Note: Descriptions are shown in the official language in which they were submitted.
METHOD FOR SITE-DIRECTED MUTAGENESIS OF BnHBBD GENE OF BRASSICA
NAPUS L., AND USE
TECHNICAL FIELD
The present disclosure belongs to the technical field of plant gene editing
and plant breeding,
and specifically relates to a method for site-directed mutagenesis (SDM) of a
BnHBBD gene of
Brassica napus L., and a use.
BACKGROUND
As one of the most widely planted oil crops in China, Brassica napus L. can be
used not only
for production of edible oil, but also for ornamentation. Brassica napus L. is
one of the major cash
crops in China. The biological breeding and seed engineering have developed
rapidly. Currently,
the breeding means and techniques in China pay more attention to biological
breeding, and China
will soon set up key special projects for the mining and innovative
utilization of agricultural
biological germplasm resources, which enhances the innovation ability and
improves the
independent research and development level.
In the modern society, with the improvement of people's living standards and
due to the bright
colorful flowers, wide distribution, simple management, and low investment of
Brassica napus L.,
Brassica napus L. has naturally become a farmland landscape crop with a high
ornamental value,
and the Brassica napus L. tourism has been increasingly popular. The most
famous Duotian
Brassica napus L. Flower Scenic Area in Jiangsu Xinghua and Brassica napus L.
Flower Sea
Scenic Area in Qinghai Menyuan have a ticket revenue of nearly one million in
just one day and a
comprehensive tourism income of billions (the data are derived from the
Jiangsu Provincial
People's Government and the Menyuan County People's Government).
Gene editing is an emerging genetic engineering technology that can accurately
modify a
specific gene in a genome of an organism. In recent years, studies have shown
that a gene editing
technique can be used to knock out an LNK2 gene in Glycine max L. to affect a
flowering time of
Glycine max L.; a CRISPR/Cas9 system can be used to acquire an Otyza sativa L.
mutant in which
a relationship between pyruvate kinase (PK) and the expression of a cyclin
protein is revealed to
facilitate the improvement of a grain yield; and the knockout of a plurality
of lysophosphatidic
acid acyltransferase (LPAT) genes in an allotetraploid of Brassica napus L.
through multiplexed
gRNA and single gRNA can change a fatty acid content. The CRISPR/Cas9 system-
based SDM
technique has gradually matured, and can greatly shorten an acquisition cycle
of a new germplasm.
Currently, when Brassica napus L. grows to a flowering stage in a natural
environment,
ascospores of Sclerotinia sclerotiorum (S. sclerotiorum) may be transmitted to
various parts of
Brassica napus L. Among various parts of Brassica napus L., withered petals
have the highest
CA 03211382 2023- 9- 7 1
bacterium-bearing rate, and hyphae will fall to stems and leaves with the
abscission of petals and
cause secondary infection to Brassica napus L., resulting in large-area attack
of S. sclerotiorum.
In addition, Brassica napus L. also has problems such as easy silique
cracking, large rapeseed loss
due to mechanized harvest, low harvesting efficiency, and short suitable
ornamental flowering
stage.
SUMMARY
In view of the deficiencies in the prior art, the present disclosure provides
a method for SDM
of a BnHBBD gene of Brassica napus L., and a use. In the present disclosure, a
CIRSPR/Cas9
system is used to breed a transgenic plant with a long flowering stage, S.
sclerotiorum resistance,
and a silique that is not easy to crack through SDM of a BnHBBD gene of
Brassica napus L. In
the gene name BnHBBD, Bn represents an English abbreviation of Brassica napus
L., and H, B,
13, and D are Chinese pinyin initials of flower (Hua), petal (Ban), No (Bu),
and abscission (Diao).
The present disclosure provides a CRISPR/Cas9 system sequence element set for
SDM of a
BnHBBD gene of Brassica napus L., including U6-26p-Targetl-gRNA, U6-26p-
Target2-gRNA,
and a Cas9 gene optimized according to a codon,
where the U6-26p-Targetl-gRNA includes a promoter U6-26p, a gRNA backbone
structure,
and Target 1; the U6-26p-Target2-gRNA includes a promoter U6-26p, a gRNA
backbone structure,
and Target2;
the BnHBBD gene of Brassica napus L. includes BnHBBD-006 and BnHBBD-A07; the
Targetl is a target sequence of the gene BnHBBD-006; and the Target2 is a
target sequence of the
gene BnHBBD-A07.
The Targetl has a nucleotide sequence: 5'-TACGATGGTTCTGCTCTGTC-3' (SEQ ID NO:
1);
the Target2 has a nucleotide sequence: 5'-TGCAAGAATTGGAGCCACCG-3' (SEQ ID NO:
2); and
the gRNA has a nucleotide sequence:
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA
AAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO: 3).
Further, the BnHBBD-006 corresponds to a nucleotide sequence shown in SEQ ID
NO: 4 and
an amino acid sequence shown in SEQ ID NO: 6; and
the BnHBBD-A07 corresponds to a nucleotide sequence shown in SEQ ID NO: 5 and
an
amino acid sequence shown in SEQ ID NO: 7.
The present disclosure also provides a gene-editing vector pKSE401-BnHBBD-
CRISPR,
including the CRISPR/Cas9 system sequence element set for SDM of a BnHBBD gene
of Brassica
napus L. described above.
CA 03211382 2023- 9-7
2
The present disclosure also provides a genetically engineered bacterium (GEB)
for SDM of
a BnHBBD gene of Brassica napus L., and the GEB is obtained by transforming
the gene-editing
vector pKSE401-BnHBBD-CRISPR described above into a host bacterium.
The present disclosure also provides a kit for SDM of a BnHBBD gene of
Brassica napus L.,
including the gene-editing vector described above or the GEB described above.
The present disclosure also provides a use of the sequence element set
described above, the
gene-editing vector pKSE401-BnHBBD-CRISPR described above, the GEB described
above, or
the kit described above, including:
A) a use in SDM of a gene BnHBBD-006 and/or a gene BnHBBD-A07 of Brassica
napus L.,
where the gene BnHBBD-006 corresponds to a nucleotide sequence shown in SEQ ID
NO: 4 and
an amino acid sequence shown in SEQ ID NO: 6, and the gene BnHBBD-A07
corresponds to a
nucleotide sequence shown in SEQ ID NO: 5 and an amino acid sequence shown in
SEQ ID NO:
7;
B) a use in breeding of Brassica napus L. with a long flowering stage; and/or
C) a use in breeding of Brassica napus L. with S. sclerotiorum resistance;
and/or
D) a use in breeding of Brassica napus L. with a silique that is not easy to
crack.
The present disclosure also provides a method for SDM of a BnHBBD gene of
Brassica napus
L. with a CIRSPR/Cas9 system, including:
(1) designing and screening Targetl and Target2 for the BnHBBD gene in the
Brassica napus
L., designing gRNA sequences, and ligating the Targetl and the Target2 with
the gRNA sequences
respectively to construct a dual-target gene-editing vector pKSE401-BnHBBD-
CRISPR;
(2) transforming the gene-editing vector pKSE401-BnHBBD-CRISPR into
Agrobacterium
GV3101 to obtain Agrobacterium carrying the gene-editing vector pKSE401-BnHBBD-
CRISPR;
(3) conducting expanded cultivation to obtain an Agrobacterium bacterial
solution, and
mediating transformation of a hypocotyl of the Brassica napus L. with the
Agrobacterium bacterial
solution;
(4) cultivating the hypocotyl of the Brassica napus L., and conducting callus
induction,
redifferentiation, rooting cultivation, seedling exercise, and transplantation
to obtain transgenic
Brassica napus L.; and
(5) identifying the transgenic Brassica napus L. in which the BnHBBD gene has
undergone
a mutation.
The BnHBBD gene of Brassica napus L. includes BnHBBD-006 and BnHBBD-A07; the
Target 1 is a target sequence of the gene BnHBBD-006; and the Target2 is a
target sequence of the
gene BnHBBD-A07;
the Targetl has a nucleotide sequence shown in SEQ ID NO: 1;
the Target2 has a nucleotide sequence shown in SEQ ID NO: 2;
CA 03211382 2023- 9-7
3
the sgRNA has a nucleotide sequence shown in SEQ ID NO: 3;
the BnHBBD-006 corresponds to a nucleotide sequence shown in SEQ ID NO: 4 and
an
amino acid sequence shown in SEQ ID NO: 6; and
the BnHBBD-A07 corresponds to a nucleotide sequence shown in SEQ ID NO: 5 and
an
amino acid sequence shown in SEQ ID NO: 7.
The mutation of the BnHBBD gene includes insertion of a T base.
The present disclosure further provides a use of a mutated BnHBBD gene
obtained by the
method described above in regulation of abscission of a floral organ of
Brassica napus L.
Specifically, the use includes: inhibiting normal synthesis of an HBBD protein
in Brassica
napus L., breeding Brassica napus L. with a long flowering stage, breeding
Brassica napus L.
with S. sclerotiorum resistance, and breeding Brassica napus L. with a silique
that is not easy to
crack.
Compared with the prior art, the present disclosure has the following
advantages.
Inflorescence deficient in abscission (IDA) can bind to co-receptors HAE and
HSL2 on a
membrane, and through phosphorylation and a signaling cascade amplification
reaction, an
abscission signal is transmitted to an intracellular downstream regulation
factor, such that cells in
an abscission zone (AZ) are expanded to finally cause abscission of floral
organs. However, cells
in an AZ of a mutant are no longer expanded, and petals no longer fall off,
such that a separation
layer between a silique peel and a false dissepiment is affected to some
extent, a silique is not easy
to crack, and rapeseeds are not easy to fall off, which reduces a loss during
mechanized harvest
and improves the production efficiency of rapeseeds. In the present
disclosure, among five
homologous genes of Brassica napus L., two effective genes BnaA07g27400D and
BnaC06g29530D in Brassica napus L. that have the highest expression level, are
closest to
Arabidopsis thaliana (A. thaliana), and can control the abscission of floral
organs are identified
and named BnHBBD-A07 and BnHBBD-006, and a CIRSPR/Cas9 system is used to
conduct SDM
for the genes to obtain a Brassica napus L. germplasm without petal
abscission. Since ascospore
of S. sclerotiorum can only germinate to produce hyphae on petals and cannot
germinate to produce
hyphae when directly falling on Brassica napus L. leaves, the non-abscission
of petals can prevent
S. sclerotiorum from further infecting lower leaves, which can allow S.
sclerotiorum resistance.
The present disclosure successfully applies a gene editing technique to
Brassica napus L.,
which greatly shortens an acquisition cycle of a new germplasm and provides a
new idea for
Brassica napus L. breeding. A transformant obtained after transforming the
gene-editing vector
pKSE401-BnHBBD-CRISPR constructed by the present disclosure into Brassica
napus L. provides
an experimental material for research on a function and an action mechanism of
the gene BnHBBD,
can also be used as a novel germplasm resource with a long flowering stage, S.
sclerotiorum
resistance, and no abscission, and provides a novel gene source for Brassica
napus L. breeding,
CA 03211382 2023- 9-7
4
which is conducive to promotion of a progress of agricultural science.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a comparison diagram illustrating differences in nucleotide and
amino acid
sequences between BnHBBD-A07 and BnHBBD-006.
FIG. 2 shows a schematic diagram illustrating locations of the screened Target
1 and Target2
on a gene (a) and a brief schematic diagram illustrating a pKSE401-BnHBBD-
CRISPR plasmid
between LB and RB (b), where LB: left boundary; RB: right boundary; Kan:
kanamycin resistance
gene; P-CaMV35S: CaMV35 promoter; U6-26p-Targetl-gRNA: gRNA expression element
set,
including a promoter U6-26p, a gRNA backbone structure, and Targetl; U6-26p-
Target2-gRNA:
gRNA expression element set, including a promoter U6-26p, a gRNA backbone
structure, and
Target2; and Cas9: a Cas9 gene optimized according to a codon.
FIG. 3 is a PCR identification gel pattern of leaf genomes extracted from two
positive
transformants, where WT: wild type; hbbd-1 and hbbd-2: mutant transgenic
plants; +: positive
control, pKSE401-BnHBBD-CRISPR plasmid; -: negative control, ddH20; and
Marker: Takara
DL2000 DNA Marker.
FIG. 4 is a schematic diagram illustrating sequencing results of a gene BnHBBD-
A07 (a) and
a gene BnHBBD-006 (b) in an hbbd mutant compared with WT.
FIG. 5 is a schematic diagram illustrating analysis results of frameshift
mutations caused by
T insertion at Targetl in an hbbd mutant, where (a) shows a change of a gene
BnHBBD-A07 in the
mutant compared with WT and (b) shows a change of a gene BnHBBD-006 in the
mutant
compared with WT.
FIG. 6 is a comparison diagram illustrating flowering stages of WT (a) and a
non-floral organ
abscission phenotype of an hbbd mutant (b).
FIG. 7 is a comparison diagram illustrating silique mature stages of non-
floral organ
abscission phenotypes (hbbd) of three different hbbd mutant strains and WT.
FIG. 8 is a comparison diagram illustrating inflorescence stages of a mutant
(hbbd) and WT,
where numbers in this figure represent position numbers of Brassica napus L.
inflorescences; and
a first flower blossomed from a flower bud is numbered 1, a second flower is
numbered 2, and so
on.
FIG. 9 is a schematic comparison diagram illustrating pathogenesis pathways of
an hbbd
mutant and WT infected with S. sclerotiorum under natural conditions.
FIG. 10 is a schematic comparison diagram illustrating incidence of an hbbd
mutant and WT
infected with S. sclerotiorum in an incubator environment, where short arrows
in (a) and (c)
represent inoculation positions of S. sclerotiorum; a long arrow in (b)
represents abscission of
petals of the WT to leaves; a long arrow + cross in (d) represents non-
abscission of petals of the
CA 03211382 2023- 9-7
mutant to leaves; and 0 day of post-inoculation (dpi) and 4 dpi represent day
0 and day 4 after
inoculation of S. sclerotiorum, respectively.
FIG. 11 is a statistical chart illustrating a number of diseased petals after
inoculation with S.
sclerotiorum, where according to Hest, P < 0.001, which indicates a
significant difference and is
represented by three *.
FIG. 12 is a measurement chart of silique cracking forces of a mutant (hbbd)
and WT, where
according to t-test, P < 0.05, which indicates a significant difference and is
represented by one *.
DETAILED DESCRIPTION OF THE EMBODIMENTS
The present disclosure will be further described below in conjunction with the
accompanying
drawings and specific embodiments, but the protection scope of the present
disclosure is not
limited thereto.
In the following embodiments, various processes and methods that are not
described in detail
are conventional methods well known in the art. The sources, trade names, and
components
needing to be listed of reagents are indicated when the reagents appear for
the first time, and unless
otherwise specified, the same reagents appearing thereafter are the same as
those indicated for the
first time. The reagents, materials, or the like involved are commercially
available unless otherwise
specified.
Media and formulas thereof in the present disclosure are as follows.
Lysogeny broth (LB) liquid medium: 10 g of tryptone, 5 g of yeast extract, and
10 g of sodium
chloride were weighed and dissolved in 80 mL of double distilled water (DDW),
the resulting
solution was diluted to 1 L and then dispensed into 10 Erlenmeyer flasks, and
the Erlenmeyer
flasks were sealed with a sealing film, autoclaved at 121 C for 15 min,
cooled, and stored in a 4 C
refrigerator.
LB solid medium: 10 g of tryptone, 5 g of yeast extract, 10 g of sodium
chloride, and 15 g of
an agar powder were weighed and dissolved in 800 mL of DDW, the resulting
solution was diluted
to 1 L and then dispensed into 10 Erlenmeyer flasks, and the Erlenmeyer flasks
were sealed with
a sealing film, autoclaved at 121 C for 15 mm, cooled, and stored in a 4 C
refrigerator. When in
use, the LB solid medium was heated and melted in a microwave oven, the
resulting liquid was
cooled to about 50 C, an antibiotic was added, and the resulting mixture was
thoroughly shaken
and then immediately poured into sterile petri dishes with about 10 mL for
each petri dish.
MO medium: 4.4 g/L of an MS powder and 30 g/L of sucrose were mixed and
diluted with
DDW, a pH was adjusted to 5.84 to 5.88, 10 g/L of a coagulating agent Agar was
added, and the
resulting medium was sterilized and dispensed.
DM medium: 4.4 g/L of an MS powder and 30 g/L of sucrose were mixed and
diluted with
DDW, a pH was adjusted to 5.84 to 5.88, and the resulting medium was
sterilized and then cooled;
CA 03211382 2023- 9-7
6
and AS was added at 1 mL/1 L (stock solution: 100 gnol/mL) and the resulting
medium was placed
in a 4 C refrigerator for later use, or the AS could be added when in use.
M1 medium: 4.4 g/L of an MS powder, 30 g/L of sucrose, 18 g/L of mannitol, 1
mg/L of 2,4-
D, and 0.3 mg/L of KT were mixed and diluted with DDW, a pH was adjusted to
5.84 to 5.88, 10
g/L of a coagulating agent Agar was added, and the resulting medium was
sterilized and then
cooled; and AS was added at 1 mL/1 L (stock solution: 100 iimol/mL) and the
resulting medium
was placed in a 4 C refrigerator for later use, or the AS could be added when
in use.
M2 medium: 4.4 g/L of an MS powder, 30 g/L of sucrose, 18 g/L of mannitol, 1
mg/L of 2,4-
D, and 0.3 mg/L of KT were mixed and diluted with DDW, a pH was adjusted to
5.84 to 5.88, 10
g/L of a coagulating agent Agar was added, and the resulting medium was
sterilized and then
cooled; and 300 mg/L of timentin (TMT), 150 !anion of STS (because a
precipitate will appear
in STS after being placed for a long time, STS should be prepared just before
use), and 25 mg/L
of kanamycin were added, and the resulting medium was then dispensed into
sterile petri dishes.
M3 medium: 4.4 g/L of an MS powder, 10 g/L of glucose, 0.25 g/L of xylose, and
0.6 g/L of
MES were mixed and diluted with DDW, a pH was adjusted to 5.84 to 5.88, 10 g/L
of a coagulating
agent Agar was added, and the resulting medium was sterilized and then cooled;
and then 2 mg/L
of ZT, 0.1 mg/L of IAA, 300 mg/L of TMT, 150 mon of AgNO3, and 25 mg/L of
kanamycin
were added, and the resulting medium was then dispensed into sterile petri
dishes.
M4 medium: 4.4 g/L of an MS powder and 10 g/L of sucrose were mixed and
diluted with
DDW, a pH was adjusted to 5.84 to 5.88, 8 g/L of a coagulating agent Agar was
added, and the
resulting medium was sterilized and then cooled; and then 300 mg/L of TMT was
added, and the
resulting medium was dispensed.
PDA solid medium: 7.4 g of a potato glucose agar medium powder purchased from
Sinopharm was weighed, 200 mL of distilled water was added, and the resulting
medium was
autoclaved at 121 C for 15 min, cooled, and stored in a 4 C refrigerator. When
in use, the PDA
solid medium was heated and melted in a microwave oven, the resulting liquid
was cooled to about
50 C, an antibiotic was added, and the resulting mixture was thoroughly shaken
and then
immediately poured into sterile petri dishes with about 20 mL for each petri
dish.
Example 1 Identification and acquisition of a BnHBBD gene
There are five members of HBBD in Brassica napus L. In the present disclosure,
the five
member genes were screened through an evolutionary tree and homology
comparison according
to transcriptome data and bioinformatics analysis to obtain two HBBD genes
with the highest
expression level and the highest homology, namely, BnaA07g27400D and
BnaC06g29530D
(https://www.genoscope.cns.fr/brassicanapus/) (referred to as BnHBBD-A07 and
BnHBBD-006
hereinafter). Because the two genes have a high degree of similarity and are
different merely in a
CA 03211382 2023- 9-7
7
few bases, it is difficult to distinguish the two genes by an ordinary PCR
method. In this example,
BnHBBD-A07 and BnHBBD-006 were distinguished by a sequencing method.
Primers were designed according to coding sequences (CDS sequences, gene Nos.:
BnaA07g27400D and BnaC06g29530D) of the BnHBBD gene on the Brassica napus L.
website
(https://www.genoscope.cns.fr/brassicanapus/), and sequences of the primers
were as follows:
HBBD-F (SEQ ID NO: 13): ATGGCTCCGTGTCGTACG and
HBBD-R (SEQ ID NO: 14): TCAATGAGGATGAGAGTC.
With leaf DNA of a Brassica napus L. variety Y127 (derived from Huazhong
Agricultural
University) as a template, a CDS sequence of a BnHBBD gene was amplified with
a high-fidelity
enzyme 2*Phanta MAX Master Mix (purchased from Nanjing Vazyme Biotech Co.,
Ltd.), and a
PCR reaction was shown in Table 1.
Table 1 PCR amplification reaction system with the high-fidelity enzyme
PCR system Volume
ddH20 20 lit
2*Phanta Max Master Mix 25 pL
Upstream primer (10 [LM) 2 ii,L,
Downstream primer (10 M) 2 lit
Template DNA (50 ng to 400 ng) 14
A PCR procedure was as follows: predenaturation at 95 C for 3 min;
denaturation at 95 C
for 15 s, annealing at 52 C for 15 s, and extension at 72 C for 30 s, with 35
cycles in total; and
final extension at 72 C for 5 min. After the PCR was completed, a PCR product
was subjected to
gel electrophoresis at 120 V for 30 min in a 2% (mass volume fraction) agarose
gel and then
imaged by an ultraviolet (UV) gel imager, and results were recorded. The
results showed that target
fragments amplified by the primers, namely, BnHBBD-A07 and BnHBBD-006 gene
fragments,
had a size of about 231 bp.
With reference to operating instructions of a UNIQ-10 column gel DNA recovery
kit
(purchased from Sangon Biotech (Shanghai) Co., Ltd.), a PCR amplification
product BnHBBD
was recovered from an agarose gel and then ligated with a pMD19-T vector
(purchased from
Takara Biotechnology (Dalian) Co., Ltd.). A ligation system included 4.5 [tI.,
of a gel recovery
product, 0.5 1AL of a pMD-19T vector, and 5 1.1L of a Solution I (purchased
from Takara
Biotechnology (Dalian) Co., Ltd.), and ligation was conducted overnight at 16
C to obtain a
ligation product.
[tI., of the ligation product was added to 301.IL of competent Escherichia
coil (E. coil) cells
(purchased from Nanjing Vazyme Biotech Co., Ltd.), and then the ligation
product was
transformed into E. coil through heat shock; and then positive colonies were
screened with an LB
medium including Amp at a final concentration of 30 mg/mL, 10 single colonies
were picked and
CA 03211382 2023- 9- 7
8
cultivated under shaking for 12 h to 16 h, and 2 L of a bacterial solution
was collected and used
as a template to conduct PCR amplification for identification. Primers for the
PCR were as follows:
M13-F (SEQ ID NO: 15): TGTAAAACGACGGCCAGT
M13-R (SEQ ID NO: 16): CAGGAAACAGCTATGACC.
A PCR amplification reaction system was shown in Table 2; and a PCR procedure
was as
follows: predenaturation at 94 C for 3 min; denaturation at 94 C for 30 s,
annealing at 50 C for
30 s, and extension at 72 C for 1 min, with 28 cycles in total; and final
extension at 72 C for 10
min.
Table 2 Bacterial solution PCR amplification reaction system
PCR system Volume
ddH20 6 pt
rTaq 10 pL
Upstream primer (10 M) 1 pt
Downstream primer (10 M) 1 [IL
Bacterial solution 2 pt
PCR amplification results were obtained by testing on a 2% agarose gel, and
test results
showed that a DNA fragment obtained was of about 400 bp, indicating successful
transformation.
bacterial solutions with successful transformation were selected, and 100 [IL
of each of the
bacterial solutions was pipetted and sent to Sangon Biotech (Shanghai) Co.,
Ltd. for sequencing.
Analysis of sequencing results showed that BnHBBD-A07 corresponded to a
nucleotide sequence
shown in SEQ ID NO: 4 and an amino acid sequence shown in SEQ ID NO: 6; and
BnHBBD-006
corresponded to a nucleotide sequence shown in SEQ ID NO: 5 and an amino acid
sequence shown
in SEQ ID NO: 7.
According to comparison with reference to a sequence list, a nucleotide
sequence of
BnHBBD-006 was different from a nucleotide sequence of BnHBBD-A07 in a total
of 4 bases, and
the 4 bases in BnHBBD-006 and BnHBBD-A07 were as follows: position 59: G¨>A,
position 129:
T¨>C, position 140: T¨>A, and position 159: C¨>G. The above sequence
differences between the
two nucleotide sequences led to changes in two amino acids, and the two amino
acids in BnHBBD-
006 and BnHBBD-A07 were as follows: position 20: N¨>S and position 47: H¨>L. A
schematic
comparison diagram was shown in FIG. 1.
Example 2 Construction of a gene-editing vector for SDM of genes BnHBBD-A07
and
BnHBBD-006 in Brassica napus L. based on a CRISPR/Cas9 system
BnHBBD-A07 and BnHBBD-006 gene sequences were submitted to a website
http://cbi.hzau.edu.cn/cgi-bin/CRISPR, targets were screened, and Targetl and
Target2 were
selected. The Targetl had a sequence of 5'-TACGATGGTTCTGCTCTGTC-3' (SEQ ID NO:
1),
and the Target2 had a sequence of 5'-TGCAAGAATTGGAGCCACCG-3' (SEQ ID NO: 2).
The
CA 03211382 2023- 9-7
9
above two target sequences were ligated with 5' termini of two identical gRNA
sequences
respectively: [(20 bp
target)
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAA
GTGGCACCGAGTCGGTGCTTTTTTT] (SEQ ID NO: 3). The (20 bp target) indicated a
length
of each of Targetl and Target2, such that the constructed dual-target gene-
editing vector pKSE401-
BnHBBD-CRISPR could knock out a target sequence twice to ensure effective
editing.
CRISPR/Cas9 vector target primers were designed according to the screened
targets, and
sequences of the primers were shown in Table 3, which ensured that the
designed 2 targets could
knock out BnHBBD-A0 7 and BnHBBD-006 simultaneously.
Table 3 CRISPR/Cas9 vector target primers
Primer Sequence 5'-3'
HBBD-DT1-F0 (SEQ ID NO: 9)
TGTACGATGGTTCTGCTCTGTCGTTTTAGAGCTAGAAATAGC
FIBBD-DT2-R0 (SEQ ID NO: 10)
AACCGGTGGCTCCAATTCTTGCACAATCTCTTAGTCGACTCTAC
HBBD-DT1-Bs (SEQ ID NO: 11)
ATATATGGTCTCGATTGTACGATGGTTCTGCTCTGTCGTT
HBBD-DT2-BsR (SEQ ID NO: 12)
ATTATTGGTCTCGAAACCGGTGGCTCCAATTCTTGCACAA
Subsequently, a template entry vector pCBC-DT1T2 (from Professor Hong Dengfeng
of
Huazhong Agricultural University) was subjected to PCR amplification with the
four primers in
Table 3. A PCR reaction system was the same as in Table 1; and a PCR procedure
was as follows:
predenaturation at 95 C for 3 min; denaturation at 95 C for 15 s, annealing at
52 C for 15 s, and
extension at 72 C for 30 s, with 35 cycles; and final extension at 72 C for 5
min. The primers
HBBD-DT1-BsF and HBBD-DT2-BsR had a normal concentration of 10 M; and the
primers
HBBD-DT1-F0 and HBBD-DT2-R0 were diluted 20 times to a concentration of 5 M.
A product
of the PCR was purified and recovered, and the product of the PCR had a length
of 626 bp. An
enzyme digestion-ligation reaction system was established, a specific reaction
system was shown
in Table 4, and reaction conditions were as follows: keeping at 37 C for 5 h,
keeping at 50 C for
min, and keeping at 80 C for 10 min.
Table 4 Enzyme digestion-ligation reaction system
Component Volume
PCR product (626 bp) 2 I.,
pKSE401 2 [iL
10*NEB T4 Buffer 1.5 iaL
10*BSA 1.5 IAL
Bsa I (NEB) 1 [iL
T4 Ligase (NEB)/high concentration 1 I.,
ddH20 6 !IL
After the reaction was completed, 51AL of a ligation product was taken to
transform competent
CA 03211382 2023- 9- 7
E. coil DH5a, transformed E. coil was cultivated overnight at 37 C on a solid
LB plating medium
including 50 mg/mL Kan for screening, and then positive clones were picked and
cultivated under
shaking for 4 h to 6 h in 400 j.tL of a liquid LB medium including 50 mg/mL
Kan; and 2 tiL of the
resulting bacterial solution was taken and used as a template to conduct PCR
amplification for
identification. Identification primers were designed and identified with a
sequence in a U6
promoter on a pKSE401 vector, an annealing temperature was changed to 57 C,
and other PCR
amplification reaction systems and conditions were the same as that for the
bacterial solution PCR
amplification reaction in Table 2. Specific primer sequences were as follows:
U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO: 17) and
U629-IDR: AGCCCTCTTCTTTCGATCCATCAAC (SEQ ID NO: 18).
A fragment obtained after electrophoresis in the PCR identification had a size
of 726 bp. 100
1.t1_, of a positive clone bacterial solution with a correct fragment size was
taken and sent to Sangon
Biotech (Shanghai) Co., Ltd. for sequencing, and then forward sequencing
primers were designed
with a sequence in the U6 promoter on the pKSE401 vector. Primer sequences
were as follows:
U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO: 17) and
U629-IDF: TTAATCCAAACTACTGCAGCCTGAC (SEQ ID NO: 19).
According to sequencing results, a positive clone bacterial solution with the
designed Targetl
and Target2 was subjected to expanded cultivation, a plasmid was extracted to
obtain apKSE401-
BnHBBD-CRISPR plasmid, and finally the plasmid was transformed into
Agrobacterium GV3101;
and transformed Agrobacterium was subjected to expanded cultivation and
preserved for later use.
FIG. 2 shows a schematic diagram illustrating locations of the screened
Targetl and Target2
on the gene (a) and a brief schematic diagram illustrating a pKSE401-BnHBBD-
CRISPR plasmid
between LB and RB (b), where LB: left boundary; RB: right boundary; Kan:
kanamycin resistance
gene; P-CaMV35S: CaMV35 promoter; U6-26p-Targetl-gRNA: gRNA expression element
set,
including a promoter U6-26p, a gRNA backbone structure, and Targetl; U6-26p-
Target2-gRNA:
gRNA expression element set, including a promoter U6-26p, a gRNA backbone
structure, and
Target2; and Cas9: a Cas9 gene optimized according to a codon. The Cas9 gene
was derived from
a sequence of Streptococcus pyogenes (S. pyogenes) and was optimized based on
a Zea mays L.
codon, and the Cas9 gene optimized according to a codon was purchased from
http://www.addgene.org,/62202/.
Example 3 Transformation of the gene-editing recombinant vectorpKSE401-BnHBBD-
CRISPR into Brassica napus L.
A. Sowing:
In order to quickly acquire a required novel Brassica napus L. germplasm,
seeds of Brassica
napus L. Y127 that did not require vernalization and could grow fast (the
seeds were from
Professor Hong Dengfeng of Huazhong Agricultural University) were selected and
placed in a 10
CA 03211382 2023- 9-7
11
mL centrifuge tube, alcohol with a volume fraction of 75% was added, the
centrifuge tube was
inverted up and down, and the seeds were soaked for 1 min; the alcohol was
removed by a pipette,
and the seeds were rinsed with an appropriate amount of sterile water 3 to 5
times; and a 15%
bleach solution (which was prepared with 8.115 mL of sterile water, 1.875 mL
of sodium
hypochlorite, and 10 [LL of Triton) was added, the centrifuge tube was
inverted up and down, and
the seeds were soaked for 6 min. For heavily-contaminated seeds, a time of the
disinfection and
sterilization with alcohol could be appropriately extended, but a too-long
time would affect the
germination of seeds. Then the disinfectant was removed, and the seeds were
rinsed with an
appropriate amount of sterile water 3 to 5 times, during which the centrifuge
tube was inverted up
and down each time and an inside of the centrifuge tube was kept in a sterile
environment. Finally,
the sterile water was removed, burned sterile forceps were used to sow
sterilized seeds on an MO
medium with about 25 seeds per bottle, and the seeds were cultivated in the
dark light at 24 C for
6 d to obtain Brassica napus L. hypocotyls each with a required length.
B. Bacterial solution preparation:
to 7 days after the sowing, Agrobacterium carrying the pKSE401-BnHBBD-CRISPR
plasmid obtained in Example 2 was cultivated with liquid LB, and a specific
cultivation method
was as follows: 20 III., of the Agrobacterium carrying the pKSE401-BnHBBD-
CRISPR plasmid
was added to 5 mL of resistant LB (50 mg/L Kan +50 mg/L Gen +50 mg/L Rif) and
cultivated in
a shaker at 28 C and 180 rpm to 220 rpm for about 14 h to 16 h.
Because a reproduction rate of Agrobacterium in a medium is related to an
activity of
Agrobacterium and Agrobacterium at a logarithmic propagation state has the
optimal activity and
is most likely to infect a plant, an inoculation time should be strictly
calculated. The inoculation
was repeatedly conducted at an interval of 2 h, for example, the inoculation
was conducted at 18:00
and 20:00, and an appropriate concentration was selected at 8:00 the next
morning, which could
prevent a bacterial concentration from being too high. Before shaking
cultivation of bacteria,
positive single colonies were picked, inoculated on a resistant plate, and
cultivated at 28 C for 48
h until single colonies grew on the plate, and then the single colonies were
repeatedly pipetted up
and down by a 101.IL pipette tip in the medium to make the bacteria grow
evenly.
C. Infection and co-cultivation:
A co-cultivation medium M1 and a DM medium each were prepared. The M1 medium
was
sterilized at 121 C for 15 min and then quickly cooled (by about 50 C) during
which
acetosyringone (AS) was added (final concentration: 100 laM); and AS was also
added (final
concentration: 100jaM) to the DM medium, and the resulting medium was denoted
as DM (AS+)
for later use.
An OD value of bacteria in the LB medium obtained in step B was measured by a
spectrophotometer, and a bacterial solution with an OD value of about 0.4 was
selected and
CA 03211382 2023- 9- 7
12
generally subjected to shaking cultivation for 14 h to 16 h. 2 mL of a
cultivated bacterial solution
was pipetted to a sterile centrifuge tube and centrifuged at 3,000 rpm for 3
mm, and the resulting
supernatant was discarded; then 2 mL of the DM (AS+) medium was added for
suspending, the
resulting suspension was centrifuged at 3,000 rpm for 3 min, and the resulting
supernatant was
discarded; and 2 mL of the DM (AS+) medium was added for suspending, and the
resulting
suspension was placed in a 4 C refrigerator for later use.
The Brassica napus L. hypocotyl grown after the sowing in step A was cut off
by sterile
dissecting scissors, cut into 0.8 cm to 1.0 cm segments, and placed in a petri
dish with 18 mL of
the DM medium; and after the hypocotyl was completely cut into segments, 2 mL
of a bacterial
solution resulting from resuspending with the DM (AS+) medium was then poured
into the petri
dish to a liquid volume of 20 mL to allow infection for 10 min to 15 min (the
infection time could
not be too long, otherwise the explant was easy to die), during which the
petri dish was shaken 4
to 5 times at a specified interval. After the infection was conducted for 8
min, the DM (AS')
bacterial solution was removed by a pipette, the explant was transferred by
sterile forceps to sterile
filter paper and placed for a moment to absorb the excess bacterial solution
on the explant, then
transferred to an M1 solid medium, and placed in the dark at 24 C or at a dark
place in a light
cultivation chamber.
D. Selective cultivation and callus induction:
The explant cultivated in the M1 medium for 36 h to 48 h was transferred to an
M2 medium,
normally cultivated at 24 C under light, and then alternately cultivated with
a 16 h light/8 h dark
cycle to induce a callus within 2 to 3 weeks.
E. Redifferentiation:
The explant was transferred to an M3 medium and sub-cultivated every 2 to 3
weeks until
green shoots appeared.
F. Rooting cultivation:
It took about 20 days for green shoots with intact growth points transferred
to an M4 medium
to grow and root. Rooted seedlings could be directly placed in a cultivation
room for seedling
exercise, and after a seedling state was stable, the seedlings were taken out
from a medium without
destroying a root system of a seedling, then transferred to a soil, and
cultivated with the seedlings
moisturized by a plastic wrap for 1 to 2 weeks to obtain transgenic Brassica
napus L. for
identification.
Example 4 Identification of transgenic Brassica napus L. and detection of gene
editing
sites
After the growth of the transgenic Brassica napus L. plant in Example 3 was
stable, DNA
was extracted by a cetyltrimethylammonium bromide (CTAB) method from leaves of
the
transgenic Brassica napus L., and specific steps were as follows:
CA 03211382 2023- 9- 7
13
A. A small amount of leaves was collected, added to a 1.5 mL centrifuge tube,
and ground
with liquid nitrogen into a dry powder, then 6001.tL of CTAB was added, and
the resulting sample
was incubated in a 65 C water bath for 60 min.
B. After the incubation was completed, 600 III, of a chloroforrn/isoamyl
alcohol (in a volume
ratio of 24:1) solution was added to the centrifuge tube, and the centrifuge
tube was vigorously
shaken to thoroughly remove proteins and then centrifuged in a centrifuge at
12,000 g for 10 min.
C. After the centrifugation was completed, the centrifuge tube was gently
taken out, where a
solution in the centrifuge tube was separated into three layers including an
aqueous phase, a leaf
fragment impurity phase, and an organic phase; 400 ttL to 500 ttL of the upper
aqueous phase was
pipetted and transferred to a new centrifuge tube, then 400 tit to 500 [d., of
isopropyl alcohol (IPA)
was added, and the centrifuge tube was gently inverted up and down for
thorough mixing; and the
resulting sample was placed in a -20 C refrigerator and cooled for at least 10
min to make the IPA
precipitate DNA effectively.
D. The centrifuge tube was centrifuged in a centrifuge for 10 min at room
temperature and
12,000 g.
E. The resulting supernatant was discarded, 700 paL of a pre-cooled ethanol
with a volume
fraction of 70% was added for washing, a bottom of the centrifuge tube was
flicked to make a
precipitate floated, and the centrifuge tube was gently inverted up and down
and then
instantaneously centrifuged at 12,000 g.
F. The resulting supernatant was discarded, the ethanol solution was removed
by a pipette,
and then the resulting precipitate was air-dried in a clean bench to remove
the volatile organic
solution.
G. 50 ilL to 1001aL of ddH20 was added to the centrifuge tube to dissolve the
precipitate, and
the centrifuge tube was placed in a 37 C water bath for 30 min to obtain a
genome sample.
H. lIAL of the genome sample was taken and tested for concentration, and if it
was tested to
be qualified, the genome sample was placed in a -20 C refrigerator for later
use.
With the genome sample obtained in the above step as a template, the pKSE401-
BnHBBD-
CRISPR plasmid as a positive control, and DNA of a recipient material that was
not genetically
transformed and ddH20 as negative controls, PCR identification was conducted.
Identification
primers were designed according to the U6 promoter and Cas9 protein sequence
on the pKSE401
vector (2 pairs of primers were simultaneously used to identify a genome of
transgenic Brassica
napus L. to be identified to ensure a confidence level of a result), annealing
temperatures were
57 C and 62 C, respectively, and other PCR amplification reaction procedures
and conditions were
the same as that for the bacterial solution PCR in Table 2. Primer sequences
were as follows:
Primer set 1: length of an amplified fragment: 726 bp
U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO: 17) and
CA 03211382 2023- 9- 7
14
U629-IDR: AGCCCTCTTCTTTCGATCCATCAAC (SEQ ID NO: 18).
Primer set 2: length of an amplified fragment: 701 bp
Cas9-F: TGCAGGAGATTTTCTCCAACGA (SEQ ID NO: 20) and
Cas9-R: AGCCTTCGTAATCTCGGTGTTCA (SEQ ID NO: 21).
After the PCR was completed, an amplification product was subjected to
electrophoresis in a
1% agarose gel and then imaged by a UV gel imager, and results were recorded.
FIG. 3 is a PCR
identification gel pattern of leaf genomes extracted from two positive
transformants, where WT:
wild type; hbbd-1 and hbbd-2: mutant transgenic plants; +: positive control,
pKSE401-BnHBBD-
CRISPR plasmid; -: negative control, ddH20; and Marker: Takara DL2000 DNA
Marker
The figure could confirm that the gene-editing vector constructed in Example 3
was
successfully transformed into Brassica napus L. Successfully-transformed
positive plants were
acquired through a plant tissue cultivation process.
In order to further determine a gene editing situation of a positive plant,
for a genome of a
successfully-transformed positive plant, BnHBBD-A07 and BnHBBD-006 were
subjected to PCR
amplification with a high-fidelity enzyme, electrophoresis, gel recovery, and
ligation with a
pMD19-T vector, the resulting plasmid was transformed into E. coli,
transformed E. coli was
picked for identification, and a monoclone bacterial solution was sent to
Sangon Biotech (Shanghai)
Co., Ltd. for sequencing. Specific experimental operations and methods were
the same as in
Example 1.
Sequencing results were shown in FIG. 4. The sequencing results were analyzed
and
compared with actual sequencing results of WT BnHBBD-A07 and BnHBBD-006
obtained in
Example 1, and it could be found that there was a T base insertion at Targetl
in many monoclones.
Thus, the T base insertion was further analyzed, and analysis results were
shown in FIG. 5.
FIG. 5 is a schematic diagram illustrating analysis results of frameshift
mutations caused by
T insertion at Targetl in an hbbd mutant, where (a) shows a change of a gene
BnHBBD-A07 in the
mutant compared with WT and (b) shows a change of a gene BnHBBD-006 in the
mutant
compared with WT. It can be seen from the figure that the BnHBBD-A07 and
BnHBBD-006 genes
of the hbbd mutant both are subjected to frameshift mutations, such that a
translation process of
an HBBD gene is terminated early, and thus an HBBD protein cannot be
synthesized normally,
which can confirm that the gene-editing vector successfully conducts its
function at targets to
successfully knock out the BnHBBD-A07 and BnHBBD-006 genes in Brassica napus
L.
Example 5 Analysis of a non-floral organ abscission phenotype of transgenic
Brassica
napus L.
The qualified hbbd mutant in Example 4 was placed in an incubator with a 16 h
light/8 h dark
cycle and a relative humidity of 70% and cultivated to a flowering stage; and
the WT (Brassica
napus L. Y127, which was from Professor Hong Dengfeng of Huazhong Agricultural
University)
CA 03211382 2023- 9- 7
and the mutant were observed, and petal abscission conditions were recorded.
In this experiment,
3 biological replicates were set; and an attachment situation of floral organs
referred to a natural
abscission situation of the floral organs without being affected by external
forces, and a specific
attachment time referred to a time from blossoming of flower buds to complete
abscission. Results
were shown in Table 5.
Table 5 Statistical data of attachment of floral organs
Number of
Attachment of floral
Plant name investigated floral
organs (d)
organs
WT 10 5 0.5
hbbd-1 12 00
hbbd-2 10 oo
hbbd-3 11 oo
FIG. 6 is a comparison diagram illustrating flowering stages of WT (a) and a
non-floral organ
abscission phenotype of an hbbd mutant (b). It can be clearly seen that floral
organs of the mutant
are attached to an AZ. It can be seen from the statistical data in Table 5
that floral organs of the
hbbd mutant can continuously exist at a flower bud stage, a first-blooming
stage, a fully-blooming
stage, a pollination stage, and a mature stage when not undergoing an action
of an external force.
FIG. 7 is a comparison diagram illustrating silique mature stages of non-
floral organ abscission
phenotypes (hbbd) of three different hbbd mutant strains and WT. It can be
seen from the figure
that a color of floral organs gradually changes from yellow to white, and even
at a silique growth
stage and a silique mature stage, floral organs continue to exist in the non-
floral organ abscission
phenotype. FIG. 8 is a comparison diagram illustrating inflorescence stages of
an hbbd mutant and
WT, where numbers in this figure represent position numbers of Brassica napus
L. inflorescences;
and a first flower blossomed from a flower bud is numbered 1, a second flower
is numbered 2, and
so on. It can be seen from the figure that, when flowers are numbered
according to inflorescence
positions, a non-floral organ abscission phenotype can be clearly identified.
When ascospores of S. sclerotiorum in nature fall on petals and then fall to
leaves or stems
with the abscission of WT floral organs, hyphae of S. sclerotiorum begin to
grow to produce an
infection environment, and in severe cases, sclerotia will be produced in a
stem of Brassica napus
L., such that the stem becomes hollow due to infection of S. sclerotiorum,
which leads to death of
the entire plant, causing a great economic loss. FIG. 9 is a schematic
comparison diagram
illustrating pathogenesis pathways of an hbbd mutant and WT infected with S.
sclerotiorum under
natural conditions. It can be seen from the figure that floral organs of the
hbbd mutant do not fall
off, and thus ascospores falling on the floral organs do not grow.
In this example, the resistance of the non-floral organ abscission phenotype
of the hbbd
CA 03211382 2023- 9- 7
16
mutant to S. sclerotiorum was also tested in an incubator environment, and a
specific test method
was as follows: sclerotia of S. sclerotiorum isolated from a test field were
inoculated in a PDA
solid petri dish and invertedly cultivated at 28 C for 6 d until hyphae grew
to an edge of the petri
dish, 0.3 cm * 0.3 cm mycelium at the edge were collected and inoculated to
petals of 3 WT plants
and 3 mutant plants with 6 petals per plant, and then the inoculated plants
were cultivated in an
artificial climate chest (purchased from Shanghai Yiheng Instrument Co.,
Ltd.). In order to
simulate natural conditions, conditions for the cultivation were as follows:
temperature: 22 C,
humidity: 90%, 12 h weak light/12 h dark cycle, and the growth of hyphae was
observed every 12
h. Statistical data of incidence after petals were inoculated with S.
sclerotiorum were shown in
Table 6.
Table 6 Statistical data of incidence after petals were inoculated with S.
sclerotiorum
Plant name Number of inoculated petals Number of diseased petals after
inoculation
WT-1 6 6
WT-2 6 5
WT-3 6 5
hbbd-1 6 1
hbbd-2 6 0
hbbd-3 6 0
Table 6 showed the statistical data of incidence after petals were inoculated
with S.
sclerotiorum, and it could be seen that, after the hbbd mutant and the WT were
infected with S.
sclerotiorum, inoculated petals of the WT were basically diseased, while
inoculated petals of the
hbbd mutant were basically not diseased.
FIG. 10 is a schematic comparison diagram illustrating incidence of an hbbd
mutant and WT
infected with S. sclerotiorum in an incubator environment, where short arrows
in (a) and (c)
represent inoculation positions of S. sclerotiorum; a long arrow in (b)
represents abscission of
petals of the WT to leaves; a long arrow + cross in (d) represents non-
abscission of petals of the
mutant to leaves; and 0 dpi and 4 dpi represent day 0 and day 4 after
inoculation of S. sclerotiorum,
respectively. It can be seen from the figure that petals of the WT fall off,
S. sclerotiorum that has
begun to grow on the petals is very likely to fall off with the petals and is
attached to leaves, and
the continuous infection of S. sclerotiorum causes the rot of the leaves,
resulting in a heavy disease;
and floral organs of the hbbd mutant do not fall off, and are at a top layer
of a plant with low
humidity and excellent ventilation, such that S. sclerotiorum is not easy to
grow, the disease is not
developed, and the plant grows normally and will not be infected by S.
sclerotiorum to die.
FIG. 11 is a statistical chart illustrating a number of diseased petals after
inoculation with S.
sclerotiorum, where according to t-test, P < 0.001; and it can be seen that a
number of diseased
CA 03211382 2023- 9- 7
17
petals of the hbbd mutant is significantly lower than a number of diseased
petals of the WT.
In this example, silique cracking forces of the hbbd mutant and WT were also
tested, and
specific test steps were as follows: 40 days after flowering of the WT and
hbbd mutant, a total of
mature siliques were collected, placed in an environment with a temperature of
25 C and a
humidity of 50% for one week, and then glued by a glue to a thin plate, where
a plane in which a
false dissepiment of a Brassica napus L. silique was parallel to a plane of
the thin plate, a tail of a
silique was aligned with an edge of the thin plate, and a handle of a silique
was outside the thin
plate. With a TA.XT Plus texture analyzer (Stable Micro System, UK), an L-hook
was fixed on a
probe, and then used to hook and fix a base of a silique in a direction
perpendicular to the thin
plate at a junction between a silique and a handle of a silique on the thin
plate. During a
measurement, the thin plate was pressed by hands, the probe was allowed to
move upwards at a
uniform speed of 1 mrn/min and then move upwards at a uniform speed of 0.5
mm/min when
touching a handle of a silique, the silique was pulled off, and pull crack
force data of the WT and
mutant were recorded.
Before cracking of a silique, a force received by the silique continues to
increase; and after
cracking of the silique, a force received by the silique suddenly decreases. A
peak of the force
received by the silique is a maximum pull crack force of the silique; and the
larger the peak, the
greater the crack resistance of the silique. FIG. 12 is a measurement chart of
silique cracking forces
of the mutant (hbbd) and WT, and it can be seen from the figure that a maximum
pull crack force
of a silique of the WT is about 0.3 N to 0.5 N and a maximum pull crack force
of a silique of the
mutant is about 0.6 N to 0.8 N, where according to t-test, P < 0.05; and a
pull crack force of the
mutant is significantly larger than a pull crack force of the WT, that is, the
cracking resistance of
the silique of the mutant is enhanced.
The above experimental results can indicate that an HBBD protein in Brassica
napus L. is
also one of the important proteins to regulate the abscission of floral
organs, which provides a
resource for allowing flowering stage extension, S. sclerotiorum resistance,
and mechanized
harvest.
The basic principles, main features, and advantages of the present disclosure
are shown and
described above. It should be understood by those skilled in the art that the
present disclosure is
not limited by the above examples, and the above examples and the description
only illustrate the
principle of the present disclosure. Various changes and modifications may be
made to the present
disclosure without departing from the spirit and scope of the present
disclosure, and such changes
and modifications all fall within the claimed scope of the present disclosure.
The claimed
protection scope of the present disclosure is defined by the appended claims
and equivalents
thereof.
CA 03211382 2023- 9- 7
18
