Note: Descriptions are shown in the official language in which they were submitted.
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
METHODS FOR USING GUIDE RNAS WITH CHEMICAL MODIFICATIONS
Cross-Reference to Related Application
[001] The present application claims the benefit of priority to U.S.
Provisional Application
Nos. 63/243,985, filed Sept. 14, 2021, and 63/339,737, filed May 9, 2022, the
entire contents of
each of which is incorporated herein by reference in its entirety.
Technical Field
[002] The present disclosure relates to the field of molecular biology. In
particular, the
present disclosure relates to the clusters of regularly interspaced short
palindromic repeats
(CRISPR) technology.
Background
[003] The native prokaryotic CRISPR-Cas system comprises an array of short
repeats with
intervening variable sequences of constant length (i.e., clusters of regularly
interspaced short
palindromic repeats, or "CRISPR"), and CRISPR-associated ("Cas") proteins. The
RNA of the
transcribed CRISPR array is processed by a subset of the Cas proteins into
small guide RNAs,
which generally have two components as discussed below. There are at least six
different systems:
Type I, Type II, Type III, Type IV, Type V, and Type VI. The enzymes involved
in the processing
of the RNA into mature crRNA are different in these six systems. In native
prokaryotic Type II
systems, the guide RNA ("gRNA") comprises two short, non-coding RNA segments
referred to as
CRISPR RNA ("crRNA") and trans-acting RNA ("tracrRNA"). In native Type V
systems, the
guide RNA comprises a crRNA that is sufficient to form an active complex with
a Cas12 (e.g.,
Cas12a is also known as Cpfl) protein without a tracrRNA segment. The gRNA
forms a complex
with a Cas protein (a ribonucleoprotein "RNP" complex). The gRNA:Cas protein
complex binds
a target polynucleotide sequence having a protospacer adjacent motif ("PAM")
and a protospacer,
which comprises a sequence complementary to a portion of the gRNA. The
recognition and
binding of the target polynucleotide by the gRNA:Cas protein complex induces
cleavage of the
target polynucleotide. The native CRISPR-Cas system functions as an immune
system in
prokaryotes, where gRNA:Cas protein complexes recognize and silence exogenous
genetic
1
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
elements in a manner analogous to RNAi in eukaryotic organisms, thereby
conferring resistance
to exogenous genetic elements such as plasmids and phages.
[004] Many enhancements and refinements of CRISPR technology have been and
continue
to be developed. Early approaches include using the CRISPR-Cas system to
cleave both strands
of a target DNA, and editing takes place by homologous recombination or non-
homologous end
joining due to the double-stranded break. Newer technologies include
modulation of gene
expression and other gene-editing methods. For instance, prime editing is a
CRISPR-based
technology for the editing of targeted sequences in DNA, and it allows for
various forms of base
substitutions, such as transversion and transition mutations. It also allows
for precise insertions
and deletions, including large deletions of up to about 700 bp long. Notably
prime editing does not
require an exogenous DNA repair template. Instead, a polymerization template
containing the
desired edits is included in the guide RNA, which complexes with a Cas protein
that is fused with
a polymerase (such as a reverse transcriptase). Upon binding a target site,
the Cas protein nicks
the target site, and the polymerase can synthesize a new strand of DNA using
the polymerization
template. Base editing is another gene-editing technique where a base editor
enzyme, such as a
cytidine deaminase, is delivered with a Cas protein and a guide RNA. The base
editor enzyme is
directed to the target site by the gRNA:Cas protein complex, and catalyzes
deamination and hence
mutation of cytidine residues at the target site. Modulation of gene
expression may be achieved,
for example, by fusing a transcriptional activator or inhibitor to a Cas
protein that has no cleavage
activity but can complex with a gRNA to bind to a target site. As a result,
the transcriptional
activator or inhibitor can regulate gene expression at the target site. The
technique is thus called
CRISPRa and CRISPRi, respectively, wherein "a" stands for activation and "i"
stands for
inhibition.
[005] Despite these advances, there exists a need in the art for further
improvements to
CRISPR technology and, in particular, for improvements to the efficiency and
stability of
CRISPR-based systems, e.g., to bolster the adoption of CRISPR-based gene
editing or modulation.
Description of the Figures
[006] FIG. 1 is a graph showing the results of a titration study in which
an increasing amount
of gRNA was mixed with a fixed amount of Cas9 protein for transfection into
0.2 million HepG2
cells where the HBB gene was targeted for creation of indels at the target
site. These results
2
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
illustrate the concept of a saturating amount of a transfected component for
editing, where the
increasing amount reaches a plateau of editing activity and further increases
in the amount do not
increase the editing yield in a constant number of cells.
[007] FIG. 2 is a graph showing on- and off-target editing of HBB in HepG2
cells transfected
with sub-saturating amounts of Cas mRNA and gRNA (0.0625 pmol of Cas9 mRNA and
10 pmol
gRNA for 0.2 million cells) after washing the cells with PBS buffer to remove
residual serum.
[008] FIG. 3 is a graph showing on- and off-target editing of HBB in HepG2
cells transfected
with sub-saturating amounts of Cas mRNA and gRNA (0.0625 pmol of Cas9 mRNA and
10 pmol
gRNA for 0.2 million cells) after washing the cells with PBS buffer to remove
residual serum.
[009] FIG. 4 is a graph showing on- and off-target editing of HBB in HepG2
cells transfected
with sub-saturating amounts of Cas mRNA and gRNA (0.5 pmol of Cas9 mRNA and 30
pmol
gRNA for 0.2 million cells) when the cells were not washed with buffer to
remove residual serum
prior to transfection.
[0010] FIG. 5 is a graph showing on- and off-target editing of HBB in HepG2
cells transfected
with sub-saturating amounts of Cas protein and gRNA (12.5 pmol of Cas9 protein
and 30 pmol of
sgRNA for 0.2 million cells) when the cells were not washed with buffer to
remove serum prior to
transfection.
[0011] FIG. 6 illustrates two exemplary gRNAs that incorporate 3xMS at the
5' and 3' end
(top), or 3xMS at the 5' end and 3xMP at the 3' end (bottom).
[0012] FIG. 7 is a graph showing the results of an experiment that
evaluated the relative level
of chemically-modified gRNA in K562 cells over time. Cells were transfected
with gRNA in the
absence of Cas protein, after washing the cells with PBS buffer to remove
residual serum.
[0013] FIG. 8 is a graph showing on- and off-target editing of HBB in
primary human T cells
transfected with sub-saturating amounts of Cas9 mRNA and gRNA (0.0625 pmol of
Cas9 mRNA
and 5 pmol of sgRNA for 0.2 million cells) after washing the cells with PBS
buffer to remove
residual serum.
[0014] FIG. 9 is a graph showing the results of cytidine base editing of
HBB in K562 cells
using chemically-modified gRNA having MS or MP at the 3' end relative to a
control using
3
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
unmodified gRNA. Cells were co-transfected with gRNA and an mRNA encoding a
Cas9 nickase
fused to a cytidine deaminase.
[0015] FIG. 10 is an illustration depicting prime editing using an
exemplary CRISPR-Cas
system.
[0016] FIG. 11 is a graph showing the effectiveness of prime editing of
EV/X/ in K562 cells
using an initial set of chemically-modified pegRNAs. Cells were co-transfected
with pegRNA and
mRNA encoding a Cas9 nickase fused to a reverse transcriptase.
[0017] FIG. 12 is a graph showing the effectiveness of prime editing of
EV/X/ in Jurkat cells
using an initial set of chemically-modified pegRNAs. Cells were co-transfected
with pegRNA and
mRNA encoding a Cas9 nickase fused to a reverse transcriptase.
[0018] FIG. 13 is a graph showing the effectiveness of prime editing of
EV/X/ in K562 cells
using a second set of chemically-modified pegRNAs. Cells were co-transfected
with pegRNA and
mRNA encoding a Cas9 nickase fused to a reverse transcriptase.
[0019] FIG. 14 is a graph showing the effectiveness of prime editing of
EV/X/ in Jurkat cells
using a second set of chemically-modified pegRNAs. Cells were co-transfected
with pegRNA and
mRNA encoding a Cas9 nickase fused to a reverse transcriptase.
[0020] FIG. 15 is a graph showing the effectiveness of prime editing of
RUNX1 in K562 cells
using an initial set of chemically-modified pegRNAs. Cells were co-transfected
with pegRNA and
mRNA encoding a Cas9 nickase fused to a reverse transcriptase.
[0021] FIG. 16 is a graph showing the effectiveness of prime editing of
RUNX1 in Jurkat cells
using an initial set of chemically-modified pegRNAs. Cells were co-transfected
with pegRNA and
mRNA encoding a Cas9 nickase fused to a reverse transcriptase.
[0022] FIG. 17 illustrates the chemical structure of 2'-0-methyl-3'-
phosphorothioate (MS) and
2'-0-methyl-3'-phosphonoacetate (1V113), two examples of chemically-modified
nucleotides that
may be incorporated into the pegRNAs disclosed herein.
[0023] FIG. 18 illustrates prime editing of EV/X/ and RUNX1 using exemplary
target
sequences.
4
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0024] FIG. 19 is a graph showing the results of an experiment that
assessed prime editing of
EV/X/ in K562 cells. In this case, the prime editing was used to knockout the
PAM in E/11X/. Cells
were co-transfected with pegRNA and mRNA encoding a Cas9 nickase fused to a
reverse
transcriptase.
[0025] FIG. 20 is a graph showing the results of an experiment that
assessed prime editing of
E/11X/ in Jurkat cells. In this case, the prime editing was used to knockout
the PAM in E/11X/.
Cells were co-transfected with pegRNA and mRNA encoding a Cas9 nickase fused
to a reverse
transcriptase.
[0026] FIG. 21 is a graph showing the results of an experiment that
assessed prime editing of
RUNX1 in K562 cells. In this case, the prime editing was used to introduce a
three-base insertion
in RUNX1. Cells were co-transfected with pegRNA and mRNA encoding a Cas9
nickase fused to
a reverse transcriptase.
[0027] FIG. 22 is a graph showing the results of an experiment that
assessed prime editing of
RUNX1 in Jurkat cells. In this case, the prime editing was used to introduce a
three-base insertion
in RUNX1. Cells were co-transfected with pegRNA and mRNA encoding a Cas9
nickase fused to
a reverse transcriptase.
[0028] FIG. 23 is a graph showing the results of an experiment that
assessed editing of the
HBB sickle cell allele (and a known intergenic off-target locus) in unrinsed
HepG2 cells co-
transfected with sgRNA and mRNA encoding a Cas9 protein.
[0029] FIG. 24 is a graph showing the results of an experiment that
assessed editing of the
HBB sickle cell allele (and a known intergenic off-target locus) in unrinsed
HepG2 cells
transfected with ribonucleoprotein (RNP) complexes formed from chemically-
modified sgRNA
pre-complexed with Cas9 protein.
[0030] FIG. 25 is a graph showing the results of an experiment that
assessed editing of the
HBB sickle cell allele (and a known intergenic off-target locus) in unrinsed
HepG2 cells
transfected with ribonucleoprotein (RNP) complexes formed by chemically-
modified 163mer
sgRNAs pre-complexed with Cas9 protein. The 163mer sgRNAs were designed for
CRISPRa
SAM systems but were used with SpCas9 protein to produce indels instead of
using them for gene
activation by CRISPRa.
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Detailed Description
[0031] Provided herein are methods for CRISPR/Cas-based genome editing
and/or modulation
of gene expression in a cell (e.g., a primary cell for use in ex vivo therapy)
or an in vivo cell (e.g.,
a cell in an organ or tissue of a subject such as a human). In particular, the
methods provided herein
utilize chemically-modified guide RNAs (gRNAs) having enhanced activity or
yield in gene
editing or regulation compared to corresponding unmodified gRNAs. In some
aspects, the present
disclosure provides methods for editing a sequence of a target nucleic acid,
or modulating
expression of the target nucleic acid, in a cell by introducing a chemically-
modified gRNA that
hybridizes to the target nucleic acid together with either a Cas protein, an
mRNA encoding a Cas
protein , or a recombinant expression vector comprising a nucleotide sequence
encoding a Cas
protein. In some aspects, the Cas protein may be a variant that lacks nuclease
activity (e.g., dCas9),
or which possesses a nickase activity. In some aspects, the Cas protein is a
fusion protein
comprising a Cas polypeptide and a reverse transcriptase polypeptide. In some
aspects, the present
disclosure provides methods for preventing or treating a genetic disease in a
subject by
administering a sufficient amount of the chemically modified gRNA to correct a
genetic mutation
associated with the disease (e.g., by editing the genomic DNA of a patient or
by modulating
expression of a gene associated with the disease).
[0032] Aspects of the present disclosure employ conventional techniques of
immunology,
biochemistry, chemistry, molecular biology, microbiology, cell biology,
f1,01101TliCS and
recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch
and
_Martians, Molecular Cloning: A Laboratory Manual, 2nd edition (1989), Current
Protocols in
Molecular Biology (F. M Ausubel, et al. eds., (1987)), the series Methods in
Enzymology
(Academic Press, Inc.): PCR 2: A Practical Approach (M. J. MacPherson, B. a
Hames and G. R.
Taylor eds. (1995)), Harlow mid Lane, eds. (1988) Antibodies, A Laboratoiy
Manual, and Animal
Cell Culture (R. L Freshney, ed. (1987)).
[0033] Oligonucleotides that are not commercially available can be
chemically synthesized,
e.g., according to the solid phase phosphoratnidite tri ester method first
described by Beaucage and
Caruthers, Tetrahedron Lett. 22:18594862 (1980, using an automated
synthesizer, as described
in Van Devan ter et. al., Nucleic Acids Res. 12:6159-6168 (1984). Purification
of oh i gon-ucl eotides
is performed using any art-recognized strategy, e.g., native acrylarnide gel
electrophoresis or
6
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
anion-exchange high performance liquid chromatography (11131_,C) as described
in Pearson and
Reanier,J. Chrom. 255: 137-149 (1983).
Definitions and Abbreviations
[0034] Unless specifically indicated otherwise, all technical and
scientific terms used herein
have the same meaning as commonly understood by those of ordinary skill in the
art. In addition,
any method or material similar or equivalent to a method or material described
herein can be used
in the practice of the methods and preparation of the compositions described
herein. For purposes
of the present disclosure, the following terms are defined.
[0035] The terms "a," "an," or "the" as used herein not only include
aspects with one member,
but also include aspects with more than one member. For instance, the singular
forms "a," "an,"
and "the" include plural referents unless the context clearly dictates
otherwise. Thus, for example,
reference to "a cell" includes a plurality of such cells and reference to "the
agent" includes
reference to one or more agents known to those skilled in the art, and so
forth.
[001] The term "CRISPR-associated protein" or "Cas protein" or "Cas
polypeptide" refers to
a wild type Cas protein, a fragment thereof, or a mutant or variant thereof.
The term "Cas mutant"
or "Cas variant" refers to a protein or polypeptide derivative of a wild type
Cas protein, e.g., a
protein having one or more point mutations, insertions, deletions,
truncations, a fusion protein, or
a combination thereof In certain embodiments, the "Cas mutant" or "Cas
variant" substantially
retains the nuclease activity of the Cas protein. In certain embodiments, the
"Cas mutant" or "Cas
variant" is mutated such that one or both nuclease domains are inactive (this
protein may be
referred to as a Cas nickase or dead Cas protein, respectively). In certain
embodiments, the "Cas
mutant" or "Cas variant" has nuclease activity. In certain embodiments, the
"Cas mutant" or "Cas
variant" lacks some or all of the nuclease activity of its wild-type
counterpart. The term "CRISPR-
associated protein" or "Cas protein" also includes a wild type Cpfl protein,
also referred to as
Cas12a, of various species of prokaryotes (and named for Clustered Regularly
Interspaced Short
Palindromic Repeats from Prevotella and Francisella 1 ribonucleoproteins or
CRISPR/Cpfl
ribonucleoproteins), a fragment thereof, or a mutant or variant thereof. Cas
protein includes any
of the CRISPR-associated proteins, including but not limited to any one in the
six different
CRISPR systems: Type I, Type II, Type III, Type IV, Type V, and Type VI.
7
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[002] The term "nuclease domain" of a Cas protein refers to the polypeptide
sequence or
domain within the protein which possesses the catalytic activity for DNA
cleavage. Cas9 typically
catalyzes a double-stranded break upstream of the PAM sequence. A nuclease
domain can be
contained in a single polypeptide chain, or cleavage activity can result from
the association of two
(or more) polypeptides. A single nuclease domain may consist of more than one
isolated stretch
of amino acids within a given polypeptide. Examples of these domains include
RuvC-like motifs
(amino acids 7-22, 759-766 and 982-989 in SEQ ID NO: 1) and HNH motifs (amino
acids 837-
863); see Gasiunas et al. (2012) Proc. Natl. Acad. Sci. USA 109:39, E2579-
E2586 and
WO/2013176772.
[003] A synthetic guide RNA ("gRNA") that has "gRNA functionality" is one
that has one
or more of the functions of naturally occurring guide RNA, such as associating
with a Cas protein
to form a ribonucleoprotein (RNP) complex, or a function performed by the
guide RNA in
association with a Cas protein (i.e., a function of the RNP complex). In
certain embodiments, the
functionality includes binding a target polynucleotide. In certain
embodiments, the functionality
includes targeting a Cas protein or a gRNA:Cas protein complex to a target
polynucleotide. In
certain embodiments, the functionality includes nicking a target
polynucleotide. In certain
embodiments, the functionality includes cleaving a target polynucleotide. In
certain embodiments,
the functionality includes associating with or binding to a Cas protein. For
example, the Cas protein
may be engineered to be a "dead" Cas protein (dCas) fused to one or more
proteins or portions
thereof, such as a transcription factor enhancer or repressor, a deaminase
protein, a reverse
transcriptase, a polymerase, etc., such that the fused protein(s) or
portion(s) thereof can exert its
functions at the target site. In certain embodiments, the functionality
comprises base editing
functionality. In other embodiments, the functionality includes prime editing
functionality. In
certain embodiments, the functionality includes activation, repression or
interference of gene
expression. In other embodiments, the functionality includes epigenetic
modifications. In certain
embodiments, the functionality is any other known function of a guide RNA in a
CRISPR-Cas
system with a Cas protein, including an artificial CRISPR-Cas system with an
engineered Cas
protein. In certain embodiments, the functionality is any other function of
natural guide RNA. The
synthetic guide RNA may have gRNA functionality to a greater or lesser extent
than a naturally
occurring guide RNA. In certain embodiments, a synthetic guide RNA may have
greater activities
8
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
as to one function and lesser activities as to another function in comparison
to a similar naturally
occurring guide RNA.
[004] A Cas protein having a single-strand "nicking" activity refers to a
Cas protein,
including a Cas mutant or Cas variant, that has reduced ability to cleave one
of two strands of a
dsDNA as compared to a wild type Cas protein. For example, in certain
embodiments, a Cas
protein having a single-strand nicking activity has a mutation (e.g., amino
acid substitution) that
reduces the function of the RuvC domain (or the HNH domain) and as a result
reduces the ability
to cleave one strand of the target DNA. Examples of such variants include the
DlOA,
H839A/H840A, and/or N863A substitutions in S. pyogenes Cas9, and also include
the same or
similar substitutions at equivalent sites in Cas9 enzymes of other species.
[005] A Cas protein having "binding" activity or that "binds" a target
polynucleotide refers
to a Cas protein which forms a complex with a guide RNA and, when in such a
complex, the guide
RNA hybridizes with another polynucleotide, such as a target polynucleotide
sequence, via
hydrogen bonding between the bases of the guide RNA and the other
polynucleotide to form base
pairs. The hydrogen bonding may occur by Watson-Crick base pairing or in any
other sequence
specific manner. The hybrid may comprise two strands forming a duplex, three
or more strands
forming a multi-stranded triplex, or any combination of these.
[006] A "CRISPR system" is a system that utilizes at least one Cas protein
and at least one
gRNA to provide a function or effect, including but not limited to gene
editing, DNA cleavage,
DNA nicking, DNA binding, regulation of gene expression, CRISPR activation
(CRISPRa),
CRISPR interference (CRISPRi), and any other function that can be achieved by
linking a Cas
protein to another effector, thereby achieving the effector function on a
target sequence recognized
by the Cas protein. For example, a nuclease-free Cas protein can be fused to a
transcription factor,
a deaminase, a methylase, a reverse transcriptase, etc. The resulting fusion
protein, in the presence
of a guide RNA for the target, can be used to edit, regulate the transcription
of, deaminate, or
methylate, the target. As another example, in prime editing, a Cas protein is
used with a reverse
transcriptase or other polymerases (optionally as a fusion protein) to edit
target nucleic acids in
the presence of a pegRNA.
[007] A "fusion protein" is a protein comprising at least two peptide
sequences (i.e., amino
acid sequences) covalently linked to each other, where the two peptide
sequences are not
9
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
covalently linked in nature. The two peptide sequences can be linked directly
(with a bond in
between) or indirectly (with a linker in between, wherein the linker may
comprise any chemical
structure, including but not limited to a third peptide sequence).
[008] A "prime editor" is a molecule, or a collection of multiple
molecules, that has both Cas
protein and reverse transcriptase activities. In some embodiments, the Cas
protein is a nickase. In
some embodiments, the prime editor is a fusion protein comprising both a Cas
protein and a reverse
transcriptase. As indicated elsewhere in this disclosure, other polymerases
can be used in prime
editing in lieu of a reverse transcriptase, so a prime editor may comprise a
polymerase that is not
a reverse transcriptase, in lieu of the RT. Different versions of prime editor
have been developed
and are referred to as PE1, PE2, PE3, etc. For example "PE2" refers to a PE
complex comprising
a fusion protein (PE2 protein) comprising a Cas9(H840A) nickase and a variant
of MMLV RT
having the following structure:
[NL S]-[Cas9(H840A)Hlinker]-[MMLV RT(D200N)(T330P)(L603W)(T306K)(W313F)], and
a
desired pegRNA. "PE3" refers to PE2 plus a second-strand nicking guide RNA
that complexes
with the PE2 protein and introduces a nick in the non-edited DNA strand in
order to stimulate the
cell into repairing the target region, which facilitates incorporation of the
edits into the genome
(see Anzalone et al. 2019; see Liu W02020191153). Prime editors use
specialized gRNAs,
referred to as prime editing gRNAs or "pegRNAs", as described in detail
elsewhere in this
disclosure.
[009] A "base editor" or "BE" is a molecule, or a collection of multiple
molecules, that has
both Cas protein (or mutated protein) and deaminase or transglycosylation
activities. Base editors
(BEs) are typically fusions of a Cas domain and a nucleotide modification
domain (e.g., a natural
or evolved deaminase, such as a cytidine deaminase, e.g., APOBEC1
("apolipoprotein B mRNA
editing enzyme, catalytic polypeptide 1"), CDA ("cytidine deaminase"), and AID
("activation-
induced cytidine deaminase") or adenosine deaminase, e.g., TadA (Bacterial
tRNA-specific
adenosine deaminase)).Two classes of deaminase base editors have been
generally described to
date: cytosine base editors ("CBE") that convert target C:G base pairs to T:A
base pairs, and
adenosine base editors ("ABE") which convert A:T base pairs to G:C base pairs.
Collectively,
these two classes of base editors enable the targeted installation of all
possible transition mutations
(C-to-T, G-to-A, A-to-G, T-to-C, C- to-U, and A-to-U), see Gaudelli, N.M. et
al, Programmable
base editing of A:T to G:C in genomic DNA without DNA cleavage. Nature 551,
464-471 (2017),
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
which is incorporated herein by reference. Another nucleotide modification
domain used in base
editing is a transglycosylase domain such as a wild-type tRNA guanine
transglycosylase (TGT),
or a variant thereof, e.g., a TGT that substitutes a first nucleobase (i.e., a
thymine) for a second
nucleobase at a ribose- nucleobase glycosidic bond. The transglycosylase
editor provides for
thymine-to-guanine or "TGBE" (or adenine-to-cytosine or "ACBE") transversion
base editors. In
some cases, base editors may also include proteins or domains that alter
cellular DNA repair
processes to increase the efficiency and/or stability of the resulting single-
nucleotide change. In
some embodiments the base editors comprise one or more NLSs (Nuclear
Localization Sequence),
and may further include one or more Uracil-DNA glycosylase inhibitor (UGI)
domains, which are
capable of inhibiting Uracil-DNA glycosylase, thereby improving base editing
efficiency of C to
T base editor proteins. In some embodiments, the Cas domain is a nickase (e.g.
nCas9). In some
embodiments, the Cas protein is a fully nuclease-inactivated protein or a dead
Cas9 "dCas9". In
some embodiments, the base editor is a fusion protein comprising both a Cas
protein (or portion
thereof) and a deaminase (or portion thereof). In some embodiments, the base
editor is a fusion
protein comprising both a Cas protein (or portion thereof) and a
transglycosylase (or portion
thereof). Different versions of base editors that represent improvements over
prior systems have
been developed such as base editors with different or expanded PAM
compatibilities (see: Kim,
Y.B. et al. Increasing the genome-targeting scope and precision of base
editing with engineered
Cas9-cytidine deaminase fusions. Nature biotechnology 35, 371-376 (2017); Hu,
J.H. et al.
Evolved Cas9 variants with broad PAM compatibility and high DNA specificity.
Nature 556, 57-
63 (2018); Li, X. et al. Base editing with a Cpfl-cytidine deaminase fusion.
Nature biotechnology
36, 324-327 (2018)), High fidelity base editors with reduced off-target
activity (see: Hu, J.H. et al.
Evolved Cas9 variants with broad PAM compatibility and high DNA specificity.
Nature 556, 57-
63 (2018); Rees, H.A. et al. Improving the DNA specificity and applicability
of base editing
through protein engineering and protein delivery. Nat Commun 8, 15790 (2017);
Kleinstiver, B.P.,
Pattanayak, V., Prew, M.S. & Nature, T.-S.Q. High-fidelity CRISPR-Cas9
nucleases with no
detectable genome-wide off-target effects. Nature (2016); Chen, J. S. et al.
Enhanced proofreading
governs CRISPR-Cas9 targeting accuracy. Nature 550, 407-410 (2017); Slaymaker,
I.M. et al.
Rationally engineered Cas9 nucleases with improved specificity. Science 351,
84-88 (2016)), base
editors with narrower editing windows (normally ¨5 nucleotides wide) (see:
Kim, Y.B. et al.
Increasing the genome-targeting scope and precision of base editing with
engineered Cas9-cytidine
11
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
deaminase fusions. Nature biotechnology 35, 371-376 (2017).), and a cytidine
base editor (BE4)
with reduced by-products (see: Komor, A.C. et al. Improved base excision
repair inhibition and
bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher
efficiency and product
purity. Sci Adv 3, eaao4774 (2017)). The different versions of base editors
are referred to as BE1,
BE2, BE3, BE4 etc. Unlike prime editors, base editors function in concert with
"conventional"
gRNAs (e.g. Cas9 style or Cpfl style), that program the Cas effector portion
of the base editor to
target the nucleic acid at a desired sequence location.
[0010] A "guide RNA" (or "gRNA") generally refers to an RNA molecule (or a
group of RNA
molecules collectively) that can bind to a Cas protein and aid in targeting
the Cas protein to a
specific location within a target polynucleotide (e.g. a DNA). Thus, a guide
RNA comprises a
guide sequence that can hybridize to a target sequence, and another part of
the guide RNA (the
"scaffold") functions to bind a Cas protein to form a ribonucleoprotein (RNP)
complex of the guide
RNA and the Cas protein. There are various styles of guide RNAs, including but
not limited to the
Cas9 style and the Cpfl style of guide RNAs. A "Cas9 style" of guide RNA
comprises a crRNA
segment and a tracrRNA segment. As used herein, the term "crRNA" or "crRNA
segment" refers
to an RNA molecule or portion thereof that includes a polynucleotide-targeting
guide sequence; a
scaffold sequence which helps to interact with a Cas protein; and, optionally,
a 5'-overhang
sequence. As used herein, the term "tracrRNA" or "tracrRNA segment" refers to
an RNA molecule
or portion thereof that includes a protein-binding segment capable of
interacting with a CRISPR-
associated protein, such as a Cas9. In addition to Cas9, there are other Cas
proteins employing the
Cas9 style of guide RNAs, and the word "Cas9" is used in the term "Cas9 style"
merely to specify
a representative member of the various Cas proteins that employ this style. A
"Cpfl style" is a
one-molecule guide RNA comprising a scaffold that is 5' to a guide sequence.
In the literature,
the Cpfl guide RNA is often described as having only a crRNA but not a
tracrRNA. It should be
noted that, regardless of the terminology, all guide RNAs have a guide
sequence to bind to the
target, and a scaffold region that can interact with a Cas protein. Unlike
prime editing which uses
specialized gRNA (pegRNA), base editing uses conventional gRNAs (i.e. Cas9
style and Cpfl
style).
[0011] The term "guide RNA" encompasses a single-guide RNA ("sgRNA") that
contains all
functional parts in one molecule. For example, in a sgRNA of the Cas9 style,
the crRNA segment
and the tracrRNA segment are located in the same RNA molecule. As another
example, the Cpfl
12
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
guide RNA is naturally a single-guide RNA molecule. The term "guide RNA" also
encompasses,
collectively, a group of two or more RNA molecules; for example, the crRNA
segment and the
tracrRNA segment may be located in separate RNA molecules. Furthermore, the
term "gRNA" as
used herein encompasses guide RNAs that are used in prime editing (pegRNA),
base editing and
gene expression modulation and any other CRISPR technology that employs gRNAs.
[0012] Optionally, a "guide RNA" may comprise one or more additional
segments that serve
one or more accessory functions upon being recognized and bound by cognate
polypeptides or
enzymes that perform molecular functions alongside the function of the Cas
protein associated
with the gRNA. For example, a gRNA for prime editing (which is commonly
referred to as a
"pegRNA") may comprise a primer binding site and a reverse transcriptase
template. In another
example, the gRNA may comprise one or more polynucleotide segments that form
one or more
aptamers (e.g. MS2 aptamer) that recognize and bind aptamer-binding
polypeptides (optionally
fused to other polypeptides, (e.g. MS2-p65-HSF1) that serve accessory
functions such as
transcriptional activation alongside the Cas protein or Cas fusion protein
(e.g. dCas9-VP64), these
systems are known as a synergistic activation mediator "SAM" system; see S.
Konermann et al.,
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.
Nature. 517,
583-588 (2015)., see M. A. Horlbeck et al., Compact and highly active next-
generation libraries
for CRISPR-mediated gene repression and activation. eLife. 5, e19760 (2016)).
[0013] Optionally, a "guide RNA" may comprise an additional polynucleotide
segment (such
as a 3' (or 5')-terminal polyuridine tail, a hairpin, a stem loop, a toeloop
etc.) that can increase the
stability of the gRNA by impeding its degradation, as can occur for example by
nucleases such as
endonucleases and/or exonucleases.
[0014] The term "guide sequence" refers to a contiguous sequence of
nucleotides in a gRNA
(or pegRNA) which has partial or complete complementarity to a target sequence
in a target
polynucleotide and can hybridize to the target sequence by base pairing
facilitated by a Cas protein.
In some cases, a target sequence is adjacent to a PAM site (the PAM sequence).
In some cases, the
target sequence may be located immediately upstream of the PAM sequence. A
target sequence,
which hybridizes to the guide sequence, may be immediately downstream from the
complement
of the PAM sequence. In other examples such as Cpfl, the location of the
target sequence, which
hybridizes to the guide sequence, may be upstream from the complement of the
PAM sequence.
13
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0015] A guide sequence can be as short as about 14 nucleotides and as long
as about 30
nucleotides. Typical guide sequences are 15, 16, 17, 18, 19, 20, 21, 22, 23
and 24 nucleotides long.
The length of the guide sequence varies across the two classes and six types
of CRISPR-Cas
systems mentioned above. Synthetic guide sequences for Cas9 are usually 20
nucleotides long, but
can be longer or shorter. When a guide sequence is shorter than 20
nucleotides, it is typically a
deletion from the 5'-end compared to a 20-nucleotide guide sequence. By way of
example, a guide
sequence may consist of 20 nucleotides complementary to a target sequence. In
other words, the
guide sequence is identical to the 20 nucleotides upstream of the PAM
sequence, except the A/U
difference between DNA and RNA. If this guide sequence is truncated by 3
nucleotides from the
5'-end, nucleotide 4 of the 20-nucleotide guide sequence now becomes
nucleotide 1 in the 17-mer,
nucleotide 5 of the 20-nucleotide guide sequence now becomes nucleotide 2 in
the 17-mer, etc.
The new position is the original position minus 3 for a 17-mer guide sequence.
[0016] As used herein, the term "prime editing guide RNA" (or "pegRNA")
refers to a guide
RNA (gRNA) that comprises a reverse transcriptase template sequence encoding
one or more edits
to a target sequence of a nucleic acid, and a primer binding site that can
bind to a sequence in the
target region (also called a target site). For example, a pegRNA may comprise
a reverse
transcriptase template sequence comprising one or more nucleotide
substitutions, insertions or
deletions to a sequence in the target region. A pegRNA has the function of
complexing with a Cas
protein and hybridizing to a target sequence in a target region, usually in
the genome of a cell, to
result in editing of a sequence in the target region. In some embodiments,
without being limited
to a theory, the pegRNA forms an RNP complex with a Cas protein and binds the
target sequence
in the target region, the Cas protein makes a nick on one strand of the target
region to result in a
flap, the primer binding site of the pegRNA hybridizes with the flap, the
reverse transcriptase uses
the flap as a primer on the hybridized reverse transcriptase template of the
pegRNA which serves
as a template to synthesize a new DNA sequence onto the nicked end of the flap
which then
contains the desired edits, and ultimately, this new DNA sequence replaces an
original sequence
in the target region, resulting in editing of the target.
[0017] A "pegRNA" may comprise the reverse transcriptase template and
primer binding site
near its 5' end or 3' end. The "prime editing end" is one end of the pegRNA,
either 5' or 3', that
is closer to the reverse transcriptase template and primer binding site than
to the guide sequence.
The other end of the pegRNA is the "distal end", which is closer to the guide
sequence than to the
14
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
reverse transcriptase template or primer binding site. Thus, the order of
these components is, in
either 5' or 3' orientation:
prime editing end ¨ (primer binding site and reverse transcriptase template) ¨
(guide
sequence and scaffold) ¨ distal end
where the parentheses indicate that the two segments mentioned within could be
switched in order
with respect to each other, depending on the style of the pegRNA (e.g. Cas9
style or Cpfl style)
as well as the position of the prime editing end (i.e., a 5' end or a 3' end).
It should be noted that
if the pegRNA is not a single-guide RNA but comprises more than one RNA
molecule, the prime
editing end refers to the end closer to the primer binding site and reverse
transcriptase template in
the RNA molecule containing these components, whereas the opposite end of this
RNA molecule
is the distal end. The guide sequence may be in a different RNA molecule of
the pegRNA, distinct
from the RNA molecule bearing the prime editing end and the distal end.
[0018] A "nicking guide RNA" or "nicking gRNA" is a guide RNA (not a
pegRNA) that can
be optionally added in prime editing to cause nicking of the strand that is
not being edited, in or
near the target region. Such nicking helps to stimulate the cell in which
prime editing is taking
place to repair the relevant area, i.e. the target region.
[0019] An "extension tail" is a stretch of nucleotides of 1, 2, 3 4, 5, 6,
7, 8, 9, or 10
nucleotides that can be added to either the 5' end or 3' end of a guide RNA,
such as a pegRNA.
A "poly(N) tail" is a homopolymer extension tail, containing 1-10 nucleotides
with the same
nucleobase, for example A, U, C or T. A "polyuridine tail" or "polyU tail" is
a poly(N) tail
containing 1-10 uridines. Similarly, a "polyA tail" contains 1-10 adenosines.
[0020] The term "nucleic acid," "nucleotide," or "polynucleotide" refers to
deoxyribonucleic
acids (DNA), ribonucleic acids (RNA) and polymers thereof in either single-,
double- or multi-
stranded form. The term includes, but is not limited to, single-, double- or
multi-stranded DNA or
RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and/or
pyrimidine bases or other natural, chemically modified, biochemically
modified, non-natural,
synthetic or derivatized nucleotide bases. In some embodiments, a nucleic acid
can comprise a
mixture of DNA, RNA and analogs thereof. Unless specifically limited, the term
encompasses
nucleic acids containing known analogs of natural nucleotides that have
similar binding properties
as the reference nucleic acid. Unless otherwise indicated, a particular
nucleic acid sequence also
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
implicitly encompasses conservatively modified variants thereof (e.g.,
degenerate codon
substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs),
and complementary
sequences as well as the sequence explicitly indicated. Specifically,
degenerate codon substitutions
may be achieved by generating sequences in which the third position of one or
more selected (or
all) codons is substituted with mixed-base and/or deoxyinosine residues
(Batzer et al., Nucleic
Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985);
and Rossolini et
al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used
interchangeably with gene,
cDNA, and mRNA encoded by a gene.
[0021] The term "nucleotide analog" or "modified nucleotide" refers to a
nucleotide that
contains one or more chemical modifications (e.g., substitutions), in or on
the nitrogenous base of
the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or
guanine (G)), in or on
the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified
ribose, modified
deoxyribose, six-membered sugar analog, or open-chain sugar analog), or the
phosphate.
[0022] The term "gene" or "nucleotide sequence encoding a polypeptide"
means the segment
of DNA involved in producing a polypeptide chain. The DNA segment may include
regions
preceding and following the coding region (leader and trailer) involved in the
transcription/translation of the gene product and the regulation of the
transcription/translation, as
well as intervening sequences (introns) between individual coding segments
(exons).
[0023] The terms "polypeptide," "peptide," and "protein" are used
interchangeably herein to
refer to a polymer of amino acid residues. The terms apply to amino acid
polymers in which one
or more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring
amino acid, as well as to naturally occurring amino acid polymers and non-
naturally occurring
amino acid polymers. As used herein, the terms encompass amino acid chains of
any length,
including full-length proteins, wherein the amino acid residues are linked by
covalent peptide
bonds.
[0024] The term "nucleic acid", "polynucleotide" or "oligonucleotide"
refers to a DNA
molecule, an RNA molecule, or analogs thereof. As used herein, the terms
"nucleic acid",
"polynucleotide" and "oligonucleotide" include, but are not limited to DNA
molecules such as
cDNA, genomic DNA or synthetic DNA and RNA molecules such as a guide RNA,
messenger
16
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
RNA or synthetic RNA. Moreover, as used herein, the terms include single-
stranded and double-
stranded forms.
[0025] The term "hybridization" or "hybridizing" refers to a process where
completely or
partially complementary polynucleotide strands come together under suitable
hybridization
conditions to form a double-stranded structure or a region in which the two
constituent strands are
joined by hydrogen bonds. As used herein, the term "partial hybridization"
includes where the
double-stranded structure or region contains one or more bulges or mismatches.
Although
hydrogen bonds typically form between adenine and thymine or adenine and
uracil (A and T, or
A and U, respectively) or cytosine and guanine (C and G), other non-canonical
base pairs may
form (see, e.g., Adams et al., "The Biochemistry of the Nucleic Acids," 11th
ed., 1992). It is
contemplated that modified nucleotides may form hydrogen bonds that allow or
promote
hybridization in a non-canonical way.
[0026] The term "complementarity" refers to the ability of a nucleic acid
to form hydrogen
bond(s) with another nucleic acid sequence by either traditional Watson-Crick
or other non-
traditional types. A percent complementarity indicates the percentage of
residues in a nucleic acid
molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with
a second nucleic
acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%,
90%, and 100%
complementary). "Perfectly complementary" means that all the contiguous
residues of a nucleic
acid sequence will hydrogen bond with the same number of contiguous residues
in a second nucleic
acid sequence. "Substantially complementary" as used herein refers to a degree
of
complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%,
98%, 99%, or
100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 30, 35, 40,
45, 50, or more nucleotides, or refers to two nucleic acids that hybridize
under stringent conditions.
[0027] As used herein, the term "portion", "segment", "element", or
"fragment" of a sequence
refers to any portion of the sequence (e.g., a nucleotide subsequence or an
amino acid subsequence)
that is smaller than the complete sequence. Portions, segments, elements, or
fragments of
polynucleotides can be of any length that is more than 1, for example, at
least 5, 10, 15, 20, 25, 30,
40, 50, 75, 100, 150, 200, 300 or 500 or more nucleotides in length.
[0028] The term "oligonucleotide" as used herein denotes a multimer of
nucleotides. For
example, an oligonucleotide may have about 2 to about 200 nucleotides, up to
about 50 nucleotides,
17
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
up to about 100 nucleotides, up to about 500 nucleotides in length, or any
integer value between 2
and 500 in nucleotide number. In some embodiments, an oligonucleotide may be
in the range of
30 to 300 nucleotides in length or 30 to 400 nucleotides in length.
Oligonucleotides may contain
ribonucleotide monomers (i.e., may be oligoribonucleotides) and/or
deoxyribonucleotide
monomers. An oligonucleotide may be 10 to 20, 21 to 30, 31 to 40, 41 to 50, 51-
60, 61 to 70, 71
to 80, 80 to 100, 100 to 150, 150 to 200, 200 to 250, 250 to 300, 300 to 350,
or 350 to 400
nucleotides in length, for example, and any integer value in between these
ranges.
[0029]
A "recombinant expression vector" is a nucleic acid construct, generated
recombinantly
or synthetically, with a series of specified nucleic acid elements that permit
transcription of a
particular polynucleotide sequence in a host cell. An expression vector may be
part of a plasmid,
viral genome, or nucleic acid fragment. Typically, an expression vector
includes a polynucleotide
to be transcribed, operably linked to a promoter. "Operably linked" in this
context means two or
more genetic elements, such as a polynucleotide coding sequence and a
promoter, placed in relative
positions that permit the proper biological functioning of the elements, such
as the promoter
directing transcription of the coding sequence. The term "promoter" is used
herein to refer to an
array of nucleic acid control sequences that direct transcription of a nucleic
acid. As used herein,
a promoter includes necessary nucleic acid sequences near the start site of
transcription, such as,
in the case of a polymerase II type promoter, a TATA element. A promoter also
optionally includes
distal enhancer or repressor elements, which can be located as much as several
thousand base pairs
from the start site of transcription. Other elements that may be present in an
expression vector
include those that enhance transcription (e.g., enhancers) and terminate
transcription (e.g.,
terminators), as well as those that confer certain binding affinity or
antigenicity to the recombinant
protein produced from the expression vector.
[0030]
"Recombinant" refers to a genetically modified polynucleotide, polypeptide,
cell,
tissue, or organism. For example, a recombinant polynucleotide (or a copy or
complement of a
recombinant polynucleotide) is one that has been manipulated using well known
methods. A
recombinant expression cassette comprising a promoter operably linked to a
second polynucleotide
(e.g., a coding sequence) can include a promoter that is heterologous to the
second polynucleotide
as the result of human manipulation (e.g., by methods described in Sambrook et
al., Molecular
Cloning _____________________________________________________________________
A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New
York,
(1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley &
Sons, Inc. (1994-
18
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
1998)). A recombinant expression cassette (or expression vector) typically
comprises
polynucleotides in combinations that are not found in nature. For instance,
human manipulated
restriction sites or plasmid vector sequences can flank or separate the
promoter from other
sequences. A recombinant protein is one that is expressed from a recombinant
polynucleotide, and
recombinant cells, tissues, and organisms are those that comprise recombinant
sequences
(polynucleotide and/or polypeptide).
[0031] "Editing" a nucleic acid target means causing a change in the
nucleotide sequence of
the target. The change may be an insertion, deletion or substitution, each of
a single nucleotide or
multiple nucleotides. Where multiple nucleotides are inserted, deleted or
substituted, the
nucleotides may be consecutive or not consecutive. The change may be a
combination of any of
the above. "Editing" comprises "base editing" and "prime editing"
technologies.
[0032] "Editing efficiency" is a measure of the Cas-induced editing
achieved in one or more
cells. The results of genome editing at the target, and potential off-target
sites, can be measured
using standard methods known in the art, for example, genomic DNA sequencing,
RNA
sequencing, or deep sequencing of PCR amplicons of the target site and any off-
target sites of
interest. Also, indel mutations in genomic DNA can be identified by using the
SURVEYOR
mutation detection kit (Integrated DNA Technologies, Coralville, Iowa) or the
GuideitTM Indel
Identification Kit (Clontech, Mountain View, CA). In addition, techniques that
measure the
presence or absence of proteins, e.g. gel or capillary; electrophoresis,
Western blotting, flow
cytotnetry, or mass spectrometry techniques can be used to quantify the
efficiency of editing aimed
to introduce or knock.-out protein-coding genes. These techniques can be
applied to populations of
cells in bulk preparations or at a single cell level. In some embodiments, the
efficiency is measured.
using the number of the correct edits in a population of cells measured in
bulk or at a single-cell
level, in some embodiments, th.e efficiency is measured as the percentage of
the targets that are
correctly edited, or the number or percentage of the cells that show the
corrected genotype or
phenotype.
[0033] "Modulating the expression of a gene" means altering (decreasing or
activating) the
expression of a specific gene product. CRISPR activation or "CRISPRa" refers
to the activation
of a gene whereas CRISPR interference or "CRISPRi" refers to the interference
of a gene
expression. Both systems use a nuclease deficient Cas protein (dCas9) fused or
interacting in
19
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
combination with transcriptional effector(s) (activator or repressor). CRISPRa
may be performed
in a SAM system (dCas9-VP64) as described previously. When used with gene-
specific CRISPRa,
the gRNA comprising a MS2 aptamer recruits the MS2-p65-HSF1 fusion to the
transcriptional
start site (TSS) of the targeted gene to initiate activation. CRISPRa and
CRISPRi can be both
performed and combined in a multiplexed fashion (e.g., targeting of multiple
genes). CRISPRoff
is a programmable epigenetic memory writer consisting of a dead Cas9 fusion
protein that
establishes DNA methylation and repressive histone modifications that can
heritably alter gene
expression (Nunez et al., Genome-wide programmable transcriptional memory by
CRISPR-based
epigenome editing, Cell. (2021) 184(9):2503-2519.
[0034] "Gene expression modulation efficiency" can be measured for example
by techniques
that measure the relative or absolute levels of different RNAs, e.g. qRT-PCR
or RNA.-sequencing,
or by various methods that measure the relative or absolute levels of
proteins, e.g. gel or capillary
electrophoresis. Western blotting, flow cytometry, or mass spectrometry
techniques. These
techniques can be applied to populations of cells in bulk preparations or at a
single cell level. In
some embodiments, the efficiency is measured using the amount of the protein
or RNA expressed
from the target gene in a population of cells measured in bulk or at a single-
cell level.
[0035] The term "single nucleotide polymorphism" or "SNP" refers to a
change of a single
nucleotide with a polynucleotide, including within an allele. This can include
the replacement of
one nucleotide by another, as well as deletion or insertion of a single
nucleotide. Most typically,
SNPs are biallelic markers although tri- and tetra-allelic markers can also
exist. By way of non-
limiting example, a nucleic acid molecule comprising SNP A\C may include a C
or A at the
polymorphic position.
[0036] "Nucleases" as used herein means enzymes capable of cleaving the
phosphodiester
linkage between nucleotides of nucleic acids. Nucleases variously can effect
both single and/or
double stranded cleavage of DNA and/or RNA molecules. In living organisms,
they are essential
machinery for many aspects of DNA repair. As used herein, nucleases refer to
both exonucleases
and endonucleases and encompass ribonucleases as well as deoxyribonucleases.
[0037] The term "primary cell" refers to a cell isolated directly from a
multicellular organism. Primary
cells typically have undergone very few population doublings and are therefore
more representative of the
main functional component of the tissue from which they are derived in
comparison to continuous (tumor
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
or artificially immortalized) cell lines. In some cases, primary cells are
cells that have been isolated and
then used immediately. In other cases, primary cells cannot divide
indefinitely and thus cannot be cultured
for long periods of time in vitro.
[0038] The terms "nucleases-containing fluid" is used herein to refer to
any medium in which
nucleases are present. For instance, the medium can be a cell culture medium
or a medium that
originated from a cell culture medium, meaning that the cells were transferred
from a cell culture
medium, into a new medium with or without washing the cells but without
removing all the
components contained in the original medium, and therefore may still contain
nucleases. For
instance, a cell may be transferred from a cell culture medium to a reaction
medium without
washing the cell or without removal of substantially all the components of the
cell culture medium,
and therefore nucleases may be present at the time of contacting the cell with
the gRNA and the
Cas protein (RNP) or the gRNA and the mRNA or DNA vector encoding the editing
Cas effector.
The fluid may be a serum, a human serum, an animal serum, a bovine serum
(BSA), a fetal serum,
a cerebrospinal fluid (C SF) or another bodily fluid.
[0039] The terms "culture," "culturing," "grow," "growing," "maintain,"
"maintaining,"
"expand," "expanding," etc., when referring to cell culture itself or the
process of culturing, can
be used interchangeably to mean that a cell (e.g., primary cell) is maintained
outside its normal
environment under controlled conditions, e.g., under conditions suitable for
survival. Cultured
cells are allowed to survive, and culturing can result in cell growth, stasis,
differentiation or
division. The term does not imply that all cells in the culture survive, grow,
or divide, as some may
naturally die or senesce. Cells are typically cultured in media, which can be
changed during the
course of the culture.
[0040] The terms "subject," "patient," and "individual" are used herein
interchangeably to
include a human or animal. For example, the animal subject may be a mammal, a
primate (e.g., a
monkey), a livestock animal (e.g., a horse, a cow, a sheep, a pig, or a goat),
a companion animal
(e.g., a dog, a cat), a laboratory test animal (e.g., a mouse, a rat, a guinea
pig, a bird), an animal of
veterinary significance, or an animal of economic significance.
[0041] As used herein, the term "administering" includes oral
administration, topical contact,
administration as a suppository, intravenous, intraperitoneal, intramuscular,
intralesional,
intrathecal, intranasal, or subcutaneous administration to a subject.
Administration is by any route,
21
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
including parenteral and transmucosal (e.g., buccal, sublingual, palatal,
gingival, nasal, vaginal,
rectal, or transdermal). Parenteral administration includes, e.g.,
intravenous, intramuscular, intra-
arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and
intracranial. Other
modes of delivery include, but are not limited to, the use of liposomal
formulations, intravenous
infusion, transdermal patches, etc.
[0042] The term "treating" refers to an approach for obtaining beneficial
or desired results
including but not limited to a therapeutic benefit and/or a prophylactic
benefit. By therapeutic
benefit is meant any therapeutically relevant improvement in or effect on one
or more diseases,
conditions, or symptoms under treatment. For prophylactic benefit, the
compositions may be
administered to a subject at risk of developing a particular disease,
condition, or symptom, or to a
subject reporting one or more of the physiological symptoms of a disease, even
though the disease,
condition, or symptom may not have yet been manifested.
The term "effective amount" or "sufficient amount" refers to the amount of an
agent (e.g., Cas
protein, modified gRNA/pegRNA, etc.) that is sufficient to effect beneficial
or desired results. The
therapeutically effective amount may vary depending upon one or more of: the
subject and disease
condition being treated, the weight and age of the subject, the severity of
the disease condition, the
manner of administration and the like, which can readily be determined by one
of ordinary skill in
the art. The specific amount may vary depending on one or more of: the
particular agent chosen,
the target cell type, the location of the target cell in the subject, the
dosing regimen to be followed,
whether it is administered in combination with other agents, timing of
administration, and the
physical delivery system in which it is carried.
[0043] As disclosed herein, a number of ranges of values are provided. It
is understood that
each intervening value between the upper and lower limits of that range is
also specifically
contemplated. Each smaller range or intervening value encompassed by a stated
range is also
specifically contemplated. The term "about" generally refers to plus or minus
10% of the indicated
number. For example, "about 10%" may indicate a range of 9% to 11%, and "about
20" may mean
from 18-22. Other meanings of "about" may be apparent from the context, such
as rounding off,
so, for example "about 1" may also mean from 0.5 to 1.4.
22
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0044] Several chemically-modified nucleotides are described herein. Note
that each of MS,
MP, and MSP can mean the corresponding modification, or a nucleotide
comprising the
corresponding modification. The following abbreviations shall be used in
relevant contexts:
[0045] "PACE": phosphonoacetate
[0046] "MS": 2'-0-methyl-3 1-phosphorothioate
[0047] "MP": 21-0-methyl-31-phosphonoacetate
[0048] "MSP": 21-0-methyl -3 1-thiophosphonoacetate
[0049] "2'-MOE": 2'-0-methoxyethyl
[0050] Other definitions of terms may appear throughout the specification.
[0051] The present invention demonstrates that certain modifications of a
guide RNA, in
specific positions, render the guide RNA extra resistant to degradation by
nucleases. This is
particularly important for in vivo delivery of guide RNAs for CRISPR-mediated
gene editing or
modulation of gene expression, as nuclease activities are high in vivo. For
example, bodily fluids,
such as serum and cerebrospinal fluid (CSF), contain relatively abundant
nucleases. In such a
challenging environment, the guide RNA tends to be degraded, thus its
concentration does not
reach a level that can achieve higher performance (i.e., sub-saturated).
Therefore, any increase in
guide RNA concentration, and thereby in the chance of gene editing and
modulation of gene
expression, would be significant in this industry. This invention provides the
surprising discovery
that certain guide RNAs, for example those with phosphorothioate modifications
at the 5' end as
well as phosphonocarboxylate or thiophosphonocarboxylate modifications at the
3' end, led to
higher CRISPR activities even in the presence of serum, as compared to
counterparts that are
unmodified or contains other modifications (e.g. phosphorothioate in the place
of
phosphonocarboxylate or thiophosphonocarboxylate but otherwise the same).
[0052] Similarly, cells to be subjected to CRISPR-mediated
editing/modulation for ex vivo
therapy are usually in cell culture media that contain serum, or, if freshly
harvested from a subject,
contain bodily fluids in the environment. As such, nucleases present in the
serum or bodily fluids
would degrade the guide RNAs delivered to the cells and reduce the efficiency
of CRISPR-
mediated editing/modulation. Although cells can be washed before CRISPR
treatment in order to
23
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
lower the amount of serum or bodily fluid, extensive washing may be unhealthy
to the cells.
Furthermore, CRISPR-mediated editing/modulation does not happen immediately
after the guide
RNA and other CRISPR effectors are added to the cells, and the cells need to
be cultured for a
period of time. Culturing in the absence of serum is often detrimental to
cells, and is a risk factor
for ex vivo therapy since the cells will be delivered to a patient later. The
modified guide RNAs
of the present invention, which are more resistant to nuclease degradation, is
a significant
improvement for resolving these problems.
[0053] Modified guide RNAs of the present invention are useful when
introduced into cells in
a "naked" manner and directly exposed to nucleases, e.g., co-transfected or
otherwise delivered
with a DNA or mRNA encoding a Cas protein. However, even when the guide RNA is
not naked,
for example present in a ribonucleoprotein (RNP) with the Cas protein, or in a
nanoparticle with
or without the Cas protein, the modifications described herein are also
advantageous.
[0054] In one aspect of the present disclosure, methods are provided for
editing a target region,
or modulating expression of a target gene in a target region, in a nucleic
acid in a cell. The methods
comprise providing to the cell a) a CRISPR-associated ("Cas") protein, and b)
a modified guide
RNA comprising a 5' end and a 3' end, a guide sequence that is capable of
hybridizing to the target
sequence in the target region, and a scaffold region that interacts with the
Cas protein. The
modified guide RNA also comprises one or more phosphorothioate modifications
within 5
nucleotides of the 5' end, and at least two consecutive phosphonocarboxylate
or
thiophosphonocarboxylate modifications within 5 nucleotides of the 3' end. The
cell exists ex vivo
in the presence of nuclease containing fluids, or exists in vivo. In the
present methods, providing
the Cas protein and the modified guide RNA to the cell results in editing of
the target region or
modulation of expression of the target gene.
[0055] In some embodiments, the modified guide RNA comprises 2, 3, 4, or 5
phosphonocarboxylate or thiophosphonocarboxylate modifications within 5
nucleotides of the 3'
end. The at least two consecutive phosphonocarboxylate or
thiophosphonocarboxylate
modifications within 5 nucleotides of the 3' end of the gRNA may comprise at
least 2, 3, 4, or 5
MP nucleotides, which may be arranged in any order, including two consecutive
modified
nucleotides and one or two nonconsecutive modified nucleotides, three
consecutive modified
nucleotides and one nonconsecutive modified nucleotides, two pairs of two
consecutive modified
24
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
nucleotides, or five two consecutive modified nucleotides. In some
embodiments, the modified
guide RNA comprises at least two, at least three, at least four, or five
consecutive MP nucleotides
within 5 nucleotides of the 3' end. In some embodiments, the modified guide
RNA comprises 1, 2,
3, 4, or 5 phosphorothioate modifications within 5 nucleotides of the 5' end.
The one or more
phosphorothioate modifications within 5 nucleotides of the 5' end of the gRNA
may comprise at
least 1, at least 2, at least 3, at least 4, or 5 MS nucleotides, which may be
arranged in any order,
including consecutively or nonconsecutively. In some embodiments of the
present methods, the
modified guide RNA comprises at least two, at least three, at least four, or
five consecutive MS
nucleotides within 5 nucleotides of the 5' end. The one or more modified
nucleotides within 5
nucleotides of the 3' or 5' end of the gRNA may be independently selected
(e.g., the number and/or
order of modified nucleotides may be different on the 5' and the 3' end of the
gRNA).
[0056] In some embodiments, the modified guide RNA further comprises
modified
nucleotide(s) located outside of 5 nucleotides within the 5' end and 3' end.
The modified guide
RNA may comprise one or more modifications in the guide sequence that enhance
target
specificity (as described, e.g., in U.S. Patent No. 10,767,175). For example,
the modified guide
RNA may comprise a modified nucleotide at position 5 or position 11 of the
modified guide
sequence.
[0057] In some embodiments, the modified guide RNA is a single guide RNA.
In some
embodiments, the guide RNA is a single-guide RNA comprising exactly or at
least 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,
63, 64, 65, 66, 67, 68, 69,
70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111,
112, 113, 114, 115, 116,
117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131,
132, 133, 134, 135, 136,
137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151,
152, 153, 154, 155, 156,
157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171,
172, 173, 174, 175, 176,
177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191,
192, 193, 194, 195, 196,
197, 198, 199, or 200 nucleotides, and/or up to 180, 179, 178, 177, 176, 175,
174, 173, 172, 171,
170, 169, 168, 167, 166, 165, 164, 163, 162, 161, 159, 158, 157, 156, 155,
154, 153, 152, 151, 150,
149, 148, 147, 146, 145, 144, 143, 142, 141, 140, 139, 138, 137, 136, 135,
134, 133, 132, 131, 130,
129, 128, 127, 126, 125, 124, 123, 122, 121, or 120 nucleotides. It is
expressly contemplated that
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
any of the foregoing minima and maxima can be combined to form a range, as
long as the minimum
as less than the maximum.
[0058] In some embodiments, the Cas protein is provided to the cell as an
mRNA encoding a
Cas protein or a variant or fusion protein thereof In some embodiments, the
Cas protein is provided
to the cell as a recombinant expression vector comprising a nucleotide
sequence encoding a Cas
protein or a variant or fusion protein thereof. The cell can be transfected
with the mRNA or
expression vector encoding the Cas protein, separately or together with the
modified guide RNA.
In some embodiments, the cell is co-transfected with the modified guide RNA
and an mRNA or
expression vector encoding the Cas protein. When co-transfected, the modified
guide RNA and
the mRNA or expression vector encoding the Cas protein can be provided to the
cell in separate
delivery systems or in a single delivery system. Alternatively, the cell may
be transfected with the
modified guide RNA before or after being transfected with an mRNA or
expression vector
encoding a Cas protein. The cell can be transfected by electroporation,
microinjection, lipofection
or exposure to nanoparticles or other delivery systems (as described in more
detail below). In some
embodiments, the mRNA or expression vector encoding the Cas protein and/or
modified guide
RNA are provided in nanoparticles, e.g., lipid nanoparticles.
[0059] In some embodiments, the Cas protein and the modified guide RNA are
provided as a
ribonucleoprotein complex (RNP). The modified guide RNA can be complexed with
a Cas protein
or a variant or fusion protein thereof to form a RNP for introduction into a
cell. The RNP can be
provided to a cell in a delivery system such as by electroporation,
microinjection, virus-like
particles, lipofection or exposure to nanoparticles or other delivery systems
(as described in more
detail below). In some embodiments, the Cas protein and/or modified guide RNA
are provided in
nanoparticles, e.g., lipid nanoparticles.
[0060] In some embodiments, the cell to be edited or modulated is ex vivo.
In other
embodiments, the cell to be edited or modulated is in vivo. The present
methods can be used for
editing a target region, or modulating expression of a target gene in a target
region, in a nucleic
acid in an ex vivo cell that was previously cultured in a medium comprising
serum, where the cell
was incompletely separated from the serum or one or more serum components. For
example, the
method may comprise transferring a cell from a cell culture medium to a
reaction medium without
washing the cell, or without extensive washing of the cell. In some
embodiments, the modified
26
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
guide RNA and the Cas protein are provided to the cell in the presence of
serum or one or more
serum components, such as an in vivo cell in blood, plasma or serum.
[0061] In some embodiments, the cell is a population of cells, each
comprising the target
region. For instance, the population of cells may be a cell culture or derived
from a cell culture.
The cell or population of cells may be in a cell culture medium or nuclease
containing fluid before
the modified guide RNA and the Cas protein are provided to the cell, and in
some embodiments,
the cell is washed but not completely free from the cell culture medium, or
one or more components
of the cell culture medium such that nucleases are still present, before the
introduction of the
editing components. For instance, a cell may be transferred from a cell
culture medium to a reaction
medium without washing the cell or without removal of substantially all the
components of the
cell culture medium. Alternatively, the cell or population of cells may be
present in a cell culture
medium at the time of providing the modified guide RNA and the Cas protein. In
such
embodiments, the cell culture medium can function as a reaction medium for
editing or modulating
a target sequence in the cell. In some embodiments, the cell is in, or is
transferred from, a cell
culture medium comprising serum or one or more other medium components, such
one or more
natural proteins of human or animal origin. In some embodiments, the cell is
in, or is transferred
from, a cell culture medium comprising bovine serum albumin, horse serum, or
fetal bovine serum.
[0062] In some embodiments, the editing or expression modulation that
results from providing
the modified guide RNA to the cell is at least 10%, at least 20%, at least
25%, or at least 50% more
efficient than editing or modulation caused by an unmodified guide RNA that is
otherwise identical
to the modified guide RNA. For instance, the present methods have a mean indel
yield or mean
edit yield at least 10%, at least 20%, at least 25%, or at least 50% higher
than the yield obtained in
a corresponding method employing an unmodified guide RNA that is otherwise
identical to the
modified guide RNA. In some embodiments, the editing or modulation that
results from providing
the modified guide RNA to the cell is at least 2-fold, at least 3-fold, or at
least 5-fold more efficient
than editing or modulation caused by an unmodified guide RNA that is otherwise
identical to the
modified guide RNA. For instance, the present methods have a mean indel yield
or mean edit yield
at least 2-fold, at least 3-fold, or at least 5-fold higher than a
corresponding method employing an
unmodified guide RNA that is otherwise identical to the modified guide RNA.
27
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0063] Multiplexing is contemplated in the present invention by using a
plurality of modified
gRNAs for a plurality of target regions. In some embodiments, two modified
guide RNAs of the
present application are used to edit (or modulate) two different target
regions in the same cell,
preferably at the same time. In some embodiments, a modified guide RNA is used
to edit a first
target region, and a second modified guide RNA is used to modulate the
expression of a target
region (which may be the same or different from the first target region), in a
multiplexed manner.
[0064] In recent years, CRISPR-based technologies have emerged as a
potentially
revolutionary therapy (e.g., for correcting genetic defects). However, the use
of CRISPR systems
has been limited due to practical concerns. In particular, there is a need for
methods to stabilize
the guide RNA (gRNA) for in vivo delivery of CRISPR-Cas components. Prior
research has
investigated the use of gRNAs having chemically-modified nucleotides. As
explained herein, the
present disclosure is based in part on the surprising discovery that the
incorporation of particular
modified nucleotides at the 3' end of a gRNA can improve the yield of Cas-
mediated editing or
modulation of target nucleic acids, with a pronounced improvement in cases
where a gRNA and
an mRNA or DNA encoding a Cas protein are introduced (e.g. co-transfection)
into a cell under
challenging conditions.
[0065] In some aspects, the guide RNAs disclosed herein may be particularly
advantageous in
applications wherein the guide RNA is introduced into a cell under one or more
challenging
conditions such as:
i. the cell is in a medium comprising serum (e.g., fetal bovine serum);
ii. the cell was previously cultured in a medium comprising serum, and
serum is still present
when the guide RNA is introduced;
iii. the cell was previously cultured in a medium comprising one or more
nucleases, and the
nucleases are still present when the guide RNA is introduced;
iv. the cell has a relatively high level of nuclease activity, such as
relatively high expression
of one or more nucleases;
v. the cell has a relatively low level of nuclease inhibitor activity, such
as a relatively low
expression of nuclease inhibitor;
vi. the modified guide RNA is not in a complex with a Cas protein before
delivery into the
cell;
28
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
vii. the cell exists in vivo; and
viii. combinations thereof where applicable.
[0066] The concept of saturation is well known in the art. When a substance
is at its "saturating
level," any further increase in the amount of the substance does not result in
higher activities. A
"sub-saturating level" is lower than the saturating level, and adding more of
the substance at issue
can lead to higher activities. One may determine the threshold of saturation
empirically using
conventional assays. For example, FIG. 1 shows the results of an assay that
evaluated Cas editing
activity following co-transfection with increasing amounts of a synthetic gRNA
and a constant
amount of Cas protein. As shown by this figure Cas-mediated editing activity
plateaued at 25-
31.25 pmoles of gRNA, when the level of gRNA reaches a saturation point for
transfection of 0.2
million cells.
[0067] In many cases, it would be desirable to use a saturating level of
the components required
by a chemical reaction. However, such conditions are not always feasible,
particularly in the case
of therapeutics where it may not be possible or safe to treat a human or
animal with a saturating
level of one or more compounds. In the case of CRISPR-based therapies,
transfection efficiency
is typically a bottleneck that limits the effectiveness of the therapy. For
example, current CRISR-
based therapies normally require co-transfection of one or more cells of a
patient with a gRNA
and an mRNA encoding a Cas protein. If the transfection efficiency is low, one
or both components
may be delivered at a level below the effective amount required for a
therapeutic effect. The
modified guide RNA constructs disclosed herein address this need in the art in
that they typically
display high levels of Cas editing activity even when transfected at a sub-
saturating level. Indeed,
the incorporation of one or more phosphonocarboxylate modifications at the 3'
end of a synthetic
gRNA is particularly advantageous for CRISPR-based methods involving co-
transfection of Cas
mRNA with synthetic gRNA.
[0068] As noted above, the present disclosure also provide modified pegRNA
constructs and
methods which retain high levels of prime editing activity under challenging
conditions, such as
when transfected at sub-saturating amounts. This result is particularly
surprising, as the structure
of a traditional guide RNA (gRNA) is very different from that of a prime
editing gRNA (pegRNA),
and it was unclear, prior to the present disclosure, how chemical
modifications of a pegRNA would
29
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
impact its activity. In particular, pegRNAs contain additional sequences in
their 3' portions
compared to typical gRNAs (i.e., a reverse transcriptase template and a primer
binding site
sequence) and the 3' ends of pegRNAs perform a different function in prime
editing than the 3'
ends of typical gRNAs in other CRISPR-Cas systems. Thus, phosphoribose (or
other chemical)
modifications at the 3' terminus of pegRNA have the potential to interfere
with the role of the
primer binding site sequence, which hybridizes to the 3' end of the nicked
strand of the DNA target
site, such that the reverse transcriptase recognizes the resulting RNA:DNA
duplex as an acceptable
substrate for primer extension of the nicked 3' end to achieve prime editing.
[0069] Based on this understanding, one would expect that some
phosphoribose modifications
such as MS and MP in the RNA segment of the RNA:DNA duplex may interfere with,
or reduce,
the affinity of the reverse transcriptase for this duplex and thus reduce
prime editing activity.
Moreover, positions and/or combinations of positions where phosphoriboses are
modified (such
as by MS or1VIP) would be expected to interfere with reverse transcriptase
function in prime editing
and thus reduce prime editing activity. A published co-crystal structure of a
complex between an
RNA:DNA duplex and a portion of the duplex-complexing polypeptide fragment of
the reverse
transcriptase from xenotropic murine leukemia virus-related virus, a close
relative of the Moloney
murine leukemia virus (MMLV) whose reverse transcriptase is typically employed
in prime
editing, lacks the portion of the reverse transcriptase that interacts with
the 3' terminus of the RNA
strand in the RNA:DNA duplex (Nowak et al., Nucl. Acids Res. 2013, 3874-3887),
leaving the art
with a lack of information about the RNA-protein contacts which may be
important at the 3'
terminus of a pegRNA in prime editing.
[0070] The present disclosure is based in part on the surprising finding
that modified gRNAs
or pegRNAs which include one or more MP modifications at the 3' end,
optionally with one or
more modifications at the 5' end, can enhance Cas-mediated editing activities,
particularly in cases
where the modified guide RNA is transfected into a cell at a sub-saturating
level. As discussed in
further detail below, various designs of chemically-synthesized single guide
RNAs, which can be
about 100 nts long, and pegRNAs, which are typically longer, were co-
transfected with a Cas
protein or mRNA encoding a Cas protein in cultured human cells and enhanced
activity was
observed when MS or MP modifications were added to phosphoriboses at the 3'
end of the
gRNA/pegRNA.
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0071] In order to evaluate the impact of various 3' and/or 5' end
modifications, a series of
synthetic gRNAs targeting the HBB gene were created by systematically
incorporating MS or 1\,/fP
phosphoribose modifications at the 3' ends of the gRNAs as listed in Table 1.
The 5' and 3' end
modifications are indicated in the name of each synthetic gRNA; for example,
HBB-101-
3xMS,3xMP means a guide RNA for the HBB gene with three MS modifications at
the 5' end and
three MP modifications at the 3' end of the gRNA. The exact locations of the
modifications are
denoted by underline in the sequences shown in Figure 1. The name also
indicates the RNA length;
for example, HBB-101-etc. means a strand of sgRNA targeting the HBB gene that
is composed of
101 nucleotides. Likewise, HBB-99-etc. means the sgRNA strand is composed of
99 nucleotides.
The difference in sequence length between these and similar lengths lies in
the different number
of uridines in the short polyuridine (polyU) tail at the 3' terminus of the
sgRNA, as specified by
the sequences defined in Table 1. In the examples listed in Table 1, the 3'
polyU tail is composed
of 3, 4, 5, 6 or 7 consecutive uridines (as a point of reference, the 3' polyU
tail on natural tracrRNAs
is generally composed of 7 consecutive uridines). Also, any modification in
the guide sequence is
indicated after the name of the target gene and the RNA length. For example,
HBB-102-11MP-
3xMS,3xMP means a guide RNA for the HBB gene composed of 102 nucleotides with
three MS
modifications at the 5'-end and three MP modifications at the 3'-end and
comprising an MP
modification at position 11 in the guide sequence. The exact locations of the
modifications are
denoted by underline in the sequences shown in Table 1 (as well as Tables 2 to
4, with MP
modifications in the guide sequence noted in underlined bold.
Table 1. Exemplary synthetic gRNAs targeting the HBB gene
SEQ sgRNA Name Sequence (5' ¨> 3') Length
ID NO (nts)
CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
1 HBB-100_unmodified AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGCUUUU
CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
2 HBB-100_3xMS,3xMS AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGCUU
CIWGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
3 HBB-99_3xMS,1xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 99
GGCACCGAGUCGGUGCUUU
CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
4 HBB-100_3xMS,1xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGCUUUU
31
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
<IWGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
HBB-100_3xMS,2xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGCUUUU
CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
6 HBB-101_3xMS,3xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 101
GGCACCGAGUCGGUGCUUUUU
CuUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
7 HBB-102_3xMS,3xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 102
GGCACCGAGUCGGUGCUUUUUU
('UuGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
8 HBB-102_3xMS,4xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 102
GGCACCGAGUCGGUGCUUUUUU
CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
9 HBB-103_3xMS,4xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 103
GGCACCGAGUCGGUGCUUUUUUU
CuUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
HBB-100_5MP_3xMS,3xMS AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGU
<IWGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
11 HBB-99_5MP_3xMS,1xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 99
GGCACCGAGUCGGUGCUUU
::UUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
12 HBB-100_5MP_3xMS,2xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGCUUUU
CuUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
13 HBB-101_5MP_3xMS,3xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 101
GGCACCGAGUCGGUGCUUUUU
('UuCCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
14 HBB-102_5MP_3xMS,4xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 102
GGCACCGAGUCGGUGCUUUUUU
CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
HBB-100_11MP_3xMS,3xMS AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGaMUU
CuUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
16 HBB-100_11MP_3xMS,1xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGCUUUU
<IWGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
17 HBB-100_11MP_3xMS,2xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 100
GGCACCGAGUCGGUGCUUUU
CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
18 HBB-102_11MP_3xMS,3xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 102
GGCACCGAGUCGGUGCUUUUUU
CuUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGAAAUAGC
19 HBB-103_11MP_3xMS,4xMP AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 103
GGCACCGAGUCGGUGCUUUUUUU
CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGGCCAACA
UGAGGAUCACCCAUGUCUGCAGGGCCUAGCAAGUUAAAAU
HBB-163_unmodified AAGGCUAGUCCGUUAUCAACUUGGCCAACAUGAGGAUCAC 163
CCAUGUCUGCAGGGCCAAGUGGCACCGAGUCGGUGCUUUU
UUU
32
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
.CUUGCCCCACAGGGCAGUAAGUUUUAGAGCUAGGCCAACA
UGAGGAUCACCCAUGUCUGCAGGGCCUAGCAAGUUAAAAU
21 HBB-163_3xMS,1xMP AAGGCUAGUCCGUUAUCAACUUGGCCAACAUGAGGAUCAC 163
CCAUGUCUGCAGGGCCAAGUGGCACCGAGUCGGUGCUUUU
UUU
CIWGCCCCACAGGGCAGUAAGUUUUAGAGCUAGGCCAACA
UGAGGAUCACCCAUGUCUGCAGGGCCUAGCAAGUUAAAAU
22 HBB-163_3xMS,2xMP AAGGCUAGUCCGUUAUCAACUUGGCCAACAUGAGGAUCAC 163
CCAUGUCUGCAGGGCCAAGUGGCACCGAGUCGGUGCUUUU
UUU
CIWGCCCCACAGGGCAGUAAGUUUUAGAGCUAGGCCAACA
UGAGGAUCACCCAUGUCUGCAGGGCCUAGCAAGUUAAAAU
23 HBB-163_3xMS,3xMP AAGGCUAGUCCGUUAUCAACUUGGCCAACAUGAGGAUCAC 163
CCAUGUCUGCAGGGCCAAGUGGCACCGAGUCGGUGCUUUU
UUU
CIWGCCCCACAGGGCAGUAAGUUUUAGAGCUAGGCCAACA
UGAGGAUCACCCAUGUCUGCAGGGCCUAGCAAGUUAAAAU
24 HBB-163_3xMS,4xMP AAGGCUAGUCCGUUAUCAACUUGGCCAACAUGAGGAUCAC 163
CCAUGUCUGCAGGGCCAAGUGGCACCGAGUCGGUGCUUUU
uuu
[0072] The number and types of chemical modifications at the 3' end of
gRNAs can
substantially improve their efficacy for DNA editing under conditions wherein
a sub-saturating
amount of the gRNA is delivered into a cell (e.g., by nucleofection). This
benefit is especially
pronounced in methods using gRNA co-transfected with an mRNA encoding a Cas
protein, as
opposed to being co-transfected in a complex with Cas protein as a
ribonucleoprotein (RNP)
complex. The number and types of chemical modifications incorporated into a
gRNA can also
improve the editing efficiency of a Cas RNP complex, illustrated by the data
provided herein
regarding transfection of cells suspended in growth media comprising serum
(which is known to
contain nucleases). See, e.g., FIGs. 4 and 5. The experimental data described
herein also shows
that certain chemical modifications and certain sequence positions in the
transfected gRNA
sequence can be especially advantageous for enhancing editing yields, such as
by incorporating
one or more MP modifications at consecutive 3' terminal phosphoriboses on the
3' end of a gRNA.
[0073] Any of the 5' and 3' end modifications described herein may
optionally be combined
with modifications in the guide sequence of a gRNA that enhance target
specificity (as described,
e.g., in U.S. Patent No. 10,767,175). For example, MP modifications on the 3'
end (such as 1V113 at
the second nucleotide from the 3' end, which means the first internucleotide
linkage from the 3'
end comprises a phosphonoacetate) may be combined with MP or other
modifications at position
33
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
or 11 (counting from the 5' end of the guide sequence in a 20-nucleotide guide
sequence) in the
guide sequence portion of a gRNA or pegRNA, as illustrated in Table 1 and as
tested in Figures
2-5.
[0074] The chemical modifications may be incorporated during chemical
synthesis of gRNAs
by using chemically-modified phosphoramidites at select cycles of amidite
coupling to produce
the desired sequence. Once synthesized, the chemically-modified gRNA is used
in the same
manner as unmodified gRNA for gene editing or regulation. A preferred
embodiment is to co-
transfect the chemically-modified synthetic gRNA with an mRNA or DNA encoding
a Cas protein.
Chemical modifications enhance the activity of the gRNA in transfected cells,
including when
delivered by electroporation, lipofection or exposure of live cells or tissues
to nanoparticles
charged with gRNA and/or an mRNA encoding a Cas protein.
[0075] Exemplary synthetic pegRNAs are shown below in Tables 2 and 3. These
pegRNAs
were modified by systematically incorporating MS or MP phosphoribose
modifications at the 3'
ends. The 5' and 3' end modifications are indicated in the name of each
synthetic pegRNA, which
also indicates the target gene. For example, "EMX1-peg-3xMS,3xMP" refers to a
pegRNA for the
EiV/X/ gene with three MS modifications at the 5' end and three 1\,/fP
modifications at the 3' end of
the pegRNA. The exact locations of the modifications are denoted by
underlining in the sequences
shown in Table 2. Some of the pegRNA designs have a short polyuridine tract
(i.e., a polyU tail)
added to the 3' terminus, as indicated by "+3'UU", "+3'UUU", or "+3'UUUU" in
the pegRNA
name.
Table 2. Exemplary synthetic pegRNAs targeting the EiV/X/ gene
SEQ ID
Length
sgRNA Name Sequence (5' ¨> 3')
NO (nts)
(A6UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
25 EMX1-peg_3xMS,unmod 124
AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGAC
UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
26 EMX1-peg_3xMS,3xMS 124
AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGOAC
.GAGUCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
27 EMX1-peg_3xMS,1xMP 124
AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGAC
34
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
GA.GUCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
28 EMX1-peg_3xMS,2xMP 124
AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGAC
^ UCCGAGCAGAAGAAGAAGU UU UAGAGCUAGAAAU
AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
29 EMX1-peg_3xMS,3xMP 124
AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGAC
.GUGUUUGUACUUUGUCCUCGUUUUAGAGCUAGAAA
30 EMX1-ng_3xMS,3xMS UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG 100
AAAAAGUGGCACCGAGUCGGUGCUuUU
^ UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
41 EMX1-peg+3'UU-3xMS,3xMS 126
AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGLU
f.:::...UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
EMX1-peg+3'UUUU- AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
42 128
3xMS,3xMS AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGAC U
::.:.:%.=:UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
43 EMX1-peg+3'UU-3xMS,1xMP 126
AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGACUU
:...:..f.:UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
44 EMX1-peg+3'UU-3xMS,2xMP 126
AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGACUU
UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
EMX1-peg+3'UUU- AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
45 127
3xMS,2xMP AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGACUUU
f.....%.::UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
EMX1-peg+3'UUUU- AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
46 128
3xMS,3xMP AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGACUUUU
:...:..f.:UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
EMX1-peg+3'UUUU- AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
47 128
3xMS,2xMP AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGACUUUU
.=:::.::.:UCCGAGCAGAAGAAGAAGUUUUAGAGCUAGAAAU
EMX1-peg+3'UUUU- AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA
48 128
3xMS,1xMP AAAAGUGGCACCGAGUCGGUGCAUGGGAGCACUUCUU
CUUCUGCUCGGACUUUU
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
Table 3. Exemplary synthetic pegRNAs targeting the E/11X/ gene.
SEQ ID Length
sgRNA Name Sequence (5' ¨> 3')
NO (nts)
GCAUUUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
31 RUNX1-peg_3xMS,unmod 129
AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAU
UUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
32 RUNX1-peg_3xMS,3xMS 129
AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAU
UUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
33 RUNX1-peg_3xMS,1xMP 129
AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAU
<3CAUUUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
34 RUNX1-peg_3xMS,2xMP 129
AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAU
UUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
35 RUNX1-peg_3xMS,3xMP 129
AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAU
Ak3GAAGCACUGUGGGUACGAGUUUUAGAGCUAGAAA
36 RUNX1-ng_3xMS,3xMS UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG 100
AAAAAGUGGCACCGAGUCGGUGCULWU
OCAUUUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
RUNX1-peg+UU- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
49 131
3xMS,3xMS AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAUUU
6CAUUUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
RUNX1-peg+UUUU- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
50 133
3xMS,3xMS AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAUW.MU
UUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
RUNX1-peg+UU- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
51 131
3xMS,2xMP AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAUUU
OCAUUUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
RUNX1-peg+UUUU- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
52 133
3xMS,3xMP AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAUUUUU
6CAUUUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
RUNX1-peg+UUUU- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
53 133
3xMS,2xMP AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAUUUUU
UUUCAGGAGGAAGCGAGUUUUAGAGCUAGAAA
RUNX1-peg+UUUU- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG
54 133
3xMS,1xMP AAAAAGUGGCACCGAGUCGGUGCUGUCUGAAGCCAUC
CAUGCUUCCUCCUGAAAAUUUuu
36
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Table 4. Exemplary synthetic gRNAs targeting the IL2RG gene
SEQ ID NO sgRNA Name Sequence (5' ¨> 3')
Length
(nts)
AAUGAUGGCUUCAACAGUUUUAGAGCUAGAAA
37 IL2RG-100_3xMS,3xMS UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG 100
AAAAAGUGGCACCGAGUCGGUGOARAJ
k3(-;GUAAUGAUGGCUUCAACAGUUUUAGAGCUAGAAA
38 IL2RG-100_3xMS,2xMP UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG 100
AAAAAGUGGCACCGAGUCGGUGCUUUU
<='.:.(-=3UAAUGAUGGCUUCAACAGUUUUAGAGCUAGAAA
39 IL2RG-102_3xMS,3xMP UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG 102
AAAAAGUGGCACCGAGUCGGUGCUUUUUU
AAUGAUGGCUUCAACAGUUUUAGAGCUAGAAA
40 IL2RG-103_3xMS,4xMP UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG 103
AAAAAGUGGCACCGAGUCGGUGCUUUUUUU
[0076] As demonstrated by the examples described below, the use of chemical
modifications
at the 3' end of pegRNAs substantially improves the efficacy of synthetic
pegRNAs with prime
editors (with respect to pegRNAs that are unmodified at the 3' end). The use
of synthetic pegRNAs
for prime editing can be preferred when aiming to limit the duration of
editing activity, as opposed
to a sustained editing activity when pegRNAs and prime editors are
constitutively expressed in
cells transfected with DNA vectors as originally reported in the literature
(see Anzalone et al.
2019). The present disclosure further demonstrates that data certain chemical
modifications and
certain sequence positions in a pegRNA sequence can be especially
advantageous, in some aspects,
such as incorporating two MP modifications at consecutive 3' terminal
phosphoriboses on a
pegRNA strand that terminates with a primer binding segment at the 3' terminus
(without adding
a downstream polyU tail to the 3' terminus).
A. Exemplary CRISPR/Cas systems
[0077] The CRISPR/Cas system of genome modification includes a Cas protein
(e.g., Cas9
nuclease), and a DNA-targeting RNA (e.g., modified gRNA) containing a guide
sequence that
targets the Cas protein to the target DNA, and a scaffold region that
interacts with the Cas protein
(e.g., tracrRNA). In some instances, a variant of a Cas protein such as a Cas9
mutant containing
one or more of the following mutations: DlOA, H840A, D839A, and H863A, can be
used. In other
37
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
instances, a fragment of a Cas protein or a variant thereof with desired
properties (e.g., capable of
generating single- or double-strand breaks and/or modulating gene expression)
can be used. A
donor repair template may be used in some CRISPR applications, which, for
example, can include
a nucleotide sequence encoding a reporter polypeptide such as a fluorescent
protein or an antibiotic
resistance marker, and homology arms that are homologous to the target DNA and
flank the site
of gene modification. Alternatively, the donor repair template can be a single-
stranded
oligodeoxynucleotide (ssODN). In some aspects, a CRISPR/CAS system may include
a Cas
protein capable of acting as a prime editor (e.g., a fusion protein comprising
a Cas protein which
displays nickase activity fused to a reverse transcriptase protein or domain
thereof). A prime editor
may be used with a pegRNA, which incorporates a reverse transcriptase template
containing one
or more edits to the sequence of a target nucleic acid, in order to modify the
sequence of the target
nucleic acid by a process referred to as prime editing.
[0078] 1. Cas proteins and Variants Thereof
[0079] The CRISPR (Clustered Regularly Interspaced Short Palindromic
Repeats)/Cas
(CRISPR-associated protein) nuclease system was discovered in bacteria but has
been used in
eukaryotic cells (e.g. mammalian) for genome editing/modulation of gene
expression. It is based
on part of the adaptive immune response of many bacteria and archaea. When a
virus or plasmid
invades such a microbe, segments of the invader's DNA are incorporated into a
CRISPR locus (or
"CRISPR array") in the microbial genome. Expression of the CRISPR locus
produces non-coding
CRISPR RNAs (crRNA). In Type II CRISPR systems, the crRNA then associates,
through a region
of partial complementarity, with another type of RNA called tracrRNA to guide
the Cas (e.g., Cas9)
protein to a region homologous to the crRNA in the target DNA called a
"protospacer." The Cas
(e.g., Cas9) protein cleaves the DNA to generate blunt ends at the double-
strand break at sites
specified by a 20-nucleotide guide sequence contained within the crRNA
transcript. The Cas (e.g.,
Cas9) protein requires both the crRNA and the tracrRNA for site-specific DNA
recognition and
cleavage. This system has been engineered such that the crRNA and tracrRNA can
be combined
into one molecule (a single guide RNA or "sgRNA") (see, e.g., Jinek et al.
(2012) Science, 337:816-821; Jinek et al. (2013) eLife, 2:e00471; Segal (2013)
eLife, 2:e00563).
Thus, the CRISPR/Cas system can be engineered to create a double-strand break
at a desired target
in a genome of a cell, and harness the cell's endogenous mechanisms to repair
the induced break
by homology-directed repair (HDR) or nonhomologous end-joining (NHEJ).
38
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0080] In some embodiments, the Cas protein has DNA cleavage activity. The
Cas protein can
direct cleavage of one or both strands at a location in a target DNA sequence.
For example, the
Cas protein can be a nickase having one or more inactivated catalytic domains
that cleaves a single
strand of a target DNA sequence (e.g., as in the case of a prime editor Cas
protein).
[0081] Non-limiting examples of Cas proteins include Casl, Cas1B, Cas2,
Cas3, Cas4, Cas5,
Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Cas10, Cash, Cas12,
Cas13, Cas14,
Cas(I), CasX, Csy 1, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2,
Csm3, Csm4, Csm5,
Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Cpfl, Csbl, Csb2, Csb3, Csx17, Csx14,
Csx10, Csx16,
CsaX, Csx3, Csxl, Csx15, Csfl, Csf2, Csf3, Csf4, homologs thereof, variants
thereof, fragments
thereof, mutants thereof, and derivatives thereof. There are at least six
types of Cas protein (Types
I through VI), and at least 33 subtypes (see, e.g., Makarova et al., Nat. Rev.
Microbiol., 2020, 18:2,
67-83). Type II Cas proteins include Casl, Cas2, Csn2, and Cas9. Cas proteins
are known to those
skilled in the art. For example, the amino acid sequence of the Streptococcus
pyogenes wild-type
Cas9 polypeptide is set forth, e.g., in NBCI Ref. Seq. No. NP 269215, and the
amino acid sequence
of Streptococcus thermophilus wild-type Cas9 polypeptide is set forth, e.g.,
in NBCI Ref. Seq. No.
WP 011681470. CRISPR-related endonucleases that are useful in aspects of the
present disclosure
are disclosed, e.g., in U.S. Patent Nos. 9,267,135; 9,745,610; and 10,266,850.
[0082] Cas proteins, e.g., Cas9 polypeptides, can be derived from a variety
of bacterial species
including, but not limited to, Veillonella atypical, Fusobacterium nucleatum,
Filifactor alocis,
Solobacterium moorei, Coprococcus catus, Treponema dent/cola, Peptomphilus
duerdenii,
Catenibacterium mitsuokai, Streptococcus mutans, Listeria innocua,
Staphylococcus
pseudintermedius, Acidaminococcus intestine, Olsenella uli, Oenococcus
kitaharae,
Bifidobacterium bifidum, Lactobacillus rhamnosus, Lactobacillus gasseri,
Finegoldia magna,
Mycoplasma mobile, Mycoplasma gallisepticum, Mycoplasma ovipneumoniae,
Mycoplasma canis,
Mycoplasma synoviae, Eubacterium rectale, Streptococcus thermophilus,
Eubacterium dolichum,
Lactobacillus coryniformis subsp. Torquens, Ilyobacter polytropus,
Ruminococcus albus,
Akkermansia mucimphila, Acidothermus cellulolyticus, Bifidobacterium longum,
Bifidobacterium
dentium, Corynebacterium diphtheria, Elusimicrobium minutum, Nitratifractor
salsuginis,
Sphaerochaeta globus, Fibrobacter succinogenes subsp. Succinogenes,
Bacteroides
Capnocytophaga ochracea, Rhodopseudomonas palustris, Prevotella micans,
Prevotella
ruminicola, Flavobacterium columnare, Aminomonas paucivorans, Rhodospirillum
rubrum,
39
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Candidatus Puniceispirillum marinum, Verminephrobacter eiseniae, Ralstonia
syzygii,
Dinoroseobacter shibae, Azospirillum, Nitrobacter hamburgensis,
Bradyrhizobium, Wolinella
succinogenes, Campylobacter jejuni subsp. Jejuni, Helicobacter mustelae,
Bacillus cereus,
Acidovorax ebreus, Clostridium perfringens, Parvibaculum lavamentivorans,
Roseburia
intestinalis, Neisseria meningitidis, Pasteurella multocida subsp. Multocida,
Sutterella
wadsworthensis, proteobacterium, Legionella pneumophila, Parasutterella
excrementihominis,
Wolinella succinogenes, and Francisella novicida.
[0083] "Cas9" refers to an RNA-guided double-stranded DNA-binding nuclease
protein or
nickase protein. Wild-type Cas9 nuclease has two functional domains, e.g.,
RuvC and HNH, that
cut different DNA strands. Cas9 can induce double-strand breaks in genomic DNA
(target DNA)
when both functional domains are active. The Cas9 enzyme can comprise one or
more catalytic
domains of a Cas9 protein derived from bacteria belonging to the group
consisting of Corynebacter,
Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus,
Lactobacillus,
Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta,
Azospirillum,
Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus,
Nitratifractor, and
Campylobacter. . In some embodiments, the two catalytic domains are derived
from different
bacterial species.
[0084] "Cas12" (comprising variants Cas12a (also known as Cpfl), Cas12b,
c2c1, c2c3, CasX,
and CasY) refers to an RNA-guided double-stranded DNA-binding nuclease protein
containing a
mixed alpha/beta domain, a RuvC-I followed by a helical region, a RuvC-II and
a zinc finger-like
domain or nickase protein. Wild-type Cas12 nucleases produce staggered, 5'
overhangs on the
dsDNA target sequence and do not require a tracrRNA. Cas12 and its variants
recognize a 5' AT-
rich PAM sequence on the target dsDNA. An insert domain, called Nuc, of the
Cas12a protein has
been demonstrated to be responsible for target strand cleavage. The Cas12
enzyme can comprise
one or more catalytic domains of a Cas12 protein derived from bacteria
belonging to the group
consisting ofFrancisella and Prevotella.
[0085] Useful variants of the Cas9 protein can include a single inactive
catalytic domain, such
as a RuvC- or HNE1- enzymes, both of which are nickases. Such Cas proteins are
useful, e.g., in
the context of prime editing. A Cas9 nickase has only one active functional
domain and can cut
only one strand of the target DNA, thereby creating a single-strand break or
nick. In some
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
embodiments, the Cas protein is a mutant Cas9 nuclease having at least a DlOA
mutation, and is
a Cas9 nickase. In other embodiments, the Cas protein is a mutant Cas9
nuclease having at least a
H840A mutation, and is a Cas9 nickase. Other examples of mutations present in
a Cas9 nickase
include, without limitation, N854A and N863A. A double-strand break can be
introduced using a
Cas9 nickase if at least two DNA-targeting RNAs that target opposite DNA
strands are used. A
staggered double-nick-induced double-strand break can be repaired by NHEJ or
HDR (Ran et al.,
2013, Cell, 154:1380-1389; Anzalone et al. Nature 576:7785, 2019, 149-15).
This gene editing
strategy favors HDR and decreases the frequency of indel mutations as
byproducts. Non-limiting
examples of Cas9 nucleases or nickases are described in, for example, U.S.
Pat. Nos. 8,895,308;
8,889,418; 8,865,406; 9,267,135; and 9,738,908; and in U.S. Patent Application
Pub. No.
2014/0186919. The Cas9 nuclease or nickase can be codon-optimized for the
target cell or target
organism.
[0086] In some embodiments, the Cas protein can be a Cas9 polypeptide that
contains two
silencing mutations of the RuvC1 and HNH nuclease domains (D10A and H840A),
which is
referred to as dCas9 (Jinek et al., Science, 2012, 337:816-821; Qi et al.,
Cell, 152(5):1173-1183).
In one embodiment, the dCas9 polypeptide from Streptococcus pyogenes comprises
at least one
mutation at position D10, G12, G17, E762, H840, N854, N863, H982, H983, A984,
D986, A987
or any combination thereof. Descriptions of such dCas9 polypeptides and
variants thereof are
provided in, for example, International Patent Pub. No. WO 2013/176772. The
dCas9 enzyme can
contain a mutation at D10, E762, H983 or D986, as well as a mutation at H840
or N863. In some
instances, the dCas9 enzyme contains a DlOA or DION mutation. Also, the dCas9
enzyme can
include a H840A, H840Y, or H840N. In some embodiments, the dCas9 enzyme used
in aspects of
the present disclosure comprises DlOA and H840A; DlOA and H840Y; DlOA and
H840N; DION
and H840A; DION and H840Y; or DION and H840N substitutions. The substitutions
can be
conservative or non-conservative substitutions to render the Cas9 polypeptide
catalytically
inactive and able to bind to target DNA.
[0087] The dCas9 polypeptide is catalytically inactive and lacks nuclease
activity. In some
instances, the dCas9 enzyme or a variant or fragment thereof can block
transcription of a target
sequence, and in some cases, block RNA polymerase. In other instances, the
dCas9 enzyme or a
variant or fragment thereof can activate transcription of a target sequence,
for example, when fused
41
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
to a transcriptional activator polypeptide. In some embodiments, the Cas
protein or protein variants
comprise one or more NLS sequences.
[0088] In some embodiments, the Cas protein can be a fusion protein which
comprises one or
more Cas nuclease domains fused to one or more heterologous functional domains
of a second
protein, with an optional intervening linker, wherein the linker does not
interfere with activity of
the fusion protein. Heterologous in this context means the functional domain
is from a protein
other than a Cas protein. In some embodiments, the heterologous functional
domain comprise an
enzymatic domain and/or a binding domain. In some embodiments, the
heterologous enzymatic
domain is a nuclease, a nickase, a recombinase, a deaminase, a
methyltransferase, a polymerase, a
reverse transcriptase, a methylase, an acetylase, an acetyltransferase, a
transcriptional activator, or
a transcriptional repressor domain. In some embodiments, the heterologous
enzymatic domain
comprises base editing activity, nucleotide deaminase activity, methylase
activity, demethylase
activity, translation activation activity, translation repression activity,
transcription activation
activity, transcription repression activity, transcription release factor
activity, chromatin modifying
or remodeling activity, histone modification activity, nuclease activity,
single-strand RNA
cleavage activity, double-strand RNA cleavage activity, single-strand DNA
cleavage activity,
double-strand DNA cleavage activity, nucleic acid binding activity, detectable
activity, or any
combination thereof
[0089] In some embodiments, the Cas protein comprises a heterologous
functional domain
which is a base editor, such as a cytidine deaminase domain, for example, from
the apolipoprotein
B mRNA-editing enzyme, catalytic polypeptide-like (APOBEC) family of
deaminases, including
APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D/E, APOBEC3F,
APOBEC3G, APOBEC3H, or APOBEC4; activation-induced cytidine deaminase (AID),
e.g.,
activation induced cytidine deaminase (AICDA); cytosine deaminase 1 (CDA1) or
CDA2; or
cytosine deaminase acting on tRNA (CDAT). In some embodiments, the
heterologous functional
domain is a deaminase that modifies adenosine DNA bases, e.g., the deaminase
is an adenosine
deaminase 1 (ADA1), ADA2; adenosine deaminase acting on RNA 1 (ADAR1), ADAR2,
ADAR3;
adenosine deaminase acting on tRNA 1 (ADAT1), ADAT2, ADAT3; and naturally
occurring or
engineered tRNA-specific adenosine deaminase (TadA). In some embodiments, the
heterologous
functional domain is a biological tether. In some embodiments, the biological
tether is MS2, Csy4
or lambda N protein. In some embodiments, the heterologous functional domain
is FokI.
42
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0090] In some embodiments, the Cas protein comprises a heterologous
functional domain
which is an enzyme, domain, or peptide that inhibits or enhances endogenous
DNA repair or base
excision repair (BER) pathways, for example, uracil DNA glycosylase inhibitor
(UGI) that inhibits
uracil DNA glycosylase (UDG, also known as uracil N-glycosylase, or UNG)
mediated excision
of uracil to initiate BER; or DNA end-binding proteins such as Gam from the
bacteriophage Mu.
[0091] In some embodiments, the Cas protein comprises a heterologous
functional domain
which is a transcriptional activation domain, for example, a VP64 domain, a
p65 domain, a MyoD1
domain, or a HSF1 domain. In some embodiments, the Cas protein comprises a
heterologous
functional domain which is a transcriptional repression domain, for example, a
Krueppel-
associated box (KRAB) domain, an ERF repressor domain (ERD), a mSin3A
interaction domain
(SID) domain, a SID4X domain, a NuE domain, or a NcoR domain. In some
embodiments, the
Cas protein comprises a heterologous functional domain which is a nuclease
domain, for example,
a Fokl domain. In some embodiments, In some embodiments, the Cas protein
comprises a
transcriptional silencer domain, for example, Heterochromatin Protein 1 (HP1),
e.g., HP 1 a or
HP1D. In some embodiments, the heterologous functional domain of the Cas
protein is an enzyme
that modifies the methylation state of DNA. In some embodiments, the enzyme
that modifies the
methylation state of DNA is a DNA methyltransferase (DNMT) or a TET protein.
In some
embodiments, the TET protein is TETI. In some embodiments, the heterologous
functional
domain of the Cas protein is an enzyme that modifies a histone subunit. In
some embodiments, the
enzyme that modifies a histone subunit is a histone acetyltransferase (HAT),
histone deacetylase
(HDAC), histone methyltransferase (HMT), or histone demethylase.
[0092] For gene regulation (e.g., modulating transcription of target DNA),
a nuclease-deficient
Cas protein, such as but not limited to dCas9, can be used for transcriptional
activation or
transcriptional repression. Methods of inactivating gene expression using a
nuclease-null Cas
protein are described, for example, in Larson et al., Nat. Protoc., 2013,
8(11):2180-2196.
[0093] In some embodiments, the Cas protein comprises one or more nuclear
localization
signal (NLS) domains. The one or more NLS domain(s) may be positioned at or
near or in
proximity to a terminus of the effector protein (e.g., C2c2) and if two or
more NLSs, each of the
two may be positioned at or near or in proximity to a terminus of the effector
protein (e.g., C2c2).
43
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0094] In some embodiments, a nucleotide sequence encoding the Cas protein
is present in a
recombinant expression vector. In certain instances, the recombinant
expression vector is a viral
construct, e.g., a recombinant adeno-associated virus construct, a recombinant
adenoviral construct,
a recombinant lentiviral construct, etc. For example, viral vectors can be
based on vaccinia virus,
poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus,
human
immunodeficiency virus, and the like. A retroviral vector can be based on
Murine Leukemia Virus,
spleen necrosis virus, and vectors derived from retroviruses such as Rous
Sarcoma Virus, Harvey
Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency
virus,
myeloproliferative sarcoma virus, mammary tumor virus, and the like. Useful
expression vectors
are known to those of skill in the art, and many are commercially available.
The following vectors
are provided by way of example for eukaryotic host cells: pXT1, pSG5, pSVK3,
pBPV, pMSG,
and pSVLSV40. However, any other vector may be used if it is compatible with
the host cell.
[0095] Depending on the target cell/expression system used, any of a number
of transcription
and translation control elements, including promoter, transcription enhancers,
transcription
terminators, and the like, may be used in the expression vector. Useful
promoters can be derived
from viruses, or any organism, e.g., prokaryotic or eukaryotic organisms.
Suitable promoters
include, but are not limited to, the 5V40 early promoter, mouse mammary tumor
virus long
terminal repeat (LTR) promoter; adenovirus major late promoter (Ad MLP); a
herpes simplex
virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV
immediate early
promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, a human U6 small
nuclear
promoter (U6), an enhanced U6 promoter, a human H1 promoter (H1), etc.
[0096] The Cas protein can be introduced into a cell (e.g., a cell such as
a primary cell for ex
vivo therapy, or an in vivo cell such as in a patient) as a Cas polypeptide,
an mRNA encoding a
Cas polypeptide, or a recombinant expression vector comprising a nucleotide
sequence encoding
a Cas polypeptide.
2. Chemically-Modified Guide RNA (gRNA)
[0097] The modified gRNAs for use in the CRISPR/Cas system of genome
modification
typically include a guide sequence that is complementary to a target nucleic
acid sequence and a
scaffold region that interacts with a Cas protein.
44
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[0098] The guide sequence of the modified guide RNA can be any
polynucleotide sequence
having sufficient complementarity with a target polynucleotide sequence (e.g.,
target DNA
sequence) to hybridize with the target sequence and direct sequence-specific
binding of a CRISPR
complex to the target sequence. In some embodiments, the degree of
complementarity between a
guide sequence of the modified guide RNA and its corresponding target
sequence, when optimally
aligned using a suitable alignment algorithm, is about or more than about 50%,
60%, 75%, 80%,
85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with
the use of any
suitable algorithm for aligning sequences, non-limiting example of which
include the Smith-
Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the
Burrows-
Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X,
BLAT, Novoalign
(Novocraft Technologies, ELAND (Illumina, San Diego, Calif), SOAP (available
at
soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some
embodiments, a
guide sequence is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length.
In some instances, a
guide sequence is about 20 nucleotides in length. In other instances, a guide
sequence is about 15
nucleotides in length. In other instances, a guide sequence is about 25
nucleotides in length. The
ability of a guide sequence to direct sequence-specific binding of a CRISPR
complex to a target
sequence may be assessed by any suitable assay. Binding can be assessed
directly, or indirectly by
using, e.g., editing or cleavage as a proxy. For example, the components of a
CRISPR system
sufficient to form a CRISPR complex, including the guide sequence to be
tested, may be provided
to a host cell having the corresponding target sequence, such as by
transfection with vectors
encoding the components of the CRISPR sequence, followed by an assessment of
editing or
cleavage within the target sequence. Similarly, cleavage of a target
polynucleotide sequence may
be evaluated in a test tube by providing the target sequence, components of a
CRISPR complex,
including the guide sequence to be tested and a control guide sequence
different from the test guide
sequence, and comparing binding or rate of cleavage at the target sequence
between the test and
control guide sequence reactions.
[0099] The nucleotide sequence of a guide RNA can be selected using any of
the web-based
software described above. Considerations for selecting a DNA-targeting RNA
include the PAM
sequence for the Cas protein (e.g., Cas9 polypeptide) to be used, and
strategies for minimizing off-
target modifications. Tools, such as the CRISPR Design Tool, can provide
sequences for preparing
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
the modified gRNA, for assessing target modification efficiency, and/or
assessing cleavage at off-
target sites. Another consideration for selecting the sequence of a modified
guide RNA includes
reducing the degree of secondary structure within the guide sequence.
Secondary structure may be
determined by any suitable polynucleotide folding algorithm. Some programs are
based on
calculating the minimal Gibbs free energy. Examples of suitable algorithms
include mFold (Zuker
and Stiegler, Nucleic Acids Res, 9 (1981), 133-148), UNAFold package (Markham
et al., Methods
Mol Biol, 2008, 453:3-31) and RNAfold form the ViennaRNA Package.
[00100] One or more nucleotides of the guide sequence and/or one or more
nucleotides of the
scaffold region of the modified guide RNA can be a modified nucleotide. For
instance, a guide
sequence that is about 20 nucleotides in length may have 1 or more, e.g., 1,
2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more modified nucleotides. In
some cases, the guide
sequence includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more modified
nucleotides. In other cases,
the guide sequence includes at least 2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 19, 20, or
more modified nucleotides. The modified nucleotides can be located at any
nucleic acid position
of the guide sequence. In other words, the modified nucleotides can be at or
near the first and/or
last nucleotide of the guide sequence, and/or at any position in between. For
example, for a guide
sequence that is 20 nucleotides in length, the one or more modified
nucleotides can be located at
nucleic acid position 1, position 2, position 3, position 4, position 5,
position 6, position 7, position
8, position 9, position 10, position 11, position 12, position 13, position
14, position 15, position
16, position 17, position 18, position 19, and/or position 20 of the guide
sequence. In certain
instances, from about 10% to about 30%, e.g., about 10% to about 25%, about
10% to about 20%,
about 10% to about 15%, about 15% to about 30%, about 20% to about 30%, or
about 25% to
about 30% of the guide sequence can comprise modified nucleotides. In other
instances, from
about 10% to about 30%, e.g., about 10%, about 11%, about 12%, about 13%,
about 14%, about
15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about
22%, about
23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, or
about 30% of the
guide sequence can comprise modified nucleotides.
[00101] In some embodiments, the scaffold region of the modified guide RNA
contains one or
more modified nucleotides. For example, a scaffold region that is about 80
nucleotides in length
may have 1 or more, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 76, 77,
78, 79, 80, or more modified
46
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
nucleotides. In some instances, the scaffold region includes at least 2, 3, 4,
5, 6, 7, 8, 9, 10, or more
modified nucleotides. In other instances, the scaffold region includes at
least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 19, 20, or more modified nucleotides. The
modified nucleotides can
be located at any nucleic acid position of the scaffold region. For example,
the modified
nucleotides can be at or near the first and/or last nucleotide of the scaffold
region, and/or at any
position in between. For example, for a scaffold region that is about 80
nucleotides in length, the
one or more modified nucleotides can be located at nucleic acid position 1,
position 2, position 3,
position 4, position 5, position 6, position 7, position 8, position 9,
position 10, position 11,
position 12, position 13, position 14, position 15, position 16, position 17,
position 18, position 19,
position 20, position 21, position 22, position 23, position 24, position 25,
position 26, position 27,
position 28, position 29, position 30, position 31, position 32, position 33,
position 34, position 35,
position 36, position 37, position 38, position 39, position 40, position 41,
position 42, position 43,
position 44, position 45, position 46, position 47, position 48, position 49,
position 50, position 51,
position 52, position 53, position 54, position 55, position 56, position 57,
position 58, position 59,
position 60, position 61, position 62, position 63, position 64, position 65,
position 66, position 67,
position 68, position 69, position 70, position 71, position 72, position 73,
position 74, position 75,
position 76, position 77, position 78, position 79, and/or position 80 of the
sequence. In some
instances, from about 1% to about 10%, e.g., about 1% to about 8%, about 1% to
about 5%, about
5% to about 10%, or about 3% to about 7% of the scaffold region can comprise
modified
nucleotides. In other instances, from about 1% to about 10%, e.g., about 1%,
about 2%, about 3%,
about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, or about 10% of
the scaffold
region can comprise modified nucleotides.
[00102] The modified nucleotides of the guide RNA can include a modification
in the ribose
(e.g., sugar) group, phosphate group, nucleobase, or any combination thereof.
In some
embodiments, the modification in the ribose group comprises a modification at
the 2' position of
the ribose.
[00103] In some embodiments, the modified nucleotide includes a 2' fluoro-
arabino nucleic acid,
tricycle-DNA (tc-DNA), peptide nucleic acid, cyclohexene nucleic acid (CeNA),
locked nucleic
acid (LNA), ethylene-bridged nucleic acid (ENA), xeno nucleic acid (XNA), a
phosphodiamidate
morpholino, or a combination thereof.
47
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[00104] Modified nucleotides or nucleotide analogues can include sugar- and/or
backbone-
modified ribonucleotides (i.e., include modifications to the phosphate-sugar
backbone). For
example, the phosphodiester linkages of a native or natural RNA may be
modified to include at
least one of a nitrogen or sulfur heteroatom. In some backbone-modified
ribonucleotides the
phosphoester group connecting to adjacent ribonucleotides may be replaced by a
modified group,
e.g., of phosphorothioate group. In preferred sugar-modified ribonucleotides,
the 2' moiety is a
group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or ON, wherein R is
Ci-C6 alkyl,
alkenyl or alkynyl and halo is F, Cl, Br or I.
[00105] In some embodiments, the modified nucleotide contains a sugar
modification. Non-
limiting examples of sugar modifications include 2'-deoxy-2'-fluoro-
oligoribonucleotide (2'-
fluoro-2'-deoxycytidine-5'-triphosphate, 2'-fluoro-2'-deoxyuridine-5'-
triphosphate), 2'-deoxy-2'-
deamine oligoribonucl eoti de
(2'-amino-2'-deoxycyti dine-5 '-triphosphate, 2'-amino-2'-
deoxyuri dine-5 '-triphosphate), 2'-0-alkyl
oligoribonucleotide, 2'-deoxy-2'-C-alkyl
oligoribonucleotide (2'-0 -methylcytidine-5'-triphosphate, 2'-methyluridine-5'-
triphosphate), 2'-
C-alkyl oligoribonucleotide, and isomers thereof (2'-aracytidine-5'-
triphosphate, 2'-arauridine-5'-
triphosphate), azidotriphosphate (2'-azido-2'-deoxycytidine-5'-triphosphate,
2'-azido-2'-
deoxyuridine-5'-triphosphate), and combinations thereof
[00106] In some embodiments, the modified guide RNA contains one or more 2'-
fluoro, 2'-
amino and/or 2'-thio modifications. In some instances, the modification is a
2'-fluoro-cytidine, 2'-
fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine,
2'-amino-uridine, 2'-
amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine, 5-
amino-allyl-uridine,
5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-
aminopurine, 2'-amino-
butyryl-pyrene-uridine, 5-fluoro-cytidine, and/or 5-fluoro-uridine.
[00107] There are more than 96 naturally occurring nucleoside modifications
found on
mammalian RNA. See, e.g., Limbach et al., Nucleic Acids Research, 22(12):2183-
2196 (1994).
The preparation of nucleotides and modified nucleotides and nucleosides are
well-known in the
art and described in, e.g., U.S. Pat. Nos. 4,373,071, 4,458,066, 4,500,707,
4,668,777, 4,973,679,
5,047,524, 5,132,418, 5,153,319, 5,262,530, and 5,700,642. Numerous modified
nucleosides and
modified nucleotides that are suitable for use as described herein are
commercially available. The
nucleoside can be an analogue of a naturally occurring nucleoside. In some
cases, the analogue is
48
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
dihydrouridine, methyl adenosine, methylcytidine, methyluridine,
methylpseudouridine,
thiouridine, deoxycytodine, and deoxyuridine.
[00108] In some cases, the modified guide RNA described herein includes a
nucleobase-
modified ribonucleotide, i.e., a ribonucleotide containing at least one non-
naturally occurring
nucleobase instead of a naturally occurring nucleobase. Non-limiting examples
of modified
nucleobases which can be incorporated into modified nucleosides and modified
nucleotides
include m5C (5-methylcytidine), m5U (5-methyluridine), m6A (N6-
methyladenosine), s2U (2-
thiouridine), Um (2'-0-methyluridine), ml A (1-methyl adenosine), m2A (2-
methyladenosine),
Am (2-1-0-methyladenosine), ms2m6A (2-methylthio-N6-methyladenosine), i6A (N6-
isopentenyl adenosine), ms2i6A (2-methylthio-N6-isopentenyladenosine), io6A
(N6-(cis-
hydroxyisopentenyl) adenosine), ms2io6A (2-methylthio-N6-(cis-
hydroxyisopentenyl)adenosine),
g6A (N6-glycinylcarbamoyladenosine), t6A (N6-threonyl carbamoyladenosine),
ms2t6A (2-
methylthio-N6-threonyl carb amoyladenosine), m6t6A
(N6-methyl-N6-
threonylcarbamoyladenosine), hn6A(N6-hydroxynorvalylcarbamoyl adenosine),
ms2hn6A (2-
methylthio-N6-hydroxynorvaly1 carbamoyladenosine), Ar(p) (2-0-
ribosyladenosine(phosphate)),
I (inosine), m 11 (1-methylinosine), m'Im (1,2'-0-dimethylinosine), m3C (3-
methylcytidine), Cm
(2T-0-methylcytidine), s2C (2-thiocytidine), ac4C (N4-acetylcytidine), f5C (5-
fonnylcytidine),
m5Cm (5,2-0-dimethylcytidine), ac4Cm (N4acetyl2TOmethylcytidine), k2C
(lysidine), m1G (1-
methylguanosine), m2G (N2-methylguanosine), m7G (7-methylguanosine), Gm (2'-0-
methylguanosine), m22G (N2,N2-dimethylguanosine), m2Gm (N2,2'-0-
dimethylguanosine),
m22Gm (N2,N2,2'-0-trimethylguanosine), Gr(p) (2'-0-
ribosylguanosine(phosphate)), yW
(wybutosine), o2yW (peroxywybutosine), OHyW (hydroxywybutosine), OHyW*
(undermodified
hydroxywybutosine), imG (wyosine), mimG (methylguanosine), Q (queuosine), oQ
(epoxyqueuosine), galQ (galactosyl-queuosine), manQ (mannosyl-queuosine),
preQo (7-cyano-7-
deazaguanosine), preQi (7-aminomethy1-7-deazaguanosine), G (archaeosine), D
(dihydrouridine),
m5Um (5,2'-0-dimethyluridine), s4U (4-thiouridine), m5 s2U (5-methy1-2-
thiouridine), s2Um (2-
thi o-2'-0-methyluri dine), acp3U (3 -(3 -
amino-3 -carb oxypropyl)uri di ne), ho5U (5-
hydroxyuridine), mo5U (5-methoxyuridine), cmo5U (uridine 5-oxyacetic acid),
mcmo5U (uridine
5-oxyacetic acid methyl ester), chm5U (5-(carboxyhydroxymethyl)uridine)),
mchm5U (5-
(carboxyhydroxymethyl)uridine methyl ester), mcm5U (5-methoxycarbonyl
methyluridine),
mcm5Um (S-m ethoxy carb onylm ethy1-2-0-m ethyluri dine),
mcm5 s2U (5-
49
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
methoxycarbonylmethy1-2-thiouridine), nm5 s2U (5-aminomethy1-2-thiouridine),
mnm5U (5-
methylaminomethyluridine), mnm5s2U (5-methylaminomethy1-2-thiouridine),
mnm5se2U (5-
methylaminomethy1-2-selenouridine), ncm5U (5-carbamoylmethyl uridine), ncm5Um
(5-
carbamoylmethy1-2'-0-methyluridine), cmnm5U (5-
carboxymethylaminomethyluridine),
cnmm5Um (5 -carb oxym ethyl ami nom ethy1-2-L-0-m ethyluri di ne),
cmnm5s2U (5-
carboxymethylaminomethy1-2-thiouridine), m62A (N6,N6-dimethyladenosine), Tm
(2'-0-
methylinosine), m4C (N4-methylcytidine), m4Cm (N4,2-0-dimethylcytidine), hm5C
(5-
hydroxymethylcytidine), m3U (3-methyluridine), cm5U (5-carboxymethyluridine),
m6Am (N6,T-
0-dimethyladenosine), m62Am (N6,N6,0-2-trimethyladenosine), m2'7G (N2,7-
dimethylguanosine), m2'2'7G (N2,N2,7-trimethylguanosine), m3Um (3,2T-0-
dimethyluridine),
m5D
(5-methyldihydrouridine), f5Cm (5-formy1-2'-0-methylcytidine), ml Gm (1,2'4)-
dimethylguanosine), m'Am (1,2-0-dimethyl adenosine)irinomethyluridine), tm5s2U
(S-
taurinomethy1-2-thiouridine)), imG-14 (4-demethyl guanosine), imG2
(isoguanosine), or ac6A
(N6-acetyladenosine), hypoxanthine, inosine, 8-oxo-adenine, 7-substituted
derivatives thereof,
dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5-aminouracil, 5-(C1-
C6)-alkyluracil, 5-
methyluracil, 5-(C2-C6)-alkenyluracil, 5-(C2-C6)-alkynyluracil, 5-
(hydroxymethyl)uracil, 5-
chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxy cytosine, 5-(C1-C6)-
alkylcytosine, 5-
methylcytosine, 5-(C2-C6)-alkenylcytosine, 5-(C2-C6)-alkynylcytosine, 5-
chlorocytosine, 5-
fluorocytosine, 5-bromocytosine, N2-dimethylguanine, 7-deazaguanine, 8-
azaguanine, 7-deaza-7-
substituted guanine, 7-deaza-7-(C2-C6)alkynylguanine, 7-deaza-8-sub stituted
guanine, 8-
hydroxyguanine, 6-thioguanine, 8-oxoguanine, 2-aminopurine, 2-amino-6-
chloropurine, 2,4-
diaminopurine, 2,6-diaminopurine, 8-azapurine, substituted 7-deazapurine, 7-
deaza-7-substituted
purine, 7-deaza-8-substituted purine, and combinations thereof
[00109] In some embodiments, the phosphate backbone of the guide RNA is
altered. The
modified gRNA can include one or more phosphorothioate, phosphoramidate (e.g.,
N3'-P5'-
phosphoramidate (NP)), 2'-0-methoxy-ethyl (2'MOE), 2'-0-methyl-ethyl (2'ME),
and/or
methylphosphonate linkages.
[00110] In particular embodiments, one or more of the modified nucleotides of
the guide
sequence and/or one or more of the modified nucleotides of the scaffold region
of the guide RNA
include a 2'-0-methyl (M) nucleotide, a 2'-0-methyl 3'-phosphorothioate (MS)
nucleotide, a 2'-
0-methy1-3'-phosphonoacetate (MP) nucleotide, a 2'-0-methyl 3'thioPACE (MSP)
nucleotide, or
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
a combination thereof In some instances, the guide RNA includes one or more MS
nucleotides.
In other instances, the guide RNA includes one or more MP/MSP nucleotides. In
yet other
instances, the guide RNA includes one or more MS nucleotides and one or more
1VIP/MSP
nucleotides. In further instances, the guide RNA does not include M
nucleotides. In certain
instances, the guide RNA includes one or more MS nucleotides and/or one or
more MP/MSP
nucleotides, and further includes one or more M nucleotides. In certain other
instances, MS
nucleotides and/or 1VIP/MSP nucleotides are the only modified nucleotides
present in the guide
RNA.
[00111] In some aspects, the modified guide RNA, and the Cas proteins (or mRNA
encoding
the same) described herein may be present in a composition (e.g., a CRISPR/Cas
reaction mixture)
in particular amounts, ratios, or ranges. For example, a reaction mixture may
comprise: a) 1 to 200
pmols of a guide RNA; b) 1 to 100 pmols of a Cas protein, or 0.01 to 3.0 pmols
of a DNA or
mRNA encoding a Cas protein; c) a guide RNA and a Cas protein, at a molar
ratio 0.1:1 to 3:1;
and/or d) a guide RNA and a DNA or mRNA encoding the Cas protein, at a molar
ratio of 1:1 to
200:1. For example, in some aspects, a reaction mixture comprises a plurality
of cells; and i) 1 to
100 pmols of the guide RNA (or pegRNA) per 100,000 cells, and/or ii) 1 to 50
pmols of the Cas
protein or 0.01 to 3.0 pmols of the DNA or mRNA encoding the Cas protein, per
100,000 cells.
Similarly, in some aspects, a reaction mixture may comprise at least, about,
or at most 10, 20, 30,
40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or
200 pmols of the guide
RNA, or an amount within a ranged bounded by any combination of the foregoing
values, per 1
pmol of the DNA or mRNA encoding the Cas protein. In some aspects, the molar
ratio of the guide
RNA to the DNA or mRNA encoding the Cas protein is at least, about, or at most
200:1, 190:1,
180:1, 170:1, 160:1, 150:1, 140:1, 130:1, 120:1, 110:1, 100:1, 90:1, 80:1,
70:1, 60:1, 50:1, 40:1,
30:1, 20:1, or 10:1, or a ratio within a range bounded by any combination of
the foregoing ratios.
In some aspects, a reaction mixture according to the disclosure comprises at
least, about, or at most
1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4,
2.5, 2.6, 2.7, 2.8, 2.9 or 3.0 pmols
of the guide RNA, or an amount within a range bounded by any combination of
the foregoing
values, per 1 pmol of the Cas protein.
[00112] It should be noted that any of the modifications described herein may
be combined and
incorporated in the guide sequence and/or the scaffold region of the modified
gRNA.
51
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[00113] In some cases, the guide RNA also includes a structural modification
such as a stem
loop, e.g., MS2 stem loop or tetraloop.
[00114] The guide RNA can be synthesized by any method known to one of
ordinary skill in
the art. Modified gRNAs can be synthesized using 2'-0-thionocarbamate-
protected nucleoside
phosphoramidites. Methods are described in, e.g., Dellinger et al., I American
Chemical
Society 133, 11540-11556 (2011); Threlfall et al., Organic & Biomolecular
Chemistry 10, 746-
754 (2012); and Dellinger et al., I American Chemical Society 125, 940-950
(2003).
[00115] The chemically modified gRNAs or pegRNAs can be used with any CRISPR-
associated technology, e.g., and RNA-guided technology. As described herein,
the guide RNA can
serve as a guide for any Cas protein or variant or fragment thereof, including
any engineered or
man-made Cas9 polypeptide. The modified gRNAs or pegRNAs can target DNA and/or
RNA
molecules in isolated primary cells for ex vivo therapy or in vivo (e.g., in
an animal). The methods
disclosed herein can be applied to genome editing, gene regulation, imaging,
and any other
CRISPR-based applications.
3. Donor Repair Template
[00116] In some embodiments, the present disclosure provides a recombinant
donor repair
template comprising two homology arms that are homologous to portions of a
target DNA
sequence (e.g., target gene or locus) at either side of a Cas protein (e.g.,
Cas9 nuclease) cleavage
site. In certain instances, the recombinant donor repair template comprises a
reporter cassette that
includes a nucleotide sequence encoding a reporter polypeptide (e.g., a
detectable polypeptide,
fluorescent polypeptide, or a selectable marker), and two homology arms that
flank the reporter
cassette and are homologous to portions of the target DNA at either side of
the Cas protein cleavage
site. The reporter cassette can further comprise a sequence encoding a self-
cleavage peptide, one
or more nuclear localization signals, and/or a fluorescent polypeptide, e.g.
superfolder GFP
(sfGFP).
[00117] In some embodiments, the homology arms are the same length. In other
embodiments,
the homology arms are different lengths. The homology arms can be at least
about 10 base pairs
(bp), e.g., at least about 10 bp, 15 bp, 20 bp, 25 bp, 30 bp, 35 bp, 45 bp, 55
bp, 65 bp, 75 bp, 85
bp, 95 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500
bp, 550 bp, 600
bp, 650 bp, 700 bp, 750 bp, 800 bp, 850 bp, 900 bp, 950 bp, 1000 bp, 1.1
kilobases (kb), 1.2 kb,
52
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb, 1.9 kb, 2.0 kb, 2.1 kb, 2.2
kb, 2.3 kb, 2.4 kb, 2.5 kb,
2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3.0 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb, 3.5
kb, 3.6 kb, 3.7 kb, 3.8 kb,
3.9 kb, 4.0 kb, or longer. The homology arms can be about 10 bp to about 4 kb,
e.g., about 10 bp
to about 20 bp, about 10 bp to about 50 bp, about 10 bp to about 100 bp, about
10 bp to about 200
bp, about 10 bp to about 500 bp, about 10 bp to about 1 kb, about 10 bp to
about 2 kb, about 10 bp
to about 4 kb, about 100 bp to about 200 bp, about 100 bp to about 500 bp,
about 100 bp to about
1 kb, about 100 bp to about 2 kb, about 100 bp to about 4 kb, about 500 bp to
about 1 kb, about
500 bp to about 2 kb, about 500 bp to about 4 kb, about 1 kb to about 2 kb,
about 1 kb to about 2
kb, about 1 kb to about 4 kb, or about 2 kb to about 4 kb.
[00118] The donor repair template can be cloned into an expression vector.
Conventional viral
and non-viral based expression vectors known to those of ordinary skill in the
art can be used.
[00119] In place of a recombinant donor repair template, a single-stranded
oligodeoxynucleotide (ssODN) donor template can be used for homologous
recombination-
mediated repair. An ssODN is useful for introducing short modifications within
a target DNA. For
instance, ssODN are suited for precisely correcting genetic mutations such as
SNPs. ssODNs can
contain two flanking, homologous sequences on each side of the target site of
Cas protein cleavage
and can be oriented in the sense or antisense direction relative to the target
DNA. Each flanking
sequence can be at least about 10 base pairs (bp), e.g., at least about 10 bp,
15 bp, 20 bp, 25 bp, 30
bp, 35 bp, 40 bp, 45 bp, 50 bp, 55 bp, 60 bp, 65 bp, 70 bp, 75 bp, 80 bp, 85
bp, 90 bp, 95 bp, 100
bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 550 bp,
600 bp, 650 bp, 700
bp, 750 bp, 800 bp, 850 bp, 900 bp, 950 bp, 1 kb, 2 kb, 4 kb, or longer. In
some embodiments,
each homology arm is about 10 bp to about 4 kb, e.g., about 10 bp to about 20
bp, about 10 bp to
about 50 bp, about 10 bp to about 100 bp, about 10 bp to about 200 bp, about
10 bp to about 500
bp, about 10 bp to about 1 kb, about 10 bp to about 2 kb, about 10 bp to about
4 kb, about 100 bp
to about 200 bp, about 100 bp to about 500 bp, about 100 bp to about 1 kb,
about 100 bp to about
2 kb, about 100 bp to about 4 kb, about 500 bp to about 1 kb, about 500 bp to
about 2 kb, about
500 bp to about 4 kb, about 1 kb to about 2 kb, about 1 kb to about 2 kb,
about 1 kb to about 4 kb,
or about 2 kb to about 4 kb. The ssODN can be at least about 25 nucleotides
(nt) in length, e.g., at
least about 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 70
nt, 75 nt, 80 nt, 85 nt, 90
nt, 95 nt, 100 nt, 150 nt, 200 nt, 250 nt, 300 nt, or longer. In some
embodiments, the ssODN is
53
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
about 25 to about 50; about 50 to about 100; about 100 to about 150; about 150
to about 200; about
200 to about 250; about 250 to about 300; or about 25 nt to about 300 nt in
length.
[00120] In some embodiments, the ssODN template comprises at least one,
e.g., 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, or more
modified nucleotides
described herein. In some instances, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%,
60%, 70%, 80%,
90%, or 99% of the sequence of the ssODN includes a modified nucleotide. In
some embodiments,
the modified nucleotides are located at one or both of the terminal ends of
the ssODN. The
modified nucleotides can be at the first, second, third, fourth, fifth, sixth,
seventh, eighth, ninth, or
tenth terminal nucleotide, or any combination thereof For instance, the
modified nucleotides can
be at the three terminal nucleotides at both ends of the ssODN template.
Additionally, the modified
nucleotides can be located internal to the terminal ends.
[00121] In some aspects, e.g., prime editing, an exogenous DNA repair template
is not required.
For example, the modified pegRNAs described herein include a reverse
transcriptase sequence
(e.g., at the 3' end in proximity to a primer binding site sequence)
containing one or more edits to
a target nucleic acid, which is used as a template by a prime editor Cas
protein when performing
prime editing of the target nucleic acid.
4. Target DNA
[00122] In the CRISPR/Cas system, the target DNA sequence can be immediately
followed by
a protospacer adjacent motif (PAM) sequence. The target DNA site may lie
immediately 5' of a
PAM sequence that is specific to the bacterial species of the Cas protein
used. For instance, the
PAM sequence of Streptococcus pyogenes-derived Cas9 is NGG; the PAM sequence
ofNeisseria
meningitidis-derived Cas9 is NNNNGATT; the PAM sequence of Streptococcus
thermophilus-
derived Cas9 is NNAGAA; and the PAM sequence of Treponema dent/cola-derived
Cas9 is
NAAAAC. In some embodiments, the PAM sequence can be 5'-NGG, wherein N is any
nucleotide;
5'-NRG, wherein N is any nucleotide and R is a purine; or 5'-NNGRR, wherein N
is any nucleotide
and R is a purine. For the S. pyogenes system, the selected target DNA
sequence should
immediately precede (e.g., be located 5') a 5rNIGG PAM, wherein N is any
nucleotide, such that
the guide sequence of the DNA-targeting RNA (e.g., modified gRNA) base pairs
with the opposite
strand to mediate cleavage at about 3 base pairs upstream of the PAM sequence.
54
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[00123] In some embodiments, the degree of complementarity between a guide
sequence of the
DNA-targeting RNA (e.g., guide RNA) and its corresponding target DNA sequence,
when
optimally aligned using a suitable alignment algorithm, is about or more than
about 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99%, or
more. Optimal alignment may be determined with the use of any suitable
algorithm for aligning
sequences, non-limiting example of which include the Smith-Waterman algorithm,
the
Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform
(e.g. the
Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft
Technologies,
Selangor, Malaysia), and ELAND (Illumina, San Diego, Calif).
[00124] The target DNA site can be selected in a predefined genomic sequence
(gene) using
web-based software such as ZiFiT Targeter software (Sander et al., 2007,
Nucleic Acids Res,
35:599-605; Sander et al., 2010, Nucleic Acids Res, 38:462-468), E-CRISP
(Heigwer et al., 2014,
Nat Methods, 11:122-123), RGEN Tools (Bae et al., 2014, Bioinformatics,
30(10):1473-1475),
CasFinder (Aach et al., 2014, bioRxiv), DNA2.0 gNRA Design Tool (DNA2.0, Menlo
Park,
Calif), and the CRISPick Design Tool (Broad Institute, Cambridge, Mass.). Such
tools analyze a
genomic sequence (e.g., gene or locus of interest) and identify suitable
target site for gene editing.
To assess off-target gene modifications for each DNA-targeting RNA (e.g.,
modified gRNA),
computationally predictions of off-target sites are made based on quantitative
specificity analysis
of base-pairing mismatch identity, position and distribution.
5. Modulating Gene Expression
[00125] The CRISPR/Cas system may be used to regulate gene expression, such as
inhibiting
gene expression or activating gene expression. As a non-limiting example, a
complex comprising
a Cas9 variant or fragment and an gRNA that can bind to a target DNA sequence
can block or
hinder transcription initiation and/elongation by RNA polymerase. This, in
turn, can inhibit or
repress gene expression of the target DNA. Alternatively, a complex comprising
a different Cas9
variant or fragment and an gRNA that can bind to a target DNA sequence can
induce or activate
gene expression of the target DNA.
[00126] Detailed descriptions of methods for performing CRISPR interference
(CRISPRi) to
inactivate or reduce gene expression can be found in, e.g., Larson et al.,
Nature Protocols, 2013,
8(11):2180-2196, and Qi et al., Cell, 152, 2013, 1173-1183. In CRISPRi, the
gRNA-Cas9 variant
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
complex can bind to a nontemplate strand of a protein-coding region and block
transcription
elongation. In some cases, when the gRNA-Cas9 variant complex binds to a
promoter region of a
gene, the complex prevents or hinders transcription initiation.
[00127] Detailed descriptions of methods for performing CRISPR activation to
increase gene
expression can be found in, e.g., Cheng et al., Cell Research, 2013, 23:1163-
1171, Konerman et
al., Nature, 2015, 517:583-588, and U.S. Pat. No. 8,697,359.
[00128] For CRISPR-based control of gene expression, a catalytically inactive
variant of the
Cas protein (e.g., Cas9 polypeptide) that lacks endonucleolytic activity can
be used. In some
embodiments, the Cas protein is a Cas9 variant that contains at least two
point mutations in the
RuvC-like and HNH nuclease domains. In some embodiments, the Cas9 variant has
D 1 OA and
H840A amino acid substitutions, which is referred to as dCas9 (Jinek et al.,
Science, 2012,
337:816-821; Qi et al., Cell, 152(5)1173-1183). In some cases, the dCas9
polypeptide
from Streptococcus pyogenes comprises at least one mutation at position D10,
G12, G17, E762,
H840, N854, N863, H982, H983, A984, D986, A987 or any combination thereof
Descriptions of
such dCas9 polypeptides and variants thereof are provided in, for example,
International Patent
Application Pub. No. W02013/176772. The dCas9 enzyme can contain a mutation at
D10, E762,
H983 or D986, as well as a mutation at H840 or N863. In some cases, the dCas9
enzyme contains
a DlOA or DION mutation. Also, the dCas9 enzyme can include a H840A, H840Y, or
H840N. In
some cases, the dCas9 enzyme comprises D 1 OA and H840A; D 1 OA and H840Y; D 1
OA and
H840N; DION and H840A; DION and H840Y; or DION and H840N substitutions. The
substitutions can be conservative or non-conservative substitutions to render
the Cas9 polypeptide
catalytically inactive and able to bind to target DNA.
[00129] In certain embodiments, the dCas9 polypeptide is catalytically
inactive such as
defective in nuclease activity. In some instances, the dCas9 enzyme or a
variant or fragment thereof
can block transcription of a target sequence, and in some cases, block RNA
polymerase. In other
instances, the dCas9 enzyme or a variant or fragment thereof can activate
transcription of a target
sequence.
[00130] In certain embodiments, the Cas9 variant lacking endonucleolytic
activity (e.g., dCas9)
can be fused to a transcriptional repression domain, e.g., a Kruppel
associated box (KRAB) domain,
or a transcriptional activation domain, e.g., a VP16 transactivation domain.
In some embodiments,
56
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
the Cas9 variant is a fusion polypeptide comprising dCas9 and a transcription
factor, e.g., RNA
polymerase omega factor, heat shock factor 1, or a fragment thereof In other
embodiments, the
Cas9 variant is a fusion polypeptide comprising dCas9 and a DNA methylase,
histone acetylase,
or a fragment thereof.
[00131] For CRISPR-based control of gene expression mediated by RNA binding
and/or RNA
cleavage, a suitable Cas protein (e.g., Cas9 polypeptide) variant having
endoribonuclease activity,
as described in, e.g., O'Connell et al., Nature, 2014, 516:263-266, can be
used. Other useful Cas
protein (e.g., Cas9) variants are described in, e.g., U.S. Patent No.
9,745,610. Other CRISPR-
related enzymes that can cleave RNA include a Csy4 endoribonuclease, a CRISPR-
related Cas6
enzyme, a Cas5 family member enzyme, a Cas6 family member enzyme, a Type I
CRISPR system
endoribonuclease, a Type II CRISPR system endoribonuclease, a Type III CRISPR
system
endoribonuclease, and variants thereof
[00132] In some embodiments of CRISPR-based RNA cleavage, a DNA
oligonucleotide
containing a PAM sequence (e.g., PAMmer) is used with the modified gRNA and
Cas protein (e.g.,
Cas9) variant described herein to bind to and cleave a single-stranded RNA
transcript. Detailed
descriptions of suitable PAMmer sequences are found in, e.g., O'Connell et
al., Nature, 2014,
516:263-266.
[00133] In some embodiments, a plurality of modified gRNAs and/or pegRNAs is
used to target
different regions of a target gene to regulate gene expression of that target
gene. The plurality of
modified gRNAs and/or pegRNAs can provide synergistic modulation (e.g.,
inhibition or
activation) of gene expression of a single target gene compared to each
modified gRNA alone. In
other embodiments, a plurality of modified gRNAs/pegRNAs is used to regulate
gene expression
of at least two different target genes.
[00134] B. Cells Ex Vivo
[00135] In some aspects of the present methods, the target sequence is in a
cell. The present
methods can be used to edit, modulate, cleave, nick, or bind a target sequence
in a nucleic acid in
any cell of interest, including primary cells, immortalized cells, cells from
cell lines, cells from
cell culture, and others. In some embodiments, the cell is a cell type with
one or challenging
conditions. For example, cells having high nuclease (e.g. ribonuclease,
exonuclease,
57
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
exoribonuclease) expression, concentration and/or activity, for example, cell
types high in a
particular nuclease.
[00136] The compositions and methods disclosed herein can be used to edit or
regulate the
expression of a target nucleic acid in a primary cell of interest. The primary
cell can be a cell
isolated from any multicellular organism, e.g., a plant cell (e.g., a rice
cell, a wheat cell, a tomato
cell, an Arabidopsis thaliana cell, a Zea mays cell, and the like), a cell
from a multicellular protist,
a cell from a multicellular fungus, an animal cell such as a cell from an
invertebrate animal (e.g.,
fruit fly, cnidarian, echinoderm, nematode, etc.) or a cell from a vertebrate
animal (e.g., fish,
amphibian, reptile, bird, mammal, etc.), a cell from a human, a cell from a
healthy human, a cell
from a human patient, a cell from a cancer patient, etc. In some cases, the
primary cell with genome
edits or induced gene regulation can be transplanted to a subject (e.g.,
patient). For instance, the
primary cell can be derived from the subject (e.g., patient) to be treated.
[00137] Any type of primary cell may be of interest, such as a stem cell,
e.g., embryonic stem
cell, induced pluripotent stem cell, adult stem cell (e.g., mesenchymal stem
cell, neural stem cell,
hematopoietic stem cell, organ stem cell), a progenitor cell, a somatic cell
(e.g., fibroblast,
hepatocyte, heart cell, liver cell, pancreatic cell, muscle cell, skin cell,
blood cell, neural cell,
immune cell), and any other cell of the body, e.g., human body. Primary cells
are typically derived
from a subject, e.g., an animal subject or a human subject, and allowed to
grow in vitro for a limited
number of passages. In some embodiments, the cells are disease cells or
derived from a subject
with a disease. For instance, the cells can be cancer or tumor cells.
[00138] Primary cells can be harvested from a subject by any standard method.
For instance,
cells from tissues, such as skin, muscle, bone marrow, spleen, liver, kidney,
pancreas, lung,
intestine, stomach, etc., can be harvested by a tissue biopsy or a fine needle
aspirate. Blood cells
and/or immune cells can be isolated from whole blood, plasma or serum. In some
cases, suitable
primary cells include peripheral blood mononuclear cells (PBMC), peripheral
blood lymphocytes
(PBL), and other blood cell subsets such as, but not limited to, T cell, a
natural killer cell, a
monocyte, a natural killer T cell, a monocyte-precursor cell, a hematopoietic
stem and progenitor
cell (HSPC) such as CD34+ HSPCs, or a non-pluripotent stem cell. In some
cases, the cell can be
any immune cell including, but not limited to, any T cell such as tumor
infiltrating cells (TILs),
CD3+ T cells, CD4+ T cells, CD8+ T cells, or any other type of T cell. The T
cell can also include
58
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
memory T cells, memory stem T cells, or effector T cells. The T cells can also
be skewed towards
particular populations and phenotypes. For example, the T cells can be skewed
to phenotypically
comprise CD45R0(¨), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+) and/or IL-
7Ra(+).
Suitable cells can be selected that comprise one of more markers selected from
a list comprising
CD45R0(¨), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+) and/or IL-7Ra(+).
Induced
pluripotent stem cells can be generated from differentiated cells according to
standard protocols
described in, for example, U.S. Pat. Nos. 7,682,828, 8,058,065, 8,530,238,
8,871,504, 8,900,871
and 8,791,248.
C. Ex Vivo Therapy
[00139] The methods described herein can be used in ex vivo therapy. Ex
vivo therapy can
comprise administering a composition (e.g., a cell) generated or modified
outside of an organism
to a subject (e.g., patient). In some embodiments, the composition (e.g.
comprising a cell) can be
generated or modified by the methods disclosed herein. For example, ex vivo
therapy can comprise
administering a primary cell generated or modified outside of an organism to a
subject (e.g.,
patient), wherein the primary cell has been cultured and edited/modulated in
vitro in accordance
with the methods of the present disclosure that includes contacting the target
nucleic acid in the
primary cell with one or more modified gRNAs described herein and a Cas
protein (e.g., Cas9
polypeptide) or variant or fragment thereof, an mRNA encoding a Cas protein
(e.g., Cas9
polypeptide) or variant or fragment thereof, or a recombinant expression
vector comprising a
nucleotide sequence encoding a Cas protein (e.g., Cas9 polypeptide) or variant
or fragment thereof
[00140] In some embodiments, the composition (e.g., a cell) can be derived
from the subject
(e.g., patient) to be treated by ex vivo therapy. In some embodiments, ex vivo
therapy can include
cell-based therapy, such as adoptive immunotherapy.
[00141] In some embodiments, the composition used in ex vivo therapy can be a
cell. The cell
can be a primary cell, including but not limited to, peripheral blood
mononuclear cells (PBMCs),
peripheral blood lymphocytes (PBLs), and other blood cell subsets. The primary
cell can be an
immune cell. The primary cell can be a T cell (e.g., CD3+ T cells, CD4+ T
cells, and/or CD8+ T
cells), a natural killer cell, a monocyte, a natural killer T cell, a monocyte-
precursor cell, a
hematopoietic stem cell or a non-pluripotent stem cell, a stem cell, or a
progenitor cell. The primary
59
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
cell can be a hematopoietic stem or progenitor cell (HSPC) such as CD34+
HSPCs. The primary
cell can be a human cell. The primary cell can be isolated, selected, and/or
cultured. The primary
cell can be expanded ex vivo. The primary cell can be expanded in vivo. The
primary cell can be
CD45R0(¨), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and/or IL-7Ra(+).
The
primary cell can be autologous to a subject receiving the cell. Or the primary
cell can be non-
autologous to the subject. The primary cell can be a good manufacturing
practices (G1VIP)
compatible reagent. The primary cell can be a part of a combination therapy to
treat diseases,
including cancer, infections, autoimmune disorders, or graft-versus-host
disease (GVHD), in a
subject having or at risk for such diseases.
[00142] As a non-limiting example of ex vivo therapy, a primary cell can be
isolated from a
multicellular organism (e.g., a plant, multicellular protist, multicellular
fungus, invertebrate animal,
vertebrate animal such as human, etc.) prior to contacting a target nucleic
acid within the primary
cell with a Cas protein and a modified gRNA. After contacting the target
nucleic acid with the Cas
protein and the guide RNA, the primary cell or its progeny (e.g., a cell
derived from the primary
cell) can be returned to the multicellular organism.
[00143] In some embodiments, the Cas protein and the guide RNA are introduced
into a living
organism, such as by introduction to a serum-containing fluid in or from the
living organism (e.g.,
whole blood, plasma or serum).
D. Methods for Introducing Nucleic Acids and/or Polypeptides Into Target Cells
[00144] Methods for introducing polypeptides and nucleic acids into a target
cell (host cell) are
known in the art and can be employed in the present methods, to introduce a
nucleic acid (e.g., a
nucleotide sequence encoding a Cas protein, a modified guide RNA, a donor
repair template for
homology-directed repair (HDR), etc.), a polypeptide (such as a Cas protein, a
polymerase, a
deaminase, etc.), or an RNP (e.g. gRNA/Cas protein complex) into a cell, e.g.,
a primary cell such
as a stem cell, a progenitor cell, or a differentiated cell. Non-limiting
examples of suitable methods
include electroporation, viral or bacteriophage infection, transfection,
microinjection, conjugation,
protoplast fusion, lipofection, calcium phosphate precipitation,
polyethyleneimine (PEI)-mediated
transfection, DEAE-dextran mediated transfection, liposome-mediated
transfection, particle gun
technology, calcium phosphate precipitation, direct microinjection,
nanoparticle-mediated
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
delivery (e.g. lipid nanoparticle-mediated delivery, polymer nanoparticle-
mediated delivery,
hybrid lipid-polymer nanoparticle mediated delivery), and the like.
[00145] In some embodiments, the components of a CRISPR system can be
introduced into a
cell using a delivery system. In certain instances, the delivery system
comprises a nanoparticle, a
microparticle (e.g., a polymer micropolymer), a liposome, a micelle, a
virosome, a viral particle,
a virus-like particle (VLP), a nucleic acid complex, a transfection agent, an
electroporation agent
(e.g., using a NEON transfection system), a nucleofection agent, a lipofection
agent, and/or a
buffer system that includes the component(s) to be delivered. For instance,
the components can be
mixed with a lipofection agent such that they are encapsulated or packaged
into cationic submicron
oil-in-water emulsions. Alternatively, the components can be delivered without
a delivery system,
e.g., as an aqueous solution.
[00146] Methods of preparing liposomes and encapsulating polypeptides and
nucleic acids in
liposomes are described in, e.g., Methods and Protocols, Volume 1:
Pharmaceutical Nanocarriers:
Methods and Protocols. (ed. Weissig). Humana Press, 2009 and Heyes et al.
(2005) J Controlled
Release 107:276-87. Methods of preparing microparticles and encapsulating
polypeptides and
nucleic acids are described in, e.g., Functional Polymer Colloids and
Microparticles volume 4
(Microspheres, microcapsules & liposomes). (eds. Arshady & Guyot). Citus
Books, 2002
and Microparticulate Systems for the Delivery of Proteins and Vaccines. (eds.
Cohen & Bernstein).
CRC Press, 1996. See Advanced Drug Delivery Reviews 2021, Volume 168, for
reviews on
preparation of nanoparticles such as lipid, polymer or hybrid lipid-polymer
nanoparticles.
[00147] E. Methods for Assessing the Efficiency of Genome Editing
[00148] To functionally test the presence of the correct genomic editing
modification, the target
DNA can be analyzed by standard methods known to those in the art. For
example, indel mutations
can be identified by sequencing using the SURVEYOR mutation detection kit
(Integrated DNA
Technologies, Coralville, Iowa) or the GuideitTM Indel Identification Kit
(Clontech, Mountain
View, Calif.). Homology-directed repair (HDR), base editing, or prime editing-
mediated edits can
be detected by PCR-based methods, and in combination with sequencing or RFLP
analysis. Non-
limiting examples of PCR-based kits include the Guide-it Mutation Detection
Kit (Clontech) and
the GeneArt Genomic Cleavage Detection Kit (Life Technologies, Carlsbad,
Calif.). Deep
61
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
sequencing can also be used, particularly for a large number of samples or
potential target/off-
target sites.
[00149] In certain embodiments, the efficiency (e.g., specificity) of
genome editing corresponds
to the number or percentage of on-target genome editing events relative to the
number or
percentage of all genome editing events, including on-target and off-target
events. In some
embodiments, the efficiency of editing of a target region corresponds to the
number of expected
editing of that target region, at the level of either single cells or cell
populations.
[00150] In some embodiments, the modified gRNAs described herein are capable
of enhancing
genome editing of a target DNA sequence in a cell such as a primary cell
relative to the
corresponding unmodified gRNAs. The genome editing can comprise homology-
directed repair
(HDR) (e.g., insertions, deletions, or point mutations), prime editing, base
editing, or
nonhomologous end joining (NHEJ).
[00151] In certain embodiments, the nuclease-mediated genome editing
efficiency of a target
DNA sequence in a cell is enhanced by at least about 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%,
45%, 0.5-fold, 0.6-fold, 0.7-fold, 0.8-fold, 0.9-fold, 1-fold, 1.1-fold, 1.2-
fold, 1.3-fold, 1.4-fold,
1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-
fold, 6-fold, 6.5-fold, 7-fold,
7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold, 15-fold, 20-fold, 25-
fold, 30-fold, 35-fold, 40-
fold, 45-fold, 50-fold, or greater in the presence of a guide RNA described
herein compared to the
corresponding unmodified gRNA sequence. In some other embodiments, the
efficiency is
compared to a corresponding gRNA with different modifications and achieves a
level of
enhancement described above. For example, gRNAs with lx, 2x, or 3x MS at the
5' end as well
as 2x, 3x, or 4x MP or MSP at the 3' end, may be compared to gRNAs with the
same number of
MS instead of MP/MSP (i.e. lx, 2x, or 3x MS at the 5' end as well as 2x, 3x,
or 4x MS at the 3'
end).
F. Methods for Preventing or Treating a Genetic Disease in a Subject
[00152] The modified gRNAs can be applied to targeted nuclease-based
therapeutics of genetic
diseases. Current approaches for precisely correcting genetic mutations in the
genome of primary
patient cells can be very inefficient (sometimes less than 1% of cells can be
precisely edited). The
modified gRNAs described herein can enhance the activity of genome editing and
increase the
efficacy of genome editing-based therapies. In particular embodiments,
modified gRNAs may be
62
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
used for in vivo gene editing of genes in subjects with a genetic disease. The
modified gRNAs can
be administered to a subject via any suitable route of administration and at
doses or amounts
sufficient to enhance the effect (e.g., improve the genome editing efficiency)
of the nuclease-based
therapy.
[00153] Provided herein is a method for preventing or treating a genetic
disease in a subject in
need thereof by correcting a genetic mutation associated with the disease. The
method includes
administering to the subject a modified guide RNA described herein in an
amount that is sufficient
to correct the mutation. Also provided herein is the use of a modified guide
RNA described herein
in the manufacture of a medicament for preventing or treating a genetic
disease in a subject in need
thereof by correcting a genetic mutation associated with the disease. The
modified guide RNA can
be contained in a composition that also includes a Cas protein (e.g., Cas9
polypeptide), an mRNA
encoding a Cas protein , or a recombinant expression vector comprising a
nucleotide sequence
encoding a Cas protein . In some instances, the modified guide RNA is included
in a delivery
system described above.
[00154] The genetic diseases that may be corrected by the method include, but
are not limited
to, X-linked severe combined immune deficiency, sickle cell anemia,
thalassemia, hemophilia,
neoplasia, cancer, age-related macular degeneration, schizophrenia,
trinucleotide repeat disorders,
fragile X syndrome, prion-related disorders, amyotrophic lateral sclerosis,
drug addiction, autism,
Alzheimer's disease, Parkinson's disease, cystic fibrosis, blood and
coagulation disease or
disorders, inflammation, immune-related diseases or disorders, metabolic
diseases, liver diseases
and disorders, kidney diseases and disorders, muscular/skeletal diseases and
disorders (e.g.,
muscular dystrophy, Duchenne muscular dystrophy), neurological and neuronal
diseases and
disorders, cardiovascular diseases and disorders, pulmonary diseases and
disorders, ocular
diseases and disorders, viral infections (e.g., HIV infection), and the like.
EXAMPLES
[00155] Aspects of the present teachings can be further understood in light of
the following
examples, which should not be construed as limiting the scope of the present
teachings in any
way.
[00156] Various general methods and reagents were used in the examples which
follow, and
are described below to facilitate understanding of the examples, though it
should be understood
63
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
that variations and alternatives in preparation, testing and other details may
be employed in
accordance with the teachings herein.
[00157] Preparation of gRNAs and mRNAs. RNA oligomers were synthesized on Dr.
Oligo
48 and 96 synthesizers (Biolytic Lab Performance Inc.) using 2'-0-
thionocarbamate-protected
nucleoside phosphoramidites (Sigma-Aldrich and Hongene) on controlled pore
glass (LGC)
according to previously described procedures. The 2'-0-methy1-3'-0-
(diisopropylamino)-
phosphinoacetic acid-1,1-dimethylcyanoethyl ester-5'-0-dimethoxytrityl
nucleosides used for
synthesis of MP-modified RNAs were purchased from Glen Research and Hongene.
For
phosphorothioate containing oligomers, the iodine oxidation step after the
coupling reaction was
replaced by a sulfurization step using a 0.05 M solution of 3-((N,N-
dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-5-thione in a pyridine-
acetonitrile (3:2)
mixture for 6 min. Unless otherwise noted, reagents for solid-phase RNA
synthesis were
purchased from Glen Research and Honeywell. The phosphonoacetate modifications
incorporated in the 1VIP-modified gRNAs were synthesized using protocols
adapted from
previous publications (see, e.g., Dellinger et al., 2003 and Threlfall et al.,
2012, supra), by using
the commercially available protected nucleoside phosphinoamidite monomers
above. All
oligonucleotides were purified using reversed-phase high-performance liquid
chromatography
(RP-HPLC) and analyzed by liquid chromatography¨mass spectrometry (LC-MS)
using an
Agilent 1290 Infinity series LC system coupled to an Agilent 6545 Q-TOF (time-
of-flight) mass
spectrometer. In all cases, the mass determined by deconvolution of the series
of peaks
comprising multiple charge states in a mass spectrum of purified gRNA matched
the expected
mass within error of the calibrated instrument (the specification for quality
assurance used in this
assay is that the observed mass of purified gRNA is within 0.01% of the
calculated mass), thus
confirming the composition of each synthetic gRNA.
[00158] CleanCap Cas9 mRNA fully substituted with 5-methoxyuridine was
purchased from
TriLink (L-7206). BE4-Gam mRNA and PE2 mRNA, which encode BE4-Gam protein and
PE2
protein respectively, were purchased from TriLink as custom orders by
providing the coding
sequences to which TriLink added their own proprietary 5' and 3' UTRs. The
custom mRNAs
were fully substituted with 5-methylcytidine and pseudouridine, capped with
CleanCap AG, and
polyA tailed.
64
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[00159] Cell culture and nucleofections. Human K562 cells were obtained from
ATCC and
cultured in RPMI 1640 + GlutaMax media (gibco) supplemented with 10% fetal
bovine serum
(gibco). K562 cells (within passage number 4 to 14) were nucleofected using a
Lonza 4D-
Nucleofector (96-well shuttle device, program FF-120) per manufacturer's
instructions utilizing
a Lonza SF Cell Line kit (V4SC-2960) with 0.2 million cells per transfection
in 20 [EL of SF
buffer combined with 6 [EL of 125 pmoles of gRNA and 1.87 pmoles of BE4-Gam
mRNA in
PBS buffer for cytidine base editing or combined with 8 [EL of 125 pmoles of
pegRNA with 100
pmoles of nicking gRNA and 1.35 pmoles of PE2 mRNA in PBS buffer for prime
editing. Cells
were cultured at 37 C in ambient oxygen and 5% carbon dioxide and were
harvested at 48 hr
post-transfection.
[00160] Human Jurkat Clone E6-1 cells were obtained from ATCC and were
cultured in
RPMI 1640 + GlutaMax media supplemented with 10% fetal bovine serum. Jurkat
cells (within
passage number 7 to 20) were nucleofected (program CL-120) utilizing a Lonza
SE Cell Line kit
(V4SC-1960) with 0.2 million cells in 20 [EL of SE buffer combined with 8 [EL
of 125 pmoles of
pegRNA, 100 pmoles of nicking gRNA and 1.35 pmoles of PE2 mRNA in PBS buffer.
Cultured
cells were harvested at 72 hr post-transfection.
[00161] Human HepG2 cells were obtained from ATCC and were cultured in
Dulbecco's
Modified Eagle's Medium (DMEM) + L-Glutamine + 4.5 g/L D-Glucose media (gibco)
supplemented with 10% fetal bovine serum. HepG2 cells (within passage number 4
to 13) were
spun down from culture media and were either rinsed or not with PBS and spun
down again.
Cells were nucleofected (program EH-100) utilizing a Lonza SF Cell Line kit
(V4SC-2960) with
0.2 million cells in 20 [EL of SF buffer combined with 3 [EL of 10 pmoles of
gRNA and 0.0625
pmoles of Cas9 mRNA in PBS buffer, or were nucleofected in the presence of
residual serum by
combining 0.2 million cells in 20 [EL of SF buffer with 5 [EL of 30 pmoles of
gRNA and 0.5
pmoles of Cas9 mRNA or 12.5 pmoles of S. pyogenes Cas9 (SpCas9) protein
(Aldeveron) in
PBS buffer. For 163mer gRNAs, 0.2 million cells were likewise nucleofected in
the presence of
residual serum and SF buffer by combining these with 5 [EL of 125 pmoles of
163mer gRNA and
50 pmoles of SpCas9 protein in PBS buffer. For all RNP transfections, gRNA was
pre-
complexed with SpCas9 protein (Aldevron) in PBS buffer by combining and
incubating at room
temperature for about 20 min before combining with cells in SF buffer for
nucleofection. For
mRNA transfections, gRNA was likewise combined with Cas9 mRNA (TriLink) in PBS
buffer
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
and kept on ice for about 20 min until combined with cells in SF buffer for
nucleofection.
Cultured HepG2 cells were harvested at about 72 hr post-transfection.
[00162] Human primary T cells (LP, CR, CD3+, NS) were obtained from AllCells
(Alameda,
CA) and were cultured in RPMI 1640 + GlutaMax media supplemented with 10%
fetal bovine
serum, 5ng/mL of human IL-7 and 5ng/mL of human IL-15 (gibco). Primary T cells
were
activated for 48 hr with anti-human CD3/CD28 magnetic Dynabeads (Thermo
Fisher) at a beads-
to-cells concentration of 3:1. Debeaded primary T cells were nucleofected
(program EO-115)
utilizing a Lonza P3 Primary Cell kit (V4SP-3960) with 0.2 million cells in 20
pL of P3 buffer
combined with 2.7 pL of 5 pmoles of gRNA and 0.0625 pmoles of Cas9 mRNA in PBS
buffer.
Cultured cells were harvested at 7 days post-transfection. Throughout the
culture period, T cells
were maintained at an approximate density of 1M cells per mL of media.
Following
electroporation, additional media was added every 2 days.
[00163] qRT-PCR assays. Human K562 cells were cultured as above, and 0.2
million cells
per replicate were nucleofected with 125 pmoles of gRNA (without Cas9 mRNA or
protein) as
described. For each timepoint, cells were collected in 1.7-mL Eppendorf tubes,
rinsed with PBS,
then resuspended in 750 pL of Qiazol and kept at room temperature for 5 min
before transferring
to a -20 C freezer. Total RNA in PBS was isolated from Qiazol plus chloroform
extracts using a
miRNeasy kit (Qiagen) on a QiaCube HT and then immediately reverse transcribed
using a
Protoscript II first-strand cDNA synthesis kit (NEB). qRT-PCR was performed on
an Applied
Biosystems QuantStudio 6 Flex instrument using TaqPath ProAmp master mix with
two TaqMan
MGB probes, one for gRNA labeled with FAM and the other for U6 snRNA labeled
with VIC
(Thermo Fisher) for normalization to the amount of total RNA isolated,
calculated as ACt. The
ACt values for triplicate samples were averaged and normalized to the lowest
observed mean
ACt value to calculate AACt values. Relative gRNA levels were calculated as 2 -
AACt.
[00164] PCR-targeted deep sequencing and quantification of targeted genomic
modifications.
Genomic DNA purification and construction of PCR-targeted deep sequencing
libraries were
performed as previously described. Library concentration was determined using
a Qubit dsDNA
BR assay kit (Thermo Fisher). Paired-end 2x220-bp reads were sequenced on a
MiSeq (Illumina)
at 0.8 ng/pL of PCR-amplified library along with 20.5% PhiX.
[00165] Paired-end reads were merged using FLASH version 1.2.11 software and
then
mapped to the human genome using BWA-MEM software (bwa-0.7.10) set to default
66
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
parameters. Reads were scored as having an indel or not according to whether
an insertion or a
deletion was found within 10 bp's of the Cas9 cleavage site. For prime editing
analysis, reads
were scored as having an edit if the desired edit was identified in the read.
For cytidine base
editing analysis, reads were scored as base edited if cytidines were edited
within a window of
10-20 bp upstream of the PAM site. For each replicate in each experiment,
mapped reads were
segregated according to mapped amplicon locus and were binned by the presence
or absence of
an indel or edit. The tally of reads per bin was used to calculate %indels or
%edits produced at
each locus. Indel or edit yields and standard deviations for plots were
calculated by logit
transformation of %indels or %edits, transformed as ln(r/(1-r)) where r is
%indels or %edits per
specific locus, to closely approximate a normal distribution. Triplicate mock
transfections
provided a mean mock control (or negative control), and triplicate samples
showing a mean indel
yield or mean edit yield significantly higher (t-test p <0.05) than the
corresponding negative
control were considered above background.
Example 1
[00166] This example evaluated the stability of guide RNAs having 2'-0-methy1-
3'-
phosphonoacetate (MP) and 2'-0-methyl-3'-phosphorothioate (MS) modifications
at their 3'
ends. To evaluate the relative lifetimes of single-guide RNAs with MS or MP
modifications at
the 3' end in transfected cells, guide RNAs were synthesized with MS
modifications at the first
three internucleotide linkages at the 5' end and either MS modifications at
the last three
internucleotide linkages at the 3' end (denoted as 3xMS,3xMS) or 2, 3 or 4
consecutive MP
modifications at the terminal internucleotide linkages at the 3' end (denoted
as 3xMS,2x1V1P;
3xMS,3xMP; and 3xMS,4xMP; respectively). Each modified gRNA was transfected
individually
into human K562 cells in the absence of Cas9, and qRT-PCR was used to measure
the relative
amount of sgRNA remaining in cells collected at a series of timepoints from 1
to 96 hours post-
transfection.
[00167] As shown by FIG. 7, a much steeper decline in the relative level of
the 3xMS,3xMS
gRNA detected across 1, 6, and 24 h post-transfection was observed, in
comparison to that for
any of the gRNAs modified with MPs at the 3' end (either two, three, or four
consecutive MPs).
Specifically, at 1 h post-transfection, the relative amounts of transfected
gRNA differed by only
2.6-fold with largely overlapping error bars among all four variations of 3'
end protection,
67
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
whereas much larger differences were observed at 6 h post-transfection, when
the remaining
amount of 3xMS,3xMS-protected gRNA had dropped to a relative level of about 1
/10 (0.039)
that of the 3xMS,3xMP- and 3xMS,4xMP-protected gRNAs (0.341¨ 0.351). The
differences
became even larger at the 24 h time point where they varied according to the
level of 3' end
protection in a logical progression from having 3xMS to 2xMP to 3x1\4P to
4x1\4P at the 3' end,
resulting in residual gRNA levels that spanned ca. 250-fold, consistent with
the level of 3' end
protection. Thus, it was found that incorporating MP modifications at the 3'
end of uncomplexed
gRNAs can significantly enhance their stability in transfected cells relative
to MS modifications,
specifically by 1-2 orders of magnitude for three different MP-modified gRNAs
tested in
parallel with an MS-only modified gRNA. The designs with three or four
consecutive MPs at the
3' end can prolong the lifetimes of the free gRNAs across even longer time
points (72 and 96 h
post-transfection).
Example 2
[00168] Phosphonate modifications can be stably incorporated in DNA and RNA
oligonucleotides and have been demonstrated to increase their resistance to
nucleases relative to
phosphorothioates. In a previous report exploring the use of1VIP to enhance
the specificity of
gRNAs by incorporating it in the 20-nt guide sequence portion, it was found
that MP at specific
sequence positions such as position 5 or 11 (counted from the 5' end of the 20
nucleotides) can
significantly reduce off-target editing while maintaining high on-target
editing as described in,
e.g., Ryan et al., Nucleic Acids Research 46, 792-803 (2018). However, it was
also reported that
incorporating MP modifications within the first one, two or three nucleotides
at the 5' ends of
gRNAs can, in some guide sequences, decrease their on-target cleavage activity
and/or increase
their off-target activities and thus lower specificity (see, e.g., Ryan et
al., 2018).
[00169] To further explore the potential utility of phosphonate modifications
in guide RNAs,
the performance of gRNAs containing different numbers of consecutive 2'-0-
methy1-3'-
phosphonoacetate (2'-0-methyl-3'-PACE, or "MP") modifications at the 3' end
was evaluated in
comparison to guide RNAs with 2'-0-methyl-3'-phosphorothioate (or "MS")
modifications at
that end. The results of this study are further described in Ryan et al.
"Phosphonoacetate
Modifications Enhance the Stability and Editing Yields of Guide RNAs for Cas9
Editors."
Biochemistry (2022) doi. org/10.1021/acs.biochem.1c00768.
68
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[00170] This experiment was designed to evaluate Cas activity following co-
transfection of
HepG2 cells with relatively low (sub-saturating) amounts of chemically-
modified guide RNA
and an mRNA encoding a Cas protein, using HBB as the target gene. Such sub-
saturating
amounts constitute challenging conditions for editing a target region of the
cell.
[00171] For three sets of samples, an mRNA encoding Cas9 was co-transfected
into human
hepatocytes (HepG2 cells) with modified gRNAs targeting HBB. (see Table 1
supra). For a
fourth set of HepG2 cells, modified gRNAs targeting the same site in HBB were
precomplexed
with purified recombinant Cas9 protein to form RNPs, which were then
transfected into the cells.
Each transfection was performed in triplicate samples of cells that were
cultured separately.
Genomic DNA was harvested, the HBB target and off-target sequence were
amplified using
primers specific for the HBB gene and an intergenic off-target site,
respectively, to produce
amplicons that were sequenced, and the extent of editing ("%Indels") at the
target and off-target
sites was determined from the sequencing results. ON and OFF indicate the on-
target and off-
target sequences, respectively. The intergenic off-target locus was monitored
because it is known
to suffer high collateral activity when targeting the chosen target sequence
in the HBB gene.
Editing yields for the modified gRNA described in Table 1 are plotted as bar
graphs in FIGs. 2-
5.
[00172] As demonstrated by FIGs. 2-5, co-transfection with sub-saturating
levels of a
modified guide RNA targeting HBB and an mRNA encoding a Cas protein (or an RNP
complex
of the modified guide RNAs) resulted in a higher level of editing yield
relative to samples co-
transfected with an equivalent amount of an unmodified gRNA. Furthermore, the
addition of 2,
3, or 4 MP modifications at the 3' end of the modified gRNA resulted in a
progressively higher
increase in editing yield, in addition to a substantial increase relative to
modified gRNAs
comprising 3 MS modifications at the 3' end of the modified gRNA. See, e.g.,
FIGs. 2 and 4. As
shown by FIGs. 3 and 5, the inclusion of an MP modification at position 5 or
11 (counted from
the 5' end of the 20-nt guide sequence in the gRNA) also reduced off-target
activity. In
particular, the inclusion of an MP at the position 5 in the gRNA had minimal
impact on editing
yield while substantially reducing off-target activity.
[00173] It was further observed that 1VIP modification of the 3' end
significantly enhanced
editing yields in HepG2 cells (FIG. 3). For instance, designs with 2, 3 or 4
consecutive 1VIP
modifications at the 3' end gave at least 2-fold more Cas9-mediated indels
than a comparable
69
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
design with 3xMS at the 3' end (81%-83% at the ON-target site for the 2xMP,
3x1\4P and 4xMP
modifications versus 38% for 3xMS at the 3' end). A similar trend was observed
for the same
gRNAs transfected into primary human T cells although the increase was more
modest in that
the 2xMP, 3x1\4P and 4x1\4P modifications gave a 1.3-fold higher level of ON-
target indels than
when using 3xMS at the 3' end (FIG. 8). Incorporation of an additional MP at
position 5 in the
20-nt guide sequence portion of the gRNA significantly lowered editing at the
OFF1 site in both
cell types while maintaining high on-target editing efficiency, as previously
reported as a means
for enhancing specificity (see, e.g., Ryan et al., 2018). Indeed, indels at
the OFF1 site were
reduced by 7-10 fold in HepG2 cells by incorporating 1\IP at position 5 and
similarly by 6-7 fold
in primary T cells.
[00174] As shown by FIG. 9, the use of chemically-modified gRNAs was also
evaluated in
combination with a base editor. Base editors are a class of alternative genome
editing systems
built around Cas9 nickase (nCas9) or dead Cas9 (dCas9) fused to one of various
deaminases that
enable editing of genomic DNA in cells without creating double-stranded
breaks. Both cytidine
base editors (CBE) and adenosine base editors (ABE) have been reported, and
these have
inspired a number of variations for base editing. The potential benefits of
using MP
modifications in contrast to MS modifications at the 3' ends of such gRNAs
were tested in the
context of a CBE, namely BE4-Gam mRNA. A 1.4-fold higher level of cytidine
editing was
observed by using CBE mRNA in K562 cells co-transfected with gRNA modified
with MP at
the 3' end versus an alternative design with MS at the 3' end.
Example 3
[00175] This example evaluated the use of 2'-0-methyl-3'-phosphonoacetate (MP)
and 2'-0-
methy1-3'-phosphorothioate (MS) modifications at the 3' end of chemically
synthesized
pegRNAs. An experiment was conducted to explore two approaches for prime
editing adopted
from the literature that knock out the PAM in EV/X/ or introduce a 3-base
insertion in RUNX1,
both of which utilize pegRNAs with a primer binding sequence comprising 15
nucleotides. The
particular sequence edits that were evaluated in this experiment are shown in
FIG. 18. An mRNA
encoding a prime editor (in this case, a fusion protein comprising a Cas9
nickase and an MMLV-
derived reverse transcriptase) was introduced into K562 or Jurkat cells with a
pegRNA targeting
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
the EV/X/ gene. Each transfection was performed in triplicate samples of cells
that were cultured
separately. Genomic DNA was harvested, the EMX1 target sequence was amplified
using
primers specific for EMX1 to produce amplicons that were sequenced, and the
extent of prime
editing ("%Edit") was determined from the sequencing results. Also determined
from the
sequencing results was the extent of undesired indel formation ("%Indels") at
the nickase site in
the EMX1 target sequence. Such indels are known byproducts of prime editing
and are generally
considered undesirable (see Anzalone et al. 2019). Prime editing yields and
indel byproduct
yields per pegRNA are plotted as bar graphs in FIGs. 11-16. The sequences used
in this assay
were selected from sequences shown in Table 2. Data in FIGs. 11-12 were
obtained using a first
batch synthesis of pegRNAs targeting E/V/X/, whereas data in FIGs. 13-14 were
obtained using a
second batch synthesis of pegRNAs targeting EA/X/. Note that some of the same
sequences were
synthesized again in the second batch synthesis. Conversely data in FIGs. 15-
16 were obtained
using pegRNAs targeting RUNX1 (i.e., using sequences described in Table 3).
[00176] As illustrated by the results shown in FIGs. 11-16, the inclusion of
MS and MP
nucleotides as chemical modifications at the 5' end and the 3' end,
respectively, of pegRNAs
increases prime editing activity. The enhanced activity of constructs having
modified nucleotides
at the 3' end of the pegRNA is particularly surprising, given the fact that
the 3' end of a pegRNA
contains additional functional sites (e.g., the primer binding site and a
reverse transcriptase
template sequence). As noted above, prior to the present disclosure it would
have been expected
that the inclusion of chemically-modified nucleotides (e.g., MS and/or MP) at
this site would
interfere with the functionality provided by these other 3' end components of
a pegRNA.
Example 4
[00177] This example evaluated the incorporation of 1V113 or MS modifications
at the 3' end of
chemically synthesized pegRNAs. The methods used in this experiment are
consistent with the
methods described above. In short, prime editing approaches were adopted to
knockout the PAM
in EV/X/ or to introduce a 3-base insertion in RUNX1 . K562 cells were co-
transfected with prime
editor mRNA (in this case, a fusion protein comprising a Cas9 nickase and an
MMLV-derived
reverse transcriptase) and synthetic pegRNA modified by 3xMS at the 5' end and
various
modification schemes at the 3' end (as indicated) for editing E/V/X/ or RUNX1
. Jurkat cells were
likewise transfected using the same pegRNAs for editing EV/X/ or RUNX1 .
Editing yields were
71
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
measured by deep sequencing of PCR amplicons of the target loci for both the
desired edit
(%Edit) and any contaminating indel byproducts (%By-indels). Bars in the
associated figures
represent means with std. dev. (n = 3).
[00178] As shown by FIGs. 19-22, this experiment compared pegRNAs having 3xMS
at the 3'
end for both targets with alternative designs having one, two or three
consecutive MPs at the 3'
end, each co-transfected with PE2 mRNA in K562 or Jurkat cells. The results
show that
pegRNAs with MP modifications at the 3' end performed well and can achieve
comparable, or in
some cases somewhat higher, editing yields than 3xMS. For the two pegRNA
sequences tested
here, designs with 2xMP and/or 3xMP at the 3' end performed consistently
better than designs
with 1xMP at the 3' end (specifically 1.2-1.4-fold better).
Example 5
[00179] This example demonstrated that the use of1VIP modifications at the 3'
end of
chemically synthesized gRNAs help to maximize editing yields in the presence
of serum. To
simulate harsher cellular environments that CRISPR-Cas components may
encounter when
delivered in vivo (as by nanocarriers or other cell-penetrating formulations),
an experiment was
conducted wherein Cas9 mRNA was co-transfected with gRNA into cells that were
isolated from
culture media but not rinsed with PBS buffer to remove residual serum, which
is known to
contain nucleases.
[00180] The methods used in this experiment are consistent with the methods
described
above. However, it is noted that under the conditions of this experiment,
higher amounts of
gRNA and Cas9 mRNA were needed to achieve substantial levels of editing,
specifically, 3-fold
more gRNA and 8-fold more Cas9 mRNA per transfection was used for the
experiment that
resulted in the data shown in FIG. 23, as compared to the experiment that
resulted in the data
shown in FIG. 3 where the same number of cells per transfection were washed
with buffer before
introducing the CRISPR-Cas components.
[00181] Based on the results of this study, it appears that extracellular
nucleases in serum not
rinsed from cells degraded the transfected RNAs. We found that gRNAs withlVIP
modifications
at the 3' end gave substantially higher editing yields (by an order-of-
magnitude or more)
compared to gRNAs with MS modifications at the 3' end when co-transfected with
Cas9 mRNA
72
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
into unrinsed HepG2 cells (FIG. 23). Specifically, 15%-44% editing yield for
gRNAs with one
or more 1VIPs at the 3' end was observed versus less than 2% with 3xMS at the
3' end.
[00182] In a parallel experiment, an RNP version of each gRNA was prepared by
pre-
complexation with Cas9 protein in PBS buffer and transfected into aliquots of
unrinsed HepG2
cells. As expected, the unmodified and 3xMS-modified gRNAs gave higher indel
yields as RNP
formulations than when these were co-transfected with Cas9 mRNA, as pre-
complexation of
gRNA with Cas9 protein in RNP helps shield the gRNA from nucleolytic
degradation (compare
the results shown in FIG. 24 versus FIG. 23). Even though the improvement in
editing efficiency
between RNPs incorporating gRNA with MP versus MS modifications at the 3' end
was not as
dramatic as when using these modifications in co-transfections with Cas9 mRNA,
designs with
1VIPs at the 3' end gave significantly higher Cas9-mediated indels than a
comparable design with
3xMS at the 3' end (70%-73% indels at the ON-target site for the 2xMP, 3xMP
and 4x1\/IP
modifications at the 3' end versus 52% for 3xMS at the 3' end, a difference of
about 1.3 fold)
(see FIG. 24). A similar outcome was observed for a different set of synthetic
163mer gRNAs
designed for CRISPRa SAM systems but used with SpCas9 protein in RNP
formulations to
produce indels instead of using them for gene activation by CRISPRa (FIG. 25).
EXEMPLARY EMBODIMENTS
Section A
Embodiment Al. A method of editing a target region in a nucleic acid under
one or more
challenging conditions, the method comprising:
providing to the cell
a) a CRISPR-associated ("Cas") protein, and
b) a modified guide RNA comprising a guide sequence that is capable of
hybridizing
to the target region and a scaffold that interacts with the Cas protein,
wherein the modified guide
RNA comprises a 5' end and a 3' end, and the modified guide RNA further
comprises one or more
modified nucleotides within 5 nucleotides of the 3' end, wherein the one or
more modified
nucleotides comprises at least one nucleotide with a 2' modification and an
internucleotide linkage
modification, wherein the 2' modification is selected from 2'-0-methyl, 2'-
fluoro, 2'-0-
methoxyethyl (2'-M0E) and 2'-deoxy, and the internucleotide linkage
modification is a
phosphonocarboxylate or thiophosphonocarboxylate;
73
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
wherein the one or more challenging conditions are selected from the group
consisting of:
i.
the target region or a cell comprising the target region is in a medium
comprising
serum (e.g., fetal bovine serum);
a cell comprising the target region was previously cultured in a medium
comprising
serum, and the cell was incompletely separated from the serum;
a cell comprising the target region was previously cultured in a medium
comprising
one or more exoribonucleases, and the cell was incompletely separated from the
one or more
exoribonucleases;
iv. a cell comprising the target region has a relatively high level of
exoribonuclease
activity, such as relatively high expression of one or more exoribonucleases;
v. a cell comprising the target region has a relatively low level of
ribonuclease
inhibitor activity, such as a relatively low expression of ribonuclease
inhibitor;
vi. the modified guide RNA is not in a complex with a Cas protein before
delivery into
a cell comprising the target region; and
vii. applicable combinations thereof;
wherein the Cas protein and the modified guide RNA form a complex that results
in editing
the target region.
Embodiment A2. The method of Embodiment Al, wherein the internucleotide
linkage
modification is a phosphonocarboxylate.
Embodiment A3.
The method of Embodiment A2, wherein the phosphonocarboxylate is
phosphonoacetate.
Embodiment A4.
The method of Embodiment Al, wherein the thiophosphonocarboxylate is
thiophosphonoacetate.
Embodiment A5.
The method of any of Embodiments Al to 4, wherein the Cas protein is
introduced as an mRNA encoding the Cas protein.
74
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment A6. The method of any of Embodiments Al to 4, wherein the Cas
protein is
introduced as an expression vector encoding the Cas protein.
Embodiment A7. The method of Embodiment A5 or A6, wherein the mRNA or
expression
vector encoding the Cas protein is contained in a nanoparticle when introduced
to the target region.
Embodiment A8. The method of any of Embodiments Al to A4, wherein the Cas
protein and
the guide RNA are introduced as a ribonucleoprotein (RNP) complex.
Embodiment A9. The method of any of the preceding embodiments, wherein the
2'
modification is 2' -0-methyl.
Embodiment A10. The method of any of Embodiments Al -A8, wherein the 2'
modification is
2'-fluoro.
Embodiment All. The method of any of Embodiments Al -A8, wherein the 2'
modification is
2'-M0E.
Embodiment Al2. The method of any of Embodiments Al -A8, wherein the 2'
modification is
2'-deoxy.
Embodiment A13. The method of any of the preceding embodiments, wherein the
one or more
edits comprise one or more single-nucleotide changes, an insertion of one or
more nucleotides,
and/or a deletion of one or more nucleotides.
Embodiment A14. The method of any of the preceding embodiments, wherein the
target region
is present in a cell-free assay.
Embodiment A15. The method of Embodiment A14, wherein the method further
comprises
extracting nucleic acid from a cell, such as by lysing the cell, forming an
assay mixture comprising
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
the extracted nucleic acid and one or more other cell components, such as
exoribonucleases or
other enzymes, and introducing the guide RNA to the assay mixture.
Embodiment A16. The method of any of the preceding embodiments, wherein the
target region
is in a cell having high ribonuclease expression, concentration and/or
activity, for example, cell
types high in a particular nuclease.
Embodiment A17. The method of Embodiment A16, wherein the cells comprise
primary cells.
Embodiment A18. The method of Embodiment A17, wherein the cell exists ex
vivo, and the
method further comprises one or more steps for separating the cell from a
living organism. The
cell can be separated into a reaction mixture, or a separated cell can be
transferred into a reaction
mixture.
Embodiment A19. The method of any of Embodiments A16-A18, wherein the cell
is isolated
from a multicellular organism prior to introducing the modified guide RNA and
the Cas protein to
the target region in the cell.
Embodiment A20. The method of Embodiment A19, wherein the cell or a progeny
thereof is
returned to the multicellular organism after introducing the modified guide
RNA and the Cas
protein to the target region in the cell.
Embodiment A21. The method of any of Embodiments A16-A20, wherein the cell
is a primary
cell.
Embodiment A22. The method of Embodiment A21, wherein the primary cell is a
stem cell or
an immune cell.
Embodiment A23. The method of Embodiment A22, wherein the stem cell is a
hematopoietic
stem and progenitor cell (HSPC), a mesenchymal stem cell, a neural stem cell,
or an organ stem
cell.
76
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment A24. The method of Embodiment A22, wherein the immune cell is a
T cell, a
natural killer cell, a monocyte, a peripheral blood mononuclear cell (PBMC),
or a peripheral blood
lymphocyte (PBL).
Embodiment A25. The method of Embodiment A24, wherein the cell is a T-cell.
Embodiment A26. The method of any of Embodiments A16-A20, wherein the cell
is a
hepatocyte.
Embodiment A27. The method of any of Embodiments A16-A26, wherein the cell
is a
population of cells, each comprising the target region.
Embodiment A28. The method of any of Embodiments A16-A27, wherein the cell
is in a cell
culture, wherein the cell is in a cell culture medium comprising serum or one
or more other medium
components.
Embodiment A29. The method of Embodiment A28, wherein the cell is not
separated from the
cell culture medium before the Cas protein and the modified guide RNA are
introduced.
Embodiment A30. The method of any of Embodiments A1-13 and A16-A29, wherein
the Cas
protein and the modified guide RNA are introduced into a living organism.
Embodiment A31. The method of Embodiment A30, wherein the Cas protein and
the modified
guide RNA are introduced to a serum-containing fluid in or from the living
organism.
Embodiment A32. The method of any of the preceding embodiments, wherein the
editing is
prime editing, and the modified guide RNA further comprises a region
comprising desired edit(s).
77
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment A33. The method of any of the preceding embodiments, wherein the
editing
comprises homologous-directed repair (HDR), nonhomologous end joining (NHEJ),
prime
editing, or base editing.
Embodiment A34. The method of any of the preceding embodiments, wherein the
Cas protein
is a Cas9 or Cas12 protein.
Embodiment A35. The method of any of the preceding embodiments, wherein the
Cas protein
is a Cas nickase capable of nicking a single strand of DNA.
Embodiment A36. The method of any of the preceding embodiments, wherein the
Cas protein
is a fusion protein comprising a Cas domain and a heterologous functional
domain, wherein the
heterologous functional domain comprises base editing activity, nucleotide
deaminase activity,
transglycosylase activity, methylase activity, demethylase activity, reverse
transcriptase activity,
polymerase activity, translation activation activity, translation repression
activity, transcription
activation activity, transcription repression activity, transcription release
factor activity, chromatin
modifying or remodeling activity, histone modification activity, nuclease
activity, single-strand
RNA cleavage activity, double-strand RNA cleavage activity, single-strand DNA
cleavage
activity, double-strand DNA cleavage activity, nucleic acid binding activity,
detectable activity,
or any combination thereof.
Embodiment A37. The method of Embodiment A36, wherein the fusion protein
comprises a
Cas nickase domain and a nucleotide deaminase.
Embodiment A38. The method of Embodiment A36, wherein the nucleotide
deaminase is an
adenosine deaminase or a cytidine deaminase.
Embodiment A39. The method of Embodiment A36, wherein the fusion protein
comprises one
or more nucleic acid modifying domains.
78
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment A40. The method of Embodiment A36, wherein the nucleic acid
modifying
domain is a DNA polymerase domain, a recombinase domain, a ribonucleotide
reductase domain,
a methyltransferase domain, a diadenosine tetraphosphate hydrolase domain, a
DNA helicase
domain, or a RNA helicase domain.
Embodiment A41. The method of Embodiment A36, wherein the fusion protein
comprises a
Cas nickase domain and a reverse transcriptase domain.
Embodiment A42. The method of any of the preceding embodiments, wherein the
guide RNA
is a single-guide RNA.
Embodiment A43. The method of Embodiment A42, wherein the modified guide
RNA is a
single-guide RNA comprising at least 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55,
56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81,
82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100,
101, 102, 103, 104, 105,
106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120,
121, 122, 123, 124,
125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, or 139,
140, 141, 142, 143,
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158,
159, 160, 161, 162,
163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177,
178, 179, 180, 181,
182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196,
197, 198, 199, or 200
nucleotides, and/or
up to 180, 179, 178, 177, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167,
166, 165, 164,
163, 162, 161, 159, 158, 157, 156, 155, 154, 153, 152, 151, 150, 149, 148,
147, 146, 145, 144,
143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129,
128, 127, 126, 125,
124, 123, 122, 121, or 120 nucleotides.
Embodiment A44. The method of any of the preceding embodiments, wherein the
guide RNA
further comprises one or more modified nucleotides within 5 nucleotides of the
5' end, alternatively
within 3 nucleotides of the 5' end.
79
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment A45. The method of Embodiment A44, wherein the one or more
modified
nucleotides at the 5' end comprises at least one nucleotide with a 2'
modification and an
internucleotide linkage modification, wherein the 2' modification is selected
from 2'-0-methyl, 2'-
fluor , 2'-0-methoxyethyl (2'-M0E) and 2'-deoxy, and the internucleotide
linkage modification is
selected from phosphonocarboxylate, thiophosphonocarboxylate, and
phosphorothioate.
Embodiment A46. The method of any of the preceding embodiments, wherein the
guide RNA
further comprises one or more modified nucleotides at one or more positions
other than at least 5
nucleotides from both the 5' end and the 3' end of the guide RNA.
Embodiment A47. A method of modulating expression of a target gene in a
target region, in a
nucleic acid in a cell, under one or more challenging conditions, the method
comprising:
providing to the cell
a) a CRISPR-associated ("Cas") protein, or a DNA or mRNA encoding the Cas
protein, and
b) a modified guide RNA comprising a guide sequence that is capable of
hybridizing
to the target region and a region that interacts with the Cas protein, wherein
the modified guide
RNA comprises a 5' end and a 3' end, and the modified guide RNA further
comprises one or more
modified nucleotides within 5 nucleotides of the 3' end, wherein the one or
more modified
nucleotides comprises at least one nucleotide with a 2' modification and an
internucleotide linkage
modification, wherein the 2' modification is selected from 2'-0-methyl, 2'-
fluoro, 2'-0-
methoxyethyl (2'-M0E) and 2'-deoxy, and the internucleotide linkage
modification is a
phosphonocarboxylate or thiophosphonocarboxylate; and
wherein the Cas protein and the modified guide RNA form a complex that results
in
modulating the expression of the target region.
Embodiment A48. The method of Embodiment A47, wherein the Cas protein or
the modified
guide RNA further comprise an epigenetic modifier, or a transcriptional or
translational activation
or repression signal.
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment A49. The method of Embodiment A47, wherein the Cas protein is a
fusion protein
comprising an inactive Cas nuclease domain and a heterologous functional
domain selected from
a transcriptional activation domain and a transcriptional repression domains.
Embodiment A50. The method of Embodiment A49, wherein the heterologous
functional
domain is a transcriptional activation domain.
Embodiment A51. The method of Embodiment A50, wherein the transcriptional
activation
domain is a VP64 domain, a p65 domain, a MyoD1 domain, or a HSF1 domain.
Embodiment A52. The method of Embodiment A49, wherein the heterologous
functional
domain is a transcriptional repression domain.
Embodiment A53. The method of Embodiment A52, wherein the transcriptional
repression
domain is a KRAB domain, a SID domain, a SID4X domain, a NuE domain, or a NcoR
domain.
Embodiment A54. A method of prime editing a target region in a nucleic acid
under one or
more challenging conditions, the method comprising:
a) providing to the cell
a Cas protein capable of nicking a single strand of the nucleic acid;
a reverse transcriptase; and
a modified prime editing guide RNA ("pegRNA") comprising:
i) a guide sequence that is capable of hybridizing to the target region,
ii) a region that interacts with the Cas protein,
iii) a reverse transcriptase template sequence that comprises one or more
edits to the
sequence of the nucleic acid, and
iv) a primer-binding site sequence that can bind to a complement of the target
region;
wherein the modified pegRNA comprises a 5' end and a 3' end, and the modified
pegRNA further
comprises one or more modified nucleotides within 5 nucleotides of the 3' end,
wherein the one or
more modified nucleotides comprises at least one nucleotide with a 2'
modification and an
internucleotide linkage modification, wherein the 2' modification is selected
from 2'-0-methyl, 2'-
81
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
fluor , 2'-0-methoxyethyl (2'-M0E) and 2'-deoxy, and the internucleotide
linkage modification is
a phosphonocarboxylate or thiophosphonocarboxylate; and
wherein the Cas protein and the modified guide RNA form a complex that results
in editing the
target region.
Embodiment A55. The method of Embodiment A54, wherein the Cas protein and
the reverse
transcriptase are connected by a linker to form a fusion protein.
Embodiment A56. The method of any one of the preceding embodiments, wherein
the guide
RNA comprises at least one phosphorothioate internucleotide linkage within 5
nucleotides of the
5' end, and at least two consecutive phosphonocarboxylate or
thiophosphonocarboxylate
internucleotide linkages within 5 nucleotides of the 3' end.
Embodiment A57. The method of any one of the preceding embodiments, wherein
the guide
RNA comprises at least one phosphorothioate internucleotide linkage within 5
nucleotides of the
5' end, and at least two consecutive phosphonoacetate or thiophosphonoacetate
internucleotide
linkages within 5 nucleotides of the 3' end.
Embodiment A58. The method of any one of the preceding embodiments, wherein
the guide
RNA comprises at least one MS within 5 nucleotides of the 5' end, and at least
two consecutive
MP or MSP within 5 nucleotides of the 3' end.
Embodiment A59. The method of any one of the preceding embodiments, wherein
the guide
RNA comprises three MS within 5 nucleotides of the 5' end, and three MP or MSP
within 5
nucleotides of the 3' end.
Embodiment A60. The method of any one of the preceding embodiments, wherein
the editing
and/or the modulation of expression of a target gene are performed in a
multiplexed fashion (i.e.
on at least two target genes or at least two target regions).
82
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Section B
Embodiment Bl. A method of editing a target region in a nucleic acid in a
cell, the method
comprising providing to the cell:
a) a CRISPR-associated ("Cas") protein, and
b) a modified guide RNA comprising a 5' end and a 3' end, and:
a guide sequence that is capable of hybridizing to a target sequence in the
target
region,
a scaffold region that interacts with the Cas protein, and
one or more phosphorothioate modifications within 5 nucleotides of the 5' end,
and
at least two consecutive phosphonocarboxylate or thiophosphonocarboxylate
modifications within 5 nucleotides of the 3' end;
wherein the cell exists ex vivo in the presence of a nuclease-containing
fluid, or exists in
vivo, and
said providing results in editing of the target region.
Embodiment B1.1. A method of editing a target region in a nucleic acid in a
cell, the method
comprising providing to the cell:
a) a CRISPR-associated ("Cas") protein, and
b) a modified guide RNA that is a prime editing guide RNA (pegRNA)
comprising a
5' end and a 3' end, one of which is a prime editing end and the other is a
distal end, the modified
guide RNA further comprising:
a guide sequence that is capable of hybridizing to a target sequence in the
target region,
a scaffold region that interacts with the Cas protein, and
one or more phosphorothioate modifications within 5 nucleotides of the distal
end, and at
least two consecutive phosphonocarboxylate or thiophosphonocarboxylate
modifications within 5
nucleotides of the prime editing end;
wherein the cell exists ex vivo in the presence of a nuclease-containing
fluid, or exists in
vivo, and
said providing results in editing of the target region.
83
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment B2. The method of Embodiment B1 or B1.1, wherein said editing
occurs with an
efficiency higher than that by an unmodified gRNA that is otherwise identical
to the modified
guide RNA
Embodiment B3. A method of modulating expression of a target gene in a target
region in a nucleic
acid in a cell, the method comprising providing to the cell:
a) a CRISPR-associated ("Cas") protein, and
b) a modified guide RNA comprising a 5' end and a 3' end, and:
a guide sequence that is capable of hybridizing to a target sequence in the
target
region,
a scaffold region that interacts with the Cas protein, and
one or more phosphorothioate modifications within 5 nucleotides of the 5' end,
and
at least two consecutive phosphonocarboxylate or thiophosphonocarboxylate
modifications within 5 nucleotides of the 3' end;
wherein the cell exists ex vivo in the presence of a nuclease-containing
fluid, or exists in
vivo, and
said providing results in modulation of expression of the target gene.
Embodiment B4. The method of Embodiment B3, wherein the modulation occurs with
an
efficiency higher than that by an unmodified gRNA that is otherwise identical
to the modified
guide RNA.
Embodiment B5. The method of any one of the preceding B embodiments, wherein
the cell exists
in vivo.
Embodiment B6. The method of any one of the preceding B embodiments, wherein
the cell exists
ex vivo in the presence of a nuclease-containing fluid.
Embodiment B7. The method of any one of the preceding B embodiments, wherein
the modified
guide RNA comprises at least two consecutive 2'-0-methyl-31-phosphorothioate
(MS) within 5
84
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
nucleotides of the 5' end (exception; "the distal end" in lieu of "the 5' end"
when this embodiment
depends from Embodiment B1.1).
Embodiment B8. The method of any one of the preceding B embodiments, wherein
the
phosphonocarb oxyl ate is phosphonoacetate and the thi ophosphonocarb oxyl ate
is
thiophosphonoacetate.
Embodiment B9. The method of any one of the preceding B embodiments, wherein
the modified
guide RNA comprises at least two consecutive 2'-0-methyl-31-phosphonoacetate
(1V113) or 2'-0-
methy1-3'-thiophosphonoacetate (MSP) within 5 nucleotides of the 3' end
(exception: "the prime
ending end" in lieu of "the 5' end" when this embodiment depends from
Embodiment B1.1).
Embodiment B10. The method of any one of the preceding B embodiments, wherein
the modified
guide RNA further comprises modified nucleotide(s) located outside of 5
nucleotides within the
5' end and 3' end.
Embodiment B11. The method of any one of the preceding B embodiments, wherein
the modified
guide RNA is a single guide RNA.
Embodiment B12. The method of any one of the preceding B embodiments, wherein
the Cas
protein is provided as an mRNA encoding the Cas protein.
Embodiment B13. The method of any one of Embodiments Bl-B11, wherein the Cas
protein is
provided as a DNA encoding the Cas protein.
Embodiment B14. The method of Embodiment B13, wherein the DNA is a viral
expression vector.
Embodiment B15. The method of any one of Embodiments Bl-B11, wherein the Cas
protein and
the modified guide RNA are provided as a ribonucleoprotein complex (RNP).
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment B16. The method of any one of Embodiments B1-B11, wherein the Cas
protein
and/or modified guide RNA are provided in nanoparticle(s).
Embodiment B17. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 5%.
Embodiment B18. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 10%.
Embodiment B19. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 15%.
Embodiment B20. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 20%.
Embodiment B21. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 25%.
Embodiment B22. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 30%.
Embodiment B23. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 35%.
Embodiment B24. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 40%.
Embodiment B25. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 45%.
86
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment B26. The method of any one of the preceding B embodiments, wherein
the efficiency
is higher by at least 50%.
Embodiment B27. The method of any one of the preceding B embodiments, wherein
the Cas
protein is capable of cleaving both strands of DNA.
Embodiment B28. The method of any one of embodiments B1-B26, wherein the Cas
protein is a
nickase.
Embodiment B29. The method of any one of embodiments B1-B26, wherein the Cas
protein does
not have nuclease activity.
Embodiment B30. The method of any one of the preceding B embodiments, wherein
the Cas
protein is part of a fusion protein that further comprises a heterologous
protein.
Embodiment B31. The method of any one of the preceding B embodiments, wherein
the Cas
protein is a Type II Cas protein.
Embodiment B32. The method of any one of the preceding B embodiments, wherein
the Cas
protein is a Cas9 protein, or a variant or fragment thereof.
Embodiment B33. The method of Embodiment B32, wherein the Cas9 protein is from
Streptococcus pyogenes.
Embodiment B34. The method of any one of Embodiments B1-B32, wherein the Cas
protein is a
Cpfl protein, or a variant or fragment thereof
Embodiment B35. The method of any one of the preceding B embodiments, wherein
the Cas
protein is a hybrid protein having sequences from at least two different wild
type Cas proteins.
87
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
Embodiment B36. The method of any one of the preceding B embodiments, wherein
the modified
guide RNA is 40-70 nucleotides in length.
Embodiment B37. The method of any one of the preceding B embodiments, wherein
the modified
guide RNA is 40-100 nucleotides in length.
Embodiment B38. The method of any one of Embodiments B1-B35, wherein the
modified guide
RNA is 90-110 nucleotides in length.
Embodiment B39. The method of any one of Embodiments B1-B35, wherein the
modified guide
RNA is 90-130 nucleotides in length.
Embodiment B40. The method of any one of Embodiments B1-B35, wherein the
modified guide
RNA is 130-160 nucleotides in length.
Embodiment B41. The method of any one of Embodiments B1-B35, wherein the
modified guide
RNA is 160-200 nucleotides in length.
Embodiment B42. The method of any one of the preceding B embodiments, wherein
the modified
guide RNA is a pegRNA.
Embodiment B43. The method of any one of the preceding B embodiments, wherein
the
phosphorothioate, phosphonocarboxylate or thiophosphonocarboxylate
modifications are each
present in a nucleotide that also comprises a 2'-0-Methyl modification.
Embodiment B44. The method of any one of the preceding B embodiments, further
comprising
editing a second target region in the cell using a second modified guide RNA
that comprises:
a 5' end and a 3' end,
a guide sequence that is capable of hybridizing to a second target sequence in
the second target
region, and
88
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
one or more phosphorothioate modifications within 5 nucleotides of the 5' end
(except that if this
embodiment depends from B1.1, this would be the distal end), and at least two
consecutive
phosphonocarboxylate or thiophosphonocarboxylate modifications within 5
nucleotides of the 3'
end (except that if this embodiment depends from B1.1, this would be the prime
editing end).
Embodiment B45. The method of any one of the preceding B embodiments, further
comprising
modulating expression of a third target gene in a third target region in the
cell using a third
modified guide RNA that comprises:
a 5' end and a 3' end,
a guide sequence that is capable of hybridizing to a third target sequence in
the third target region,
and
one or more phosphorothioate modifications within 5 nucleotides of the 5' end,
and at least two
consecutive phosphonocarboxylate or thiophosphonocarboxylate modifications
within 5
nucleotides of the 3' end.
Embodiment B46. The method of any one of the preceding B embodiments, wherein
the nuclease
is an exonuclease.
Embodiment B47. The method of any one of the preceding B embodiments, wherein
the nuclease
is ribonuclease.
Section C
Embodiment Cl. A method of editing two or more nucleic acid target regions,
comprising a first
target region and a second target region in a cell, the method comprising
providing to the cell:
a) a CRISPR-associated ("Cas") protein;
b) a first modified guide RNA comprising a 5' end and a 3' end, and:
a first guide sequence that is capable of hybridizing to a first target
sequence in the
first target region,
a scaffold region that interacts with the Cas protein, and
89
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
one or more phosphorothioate modifications within 5 nucleotides of the 5' end,
and
at least two consecutive phosphonocarboxylate or thiophosphonocarboxylate
modifications within 5 nucleotides of the 3' end;
c) a second modified guide RNA comprising a 5' end and a 3' end, and:
a second guide sequence that is capable of hybridizing to a second target
sequence
in the second target region,
a scaffold region that interacts with the Cas protein, and
one or more phosphorothioate modifications within 5 nucleotides of the 5' end,
and
at least two consecutive phosphonocarboxylate or thiophosphonocarboxylate
modifications within 5 nucleotides of the 3' end;
wherein the cell exists ex vivo in the presence of a nuclease-containing
fluid, or exists in
vivo, and
said providing results in editing of the first and second target regions.
Embodiment C2. A method of modulating expression of at least a first target
gene in a first target
region and a second target gene in a second target region in a cell, the
method comprising providing
to the cell:
a) a CRISPR-associated ("Cas") protein;
b) a first modified guide RNA comprising a 5' end and a 3' end, and:
a first guide sequence that is capable of hybridizing to a first target
sequence in the
first target region,
a scaffold region that interacts with the Cas protein, and
one or more phosphorothioate modifications within 5 nucleotides of the 5' end,
and
at least two consecutive phosphonocarboxylate or thiophosphonocarboxylate
modifications within 5 nucleotides of the 3' end;
c) a second modified guide RNA comprising a 5' end and a 3' end, and:
a second guide sequence that is capable of hybridizing to a second target
sequence
in the second target region,
a scaffold region that interacts with the Cas protein, and
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
one or more phosphorothioate modifications within 5 nucleotides of the 5' end,
and
at least two consecutive phosphonocarboxylate or thiophosphonocarboxylate
modifications within 5 nucleotides of the 3' end;
wherein the cell exists ex vivo in the presence of a nuclease-containing
fluid, or exists in
vivo, and
said providing results in modulation of expression of the first and second
target genes.
Embodiment C3. The method of Embodiment Cl or C2, wherein the editing of the
first target
region, or modulation of the first target gene, has a first efficiency which
is higher than that of an
unmodified guide RNA otherwise identical to the first modified guide RNA.
Embodiment C4. The method of Embodiment C3, wherein the editing of the second
target region,
or modulation of the second target gene, has a second efficiency which is
higher than that of an
unmodified guide RNA otherwise identical to the second modified guide RNA.
Embodiment C5. The method of any one of the preceding C embodiments, wherein
the cell exists
in vivo.
Embodiment C6. The method of any one of Embodiment C1-C4, wherein the cell
exists ex vivo
in the presence of a nuclease-containing fluid.
Embodiment C7. The method of any one of the preceding C embodiments, further
comprising
applicable additional limitation(s) from each of the A embodiments or B
embodiments.
[00183] The foregoing description of exemplary or preferred embodiments should
be taken as
illustrating, rather than as limiting, the present disclosure as defined by
the claims. As will be
readily appreciated, numerous variations and combinations of the features set
forth above can be
utilized without departing from the present disclosure as set forth in the
claims. Such variations
are not regarded as a departure from the scope of the disclosure, and all such
variations are intended
to be included within the scope of the following claims. All references cited
herein are
incorporated by reference in their entireties.
91
CA 03230928 2024-03-01
WO 2023/043856 PCT/US2022/043553
[00184] All publications, patents, and patent applications mentioned in
this specification are
herein incorporated by reference to the same extent as if each individual
publication, patent, or
patent application was specifically and individually indicated to be
incorporated by reference.
92
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
Sequence Listing
1 Sequence Listing
Information
1-1 File Name 20210117-03 (027644-8453).xml
1-2 DTD Version V1_3
1-3 Software Name WIPO Sequence
1-4 Software Version 2.1.2
1-5 Production Date 2022-09-14
1-6 Original free text
language code
1-7 Non English free
text language code
2 General
Information
US 2-1 Current application:
IP Office
2-2 Current application:
Application number
2-3
Current application: Filing date
Current application:
2-4 Applicant file 20210117-03 (027644-8453)
reference
Earliest priority
2-5 application: IP US
Office
Earliest priority
2-6 application: 63/243,985
Application number
Earliest priority
2-7 application: Filing 2021-09-14
date
2-
Applicant name Agilent Technologies, Inc.
8en
2-8 Applicant name:
Name Latin
2-9 Inventor name
2-9 Inventor name:
Name Latin
2-
Invention title METHODS FOR USING GUIDE RNAS WITH CHEMICAL MODIFICATIONS
10en
2-11
Sequence Total
54
Quantity
3-1 Sequences
3-1- Sequence Number 1
1 [ID]
3-1-
Molecule Type RNA
2
3-1-
Length 100
3
3-1- Features source 1..100
93
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
4-1 Location/Qualifiers mol_type= other RNA
organism= synthetic construct
NonEnglishQualifier
Value
3-1- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 100
3-2 Sequences
3-2- Sequence Number 2
1 [ID]
3-2-
Molecule Type RNA
2
3-2-
Length 100
3
source 1..100
3-2- Features
mol_type= other RNA
4-1 Location/Qualifiers
organism= synthetic construct
NonEnglishQualifier
Value
modified base 1..3
3-2- Features
mod base= OTHER
4-2 Location/Qualifiers
note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
modified base 97..99
3-2- Features
mod base= OTHER
4-3 Location/Qualifiers
note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3-2- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-3 Sequences
3-3- Sequence Number 3
1 [ID]
3-3-
Molecule Type RNA
2
3-3-
Length 99
3
source 1..99
3-3- Features
mol_type= other RNA
4-1 Location/Qualifiers
organism= synthetic construct
NonEnglishQualifier
Value
modified base 1..3
3-3- Features
mod base= OTHER
4-2 Location/Qualifiers
note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
modified base 98
3-3- Features
mod base= OTHER
4-3 Location/Qualifiers
note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3-3- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgcttt
99
3-4 Sequences
94
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3-4- Sequence Number 4
1 [ID]
3-4-
Molecule Type RNA
2
3-4-
Length 100
3
source 1..100
3-4- Features
4-1 Location/Qualifiers mol_type= other RNA
organism= synthetic construct
NonEnglishQualifier
Value
modified base 1..3
3-4- Features
mod base= OTHER
4-2 Location/Qualifiers
note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
modified base 99
3-4- Features
mod base= OTHER
4-3 Location/Qualifiers
note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3-4- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 100
3-5 Sequences
3-5- Sequence Number 5
1 [ID]
3-5-
Molecule Type RNA
2
3-5-
Length 100
3
source 1..100
3-5- Features
4-1 Location/Qualifiers mol_type= other RNA
organism= synthetic construct
NonEnglishQualifier
Value
modified base 1..3
3-5- Features
mod base= OTHER
4-2 Location/Qualifiers
note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
modified base 98..99
3-5- Features
mod base= OTHER
4-3 Location/Qualifiers
note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3-5- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-6 Sequences
3-6- Sequence Number 6
1 [ID]
3-6-
Molecule Type RNA
2
3-6-
Length 101
3
3-6- Features source 1..101
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
I 4-1 I Location/Qualifiers I mol_type= other RNA
I organism= synthetic construct
NonEnglishQualifier
Value
modified base 1..3
3-6- Features
mod base= OTHER
4-2 Location/Qualifiers
note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
modified base 98..100
3-6- Features
mod. base= OTHER
4-3 Location/Qualifiers
note= 2I-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3-6- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt t 101
3-7 Sequences
3-7- Sequence Number 7
1 [ID]
3-7-
Molecule Type RNA
2
3-7-
Length 102
3
source 1..102
3-7- Features
4-1 Location/Qualifiers mol_type= other RNA
organism= synthetic construct
NonEnglishQualifier
Value
modified base 1..3
3-7- Features
mod base= OTHER
4-2 Location/Qualifiers
note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
modified base 99..101
3-7- Features
mod base= OTHER
4-3 Location/Qualifiers
note= 2I-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3-7- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tt
102
3-8 Sequences
3-8- Sequence Number 8
1 [ID]
3-8-
Molecule Type RNA
2
3-8-
Length 102
3
source 1..102
3-8- Features
4-1 Location/Qualifiers mol_type= other RNA
organism= synthetic construct
NonEnglishQualifier
Value
modified base 1..3
3-8- Features
mod base= OTHER
4-2 Location/Qualifiers
note= 2I-0-methyl-3'-phosphorothioate nucleotide
96
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
NonEnglishQualifier
Value
modified base 98..101
3-8- Features
mod base= OTHER
4-3 Location/Qualifiers
note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3-8- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tt 102
3-9 Sequences
3-9- Sequence Number 9
1 [ID]
3-9-
Molecule Type RNA
2
3-9-
Length 103
3
source 1..103
3-9- Features
mol_type= other RNA
4-1 Location/Qualifiers
organism= synthetic construct
NonEnglishQualifier
Value
modified base 1..3
3-9- Features
mod base= OTHER
4-2 Location/Qualifiers
note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
modified base 99..103
3-9- Features
mod base= OTHER
4-3 Location/Qualifiers
note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3-9- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt
103
3-10 Sequences
3- Sequence Number
10-1 [ID]
10-2 3-
Molecule Type RNA
10-3 3-
Length 100
3- Features source 1..100
10- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
10- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 97..99
10- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
97
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Features modified_base 5
10- Location/Qualifiers mod base= OTHER
4-4 note= 2'-0-methy1-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
Residues -5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-11 Sequences
3- Sequence Number
11
11-1 [ID]
11-2 3-
Molecule Type RNA
11-3 3-
Length 99
3- Features source 1..99
11- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
11- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methy1-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 5
11- mod base¨ OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Features modified base 98
11- mod base= OTHER
Location/Qualifiers
4-4 note= 2'-0-methy1-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
11-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgcttt
99
3-12 Sequences
3- Sequence Number
12
12-1 [ID]
12-2 3-
Molecule Type RNA
12-3 3-
Length 100
3- Features source 1..100
12- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
12- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 5
12- mod base¨ OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
98
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
NonEnglishQualifier
Value
3- Features modified base 98..99
12- mod base= OTHER
Location/Qualifiers
4-4 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
12-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-13 Sequences
3- Sequence Number 13
13-1 [ID]
13-2 3-
Molecule Type RNA
13-3 3-
Length 101
3- Features source 1..101
13- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
13- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 5
13- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Features modified base 98..100
13- mod base= OTHER
Location/Qualifiers
4-4 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
13-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt t
101
3-14 Sequences
3- Sequence Number
14
14-1 [ID]
14-2 3-
Molecule Type RNA
14-3 3-
Length 102
3- Features source 1..102
14- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
14- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
99
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Features modified_base 5
14- Location/Qualifiers mod base= OTHER
4-3 note= 2'-0-methy1-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Features modified base 98..101
14- mod base= OTHER
Location/Qualifiers
4-4 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
14 Residues -5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tt
102
3-15 Sequences
3- Sequence Number 15
15-1 [ID]
15-2 3-
Molecule Type RNA
15-3 3-
Length 100
3- Features source 1..100
15- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
15- mod base¨ OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 97..99
15- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methy1-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 11
15- mod base= OTHER
Location/Qualifiers
4-4 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
15-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-16 Sequences
3- Sequence Number
16
16-1 [ID]
162 3-
Molecule Type RNA
16-3 3-
Length 100
3- Features source 1..100
16- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
16- mod base¨ OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
100
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
NonEnglishQualifier
Value
3- Features modified base 11
16- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Features modified base 99
16- mod base= OTHER
Location/Qualifiers
4-4 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
16-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-17 Sequences
3- Sequence Number
17
17-1 [ID]
3-
Molecule Type RNA
17-2
17-3 3-
Length 100
3- Features source 1..100
17- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
17- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 11
17- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Features modified base 98..99
17- mod base= OTHER
Location/Qualifiers
4-4 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
17-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-18 Sequences
3- Sequence Number
18
18-1 [ID]
18-2 3-
Molecule Type RNA
3-
Length 102
18-3
3- Features source 1..102
18- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
101
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Features modified_base 1..3
18- Location/Qualifiers mod base= OTHER
4-2 note= 2'-0-methy1-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified¨ base 11
18- mod base= OTHER
Location/Qualifiers ¨
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Features modified¨ base 99..101
18- mod base= OTHER
Location/Qualifiers ¨
4-4 note= 2'-0-methy1-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
18-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tt
102
3-19 Sequences
3- Sequence Number
19
19-1 [ID]
19-2 3-
Molecule Type RNA
19-3 3-
Length 103
3- Features source 1..103
19- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified¨ base 1..3
19- mod base= OTHER
Location/Qualifiers ¨
4-2 note= 2'-0-methy1-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified¨ base 11
19- mod base= OTHER
Location/Qualifiers ¨
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Features modified¨ base 99..102
19- mod base= OTHER
Location/Qualifiers ¨
4-4 note= 2'-0-methy1-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- cttgccccac agggcagtaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
19 Residues -5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt
103
3-20 Sequences
3- Sequence Number
20-1 [ID]
20-2 3-
Molecule Type RNA
20-3 3-
Length 163
3- source 1..163
Features
20- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
102
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
NonEnglishQualifier
Value
cttgccccac agggcagtaa gttttagagc taggccaaca tgaggatcac ccatgtctgc 60
3-
Residues agggcctagc aagttaaaat aaggctagtc cgttatcaac ttggccaaca
tgaggatcac 120
20-5
ccatgtctgc agggccaagt ggcaccgagt cggtgctttt ttt
163
3-21 Sequences
3- Sequence Number
21
21-1 [ID]
21-2 3-
Molecule Type RNA
21-3 3-
Length 163
3- Features source 1..163
21- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
21- mod base¨ OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 162
21- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
cttgccccac agggcagtaa gttttagagc taggccaaca tgaggatcac ccatgtctgc 60
3-
Residues agggcctagc aagttaaaat aaggctagtc cgttatcaac ttggccaaca
tgaggatcac 120
21-5
ccatgtctgc agggccaagt ggcaccgagt cggtgctttt ttt
163
3-22 Sequences
3- Sequence Number
22
22-1 [ID]
22-2 3-
Molecule Type RNA
3-
Length 163
22-3
3- Features source 1..163
22- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
22- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 161..162
22- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
cttgccccac agggcagtaa gttttagagc taggccaaca tgaggatcac ccatgtctgc 60
3-
Residues agggcctagc aagttaaaat aaggctagtc cgttatcaac ttggccaaca
tgaggatcac 120
22-5
ccatgtctgc agggccaagt ggcaccgagt cggtgctttt ttt
163
103
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3-23 Sequences
3- Sequence Number 23
23-1 [ID]
23-2 3-
Molecule Type RNA
23-3 3-
Length 163
3- Features source 1..163
23- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
23- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 160..162
23- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
cttgccccac agggcagtaa gttttagagc taggccaaca tgaggatcac ccatgtctgc 60
23-5 3-
Residues agggcctagc aagttaaaat aaggctagtc cgttatcaac ttggccaaca
tgaggatcac 120
ccatgtctgc agggccaagt ggcaccgagt cggtgctttt ttt
163
3-24 Sequences
3- Sequence Number
24
24-1 [ID]
24-2 3-
Molecule Type RNA
24-3 3-
Length 163
3- Features source 1..163
24- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
24- mod base¨ OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 159..162
24- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methy1-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
cttgccccac agggcagtaa gttttagagc taggccaaca tgaggatcac ccatgtctgc 60
24-5 3-
Residues agggcctagc aagttaaaat aaggctagtc cgttatcaac ttggccaaca
tgaggatcac 120
ccatgtctgc agggccaagt ggcaccgagt cggtgctttt ttt
163
3-25 Sequences
3- Sequence Number
25-1 [ID]
25-2 3-
Molecule Type RNA
104
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Length 124
25-3
3- Features source 1..124
25- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
25- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
25-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
ggac
124
3-26 Sequences
3- Sequence Number
26
26-1 [ID]
26-2 3-
Molecule Type RNA
26-3 3-
Length 124
3- Features source 1..124
26- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
26- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 121..123
26- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
26-5
ggac
124
3-27 Sequences
3- Sequence Number
27
27-1 [ID]
27-2 3-
Molecule Type RNA
27-3 3-
Length 124
3- Features source 1..124
27- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
27- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
105
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
Value
3- Features modified_base 123
27- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
27-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
ggac
124
3-28 Sequences
3- Sequence Number
28
28-1 [ID]
28-2 3-
Molecule Type RNA
28-3 3-
Length 124
3- Features source 1..124
28- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
28- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 122..123
28- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
28-5
ggac
124
3-29 Sequences
3- Sequence Number 29
29-1 [ID]
29-2 3-
Molecule Type RNA
29-3 3-
Length 124
3- Features source 1..124
29- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
29- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 121..123
29- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methy1-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
106
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Residues gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
29-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
ggac
124
3-30 Sequences
3- Sequence Number 30
30-1 [ID]
30-2 3-
Molecule Type RNA
30-3 3-
Length 100
3- Features source 1..100
30- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
30- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 97..99
30- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Residues gccgtttgta ctttgtcctc gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
30-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-31 Sequences
3- Sequence Number .. 31
31-1 [ID]
31-2 3-
Molecule Type RNA
31-3 3-
Length 129
3- Features source 1..129
31- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
31- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
31-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
cctgaaaat
129
3-32 Sequences
3- Sequence Number 32
32-1 [ID]
32-2 3-
Molecule Type RNA
32-3 3-
Length 129
107
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Features source 1..129
32- Location/Qualifiers mol_type= other RNA
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
32- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 126..128
32- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
32-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
cctgaaaat
129
3-33 Sequences
3- Sequence Number
33
33-1 [ID]
33-2 3-
Molecule Type RNA
3-
Length 129
33-3
3- Features source 1..129
33- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
33- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 128
33- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
33-5 cctgaaaat
129
3-34 Sequences
3- Sequence Number
34
34-1 [ID]
34-2 3-
Molecule Type RNA
3-
Length 129
34-3
3- Features source 1..129
34- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
108
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
34- Location/Qualifiers I mod base= OTHER
4-2 I note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 127..128
34- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
34-5
cctgaaaat
129
3-35 Sequences
3- Sequence Number
35-1 [ID]
35-2 3-
Molecule Type RNA
3-
Length 129
35-3
3- Features source 1..129
35- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
35- mod base¨ OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 126..128
35- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
35-5 cctgaaaat
129
3-36 Sequences
3- Sequence Number
36
36-1 [ID]
36-2 3-
Molecule Type RNA
36-3 3-
Length 100
3- source 1..100
Features
36- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
36- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 97..99
36- Location/Qualifiers mod base= OTHER
109
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
4-3 I note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- atgaagcact gtgggtacga gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
36 Residues -5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-37 Sequences
3- Sequence Number 37
37-1 [ID]
37-2 3-
Molecule Type RNA
3-
Length 100
37-3
3- Features source 1..100
37- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
37- mod base= OTHER
Location/Qualifiers
4-2 note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 97..99
37- mod base= OTHER
Location/Qualifiers
4-3 note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Residues tggtaatgat ggcttcaaca gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
37-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-38 Sequences
3- Sequence Number
38
38-1 [ID]
38-2 3-
Molecule Type RNA
38-3 3-
Length 100
3- Features source 1..100
38- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
38- mod base= OTHER
Location/Qualifiers
4-2 note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 98..99
38- mod base= OTHER
Location/Qualifiers
4-3 note= 2I-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- tggtaatgat ggcttcaaca gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
38 Residues -5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt
100
3-39 Sequences
110
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Sequence Number .. 39
39-1 [ID]
39-2 3-
Molecule Type RNA
3-
Length 102
39-3
3- Features source 1..102
39- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
39- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 99..101
39- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues tggtaatgat ggcttcaaca gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
39-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tt
102
3-40 Sequences
3- Sequence Number
40-1 [ID]
40-2 3-
Molecule Type RNA
40-3 3-
Length 103
3- Features source 1..103
40- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
40- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 99..102
40- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3- Residues tggtaatgat ggcttcaaca gttttagagc tagaaatagc aagttaaaat
aaggctagtc 60
40-5 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt
103
3-41 Sequences
3- Sequence Number
41
41-1 [ID]
41-2 3-
Molecule Type RNA
41-3 3-
Length 126
3- Features source 1..126
111
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
41- Location/Qualifiers I mol_type= other RNA
4-1 I organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
41- mod base= OTHER
Location/Qualifiers
4-2 note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier 123. 125
Value
3- modified base 124..126
Features
41- mod base= OTHER
Location/Qualifiers
4-3 note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
41-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
ggactt
126
3-42 Sequences
3- Sequence Number
42
42-1 [ID]
42-2 3-
Molecule Type RNA
42-3 3-
Length 128
3- Features source 1..128
42- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
42- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 126..128
42- mod base= OTHER
Location/Qualifiers
4-3 note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
42-5
ggactttt
128
3-43 Sequences
3- Sequence Number 43
43-1 [ID]
43-2 3-
Molecule Type RNA
3-
Length 126
43-3
3- Features source 1..126
43- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
43- Location/Qualifiers mod base= OTHER
112
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
4-2 I note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier (On
Value
3- Features modified base 123..125
43- mod base= OTHER
Location/Qualifiers
4-3 note= 2I-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
43-5
ggactt
126
3-44 Sequences
3- Sequence Number
44
44-1 [ID]
44-2 3-
Molecule Type RNA
3-
Length 126
44-3
3- Features source 1..126
44- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
44- mod base= OTHER
Location/Qualifiers
4-2 note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 124..125
44- mod base= OTHER
Location/Qualifiers
4-3 note= 2I-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
44-5
ggactt
126
3-45 Sequences
3- Sequence Number
45-1 [ID]
45-2 3-
Molecule Type RNA
3-
Length 127
45-3
3- Features source 1..127
45- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified base 1..3
45- mod base= OTHER
Location/Qualifiers
4-2 note= 2I-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified base 125..126
45- mod base¨ OTHER
Location/Qualifiers
4-3 note= 2I-0-methyl-3'-phosphonoacetate nucleotide
113
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
45-5
ggacttt
127
3-46 Sequences
3- Sequence Number
46
46-1 [ID]
46-2 3-
Molecule Type RNA
46-3 3-
Length 128
3- source 1..128
Features
46- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
46- mod base¨ OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 125..127
46- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
46-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
ggactttt
128
3-47 Sequences
3- Sequence Number
47
47-1 [ID]
47-2 3-
Molecule Type RNA
3-
Length 128
47-3
3- source 1..128
Features
47- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
47- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 125..126
47- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
47-5
ggactttt
128
114
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3-48 Sequences
3- Sequence Number
48
48-1 [ID]
48-2 3-
Molecule Type RNA
48-3 3-
Length 128
3- Features source 1..128
48- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
48- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 127
48- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gagtccgagc agaagaagaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
48-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgcatgg gagcacttct
tcttctgctc 120
ggactttt
128
3-49 Sequences
3- Sequence Number 49
49-1 [ID]
49-2 3-
Molecule Type RNA
3-
Length 131
49-3
3- Features source 1..131
49- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
49- mod base¨ OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 128..130
49- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methy1-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
49-5
cctgaaaatt t
131
3-50 Sequences
3- Sequence Number
50-1 [ID]
50-2 3-
Molecule Type RNA
115
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Length 133
50-3
3- Features source 1..133
50- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
50- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 130..132
50- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
50-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
cctgaaaatt ttt
133
3-51 Sequences
3- Sequence Number
51
51-1 [ID]
51-2 3-
Molecule Type RNA
51-3 3-
Length 131
3- Features source 1..131
51- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
51- mod base= OTHER
Location/Qualifiers
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 129..130
51- mod base= OTHER
Location/Qualifiers
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
51-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
cctgaaaatt t
131
3-52 Sequences
3- Sequence Number
52
52-1 [ID]
52-2 3-
Molecule Type RNA
52-3 3-
Length 133
3- Features source 1..133
52- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
116
CA 03230928 2024-03-01
WO 2023/043856 PCTMS2022/043553
Value
3- Features modified_base 1..3
52- mod base= OTHER
Location/Qualifiers ¨
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 130..132
52- mod base= OTHER
Location/Qualifiers ¨
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
52-5 3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
cctgaaaatt ttt
133
3-53 Sequences
3- Sequence Number
53
53-1 [ID]
53-2 3-
Molecule Type RNA
3-
Length 133
53-3
3- Features source 1..133
53- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
53- mod base= OTHER
Location/Qualifiers ¨
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
3- Features modified_base 131..132
53- mod base= OTHER
Location/Qualifiers ¨
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
3-
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
53-5 cctgaaaatt ttt
133
3-54 Sequences
3- Sequence Number
54
54-1 [ID]
54-2 3-
Molecule Type RNA
3-
Length 133
54-3
3- Features source 1..133
54- mol_type= other RNA
Location/Qualifiers
4-1 organism= synthetic construct
NonEnglishQualifier
Value
3- Features modified_base 1..3
54- mod base= OTHER
Location/Qualifiers ¨
4-2 note= 2'-0-methyl-3'-phosphorothioate nucleotide
NonEnglishQualifier
Value
117
CA 03230928 2024-03-01
WO 2023/043856
PCT/US2022/043553
3- Features modified_base 132
54- Location/Qualifiers mod base= OTHER
4-3 note= 2'-0-methyl-3'-phosphonoacetate nucleotide
NonEnglishQualifier
Value
3-
gcattttcag gaggaagcga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
Residues cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc tgaagccatc
catgcttcct 120
54-5
cctgaaaatt ttt
133
118
