodiments, the dead guide
RNA is not configured to recruit an exogenous trans-acting factor to a target
region (e.g., the CCAAT
box target region, 13 nt target region, proximal HBG1/2 promoter target
sequence, and/or the GATA1
binding motif in BCL11Ae).
[0217] This overview has focused on a handful of exemplary embodiments that
illustrate the
principles of genome editing systems and CRISPR-mediated methods of altering
cells. For clarity,
however, this disclosure encompasses modifications and variations that have
not been expressly
addressed above, but will be evident to those of skill in the art. With that
in mind, the following
disclosure is intended to illustrate the operating principles of genome
editing systems more generally.
What follows should not be understood as limiting, but rather illustrative of
certain principles of
genome editing systems and CRISPR-mediated methods utilizing these systems,
which, in
combination with the instant disclosure, will inform those of skill in the art
about additional
implementations and modifications that are within its scope.
Genome editing systems
[0218] The term "genome editing system" refers to any system having RNA-guided
DNA editing
activity. Genome editing systems of the present disclosure include at least
two components adapted
63
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
from naturally occurring CRISPR systems: a guide RNA (gRNA) and an RNA-guided
nuclease.
These two components form a complex that is capable of associating with a
specific nucleic acid
sequence and editing the DNA in or around that nucleic acid sequence, for
instance by making one or
more of a single-strand break (an SSB or nick), a double-strand break (a DSB)
and/or a point
mutation.
[0219] Genome editing systems can be implemented (e.g. administered or
delivered to a cell or a
subject) in a variety of ways, and different implementations may be suitable
for distinct applications.
For instance, a genome editing system is implemented, in certain embodiments,
as a protein/RNA
complex (a ribonucleoprotein, or RNP), which can be included in a
pharmaceutical composition that
optionally includes a pharmaceutically acceptable carrier and/or an
encapsulating agent, such as,
without limitation, a lipid or polymer micro- or nano-particle, micelle, or
liposome. In certain
embodiments, a genome editing system is implemented as one or more nucleic
acids encoding the
RNA-guided nuclease and guide RNA components described above (optionally with
one or more
additional components); in certain embodiments, the genome editing system is
implemented as one or
more vectors comprising such nucleic acids, for instance a viral vector such
as an adeno-associated
virus (see section below under the heading "Implementation of genome editing
systems: delivery,
formulations, and routes of administration"); and in certain embodiments, the
genome editing system
is implemented as a combination of any of the foregoing. Additional or
modified implementations
that operate according to the principles set forth herein will be apparent to
the skilled artisan and are
within the scope of this disclosure.
[0220] It should be noted that the genome editing systems of the present
disclosure can be targeted to
a single specific nucleotide sequence, or may be targeted to ¨ and capable of
editing in parallel ¨
two or more specific nucleotide sequences through the use of two or more guide
RNAs. The use of
multiple gRNAs is referred to as "multiplexing" throughout this disclosure,
and can be employed to
target multiple, unrelated target sequences of interest, or to form multiple
SSBs or DSBs within a
single target domain and, in some cases, to generate specific edits within
such target domain. For
example, International Patent Publication No. WO 2015/138510 by Maeder et al.
("Maeder"), which
is incorporated by reference herein, describes a genome editing system for
correcting a point mutation
(C.2991+1655A to G) in the human CEP290 gene that results in the creation of a
cryptic splice site,
which in turn reduces or eliminates the function of the gene. The genome
editing system of Maeder
utilizes two guide RNAs targeted to sequences on either side of (i.e.
flanking) the point mutation, and
forms DSBs that flank the mutation. This, in turn, promotes deletion of the
intervening sequence,
including the mutation, thereby eliminating the cryptic splice site and
restoring normal gene function.
[0221] As another example, WO 2016/073990 by Cotta-Ramusino et al. ("Cotta-
Ramusino"), which
is incorporated by reference herein, describes a genome editing system that
utilizes two gRNAs in
64
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
combination with a Cas9 nickase (a Cas9 that makes a single strand nick such
as S. pyogenes Dl OA),
an arrangement termed a "dual-nickase system." The dual-nickase system of
Cotta-Ramusino is
configured to make two nicks on opposite strands of a sequence of interest
that are offset by one or
more nucleotides, which nicks combine to create a double strand break having
an overhang (5' in the
case of Cotta-Ramusino, though 3' overhangs are also possible). The overhang,
in turn, can facilitate
homology directed repair events in some circumstances. And, as another
example, WO 2015/070083
by Palestrant et al. (incorporated by reference herein) describes a gRNA
targeted to a nucleotide
sequence encoding Cas9 (referred to as a "governing RNA"), which can be
included in a genome
editing system comprising one or more additional gRNAs to permit transient
expression of a Cas9 that
might otherwise be constitutively expressed, for example in some virally
transduced cells. These
multiplexing applications are intended to be exemplary, rather than limiting,
and the skilled artisan
will appreciate that other applications of multiplexing are generally
compatible with the genome
editing systems described here.
[0222] As disclosed herein, in certain embodiments, genome editing systems may
comprise multiple
gRNAs that may be used to introduce mutations into the GATA1 binding motif in
BCL11Ae or the 13
nt target region of HBG1 and/or HBG2. In certain embodiments, genome editing
systems disclosed
herein may comprise multiple gRNAs used to introduce mutations into the GATA1
binding motif in
BCL11Ae and the 13 nt target region of HBG1 and/or HBG2.
[0223] Genome editing systems can, in some instances, form double strand
breaks that are repaired
by cellular DNA double-strand break mechanisms such as NHEJ or HDR. These
mechanisms are
described throughout the literature (see, e.g., Davis & Maizels 2014
(describing Alt-HDR); Frit 2014
(describing Alt-NHEJ); Iyama & Wilson 2013 (describing canonical HDR and NHEJ
pathways
generally)).
[0224] Where genome editing systems operate by forming DSBs, such systems
optionally include
one or more components that promote or facilitate a particular mode of double-
strand break repair or a
particular repair outcome. For instance, Cotta-Ramusino also describes genome
editing systems in
which a single stranded oligonucleotide "donor template" is added; the donor
template is incorporated
into a target region of cellular DNA that is cleaved by the genome editing
system, and can result in a
change in the target sequence.
[0225] In certain embodiments, genome editing systems modify a target
sequence, or modify
expression of a gene in or near the target sequence, without causing single-
or double-strand breaks.
For example, a genome editing system may include an RNA-guided nuclease fused
to a functional
domain that acts on DNA, thereby modifying the target sequence or its
expression. As one example,
an RNA-guided nuclease can be connected to (e.g. fused to) a cytidine
deaminase functional domain,
and may operate by generating targeted C-to-A substitutions. Exemplary
nuclease/deaminase fusions
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
are described in Komor 2016, which is incorporated by reference herein.
Alternatively, a genome
editing system may utilize a cleavage-inactivated (i.e. a "dead") nuclease,
such as a dead Cas9
(dCas9), and may operate by forming stable complexes on one or more targeted
regions of cellular
DNA, thereby interfering with functions involving the targeted region(s)
including, without limitation,
mRNA transcription, chromatin remodeling, etc. In certain embodiments, a
genome editing system
may include an RNA-guided helicase that unwinds DNA within or proximal to the
target sequence,
without causing single- or double-stranded breaks. For example a genome
editing system may
include an RNA-guided helicase configured to associate within or near the
target sequence to unwind
DNA and induce accessibility to the target sequence. In certain embodiments,
the RNA-guided
helicase may be complexed to a dead guide RNA that is configured to lack
cleavage activity allowing
for unwinding of the DNA without causing breaks in the DNA.
Guide RNA (gRNA) molecules
[0226] The terms "guide RNA" and "gRNA" refer to any nucleic acid that
promotes the specific
association (or "targeting") of an RNA-guided nuclease such as a Cpfl molecule
to a target sequence
such as a genomic or episomal sequence in a cell. gRNAs can be unimolecular
(comprising a single
RNA molecule, and referred to alternatively as chimeric), or modular
(comprising more than one, and
typically two, separate RNA molecules, such as a crRNA and a tracrRNA, which
are usually
associated with one another, for instance by duplexing). gRNAs and their
component parts are
described throughout the literature (see, e.g., Briner 2014, which is
incorporated by reference; Cotta-
Ramusino). Examples of modular and unimolecular gRNAs that may be used
according to the
embodiments herein include, without limitation, the sequences set forth in SEQ
ID NOs:29-31 and
38-51. Examples of gRNA proximal and tail domains that may be used according
to the embodiments
herein include, without limitation, the sequences set forth in SEQ ID NOs:32-
37.
[0227] In bacteria and archea, type II CRISPR systems generally comprise an
RNA-guided nuclease
protein such as Cas9, a CRISPR RNA (crRNA) that includes a 5' region that is
complementary to a
foreign sequence, and a trans-activating crRNA (tracrRNA) that includes a 5'
region that is
complementary to, and forms a duplex with, a 3' region of the crRNA. While not
intending to be
bound by any theory, it is thought that this duplex facilitates the formation
of¨ and is necessary for
the activity of¨ the Cas9/gRNA complex. As type II CRISPR systems were adapted
for use in gene
editing, it was discovered that the crRNA and tracrRNA could be joined into a
single unimolecular or
chimeric guide RNA, in one non-limiting example, by means of a four nucleotide
(e.g. GAAA)
"tetraloop" or "linker" sequence bridging complementary regions of the crRNA
(at its 3' end) and the
tracrRNA (at its 5' end). (Mali 2013; Jiang 2013; Jinek 2012; all incorporated
by reference herein).
[0228] Guide RNAs, whether unimolecular or modular, include a "targeting
domain" that is fully or
partially complementary to a target domain within a target sequence, such as a
DNA sequence in the
66
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
genome of a cell where editing is desired. Targeting domains are referred to
by various names in the
literature, including without limitation "guide sequences" (Hsu 2013,
incorporated by reference
herein), "complementarity regions" (Cotta-Ramusino), "spacers" (Briner 2014)
and generically as
"crRNAs" (Jiang). Irrespective of the names they are given, targeting domains
are typically 10-30
nucleotides in length, and in certain embodiments are 16-24 nucleotides in
length (for instance, 16,
17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and are at or near
the 5' terminus of in the case
of a Cas9 gRNA, and at or near the 3' terminus in the case of a Cpfl gRNA.
[0229] In addition to the targeting domains, gRNAs typically (but not
necessarily, as discussed
below) include a plurality of domains that may influence the formation or
activity of gRNA/Cas9
complexes. For instance, as mentioned above, the duplexed structure formed by
first and secondary
complementarity domains of a gRNA (also referred to as a repeat:anti-repeat
duplex) interacts with
the recognition (REC) lobe of Cas9 and can mediate the formation of Cas9/gRNA
complexes
(Nishimasu 2014; Nishimasu 2015; both incorporated by reference herein). It
should be noted that
the first and/or second complementarity domains may contain one or more poly-A
tracts, which can
be recognized by RNA polymerases as a termination signal. The sequence of the
first and second
complementarity domains are, therefore, optionally modified to eliminate these
tracts and promote the
complete in vitro transcription of gRNAs, for instance through the use of A-G
swaps as described in
Briner 2014, or A-U swaps. These and other similar modifications to the first
and second
complementarity domains are within the scope of the present disclosure.
[0230] Along with the first and second complementarity domains, Cas9 gRNAs
typically include two
or more additional duplexed regions that are involved in nuclease activity in
vivo but not necessarily
in vitro. (Nishimasu 2015). A first stem-loop one near the 3' portion of the
second complementarity
domain is referred to variously as the "proximal domain," (Cotta-Ramusino)
"stem loop 1"
(Nishimasu 2014 and 2015) and the "nexus" (Briner 2014). One or more
additional stem loop
structures are generally present near the 3' end of the gRNA, with the number
varying by species: S.
pyogenes gRNAs typically include two 3' stem loops (for a total of four stem
loop structures
including the repeat:anti-repeat duplex), while S. aureus and other species
have only one (for a total
of three stem loop structures). A description of conserved stem loop
structures (and gRNA structures
more generally) organized by species is provided in Briner 2014.
[0231] While the foregoing description has focused on gRNAs for use with Cas9,
it should be
appreciated that other RNA-guided nucleases exist which utilize gRNAs that
differ in some ways
from those described to this point. For instance, Cpfl ("CRISPR from
Prevotella and Franciscella 1")
is a recently discovered RNA-guided nuclease that does not require a tracrRNA
to function. (Zetsche
2015, incorporated by reference herein). A gRNA for use in a Cpfl genome
editing system generally
includes a targeting domain and a complementarity domain (alternately referred
to as a "handle"). It
67
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
should also be noted that, in gRNAs for use with Cpfl, the targeting domain is
usually present at or
near the 3' end, rather than the 5' end as described above in connection with
Cas9 gRNAs (the handle
is at or near the 5' end of a Cpfl gRNA). Exemplary targeting domains of Cpfl
gRNAs are set forth
in Table 6 and Table 12.
[0232] Those of skill in the art will appreciate, however, that although
structural differences may
exist between gRNAs from different prokaryotic species, or between Cpfl and
Cas9 gRNAs, the
principles by which gRNAs operate are generally consistent. Because of this
consistency of
operation, gRNAs can be defined, in broad terms, by their targeting domain
sequences, and skilled
artisans will appreciate that a given targeting domain sequence can be
incorporated in any suitable
gRNA, including a unimolecular or chimeric gRNA, or a gRNA that includes one
or more chemical
modifications and/or sequential modifications (substitutions, additional
nucleotides, truncations, etc.).
Thus, for economy of presentation in this disclosure, gRNAs may be described
solely in terms of their
targeting domain sequences.
[0233] More generally, skilled artisans will appreciate that some aspects of
the present disclosure
relate to systems, methods and compositions that can be implemented using
multiple RNA-guided
nucleases. For this reason, unless otherwise specified, the term gRNA should
be understood to
encompass any suitable gRNA that can be used with any RNA-guided nuclease, and
not only those
gRNAs that are compatible with a particular species of Cas9 or Cpfl. By way of
illustration, the term
gRNA can, in certain embodiments, include a gRNA for use with any RNA-guided
nuclease
occurring in a Class 2 CRISPR system, such as a type II or type V or CRISPR
system, or an RNA-
guided nuclease derived or adapted therefrom.
gRNA design
[0234] Methods for selection and validation of target sequences as well as off-
target analyses have
been described previously (see, e.g., Mali 2013; Hsu 2013; Fu 2014; Heigwer
2014; Bae 2014; Xiao
2014). Each of these references is incorporated by reference herein. As a non-
limiting example,
gRNA design may involve the use of a software tool to optimize the choice of
potential target
sequences corresponding to a user's target sequence, e.g., to minimize total
off-target activity across
the genome. While off-target activity is not limited to cleavage, the cleavage
efficiency at each off-
target sequence can be predicted, e.g., using an experimentally-derived
weighting scheme. These and
other guide selection methods are described in detail in Maeder and Cotta-
Ramusino.
[0235] Targeting domain sequences of gRNAs that were designed to target
disruption of the CCAAT
box target region include, but are not limited to, SEQ ID NO:1002. In certain
embodiments, gRNAs
comprising the sequence set forth in SEQ ID NO:1002 may be complexed with a
Cpfl protein or
modified Cpfl protein to generate alterations at the CCAAT box target region.
In certain
68
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
embodiments, gRNAs comprising any of the Cpfl gRNAs set forth in Table 9,
Table 12, or Table 13
may be complexed with a Cpfl protein or modified Cpfl protein forming an RNP
("gRNA-Cpfl-
RNP") to generate alterations at the CCAAT box target region. In certain
embodiments, the modified
Cpfl protein may be His-AsCpfl-nNLS (SEQ ID NO: 1000) or His-AsCpfl-sNLS-sNLS
(SEQ ID
NO:1001). In certain embodiments, the Cpfl molecule of the gRNA-Cpfl-RNP may
be encoded by a
sequence set forth in SEQ ID NOs:1000, 1001, 1008-1018, 1032, 1035-39 (Cpfl
polypeptide
sequences) or SEQ ID NOs:1019-1021 (Cpfl polynucleotide sequences).
gRNA modifications
[0236] The activity, stability, or other characteristics of gRNAs can be
altered through the
incorporation of certain modifications. As one example, transiently expressed
or delivered nucleic
acids can be prone to degradation by, e.g., cellular nucleases. Accordingly,
the gRNAs described
herein can contain one or more modified nucleosides or nucleotides which
introduce stability toward
nucleases. While not wishing to be bound by theory it is also believed that
certain modified gRNAs
described herein can exhibit a reduced innate immune response when introduced
into cells. Those of
skill in the art will be aware of certain cellular responses commonly observed
in cells, e.g.,
mammalian cells, in response to exogenous nucleic acids, particularly those of
viral or bacterial
origin. Such responses, which can include induction of cytokine expression and
release and cell
death, may be reduced or eliminated altogether by the modifications presented
herein.
[0237] Certain exemplary modifications discussed in this section can be
included at any position
within a gRNA sequence including, without limitation at or near the 5' end
(e.g., within 1-10, 1-5, or
1-2 nucleotides of the 5' end) and/or at or near the 3' end (e.g., within 1-
10, 1-5, or 1-2 nucleotides of
the 3' end). In some cases, modifications are positioned within functional
motifs, such as the repeat-
anti-repeat duplex of a Cas9 gRNA, a stem loop structure of a Cas9 or Cpfl
gRNA, and/or a targeting
domain of a gRNA.
[0238] As one example, the 5' end of a gRNA can include a eukaryotic mRNA cap
structure or cap
analog (e.g., a G(5 )ppp(5 )G cap analog, am 7G(5 )ppp(5 )G cap analog, or a 3
'-0-Me-
m7G(5 )ppp(5 ')G anti reverse cap analog (ARCA)), as shown below:
CH.-3
N NH
N
/ *i2
NH2 N H2CO¨P¨ P¨OCH2
1
0- 0- 0-
µ'. 11.1111116...-"" HCI444444444441.--
OH
69
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
The cap or cap analog can be included during either chemical synthesis or in
vitro transcription of the
gRNA.
[0239] Along similar lines, the 5' end of the gRNA can lack a 5' triphosphate
group. For instance, in
vitro transcribed gRNAs can be phosphatase-treated (e.g., using calf
intestinal alkaline phosphatase)
to remove a 5' triphosphate group.
[0240] Another common modification involves the addition, at the 3' end of a
gRNA, of a plurality
(e.g., 1-10, 10-20, or 25-200) of adenine (A) residues referred to as a polyA
tract. The polyA tract can
be added to a gRNA during chemical synthesis, following in vitro transcription
using a polyadenosine
polymerase (e.g., E. coli Poly(A)Polymerase), or in vivo by means of a
polyadenylation sequence, as
described in Maeder.
[0241] It should be noted that the modifications described herein can be
combined in any suitable
manner, e.g. a gRNA, whether transcribed in vivo from a DNA vector, or in
vitro transcribed gRNA,
can include either or both of a 5' cap structure or cap analog and a 3' polyA
tract.
[0242] Guide RNAs can be modified at a 3' terminal U ribose. For example, the
two terminal
hydroxyl groups of the U ribose can be oxidized to aldehyde groups and a
concomitant opening of the
ribose ring to afford a modified nucleoside as shown below:
HO
0 0
wherein "U" can be an unmodified or modified uridine.
[0243] The 3' terminal U ribose can be modified with a 2'3' cyclic phosphate
as shown below:
HO
0
pH
0\ /0
-
0 0
wherein "U" can be an unmodified or modified uridine.
[0244] Guide RNAs can contain 3' nucleotides which can be stabilized against
degradation, e.g., by
incorporating one or more of the modified nucleotides described herein. In
certain embodiments,
uridines can be replaced with modified uridines, e.g., 5-(2-amino)propyl
uridine, and 5-bromo uridine,
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
or with any of the modified uridines described herein; adenosines and
guanosines can be replaced
with modified adenosines and guanosines, e.g., with modifications at the 8-
position, e.g., 8-bromo
guanosine, or with any of the modified adenosines or guanosines described
herein.
[0245] In certain embodiments, sugar-modified ribonucleotides can be
incorporated into the gRNA,
e.g., wherein the 2' OH-group is replaced by a group selected from H, -OR, -R
(wherein R can be,
e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), halo, -SH, -SR
(wherein R can be, e.g., alkyl,
cycloalkyl, aryl, aralkyl, heteroaryl or sugar), amino (wherein amino can be,
e.g., NH2; alkylamino,
dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino,
diheteroarylamino, or amino
acid); or cyano (-CN). In certain embodiments, the phosphate backbone can be
modified as described
herein, e.g., with a phosphorothioate (PhTx) group. In certain embodiments,
one or more of the
nucleotides of the gRNA can each independently be a modified or unmodified
nucleotide including,
but not limited to 2'-sugar modified, such as, 2'-0-methyl, 2'-0-methoxyethyl,
or 2'-Fluoro modified
including, e.g., 2'-F or 2'-0-methyl, adenosine (A), 2'-F or 2'-0-methyl,
cytidine (C), 2'-F or 2'-0-
methyl, uridine (U), 2'-F or 2'-0-methyl, thymidine (T), 2'-F or 2'-0-methyl,
guanosine (G), 2'-0-
methoxyethy1-5-methyluridine (Teo), 2' -0-methoxyethyladenosine (Aeo), 2' -0-
methoxyethy1-5-
methylcytidine (m5Ceo), and any combinations thereof
[0246] Guide RNAs can also include "locked" nucleic acids (LNA) in which the
2' OH-group can be
connected, e.g., by a C1-6 alkylene or C1-6 heteroalkylene bridge, to the 4'
carbon of the same ribose
sugar. Any suitable moiety can be used to provide such bridges, include
without limitation
methylene, propylene, ether, or amino bridges; 0-amino (wherein amino can be,
e.g., NH2;
alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino,
heteroarylamino, or
diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy or 0(CH2).-
amino (wherein
amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino,
diarylamino,
heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino).
[0247] In certain embodiments, a gRNA can include a modified nucleotide which
is multicyclic (e.g.,
tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) (e.g., R-GNA
or S-GNA, where
ribose is replaced by glycol units attached to phosphodiester bonds), or
threose nucleic acid (TNA,
where ribose is replaced with a-L-threofuranosyl-(3'¨>2')).
[0248] Generally, gRNAs include the sugar group ribose, which is a 5-membered
ring having an
oxygen. Exemplary modified gRNAs can include, without limitation, replacement
of the oxygen in
ribose (e.g., with sulfur (S), selenium (Se), or alkylene, such as, e.g.,
methylene or ethylene); addition
of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl);
ring contraction of
ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring
expansion of ribose (e.g., to
form a 6- or 7-membered ring having an additional carbon or heteroatom, such
as for example,
anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino
that also has a
71
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
phosphoramidate backbone). Although the majority of sugar analog alterations
are localized to the 2'
position, other sites are amenable to modification, including the 4' position.
In certain embodiments,
a gRNA comprises a 4'-S, 4'-Se or a 4' -C-aminomethy1-2' -0-Me modification.
[0249] In certain embodiments, deaza nucleotides, e.g., 7-deaza-adenosine, can
be incorporated into
the gRNA. In certain embodiments, 0- and N-alkylated nucleotides, e.g., N6-
methyl adenosine, can
be incorporated into the gRNA. In certain embodiments, one or more or all of
the nucleotides in a
gRNA are deoxynucleotides.
[0250] In certain embodiments, gRNAs as used herein may be modified or
unmodified gRNAs. In
certain embodiments, a gRNA may include one or more modifications. In certain
embodiments, the
one or more modifications may include a phosphorothioate linkage modification,
a
phosphorodithioate (PS2) linkage modification, a 2'-0-methyl modification, or
combinations thereof.
In certain embodiments, the one or more modifications may be at the 5' end of
the gRNA, at the 3'
end of the gRNA, or combinations thereof.
[0251] In certain embodiments, a gRNA modification may comprise one or more
phosphorodithioate
(PS2) linkage modifications.
[0252] In some embodiments, a gRNA used herein includes one or more or a
stretch of
deoxyribonucleic acid (DNA) bases, also referred to herein as a "DNA
extension." in some
embodiments, a gRNA used herein includes a DNA extension at the 5' end of the
gRNA, the 3' end of
the gRNA, or a combination thereof In certain embodiments, the DNA extension
may be 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52,
53, 54, 55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,
80, 81, 82, 83, 84, 85, 86, 87,
88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 DNA. bases long, For
example, in certain
embodiments, the DNA extension may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 DNA
bases long. in certain
embodiments, the DNA. extension may include one or more DNA bases selected
from adenine (A),
guanine (CI), cytosine (C), or thymine (F). in certain embodiments, the DNA
extension includes the
same DNA bases. For example, the DNA extension may include a stretch of
adenine (A) bases. In
certain embodiments, the DNA. extension may include a stretch of thymine, (T)
bases. In certain
embodiments, the DNA extension includes a combination of different DNA bases.
In certain
embodiments, a DNA extension may comprise a sequence set forth in Table 18.
For example, a DNA.
extension may comprise a sequence set forth in SEQ ID NOs:1.235-1250, In
certain embodiments, a
gRNA used herein includes a DNA extension as well as one or more
phosphorothioate linkage
modifications, one or more phosphorodithioate (PS2) linkage modifications, one
or more 2'-0-methyl
modifications, or combinations thereof In certain embodiments, the one or more
modifications may
be at the 5' end of the gRNA, at the 3' end of the gRNA, or combinations
thereof in certain
72
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
embodiments, a gRNA including a DNA extension may comprise a sequence set
forth in Table 13
that includes a DNA extension. In a particular embodiment, a gRNA including a
DNA extension may
comprise the sequence set forth in SEQ ID NO:1051. In certain embodiments, a
gRNA including a
DNA extension may comprise a sequence selected from the group consisting of
SEQ ID NOs:1046-
1060, 1067, 1068, 1074, 1075, 1078, 1081-1084, 1086-1087, 1089-1090, 1092-
1093, 1098-1102, and
1106. Without wishing to be bound by theory, it is contemplated that any DNA
extension may be
used herein, so long as it does not hybridize to the target nucleic acid being
targeted by the gRNA and
it also exhibits an increase in editing at the target nucleic acid site
relative to a gRNA which does not
include such a DNA extension.
[0253] In some embodiments, a gRNA used herein includes one or more or a
stretch of ribonucleic
acid (RNA) bases, also referred to herein as an "RNA extension." In some
embodiments, a gRNA
used herein includes an RNA extension at the 5' end of the gRNA, the 3' end of
the gRNA, or a
combination thereof. In certain embodiments, the RNA extension may be 1, 2, 3,
4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 61, 62, 63, 64,
65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83,
84, 85, 86, 87, 88, 89, 90, 91,
92, 93, 94, 95, 96, 97, 98, 99, or 100 RNA bases long. For example, in certain
embodiments, the
RNA extension may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 RNA bases long. In
certain embodiments, the
RNA extension may include one or more RNA bases selected from adenine (rA),
guanine (rG),
cytosine (rC), or uracil (rU), in which the "r" represents RNA, 2e-hydroxy, in
certain embodiments,
the RNA extension includes the same RNA bases. For example, the RNA extension
may include a
stretch of adenine (rA) bases. In certain embodiments, the RNA extension
includes a combination of
different RNA bases. In certain embodiments, an RNA extension may comprise a
sequence set forth
in Table 18. For example, an RNA extension may comprise a sequence set forth
in 1231-1234, 1251-
1253. In certain embodiments, a gRNA used herein includes an RNA extension as
well as one or
more phosphorothioate linkage modifications, one or more phosphorodithioate
(PS2) linkage
modifications, one or more 2'-0-methyl modifications, or combinations thereof
In certain
embodiments, the one or more modifications may be at the 5' end of the gRNA,
at the 3' end of the
gRNA, or combinations thereof in certain embodiments, a gRNA including a RNA
extension may
comprise a sequence set forth in Table 13 that includes an RNA extension.
gRNAs including an
RNA extension at the 5' end of the gRNA may comprise a sequence selected from
the group
consisting of SEQ ID NOs:10424045, 11034105, gRNAs including an RNA extension
at the 3' end
of the gRNA may comprise a sequence selected from the group consisting of SEQ
ID NOs:1070-
1075, 1079, 1081, 10984100.
73
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0254] It is contemplated that gRNAs used herein may also include an RNA
extension and a DNA
extension. In certain embodiments, the RNA extension and DNA extension may
both be at the 5' end
of the gRNA, the 3' end of the gRNA, or a combination thereof In certain
embodiments, the RNA
extension is at the 5' end of the gRNA and the DNA extension is at the 3' end
of the gRNA. In
certain embodiments, the RNA extension is at the 3' end of the gRNA and the
DNA extension is at
the 5' end of the gRNA.
[0255] In some embodiments, a gRNA which includes both a phosphorochioate
modification at the 3'
end as well as a DNA extension at the 5' end is complexed with a RNA-guided
nuclease, e.g., Cpfl,
to form an RNP, which is then employed to edit a hematopoietic stern cell (I-
ISC) or a CD34+ cell ex
vivo (i.e., outside the body of a subject from whom such a cell is derived),
at the HBG locus.
[0256] An example of a gRNA as used herein comprises the sequence set forth in
SEQ ID NO:1051.
Dead gRNA molecules
[0257] Dead guide RNA (dgRNA) molecules according to the present disclosure
include dead guide
RNA molecules that comprise reduced, low, or undetectable cleavage activity.
The targeting domain
sequences of dead guide RNAs are shorter in length by 1, 2, 3, 4, 5, 6, 7, 8,
9, or 10 nucleotides
compared to the targeting domain sequence of active guide RNAs. In certain
embodiments, dead
guide RNA molecules may comprise a targeting domain comprising 15 nucleotides
or fewer in length,
14 nucleotides or fewer in length, 13 nucleotides or fewer in length, 12
nucleotides or fewer in length,
or 11 nucleotides or fewer in length. In some embodiments, dead guide RNAs are
configured such
that they do not provide an RNA guided-nuclease cleavage event. Dead guide
RNAs may be
generated by removing the 5' end of a gRNA targeting domain sequence, which
results in a truncated
targeting domain sequence. For example, if a gRNA sequence, configured to
provide a cleavage
event (i.e., 17 nucleotides or more in length), has a targeting domain
sequence that is 20 nucleotides in
length, a dead guide RNA may be created by removing 5 nucleotides from the 5'
end of the gRNA
sequence. For example, dgRNAs used herein may comprise a targeting domain set
forth in, for
example, Tables 8, 9, or 13 that has been truncated from the 5' end of the
gRNA sequence and
comprises 15 nucleotides or fewer in length. In certain embodiments, the dgRNA
may be configured
to bind (or associate with) a nucleic acid sequence within or proximal to a
target region (e.g., the
CCAAT box target region, 13 nt target region, proximal HBG1/2 promoter target
sequence) to be
edited. In certain embodiments, proximal to may denote the region within 10,
25, 50, 100, or 200
nucleotides of a target region (e.g., the CCAAT box target region, 13 nt
target region, proximal
HBG1/2 promoter target sequence). In certain embodiments, the dead guide RNA
is not configured to
recruit an exogenous trans-acting factor to a target region. In certain
embodiments, the dgRNA is
configured such that it does not provide a DNA cleavage event when complexed
with an RNA-guided
nuclease. Skilled artisans will appreciate that dead guide RNA molecules may
be designed to
74
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
comprise targeting domains complementary to regions proximal to or within a
target region in a target
nucleic acid. In certain embodiments, dead guide RNAs comprise targeting
domain sequences that
are complementary to the transcription strand or non-transcription strand of
double stranded DNA.
The dgRNAs herein may include modifications at the 5' and 3' end of the dgRNA
as described for
guide RNAs in the section "gRNA modifications" herein. For example, in certain
embodiments,
dead guide RNAs may include an anti-reverse cap analog (ARCA) at the 5' end of
the RNA. In
certain embodiments, dgRNAs may include a polyA tail at the 3' end.
[0258] In certain embodiments, the use of a dead guide RNA with the genome
editing systems and
methods disclosed herein may increase the total editing level of an active
guide RNA. In certain
embodiments, the use of a dead guide RNA with the genome editing systems
disclosed herein and
methods thereof may increase the frequency of deletions. In certain
embodiments, the deletions may
extend from the cut site of the active guide RNA toward the dead guide RNA
binding site. In this
way the dead guide RNA can change the directionality of an active guide RNA
and orient editing
toward a desired target region.
[0259] As used herein, the terms "dead gRNA" and "truncated gRNA" are used
interchangeably.
RNA-guided nucleases
[0260] RNA-guided nucleases according to the present disclosure include, but
are not limited to,
naturally-occurring Class 2 CRISPR nucleases such as Cpfl, and Cas9, as well
as other nucleases
derived or obtained therefrom. It has also been shown that certain RNA-guided
nucleases, such as
Cas9, also have helicase activity that enables them to unwind nucleic acid. In
certain embodiments,
the RNA-guided helicases according to the present disclosure may be any of the
RNA-nucleases
described herein and supra in the section entitled "RNA-guided nucleases." In
certain embodiments,
the RNA-guided nuclease is not configured to recruit an exogenous trans-acting
factor to a target
region. In certain embodiments, an RNA-guided helicase may be an RNA-guided
nuclease
configured to lack nuclease activity. For example, in certain embodiments, an
RNA-guided helicase
may be a catalytically inactive RNA-guided nuclease that lacks nuclease
activity, but still retains its
helicase activity. In certain embodiments, an RNA-guided nuclease may be
mutated to abolish its
nuclease activity (e.g., dead Cas9), creating a catalytically inactive RNA-
guided nuclease that is
unable to cleave nucleic acid, but which can still unwind DNA. In certain
embodiments, an RNA-
guided helicase may be complexed with any of the dead guide RNAs as described
herein. For
example, a catalytically active RNA-guided helicase (e.g., Cas9 or Cpfl) may
form an RNP complex
with a dead guide RNA, resulting in a catalytically inactive dead RNP (dRNP).
In certain
embodiments, a catalytically inactive RNA-guided helicase (e.g., dead Cas9)
and a dead guide RNA
may form a dRNP. These dRNPs, although incapable of providing a cleavage
event, still retain their
helicase activity that is important for unwinding nucleic acid.
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0261] In functional terms, RNA-guided nucleases are defined as those
nucleases that: (a) interact
with (e.g. complex with) a gRNA; and (b) together with the gRNA, associate
with, and optionally
cleave or modify, a target region of a DNA that includes (i) a sequence
complementary to the
targeting domain of the gRNA and, optionally, (ii) an additional sequence
referred to as a
"protospacer adjacent motif," or "PAM," which is described in greater detail
below. As the following
examples will illustrate, RNA-guided nucleases can be defined, in broad terms,
by their PAM
specificity and cleavage activity, even though variations may exist between
individual RNA-guided
nucleases that share the same PAM specificity or cleavage activity. Skilled
artisans will appreciate
that some aspects of the present disclosure relate to systems, methods and
compositions that can be
implemented using any suitable RNA-guided nuclease having a certain PAM
specificity and/or
cleavage activity. For this reason, unless otherwise specified, the term RNA-
guided nuclease should
be understood as a generic term, and not limited to any particular type (e.g.
Cas9 vs. Cpfl), species
(e.g. S. pyogenes vs. S. aureus) or variation (e.g. full-length vs. truncated
or split; naturally-occurring
PAM specificity vs. engineered PAM specificity, etc.) of RNA-guided nuclease.
For example, in
certain embodiments, the RNA-guided nuclease may be Cas-(1) (Pausch 2020).
[0262] Various RNA-guided nucleases may require different sequential
relationships between PAMs
and protospacers. In general, Cas9s recognize PAM sequences that are 3' of the
protospacer. Cpfl,
on the other hand, generally recognizes PAM sequences that are 5' of the
protospacer.
[0263] In addition to recognizing specific sequential orientations of PAMs and
protospacers, RNA-
guided nucleases can also recognize specific PAM sequences. S. aureus Cas9,
for instance,
recognizes a PAM sequence of NNGRRT or NNGRRV, wherein the N residues are
immediately 3' of
the region recognized by the gRNA targeting domain. S. pyogenes Cas9
recognizes NGG PAM
sequences. And F. novicida Cpfl recognizes a TTN PAM sequence. PAM sequences
have been
identified for a variety of RNA-guided nucleases, and a strategy for
identifying novel PAM sequences
has been described by Shmakov 2015. It should also be noted that engineered
RNA-guided nucleases
can have PAM specificities that differ from the PAM specificities of reference
molecules (for
instance, in the case of an engineered RNA-guided nuclease, the reference
molecule may be the
naturally occurring variant from which the RNA-guided nuclease is derived, or
the naturally occurring
variant having the greatest amino acid sequence homology to the engineered RNA-
guided nuclease).
Examples of PAMs that may be used according to the embodiments herein include,
without
limitation, the sequences set forth in SEQ ID NOs:199-205.
[0264] In addition to their PAM specificity, RNA-guided nucleases can be
characterized by their
DNA cleavage activity: naturally-occurring RNA-guided nucleases typically form
DSBs in target
nucleic acids, but engineered variants have been produced that generate only
SSBs (discussed above
and in Ran & Hsu 2013, incorporated by reference herein), or that do not cut
at all.
76
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Cas9
[0265] Crystal structures have been determined for S. pyogenes Cas9 (Jinek
2014), and for S. aureus
Cas9 in complex with a unimolecular guide RNA and a target DNA (Nishimasu
2014; Anders 2014;
and Nishimasu 2015).
[0266] A naturally occurring Cas9 protein comprises two lobes: a recognition
(REC) lobe and a
nuclease (NUC) lobe; each of which comprise particular structural and/or
functional domains. The
REC lobe comprises an arginine-rich bridge helix (BH) domain, and at least one
REC domain (e.g. a
REC1 domain and, optionally, a REC2 domain). The REC lobe does not share
structural similarity
with other known proteins, indicating that it is a unique functional domain.
While not wishing to be
bound by any theory, mutational analyses suggest specific functional roles for
the BH and REC
domains: the BH domain appears to play a role in gRNA:DNA recognition, while
the REC domain is
thought to interact with the repeat:anti-repeat duplex of the gRNA and to
mediate the formation of the
Cas9/gRNA complex.
[0267] The NUC lobe comprises a RuvC domain, an HNH domain, and a PAM-
interacting (PI)
domain. The RuvC domain shares structural similarity to retroviral integrase
superfamily members
and cleaves the non-complementary (i.e. bottom) strand of the target nucleic
acid. It may be formed
from two or more split RuvC motifs (such as RuvC I, RuvCII, and RuvCIII in S.
pyogenes and S.
aureus). The HNH domain, meanwhile, is structurally similar to HNN
endonuclease motifs, and
cleaves the complementary (i.e. top) strand of the target nucleic acid. The PI
domain, as its name
suggests, contributes to PAM specificity. Examples of polypeptide sequences
encoding Cas9 RuvC-
like and Cas9 HNH-like domains that may be used according to the embodiments
herein are set forth
in SEQ ID NOs:15-23, 52-123 (RuvC-like domains) and SEQ ID NOs:24-28, 124-198
(HNH-like
domains).
[0268] While certain functions of Cas9 are linked to (but not necessarily
fully determined by) the
specific domains set forth above, these and other functions may be mediated or
influenced by other
Cas9 domains, or by multiple domains on either lobe. For instance, in S.
pyogenes Cas9, as described
in Nishimasu 2014, the repeat:antirepeat duplex of the gRNA falls into a
groove between the REC and
NUC lobes, and nucleotides in the duplex interact with amino acids in the BH,
PI, and REC domains.
Some nucleotides in the first stem loop structure also interact with amino
acids in multiple domains
(PI, BH and REC1), as do some nucleotides in the second and third stem loops
(RuvC and PI
domains). Examples of polypeptide sequences encoding Cas9 molecules that may
be used according
to the embodiments herein are set forth in SEQ ID NOs:1-2, 4-6, 12, and 14.
77
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Cpfl
[0269] The crystal structure of Acidaminococcus sp. Cpfl in complex with crRNA
and a double-
stranded (ds) DNA target including a TTTN PAM sequence has been solved by
Yamano 2016
(incorporated by reference herein). Cpfl, like Cas9, has two lobes: a REC
(recognition) lobe, and a
NUC (nuclease) lobe. The REC lobe includes REC1 and REC2 domains, which lack
similarity to any
known protein structures. The NUC lobe, meanwhile, includes three RuvC domains
(RuvC-I, -II and
-III) and a BH domain. However, in contrast to Cas9, the Cpfl REC lobe lacks
an HNH domain, and
includes other domains that also lack similarity to known protein structures:
a structurally unique PI
domain, three Wedge (WED) domains (WED-I, -II and -III), and a nuclease (Nuc)
domain.
[0270] While Cas9 and Cpfl share similarities in structure and function, it
should be appreciated that
certain Cpfl activities are mediated by structural domains that are not
analogous to any Cas9
domains. For instance, cleavage of the complementary strand of the target DNA
appears to be
mediated by the Nuc domain, which differs sequentially and spatially from the
HNH domain of Cas9.
Additionally, the non-targeting portion of Cpfl gRNA (the handle) adopts a
pseudoknot structure,
rather than a stem loop structure formed by the repeat:antirepeat duplex in
Cas9 gRNAs.
[0271] In certain embodiments, a Cpfl protein may be a modified Cpfl protein.
In certain
embodiments, a modified Cpfl protein may include one or more modifications. In
certain embodiments
the modifications may be, without limitation, one or more mutations in a Cpfl
nucleotide sequence or
Cpfl amino acid sequence, one or more additional sequences such as a His tag
or a nuclear localization
signal (NLS), or a combination thereof In certain embodiments, a modified Cpfl
may also be referred
to herein as a Cpfl variant.
[0272] In certain embodiments, the Cpfl protein may be derived from a Cpfl
protein selected from
the group consisting of Acidaminococcus sp. strain BV3L6 Cpfl protein
(AsCpfl), Lachnospiraceae
bacterium ND2006 Cpfl protein (LbCpfl), and Lachnospiraceae bacterium MA2020
(Lb2Cpf1). In
certain embodiments, the Cpfl protein may comprise a sequence selected from
the group consisting of
SEQ ID NOs:1016-1018, having the codon-optimized nucleic acid sequences of SEQ
ID NOs:1019-
1021, respectively.
[0273] In certain embodiments, the modified Cpfl protein may comprise a
nuclear localization signal
(NLS). For example, but not by way of limitation, NLS sequences useful in
connection with the
methods and compositions disclosed herein will comprise an amino acid sequence
capable of
facilitating protein import into the cell nucleus. NLS sequences useful in
connection with the methods
and compositions disclosed herein are known in the art. Examples of such NLS
sequences include the
nucleoplasmin NLS having the amino acid sequence: KRPAATKKAGQAKKKK (SEQ ID
NO:1006)
and the simian virus 40 "5V40" NLS having the amino acid sequence PKKKRKV (SEQ
ID NO:1007).
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0274] In certain embodiments, the NLS sequence of the modified Cpfl protein
is positioned at or near
the C-terminus of the Cpfl protein sequence. For example, but not by way of
limitation, the modified
Cpfl protein can be selected from the following: His-AsCpfl-nNLS (SEQ ID
NO:1000); His-AsCpfl-
sNLS (SEQ ID NO:1008) and His-AsCpfl-sNLS-sNLS (SEQ ID NO:1001), where "His"
refers to a
six-histidine purification sequence, "AsCpfl" refers to the Acidaminococcus
sp. Cpfl protein sequence,
"nNLS" refers to the nucleoplasmin NLS, and "sNLS" refers to the 5V40 NLS.
Additional
permutations of the identity and C-terminal positions of NLS sequences, e.g.,
appending two or more
nNLS sequences or combinations of nNLS and sNLS sequences (or other NLS
sequences), as well as
sequences with and without purification sequences, e.g., six-histidine
sequences, are within the scope
of the instantly disclosed subject matter.
[0275] In certain embodiments, the NLS sequence of the modified Cpfl protein
may be positioned at
or near the N-terminus of the Cpfl protein sequence. For example, but not by
way of limitation, the
modified Cpfl protein may be selected from the following: His-sNLS-AsCpfl (SEQ
ID NO:1009), His-
sNL S-sNLS-AsCpfl (SEQ ID NO:1010), and sNLS-sNLS-AsCpfl (SEQ ID NO:1011).
Additional
permutations of the identity and N-terminal positions of NLS sequences, e.g.,
appending two or more
nNLS sequences or combinations of nNLS and sNLS sequences (or other NLS
sequences), as well as
sequences with and without purification sequences, e.g., six-histidine
sequences, are within the scope
of the instantly disclosed subject matter.
[0276] In certain embodiments, the modified Cpfl protein may comprise NLS
sequences positioned at
or near both the N-terminus and C-terminus of the Cpfl protein sequence. For
example, but not by way
of limitation, the modified Cpfl protein may be selected from the following:
His-sNLS-AsCpfl-sNLS
(SEQ ID NO:1012) and His-sNLS-sNLS-AsCpfl-sNLS-sNLS (SEQ ID NO:1013).
Additional
permutations of the identity and N-terminal/C-terminal positions of NLS
sequences, e.g., appending
two or more nNLS sequences or combinations of nNLS and sNLS sequences (or
other NLS sequences)
to either the N-terminal/C-terminal positions, as well as sequences with and
without purification
sequences, e.g., six-histidine sequences, are within the scope of the
instantly disclosed subject matter.
[0277] In certain embodiments, the modified Cpfl protein may comprise an
alteration (e.g., a deletion
or substitution) at one or more cysteine residues of the Cpfl protein
sequence. For example, but not by
way of limitation, modified Cpfl protein may comprise an alteration at a
position selected from the
group consisting of: C65, C205, C334, C379, C608, C674, C1025, and C1248. In
certain embodiments,
the modified Cpfl protein may comprise a substitution of one or more cysteine
residues for a serine or
alanine. In certain embodiments, the modified Cpfl protein may comprise an
alteration selected from
the group consisting of: C655, C2055, C3345, C3795, C6085, C6745, C10255, and
C1248S. In certain
embodiments, the modified Cpfl protein may comprise an alteration selected
from the group consisting
of: C65A, C205A, C334A, C379A, C608A, C674A, C1025A, and C1248A. In certain
embodiments,
79
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
the modified Cpfl protein may comprise alterations at positions C334 and C674
or C334, C379, and
C674. In certain embodiments, the modified Cpfl protein may comprise the
following alterations:
C334S and C674S, or C334S, C379S, and C674S. In certain embodiments, the
modified Cpfl protein
may comprise the following alterations: C334A and C674A, or C334A, C379A, and
C674A. In certain
embodiments, the modified Cpfl protein may comprise both one or more cysteine
residue alteration as
well as the introduction of one or more NLS sequences, e.g., His-AsCpfl-nNLS
Cys-less (SEQ ID
NO:1014) or His-AsCpfl-nNLS Cy s-low (SEQ ID NO:1015). In various embodiments,
the Cpfl
protein comprising a deletion or substitution in one or more cysteine residues
exhibits reduced
aggregation.
[0278] In certain embodiments, other modified Cpfl proteins known in the art
may be used with the
methods and systems described herein. For example, in certain embodiments, the
modified Cpfl may
be Cpfl containing the mutation 5542R/K548V/N552R ("Cpfl RVR"). Cpfl RVR has
been shown to
cleave target sites with a TATV PAM. In certain embodiments, the modified Cpfl
may be Cpfl
containing the mutation 5542R/K607R ("Cpfl RR"). Cpfl RR has been shown to
cleave target sites
with a TYCV/CCCC PAM.
[0279] In some embodiments, a Cpfl variant is used herein, wherein the Cpfl
variant comprises
mutations at one or more residues of AsCpfl (Acidaminococcus sp. BV3L6)
selected from the group
consisting of 11, 12, 13, 14, 15, 16, 17, 34, 36, 39, 40, 43, 46, 47, 50, 54,
57, 58, 111, 126, 127, 128,
129, 130, 131, 132, 133, 134, 135, 136, 157, 158, 159, 160, 161, 162, 163,
164, 165, 166, 167, 168,
169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 532, 533, 534, 535, 536,
537, 538, 539, 540, 541,
542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556,
565, 566, 567, 568, 569,
570, 571, 572, 573, 574, 575, 592, 593, 594, 595, 596, 597, 598, 599, 600,
601, 602, 603, 604, 605,
606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620,
626, 627, 628, 629, 630,
631, 632, 633, 634, 635, 636, 637, 638, 642, 643, 644, 645, 646, 647, 648,
649, 651, 652, 653, 654,
655, 656, 676, 679, 680, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691,
692, 693, 707, 711, 714,
715, 716, 717, 718, 719, 720, 721, 722, 739, 765, 768, 769, 773, 777, 778,
779, 780, 781, 782, 783,
784, 785, 786, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881,
882, 883, 884, or 1048 or
the corresponding position of an AsCpfl orthologue, homologue, or variant.
[0280] In certain embodiments, a Cpfl variant as used herein may include any
of the Cpfl proteins
described in International Publication Number WO 2017/184768 Al by Zhang et
al. ("768
Publication"), which is incorporated by reference herein.
[0281] In certain embodiments, a modified Cpfl protein (also referred to as a
Cpfl variant) used herein
may be encoded by any of the sequences set forth in SEQ ID NOs:1000, 1001,
1008-1018, 1032, 1035-
39, 1094-1097, 1107-09 (Cpfl polypeptide sequences) or SEQ ID NOs:1019-1021,
1110-17 (Cpfl
polynucleotide sequences). Table 14 sets forth exemplary Cpfl variant amino
acid and nucleotide
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
sequences. These sequences are set forth in Fig. 40, which details the
positions of six-histidine
sequences (underlined letters) and NLS sequences (bolded letters). Additional
permutations of the
identity and N-terminal/C-terminal positions of NLS sequences, e.g., appending
two or more nNLS
sequences or combinations of nNLS and sNLS sequences (or other NLS sequences)
to either the N-
terminal/C-terminal positions, as well as sequences with and without
purification sequences, e.g., six-
histidine sequences, are within the scope of the instantly disclosed subject
matter.
[0282] In certain embodiments, any of the Cpfl proteins or modified Cpfl
proteins disclosed herein
may be complexed with one or more gRNA comprising the targeting domain set
forth in SEQ ID NOs
1002 and/or 1004 to alter a CCAAT box target region. In certain embodiments,
any of the Cpfl proteins
or modified Cpfl proteins disclosed herein may be complexed with one or more
gRNA comprising a
sequence set forth in Table 12 or Table 13. In certain embodiments, the
modified Cpfl protein may
be His-AsCpfl-nNLS (SEQ ID NO:1000) or His-AsCpfl-sNLS-sNLS (SEQ ID NO:1001).
In certain
embodiments, a modified Cpfl protein used herein may be encoded by any of the
sequences set forth
in SEQ ID NOs:1000, 1001, 1008-1018, 1032, 1035-39, 1094-1097, 1107-09 (Cpfl
polypeptide
sequences) or SEQ ID NOs:1019-1021, 1110-17 (Cpfl polynucleotide sequences).
In certain
embodiments, the modified Cpfl protein may comprise the sequence set forth in
SEQ ID NO:1097.
[0283] In certain embodiments, the modified Cpfl protein may include a Cpfl
variant described in
Kleinstiver 2019. For example, without limitation, in certain embodiments, the
modified Cpfl protein
may be enAsCas12a. In certain embodiments, the modified Cpfl protein may
cleave target sites with
a TTTV PAM. In certain embodiments, the modified Cpfl protein may cleave
target sites with a
NWYN PAM.
Modifications of RNA-guided nucleases
[0284] The RNA-guided nucleases described above have activities and properties
that can be useful
in a variety of applications, but the skilled artisan will appreciate that RNA-
guided nucleases can also
be modified in certain instances, to alter cleavage activity, PAM specificity,
or other structural or
functional features.
[0285] Turning first to modifications that alter cleavage activity, mutations
that reduce or eliminate
the activity of domains within the NUC lobe have been described above.
Exemplary mutations that
may be made in the RuvC domains, in the Cas9 HNH domain, or in the Cpfl Nuc
domain are
described in Ran & Hsu 2013 and Yamano 2016, as well as in Cotta-Ramusino. In
general, mutations
that reduce or eliminate activity in one of the two nuclease domains result in
RNA-guided nucleases
with nickase activity, but it should be noted that the type of nickase
activity varies depending on
which domain is inactivated. As one example, inactivation of a RuvC domain of
a Cas9 will result in
81
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
a nickase that cleaves the complementary or top strand as shown below (where C
denotes the site of
cleavage).
[0286] On the other hand, inactivation of a Cas9 HNH domain results in a
nickase that cleaves the
bottom or non-complementary strand.
[0287] Modifications of PAM specificity relative to naturally occurring Cas9
reference molecules
has been described by Kleinstiver et al. for both S. pyogenes (Kleinstiver
2015a) and S. aureus
(Kleinstiver 2015b). Kleinstiver et al. have also described modifications that
improve the targeting
fidelity of Cas9 (Kleinstiver 2016). Kleinstiver et al. have also described
modifications of Cpfl that
provide increased activity and improved targeting ranges (Kleinstiver 2019).
Each of these references
is incorporated by reference herein.
[0288] RNA-guided nucleases have been split into two or more parts, as
described by Zetsche 2015
and Fine 2015 (both incorporated by reference herein).
[0289] RNA-guided nucleases can be, in certain embodiments, size-optimized or
truncated, for
instance via one or more deletions that reduce the size of the nuclease while
still retaining gRNA
association, target and PAM recognition, and cleavage activities. In certain
embodiments, RNA
guided nucleases are bound, covalently or non-covalently, to another
polypeptide, nucleotide, or other
structure, optionally by means of a linker. Exemplary bound nucleases and
linkers are described by
Guilinger 2014, incorporated by reference herein for all purposes.
[0290] RNA-guided nucleases also optionally include a tag, such as, but not
limited to, a nuclear
localization signal to facilitate movement of RNA-guided nuclease protein into
the nucleus. In certain
embodiments, the RNA-guided nuclease can incorporate C- and/or N-terminal
nuclear localization
signals. Nuclear localization sequences are known in the art and are described
in Maeder and
elsewhere.
[0291] The foregoing list of modifications is intended to be exemplary in
nature, and the skilled
artisan will appreciate, in view of the instant disclosure, that other
modifications may be possible or
desirable in certain applications. For brevity, therefore, exemplary systems,
methods and
compositions of the present disclosure are presented with reference to
particular RNA-guided
nucleases, but it should be understood that the RNA-guided nucleases used may
be modified in ways
that do not alter their operating principles. Such modifications are within
the scope of the present
disclosure.
82
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Nucleic acids encoding RNA-guided nucleases
[0292] Nucleic acids encoding RNA-guided nucleases, e.g., Cas9, Cpfl or
functional fragments
thereof, are provided herein. Exemplary nucleic acids encoding RNA-guided
nucleases have been
described previously (see, e.g., Cong 2013; Wang 2013; Mali 2013; Jinek 2012).
[0293] In some cases, a nucleic acid encoding an RNA-guided nuclease can be a
synthetic nucleic
acid sequence. For example, the synthetic nucleic acid molecule can be
chemically modified. In
certain embodiments, an mRNA encoding an RNA-guided nuclease will have one or
more (e.g., all)
of the following properties: it can be capped; polyadenylated; and substituted
with 5-methylcytidine
and/or pseudouridine.
[0294] Synthetic nucleic acid sequences can also be codon optimized, e.g., at
least one non-common
codon or less-common codon has been replaced by a common codon. For example,
the synthetic
nucleic acid can direct the synthesis of an optimized messenger mRNA, e.g.,
optimized for expression
in a mammalian expression system, e.g., described herein. Examples of codon
optimized Cas9 coding
sequences are presented in Cotta-Ramusino.
[0295] In addition, or alternatively, a nucleic acid encoding an RNA-guided
nuclease may comprise a
nuclear localization sequence (NLS). Nuclear localization sequences are known
in the art.
Functional analysis of candidate molecules
[0296] Candidate RNA-guided nucleases, gRNAs, and complexes thereof, can be
evaluated by
standard methods known in the art. See, e.g. Cotta-Ramusino. The stability of
RNP complexes may
be evaluated by differential scanning fluorimetry, as described below.
Differential Scanning Fluorimetry (DSF)
[0297] The thermostability of ribonucleoprotein (RNP) complexes comprising
gRNAs and RNA-
guided nucleases can be measured via DSF. The DSF technique measures the
thermostability of a
protein, which can increase under favorable conditions such as the addition of
a binding RNA
molecule, e.g., a gRNA.
[0298] A DSF assay can be performed according to any suitable protocol, and
can be employed in
any suitable setting, including without limitation (a) testing different
conditions (e.g. different
stoichiometric ratios of gRNA: RNA-guided nuclease protein, different buffer
solutions, etc.) to
identify optimal conditions for RNP formation; and (b) testing modifications
(e.g. chemical
modifications, alterations of sequence, etc.) of an RNA-guided nuclease and/or
a gRNA to identify
those modifications that improve RNP formation or stability. One readout of a
DSF assay is a shift in
melting temperature of the RNP complex; a relatively high shift suggests that
the RNP complex is
83
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
more stable (and may thus have greater activity or more favorable kinetics of
formation, kinetics of
degradation, or another functional characteristic) relative to a reference RNP
complex characterized
by a lower shift. When the DSF assay is deployed as a screening tool, a
threshold melting
temperature shift may be specified, so that the output is one or more RNPs
having a melting
temperature shift at or above the threshold. For instance, the threshold can
be 5-10 C (e.g. 5 , 6 , 7 ,
8 , 9 , 10 ) or more, and the output may be one or more RNPs characterized by
a melting temperature
shift greater than or equal to the threshold.
[0299] Two non-limiting examples of DSF assay conditions are set forth below:
[0300] To determine the best solution to form RNP complexes, a fixed
concentration (e.g. 2 M) of
Cas9 in water+10x SYPRO Orange (Life Technologies cat#S-6650) is dispensed
into a 384 well
plate. An equimolar amount of gRNA diluted in solutions with varied pH and
salt is then added.
After incubating at room temperature for 10'and brief centrifugation to remove
any bubbles, a Bio-
Rad CFX384TM Real-Time System C1000 TouchTm Thermal Cycler with the Bio-Rad
CFX Manager
software is used to run a gradient from 20 C to 90 C with a 1 C increase in
temperature every 10
seconds.
[0301] The second assay consists of mixing various concentrations of gRNA with
fixed
concentration (e.g. 2 M) Cas9 in optimal buffer from assay 1 above and
incubating (e.g. at RT for
10') in a 384 well plate. An equal volume of optimal buffer + 10x SYPRO Orange
(Life
Technologies cat#S-6650) is added and the plate sealed with Microseal0 B
adhesive (MSB-1001).
Following brief centrifugation to remove any bubbles, a Bio-Rad CFX384TM Real-
Time System
C1000 TouchTm Thermal Cycler with the Bio-Rad CFX Manager software is used to
run a gradient
from 20 C to 90 C with a 1 C increase in temperature every 10 seconds.
Genome editing strategies
[0302] The genome editing systems described above are used, in various
embodiments of the present
disclosure, to generate edits in (i.e. to alter) targeted regions of DNA
within or obtained from a cell.
Various strategies are described herein to generate particular edits, and
these strategies are generally
described in terms of the desired repair outcome, the number and positioning
of individual edits (e.g.
SSBs or DSBs), and the target sites of such edits.
[0303] Genome editing strategies that involve the formation of SSBs or DSBs
are characterized by
repair outcomes including: (a) deletion of all or part of a targeted region;
(b) insertion into or
replacement of all or part of a targeted region; or (c) interruption of all or
part of a targeted region.
This grouping is not intended to be limiting, or to be binding to any
particular theory or model, and is
offered solely for economy of presentation. Skilled artisans will appreciate
that the listed outcomes
are not mutually exclusive and that some repairs may result in other outcomes.
The description of a
84
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
particular editing strategy or method should not be understood to require a
particular repair outcome
unless otherwise specified.
[0304] Replacement of a targeted region generally involves the replacement of
all or part of the
existing sequence within the targeted region with a homologous sequence, for
instance through gene
correction or gene conversion, two repair outcomes that are mediated by HDR
pathways. HDR is
promoted by the use of a donor template, which can be single-stranded or
double stranded, as
described in greater detail below. Single or double stranded templates can be
exogenous, in which
case they will promote gene correction, or they can be endogenous (e.g. a
homologous sequence
within the cellular genome), to promote gene conversion. Exogenous templates
can have asymmetric
overhangs (i.e. the portion of the template that is complementary to the site
of the DSB may be offset
in a 3' or 5' direction, rather than being centered within the donor
template), for instance as described
by Richardson 2016 (incorporated by reference herein). In instances where the
template is single
stranded, it can correspond to either the complementary (top) or non-
complementary (bottom) strand
of the targeted region.
[0305] Gene conversion and gene correction are facilitated, in some cases, by
the formation of one or
more nicks in or around the targeted region, as described in Ran & Hsu 2013
and Cotta-Ramusino. In
some cases, a dual-nickase strategy is used to form two offset SSBs that, in
turn, form a single DSB
having an overhang (e.g. a 5' overhang).
[0306] Interruption and/or deletion of all or part of a targeted sequence can
be achieved by a variety
of repair outcomes. As one example, a sequence can be deleted by
simultaneously generating two or
more DSBs that flank a targeted region, which is then excised when the DSBs
are repaired, as is
described in Maeder for the LCA10 mutation. As another example, a sequence can
be interrupted by
a deletion generated by formation of a double strand break with single-
stranded overhangs, followed
by exonucleolytic processing of the overhangs prior to repair.
[0307] One specific subset of target sequence interruptions is mediated by the
formation of an indel
within the targeted sequence, where the repair outcome is typically mediated
by NHEJ pathways
(including Alt-NHEJ). NHEJ is referred to as an "error prone" repair pathway
because of its
association with indel mutations. In some cases, however, a DSB is repaired by
NHEJ without
alteration of the sequence around it (a so-called "perfect" or "scarless"
repair); this generally requires
the two ends of the DSB to be perfectly ligated. Indels, meanwhile, are
thought to arise from
enzymatic processing of free DNA ends before they are ligated that adds and/or
removes nucleotides
from either or both strands of either or both free ends.
[0308] Because the enzymatic processing of free DSB ends may be stochastic in
nature, indel
mutations tend to be variable, occurring along a distribution, and can be
influenced by a variety of
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
factors, including the specific target site, the cell type used, the genome
editing strategy used, etc.
Even so, it is possible to draw limited generalizations about indel formation:
deletions formed by
repair of a single DSB are most commonly in the 1-50 bp range, but can reach
greater than 100-200
bp. Insertions formed by repair of a single DSB tend to be shorter and often
include short
duplications of the sequence immediately surrounding the break site. However,
it is possible to obtain
large insertions, and in these cases, the inserted sequence has often been
traced to other regions of the
genome or to plasmid DNA present in the cells.
[0309] Indel mutations ¨ and genome editing systems configured to produce
indels ¨ are useful for
interrupting target sequences, for example, when the generation of a specific
final sequence is not
required and/or where a frameshift mutation would be tolerated. They can also
be useful in settings
where particular sequences are preferred, insofar as the certain sequences
desired tend to occur
preferentially from the repair of an SSB or DSB at a given site. Indel
mutations are also a useful tool
for evaluating or screening the activity of particular genome editing systems
and their components. In
these and other settings, indels can be characterized by (a) their relative
and absolute frequencies in
the genomes of cells contacted with genome editing systems and (b) the
distribution of numerical
differences relative to the unedited sequence, e.g. 1, 2, 3, etc. As one
example, in a lead-finding
setting, multiple gRNAs can be screened to identify those gRNAs that most
efficiently drive cutting at
a target site based on an indel readout under controlled conditions. Guides
that produce indels at or
above a threshold frequency, or that produce a particular distribution of
indels, can be selected for
further study and development. Indel frequency and distribution can also be
useful as a readout for
evaluating different genome editing system implementations or formulations and
delivery methods,
for instance by keeping the gRNA constant and varying certain other reaction
conditions or delivery
methods.
Multiplex Strategies
[0310] Genome editing systems according to this disclosure may also be
employed for multiplex
gene editing to generate two or more DSBs, either in the same locus or in
different loci. Any of the
RNA-guided nucleases and gRNAs disclosed herein may be used in genome editing
systems for
multiplex gene editing. Strategies for editing that involve the formation of
multiple DSBs, or SSBs,
are described in, for instance, Cotta-Ramusino. In certain embodiments,
multiple gRNAs and an
RNA-guided nuclease may be used in genome editing systems to introduce
alterations (e.g., deletions,
insertions) into the CCAAT box target region of HBG1 and/or HBG2. In certain
embodiments, the
RNA-guided nuclease may be a Cpfl or modified Cpfl.
86
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Donor template design
[0311] Donor template design is described in detail in the literature, for
instance in Cotta-Ramusino.
DNA oligomer donor templates (oligodeoxynucleotides or ODNs), which can be
single stranded
(ssODNs) or double-stranded (dsODNs), can be used to facilitate HDR-based
repair of DSBs or to
boost overall editing rate, and are particularly useful for introducing
alterations into a target DNA
sequence, inserting a new sequence into the target sequence, or replacing the
target sequence
altogether.
[0312] Whether single-stranded or double stranded, donor templates generally
include regions that
are homologous to regions of DNA within or near (e.g. flanking or adjoining) a
target sequence to be
cleaved. These homologous regions are referred to here as "homology arms," and
are illustrated
schematically below:
[5' homology arm] ¨ [replacement sequence] -- [3' homology arm].
[0313] The homology arms can have any suitable length (including 0 nucleotides
if only one
homology arm is used), and 3' and 5' homology arms can have the same length,
or can differ in
length. The selection of appropriate homology arm lengths can be influenced by
a variety of factors,
such as the desire to avoid homologies or microhomologies with certain
sequences such as Alu
repeats or other very common elements. For example, a 5' homology arm can be
shortened to avoid a
sequence repeat element. In other embodiments, a 3' homology arm can be
shortened to avoid a
sequence repeat element. In some embodiments, both the 5' and the 3' homology
arms can be
shortened to avoid including certain sequence repeat elements. In addition,
some homology arm
designs can improve the efficiency of editing or increase the frequency of a
desired repair outcome.
For example, Richardson 2016, which is incorporated by reference herein, found
that the relative
asymmetry of 3' and 5' homology arms of single stranded donor templates
influenced repair rates
and/or outcomes.
[0314] Replacement sequences in donor templates have been described elsewhere,
including in
Cotta-Ramusino. A replacement sequence can be any suitable length (including
zero nucleotides,
where the desired repair outcome is a deletion), and typically includes one,
two, three or more
sequence modifications relative to the naturally-occurring sequence within a
cell in which editing is
desired. One common sequence modification involves the alteration of the
naturally-occurring
sequence to repair a mutation that is related to a disease or condition of
which treatment is desired.
Another common sequence modification involves the alteration of one or more
sequences that are
complementary to, or then, the PAM sequence of the RNA-guided nuclease or the
targeting domain of
the gRNA(s) being used to generate an SSB or DSB, to reduce or eliminate
repeated cleavage of the
target site after the replacement sequence has been incorporated into the
target site.
87
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0315] Where a linear ssODN is used, it can be configured to (i) anneal to the
nicked strand of the
target nucleic acid, (ii) anneal to the intact strand of the target nucleic
acid, (iii) anneal to the plus
strand of the target nucleic acid, and/or (iv) anneal to the minus strand of
the target nucleic acid. An
ssODN may have any suitable length, e.g., about, at least, or no more than 80-
200 nucleotides (e.g.,
80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides).
[0316] It should be noted that a template nucleic acid can also be a nucleic
acid vector, such as a
viral genome or circular double stranded DNA, e.g., a plasmid. Nucleic acid
vectors comprising
donor templates can include other coding or non-coding elements. For example,
a template nucleic
acid can be delivered as part of a viral genome (e.g. in an AAV or lentiviral
genome) that includes
certain genomic backbone elements (e.g. inverted terminal repeats, in the case
of an AAV genome)
and optionally includes additional sequences coding for a gRNA and/or an RNA-
guided nuclease. In
certain embodiments, the donor template can be adjacent to, or flanked by,
target sites recognized by
one or more gRNAs, to facilitate the formation of free DSBs on one or both
ends of the donor
template that can participate in repair of corresponding SSBs or DSBs formed
in cellular DNA using
the same gRNAs. Exemplary nucleic acid vectors suitable for use as donor
templates are described in
Cotta-Ramusino, which is incorporated by reference.
[0317] Whatever format is used, a template nucleic acid can be designed to
avoid undesirable
sequences. In certain embodiments, one or both homology arms can be shortened
to avoid overlap
with certain sequence repeat elements, e.g., Alu repeats, LINE elements, etc.
[0318] In certain embodiments, silent, non-pathogenic SNPs may be included in
the ssODN donor
template to allow for identification of a gene editing event.
[0319] In certain embodiments, a donor template may be a non-specific template
that is non-
homologous to regions of DNA within or near a target sequence to be cleaved.
In certain
embodiments, donor templates for use in targeting the GATA1 binding motif in
BCL11Ae may
include, without limitation, non-target specific templates that are
nonhomologous to regions of DNA
within or near the GATA1 binding motif in BCL11Ae. In certain embodiments,
donor templates for
use in targeting the 13 nt target region may include, without limitation, non-
target specific templates
that are nonhomologous to regions of DNA within or near the 13 nt target
region.
[0320] A donor template or template nucleic acid, as that term is used herein,
refers to a nucleic acid
sequence which can be used in conjunction with an RNA nuclease molecule and
one or more gRNA
molecules to alter (e.g., delete, disrupt, or modify) a target DNA sequence.
In certain embodiments,
the template nucleic acid results in an alteration (e.g., deletion) at the
CCAAT box target region of
HBG1 and/or HBG2. In certain embodiments, the alteration is a non-naturally
occurring alteration.
In certain embodiments, the non-naturally occurring alteration at the CCAAT
box target region of
88
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
HBG1 and/or HBG2 may comprise the 18 nt target region, the 11 nt target
region, the 4 nt target
region, or the 1 nt target region, or a combination thereof In certain
embodiments, the alteration is a
naturally occurring alteration. In certain embodiments, the naturally
occurring alteration at the
CCAAT box target region of HBG1 and/or HBG2 may comprise the 13 nt target
region, the c.-117
G>A target region, or a combination thereof In certain embodiments, the
template nucleic acid is an
ssODN. In certain embodiments, the ssODN is a positive strand or a negative
strand.
[0321] For example, a template nucleic acid for introducing the 18 nt deletion
at the 18 nt target
region (HBG1 c.-104 to -121, HBG2 c.-104 to -121, or a combination thereof)
may comprise a 5'
homology arm, a replacement sequence, and a 3' homology arm, where the
replacement sequence is 0
nucleotides or 0 bp. In certain embodiments, the 5' homology arm may be about
25 to about 200
nucleotides or more in length, e.g., at least about 25, 50, 75, 100, 125, 150,
175, or 200 nucleotides in
length. In certain embodiments, the 5' homology arm comprises about 50 to 100
bp, e.g., 55 to 95, 60
to 90, 70 to 90, or 80 to 90 bp, homology 5' of the 18 nt target region. In
certain embodiments, the 3'
homology arm may be about 25 to about 200 nucleotides or more in length, e.g.,
at least about 25, 50,
75, 100, 125, 150, 175, or 200 nucleotides in length. In certain embodiments,
the 3' homology arm
comprises about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90
bp, homology 3' of the 18
nt target region. In certain embodiments, the 5' and 3' homology arms are
symmetrical in length. In
certain embodiments, the 5' and 3' homology arms are asymmetrical in length.
In certain
embodiments, the template nucleic acid is an ssODN. In certain embodiments,
the ssODN is a
positive strand. In certain embodiments, the ssODN is a negative strand. In
certain embodiments, the
ssODN comprises, consists essentially of, or consists of SEQ ID NO:974
(0L116409) or SEQ ID
NO:975 (0L116410).
[0322] In certain embodiments, a template nucleic acid for introducing the 11
nt deletion at the 11 nt
target region (HBG1 c.-105 to -115, HBG2 c.-105 to -115, or a combination
thereof) may comprise a
5' homology arm, a replacement sequence, and a 3' homology arm, where the
replacement sequence
is 0 nucleotides or 0 bp. In certain embodiments, the 5' homology arm may be
about 25 to about 200
nucleotides in length, e.g., at least about 25, 50, 75, 100, 125, 150, 175, or
200 nucleotides in length.
In certain embodiments, the 5' homology arm comprises about 50 to 100 bp,
e.g., 55 to 95, 60 to 90,
70 to 90, or 80 to 90 bp, homology 5' of the 11 nt target region. In certain
embodiments, the 3'
homology arm may be about 25 to about 200 nucleotides in length, e.g., at
least about 25, 50, 75, 100,
125, 150, 175, or 200 nucleotides in length. In certain embodiments, the 3'
homology arm comprises
about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp,
homology 3' of the 11 nt target
region. In certain embodiments, the 5' and 3' homology arms are symmetrical in
length. In certain
embodiments, the 5' and 3' homology arms are asymmetrical in length. In
certain embodiments, the
template nucleic acid is an ssODN. In certain embodiments, the ssODN is a
positive strand. In
89
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
certain embodiments, the ssODN is a negative strand. In certain embodiments,
the ssODN comprises,
consists essentially of, or consists of SEQ ID NO:976 (0L116411) or SEQ ID
NO:978 (0L116413).
[0323] In certain embodiments, a template nucleic acid for introducing the 4
nt deletion at the 4 nt
target region (HBG1 c.-112 to -115, HBG2 c.-112 to -115, or a combination
thereof) may comprise a
5' homology arm, a replacement sequence, and a 3' homology arm, where the
replacement sequence
is 0 nucleotides or 0 bp. In certain embodiments, the 5' homology arm may be
about 25 to about 200
nucleotides in length, e.g., at least about 25, 50, 75, 100, 125, 150, 175, or
200 nucleotides in length.
In certain embodiments, the 5' homology arm comprises about 50 to 100 bp,
e.g., 55 to 95, 60 to 90,
70 to 90, or 80 to 90 bp, homology 5' of the 4 nt target region. In certain
embodiments, the 3'
homology arm may be about 25 to about 200 nucleotides in length, e.g., at
least about 25, 50, 75, 100,
125, 150, 175, or 200 nucleotides in length. In certain embodiments, the 3'
homology arm comprises
about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp,
homology 3' of the 4 nt target
region. In certain embodiments, the 5' and 3' homology arms are symmetrical in
length. In certain
embodiments, the 5' and 3' homology arms are asymmetrical in length. In
certain embodiments, the
template nucleic acid is an ssODN. In certain embodiments, the ssODN is a
positive strand. In
certain embodiments, the ssODN is a negative strand. In certain embodiments,
the ssODN comprises,
consists essentially of, or consists of SEQ ID NO:984 (0L116419), SEQ ID
NO:985 (0L116420),
SEQ ID NO:986 (0L116421), SEQ ID NO:987 (0L116422), SEQ ID NO:988 (0L116423),
SEQ ID
NO:989 (0L116424), SEQ ID NO:990 (0L116425), SEQ ID NO:991 (0L116426), SEQ ID
NO:992
(0L116427), SEQ ID NO:993 (0L116428), SEQ ID NO:994 (0L116429), or SEQ ID
NO:995
(0L116430).
[0324] In certain embodiments, a template nucleic acid for introducing the 1
nt deletion at the 1 nt
target region (HBG1 c.-116, HBG2 c.-116, or a combination thereof) may
comprise a 5' homology
arm, a replacement sequence, and a 3' homology arm, where the replacement
sequence is 0
nucleotides or 0 bp. In certain embodiments, the 5' homology arm may be about
25 to about 200
nucleotides in length, e.g., at least about 25, 50, 75, 100, 125, 150, 175, or
200 nucleotides in length.
In certain embodiments, the 5' homology arm comprises about 50 to 100 bp,
e.g., 55 to 95, 60 to 90,
70 to 90, or 80 to 90 bp, homology 5' of the 1 nt target region. In certain
embodiments, the 3'
homology arm may be about 25 to about 200 nucleotides in length, e.g., at
least about 25, 50, 75, 100,
125, 150, 175, or 200 nucleotides in length. In certain embodiments, the 3'
homology arm comprises
about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp,
homology 3' of the 1 nt target
region. In certain embodiments, the 5' and 3' homology arms are symmetrical in
length. In certain
embodiments, the 5' and 3' homology arms are asymmetrical in length. In
certain embodiments, the
template nucleic acid is an ssODN. In certain embodiments, the ssODN is a
positive strand. In
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
certain embodiments, the ssODN is a negative strand. In certain embodiments,
the ssODN comprises,
consists essentially of, or consists of SEQ ID NO:982 (0L116417) or SEQ ID
NO:983 (0L116418).
[0325] In certain embodiments, the alteration at the CCAAT box target region
recapitulates or is
similar to a naturally occurring alteration, such as a 13 nt deletion. In
certain embodiments, a
template nucleic acid for introducing the 13 nt deletion at the 13 nt target
region (HBG1 c.-116,
HBG2 c.-116, or a combination thereof) may comprise a 5' homology arm, a
replacement sequence,
and a 3' homology arm, where the replacement sequence is 0 nucleotides or 0
bp. In certain
embodiments, the 5' homology arm may be about 25 to about 200 nucleotides in
length, e.g., at least
about 25, 50, 75, 100, 125, 150, 175, or 200 nucleotides in length. In certain
embodiments, the 5'
homology arm comprises about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90,
or 80 to 90 bp,
homology 5' of the 13 nt target region. In certain embodiments, the 3'
homology arm may be about
25 to about 200 nucleotides in length, e.g., at least about 25, 50, 75, 100,
125, 150, 175, or 200
nucleotides in length. In certain embodiments, the 3' homology arm comprises
about 50 to 100 bp,
e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp, homology 3' of the 13 nt
target region. In certain
embodiments, the 5' and 3' homology arms are symmetrical in length. In certain
embodiments, the 5'
and 3' homology arms are asymmetrical in length. In certain embodiments, the
template nucleic acid
is an ssODN. In certain embodiments, the ssODN is a positive strand. In
certain embodiments, the
ssODN is a negative strand. In certain embodiments, the ssODN comprises,
consists essentially of, or
consists of SEQ ID NO:979 (0L116414) or SEQ ID NO:977 (0L116412).
[0326] In certain embodiments, the alteration at the CCAAT box target region
recapitulates or is
similar to a naturally occurring alteration, such as a substitution from G to
A at the -117G>A target
region. In certain embodiments, a template nucleic acid for introducing the -
117G>A substitution at
the -117G>A target region (HBG1 c.-117 G>A, HBG2 c.-117 G>A, or a combination
thereof) may
comprise a 5' homology arm, a replacement sequence, and a 3' homology arm,
where the replacement
sequence is 0 nucleotides or 0 bp. In certain embodiments, the 5' homology arm
may be about 100 to
about 200 nucleotides in length, e.g., at least about 100, 125, 150, 175, or
200 nucleotides in length.
In certain embodiments, the 5' homology arm comprises about 50 to 100 bp,
e.g., 55 to 95, 60 to 90,
70 to 90, or 80 to 90 bp, homology 5' of the -117G>A target region. In certain
embodiments, the 3'
homology arm may be about 25 to about 200 nucleotides in length, e.g., at
least about 25, 50, 75, 100,
125, 150, 175, or 200 nucleotides in length. In certain embodiments, the 3'
homology arm comprises
about 50 to 100 bp, e.g., 55 to 95, 60 to 90, 70 to 90, or 80 to 90 bp,
homology 3' of the -117G>A
target region. In certain embodiments, the 5' and 3' homology arms are
symmetrical in length. In
certain embodiments, the 5' and 3' homology arms are asymmetrical in length.
In certain
embodiments, the template nucleic acid is an ssODN. In certain embodiments,
the ssODN is a
positive strand. In certain embodiments, the ssODN is a negative strand. In
certain embodiments, the
91
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
ssODN comprises, consists essentially of, or consists of SEQ ID NO:980
(0L116415) or SEQ ID
NO:981 (0L116416).
[0327] In certain embodiments, the 5' homology arm comprises a 5'
phosphorothioate (PhTx)
modification. In certain embodiments, the 3' homology arm comprises a 3' PhTx
modification. In
certain embodiments, the template nucleic acid comprises a 5' and 3' PhTx
modification.
[0328] In certain embodiments, the ssODNs for introducing alterations (e.g.,
deletions) at the
CCAAT box target region may be used in conjunction with an RNA nuclease and
one or more gRNAs
that target the CCAAT target region, for example, the gRNAs disclosed in Table
6, Table 12, Table
13.
Target cells
[0329] Genome editing systems according to this disclosure can be used to
manipulate or alter a cell,
e.g., to edit or alter a target nucleic acid. The manipulating can occur, in
various embodiments, in
vivo or ex vivo.
[0330] A variety of cell types can be manipulated or altered according to the
embodiments of this
disclosure, and in some cases, such as in vivo applications, a plurality of
cell types are altered or
manipulated, for example by delivering genome editing systems according to
this disclosure to a
plurality of cell types. In other cases, however, it may be desirable to limit
manipulation or alteration
to a particular cell type or types. For instance, it can be desirable in some
instances to edit a cell with
limited differentiation potential or a terminally differentiated cell, such as
a photoreceptor cell in the
case of Maeder, in which modification of a genotype is expected to result in a
change in cell
phenotype. In other cases, however, it may be desirable to edit a less
differentiated, multipotent or
pluripotent, stem or progenitor cell. By way of example, the cell may be an
embryonic stem cell,
induced pluripotent stem cell (iPSC), hematopoietic stem/progenitor cell
(HSPC), or other stem or
progenitor cell type that differentiates into a cell type of relevance to a
given application or indication.
[0331] As a corollary, the cell being altered or manipulated is, variously, a
dividing cell or a non-
dividing cell, depending on the cell type(s) being targeted and/or the desired
editing outcome.
[0332] When cells are manipulated or altered ex vivo, the cells can be used
(e.g. administered to a
subject) immediately, or they can be maintained or stored for later use. Those
of skill in the art will
appreciate that cells can be maintained in culture or stored (e.g. frozen in
liquid nitrogen) using any
suitable method known in the art.
92
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
Implementation of genome editing systems: delivery, formulations, and routes
of administration
[0333] As discussed above, the genome editing systems of this disclosure can
be implemented in any
suitable manner, meaning that the components of such systems, including
without limitation the
RNA-guided nuclease, gRNA, and optional donor template nucleic acid, can be
delivered, formulated,
or administered in any suitable form or combination of forms that results in
the transduction,
expression or introduction of a genome editing system and/or causes a desired
repair outcome in a
cell, tissue or subject. Tables 2 and 3 set forth several, non-limiting
examples of genome editing
system implementations. Those of skill in the art will appreciate, however,
that these listings are not
comprehensive, and that other implementations are possible. With reference to
Table 2 in particular,
the table lists several exemplary implementations of a genome editing system
comprising a single
gRNA and an optional donor template. However, genome editing systems according
to this disclosure
can incorporate multiple gRNAs, multiple RNA-guided nucleases, and other
components such as
proteins, and a variety of implementations will be evident to the skilled
artisan based on the principles
illustrated in the table. In the table, [N/A] indicates that the genome
editing system does not include
the indicated component.
Table 2
Genome Editing System Components
RNA-guided Donor Comments
gRNA
Nuclease Template
An RNA-guided nuclease protein
Protein RNA [N/A] complexed with a gRNA molecule (an
RNP complex)
An RNP complex as described above
Protein RNA DNA plus a single-stranded or double
stranded donor template.
An RNA-guided nuclease protein plus
Protein DNA [N/A]
gRNA transcribed from DNA.
An RNA-guided nuclease protein plus
Protein DNA DNA gRNA-encoding DNA and a separate
DNA donor template.
An RNA-guided nuclease protein and
Protein DNA a single DNA encoding both a gRNA
and a donor template.
A DNA or DNA vector encoding an
DNA RNA-guided nuclease, a gRNA and a
donor template.
Two separate DNAs, or two separate
DNA DNA [N/A]
DNA vectors, encoding the RNA-
guided nuclease and the gRNA,
respectively.
Three separate DNAs, or three
DNA DNA DNA separate DNA vectors, encoding the
RNA-guided nuclease, the gRNA and
the donor template, respectively.
93
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
A DNA or DNA vector encoding an
DNA [N/A]
RNA-guided nuclease and a gRNA
A first DNA or DNA vector encoding
an RNA-guided nuclease and a gRNA,
DNA DNA
and a second DNA or DNA vector
encoding a donor template.
A first DNA or DNA vector encoding
an RNA-guided nuclease and second
DNA DNA
DNA or DNA vector encoding a
gRNA and a donor template.
A first DNA or DNA vector encoding
DNA
an RNA-guided nuclease and a donor
DNA template, and a second DNA or DNA
vector encoding a gRNA
DNA A DNA or DNA vector encoding an
RNA-guided nuclease and a donor
RNA template, and a gRNA
An RNA or RNA vector encoding an
RNA [N/A] RNA-guided nuclease and comprising
a gRNA
An RNA or RNA vector encoding an
RNA-guided nuclease and comprising
RNA DNA
a gRNA, and a DNA or DNA vector
encoding a donor template.
[0334] Table 3 summarizes various delivery methods for the components of
genome editing systems,
as described herein. Again, the listing is intended to be exemplary rather
than limiting.
Table 3
Delivery
Type of
into Non- Duration of Genome
Delivery Vector/Mode Molecule
Dividing Expression Integration
Delivered
Cells
Physical (e.g., electroporation, YES Transient NO Nucleic Acids
particle gun, Calcium and Proteins
Phosphate transfection, cell
compression or squeezing)
Viral Retrovirus NO Stable YES RNA
Lentivirus YES Stable YES/NO with RNA
modifications
Adenovirus YES Transient NO DNA
Adeno- YES Stable NO DNA
Associated Virus
(AAV)
94
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Vaccinia Virus YES Very NO DNA
Transient
Herpes Simplex YES Stable NO DNA
Virus
Non-Viral Cationic YES Transient Depends on Nucleic Acids
Liposomes what is and Proteins
delivered
Polymeric YES Transient Depends on Nucleic Acids
Nanoparticles what is and Proteins
delivered
Biological Attenuated YES Transient NO Nucleic Acids
Non-Viral Bacteria
Delivery
Vehicles
Engineered YES Transient NO Nucleic Acids
Bacteriophages
Mammalian YES Transient NO Nucleic Acids
Virus-like
Particles
Biological YES Transient NO Nucleic Acids
liposomes:
Erythrocyte
Ghosts and
Exosomes
Nucleic acid-based delivery of genome editing systems
[0335] Nucleic acids encoding the various elements of a genome editing system
according to the
present disclosure can be administered to subjects or delivered into cells by
art-known methods or as
described herein. For example, RNA-guided nuclease-encoding and/or gRNA-
encoding DNA, as
well as donor template nucleic acids can be delivered by, e.g., vectors (e.g.,
viral or non-viral vectors),
non-vector based methods (e.g., using naked DNA or DNA complexes), or a
combination thereof
[0336] Nucleic acids encoding genome editing systems or components thereof can
be delivered
directly to cells as naked DNA or RNA, for instance by means of transfection
or electroporation, or
can be conjugated to molecules (e.g., N-acetylgalactosamine) promoting uptake
by the target cells
(e.g., erythrocytes, HSCs). Nucleic acid vectors, such as the vectors
summarized in Table 3, can also
be used.
[0337] Nucleic acid vectors can comprise one or more sequences encoding genome
editing system
components, such as an RNA-guided nuclease, a gRNA and/or a donor template. A
vector can also
comprise a sequence encoding a signal peptide (e.g., for nuclear localization,
nucleolar localization, or
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
mitochondrial localization), associated with (e.g., inserted into or fused to)
a sequence coding for a
protein. As one example, a nucleic acid vectors can include a Cas9 coding
sequence that includes one
or more nuclear localization sequences (e.g., a nuclear localization sequence
from SV40).
[0338] The nucleic acid vector can also include any suitable number of
regulatory/control elements,
e.g., promoters, enhancers, introns, polyadenylation signals, Kozak consensus
sequences, or internal
ribosome entry sites (IRES). These elements are well known in the art, and are
described in Cotta-
Ramusino.
[0339] Nucleic acid vectors according to this disclosure include recombinant
viral vectors.
Exemplary viral vectors are set forth in Table 3, and additional suitable
viral vectors and their use and
production are described in Cotta-Ramusino. Other viral vectors known in the
art can also be used.
In addition, viral particles can be used to deliver genome editing system
components in nucleic acid
and/or peptide form. For example, "empty" viral particles can be assembled to
contain any suitable
cargo. Viral vectors and viral particles can also be engineered to incorporate
targeting ligands to alter
target tissue specificity.
[0340] In addition to viral vectors, non-viral vectors can be used to deliver
nucleic acids encoding
genome editing systems according to the present disclosure. One important
category of non-viral
nucleic acid vectors are nanoparticles, which can be organic or inorganic.
Nanoparticles are well
known in the art, and are summarized in Cotta-Ramusino. Any suitable
nanoparticle design can be
used to deliver genome editing system components or nucleic acids encoding
such components. For
instance, organic (e.g. lipid and/or polymer) nonparticles can be suitable for
use as delivery vehicles
in certain embodiments of this disclosure. Exemplary lipids for use in
nanoparticle formulations,
and/or gene transfer are shown in Table 4 and Table 5 lists exemplary polymers
for use in gene
transfer and/or nanoparticle formulations.
Table 4: Lipids Used for Gene Transfer
Lipid Abbreviation Feature
1,2-Dioleoyl-sn-glycero-3-phosphatidylcholine DOPC Helper
1,2-Dioleoyl-sn-glycero-3-phosphatidylethanolamine DOPE Helper
Cholesterol Helper
N-[1-(2,3-Dioleyloxy)propyliN,N,N-trimethylammonium chloride DOTMA
Cationic
1,2-Dioleoyloxy-3-trimethylammonium-propane DOTAP Cationic
Dioctadecylamidoglycylspermine DOGS Cationic
N-(3-Aminopropy1)-N,N-dimethy1-2,3-bis(dodecyloxy)-1- GAP-DLRIE
Cationic
propanaminium bromide
96
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Cetyltrimethylammonium bromide CTAB
Cationic
6-Lauroxyhexyl ornithinate LHON
Cationic
1-(2,3-Diole oy loxypropyl) -2,4,6-trimethy 1pyridinium 20c
Cationic
2,3-Dioley loxy -N- [2(sperminecarboxamido-ethy1] -N,N-dimethy1-1 - DOSPA
Cationic
propanaminium trifluoroacetate
1,2-Dioley1-3-trimethylammonium-propane DOPA
Cationic
N- (2-Hy droxy ethyl)-N,N-dimethyl-2,3-bis (tetrade cy loxy)-1- MDRIE
Cationic
propanaminium bromide
Dimyristooxypropyl dimethyl hydroxyethyl ammonium bromide DMRI
Cationic
313- [N-(N' ,N '-Dimethy laminoethane) -carbamoyl] chole sterol DC-
Chol Cationic
Bis -guanidium -tren-chole sterol BGTC
Cationic
1,3-Diodeoxy -2-(6-carboxy -spermy1)-propylamide DOSPER
Cationic
Dimethyloctadecylammonium bromide DDAB
Cationic
Dioctadecylamidoglicylspermidin D SL
Cationic
rac - [(2,3 -Dioctadecy loxypropyl) (2-hy droxy ethyl)] -dimethylammonium CLIP-
1 Cationic
chloride
rac- [2(2,3-Dihexadecyloxypropyl- CLIP-6
Cationic
oxymethyloxy)ethyl]trimethylammonium bromide
Ethyldimyristoylphosphatidylcholine EDMPC
Cationic
1,2-Distearyloxy -N,N-dimethy1-3-aminopropane DSDMA
Cationic
1,2-Dimyristoyl-trimethylammonium propane DMTAP
Cationic
0,0 '-Dimyristyl-N-ly syl aspartate DMKE
Cationic
1,2-Diste aroy 1- sn-gly cero -3 -ethy 1phosphocholine DSEPC
Cationic
N-Palmitoyl D-erythro-sphingosyl carbamoyl-spermine CC S
Cationic
N-t-Butyl-NO -tetradecy1-3-tetradecy laminopropionamidine diC14-
amidine Cationic
Octadecenolyoxy[ethy1-2-heptadeceny1-3 hydroxyethyl] imidazolinium DOTIM
Cationic
chloride
Ni -Chole stery loxy c arbony1-3 ,7-diazanonane -1,9-diamine CDAN
Cationic
2-(3- [Bis(3-amino-propy1)-amino]propylamino)-N- RPR209120
Cationic
ditetradecylcarbamoylme-ethyl-acetamide
1,2-dilinoley loxy -3- dimethylaminopropane DLinDMA
Cationic
2,2-dilinoley1-4-dimethy laminoethy 1- [1,3] - dioxolane DLin-
KC2-DMA Cationic
dilinoleyl- methyl-4-dimethylaminobutyrate DLin-
MC3-DMA Cationic
97
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Table 5: Polymers Used for Gene Transfer
Polymer Abbreviation
Poly(ethylene)glycol PEG
Polyethylenimine PEI
Dithiobis(succinimidylpropionate) DSP
Dimethy1-3,3'-dithiobispropionimidate DTBP
Poly(ethylene imine) biscarbamate PEIC
Poly(L-lysine) PLL
Histidine modified PLL
Poly(N-vinylpyrrolidone) PVP
Poly(propylenimine) PPI
Poly(amidoamine) PAMAM
Poly(amido ethylenimine) SS-PAEI
Triethylenetetramine TETA
Poly(I3-aminoester)
Poly(4-hydroxy-L-proline ester) PHP
Poly(allylamine)
Po1y(a-14-aminobuty1l-L-g1yco1ic acid) PAGA
Poly(D,L-lactic-co-glycolic acid) PLGA
Poly(N-ethyl-4-vinylpyridinium bromide)
Poly(phosphazene)s PPZ
Poly(phosphoester)s PPE
Poly(phosphoramidate)s PPA
Poly(N-2-hydroxypropylmethacrylamide) pHPMA
Poly (2-(dimethylamino)ethyl methacrylate) pDMAEMA
Poly(2-aminoethyl propylene phosphate) PPE-EA
Chitosan
Galactosylated chitosan
N-Dodacylated chitosan
Histone
Collagen
98
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Dextran-spermine D-SPM
[0341] Non-viral vectors optionally include targeting modifications to improve
uptake and/or
selectively target certain cell types. These targeting modifications can
include e.g., cell specific
antigens, monoclonal antibodies, single chain antibodies, aptamers, polymers,
sugars (e.g., N-
acetylgalactosamine (GalNAc)), and cell penetrating peptides. Such vectors
also optionally use
fusogenic and endosome-de stabilizing peptides/polymers, undergo acid-
triggered conformational
changes (e.g., to accelerate endosomal escape of the cargo), and/or
incorporate a stimuli-cleavable
polymer, e.g., for release in a cellular compartment. For example, disulfide-
based cationic polymers
that are cleaved in the reducing cellular environment can be used.
[0342] In certain embodiments, one or more nucleic acid molecules (e.g., DNA
molecules) other than
the components of a genome editing system, e.g., the RNA-guided nuclease
component and/or the
gRNA component described herein, are delivered. In certain embodiments, the
nucleic acid molecule
is delivered at the same time as one or more of the components of the Genome
editing system. In
certain embodiments, the nucleic acid molecule is delivered before or after
(e.g., less than about 30
minutes, 1 hour, 2 hours, 3 hours, 6 hours, 9 hours, 12 hours, 1 day, 2 days,
3 days, 1 week, 2 weeks,
or 4 weeks) one or more of the components of the Genome editing system are
delivered. In certain
embodiments, the nucleic acid molecule is delivered by a different means than
one or more of the
components of the genome editing system, e.g., the RNA-guided nuclease
component and/or the
gRNA component, are delivered. The nucleic acid molecule can be delivered by
any of the delivery
methods described herein. For example, the nucleic acid molecule can be
delivered by a viral vector,
e.g., an integration-deficient lentivirus, and the RNA-guided nuclease
molecule component and/or the
gRNA component can be delivered by electroporation, e.g., such that the
toxicity caused by nucleic
acids (e.g., DNAs) can be reduced. In certain embodiments, the nucleic acid
molecule encodes a
therapeutic protein, e.g., a protein described herein. In certain embodiments,
the nucleic acid
molecule encodes an RNA molecule, e.g., an RNA molecule described herein.
Delivery of RNPs and/or RNA encoding genome editing system components
[0343] RNPs (complexes of gRNAs and RNA-guided nucleases) and/or RNAs encoding
RNA-
guided nucleases and/or gRNAs, can be delivered into cells or administered to
subjects by art-known
methods, some of which are described in Cotta-Ramusino. In vitro, RNA-guided
nuclease-encoding
and/or gRNA-encoding RNA can be delivered, e.g., by microinjection,
electroporation, transient cell
compression or squeezing (see, e.g., Lee 2012). Lipid-mediated transfection,
peptide-mediated
delivery, GalNAc- or other conjugate-mediated delivery, and combinations
thereof, can also be used
for delivery in vitro and in vivo. A protective, interactive, non-condensing
(PINC) system may be
used for delivery.
99
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0344] In vitro delivery via electroporation comprises mixing the cells with
the RNA encoding RNA-
guided nucleases and/or gRNAs, with or without donor template nucleic acid
molecules, in a
cartridge, chamber or cuvette and applying one or more electrical impulses of
defined duration and
amplitude. Systems and protocols for electroporation are known in the art, and
any suitable
electroporation tool and/or protocol can be used in connection with the
various embodiments of this
disclosure.
Route of administration
[0345] Genome editing systems, or cells altered or manipulated using such
systems, can be
administered to subjects by any suitable mode or route, whether local or
systemic. Systemic modes of
administration include oral and parenteral routes. Parenteral routes include,
by way of example,
intravenous, intramarrow, intrarterial, intramuscular, intradermal,
subcutaneous, intranasal, and
intraperitoneal routes. Components administered systemically can be modified
or formulated to
target, e.g., HSCs, hematopoietic stem/progenitor cells, or erythroid
progenitors or precursor cells.
[0346] Local modes of administration include, by way of example, intramarrow
injection into the
trabecular bone or intrafemoral injection into the marrow space, and infusion
into the portal vein. In
certain embodiments, significantly smaller amounts of the components (compared
with systemic
approaches) can exert an effect when administered locally (for example,
directly into the bone
marrow) compared to when administered systemically (for example,
intravenously). Local modes of
administration can reduce or eliminate the incidence of potentially toxic side
effects that may occur
when therapeutically effective amounts of a component are administered
systemically.
[0347] Administration can be provided as a periodic bolus (for example,
intravenously) or as
continuous infusion from an internal reservoir or from an external reservoir
(for example, from an
intravenous bag or implantable pump). Components can be administered locally,
for example, by
continuous release from a sustained release drug delivery device.
[0348] In addition, components can be formulated to permit release over a
prolonged period of time.
A release system can include a matrix of a biodegradable material or a
material which releases the
incorporated components by diffusion. The components can be homogeneously or
heterogeneously
distributed within the release system. A variety of release systems can be
useful, however, the choice
of the appropriate system will depend upon rate of release required by a
particular application. Both
non-degradable and degradable release systems can be used. Suitable release
systems include
polymers and polymeric matrices, non-polymeric matrices, or inorganic and
organic excipients and
diluents such as, but not limited to, calcium carbonate and sugar (for
example, trehalose). Release
systems may be natural or synthetic. However, synthetic release systems are
preferred because
generally they are more reliable, more reproducible and produce more defined
release profiles. The
100
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
release system material can be selected so that components having different
molecular weights are
released by diffusion through or degradation of the material.
[0349] Representative synthetic, biodegradable polymers include, for example:
polyamides such as
poly(amino acids) and poly(peptides); polyesters such as poly(lactic acid),
poly(glycolic acid),
poly (lactic-co-glycolic acid), and poly(caprolactone); poly(anhydrides);
polyorthoesters;
polycarbonates; and chemical derivatives thereof (substitutions, additions of
chemical groups, for
example, alkyl, alkylene, hydroxylations, oxidations, and other modifications
routinely made by those
skilled in the art), copolymers and mixtures thereof Representative synthetic,
non-degradable
polymers include, for example: polyethers such as poly(ethylene oxide),
poly(ethylene glycol), and
poly(tetramethylene oxide); vinyl polymers-polyacrylates and polymethacrylates
such as methyl,
ethyl, other alkyl, hydroxyethyl methacrylate, acrylic and methacrylic acids,
and others such as
poly(vinyl alcohol), poly(vinyl pyrolidone), and poly(vinyl acetate);
poly(urethanes); cellulose and its
derivatives such as alkyl, hydroxyalkyl, ethers, esters, nitrocellulose, and
various cellulose acetates;
polysiloxanes; and any chemical derivatives thereof (substitutions, additions
of chemical groups, for
example, alkyl, alkylene, hydroxylations, oxidations, and other modifications
routinely made by those
skilled in the art), copolymers and mixtures thereof
[0350] Poly(lactide-co-glycolide) microsphere can also be used. Typically the
microspheres are
composed of a polymer of lactic acid and glycolic acid, which are structured
to form hollow spheres.
The spheres can be approximately 15-30 microns in diameter and can be loaded
with components
described herein. In some embodiments, genome editing systems, system
components and/or nucleic
acids encoding system components, are delivered with a block copolymer such as
a poloxamer or a
poloxamine.
Multi-modal or differential delivery of components
[0351] Skilled artisans will appreciate, in view of the instant disclosure,
that different components of
genome editing systems disclosed herein can be delivered together or
separately and simultaneously
or non-simultaneously. Separate and/or asynchronous delivery of genome editing
system components
can be particularly desirable to provide temporal or spatial control over the
function of genome
editing systems and to limit certain effects caused by their activity.
[0352] Different or differential modes as used herein refer to modes of
delivery that confer different
pharmacodynamic or pharmacokinetic properties on the subject component
molecule, e.g., a RNA-
guided nuclease molecule, gRNA, template nucleic acid, or payload. For
example, the modes of
delivery can result in different tissue distribution, different half-life, or
different temporal distribution,
e.g., in a selected compartment, tissue, or organ.
101
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0353] Some modes of delivery, e.g., delivery by a nucleic acid vector that
persists in a cell, or in
progeny of a cell, e.g., by autonomous replication or insertion into cellular
nucleic acid, result in more
persistent expression of and presence of a component. Examples include viral,
e.g., AAV or
lentivirus, delivery.
[0354] By way of example, the components of a genome editing system, e.g., a
RNA-guided
nuclease and a gRNA, can be delivered by modes that differ in terms of
resulting half-life or
persistent of the delivered component the body, or in a particular
compartment, tissue or organ. In
certain embodiments, a gRNA can be delivered by such modes. The RNA-guided
nuclease molecule
component can be delivered by a mode which results in less persistence or less
exposure to the body
or a particular compartment or tissue or organ.
[0355] More generally, in certain embodiments, a first mode of delivery is
used to deliver a first
component and a second mode of delivery is used to deliver a second component.
The first mode of
delivery confers a first pharmacodynamic or pharmacokinetic property. The
first pharmacodynamic
property can be, e.g., distribution, persistence, or exposure, of the
component, or of a nucleic acid that
encodes the component, in the body, a compartment, tissue or organ. The second
mode of delivery
confers a second pharmacodynamic or pharmacokinetic property. The second
pharmacodynamic
property can be, e.g., distribution, persistence, or exposure, of the
component, or of a nucleic acid that
encodes the component, in the body, a compartment, tissue or organ.
[0356] In certain embodiments, the first pharmacodynamic or pharmacokinetic
property, e.g.,
distribution, persistence or exposure, is more limited than the second
pharmacodynamic or
pharmacokinetic property.
[0357] In certain embodiments, the first mode of delivery is selected to
optimize, e.g., minimize, a
pharmacodynamic or pharmacokinetic property, e.g., distribution, persistence
or exposure.
[0358] In certain embodiments, the second mode of delivery is selected to
optimize, e.g., maximize,
a pharmacodynamic or pharmacokinetic property, e.g., distribution, persistence
or exposure.
[0359] In certain embodiments, the first mode of delivery comprises the use of
a relatively persistent
element, e.g., a nucleic acid, e.g., a plasmid or viral vector, e.g., an AAV
or lentivirus. As such
vectors are relatively persistent product transcribed from them would be
relatively persistent.
[0360] In certain embodiments, the second mode of delivery comprises a
relatively transient element,
e.g., an RNA or protein.
[0361] In certain embodiments, the first component comprises gRNA, and the
delivery mode is
relatively persistent, e.g., the gRNA is transcribed from a plasmid or viral
vector, e.g., an AAV or
lentivirus. Transcription of these genes would be of little physiological
consequence because the
102
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
genes do not encode for a protein product, and the gRNAs are incapable of
acting in isolation. The
second component, a RNA-guided nuclease molecule, is delivered in a transient
manner, for example
as mRNA or as protein, ensuring that the full RNA-guided nuclease
molecule/gRNA complex is only
present and active for a short period of time.
[0362] Furthermore, the components can be delivered in different molecular
form or with different
delivery vectors that complement one another to enhance safety and tissue
specificity.
[0363] Use of differential delivery modes can enhance performance, safety,
and/or efficacy, e.g., the
likelihood of an eventual off-target modification can be reduced. Delivery of
immunogenic
components, e.g., Cas9 molecules, by less persistent modes can reduce
immunogenicity, as peptides
from the bacterially-derived Cas enzyme are displayed on the surface of the
cell by MHC molecules.
A two-part delivery system can alleviate these drawbacks.
[0364] Differential delivery modes can be used to deliver components to
different, but overlapping
target regions. The formation active complex is minimized outside the overlap
of the target regions.
Thus, in certain embodiments, a first component, e.g., a gRNA is delivered by
a first delivery mode
that results in a first spatial, e.g., tissue, distribution. A second
component, e.g., a RNA-guided
nuclease molecule is delivered by a second delivery mode that results in a
second spatial, e.g., tissue,
distribution. In certain embodiments, the first mode comprises a first element
selected from a
liposome, nanoparticle, e.g., polymeric nanoparticle, and a nucleic acid,
e.g., viral vector. The second
mode comprises a second element selected from the group. In certain
embodiments, the first mode of
delivery comprises a first targeting element, e.g., a cell specific receptor
or an antibody, and the
second mode of delivery does not include that element. In certain embodiments,
the second mode of
delivery comprises a second targeting element, e.g., a second cell specific
receptor or second
antibody.
[0365] When the RNA-guided nuclease molecule is delivered in a virus delivery
vector, a liposome,
or polymeric nanoparticle, there is the potential for delivery to and
therapeutic activity in multiple
tissues, when it may be desirable to only target a single tissue. A two-part
delivery system can
resolve this challenge and enhance tissue specificity. If the gRNA and the RNA-
guided nuclease
molecule are packaged in separated delivery vehicles with distinct but
overlapping tissue tropism, the
fully functional complex is only be formed in the tissue that is targeted by
both vectors.
EXAMPLES
[0366] The principles and embodiments described above are further illustrated
by the non-limiting
examples that follow:
103
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Example 1: Cpfl RNP containing gRNA targeting the CCAAT box supports gene
editing in human
hematopoietic stem/progenitor cells
[0367] A Cpfl guide RNA, HBG1-1 (i.e., 01113620 (Table 6)), was designed to
target the HBG
distal CCAAT box. To determine optimal nuclear localization signal
configuration for
Acidaminococcus sp. Cpfl ("AsCpfl") delivery in CD34+ cells, HBG1-1 gRNA was
complexed to
two nuclear localization signal (NLS) variants of AsCpfl, namely His-AsCpfl-
nNLS (SEQ ID NO:
1000) and His-AsCpfl-sNLS-sNLS (SEQ ID NO:1001). "His" refers to a six-
histidine purification
sequence, "AsCpfl" refers to the Acidaminococcus sp. Cpfl protein sequence,
"nNLS" refers to the
nucleoplasmin NLS, and "sNLS" refers to the 5V40 NLS.
[0368] Briefly, mPB CD34+ cells were pre-stimulated for 2 days with human
cytokines in X-Vivo-
and then electroporated with the RNPs at 5 itM or 20 M. The genomic DNA was
extracted three
days post electroporation and next-generation sequencing was performed on the
HBG PCR products.
HBG1-1 gRNA complexed to either of the Cpfl NLS variants tested ("His-AsCpfl-
sNLS-
sNLS_HBG1-1 RNP" or "His-AsCpfl-nNLS_HBG1-1 RNP"), supported editing of CD34+
cells at
the 13 nt target site. His-AsCpfl-sNLS-sNLS_HBG1-1 RNP generated 60.6% edited
alleles and His-
AsCpfl-nNLS_HBG1-1 RNP generated 51.1% edited alleles at the highest dose
tested (Fig. 3A).
Table 6: HBG1-1 gRNA sequence for targeting the CCAAT box in CD34 cells
Targeting Targeting
Targeting Targeting
OLI-ID domain domain
gRNA domain domain
ID
sequence plus sequence plus Sense
sequence sequence
PAM (UUUG) PAM (TTTG)
(RNA) (DNA)
(RNA) (DNA)
HBG1-1 01113620 CCUUGUC CCTTGTC UUUGCCUUGU TTTGCCTTG Antisense
AAGGCUA AAGGCTA CAAGGCUAUU TCAAGGCT
UUGGUC TTGGTC GGUC (SEQ ID ATTGGTC
(SEQ ID (SEQ ID NO:1004) (SEQ ID
NO:1002) NO:1003) NO:1005)
Example 2: Co-delivery of Cpfl RNP targeting the CCAAT box with ssODN donors
supports gene
editing in human hematopoietic stem/progenitor cells
[0369] RNP comprising HBG1-1 gRNA complexed to the His-AsCpfl-sNLS-sNLS
variant ("His-
AsCpfl-sNLS-sNLS_HBG1-1 RNP") were co-delivered by electroporation with single
stranded
oligodeoxynucleotide donor repair templates (ssODNs) to mPB CD34+ cells.
01116430 and
01116424 ssODNs were designed to "encode" a 4 nucleotide deletion and 01116409
and 01116410
ssODNs were designed to "encode" a 18 nucleotide deletion (Table 7). Both the
4 nt and 18 nt
deletions disrupt the HBG distal CCAAT box and are associated with induction
of HBG expression.
104
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
The ssODNs include 90 nucleotide-long homology arms flanking the encoded
absent sequence to
create perfect deletion. The ssODNs were modified to contain phosphorothioates
(PhTx) at the 5' and
3' ends (01116430, 01116424, 01116409, and 01116410, Table 7). Briefly, human
adult mPB
CD34+ cells pre-stimulated for two days in medium supplemented with human
cytokines were
electroporated with 5 itM RNP comprising the His-AsCpfl-sNLS-sNLS protein
complexed to HBG1-
1 gRNA ("His-AsCpfl-sNLS-sNLS_HBG1-1 RNP") either alone, or in combination
with 2.5 itM of
one of the ssODN donors (01116430, 011164324, 01116409, or 0LI16410). Co-
delivery of the
RNP and ssODN donor encoding the 18 nt deletion with positive strand homology
arms (0L116409)
enhanced the editing frequency from 39.5% without donor to 73.3%, as
determined by sequencing
analysis of the HBG PCR product from genomic DNA extracted at 72 hours post-
electroporation (Fig.
4A).
Table 7: Single strand deoxynucleotide donor repair templates "encoding"
deletions or
mutations at or near the CCAAT box
ssODN ID OLI-ID Sequence
Ptx ssODN - 01116409 G*GTGCTTCCTTTTATTCTTCATCCCTAGCCAGCCGCCGGCCCC
Positive TGGCCTCACTGGATACTCTAAGACTATTGGTCAAGTTTGCCTT
Strand -18nt GTCAAGGCTGGCCAACCCATGGGTGGAGTTTAGCCAGGGACC
(180) GTTTCAGACAGATATTTGCATTGAGATAGTGTGGGGAAGGGG
CCCCCAAGA*G (SEQ ID NO:974)
Ptx ssODN - 01116410 C*TCTTGGGGGCCCCTTCCCCACACTATCTCAATGCAAATATC
Negative TGTCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGCC
Strand -18nt AGCCTTGACAAGGCAAACTTGACCAATAGTCTTAGAGTATCC
(180) AGTGAGGCCAGGGGCCGGCGGCTGGCTAGGGATGAAGAATA
AAAGGAAGCAC*C (SEQ ID NO:975)
Ptx ssODN - 01116411 G*GCCCCTTCCCCACACTATCTCAATGCAAATATCTGTCTGAA
Negative ACGGTCCCTGGCTAAACTCCACCCATGGGTTGGCCAGCCTTGC
Strand -1 lnt CTTGAGACAAGGCAAACTTGACCAATAGTCTTAGAGTATCCA
(180) GTGAGGCCAGGGGCCGGCGGCTGGCTAGGGATGAAGAATAA
AAGGAAGCACC*C (SEQ ID NO:976)
Ptx ssODN - 01116412 G*GCCCCTTCCCCACACTATCTCAATGCAAATATCTGTCTGAA
Negative ACGGTCCCTGGCTAAACTCCACCCATGGGTTGGCCAGCCTTGC
Strand -13nt CTTGACAAGGCAAACTTGACCAATAGTCTTAGAGTATCCAGT
(180) GAGGCCAGGGGCCGGCGGCTGGCTAGGGATGAAGAATAAAA
GGAAGCACCCT*T (SEQ ID NO:977)
Ptx ssODN - 01116413 G*GGTGCTTCCTTTTATTCTTCATCCCTAGCCAGCCGCCGGCCC
Positive CTGGCCTCACTGGATACTCTAAGACTATTGGTCAAGTTTGCCT
Strand -1 lnt TGTCTCAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGC
(180) CAGGGACCGTTTCAGACAGATATTTGCATTGAGATAGTGTGG
GGAAGGGGC*C (SEQ ID NO:978)
Ptx ssODN - 01116414 A*AGGGTGCTTCCTTTTATTCTTCATCCCTAGCCAGCCGCCGGC
Positive CCCTGGCCTCACTGGATACTCTAAGACTATTGGTCAAGTTTGC
Strand -13nt CTTGTCAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGC
(180) CAGGGACCGTTTCAGACAGATATTTGCATTGAGATAGTGTGG
GGAAGGGGC*C (SEQ ID NO:979)
105
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
Ptx ssODN - 0LI16415 G*GCCCCTTCCCCACACTATCTCAATGCAAATATCTGTCTGAA
Negative ACGGTCCCTGGCTAAACTCCACCCATGGGTTGGCCAGCCTTGC
Strand 117: CTTAACCAATAGCCTTGACAAGGCAAACTTGACCAATAGTCTT
G>A (180) AGAGTATCCAGTGAGGCCAGGGGCCGGCGGCTGGCTAGGGAT
GAAGAATAA*A (SEQ ID NO:980)
Ptx ssODN - 01116416 T*TTATTCTTCATCCCTAGCCAGCCGCCGGCCCCTGGCCTCACT
Positive GGATACTCTAAGACTATTGGTCAAGTTTGCCTTGTCAAGGCTA
Strand 117: TTGGTTAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGC
G>A (180) CAGGGACCGTTTCAGACAGATATTTGCATTGAGATAGTGTGG
GGAAGGGGC*C (SEQ ID NO:981)
Ptx ssODN - 01116417 G*GCCCCTTCCCCACACTATCTCAATGCAAATATCTGTCTGAA
Negative ACGGTCCCTGGCTAAACTCCACCCATGGGTTGGCCAGCCTTGC
Strand -Int CTTGCCAATAGCCTTGACAAGGCAAACTTGACCAATAGTCTTA
(180) GAGTATCCAGTGAGGCCAGGGGCCGGCGGCTGGCTAGGGATG
AAGAATAAA*A (SEQ ID NO:982)
Ptx ssODN - 01116418 T*TTTATTCTTCATCCCTAGCCAGCCGCCGGCCCCTGGCCTCAC
Positive TGGATACTCTAAGACTATTGGTCAAGTTTGCCTTGTCAAGGCT
Strand -Int ATTGGCAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGC
(180) CAGGGACCGTTTCAGACAGATATTTGCATTGAGATAGTGTGG
GGAAGGGGC*C (SEQ ID NO:983)
Ptx ssODN - 01116419 T*GGCTAAACTCCACCCATGGGTTGGCCAGCCTTGCCTTGATA
Negative GCCTTGACAAGGCAAACTTGACCAATAGTCTTAGAGTATCCA
Strand -4nt GTGAGGCCAGGGGCCGGCGGCTGGCTAGGGATGAA*G (SEQ
40/80 (120) ID NO:984)
Ptx ssODN - 01116420 C*CACCCATGGGTTGGCCAGCCTTGCCTTGATAGCCTTGACAA
Negative GGCAAACTTGACCAATAGTCTTAGAGTATCCAGTGAGGCCAG
Strand -4nt GGGCCGGCGGCTGGC*T (SEQ ID NO:985)
30/70 (100)
Ptx ssODN - 01116421 A*AACGGTCCCTGGCTAAACTCCACCCATGGGTTGGCCAGCCT
Negative TGCCTTGATAGCCTTGACAAGGCAAACTTGACCAATAGTCTTA
Strand -4nt GAGTATCCAGTGAG*G (SEQ ID NO:986)
(100)
Ptx ssODN - 01116422 T*ATCTGTCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGT
Negative TGGCCAGCCTTGCCTTGATAGCCTTGACAAGGCAAACTTGACC
Strand -4nt AATAGTCTTAGAGTATCCAGTGAGGCCAGGGGCC*G (SEQ ID
(120) NO:987)
Ptx ssODN - 01116423 T*CAATGCAAATATCTGTCTGAAACGGTCCCTGGCTAAACTCC
Negative ACCCATGGGTTGGCCAGCCTTGCCTTGATAGCCTTGACAAGGC
Strand -4nt AAACTTGACCAATAGTCTTAGAGTATCCAGTGAGGCCAGGGG
(140) CCGGCGGCTGGC*T (SEQ ID NO:988)
Ptx ssODN - 01116424 G*GCCCCTTCCCCACACTATCTCAATGCAAATATCTGTCTGAA
Negative ACGGTCCCTGGCTAAACTCCACCCATGGGTTGGCCAGCCTTGC
Strand -4nt CTTGATAGCCTTGACAAGGCAAACTTGACCAATAGTCTTAGA
(180) GTATCCAGTGAGGCCAGGGGCCGGCGGCTGGCTAGGGATGAA
GAATAAAAGG*A (SEQ ID NO:989)
Ptx ssODN - OLI16425 T*ACTCTAAGACTATTGGTCAAGTTTGCCTTGTCAAGGCTATC
Positive AAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGCCAGGGA
Strand -4nt CCGTTTCAGACAGATATTTGCATTGAGATAGTGTG*G (SEQ ID
40/80 (120) NO:990)
Ptx ssODN - 01116426 C*TATTGGTCAAGTTTGCCTTGTCAAGGCTATCAAGGCAAGGC
Positive TGGCCAACCCATGGGTGGAGTTTAGCCAGGGACCGTTTCAGA
Strand -4nt CAGATATTTGCATTG*A (SEQ ID NO:991)
30/70 (100)
106
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
Ptx ssODN - 01116427 C*CTCACTGGATACTCTAAGACTATTGGTCAAGTTTGCCTTGTC
Positive AAGGCTATCAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTT
Strand -4nt AGCCAGGGACCGTT*T (SEQ ID NO:992)
(100)
Ptx ssODN - 01116428 C*GGCCCCTGGCCTCACTGGATACTCTAAGACTATTGGTCAAG
Positive TTTGCCTTGTCAAGGCTATCAAGGCAAGGCTGGCCAACCCATG
Strand -4nt GGTGGAGTTTAGCCAGGGACCGTTTCAGACAGAT*A (SEQ ID
(120) NO:993)
Ptx ssODN - 01116429 A*GCCAGCCGCCGGCCCCTGGCCTCACTGGATACTCTAAGACT
Positive ATTGGTCAAGTTTGCCTTGTCAAGGCTATCAAGGCAAGGCTGG
Strand -4nt CCAACCCATGGGTGGAGTTTAGCCAGGGACCGTTTCAGACAG
(140) ATATTTGCATTG*A (SEQ ID NO:994)
Ptx ssODN - 0LI16430 T*CCTTTTATTCTTCATCCCTAGCCAGCCGCCGGCCCCTGGCCT
Positive CACTGGATACTCTAAGACTATTGGTCAAGTTTGCCTTGTCAAG
Strand -4nt GCTATCAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGC
(180) CAGGGACCGTTTCAGACAGATATTTGCATTGAGATAGTGTGG
GGAAGGGGC*C (SEQ ID NO:995)
Ptx ssODN - 01116431 C*CCTGGCCTCACTGGATACTCTAAGACTATTGGTCAAGTTTG
Positive CCTTGTCAAGGCTGGCCAACCCATGGGTGGAGTTTAGCCAGG
Strand -18nt GACCGTTTCAGACAG*A (SEQ ID NO:1040)
(100)
* : Represents phosphorothioate modification
[0370] Further analysis of the specific type and size of deletions at the
target site revealed that in the
presence of the 18 nt positive strand donor (01116409), 57.3% of alleles
carried the 18 nt deletion
compared to 7.5% of alleles when the His-AsCpfl-sNLS-sNLS_HBG1-1 RNP was
delivered alone
(Fig. 4B). The ssODN co-delivery mediated precise repair of the DNA DSB
because the 18 nt
deletion represented 71.2% of all the indels generated with co-delivery of
ssODN 01116409 and His-
AsCpfl-sNLS-sNLS_HBG1-1 RNP, whereas the 18 nt deletion represented only 19.0%
of all the
indels were generated when delivering His-AsCpfl-sNLS-sNLS_HBG1-1 RNP alone
(Fig. 4C).
[0371] Although the data in Figures 4A-4C originally suggested that codelivery
of Cpfl RNP with
ssODN donors increased precise gene editing of genomic DNA resulting in the 18
nt deletion,
subsequent testing repeating the experiment in Example 2 confirmed that these
data were an artifact
of the experiment. Nonetheless, data acquired from the subsequent repeated
experiments testing the
AsCpfl RNP using the guide RNA HBG1-1 and ssODN 01116409 indicated that
codelivery of an
ssODN donor supports increased total editing in human mPB-CD34+ cells,
although not associated
with precise repair of the DNA DSB toward the "-18nt deletion" (see Example
10).
Example 3: Cpfl RNP containing gRNA targeting the distal CCAAT box region of
the HBG promoter
supports gene editing in human hematopoietic stem/progenitor cells which
promotes induction of HbF
protein expression in the erythroid progeny
[0372] Guide RNA HBG1-1 (Table 8) having a targeting domain comprising SEQ ID
NO:1002
(Table 9), targets a site within the HBG promoter (Fig. 5A). The HBG1-1 gRNA
(SEQ ID NO:1022)
107
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
was complexed to wild-type AsCpfl (AsCpfl-sNLS-sNLS, SEQ ID NO:1001) to form
an RNP
("AsCpfl-HBG1-1-RNP", Table 8). This complex (5 M or 20 M) was then
electroporated into
mobilized peripheral blood (mPB) derived CD34+ cells using either the Amaxa
nucleofector (Lonza),
or the MaxCyte GT (MaxCyte, Inc.) electroporation device. The level of
insertions / deletions at the
target site was analyzed by Illumina sequencing (NGS) of the PCR amplified
target site three days
after electroporation. AsCpfl-HBG1-1-RNP supported on-target editing of 43%
and 17%,
respectively, on the Amaxa and MaxCyte electroporation systems (Figs. 6A
(Amaxa) and 6B
(MaxCyte)). Following the editing of mPB CD34+ cells, ex vivo differentiation
into the erythroid
linage was performed for 18 days (Giarratana 2011). Then, relative expression
levels of gamma-
globin chains (over total beta-like globin chains) was measured by UPLC (Figs.
6A (Amaxa) and 6B
(MaxCyte)). AsCpfl-HBG1-1-RNP led to an increase of gamma-globin expression by
up to 21%
above levels detected in cells derived from mock electroporated mPB CD34+
cells (Fig. 6A).
108
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
Table 8: RNP components
Protein RNP
RNP ID gRNA gRNA sequence
gRNA ID
variant components modification (RNA)
UAAUUUCUACUC
AsCpfl-
gRNA UUGUAGAUCCUU
HBG1-1 sNLS-sNLS HBG1-1- Synthetic
GUCAAGGCUAUU
+
gRNA (SEQ ID AsCpfl-RNP unmodified
AsCpfl WT GGUC (SEQ ID
NO:1001)
NO:1022)
His UAAUUUCUACUC
gRNA
sNLS-sNLS HBG1-1- UUGUAGAUCCUU
HBG1-1 + Synthetic
GUCAAGGCUAUU
H800A AsCpf1H800
unmodified
gRNA
(SEQ ID AsCpfl
H800A A-RNP GGUC (SEQ ID
N NO:1032) O:1022)
His UAAUUUCUACUC
gRNA
sNLS-sNLS HBG1-1- UUGUAGAUCCUU
HBG1-1 + 5'0Me-
H800A AsCpf1H800 GUCAAGGCUAUU
PS20Me
gRNA
(SEQ ID AsCpfl
H800A A-RNP GGmU/P52/mC
NO:1032) (SEQ ID NO:1041)
mG*mG*mC*UGG
CCAACCCAUGU
UUUAGAGCUAG
AAAUAGCAAGU
tSpA
SpCas9WT dead gRNA UAAAAUAAGGC
(SEQ ID + tSpA-Cas9- Synthetic 5' -
UAGUCCGUUAU
RNP 3' 3xPSOMe
dead gRNA
NO:1033) SpCas9 WT CAACUUGAAAA
AGUGGCACCGA
GUCGGUGCmU*
mU*mU*U
(SEQ ID NO:1024)
mG*mG*mC*AAG
GCUGGCCAACC
CAUGUUUUAGA
GCUAGAAAUAG
His-NLS- gRNA
CAAGUUAAAAU
SpA SpCas9D10A + SpA-D10A- Synthetic 5' -
AAGGCUAGUCC
gRNA (SEQ ID SpCas9 RNP 3' 3xPSOMe
GUUAUCAACUU
NO:1034) nickase
GAAAAAGUGGC
ACCGAGUCGGU
GCmU*mU*mU*U
(SEQ ID NO:1025)
mU*mA*mG*UCU
UAGAGUAUCCA
GUGGUUUUAGA
GCUAGAAAUAG
His-NLS- gRNA
CAAGUUAAAAU
SpG SpCas9D10A + SpG-D10A- Synthetic 5' -
AAGGCUAGUCC
gRNA (SEQ ID SpCas9 RNP 3' 3xPSOMe
GUUAUCAACUU
NO:1034) nickase
GAAAAAGUGGC
ACCGAGUCGGU
GCmU*mU*mU*U
(SEQ ID NO:1026)
109
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
mU*mU*mA*GAG
UAUCCAGUGGU
UUUAGAGCUAG
AAAUAGCAAGU
SpCas9WT dead gRNA UAAAAUAAGGC
Sp182 5p182-Cas9- Synthetic 5' -
(SEQ ID UAGUCCGUUAU
dead gRNA RNP 3' 3xPSOMe
NO:1033) SpCas9 WT CAACUUGAAAA
AGUGGCACCGA
GUCGGUGCmU*
mU*mU*U
(SEQ ID NO:1027)
"His" refers to a six-histidine purification sequence
"AsCpfl" refers to the Acidaminococcus sp. Cpfl protein sequence
"nNLS" refers to the nucleoplasmin NLS, and "sNLS" refers to the 5V40 NLS
"SpCas9" refers to the S. Pyogenes Cas9 protein sequence
represents phosphorothioate modification
"PS" represents phosphorothioate modification
"PS2" represents phosphorodithioate modification
"OMe" represents a 2-o-methyl modification
"m" represents a 2-o-methyl modification
Table 9: guide RNA targeting domain sequences
gRNA Targeting domain sequence gRNA Targeting domain sequence (DNA)
gRNA ID
(RNA)
HBG1-1 CCUUGUCAAGGCUAUUGGUC CCTTGTCAAGGCTATTGGTC
gRNA (SEQ ID NO:1002) (SEQ ID NO:1003)
Sp182 UUAGAGUAUCCAGUG TTAGAGTATCCAGTG
dgRNA (SEQ ID NO:1028) (SEQ ID NO:1029)
SpG UAGUCUUAGAGUAUCCAGUG TAGTCTTAGAGTATCCAGTG
gRNA (SEQ ID NO:359) (SEQ ID NO:1030)
SpA GGCAAGGCUGGCCAACCCAU (SEQ GGCAAGGCTGGCCAACCCAT
gRNA ID NO:941) (SEQ ID NO:944)
tSpA GGCUGGCCAACCCAU GGCTGGCCAACCCAT
dgRNA (SEQ ID NO:326) (SEQ ID NO:1031)
Example 4: Cpfl RNP editing efficiency at the CCAAT box region of the HBG
promoter is enhanced
when co-delivered with S. Pyogenes Cas9 RNP with no impact on viability
[0373] It was hypothesized that the co-delivery of Cpfl-RNP with proximally
targeting S. Pyogenes
Cas9 RNP, either catalytically inactive or introducing single nicks, could
enhance editing levels at the
target site. In an attempt to enhance Cpfl-RNP mediated editing at the distal
CCAAT box region of
the HBG promoter, HBG1-1-AsCpf1H800A-RNP (composed of His-AsCpfl-sNLS-sNLS-
H800A
(SEQ ID NO:1032) complexed to HBG1-1 gRNA with a 3' modification as shown in
Table 8 (SEQ
ID NO:1041) was co-delivered into mPB CD34+ cells with: (1) S. Pyogenes Cas9
DlOA RNP
containing a Cas9 DlOA protein (His-NLS-SpCas9D10A, SEQ ID NO:1034) complexed
to a full
length guide RNA (100mer) selected from: (a) SpA gRNA (Tables 8, 9; Fig. 5B)
("SpA-D10A-
110
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
RNP", Table 8) or (b) SpG gRNA (Tables 8, 9; Fig. 5C) ("SpG-D10A-RNP", Table
8)); (2) S.
Pyogenes WT Cas9 RNP containing a WT Cas9 protein (SpCas9WT, SEQ ID NO:1033)
complexed
to a truncated dead guide RNA (95mer - with a shortened protospacer region)
selected from (a) tSpA
dgRNA (Tables 8, 9; Fig. 5E) ("tSpA-Cas9-RNP", Table 8); (b) 5p182 dgRNA
(Tables 8, 9; Fig.
5F) ("5p182-Cas9-RNP", Table 8); or (c) tSpA-Cas9-RNP and 5p182-Cas9-RNP
(Tables 8, 9, Fig.
5D). The RNP complexes were electroporated using the MaxCyte GT device
(MaxCyte, Inc). The
level of insertions / deletions at the target site was then analyzed by
Illumina sequencing (NGS) of the
PCR amplified target site three days after electroporation. In all
combinations tested, irrespective of
the S. Pyogenes Cas9 enzyme used (Dl OA or WT) and of PAM orientation, total
editing was
increased above levels observed following Maxcyte delivery of HBG1-1-
AsCpf1H800A-RNP alone
(Fig. 7 and Table 10). In addition there was no detrimental effect on
viability of mPB CD34+ cells
when S. Pyogenes Cas9 RNP were co-delivered (Fig. 8).
Table 10: Summary of indels and gamma globin expression with each RNP
combination at the
maximum RNP dose tested
Cpfl RNP Cas9 RNP1 Cas9 RNP2 Indels
(NGS) Gamma Globin (over
total beta-like chains)
0% 13.5%
HBG1-1-
AsCpf1H800A- 8.0% 20.0%
RNP
HBG1-1-
SpG-D10A-
AsCpf1H800A- 88.6% 30.2%
RNP
RNP
HBG1-1-
SpA-D10A-
AsCpf1H800A- 42.6% 32.5%
RNP
RNP
HBG1-1-
AsCpf1H800A- tSpA-Cas9-RNP 32.2% 19.8%
RNP
HBG1-1-
Sp182-Cas9-
AsCpf1H800A- 85.4% 42.8%
RNP
RNP
HBG1-1-
5p182-Cas9- AsCpf1H800A- tSpA-Cas9-RNP 80.1% 33.7%
RNP
RNP
Example 5: Cpfl editing profile can be manipulated with co-delivery of S.
Pyogenes Cas9-D10A-
RNP
111
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0374] In addition to the increase in total editing observed when HBG1-1-
AsCpf1H800A-RNP was
co-delivered to mPB CD34+ cells with S. Pyogenes Cas9-D10A-RNP (Fig. 7),
changes to the indel
profile were also observed. The introduction of a single strand break proximal
to the Cpfl-RNP target
site by the DIM enzyme (Fig. 9A) altered the directionality, length and/or
position of the indels (Fig.
9B). For example, Sp182-D10A-RNP strongly shifted the profile toward the
nicking site introduced
by the DIM RNP, with deletions of various length extending from the Cpfl cut
site toward the
upstream nicking site (Sp182-D10A-RNP, Fig. 9B). While the SpA-D10A-RNP also
promoted the
generation of deletions extending from the HBG1-1-AsCpf1H800A-RNP cut site to
the nicking site
introduced by the DIM enzyme (here located downstream), in this case,
additional deletions
apparently originating from the nicking site, but not extending fully to the
HBG1-1-AsCpf1H800A-
RNP cut site, were also produced (SpA-D10A-RNP, Fig. 9B).
[0375] It is probable that the orientation, target strand, and distance of the
S. Pyogenes Cas9-D10A-
RNP target site to the Cpfl-RNP target site leads to differences in the
position and length of the
mutations promoted by the additional DNA nick (Fig. 9A). It should be noted
that in certain
applications this directional manipulation of the indel profile, i.e., an
increase in the frequency of
indels occurring between the Cpfl-RNP and S. Pyogenes Cas9 D10A-RNP binding
sites, could be
used to favor a desired editing outcome, to increase the rate of productive
indels (e.g., indels
disrupting a targeted site). In the case set-out within, to disrupt the dCCAAT
target region and induce
HbF protein expression, the co-delivery of HBG1-1-AsCpf1H800A-RNP with S.
Pyogenes D10A-
RNP led to an increase of gamma globin levels by 16.7% (SpG-D10A-RNP) or 19.0%
(SpA-D10A-
RNP) above levels detected in mock electroporated cells, as detected by UPLC
analysis after 18 days
of erythroid differentiation post electroporation (Fig. 7 and Table 10). The
frequency of productive
indels was higher when pairing HBG1-1-AsCpf1H800A-RNP with SpA-D10A-RNP
(versus SpG-
D10A-RNP) as a higher increase in HbF levels (19% with Cas9D10A-SpA-RNP vs
16.7% with SpG-
D10A-RNP) was achieved from a lower editing level (42.6% with SpA-D10A-RNP vs
88.6% with
SpG-D10A-RNP) (Fig. 7 and Table 10).
Example 6: Cpfl editing is increased without altering the editing profile in
the presence of S.
Pyogenes Cas9 WT RNP containing a dead guide RNA
[0376] When co-delivering HBG1-1-AsCpf1H800A-RNP (at a fixed dose of 6 p,M) to
mPB CD34+
cells with increasing doses of Sp182-Cas9-RNP (complexed with a truncated,
95mer dead gRNA,
Sp182), using the MaxCyte electroporator device, an editing boost has been
observed up to greater
than 10-fold (85.4% editing with the highest dose of Sp182-Cas9-RNP versus
8.0% when HBG1-1-
AsCpf1H800A-RNP was delivered alone) (Fig. 7). The levels of editing achieved
here by co-
delivering Sp182-Cas9-RNP also greatly surpassed the levels of editing
obtained using the MaxCyte
electroporator device when HBG1-1-AsCpf1H800A-RNP was delivered alone at doses
as high as
112
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
20uM (Fig. 6B). In contrast to the results observed by co-delivering a D10A-
RNP (in Example 5),
the increase in editing achieved by co-delivering HBG1-1-AsCpf1H800A-RNP with
Sp182-Cas9-
RNP (Cas9-WT complexed with a truncated gRNA) was not associated with an
apparent impact on
the indel profile. The indels detected in electroporated cells were centered
around the Cpfl cut site in
an approximal symmetrical fashion and no indels were detected at the Sp182-
Cas9-RNP target site
(Fig. 10A). Of note, 96% of the total indels were disrupting the distal-CCAAT
box, and 79.5% of
total indels disrupted 3 or more nucleotides of the CCAAT box motif (Fig.
10B). Further dosing
optimization using HBG1-1-AsCpf1H800A-RNP (composed of His-AsCpfl-sNLS-sNLS-
H800A
(SEQ ID NO:1032) complexed to HBG1-1 gRNA (SEQ ID NO:1022)) and 5p182-Cas9-RNP
enabled
editing levels of up to 92% in mPB-CD34+ cells at 120 hours post-
electroporation using the MaxCyte
device, and lead to gamma chain expression levels 32% above background in
erythroid derived cells
(41% of gamma chains in treated cells, 8% in mock treated cells) (Fig. 11).
Those results
demonstrate that an RNP composed of WT S. Pyogenes Cas9 protein complexed with
a truncated
gRNA can increase the editing from a proximally binding Cpfl-RNP without
introducing detectable
levels of editing at its own binding site nor noticeably affecting the length
nor directionality of indels
generated by the Cpfl-RNP. Here, the editing enhancement provided by the 5p182-
Cas9-RNP
enables high editing of the HBG1-1-AsCpf1H800A-RNP at the HBG promoter, with a
high frequency
of indels disrupting the distal CCAAT box target motif and leading to
therapeutically relevant levels
of gamma chain expression in the bulk erythroid progeny of the electroporated
cells.
Example 7: Clonal HbF distribution within cell population edited with Cpfl
gRNA targeting the distal
CCAAT box
[0377] A single cell experiment was next performed to evaluate the
distribution of gamma chain
expression levels in erythroid cells derived from mPB CD34+ cells
electroporated with the HBG1-1-
AsCpf1H800A-RNP (composed of His-AsCpfl-sNLS-sNLS-H800A (SEQ ID NO:1032)
complexed
to HBG1-1 gRNA with a 3' modification as shown in Table 8 (SEQ ID NO:1041)) +
5p182-Cas9-
RNP combination (Fig. 5F, Table 8). After being left to recover during 48
hours post-
electroporation, the cells were sorted by Fluorescence Activated Cell Sorting
(FACS) at 1-cell / well
in non-tissue culture treated 384-well plates. The cells were then
differentiated and expanded clonally
for 18 days into the erythroid lineage (adapted from Giarratana 2011). UPLC
analysis was performed
to determine the distribution of gamma chain expression levels (percentage of
gamma chains/[total
beta-like chains]) in the clonal erythroid progeny of cells derived from the
total population of mPB-
CD34+ cells initially edited. It is considered that in order to achieve a
functional benefit and alleviate
symptoms associated with sickle cell disease, ¨30% of the erythroid cells
should have fetal
hemoglobin levels greater than 30%. Of the clones analyzed, 83.1% had gamma
chains levels above
the median level detected in erythroid clones derived from mock electroporated
mPB CD34+ cells
113
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
(median value = 18.8%), 64.2% had gamma chains levels exceeding 30% of total
beta-like and 35.8%
had gamma chains levels exceeding 48.8% of total beta-like (30% +18.8% median
level in control
cells) (Fig. 12).
Example 8: Screen of Cpfl gRNAs targeting the HBG promoter region
[0378] To identify other AsCpfl gRNA that could be used as a component of a
single RNP or in
combination with a "booster element" to increase editing of the HBG promoter
region in CD34+ cells
and induce fetal globin expression in the erythroid progeny of modified cells,
His-AsCpfl-NLS-NLS
("AsCpfl," SEQ ID NO:1000); AsCpfl 5542R/K607R ("AsCpfl RR," SEQ ID NO:1036);
or AsCpfl
5542R/K548V/N552R ("AsCpfl RVR," SEQ ID NO:1037) gRNA sequences targeting
several
domains of the HBG promoter (Table 11) were designed (listed in Table 12).
AsCpfl RR and
AsCpfl RVR are engineered AsCpfl variants which recognize TYCV/ACCC/CCCC and
TATV/RATR PAMs, respectively (Gao 2017).
Table 11: Subdomains of the HBG genomic region
Genomic Nucleotides Name of Region
Coordinate of
HbG*
Chr 11 TCCTAAAGCT TGGAACACTT Region 1: Downstream of
(NC_000011.10): TCCCTTCCTT AAGAACCATC HBG1
5,247,883- CTTGCTACTC AGCTGCAATC
5,248,186 AATCCAGCCC CCAGGTCTTC
ACTGAACCTT TTCCCATCTC
TTCCAAAACA TCTGTTTCTG
AGAAGTCCTG TCCTATAGAG
GTCTTTCTTC CCACCGGATT
TCTCCTACAC CATTTACTCC
CACTTGCAGA ACTCCCGTGT
ACAAGTGTCT TTACTGCTTT
TATTTGCTCA TCAAAATGCA
CATCTCATAT AAAAATAAAT
GAGGAGCATG CACACACCAC
AAACACAAAC AGGCATGCAG
AAAT (SEQ ID NO:1118)
Chr 11 ATAAAGATGA ACCCATAGTG Region 2: HBG1 Intron 2- A
(NC_000011.10): AGCTGAGAGC TCCAGCCTGG
5,248,509 ¨ CCTCCAGATA ACTACACACC
5,249,173 AAGCTTCCAC CCAGAATCAA
GCCTATGTTA ACTTCCCTCA
AAGCCTGAGA TTTTGCCTTC
CCATTAAATG CAGGTAGTTG
TTCCCCTTCA AGCACTAGTC
ACTGGCCATA ATTTAAATCT
TGCTATCTTC TTGCCACCAT
GAACCCTGTA TGTTGTAGGC
TGAAGACGTT AAAAGAAACA
114
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
CACGCTGACA CACACACACA
CACGCGCGCG CGCACACACA
CACACACACA CAGAGCTGAC
TTTCAAAATC TACTCCAGCC
CAAATGTTTC AATTGTTCCT
CACCCCTGGA CATACTTTGC
CCCCATCTGG AATTAAAGGA
TATAAGTTTG TAATGAAGCA
TTAGCAGCAT TTTATATGTG
TCCAGCTGAT ATAGGAATAG
CCTTAGCAAT GTATGTTTGG
CCACCAAAGT TCCCCACTTT
GACTGAGCCA ATATATGCCT
TCTGCCTGCA TCTTTTTAAC
GACCATACTT GTCCTGCCTC
CAGATAGATG TTTTAAAACA
ACAAAAATGA GGGAAAGATG
AAAGTTCTTT CTACTGGAAT
CTAATAAAGA AAAGTCATTT
TCCTCATTTC CACCTCTCTT
TTCTCAAAGT CAAAATTGTC
CATCT (SEQ ID NO:1119)
Chr 11 CCCTAAAACA TTACCACTGG Region 3: HBG1 Intron 2- B
(NC_000011.10): GTCTCAGCCC AGTTAGTCCT
5,249,198 ¨ CTGCAGTTTC TTCACCCCCA
5,249,362 ACCCCAGTAT CTTCAAACAG
CTCACACCCT GCTGTGCTCA
GATCAATACT CCGTTGTCTA
AGTTGCCTCG AGACTAAAGG
CAACAGGGCT GAAACATCTC
CTGGA (SEQ ID NO:1120)
Chr 11 CTGTGAGATT GACAAGAACA Region 4: HBG1 Intron 1
(NC_000011.10): GTTTGACAGT CAGAAGGTGC
5,249,591¨ CACAAATCCT GAGAAGCGAC
5,249,712 CTGGACTTTT GCCAGGCACA
GGGTCCTTCC TTCCCTCCCT
TGTCCTGGTC ACCAGAGCCT AC
(SEQ ID NO:1121)
Chr 11 GCCGCCGGCC CCTGGCCTCA Region 5: HBG1 -60 nt region
(NC_000011.10): CTGG (SEQ ID NO:1122) from Transcription Start Site
5,249,904 ¨ (TSS)
5,249,927
Chr 11 CCTTGTCAAG GCTATTGGTC Region 6: HBG1 -110 nt region
(NC 000011.10): AAGGCAAGGC TGG (SEQ ID from TSS
5,249,955 ¨ NO:1123)
5,249,987
Chr 11 TGAGATAGTG TGGGGAAGGG Region 7: HBG1 -200 nt region
(NC 000011.10): GCCCCC AAGAGGATAC (SEQ ID from TSS
5,250,040¨ NO:1124)
5,250,075
Chr 11 TATAGCCTTT GCCTTGTTCC Region 8: HBG1 -250 nt region
(NC 000011.10): GATTCAGTCA TTCCAGTTTT T (SEQ from TSS
5,250,089¨ ID NO:1125)
5,250,129
115
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Chr 11 TCTTCCCTTT AGCTAGTTTC Region 9: HBG1 -333 nt region
(NC 000011.10): CTTCTCCCAT CATAGAGGAT from TSS
5,250,141 ¨ ACCAGGACTT CTTTTGTCAG
5,250,254 CCGTTTTTTA CCTTCTTGTC
TCTAGCTCCA GTGAGGCCTG
TAGTTTAAAG CTAA (SEQ ID
NO:1126)
Chr 11 CCACAGTTTC AGCGCAGTAA Region 10: HBG1 -650 nt
(NC_000011.10): TAGATTAGTG TTACATAATA region from TSS
5,250,464 ¨ TAAGACCTAA TGCTTACCTC
5,250,549 AATATCTACT TATCCGTACC
TATTTG (SEQ ID NO:1127)
Chr 11 TATTCAGGTA TGTATGTATA Region 11: HBG1 -800 nt
(NC_000011.10): CACCAGATGA TGTGTATTTA region from TSS
5,250,594 ¨ CCACTGGATA AGTGTGTGTG
5,250,735 CTGGCTGATG ACCCAGGGTT
TTGGCGTAGC TCTTCTATGC
TCAGTAAAGA TGATGGTAGA
ATGTTCTTTG GCAGGTACTG TG
(SEQ ID NO:1128)
Chr 11 CAATAAAGAT GAACCCATAG Region 12: HBG2 Intron 2- A
(NC_000011.10): TGAGCTGAGA GCTCCAGCCT
5,253,425 ¨ GGCCTCCAGA TAACTACACA
5,254,121 CCAAGCTTCC ACCCAGAATC
AAGCCTATGT TAACTTCCCT
CAAAGCCTGA GATTTTGCTT
TCCCATTAAA TGCAGGTAGT
TGTTCTTCTT GCAGCACTAG
TCACTGGCCA TAATTTAAAT
CTTGTTATCT TCTTGCCACC
ATGAACCCTG TATGCTGTAG
GCTGAAAACG TTAAAAGAAA
CACACGCTCT CACACACACA
CAAACACACG CGCGCACACA
CACACACACA CACACAGAGC
TGACTTTCAA AATCTACTCC
AGCCCAAATG TTTCAATTGT
TCCTCACCCC TGGACATACT
TTGCCCCCAT CTGGAATTAA
AGGATATAAG TTTGTAATGA
AGCATTAGCA GCATTTTATA
TGTGTCCAGC TGATATAGGA
ATAGCCTTAG CAATGTATGT
TTGGCCACCA AAGTTCCCCA
CTTTGACTGA GCCAATATAT
GCCTTCTGCC TGCATCTTTT
TAATGACCAT ACTTGTCCTG
CCTCCAGATA GATGTTTTAA
AACGAATAAC AAAAATAGGG
GAAAGGTGAA AGTTCTTTCT
ACCGAAATCT AATAAAGAAA
AGTCATTTTC CTCATTTCCA
CCTCTCTTTT CTCAAAGTCA
AAGTTGTCCA TCTAGATTTT
116
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
CAGAGGCACT CCTTAGG (SEQ ID
NO:1129)
Chr 11 CCCTAAAACA TTGCCACTGG Region 13: HBG2 Intron 2 - B
(NC_000011.10): GTCTCAGCCC AGTTAGTCCT
5,254,122 ¨ CTGCAGTTTC TTCACTCCCA
5,254,306 ACCCCAGTAT CTTCAAACAG
CTCACACCCT GCTGTGCTCA
GATCAATACT CAGTTGTCTA
AGTTGCCTCG AGACTAAAGG
CAACAGTGCT GAAACATCTC
CTGGACTCAC CTTGAAGTTC
TCAGG (SEQ ID NO:1130)
Chr 11 AGCCTGTGAG ATTGACAAGA Region 14: HBG2 Intron 1
(NC_000011.10): ACAGTTTGAC AGTCAGAAGG
5,254,511¨ TGCCACAAAT CCTGAGAAGC
5,254,648 GACCTGGACT TTTGCCAGGC
ACAGGGTCCT TCCTTCCCTC
CCTTGTCCTG GTCACCAGAG
CCTACCTTCC CAGGGTT (SEQ ID
NO:1131)
Chr 11 CCGCCGGCCC CTGGCCTCAC Region 15: HBG2 -60 nt region
(NC 000011.10): TGGATACTCT AAGACTAT (SEQ ID from TSS
5,254,829¨ NO:1132)
5,254,866
Chr 11 CCTTGTCAAG GCTATTGGTC Region 16: HBG2 -110 nt
(NC_000011.10): AAGGCAAGGC T (SEQ ID NO:1133) region from TSS
5,254,879 ¨
5,254,909
Chr 11 CAGGGACCGT TTCAGACAGA Region 17: HBG2 -200 nt
(NC_000011.10): TATTTGCATT GAGATAGTGT region from TSS
5,254,935 GGGGAAGGGG CCCCCAAGAG
5,255,009 GATACTGCTG CTTAA (SEQ ID
NO:1134)
Chr 11 TTGCCTTGTT CCGATTCAGT Region 18: HBG2 -250 nt
(NC_000011.10): CATTCCAAT (SEQ ID NO:1135) region from TSS
5,255,025 ¨
5,255,053
Chr 11 TTTAGCTAGT TTTCTTCTCC Region 19: HBG2 -330 nt
(NC_000011.10): CACCATAGAA GATACCAGGA region from TSS
5,255,076 ¨ CTTCTTTTGT CAGCCGTTTT
5,255,179 TCACCTTCTT GTCTGTAGCT
CCAGTGAGGC CTGTAGTTTA
AAGT (SEQ ID NO:1136)
Chr 11 GGACACGTCT TAGTCTCATT Region 20: HBG2 -500 nt
(NC_000011.10): TAGTAAGCAT TGGTTTCC (SEQ ID region from TSS
5,255,255 ¨ NO:1137)
5,255,292
Chr 11 TTTTTTATAT TCAGGTATGT Region 21: HBG2 -800 nt
(NC 000011.10): ATGTAGGCAC CCGATGATGT region from TSS
5,255,518¨ GTATTTATCA CTGGATAAGT
5,255,641 GTATGTGCTG GCTGATGACC
CAGGGTTTTG GTGTAGCTCT
TCTATGCTCG GTAAAGATGA TGGT
(SEQ ID NO:1138)
117
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
*NCBI Reference Sequence NC_000011, the coordinates are reported using the One-
based
coordinate system, "Homo sapiens chromosome 11, GRCh38.p12 Primary Assembly,"
(Version
NC_000011.10).
Table 12: Cpfl guide RNAs
gRNA Genomic
gRNA Targeting gRNA Targeting Genomic
targeting coordinates %
domain domain coordinates . Strand
domain at HbG2** Editing
sequence (RNA) sequence (DNA) at HbG1**
sequence ID*
AGACAGAUAU AGACAGATAT Chr 1 1:52549
AsCpfl HBG1 UUGCAUUGAG TTGCATTGAG Chrll :525002 48:5254967
5.43
Promoter-1 (SEQ ID (SEQ ID 4:5250043
NO:1139) NO:1140)
CAUUGAGAUA CATTGAGATA Chr 1 1:52549
AsCpfl HBG1 GUGUGGGGA GTGTGGGGAA Chrll :525003 61:5254980
8.30
Promoter-2 A (SEQ ID (SEQ ID 7:5250056
NO:1141) NO:1142)
UAGCCUUUGC TAGCCTTTGC Chr 1 1:52550
AsCpfl HBG1 CUUGUUCCGA CTTGTTCCGA Chrll :525009 19:5255038
0.23
Promoter-3 (SEQ ID (SEQ ID 1:5250110
NO:1143) NO:1144)
CCUUGUUCCG CCTTGTTCCG Chr 1 1:52550
AsCpfl HBG1 AUUCAGUCAU ATTCAGTCAT Chrll :525010 28:5255047
1.15
Promoter-4 (SEQ ID (SEQ ID 0:5250119
NO:1145) NO:1146)
UCUAAUUUAU TCTAATTTATT Chr 1 1:52550
AsCpfl HBG1 UCUUCCCUUU CTTCCCTTT Chrll :525013 59:5255078
0.16
Promoter-5 (SEQ ID (SEQ ID 1:5250150
NO:1147) NO:1148)
CUUCUCCCAU CTTCTCCCATC
AsCpfl HBG1 CAUAGAGGAU ATAGAGGAT Chrll :525016
12.73
Promoter-6 (SEQ ID (SEQ ID 1:5250180
NO:1149) NO:1150)
UUCUCCCACC TTCTCCCACC Chr 1 1:52550
AsCpfl HBG2 AUAGAAGAU ATAGAAGATA 90:5255109
8.11
Promoter-7 A (SEQ ID (SEQ ID
NO:1151) NO:1152)
CCACUGGAUA CCACTGGATA
AsCpfl HBG1 AGUGUGUGU AGTGTGTGTG Chrll :525063
13.33
Promoter-8 G (SEQ ID (SEQ ID 4:5250653
NO:1153) NO:1154)
GCGUAGCUCU GCGTAGCTCT
AsCpfl HBG1 UCUAUGCUCA TCTATGCTCA Chrll :525067
13.48
Promoter-9 (SEQ ID (SEQ ID 7:5250696
NO:1155) NO:1156)
CUGAGCAUAG CTGAGCATAG
AsCpfl HBG1 AAGAGCUACG AAGAGCTACG Chrll :525067
10.73
Promoter-10 (SEQ ID (SEQ ID 8:5250697
NO:1157) NO:1158)
AsCpfl HBG2 UCACUGGAUA TCACTGGATA Chr 1 1:52555
0.43
Promoter-11 AGUGUAUGU AGTGTATGTG 65:5255584
118
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
G (SEQ ID (SEQ ID
NO:1159) NO:1160)
GUGUAGCUCU GT GTAGCTCT
AsCpfl HBG2 UCUAUGCUCG TCTATGCTCG Chr 1 1:52556
5.78 +
Promoter-12 (SEQ ID (SEQ ID 08:5255627
NO:1161) NO:1162)
CCGAGCAUAG CCGAGCATAG
AsCpfl HBG2 AAGAGCUACA AAGAGCTACA Chr 1 1:52556
3.24 -
Promoter-13 (SEQ ID (SEQ ID 09:5255628
NO:1163) NO:1164)
CCUUGUCAAG CCTTGTCAAG Chr 1 1:52548
HBGI -1 GCUAUUGGUC GCTATTGGTC Chrll :524995 79:5254898
17.96 +
AsCpfl (SEQ ID (SEQ ID 5:5249974
NO:1002) NO:1003)
GACAGAUAUU GACAGATATT Chr 1 1:52549
AsCpfl RR
UGCAUUGAGA TGCATTGAGA Chrll :525002 49:5254968
HBGI 8.48 +
(SEQ ID (SEQ ID 5:5250044
Promoter-I
NO:1167) NO:1168)
ACACUAUCUC ACACTATCTC
AsCpfl RR
AAUGCAAAUA AATGCAAATA Chrll :525003 Chr 1 1:52549
HBGI 0.09 -
(SEQ ID (SEQ ID 1:5250050 55:5254974
Promoter-2
NO:1169) NO:1170)
CACACUAUCU CACACTATCT
AsCpfl RR
CAAUGCAAAU CAATGCAAAT Chrll :525003 Chr11:52549
HBGI 2.10 -
(SEQ ID (SEQ ID 2:5250051 56:5254975
Promoter-3
NO:1171) NO:1172)
CCACACUAUC CCACACTATC
AsCpfl RR
UCAAUGCAAA TCAATGCAAA Chrll :525003 Chr 1 1:52549
HBGI 2.52 -
(SEQ ID (SEQ ID 3:5250052 57:5254976
Promoter-4
NO:1173) NO:1174)
UUCCCCACAC TTCCCCACAC
AsCpfl RR
UAUCUCAAUG TATCTCAATG Chrll :525003 Chr 1 1:52549
HBGI 0.05 -
(SEQ ID (SEQ ID 7:5250056 61:5254980
Promoter-5
NO:1175) NO:1176)
GAUUCAGUCA GATTCAGTCA
AsCpfl RR
UUCCAGUUUU TTCCAGTTTT Chrll :525010
HBGI 0.77 +
(SEQ ID (SEQ ID 9:5250128
Promoter-6
NO:1177) NO:1178)
AUUCAGUCAU ATTCAGTCAT
AsCpfl RR
UCCAGUUUUU TCCAGTTTTT Chrll :525011
HBGI 0.24 +
(SEQ ID (SEQ ID 0:5250129
Promoter-7
NO:1179) NO:1180)
GUCAUUCCAG GTCATTCCAG
AsCpfl RR
UUUUUCUCUA TTTTTCTCTA Chrll :525011
HBGI 1.00 +
(SEQ ID (SEQ ID 5:5250134
Promoter-8
NO:1181) NO:1182)
AGUUUUUCUC AGTTTTTCTCT
AsCpfl RR
UAAUUUAUUC AATTTATTC Chrll :525012
HBGI 0.15 +
(SEQ ID (SEQ ID 3:5250142
Promoter-9
NO:1183) NO:1184)
GUUUUUCUCU GTTTTTCTCTA
AsCpfl RR
AAUUUAUUCU ATTTATTCT Chrll :525012
HBGI 0.15 +
(SEQ ID (SEQ ID 4:5250143
Promoter-10
NO:1185) NO:1186)
119
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
GAUUCAGUCA CAAGAGGATA
AsCpfl RR
UUCCAAUUUU CT GCT GCTTA Chr 11:52549
HBG2 *** +
(SEQ ID (SEQ ID 89:5255008
Promoter-11
NO:1187) NO:1188)
AUUCAGUCAU AAGAGGATAC
AsCpfl RR
UCCAAUUUUU TGCTGCTTAA Chr 11:52549
HBG2 *** +
(SEQ ID (SEQ ID 90:5255009
Promoter-12
NO:1189) NO:1190)
GUCAUUCCAA GATTCAGTCA
AsCpfl RR
UUUUUCUCUA TTCCAATTTT Chr 11:52550
HBG2 0.25 +
(SEQ ID (SEQ ID 37:5255056
Promoter-13
NO:1191) NO:1192)
AAUUUUUCUC ATTCAGTCAT
AsCpfl RR
UAAUUUAUUC TCCAATTTTT Chr 11:52550
HBG2 0.13 +
(SEQ ID (SEQ ID 38:5255057
Promoter-14
NO:1193) NO:1194)
AUUUUUCUCU GTCATTCCAA
AsCpfl RR
AAUUUAUUCU TTTTTCTCTA Chr 11:52550
HBG2 0.32 +
(SEQ ID (SEQ ID 43:5255062
Promoter-15
NO:1195) NO:1196)
UUCUCCCAUC AATTTTTCTCT
AsCpfl RR
AUAGAGGAU AATTTATTC Chr 11:52550
HBG2 0.14 +
A (SEQ ID (SEQ ID 51:5255070
Promoter-16
NO:1197) NO:1198)
AUCAUAGAGG ATTTTTCTCTA
AsCpfl RR
AUACCAGGAC ATTTATTCT Chr 11:52550
HBG2 0.10 +
(SEQ ID (SEQ ID 52:5255071
Promoter-17
NO:1199) NO:1200)
ACCAUAGAAG TTCTCCCATC
AsCpfl RR
AUACCAGGAC ATAGAGGATA Chrll :525016
HBG1 1.40 +
(SEQ ID (SEQ ID 2:5250181
Promoter-18
NO:1201) NO:1202)
CAGUACCUGC ATCATAGAGG
AsCpfl RR
CAAAGAACAU ATACCAGGAC Chrll :525016
HBG1 7.88 +
(SEQ ID (SEQ ID 9:5250188
Promoter-19
NO:1203) NO:1204)
UAGUAUCUGG ACCATAGAAG Chrl 1:52550
AsCpfl RR
UAAAGAGCAU ATACCAGGAC 97:5255116
HBG2 13.03 +
(SEQ ID (SEQ ID
Promoter-20
NO:1205) NO:1206)
UCAAUGCAAA CAGTACCT GC
AsCpfl RR
UAUCUGUCUG CAAAGAACAT Chrll :525071
HBG1 13.31 -
(SEQ ID (SEQ ID 4:5250733
Promoter-21
NO:1207) NO:1208)
CUCUUGGGGG TAGTATCTGG Chr 11:52556
AsCpfl RR
CCCCUUCCCC TAAAGAGCAT 45:5255664
HBG2 4.07 -
(SEQ ID (SEQ ID
Promoter-22
NO:1209) NO:1210)
GAUUCAGUCA TCAATGCAAA Chr 11:52549
AsCpfl RVR
UUCCAAUUUU TATCTGTCTG Chrll :525002 47:5254966
HBG1 0.15 -
(SEQ ID (SEQ ID 3:5250042
Promoter-1
NO:1211) NO:1212)
120
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
AUUCAGUCAU CTCTTGGGGG Chr11:52549
AsCpfl RVR
UCCAAUUUUU CCCCTTCCCC Chrll :525005 75:5254994
HBG1 1.09
(SEQ ID (SEQ ID 1:5250070
Promoter-2
NO:1213) NO:1214)
AAAAAAAUU AAAAAAATTA
AsCpfl RVR
AGCAGUAUCC GCAGTATCCT Chrll :525006
HBG1 ***
U (SEQ ID (SEQ ID 9:5250088
Promoter-3
NO:1215) NO:1216)
GCCUUUGCCU GCCTTTGCCTT Chr11:52550
AsCpfl RVR
UGUUCCGAUU GTTCCGATT Chr11:525009 21:5255040
HBG1 3.96
(SEQ ID (SEQ ID 3:5250112
Promoter-4
NO:1217) NO:1218)
AAAAAAAUU AAAAAAATTA Chr11:52549
AsCpfl RVR
AAGCAGCAGU AGCAGCAGTA 97:5255016
HBG2 ***
A (SEQ ID (SEQ ID
Promoter-5
NO:1219) NO:1220)
CUCAGUAAAG CTCAGTAAAG
AsCpfl RVR
AUGAUGGUA ATGATGGTAG Chrll :525069
HBG1 5.32
G (SEQ ID (SEQ ID 3:5250712
Promoter-6
NO:1221) NO:1222)
ACUGGAUAAG ACTGGATAAG Chr11:52555
AsCpfl RVR
UGUAUGUGCU TGTATGTGCT 67:5255586
HBG2 9.78
(SEQ ID (SEQ ID
Promoter-7
NO:1223) NO:1224)
UGCUGGCUGA TGCTGGCTGA Chr11:52555
AsCpfl RVR
UGACCCAGGG TGACCCAGGG Chrll :525065 83:5255602
HBG2 0.24
(SEQ ID (SEQ ID 2:5250671
Promoter-8
NO:1225) NO:1226)
CUCGGUAAAG CTCGGTAAAG
AsCpfl RVR
AUGAUGGUA ATGATGGTAG Chr11:52556
HBG2 5.75
G (SEQ ID (SEQ ID 24:5255643
Promoter-9
NO:1227) NO:1228)
UGGUAAAGA
AsCpfl RVR TGGTAAAGAG
GCAUUCUACC Chr11:52556
HBG2 CATTCTACCA 8.55
A (SEQ ID 38:5255657
Promoter-10 (SEQ ID
NO:1229)
NO:1230)
* the gRNA ID name provides the particular Cpfl molecule used in the RNP
complex
**NCBI Reference Sequence NC 000011, the coordinates are reported using the
One-based coordinate system,
"Homo sapiens chromosome 11, GRCh38.p12 Primary Assembly," (Version NC
000011.10).
*** represents gRNAs that were not tested.
[0379] RNPs (5 p,M) containing AsCpfl protein (SEQ ID NO:1000), AsCpfl RR
protein (SEQ ID
NO:1036), or AsCpfl RVR (SEQ ID NO:1037) complexed with single gRNAs
comprising gRNA
targeting domains from Table 12 (see gRNA ID name for the particular Cpfl
molecule used) were
delivered to mobilized peripheral blood (mPB) CD34+ cells using the Amaxa
electroporator device
(Lonza). After 72 hours, genomic DNA was extracted from cells and the level of
insertions /
deletions at the target site was then analyzed by Illumina sequencing (NGS) of
the PCR amplified
target site. The percentage of editing (indels= deletions and insertions) for
each gRNA is shown in
Table 12 above. In certain embodiments, Cpfl RNPs comprising one or more of
the gRNAs set forth
121
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
in Table 12 may be used to target the regions listed in Table 11 to induce HbF
expression and may be
co-delivered with a "booster element" to achieve higher editing levels
compared to the editing level of
the Cpfl RNP alone.
Example 9: Co-delivery of HBG1-1-Cpf1 RNP targeting the CCAAT box with ssODN
supports an
increase in gene editing in human hematopoietic stem/progenitor cells
[0380] A 100 nt ssODN generating the "18 nt deletion" (HBG A-104:-121) (i.e.,
ssODN 01116431
(SEQ ID NO:1040), Table 7) was co-delivered with Cpfl RNP to further
investigate the editing
outcome.
[0381] Briefly, human adult mPB CD34+ cells pre-stimulated for two days in
medium supplemented
with human cytokines were electroporated with RNP comprising the His-AsCpfl-
sNLS-sNLS H800A
protein (SEQ ID NO:1032, Table 8) complexed to modified HBG1-1 gRNA (SEQ ID
NO:1041,
Table 8) ("His-AsCpfl-sNLS-sNLS H800A_HBG1-1 RNP") either alone at 6 M or in
combination
with 01116431 (0.5 ¨6 M). Co-delivery of the RNP and ssODN donor encoding the
18 nt deletion
with positive strand homology arms (OLI16431) enhanced the editing frequency
from 8.0% without
donor to 75.6%, as determined by sequencing analysis of the HBG PCR product
from genomic DNA
extracted at 72 hours post-electroporation (Fig. 13A). This level of editing
enabled an increase in
HbF levels of ¨24% above background (Fig. 13A). Additionally, it should be
noted that there was no
decrease observed in cell viability (Fig. 13B) as measured by DAPI exclusion
or of colony forming
potential (Fig. 13C) at any of the doses tested.
Example 10: Optimization of HBG1-1-Cpf1 RNP and OLI16431 dosing to maximize
editing at the
RNP targeting distal CCAAT box site
[0382] Having demonstrated increased editing when co-delivering ssODN with RNP
(see, e.g.,
Example 9), the same methodology was used to optimize the dosing of each
component in order to
maximize total editing. Briefly, a dosing matrix was set up with RNP
comprising the His-AsCpfl-
sNLS-sNLS H800A protein (SEQ ID NO:1032, Table 8) complexed to unmodified HBG1-
1 gRNA
(SEQ ID NO:1022, Table 8) ("His-AsCpfl-sNLS-sNLS H800A_HBG1-1 RNP") being co-
delivered
at 0¨ 12 M with 01116431 (SEQ ID NO:1040, Table 7) at 0¨ 12 M. Using a dose
of 8 M His-
AsCpfl-sNLS-sNLS H800A_HBG1-1 RNP co-delivered with 8 M 01116431, a maximum
of 89.4%
indels was achieved when measured by sequencing analysis of the HBG PCR
product from genomic
DNA extracted from cells following 14 days erythroid culture (Fig. 14A). This
coincided with an
increase in HbF levels to >32% above background under these dosing conditions
(Fig. 14A). The
viability of this sample (His-AsCpfl-sNLS-sNLS H800A_HBG1-1 RNP [8 MI +
01116431 [8 M1)
was comparable to that of the untreated control sample at both 48 hours post
electroporation and after
14 days in erythroid culture (Fig. 14B).
122
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0383] However, an artifact was observed when > 8 laM OLI16431 was
electroporated into the cells
alone, without RNP. Under these conditions, there was a false positive result
when PCR
amplification was performed 48 hour post electroporation, likely due to
excessive ssODN within the
system (see Fig. 14A, 8 laM and 12 laM for 01116431 alone at 48 hours (black
bars)). At lower doses
of ssODN, and at later timepoints, this false positive was no longer apparent
(Fig. 14A, 4 laM and 6
laM for 01116431 alone at 48 hours (black bars) and 4 p,M, 6 p,M, 8 p,M, and
12 laM for 01116431
alone at 14 days (light grey bars)). In addition, the decrease in cell
viability observed with the ssODN
alone groups (Fig. 14B, dropping to ¨57% with 12 laM 01116431 alone at 48
hours (black bars)) may
be a compounding factor. That there was no false positive result at ssODN
doses of 4 laM and 6 laM
suggests that this artifact may be due to excessive ssODN. These factors,
along with the baseline HbF
levels observed with the 8 laM and 12 laM 01116431 alone groups (Fig. 14A,
grey dots as compared
to negative control), provide confidence that the substantial and sustained
boost in RNP editing with
the addition of ssODN is real and not an artifact.
Example 11: RNPs containing various Cpfl and gRNA targeting the HBG promoter
region support
gene editing in human hematopoietic stem/progenitor cells which promotes
induction of HbF protein
expression in the erythroid progeny
[0384] Guide RNAs comprising SEQ ID NOs:1022, 1023, 1041-1093, 1098-1106
(Table 13) were
complexed to various Cpfl variant enzymes (SEQ ID NOs:1032, 1094-1097, 1107-
1109, Table 14) to
form various RNP complexes (Table 15). The RNPs contained gRNAs with
modifications to the 5'
end and/or modifications to the 3' end of the gRNA (Table 13). Guide RNAs
comprising SEQ ID
NOs:1022, 1023, 1041-1084, 1098-1106 (Table 13) have the same expected
cleavage site at the distal
CCAAT box target region, the related targeting domains contain the sequences
set forth in SEQ ID
NO:1002 (HBG1-1), SEQ ID NO:1254 (HBG1-1 ¨ 21mer), SEQ ID NO:1256 (HBG1-1 ¨
22mer),
SEQ ID NO:1258 (HBG1-1 ¨ 23mer), for gRNA comprising a 20 mer, 21 mer, 22 mer,
or 23 mer
protospacer sequence respectively (Table 15, Table 16). In some cases gRNA
targeting other
positions within the HBG promoter were also tested, including guide RNAs SEQ
ID NOs:1085-1096,
comprising targeting domains containing the sequences set forth in SEQ ID
NOs:1260 (AsCpfl
HBG1 Promoter-1 (21mer)), SEQ ID NO:1262 (AsCpfl HBG1 Promoter-2 (21mer)) or
SEQ ID
NO:1264 (AsCpfl HBG1 Promoter-6 (21mer)) (Table 16, Table 17). Table 15
provides a listing of
each RNP tested in Examples 11-13 and the SEQ ID NO of the gRNA and the SEQ ID
NO of the
Cpfl variant that form each RNP complex. Additional information about each
gRNA and Cpfl
variant may be found in Table 13 and Table 14, respectively.
[0385] The gRNAs used in Examples 11 and 12 were chemically synthesized.
Chemicals for
oligonucleotide synthesis were purchased from BioAutomation, Glen Research,
Millipore Sigma,
Sigma-Aldrich, ChemGenes, and Thermo Fisher Scientific. The solid support used
for synthesis was
either a Unylinker 2000 A CPG resin, a 2'-TBDMS rU 2000 A CPG resin or a 2'-0-
methyl adenosine
123
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
(N-Bz) Icaa 2000 A CPG resin from ChemGenes. RNA (TBDMS-protected) and DNA
phosphoramidites were obtained from Thermo Fisher Scientific. In certain
embodiments,
phosphorothioates were introduced during a sulfurization step with a solution
of DDTT (3-
((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione) from Glen
Research.
Oligonucleotides were synthesized using standard RNA and DNA phosphoramidite
chemistry on
either a BioAutomation MerMade 12 synthesizer or on a GE Akta OligoPilot 100
synthesizer.
Following synthesis, the oligonucleotides were cleaved from the solid support
and deprotected in a
two-step process using ammonium hydroxide/methylamine and TEA-3HF. After
desalting, the
oligonucleotides were purified using reversed-phase chromatography on a
preparative HPLC.
[0386] First, the effect of editing using RNPs comprising gRNAs with
modifications to the 5' end of
the gRNAs was tested. Briefly, RNP complexes (6.0 ILtM and 12 p,M) were
delivered to 1 x 106mPB
CD34+ cells via MaxCyte electroporation, following 48 hours pre-stimulation in
X-Vivo 10 media
supplemented with SCF, TPO and FLT3. The level of insertions / deletions at
the target site was
analyzed by Illumina sequencing (NGS) of the PCR amplified target site at 72
hours after
electroporation. Results demonstrate that RNPs comprising gRNAs with no
modification (RNP33,
also referred to as "HBG1-1-AsCpfl RNP," Table 8) or modifications to the 5'
end of the gRNA
including the addition of 5 nt RNA (RNP37), 10 nt RNA (RNP38), 25 nt RNA
(RNP39), 60 nt RNA
(RNP40), 5 nt DNA (RNP41), 10 nt DNA (RNP42), 25 nt DNA (RNP43), and 60 nt DNA
(RNP44)
(Table 15) supports on-target editing (Fig. 15).
[0387] Next, the effect of co-delivery of Cpfl RNP with Sp182 dead RNP (dead
gRNA comprising
SEQ ID NO:1027 (Table 8) complexed with S. pyogenes Cas9 (SEQ ID NO:1033)) or
ssODN
01116431 (SEQ ID NO:1040, Table 7) was tested. Briefly, a dosing matrix with
RNP33 (no 5' or 3'
gRNA modification, Table 15) complexes at varying concentrations (6 p,M, 8
p,M, 8 p,M, and 12 p,M)
were co-delivered with Sp182 RNP (8 p,M, 8 p,M, 6 p,M, and 4 p,M) or ssODN
01116431 (8 p,M, 8
p,M, 6 p,M, and 4 p,M) to 5.25 x 106 mPB CD34+ cells via MaxCyte
electroporation, following 48
hours pre-stimulation in X-Vivo 10 media supplemented with SCF, TPO and FLT3.
Following
electroporation, cells were placed back to culture for a further 48 hours.
Then, a fraction of the CD34
cells were split for gDNA extraction and indel quantification in the bulk cell
population. In addition,
to investigate the editing in phenotypic progenitors and phenotypic
hematopoietic stem cells (HSCs),
HSPC subpopulations were characterized (amongst the remainder CD34 cells) by
immune-
phenotyping (Notta 2011) and separated by fluorescence Activated Cell Sorting
(FACS). Immune
phenotyping at 48 hours post electroporation was performed by staining cells
with antibodies against
hCD34, hCD38, hCD45RA, hCD90, and hCD123. Phenotypic HSCs were defined as
hCD34bright
hCD38 hCD90+ hCD45RA-, and progenitors were defined as hCD34bright CD38+.
These two
populations were sorted by FACS and DNA was extracted to determine the editing
levels in these
sub-populations. The level of insertions / deletions at the target site was
analyzed by Illumina
124
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
sequencing (NGS) of the PCR amplified target. Results demonstrate that RNP33
co-delivered with
the "booster elements" Sp182 RNP or ssODN 01116431 support on-target editing
(Figs. 16A-16B) at
levels higher than those observed when delivering RNP33 alone (Fig. 15).
[0388] Next, the effect of co-delivery of RNP33 (no 5' or 3' gRNA
modification, Table 15), RNP43
(+25 DNA 5' gRNA modification, Table 15) or RNP34 (1xPS2-0Me + lx0Me 3' gRNA
modifications, Table 15) with Sp182 dgRNA (Table 9) or ssODN 01116431 (Table
7) was tested.
Briefly, RNP33, RNP34, or RNP43 complexes (8 p,M) were co-delivered with Sp182
RNP (8 p,M) or
ssODN 01116431 (8 p,M) to 5.25 x 106 mPB CD34+ cells via MaxCyte
electroporation, following 48
hours pre-stimulation in X-Vivo 10 media supplemented with SCF, TPO and FLT3.
Following
electroporation, cells were placed back to culture for a further 48 hours
prior to sorting into
phenotypic progenitor and phenotypic HSC fractions for indel quantification.
The level of insertions /
deletions at the target site was analyzed by Illumina sequencing (NGS) of the
PCR amplified target
site at 48 hours after electroporation. Results demonstrate that RNPs
containing gRNAs with 5'
modification or 3' modifications co-delivered with the "booster elements"
Sp182 RNP or ssODN
01116431 support on-target editing (Figs. 17). Both booster elements tested
provided comparable
editing levels to RNP34 and RNP33. When compared to editing levels obtained
without the booster
element, while RNP33 editing was enhanced by both booster elements, RNP43
editing was however
only increased with the addition of Sp182 RNP (Figs. 15, 17).
[0389] Next the effect of different Cpfl proteins on RNP editing was tested. A
stoichiometric
comparison (gRNA:Cpfl) with RNPs comprising various Cpfl proteins was
performed. Briefly,
RNPs (RNP64, RNP63, RNP45, Table 15) were delivered at a stoichiometry
(gRNA:Cpfl
complexation ratio) of either 2 or 4, where the gRNA is in a molar excess. All
RNPs were delivered
via MaxCyte electroporation at 8 ILtM to 1 x 106CD34+ cells following 48 hours
pre-stimulation in X-
Vivo 10 media supplemented with SCF, TPO and FLT3. Following electroporation,
cells were placed
back to culture for a further 72 hours prior to indel quantification. Results
demonstrated that there
was no difference in editing rates with altered stoichiometry at the
concentration tested (Fig. 18).
RNP45 (comprising Cpfl protein SEQ ID NO:1094) outperforms RNP63 (comprising
Cpfl protein
SEQ ID NO:1095) and RNP64 (comprising Cpfl SEQ ID NO:1109).
[0390] Next, the effect of Sp182 RNP or ssODN 01116431 co-delivery with
various RNPs
containing different Cpfl proteins was tested. Briefly, RNPs (RNP33, RNP64,
RNP63, RNP45,
Table 15) were delivered alone or in combination with Sp182 RNP or ssODN
01116431. All
reagents were delivered via MaxCyte electroporation at 8 ILtM to 1 x 106CD34+
cells following 48
hours pre-stimulation in X-Vivo 10 media supplemented with SCF, TPO and FLT3.
Following
electroporation, cells were placed back to culture for a further 72 hours
prior to indel quantification.
Results indicate the "booster elements" Sp182 RNP or ssODN 01116431 enhanced
editing for all
RNPs tested (Fig. 19).
125
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
[0391] The effect of editing using RNPs containing gRNAs with various 5' DNA
extensions, or RNP
without a 5' DNA extension (RNP45) co-delivered with or without ssODN 01116431
was tested.
Briefly, following 48 hours pre-stimulation in X-Vivo 10 media supplemented
with SCF, TPO and
FLT3, RNPs (RNP45 (no 5' modification), RNP46, RNP47, RNP48, RNP49, RNP50,
RNP51,
RNP52, RNP53, RNP54, RNP55, RNP56, and RNP57, Table 15) at a concentration of
8 itM were
delivered alone or co-delivered with 8 itM ssODN OLI16431 via MaxCyte
electroporation to 1 x 106
CD34+ cells. Following electroporation, cells were placed back to culture
prior to indel
quantification. Results demonstrate that all RNPs support on-target editing
(Fig. 20).
[0392] The effect of editing using RNPs including gRNAs having the same 5' DNA
extension but
different 3' gRNA modifications was tested to assess the impact of 3' gRNA
modifications. Briefly,
RNPs comprising gRNAs with matched 5' ends, but different 3' gRNA
modifications (RNP49 vs.
RNP58 and RNP59 v. RNP60) were delivered at a concentration of 8 itM via
MaxCyte
electroporation to 1 x 106 CD34+ cells following 48 hours pre-stimulation in X-
Vivo 10 media
supplemented with SCF, TPO and FLT3. Following electroporation, cells were
placed back to culture
prior to indel quantification. In both comparisons, RNPs containing gRNA with
3' PS-0Me
outperformed the unmodified 3' version at 24h post electroporation (Fig. 21).
[0393] Next, different concentrations of Cpfl and gRNA for RNP58 were tested.
Briefly, RNP58
(+25 DNA 5' gRNA modification and 1xPS-0Me 3' gRNA modification, Table 15) was
delivered
via MaxCyte electroporation to 1 x 106 CD34+ cells following 48 hours pre-
stimulation at a
stoichiometry (gRNA:Cpfl complexation ratio) of either 2:1, 1:1 or 0.5:1 molar
ratios. Following
electroporation, cells were placed back to culture prior to indel
quantification. At all doses tested,
editing was best when RNP was complexed at a 2:1 ratio (Figs. 22A-22B).
[0394] The effect of editing using RNPs including gRNAs having the same 5' DNA
extension but
different 3' gRNA modifications was further tested to assess the impact of 3'
gRNA modifications.
Briefly, RNPs comprising gRNAs with matched 5' ends, but different 3' gRNA
modifications
(RNP58, RNP2, RNP3, RNP4, RNP5, RNP6, RNP7, RNP8, RNP9, RNP10) were delivered
at
varying concentrations (1 itM, 2 itM, 4 itM) via MaxCyte electroporation to 1
x 106 CD34+ cells
following 48 hours pre-stimulation. Following electroporation, cells were
placed back to culture prior
to indel quantification. Results indicate that all RNPs support on-target
editing (Figs. 23A-23B).
[0395] Next, editing by RNPs that include gRNAs with 3' gRNA modifications or
5' and 3'
modifications that target various regions of the HBG promoter were tested.
Those include guide
RNAs SEQ ID NOs :1085-1096, comprising targeting domains SEQ ID NOs:1260
(AsCpfl HBG1
Promoter-1 (21mer)), 1262 (AsCpfl HBG1 Promoter-2 (21mer)), 1264 (AsCpfl HBG1
Promoter-6
(21mer)) (Table 16, Table 17). Instead of the distal CCAAT box target region,
those gRNAs are
configured to provide an editing event within regions selected from Table 11.
Briefly, RNPs
including gRNAs containing an unmodified 5' gRNA and a 1xPS-0Me 3' gRNA
modification
126
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
(RNP11, RNP16, RNP19, and RNP22, Table 15), RNPs including gRNAs containing a
+20 DNA
+2xPS 5' gRNA modification and a 1xPS-0Me 3' gRNA modification (RNP12, RNP21,
and RNP24,
Table 15), RNPs including gRNAs containing a +25 DNA 5' gRNA modification and
a 1xPS-0Me
3' gRNA modification (RNP58 and RNP20, Table 15) were delivered at a
concentration of 8 itM via
MaxCyte electroporation to 1 x 106 CD34+ cells following 48 hours pre-
stimulation in X-Vivo 10
media supplemented with SCF, TPO and FLT3. Following the editing of mPB CD34+
cells, ex vivo
differentiation into the erythroid lineage was performed for 18 days
(Giarratana 2011), with gDNA
being isolated on day 14 of culture for indel analysis. Briefly, RNP was
delivered to CD34+ cells, as
described above. Following 48 hours recovery in X-Vivo 10 media supplemented
with SCF, TPO and
FLT3, the treated cells were counted and transferred to erythroid
differentiation media, with cell
counts and feeds occurring on days 4, 7, 10 and 14, with erythroid collection
at day 18. These CD34+
derived erythroid cells were then counted and lysed in HPLC grade water,
before filtering to removed
cell debris. Then, relative expression levels of gamma-globin chains (over
total beta-like globin
chains) was measured for each sample by UPLC, with protein separation being
achieved by gradually
increasing the ratio of acetonitrile with 0.1% trifluoroacetic acid, to water
with 0.1% trifluoroacetic
acid (Figs. 24A-24C). Figs 24A-24C showed all RNP supported on-target editing.
However only
editing at certain target sites give rise to increased HBF expression. The
same experiment was
performed with varying concentrations (0, 1 itM, 2 itM, 4 itM) of RNP58 (Fig.
25).
[0396] Next the effect of different Cpfl proteins on RNP editing was tested.
Briefly, RNP58,
RNP26, RNP27, and RNP28 (Table 15) including gRNAs comprising SEQ ID NO:1051
(+25 DNA
5' gRNA modification and a 1xPS-0Me 3' gRNA modification, Table 13) complexed
with varying
Cpfl proteins were delivered via MaxCyte electroporation at 8 itM to 1 x 106
CD34+ cells following
48 hours pre-stimulation in X-Vivo 10 media supplemented with SCF, TPO and
FLT3. Results
demonstrated that all RNPs support on-target editing (Fig. 26).
[0397] Next the effect of different RNPs containing gRNAs with various 5' gRNA
modifications and
the same 3' modification was tested. Briefly, RNPs (RNP58 (+25 DNA 5' gRNA
modification and a
1xPS-0Me 3' gRNA modification), RNP29 (+25 DNA + 2xPS 5' gRNA modification and
a 1xPS-
0Me 3' gRNA modification), RNP30 (PolyA RNA + 2xPS 5' gRNA modification and a
1xPS-0Me
3' gRNA modification), and RNP31 (PolyU RNA + 2xPS 5' gRNA modification and a
1xPS-0Me 3'
gRNA modification) (Table 15)) were delivered via MaxCyte electroporation at 1
itM, 2 itM, or 4
itM to 1 x 106 CD34+ cells following 48 hours pre-stimulation in X-Vivo 10
media supplemented
with SCF, TPO and FLT3 (RNP30 was not tested at 1 itM due to availability of
cells). Results
demonstrated that all RNPs support on-target editing (Fig. 27).
[0398] Next the effect of different Cpfl proteins on RNP editing was tested.
Briefly, RNP58,
RNP27, and RNP26 (Table 15) including gRNAs comprising SEQ ID NO:1051 (+25 DNA
5' gRNA
modification and a 1xPS-0Me 3' gRNA modification, Table 13) complexed with
varying Cpfl
127
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
proteins were delivered via MaxCyte electroporation at 2 ILtM or 4 ILtM to 1 x
106 CD34+ cells
following 48 hours pre-stimulation in X-Vivo 10 media supplemented with SCF,
TPO and FLT3. To
investigate the editing in bulk CD34, phenotypic progenitors, and phenotypic
hematopoietic stem
cells (HSCs), HSPC subpopulations were characterized. Thus, following
electroporation, cells were
placed back to culture for a further 48 hours prior to sorting into progenitor
and HSC fractions for
indel quantification. The level of insertions / deletions at the target site
was analyzed by Illumina
sequencing (NGS) of the PCR amplified target site at 48 hours after
electroporation. Results
demonstrated that all RNPs support on-target editing in bulk CD34, phenotypic
progenitors, and
phenotypic hematopoietic stem cells (Fig. 28).
[0399] Next, the effect of co-delivery of RNP with Sp182 RNP (dead gRNA
comprising SEQ ID
NO:1027 (Table 8) complexed with S. pyogenes Cas9 (SEQ ID NO:1033)) or ssODN
01116431
(SEQ ID NO:1040, Table 7) on RNP containing different Cpfl proteins was
tested. Briefly, RNP61,
RNP62, RNP34 (Table 15) were co-delivered at 8 ILtM with Sp182 RNP (8 p,M) or
ssODN 01116431
(8 p,M) to 25 x 106mPB CD34+ cells via MaxCyte electroporation, following 48
hours pre-
stimulation in X-Vivo 10 media supplemented with SCF, TPO and FLT3. To
investigate the editing
in bulk CD34, phenotypic progenitors, and phenotypic hematopoietic stem cells
(HSCs), HSPC
subpopulations were characterized. Thus, following electroporation, cells were
placed back to culture
for a further 48 hours prior to sorting into progenitor and HSC fractions for
indel quantification. The
level of insertions / deletions at the target site was analyzed by Illumina
sequencing (NGS) of the PCR
amplified target site at 48 hours after electroporation. Results demonstrate
that RNP co-delivered
with the "booster elements" Sp182 RNP or ssODN 01116431 support on-target
editing (Fig. 29). A
fraction of these cells were also cryopreserved 24 hours post electroporation
to be further
characterized in an in vivo engraftment model (see Example 12).
[0400] Next, the effect of RNP58 and RNP32 editing was tested. Briefly, RNP58
and RNP32 (Table
15) were delivered at 2 ILtM to 6 x 106mPB CD34+ cells via MaxCyte
electroporation, following 48
hours pre-stimulation in X-Vivo 10 media supplemented with SCF, TPO and FLT3.
To investigate
the editing in bulk CD34, phenotypic progenitors, and phenotypic HSCs, HSPC
subpopulations were
characterized. Thus, following electroporation, cells were placed back to
culture for a further 48
hours prior to sorting into progenitor and HSC fractions for indel
quantification. The level of
insertions / deletions at the target site was analyzed by Illumina sequencing
(NGS) of the PCR
amplified target site at 48 hours after electroporation. Results demonstrate
that RNP58 and RNP32
support on-target editing (Fig. 30).
[0401] RNP58 and RNP1 (Table 15) were delivered at concentrations of 2 ILtM to
8 ILtM to 25 x 106
mPB CD34+ cells via MaxCyte electroporation, following 48 hours pre-
stimulation in X-Vivo 10
media supplemented with SCF, TPO and FLT3. To investigate the editing in bulk
CD34, phenotypic
progenitors, and phenotypic hematopoietic stem cells (HSCs), HSPC
subpopulations were
128
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
characterized. Thus, following electroporation, cells were placed back to
culture for a further 48
hours prior to sorting into progenitor and HSC fractions for indel
quantification. The level of
insertions / deletions at the target site was analyzed by Illumina sequencing
(NGS) of the PCR
amplified target site at 48 hours after electroporation. Results demonstrate
that the RNP tested
support on-target editing (Fig. 31). A fraction of these cells were also
cryopreserved 24 hours post
electroporation for further characterized in an in vivo engraftment model (see
Example 12).
Example 12: Infusion of edited mPB CD34+ cells into NOD,B6.SCID Il2ry-/-
Kit(W41/W41) mice
results in long term engraftment and HbF induction
[0402] To determine whether delivery of RNP34 and RNP33 (Table 15) co-
delivered with ssODN
01116431 (SEQ ID NO:1040, Table 7) achieves edits in long term repopulating
hematopoietic stem
cells, human adult CD34+ cells from mobilized peripheral blood (mPB) were
infused into
nonirradiated NOD,B6.SCID Il2ry-/- Kit(W41/W41) (Jackson lab stock name:
NOD.Cg-Kit<W-41J>
Tyr<+> Prkdc<scid> Il2rg<tmlWjl>/ThomJ) ("NBSGW") mice. Briefly, mPB CD34+
cells at 62.5 x
106/mL were electroporated via MaxCyte electroporation with RNP at a dose of 8
laM and 6 laM
ssODN OLI16431 following 48 hours pre-stimulation in X-Vivo 10 media
supplemented with SCF,
TPO and FLT3. After 24 hours, mCD34+ cells were cryopreserved. Five days
later, mPB CD34+
cells were thawed and infused into NBSGW mice at 1 million cells per mouse via
intravenous tail
vein injection. Eight weeks later, mice were euthanized and bone marrow (BM)
was collected from
femurs, tibias, and pelvic bones. Bone marrow sub-populations of cells
respectively identified as
CD15+, CD19+, glycophorin A (GlyA, CD235a+), and lineage-negative CD34+ were
isolated by
FACS, and DNA was extracted to determine the editing levels in each of these
fractions. Fig. 32
depicts the frequency of indels, as determined by next generation sequencing,
of unfractionated BM,
or flow-sorted individual BM sub-populations.
[0403] Next, to determine whether delivery of RNP34 or RNP33 (Table 15) co-
delivered with Sp182
RNP (dead gRNA comprising SEQ ID NO:1027 (Table 8) complexed with S. pyogenes
Cas9 (SEQ
ID NO:1033)) achieves edits in long term repopulating hematopoietic stem
cells, human adult CD34+
cells from mobilized peripheral blood (mPB) were infused into nonirradiated
NBSGW mice. Briefly,
mPB CD34+ cells at 62.5 x 106/mL were electroporated via MaxCyte
electroporation with RNP at
varying doses and varying doses of Sp182 RNP following 48 hours pre-
stimulation in X-Vivo 10
media supplemented with SCF, TPO and FLT3. After 24 hours, mCD34+ cells were
cryopreserved.
Five days later, mPB CD34+ cells were thawed and infused into NBSGW mice at 1
million cells per
mouse via intravenous tail vein injection. Eight weeks later, mice were
euthanized and bone marrow
(BM) was collected from femurs, tibias, and pelvic bones. Bone marrow sub-
populations of cells
respectively identified as CD15+, CD19+, glycophorin A (GlyA, CD235a+), and
lineage-negative
CD34+ were isolated by FACS, and DNA was extracted to determine the editing
levels in each of
129
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
these fractions. Fig. 33A depicts the frequency of indels, as determined by
next generation
sequencing, of unfractionated BM, or flow-sorted individual BM sub-
populations.
[0404] Lastly, long term HbF induction by BM-derived CD34+ cells was analyzed.
An aliquot of
BM cells were cultured under erythroid differentiation conditions for 18 days
(Giarratana 2011), and
evaluated for HbF expression by UPLC. Briefly, unfractionated BM cells
extracted from mice 8
weeks after infusion were placed in erythroid culture conditions for 18 days.
Cell counts and feeds
occurred on days 7, 10 and 14, with erythroid collection at day 18. These bone
marrow derived
erythroid cells were then counted and lysed in HPLC grade water before
filtering to removed cell
debris. Then, relative expression levels of gamma-globin chains (over total
beta-like globin chains)
was measured for each sample by UPLC, with protein separation being achieved
by gradually
increasing the ratio of acetonitrile with 0.1% trifluoroacetic acid, to water
with 0.1% trifluoroacetic
acid (Fig. 33B). These data demonstrate that robust long-term HbF induction is
achieved by RNP34
and RNP33 co-delivered with Sp182 RNP editing of human CD34+ cells.
[0405] Next, to determine whether delivery of RNP61 or RNP62 (Table 15) co-
delivered with
ssODN 01116431 (SEQ ID NO:1040, Table 7) achieves edits in long term
repopulating
hematopoietic stem cells, human adult CD34+ cells from mPB were infused into
nonirradiated
NBSGW mice. Briefly, mPB CD34+ cells at 62.5 x 106/mL were electroporated via
MaxCyte
electroporation with 8 ILtM RNP and 8 ILtM ssODN 01116431 following 48 hours
pre-stimulation in
X-Vivo 10 media supplemented with SCF, TPO and FLT3. After 24 hours, mCD34+
cells were
cryopreserved. Four days later, mPB CD34+ cells were thawed and infused into
NBSGW mice at 1
million cells per mouse via intravenous tail vein injection. Eight weeks
later, mice were euthanized
and bone marrow (BM) was collected from femurs, tibias, and pelvic bones. Bone
marrow sub-
populations of cells respectively identified as CD15+, CD19+, glycophorin A
(GlyA, CD235a+), and
lineage-negative CD34+ were isolated by FACS, and DNA was extracted to
determine the editing
levels in each of these fractions. Fig. 34A depicts the frequency of indels,
as determined by next
generation sequencing, of unfractionated BM, or flow-sorted individual BM sub-
populations.
[0406] Lastly, long term HbF induction by BM-derived CD235a+ (GlyA+) erythroid
cells was
analyzed. An aliquot of BM cells were cultured under erythroid differentiation
conditions for 18 days
and evaluated for HbF expression by UPLC. Briefly, unfractionated BM cells
extracted from mice 8
weeks after infusion were placed in erythroid culture conditions for 18 days.
Fig. 34B depicts the
HbF expression, calculated as gamma/beta-like chains (%) by erythroid cells.
These data demonstrate
that robust long-term HbF induction is achieved by RNP61 and RNP62 co-
delivered with ssODN
01116431 editing of human CD34+ cells.
[0407] Next, to determine whether delivery of RNP1 or RNP58 (Table 15)
achieves edits in long
term repopulating hematopoietic stem cells, human adult CD34+ cells from mPB
were infused into
nonirradiated NBSGW mice. Briefly, mPB CD34+ cells at 62.5 x 106/mL were
electroporated via
130
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
MaxCyte electroporation with 4 ILtM or 8 ILtM RNP1 or 2 p,M, 4 p,M, or 8 ILtM
RNP58 following 48
hours pre-stimulation in X-Vivo 10 media supplemented with SCF, TPO and FLT3.
After 24 hours,
mCD34+ cells were cryopreserved. Four days later, mPB CD34+ cells were thawed
and infused into
NBSGW mice at 1 million cells per mouse via intravenous tail vein injection.
Eight weeks later, mice
were euthanized and bone marrow (BM) was collected from femurs, tibias, and
pelvic bones. Human
chimerism and lineage reconstitution (CD45+, CD14+, CD19+, glycophorin A
(GlyA, CD235a+),
lineage, and CD34+, and mouse CD45+ marker expression) in BM was determined by
flow cytometry
and analyzed (Fig. 35). The frequency of GlyA+ cells was calculated as GlyA+
cells/total cells in
BM. Human chimerism was defined as human CD45/(human CD45+mCD45).
[0408] Similar chimerism and lineage distributions were achieved 8-weeks post-
transplant by RNP-
transfected mPB CD34+ cells compared to mock-transfected mPB CD34+ cells
demonstrating that
editing is comparable with retaining the engraftment potential of
hematopoietic stem cells. Fig. 36
depicts the indels, as determined by next generation sequencing, of
unfractionated BM, at 8 weeks
post-infusion. Fig. 37 shows the frequency of indel rate in BM, CD15+, CD19+,
glycophorin A
(GlyA, CD235a+), and lin-CD34+ cells with 2 p,M, 4 p,M, or 8 ILtM of RNP58.
[0409] Long term HbF induction by CD235a+ (GlyA+) erythroid cells, derived
from edited CD34+
cells was also analyzed. GlyA+ cells obtained from bone marrow, were isolated
by fluorescence
Activated Cell Sorting (FACS), collected and lysed in HPLC grade water.
Lysates were then
evaluated for HbF expression by UPLC. Fig. 38 depicts the HbF expression,
calculated as
gamma/beta-like chains (%) by GlyA+ cells. These data demonstrate that robust
long-term HbF
induction is achieved RNP58 editing of human CD34+ cells at various RNP58
concentrations.
[0410] Importantly, CD34+ cells that were electroporated with varying
concentrations of RNP1 or
RNP58 maintained their ex vivo hematopoietic activity (i.e., no difference in
the quantity or diversity
of erythroid and myeloid colonies compared to untreated donor matched CD34+
cell negative control),
as determined in hematopoietic colony forming cell (CFC) assays (Fig. 39).
Example 13: NHEJ mediated deletions of 4 nucleotides or larger at the distal
CCAAT box region of
HBG promoter are maintained long-term and promote elevated HbF expression.
[0411] Delivery of RNP containing the Cas9 or Cpfl enzyme targeting the HBG
promoter region
(Fig. 41A) results in the generation of a multitude of insertions and
deletions (indels). These include
indels derived from microhomology mediated end joining (MMEJ) and non-
homologous end joining
(NHEJ) repair mechanisms. As shown below, the MMEJ repair mechanism is not
well utilized during
editing of the long-term stem cell population (HSC) and this type of edit is
lost over time.
[0412] Briefly, mPB CD34+ cells at 62.5 x 106/mL were electroporated via
MaxCyte electroporation
with Sp35 RNP following 48 hours pre-stimulation in X-Vivo 10 media
supplemented with SCF, TPO
and FLT3. Sp35 RNP comprises 5p35 gRNA (comprising the targeting domain of SEQ
ID NO:339
(i.e., CUUGUCAAGGCUAUUGGUCA (RNA)); SEQ ID NO:917 (i.e.,
131
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
CTTGTCAAGGCTATTGGTCA (DNA)) complexed with S. pyogenes wildtype (Wt) Cas9
protein.
After 24 hours, an aliquot of mPB CD34+ cells was collected for pre-infusion
(CD34) indel analysis,
another aliquot was placed in erythroid differentiation for indel analysis in
the progeny of erythroid
progenitors. The rest of the cells were cryopreserved and stored in liquid
nitrogen until the initiation
of the engraftment study. At the time of infusion, mPB CD34+ cells were thawed
and infused into
nonirradiated NOD,B6.SCID Il2ry-/- Kit(W41/W41) (Jackson lab stock name:
NOD.Cg-Kit<W-41J>
Tyr<+> Prkdc<scid> Il2rg<tm1Wjl>/ThomJ) ("NBSGW") mice at 1 million cells per
mouse via
intravenous tail vein injection. Sixteen weeks later, mice were euthanized and
bone marrow (BM)
was collected from femurs, tibias, and pelvic bones and lineage-negative CD34+
were isolated by
FACS, and DNA was extracted from cells collected at pre-infusion, in their
erythroid progeny
(derived in vitro) and in cells collected at 16 weeks in vivo to determine the
indels
(insertions/deletions) using the following primers: Forward =
CATGGCGTCTGGACTAGGAG (SEQ
ID NO:1266) and Reverse = AAACACATTTCACAATCCCTGAAC (SEQ ID NO:1267). The read
sequence surrounding every detected deletion was analyzed to identify whether
it was likely the result
of DSB repair by MMEJ or NHEJ pathways. MMEJ is distinguished from NHEJ by its
use of
microhomology sequences. MMEJ repair relies on strand resection and annealing
of proximally
located repeated stretches of nucleotides (microhomologies), surrounding the
DSB. The resulting
deletion removes one of the microhomology sequences together with the entire
intervening sequence
between the two microhomologies. Thus, probable MMEJ-mediated deletion can be
identified by
searching for the presence of a nucleotide sequence at either end of the
deleted sequence that is
repeated in the region immediately flanking the other end of the deletion.
Based on this, deletions
were classified as "MMEJ" if stretches of 2 base pairs (bp) or more were
detected at the deletion
boundary and repeated in the region immediately flanking the other end of the
deletion. All other
deletions were classified as NHEJ.
[0413] Prior to infusion, ¨30% of indels were derived from MMEJ repair (Fig.
41B, CD34, black
striped bar = MMEJ, white bar = NHEJ). In erythroid progenitors (based on
indels detected after
erythroid differentiation of CD34 cells), MMEJ indels represented ¨36% of
indels (Fig. 41B, Prog,
black striped bar = MMEJ, white bar = NHEJ). Following 16 weeks engraftment,
the majority of the
MMEJ indels were lost (Fig. 41B, HSC, black striped bar = MMEJ, white bar =
NHEJ) with the
NHEJ derived edits being maintained. This observation has also been observed
by others (Bauer
2019, Wu 2019, Weber 2020), and does not appear to be site specific. It was
attributed to the
transition from a predominant population of actively cycling, and MMEJ-prone
short-lived
progenitors that constitute most of the CD34+ cells pre-infusion, to the
output of more quiescent (and
less MMEJ-prone) self-renewing hematopoietic stem cells (HSCs) at later
timepoints in vivo. While
HSCs provide hematopoietic reconstitution post-engraftment long-term, they
represent a very rare
population within the CD34+ bulk population pre-infusion. This finding
highlights the need to use an
132
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
editing tool that generates HbF-inducing indels through NHEJ-mediated repair
rather than MMEJ
repair to achieve durable HbF expression.
[0414] In addition, genotype to phenotype analysis at the distal CCAAT-box
region of
the HBG1/2 promoters identified mutations leading to most elevated HbF
expression. A single cell
experiment was performed to evaluate the distribution of gamma chain
expression levels in erythroid
cells derived from mPB CD34+ cells edited at the distal CCAAT box region.
Indels were generated
at this site using either Sp35 RNP or RNP34 (Table 15) + Sp182-Cas9-RNP (Fig.
5F, Table 8).
Briefly, mPB CD34+ cells at 6.25 x 106/mL (100 1) were electroporated via
MaxCyte electroporation
with 4 laM Sp35 RNP or 8 laM HBG1-1-AsCpf1H800A-RNP co-delivered with 8 laM
Sp182-Cas9-
RNP (all RNPs at a molar ratio of 4:1 gRNA:RNA guided nuclease) following 48
hours pre-
stimulation in X-Vivo 10 media supplemented with SCF, TPO and FLT3. Sp35 RNP
comprises Sp35
gRNA (comprising the targeting domain of SEQ ID NO:339 (i.e.,
CUUGUCAAGGCUAUUGGUCA
(RNA)); SEQ ID NO:917 (i.e., CTTGTCAAGGCTATTGGTCA (DNA)) complexed with S.
pyogenes wildtype (Wt) Cas9 protein. RNP34 comprises HBG1-1-AsCpf1H800A-RNP
(composed of
His-AsCpfl-sNLS-sNLS-H800A (SEQ ID NO:1032) complexed to HBG1-1 gRNA with a 3'
modification as shown in Table 8 (SEQ ID NO:1041)). After being left to
recover for 48 hours post-
electroporation, the cells were sorted by Fluorescence Activated Cell Sorting
(FACS) at 1-cell / well
in non-tissue culture treated 384-well plates. The cells were then
differentiated and expanded clonally
for 18 days into the erythroid lineage (adapted from Giarratana 2011). UPLC
analysis was performed
to determine the distribution of G-gamma chain expression levels (percentage
of G-gamma/[total
beta-like chains]) in the clonal erythroid progeny of cells derived from the
total population of mPB-
CD34+ cells initially edited. Sequencing analysis (allele identification and
detection of indels using
the following primers: Forward = CATGGCGTCTGGACTAGGAG (SEQ ID NO:1266) and
Reverse
= AAACACATTTCACAATCCCTGAAC (SEQ ID NO:1267)) and ddPCR (loss of 4.9kb fragment
deleting g-Gamma coding sequence) was performed on gDNA from an aliquot of
each clonal culture
collected on day 14, prior to enucleation, and enabled identification of
clones containing only one
allele coding for G-gamma, in association with a specific indel. Indels
disrupting more than 3
nucleotides were generally associated with more elevated HbF expression
compared to smaller indels
(Fig. 41C). This finding highlights that using an editing tool that generates
larger deletions at the
distal CCAAT box region will provide more elevated levels of HbF expression,
likely by more
effectively disrupting the binding at this site of regulatory factors
repressing HBG expression.
Notably, most of the larger deletions evaluated were detected in clones
derived from the CD34 cells
edited with the Cpfl RNP, while most of the smaller deletions evaluated were
detected from clones
derived from the CD34 cells edited with the Cas9 RNP (Fig. 41D), suggesting
that larger indels occur
more frequently with the Cpfl, leading to a potentially higher fraction of
cells with elevated HbF in
the erythroid progeny of CD34 cells edited with Cpfl compared to Cas9.
Consistent with this result,
133
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
distribution of gamma chain expression levels (percentage of gamma
chains/[total beta-like chains])
in the clonal erythroid progeny of cells derived from the total population of
mPB-CD34+ cells
initially edited by either the Cpfl or Cas9 RNP showed a higher frequency of
cells with high HbF in
the Cpfl sample compared to the spCas9 sample (Fig. 41E). Of the clones
analyzed derived from the
CD34+ cells edited with the Cpfl RNP, 83.1% had gamma chains levels above the
median level
detected in erythroid clones derived from mock electroporated mPB CD34+ cells
(median value =
18.8%), 64.2% had gamma chains levels exceeding 30% of total beta-like and
35.8% had gamma
chains levels exceeding 48.8% of total beta-like (30% +18.8% median level in
control cells). Of the
clones analyzed derived from the CD34+ cells edited with the Cas9 RNP, 71.4%
had gamma chains
levels above the median level detected in erythroid clones derived from mock
electroporated mPB
CD34+ cells (median value = 18.8%), 49.5% had gamma chains levels exceeding
30% of total beta-
like and 23.1% had gamma chains levels exceeding 48.8% of total beta-like (30%
+18.8% median
level in control cells).
Example 14: Cpfl RNP targeting the distal CCAAT box region of the HBG promoter
is efficient at
generating durable NHEJ mediated deletions of 4 nucleotides or larger
[0415] RNP, consisting of guide RNA targeting the distal CCAAT box region of
the HBG promoter
complexed with either Cpfl or Cas9 enzyme was electroporated into mobilized
peripheral blood
(mPB) derived CD34+ cells using the MaxCyte GT (MaxCyte, Inc.) electroporation
device. Briefly,
mPB CD34+ cells at 62.5 x 106/mL were electroporated with 4 laM Sp35 RNP (at a
molar ratio of 2:1
gRNA:RNA-guided nuclease) or 8 laM RNP58 (Table 15) (at a molar ratio of 4:1
gRNA:RNA-guided
nuclease) following 48 hours pre-stimulation in X-Vivo 10 media supplemented
with SCF, TPO and
FLT3. Sp35 RNP comprises Sp35 gRNA (comprising the targeting domain of SEQ ID
NO:339 (i.e.,
CUUGUCAAGGCUAUUGGUCA) (RNA)); SEQ ID NO:917 (i.e.,
CTTGTCAAGGCTATTGGTCA) (DNA)) complexed with S. pyogenes wildtype (Wt) Cas9
protein.
[0416] The level and profile of insertions / deletions at the target site was
analyzed 24 hours after
electroporation. The fraction of small indels present in the samples was
assessed by Illumina
amplicon sequencing (ILL-seq), following library preparation method and
analysis. A 15 bp window
around the expected cut site was used in the analysis to calculate editing
rates. The oligonucleotides
and amplicon used to generate the targeted amplicon sequencing products are
provided in Fig. 55A
and Fig. 55B.
[0417] To characterize editing by RNP32, the indels generated in each sample
were analyzed and
processed. The results were summarized by looking at 1) percentage deletion
for each base within the
target region, 2) distribution of insertion and deletion center positions, and
3) distribution of insertion
and deletion lengths. To perform these analyses, the cigar strings for the
reads in the alignment bam
files were processed, using the following steps:
1) Group indels appearing in the same read.
134
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
2) Create indel id for indels from each read. Indel =id is a string
identifying the indel, shown as
indel_start_position + _ + indeliength + _ + ID. Where ID is NA for deletions
and for insertions
is the sequence inserted. See example in Fig. 55D.
3) Group reads with the same indel
4) Count number of reads with the same indels and calculate their total
fractions (including wt) and
fractions in indels (excluding wt). Fractions in indels allow for a comparison
between samples
when they have different amounts of total editing.
[0418] Deletions were classified as "MMEJ" if stretches of 2 base pairs or
more were deletion
boundary and repeated in the region immediately flanking the other end of the
deletion. All other
deletions were classified as NHEJ. Table 24 shows the indels detected in the
samples edited by
RNP58 or 5p35 RNP.
[0419] Delivery of RNP containing the Cas9 or Cpfl enzyme targeting the HBG
promoter region
(Fig. 41A) results in the generation of a multitude of insertions and
deletions (indels). Different
enzymes have different mechanistic properties; including relative to their
engagement with the DNA
target site and their cleavage activity, and leave different DNA ends that
impact the repair outcome
(Sternberg 2014, Strohkendl 2018, Swarts 2018). Notably, Cpfl editing results
in a four nucleotide 5'
overhang, which is quite different from the blunt ends of SpCas9 edits (see
Fig. 41A).
Evaluation of the editing profile mediated by a Cpfl and Cas9 RNP targeting
the distal box (RNP58
and Sp35RNP, respectfully) showed that indels generated by both enzymes were
generally centered at
the distal CCAAT box region (Fig. 4211), and the most commonly deleted base
was at position TSS:-
113 for both RNPs (Fig. 42E and 42F). However, evaluation of individual
indels, as defined by their
position relative the HBG-TSS, length, and sequence in the case of insertions,
demonstrates
differences in the editing outcome after editing this site with the SpCas9 or
Cpfl RNP. Figs. 42C and
42D show the top 20 indels generated by the Cpfl and Cas9 RNP, respectively.
The most abundant
indel generated by Cas9 was the MMEJ-meditated 13 bp deletion 157_-13_NA
(HBG1/2 c.-102 to -
114, Table 24), more commonly known as the 13 bp HPFH deletion, detected at
31.88% in the Cas9
sample compared to 3.36% in the Cpfl sample (Figs. 42D and 42C, respectively).
The most
abundant indel generated by Cpfl, was the MMEJ mediated 18 nt deletion 159_-
18_NA (HBG1/2 c.-
104 to -121, Table 24), which was detected at 18.53% in the Cpfl sample
compared to 1.35% in the
Cas9 sample (Figs. 42C and 42D, respectively). The five most common NHEJ
indels detected in
each sample were deletions of 3 to 7 bp in length for the Cpfl sample and were
deletions of 1 to 4 bp
and a 1 bp insertion for Cas9 (Figs. 42C and 42D, respectively). The full list
of indels detected at >
0.1% in any of the two samples is shown in Table 24.
[0420] While most indels detected at > 0.1% in any of the two samples were
also detected in the
other sample (above or below 0.1%), their relative frequencies amongst all
indels were different
depending on the enzyme (Table 24 and Fig. 421). Notably, insertions were
detected at 14.09% in the
135
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Cas9 (Sp35 RNP) sample but were rarely detected in the Cpfl (RNP58) sample
(0.47 %). Also,
larger indels were enriched in CD34 cells edited with the Cpfl RNP (RNP58)
compared to the Cas9
RNP (Sp35 RNP) (Fig. 42J). Fig. 42G shows the distribution of indel length
generated by each RNP,
and Fig. 42A shows the distribution of indel length generated by each RNP for
indels categorized as
NHEJ-mediated. Most indels generated by Cpfl were larger than 3 bp (Fig. 42G),
which was shown
to be associated with more elevated HbF in erythroid cells (Fig. 41C). Cas9
also generated deletions
larger than 3 bp, however, those were primarily generated via the MMEJ repair
pathway, which are
expected to be less frequently observed in vivo after infusion, as this repair
pathway is poorly utilized
by the rare population of HSC within the CD34+ cells. NHEJ is the major repair
pathway utilized by
HSC (Fig. 41B), thus evaluation of the NHEJ-mediated indel profile provides
information on the type
of indels that are expected to be maintained in vivo at long-term after
infusion of CD34+ cells.
[0421] When compared to Cas9 RNP (Sp35 RNP), the Cpfl RNP (RNP58) showed a
shift to larger
NHEJ mediated indels (Fig. 42A), with the most commonly observed NHEJ indel
length being 1 bp
for Cas9 compared to 5 bp for Cpfl, indicating a more favorable CD34+ cells
editing profile by Cpfl
for both robust and durable induction of HbF.
[0422] The percentage of > 3 bp NHEJ mediated indels, > 3 bp MMEJ mediated
indels, and < 3 bp
indels at the distal CCAAT box resulting from editing by RNP58 (Cpfl) or Sp35
RNP (Cas9) is
shown in Fig. 42B (indels generated by SpCas9 (left pie chart): NHEJ > 3 bp =
21.42%; < 3 bp =
48.84%; MMEJ > 3 bp = 29.74%; indels generated by RNP58 (right pie chart):
NHEJ > 3 bp =
64.86%; < 3 bp = 11.11%; MMEJ > 3 bp = 24.02%). Cas9 (Sp35 RNP)-edited cells
comprised a
large fraction of small indels less than 3 bp in length, and indels> 3 bp in
length (associated with
highest levels of HbF) were largely mediated by the MMEJ pathway (Fig. 42B).
Instead, close to
90% of indels mediated by Cpfl (RNP58) were > 3 bp in length, approximately
two third of those
mediated by NHEJ (Fig. 42B), suggesting that the high fraction of indels > 3
bp in length is expected
to be maintained at long term in vivo, and the ratio of MMEJ-mediated indels
is reduced in favor of
NHEJ-mediated indels (Fig. 41B). Taken together, this highlights that the most
durable NHEJ
mediated indels are productive (>3 bp) with RNP58, whereas Sp35 RNP produces a
much lower
fraction of productive indels, many of which are not durable (MMEJ meditated).
This demonstrates
that RNP58 is an advantageous editing tool that generates HbF-inducing indels
through NHEJ-
mediated repair rather than solely via MMEJ repair to achieve durable HbF
expression.
Example 15: Infusion of RNP32 edited mPB CD34+ cells into NOD,B6.SCID Il2ry-/-
Kit
(W41/W41) mice results in long term engraftment, indel maintenance, and high
HbF induction
[0423] To determine whether RNP32 achieves edits in long term repopulating
hematopoietic stem
cells, human adult CD34+ cells from mobilized peripheral blood (mPB) were
infused into
nonirradiated NOD,B6.SCID Il2ry-/- Kit(W41/W41) (Jackson lab stock name:
NOD.Cg-Kit<W-41J>
Tyr<+> Prkdc<scid> Il2rg<tmlWjl>/ThomJ) ("NBSGW") mice. Briefly, mPB CD34+
cells at 62.5 x
136
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
106/mL were electroporated via MaxCyte electroporation with 6 laM RNP32 (Table
15) (at a molar
ratio of 2:1 gRNA:RNA guided nuclease) or buffer only ("Mock") following 48
hours pre-stimulation
in X-Vivo 10 media supplemented with SCF, TPO and FLT3. After a further 24
hours, mCD34+
cells were cryopreserved. A portion of the cells was placed in in vitro
culture for up to 72h post-
electroporation and gDNA collected every day for indel analysis. On the day of
infusion, mPB
CD34+ cells were thawed and infused into NBSGW mice at 1 million cells per
mouse via intravenous
tail vein injection. Sixteen weeks later, mice were euthanized and bone marrow
(BM) was collected
from femurs, tibias, and pelvic bones.
[0424] Genomic DNA was isolated from both the pre-infused CD34+ cells (24-72
hours post
electroporation) and from the bone marrow following 16 weeks engraftment. At
24 hours post
electroporation, approximately 92% indels were achieved, as measured by
Illumina sequencing of the
on-target PCR product using the following primers: Forward =
CATGGCGTCTGGACTAGGAG
(SEQ ID NO:1266) and Reverse = AAACACATTTCACAATCCCTGAAC (SEQ ID NO:1267).
[0425] Analysis of the indel length distribution and classification of indels
of length 3bp, and of
indels of length >3bp either categorized as MMEJ or NHEJ mediated indels, was
conducted on the
preinfusion cell population after 24h to 72h of in vitro culture post-
electroporation. Deletions were
classified as "MMEJ" if stretches of 2 base pairs (bp) or more were detected
at the deletion boundary
and repeated in the region immediately flanking the other end of the deletion.
All other deletions were
classified as NHEJ.
[0426] The distribution of indel length, shown in Figs. 43 H-K, and for NHEJ-
indels only in Figs.
43D-G), was very similar across all timepoints (Figs. 43D and 43K). Insertions
were rarely detected,
and the most commonly observed deletion size was -18, which notably
corresponds to the size of the
18 bp MMEJ deletion HBG1/2 c.-104 to -121 and is the most frequent repair
outcome after editing
this site with Cpfl (Figs. 42C, 57, Table 25). The most commonly observed
deletion size amongst
NHEJ indels was 5 bp as shown in Figs. 43 D-G.
[0427] At all timepoints, indels of size larger than 3 bp, which were observed
to be associated with
the highest levels of HbF induction (Fig. 41C), represented close to 90% of
all indels (Fig. 43A-C).
About two thirds of those were mediated by NHEJ, suggesting that the high
fraction of indels > 3 bp
length is expected to be maintained at long term in vivo, where the ratio of
MMEJ-mediated indels is
reduced in favor of NHEJ-mediated indels (Fig. 41B).
[0428] Following 16 weeks engraftment, ¨96% indels were measured demonstrating
indel
maintenance within the long term repopulating CD34+ cells (Fig. 43A).
[0429] Next, sub-populations of cells within the bone marrow were identified
via FACS analysis to
determine levels of multilineage engraftment. Human chimerism and lineage
reconstitution (CD45+,
CD15+, CD19+, glycophorin A (GlyA, CD235a+), lineage, and CD34+, and mouse
CD45+ marker
expression) in BM was determined by flow cytometry and analyzed. The frequency
of GlyA+ cells
137
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
was calculated as GlyA+ cells/total cells in BM. Human chimerism was defined
as human
CD45/(human CD45+mCD45). Analysis revealed a high level of human chimerism,
with no
difference compared to mock electroporated cells. Greater than 90% human
chimerism was achieved
in both the mock and RNP32 edited groups of mice (Fig. 43M). In addition,
comparable
reconstitution of the B-cell, neutrophil, erythroid, and CD34+ cell lineages
was observed in mice
infused with RNP32 or Mock electroporated cells (Fig. 43M).
[0430] Long term HbF induction by CD235a+ (GlyA+) erythroid cells, derived
from RNP32 edited
CD34+ cells was also analyzed. GlyA+ cells obtained from bone marrow were
stained for gamma
globin expression and analyzed via flow cytometry. The edited cells
demonstrated pancellular
distribution with ¨90% of cells being F positive (Fig. 43N). In addition, the
GlyA+ cell population
was isolated by Fluorescence Activated Cell Sorting (FACS), collected and
lysed in HPLC grade
water. Lysates were then evaluated for HbF expression by UPLC. Fig. 430
depicts the HbF
expression within the GlyA+ population, which exceeded 50%, calculated as
gamma/beta-like chains
(%) by GlyA+ cells.
[0431] These data demonstrate that robust long-term HbF induction is achieved
with RNP32 editing
of human CD34+ cells. In addition, RNP32 editing does not negatively impact
the engraftment and
lineage reconstitution capacity of CD34+ cells.
Example 16: Infusion of RNP32 edited mPB CD34+ cells into NSG (NOD-SCID
112ryNa ) mice
demonstrates a highly polyclonal and stable engraftment of edited cells over
20 weeks with no clonal
outgrowth
[0432] To determine whether indels derived from RNP32 (Table 15) maintain a
polyclonal profile
longitudinally, human adult CD34+ cells from mobilized peripheral blood (mPB)
were infused into
nonirradiated NSG (NOD-SCID Il2ryNu11 ) (Jackson lab stock name: NOD.Cg-
Prkdeld Il2rew'l/SzJ
("NSG") mice. Briefly, mPB CD34+ cells at 62.5 x 106/mL were electroporated
via MaxCyte
electroporation with 6 laM RNP32 or buffer only ("Mock") following 48 hours
pre-stimulation in X-
Vivo 10 media supplemented with SCF, TPO and FLT3. After a further 24 hours,
mCD34+ cells
were cryopreserved. On the day of infusion, mPB CD34+ cells were thawed and
infused into
busulfan treated NSG mice at 5 million cells per mouse via intravenous tail
vein injection. Blood was
collected from mice via tail snips at 8, 12, 16, and 20 weeks post infusion
and gDNA was isolated.
Indel profile analysis was performed on these samples, along with the pre-
infusion CD34+ cell
product (24 hours post electroporation) to track maintenance of polyclonality.
The following primers
were used to detect indels: Forward = CATGGCGTCTGGACTAGGAG (SEQ ID NO:1266)
and
Reverse = AAACACATTTCACAATCCCTGAAC (SEQ ID NO:1267). No notable clonal
outgrowth
occurred in any of the mice analyzed demonstrating maintenance of a diverse
indel profile over a 20
week period (Fig. 44A). In addition, at 20 weeks post engraftment, mice were
euthanized and bone
marrow (BM) was collected from femurs and tibias. Genomic DNA was isolated and
indel profile
138
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
analysis was performed using the primers described above. As seen in the
peripheral blood, a diverse
array of indels was observed (Fig. 44B). This demonstrates that hematopoiesis
was reconstituted by a
large number of edited hematopoietic stem cells, indicating that the RNP
mediated gene modification
did not impair the capacity of HSC within the edited CD34 cell population to
engraft and self renew
in vivo. In addition, no clonal outgrowth was observed suggesting that no
cells with uncontrolled
proliferation of tumorigenic potential was generated following the
modification of the CD34 cells by
the RNP. Emergence of a dominant clone would be a potential indication of
uncontrolled
proliferation or tumorigenesis, which is not seen with RNP32 editing.
Example 17: Use of RNP32 for the treatment of sickle-cell disease
[0433] As described herein, an autologous cell therapy for sickle cell disease
(SCD) can be
developed that comprises CD34+ cells from patients with SCD that are edited
with a AsCas12a
(Cpfl) RNP at the HBG1 and HBG2 promoters to induce the expression of anti-
sickling fetal
hemoglobin. This autologous cell therapy is a therapeutic approach to SCD to
promote the expression
of anti-sickling fetal hemoglobin by directly targeting the promoter of the
HBG1 and HBG2 genes
which encode for the fetal gamma globin chains (Fig. 45).
[0434] The efficiency of RNP32 editing for such a cell therapy was determined
using CD34+ cells
obtained from three independent normal adult donors and four SCD patient
donors and compared.
Seven batches of mobilized peripheral blood CD34+ cells were used in two
independent experiments
(Table).
Table 19: CD34+ cell batches
Cell Batch ID Donor Type Donor Mobilization
Regimen
CEL021-014 Normal G-CSF and plerixafor
CEL042-001 Normal G-CSF
CEL238-001 Normal G-CSF and plerixafor
CEL211-001 SCD Plerixafor
CEL239-001 SCD Plerixafor
CEL240-001 SCD Plerixafor
CEL241-001 SCD Plerixafor
Normal donor type cells were obtained as leukopaks from Hemacare
and enriched using the CliniMACS Plus system. SCD CD34+ cells
were shipped frozen on dry ice from NIH and University of California,
San Francisco. All vials were stored in liquid nitrogen vapor phase until
ready for experiments.
[0435] Briefly, CD34+ cells from normal or SCD donors were pre-stimulated in
media consisting of
X-Vivo 10, supplemented with 1 X Glutamax, 100 ng/mL stem cell factor (SCF),
100 ng/mL
thrombopoietin (TPO), and 100 ng/mL FMS-like tyrosine kinase 3 ligand (F1t3L)
for 2 days in a
humidified incubator at 37 C, 5% carbon dioxide (CO2). After 2 days of
culture, cells were collected
and resuspended in MaxCyte electroporation buffer. RNP32 (6 p.M, at a
gRNA/protein molar ratio of
2) was delivered to CD34+ cells via a MaxCyte GT electroporation device. 1 x
106 to 6.25 x 106 cells
139
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
can be used per 0C-100 cartridge for electroporation. However, due to the
limited number of cells
available from SCD donors, 0.4 x 106 to 1 x 106 cells from each batch were
used for electroporation
(Fig. 46B). Pre-warmed complete media was then added to the cells to give a
final cell density of
approximately 1 x 106 cells/mL (assuming approximately 10% cell loss during
processing). The
electroporated cells, along with untreated control cells (cells that did not
undergo electroporation),
were then placed in a humidified incubator at 37 C, 5% CO2. At Days 1, 2, and
3 post-
electroporation, an aliquot of cells was counted to determine viability and
cells were harvested for
further analyses.
[0436] Comparable viabilities were obtained between normal and SCD CD34+ cells
treated with
RNP32 at Days 1 to 3 post-electroporation (Fig. 46A, Fig. 46B). The two
samples with the lowest
viability (one SCD and one normal donor CD34+ cells) coincided with low cell
numbers used at
electroporation (Fig. 46B).
[0437] Electroporated CD34+ cells were resuspended in Quick Extract at a
concentration of 2,000 to
4,000 cells/pi. Crude genomic deoxyribonucleic acid (gDNA) extraction was
conducted by
subjecting the lysate to the following conditions in a thermocycler: 15 min at
65 C followed by 10
min at 95 C. Crude gDNA was then analyzed for indels by next generation
sequencing using the
following primers: Forward = CATGGCGTCTGGACTAGGAG (SEQ ID NO:1266) and Reverse
=
AAACACATTTCACAATCCCTGAAC (SEQ ID NO:1267). RNP32 edited normal donor CD34+
cells as efficiently as SCD CD34+ cells (Fig. 47A, Fig. 47C). The indel levels
were variable at Day 1
post electroporation (normal, 40.07% to 84.39%; SCD, 46.78% to 79.50%) but
increased to
approximately 90% by Day 3 post electroporation in both normal (83.13% to
97.17%) and SCD
CD34+ cells (83.04% to 95.78%) (Fig. 47C, Fig. 47B (Day 3)). The variable
levels of editing
observed at Day 1 was likely related to the low number of cells used in this
experiment, which was
limited by the availability of cells from SCD donors as described above.
[0438] RNP32 recognizes both HBG1 and HBG2 promoters. Cleavage at both sites
can lead to the
deletion of the 4.9 kb intervening sequence. To assess the frequency of the
4.9 kb deletion, two
ddPCR assays were designed, on-target amplicon and reference amplicon (Fig.
48A). The relative
positions of the primers and probes are shown in Fig. 48A and the sequences
are provided in Fig.
48B. For each sample, approximately 1.1 ng of gRNA was added to a droplet
generator (BioRad) in a
PCR plate and droplets were generated following manufacturers instruction. The
plate was then
moved to the thermocycler and the following protocol was run: 1 cycle of 10
min at 98 C, 40 cycles
of 30 seconds at 94 C and 2 min at 94 C, followed by 1 cycle of 10 min at 98
C and hold at 4 C.
Afterward, the plate was moved to the droplet reader (BioRad) for
quantification and counting of
droplets that are; a) Negative, b) Positive for both the on-target amplicon
and reference amplicon, c)
Positive for on-target only, d) Positive for reference only. To determine the
percentage of 4.9 kb
deletions, the following equation was applied to each sample.
140
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
conc. on target
conc. reference
Re f erence correction factor *
% 4.9kb deletion ¨ x 100
conc. reference
[0439] *Reference correction factor was calculated as an average of [(on
target concentration)/
(reference concentration)] of the control samples.
[0440] The on-target editing by RNP32 also resulted in the deletion of the 4.9
kb fragment between
the HBG1 and HBG2 promoters, which occurred at a frequency of approximately
27% of the beta
globin loci in both normal (16.4% to 38.5%) and SCD CD34+ cells (20.7% to
32.4%) at Day 1 post-
electroporation (Fig. 49A, Fig. 49B).
[0441] Erythroid progeny of normal and SCD CD34+ cells were also characterized
and the ability of
RNP32-edited CD34+ cells to differentiate into erythroid cells was determined.
Briefly, at Day 1
post-electroporation (described above), 120,000 cells were cultured in
erythroid-inducing media to
generate erythroid cells using a modified three-step differentiation protocol
developed by Giarratana
and colleagues (Giarratana, 2005). CD34+ cells were cultured for 7 days in
Step-1 media consisting
of Iscove's modified Dulbecco's medium (IMDM) supplemented with 1X GlutaMAX
(Gibco), 100
U/mL penicillin, 100 mg/mL streptomycin, 5% human AB+ plasma, 330 jig/mL human
holo
transferrin, 20 mg/mL human insulin, 2 U/mL heparin, 1 laM hydrocortisone, 3
U/mL recombinant
human erythropoietin (EPO), 100 ng/mL SCF, and 5 ng/mL interleukin (IL)-3. On
Day 7, cells were
transferred to Step-2 media, which was identical to Step-1 media except the
absence of hydrocortisone
and IL-3 and cultured for 4 days. Next, cells were cultured for 7 days in Step-
3 media, which was
similar to Step-2 media but without the addition of SCF, and 5% human AB+
plasma was replaced
with 5% KnockOut Serum Replacement (Gibco). At the end of the 18-day culture,
10 jut of cells
were stained with 90 jut of erythroid fluorescence activated cell sorting
(FACS) master mix for 15
min at 4 C and acquired on a Guava easyCyte 12HT flow cytometer to determine
enucleation
frequency. Up to 120 mL cell suspension per sample was spun down at 500 x g
for 5 min to reduce
the total volume of each sample down to 20 mL. Cell suspension was then passed
through Acrodisc
WBC syringe filters to remove nucleated cells and the resultant RBCs were used
for further analyses
in the experiments set forth in this example.
[0442] When placed under erythroid-inducing conditions, normal and SCD CD34+
cells (RNP32-
edited cells and unedited cells), underwent robust expansion, averaging 23,000
fold across all
experimental groups in 18 days (Figs. 50A, Table 20). By Day 18, the culture
consisted of
erythroblasts, RBCs, and extruded nuclei (pyrenocytes) (data not shown).
Approximately 80% of the
erythroid cells across all groups reached terminal maturation and lost their
nucleus (Fig. 50B). In
141
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
summary, comparable fold expansion and terminal maturation were achieved by
normal and SCD
CD34+ cells with or without RNP32 electroporation.
Table 20: Phenotype characterization of erythroid progeny of CD34+ cells
HbF+
Experiment Donor Fold Enucleation HbF
Donor Lot Treatment cells
ID Type Expansion (%) (%)
(0/;)
untreated 12465 77.42 .54
3
SCD011 CEL211-001 SCD
4168
RNP32 15118 75.61 .6 untreated
25814 83.62 17.97
CEL238-001 Normal
RNP32 16674 81.77 39.24 L
untreated 11686 80.57 25.84 71.27
CEL240-001 SCD
RNP32 12856 78.30 58.99 94.50
untreated 16793 83.21 17.26 58.65
CEL241-001 SCD
RNP32 16937 84.72 53.70 93.45
SCD014 untreated 19732 76.43 18.25
50.09
CEL239-001 SCD
RNP32 20540 76.79 51.03 93.29
untreated 27390 80.06 27.92 64.51
CEL211-001 SCD
RNP32 35845 81.21 58.71 93.79
untreated 16214 78.15 16.36 58.23
CEL238-001 normal
RNP32 29239 81.70 51.60 92.92
untreated 21498 87.12 11.08 37.76
CEL021-014 normal
RNP32 27659 86.71 38.38 90.61
untreated 26615 69.14 10.49 45.00
CEL042-001 normal
RNP32 53774 80.08 43.83 93.85
The enucleation rate was calculated as proportion of NucRed-cells (RBC) within
CD235+ (erythroid)
population.
[0443] HbF induction in the erythroid progeny of normal and SCD CD34+ cells
post-editing by
RNP32 was also characterized and a globin chain analysis was performed.
Expression of various
hemoglobin subunits was analyzed using reverse phase ultra-performance liquid
chromatography
(RP-UPLC) modified from a method described by Masala and Manca (Masala 1994)).
1 x 106 cells
post filtration from erythroid differentiation described above were washed
once with phosphate
buffered saline (PBS)-0.5% bovine serum albumin (BSA), and then lysed in 50
p.L liquid
chromatography-mass spectrometry (LC-MS) grade water. Samples were loaded onto
the Agilent
1290 UPLC system. Elution was followed at 220 nm with no reference wavelength.
The globin
chains were eluted in the following order: f3, a, AyT (a common Ay variant,
gene product of HBG1),
Gy (gene product of HBG2), and Ay (gene product of HBG1). Area under the curve
under each peak
approximated the relative abundance of each globin chain and was used to
calculate the level of HbF.
As HbA is composed of a2132 and HbF is composed of a2y2, the level of HbF
expression was
calculated as (Ay + &y)/(Ay + Gy +13) (%), or (AyT + Ay + Gy)/( AyT + Ay + Gy
+13) (%), labelled
as y/13-like (%).
[0444] The frequency of HbF+ cells (HbF-expressing cells) in RBCs following
filtration was
determined using a method described by Thorpe (Thorpe 1994). In brief, the
RBCs from the
erythroid differentiation described above were fixed with 4% formaldehyde,
permeabilized with ice-
cold acetone, washed with PBS-0.5% BSA, and stained with HbF+ cell FACS master
mix. Cells were
142
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
washed with PBS-0.5% BSA, resuspended in PBS 0.5% with NucRed (2 drops/mL) and
acquired on
the Guava flow cytometer.
[0445] Erythroid cells derived from normal and SCD CD34+ cells electroporated
with RNP32
demonstrated elevated, and pancellular HbF expression. An average of 43.26%
HbF was measured in
the treated normal donor group (38.38% to 51.60%), and 54.21% HbF in the
treated SCD donor group
(48.63% to 58.99%), significantly increased from a background of 13.98%
(10.49% to 17.97%) and
21.16% (16.54% to 27.92%) in the untreated normal donor group and SCD donor
group, respectively
(Fig. 51A, Table 20). In addition, on average > 92% of RBCs derived from RNP32-
electroporated
CD34+ cells of either donor type (normal or SCD donors) were HbF+ (normal,
90.61% to 93.85%;
SCD, 93.29% to 94.50%) (Fig. 51B, Table 20), which was significantly elevated
compared to RBCs
derived from respective untreated CD34+ cells (normal, 37.76% to 58.23%; SCD,
50.09% to
71.27%). Thus, high RNP32 editing levels resulted in elevated HbF levels after
in vitro erythroid
differentiation, with over 50% of HbF measured in RNP32-derived red blood
cells (Fig. 51C).
[0446] Several assays were conducted to demonstrate the clinical relevance of
the elevated fetal
hemoglobin in untreated sickle cell patient cells, and to a lesser extent the
untreated cells from normal
donors, as shown in Fig. 51B. Due to the in vitro culture used to
differentiate the CD34+ cells into
RBCs to conduct those assays, there is a high background of HbF in untreated
cells derived from SCD
patients. This is expected with these culture conditions, and has been
previously reported by Metais
et al. (Metais 2019). This likely partially masks the full extent of the
benefit achieved in modified
cells when compared to unmodified cells.
[0447] To evaluate the impact of HbF induction on the sickling of RBCs as a
result of hypoxia-
induced HbS polymerization, untreated RBCs derived from unedited SCD CD34+
cells (unedited
control cells) and RBCs derived from edited SCD CD34+ cells were incubated
with oxygen scavenger
sodium metabisulfite solution to remove oxygen from the cell suspension,
thereby placing the cells
under extremely reduced oxygen tension. The percentage of sickled RBCs derived
from unedited
SCD CD34+ cells and sickled RBCs derived from RNP-32 edited SCD CD34+ cells
was then
determined and compared.
[0448] Briefly, cells were first induced to generate erythroid cells. One
million RNP32-edited RBCs
were collected from the erythroid differentiation assay as described above and
washed with PBS-0.5%
BSA. The cell pellet was then resuspended in 20 jut PBS and mixed with 20 jut
of 2% sodium
metabisulfite weight/volume in water. One drop (approximately 20 pi) of this
cell mix was then
placed on a microscopic slide, covered with a coverslip and the edges were
sealed. Slides were stored
at room temperature for 1 to 4 hours before imaging and analyzing for
morphological changes.
Average sickling frequency reduced from 38.3% in untreated SCD RBCs (having a
mean HbF of
19.9%) to 10.6% in RNP32-edited SCD RBCs (having a mean HbF of 53.8%),
representing an
approximate 4-fold decrease in sickling morphology for RNP32-edited RBCs from
SCD patients
143
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
compared with unedited RBCs from SCD patients (Fig. 52). Sodium meta-bisulfite
leads to extreme
hypoxia, below levels commonly observed physiologically, thus even lower
percentage of sickling
RBC is expected in vivo from the edited cells.
[0449] The deformability of SCD RBCs was also evaluated. To evaluate whether
HbF induction
decreases the rigidity and improves the deformability of SCD RBCs when
deoxygenated, untreated
RBCs from patients with SCD and RNP32-edited RBCs from SCD patients were
analyzed on a
Lorrca ektacytometer where shear stress was applied under decreasing oxygen
tension (Fig. 53A).
Fifteen million RBCs following filtration from erythroid differentiation (as
described above) were
collected and washed with PBS-0.5% BSA. Cells were centrifuged at 500 x g for
5 minutes,
resuspended in 1.5 ml of OXY ISO solution (Lorrca), and mixed gently by
inversion. Cell suspension
was then loaded onto the Lorrca ektacytometer where Oxygenscan was performed
per manufacturer's
instructions to measure the deformability of RBCs under shear stress when
deoxygenated. RBC
deformability was expressed as elongation index (El) (Fig. 53A) and "point of
sickling" represented
the relative oxygen pressure when the SCD RBCs started to sickle and lost > 5%
of the El during
deoxygenation. Normal RBCs containing healthy adult hemoglobin (HbA and HbF)
from three
different donors were not impacted by the reduction in oxygen tension (Fig.
53B). In contrast, SCD
RBCs from four donors became rigid when deoxygenated, as illustrated by the
gradual decrease in
elongation index corresponding with oxygen depletion (Fig. 53C (black line)).
SCD RBCs derived
from RNP32-edited CD34+ cells started to sickle at lower oxygen tension
(represented as the point of
sickling) compared to RBCs from untreated CD34+ cells (Fig. 53C (grey line),
53D, Table 21). In
addition, deoxygenated RNP32-treated SCD RBCs remained more flexible than
untreated SCD RBCs
as demonstrated by the higher minimum elongation index observed for RNP32-
treated SCD RBCs
relative to untreated SCD RBCs (Fig. 53E, Table 21).
Table 21: Summary of deformability assessment of RBCs
Minimum
Experiment Donor Point of Sickling
Donor Lot Treatment Elongation
ID Type (p02, mmHg)
Index
0.085
SCD011 CEL211-001 SCD untreated 60.17
RNP32 35.11 0.260
CEL240 001 SCD untreated 38.55 0.187
- RNP32 21.80 0.340
CEL241 001 SCD untreated 31.18 0.292
- RNP32 11.80 0.399
SCD014
CEL239 001 SCD untreated 53.60 0.104
- RNP32 50.09 0.238
CEL211 001 SCD untreated 41.62 0.156
- RNP32 21.27 0.330
[0450] Next, to assess whether the reduced sickling and increased flexibility
of SCD RBCs derived
from RNP32-edited CD34+ cells would lead to improved rheological behavior,
RBCs were evaluated
144
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
using a microfluidic platform. The microfluidic platform replicated blood flow
in the
microvasculature for direct observation of the bulk flow of cultured SCD RBCs
under varying oxygen
conditions. When deoxygenated, the intracellular polymerization of HbS makes
RBCs inflexible and
rigid which translates to a drop in the velocity through the microchannel.
Briefly, one hundred and
fifty million RBCs following filtration after erythroid induction as described
above were spun down
and resuspended in fresh Step-3 media to a final concentration of 10 x 106
cells/mL. Cultured RBCs
were washed with PBS, and resuspended in PBS to achieve a 20% target
hematocrit. A 15 ILtL volume
of cultured RBCs was loaded onto the device under constant pressure and
subjected to varying levels
of oxygen controlled via a gas mixing system. The flow was captured by a high-
speed camera and the
blood velocity through the channel was determined using the Kanade-Lucus-
Tomasi feature tracking
in MATLAB. The velocity of the cells was then measured under a range of oxygen
levels. Typical
oxygen levels observed in the venous circulation are approximately 4% to 6%
oxygen.
[0451] RBCs from normal donors showed no oxygen-dependent rheology impairment
(Fig. 54A,
Fig. 54B). While the rheological behavior of RBCs derived from RNP32-edited
SCD CD34+ cells
did not completely normalize, they exhibited lower magnitudes of impairment
during hypoxia and
required more extreme hypoxia before the onset of a decrease in velocity
compared with RBCs
derived from untreated SCD CD34+ cells (10% oxygen for RBCs derived from
untreated SCD
CD34+ cells and 6% oxygen for RBCs derived from RNP32-edited SCD CD34+ cells).
As shown in
Fig. 54C, RBCs derived from RNP32-edited SCD CD34+ cells (circles)
demonstrated a drastically
improved rheological behavior compared to RBCs derived from untreated SCD
CD34+ cells
(triangles) at physiological oxygen levels. Unedited RBCs from normal donors
(diamonds) showed
no oxygen-dependent rheology impairment. While the rheological behavior of
RBCs derived from
RNP32-edited SCD CD34+ cells did not completely normalize, they exhibited
lower magnitudes of
impairment during hypoxia and required more extreme hypoxia for the onset of
decrease in velocity
compared with RBCs derived from unedited SCD patient CD34+ cells. Notably, at
oxygen levels
typically observed in the venous circulation, the velocity of red blood cells
derived from RNP32-
edited CD34 cells was almost fully normalized compared to RBC derived normal
donor cells. The
reduction in rheology impairment under hypoxia was also strongly correlated
with increased levels of
HbF in the RBCs (Fig. 54D, Fig. 54E). For example Fig. 54E shows that RBCs
that had the highest
HbF levels exhibited the highest velocity at a physiological oxygen level of
4%. This indicates that
the phenotypic correction of RBCs from sickle cell patients is greatest with
very high levels of HbF
expression, as observed with RBCs derived from RNP32-edited SCD CD34+ cells
(Fig. 54D, Fig.
54E).
[0452] In sum, two studies were conducted to interrogate editing of SCD and
normal CD34+ cells
with RNP32 and determine the functional outcome in the erythroid progeny.
RNP32 efficiently
edited normal and SCD CD34+ cells, achieving approximately 90% insertions
and/or deletions
145
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
(indels) at Day 3 post-electroporation. Editing of CD34+ cells with RNP32 did
not negatively impact
the erythroid differentiation or maturation. Robust HbF expression was
obtained, averaging 43.26%
and 54.21% of total hemoglobin in RBCs derived from RNP32-edited normal and
SCD CD34+ cells
respectively, distributed in a pancellular fashion (averaging > 92% RBCs). The
high level of HbF
expression in RBCs derived from RNP32-edited SCD CD34+ cells coincided with
decreased sickling,
improved deformability under shear stress, and improved flow through
microfluidic channels when
deoxygenated compared to RBCs derived from untreated SCD CD34+ cells.
Potentially
therapeutically relevant levels of HbF were achieved through highly efficient
RNP32 editing of
CD34+ cells at the HBG1 and HBG2 promoter region. This translates to a
reduction in sickling and
improved rheological properties in red blood cells, which is advantageous for
an autologous cell
therapy using RNP32 for the treatment of sickle-cell disease.
Example 18: Meta-analysis of on-target indels generated by RNP32 in CD34+
cells
[0453] Following CRISPR/Cas editing, DNA repair mechanisms like non-homologous
end joining
(NHEJ) and microhomology -mediated end joining (MMEJ) result in highly
heterogeneous repair
outcomes comprising hundreds of different genotypes. The editing outcomes
produced when using
Cpfl (also referred to as AsCas12a), the enzyme used for RNP32, have not been
characterized in
detail. Cpfl editing results in a four nucleotide 5' overhang (see Fig. 55A),
which is quite different
from the blunt ends of SpCas9 edits (see Fig. 41A). As used in this example,
"cut site" is used to
refer to the position at the middle of the expected overhang resulting from
editing with RNP32 (Fig.
55A, grey dashed line).
[0454] DNA repair mechanisms often create indels ranging in size from 1 to
approximately 50 base
pairs (bp), which are typically detected by PCR-based targeted sequencing
assays. More complex
genomic repair outcomes have also been described (Error! Reference source not
found. 2018;
Error! Reference source not found. 2018; Error! Reference source not found.
2020), and include
deletions at the on-target locus larger than ¨50 bp, called resections, and
translocations. These more
complex rearrangements require other methods for a precise quantification
(see, e.g.,
PCT/US2018/012652).
[0455] To determine the indel profile generated by RNP32, indels ranging in
size from 1 bp to
approximately 50 bp at the distal CCAAT-box generated by RNP32 were
characterized using PCR-
based targeted sequencing assays. The indel patterns were studied in a variety
of samples, spanning
different genotypes (normal vs sickle cell disease) and mobilization regimens
(plerixafor alone vs G-
CSF alone vs G-CSF + plerixafor) (Table 12). This meta-analysis demonstrates
that RNP editing at
the CCAAT box results in a distinct indel profile that is reproducible across
a variety of samples and
levels of editing.
Table 22: Samples used in meta-analysis
146
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Exp. # / Donor Donor Mobilization RNP32
CEL ID (Donor)
Batch # Type Regimen
SCD011 Normal CEL238-001 G-CSF & plerixafor 6
SCD011 SCD CEL211-001 plerixafor 6
SCD014 Normal CEL021 -014 G-C SF & plerixafor 6
SCD014 Normal CEL042-001 G-CSF 6
SCD014 Normal CEL238-001 G-CSF & plerixafor 6
SCD014 SCD CEL211-001 plerixafor 6
SCD014 SCD CEL239-001 plerixafor 6
SCD014 SCD CEL240-001 plerixafor 6
SCD014 SCD CEL241-001 plerixafor 6
SCD1 Normal CEL172-008 G-CSF & plerixafor 8
SCD1 Normal CEL182-008 G-CSF & plerixafor 8
SCD1 Normal CEL171-008 G-CSF & plerixafor 8
SCD1 Normal CEL192-008 G-CSF & plerixafor 8
SCD1 Normal CEL168-008 G-CSF & plerixafor 8
Samples were obtained from research-scale (SCD011, SCD014) or large-scale
(SCD1) processes. No significant differences were observed in RNP32-edited
cells produced using research-scale versus large-scale processes (data not
shown).
The donors from experiments SCD011 and SCD014 are the same as those in
Example 17 (Table 20).
[0456] Mobilized peripheral blood CD34+ cells from 12 distinct donors (normal
donors and SCD
donors) were used in this meta-analysis (Table 22). Five samples from normal
donors were generated
using a large-scale process (Table 22, Experiment SCD1). Briefly, leukopaks
(HemaCare or
KeyBiologics) were obtained from normal donors mobilized with granulocyte
colony stimulating
factor (G-CSF) and plerixafor. CD34+ cells were enriched using the CliniMACS
Plus system,
aliquoted, cryopreserved in Cryostor CS10, and stored in liquid nitrogen vapor
phase. CD34+ cells
were thawed, cultured for 2 days in complete media consisting of X-Vivo 10,
supplemented with 1 X
Glutamax, 100 ng/mL stem cell factor (SCF), 100 ng/mL thrombopoietin (TP0),
and 100 ng/mL
FMS-like tyrosine kinase 3 ligand (F1t3L), mixed with RNP32 (at a gRNA/protein
molar ratio of 2) to
a final concentration of 8 p.M, and electroporated with a Maxcyte GT
electroporation device per
manufacturer's instruction. The cellular materials were cultured overnight
following electroporation,
147
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
aliquoted, and cryopreserved in Cryostor CS10, and stored in liquid nitrogen
vapor phase until ready
for experimentation.
[0457] Nine samples were generated using a research-scale process (Table 22,
SCD011 and
SCD014). Cells were thawed, washed, and cultured at 1 x 106 cells/mL in
complete media consisting
of X-Vivo 10, supplemented with 1 X Glutamax, 100 ng/mL stem cell factor
(SCF), 100 ng/mL
thrombopoietin (TPO), and 100 ng/mL FMS-like tyrosine kinase 3 ligand (F1t3L)
for 2 days in a
humidified incubator at 37 C, 5% carbon dioxide (CO2). After 2 days of
culture, cells were collected
and resuspended in Maxcyte electroporation buffer. RNP32 (at a gRNA/protein
molar ratio of 2) was
added to the cell suspension to a final concentration of 6 M. The mixture was
transferred to a
Maxcyte OC-100 cartridge and electroporated with a Maxcyte GT electroporation
device per
manufacturer's instruction. After electroporation, cells were cultured in
complete media for 1 day
prior to harvesting for analysis.
[0458] The fraction of small indels present in the samples was assessed by
Illumina amplicon
sequencing (ILL-seq), following library preparation method and analysis. A 15
bp window around
the expected cut site was used in the analysis to calculate editing rates. The
oligonucleotides and
amplicon used to generate the targeted amplicon sequencing products are
provided in Fig. 55A and
Fig. 55B.
[0459] To characterize editing by RNP32, the indels generated in each sample
were analyzed and
processed. The results were summarized by looking at 1) percentage deletion
for each base within the
target region, 2) distribution of insertion and deletion center positions, and
3) distribution of insertion
and deletion lengths. To perform these analyses, the cigar strings for the
reads in the alignment bam
files were processed, using the following steps:
5) Group indels appearing in the same read.
6) Create indel id for indels from each read. Indel =id is a string
identifying the indel, shown as
indel_start_position + _ + indeliength + _ + ID. Where ID is NA for deletions
and for insertions
is the sequence inserted. See example in Fig. 55D.
7) Group reads with the same indel_id.
8) Count number of reads with the same indels and calculate their total
fractions (including wt) and
fractions in indels (excluding wt). Fractions in indels allow for a comparison
between samples
when they have different amounts of total editing.
[0460] To analyze the reproducibility of the individual indels detected across
samples, the number of
times they were detected across samples and their average percentage in indels
was estimated. When
an indel was not detected in a particular sample it was assumed to have a
percentage of 0%.
[0461] The total percentage of indels for each RNP32-edited sample in this
analysis are shown in
Table 23. All the samples (including normal and SCD donors) exhibited overall
editing greater than
72.6% (ranging from 72.6% to 89.2%), except for three samples that exhibited
lower editing between
148
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
about 40% to 53%. The samples exhibiting lower editing had low viability
potentially associated with
lower numbers of cells used for electroporation.
Table 23: Editing results for all the samples
Donor Type CEL ID EXP # Total Indels %
Normal CEL238-001 SCD011 84.39%
SCD CEL211-001 SCD011 79.50%
Normal CEL021-014 SCD014 40.07%
Normal CEL042-001 SCD014 78.37%
Normal CEL238-001 SCD014 80.70%
SCD CEL211-001 SCD014 46.78%
SCD CEL239-001 SCD014 52.92%
SCD CEL240-001 SCD014 75.38%
SCD CEL241-001 SCD014 72.63%
Normal CEL172-008 SCD1 88.91%
Normal CEL182-008 SCD1 87.11%
Normal CEL171-008 SCD1 84.04%
Normal CEL192-008 SCD1 89.24%
Normal CEL168-008 SCD1 88.76%
[0462] In total, 385 unique indels were detected, counting only those indels
that were found at a
percentage above 0.1% (out of total indels) in at least one of the samples in
Table 25.
[0463] The wt allele and the top 20 indels are shown in Fig. 57, alongside
their relative average
frequency (amongst all samples). The most abundant indel, 159_48_NA, was
present on average
15.15% among all the samples. Notably, indel 157_43_NA, more commonly known as
the 13bp
HPFH deletion, was detected on average at 2.63%. The 13bp deletion is a
naturally occurring
mutation associated with elevated HbF.
[0464] Indel analysis of the bulk CD34+ population (progenitors) 24-72 hours
after electroporation
can determine whether editing at this site was derived from Cas12a, or Cas9.
In the case of Cas12a,
the most dominant indel detected at this timepoint is the 159_48 deletion,
however with Cas9 the
most frequent indel is the 157_-13 deletion. In addition, the most common NHEJ
indel generated by
Cas9 at this site is a -1 bp deletion (169_4_NA, Table 24), which occurred
here at ¨9.6%. In
contrast, following editing with Cas12a, the most common NHEJ indels generated
are 6 bp and 4 bp
deletions (165_-6_NA, and 167_-4_NA; Table 24, RNP58; Table 25, RNP32). Cpfl
generally
produces larger NHEJ deletions, when compared to Cas9 at this site.
[0465] Indel analysis of the bulk CD34+ population (progenitors) 24-72 hours
after electroporation
can determine whether edits (indels) at this site were derived from Cpfl or
Cas9. For example, in the
149
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
case of Cpfl, the most dominant indel detected at this timepoint is the 159_48
deletion at an average
percentage of 15.15% of the total indels (Table 25) compared to an average
percentage of 1.35% for
SpCas9, see Table 24. However, the most frequent indel for SpCas9 is the
157_43 deletion at an
average percentage of 31.88% of the total indels (Table 24) versus an average
percentage of 2.63% of
the total indels for Cpfl (Table 25).
[0466] Results for the distributions of indel center points and indel lengths
are shown in Figs. 58 and
59, respectively. The most common indel center position (peak) was located 6
bp away from the cut
site, at position TSS:-113. Peaks in the deletion length distribution were
observed at 13 bp and 18 bp,
corresponding mostly to the 15 7_- and 159_48_NA MMEJ indels. Due to the
resection and
utilization of microhomology sequences during MMEJ repair, this pathway tends
to generate larger
size deletions than those mediated via the NHEJ pathway. Besides those, the
most commonly
observed deletion length was 5 bp with 9.30% (Fig. 60). Insertions were rarely
detected (total
contribution of 0.50%). Deletions between 1 bp and 25 bp had a total
contribution of 92.03% among
all indels (deletions between 3 bp and 25 bp had a total contribution of
85.85% among all indels,
deletions between 4 bp and 25 bp had a total contribution of 80.35% among all
indels, and deletions
between 5 bp and 25 bp had a total contribution of 72.04% among all indels)
(Table 25). Overall,
both the distribution of indel center points and indel lengths were very
similar across the Normal and
SCD samples. As shown in Fig 41C above, the generation of indels 4 bp and
longer results in the
highest induction of HbF.
[0467] The results for the percentage of bases deleted along the target region
(deletion profile) are
shown in Fig. 61 and Fig. 62 (normalized to the same maximum value of 1 for
comparison between
samples). The shapes of the profiles are very similar across all samples,
despite having different total
editing values (Table 23). No major differences were observed between Normal
donor (Normal) and
sickle cell disease donor (SCD) samples or different mobilization regimens.
The deletion profiles
show that the peak of the distribution (most commonly deleted base) is 6 bp
toward the TSS from the
cut site, at TSS: ¨113.
[0468] Of the total of 385 indels detected at 0.1% in any of the samples
evaluated, 108 indels were
detected in all 14 samples (Fig. 63 and Table 25). All indels present at an
average percentage in indel
greater than 0.22% were detected in all 14 samples (a total of 55 indels,
above the grey line Fig. 64
and also in Table 25), and had a total indel contribution of 69.90%. Overall,
the reproducibility of
indel detection was very high.
[0469] To look in more detail at the consistency in each individual indel
frequency between the
indels detected across all samples, their pairwise correlation plots and R2
were calculated. To avoid
under sampling bias, when comparing two samples, only indels which had a
minimum percentage of
0.1% (of all indels) in at least one of the two samples was considered.
Excluding the three samples
with editing below 60% due to the low number of cells used for electroporation
(see Table 22), all R2
150
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
values were greater than 0.8 (data not shown). Overall, the correlation
between indel percentages
among the samples with high editing was very high.
[0470] In sum, a total of 385 unique indels were detected at a percentage
above 0.1% in at least one
of the 14 edited samples tested in this Example. The most abundant indel, 159_-
18_NA, was present
between all the indels on average 15.15% among all the samples. Indel 157_-
13_NA, more
commonly known as the 13bp HPFH deletion, was detected on average at 2.63%.
The shapes of the
indel profiles for all edited samples were very similar across all studies,
despite having different total
editing values. No major differences were observed between Normal donor and
SCD donor samples
or different mobilization regimens.
[0471] Evaluation of individual indel positions showed that indels generated
by RNP32 were mostly
centered around position TSS: ¨113, which was also the most commonly deleted
base observed.
Evaluation of the distribution of indel lengths showed peaks at ¨18 and ¨13
corresponding primarily
to the MMEJ indels, 159_-18_NA (most abundant indel, starting at TSS: ¨104 and
of length 18 bases)
and 157_-13_NA (starting at TSS: ¨102, 13bp HPFH deletion). Besides these, the
most commonly
observed deletion length was 5 bp at 9.30%. Insertions were rarely detected
(total contribution of
0.50%). Deletions between 1 bp and 25 bp had a total contribution of 92.03%
among all indels.
Overall, the distribution of indel length and center position were very
similar between the Normal and
SCD samples. Of the total of 385 unique indels, 108 indels were detected in
all 14 samples. All
indels present at an average percentage in indel greater than 0.22% were
detected in all 14 samples (a
total of 55 indels), and had a total indel contribution of 69.90%. Pairwise
correlations among the
detected indels (excluding the three samples with editing below 60%) had R2
values greater than 0.8.
[0472] This data demonstrate that RNP32 editing at the HBG1/2 distal CCAAT box
results in a
unique indel signature that is reproducible across a variety of samples and
levels of editing.
Example 19: Analysis of normal donor CD34+ cell RNP32 editing efficiency
including 4.9 kb
fragment deletion
[0473] The on-target editing efficiency of RNP32 in mobilized peripheral blood
CD34+ cells
obtained from four independent normal adult donors was assessed, as well as
the frequency of
deletion of the 4.9 kb fragment between the two RNP32 cut sites. In addition,
the on-target indel
levels and frequency of the 4.9 kb deletion were also measured in several
subpopulations of HSPC
sorted from total CD34+ cells to address whether phenotypic long-term
hematopoietic stem cells (LT-
HSC) could be edited efficiently with RNP32.
[0474] Leukopaks from four normal donors treated with granulocyte colony-
stimulating factor (G-
CSF) plus Mozobil or with G-CSF alone were obtained from HemaCare. CD34+ cells
(Lot: CEL045-
002, CEL046-004, CEL047-002, and CEL021-021) were enriched using the CliniMACS
system
(Miltenyi), aliquoted, and cryopreserved in Cryostor CS10. Cells were thawed,
washed, and cultured
at 1 x 106 cells/mL in complete media consisting of X-Vivo 10, supplemented
with 1 X Glutamax,
151
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
100 ng/mL stem cell factor (SCF), 100 ng/mL thrombopoietin (TPO), and 100
ng/mL FMS-like
tyrosine kinase 3 ligand (F1t3L) for 2 days in a humidified incubator at 37 C,
5% carbon dioxide
(CO2). After 2 days of cultures, cells were collected and resuspended in
Maxcyte electroporation
buffer. RNP32 (gRNA/protein molar ratio of 2) was added to the cell suspension
to a final
concentration of 6 M. The mixture was transferred to a Maxcyte OC-100
cartridge and
electroporated with a Maxcyte GT electroporation device per manufacturer's
instruction.
[0475] RNP32 recognizes both HBG1 and HBG2 promoters. Cleavage at both sites
can lead to the
deletion of the 4.9 kb intervening sequence. To assess the frequency of the
4.9 kb fragment deletion,
the two ddPCR assays, reference amplicon and on-target amplicon, were
performed as described in
Example 17 (see Figs. 48A-48D). Briefly, cells at 1 or 2 days post-
electroporation with RNP32, and
sorted cells were resuspended in Quick Extract at a concentration of 2,000 to
4,000 cells/ L. Crude
genomic deoxyribonucleic acid (gDNA) extraction was conducted by subjecting
the lysate to the
following conditions in a thermocycler: 15 min at 65 C followed by 10 min at
95 C. Crude gDNA
was then analyzed for indels (insertions and deletions) by next generation
sequencing (using the
primers set forth in Fig. 55A) and 4.9kb fragment deletion assessment by
digital droplet polymerase
chain reaction (ddPCR).
[0476] RNP32 edited the HBG1 and HBG2 promoters of normal donor CD34+ cells in
an RNP
concentration-, and time-dependent manner without significantly impacting the
cell viability (Fig.
65A, 65B, Fig. 66, and Fig. 67). At 8 M, the highest concentration of RNP32
tested, an average of
86% on-target indel level was achieved in normal donor CD34+ cells by Day 1
and rose to 91% by
Day 2 post-electroporation (Fig. 68). The increase was more evident at lower
RNP concentration
with average indel level at 1 itM rising from 62% to 77% by Day 1 and Day 2
post-electroporation.
By Day 2 post-electroporation, > 85% on-target indel level was routinely
achieved when CD34+ cells
were transfected with > 3 itM RNP32.
[0477] Editing of CD34+ cells with RNP32 resulted in frequent deletion of the
4.9 kb intervening
fragment between the two RNP32 cut sites at the HBG1 and HBG2 gene promoters,
respectively. On
average, approximately 35% of the beta globin loci in the CD34+ cells had the
4.9 kb fragment
deleted both at Day 1 and Day 2 post electroporation with > 2 itM of RNP32
(Fig. 69A, Fig. 69B and
Fig. 70). The 4.9 kb fragment deletion to indel ratio in CD34+ cells was
approximately 0.47 at Day 1
and decreased to approximately 0.40 at Day 2 post-electroporation with > 2 itM
of RNP32.
[0478] CD34+ cells are heterogeneous and comprise lineage-restricted
progenitors, MPPs, as well as
self-renewing LT-HSCs. As LT-HSCs will be responsible for providing long-term
reconstitution of a
patient's hematopoietic system, high levels of editing in this population are
pertinent for the durability
of the treatment. To address whether different subpopulations of CD34+ cells
were edited similarly,
the on-target indel levels in CMPs, MPPs, and phenotypic LT-HSCs, defined by
surface
152
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
immunophenotype, was evaluated and compared to the on-target indel levels in
total CD34+ cells
across multiple RNP concentrations.
[0479] Briefly, CD34+ cells were sorted two days post electroporation with
RNP32 to obtain three
subpopulations of HSPCs including phenotypic LT-HSC, multipotent progenitor
(MPP) cells, and
common myeloid progenitor (CMP) cells using a BD fluorescence-activated cell
sorting (FACS)Aria
Fusion cell sorter (BD Biosciences). Gating was set to collect the following
enriched CD34+ cell
subpopulations: phenotypic LT-HSC (P7, CD34 bright, CD38 low/negative, CD90+,
CD45RA-),
MPP (P6, CD34 bright, CD38 low/negative, CD90-, CD45RA-), and CMP (P9, CD34
bright, CD38
high, CD123+, CD45RA-).
[0480] Of the three subpopulations, CMPs consistently had the highest on-
target indel levels and
phenotypic LT-HSCs had the lowest on-target indel levels (analyzed via NGS
using the primers set
forth in Fig. 55B) across all RNP concentrations evaluated (Fig. 71A, Fig. 71B
and Fig. 72Error!
Reference source not found.) (Study MAX072). Nevertheless, at > 3 laM RNP32,
on-target indel
levels of > 85% were achieved in phenotypic LT-HSCs, similar to the on-target
indel levels detected
in total CD34+ cells, suggesting that self-renewing LT-HSCs can be efficiently
edited using RNP32
(Fig. 71A, Fig. 71B and Fig. 72).
[0481] RNP32 editing resulted in deletion of the 4.9 kb fragment in all three
subpopulations of
hematopoietic stem and progenitor cells tested (Fig. 73A and Fig. 74). Of the
three subpopulations,
CMPs consistently had the highest levels of deletion of the 4.9 kb fragment
and phenotypic LT-HSCs
had the lowest levels of deletion of the 4.9 kb fragment across all RNP
concentrations evaluated. The
4.9 kb fragment to indel ratio averaged across all RNP concentrations was
approximately 0.43, 0.49,
0.33, and 0.25 in total CD34+ cells, CMP, MPP, and phenotypic LT-HSC
respectively (Fig. 73B),
demonstrating that the LT-HSCs had less frequent deletion of the 4.9 kb
fragment as a result of
RNP32 editing than their short term counterparts. Retention of the 4.9 kb
inter-edit region is
beneficial because a higher deletion of the 4.9 kb fragment results in a lower
production of HbF.
Therefore, lower levels of deletion of the 4.9 kb fragment in LT-HSCs edited
by RNP32 is
advantageous. The results herein demonstrate that editing with RNP32 can
generate cells with
clinically relevant levels of healthy HbF.
[0482] In sum, on-target indel levels and the associated 4.9 kb fragment
deletion between the HBG1
and HBG2 promotors were assessed following electroporation of normal human
donor CD34+ cells
with RNP32. RNP32 was highly efficient at editing CD34+ cells, with consistent
editing achieved
across multiple RNP batches and cell donor lots. Greater than 85% on target
indels in CD34+ cells
were routinely achieved when electroporated with > 3 laM RNP32. Comparable
levels of indels
between total CD34+ cells and sorted phenotypic LT HSC were also observed when
electroporated
with > 3 laM RNP32. Loss of the 4.9 kb fragment between two RNP32 cut sites
occurred at a
frequency that was cell subpopulation dependent. Total CD34+ cells lost the
4.9 kb fragment at a
153
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
frequency of approximately 0.4 per indel. This frequency dropped to
approximately 0.25 per indel in
the phenotypic LT-HSC subset of CD34+ cells.
Example 20: Treatment of I3-hemoglobinopathy using edited hematopoietic stem
cells
[0483] The methods and genome editing systems disclosed herein may be used for
the treatment of a
I3-hemoglobinopathy, such as sickle cell disease or beta-thalassemia, in a
patient in need thereof For
example, genome editing may be performed on cells derived from the patient in
an autologous
procedure. Correction of the patient's cells ex-vivo and reintroduction of the
cells into the patient may
result in increased HbF expression and treatment of the I3-hemoglobinopathy.
[0484] For example, HSCs may be extracted from the bone marrow of a patient
with a 13-
hemoglobinopathy using techniques that are well-known to skilled artisans. The
HSCs may be
modified using methods disclosed herein for genome editing. For example, RNPs
comprised of guide
RNAs (gRNA) that target one or more regions in the HBG gene complexed with an
RNA-guided
nuclease may be used to edit the HSCs. In certain embodiments, the RNA-guided
nuclease may be a
Cpfl protein. In certain embodiments, the Cpfl protein may be a modified Cpfl
protein. In certain
embodiments, the modified Cpfl protein may be encoded by a sequence set forth
in SEQ ID
NOs:1000, 1001, 1008-1018, 1032, 1035-39, 1094-1097, 1107-09 (Cpfl polypeptide
sequences) or
SEQ ID NOs:1019-1021, 1110-17 (Cpfl polynucleotide sequences). For example,
the modified Cpfl
protein may be encoded by the sequence set forth in SEQ ID NO:1097. In certain
embodiments, the
gRNA may be a modified or unmodified gRNA. In certain embodiments, the gRNA
may comprise a
sequence set forth in Table 6, Table 12, or Table 13. For example, in certain
embodiments, the
gRNA may comprise the sequence set forth in SEQ ID NO:1051. In certain
embodiments, the RNP
complex may comprise an RNP complex set forth in Table 15. For example, the
RNP complex may
include a gRNA comprising the sequence set forth in SEQ ID NO:1051 and a
modified Cpfl protein
encoded by the sequence set forth in SEQ ID NO:1097 (RNP32, Table 15). In
certain embodiments,
modified HSCs have an increase in the frequency or level of an indel in the
human HBG1 gene,
HBG2 gene, or both, relative to unmodified HSCs. In certain embodiments, the
modified HSCs can
differentiate into erythroid cells that express an increased level of HbF. A
population of the modified
HSCs may be selected for reintroduction into the patient via transfusion or
other methods known to
skilled artisans. The population of modified HSCs for reintroduction may be
selected based on, for
example, increased HbF expression of the erythroid progeny of the modified
HSCs or increased indel
frequency of the modified HSCs. In some embodiments, any form of ablation
prior to reintroduction
of the cells may be used to enhance engraftment of the modified HSCs. In other
embodiments,
peripheral blood stem cells (PBSCs) can be extracted from a patient with a I3-
hemoglobinopathy using
techniques that are well-known to skilled artisans (e.g., apheresis or
leukapheresis) and stem cells can
be removed from the PBSCs. The genome editing methods described above can be
performed on the
stem cells and the modified stem cells can be reintroduced into the patient as
described above.
154
SSI
ZEOT :ON CFI OHS Z1701 :ON CFI OHS LEdIsal
ZEOT :ON CFI OHS 11701 :ON CFI OHS tEdIsal
ZEOT :ON CFI OHS ZZOT :ON CFI OHS (1101
L601 :ON CH OHS ISOT :ON CFI OHS MINH
17601 :ON CH OHS coii ON CFI OHS MINH
17601 :ON CH OHS 17011 :ON CFI OHS 0(1101
17601 :ON CH OHS 0 T T :ON CFI OHS adIsal
801T :ON CFI OHS ISOT :ON CFI OHS KdIsal
LOT T :ON CFI OHS ISOT :ON CFI OHS adIsal
9601 :ON CH OHS ISOT :ON CFI OHS 9ZdIsal
17601 :ON CH OHS 601 :ON CH OHS ftdIsal
L601 :ON CH OHS 81701 :ON CFI OHS MARI
17601 :ON CH OHS 1601 :ON CH OHS MINH
MOT :ON CH OHS 0601 :ON CH OHS MINH
MOT :ON CH OHS 6801 :ON CH OHS OtdIsal
MOT :ON CH OHS 8801 :ON CFI OHS
MOT :ON CH OHS g8OT :ON CFI OHS
MOT :ON CH OHS 17801 :ON CFI OHS Zliftsal
MOT :ON CH OHS 6901 :ON CH OHS lIdMU
MOT :ON CH OHS 801 :ON CFI OHS Oliftsal
MOT :ON CH OHS Z801 :ON CFI OHS 6dIsal
MO :ON CEI OHS 1801 :ON CFI OHS 8dIsal
MO :ON CEI OHS ZOT T :ON CFI OHS LdIs111
17601 :ON CH OHS 8901 :ON CH OHS 9dIsa1
1760 :ON CH OHS IOU :ON CFI OHS S (AM
MO :ON CEI OHS NTT :ON CEI OHS tdMU
17601 :ON CH OHS 6601 :ON CH OHS (1101
17601 :ON CH OHS 8601 :ON CH OHS ZdIsal
g60 :ON CEI OHS SO :ON CEI OHS I (AM
6011 :ON CH OHS ZZOT :ON CFI OHS 179(1101
**ON at Oas PPV oumw -LOD *ON at Oas vtoit 3UIM (AM
saxaiduma disal :SI 3Plui
Of' '44 3 3 S*
LITT:ON m OHS 60T FON CEI OHS L-103
9TIFON CEI OHS 80T FON CEI OHS 9-TO3
SIMON m OHS LOT :ON CEI OHS S-103
17T TFON m OHS L60-1 :ON CEI OHS 17- TOD
ET FON m OHS 960T :ON CEI OHS 1O3
ZITFON im OHS g60 :ON CEI OHS Z-103
TFON im OHS 17601:0N CH OHS 1- TOD
V008H SINS
OTT FON im OHS ZEOT :ON CH OHS -SINs-UdDsV-s!H
*ON at Oas *ON at Oas PPV
appinianN lunreA -LOD ou-Ruv lunreA jjcI atlunreA IAD
sluoguA uploid HOD :rj appi,
tS890/0ZOZSI1IIDd 0t06II/IZOZ OM
LO-90-ZZOZ SSOV9TE0 VD
9c1
3iqUi 33S**
3iqUi 33S*
ç601 :ON CH OHS ZZOI :ON CH OHS 9c1N11
17601 :ON CH OHS ItOI :ON CH OHS Z9c1N11
ç601 :ON CH OHS ItOI :ON CH OHS I9c1N11
17601 :ON CH OHS 8901 :ON CH OHS 09c1N11
17601 :ON CH OHS L901 :ON CH OHS
17601 :ON CH OHS ISOI :ON CH OHS
17601 :ON CH OHS 0901 :ON CH OHS LdMll
17601 :ON CH OHS 6g0I :ON CH OHS
17601 :ON CH OHS scot :ON CH OHS
17601 :ON CH OHS LSOI :ON CH OHS 17ScINII
17601 :ON CH OHS 9g01 :ON OHS ScINI1
17601 :ON CH OHS SSOI :ON CH OHS ZdMU
17601 :ON CH OHS 17g0I :ON CH OHS idMll
17601 :ON CH OHS EgOI :ON CH OHS
17601 :ON CH OHS 81701 :ON CH OHS 617c1N11
17601 :ON CH OHS ZSOI :ON CH OHS 817c1N11
17601 :ON CH OHS L1701 :ON CH OHS Ltc1N11
17601 :ON CH OHS 91701 :ON CH OHS 917c1N11
17601 :ON CH OHS ZZOI :ON CH OHS Stc1N11
ZEOT :ON CFI OHS 61701 :ON CH OHS 1717c1N11
ZEOI :ON CH OHS 81701 :ON CH OHS 17c1N11
ZEOT :ON CFI OHS L1701 :ON CH OHS Z17c1N11
ZEOT :ON CFI OHS 91701 :ON CH OHS Itc1N11
ZEOI :ON CH OHS g170I :ON CH OHS 017c1N11
ZEOT :ON CFI OHS 171701 :ON CH OHS 6c1N11
ZEOT :ON CFI OHS 1701 :ON CH OHS 8c1N11
tS890/0ZOZSI1/134:1
OtO6II/IZOZ OM
LO-90-ZZOZ SSOV9TE0 VD
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Table 16: Cpfl HBG1 targeting domains and expected cleavage sites
gRNA ID gRNA gRNA Targeting Expected Strand
Targeting
Targeting Targeting Domain cleavage site Domain
Domain Domain coordinates at coordinates at Length
(RNA) (DNA) HBG1 * HBG1#
HBG1-1 CCUUGU CCTTGTCA Chr 1 1 :5249954¨ Chr 1 1:5249973, + 20
CAAGGC AGGCTATT 5249974 Chr 1 1:5249977
UAUUGG GGTC (SEQ
UC (SEQ ID NO:1003)
ID
NO:1002)
HBG1-1 CCUUGU CCTTGTCA Chr 1 1 :5249954¨ Chr 1 1:5249973, + 21
(21mer) CAAGGC AGGCTATT Chrll :5249975 Chr11:5249977
UAUUGG GGTCA (SEQ
UCA (SEQ ID NO:1255)
ID
NO:1254)
HBG1-1 CCUUGU CCTTGTCA Chr 1 1 :5249954¨ Chr 1 1:5249973, + 22
(22mer) CAAGGC AGGCTATT Chrll :5249976 Chr11:5249977
UAUUGG GGTCAA
UCAA (SEQ ID
(SEQ ID NO:1257)
NO:1256)
HBG1-1 CCUUGU CCTTGTCA Chr 1 1 :5249954¨ Chr 1 1:5249973, + 23
(23mer) CAAGGC AGGCTATT Chrll :5249976 Chr11:5249977
UAUUGG GGTCAAG
UCAAG (SEQ ID
(SEQ ID NO:1259)
NO:1258)
AsCpfl AGACAG AGACAGAT Chr 1 1 :5250023- Chr 1 1:5250042, + 20
HBG1 AUAUUU ATTTGCATT Chr 1 1 :5250043 Chr 1 1:5250046
Promoter-1 GCAUUG GAG (SEQ ID
AG (SEQ NO:1140)
ID
NO:1139)
AsCpfl AGACAG AGACAGAT Chr 1 1:5250042, + 21
HBG1 AUAUUU ATTTGCATT Chr 1 1:5250046
Promoter-1 GCAUUG GAGA (SEQ
(21mer) AGA (SEQ ID NO:1261) Chr 1 1 :5250023-
ID Chr 1 1 :5250044
NO:1260)
AsCpfl CAUUGA CATTGAGA Chr 1 1 :5250036- Chr 1 1:5250055, + 20
HBG1 GAUAGU TAGTGTGG Chr 1 1:5250056 Chr 1 1:5250059
Promoter-2 GUGGGG GGAA (SEQ
AA (SEQ ID NO:1142)
ID
NO:1141)
AsCpfl CAUUGA CATTGAGA Chr 1 1 :5250036- Chr 1 1:5250055, + 21
HBG1 GAUAGU TAGTGTGG Chr 1 1:5250057 Chr 1 1:5250059
Promoter-2 GUGGGG GGAAG
(21mer) AAG (SEQ (SEQ ID
NO:1263)
157
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
ID
NO:1262)
AsCpfl CUUCUC CTTCTCCCA Chr11:5250160- Chrl 1:5250179, + 20
HBG1 CCAUCA TCATAGAG Chr11:5250180 Chrl 1:5250183
Promoter-6 UAGAGG GAT (SEQ ID
AU (SEQ NO:1150)
ID
NO:1149)
AsCpfl CUUCUC CTTCTCCCA Chr11:5250160- Chrl 1:5250179, + 21
HBG1 CCAUCA TCATAGAG Chr11:5250181 Chrl 1:5250183
Promoter-6 UAGAGG GATA (SEQ
(21mer) AUA (SEQ ID NO:1265)
ID
NO:1264)
*NCBI Reference Sequence NC_000011, the coordinates are reported using the One-
based coordinate
system, "Homo sapiens chromosome 11, GRCh38.p12 Primary Assembly," (Version
NC_000011.10).
# Expected cleavage sites based on Zetsche et al, 2015, coordinates are
reported using zero-based
coordinates.
158
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Table 17: Cpfl HBG2 targeting domains and expected cleavage sites
gRNA ID gRNA gRNA Targeting Expected
Strand Targeting
Targeting Targeting Domain cleavage site Domain
Domain Domain (DNA) coordinates at coordinates at Length
(RNA) HBG2 * HBG2#
HBG1-1 CCUUGUC CCTTGTCAA Chr11:5254878 Chrl 1:5254897, + 20
AAGGCUA GGCTATTGG Chr11:5254898 Chrl 1:5254901
UUGGUC TC (SEQ ID
(SEQ ID NO:1003)
NO:1002)
HBG1-1 CCUUGUC CCTTGTCAA Chr11:5254878 Chrl 1:5254897, + 21
21mer AAGGCUA GGCTATTGG Chr11:5254899 Chrl 1:5254901
UUGGUCA TCA (SEQ ID
(SEQ ID NO:1255)
NO:1254)
HBG1-1 CCUUGUC CCTTGTCAA Chr11:5254878 Chrl 1:5254897, + 22
22mer AAGGCUA GGCTATTGG Chr11:5254900 Chrl 1:5254901
UUGGUCA TCAA (SEQ ID
A (SEQ ID NO:1257)
NO:1256)
HBG1-1 CCUUGUC CCTTGTCAA Chr11:5254878 Chrl 1:5254897, + 23
23mer AAGGCUA GGCTATTGG Chr11:5254901 Chrl 1:5254901
UUGGUCA TCAAG (SEQ
AG (SEQ ID ID NO:1259)
NO:1258)
AsCpfl AGACAGA AGACAGATA Chr11:5254947 Chrl 1:5254966 + 20
HBG1 UAUUUGC TTTGCATTG Chr11:5254967 Chrl 1:5254970
Promoter-1 AUUGAG AG (SEQ ID
(SEQ ID NO:1140)
NO:1139)
AsCpfl AGACAGA AGACAGATA Chrl 1:5254966 + 21
HBG1 UAUUUGC TTTGCATTG Chrl 1:5254970
Promoter-1 AUUGAGA AGA (SEQ ID Chr11:5254947
(21mer) (SEQ ID NO:1261) Chr 11:5254968
NO:1260)
AsCpfl CAUUGAG CATTGAGAT Chr11:5254960 Chrl 1:5254979 + 20
HBG1 AUAGUGU AGTGTGGGG Chrll :5254980 Chr 1 1:5254983
Promoter-2 GGGGAA AA
(SEQ ID (SEQ ID
NO:1141) NO:1142)
AsCpfl CAUUGAG CATTGAGAT Chr11:5254960 Chrl 1:5254979 + 21
HBG1 AUAGUGU AGTGTGGGG Chrll :5254981 Chr 1 1:5254983
Promoter-2 GGGGAAG AAG (SEQ ID
(21mer) (SEQ ID NO:1263)
NO:1262)
*NCBI Reference Sequence NC_000011, the coordinates are reported using the One-
based coordinate
system, "Homo sapiens chromosome 11, GRCh38.p12 Primary Assembly," (Version
NC_000011.10).
# Expected cleavage sites based on (Zetsche et al, 2015), coordinates are
reported using zero-based
coordinates.
159
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Table 18: gRNA 5' Extensions
5' extension
Sequence ID 5' extension sequence 5' modification
No:
1231 rCrUrUrUrU +5 RNA
1232 rArArGrArCrCrUrUrUrU +10 RNA
1233 rArUrGrUrGrUrUrUrUrUrGrUrCrArArArArGrArCrCrUrUrUrU +25 RNA
rArGrGrCrCrArGrCrUrUrGrCrCrGrGrUrUrUrUrUrUrArGrUrCrG
rUrGrCrUrGrCrUrUrCrArUrGrUrGrUrUrUrUrUrGrUrCrArArAr +60 RNA
1234 ArGrArCrCrUrUrUrU
1235 CTTTT +5 DNA
1236 AAGACCTTTT +10 DNA
1237 ATGTGTTTTTGTCAAAAGACCTTTT +25 DNA
AGGCCAGCTTGCCGGTTTTTTAGTCGTGCTGCTTCATGTG
1238 TTTTTGTCAAAAGACCTTTT +60 DNA
1239 TTTTTGTCAAAAGACCTTTT +20 DNA
1240 GCTTCATGTGTTTTTGTCAAAAGACCTTTT +30 DNA
GCCGGTTTTTTAGTCGTGCTGCTTCATGTGTTTTTGTCAAA
1241 AGACCTTTT +50 DNA
1242 TAGTCGTGCTGCTTCATGTGTTTTTGTCAAAAGACCTTTT +40 DNA
1243 C*C*GAAGTTTTCTTCGGTTTT +20 DNA + 2xPS
1244 T*T*TTTCCGAAGTTTTCTTCGGTTTT +25 DNA + 2xPS
1245 A*A*CGCTTTTTCCGAAGTTTTCTTCGGTTTT +30 DNA + 2xPS
G*C*GTTGTTTTCAACGCTTTTTCCGAAGTTTTCTTCGGTT
1246 TT +41 DNA + 2xPS
G*G*CTTCTTTTGAAGCCTTTTTGCGTTGTTTTCAACGCTT
1247 TTTCCGAAGTTTTCTTCGGTTTT +62 DNA + 2xPS
1248 A*T*GTGTTTTTGTCAAAAGACCTTTT +25 DNA + 2xPS
1249 AAAAAAAAAAAAAAAAAAAAAAAAA +25 A
1250 TTTTTTTTTTTTTTTTTTTTTTTTT +25 T
mA*mU*rGrUrGrUrUrUrUrUrGrUrCrArArArArGrArCrCrUrUrU
1251 rU +25 RNA + 2xPS
mA*mA*rArArArArArArArArArArArArArArArArArArArArAr PolyA RNA +
1252 ArA 2xPS
mU*mU*rUrUrUrUrUrUrUrUrUrUrUrUrUrUrUrUrUrUrUrUrUr PolyU RNA +
1253 UrU 2xPS
All bases are in upper case
Lowercase "r" represents RNA, 2'-hydroxy; bases not modified by an "r" are DNA
All bases are linked via standard phosphodiester bonds except as noted:
represents phosphorothioate modification
"PS" represents phosphorothioate modification
160
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Table 13: Cpfl guide RNAs
gRNA gRNA Sequence 5' mod.** 3' mod. Length of Length of gRNA
Sequence crRNA + gRNA Targeting
SEQ ID gRNA targeting Domain
NO. targeting domain (RNA)
domain
1022 rUrArArUrUrUrCr - - 40 20 CCUUGUC
UrArCrUrCrUrUrG AAGGCUA
rUrArGrArUrCrCr UUGGUC
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1002)
GrUrC
1023 rUrArArUrUrUrCr - 1xPS2- 41 21 CCUUGUC
UrArCrUrCrUrUrG OMe + AAGGCUA
rUrArGrArUrCrCr 1 x0Me UUGGUCA
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1254)
GrUmC/P S2/mA
1041 rUrArArUrUrUrCr - 1xP52- 40 20 CCUUGUC
UrArCrUrCrUrUrG OMe + AAGGCUA
rUrArGrArUrCrCr 1 x0Me UUGGUC
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1002)
GmU/P S2/mC
1042 rCrUrUrUrUrUrAr +5 RNA - 45 20 CCUUGUC
ArUrUrUrCrUrArC AAGGCUA
rUrCrUrUrGrUrAr UUGGUC
GrArUrCrCrUrUrG (SEQ ID
rUrCrArArGrGrCr NO:1002)
UrArUrUrGrGrUrC
1043 rArArGrArCrCrUr +10 RNA - 50 20 CCUUGUC
UrUrUrUrArArUr AAGGCUA
UrUrCrUrArCrUrC UUGGUC
rUrUrGrUrArGrAr (SEQ ID
UrCrCrUrUrGrUrC NO:1002)
rArArGrGrCrUrAr
UrUrGrGrUrC
1044 rArUrGrUrGrUrUr +25 RNA - 65 20 CCUUGUC
UrUrUrGrUrCrArA AAGGCUA
rArArGrArCrCrUr UUGGUC
UrUrUrUrArArUr
161
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
UrUrCrUrArCrUrC (SEQ ID
rUrUrGrUrArGrAr NO:1002)
UrCrCrUrUrGrUrC
rArArGrGrCrUrAr
UrUrGrGrUrC
1045 rArGrGrCrCrArGr +60 RNA - 100 20 CCUUGUC
CrUrUrGrCrCrGrG AAGGCUA
rUrUrUrUrUrUrAr UUGGUC
GrUrCrGrUrGrCrU (SEQ ID
rGrCrUrUrCrArUr NO:1002)
GrUrGrUrUrUrUr
UrGrUrCrArArArA
rGrArCrCrUrUrUr
UrUrArArUrUrUrC
rUrArCrUrCrUrUr
GrUrArGrArUrCrC
rUrUrGrUrCrArAr
GrGrCrUrArUrUrG
rGrUrC
1046 CTTTTrUrArArUr +5 DNA - 45 20 CCUUGUC
UrUrCrUrArCrUrC AAGGCUA
rUrUrGrUrArGrAr UUGGUC
UrCrCrUrUrGrUrC (SEQ ID
rArArGrGrCrUrAr NO:1002)
UrUrGrGrUrC
1047 AAGACCTTTTrUr +10 DNA - 50 20 CCUUGUC
ArArUrUrUrCrUrA AAGGCUA
rCrUrCrUrUrGrUr UUGGUC
ArGrArUrCrCrUrU (SEQ ID
rGrUrCrArArGrGr NO:1002)
CrUrArUrUrGrGrU
rC
1048 ATGTGTTTTTGT +25 DNA - 65 20 CCUUGUC
CAAAAGACCTT AAGGCUA
TTrUrArArUrUrUr UUGGUC
CrUrArCrUrCrUrU (SEQ ID
rGrUrArGrArUrCr NO:1002)
CrUrUrGrUrCrArA
rGrGrCrUrArUrUr
GrGrUrC
1049 AGGCCAGCTTG +60 DNA - 100 20 CCUUGUC
CCGGTTTTTTAG AAGGCUA
TCGTGCTGCTTC UUGGUC
ATGTGTTTTTGT
162
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
CAAAAGACCTT (SEQ ID
TTrUrArArUrUrUr NO:1002)
CrUrArCrUrCrUrU
rGrUrArGrArUrCr
CrUrUrGrUrCrArA
rGrGrCrUrArUrUr
GrGrUrC
1050 ATGTGTTTTTGT +25 DNA 1xPS2- 66 21 CCUUGUC
CAAAAGACCTT OMe + AAGGCUA
TTrUrArArUrUrUr 1 x0Me UUGGUCA
CrUrArCrUrCrUrU (SEQ ID
rGrUrArGrArUrCr NO:1254)
CrUrUrGrUrCrArA
rGrGrCrUrArUrUr
GrGrUmC/P52/mA
1051 ATGTGTTTTTGT +25 DNA 1xPS- 66 21 CCUUGUC
CAAAAGACCTT OMe AAGGCUA
TTrUrArArUrUrUr UUGGUCA
CrUrArCrUrCrUrU (SEQ ID
rGrUrArGrArUrCr NO:1254)
CrUrUrGrUrCrArA
rGrGrCrUrArUrUr
GrGrUrC*mA
1052 TTTTTGTCAAAA +20 DNA - 60 20 CCUUGUC
GACCTTTTrUrAr AAGGCUA
ArUrUrUrCrUrArC UUGGUC
rUrCrUrUrGrUrAr (SEQ ID
GrArUrCrCrUrUrG NO:1002)
rUrCrArArGrGrCr
UrArUrUrGrGrUrC
1053 GCTTCATGTGTT +30 DNA - 70 20 CCUUGUC
TTTGTCAAAAG AAGGCUA
ACCTTTTrUrArAr UUGGUC
UrUrUrCrUrArCrU (SEQ ID
rCrUrUrGrUrArGr NO:1002)
ArUrCrCrUrUrGrU
rCrArArGrGrCrUr
ArUrUrGrGrUrC
1054 GCCGGTTTTTTA +50 DNA - 90 20 CCUUGUC
GTCGTGCTGCTT AAGGCUA
CATGTGTTTTTG UUGGUC
TCAAAAGACCT (SEQ ID
TTTrUrArArUrUr NO:1002)
UrCrUrArCrUrCrU
163
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
rUrGrUrArGrArUr
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrC
1055 TAGTCGTGCTGC +40 DNA - 80 20 CCUUGUC
TTCATGTGTTTT AAGGCUA
TGTCAAAAGAC UUGGUC
CTTTTrUrArArUr (SEQ ID
UrUrCrUrArCrUrC NO:1002)
rUrUrGrUrArGrAr
UrCrCrUrUrGrUrC
rArArGrGrCrUrAr
UrUrGrGrUrC
1056 C*C*GAAGTTTT +20 DNA - 60 20 CCUUGUC
CTTCGGTTTTrUr + 2xPS AAGGCUA
ArArUrUrUrCrUrA UUGGUC
rCrUrCrUrUrGrUr (SEQ ID
ArGrArUrCrCrUrU NO:1002)
rGrUrCrArArGrGr
CrUrArUrUrGrGrU
rC
1057 T*T*TTTCCGAA +25 DNA - 65 20 CCUUGUC
GTTTTCTTCGGT + 2xPS AAGGCUA
TTTrUrArArUrUr UUGGUC
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1002)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrC
1058 A*A*CGCTTTTT +30 DNA - 70 20 CCUUGUC
CCGAAGTTTTCT + 2xPS AAGGCUA
TCGGTTTTrUrAr UUGGUC
ArUrUrUrCrUrArC (SEQ ID
rUrCrUrUrGrUrAr NO:1002)
GrArUrCrCrUrUrG
rUrCrArArGrGrCr
UrArUrUrGrGrUrC
1059 G*C*GTTGTTTT +41 DNA - 81 20 CCUUGUC
CAACGCTTTTTC + 2xPS AAGGCUA
CGAAGTTTTCTT UUGGUC
CGGTTTTrUrArAr (SEQ ID
UrUrUrCrUrArCrU NO:1002)
rCrUrUrGrUrArGr
ArUrCrCrUrUrGrU
164
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
rCrArArGrGrCrUr
ArUrUrGrGrUrC
1060 G*G*CTTCTTTT +62 DNA - 102 20 CCUUGUC
GAAGCCTTTTTG + 2xPS AAGGCUA
CGTTGTTTTCAA UUGGUC
CGCTTTTTCCGA (SEQ ID
AGTTTTCTTCGG NO:1002)
TTTTrUrArArUrUr
UrCrUrArCrUrCrU
rUrGrUrArGrArUr
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrC
1061 mUrArArUrUrUrC lx0Me - 40 20 CCUUGUC
rUrArCrUrCrUrUr AAGGCUA
GrUrArGrArUrCrC UUGGUC
rUrUrGrUrCrArAr (SEQ ID
GrGrCrUrArUrUrG NO:1002)
rGrUrC
1062 mU*rArArUrUrUr 1xPS-0Me - 40 20 CCUUGUC
CrUrArCrUrCrUrU AAGGCUA
rGrUrArGrArUrCr UUGGUC
CrUrUrGrUrCrArA (SEQ ID
rGrGrCrUrArUrUr NO:1002)
GrGrUrC
1063 mUmArArUrUrUr 2x0Me - 40 20 CCUUGUC
CrUrArCrUrCrUrU AAGGCUA
rGrUrArGrArUrCr UUGGUC
CrUrUrGrUrCrArA (SEQ ID
rGrGrCrUrArUrUr NO:1002)
GrGrUrC
1064 mU*mA*rArUrUr 2xPS-0Me - 40 20 CCUUGUC
UrCrUrArCrUrCrU AAGGCUA
rUrGrUrArGrArUr UUGGUC
CrCrUrUrGrUrCrA (SEQ ID
rArGrGrCrUrArUr NO:1002)
UrGrGrUrC
1065 mUmAmArUrUrUr 3x0Me - 40 20 CCUUGUC
CrUrArCrUrCrUrU AAGGCUA
rGrUrArGrArUrCr UUGGUC
CrUrUrGrUrCrArA (SEQ ID
NO:1002)
165
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
rGrGrCrUrArUrUr
GrGrUrC
1066 mU*mA*mA*rUr 3xPS-OMe - 40 20 CCUUGUC
UrUrCrUrArCrUrC AAGGCUA
rUrUrGrUrArGrAr UUGGUC
UrCrCrUrUrGrUrC (SEQ ID
rArArGrGrCrUrAr NO:1002)
UrUrGrGrUrC
1067 A*T*GTGTTTTT +25 DNA - 65 20 CCUUGUC
GTCAAAAGACC + 2xPS AAGGCUA
TTTTrUrArArUrUr UUGGUC
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1002)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrC
1068 A*T*GTGTTTTT +25 DNA 1xPS- 66 21 CCUUGUC
GTCAAAAGACC + 2xPS OMe AAGGCUA
TTTTrUrArArUrUr UUGGUCA
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1254)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrC*mA
1069 rUrArArUrUrUrCr - 1xPS- 41 21 CCUUGUC
UrArCrUrCrUrUrG OMe AAGGCUA
rUrArGrArUrCrCr UUGGUCA
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1254)
GrUrC*mA
1070 rUrArArUrUrUrCr - 1xP5- 42 21 CCUUGUC
UrArCrUrCrUrUrG OMe + AAGGCUA
rUrArGrArUrCrCr rU UUGGUCA
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1254)
GrUrCmA*rU
1071 rUrArArUrUrUrCr - rU 41 20 CCUUGUC
UrArCrUrCrUrUrG AAGGCUA
rUrArGrArUrCrCr UUGGUC
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1002)
GrUrCrU
166
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
1072 rUrArArUrUrUrCr - rU 42 21 CCUUGUC
UrArCrUrCrUrUrG AAGGCUA
rUrArGrArUrCrCr UUGGUCA
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1254)
GrUrCrArU
1073 rUrArArUrUrUrCr - rU 44 23 CCUUGUC
UrArCrUrCrUrUrG AAGGCUA
rUrArGrArUrCrCr UUGGUCA
UrUrGrUrCrArArG AG (SEQ ID
rGrCrUrArUrUrGr NO:1258)
GrUrCrArArGrU
1074 A*T*GTGTTTTT +25 DNA rU 66 20 CCUUGUC
GTCAAAAGACC + 2xPS AAGGCUA
TTTTrUrArArUrUr UUGGUC
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1002)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrCrU
1075 A*T*GTGTTTTT +25 DNA rU 69 23 CCUUGUC
GTCAAAAGACC + 2xPS AAGGCUA
TTTTrUrArArUrUr UUGGUCA
UrCrUrArCrUrCrU AG (SEQ ID
rUrGrUrArGrArUr NO:1258)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrCrArArG
rU
1076 rUrArArUrUrUrCr - - 41 21 CCUUGUC
UrArCrUrCrUrUrG AAGGCUA
rUrArGrArUrCrCr UUGGUCA
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1254)
GrUrCrA
1077 rUrArArUrUrUrCr - - 43 23 CCUUGUC
UrArCrUrCrUrUrG AAGGCUA
rUrArGrArUrCrCr UUGGUCA
UrUrGrUrCrArArG AG (SEQ ID
rGrCrUrArUrUrGr NO:1258)
GrUrCrArArG
167
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
1078 A*T*GTGTTTTT +25 DNA - 68 23 CCUUGUC
GTCAAAAGACC + 2xPS AAGGCUA
TTTTrUrArArUrUr UUGGUCA
UrCrUrArCrUrCrU AG (SEQ ID
rUrGrUrArGrArUr NO:1258)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrCrArArG
1079 rUrArArUrUrUrCr - 4xrU 44 20 CCUUGUC
UrArCrUrCrUrUrG AAGGCUA
rUrArGrArUrCrCr UUGGUC
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1002)
GrUrCrUrUrUrU
1080 rUrArArUrUrUrCr - 3xPS- 44 20 CCUUGUC
UrArCrUrCrUrUrG OMe-U AAGGCUA
rUrArGrArUrCrCr + rU UUGGUC
UrUrGrUrCrArArG (SEQ ID
rGrCrUrArUrUrGr NO:1002)
GrUrCmU*mU*m
U*rU
1081 A*T*GTGTTTTT +25 DNA 4xrU 69 20 CCUUGUC
GTCAAAAGACC + 2xPS AAGGCUA
TTTTrUrArArUrUr UUGGUC
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1002)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrCrUrUrU
rU
1082 AAAAAAAAAAA +25 A 1xPS- 66 21 CCUUGUC
AAAAAAAAAAA OMe AAGGCUA
AAArUrArArUrUr UUGGUCA
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1254)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrC*mA
1083 TTTTTTTTTTTTT +25 T 1xPS- 66 21 CCUUGUC
TTTTTTTTTTTTr OMe AAGGCUA
UrArArUrUrUrCrU UUGGUCA
rArCrUrCrUrUrGr (SEQ ID
UrArGrArUrCrCrU NO:1254)
rUrGrUrCrArArGr
168
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
GrCrUrArUrUrGrG
rUrC *mA
1084 C*C*GAAGTTTT +20 DNA 1 xP S- 61 21 CCUUGUC
CTTCGGTTTTrUr + 2xP S OMe AAGGCUA
ArArUrUrUrCrUrA UUGGUCA
rCrUrCrUrUrGrUr (SEQ ID
ArGrArUrCrCrUrU NO:1254)
rGrUrCrArArGrGr
CrUrArUrUrGrGrU
rC*mA
1085 rUrArArUrUrUrCr - 1xPS- 41 21 AGACAGA
UrArCrUrCrUrUrG OMe UAUUUGC
rUrArGrArUrArGr AUU GAGA
ArCrArGrArUrArU (SEQ ID
rUrUrGrCrArUrUr NO:1260)
GrArG*mA
1086 ATGTGTTTTTGT +25 DNA 1 xP S- 66 21 AGACAGA
CAAAAGACCTT OMe UAUUUGC
TTrUrArArUrUrUr AUU GAGA
CrUrArCrUrCrUrU (SEQ ID
rGrUrArGrArUrAr NO:1260)
GrArCrArGrArUrA
rUrUrUrGrCrArUr
UrGrArG*mA
1087 C*C*GAAGTTTT +20 DNA 1 xP S- 61 21 AGACAGA
CTTCGGTTTTrUr + 2xP S OMe UAUUUGC
ArArUrUrUrCrUrA AUU GAGA
rCrUrCrUrUrGrUr (SEQ ID
ArGrArUrArGrArC NO:1260)
rArGrArUrArUrUr
UrGrCrArUrUGrAr
G*mA
1088 rUrArArUrUrUrCr - 1xPS- 41 21 CAUUGAG
UrArCrUrCrUrUrG OMe AUAGUGU
rUrArGrArUrCrAr GGGGAAG
UrUrGrArGrArUr (SEQ ID
ArGrUrGrUrGrGr NO:1262)
GrGrArA*mG
1089 ATGTGTTTTTGT +25 DNA 1 xP S- 66 21 CAUUGAG
CAAAAGACCTT OMe AUAGUGU
TTrUrArArUrUrUr GGGGAAG
CrUrArCrUrCrUrU
rGrUrArGrArUrCr
169
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
ArUrUrGrArGrAr (SEQ ID
UrArGrUrGrUrGr NO:1262)
GrGrGrArA*mG
1090 C*C*GAAGTTTT +20 DNA 1 xP S- 61 21 CAUUGAG
CTTCGGTTTTrUr + 2xP S OMe AUAGUGU
ArArUrUrUrCrUrA GGGGAAG
rCrUrCrUrUrGrUr (SEQ ID
ArGrArUrCrArUrU NO:1262)
rGrArGrArUrArGr
Ur GrUr GrGr GrGr
ArA*mG
1091 rUrArArUrUrUrCr - 1xP5- 41 21 CUUCUCC
UrArCrUrCrUrUrG OMe CAUCAUA
rUrArGrArUrCrUr GAGGAUA
UrCrUrCrCrCrArU (SEQ ID
rCrArUrArGrArGr NO:1264)
GrArU*mA
1092 ATGTGTTTTTGT +25 DNA 1 xP S- 66 21 CUUCUCC
CAAAAGACCTT OMe CAUCAUA
TTrUrArArUrUrUr GAGGAUA
CrUrArCrUrCrUrU (SEQ ID
rGrUrArGrArUrCr NO:1264)
UrUrCrUrCrCrCrA
rUrCrArUrArGrAr
GrGrArU*mA
1093 C*C*GAAGTTTT +20 DNA 1 xP S- 61 21 CUUCUCC
CTTCGGTTTTrUr + 2xP S OMe CAUCAUA
ArArUrUrUrCrUrA GAGGAUA
rCrUrCrUrUrGrUr (SEQ ID
ArGrArUrCrUrUrC NO:1264)
rUrCrCrCrArUrCr
ArUrArGrArGrGr
ArU*mA
1098 A*T*GTGTTTTT +25 DNA 1 xP S- 67 21 CCUUGUC
GTCAAAAGACC + 2xPS OMe + AAGGCUA
TTTTrUrArArUrUr rU UUGGUCA
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1254)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
Ur GrGrUrCmA*rU
170
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
1099 A*T*GTGTTTTT +25 DNA 2xPS- 68 22 CCUUGUC
GTCAAAAGACC + 2xPS OMe + AAGGCUA
TTTTrUrArArUrUr rU UUGGUCA
UrCrUrArCrUrCrU A (SEQ ID
rUrGrUrArGrArUr NO:1256)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrCmA*m
A*rU
1100 A*T*GTGTTTTT +25 DNA 1xPS- 66 20 CCUUGUC
GTCAAAAGACC + 2xPS OMe + AAGGCUA
TTTTrUrArArUrUr rU UUGGUC
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1002)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUmC*rU
1101 A*T*GTGTTTTT +25 DNA 1xPS- 65 20 CCUUGUC
GTCAAAAGACC + 2xPS OMe AAGGCUA
TTTTrUrArArUrUr UUGGUC
UrCrUrArCrUrCrU (SEQ ID
rUrGrUrArGrArUr NO:1002)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrU*mC
1102 A*T*GTGTTTTT +25 DNA 2xPS- 67 22 CCUUGUC
GTCAAAAGACC + 2xPS OMe AAGGCUA
TTTTrUrArArUrUr UUGGUCA
UrCrUrArCrUrCrU A (SEQ ID
rUrGrUrArGrArUr NO:1256)
CrCrUrUrGrUrCrA
rArGrGrCrUrArUr
UrGrGrUrC*mA*
mA
1103 mA*mU*rGrUrGr +25 RNA 1xPS- 66 21 CCUUGUC
UrUrUrUrUrGrUrC + 2xPS OMe AAGGCUA
rArArArArGrArCr UUGGUCA
CrUrUrUrUrUrArA (SEQ ID
rUrUrUrCrUrArCr NO:1254)
UrCrUrUrGrUrArG
rArUrCrCrUrUrGr
UrCrArArGrGrCrU
rArUrUrGrGrUrC*
mA
171
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
1104 mA*mA*rArArAr PolyA 1xPS- 66 21 CCUUGUC
ArArArArArArAr RNA + OMe AAGGCUA
ArArArArArArAr 2xPS UUGGUCA
ArArArArArArUr (SEQ ID
ArArUrUrUrCrUrA NO:1254)
rCrUrCrUrUrGrUr
ArGrArUrCrCrUrU
rGrUrCrArArGrGr
CrUrArUrUrGrGrU
rC*mA
1105 mU*mU*rUrUrUr PolyU 1xPS- 66 21 CCUUGUC
UrUrUrUrUrUrUr RNA + OMe AAGGCUA
UrUrUrUrUrUrUr 2xPS UUGGUCA
UrUrUrUrUrUrUr (SEQ ID
ArArUrUrUrCrUrA NO:1254)
rCrUrCrUrUrGrUr
ArGrArUrCrCrUrU
rGrUrCrArArGrGr
CrUrArUrUrGrGrU
rC*mA
All bases are in upper case
Lowercase "r" represents RNA, 2'-hydroxy; bases not modified by an "r" are DNA
All bases are linked via standard phosphodiester bonds except as noted:
represents phosphorothioate modification
"PS" represents phosphorothioate modification
"PS2" represents phosphorodithioate modification
"OMe" represents a 2'-o-methyl modification
"m" represents a 2' -o-methyl modification
**Table 18 provides a listing of the sequences of the gRNA 5' extensions
Table 24: Sp35 RNP and RNP58 Indels
Indel_id OA in "% in indel" MMEJ Genomic Genomic
HBG1 and
indel" Coordinates at Coordinates at
HBG2
Cpfl (RNP58)
HBG1 HBG2 Position
SpCas9
(Sp35 RNP)
chr11:5,249,961- chr11:5,254,885- HBG1/2
c.-
159 -18 NA 0.013503714 0.185309532 True 5,249,978 5,254,902
104 to -121
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -6 NA 0.011778239 0.050633257 False 5,249,972 5,254,896
110 to -115
chr11:5,249,969- chr11:5,254,893- HBG1/2
c.-
167 -4 NA 0.046087674 0.049159297 False 5,249,972 5,254,896
112 to -115
chr11:5,249,970- chr11:5,254,894- HBG1/2
c.-
168 -3 NA 0.072269874 0.044737417 False 5,249,972 5,254,896
113 to -115
chr11:5,249,959- chr11:5,254,883- HBG1/2
c.-
157 -13 NA 0.318812673 0.033628125 True 5,249,971 5,254,895
102 to -114
172
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -7 NA 0.001100303 0.027923354 False
5,249,974 5,254,898 111 to -117
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -5 NA 0.007076946 0.025412163 False
5,249,972 5,254,896 111 to -115
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -5 NA 0.000775213 0.024948138 False
5,249,975 5,254,899 114 to -118
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -5 NA 0.000475131 0.018288023 False
5,249,974 5,254,898 113 to -117
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -4 NA 0.001400385 0.017605634 False
5,249,974 5,254,898 114 to -117
chr11:5,249,969-
chr11:5,254,893- HBG1/2 c.-
167 -5 NA 0.000700193 0.014548531 False
5,249,973 5,254,897 112 to -116
chr11:5,249,966-
chr11:5,254,890- HBG1/2 c.-
164 -8 NA 0.002275626 0.01375696 False
5,249,973 5,254,897 109 to -116
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -8 NA 0.000625172 0.011982749 False
5,249,975 5,254,899 111 to -118
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -12 NA 0.000300083 0.01031772 False
5,249,979 5,254,903 111 to -122
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -2 NA 0.084173148 0.010263129 False
5,249,972 5,254,896 114 to -115
chr11:5,249,969-
chr11:5,254,893- HBG1/2 c.-
167 -6 NA 0.000500138 0.008952942 False
5,249,974 5,254,898 112 to -117
chr11:5,249,959-
chr11:5,254,883- HBG1/2 c.-
157 -18 NA 0.001650454 0.008024894 False
5,249,976 5,254,900 102 to -119
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -13 NA 0.012028308 0.006960367 False
5,249,980 5,254,904 111 to -123
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -10 NA 0.000050014 0.006359865 False
5,249,979 5,254,903 113 to -122
chr11:5,249,964-
chr11:5,254,888- HBG1/2 c.-
162 -22 NA 0.001050289 0.006086909 True
5,249,985 5,254,909 107 to -128
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -8 NA 0.000100028 0.00589584 False
5,249,978 5,254,902 114 to -121
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -9 NA 0.000050014 0.005868545 False
5,249,979 5,254,903 114 to -122
chr11:5,249,967-
chr11:5,254,891- HBG1/2 c.-
165 -7 NA 0.000425117 0.005704771 False
5,249,973 5,254,897 110 to -116
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -7 NA 0.000325089 0.005677476 False
5,249,977 5,254,901 114 to -120
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -8 NA 0.000200055 0.005349929 False
5,249,977 5,254,901 113 to -120
chr11:5,249,972-
chr11:5,254,896- HBG1/2 c.-
170 -2 NA 0.001025282 0.00515886 False
5,249,973 5,254,897 115 to -116
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -9 NA 0 0.005022382 False 5,249,978
5,254,902 113 to -121
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -6 NA 0.000150041 0.004967791 False
5,249,975 5,254,899 113 to -118
173
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -10 NA 0.000050014 0.004858609 False
5,249,980 5,254,904 114 to -123
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -11 NA 0.000025007 0.004749427 False
5,249,978 5,254,902 111 to -121
chr11:5,249,966-
chr11:5,254,890- HBG1/2 c.-
164 -23 NA 0.000125034 0.004722131 False
5,249,988 5,254,912 109 to -131
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -10 NA 0.000050014 0.00417622 False
5,249,977 5,254,901 111 to -120
chr11:5,249,969-
chr11:5,254,893- HBG1/2 c.-
167 -11 NA 0 0.004039742 False 5,249,979
5,254,903 .. 112 to -122
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -7 NA 0.000125034 0.003957856 False
5,249,976 5,254,900 113 to -119
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -11 NA 0.000125034 0.003794082 False
5,249,980 5,254,904 113 to -123
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -9 NA 0.000025007 0.003766787 False
5,249,976 5,254,900 111 to -119
chr11:5,249,969-
chr11:5,254,893- HBG1/2 c.-
167 -1 NA 0.000975268 0.0036849 False
5,249,969 5,254,893 112 to -112
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -2 NA 0.003325915 0.003575718 False
5,249,971 5,254,895 113 to -114
chr11:5,249,969-
chr11:5,254,893- HBG1/2 c.-
167 -9 NA 0.000075021 0.003521127 False
5,249,977 5,254,901 112 to -120
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -12 NA 0.000200055 0.003521127 False
5,249,981 5,254,905 113 to -124
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -15 NA 0.000050014 0.003493831 False
5,249,982 5,254,906 111 to -125
chr11:5,249,964-
chr11:5,254,888- HBG1/2 c.-
162 -7 NA 0.005901623 0.00343924 True
5,249,970 5,254,894 107 to -113
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -12 NA 0.001775488 0.003384649 False
5,249,982 5,254,906 114 to -125
chr11:5,249,970-
chr11:5,254,894- HBG1/2 c.-
168 -13 NA 0.001000275 0.003357353 False
5,249,982 5,254,906 113 to -125
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -4 NA 0.001000275 0.003111693 False
5,249,971 5,254,895 111 to -114
chr11:5,249,969-
chr11:5,254,893- HBG1/2 c.-
167 -10 NA 0.000050014 0.003057102 False
5,249,978 5,254,902 112 to -121
chr11:5,249,971-
chr11:5,254,895- HBG1/2 c.-
169 -13 NA 0.001500413 0.002756851 False
5,249,983 5,254,907 114 to -126
chr11:5,249,959-
chr11:5,254,883- HBG1/2 c.-
157 -19 NA 0.000075021 0.002483896 False
5,249,977 5,254,901 102 to -120
chr11:5,249,968-
chr11:5,254,892- HBG1/2 c.-
166 -14 NA 0.000025007 0.0024566 False
5,249,981 5,254,905 111 to -124
chr11:5,249,960-
chr11:5,254,884- HBG1/2 c.-
158 -14 NA 0.000050014 0.002429305 False
5,249,973 5,254,897 103 to -116
chr11:5,249,969-
chr11:5,254,893- HBG1/2 c.-
167 -3 NA 0.002700743 0.002402009 False
5,249,971 5,254,895 112 to -114
174
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
chr11:5,249,965- chr11:5,254,889- HBG1/2
c.-
163 -9 NA 0.000200055 0.002265531 False 5,249,973
5,254,897 108 to -116
chr11:5,249,964- chr11:5,254,888- HBG1/2
c.-
162 -8 NA 0.006076671 0.002156349 False 5,249,971
5,254,895 107 to -114
chr11:5,249,970- chr11:5,254,894- HBG1/2
c.-
168 -14 NA 0 0.002129053 False 5,249,983 5,254,907
113 to -126
chr11:5,249,969- chr11:5,254,893- HBG1/2
c.-
167 -16 NA 0.000050014 0.00196528 False 5,249,984
5,254,908 112 to -127
chr11:5,249,968- chr11:5,254,892- HBG1/2
c.-
166 -16 NA 0 0.001910689 False 5,249,983 5,254,907
111 to -126
chr11:5,249,971- chr11:5,254,895- HBG1/2
c.-
169 -14 NA 0.000125034 0.001910689 False 5,249,984
5,254,908 114 to -127
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -3 NA 0.000925254 0.001883393 False 5,249,969
5,254,893 110 to -112
chr11:5,249,959- chr11:5,254,883- HBG1/2
c.-
157 -23 NA 0.000100028 0.001856098 False 5,249,981
5,254,905 102 to -124
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -14 NA 0.000025007 0.001856098 False 5,249,980
5,254,904 110 to -123
chr11:5,249,968- chr11:5,254,892- HBG1/2
c.-
166 -27 NA 0.000225062 0.00171962 True 5,249,994
5,254,918 111 to -137
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -9 NA 0.000200055 0.001692324 False 5,249,975
5,254,899 110 to -118
chr11:5,249,969- chr11:5,254,893- HBG1/2
c.-
167 -18 NA 0.000250069 0.001665029 False 5,249,986
5,254,910 112 to -129
chr11:5,249,958- chr11:5,254,882- HBG1/2
c.-
156 -27 NA 0 0.001610438 True 5,249,984 5,254,908 --
101 to -127
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -2 NA 0.000425117 0.001610438 False 5,249,968
5,254,892 110 to -111
chr11:5,249,952- chr11:5,254,876- HBG1/2
c.-
150 -21 NA 0.000225062 0.001583142 False 5,249,972
5,254,896 95 to -115
chr11:5,249,954- chr11:5,254,878- HBG1/2
c.-
152 -24 NA 0.000225062 0.001583142 True 5,249,977
5,254,901 97 to -120
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -12 NA 0.000225062 0.001583142 False 5,249,978
5,254,902 110 to -121
chr11:5,249,969- chr11:5,254,893- HBG1/2
c.-
167 -2 NA 0.000850234 0.001583142 False 5,249,970
5,254,894 112 to -113
chr11:5,249,966- chr11:5,254,890- HBG1/2
c.-
164 -9 NA 0.000150041 0.001555847 False 5,249,974
5,254,898 109 to -117
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -11 NA 0.000025007 0.001528551 False 5,249,977
5,254,901 110 to -120
chr11:5,249,961- chr11:5,254,885- HBG1/2
c.-
159 -28 NA 0.000125034 0.001501256 True 5,249,988
5,254,912 104 to -131
chr11:5,249,971- chr11:5,254,895- HBG1/2
c.-
169 -6 NA 0.013753782 0.001501256 True 5,249,976
5,254,900 114 to -119
chr11:5,249,962- chr11:5,254,886- HBG1/2
c.-
160 -12 NA 0.000050014 0.00147396 False 5,249,973
5,254,897 105 to -116
175
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
chr11:5,249,947- chr11:5,254,871- HBG1/2
c.-
145 -32 NA 0.001125309 0.001446664 True 5,249,978
5,254,902 90 to -121
chr11:5,249,971- chr11:5,254,895- HBG1/2
c.-
169 -1 NA 0.096276476 0.001446664 False 5,249,971
5,254,895 114 to -114
chr11:5,249,965- chr11:5,254,889- HBG1/2
c.-
163 -10 NA 0.000125034 0.001419369 False 5,249,974
5,254,898 108 to -117
chr11:5,249,954- chr11:5,254,878- HBG1/2
c.-
152 -33 NA 0.000200055 0.001392073 True 5,249,986
5,254,910 97 to -129
chr11:5,249,958- chr11:5,254,882- HBG1/2
c.-
156 -15 NA 0.000750206 0.001392073 False 5,249,972
5,254,896 101 to -115
chr11:5,249,969- chr11:5,254,893- HBG1/2
c.-
167 -14 NA 0.000075021 0.001337482 False 5,249,982
5,254,906 112 to -125
chr11:5,249,960- chr11:5,254,884- HBG1/2
c.-
158 -16 NA 0 0.001310187 False 5,249,975 5,254,899
103 to -118
chr11:5,249,964- chr11:5,254,888- HBG1/2
c.-
162 -9 NA 0.002200605 0.001310187 False 5,249,972
5,254,896 107 to -115
chr11:5,249,966- chr11:5,254,890- HBG1/2
c.-
164 -10 NA 0.000325089 0.001310187 False 5,249,975
5,254,899 109 to -118
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -5 NA 0.001975543 0.001310187 False 5,249,971
5,254,895 110 to -114
chr11:5,249,971- chr11:5,254,895- HBG1/2
c.-
169 -11 NA 0.015704319 0.001310187 True 5,249,981
5,254,905 114 to -124
chr11:5,249,972- chr11:5,254,896- HBG1/2
c.-
170 -4 NA 0.00040011 0.001310187 False 5,249,975
5,254,899 115 to -118
chr11:5,249,954- chr11:5,254,878- HBG1/2
c.-
152 -29 NA 0.000450124 0.001282891 True 5,249,982
5,254,906 97 to -125
chr11:5,249,963- chr11:5,254,887- HBG1/2
c.-
161 -11 NA 0 0.0012283 False 5,249,973 5,254,897 106 to -
116
chr11:5,249,971- chr11:5,254,895- HBG1/2
c.-
169 -18 NA 0.000100028 0.0012283 False 5,249,988
5,254,912 114 to -131
chr11:5,249,966- chr11:5,254,890- HBG1/2
c.-
164 -27 NA 0.000275076 0.001201004 False 5,249,992
5,254,916 109 to -135
chr11:5,249,970- chr11:5,254,894- HBG1/2
c.-
168 -18 NA 0.000100028 0.001201004 False 5,249,987
5,254,911 113 to -130
chr11:5,249,970- chr11:5,254,894- HBG1/2
c.-
168 -23 NA 0 0.001201004 False 5,249,992 5,254,916
113 to -135
chr11:5,249,952- chr11:5,254,876- HBG1/2
c.-
150 -33 NA 0.000150041 0.001173709 False 5,249,984
5,254,908 95 to -127
chr11:5,249,953- chr11:5,254,877- HBG1/2
c.-
151 -20 NA 0.000225062 0.001173709 False 5,249,972
5,254,896 96 to -115
chr11:5,249,971- chr11:5,254,895- HBG1/2
c.-
169 -22 NA 0.000025007 0.001173709 False 5,249,992
5,254,916 114 to -135
chr11:5,249,964- chr11:5,254,888- HBG1/2
c.-
162 -14 NA 0.000125034 0.001146413 False 5,249,977
5,254,901 107 to -120
chr11:5,249,968- chr11:5,254,892- HBG1/2
c.-
166 -21 NA 0.000025007 0.001146413 False 5,249,988
5,254,912 111 to -131
176
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
chr11:5,249,962- chr11:5,254,886- HBG1/2
c.-
160 -11 NA 0.001675461 0.001119118 False 5,249,972 5,254,896
105 to -115
chr11:5,249,957- chr11:5,254,881- HBG1/2
c.-
155 -16 NA 0.000350096 0.001091822 False 5,249,972 5,254,896
100 to -115
chr11:5,249,968- chr11:5,254,892- HBG1/2
c.-
166 -26 NA 0 0.001091822 False 5,249,993 5,254,917
111 to -136
chr11:5,249,959- chr11:5,254,883- HBG1/2
c.-
157 -24 NA 0.000125034 0.001064527 False 5,249,982 5,254,906
102 to -125
chr11:5,249,967- chr11:5,254,891- HBG1/2
c.-
165 -15 NA 0.000050014 0.001064527 False 5,249,981 5,254,905
110 to -124
chr11:5,249,964- chr11:5,254,888- HBG1/2
c.-
162 -33 NA 0.000025007 0.001037231 True 5,249,996 5,254,920
107 to -139
chr11:5,249,965- chr11:5,254,889- HBG1/2
c.-
163 -12 NA 0.000100028 0.001037231 False 5,249,976 5,254,900
108 to -119
chr11:5,249,965- chr11:5,254,889- HBG1/2
c.-
163 -6 NA 0.001050289 0.001009936 False 5,249,970 5,254,894
108 to -113
chr11:5,249,966- chr11:5,254,890- HBG1/2
c.-
164 -28 NA 0.000175048 0.001009936 False 5,249,993 5,254,917
109 to -136
chr11:5,249,957- chr11:5,254,881- HBG1/2
c.-
155 -12 NA 0.001150316 0.000928049 True 5,249,968 5,254,892
100 to -111
chr11:5,249,939- chr11:5,254,863- HBG1/2
c.-
137 -27 NA 0.003901073 0.000846162 True 5,249,965 5,254,889
82 to -108
chr11:5,249,963- chr11:5,254,887- HBG1/2
c.-
161 -10 NA 0.001625447 0.000655093 False 5,249,972 5,254,896
106 to -115
chr11:5,249,972- chr11:5,254,896- HBG1/2
c.-
170 -10 NA 0.001050289 0.000545911 False 5,249,981 5,254,905
115 to -124
chr11:5,249,973- chr11:5,254,897- HBG1/2
c.-
171 -1 NA 0.018029958 0.000464024 False 5,249,973 5,254,897
116 to -116
chr11:5,249,956- chr11:5,254,880- HBG1/2
c.-
154 -18 NA 0.001325364 0.000327547 False 5,249,973 5,254,897
99 to -116
chr11:5,249,970- chr11:5,254,894- HBG1/2
c.-
168 -15 NA 0.007727125 0.000300251 True 5,249,984 5,254,908
113 to -127
chr11:5,249,973- chr11:5,254,897- HBG1/2
c.-
171 -2 NA 0.003325915 0.000191069 False 5,249,974 5,254,898
116 to -117
chr11:5,249,972- chr11:5,254,896- HBG1/2
c.-
170 1 A 0.001025282 0.000163773 False 5,249,970 5,254,894
115 to -113
chr11:5,249,973- chr11:5,254,897- HBG1/2
c.-
171 1 C 0.007877166 0.000054591 False 5,249,971 5,254,895
116 to -114
chr11:5,249,971- chr11:5,254,895- HBG1/2
c.-
169 2 GG 0.004901348 0.000027296 False 5,249,968 5,254,892
114 to -111
chr11:5,249,971- chr11:5,254,895- HBG1/2
c.-
169 1 G 0.033684263 0 False 5,249,969 5,254,893 114 to -
112
chr11:5,249,972- chr11:5,254,896- HBG1/2
c.-
1704 CCTT 0.003876066 0 False 5,249,967 5,254,891 115 to -
110
chr11:5,249,972- chr11:5,254,896- HBG1/2
c.-
1704 GCTT 0.001450399 0 False 5,249,967 5,254,891 115 to -
110
177
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
chr11:5,249,972-
chr11:5,254,896- HBG1/2 c.-
1705 GCCTT 0.001175323 0 False 5,249,966 5,254,890 115
to -109
chr11:5,249,972-
chr11:5,254,896- HBG1/2 c.-
170 -301 NA 0.001225337 0 True 5,250,272 5,255,196 115
to -415
chr11:5,249,973-
chr11:5,254,897- HBG1/2 c.-
171 1 A 0.005251444 0 False 5,249,971 5,254,895 116
to -114
chr11:5,249,973-
chr11:5,254,897- HBG1/2 c.-
171 1 T 0.027407537 0 False 5,249,971 5,254,895 116
to -114
chr11:5,249,973-
chr11:5,254,897- HBG1/2 c.-
171 2 CC 0.007151967 0 False 5,249,970 5,254,894 116
to -113
chr11:5,249,973-
chr11:5,254,897- HBG1/2 c.-
1712 CT 0.002650729 0 False 5,249,970 5,254,894 116
to -113
chr11:5,249,973-
chr11:5,254,897- HBG1/2 c.-
1712 GA 0.001050289 0 False 5,249,970 5,254,894 116
to -113
chr11:5,249,973-
chr11:5,254,897- HBG1/2 c.-
171 2 TC 0.003275901 0 False 5,249,970 5,254,894 116
to -113
chr11:5,249,973-
chr11:5,254,897- HBG1/2 c.-
171 2 TT 0.002025557 0 False 5,249,970 5,254,894 116
to -113
chr11:5,249,973-
chr11:5,254,897- HBG1/2 c.-
1713 CCC 0.001125309 0 False 5,249,969 5,254,893 116
to -112
The Indel id is a string identifying the indel, shown as indel_start_position
+ _ + indeliength + _ + ID.
Where ID is NA for deletions and for insertions is the sequence inserted.
Positive values indicate
insertions and negative values indicate deletions.
The "% in indel" is the percentage of each indel_ID amongst all indels
detected in a sample.
In the column labeled MMEJ, "True" indicates the repair was mediated via MMEJ,
and "False" indicates
the repair was mediated via NHEJ.
The genomic coordinates at HBG1 or HBG2 are reported using the One-based
coordinate system, "Homo
sapiens chromosome 11, GRCh38.p12 Primary Assembly," (Version NC_000011.10),
NCBI Reference
Sequence NC_000011.
The HBG1/2 position indicates the deletion relative to the TSS.
Table 25: RNP32 Indels
Genomic Genomic HBG1/2
Ave % Cum.
MMEJ Coordinates at Coordinates at position
Indel Id in Indel Cts Sum HBG1 HBG2
159 -18 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
15.15% 14 15.15% True 5,249,978 5,254,902 104 to -
121
165 -6 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
5.92% 14 21.07% False 5,249,972 5,254,896 ..
110 to-115
167 -4 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
5.53% 14 26.60% False 5,249,972 5,254,896
112 to-115
168 -3 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
4.18% 14 30.78% False 5,249,972 5,254,896
113 to -115
166 -5 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
3.19% 14 33.97% False 5,249,972 5,254,896
111 to -115
166 -7 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
3.10% 14 37.07% False 5,249,974 5,254,898
111 to -117
178
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
157 -13 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
2.63% 14 39.70% True 5,249,971 5,254,895 102
to -114
169 -5 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
2.07% 14 41.77% False 5,249,975 5,254,899 114
to-118
167 -5 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
1.72% 14 43.49% False 5,249,973 5,254,897 112
to -116
168 -5 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
1.54% 14 45.03% False 5,249,974 5,254,898 113
to -117
169 -4 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
1.43% 14 46.46% False 5,249,974 5,254,898 114
to -117
166 -8 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
1.41% 14 47.88% False 5,249,975 5,254,899 111
to -118
164 -8 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
1.32% 14 49.20% False 5,249,973 5,254,897 109
to -116
166 -12 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
1.28% 14 50.48% False 5,249,979 5,254,903 111
to -122
166 -13 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
1.10% 14 51.58% False 5,249,980 5,254,904 111
to -123
167 -6 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.90% 14 52.47% False 5,249,974 5,254,898 112
to -117
169 -2 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.83% 14 53.30% False 5,249,972 5,254,896 114
to -115
168 -6 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.80% 14 54.10% False 5,249,975 5,254,899 113
to -118
166 -10 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.72% 14 54.82% False 5,249,977 5,254,901 111
to -120
169 -9 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.69% 14 55.51% False 5,249,979 5,254,903 114
to -122
168 -8 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.65% 14 56.16% False 5,249,977 5,254,901 113
to -120
169 -8 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.65% 14 56.80% False 5,249,978 5,254,902 114
to -121
168 -7 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.59% 14 57.39% False 5,249,976 5,254,900 113
to -119
165 -7 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.57% 14 57.97% False 5,249,973 5,254,897 110
to -116
169 -7 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.57% 14 58.54% False 5,249,977 5,254,901 114
to -120
157 -18 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.55% 14 59.10% False 5,249,976 5,254,900 102
to -119
168 -10 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.55% 14 59.64% False 5,249,979 5,254,903 113
to -122
169 -10 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.52% 14 60.16% False 5,249,980 5,254,904 114
to -123
168 -13 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.52% 14 60.68% False 5,249,982 5,254,906 113
to -125
168 -9 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.49% 14 61.17% False 5,249,978 5,254,902 113
to -121
162 -22 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.49% 14 61.65% True 5,249,985 5,254,909 107
to -128
166 -11 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.48% 14 62.13% False 5,249,978 5,254,902 111
to -121
179
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
169 -6 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.46% 14 62.59% True 5,249,976 5,254,900 114 to-
119
168 -12 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.46% 14 63.06% False 5,249,981 5,254,905 113 to -
124
166 -15 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.43% 14 63.49% False 5,249,982 5,254,906 111 to -
125
167 -16 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.43% 14 63.92% False 5,249,984 5,254,908 112 to -
127
166 -4 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.42% 14 64.35% False 5,249,971 5,254,895 111 to -
114
167 -11 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.42% 14 64.77% False 5,249,979 5,254,903 112 to -
122
162 -7 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.42% 14 65.19% True 5,249,970 5,254,894 107 to -
113
170 -2 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.42% 14 65.60% False 5,249,973 5,254,897 115 to -
116
168 -11 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.40% 14 66.00% False 5,249,980 5,254,904 113 to -
123
167 -1 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.37% 14 66.37% False 5,249,969 5,254,893 112 to -
112
166 -9 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.33% 14 66.71% False 5,249,976 5,254,900 111 to -
119
167 -10 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.32% 14 67.03% False 5,249,978 5,254,902 112 to -
121
166 -14 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.32% 14 67.35% False 5,249,981 5,254,905 111 to -
124
167 -9 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.30% 14 67.65% False 5,249,977 5,254,901 112 to -
120
168 -2 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.29% 14 67.94% False 5,249,971 5,254,895 113 to -
114
169 -12 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.28% 14 68.22% False 5,249,982 5,254,906 114 to -
125
169 -13 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.27% 14 68.49% False 5,249,983 5,254,907 114 to -
126
169 -11 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.26% 14 68.74% True 5,249,981 5,254,905 114 to -
124
165 -9 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.24% 14 68.99% False 5,249,975 5,254,899 110 to -
118
167 -3 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.23% 14 69.22% False 5,249,971 5,254,895 112 to -
114
163 -9 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.23% 14 69.45% False 5,249,973 5,254,897 108 to -
116
167 -14 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.23% 14 69.68% False 5,249,982 5,254,906 112 to -
125
152 -24 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.22% 14 69.90% True 5,249,977 5,254,901 97 to -
120
157 -19 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.22% 13 70.12% False 5,249,977 5,254,901 102 to -
120
163 -12 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.20% 14 70.32% False 5,249,976 5,254,900 108 to -
119
166 -16 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.20% 14 70.52% False 5,249,983 5,254,907 111 to -
126
180
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
162 -10 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.19% 13 70.72% False 5,249,973 5,254,897 107 to -
116
158 -14 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.19% 13 70.91% False 5,249,973 5,254,897 103 to -
116
159 -28 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.19% 14 71.10% True 5,249,988 5,254,912 104 to -
131
162 -8 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.19% 14 71.28% False 5,249,971 5,254,895 107 to -
114
165 -2 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.19% 14 71.47% False 5,249,968 5,254,892 110 to -
111
152 -33 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.19% 14 71.65% True 5,249,986 5,254,910 97 to -
129
168 -14 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.18% 14 71.84% False 5,249,983 5,254,907 113 to -
126
161 -12 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.18% 13 72.02% False 5,249,974 5,254,898 106 to -
117
170 -4 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.18% 14 72.20% False 5,249,975 5,254,899 115 to -
118
162 -9 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.18% 13 72.37% False 5,249,972 5,254,896 107 to -
115
164 -23 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.18% 13 72.55% False 5,249,988 5,254,912 109 to -
131
164 -10 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.18% 14 72.73% False 5,249,975 5,254,899 109 to -
118
166 -27 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.17% 14 72.90% True 5,249,994 5,254,918 111 to -
137
160 -12 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.16% 14 73.06% False 5,249,973 5,254,897 105 to -
116
165 -12 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.16% 14 73.22% False 5,249,978 5,254,902 110 to -
121
170 -5 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.16% 14 73.38% False 5,249,976 5,254,900 115 to -
119
165 -11 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.16% 14 73.54% False 5,249,977 5,254,901 110 to -
120
137 -27 NA chrl 1:5,249,939- chr11:5,254,863-
HBG1/2 c.-
0.15% 14 73.69% True 5,249,965 5,254,889 82 to -
108
165 -3 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.15% 14 73.84% False 5,249,969 5,254,893 110 to -
112
169 -14 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.15% 14 73.99% False 5,249,984 5,254,908 114 to -
127
172 -5 NA chrl 1:5,249,974- chr11:5,254,898-
HBG1/2 c.-
0.15% 14 74.14% True 5,249,978 5,254,902 117 to -
121
164 -9 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.15% 14 74.29% False 5,249,974 5,254,898 109 to -
117
152 -29 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.14% 13 74.44% True 5,249,982 5,254,906 97 to -
125
166 -22 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.14% 14 74.58% False 5,249,989 5,254,913 111 to -
132
169 -1 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.14% 14 74.72% False 5,249,971 5,254,895 114 to -
114
161 -17 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.13% 14 74.85% False 5,249,979 5,254,903 106 to -
122
181
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
162 -14 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.13% 14 74.98% False 5,249,977 5,254,901 107 to -
120
153 -19 NA chrl 1:5,249,955- chr11:5,254,879-
HBG1/2 c.-
0.13% 14 75.11% False 5,249,973 5,254,897 98 to -
116
151 -20 NA chrl 1:5,249,953- chr11:5,254,877-
HBG1/2 c.-
0.13% 14 75.23% False 5,249,972 5,254,896 96 to -
115
161 -11 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.13% 13 75.36% False 5,249,973 5,254,897 106 to -
116
165 -5 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.13% 14 75.49% False 5,249,971 5,254,895 110 to -
114
156 -15 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.12% 14 75.61% False 5,249,972 5,254,896 101 to -
115
167 -2 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.12% 14 75.73% False 5,249,970 5,254,894 112 to-
113
167 -18 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.12% 14 75.86% False 5,249,986 5,254,910 112 to -
129
145 -32 NA chrl 1:5,249,947- chr11:5,254,871-
HBG1/2 c.-
0.12% 13 75.98% True 5,249,978 5,254,902 90 to -
121
166 -21 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.12% 14 76.10% False 5,249,988 5,254,912 111 to -
131
169 -18 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.12% 14 76.22% False 5,249,988 5,254,912 114 to-
131
153 -38 NA chrl 1:5,249,955- chr11:5,254,879-
HBG1/2 c.-
0.12% 13 76.34% True 5,249,992 5,254,916 98 to -
135
163 -17 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.12% 14 76.46% False 5,249,981 5,254,905 108 to -
124
165 -14 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.12% 14 76.58% False 5,249,980 5,254,904 110 to -
123
165 -15 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.12% 14 76.70% False 5,249,981 5,254,905 110 to -
124
160 -14 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.12% 13 76.81% False 5,249,975 5,254,899 105 to -
118
166 -25 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.11% 13 76.93% False 5,249,992 5,254,916 111 to -
135
170 -9 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.11% 14 77.04% False 5,249,980 5,254,904 115 to -
123
152 -18 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.11% 14 77.15% False 5,249,971 5,254,895 97 to -
114
168 -18 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.11% 14 77.26% False 5,249,987 5,254,911 113 to -
130
163 -10 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.11% 14 77.38% False 5,249,974 5,254,898 108 to -
117
160 -11 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.11% 14 77.49% False 5,249,972 5,254,896 105 to -
115
150 -21 NA chrl 1:5,249,952- chr11:5,254,876-
HBG1/2 c.-
0.11% 13 77.59% False 5,249,972 5,254,896 95 to -
115
157 -23 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.11% 13 77.70% False 5,249,981 5,254,905 102 to -
124
155 -16 NA chrl 1:5,249,957- chr11:5,254,881-
HBG1/2 c.-
0.11% 12 77.81% False 5,249,972 5,254,896 100 to -
115
167 -17 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.11% 12 77.92% False 5,249,985 5,254,909 112 to -
128
182
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
164 -28 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.11% 13 78.02% False 5,249,993 5,254,917 109 to -136
164 -27 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.10% 14 78.12% False 5,249,992 5,254,916 109 to -135
156 -38 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.10% 13 78.22% True 5,249,995 5,254,919 101 to -138
154 -18 NA chrl 1:5,249,956- chr11:5,254,880-
HBG1/2 c.-
0.10% 12 78.32% False 5,249,973 5,254,897 99 to -116
156 -27 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.10% 13 78.42% True 5,249,984 5,254,908 101 to -127
157 -24 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.10% 11 78.52% False 5,249,982 5,254,906 102 to -125
168 -19 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.10% 14 78.62% False 5,249,988 5,254,912 113 to -131
165 -10 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.10% 14 78.72% False 5,249,976 5,254,900 110 to-119
171 -1 NA chrl 1:5,249,973- chr11:5,254,897-
HBG1/2 c.-
0.10% 14 78.82% False 5,249,973 5,254,897 116 to -116
165 -16 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.10% 13 78.92% False 5,249,982 5,254,906 110 to -125
164 -14 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.10% 12 79.02% False 5,249,979 5,254,903 109 to -122
167- HBG1/2 c.-
4 NA;175 - chrl 1:5,249,969- chr11:5,254,893-
112 to -
1 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.10% 14 79.11% False 5,249,977 5,254,901 120
160 -19 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.10% 14 79.21% False 5,249,980 5,254,904 105 to -123
166 -17 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.10% 13 79.30% False 5,249,984 5,254,908 111 to -127
168 -15 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.10% 14 79.40% True 5,249,984 5,254,908 113 to -127
162 -33 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.09% 12 79.49% True 5,249,996 5,254,920 107 to -139
168 -25 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.09% 13 79.58% False 5,249,994 5,254,918 113 to -137
166 -20 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.09% 10 79.67% False 5,249,987 5,254,911 111 to -130
170 -3 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.09% 13 79.76% False 5,249,974 5,254,898 115 to -117
157 -28 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.09% 11 79.84% False 5,249,986 5,254,910 102 to -129
166 -26 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.09% 13 79.93% False 5,249,993 5,254,917 111 to -136
160 -259 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.08% 9 80.01% True 5,250,220 5,255,144 105 to -363
160 -16 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.08% 12 80.09% False 5,249,977 5,254,901 105 to -120
159 -23 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.08% 13 80.17% False 5,249,983 5,254,907 104 to -126
183
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
167 -25 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.08% 13 80.25% False 5,249,993 5,254,917 --
112 to -136
165- HBG1/2 c.-
6 NA;175 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
1 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.08% 14 80.33% False 5,249,977 5,254,901 120
157 -14 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.08% 13 80.41% False 5,249,972 5,254,896
102 to -115
154 -28 NA chrl 1:5,249,956- chr11:5,254,880-
HBG1/2 c.-
0.08% 13 80.49% True 5,249,983 5,254,907 99 to -
126
168 -23 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.08% 12 80.56% False 5,249,992 5,254,916
113 to -135
169 -23 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.08% 14 80.64% False 5,249,993 5,254,917
114 to -136
167- HBG1/2 c.-
4 NA;174 - chrl 1:5,249,969- chr11:5,254,893-
112 to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.07% 12 80.71% False 5,249,977 5,254,901 120
167 -36 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.07% 11 80.79% True 5,250,004 5,254,928 112 to -
147
165 -29 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.07% 12 80.86% False 5,249,995 5,254,919
110 to -138
163 -6 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.07% 13 80.93% False 5,249,970 5,254,894
108 to -113
159 -33 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.07% 13 81.01% True 5,249,993 5,254,917 104 to -
136
162 -11 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.07% 13 81.08% False 5,249,974 5,254,898
107 to -117
167 -20 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.07% 10 81.15% False 5,249,988 5,254,912
112 to -131
169 -24 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.07% 13 81.21% False 5,249,994 5,254,918
114 to -137
167 -24 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.07% 11 81.28% False 5,249,992 5,254,916
112 to -135
164 -15 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.07% 13 81.35% False 5,249,980 5,254,904
109 to -123
166 -19 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.07% 12 81.42% False 5,249,986 5,254,910
111 to -129
166 -1 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.07% 13 81.49% False 5,249,968 5,254,892
111 to -111
169 -17 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.07% 12 81.55% False 5,249,987 5,254,911
114 to -130
154 -17 NA chrl 1:5,249,956- chr11:5,254,880-
HBG1/2 c.-
0.07% 11 81.62% False 5,249,972 5,254,896
99 to -115
164 -11 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.07% 12 81.68% False 5,249,976 5,254,900
109 to -119
166- HBG1/2 c.-
NA;175 - chrl 1:5,249,968- chr11:5,254,892- 111
to -
1 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.07% 12 81.75% False 5,249,977 5,254,901 120
184
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
170 -10 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.07% 14 81.81% False 5,249,981 5,254,905
115 to -124
152 -19 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.06% 11 81.88% False 5,249,972 5,254,896
97 to -115
166 -23 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.06% 12 81.94% False 5,249,990 5,254,914
111 to -133
162 -19 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.06% 14 82.01% False 5,249,982 5,254,906
107 to -125
167 -38 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.06% 12 82.07% False 5,250,006 5,254,930
112 to -149
161 -10 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.06% 13 82.14% False 5,249,972 5,254,896
106 to -115
158 -15 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.06% 12 82.20% False 5,249,974 5,254,898
103 to -117
163 -11 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.06% 12 82.26% False 5,249,975 5,254,899
108 to -118
168 -17 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.06% 11 82.33% False 5,249,986 5,254,910
113 to -129
151 -43 NA chrl 1:5,249,953- chr11:5,254,877-
HBG1/2 c.-
0.06% 12 82.39% True 5,249,995 5,254,919 96 to -
138
158 -16 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.06% 12 82.45% False 5,249,975 5,254,899
103 to -118
169 -19 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.06% 13 82.51% False 5,249,989 5,254,913
114 to -132
170 -17 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.06% 12 82.57% False 5,249,988 5,254,912
115 to -131
158 -21 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.06% 12 82.63% False 5,249,980 5,254,904
103 to -123
152 -28 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.06% 13 82.69% False 5,249,981 5,254,905
97 to -124
150 -33 NA chrl 1:5,249,952- chr11:5,254,876-
HBG1/2 c.-
0.06% 13 82.74% False 5,249,984 5,254,908
95 to -127
170 -13 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.05% 13 82.80% False 5,249,984 5,254,908
115 to -127
165 -19 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.05% 13 82.85% False 5,249,985 5,254,909
110 to -128
158 -17 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.05% 11 82.91% False 5,249,976 5,254,900
103 to -119
159 -11 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.05% 7 82.96% False 5,249,971 5,254,895
104 to -114
158 -20 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.05% 12 83.01% False 5,249,979 5,254,903
103 to -122
155 -12 NA chrl 1:5,249,957- chr11:5,254,881-
HBG1/2 c.-
0.05% 10 83.07% True 5,249,968 5,254,892 100 to -
111
168- HBG1/2 c.-
3 NA;175 - chrl 1:5,249,970- chr11:5,254,894-
113 to -
1 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.05% 12 83.12% False 5,249,977 5,254,901 120
169 -16 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.05% 14 83.17% False 5,249,986 5,254,910
114 to -129
185
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
157 -40 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.05% 13 83.22% True 5,249,998 5,254,922 102 to -
141
168 -24 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.05% 11 83.27% False 5,249,993 5,254,917
113 to -136
165- HBG1/2 c.-
6 NA;174 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.05% 12 83.33% False 5,249,977 5,254,901 120
158 -36 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.05% 11 83.38% False 5,249,995 5,254,919
103 to -138
169 -22 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.05% 12 83.43% False 5,249,992 5,254,916
114 to -135
157 -16 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.05% 14 83.48% False 5,249,974 5,254,898
102 to -117
165 -291 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.05% 7 83.53% True 5,250,257 5,255,181 110 to -
400
173 -1 NA chrl 1:5,249,975- chr11:5,254,899-
HBG1/2 c.-
0.05% 12 83.58% False 5,249,975 5,254,899
118 to -118
167 -26 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.05% 11 83.63% False 5,249,994 5,254,918
112 to -137
148 -22 NA chrl 1:5,249,950- chr11:5,254,874-
HBG1/2 c.-
0.05% 10 83.68% True 5,249,971 5,254,895 93 to -
114
152 -23 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.05% 10 83.72% False 5,249,976 5,254,900
97 to -119
165 -4 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.05% 11 83.77% False 5,249,970 5,254,894
110 to -113
165 -17 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.05% 12 83.82% False 5,249,983 5,254,907
110 to -126
165 -298 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.05% 6 83.87% False 5,250,264 5,255,188
110 to -407
154 -23 NA chrl 1:5,249,956- chr11:5,254,880-
HBG1/2 c.-
0.05% 11 83.92% False 5,249,978 5,254,902
99 to -121
168- HBG1/2 c.-
3 NA;174 - chrl 1:5,249,970- chr11:5,254,894-
113 to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.05% 11 83.96% False 5,249,977 5,254,901 120
165- HBG1/2 c.-
NA;174 - chrl 1:5,249,967- chr11:5,254,891- 110
to -
12 NA 5,249,971;chal: 5,254,895;chrl 1:5
114;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.05% 1 84.01% False 5,249,987 5,254,911
130
165 -271 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.05% 6 84.06% True 5,250,237 5,255,161 110 to -
380
164- HBG1/2 c.-
4 NA;174 - chrl 1:5,249,966- chr11:5,254,890-
109 to -
2 NA 5,249,969;chal: 5,254,893;chrl 1:5
112;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.05% 4 84.11% False 5,249,977 5,254,901 120
160- chrl 1:5,249,962- chr11:5,254,886-
8 NA;170 - 5,249,969;chal: 5,254,893;chrl 1:5
HBG1/2 c.-
251 NA 5,249,972- ,254,896- 105 to -
0.05% 7 84.15% False 5,250,222 5,255,146 112;HBG1/2
186
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
c.-115 to -
365
167 -31 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.05% 11 84.20% False 5,249,999 5,254,923
112 to -142
159 -24 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.05% 9 84.24% False 5,249,984 5,254,908
104 to -127
151 -32 NA chrl 1:5,249,953- chr11:5,254,877-
HBG1/2 c.-
0.05% 11 84.29% True 5,249,984 5,254,908 96 to -
127
170 -8 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.04% 13 84.34% False 5,249,979 5,254,903
115 to -122
151 -29 NA chrl 1:5,249,953- chr11:5,254,877-
HBG1/2 c.-
0.04% 12 84.38% False 5,249,981 5,254,905
96 to -124
151 -22 NA chrl 1:5,249,953- chr11:5,254,877-
HBG1/2 c.-
0.04% 12 84.42% False 5,249,974 5,254,898
96 to -117
153 -21 NA chrl 1:5,249,955- chr11:5,254,879-
HBG1/2 c.-
0.04% 11 84.47% False 5,249,975 5,254,899
98 to -118
167 -19 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.04% 10 84.51% False 5,249,987 5,254,911
112 to -130
168 -22 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.04% 13 84.56% False 5,249,991 5,254,915
113 to -134
164 -26 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.04% 10 84.60% False 5,249,991 5,254,915
109 to -134
153 -34 NA chrl 1:5,249,955- chr11:5,254,879-
HBG1/2 c.-
0.04% 14 84.64% False 5,249,988 5,254,912
98 to -131
162 -15 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.04% 11 84.68% False 5,249,978 5,254,902
107 to -121
159 -27 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.04% 11 84.72% False 5,249,987 5,254,911
104 to -130
153 -37 NA chrl 1:5,249,955- chr11:5,254,879-
HBG1/2 c.-
0.04% 9 84.76% True 5,249,991 5,254,915 98 to -
134
175 -1 NA chrl 1:5,249,977- chr11:5,254,901-
HBG1/2 c.-
0.04% 12 84.80% False 5,249,977 5,254,901
120 to -120
160 -10 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.04% 11 84.84% False 5,249,971 5,254,895
105 to -114
155 -19 NA chrl 1:5,249,957- chr11:5,254,881-
HBG1/2 c.-
0.04% 11 84.88% False 5,249,975 5,254,899
100 to -118
164 -5 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.04% 9 84.92% False 5,249,970 5,254,894
109 to -113
163 -15 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.04% 12 84.96% False 5,249,979 5,254,903
108 to -122
161 -22 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.04% 9 85.00% False 5,249,984 5,254,908
106 to -127
155 -17 NA chrl 1:5,249,957- chr11:5,254,881-
HBG1/2 c.-
0.04% 12 85.04% False 5,249,973 5,254,897
100 to -116
165- HBG1/2 c.-
6 NA;176 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,978- ,254,902- c.-121 to -
0.04% 11 85.07% False 5,249,979 5,254,903 122
150 -32 NA chrl 1:5,249,952- chr11:5,254,876-
HBG1/2 c.-
0.04% 11 85.11% False 5,249,983 5,254,907
95 to -126
187
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
169 -25 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.04% 13 85.15% False 5,249,995 5,254,919
114 to -138
148 -33 NA chrl 1:5,249,950- chr11:5,254,874-
HBG1/2 c.-
0.04% 9 85.19% False 5,249,982 5,254,906
93 to -125
166 -36 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.04% 10 85.22% False 5,250,003 5,254,927
111 to -146
164 -19 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.04% 10 85.26% False 5,249,984 5,254,908
109 to -127
171 -3 NA chrl 1:5,249,973- chr11:5,254,897-
HBG1/2 c.-
0.04% 12 85.29% False 5,249,975 5,254,899
116 to -118
169 -21 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.03% 10 85.33% False 5,249,991 5,254,915
114 to -134
152 -22 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.03% 10 85.36% False 5,249,975 5,254,899
97 to -118
165- HBG1/2 c.-
6 NA;175 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.03% 10 85.40% False 5,249,978 5,254,902 121
162 -311 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.03% 1 85.43% True 5,250,274 5,255,198 107 to -
417
166- HBG1/2 c.-
NA;174 - chrl 1:5,249,968- chr11:5,254,892- 111
to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.03% 12 85.47% False 5,249,977 5,254,901 120
168- HBG1/2 c.-
3 NA;174 - chrl 1:5,249,970- chr11:5,254,894-
113 to -
4 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.03% 10 85.50% False 5,249,979 5,254,903 122
161 -15 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.03% 12 85.54% False 5,249,977 5,254,901
106 to -120
167- HBG1/2 c.-
1 NA;172 - chrl 1:5,249,969- chr11:5,254,893-
112 to -
5 NA 5,249,969;chal: 5,254,893;chrl 1:5
112;HBG1/2
False;Tr 5,249,974- ,254,898- c.-117 to -
0.03% 9 85.57% ue 5,249,978 5,254,902 121
157 -29 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.03% 9 85.60% False 5,249,987 5,254,911
102 to -130
163 -313 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.03% 8 85.63% True 5,250,277 5,255,201 108 to -
420
152 -25 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.03% 10 85.67% False 5,249,978 5,254,902
97 to -121
159 -15 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.03% 10 85.70% False 5,249,975 5,254,899
104 to -118
156 -20 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.03% 8 85.73% False 5,249,977 5,254,901
101 to -120
157 -21 NA chrl 1:5,249,959- chr11:5,254,883-
HBG1/2 c.-
0.03% 10 85.76% False 5,249,979 5,254,903
102 to -122
168 -30 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.03% 11 85.79% True 5,249,999 5,254,923 113 to -
142
188
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
161 -40 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.03% 8 85.82% True 5,250,002 5,254,926 -- 106 to -
145
172 -18 NA chrl 1:5,249,974- chr11:5,254,898-
HBG1/2 c.-
0.03% 10 85.85% False 5,249,991 5,254,915 --
117 to -134
167- HBG1/2 c.-
11 NA;180 - chrl 1:5,249,969- chr11:5,254,893- ..
112 to -
2 NA 5,249,979;chal: 5,254,903;chrl 1:5
122;HBG1/2
5,249,982- ,254,906- c.-125 to -
0.03% 4 85.88% False 5,249,983 5,254,907 126
167- HBG1/2 c.-
4 NA;175 - chrl 1:5,249,969- chr11:5,254,893-
112 to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.03% 9 85.91% False 5,249,978 5,254,902 121
166- HBG1/2 c.-
NA;175 - chrl 1:5,249,968- chr11:5,254,892- 111
to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.03% 6 85.94% False 5,249,978 5,254,902 121
161-8 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.03% 10 85.97% False 5,249,970 5,254,894 --
106 to -113
162 -23 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.03% 9 86.00% False 5,249,986 5,254,910 --
107 to -129
156 -30 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.03% 8 86.03% False 5,249,987 5,254,911
101 to -130
46 -338 NA chrl 1:5,249,848- chr11:5,254,772-
HBG1/2 c.9
0.03% 1 86.05% True 5,250,185 5,255,109 to -328
150 -41 NA chrl 1:5,249,952- chr11:5,254,876-
HBG1/2 c.-
0.03% 6 86.08% False 5,249,992 5,254,916
95 to -135
154 -20 NA chrl 1:5,249,956- chr11:5,254,880-
HBG1/2 c.-
0.03% 11 86.11% False 5,249,975 5,254,899
99 to -118
156 -17 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.03% 12 86.14% False 5,249,974 5,254,898
101 to -117
158 -25 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.03% 9 86.16% False 5,249,984 5,254,908 --
103 to -127
161 -32 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.03% 10 86.19% False 5,249,994 5,254,918 --
106 to -137
168 -32 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.03% 10 86.22% False 5,250,001 5,254,925
113 to -144
151 -30 NA chrl 1:5,249,953- chr11:5,254,877-
HBG1/2 c.-
0.03% 8 86.24% False 5,249,982 5,254,906 --
96 to -125
156 -40 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.03% 5 86.27% False 5,249,997 5,254,921 --
101 to -140
168 -29 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.03% 8 86.29% False 5,249,998 5,254,922 --
113 to -141
165 -38 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.03% 10 86.32% False 5,250,004 5,254,928
110 to -147
165- HBG1/2 c.-
2 NA;170 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
14 NA;188 1 5,249,968;chal: 5,254,892;chrl 1:5
111;HBG1/2
A 5,249,972- ,254,896- c.-115 to -
5,249,985;chal: 5,254,909;chrl 1:5 128;HBG1/2
5,249,990- ,254,914- c.-133 to -
0.03% 1 86.35% False 5,249,988 5,254,912 --
131
189
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
163 -16 NA chrl 1:5,249,965- chr11:5,254,889-
HBG1/2 c.-
0.02% 10 86.37% False 5,249,980 5,254,904 --
108 to -123
172 -2 NA chrl 1:5,249,974- chr11:5,254,898-
HBG1/2 c.-
0.02% 9 86.39% False 5,249,975 5,254,899
117 to -118
174 -2 NA chrl 1:5,249,976- chr11:5,254,900-
HBG1/2 c.-
0.02% 11 86.42% False 5,249,977 5,254,901 ..
119 to -120
166- HBG1/2 c.-
7 NA;176 - chrl 1:5,249,968- chr11:5,254,892-
111 to -
2 NA 5,249,974;chal: 5,254,898;chrl 1:5
117;HBG1/2
5,249,978- ,254,902- c.-121 to -
0.02% 6 86.44% False 5,249,979 5,254,903 122
160 -21 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.02% 11 86.47% False 5,249,982 5,254,906 --
105 to -125
155 -24 NA chrl 1:5,249,957- chr11:5,254,881-
HBG1/2 c.-
0.02% 10 86.49% False 5,249,980 5,254,904 ..
100 to -123
164 -20 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.02% 7 86.52% False 5,249,985 5,254,909
109 to -128
169- HBG1/2 c.-
8 NA;180 - chrl 1:5,249,971- chr11:5,254,895-
114 to -
NA 5,249,978;chal: 5,254,902;chrl 1:5
121;HBG1/2
5,249,982- ,254,906- c.-125 to -
0.02% 2 86.54% False 5,249,986 5,254,910 129
167 -28 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.02% 10 86.56% False 5,249,996 5,254,920 ..
112 to -139
158 -22 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.02% 10 86.59% False 5,249,981 5,254,905
103 to -124
164 -16 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.02% 11 86.61% False 5,249,981 5,254,905 ..
109 to -124
169- HBG1/2 c.-
4 NA;175 - chrl 1:5,249,971- chr11:5,254,895-
114 to -
2 NA 5,249,974;chal: 5,254,898;chrl 1:5
117;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.02% 7 86.63% False 5,249,978 5,254,902 121
151 -25 NA chrl 1:5,249,953- chr11:5,254,877-
HBG1/2 c.-
0.02% 10 86.66% False 5,249,977 5,254,901 ..
96 to -120
165- HBG1/2 c.-
6 NA;174 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
4 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.02% 11 86.68% False 5,249,979 5,254,903 122
157- HBG1/2 c.-
13 NA;180 - chrl 1:5,249,959- chr11:5,254,883-
102 to -
5 NA 5,249,971;chal: 5,254,895;chrl 1:5
114;HBG1/2
False;Tr 5,249,982- ,254,906- c.-125 to -
0.02% 8 86.70% ue 5,249,986 5,254,910 129
156 -36 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.02% 6 86.73% False 5,249,993 5,254,917
101 to -136
164- HBG1/2 c.-
NA;177 - chrl 1:5,249,966- chr11:5,254,890- 109
to -
2 NA 5,249,975;chal: 5,254,899;chrl 1:5
118;HBG1/2
5,249,979- ,254,903- c.-122 to -
0.02% 1 86.75% False 5,249,980 5,254,904 123
166 -293 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.02% 2 86.77% False 5,250,260 5,255,184
111 to -403
190
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
156 -31 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.02% 8 86.79% False 5,249,988 5,254,912
101 to -131
169- HBG1/2 c.-
8 NA;180 - chrl 1:5,249,971- chr11:5,254,895-
114 to -
4 NA 5,249,978;chal: 5,254,902;chrl 1:5
121;HBG1/2
False;Tr 5,249,982- ,254,906- c.-125 to -
0.02% 4 86.82% ue 5,249,985 5,254,909 128
155- HBG1/2 c.-
8 NA;165 - chrl 1:5,249,957- chr11:5,254,881-
100 to -
NA 5,249,964;chal: 5,254,888;chrl 1:5
107;HBG1/2
5,249,967- ,254,891- c.-110 to -
0.02% 1 86.84% False 5,249,971 5,254,895 114
167 1 C;171 HBG1/2 c.-
-4 NA chrl 1:5,249,969- chr11:5,254,893-
112 to -
5,249,967;chal: 5,254,891;chrl 1:5 110;HBG1/2
5,249,973- ,254,897- c.-116 to -
0.02% 1 86.86% False 5,249,976 5,254,900 119
165- HBG1/2 c.-
7 NA;175 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
1 NA 5,249,973;chal: 5,254,897;chrl 1:5
116;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.02% 6 86.88% False 5,249,977 5,254,901 120
160 -20 NA chrl 1:5,249,962- chr11:5,254,886-
HBG1/2 c.-
0.02% 11 86.91% False 5,249,981 5,254,905
105 to -124
152 -21 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.02% 9 86.93% False 5,249,974 5,254,898
97 to -117
165 -39 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.02% 9 86.95% False 5,250,005 5,254,929
110 to -148
164 -4 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.02% 7 86.97% False 5,249,969 5,254,893
109 to -112
165- HBG1/2 c.-
3 NA;171 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
3 NA 5,249,969;chal: 5,254,893;chrl 1:5
112;HBG1/2
5,249,973- ,254,897- c.-116 to -
0.02% 10 86.99% False 5,249,975 5,254,899 118
165- HBG1/2 c.-
2 NA;170 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
4 NA 5,249,968;chal: 5,254,892;chrl 1:5
111;HBG1/2
5,249,972- ,254,896- c.-115 to -
0.02% 9 87.02% False 5,249,975 5,254,899 118
160- HBG1/2 c.-
11 NA;174 - chrl 1:5,249,962- chr11:5,254,886-
105 to -
9 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.02% 1 87.04% False 5,249,984 5,254,908 127
165- HBG1/2 c.-
4 NA;171 1 chrl 1:5,249,967- chr11:5,254,891-
110 to -
C 5,249,970;chal: 5,254,894;chrl 1:5
113;HBG1/2
5,249,973- ,254,897- c.-116 to -
0.02% 1 87.06% False 5,249,971 5,254,895 114
168 1 A chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.02% 8 87.08% False 5,249,968 5,254,892
113 to -111
37 -362 NA chrl 1:5,249,839- chr11:5,254,763-
HBG1/2
0.02% 3 87.10% True 5,250,200 5,255,124 c.18 to -
343
191
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
152 -54 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.02% 7 87.12% True 5,250,007 5,254,931 97 to -
150
161 -237 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.02% 5 87.14% True 5,250,199 5,255,123 106 to -
342
167- HBG1/2 c.-
NA;175 - chrl 1:5,249,969- chr11:5,254,893- 112
to -
1 NA 5,249,973;chal: 5,254,897;chrl 1:5
116;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.02% 6 87.16% False 5,249,977 5,254,901 120
165 -30 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.02% 7 87.18% False 5,249,996 5,254,920 --
110 to -139
167- HBG1/2 c.-
17 NA;186 - chrl 1:5,249,969- chr11:5,254,893-
112 to -
5 NA 5,249,985;chal: 5,254,909;chrl 1:5
128;HBG1/2
False;Tr 5,249,988- ,254,912- c.-131 to -
0.02% 1 87.20% ue 5,249,992 5,254,916 135
166- HBG1/2 c.-
11 NA;180 - chrl 1:5,249,968- chr11:5,254,892-
111 to -
1 NA 5,249,978;chal: 5,254,902;chrl 1:5
121;HBG1/2
5,249,982- ,254,906- c.-125 to -
0.02% 10 87.22% False 5,249,982 5,254,906 125
162 -303 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.02% 3 87.24% True 5,250,266 5,255,190 107 to -
409
166 -32 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.02% 10 87.26% False 5,249,999 5,254,923
111 to -142
165 -32 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.02% 9 87.28% False 5,249,998 5,254,922
110 to -141
144 -30 NA chrl 1:5,249,946- chr11:5,254,870-
HBG1/2 c.-
0.02% 3 87.30% False 5,249,975 5,254,899
89 to -118
158- HBG1/2 c.-
NA;171 - chrl 1:5,249,960- chr11:5,254,884- 103
to -
2 NA 5,249,969;chal: 5,254,893;chrl 1:5
112;HBG1/2
5,249,973- ,254,897- c.-116 to -
0.02% 3 87.32% False 5,249,974 5,254,898 117
165- HBG1/2 c.-
4 NA;172 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
7 NA 5,249,970;chal: 5,254,894;chrl 1:5
113;HBG1/2
5,249,974- ,254,898- c.-117 to -
0.02% 3 87.34% False 5,249,980 5,254,904 123
167 -30 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.02% 8 87.36% False 5,249,998 5,254,922
112 to -141
169- HBG1/2 c.-
2 NA;173 1 chrl 1:5,249,971- chr11:5,254,895-
114 to -
A 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,975- ,254,899- c.-118 to -
0.02% 3 87.37% False 5,249,973 5,254,897 116
167- HBG1/2 c.-
2 NA;170 4 chrl 1:5,249,969- chr11:5,254,893-
112 to -
GCAA 5,249,970;chal: 5,254,894;chrl 1:5
113;HBG1/2
5,249,972- ,254,896- c.-115 to -
0.02% 1 87.39% False 5,249,967 5,254,891 110
166 1 C;167 chrl 1:5,249,968- chr11:5,254,892-
-4 NA 5,249,966;chal: 5,254,890;chrl 1:5
HBG1/2 c.-
5,249,969- ,254,893- 111 to -
0.02% 9 87.41% False 5,249,972 5,254,896 109;HBG1/2
192
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
c.-112 to -
115
170 -24 NA chrl 1:5,249,972- chr11:5,254,896-
HBG1/2 c.-
0.02% 11 87.43% False 5,249,995 5,254,919
115 to -138
167- HBG1/2 c.-
2 NA;171 - chrl 1:5,249,969- chr11:5,254,893-
112 to -
3 NA 5,249,970;chal: 5,254,894;chrl 1:5
113;HBG1/2
5,249,973- ,254,897- c.-116 to -
0.02% 10 87.44% False 5,249,975 5,254,899 118
162- HBG1/2 c.-
NA;177 1 chrl 1:5,249,964- chr11:5,254,888- 107
to -
T 5,249,973;chal: 5,254,897;chrl 1:5
116;HBG1/2
5,249,979- ,254,903- c.-122 to -
0.02% 1 87.46% False 5,249,977 5,254,901 120
124 -288 NA chrl 1:5,249,926- chr11:5,254,850-
HBG1/2 c.-
0.02% 1 87.48% True 5,250,213 5,255,137 -- 69 to -
356
159 -20 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.02% 10 87.49% False 5,249,980 5,254,904
104 to -123
161 -21 NA chrl 1:5,249,963- chr11:5,254,887-
HBG1/2 c.-
0.02% 8 87.51% False 5,249,983 5,254,907
106 to -126
160- HBG1/2 c.-
7 NA;169 - chrl 1:5,249,962- chr11:5,254,886-
105 to -
2 NA;173 - 5,249,968;chal: 5,254,892;chrl 1:5
111;HBG1/2
2 NA 5,249,971- ,254,895- c.-114 to -
5,249,972;chal: 5,254,896;chrl 1:5 115;HBG1/2
5,249,975- ,254,899- c.-118 to -
0.02% 1 87.53% False 5,249,976 5,254,900 119
156 -14 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.02% 7 87.55% False 5,249,971 5,254,895
101 to -114
159 -272 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.02% 1 87.56% True 5,250,232 5,255,156 104 to -
375
166- HBG1/2 c.-
11 NA;180 - chrl 1:5,249,968- chr11:5,254,892-
111 to -
4 NA 5,249,978;chal: 5,254,902;chrl 1:5
121;HBG1/2
False;Tr 5,249,982- ,254,906- c.-125 to -
0.02% 6 87.58% ue 5,249,985 5,254,909 128
167 8 GAAA HBG1/2 c.-
AATT;170 - chrl 1:5,249,969- chr11:5,254,893-
112 to -
8 NA 5,249,960;chal: 5,254,884;chrl 1:5
103;HBG1/2
5,249,972- ,254,896- c.-115 to -
0.02% 1 87.59% False 5,249,979 5,254,903 122
166- HBG1/2 c.-
11 NA;178 1 chrl 1:5,249,968- chr11:5,254,892-
111 to -
G 5,249,978;chal: 5,254,902;chrl 1:5
121;HBG1/2
5,249,980- ,254,904- c.-123 to -
0.02% 2 87.61% False 5,249,978 5,254,902 121
169- HBG1/2 c.-
8 NA;180 - chrl 1:5,249,971- chr11:5,254,895-
114 to -
1 NA 5,249,978;chal: 5,254,902;chrl 1:5
121;HBG1/2
5,249,982- ,254,906- c.-125 to -
0.02% 8 87.63% False 5,249,982 5,254,906 125
158 -11 NA chrl 1:5,249,960- chr11:5,254,884-
HBG1/2 c.-
0.02% 6 87.64% False 5,249,970 5,254,894
103 to -113
173 1 T chrl 1:5,249,975- chr11:5,254,899-
HBG1/2 c.-
0.02% 3 87.66% False 5,249,973 5,254,897 --
118 to-116
193
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
168 -34 NA chrl 1:5,249,970- chr11:5,254,894-
HBG1/2 c.-
0.02% 6 87.68% False 5,250,003 5,254,927 --
113 to -146
172 -20 NA chrl 1:5,249,974- chr11:5,254,898-
HBG1/2 c.-
0.02% 8 87.69% True 5,249,993 5,254,917 117 to -
136
166 -275 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.02% 1 87.71% False 5,250,242 5,255,166
111 to -385
156 -47 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.02% 3 87.72% False 5,250,004 5,254,928
101 to -147
168- HBG1/2 c.-
8 NA;178 - chrl 1:5,249,970- chr11:5,254,894-
113 to -
2 NA 5,249,977;chal: 5,254,901;chrl 1:5
120;HBG1/2
5,249,980- ,254,904- c.-123 to -
0.02% 2 87.74% False 5,249,981 5,254,905 124
164 -31 NA chrl 1:5,249,966- chr11:5,254,890-
HBG1/2 c.-
0.02% 6 87.75% False 5,249,996 5,254,920 --
109 to -139
159 -318 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.02% 2 87.77% True 5,250,278 5,255,202 104 to -
421
166- HBG1/2 c.-
1 NA;168 - chrl 1:5,249,968- chr11:5,254,892-
111 to -
230 NA 5,249,968;chal: 5,254,892;chrl 1:5
111;HBG1/2
5,249,970- ,254,894- c.-113 to -
0.01% 1 87.78% False 5,250,199 5,255,123
342
111 -260 NA chrl 1:5,249,913- chr11:5,254,837-
HBG1/2 c.-
0.01% 1 87.80% False 5,250,172 5,255,096
56 to -315
166 -272 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.01% 6 87.81% True 5,250,239 5,255,163 111 to -
382
166- HBG1/2 c.-
4 NA;171 2 chrl 1:5,249,968- chr11:5,254,892-
111 to -
AC 5,249,971;chal: 5,254,895;chrl 1:5
114;HBG1/2
5,249,973- ,254,897- c.-116 to -
0.01% 4 87.83% False 5,249,970 5,254,894 113
164- HBG1/2 c.-
3 NA;171 3 chrl 1:5,249,966- chr11:5,254,890-
109 to -
GGC 5,249,968;chal: 5,254,892;chrl 1:5
111;HBG1/2
5,249,973- ,254,897- c.-116 to -
0.01% 1 87.84% False 5,249,969 5,254,893 112
166- HBG1/2 c.-
NA;178 - chrl 1:5,249,968- chr11:5,254,892- 111
to -
1 NA 5,249,977;chal: 5,254,901;chrl 1:5
120;HBG1/2
5,249,980- ,254,904- c.-123 to -
0.01% 4 87.86% False 5,249,980 5,254,904 123
167 -307 NA chrl 1:5,249,969- chr11:5,254,893-
HBG1/2 c.-
0.01% 1 87.87% False 5,250,275 5,255,199
112 to -418
165 -308 NA chrl 1:5,249,967- chr11:5,254,891-
HBG1/2 c.-
0.01% 2 87.88% False 5,250,274 5,255,198
110 to -417
158- HBG1/2 c.-
2 NA;162 - chrl 1:5,249,960- chr11:5,254,884-
103 to -
9 NA 5,249,961;chal: 5,254,885;chrl 1:5
104;HBG1/2
5,249,964- ,254,888- c.-107 to -
0.01% 1 87.90% False 5,249,972 5,254,896 115
155- HBG1/2 c.-
22 NA;182 - chrl 1:5,249,957- chr11:5,254,881-
100 to -
1 NA 5,249,978;chal: 5,254,902;chrl 1:5
121;HBG1/2
5,249,984- ,254,908- c.-127 to -
0.01% 1 87.91% False 5,249,984 5,254,908 127
194
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
138- HBG1/2 c.-
32 NA;174 - chrl 1:5,249,940- chr11:5,254,864-
83 to -
3 NA 5,249,971;chal: 5,254,895;chrl 1:5
114;HBG1/2
5,249,976- ,254,900- c.-119 to -
0.01% 1 87.92% False 5,249,978 5,254,902 121
140 -52 NA chrl 1:5,249,942- chr11:5,254,866-
HBG1/2 c.-
0.01% 2 87.94% False 5,249,993 5,254,917
85 to -136
155 -22 NA chrl 1:5,249,957- chr11:5,254,881-
HBG1/2 c.-
0.01% 5 87.95% False 5,249,978 5,254,902
100 to -121
166- HBG1/2 c.-
NA;174 - chrl 1:5,249,968- chr11:5,254,892- 111
to -
8 NA;184 - 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
1 NA 5,249,976- ,254,900- c.-119 to -
5,249,983;chal: 5,254,907;chrl 1:5 126;HBG1/2
5,249,986- ,254,910- c.-129 to -
0.01% 1 87.96% False 5,249,986 5,254,910 129
164- HBG1/2 c.-
8 NA;175 - chrl 1:5,249,966- chr11:5,254,890-
109 to -
3 NA 5,249,973;chal: 5,254,897;chrl 1:5
116;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.01% 5 87.97% False 5,249,979 5,254,903 122
150 - HBG1/2 c.-
NA;162 - chrl 1:5,249,952- chr11:5,254,876- 95
to -
7 NA 5,249,961;chal: 5,254,885;chrl 1:5
104;HBG1/2
False;Tr 5,249,964- ,254,888- c.-107 to -
0.01% 1 87.99% ue 5,249,970 5,254,894 113
151 -37 NA chrl 1:5,249,953- chr11:5,254,877-
HBG1/2 c.-
0.01% 6 88.00% False 5,249,989 5,254,913
96 to -132
156 -270 NA chrl 1:5,249,958- chr11:5,254,882-
HBG1/2 c.-
0.01% 1 88.01% True 5,250,227 5,255,151 101 to -
370
144 -47 NA chrl 1:5,249,946- chr11:5,254,870-
HBG1/2 c.-
0.01% 4 88.02% False 5,249,992 5,254,916
89 to -135
79 -340 NA chrl 1:5,249,881- chr11:5,254,805-
HBG1/2 c.-
0.01% 1 88.03% True 5,250,220 5,255,144 24 to -
363
166 2 CA;16 HBG1/2 c.-
7-4 NA chrl 1:5,249,968- chr11:5,254,892-
111 to -
5,249,965;chal: 5,254,889;chrl 1:5 108;HBG1/2
5,249,969- ,254,893- c.-112 to -
0.01% 3 88.05% False 5,249,972 5,254,896 115
147 -25 NA chrl 1:5,249,949- chr11:5,254,873-
HBG1/2 c.-
0.01% 4 88.06% False 5,249,973 5,254,897
92 to -116
168- HBG1/2 c.-
7 NA;176 1 chrl 1:5,249,970- chr11:5,254,894-
113 to -
A 5,249,976;chal: 5,254,900;chrl 1:5
119;HBG1/2
5,249,978- ,254,902- c.-121 to -
0.01% 3 88.07% False 5,249,976 5,254,900 119
168- HBG1/2 c.-
1 NA;170 - chrl 1:5,249,970- chr11:5,254,894-
113 to -
66 NA 5,249,970;chal: 5,254,894;chrl 1:5
113;HBG1/2
5,249,972- ,254,896- c.-115 to -
0.01% 1 88.08% False 5,250,037 5,254,961 180
162- chrl 1:5,249,964- chr11:5,254,888-
3 NA;167 - 5,249,966;chal: 5,254,890;chrl 1:5
HBG1/2 c.-
9 NA 5,249,969- ,254,893- 107 to -
0.01% 2 88.09% False 5,249,977 5,254,901 109;HBG1/2
195
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
c.-112 to -
120
124 -267 NA chrl 1:5,249,926- chr11:5,254,850-
HBG1/2 c.-
0.01% 1 88.10% True 5,250,192 5,255,116 -- 69 to -
335
156- HBG1/2 c.-
9 NA;169 - chrl 1:5,249,958- chr11:5,254,882-
101 to -
1 NA;175 - 5,249,966;chal: 5,254,890;chrl 1:5
109;HBG1/2
1 NA 5,249,971- ,254,895- c.-114 to -
5,249,971;chal: 5,254,895;chrl 1:5 114;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.01% 1 88.11% False 5,249,977 5,254,901
120
159 4 TGAC; HBG1/2 C.-
162- chrl 1:5,249,961- chr11:5,254,885-
104 to -
3 NA;167 3 5,249,956;chal: 5,254,880;chrl 1:5
99;HBG1/2
GCC 5,249,964- ,254,888- c.-107 to -
5,249,966;chal: 5,254,890;chrl 1:5 109;HBG1/2
5,249,969- ,254,893- c.-112 to -
0.01% 1 88.12% False 5,249,965 5,254,889 108
169- HBG1/2 c.-
1 NA;173 - chrl 1:5,249,971- chr11:5,254,895-
114 to -
3 NA 5,249,971;chal: 5,254,895;chrl 1:5
114;HBG1/2
5,249,975- ,254,899- c.-118 to -
0.01% 5 88.13% False 5,249,977 5,254,901 120
152- HBG1/2 c.-
19 NA;176 - chrl 1:5,249,954- chr11:5,254,878-
97 to -
2 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,978- ,254,902- c.-121 to -
0.01% 1 88.14% False 5,249,979 5,254,903 122
42 -176 NA chrl 1:5,249,844- chr11:5,254,768-
HBG1/2
0.01% 2 88.15% False 5,250,019 5,254,943
c.13 to -162
169 -37 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.01% 1 88.16% True 5,250,007 5,254,931 114 to -
150
159 -301 NA chrl 1:5,249,961- chr11:5,254,885-
HBG1/2 c.-
0.01% 1 88.17% True 5,250,261 5,255,185 104 to -
404
169 -64 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.01% 5 88.18% True 5,250,034 5,254,958 114 to -
177
147 -41 NA chrl 1:5,249,949- chr11:5,254,873-
HBG1/2 c.-
0.01% 2 88.19% False 5,249,989 5,254,913
92 to -132
140- HBG1/2 c.-
31 NA;177 - chrl 1:5,249,942- chr11:5,254,866-
85 to -
1 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,979- ,254,903- c.-122 to -
0.01% 1 88.20% False 5,249,979 5,254,903 122
170- HBG1/2 c.-
1 NA;172 - chrl 1:5,249,972- chr11:5,254,896-
115 to -
303 NA 5,249,972;chal: 5,254,896;chrl 1:5
115;HBG1/2
5,249,974- ,254,898- c.-117 to -
0.01% 2 88.21% False 5,250,276 5,255,200 419
166- HBG1/2 c.-
4 NA;172 - chrl 1:5,249,968- chr11:5,254,892-
111 to -
21 NA 5,249,971;chal: 5,254,895;chrl 1:5
114;HBG1/2
5,249,974- ,254,898- c.-117 to -
0.01% 1 88.22% False 5,249,994 5,254,918 137
196
CA 03164055 2022-06-07
WO 2021/119040 PCT/US2020/063854
166- HBG1/2 c.-
7 NA;177 2 chrl 1:5,249,968- chr11:5,254,892-
111 to -
CC 5,249,974;chr11: 5,254,898;chrl 1:5
117;HBG1/2
5,249,979- ,254,903- c.-122 to -
0.01% 1 88.23% False 5,249,976 5,254,900 119
152 -254 NA chrl 1:5,249,954- chr11:5,254,878-
HBG1/2 c.-
0.01% 1 88.23% True 5,250,207 5,255,131 .. 97 to -
350
165- HBG1/2 c.-
4 NA;172 - chrl 1:5,249,967- chr11:5,254,891-
110 to -
NA 5,249,970;chr11: 5,254,894;chrl 1:5
113;HBG1/2
False;Tr 5,249,974- ,254,898- c.-117 to -
0.01% 3 88.24% ue 5,249,978 5,254,902 121
174 -13 NA chrl 1:5,249,976- chr11:5,254,900-
HBG1/2 c.-
0.01% 5 88.25% False 5,249,988 5,254,912
119 to -131
154- HBG1/2 c.-
17 NA;175 - chrl 1:5,249,956- chr11:5,254,880-
99 to -
6 NA 5,249,972;chr11: 5,254,896;chrl 1:5
115;HBG1/2
5,249,977- ,254,901- c.-120 to -
0.01% 1 88.26% False 5,249,982 5,254,906 125
161- HBG1/2 c.-
9 NA;172 - chrl 1:5,249,963- chr11:5,254,887-
106 to -
20 NA 5,249,971;chr11: 5,254,895;chrl 1:5
114;HBG1/2
False;Tr 5,249,974- ,254,898- c.-117 to -
0.01% 1 88.27% ue 5,249,993 5,254,917 136
132 -42 NA chrl 1:5,249,934- chr11:5,254,858-
HBG1/2 c.-
0.01% 1 88.28% False 5,249,975 5,254,899
77 to -118
162 -259 NA chrl 1:5,249,964- chr11:5,254,888-
HBG1/2 c.-
0.01% 2 88.29% False 5,250,222 5,255,146
107 to -365
166 -18 NA chrl 1:5,249,968- chr11:5,254,892-
HBG1/2 c.-
0.01% 2 88.29% True 5,249,985 5,254,909 111 to -
128
145 -25 NA chrl 1:5,249,947- chr11:5,254,871-
HBG1/2 c.-
0.01% 1 88.30% False 5,249,971 5,254,895
90 to -114
148 -29 NA chrl 1:5,249,950- chr11:5,254,874-
HBG1/2 c.-
0.01% 1 88.31% False 5,249,978 5,254,902
93 to -121
144 -327 NA chrl 1:5,249,946- chr11:5,254,870-
HBG1/2 c.-
0.01% 1 88.32% False 5,250,272 5,255,196
89 to -415
169 -274 NA chrl 1:5,249,971- chr11:5,254,895-
HBG1/2 c.-
0.01% 1 88.33% False 5,250,244 5,255,168
114 to -387
The Indeljd is a string identifying the indel, shown as indel_start_position +
_ + indeliength + _ + ID.
Where ID is NA for deletions and for insertions is the sequence inserted.
Positive values indicate
insertions and negative values indicate deletions.
The average percentage ("AVE % in indel") is the average percentage of each
indel_ID amongst all
indels detected in a sample. The average is calculated from n = 14 samples.
"Cts" = counts and provides the number of samples in which the indel was
identified.
"Cum. Sum" = Cumulative sum and the cumulative percentage of indels, e.g. the
top ten most abuntant
indels account for 45.03% of all indels.
In the column labeled MMEJ, "True" indicates the repair was mediated via MMEJ,
and "False" indicates
the repair was mediated via NHEJ.
The genomic coordinates at HBG1 or HBG2 are reported using the One-based
coordinate system, "Homo
sapiens chromosome 11, GRCh38.p12 Primary Assembly," (Version NC_000011.10),
NCBI Reference
Sequence NC_000011.
The HBG1/2 position indicates the deletion relative to the TSS.
197
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
SEQUENCES
[0485] Genome editing system components according to the present disclosure
(including without
limitation, RNA-guided nucleases, guide RNAs, donor template nucleic acids,
nucleic acids encoding
nucleases or guide RNAs, and portions or fragments of any of the foregoing),
are exemplified by the
nucleotide and amino acid sequences presented in the Sequence Listing. The
sequences presented in
the Sequence Listing are not intended to be limiting, but rather illustrative
of certain principles of
genome editing systems and their component parts, which, in combination with
the instant disclosure,
will inform those of skill in the art about additional implementations and
modifications that are within
the scope of this disclosure.
INCORPORATION BY REFERENCE
[0486] All publications, patents, and patent applications mentioned herein are
hereby incorporated by
reference in their entirety as if each individual publication, patent or
patent application was
specifically and individually indicated to be incorporated by reference. In
case of conflict, the present
application, including any definitions herein, will control.
EQUIVALENTS
[0487] Those skilled in the art will recognize, or be able to ascertain using
no more than routine
experimentation, many equivalents to the specific embodiments described
herein. Such equivalents
are intended to be encompassed by the following claims.
REFERENCES
Ahern et al., Br J Haematol 25(4):437-444 (1973)
Akinbami Hemoglobin 40:64-65 (2016)
Aliyu et al. Am J Hematol 83:63-70 (2008)
Anders et al. Nature 513(7519):569-573 (2014)
Angastiniotis & Modell Ann NY Acad Sci 850:251-269 (1998)
Bae et al. Bioinformatics 30(10):1473-1475 (2014)
Barbosa et al. Braz J Med Bio Res 43(8):705-711 (2010)
Bauer et al. Nat. Med. 25(5):776-783 (2019)
Bothmer et al. CRISPR J 3(3):177-187 (2020)
Bouva Hematologica 91(1):129-132 (2006)
Briner et al. Mol Cell 56(2):333-339 (2014)
Brousseau Am J Hematol 85(1):77-78 (2010)
Caldecott Nat Rev Genet 9(8):619-631 (2008)
Canvers et al. Nature 527(12):192-197 (2015)
198
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Chang etal. Mol Ther Methods Clin Dev 4:137-148 (2017)
Chassanidis Ann Hematol 88(6):549-555 (2009)
Chylinski et al. RNA Biol 10(5):726-737 (2013)
Cong et al. Science 399(6121):819-823 (2013)
Costa etal., Cad Saude Publica 18(5):1469-1471 (2002)
Davis & Maizels 2 Proc Nat! Acad Sci USA 111(10):E924-932 (2014)
Fine etal. Sci Rep. 5:10777 (2015)
Frit et al. DNA Repair (Amst) 17:81-97 (2014)
Fu et al. Nat Biotechnol 32:279-284 (2014)
Gao et al. Nat Biotechnol.: 35(8):789-792 (2017)
Giarratana et al. Nat Biotechnol. 23(1):69-74 (2005)
Giarratana etal. Blood:118,5071-5079 (2011)
Giannoukos etal. BMC Genomics 19(1):212 (2018)
Guilinger et al. Nat Biotechnol 32:577-582 (2014)
Heigwer et al. Nat Methods 11(2):122-123 (2014)
Hsu etal. Nat Biotechnol 31(9):827-832 (2013)
Iyama & Wilson DNA Repair (Amst) 12(8):620-636 (2013)
Jiang etal. Nat Biotechnol 31(3):233-239 (2013)
Jinek et al. Science 337(6096):816-821 (2012)
Jinek etal. Science 343(6176):1247997 (2014)
Kleinstiver et al. Nature 523(7561):481-485 (2015a)
Kleinstiver et al. Nat Biotechnol 33(12):1293-1298 (2015b)
Kleinstiver et al. Nature 529(7587):490-495 (2016)
Kleinstiver et al. Nat Biotechnol 37(3):276-282 (2019)
Komor etal. Nature 533(7603):420-424 (2016)
Kosicki et al. Nat Biotechnol 36(8): 765-771 (2018)
Lee et al. Nano Lett 12(12):6322-6327 (2012)
Lewis "Medical-Surgical Nursing: Assessment and Management of Clinical
Problems" (2014)
Li Cell Res 18(1):85-98 (2008)
Makarova et al. Nat Rev Microbiol 9(6)467-477 (2011)
Mali etal. Science 339(6121):823-826 (2013)
Mantovani et al. Nucleic Acids Res 16(16):7783-7797 (1988)
Masala Methods Enzymol. 231:21-44 (1994)
Marteijn et al. Nat Rev Mol Cell Biol 15(7):465-481 (2014)
Martyn et al., Biochim Biophys Acta 1860(5):525-536 (2017)
Metais etal. Blood Adv. 3(21):3379-92 (2019)
199
CA 03164055 2022-06-07
WO 2021/119040
PCT/US2020/063854
Nishimasu et al. Cell 156(5):935-949 (2014)
Nishimasu et al. Cell 162:1113-1126 (2015)
Notta et al. Science 333(6039):218-21 (2011)
Pausch et al. Science 369(6501):333-337 (2020)
Ran & Hsu Cell 154(6):1380-1389 (2013)
Richardson et al. Nat Biotechnol 34:339-344 (2016)
Swarts et al. May 22:e1481. doi: 10.1002/wrna.1481. Epub ahead of print. PMID:
29790280 (2018)
Shmakov et al. Molecular Cell 60(3):385-397 (2015)
Sternberg et al. Nature 507(7490):62-67 (2014)
Strohkendl et al. Mol. Cell 71:816-824 (2018)
Superti-Furga et al. EMBO J 7(10):3099-3107 (1988)
Thein Hum Mol Genet 18(R2):R216-223 (2009)
Thorpe et al. Br J Haematol. 87(1):125-132 (1994)
Tsai et al. Nat Biotechnol 34(5): 483 (2016)
Waber et al. Blood 67(2):551-554 (1986)
Wang et al. Cell 153(4):910-918 (2013)
Weber et al. Sci Adv. 6(7):eaay9392 (2020)
Wu et al. Nat. Med. 25(5): 776-83 (2019)
Xiao et al. Bioinformatics 30(8):1180-1182 (2014)
Xu et al. Genes Dev 24(8):783-798 (2010)
Yamano et al. Cell 165(4): 949-962 (2016)
Zetsche et al. Nat Biotechnol 33(2):139-42 (2015)
200
