Note: Descriptions are shown in the official language in which they were submitted.
WO 2021/133777
PCT/US2020/066560
MONOAMINE OXIDASE INHIBITORS AS MODIFIERS OF BETA
CELL VULNERABILITY IN TYPE I DIABETES
DESCRIPTION
[0011 This application claims the benefit of priority to United States
Provisional
Application No. 62/952,538, which was filed on December 23, 2019, and which is
incorporated by reference in its entirely.
SEQUENCE LISTING
[002] The present application is filed with a Sequence Listing in electronic
format.
The Sequence Listing is provided as a file entitled "2020-11-04 01123-0011-
00PCT Sequence Listing 5T25.txt" created on November 4, 2020, which is 12,288
bytes in
size. The information in the electronic format of the sequence listing is
incorporated herein
by reference in its entirety.
FIELD
[003] This application relates to monoamine oxidase inhibitors (MAOIs) for
treating
diabetes, including autoimmune diabetes.
BACKGROUND
[004] Type 1 diabetes (T1D) is caused by the immune-mediated killing of beta
cells
in the pancreas (1). Several groups have developed effective differentiation
protocols to
generate insulin-producing beta-like cells from human embryonic or induced
pluripotent stem
cells (2). These advances have raised the prospect of replacing lost beta
cells in T1D patients
using autologous stem cell-derived beta cells, a strategy with the potential
to provide an
unlimited supply of cells while also circumventing issues of transplant
rejection. However,
key hurdles persist. In the absence of immune suppression, recun-ent
autoimmunity rapidly
destroys transplanted beta cells. Immune therapies that would induce tolerance
to beta cells in
T1D patients have not yet been successfully translated from animal models into
human (1).
To overcome this critical issue, genetic modifications were investigated that
render
transplanted beta cells resistant to autoimmune killing. Others have attempted
to produce
hypoimmunogenic cells by targeting a series of rationally chosen genes related
to immune
recognition including antigen-presenting HLA molecules (3, 4). Although this
approach was
reported to be partially effective, it requires the complete abrogation of
immune surveillance
that protects against infection and tumor formation.
1
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
[005] This disclosure describes monoamine oxidase inhibitors (MAO inhibitors)
as
novel modifiers of beta cell vulnerability in autoimmune diabetes, such as
TID.
S Li M MARV
[006] In accordance with the description, this application describes a method
of
lowering blood glucose or increasing insulin secretion in response to glucose
in a subject
comprising administering a monoamine oxidase inhibitor (MAOI), wherein the
monoamine
oxidase inhibitor binds renalase, binds flavin adenine dinucleotide (FAD),
and/or produces an
active agent that binds renalase or FAD.
[007] In some embodiments, the subject has autoimmune diabetes. In some
embodiments, the subject has type 1 diabetes. In some embodiments, the subject
has
autoimmune diabetes induced by an immunotherapy. In some embodiments, the
monoamine
oxidase inhibitor is administered in combination with an additional treatment.
In some
embodiments, the additional treatment is insulin. In some embodiments, the
insulin is a rapid-
acting, intermediate-acting, or long-acting insulin. In some embodiments, the
additional
treatment is a glucagon-like peptide analog or agonist, dipeptidyl peptidase-4
inhibitor,
amylin analog, biguanide, thiazolidinedione, sulfonylurea, meglitinide, alpha-
glucosidase
inhibitor, or sodium/glucose transporter 2 inhibitor. In some embodiments, the
subject has a
blood sugar level higher than 11.1 mmol/liter or 200 mg/d1.
[008] In some embodiments, a method of preventing the death of pancreatic beta
cells or beta-like cells comprises administering a monoamine oxidase inhibitor
(MAOI),
wherein the monoamine oxidase inhibitor binds renalase, binds flavin adenine
dinucleotide
(FAD), and/or produces an active agent that binds renalase or FAD.
[009] In some embodiments, the beta cells are those of the subject. In some
embodiments, the beta cells are not those of the subject. In some embodiments,
the subject is
being treated with an immunotherapy. In some embodiments, the immunotherapy is
a
checkpoint antibody.
[0010] In some embodiments, the checkpoint antibody is an anti-PD-1 antibody,
anti-
PD -L1 antibody, or anti-CTLA-4 antibody. In some embodiments, the beta cells
or beta-like
cells are transplanted. In some embodiments, the beta cells or beta-like cells
are transplanted
into a patient with autoimmune diabetes. In some embodiments, the beta cells
or beta-like
cells are administered by transplant into the pancreas, liver, or fat pads via
surgery, injection,
or infusion.
2
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
[0011] In some embodiments, a method of preventing the development of type 1
diabetes comprises screening a subject for risk factors for type 1 diabetes;
determining if the
subject has increased risk of developing type 1 diabetes; and administering a
monoamine
oxidase inhibitor if the subject has an increased risk of type 1 diabetes.
[0012] In some embodiments, screening a subject for risk factors comprises
obtaining
data on a genetic risk score that is based on the known type 1 diabetes-
associated gene
variants, a family history of type 1 diabetes, the presence of one or more
autoantibodies
against beta cell antigens that are known to predict disease risk, and/or
abnormal glucose
tolerance.
[0013] In some embodiments, the subject is a mammal. In some embodiments, the
mammal is a human.
[0014] In some embodiments, the monoamine oxidase inhibitor is a
propargylamine,
hydrazine, propylamine, or oxazolidinone derivative. In some embodiments, the
monoamine
oxidase inhibitor is clorgyline, pargyline, rasagiline, selegiline,
ladostigil, ASS234,
isocarboxazid, toloxatone, or tranylcypromine.
[0015] Additional objects and advantages will be set forth in part in the
description
which follows, and in part will be obvious from the description, or may be
learned by
practice. The objects and advantages will be realized and attained by means of
the elements
and combinations particularly pointed out in the appended claims.
[0016] It is to be understood that both the foregoing general description and
the
following detailed description are exemplary and explanatory only and are not
restrictive of
the claims.
[0017] The accompanying drawings, which are incorporated in and constitute a
part
of this specification, illustrate one (several) embodiment(s) and together
with the description,
serve to explain the principles described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 shows that a genome-scale CRISPR/Cas9 screen identifies Rpz/s
as a
modifier of beta cell survival in the NOD mouse model. NIT-1 cells (107)
transduced with the
mouse GECKO A CR1SPR lentiviral library (M01=0.3) and selected with puromycin
were
implanted subcutaneously (SubQ) into NOD.scid mice, with or without
intravenous injection
of 107splenocytes from diabetic NOD mice. After 8 weeks, NIT-1 grafts were
retrieved from
recipients with (autoimmune) and without (non-autoimmune) splenocyte co-
injection. Next-
generation sequencing of gRNAs present in surviving grafts identified Rnls
gRNA
3
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
(MGLibA 46009, 5'-CTACTCCTCTCGCTATGCTC-3' (SEQ ID NO: 1)) as one of only 11
gRNAs detected at high frequency in mice with beta cell autoimmunity.
1_0019] Figures 2A-2L show that RnIs mutation protects NIT-I and primary NOD
beta
cells against autoimmune destruction in vivo. (A) Experimental approach used
to test NIT-1
beta cell survival after transplantation and induction of autoimmuni-ty.
Control (NT) and
Rnlsn't NIT-1 cells (107) carrying a luciferase reporter were implanted on
opposite flanks of
NOD .scid mice. Autoimmunity was induced by injection of 107 splenocytes from
diabetic
(DM) NOD mice. (B) Representative images of graft luminescence at days 0, 3,
7, 14 and 18
post-transplantation. (C, D) Relative luminescence of paired Rnlsin" and
control grafts over
time (C) and at day 18 (D), normalized to the ratio on day 0. Data show mean
SEM of n=5
(+splenocytes) and n=3 (-splenocytes) mice. (E) Experimental approach used to
test NIT-1
cell survival transplanted into diabetic NOD mice. Control (NT) and Rnismi"
NIT-1 cells (107)
were implanted on opposing flanks of overtly diabetic NOD mice. (F)
Representative images
of graft luminescence at day 0, 5, 8, 10, 14 and 18 post-transplantation (G)
Proportion of
remaining luminescence relative to day 0 (100%). (H) Relative luminescence of
paired
Rnlsin" and control grafts. Data show mean SEM of n=5 mice. (I) Experimental
approach
used to test autoimmune killing of primary islet beta cells. NOD .s cid islet
cells transduced
with lentivirus encoding a non-targeting (NT) control or Rn/s-targeting gRNA
and rat insulin
promoter (RIP)-driven Cas9 endonuclease were transplanted under the left and
right kidney
capsule, respectively, of the same NOD.scid recipients. Autoimmunity was
induced as in (A).
(J) Representative images of transplanted islets on the explanted kidney at
day 39. (K)
Quantification of insulin mRNA relative to glucagon (Gcg) mRNA in paired
grafts from non-
autoimmune (- splenocytes, n=5) and autoimmune (+ splenocytes, n=6) mice at
day 39. (L)
Relative insulin expression in paired Rnls""t and control (NT) grafts. Data
represent mean
SEM. * P < 0.05, ** P < 0.01, calculated by nonparametric unpaired Mann-
Whitney test (C-
D, G-H, I), and paired Wilcoxon test (K). All data are representative of 2 or
more similar
experiments.
00201 Figures 3A-3H shows that Rnls deficiency diminishes immune recognition
of
beta cells in vitro. (A-D) Representative flow cytometry data and summary data
for MHC-I
(A, B, MFI: mean fluorescent intensity) and MHC-II (C, D, expressed as % MHC-
II+ cells)
expression in control and Rnls' cells treated with thapsigargin (TG) or
vehicle (DMSO).
Data are representative of three independent experiments. (E and F) BDC2.5-TCR
transgenic
CD4+ T cells were co-cultured with NIT-1 cells and irradiated splenocytes from
NOD .scid
4
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
mice. IFN-y expression in CD4+ T cells was measured at 24 h by flow cytometry.
Representative (E) and combined data (F) from technical triplicates are shown.
Data are
representative of 5 independent experiments. (G and H) ELISPOT measurement for
the
activation of polyclonal CD8+ T cells from a diabetic NOD mouse following
stimulation with
control or Rnls' NIT-1 cells. Wells without NIT-1 cells or with PMA and
ionomycin (Iono)
were used as negative and positive controls, respectively. Data are
representative of three
independent experiments. Data were compared by ANOVA with Tukey's multiple
comparison test. ns, not significant, *** P=0.0001. All data show mean SEM.
[0021] Figures 4A-4E show that Rnls deficiency confers ER stress resistance in
vitro.
(A and B) Cell viability measurement 24 h after thapsigargin (TG) (A) and
tunicamycin (TC)
(B) treatment. n=4 technical replicates per condition, representative of 2
independent
experiments. (C-E) Measurement of the unfolded protein response (UPR) in
response to TG
challenge. ER stress pathway protein phosphorylation (PERK, eIF2a and IRE1a),
expression
(ATF4, Txnip, NRF2) and cleavage (ATF6, Caspase3) (C), Xbpl splicing (D) and
Chop and
Txnip mRNA levels (E) were measured in control (NT) and Rn/sr""tNIT-1 cells
treated with
or without 1 ?AM TG for 5 h. Data represent mean SEM, *# P < 0.05, **## P <
0.01,
***### P <0.o01, calculated by ANOVA with Sidak's multiple comparisons test. *
Control
vs. Rnls" cells in non-treatment group; # Control vs. Rnls" cells in TG-
treatment group (D
and E).
[0022] Figures 5A-5H show that pargyline binds RNLS and protects beta cells
against
autoimmunity. (A) Schematic representation of the predicted interaction of
pargyline with the
FAD co-factor within the RNLS active site. (B) Human recombinant RNLS protein
denaturation profile in the presence and absence of pargyline (PG) by a SYPRO
orange
protein-dye-based thermal shift assay. (C) RNLS melting temperature (Tm)
change in
response to pargyline. Data were fit to a variable slope four-parameter
sigmoid curve. n=3
technical replicates per condition, representative of 2 independent
experiments. (D)
Experimental approach used to test pargyline for the protection of NIT-1 cells
transplanted
into diabetic NOD mice. (E) Representative images of graft luminescence at
days 0, 3, 5, 7,
12 and 19 post- transplantation. (F) Proportion of remaining graft
luminescence relative to
day 0 (100%). (G) Blood glucose levels in the control and pargyline treated
mice over time.
(H) Plasma insulin levels in the control and pargyline treated mice at day 20
(D20). Data
show mean SEM of n=5 mice per group and are representative of 2 similar
experiments, *
P <0.05, calculated by ANOVA with Tukey's multiple comparisons test.
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
[0023] Figures 6A-6B show autoimmune killing of NIT-1 cells in NOD mice can be
visualized by bioluminescence imaging. (A and B) Bioluminescence imaging of
107 NIT-1
cells transplanted subcutaneously into NOD.scid mice. Transplanted cells were
engineered to
carry a CMV-luciferase2 (Luc2) reporter. Some recipient mice were also
injected
intravenously with 107 splenocytes isolated from spontaneously diabetic (DM)
NOD mice to
cause beta cell killing. Images were taken at day 1 (A) and 15 (B) post-
injection.
[0024] Figures 7A and 7B show validation of Rn/s mutation by CRISPR-Cas9
targeting. (A) T7 endonuclease I assay. Genomic DNA from NIT-1 wild-type (WT)
and
Rn/s' cells was tested for CRISPR-Cas9 gene editing events. Cleavage at
heteroduplex
mismatch sites by T7 endonuclease I digestion was analyzed by agarose gel
electrophoresis.
DNA from Rn/sllmt cells segregated into multiple digested fragments,
indicating efficient
mutation of the targeted region in the Rn/s gene. (B) Genomic DNA from
Rnlsinut cells was
sequenced to identify individual mutations (SEQ ID NOs: 17-23). The Rn/s gRNA
targeting
site in the wildtype (SEQ ID NO: 16) is labelled with underlining. The
mutations with the
highest frequencies in Rnlsn't cells are shown.
[0025] Figure 8 shows that Rn/s mutation does not impair insulin secretion.
Islets
(-z-,'1700) were purified from 8-week old CD1 mice, dispersed and transduced
with lentivirus
encoding a non-targeting (NT) or Rn/s-targeting gRNA together with the Cas9
endonuclease
driven by the rat insulin promoter. After 72 hours, islets were stimulated
sequentially with 2.8
mM glucose, 16.8 mM glucose and finally 30 mM KC1 to induce insulin secretion.
Islet
genomic DNA was quantified for normalization of ELISA insulin measurements to
DNA
content. n=5 technical replicates per condition and genotype. Data show mean +
SEM. Note
that islet dispersion necessary for lentiviral transduction decreased the
overall responsiveness
of purified islets compared to intact islets. Insulin secretion by Rn/s mutant
islet cells was not
significantly different from that of control (NT) islets.
[0026] Figures 9A-9B show that Rn/s mutation does not prevent allo-rej ection
of
NIT-1 beta cells. Control and Rnlsinut NIT-1 cells (107) carrying a luciferase
reporter were
implanted on opposing flanks of C57BL/6 mice (n=3). Graft bioluminescence was
measured
on days 0, 4 and 7 after transplantation. Representative bioluminescence
images (A) and
relative luminescence of grafts over time (B) are shown. Data represent mean
SEM. Both
control and mutant grafts were destroyed by allo-rejection within a week.
[0027] Figures 10A-10B show that Rnlsinut cells are not resistant to non-ER
stress
induced cell death. (A) Relative cell viability at 6 hours and 24 hours after
treatment with 40
6
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
mtVI streptozotocin (STZ) (n=3 technical replicates). (B) Relative cell
viability 48 hours after
mitomycin C (MMC) at the indicated concentration (n=3 technical replicates).
Data represent
mean SEM, *** P < 0.001, calculated by ANOVA with Sidak's multiple
comparisons test.
[0028] Figures 11A-11D show that Rnls knockout replicates the ER stress-
resistant
phenotype of RnIsn't cells. Rnls knockout NIT-1 cell lines were generated by
deleting either
exons 2-4 or exon 5. Deletion efficiency was confirmed by qPCR of genomic DNA.
Rnls
AEx2/4 cells showed ¨60% deletion of exons 2-4 genomic DNA qPCR (A) while Rnls
AEx5
cells showed ¨87% deletion of exon 5 (B). (C and D) Cell viability of Rnls
deficient cells
was measured 72 h after thapsigargin (TG, C) and tunicamycin (TC, D)
treatment. Data show
mean SEM, *** P < 0.001, calculated by unpaired t-test (A and B) and ANOVA
with
Sidak's multiple comparisons test (C and D).
[0029] Figures 12A-12B show that Rnls overexpression sensitizes NIT-1 cells to
ER
stress-induced death and reverses the resistant phenotype of RnIsm"' cells. (A
and B) NIT-1
cell viability was measured 24 h after treatment with thapsigargin (TG) at the
indicated
concentrations. Overexpression of Rnls in WT NIT-1 cells increased sensitivity
to low dose-
TG-induced killing (A). CRISPR-immune Rnls (CiRn1s) expressed in Rnls' cells
restored
sensitivity to TG-induced killing (B). n=4 technical replicates per group.
Data represent mean
SEM, *# P < 0.05, ***### P < 0.001, calculated by ANOVA plus Sidak's multiple
comparisons test. *Comparison of control vs. Rnls"t cells; #comparison of
Rnismilt vs. Rnlsinut
+ CiRnls cells.
[0030] Figures 13A-13C show that Rnls overexpression increases sensitivity to
autoimmune killing in vivo. Control (WT) and Rnls overexpressing (Rnlsn NIT-1
cells
carrying a luciferase reporter were implanted on opposing flanks of NOD.scid
mice. Some
graft recipients were also injected intravenously with splenocytes from
diabetic NOD mice
(DM NOD splenocytes). Graft bioluminescence was imaged on days 0, 2, 3 and 7
(A). The
relative luminescence of Rnls E and control grafts over time, normalized to
day 0, is shown
in (B). Data for all mice analyzed on day 3 is shown in (C). Itrilsc' graft
were more sensitive
to autoimmune killing as evidenced by more rapid loss of luminescence. By day
7, both
control and Rnlsc' grafts were killed to ¨90% (data not shown), resulting in a
similar relative
luminescence level. n=6 mice (each with two grafts). Data represent mean
SEM, * P <
0.05, **P < 0.01, calculated by unpaired t-test.
[0031] Figures 14A-14B show that Rnls overexpression restores the sensitivity
of
Rnisn't cells to autoimmune killing in vivo. Rnis" NIT-1 cells and Rnls"1"t
cells expressing
7
CA 03174673 2022- 10- 4
WO 2021/133777
PCT/US2020/066560
the CRISPR-insensitive Rnls transgene (CiRn1s), all carrying a luciferase
reporter, were
implanted on opposing flanks of NOD.scid mice. Graft recipients were also
injected
intravenously with splenocytes from diabetic (DM) NOD mice. Graft
bioluminescence was
imaged on days 0, 2, 3 and 5 post-injection (A). Relative luminescence of
paired grafts over
time normalized to day 0 is shown in (B). n=5 mice. Data represent mean SEM.
[0032] Figure 15 shows that islet Rnls expression is elevated in the diabetes-
prone
NOD mouse strain. Rnls mRNA expression levels in islets isolated from C57BL/6,
NOD and
NOD.scid mice was determined by TaqMan assays using Rills (Mm04178677 ml) and
Hprtl
(Mm0302475 ml) probes from Thermo Fisher Scientific. n=8 mice per group. Data
show
mean SEM, * P < 0.05, **P < 0.01, calculated by nonparametric Kruskal-Wallis
with
Dunn's multiple comparisons test.
[0033] Figures 16A-16H show that Rnls deficiency diminishes the UPR following
ER
stress using a variety of different markers. Data represent quantification of
Western blot data
shown in Figure 4C. Images were obtained and quantified using a C-DiGit
scanner and the
Image Studio software (LI-COR Biosciences). n=3 per group. Data show mean
SEM, *# P
<0.05, **## P < 0.01, ***### P < 0.001, calculated by ANOVA with Dunnett's
multiple
comparisons test. *Comparison to control cells without TG treatment;
#comparison to control
cells with 5-hour TG treatment.
[0034] Figure 17 shows Mils deficiency confers resistance to oxidative stress.
Control
(Ctrl) and 1?nls1' NIT-1 cells were cultured overnight with or without
hydrogen peroxide
(H202) at the indicated concentrations. Cell viability was assessed using the
CellTiter-Glo
luminescence Cell Viability Assay. Data show mean SEM of triplicate cultures
and are
representative of three independent experiments. ... P<0.0001.
[0035] Figure 18 shows that pargyline treatment preserves insulin expression
in NOD
mice with long-duration diabetes. Pancreases were isolated from control and
pargyline-
treated diabetic NOD mice described in Figure 5 that were euthanised at day 20
post-beta
cell-transplantation. Pancreatic sections were stained with anti-insulin
(DAKO, #A0564),
anti-CD3 (Bio-rad, #MCA500), and DNA dye Hoechst 33342 (Invitrogen, #H3570).
Goat
anti-guinea pig Alexa Flour 488 and donkey anti-rat Alexa Flour 594 secondary
antibodies
(Thermo Fisher Scientific, #A11073 and #A21209) were used to detect insulin
and CD3
antibodies, respectively. All images were taken using a Zeiss LSM710NLO
confocal
microscope.
8
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
[0036] Figures 19A-19B show that pargyline treatment does not prevent beta
cell
destruction after allo-transplantation. Wild-type NIT-1 cells (107) carrying a
luciferase
reporter were implanted into C57BL/6 mice that were treated or not with oral
pargyline via
addition to the drinking water. Graft bioluminescence was measured on days 1,
2, 3 and 4
after transplantation. Representative bioluminescence images (A) and relative
luminescence
of grafts over time (B) are shown. Data show mean SEM for n=3 mice per
group.
[0037] Figures 20A-20F show thermal shift assay results for human recombinant
renalase in the presence of pargyline (A), rasagiline (B), selegiline (C),
tranylcypromine (D),
isocarboxazid (E), or toloxatone (F). All drugs were used at 100mM, and caused
a
destabilization of the enzyme, as evidence by a decrease in the unfolding
temperature (left-
shift of the curves).
[0038] Figures 21A and 21B show in vivo effects of pargyline in diabetes
models. (A)
Pargyline treatment decreases diabetes onset after cyclophosphamide injection.
Groups of 10-
week-old male NOD mice were fed pargyline via the drinking water (5pg/m1).
Diabetes was
induced by intraperitoneal injection of cyclophosphamide (200mg/kg). (B)
Pargyline
treatment decreases diabetes onset after PD-1 blockade. Groups of 10-week-old
female NOD
mice were fed pargyline via the drinking water (10m/m1). Diabetes was induced
by
intravenous injection of anti-PD-1 antibody (2501.1g/mouse).
[0039] Figures 22A-22C show in vivo effects of pargyline treatment (25 tg/m1
pargyline in the drinking water) in mouse models of type 1 diabetes. Pargyline
treatment
improved survival when diabetes was induced by adoptive transfer (A) or when
diabetes was
induced by low doses of streptozotocin (STZ, B). Pargyline also delayed the
onset of diabetes
following STZ treatment (C).
DESCRIPTION OF THE SEQUENCES
[00401 Table 1 provides a listing of certain sequences referenced herein.
Table 1: Description of the Sequences
Descrip Sequences SEQ
tion ID
NO
Rnls CTACTCCTCTCGCTATGCTC 1
gRNA
Non- TAAAAACGCTGGCGGCCTAG 2
targeting
gRNA
Moclifie TTATAGTAGCCGGTACGCA 3
d Rnls
gRNA
9
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
targeting
sequenc
Rnls CGTCTGGGAAGTCTTGGTCG 4
gRNA
sequenc
e for
exon 2-4
Rh/ s CGGGACTCATCCCATTGTCG 5
gRNA
sequenc
e for
exon 2-4
Rnls GGGGAGTGAGGATAGGATAG 6
gRNA
sequenc
e for
exon 5
Rnls TCCGTAGTGGTTTTAGAGTG 7
gRNA
sequenc
e for
exon 5
Chop CCAC CACAC CT GAAAGCAGAA
forward
primer
Chop AGGTGAAAGGCAGGGACTCA 9
reverse
primer
Txnip TCAAGGGCCCTGGGAACATC 10
forward
primer
Txnip GACACTGGTGCCATTAAGTCAG 11
reverse
primer
Xbpl AAACAGAGTAGCAGCGCAGACTGC 12
forward
primer
Xbpl TCCTTCTGGGTAGACCTCTGGGAG 13
reverse
primer
Forward TGCTATAGACAGTTGGGACTTGTTT 14
primer
for Rnls
gRNA
site PCR
Reverse ATATTGCGTTCTATTATCAATGGAGATGAAGC 15
primer
for Rnls
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
gRNA
site PCR
Wildtyp CIGTGAGCTACTCCICTCGCTATG*CTCTGGGCCTCTITTATGAAG 16
e Rnl s TAGGCATGAAGATT
(*
indicates
that an
insertion
can be
introduc
ed at
this
location
to
generate
SEQ ID
NO: 20)
Rnis CTGTGAGCTACTCCTCTCG 17
mutant 1 CTCTGGGCCTCTTTTATGAAGTAGGCATGAAGATT
indicates
deletion
of a
nucleoti
de
compare
d to
wildtype
SEQ ID
NO: 16)
Rnls CTGTGAGCTACTCCTCTCGCTAT- 18
-
mutant 2 CTCTGGGCCTCTTTTATGAAGTAGGCATGAAGATT
indicates
deletion
of a
nucleoti
de
compare
d to
wildtype
SEQ ID
NO: 16)
Rnls CTGTGAGCTACTCCT 19
mutant 3 CTCTGGGCCTCTTTTATGAAGTAGGCATGAAGATT
indicates
deletion
of a
nucleoti
11
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
de
compare
d to
wildtype
SEQ ID
NO: 16)
Rnis CTGTGAGCTACTCCTCTCGCTATGGCTCTGGGCCTCTTTTATGAAG 20
mutant 4 TAGGCATGAAGATT
Rnls CTGTGAGCTACTCCTCTCG 21
mutant 5 CTGGGCCTCTTTTATGAAGTAGGCATGAAGATT
indicates
deletion
of a
nucleoti
de
compare
d to
wildtype
SEQ ID
NO: 16)
Rnls CTGTGAGCTACTC 22
mutant 6 CTCTGGGCCTCTTTTATGAAGTAGGCATGAAGATT
(-
indicates
deletion
of a
nucleoti
de
compare
d to
wildtype
SEQ ID
NO: 16)
CTGTGAGCTACTCCTCTCG 23
mutant 7 CCTCTTTTATGAAGTAGGCATGAAGATT
(-
indicates
deletion
of a
nucleoti
de
compare
d to
wildtype
SEQ ID
NO: 16)
12
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
DESCRIPTION OF THE EMBODIMENTS
I. Definitions
[0041] In addition to definitions included in this sub-section, further
definitions of
terms are interspersed throughout the text.
[0042] In this invention, -a" or -an" means at least one" or one or more,"
etc.,
unless clearly indicated otherwise by context. The term "or" means "and/or"
unless stated
otherwise. In the case of a multiple-dependent claim, however, use of the term
"or" refers
back to more than one preceding claim in the alternative only.
[0043] -Autoimmune" or -autoimmune attack," as used herein, refers to an
attack by
the subject's immune system against cells that are part of the subject. As
such, an
autoimmune disease is an abnormal immune response to a normal body part. In
the case of
type 1 diabetes, the autoimmune attack is predominantly against the beta cells
of the pancreas
that normally secrete insulin in a glucose-dependent manner. As used herein,
"autoimmune
diabetes" relates to any diabetes induced an autoimmune attack, such as type 1
diabetes or
diabetes induced by an immunotherapy.
[0044] As used herein, "beta-like cell" refers to any cell that secretes
insulin in
response to glucose. Thus, a pancreatic beta cell is a "beta-like cell." Beta-
like cells may be
derived from cells that do not normally produce insulin in response to
glucose. For example,
a beta-like cell may be a stem cell that is induced to differentiate into a
"beta-like cell- that
produces insulin in a glucose-responsive manner. (see FW Pagliuca et al., Cell
159:428-439
(2014); E Kroon et al., Nature Biotech 26(4):443-452 (2008); and A Rezania et
al., Nature
Biotech 32(11): 1121-1133 (2014). Likewise, a -beta-like cell" may also be a
pancreatic
exocrine cell (see Q Zhou et al., Nature 455:627-633 (2008)), pancreatic alpha
cell (see Li et
al, Cell 168:86-100 (2017), or gut cell (see Ariyachet C et al., Cell Stem
Cell 18(3):410-21
(2016)) that is induced to produce insulin in response to glucose. The term
"beta-like cells"
also includes cells that become glucose responsive insulin secretors after
transplantation into
a subject.
[0045] The term "treatment,- as used herein, covers any administration or
application
of a therapeutic for disease in a subject, and includes inhibiting the
disease, arresting its
development, relieving one or more symptoms of the disease, or preventing
reoccurrence of
one or more symptoms of the disease. For example, treatment of diabetes type 1
subjects
13
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
may comprise alleviating hyperglycemia as compared to a time point prior to
administration
or reducing the subject's need for exogenous insulin administration.
MAOIs that bind renalase or FAD
[0046] This application relates to lowering blood glucose or increasing
insulin
secretion in response to glucose in a subject comprising administering a
monoamine oxidase
inhibitor (MAOI) wherein the monoamine oxidase inhibitor binds renalase
(RNLS), binds
flavin adenine dinucleotide (FAD), and/or produces an active agent that binds
RNLS or FAD.
[0047] Flavin adenine dinucleotide (FAD) binding sites are conserved across
flavoprotein oxidases, such as RNLS and MAO (See Gaweska and Fitzpatrick
Biomol
Concepts. 2(5): 365-377 (2011)). These flavoprotein oxidases may have
structural diversity
in other regions, while retaining homology in the FAD binding site. FAD is
comprised of an
adenine nucleotide (adenosine monophosphate) and a flavin mononucleotide
bridged together
through their phosphate groups.
[0048] Human RNLS (hRNLS) comprises a flavin adenine dinucleotide (FAD)
binding site and uses FAD as a co-factor for catalysis. MAO (including MAO A
and MAO B
isoforms) also interacts with FAD and can complex with inhibitors that bind
FAD.
[0049] A wide variety of MAOI have been described, some of which can bind to
FAD (See Ramsay and Albreht Journal of Neural Transmission 125:1659-1683
(2018)).
1-00501 In some embodiments, the MAOI binds renalase (RNLS). MAOIs that bind
RNLS can be determined using standard binding assays. such as radioligand
binding,
functional assays, or thermal shift assays. This application describes a
variety of MAOIs that
can bind FAD and can also bind to RNLS. In some embodiments, a thermal shift
assay can be
used to determine binding of an MAOI to RNLS, such as data shown in Figures
20A-20F.
[0051] In some embodiments, the MAOI binds RNLS via binding to the FAD bound
to RNLS. In some embodiments, binding of the MAOI to RNLS blocks or inhibits
function
of RNLS.
[0052] In some embodiments, the MAOI binds FAD. In some embodiments, the
MAOI binds to the flavin of FAD. In some embodiments, the MAOI binds to the N5
atom of
flavin.
[0053] In some embodiments, the MAOI produces an active species that can bind
RNLS. In some embodiments, the MAOI produces an active species that can bind
FAD. In
some embodiments, the MAOI is modified by RNLS to an active form, which can
bind to
FAD or RNLS. In some embodiments, the MAOI or its active species forms a
covalent
adduct with FAD or RNLS.
14
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
[0054] In some embodiments, the MAOI binds reversibly to FAD or RNLS. In some
embodiments, the MAOI binds irreversibly to FAD or RNLS.
[0055] In some embodiments, the MAOI binds covalently to FAD or RNLS. In some
embodiments, the MAOI binds non-covalently to FAD or RNLS.
[0056] In some embodiments, the monoamine oxidase inhibitor is a
propargylamine,
hydrazine, propylamine, or oxazolidinone derivative.
[0057] In some embodiments, the monoamine oxidase inhibitor is clorgyline,
pargyline, rasagiline, selegiline, ladostigil, ASS234, isocarboxazid,
toloxatone, or
tranylcypromine.
III. Methods of treatment
[0058] A method of treating diabetes mellitus comprising administering a MAOI
is
encompassed. This method may be for treating diabetes, including autoimmune
diabetes. In
some embodiments, the subject has type 1 diabetes or autoimmune diabetes
induced by an
immunotherapy.
[0039] A method of lowering blood glucose levels comprising administering a
MAOI
is also encompassed. This method may be for treating subjects with diabetes,
including
autoimmune diabetes. In some embodiments, the subject has type 1 diabetes or
autoimmune
diabetes induced by an immunotherapy.
[0060] A method increasing insulin secretion in response to glucose comprising
administering a MAOI is also encompassed. This method may be for treating
subjects with
diabetes, including autoimmune diabetes. In some embodiments, the subject has
type 1
diabetes or autoimmune diabetes induced by an immunotherapy.
[0061] A method of preventing or slowing the death of pancreatic beta cells or
beta-
like cells comprising administering a MAOI is also encompassed. This method
may be for
treating subjects with diabetes, including autoimmune diabetes. In some
embodiments, the
subject has type 1 diabetes or autoimmune diabetes induced by an
immunotherapy.
[0062] Glucose levels in the blood are normally tightly regulated to maintain
an
appropriate source of energy for cells of the body. Insulin and glucagon are
principal
hormones that regulate blood glucose levels. In response to an increase in
blood glucose, such
as after a meal, insulin is released from beta cells of the pancreas. Insulin
regulates the
metabolism of carbohydrates and fats by promoting uptake of glucose from the
blood into fat
and skeletal muscle. Insulin also promotes fat storage and inhibits the
release of glucose by
the liver. Regulation of insulin levels is a primary means for the body to
regulate glucose in
the blood.
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
[0063] When glucose levels in the blood are decreased, insulin is no longer
released
and instead glucagon is released from the alpha cells of the pancreas.
Glucagon causes the
liver to convert stored glycogen into glucose and to release this glucose into
the bloodstream.
Thus, insulin and glucagon work in concert to regulate blood glucose levels.
[0064] In one embodiment, treatment of diabetes mellitus is to administer a
MAOI to
a subject to lower blood glucose.
[0065] Hyperglycemia refers to an increased level of glucose in the blood.
Hyperglycemia can be associated with high levels of sugar in the urine,
frequent urination,
and increased thirst. Diabetes mellitus refers to a medical state of
hyperglycemia.
[0066] The American Diabetes Association (ADA) suggests that fasting plasma
glucose (FPG) levels of 100 mg/dL to 125 mg/dL or HbAl c levels of 5.7% to
6.4% may be
considered hyperglycemia and may indicate that a subject is at high risk of
developing
diabetes mellitus (i.e. prediabetes, see ADA Guidelines 2015).
[0067] The ADA states that a diagnosis of diabetes mellitus may be made in a
number
of ways. A diagnosis of diabetes mellitus can be made in a subject displaying
an HbAlc level
of >6.5%, an FPG levels of >126 mg/dL, a 2-hour plasma glucose of >200 mg/dL
during an
OGTT, or a random plasma glucose level >200 mg/dL in a subject with classic
symptoms of
hyperglycemia. In some embodiments, the subject has a blood sugar level higher
than 11.1
mmol/liter or 200 mg/d1.
[0068] Diabetes mellitus can be broken into Type 1 and Type 2. Type 1 diabetes
mellitus (previously known as insulin-dependent diabetes or juvenile diabetes)
is an
autoimmune disease characterized by destruction of the insulin-producing beta
cells of the
pancreas. Classic symptoms of Type 1 diabetes mellitus are frequent urination,
increased
thirst, increased hunger, and weight loss. Subjects with Type 1 diabetes
mellitus are
dependent on administration of insulin for survival.
[0069] In the absence of regulation of glucose levels in subjects with
diabetes, a range
of serious complications may be seen. These include atherosclerosis, kidney
disease, stroke,
nerve damage, and blindness.
[0070] In some embodiments, the subject treated has diabetes mellitus based on
diagnosis criteria of the American Diabetes Association. In some embodiments,
the subject
with diabetes mellitus has an HbAl c level of >6.5%. In some embodiments, the
subject with
diabetes mellitus has an FPG levels of >126 mg/dL. In some embodiments, the
subject with
diabetes mellitus has a 2-hour plasma glucose of >200 mg/dL during an OGTT. In
some
embodiments, the subject with diabetes mellitus has a random plasma glucose
level >200
16
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
mg/dL or 11.1 mmol/L. In some embodiments, the subject with diabetes mellitus
has a
random plasma glucose level >200 mg/dL or 11.1 mmol/L with classic symptoms of
hyperglycemia.
[0071] In some embodiments of the invention, the subject treated is a mammal.
In
some embodiments, the mammal is a human, non-human primate, cow, horse, pig,
sheep,
goat, dog, cat, or rodent. In some embodiments, the subject is a human
subject.
[0072] In some embodiments, the subject has autoimmune diabetes. In some
embodiments, the subject treated has Type 1 diabetes mellitus.
[0073] In some embodiments, the subject treated has a relative decrease in
insulin
levels. In some embodiments, the subject treated has decreased beta cell mass.
In some
embodiments, the decrease in beta cell mass in a subject is due to an
autoimmune disease.
[0074] Treatment of patients with therapeutics targeted to increase the body's
immune response to cancers, termed immunotherapies, has also been associated
with the
development of autoimmune diabetes (See Alrifai T et al., Case Reports in
Oncological
Medicine 2019: Article ID 8781347). For example, immune checkpoint antibodies
have been
reported to cause immune-mediated damage of islet cells leading to induction
of autoimmune
diabetes similar to type 1 diabetes.
[0075] In some embodiments, the subject has autoimmune diabetes induced by an
immunotherapy. In some embodiments, the immunotherapy is a checkpoint
antibody. In
some embodiments, the checkpoint antibody is an anti-PD-1 antibody, anti-PD -
L1 antibody,
or anti-CTLA-4 antibody.
[0076] In one embodiment, the method comprises lowering blood glucose levels
in
the diabetic subject to below about 200 mg/dL, 150 mg/dL, 100 mg/dL, or about
125 mg/dL.
[0077] In some embodiments, treatment of diabetes is lowering blood glucose in
the
subject after administering a MAOI. In some embodiments, treatment of diabetes
is
increasing insulin levels in the subject after administering a MAOI. In some
embodiments,
treatment of diabetes is increasing insulin secretion in the subject after
administering a
MAOI.
[0078] In some embodiments, administering a MAOI causes a decrease in blood
glucose levels such that levels are less than 200 mg/dL.
[0079] In some embodiments, the MAOI is administered in combination with an
additional treatment. In some embodiments, the additional treatment is
insulin. In some
embodiments, the insulin is a rapid-acting, intermediate-acting, or long-
acting insulin. In
some embodiments, the additional treatment is a glucagon-like peptide analog
or agonist,
17
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
dipeptidyl peptidase-4 inhibitor, amylin analog, biguanide, thiazolidinedione,
sulfonylurea,
meglitinide, alpha-glucosidase inhibitor, or sodium/glucose transporter 2
inhibitor.
[0080] This application also encompasses methods of preventing the death of
pancreatic beta cells or beta-like cells comprising administering a monoamine
oxidase
inhibitor. Exemplary beta cells or beta-like cells include those that are
transplanted in a
subject as a means to treat diabetes. Currently, transplanted beta or beta-
like cells are prone to
cell death due to autoimmune attack on the transplanted cells.
[0081] In some embodiments, the beta cells or beta-like cells are
transplanted. In
some embodiments, the beta cells or beta-like cells are transplanted into a
subject with
autoimmune diabetes. In some embodiments, the beta cells or beta-like cells
are administered
by transplant into the pancreas, liver, or fat pads via surgery, injection, or
infusion.
[0082] Other exemplary beta cells or beta-like cells that can be protected by
a MAOI
include those in subjects who are at risk of developing autoimmune diabetes,
such as those of
a subject being treated with an immunotherapy. In some embodiments, the beta
or beta-like
cells are those of a subject who is being treated with an immunotherapy. In
some
embodiments, the immunotherapy is a checkpoint antibody. In some embodiments,
the
checkpoint antibody is an anti-PD-1 antibody, anti-PD -L1 antibody, or anti-
CTLA-4
antibody.
A. Transplanted beta cells or beta-like cells
[0083] Beta cells of pancreas are the cells that normally can secrete insulin.
These
beta cells of the pancreas are located in pancreatic islets, also known as the
islets of
Langerhans. A transplanted beta or beta-like cell refers to a cell that is
placed in an
individual, wherein the cell is from a different individual or is from the
same individual but
from a different original source in the body than the pancreatic islets.
[0084] In some embodiments, the beta or beta-like cell has been reintroduced
into the
same or different individual from which it was isolated. In some embodiments,
the beta or
beta-like cell are those of the subject. When introduced into the same subject
from which it
was isolated it is an autologous beta or beta-like cell. When introduced into
a different subject
from which it was isolated it is a heterologous beta or beta-like cell.
[0085] In some embodiments, the beta-like cell is a cell that does not
normally
produce insulin in response to glucose, but is induced or designed to have a
phenotype of a
beta-like cell, i.e., induced or designed to produce insulin in response to
glucose. Beta-like
cells include "designer beta cells," which have been described as using
synthetic pathways to
produce insulin (see M Xie et al., Science 354(6317):1296-1301 (2016)).
18
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
[0086] A variety of beta-like cells have been described.
a) Stem cells
[0087] Any stem cell capable of differentiating into a beta-like cell may be a
beta-like
cell according to the invention. In some embodiments, the beta-like cell may
be differentiated
from a hematopoietic stem cell, bone marrow stromal stem cell, or mesenchymal
stem cell.
[0088] Beta-like cells capable of secreting insulin in response to glucose can
be
generated from pluripotent stem cells (PSCs) (see FW Pagliuca et al., Cell
159:428-439
(2014)) or embryonic stem cells (ESCs) (see E Kroon et al., Nature Biotech
26(4):443-452
(2008) and A Rezania et al., Nature Biotech 32(11): 1121-1133 (2014)).
[0089] In some embodiments, the stem cell may be an embryonic stem cell. In
some
embodiments, the embryonic stem cell is taken from a blastocyst. In some
embodiments, the
embryonic stem cell may be derived from an embryo fertilized in vitro and
donated. In some
embodiments, the embryonic stem cell undergoes directed differentiation.
[0090] In some embodiments, the stem cell may be an adult stem cell. An adult
stem
cells may also be referred to as a -somatic" stem cell. In some embodiments,
the adult stem
cell is an undifferentiated cell found among differentiated cells in a tissue
or organ.
[0091] In some embodiments, the stem cell is an induced pluripotent stem cell
(iPSC).
[0092] In some embodiments, the stem cells may be from bone marrow, adipose
tissue, or blood. In some embodiments, the cells may be from umbilical cord
blood.
[0093] In some embodiments, stem cells undergo directed differentiation into
beta-
like cells. In some embodiments, the directed differentiation is based upon
treatment of stem
cells with modulators. In some embodiments, the directed differentiation is
based on culture
conditions.
[00941 In some embodiments, beta-like cells are generated from human PSCs
(hPSCs) in vitro. In some embodiments, beta-like cells are generated from
hPSCs using
directed differentiation. In some embodiments, beta-like cells are generated
from hPSCs
using a multi-step protocol. In some embodiments, beta-like cells are
generated from hPSCs
using sequential modulation of multiple signaling pathways. In some
embodiments, beta-like
cells are generated from hPSCs using a three-dimensional cell culture system.
[0095] In some embodiments, beta-like cells are generated from human ESCs
(hESCs) in vitro. In some embodiments, beta-like cells are generated from
hESCs using
directed differentiation. In some embodiments, beta-like cells are generated
from hPSCs
using a multi-step protocol. In some embodiments, beta-like cells are
generated from hESCs
19
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
using sequential modulation of multiple signaling pathways. In some
embodiments, beta-like
cells are generated from hESCs using a planar cell culture and air-liquid
interface at different
stages of differentiation.
b) Non-stem cells
[0096] In some embodiments, beta-like cells are produced from non-stem cells.
In
some embodiments, beta-like cells are produced from differentiated non-beta
cells. In some
embodiments, beta-like cells arc produced from reprogramming or
transdifferentiation of
differentiated non-beta cells.
[0097] In some embodiments, the beta-like cell is a reprogrammed non-beta
cell. In
some embodiments, the beta-like cell is a transdifferentiated non-beta cell.
[0098] As all cells of the body contain the full genome, any type of cell
could be
induced into a beta-like cell based on principles of reprogramming and
transdifferentiation.
Thus, the invention is not limited by the original phenotype of the beta-like
cell.
[0099] Pancreatic exocrine cells can be reprogrammed into beta-like cells that
secrete
insulin (see Q Zhou et al., Nature 455:627-633 (2008)).
[00100] In some embodiments, a pancreatic exocrine cell is
reprogrammed into
a beta-like cell. In some embodiments, the pancreatic exocrine cell is
differentiated into a
beta-like cell based on re-expression of transcription factors. In some
embodiments, these
transcription factors are Ngt73, Pdxl, and Mafa.
[00101] Pancreatic alpha cells can be transdifferentiated
into beta-like cells.
The anti-malarial drug, artemisin, inhibits the master regulatory
transcription factor Arx
(Aristaless related homeobox) and enhances gamma-amino butyric acid (GABA)
receptor
signaling, leading to impaired pancreatic alpha cell identity and
transdifferentiation of alpha
cells into a beta-like cell phenotype (see Li et al, Cell 168:86-100 (2017)
and Ben-Othman N
et al., Cell 168(1-2).73-85 (2017)).
00l021 In some embodiments, the beta-like cell is a
transdifferentiated cell. In
some embodiments, an alpha cell is transdifferentiated into a beta-like cell.
In some
embodiments, the transdifferentiation into a beta-like cell is due to
inhibition of Arx. In some
embodiments, the transdifferentiation into a beta-like cell is due to
enhancement of GABA
receptor signaling.
[00103] Stomach tissue can be reprogrammed into beta-like
cells (see
Ariyachet C et al., Cell Stem Cell 18(3):410-21 (2016)). In some embodiments,
a gut or
stomach cell is reprogrammed into a beta-like cell. In some embodiments, the
reprogramming
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
is based on expression of beta cell reprogramming factors. In some
embodiments, cells of the
antral stomach are reprogrammed into beta-like cells. In some embodiments,
these cells of
the antral stomach are antral endocrine cells. In some embodiments,
reprogrammed antral
endocrine cells can be assembled into a mini-organ of beta-like cells.
[00104] Also encompassed is a method of preventing the
development of type
1 diabetes by administering a MAOI. Certain individuals can be predicted to
have a high risk
for developing type 1 diabetes based on one or more risk factors, such as
family history.
[00105] In some embodiments, a method of preventing the
development of type
1 diabetes comprises screening a subject for risk factors for type 1 diabetes;
determining if
the subject has increased risk of developing type 1 diabetes; and
administering a MAOI if the
subject has an increased risk of type 1 diabetes.
[00106] In some embodiments, screening a subject for risk
factors comprises
obtaining data on a genetic risk score that is based on the known type 1
diabetes-associated
gene variants, a family history of type 1 diabetes, the presence of one or
more autoantibodies
against beta cell antigens that are known to predict disease risk, and/or
abnormal glucose
tolerance.
[00107] Many individuals with type 1 diabetes have a
genetic susceptibility
because their genome comprises one or more type 1 diabetes-associated gene
variant. The
presence of one or more of these variants leads to an increased risk of type 1
diabetes. As
these type 1 diabetes-associated gene variants can be inherited, a subject
with a positive
family history of type 1 diabetes may have an increased risk of developing the
disease.
[00108] A wide variety of type 1 diabetes-associated gene
variants have been
described (See, for example, Watkins RA et al., Transl Res. 164(2):110-21
(2014)). In some
embodiments, the one or more type 1 diabetes-associated gene variant are
comprised in one
or more HLA gene. In some embodiments, the one or more type 1 diabetes-
associated gene
variant are HLA polymorphisms conferring greater risk for type 1 diabetes. In
some
embodiments, the one or more type 1 diabetes-associated gene variant are
comprised in one
or more non-HLA gene.
[00109] In some embodiments, a family history of type 1
diabetes is
determined by patient history or a questionnaire. In some embodiments, a
family history of
type 1 diabetes is based on one or more sibling, parent, or grandparent having
type 1 diabetes.
[00110] In some embodiments, autoantibody levels against
beta cell antigens
are measured to determine increased risk of developing type 1 diabetes. A wide
variety of
autoantibodies against beta cell antigens have described in the literature
(See, for example,
21
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
Watkins 2014). Autoantibody panels are commercially available to identify
individuals at risk
of developing type 1 diabetes. Inclusion of certain antibodies, such as anti-
ZnT8, in
autoantibody levels can predict individuals at risk of developing type 1
diabetes. In some
embodiments, the presence of one or more autoantibodies is used to determine
an increased
risk of developing type 1 diabetes. In some embodiments, the number of
autoantibodies or the
titer of a specific autoantibody is used to determine an increased risk of
developing type 1
diabetes.
[001111 In some embodiments, an abnormal glucose tolerance
is used to
determine an increased risk of developing type 1 diabetes. In some
embodiments, a subject
with increased risk of developing type 1 diabetes shows abnormal glucose
tolerance results
without presently meeting criteria for type 1 diabetes.
[00112] In some embodiments, a subject is determined to
have an increased
risk of developing type 1 diabetes based on the presence of more than one risk
factor. For
example, a subject with a positive family history for type 1 diabetes may be
determined to
also have an abnormal glucose tolerance. Multiple risk factors for type 1
diabetes can
assessed to determine a subject's risk of developing type 1 diabetes. In some
embodiments, a
subject's risk of developing type 1 diabetes is determined using an algorithm
based on
multiple risk factors (See, for example, Watkins 2014).
[00113] In some embodiments, a subject having an increased
risk of type 1
diabetes is administered a MAOI. In some embodiments, administration of a MAOI
prevents
the development of type 1 diabetes in a subject with increased risk. In some
embodiments,
administration of a MAOI slows the time period until development of type 1
diabetes in a
subject with increased risk.
EXAMPLES
Example 1. CRISPR screen for beta cell protective mutations identifies the T1D
GWAS
candidate gene Rnls
[00114] The selective pressure of autoimmunity was used to
screen for
protective gene mutations in beta cells on a genome-wide scale. To allow for
efficient
genome editing and experimental reproducibility, we employed the NIT-1 beta
cell line,
originally derived from a nonobese diabetic (NOD) mouse insulinoma (5). These
cells are
suitable for autologous transplantation into NOD mice, the most extensively
studied animal
model for type 1 diabetes (6). Of importance, NIT-1 cells transplanted into
diabetic NOD
mice are rapidly destroyed by autoimmunity (Figs. 6A-6B). NIT-1 cells were
transduced
22
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
with the mouse lentiviral GeCK0 A CRISPR library that comprises ¨ 60,000 gRNAs
targeting a total of approximately 19,050 genes (7). Use of a low multiplicity
of infection
(MOI) ensured that cells carried at most one mutation. A total of 107 mutant
NIT-1 cells were
transplanted into immuno-deficient NOD.scid mice and injected splenocytes from
diabetic
NOD mice into transplant recipients to elicit beta cell killing (Fig. 1).
Despite almost total
beta cell destruction, a small population of NIT-1 cells were retrieved after
8 weeks that
survived the onslaught of autoimmunity. Targeted genes were identified by
sequencing the
gRNAs present in surviving beta cells. Only 11 unique gRNA sequences were
detected,
corresponding to 11 target genes, at significant frequencies in NIT-1 cells
that survived
autoimmune killing (Fig. 1). Notably, one of these genes was Rnls, the
candidate gene for a
region in the human genome associated both with the overall risk of T1D (8)
and with the age
of diabetes onset (9) by GWAS. Based on its prior association with human
autoimmune
diabetes, Rnls was prioritized for validation.
Example 2. Rnls deletion protects beta cells against autoimmune killing
[00115] A Rnls mutant NIT-I cell line (Rn/smut) was
generated using the Rn/s
gRNA identified in the screen (Figs. 7A-7B). NIT-1 cells were also engineered
to carry a
luciferase reporter for longitudinal non-invasive imaging of beta cells after
transplantation
(Figs. 6A-6B). A validation experiments was performed using an approach
similar to the
original genome-wide screen. As illustrated in Fig. 2A, Rnismut cells and
control NIT-1 cells
transduced with a non-targeting (NT) gRNA were co-transplanted on opposing
flanks of
NOD.scid mice. Transplant recipients were then injected with splenocytes from
diabetic
NOD mice. To control for beta cell survival and proliferation in the absence
of autoimmunity,
monitored beta cell transplants were monitored in NOD.scid mice that did not
receive
diabetogenic immune cells. Control NIT-1 cells were killed by autoimmunity
within one to
two weeks after transplantation, as measured by loss of graft luminescence and
analysis of
grafts explanted from euthanized mice. In contrast, Rnismut NIT-1 cells
persisted for up to 2
months in the same recipient mice (Figs. 2B-2D and data not shown). Next, the
protective
capacity of Rnls deletion was validated by implanting NIT-1 cells directly
into overtly
diabetic NOD mice (Fig. 2E). Again, control NIT-1 cells were rapidly
eliminated while
Rnls' cells survived significantly longer in diabetic NOD mice with ongoing
autoimmunity
(Figs. 2F-2H).
[00116] Disruption of Rnls was tested to see if it would
similarly protect
primary mouse beta cells. Pancreatic islets were isolated from immuno-
deficient NOD.scid
23
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
mice that are devoid of autoimmune infiltrates in the pancreas. Dispersed
islet cells were
transduced with lentivirus encoding rat insulin promoter-driven Cas9
endonuclease and either
the Rn/s-targeting (Rn/s") gRNA or a non-targeting (NT) control gRNA (Fig.
21). Gene
edited and control islets cells were transplanted each under one kidney
capsule of the same
NOD.scid mice. Two weeks later, graft recipients were injected with
splenocytes from
diabetic NOD mice to induce autoimmune beta cell killing. To control for the
effects of gene
disruption in the absence of autoimmunity, islet grafts were also followed in
NOD.scid
recipients that did not receive splenocytes from diabetic mice. As
anticipated, autoimmunity
decreased the size and insulin expression in control grafts (Figs. 2J-2L). In
contrast, Rnlsinut
islets survived autoimmunity and maintained insulin expression. These results
show that
targeting Rnls in primary beta cells was protective in a pathophysiologically
relevant setting
of autoimmune diabetes. Of note, Rnls targeting did not affect the insulin
secretory capacity
of islet cells in vitro (Fig. 8).
Example 3. Rnls mutation diminishes immune recognition of beta cells
[00117] The effect of Rn/s deficiency was investigated for
a direct effect on
immune recognition. The expression MHC class I and class II molecules on the
surface of
NIT-1 cells was comparable to that of control cells (Figs. 3A and 3B). Rnls
did not
significantly affect the response of beta cell-reactive (BCD2.5 TCR transgenic
(10, 11))
CD4+ T cells co-cultured with antigen presenting cells and NIT-1 beta cells
(12) (Fig. 3C).
However, Rnls" NIT-1 cells elicited a significantly weaker response from
polyclonal beta
cell-reactive CDS+ T cells isolated from diabetic NOD mice (Fig. 3D). Because
Rnls
deficiency diminished the response of autoreactive cytotoxic T cells, Rnlsinut
NIT-1 cells were
tested for protection against T cell allo-reactivity. To test this, Rnlsinut
and control NIT-1 cells
were transplanted into opposite flanks of MHC-mismatched C57BL/6 mice. Both
beta cell
grafts were rapidly destroyed by the strong allogenic response of host immune
cells (Figs.
9A-9B), showing that Rn/s deficiency did not affect allo-rejection. These data
suggest that
Rnls" beta cells are not impervious to immune detection or killing, but rather
that they only
fail to fully stimulate autoreactive CD8 T cells.
Example 4. Rnls mutation confers ER stress resistance
1001181 A growing body of evidence supports a role for ER
stress in the demise
of beta cells in diabetes. The unfolded protein response (UPR) that is
triggered by ER stress
has been implicated in beta cell apoptosis in both T1D and type 2 diabetes (13-
15).
Significantly, ER stress was proposed to contribute not only directly but also
indirectly to
24
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
beta cell death in T1D owing its ability to increase the presentation of auto-
and neoantigens,
for example by affecting post-translational modifications (12, 16-18). The
Rnls mutation
could affect the cellular response to ER stress and thereby diminish the
stimulation of
diabetogenic CD8+ T cells. To test this notion, NIT-1 cells were challenged
with the ER
stressor thapsigargin (TG). Control cells were highly sensitive to TG
treatment, with
concentrations greater than 50 nM killing a majority of cells. Remarkably,
Rnls mutant cells
withstood even a 20-fold greater concentration of TG (Fig. 4A). Similar
results were seen
with the alternative ER stressor tunicamycin (IC) (Fig. 4B). Of note, Rnismut
NIT-1 cells
remained sensitive to mitomycin C and streptozotocin that cause ER stress-
independent cell
death (Figs. 10A-10B). These data indicate that Rnls deficiency does not
prevent all forms of
cell death and that its protective effect may be limited to specific sources
of cellular stress. To
ascertain that ER stress resistance was a direct effect of Rnls mutation and
not caused by an
off-target effect of the Rnls gRNA, additional cell lines were generated in
which either exons
2 to 4 or exon 5 of the Rnls gene were deleted using different sets of gRNAs.
These
alternative Rn/s-deficient beta cell lines were again protected against ER
stress-induced cell
death (Figs. 11A-11D), confirming that ER stress resistance was a direct
result of Rnls
deletion.
Example 5. Rids overexpression sensitizes beta cells to ER stress and
autoimmunity
[001191 To further evaluate the role of Rnls in modifying
the sensitivity of beta
cells to ER stress and autoimmunity, Rnls was overexpressed in NIT-1 beta
cells using a
lentiviral transgene. While Rnls overexpression alone only marginally
increased sensitivity to
TG-induced killing (Fig. 12A-12B), it appeared to significantly accelerate the
autoimmune
killing of beta cells implanted into diabetic mice (Fig. 13A-13C). Re-
introduction of Rnls into
Rnismt cells was done using a transgene that carried a synonymous mutation at
the gRNA
target site to prevent CRISPR-Cas9 targeting. Rnls re-expression restored the
sensitivity of
Rnls cells to ER stress (Fig. 12A-12B). Moreover, Rnls re-expression also
accelerated the
autoimmune destruction of RnIsilmt cells in diabetic NOD mice (Figs. 14A-14B).
Collectively,
the data show that Rnls expression modulates the vulnerability of beta cells
to ER stress and
autoimmunity. Of interest, Rnls expression was 10-15 fold higher in pancreatic
islets of
diabetes-prone NOD mice than in diabetes-resistant C57BL/6 mice (Fig. 15).
Elevated Rnls
expression was not merely a result of pancreas inflammation, because similar
Rnls mRNA
levels were measured in the islets of both NOD and immuno-deficient NOD.sc1d
mice. This
intriguing observation suggests the Rnls may be a genetically encoded modifier
of beta cell
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
vulnerability in both mouse and human, though exactly how Rnls expression is
regulated in
both species remains to be elucidated.
Example 6. Rnls modifies the cellular response to ER stress
[00120] To understand how Rnls deficiency increases ER
stress resistance, the
UPR that mediates the cellular adaptation to ER stress was measured.
Activation of critical
ER stress sensors IREla (19), PERK (20) and ATF6 (21) was diminished in Rni
smut cells
following TG treatment (Figs. 4C and Figs. 16A-16H). Downstream of these UPR
triggers,
the phosphorylation of eIF2a, protein levels of ATF4 and splicing of XBP1 were
markedly
reduced (Figs. 4C and 4D, and Figs. 16A-16H). The expression of Chop and
Txrup, both
implicated in ER stress-induced apoptosis (22-24), was also diminished (Fig.
4E and Figs.
16A-16H). The data suggest that Rnls deficiency increased the threshold for ER
stress that
triggers the UPR, which could explain how Rnls mutation inhibits the pro-
apoptotic effect of
stimuli that cause cellular stress. The protective effect of Rnls deletion was
not limited to ER
stress, because Rnism"t cells also better withstood oxidative stress compared
to control NIT-1
cells (Fig. 17). Consistent with this finding, Rnls deficiency increased the
expression of a key
regulator of the oxidative stress response, NRF2 (25) (Fig. 4C and Fig. 16H).
Rnls deficiency
appears to increase the ability of beta cells to withstand cellular stress
involved in their
destruction during type 1 diabetes.
Example 7. Pargyline phenocopies the protective effects of Rnls deletion
[00121] Rnls is a flavoprotein oxidase whose cellular
function has not yet been
elucidated (26). Its proposed substrates are 2- and 6-dihydroNAD(P) (27),
isoforms off3-
NAD(P)H, though whether these are physiologically relevant is unknown.
However, the
crystal structure of human RNLS was solved several years ago (28). The enzyme
utilizes an
FAD co-factor for catalysis, resembling other oxidases including monoamine-
oxidase B
(MAO-B). Based on structural similarities, the FDA-approved MAO-B inhibitor
pargyline
(29) was predicted bind to RNLS (Fig. 5A). To test this prediction, the
thermal stability of
RNLS was measured in the presence or absence of pargyline (Figs. 5B and 5C).
Pargyline
decreased the thermal stability of RNLS in a dose-dependent manner, suggesting
a direct
interaction between the drug and the enzyme. Pargyline is an oral drug and is
water soluble,
lending itself to treating mice via their drinking water. Pargyline's efficacy
was evaluated in a
stringent beta cell transplantation model. Recently diabetic NOD mice with
severe
hyperglycemia (blood glucose > 600 mg/dL) were transplanted with NIT-1 beta
cells with or
without continuous drug feeding (Fig. 5D). Graft survival was again monitored
longitudinally
26
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
by non-invasive bioluminescence imaging (Fig. 5E). Untreated mice remained
hyperglycemic
and rapidly lost their beta cell graft (Fig. 5E-5G). Remarkably, pargyline
treatment allowed
transplanted beta cells to survive in diabetic mice, produce insulin and
reverse hyperglycemia
(Figs. 5E-5H). Upon histological analysis of the pancreas 3 weeks after
diabetes onset and
transplantation, pargyline-treated mice still harbored a significant number of
insulin-rich
islets (Fig. 18). In contrast, the pancreas of untreated diabetic mice was
entirely devoid of
insulin staining. These observations suggest that pargyline not only protected
grafted NIT-1
cells but also endogenous beta cells against autoimmunity, recapitulating the
protective effect
of Rnls deletion. Of note, pargyline did not prevent the allo-rejection of NIT-
1 cells
transplanted into C57BL/6 mice, indicating that the drug is not
immunosuppressive (Fig.
19A19B). This observation again replicates the effects of Rnls deletion that
confered
protection against autoimmunity but not allo-reactivity.
[00122] These data show that RNLS is a modifier of beta
cell vulnerability in
T1D. This finding may explain why genome variants in the RNLS locus impact the
overall
risk (8) and the age of onset (9) of T1D. How disease-associated variants
modify RAILS
function or expression is unknown. In light of our results, exploring how this
candidate T1D
risk gene is regulated seems warranted. Rnls was differentially expressed in
islets of diabetes-
prone NOD mice and diabetes-free C57BL/6 mice, lending further support to the
notion that
RNLS may be a genetic risk factor for beta cell autoimmunity.
[00123[ These data also underscore the central role of
beta cell ER stress in
promoting islet autoimmunity. The ER and oxidative stress resistance afforded
by Rnls
deficiency was correlated with protection against autoimmunity, consistent
with a growing
body of literature that implicates ER stress in T1D.
[001241 Significantly, the discovery that RNLS deficiency
endows beta cells
with the ability to resist autoimmunity suggests a genetic engineering
solution to beta cell
replacement in T1D that would interfere neither with the identity of the beta
cell nor with
immunity and immune surveillance. RNLS deletion could be a safe and effective
modification
in SC-beta cells to overcome autoimmunity in patients with T1D. Finally, an
FDA-approved
drug that replicates the protective effect of RNLS deletion. Its apparent
efficacy in protecting
beta cells, together with its favorable safety profile, should make pargyline,
and other MAO-
B inhibitors predicted to target RNLS, worthy of further evaluation for the
prevention or
treatment of type 1 diabetes.
27
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
Example 9. Evaluation of MAO inhibitors as RNLS inhibitors
[00125] To test the predicted binding of monoamine oxidase-
inhibitors
(MA0I's) to human recombinant renalase (rRNLS), thermal shift assays were
performed,
whereby the unfolding of the protein at increasing temperature was measured
using a
hydrophobic fluorescent probe. With increasing temperature, fluorescence
increases as the
protein unfolds and exposes hydrophobic residues to which the probe can bind.
[00126] Human recombinant RNLS protein was generated by
GenScript USA
Inc., using the E. Coli expression vector pET28a-MBP. RNLS protein was
obtained from the
supernatant of cell lysates, followed by purification via Ni Bio-rad column. 2
rnM RNLS
dissolved in PBS was incubated with pargyline (Sigma-Aldrich, #P8013),
rasagiline (Tocris,
cat# 4308), or selegiline (Tocris, cat# 1095) at 100 mM for 20 min at 4 C
before addition of
SYPRO Orange dye (Invitrogen, #S6650) for the measurement of thermal
denaturation. The
thermal shift assay was performed using the QuantStudio 6 Flex Real-Time PCR
system
(Applied Biosystems) with an initial temperature hold at 25 C for 2 min,
followed by a
temperature ramp up to 95 C at a rate of 1 C / s, and a final temperature hold
at 95 C for 2
min. Results were collected at 0.25 C increments.
[00127] Three MAO-I's in the propargylamine class of drugs
(pargyline
(Figure 20A), rasagiline (Figure 20B), and selegiline (Figure 20C)) shifted
the thermal
unfolding curve of rRNLS, demonstrating that these compounds directly interact
with the
enzyme, as predicted by structure-based modeling.
Example 10. In vivo effects of pargyline treatment in diabetes prevention
models
[00128] To test the ability of the MAO-I pargyline to
prevent the onset of
autoimmune diabetes in the nonobese diabetic (NOD) mouse model, the best
characterized
model for type 1 diabetes, animals were administered oral pargyline prior to
disease
induction. Diabetes was induced using either cyclophosphamide (Figure 21A) or
anti-PD-1
antibody (Figure 21B). Cyclophosphamide is a compound known to accelerate
diabetes onset
in the NOD model (See Harada M & Makin S, Dzabetologia 1984, 3: 429). PD-1
blockade
has also been shown to cause rapid onset of diabetes in NOD mice (See Ansari
MJ et al J Exp
Med 2003, 198: 63), and immune checkpoint inhibition (including PD-1
inhibition) for the
treatment of various cancers can cause autoimmune diabetes in some patients
(reviewed in
Clotman K et al J Clin Endocrinol Metab 2018, 103: 3144).
[00129] 10-week-old male or female NOD mice were injected
intraperitoneally
with cyclophosphamide (200 ug/g of body weight, Sigma-Aldrich, #C0768) or anti-
PD-1
28
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
(250 [tg/mouse iv., BioXcell, #BE0146) for diabetes induction. Pargyline
treatment was
started one week prior disease induction. Blood glucose was monitored every 1-
2 days to test
for diabetes onset.
[00130] Pargyline treatment protected against diabetes
induction and
significantly decreased the proportion of diabetic animals after either
cyclophosphamide or
anti-PD-1 treatment (Figs. 21A-21B).
[00131_1 The protective effects of pargyline treatment were
also evaluated in
additional mouse models for type 1 diabetes.
[00132] In one type 1 diabetes model, diabetes was induced
by adoptive
transfer (transplantation by intravenous injection) of 10 million splenocytes
from diabetic
NOD mice into immuno-deficient NOD.scid mice treated or not with pargyline
(25tig/m1
pargyline in the drinking water). Recipient mice were tested for diabetes for
110 days
following cell transfer. Kaplan-Meier survival curves were compared by log-
rank test, and
treatment with pargyline significantly increased survival (P=0.027, Figure
22A).
[00133] In another type 1 diabetes model, diabetes was
induced in C57BL/6
mice by repeated injection of low doses of streptozotocin (STZ, 5 consecutive
daily
intraperitoneal injections of STZ at 50mg/kg/day). Mice were treated with
pargyline
(25m/m1 pargyline in the drinking water) starting one week before induction of
diabetes.
Kaplan-Meier survival curves were compared by log-rank test (P=0.01, Figure
22B). The day
of diabetes onset in diseased mice was compared using the Mann-Whitney test
(P=0.004,
Figure 22C). Pargyline treatment significantly increased survival and delayed
the onset of
diabetes following STZ treatment.
Example 11. Screen for additional MAOI that bind to RNLS
[00134] Additional known MAOIs were tested for rRNLS
binding by thermal
shift assay. The cyclopropylamine tranylcypromine (Figure 20D) and the
hydrazine
isocarboxazid (Figure 20E), both irreversible MAOIs, and the reversible MAO-A
inhibitor
toloxatone (Figure 20F), shifted the thermal unfolding curve of rRNLS in a
manner
comparable to pargyline, demonstrating that these compounds also directly
interact with the
enzyme.
Example 12. Materials and Methods
[00135] The following methods were used in the
experiments.
Mice
29
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
[00136] Nonobese diabetic (NOD) mice, NOD.scid (NOD. CB 17
-Prktlesc"11J)
and C57BL/6J were purchased from the Jackson Laboratory (Bar Harbor, ME).
Animals were
housed in pathogen-free facilities at the Joslin Diabetes Center and all
experimental
procedures were approved and performed in accordance with institutional
guidelines and
regulations.
CRISPR GeCK0 A library screen
[00137_1 The mouse GeCKO-v2 (Genome-Scale CRISPR Knock-Out)
A
lentiviral pooled library was obtained from Addgene (Addgene, #1000000052),
targeting
19050 with 3 gRNAs/gene (30) and was prepared as previously described (31).
Wild type
NIT-1 cells (ATCC #CRL-2055) were infected with GeCK0 A CRISPR lentiviral
library at
M01=0.3, and then selected by puromycin (2 ug/m1) at day 3 post lentivirus
infection. 107
mutant NIT-1 cells were transplanted subcutaneously into 8-week-old female
NOD.scid
mice, and 107 of diabetic NOD splenocytes in 200 ul sterile PBS were injected
intravenously
at the same time to induce autoimmunity. NOD.scid mice with subcutaneously
transplanted
mutant NIT-1 cells but without diabetic NOD splenocytes injection were used as
control
(non-autoimmune group). Diabetic NOD splenocytes were isolated from
spontaneously
diabetic female NOD mice as described previously (32). The screen was
terminated at 8
weeks post-injection and the remaining grafts were retrieved from both the
autoimmune
group and the non-autoimmune group of mice. Genomic DNA was extracted from the
grafts
(Quick-gDNA midiprep kit, Zymo Research), the NGS (Next Generation Sequencing)
libraries were prepared as previously described (33), and subjected to NGS
sequencing
analysis (Novogene, CA). The gRNA sequences from the NGS sequencing data were
extracted using standard bioinformatics methods, and the distribution of gRNAs
were
calculated as Count Per Million (CPM).
Cell line
[00138] NIT-1 (#CRL-2055) and 293FT (#R7007) cell lines
were obtained
from ATCC and Thermo Fisher Scientific respectively. Cells were maintained in
DMEM
(Gibco, 10313039), supplemented with 10% fetal bovine serum (FBS, Gibco),
glutagro and
penicillin/streptomycin (Corning), in a 37 C incubator with 5% CO2. To
generate control and
Rnls' NIT-1 cells, non-targeting (NT) gRNA (5' TAAAAACGCTGGCGGCCTAG 3',
MGLibA 67395 (SEQ ID NO: 2)) and Mils gRNA (5' CTACTCCTCTCGCTATGCTC 3',
MGLibA 46009 (SEQ ID NO: 1)) were cloned into LentiCRISPR-v2 vector, and the
NT or
Rnls gRNA containing lentivirus was used to establish these cell lines,
respectively. Rnls
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
mutation in Rnl.sinut cells was confirmed by deep sequencing analysis (MGH DNA
Core
Facility, Cambridge, MA). The Rnls overexpressing NIT-1 cell line was
generated by
lentiviral infection of wild-type (WT) NIT-1 cells with EFla promoter-driven
full-length
mouse Rnls (Of note, the full-length mouse Rnls that we cloned and used is
based on the
annotation from the NCBI database in late 2017 that included 300aa, the Rnls
annotation in
NCBI was updated in March 2019 and now encodes a protein with 42 additional
amino acids
at the N-terminus). For generation of C/Rn/s-expressing Rnls' cells, Rnls
mutant NIT-1
cells were transduced with lentivirus carrying a CRISPR-immune EF la promoter-
driven full-
length mouse Rnls (CiRnls) carrying a synonymous mutation in the Rnls gRNA
target site.
The modified gRNA targeting site sequence used in Cil?nls was 5'
TTATAGTAGCCGGTACGCA 3'(SEQ ID NO: 3). The Rn/s-deficient NIT-1 cell lines
(Rnls
AFx2/4 and Rnls AFx5) were generated following previously published protocols
(36). Two
gRNAs were designed to target the 5=- and 3=-end of Rnls exon 2-4 or exon 5
genomic DNA
sequences. gRNA sequences for exon 2-4 were 5'CGTCTGGGAAGTCTTGGTCG 3' and 5'
CGGGACTCATCCCATTGTCG 3' (SEQ ID NOs: 4-5); gRNA sequences for exon 5 were
5'GGGGAGTGAGGATAGGATAG 3. and 5' TCCGTAGTGGTTTTAGAGTG 3' (SEQ ID
NOs: 6-7). The lenti-multi-CRISPR plasmid (Addgene, #85402) was used to
express two
single gRNAs cassettes for the deletion of exons 2-4 or exon 5 of Rnls . The
two gRNAs
cassettes were amplified by Phusion High-Fidelity PCR kit: 40 cycles: 98 C, 15
sec; 60 C,
15 sec; 72 C, 30sec. The PCR products were digested with BbsI (Invitrogen) and
sub-cloned
into the pSpCas9(BB)-2A-Puro (PX459) v2.0 vector (Addgene, #62988). NIT-1
cells were
then transfected with these plasmids by polyethylenimine (Fisher Scientific),
followed by
puromycin selection. All plasmid sequences were verified by Sanger sequencing
before
transduction and transfection.
Preparation and transplantation of primary islets
[001391 Islets were prepared and purified as described
previously (35) from 8
week old female NOD.scid mice. Purified NOD.scid islets were immediately
cultured in a
low-attachment plate in RMPI 1640 medium (Gibco), supplemented with 10% FBS
and
penicillin/streptomycin. Lentivirus encoding a NT or Rnls gRNA together with
Cas9
endonuclease under the control of the rat insulin promoter (RIP) was added to
the culture
media for overnight infection. The next day, islets were washed with culture
media twice and
¨300 islets were transplanted under each kidney capsule of 8 week old of
female NOD.scid
mice. Graft recipients were left to recover from surgery for two weeks, then
mice were
31
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
randomly assigned to non-autoimmune and autoimmune groups. Mice in the
autoimmune
group were injected intravenously with 107 splenocytes purified from
spontaneously diabetic
female NOD mice. Splenocytes were prepared as described previously (32). At
day 25 post
splenocyte injection, islet grafts were retrieved for gene expression analysis
by quantitative
real-time PCR (qPCR).
Quantitative real-time PCR (qPCR)
[00140] Cells or islet grafts were treated with TRIzol
(Thermo Fisher
Scientific) for RNA extraction following the manufacturer's protocol. Purified
RNA was
reverse-transcribed into cDNA using the SuperScript IV first-strand synthesis
kit
(Invitrogen). Insulin 1 (Mm01259683_g1), Glucagon (Mm01269055 ml) and Hprtl
(Mm0302475 ml) probes for TaqMan assays were purchased from Thermo Fisher
Scientific.
Gene expression levels of Chop and Txnip were analyzed by SYBR green PowerUp
qPCR
assays (Applied Biosystems). Primer sequences used for Chop: forward - 5'
CCACCACACCTGAAAGCAGAA 3' (SEQ ID NO: 8); reverse -
5' AGGTGAAAGGCAGGGACTCA 3'(SEQ ID NO: 9); Txnip: forward -5'
TCAAGGGCCCTGGGAACATC 3' (SEQ ID NO: 10); reverse -5'
GACACTGGTGCCATTAAGTCAG 3' (SEQ ID NO: 11). All qPCR assays were performed
using a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems).
Cell viability assay
[00141] Cells were seeded in 96-well white plate (50,000
cells / well) for
overnight culture with or without thapsigargin, tunicamycin, streptozotocin
(Sigma-Aldrich),
mitomycin C (Fisher Scientific) or hydrogen peroxide (H202, Fisher Scientific)
at the
indicated concentrations. Cell viability was assessed after 24 h using the
CellTiter-Glo
luminescence Cell Viability Assay (Promega).
In vivo bioluminescence imaging
[00142] NIT-1 cell lines were engineered to constitutively
express the firefly
luciferase gene (Luc2) driven by the EFla promoter via lentiviral delivery,
except in Fig. 7,
where a CMV-Luc2 construct was used. Mice transplanted with luciferase-
expressing cells
were injected with D-luciferin intraperitoneally at a dose of 150 mg/kg for
bioluminescence
imaging. D-luciferin (Gold Biotechnology, Cat# LUCK) solution was prepared in
sterile
DP BS (without calcium or magnesium) at a concentration of 15 mg/ml and
filtered (0.22 [Irn)
prior to injection. Luminescence was measured using an IVIS Spectrum imaging
system
(PerkinElmer).
32
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
Xbpl splicing assay
[001431 Cells were treated either with DMSO or
thapsigargin at 1 uM for 5 h.
RNA was extracted by TRIzol and reverse transcribed into cDNA as described for
qPCR
Spliced (s) and unspliced (u)Xbpl cDNA were amplified by PCR using the Phusion
High-
Fidelity DNA polymerase (Invitrogen) for 35 cycles: 94 C, 10 sec; 64 C, 30
sec; 72 C,
30sec. The PCR products of Xbpl were sized at 473bp (Xbplu) and 447bp (Xbpls)
and
segregated by electrophoresis using a 3% agarose gel. Ratio of Xbp Is /Xbplu
was measured
by Adobe Photoshop CC 2019. Primer sequences used for Xbpl were forward - 5'
AAACAGAGTAGCAGCGCAGACTGC 3' (SEQ ID NO: 12) and reverse -5'
TCCTTCTGGGTAGACCTCTGGGAG 3' (SEQ ID NO: 13).
Western blotting
[00144] Cell lysates were collected on ice in RIPA lysis
buffer containing
proteinase and phosphatase inhibitors (cOmplete proteinase inhibitor cocktail,
Sigma-
Aldrich; Pierce phosphatase inhibitor, Thermo Scientific Fisher). Protein
concentrations were
measured by Pierce BCA protein assay (Thermo Scientific Fisher). 40 mg
denatured cell
lysate protein were used for SDS-PAGE electrophoresis (4-20% TGX gel, Bio-
Rad). The
following primary antibodies were used: PERK (Cell signaling, #3192), phospho-
PERK
(Thr980, Cell signaling, #3179), ATF4 (Cell signaling, #11815), ATF6 (Novus
Biologicals,
#NBP1-40256SS), eIF2a (Cell signaling, #2103), phosphor-eIF2a (Ser51, Cell
signaling,
#3597), IREla (Cell signaling, #3294), phosphor-IREla (Ser724, Novus
Biologicals,
#NB100-2323SS), Txnip (MBL, K0205-3), cleaved Caspase 3 (Cell signaling,
49664S),
NRF2 (Santa Cruz, #5C365949) and actin (ABclonal, #AC004). All images were
obtained
and quantified using a C-DiGit blot scanner and the Image Studio software (LI-
COR
Biosciences).
T7 enclonuclease I assay
[00145] CRISPR/Cas9 editing in Rnls"" cells was detected
by T7 endonuclease
I mismatch cleavage assay. Genomic DNA (gDNA) was purified from control and
Rnls '1
NIT-1 cells using Quick-gDNA miniprep kit (Zymo Research). The Rnls gRNA
targeting site
was amplified using the Phusion high-fidelity PCR kit (Thermo Fisher
Scientific). Primers
for Rnls gRNA site PCR were: forward 5' TGCTATAGACAGTTGGGACTTGTTT 3' (SEQ
ID NO: 14); reverse 5' ATATTGCGTTCTATTATCAATGGAGATGAAGC 3' (SEQ ID
NO: 15). The PCR products (-200 ng) were used to form heteroduplexes by
denaturing at
95 C for 5 min and then re-annealing the products in a thermocycler using the
following
33
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
protocol: ramp down to 85 C at -2 C/sec; ramp down to 25 C at -0.1 C/sec; hold
at 4 C. 10
units T7 endonuclease I was added to the annealed PCR products and the
reaction was
incubated at 37 C for 15 min. The digestion reaction was stopped by 1 il 0.5M
EDTA and
immediately applied to a 1.5% agarose gel to visualize digested and undigested
products by
electrophoresis.
CD4' T cell stimulation assay
[00146] CD25-CD4+ T cells were isolated from BDC2.5-TCR
transgenic (Tg)
NOD mice using a CD25+ regulatory T cell isolation kit (Miltenyi, 130-091-
041). Purified
CD4 + T cells were maintained in culture for three weeks prior to being
cultured with NIT-1
cells by weekly stimulation with 1 IAM BDC2.5 mimotope in the presence of
irradiated
splenocytes from NOD.scid mice and 20 U/mL IL-2 (Peprotech, 212-12-2OUG). The
day
prior to T cell and NIT-1 co-culture, NIT-1 cell lines were incubated with or
without 1 .M
Thapsigargin for 5 h. NIT-1 cells were washed extensively with complete DMEM
after
incubation. 5x104 NIT-1 cells were then seeded in each well of a 96-well plate
in 100 L
culture medium. The next day, 105 BDC2.5-Tg CD4 + T cells and 5 x 105 NOD.sctd
splenocytes re-suspended in 1004 RPMI medium were added to NIT-1 cultures.
Cells were
co-cultured in a 37 C incubator with 5% CO2 for 24 hours. Cells were treated
with BD Golgi
plug (diluted 1 in 1,000; BD bioscience, #555029) for the last 5 h of culture.
After the
incubation, cells were collected and stained with the following antibodies,
all of which were
purchased from BioLegend; BV785 CD3 (clone 17A2, #100231), PE-Cy7 CD4 (clone
GK1.5, #100421), PE anti-TNF-a (clone MP6-XT22, #506306), PE rat IgG1 kappa
isotype
control (clone RTK2071, #400407), APC IFN-y (clone XMG1.2, #505810), and APC
rat
IgG1 kappa isotype control (clone RTK2071, #400411). Zombie Violet Fixable
Viability Kit
(BioLegend, #423114) was used for dead cell staining, and BD Cytofix/Cytoperm
Plus (BD
bioscience, #554714) was used for intra-cellular cytokine staining, following
the
manufacturer's instructions. Flow cytometry was performed on a LSR fortessa
instrument
(BD Biosciences), and data were analyzed using Flow Jo v10.6 (Flow Jo, LLC).
MI-IC class I and class II expression analyses
[00147] 5 x 105 NIT-1 cells were seeded in each well of a
24-well plate in 500
1_, complete DMEM medium.
[00148] Cells were treated with or without 1.25 !AM
Thapsigargin in a 37 C
incubator with 5% CO2 for 24 hours, collected and stained with the following
antibodies, all
of which were purchased from BioLegend; APC anti-mouse H-2Kd (clone SF1-1.1,
34
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
#116620), APC mouse IgG2a kappa isotype control (clone MOPC-173, #400219), PE
anti-
mouse lAk (Aflk) (clone 10-3.6, #109908) which cross-reacts with mouse I-Ag7,
PE mouse
IgG2a kappa isotype control (clone MOPC-173, #400213). Flow cytometry was
performed as
described above.
CD8 T cell ELISPOT assay
po1491 5 lag/mL capture antibody (BD NA/LETM Purified
Anti-mouse IFN-
y, BD Biosciences, #51-25251(A) was coated on a 96-well ELISPOT plate
(Millipore Sigma,
#MAIPS4510) overnight at 40 C. The following day, the plate was blocked with
200 ILIL
complete RPMI medium for 2 hours at room temperature. NIT-1 cells were treated
with
100U/mL IFN-y for 72 hours prior to use in the assay, washed and suspended at
105 cells /
100 pi, in complete DMEM medium. CD8+ T cells were isolated and purified from
a female
diabetic NOD mouse using mouse CD8a+ Isolation Kit (Miltenyi, #130-104-075).
105 CDR+
T cells were re-suspended in 100 [iL complete RPMI medium. NIT-1 cells and
CD8+ T cells
were then mixed at a 1:1 ratio in the antibody-coated 96-well plate and co-
cultured for 24
hours in a 37 C incubator with 5% CO2. Cells were discarded and the plate was
washed with
PBS-0.1% Tween20 washing buffer three times. 2 lag/mL detection antibody
(Biotinylated
Anti-mouse IFN- y, BD Biosciences, #51-18181(A) was added to each well and the
plate was
incubated for 2 hours at room temperature. Plates were washed three times with
washing
buffer and HRP-conjugated streptavidin (BD Biosciences, #557630) was added to
each well
for one hour. After washing four times with washing buffer and three more
times with PBS,
substrate solution (R&D, #DY999) was added to each well and incubated for 15-
30 min. The
reaction was stopped by adding deionized water to each well and the plate was
further
washed with deioni zed water. Spots were counted and analyzed on the
Immunospot S6
Universal-V instrument (Cellular Technology Limited).
RNLS structure analyses and drug-binding modeling
[00150] hRNLS uses flavin adenine dinucleotide (FAD) as a
co-factor for
catalysis. Therefore, to find compounds that could potentially inhibit hRNLS,
the Protein
Data Bank was searched for protein-inhibitor complex structures that had FAD.
MAO-B in
complex with inhibitors that covalently attached to FAD were identified
through the search.
Structural alignments and analysis of the hRNLS crystal structure with these
complex
structures based on FAD suggested that these inhibitors, for instance
pargyline, may inhibit
hRNLS as well. The model of full-length hRNLS in complex with pargyline was
built based
on the crystal structures of human renalase (PDB: 3QJ4) (36) and MAO-B
rasagiline
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
complex (PDB: 2C65) (37). The model was first optimized using the Protein
Preparation
Wizard (38) from Schrodinger at pH 7.0 and energy minimized with gradually
reduced
restraints (1000, 5, 0 force constant) on backbone and solute heavy atoms. A
multi-stage 100
ns molecular dynamics (MD) simulation using Desmond (39) was performed
afterwards. The
final frame of the MD simulation was used as the final model in Figure 6A.
RNLS thermal shift assay
[00151[ Human recombinant RNLS protein was generated by
GenScript USA
Inc., using the E. Coll expression vector pET28a-MBP. RNLS protein was
obtained from the
supernatant of cell lysates, followed by purification via Ni Bio-rad column. 2
m1V1RNLS
dissolved in PBS was incubated with pargyline (Sigma-Aldrich, #P8013) at
concentrations of
0, 0.1, 1, 10, 25, 50, 100 mM for 20 min at 4 C before addition of SYPRO
Orange dye
(Invitrogen, #S6650) for the measurement of thermal denaturation. The thermal
shift assay
was performed using the QuantStudio 6 Flex Real-Time PCR system (Applied
Biosystems)
with an initial temperature hold at 25 C for 2 min, followed by a temperature
ramp up to
95 C at a rate of 1 C / s, and a final temperature hold at 95 C for 2 min.
Results were
collected at 0.25 C increments. The melting temperature (Tm) of RNLS in the
presence and
absence of pargyline was calculated by the first derivative of the
fluorescence emission as a
function of temperature (- dF/dT).
Oral pargvline treatment study
[00152] 9-week-old female NOD mice were injected
intraperitoneally- with
cyclophosphamide (200 gig of body weight, Sigma-Aldrich, #C0768) for diabetes
induction. Diabetic NOD mice (blood glucose >450 mg/dL) identified 10-14 days
later were
randomly assigned to the control group (normal water) or pargyline treatment
group (5 griml
pargyline hydrochloride in the drinking water, Sigma-Aldrich #P8013).
Treatment was
started one week prior to beta cell transplantation. NIT-1 beta cells carrying
a luciferase
reporter were pre-treated with 5 IAM pargyline for 24 hours before
transplantation. 107NIT-1
cells were transplanted subcutaneously into each diabetic NOD mouse. Blood
glucose was
monitored every 1-2 days, and graft bioluminescence was imaged every 2-3 days.
Glucose-stimulated insulin secretion and insulin ELISA
[00153] Primary islets were isolated from 8-week old
CD1(ICR) mice (Envigo)
and immediately cultured in a 24-well low-attachment plate. Islets were
transduced with
lentivirus encoding a non-targeting (NT) or Rnls gRNA together with rat
insulin promoter-
driven Cas9 endonuclease. After 72 hours, islets were washed twice with 1 ml
Krebs Ringer
36
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
Bicarbonate HEPES (KRB) buffer containing 2.8 mM glucose, followed by 1 hour
incubation
at 37 C in 2.8 mM glucose KRB buffer. 0.8 ml KRB was taken out, saved for
insulin
measurement and replaced with 0.8 ml of 20.2 mI\4 glucose KRB buffer for a
final glucose
concentration of 16.8 mM for another 1 hour incubation at 37 C. The KRB
buffer was again
sampled for insulin, then islets were incubated with 30 mM KC1 along with 16.8
mM glucose
for 1 hour at 37 C before the final insulin sampling. Genomic DNA was
purified from islets
for normalization of insulin levels to DNA content. Insulin levels were
assessed by ultra-
sensitive mouse insulin ELISA kit (Crystal Chem, #90080).
Statistical analyses
[00154] Statistical analyses were performed by unpaired or
paired tests as
indicated using the Prism software version 8Ø2. All data are presented as
mean SEM. P <
0.05 was considered statistically significant. Sufficient sample size was
estimated without the
use of a power calculation. No samples were excluded from the analysis. No
randomization
was used for animal experiments. Data analysis was not blinded. All data are
representative
of two or more similar experiments.
[00155] References
1. M. A. Atkinson, B. 0. Roep, A. Posgai, D. C. S. Wheeler, M.
Peakman, The
challenge of modulating 13-cell autoimmunity in type 1 diabetes. Lancet
Diabetes Endocrinol.
7, 52-64 (2019).
2. J. Odorico, J. Markmann, D. Melton, J. Greenstein, A. Hwa,
C. Nostro, A. Rezania, J.
Oberholzer, D. Pipeleers, L. Yang, C. Cowan, D. Huangfu, D. Egli, U. Ben-
David, L. Vallier,
S. T. Grey, Q. Tang, B. Roep, C. Ricordi, A. Naji, G. Orlando, D. G. Anderson,
M.
Poznansky, B. Ludwig, A. Tomei, D. L. Greiner, M. Graham, M. Carpenter, G.
Migliaccio,
K. D'Amour, B. Hering, L. Piemonti, T. Bemey, M. Rickels, T. Kay, A. Adams,
Report of
the Key Opinion Leaders Meeting on Stem Cell-derived Beta Cells.
Transplantation. 102,
1223-1229 (2018).
3. X. Han, M. Wang, S. Duan, P. J. Franco, J. H.-R. Kenty, P.
Hedrick, Y. Xia, A. Allen,
L. M. R. Ferreira, J. L. Strominger, D. A. Melton, T. B. Meissner, C. A.
Cowan, Generation
of hypoimmunogenic human pluripotent stem cells. Proc. Natl. Acad. Sci. 116,
10441-10446
(2019).
4. T. Deuse, X. Hu, A. Gravina, D. Wang, G. Tediashvili, C. De,
W. 0. Thayer, A.
Wahl, J. V. Garcia, H. Reichenspumer, M. M. Davis, L. L. Lanier, S. Schrepfer,
37
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
Hypoimmunogenic derivatives of induced pluripotent stem cells evade immune
rejection in
fully immunocompetent allogeneic recipients. Nat. Biotechnol. 37, 252-258
(2019).
5. K. Hamaguchi, H. R. Gaskins, E. H. Leiter, NIT-1, a pancreatic beta-cell
line
established from a transgenic NOD/Lt mouse. Diabetes. 40, 842-9 (1991).
6. J. A. Pearson, F. S. Wong, L. Wen, The importance of the Non Obese
Diabetic
(NOD) mouse model in autoimmune diabetes. 1 Autoimmun. 66, 76-88 (2016).
7. N. E. Sanjana, 0. Shalem, F. Zhang, Improved vectors and genome-wide
libraries for
CR1SPR screening. Nat. Methods. 11, 783-784 (2014).
8. J. C. Barrett, D. G. Clayton, P. Concannon, B. Akolkar, J. D. Cooper, H.
A. Erlich, C.
Julier, G. Morahan, J. Nerup, C. Nierras, V. Plagnol, F. Pociot, H.
Schuilenburg, D. J. Smyth,
H. Stevens, J. A. Todd, N. M. Walker, S. S. Rich, Genome-wide association
study and meta-
analysis find that over 40 loci affect risk of type 1 diabetes. Nat. Genet.
41, 703-7 (2009).
9. J. M. M. Howson, J. D. Cooper, D. J. Smyth, N. M. Walker, H. Stevens, J.-
X. She, G.
S. Eisenbarth, M. Rewers, J. A. Todd, B. Akolkar, P. Concannon, H. A. Erlich,
C. Julier, G.
Morahan, J. Nerup, C. Nierras, F. Pociot, S. S. Rich, Type 1 Diabetes Genetics
Consortium,
Evidence of gene-gene interaction and age-at-diagnosis effects in type 1
diabetes. Diabetes.
61, 3012-7 (2012).
10. K. Haskins, M. Portas, B. Bergman, K. Lafferty, B. Bradley, Pancreatic
islet-specific
T-cell clones from nonobese diabetic mice. Proc. Natl, Acad. Sci. 86, 8000-
8004 (1989).
11. J. D. Katz, B. Wang, K. Haskins, C. Benoist, D. Mathis. Following a
diabetogenic T
cell from genesis through pathogenesis. Cell. 74, 1089-100 (1993).
12. M. L. Marre, J. L. Profozich, J. T. Coneybeer, X. Geng, S. Bertera, M.
J. Ford, M.
Trucco, J. D. Piganelli, Inherent ER stress in pancreatic islet f3 cells
causes self-recognition
by autoreactive T cells in type 1 diabetes. J Autoinunun. 72, 33-46 (2016).
13. A. L. Clark, F. Urano, Endoplasmic reticulum stress in beta cells and
autoimmune
diabetes. Curr. Opin. Iinmunol. 43, 60-66 (2016).
14. U. Ozcan, Q. Cao, E. Yilmaz, A.-H. Lee, N. N. Iwakoshi, E. Ozdelen, G.
Tuncman,
C. Gorgiin, L. H. Glimcher, G. S. Hotamisligil, Endoplasinic Reticulum Stress
Links Obesity,
Insulin Action, and Type 2 Diabetes. Science. 306, 457-461 (2004).
15. T. Izumi, H. Yokota-Hashimoto, S. Zhao, J. Wang, P. A. Halban, T.
Takeuchi,
Dominant negative pathogenesis by mutant proinsulin in the Akita diabetic
mouse. Diabetes.
52, 409-16 (2003).
16. M. J. L. Kracht, M. van Lummel, T. Nikolic, A. M. Joosten, S. Laban, A.
R. van der
Slik, P. A. van Veelen, F. Carlotti, E. J. P. de Koning, R. C. Hoeben, A.
Zaldumbide, B. 0.
38
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
Roep, Autoimmunity against a defective ribosomal insulin gene product in type
1 diabetes.
Nat. Med. 23, 501-507 (2017).
17. M. L. Marre, J. W. McGinty, I.-T. Chow, M. E. DeNicola, N. W. Beck, S.
C. Kent, A.
C. Powers, R. Boffin , D. M. Harlan, C. J. Greenbaum, W. W. Kwok, J. D.
Piganelli, E. A.
James, Modifying Enzymes Are Elicited by ER Stress, Generating Epitopes That
Are
Selectively Recognized by CD4 T Cells in Patients With Type 1 Diabetes.
Diabetes. 67,
1356-1368 (2018).
18. J. Sidney, J. L. Vela, D. Friedrich, R. Kolla, M. von Herrath, J. D.
Wesley, A. Sette,
Low HLA binding of diabetes-associated CD8+ T-cell epitopes is increased by
post
translational modifications. BMC Immunol. 19, 12 (2018).
19. J. S. Cox, C. E. Shamu, P. Walter, Transcriptional induction of genes
encoding
endoplasmic reticulum resident proteins requires a transmembrane protein
kinase. Cell. 73,
1197-206 (1993).
20. H. P. Harding, Y. Zhang, D. Ron, Protein translation and folding are
coupled by an
endoplasmic-reticulum-resident kinase. Nature. 397, 271-274 (1999).
21. H. Yoshida, K. Haze, H. Yanagi, T. Yura, K. Mori, Identification of the
cis -Acting
Endoplasmic Reticulum Stress Response Element Responsible for Transcriptional
Induction
of Mammalian Glucose-regulated Proteins. J. Biol. Chem. 273, 33741-33749
(1998).
22. S. Oyadomari, A. Koizumi, K. Takeda, T. Gotoh, S. Akira, E. Araki, M.
Mori,
Targeted disruption of the Chop gene delays endoplasmic reticulum
stress¨mediated diabetes.
Clin. Invest. 109, 525-532 (2002).
23. A. H. Minn, C. Hafele, A. Shalev, Thioredoxin-Interacting Protein Is
Stimulated by
Glucose through a Carbohydrate Response Element and Induces I3-Cell Apoptosis.
Endocrinology. 146, 2397-2405 (2005).
24. C. M. Oslowski, T. Hara, B. O'Sullivan-Murphy, K. Kanekura, S. Lu, M.
Hara, S.
Ishigaki, L. J. Zhu, E. Hayashi, S. T. Hui, D. Greiner, R. J. Kaufman, R.
Borten, F. Urano,
Thioredoxin-Interacting Protein Mediates ER Stress-Induced 13 Cell Death
through Initiation
of the Inflammasome. Cell Metab. 16, 265-273 (2012).
25. T. W. Kensler, N. Wakabayashi, S. Biswal, Cell survival responses to
environmental
stresses via the Keapl-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 47, 89-
116
(2007).
26. G. R. Moran, The catalytic function of renalase: A decade of phantoms.
Biochim.
Biophys. Acta - Proteins Proteomics. 1864, 177-186 (2016).
39
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
27. B. A. Beaupre, M. R. Hoag, J. Roman, F. H. Forsterling, G. R. Moran,
Metabolic
Function for Human Renalase: Oxidation of Isomeric Forms of f3-NAD(P)H that
Are
Inhibitory to Primary Metabolism. Biochemistry. 54, 795-806 (2015).
28. M. Milani, F. Ciriello, S. Baroni, V. Pandini, G. Canevari, M.
Bolognesi, A. Aliverti,
FAD-Binding Site and NADP Reactivity in Human Renalase: A New Enzyme Involved
in
Blood Pressure Regulation. I Mot Biol. 411, 463-473 (2011).
29. J. D. Taylor, A. A. Wykes, Y. C. Gladish, W. B. Martin, New Inhibitor
of
Monoamine Oxidase. Nature. 187, 941-942 (1960).
30. Sanjana, N. E., Shalem, 0. & Zhang, F. Improved vectors and genome-wide
libraries
for CRISPR screening. Nat Methods 11, 783-784, (2014).
31. Joung, J. et al. Genome-scale CRISPR-Cas9 knockout and transcriptional
activation
screening. Nat Protoc 12, 828-863, (2017).
32. Schuster, C., Jonas, F., Zhao, F. & Kissler, S. Peripherally induced
regulatory T cells
contribute to the control of autoimmune diabetes in the NOD mouse model. Eur
Immunol
48,1211-1216, (2018).
33. Shalem, 0. et al. Genome-scale CR1SPR-Cas9 knockout screening in human
cells.
Science 343, 84-87, (2014).
34. Cao, J. et al. An easy and efficient inducible CRISPR/Cas9 platform
with improved
specificity for multiple gene targeting. Nucleic Acids Res 44, e149, (2016).
35. Kuznetsova, A. etal. Trimeprazine increases IRS2 in human islets and
promotes
pancreatic beta cell growth and function in mice. JCI Insight 1, pii: e80749
(2016).
36. M. Milani, F. Ciriello, S. Baroni, V. Pandini, G. Canevari, M.
Bolognesi, A. Aliverti.
FAD-binding site and NADP reactivity in human renalase: a new enzyme involved
in blood
pressure regulation. I Mol. Biol. 411, 463-473 (2011).
37. C. Binda, F. Hubalek, M. Li, Y. Herzig, J. Sterling, D. E. Edmonson, A.
Mattevi.
Binding of rasagiline-related inhibitors to human monoamine oxidases: a
kinetic and
crystallographic analysis. J. Med. Chem. 48, 8148-8154 (2005).
38. G. M. Sastry, M. Adzhigirey, T. Day, R. Annabhimoju, W. Sherman.
Protein and
ligand preparation: Parameters, protocols, and influence on virtual screening
enrichments.
Comput. Aided Mot. Des., 27, 221-234 (2013).
39. K. J. Bowers, D. E. Chow, H. Xu, R. 0. Dror, M. P. Eastwood, B. A.
Gregersen, J. L.
Kelpeis, I. Kolossvary, M. A. Moraes, F. D. Sacerdoti, J. K. Salmon, Y. Shan,
D. E. Shaw.
Scalable Algorithms for Molecular Dynamics Simulations on Commodity Clusters.
Proceedings of the 2006 ACM/IEEE Conference on Supercomputing (5C06), p43
(2006).
CA 03174673 2022- 10-4
WO 2021/133777
PCT/US2020/066560
EQUIVALENTS
[00156] The foregoing written specification is considered
to be sufficient to
enable one skilled in the art to practice the embodiments. The foregoing
description and
Examples detail certain embodiments and describes the best mode contemplated
by the
inventors. It will be appreciated, however, that no matter how detailed the
foregoing may
appear in text, the embodiment may be practiced in many ways and should be
construed in
accordance with the appended claims and any equivalents thereof
[00157] As used herein, the term about refers to a numeric
value, including, for
example, whole numbers, fractions, and percentages, whether or not explicitly
indicated. The
term about generally refers to a range of numerical values (e.g., +/-5-10% of
the recited
range) that one of ordinary skill in the art would consider equivalent to the
recited value (e.g.,
having the same function or result). When terms such as at least and about
precede a list of
numerical values or ranges, the terms modify all of the values or ranges
provided in the list.
In some instances, the term about may include numerical values that are
rounded to the
nearest significant figure.
41
CA 03174673 2022- 10-4
