Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
En~L~N CRIPTIN GROW~ FACTOR
This invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynucleotides, the use of such polynucleotides and
polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention has been putatively
identified as a human Criptin Growth Factor, sometimes
hereinafter referred to as "CGF". The invention also relates
to inhibiting the action of such polypeptides.
Growth factors and other mitogens, including
transforming oncogenes, are capable of rapidly inducing a
complex set of genes to be expressed by certain cells (Lau,
L.F. and Nathans, D., Molecular As~ects of Cellular
Requlation, 6:165-202 (1991). These genes, which have been
named immediate early or early response genes, are
transcriptionally activated within minutes after contact with
a growth factor or mitogen, independent of de novo protein
synthesis. A group of these imm~ te early genes encodes
secreted, extracellular proteins which are needed for
coordination of complex biological processes such as
differentiation and proliferation, regeneration and wound
healing (Ryseck, R.P. et al, Cell Growth Differ., 2:235-233
~ (1991).
--1-- ,
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
The expression of these immediate early genes act as
~third messengers~ in the cascade of events triggered by
growth factors. It is also thought that they are needed to
integrate and coordinate complex biological processes, such
as differentiation and wound healing in which cell
proliferation is a common event.
The criptin growth factor is overexpressed and secreted
by certain types of cancer cells, for example, by pancreatic
cancers.
The CGF of the present invention shows amino acid
sequence homology to the cripto growth factor disclosed in
U.S. Patent 5,256,643 which is hereby incorporated by
reference in its entirety. The cripto growth factor is one
of the useful tumor markers known Cripto is often
upregulated in colon cancers and is expressed in pancreatic
cancers.
In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide, as well as
biologically active and diagnostically or therapeutically
useful fragments, analogs and derivatives thereof.
In accordance with another aspect of the ~resent
invention, there are provided isolated nucleic acid molecules
encoding the polypeptide of the present invention including
mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and
biologically active and diagnostically or therapeutically
useful fragments and derivatives thereof.
In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells,
contAin~ng a nucleic acid sequence encoding a polypeptide of
the present invention, under conditions promoting expression
of said protein and subsequent recovery of said protein.
In accordance with yet a further aspect of the present
invention, there is provided a process of utilizing such
CA 0221~286 1997-09-12
W O 96/39420 PCTrUS95/07087
polypeptide, or polynucleotide e=ncoding such polypeptide for
therapeutic purposes, for example, to treat muscle wasting
diseases, osteoporosls, to aid in implant fixation, to
stimulate wound healing and tissue regeneration, to promote
angiogenesis and to stimulate proliferation of vascular
smooth muscle and endothelial cell production.
In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
In accordance with yet another aspect of the present
invention, there are provided antagonists to such
polypeptides, which may be used to inhibit the action of such
polypeptides, for example, to limit the production of excess
connective tissue during wound healing or pulmonary fibrosis.
In accordance with yet a further aspect of the present
invention, there are also provided nucleic acid probes
comprising nucleic acid molecules of sufficient length to
speci~ically hybridize to the polynucleotide sequences of the
present invention.
In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to expression o~ the polypeptide of the
present invention and mutations in the nucleic acid sequences
encoding such polypeptide.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides,
for in vitro purposes related to scientific research,
synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should
be apparent to those skilled in the art from the teachings
herein.
The following drawings are illustrative of em~odiments
of the invention and are not meant to limit the scope of the
invention as Pncomrassed by the claims.
CA 0221~286 1997-09-12
WO 96/39420 PCT/US95/07087
Figure 1 shows the cDNA and corresponding deduced amino
acid sequence of the polypeptide of the present invention.
The s~n~rd one letter abbreviations for amino acids are
used. Sequencing was per~ormed using a 373 Automated DNA
sequencer (Applied Biosystems, Inc.).
Figure 2 shows the amino acid sequence homology between
the polypeptide of the present invention (top line) and the
cripto growth factor (bottom line).
In accordance with an aspect of the present invention,
there are provided isolated nucleic acids (polynucleotides)
which encode for the m.ature polypeptide having the deduced
amino acid sequence of Figure 1 (SEQ ID NO:2) or for the
mature polypeptide encoded by the cDNA of the clone(s)
deposited as ATCC Deposit No. 97142 on May 11, 1995.
A polynucleotide encoding a polypeptide of the present
invention was discovered in a cDNA library derived from human
pancreatic cancer tissue. It is structurally related to the
human cripto growth factor. It contains an open reading
frame encoding a protein of 230 amino acid residues of which
approximately the first 23 amino acids residues are the
putative leader sequence such that the m.ature protein
comprises 207 amino acids. As shown in figure 2 the
polypeptide of the present invention has conserved cysteine
residues in common with cripto growth factor.
Moreover, the polypeptide of the present invention has
a putative soluble portion comprising amino acid 45 to amino
acid 128 of S~Q ID NO:2, such that amino acid 129 to amino
acid 207 is a putative tr~n~m~mhrane portion.
An initial Northern blot analysis has shown very high
expression in pancreatic cancer cells.
The polynucleotide of the present invention may be in
the form. of RNA or in the form of DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be double-
stranded or single-stranded, and if single stranded m.ay be
the coding strand or non-coding (anti-sense) strand. The
CA 0221~286 1997-09-12
W O 96t39420 PCTAJS95/07087
coding sequence which encodes the mature polypeptide may be
identical to the coding sequence shown in Figure 1 (SEQ ID
NO:1) or that of the deposited clone or may be a different
coding sequence which coding sequence, as a result of the
re~lln~ncy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1)
or the deposited cDNA.
The polynucleotide which encodes for the mature
polypeptide of Figure 1 (SEQ ID No. 2) or for the mature
polypeptide encoded by the deposited cDNA may include: only
the coding sequence for the mature polypeptide; the coding
sequence for the mature polypeptide and additional coding
sequence such as a leader or secretory sequence or a
proprotein sequence; the coding sequence for the mature
polypeptide (and optionally additional coding sequence) and
non-coding sequence, such as introns or non-coding sequence
and/or 3 of the coding sequence for the mature
polypeptide.
Thus, the term "polynucleotide PnCo~;ng a polypeptide"
encompasses a polynucleotide which includes only coding
sequence for the polypeptide as well as a polynucleotide
which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the
hereinabove described polynucleotides which encode for
fragments, analogs and derivatives of the polypeptide having
the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or
the polypeptide encoded by the cDNA of the deposited clone.
The variant of the polynucleotide may be a naturally
occurring allelic variant of the polynucleotide or a non-
naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in Figure 1
(SEQ ID No. 2) or the same mature polypeptide encoded by the
cDNA of the deposited clone as well as variants of such
polynucleotides which variants encode for a fragment,
CA 0221~286 1997-09-12
W O 96/39420 PCTAUS95/07087
derivative or analog of the polypeptide of Figure 1 (SEQ ID
No. 2) or the polypeptide encoded by the cDNA of the
deposited clone. Such nucleotide variants include deletion
variants, substitution variants and addition or insertion t
variants.
As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic
variant of the coding sequence shown in Figure 1 (SEQ ID
NO:1) or of the coding sequence of the deposited clone. As
known in the art, an allelic variant is an alternate form of
a polynucleotide sequence which may have a substitution,
deletion or addition of one or more nucleotides, which does
not substantially alter the function of the encoded
polypeptide.
The present invention also includes polynucleotides,
wherein the coding sequence for the mature polypeptide may be
fused in the same reading frame to a polynucleotide sequence
which aids in expression and secretion of a polypeptide from
a host cell, for example, a leader sequence which functions
as a secretory sequence for controlling transport of a
polypeptide from the cell. The polypeptide having a leader
sequence is a preprotein and may have the leader sequence
cleaved by the host cell to form the mature form of the
polypeptide. The polynucleotides may also PnCo~e for a
proprotein which is the mature protein plus additional 5'
amino acid residues. A mature protein having a prosequence
is a proprotein and is an inactive form of the protein. Once
the prosequence is cleaved an active mature protein rPmA i n.c,
Thus, for example, the polynucleotide of the present
invention may encode for a mature protein, or for a protein
having a prosequence or for a protein having both a
prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also
have the coding sequence fused in frame to a marker sequence
which allows for purification of the polypeptide of the
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
present invention. The marker sequence may be a hexa-
histidine tag su~plied by a pQE-9 vector to provide for
puri~ication of the mature polypeptide fused to the marker in
the case of a bacterial host, or, ~or example, the marker
sequence may be a hemagglutinin (HA) tag when a m~mm~l ian
host, e.g. COS-7 cells, is used. The HA tag corresponds to
an epitope derived from the in~luenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:767 (1984)).
The term ~gene" means the segment o~ DNA involved in
producing a polypeptide chain; it includes regions preceding
and following the coding region (leader and trailer) as well
as intervening sequences (introns) between individual coding
segments (exons).
Fragments of the full length CGF gene may be used as a
hybridization probe for a cDNA library to isolate the full
length CGF gene and to isolate other genes which have a high
sequence similarity to the gene or similar biological
activity. Probes of this type preferably have at least 30
bases and may contain, for example, 50 or more bases. The
probe may also be used to identify a cDNA clone corresponding
to a full length transcript and a genomic clone or clones
that contain the complete CGF gene including regulatory and
promotor regions, exons, and introns. An example of a screen
comprises isolating the coding region of the CGF gene by
using the known DNA sequence to synthesize an oligonucleotide
probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention
are used to screen a library o~ human cDNA, genomic DNA or
mRNA to determine which members of the library the probe
hybridizes to.
The present invention further relates to
polynucleotides which hybridize to the hereinabove-described
sequences if there is at least 70%, preferablv at least 90%,
and more preferably at least 95~ identity between the
sequences. The present invention particularly relates to
CA 0221~286 1997-09-12
W O 96/39420 PCTrUS95/07087
polynucleotides which hybridize under stringent conditions to
the hereinabove-described polynucleotides. As herein used,
the term "stringent conditions" means hybridization will
occur only if there is at least 95~ and preferably at least
97~ identity between the sequences. The polynucleotides
which hybridize to the hereinabove described polynucleotides
in a preferred embodiment encode polypeptides which either
retain substantially the same biological function or activity
as the mature polypeptide encoded by the cDNAs of Figure 1
(SEQ ID NO:1) or the deposited cDNA(s).
Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50
bases which hybridize to a polynucleotide of the present
invention and which has an identity thereto, as hereinabove
described, and which may or may not retain activity. For
example, such polynucleotides may be employed as probes for
the polynucleotide of SEQ ID NO:1, for example, for recovery
of the polynucleotide or as a diagnostic probe or as a PCR
primer.
Thus, the present invention is directed to
polynucleotides having at least a 70~ identity, preferably at
least 90% and more preferably at least a 95% identity to a
polynucleotide which encodes the polypeptide of SEQ ID NO:2
as well as fragments thereof, which fragments have at least
30 bases and preferably at least 50 bases and to polypeptides
encoded by such polynucleotides.
The deposit(s) referred to herein will be maintained
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Micro-organisms for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those of skill in the art and are not an
admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides contained in the
deposited materials, as well as the amino acid sequence of
the polypeptides encoded thereby, are incorporated herein by
CA 0221~286 1997-09-12
W O 96/39420 PCT~US95/07087
reference and are controlling in the event of any conflict
with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and
no such license is hereby granted.
The present invention further relates to a polypeptide
which has the deduced amino acid sequence of Figure 1 (SEQ ID
No. 2) o~ which has the amino acid sequence encoded by the
deposited cDNA, as well as fragments, analogs and derivatives
of such polypeptide.
The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of Figure 1 (SEQ ID No. 2) or
that encoded by the deposited cDNA, means a polypeptide which
retains essentially the same biological function or activity
as such polypeptide. Thus, an analog includes a proprotein
which can be acti~ated by cleavage of the proprotein portion
to produce an active mature polypeptide.
The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide
o~ Figure 1 (SEQ ID No. 2) or that encoded by the deposited
cDNA may be (i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved
amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may
not be one encoded by the genetic code, or (ii) one in which
one or more of the amino acid residues includes a substituent
group, or (iii) one in which the mature polypeptide is fused
with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene
glycol), or (iv) one in which the additional amino acids are
fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for
purification of the mature polypeptide or a proprotein
sequence or (v) splice variants of the mature polypeptide
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
which are lacking certain amino acid residues yet still
r~tain biological activity. Such fragments, derivatives and
analogs are deemed to be within the scope of those skilled in
the art from the teachings herein.
The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
The term "isolated" means that the material is removed
from its original environm~nt (e.g., the natural environment
if it is naturally occurring). For example, a naturally-
occurring polynucleotide or polypeptide present in a living
~nim~l is not isolated, but the same polynucleotide or
polypeptide, separated from some or all of the coexisting
materials in the natural system, is isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural enviLo~ e~t.
The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature
polypeptide) as well as polypeptides which have at least 70~
similarity (preferably at least a 70% identity) to the
polypeptide of SEQ ID NO:2 and more preferably at least a 90%
similarity (more preferably at least 90% identity) to the
polypeptide of SEQ ID NO:2 and still more preferably at least
a 95% similarity (still more preferably at least a 95%
identity) to the polypeptide of SEQ ID NO:2 and also include
portions of such polypeptides with such portion of the
polypeptide generally cont~;n;ng at least 30 amino acids and
more preferably at least 50 amino acids.
As known in the art llsimilarityl~ between two
polypeptides is determined by comparing the amino acid
sequence and its conserved amino acid substitutes of one
polypeptide to the sequence of a second polypeptide.
--10--
CA 0221~286 1997-09-12
W O 96/39420 PCTAJS95/07087
Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to
synthesize full-length polynucleotides of the present
invention.
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetically engineered with vectors of the
invention and the production of polypeptides of the invention
by recombinant techniques.
Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this
invention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
form of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the CGF
genes. The culture conditions, such as temperature, pH and
the like, are those previously used with the host cell
selected for expression, and will be apparent to the
ordinarily skilled artisan.
The polynucleotides of the present invention may be
employed for producing polypeptides by recombinant
techniques. Thus, for example, the polynucleotide may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from
cr~Tnh;n~tions of plasmids and phage DNA, viral DNA such as
vaccinia, adenovirus, fowl pox virus, and pseudorabies.
--11--
CA 0221~286 1997-09-12
W O 96/39420 PCTrUS95/07087
However, any other vector may be used as long as it is
replicable and viable in the host.
The appropriate DNA sequence may be inserted into the
vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction
~n~on~clease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s)
(promoter) to direct mRNA synthesis. As representative
examples of such promoters, there may be mentioned: LTR or
SV40 promoter, the E. coli. lac or tr~, the phage 1 z~mh~ PL
promoter and other promoters known to control expression of
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome binding site
for translation initiation and a transcription terminator.
The vector may also include appropriate sequences for
amplifying expression.
In addition, the exPression vectors preferably contain
one or more selectable marker genes to provide a phenotypic
trait ~or selection of trans~ormed host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic
cell culture, or such as tetracycline or ampicillin
resistance in E. coli.
The vector cont~in;ng the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate
host to permit the host to express the protein.
As representative examples of appropriate hosts, there
may be mentioned: bacterial cells, such as E. coli,
Streptomyces~ S~lm~n~l la tYPhimurium; fungal cells, such as
yeast; insect cells such as DrosoPhila S2 and SPodoPtera Sf9;
~n~m~l cells such as C~O, COS or Bowes m~l ~nom~;
adenoviruses; plant cells, etc. The selection of an
-12-
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
appropriate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
More particularly, the present invention also includes
recombinant constructs comprising one or more of the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect o~ this
embodiment, the construct further comprises regulatory
sequences, including, for example, a promoter, operably
linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided
by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen),
pBS, pD10, phagescript, psiX174, pbluescript SK, pBSKS,
pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-
3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG,
pSVL (Pharmacia). However, any other plasmid or vector may
be used as long as they are replicable and viable in the
host.
Promoter regions can be selected from any desired gene
u ing CAT (chlor~mrh~nicol transferase) vectors or other
vectors with selectable markers. Two appropriate vectors are
PKK232-8 and PCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, 1Amh~ PR~ PL and trp.
Eukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection of the appropriate
vector and promoter is well within the level of ordinary
skill in the art.
In a further embodiment, the present invention relates
to host cells cont~in;ng the above-described constructs. The
host cell can be a higher eukaryotic cell, such as a
m~mm~lian cell, or a lower eukaryotic cell, such as a yeast
CA 022l~2s6 Iss7-os-l2
WO 96/39420 pcTlusss/o7o87
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, DEAE-
Dextran mediated transfection, or electroporation (Davis, L.,
Dibner, M., Battey, I., Basic Methods in Molecular Biology,
(1986)) .
The constructs in host cells can be used in a
conventional manner to produce the gene product encoded by
the recombinant sequence. Alternatively, the polypeptides of
the invention can be synthetically produced by conventional
peptide synthesizers.
Mature proteins can be expressed in m;~ ian cells,
yeast, bacteria, or other cells under the control of
appropriate promoters. Cell-free translation systems can
also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of
which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of
the present invention by higher eukaryotes is increased by
inserting an enhancer sequence into the vector. Enhancers
are cis-acting elements of DNA, usually about from 10 to 300
bp that act on a promoter to increase its transcription.
Examples including the SV40 PnhAncer on the late side of the
replication origin bp 100 to 270, a cytomegalovirus early
promoter enhancer, the polyoma PnhAncer on the late side of
the replication origin, and adenovirus PnhAncers.
Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin
resistance gene of E. coli and S. cerevisiae TRP1 gene, and
a promoter derived from a highly-expressed gene to direct
--14--
CA 0221~286 1997-09-12
W O ~6/39420 PCTnJS95/07087
transcription of a downstream structural sequence. Such
promoters can be derived from operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase (PGK), ~-factor,
acid phosphatase, or heat shock proteins, among others. The
heterologous structural sequence is assem~led in appropriate
phase with translation initiation and t_rmination sequences,
and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence
can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics,
e.g., stabilization or simplified purification of expressed
recombinant product.
Useful expression vectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with suitable translation
initiation and termination signals in operable reading phase
with a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of
replication to ensure maintenance of the vector and to, if
desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli,
Bacillus subtilis, S~lm~nplla ty~h;mllrium and various species
within the genera Psell~om~n~ fi, Streptomyces, and
Staphylococcus, although others may also be employed as a
matter of choice.
As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a
selectable marker and bacterial origin of replication derived
from c~m~rcially available plasmids comprising genetic
elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1
(Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
CA 0221~286 1997-09-12
W O 96/39420 PCTAJS95/07087
sections are combined with an appropriate promoter and the
structural sequence to be expressed.
Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are
cultured for an additional period.
Cells are typically harvested by centrifugation,
disrupted by physical or chemical means, and the resulting
crude extract retained for ~urther puri~ication.
Microbial cells employed in expression of proteins can
be disrupted by any convenient method, including freeze-thaw
cycling, sonication, mechanical disruption, or use of cell
lysing agents, such methods are well know to those skilled in
the art.
Various m~mm~l ian cell culture systems can also be
employed to express recombinant protein. Examples of
mA~Alian expression systems include the COS-7 lines of
monkey kidney fibroblasts, described by Gluzman, Cell, 23:175
(1981), and other cell lines capable of expressing a
compatible vector, for example, the C127, 3T3, CHO, HeLa and
BHK cell lines. ~AmmAl ian expression vectors will comprise
an origin of replication, a suitable promoter and ~nhAncer,
and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the
SV40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic elements.
The polypeptides of the present invention can be
recovered and puri~ied from recombinant cell cultures by
methods including Amm~nium sulfate or ethanol precipitation,
acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
CA 0221~286 1997-09-12
W O 96/39420 PCTrUS95/07087
chromatography and lectin chromatography. Protein refolding
steps can be used, as necessary, in completing configuration
of the mature protein. Finally, high performance liquid
- chromatography (HPLC) can be employed for final purification
steps.
The polypeptides of the present invention may be a
naturally purified product, or a product of chemical
synthetic procedures, or produced by reco~h~nAnt techni~ues
from a prokaryotic or eukaryotic host (for example, by
bacterial, yeast, higher plant, insect and m~mm~lian cells in
culture). Depending upon the host employed in a recombinant
production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
The CGF gene of the present invention may be labeled and
used as a probe for the analysis of Southern blots contAinlng
~n~onllclease digested DNA preparations to ascertain if there
are amplification, rearrangement, deletions or restrictiion
~ragment length polymorphisms of the criptin gene in normal
versus tumor tissue.
The labeled criptin gene can be employed for the
analysis of Northern blots that contain RNA to determine the
relative levels of mRNA expression in various normal and
pathologic tissue sample.
The CGF gene may be employed to generate a probe
suitable for in situ RNA:RNA hybridization for histologic
localization in normal or pathologic cells expressing CGF
mRNA.
CGF oligonucleotides (sense-strand) may be employed to
detect levels of CGF mRNA in various tissues.
CGF polypeptide is over expressed and secreted by
certain types of cancer cell, for example, pancreatic
cancers. Therefore, detection of CGF gene transcription or
an excessive amount of CGF protein allows a pancreatic cancer
-17-
CA 0221~286 1997-09-12
W O 96/39420 PCT~US9S/07087
diagnosis. Accordingly, an anti-CGF antibody could be used
to diagnose neovascularization associated with tumor
formation since an altered level of this polypeptide may be
indicative of such disorders.
A competit_on assay may be employed wherein antibodies
specific to CGF are attached to a solid support and labeled
CGF and a sample derived from the host are passed over the
solid support and the amount of label detected attached to
the solid support can be correlated to a quantity of CGF in
the sample.
A "sandwich" assay is similar to an ELISA assay. In a
"sandwich" assay the CGF polypeptide is passed over a solid
support and binds to antibody attached to a solid support.
A second antibody is then bound to the CGF polypeptide. A
third antibody which is labeled and specific to the second
antibody is then passed over the solid support and binds to
the second antibody and an amount can then be quantified.
The polypeptide of the present invention may be employed
in wound-healing and associated therapies concerned with re-
growth of tissue, such as connective tissue, skin, bone,
cartilage, muscle, lung or kidney.
The polypeptide may also be employed to stimulate
angiogenesis, for example, to ~nh~nce the growth of vascular
smooth muscle and endothelial cells. The increase in
angiogenesis would be beneficial to ischemic tissues and to
collateral coronary development in the heart subsequent to
coronary stenosis.
The polypeptide of the present invention may also be
employed during implant fixation to stimulate the growth of
cells around the implant and therefore, ~acilitate its
attachment to its intended site.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides,
as a research reagent for in vitro purposes related to
-18-
CA 0221~286 1997-09-12
W O 96/39420 PCTrUS95/07087
scientific research, synthesis of DNA and manufacture of DNA
vectors, for the purpose of developing therapeutics and
diagnostics for the treatment of human disease.
This invention provides a method for identification of
the receptor for the polypeptide of the present invention.
The gene encoding the receptor can be identified by numerous
methods known to those of skill in the art, for example,
ligand pAnni ng and FACS sorting (Coligan, et al., Current
Protocols in Immun., 1(2), Chapter 5, (1991)). Preferably,
expression cloning is employed wherein polyadenylated RNA is
prepared from a cell responsive to CGF polypeptides, and a
cDNA library created from this RNA is divided into pools and
used to transfect COS cells or other cells that are not
responsive to CGF. Transfected cells which are grown on
glass slides are exposed to labeled CGF. CGF can be labeled
by a variety of means including iodination or inclusion of a
recognition site for a site-specific protein kinase.
Following fixation and incubation, the slides are subjected
to autoradiographic analysis. Positive pools are identified
and sub-pools are prepared and retransfected using an
iterative sub-pooling and rescreening process, eventually
yielding a single clone that encodes the putative receptor.
AS an alternative approach for receptor identirication,
labeled CGF can be photoaffinity linked with cell membrane or
extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE and exposed to X-
ray film. The labeled complex containing the CGF-receptor
can be excised, resolved into peptide fragments, and
subjected to protein microsequencing. The amino acid
sequence obt~;ne~ from microsequencing would be used to
design a set of degenerate oligonucleotide probes to screen
a cDNA library to identify the gene encoding the putative
receptor.
This invention is also related to a method of screening
compounds to identify those which ~ind to and activate the
--19--
CA 0221~286 1997-09-12
WO 96/39420 PCT/US95/07087
CGF receptors. An example of such a measures stimulation of
the proliferation of endothelial cells in the presence of the
comitogen Con A. Human umbilical vein endothelial cells are
obtained and cultured in 96-well flat-bottomed culture plates
(Costar, Cambridge, MA) and supplemented with a reaction
mixture appropriate for facilitating proliferation of the
cells, the mixture contA~n~ng Con-A (Calbiochem, La Jolla,
CA). Con-A and the compound to be screened are added and
after incubation at 37~C, cultures are pulsed with
3 tH]thymidine and harvested onto glass fiber filters (PhD;
Cambridge Technology, Watertown, MA). Mean 3 [H]-thymidine
incorporation (cpm) of triplicàte cultures is determined
using a liquid scintillation counter (Beckman Instruments,
Irvine, CA). Significant 3 [H]-thymidine incorporation
indicates stimulation of endothelial cell proliferation.
To assay for antagonist compounds, the assay described
above is performed, however, in this assay CGF is added along
with the compound to be screened and the ability of the
compound to ; nh; h; t 3 [H]-thymidine incorporation in the
presence of CGF, indicates that the compound is an antagonist
to CGF.
Alternatively, CGF antagonists may be detected by
combining labeled CGF and a potential antagonist compound
with membrane-bound CGF receptors or recombinant receptors
under appropriate conditions for a competitive inhibition
assay. CGF can be labeled, such as by radioactivity, such
that the number of CGF molecules bound to the receptor can
determine the effectiveness of the potential antagonist.
Alternatively, the response of a known second messenger
system following interaction of a potential antagonist
compound and receptor would be measured. Such second
messenger systems include but are not limited to, cAMP
guanylate cyclase, ion ~h~nn~l S or phosphoinositide
hydrolysis. The compound may be labeled to detect binding.
-20-
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
A compound which binds but which does not elicit a second
messenger response is an effective antagonist compound.
Examples of potential CGF antagonist compounds include
an antibody, or in some cases, an oligonucleotide, which
binds to the polypeptide itsel~ or to the receptor ~or the
polypeptide. Alternatively, a potential anta~onist may be a
closely related protein, for example, a mutated form of CGF,
which recognizes the CGF receptor but imparts no e~ect,
thereby competitively inhibiting the action of CGF.
Another potential CGF antagonist is an antisense
construct prepared using antisense technology. Antisense
technology can be used to control gene expression through
triple-helix formation or antisense DNA or RNA, both of which
methods are based on binding of a polynucleotide to DNA or
RNA. For example, the 5' coding portion of the
polynucleotide sequence, which PnCoAes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in
transcription (triple helix -see Lee et al., Nucl. Acids
Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby
preventing transcription and the production of CGF. The
antisense RNA oligonucleotide hybridizes to the mRNA in vivo
and blocks translation of the mRNA molecule into the CGF
(antisense - Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene
Expression, CRC Press, Boca Raton, FL (1988)). The
oligonucleotides described above can also be delivered to
cells such that the antisense RNA or DNA may be expressed in
vivo to inhibit production of CGF.
Potential CGF antagonists include small molecules which
bind to the active site of the polypeptide, the receptor
binding site, or other growth factor binding site of the
-21-
,
=
CA 0221~286 1997-09-12
WO 96/39420 PCTAJS95/07087
polypeptide thereby blocking the normal biological activity
of CGF. Examples of small molecules include but are not
limited to small peptides or peptide-like molecules.
The antagonists may be employed to inhibit tumor growth,
directly or indirectly, e.g., by antagonizing CGF activity
and/or antagonizing neovascularization and the neointimal
proliferation of smooth muscle cells prevalent in
atherosclerosis and restenosis subsequent to balloon
angioplasty.
The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
The CGF polypeptides and antagonist compounds of the
present invention may be employed in comh;n~tion with a
suitable pharmaceutical carrier. Such compositions comprise
a therapeutically effective amount of the polypeptide or
antagonist compound and a pharmaceutically acceptable carrier
or excipient. Such a carrier includes but is not limited to
saline, buffered saline, dextrose, water, glycerol, ethanol,
and combinations thereof. The formulation should suit the
mode of ~m~nistration.
The invention also provides a pharmaceutical pack or kit
comprising one or more cont~n~rs filled with one or more of
the ingredients of the pharmaceutical compositions of the
invention. Associated wi such cont~ner(s) can be a notice
in the form prescribed by a governmental agency regulating
the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects a~o~al by the agency of
manufacture, use or sale for human ~m;ni~tration. In
addition, the pharmaceutical compositions may be employed in
conjunction with other therapeutic compounds.
The pharmaceutical compositions may be ~m~n~stered in
a convenient m~nner such as by the oral, topical,
intravenous, intraperitoneal, intramuscular, subcutaneous,
intranasal or intradermal routes. The pharmaceutical
CA 0221~286 1997-09-12
W O 96/39420 PCTrUS95/07087
compositions are ~m;n; stered in an amount which is effective
for treating and/or prophylaxis of the specific indication.
In general, they are ;~lmini stered in an amount of at least
about 10 ~g/kg body weight and in most cases they will be
~mi ni stered in an amount not in excess of about 8 mg/Kg body
weight per day. In most cases, the dosage is from about 10
~g/kg to about 1 mg/kg body weight daily, taking into account
the routes of administration, symptoms, etc.
CGF in combination with other growth factors including
but not limited to, PDGF, IGF, FGF, EGF or TGF-~ may
accelerate physiological responses as seen in wound healing.
The CGF polypeptide and agonists and antagonists which
are polypeptides, may also be employed in accordance with the
present invention by expression of such polypeptides in vivo,
which is often referred to as "gene therapy."
Thus, for example, cells from a patient may be
engineered with a polynucleotide (DNA or RNA) encoding a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells
may be engineered by procedures known in the art by use of a
retroviral particle cont~;n;ng RNA encoding a polypeptide of
the present invention.
Similarly, cells may be engineered in vivo for
expression of a polypeptide in vivo by, for example,
procedures known in the art. As known in the art, a producer
cell for pro~llc~ng a retroviral particle cont~;n;ng RNA
encoding the polypeptide of the present invention may be
;~m; n;stered to a patient for engineering cells in vivo and
expression of the polypeptide in vivo. These and other
methods for ~m; n;stering a polypeptide of the present
invention by such method should be apparent to those skilled
in the art from the teachings of the present invention. For
example, the expression vehicle for engineering cells may be
other than a retrovirus, for example, an adenovirus which may
-23-
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
be used to engineer cells in vivo after combination with a
suitable delivery vehicle.
Retroviruses from which the retroviral plasmid vectors
hereinabove mentloned may be derived include, but are not
limited to, Moloney Murine Leukemia Virus, spleen necrosis
virus, retroviruses such as Rous Sarcoma Virus, Harvey
Sarcoma Virus, avian leukosis virus, gibbon ape leukemia
virus, human ~mmllnodeficienCy virus, adenovirus,
Myeloproliferative Sarcoma Virus, and m~mm~ry tumor virus.
In one embodiment, the retroviral plasmid vector is derived
from Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited
to, the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other
promoter (e.g., cellular promoters such as eukaryotic
cellular promoters including, but not limited to, the
histone, pol III, and ~-actin promoters). Other viral
promoters which may be employed include, but are not limited
to, adenovirus promoters, thymidine kinase (TK) promoters,
and B19 parvovirus promoters. The selection of a suitable
promoter will be apparent to those skilled in the art from
the teachings contained herein.
The nucleic acid sequence encoding the polypeptide of
the present invention is under the control of a suitable
promoter. Suitable promoters which may be employed include,
but are not limited to, adenoviral promoters, such as the
adenoviral major late promoter; or hetorologous promoters,
such as the cytomegalovirus (CMV) promoter; the respiratory
syncytial virus (RSV) promoter; inducible promoters, such as
the MMT promoter, the metallothionein promoter; heat shock
promoters; the albumin promoter; the ApoAI promc-er; human
globin promoters; viral thymidine kinase promoters, such as
the Herpes Simplex thymidine kinase promoter; retroviral LTRs
-24-
CA 0221~286 1997-09-12
W O 96/39420 PCT/US9S/07087
(including the modified retroviral LTRs herein~hove
described); the ~-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter
which controls the genes encoding the polypeptides.
The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples
of packaging cells which may be transfected include, but are
not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X,
VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GPlenvAml2, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1,
pgs. 5-14 (1990), which is incorporated herein by reference
in its entirety. The vector may transduce the packaging
cells through any means known in the art. Such means
include, but are not limited to, electroporation, the use of
liposomes, and CaPO4 precipitation. In one alternative, the
retroviral plasmid vector may be encapsulated into a
liposome, or coupled to a lipid, and then ~m; ni stered to a
host.
The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles
then may be employed, to transduce eukaryotic cells, either
in vitro or in vivo. The transduced eukaryotic cells will
express the nucleic acid sequence(s) encoding the
polypeptide. Eukaryotic cells which may be transduced
include, but are not limited to, embryonic stem cells,
embryonic carcinom~ cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchi~l epithelial cells.
The sequences of the present invention are also valuable
for chromosome identification. The sequence is specifically
targeted to and can hybridize with a particular location on
an individual human chromosome. Moreover, there is a current
need for identifying particular sites on the chromosome. Few
chromosome marking reagents based on actual sequence data
CA 0221~286 1997-09-12
W096/39420 pcT/us9s/o7o87
(repeat polymorphisms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important ~irst step
in correlating those sequences with genes associated with
disease.
Briefly, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) ~rom the cDNA.
Computer analysis of the 3' untranslated region is used to
rapidly select primers that do not span more than one exon in
the genomic DNA, thus complicating the amplification process.
These primers are then used for PCR screening of somatic cell
hybrids cont~n~ng individual human chromosomes. Only those
hybrids cont~;n~n~ the human gene correspon~ng to the primer
will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure
for assign-ng a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide
primers, sublocalization can be achieved with p~n~ls of
fragments from specific chromosomes or pools of large genomic
clones in an analogous m~nn~r. Other mapping strategies that
can similarly be used to map to its chromosome include in
situ hybridization, prescreening with labeled flow-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) o~ a cDNA
clone to a met~rh~e chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 50 or 60 bases.
For a review o~ this technique, see Verma et al., Human
Chromosomes: a M~n~l of Basic Techniques, PeLy~llloll Press,
New York (1988).
Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
data are found, for example, in V. McKusick, Mendelian
CA 0221~286 1997-09-12
W096/39420 PCT~S95/07087
Inheritance in Man (available on line through Johns Hopkins
University Welch Medical Library). The relation~h;p between
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
a~ected i dividuals but not in any normal individuals, then
the mutation is likely to be the causative agent of the
disease.
With current resolution o~ physical m.apping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disease could be one
o~ between 50 and 500 potential causative genes. (This
assumes 1 megabase mapping resolution and one gene per 20
kb).
The polypeptides, their fragments or other derivatives,
or analogs thereof, or cells expressing them can be used as
an i~mllnogen to produce antibodies thereto. These antibodies
can be, ~or example, polyclonal or monoclonal antibodies.
The present invention also includes ~h;m~ric~ single chain,
and hnm~nized antibodies, as well as Fab fragments, or the
product of an Fab expression library. Various procedures
known in the art may be used ~or the production of such
antibodies and fragments.
Antibodies generated against the polypeptides
corresponding to a sequence of the present invention can be
obt~ine~ by direct injection of the polypeptides into an
~n~m~l or by ~m;nistering the polypeptides to an ~nim~l,
preferably a nonhnm~n. The antibody so obt~in~ will then
bind the polypeptides itself. In this m~nner~ even a
sequence encoding only a fragment o~ the polypeptides can be
used to generate antibodies binding the whole native
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
polypeptides. Such antibodies can then be used to isolate
the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line
cultures can be used. Examples include the hybridoma
technique (Kohler and Milstein, 1975, Nature, 256:495-497),
the trioma technique, the human B-cell hybridoma technique
(Kozbor et al., 1983, Tmmllnology Today 4:72), and the EBV-
hybridoma technique to produce human monoclonal antibodies
(Cole, et al., 1985, in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain
antibodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to ~mm~nogenic polypeptide products
of this invention. Also, transgenic mice may be used to
express h~lm~nized antibodies to immllnogenic polypeptide
products of this invention.
The present invention will be $urther described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified,
are by weight.
In order to facilitate understAn~ing of the following
examples certain frequently occurring methods and/or terms
will be described.
"Plasmids" are designated by a lower case p preceded
and/or followed by capital letters and/or numbers. The
starting plasmids herein are either co~m~rcially available,
publicly available on an unrestricted basis, or can be
constructed from available plasmids in accord with published
procedures. In addition, equivalent plasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
~ Digestion~ of DNA refers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
-28-
CA 0221~286 1997-09-12
W O 96/39420 PCTAUS95/07087
sequences in the DNA. The various restriction enzymes used
herein are co~mercially available and their reaction
conditions, cofactors and other requirements were used as
would be known to the ordinarily skilled artisan. For
analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~1
of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of
DNA are digested with 20 to 250 units of enzyme in a larger
volume. Appropriate buffers and substrate amounts for
particular restriction enzymes are specified by the
manufacturer. Incubation times of about 1 hour at 37~C are
ordinarily used, but may vary in accordance with the
supplier's instructions. After digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate
the desired fragment.
Size separation of the cleaved fragments is performed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Re~., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without adding a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
dephosphorylated.
~ Ligation~ refers to the process of forming
phosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accomplished using known
buffers and conditions with 10 units of T4 DNA ligase
("ligase") per 0.5 ~g of approximately equimolar amounts of
the DNA fragments to be ligated.
-29-
CA 0221~286 1997-09-12
W O 96139420 PCTrUS95/07087
Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A.,
Virology, 52:456-457 (1973).
Exam~le 1
Bacterial Ex~ression and Purification of CGF
The DNA sequence encoding CGF, ATCC # 97142, was
initially amplified using PCR oligonucleotide primers
corresponding to the 5' sequences of the processed CGF
protein (minus the signal peptide sequence) and the vector
sequences 3' to the CGF gene. Additional nucleotides
corresponding to CGF were added to the 5~ and 3' sequences
respectively. The 5' oligonucleotide primer has the sequence
5' A~ GATCCAATTTGGGAAACAGCTATCAAAGA 3' (SEQ ID NO:3)
contains a BamHI restriction enzyme site (in bold) followed
by CGF coding sequence starting from the presumed terminal
amino acid of the processed protein codon (underlined). The
3' oligonucleotide primer 5~ TACAA
CTCTAGACTATTATTTACAACATAGAAAATTAAAGGC 3' (SEQ ID NO:4)
contains an Xba I restriction site (in bold) followed by the
reverse complement of nucleotides correspon~ng to the
carboxy-terminal 5 amino acids and the translational stop
codon (underlined). The restriction enzyme sites correspond
to the restriction enzyme sites on the bacterial expression
vector pQE (Qiagen, Inc. Chatsworth, CA, 91311). pQE-9
encodes antibiotic resistance (Ampr), a bacterial origin of
replication (ori), an IPTG-regulatable promoter operator
(P/O), a ribosome b~n~;ng site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 was then digested with Hind
III and Xba I. The amplified sequences were ligated into
pQE-9 and were inserted in frame with the seguence encoding
for the histidine tag and the RBS. The desired recombinants
would contain the CGF coding sequence inserted downstream
from the histidine tag and the ribosome h~ n~ng site. The
ligation mixture was then used to transform E. coli strain
M15/rep 4 (Qiagen, Inc.) by the procedure described in
-30-
CA 0221~286 1997-09-12
W O 96/39420 PCT~US95/07087
Sam~rook, J. et al., Molecular Cloning: A Laboratory ~n~
Cold Spring Laboratory Press, (1989). M15/rep4 contains
multiple copies of the plasmid pREP4, which expresses the
lacI repressor and also confers kanamycin resistance (Kanr).
Transformants are identified by their ability to grow on LB
plates and ampicillin/kanamycin resistant colonies were
selected.Plasmid DNA was isolated and confirmed by
restriction analysis. Clones cont~;n;ng the desired
constructs were grown overnight (O/N) in liquid culture in LB
media supplemented with both Amp (100 ug/ml) and Kan (25
ug/ml). The O/N culture was used to inoculate a large
culture at a ratio of 1:100 to 1:250. The cells were grown
to an optical density 600 (O.D.~) of between 0.4 and 0.6.
IPTG ("Isopropyl-B-D-thiogalacto pyranoside") was then added
to a ~inal concentration o~ 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/O leading to
increased gene expression. Cells were grown an extra 2.5
hours such that there is an expon~nt~l growth culture
present. Cells were then harvested by centrifugation. The
CGF/6-Histidine-cont~;n;ng M15[pREP4] cells were lysed in 6M
GnHCl,50 mM NaPO4 at pH 8Ø The lysate was loaded on a
Nickel-Chelate column and the flow-through collected. The
column was washed with 6M GnHCl, 50 mM NaPO4at pH 8.0, 6.0
and 5Ø The CGF fusion protein (~90% pure) was eluted at pH
2Ø For the purpose of renaturation, the pH 2.0 eluate was
adjusted to 3 molar guanidine HCl, 100mM sodium phosphate, 10
mmolar glutathione (reduced) and 2 mmolar glutathione
(oxidized). After incubation in this solution for 12 hours
the protein was dialyzed to 10 mmolar sodium phosphate. To
run the gel, the pellets were resuspended in SDS/NaOH and 2X
SDS-PAGE loading buffer, heat denatured, then electrophoresed
on a 4-20~ SDS-PAGE gel. The proteins were visualized with
~o~-~sie Brilliant Blue R-250 stain.
Exam~le 2
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
Cloninq and ex~ression of CGF usinq the baculovirus
ex~ression svstem
The DNA sequence encoding the full length CGF protein,
ATCC ~ 97142, is amplified with the PCR primers cont~;ning 5~
BamHI and 3' XbaI. The primer sequences are 5' ACTCTTGGATCC
GCCATCATGACCTGGAGGCACCAT 3' (SEQ ID NO:5) and 5' TACAA
CTCTAGACTATTATTTACAACATAGAAAATTAAAGGC 3' (SEQ ID NO:6). The
BamHI-XbaI fragment contains the entire CGF coding region
including the signal sequence for secretion. This fragment,
designated F2, is isolated from a 1~ agarose gel using a
commercially available kit ("Geneclean", BIO 101 Inc., La
Jolla, Ca.).
The vector pA2 is used for the expression of the CGF
protein using the baculovirus expression system (for review
see: Summers, M.D. and Smith, G.E. 1987, A m~nll~l of methods
for baculovirus vectors and insect cell culture procedures,
Texas Agricultural Experimpnt~l Station Bulletin No. 1555).
This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhidrosis
virus (AcMNPV) followed by the recognition sites for the
restriction ~n~onllcleases BamHI and XbaI. The
polyadenylation site of the simian virus (SV)40 is used for
e~icient polyadenylation. For an easy selection o~
recombinant viruses the beta-galactosidase gene from E.coli
is inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at
both sides by viral sequences for the cell-mediated
homologous recombination of cotransfected wild-type viral
DNA. Many other baculovirus vectors could be used in place
of pA2 such as, pRGl, pAc373, pVL941 and pAcIMl (Luckow, V.A.
and Summers, M.D., Virology, 170:31-39).
The pA2 plasmid is digested with the restriction enzymes
BamHI and XbaI and then dephosphorylated using calf
intestinal phosphatase by procedures known in the art. The
-32-
CA 0221~286 1997-09-12
WO 96/394Z0 PCTAJS95/07087
DNA is then isolated from a 1~ agarose gel using the
commercially available kit ("Geneclean" BIO 101 Inc., La
Jolla, Ca.). This vector DNA is designated V2.
BamHI-XbaI cleaved fragment F2 and the dephosphorylated
plasmid V2 are ligated with T4 DNA ligase. E.coli strain XL1
Blue (Stratagene Cloning Systems, 11011 North Torrey Pines
Road La Jolla, Ca. 92037) are then transformed and bacteria
identified that cont~;ne~ the plasmid (pBac CGF) with the CGF
cDNA using the enzymes BamHI and XbaI. The sequence of the
cloned fragment is con~irmed by DNA sequencing.
5 ~g of the plasmid pBac CGF is cotransfected with 1.0
~g of a commercially available linearized baculovirus
("BaculoGold~ baculovirus DNA'I, Pharmingen, San Diego, CA.)
using the lipofection method ~Felgner et al. Proc. Natl.
Acad. Sci. USA, 84: 7413-7417 (1987) ) .
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid
pBac CGF are mixed in a sterile well of a microtiter plate
cont~;ning 50 ~l of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l
Lipofectin plus 90 ~l Grace's medium are added, mixed and
incubated for 15 minutes at room tempera~lre. Then the
transfection mixture is added dropwise to the Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
with lml Grace' medium without serum. The plate is rocked
back and forth to mix the newly added solution. The plate is
then incubated for 5 hours at 27~C. After 5 hours the
transfection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum
is added. The plate is put back into an incubator and
cultivation continued at 27~C for four days.
After four days the supernatant is collected and a
plaque assay performed similar as described by Summers and
Smith (supra). As a modification an agarose gel with "Blue
Galll (Life Technologies Inc., Gaithersburg) is used which
allows an easy isolation of blue st~; ne~ plaques. (A
-33-
CA 0221~286 1997-09-12
W O 96139420 PCTAjS95/07087
detailed description of a "plaque assay" can also be found in
the user's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
10),
Four days after the serial dilution, the viruses are
added to the cells and blue stained plaques are picked with
the tip of an Eppendorf pipette. The agar cont~ining the
recombinant viruses is then resuspended in an Eppendorf tube
containing 200 ~1 of Grace's medium. The agar is removed by
a brief centrifugation and the supernatant contAining the
recombinant baculoviruses is used to infect Sf9 cells seeded
in 35 mm dishes. Four days later the supernatants of these
culture dishes are harvested and then stored at 4~C.
Sf9 cells are grown in Grace's medium supplemented with
10~ heat-inactivated FBS. The cells are infected with the
recombinant baculovirus V-CGF at a multiplicity of infection
(MOI) of 2. Six hours later the medium is removed and
replaced with SF900 II medium minus methionine and cysteine
(Life Technologies Inc., Gaithersburg). 42 hours later 5 ~Ci
of 35S-methionine and 5 ~Ci 35S cysteine (Amersham) are added.
The cells are further incubated for 16 hours before they are
harvested by centrifugation and the labelled proteins
visualized by SDS-PAGE and autoradiography.
ExamPle 3
Ex~ression of Recombinant CGF in CHO cells
The vector pN346 is used for the expression of the CGF
protein. Plasmid pN346 is a derivative of the plasmid pSV2-
dhfr tATCC Accession No. 37146]. Both plasmids cont~n the
mouse dhfr gene under control of the SV40 early promoter.
rhinPce hamster ovary or other cells lacking dihydrofolate
activity that are transfected with these plasmids can be
selected by growing the cells in a selective medium (alpha
minus MEM, Lift Technologies) supplemented with the
chemotherapeutic agent methotrexate. The amplication of the
-34-
CA 0221~286 1997-09-12
WO 96/39420 PCT/US95/07087
DHFR genes in cells resistant to methotrexate (MTX) has been
well documented (see, e.g., Alt, F.W., Kellems, R.M.,
Bertino, J.R., and Schimke, R.T., 1978, J. Biol. Chem.
- 253:1357-1370, Hamlin, J.L. and Ma, C. 1990, Biochem. et
Biophys. Acta, 1097:107-143, Page, M.J. and Sy~nh~m, M.A.
1991, Biotechnology Vol. 9:64-68). Cells grown in increasing
concentrations of MTX develop resistance to the drug by
overproducing the target enzyme, DHFR, as a result of
amplification of the DHFR gene. If a second gene is linked
to the dhfr gene it is usually co-amplified and
overexpressed. Subsequently, when the methotrexate is
withdrawn, cell lines contain the amplified gene integrated
into the chromosome(s).
Plasmid pN346 contains for the expression of the gene of
interest a strong promoter of the long terminal repeat (LTR)
of the Rouse Sarcoma Virus (Cullen, et al., Molecular and
Cellular Biology, March 1985, 438-447) plus a fragment
isolated from the enh~ncer of the imm~i~te early gene of
human cytomegalovirus (CMV) (Boshart et al., Cell 41:521-530,
1985). Downstream of the promoter are the following single
restriction enzyme cleavage sites that allow the integration
of the genes: BamHI, Pvull, and Nrul. ~ehi n~ these cloning
sites the plasmid contains translational stop codons in all
three reading frames followed by the 3l intron and the
polyadenylation site of the rat preproinsulin gene. Other
high efficient promoters can also be used for the expression,
e.g., the human ~-actin promoter, the SV40 early or late
promoters or the long terminal repeats from other
retroviruses, e.g., HIV and HTLVI. For the polyadenylation
of the mRNA other signals, e.g., from the human growth
hormone or globin genes can be used as well.
Stable cell lines carrying a gene of interest integrated
into the chromosome can also be selected upon co-transfection
with a selectable marker such as gpt, G418 or hygromycin. It
-35-
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
is advantageous to use more than one selectable marker in the
beginn;ng, e.g. G418 plus methotrexate.
The plasmid pN346 is digested with the restriction
enzyme BamHI and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The vector is
then isolated from a 1% agarose gel.
The DNA sequence encoding the full length CGF protein,
ATCC # 97142, is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of thè gene:
The 5' primer has the sequence 5' ACTCTTGGATCC
GCCATCATGACCTG&AGGCACCAT 3' (SEQ ID NO:7) and contains a
BamHI restriction enzyme site (in bold) followed by 6
nucleotides resembling an efficient signal for the initiation
of translation in eukaryotic cells (Kozak, M., J. Mol. Biol.,
196:947-950, (1987)). The rem~ining nucleotides correspond
to the amino terminal 6 amino acids including the
translational initiation codon. The 3' primer has the
sequence 5' TACAACCAGCTGCTATTATTTACAACATAG 3' (SEQ ID NO:8)
and c~nt~in~ a PvuII restriction site and 18 nucleotides that
are the reverse complement of 3' CGF DNA starting at the
translational stop codon. The PCR product is digested with
BamHI-PuvII and purified on a 1% agarose gel using a
c~mm~rcially available kit ("Geneclean", BIO 101 Inc., La
Jolla, Ca.). This fragment is then ligated to BamHI-PvuII
digested, phosphatased pN346 plasmid with T4 DNA ligase.
XllBlue (Stratagene) E. coli are transformed and plated on
LB, 50 ~g/ml ampicillin plates. Colonies bearing the desired
recsmh;n~nt in the proper orientation are screened for by PCR
with a 5' primer which corresponds to the Rous sarcoma virus
promoter and a 3' primer which corresponds to the reverse
complement of CGF codons 73-79. The sequence of the cloned
fragment is confirmed by DNA se~l~ncing Transfection of
CE~O-dhfr-cells
Chinese hamster ovary cells lacking an active DHFR
enzyme are used for transfection. 5 ~g of the expression
-36-
,
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
plasmid pN346CGF are cotransfected with 0.5 ~g of the plasmid
pSVneo using the lipofectin method (Felgner et al., supra).
The plasmid pSV2-neo contains a ~m~ nAnt selectable marker,
the gene neo from Tn5 encoding an enzyme that confers
resistance to a group of antibiotics including G418. The
cells are seeded in alpha minus MEM suppl~ _nted with 1 mg/ml
G418. After 2 days, the cells are trypsinized and seeded in
hybridoma cloning plates (Greiner, Germany) and cultivated
~rom 10-14 days. After this period, single clones are
trypsinized and then seeded in 6-well petri dishes using
different concentrations of methotrexate (25, 50 nm, 100 nm,
200 nm, 400 nm). Clones growing at the highest
concentrations of methotrexate are then transferred to new 6-
well plates ront~in;ng even higher concentrations of
methotrexate (500 nM, 1 M, 2 ~M, 5 ~M). The same procedure
is repeated until clones grew at a concentration of 100 ~M.
The expression of the desired gene product is analyzed
by Western blot analysis and SDS-PAGE.
Example 4
Expression via Gene Therapy
Fibroblasts are obtained from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and
separated into small pieces. Small chunks of the tissue are
placed on a wet sur~ace of a tissue culture flask,
approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room
temperature over night. After 24 hours at room temperature,
the flask is inverted and the chunks of tissue remain fixed
to the bottom of the flask and fresh media (e.g., Ham~s F12
media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C for approximately one week.
At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in
-37-
CA 0221~286 1997-09-12
W O 96/39420 PCTrUS95/07087
culture, a monolayer of fibroblasts emerge. The monolayer is
trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine
sarcoma virus, is digested with EcoRI and HindIII and
subsequently treated with calf intestinal phosphatase. The
linear vector is fractionated on agarose gel and purified,
using glass beads.
The cDNA encoding a polypeptide of the present invention
is amplified using PCR primers which correspond to the 5' and
3' end sequences respectively. The 5' primer contains an
EcoRI site and the 3' primer also includes a HindIII site.
Equal quantities of the Moloney murine sarcoma virus linear
backbone and the amplified EcoRI and HindIII fragment are
added together, in the presence of T4 DNA ligase. The
resulting mixture is maintained under conditions appropriate
for ligation of the two fragments. The ligation mixture is
used to transform bacteria HB101, which are then plated on~o
agar-cnn~;n;ng kanamycin for the purpose of confirming that
the vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are
grown in tissue culture to confluent density in Dulbecco's
Modified Eagles Medium (DMEM) with 10% calf serum (CS),
penicillin and streptomycin. The MSV vector cont~; n; ng the
gene is then added to the media and the packaging cells are
transduced with the vector. The packaging cells now produce
infectious viral particles contAin;ng the gene (the packaging
cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells,
and subsequently, the media is harvested from a 10 cm plate
of confluent producer cells. The spent media, cont~n~ng the
infectious viral particles, is filtered through a millipore
filter to remove detached producer cells and this media is
then used to infect fibroblast cells. Media is removed from
a sub-confluent plate of fibroblasts and quickly replaced
-38-
CA 0221~286 1997-09-12
W O 96/39420 PCT/US95/07087
with the media from the producer cells. Th ~ media is
removed and replaced with fresh media. If the t_ -r of virus
is high, then virtually all fibroblasts will be infected and
no selection is re~uired. If the titer is very low, then it
is necessary to use a retroviral vector that has a selectable
marker, such as neo or his.
The engineered fibroblasts are then injected into the
host, either alone or after having been grown to confluence
on cytodex 3 microcarrier beads. The fibroblasts now produce
the protein product.
Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the
invention may be practiced otherwise than as particularly
described.
-39-
CA 02215286 1997-09-12
W O 96/39420 PCTAJS95/07087
SEQUENCE LISTING
(1) ~.RNRT~AL INFORMATION:
(i) APPLICANT: MEISSNER, ET AL.
(ii) TITLE OF INVENTION: HUMAN CRIPTIN GROWTH FACTOR
(iii) NUMBER OF SEQUENCES: 10
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRES5EE: ~ T2~T.T.~, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) ~OUN-1~Y: USA
(F) ZIP: 07068
(v) COM~Ul~ READABLE FORM:
(A) MEDI~M TYPE: 3.5 INCH DISKETTE
(B) COM~ UL~;~: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(vi) CURR~;!NT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Concurrently
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER: NONE
(B) FILING DATE: NONE
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FERR~RO, GREGORY D.
(B) REGISTRATION NU~3ER: 36,134
(C) REFERENCE/DOCKET NUMBER: 325800-
(ix) TELECOMMUNICATION INFORMATION:
(A) TEL~HON~: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: BASE PAIRS
(B) TYPE: NUChEIC ACID
(C) STRA~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
-40-
CA 0221~286 1997-09-12
W O 96/39420 PCTAJS95/07087
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:1:
~2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 205 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:2:
t2) INFORMATION FOR SEQ ID NO:3:
(i) SEQu~N~ CHARACTERISTICS
(A) LENGTH: BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:3:
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQ~N~ CHARACTERISTICS
(A) LENGTH: BASE PAIRS
(B) TYPE: NUCLE IC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
~2) INFORMATION FOR SEQ ID NO:5:
(i~ SEQUENCE CHARACTERISTICS
(A) LENGTH: BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~N~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii~ MOLECULE TYPE: Oligonucleotide
(xi~ SEQUENCE DESCRIPTION: SEQ ID NO:5:
~2) INFORMATION FOR SEQ ID NO:6:
-41-
CA 02215286 1997-09-12
W O 96/39420 PCTAiS95/07087
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
-42-
