Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02308112 2000-04-27
_ WO 99/23106 PCT/pS981Z0452
I
CASPASE-14 POLYPEPTIDES
Field of the Invention
The present invention relates to a novel effector of apoptosis. More
specifically, isolated
to nucleic acid molecules are provided encoding a human Caspase-14
polypeptide, sometimes herein
after referred to as "ERICE". Caspase-14 polypeptides are also provided, as
are vectors, host
cells and recombinant methods for producing the same. The invention further
relates to screening
methods for identifying agonists and antagonists of Caspase-14 activity. Also
provided are
therapeutic methods for treating diseases and disorders associated with
apoptosis.
Background of the Invention
The cell death machinery is conserved throughout evolution and is composed of
activators, inhibitors, and effectors (Chinnaiyan, A.M. and Dixit, V.M., Curr.
Biol. 6:555-562
( 1996)). The effector arm of the cell death pathway is composed of a rapidly
growing family of
cysteine aspartate-specific proteases termed caspases (Alnemri, E.S., et al.,
Cell 87:171 ( 1996)).
As implied by the name, these cysteine proteases cleave substrates following
an aspartate residue
(Alnemri, E.S., et al., Cell 87:171 (1996); Walker, N.P., et al., Cell 78:343-
352 (1994)).
Caspases are normally present as single polypeptide zymogens and contain an
amino-terminal
prodomain, and large and small catalytic subunits (Wilson, K.P., et al.,
Nature 370:270-274
( 1994); Rotonda, J., et al., Nat. Struct. Biol. 3:619-625 ( 1996); Fraser, A.
and Evan, G., Cell
85:781-784 ( 1996)). The two chain active enzyme (composed of the large and
small subunits) is
obtained following proteolytic processing at internal Asp residues (Wilson,
K.P., et aL, Nature
370:270-274 (1994); Rotonda, J., et al., Nat. Struct. Biol. 3:619-625 (1996);
Fraser, A. and
3o Evan, G., Cell 85:781-784 (1996)). As such, caspases are capable of
activating each other in a
manner analogous to zymogen activation that is observed in the coagulation
cascade (Boldin,
M.P., et al., Cell 85:805-815 ( 1996)). The identification of FLICE and
Mch4/FLICE2 as receptor
associated caspases suggested a surprisingly direct mechanism for activation
of the death pathway
by the cytotoxic receptors CD-95 and TNFR-1 (Boldin, M.P., et al., Cell 85:805-
815 (1996);
Muzio, M., et al., Cell 85:817-827 (1996); Vincenz, C. and Dixit, V.M., J.
Biol. Chenl.
272:6578-6583 ( 1997); Chinnaiyan, A.M., et al., Cell 81:505-512 ( 1995)).
Upon activation,
both receptors use their death domains to bind the corresponding domain in the
adaptor molecule
CA 02308112 2000-04-27
WO 99/23106 PCT/US98120452
2
FADD (F_as-associated death domain protein) (Muzio, M., et al., Cell 85:817-
827 ( 1996);
Vincenz, C. and
Dixit, V.M., J. Biol. Chem. 272:6578-6583 ( 1997); Chinnaiyan, A.M., et al.,
Cell 81:505-512
( 1995)). Dominant negative versions of FADD that lack the N-terminal segment
but still retain the
death domain potently inhibit both CD-95 and TNFR-1 induced apoptosis
(Chinnaiyan, A.M., et
al., J. Biol. Chem. 271:4961-4965 (1996); Muzio, M., et al.. J. Biol. Chem.
272:2952-2956
(1997)). Given the importance of the N-terminal segment in engaging the death
pathway, it has
been termed the death effector domain (DED) (Chinnaiyan, A.M., et al., J.
Biol. Chem.
271:4961-4965 (1996)).
1o Remarkably, the DED is present within the prodomain of FLICE and
Mch4/FLICE2 and
mutagenesis studies suggest that a homophilic interaction between the DED of
FADD and the
corresponding domain in FLICE or Mch4/FL,ICE2 is responsible for the
recruitment of these
proteases to the CD-95 and TNFR-1 signaling complexes (Muzio, M., et al., Cell
85:817-827
(1996); Vincenz, C. and Dixit, V.M., J. Biol. Chem. 272:6578-6583 (1997);
Chinnaiyan, A.M.,
et al., Cell 81:505-512 (1995); Chinnaiyan, A.M., et al., J. Biol. Chem.
271:4961-4965 (1996)).
Taken together, these data are consistent with FLICE and Mch4/FLICE2 being
apical enzymes
that initiate precipitous proteolytic processing of downstream caspases
resulting in apoptosis
(Boldin, M.P., et al., Cell 85:805-815 (1996); Srinivasula, S.M., et al., PNAS
93:14486-14491
{ 1996); Fernandes-Alnemri, T., et al., PNAS 93:7464-7469 ( 1996); Henkart,
P.A., Immunity
4:195-201 (1996)). A number of viral gene products antagonize CD-95 and TNFR-1
mediated
killing as a means to persist in the infected host (Shen, Y. and Shenk, T.S.,
Current Opinion in
Genetics and Development 5:105-111 ( 1995}). The poxvirus encoded serpin CrmA
and
baculovirus gene product p35 are direct caspase inhibitors (Walker, N.P., et
al., Cell 78:343-352
( 1994)). In contrast, the molluscum contagiosum virus protein MC 159 and the
equine herpes
virus protein E8 encode DED-containing decoy molecules that bind to either
FADD (MC 159) or
FLICE (E8) and disrupt assembly of the receptor signaling complex, thereby
abrogating the death
signal (Hu, S., et al., J. Biol. Chem. 272:9621-9624 ( 1997); Bertin, J., et
al., PNAS 94:1172=
1176 ( 1997); Thome, M., et al., Nature 386:527-521 ( 1997)). The existence of
these viral
inhibitors has raised the question of whether functionally equivalent
molecules are encoded in the
3o mammalian genome.
There is a need for factors, such as the polypeptides of the present
invention, that are
useful for effecting or inhibiting apoptosis for therapeutic purposes, for
example, in the treatment
of Alzheimer's disease, Parkinson's disease, rheumatoid arthritis, septic
shock, sepsis, stroke,
CNS inflammation, osteoporosis, ischemia, reperfusion injury, cell death
associated with
cardiovascular disease, polycystic kidney disease, apoptosis of endothelial
cells in cardiovascular
disease, degenerative liver disease, MS and head injury damage. There is a
need, therefore, for
the identification and characterization of such factors that are effectors or
inhibitors of apoptosis,
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US98120452
such as Caspase-14 polypeptides of the present invention, which can play a
role in preventing,
ameliorating or correcting the diseases and disorders associated with
apoptosis.
Summary of the Invention
The present invention provides isolated nucleic acid molecules comprising a
polynucleotide encoding the Caspase-14 polypeptide having the amino acid
sequence shown in
SEQ ID N0:2 or the amino acid sequence encoded by the human cDNA in the clone
deposited as
American Type Culture Collection ("ATCC") Deposit No.209039 on May I5, 1997.
The ATCC is
located at 10801 University Boulevard, Manassas, Virginia 20110-2209.
The present invention also relates to recombinant vectors, which include the
isolated
nucleic acid molecules of the present invention, and to host cells containing
the recombinant
vectors, as well as to methods of making such vectors and host cells and for
using them for
production of Caspase-14 polypeptides or peptides by recombinant techniques.
The invention further provides an isolated Caspase-14 polypeptide having an
amino acid
sequence encoded by the polynucleotides described herein. The present
invention also provides
a screening method for identifying compounds capable of enhancing or
inhibiting a cellular
response induced by the Caspase-14, which involves contacting cells which
express the Caspase-
14 with the candidate compound, assaying a cellular response, and comparing
the cellular
response to a standard cellular response, the standard being assayed when
contact is made in
absence of the candidate compound; whereby, an increased cellular response
over the standard
indicates that the compound is an agonist and a decreased cellular response
over the standard
indicates that the compound is an antagonist.
In another aspect, a screening assay for agonists and antagonists is provided
which
involves determining the effect a candidate compound has on Caspase-14 binding
to the TNFR-
1, TRAIL, or CD-95 receptor. In particular, the method involves contacting the
TNFR-1, TRAIL
or CD-95 receptor with a Caspase-14 polypeptide and a candidate compound and
determining
whether Caspase-14 polypeptide binding to the TNFR-1, TRAIL or CD-95 receptor
is increased
or decreased due to the presence of the candidate compound.
An additional aspect of the invention is related to a method for treating an
individual in
need of an increased level of Caspase-14 activity in the body comprising
administering to such an
individual a composition comprising a therapeutically effective amount of an
isolated Caspase-14
polypeptide of the invention or an agonist thereof.
A still further aspect of the invention is related to a method for treating an
individual in
need of a decreased level of Caspase-14 activity in the body comprising,
administering to such an
individual a composition comprising a therapeutically effective amount of a
Caspase-14
antagonist.
CA 02308112 2000-04-27
WO 99/23106 PGT/US98120452
4
Brief Description of the Figures
Figure 1 shows the nucleotide (SEQ ID NO:1) and deduced amino acid (SEQ ID
N0:2)
sequences of Caspase-14 ( encoded by cDNA clone HFJAB36 deposited with the
ATCC as
Deposit No. 209039). The protein has 377 amino acid residues and a deduced
molecular weight
of about 43.3 kDa.
Figure 2 shows an analysis of the CASPASE-14 amino acid sequence. Alpha, beta,
turn
and coil regions; hydrophilicity and hydrophobicity; amphipathic regions;
flexible regions;
to antigenic index and surface probability are shown. In the "Antigenic Index -
Jameson-Wolf'
graph, amino acid residues from about 35 to about 71, about 79 to about 99,
about 110 to about
138, about 173 to about 202, about 221 to about 250, about 259 to about 297,
about 305 to about
318 and from about 343 to about 370 in Figure 1 (SEQ ID N0:2) correspond to
the shown highly
antigenic regions of the CASPASE-14 protein.
Detailed Description
The present invention provides isolated nucleic acid molecules comprising a
polynucleotide encoding the Caspase-14 (or ERICE) polypeptide having the amino
acid sequence
2o shown in SEQ ID N0:2, which was determined by sequencing a cloned cDNA. The
acronym
ERICE stands for Evolutionarily Related I_nterleukin-1 ~i Converting Enzyme.
The Caspase-14
protein of the present invention shares sequence homology with other members
of the Caspase
family including, Caspase-1, Caspase-4, Caspase-5, Ice-3 Mouse, Caspase-3,
Caspase-6,
Caspase-7, Caspase-8, Caspase-10, Caspase-2 and Caspase-9. The nucleotide
sequence shown
in SEQ 1D NO:1 was obtained by sequencing a cDNA clone (HFJAB36), which was
deposited
on May 15, 1997 at the American Type Culture Collection, 10801 University
Blvd., Manassas _
Virginia 20110, and given accession number 209039. The deposited clone is
inserted in the
pBluescript SK(-) plasnud (Stratagene, La Jolla, CA).
3o Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by sequencing
a DNA
molecule herein were determined using an automated DNA sequencer (such as the
Model 373
from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides
encoded by DNA
molecules determined herein were predicted by translation of a DNA sequence
determined as
above. Therefore, as is known in the art for any DNA sequence determined by
this automated
approach, any nucleotide sequence determined herein may contain some errors.
Nucleotide
sequences determined by automation are typically at least about 90% identical,
more typically at
CA 02308112 2000-04-27
WO 99/Z3106 PCT/US98120452
least about 95% to at least about 99.9% identical to the actual nucleotide
sequence of the
sequenced DNA molecule. The actual sequence can be more precisely determined
by other
approaches including manual DNA sequencing methods well known in the art. As
is also known
in the art, a single insertion or deletion in a determined nucleotide sequence
compared to the actual
sequence will cause a frame shift in translation of the nucleotide sequence
such that the predicted
amino acid sequence encoded by a determined nucleotide sequence will be
completely different
from the amino acid sequence actually encoded by the sequenced DNA molecule,
beginning at the
point of such an insertion or deletion.
Using the information provided herein, such as the nucleotide sequence in SEQ
ID NO: 1,
a nucleic acid molecule of the present invention encoding a Caspase-14
polypeptide may be
obtained using standard cloning and screening procedures, such as those for
cloning cDNAs
using mRNA as starting material. Illustrative of the invention, the nucleic
acid molecule
described in SEQ ID NO:1 was discovered in a cDNA library derived from human
skin
fibroblasts. The determined nucleotide sequence of the Caspase-14 cDNA of SEQ
ID NO:1
contains an open reading frame encoding a protein of about 377 amino acid
residues and a
deduced molecular weight of about 43.3 kDa. The C~aspase-14 protein shown in
SEQ ID N0:2
is most closely related to Caspase-4 showing overall about 75% similar to
Caspase-4. Caspase-
14 shows strong similarity to many members of the Caspase family and, in
particular, the
QAC(R/Q/G)G motif conserved in all caspases is conserved in Caspase-14
(residues 256-260 in
SEQ ID N0:2).
As indicated, nucleic acid molecules of the present invention may be in the
form of RNA,
such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic
DNA
obtained by cloning or produced synthetically. The DNA may be double-stranded
or
single-stranded. Single-stranded DNA or RNA may be the coding strand, also
known as the
sense strand, or it may be the non-coding strand, also referred to as the anti-
sense strand.
By "isolated" nucleic acid molecules) is intended a nucleic acid molecule, DNA
or RNA,
which has been removed from its native environment. For example, recombinant
DNA molecules
contained in a vector are considered isolated for the purposes of the present
invention. Further
examples of isolated DNA molecules include recombinant DNA molecules
maintained in
heterologous host cells or purified (partially or substantially) DNA molecules
in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA
molecules of the
present invention. Isolated nucleic acid molecules according to the present
invention further
include such molecules produced synthetically.
Isolated nucleic acid molecules of the present invention include DNA molecules
comprising an open reading frame (ORF) shown in SEQ ID NO:1; DNA molecules
comprising
the coding sequence for the Caspase-14 protein; and DNA molecules which
comprise a sequence
substantially different from those described above but which, due to the
degeneracy of the genetic
CA 02308112 2000-04-27
WO 99/23106 PCT/US98120452
6
code, still encode the Caspase-14 protein. Of course, the genetic code is well
known in the art.
Thus, it would be routine for one skilled in the art to generate such
degenerate variants.
In another aspect, the invention provides isolated nucleic acid molecules
encoding the
Caspase-14 polypeptide having an amino acid sequence as encoded by the cDNA
clone contained
in the plasmid deposited as ATCC Deposit No. 209039 on May 15, 1997. In a
further
embodiment, nucleic acid molecules are provided encoding the Caspase-14
polypeptide or the
full-length Caspase-14 polypeptide lacking the N-terminal methionine. The
invention also
provides an isolated nucleic acid molecule having the nucleotide sequence
shown in SEQ ID NO:1
or the nucleotide sequence of the Caspase-14 cDNA contained in the above-
described deposited
clone, or a nucleic acid molecule having a sequence complementary to one of
the above
sequences. Such isolated molecules, particularly DNA molecules, are useful as
probes for gene
mapping, by in situ hybridization with chromosomes, and for detecting
expression of the
Caspase-14 gene in human tissue, for instance, by Northern blot analysis.
Caspase-14 is believed to be produced as a proprotein which consists of a
prodomain
(residues 1 to 95 in SEQ ID N0:2), a large subunit domain (residues 96 to 277
in SEQ ID N0:2},
and a small subunit domain (residues 289 to 377 in SEQ ID N0:2. Caspase-14 is
believed to be
processed by caspase-8 and that the large and small subunit domains form a
heterodimer which is
the active fragment. The heterodimeric fragment is believed to be reproducible
in vitro.
The present invention includes polypeptides comprising the following conserved
domains:
2o (a) the large subunit domain of about 175 amino acids (residues 96 to 270
in SEQ ID N0:2); and
(b) the predicted small subunit domain of about 89 amino acids (residues 289
to 377 in SEQ ID
N0:2). Also provided are polynucleotides encoding such polypeptides.
The present invention is further directed to fragments of the isolated nucleic
acid
molecules described herein. By a fragment of an isolated nucleic acid molecule
having the
nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in
SEQ ID NO:1 is
intended fragments at least about 15 nt, and more preferably at least about 20
nt, still more
preferably at least about 30 nt, and even more preferably, at least about 40
nt in length which are
useful as diagnostic probes and primers as discussed herein. Of course, larger
fragments 50-600
nt in length are also useful according to the present invention as are
fragments corresponding to
3o most, if not all, of the nucleotide sequence of the deposited cDNA or as
shown in SEQ ID NO:1.
By a fragment at least 20 nt in length, for example, is intended fragments
which include 20 or
more contiguous bases from the nucleotide sequence of the deposited cDNA or
the nucleotide
sequence as shown in SEQ ID NO:1.
Preferred nucleic acid fragments of the present invention include nucleic acid
molecules
encoding epitope-bearing portions of the CASPASE-14 protein. In particular,
such nucleic acid
fragments of the present invention include nucleic acid molecules encoding: a
polypeptide
comprising amino acid residues from about 35 to about 71, from about 79 to
about 99, from
about 110 to about 138, from about 173 to about 202, from about 221 to about
250, from about
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US98120452
7
259 to about 297, from about 305 to about 318 and from about 343 to about 370
in SEQ ID
N0:2. The inventors have determined that the above polypeptide fragments are
antigenic regions
of the CASPASE-14 protein. Methods for determining other such epitope-bearing
portions of
the CASPASE-14 protein are described in detail below.
In another aspect, the invention provides an isolated nucleic acid molecule
comprising a
polynucleotide which hybridizes under stringent hybridization conditions to a
portion of the
polynucleotide in a nucleic acid molecule of the invention described above,
for instance, the
cDNA clone contained in ATCC Deposit 209039. By "stringent hybridization
conditions" is
intended overnight incubation at 42 C in a solution comprising: 50% formamide,
5x SSC
to (750mM NaCI, 75mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x
Denhardt's
solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm
DNA, followed by
washing the filters in O.lx SSC at about 65 C.
By a polynucleotide which hybridizes to a "portion" of a polynucleotide is
intended a
polynucleotide (either DNA or RNA) hybridizing to at least about 15
nucleotides (nt), and more
15 preferably at least about 20 nt, still more preferably at least about 30
nt, and even more preferably
about 30-70 nt of the reference polynucleotide. These are useful as diagnostic
probes and primers
as discussed above and in more detail below.
By a portion of a polynucleotide of "at least 20 nt in length," for example,
is intended 20
or more contiguous nucleotides from the nucleotide sequence of the reference
polynucleotide
20 (e.g., the deposited cDNAs or the nucleotide sequence as shown in SEQ ID
NO:1 ). Of course, a
polynucleotide which hybridizes only to a poly A sequence (such as the 3
terminal poly(A) tract
of the Caspase-14 cDNA shown in SEQ ID NO: l ), or to a complementary stretch
of T (or U)
resides, would not be included in a polynucleotide of the invention used to
hybridize to a portion
of a nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid
25 molecule containing a poly (A) stretch or the complement thereof (e.g.,
practically any
double-stranded cDNA clone).
As indicated, nucleic acid molecules of the present invention which encode a
Caspase-14
polypeptide may include, but are not limited to those encoding the amino acid
sequence of the
polypeptide, by itself; the coding sequence for the mature polypeptide and
additional sequences,
3o such as those encoding a secretory sequence, such as a pre-, or pro- or
prepro- protein sequence;
the coding sequence of the polypeptide, with or without the aforementioned
additional t;oding
sequences, together with additional, non-coding sequences, including for
example, but not
limited to introns and non-coding 5' and 3' sequences, such as the
transcribed, non-translated
sequences that play a role in transcription, mRNA processing, including
splicing and
35 polyadenylation signals, for example - ribosome binding and stability of
mRNA; an additional
coding sequence which codes for additional amino acids, such as those which
provide additional
functionalities. Thus, the sequence encoding the polypeptide may be fused to a
marker sequence,
such as a sequence encoding a peptide which facilitates purification of the
fused polypeptide. In
CA 02308112 2000-04-27
- WO 99/23106 PCT/US981Z0452
8
certain preferred embodiments of this aspect of the invention, the marker
amino acid sequence is a
hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen,
Inc.), among others,
many of which are commercially available. As described in Gentz et al., Proc.
Natl. Acad. Sci.
USA 86:821-824 (1989), for instance, hexa-histidine provides for convenient
purification of the
fusion protein. The "HA" tag is another peptide useful for purification which
corresponds to an
epitope derived from the influenza hemagglutinin protein, which has been
described by Wilson et
al., Cell 37:767-778 ( 1984). As discussed below, other such fusion proteins
include the
Caspase-14 fused to Fc at the N- or C-terminus.
The present invention further relates to variants of the nucleic acid
molecules of the
l0 present invention, which encode portions, analogs or derivatives of the
Caspase-14 protein.
Variants may occur naturally, such as a natural allelic variant. By an
"allelic variant" is intended
one of several alternate forms of a gene occupying a given locus on a
chromosome of an
organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York ( 1985). Non-
naturally
occurring variants may be produced using art-known mutagenesis techniques.
Such variants include those produced by nucleotide substitutions, deletions or
additions,
which may involve one or more nucleotides. The variants may be altered in
coding regions,
non-coding regions, or both. Alterations in the coding regions may produce
conservative or
non-conservative amino acid substitutions, deletions or additions. Especially
preferred among
these are silent substitutions, additions and deletions, which do not alter
the properties and
activities of the Caspase-14 protein or portions thereof. Also especially
preferred in this regard are
conservative substitutions.
Further embodiments of the invention include isolated nucleic acid molecules
comprising a
polynucleotide having a nucleotide sequence at least 95%, 96%, 97%, 98% or 99%
identical to
(a) a nucleotide sequence encoding the polypeptide having the amino acid
sequence in SEQ ID
N0:2; (b) a nucleotide sequence encoding the polypeptide having the amino acid
sequence in SEQ
1D N0:2, but lacking the N-terminal methionine; (c) a nucleotide sequence
encoding the
polypeptide having the amino acid sequence shown as residues 96-270 in SEQ ID
N0:2; (d) a
nucleotide sequence encoding the polypeptide having the amino acid sequence
shown as residues
289-377 in SEQ ID N0:2; (e) a nucleotide sequence encoding the polypeptide
having the amino
3o acid sequence encoded by the cDNA clone contained in ATCC Deposit
No.209039; and (f) a
nucleotide sequence complementary to any of the nucleotide sequences in (a),
(b), (c), (d) or (e).
By a polynucleotide having a nucleotide sequence at least, for example, 95%
"identical"
to a reference nucleotide sequence encoding the Caspase-14 polygeptide is
intended that the
nucleotide sequence of the polynucleotide is identical to the reference
sequence except that the
polynucleotide sequence may include up to five point mutations per each 100
nucleotides of the
reference nucleotide sequence encoding a Caspase-14 polypeptide. In other
words, to obtain a
polynucleotide having a nucleotide sequence at least 95% identical to a
reference nucleotide
sequence, up to 5% of the nucleotides in the reference sequence may be deleted
or substituted
CA 02308112 2000-04-27
_ WO 99/23106 PGT/US98120452
9
with another nucleotide, or a number of nucleotides up to 5% of the total
nucleotides in the
reference sequence may be inserted into the reference sequence. These
mutations of the reference
sequence may occur at the 5' or 3' terminal positions of the reference
nucleotide sequence or
anywhere between those terminal positions, interspersed either individually
among nucleotides in
the reference sequence or in one or more contiguous groups within the
reference sequence.
As a practical matter, whether any particular nucleic acid molecule is at
least 95%, 96%,
97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in
SEQ ID NO:I or
to the nucleotide sequence of the deposited cDNA clone can be determined
conventionally using
known computer programs such as the Bestfit program (Wisconsin Sequence
Analysis Package,
Version 8 for Unix, Genetics Computer Group, University Research Park, 575
Science Drive,
Madison, WI 53711 ). Bestfit uses the local homology algorithm of Smith and
Waterman,
Advances in Applied Mathematics 2: 482-489 ( 1981 ), to find the best segment
of homology
between two sequences. When using Bestfit or any other sequence alignment
program to
determine whether a particular sequence is, for instance, 95% identical to a
reference sequence
according to the present invention, the parameters are set, of course, such
that the percentage of
identity is calculated over the full length of the reference nucleotide
sequence and that gaps in
homology of up to 5% of the total number of nucleotides in the reference
sequence are allowed.
A preferred method for determining the best overall match between a query
sequence (a
sequence of the present invention) and a subject sequence, also referred to as
a global sequence
alignment, can be determined using the FASTDB computer program based on the
algorithm of
Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245). In a sequence alignment
the query and
subject sequences are both DNA sequences. An RNA sequence can be compared by
converting
U's to T's. The result of said global sequence alignment is in percent
identity. Preferred
parameters used in a FASTDB alignment of DNA sequences to calculate percent
identity are:
Matrix=Unitary, k-tuple=4., Mismatch Penalty=1, Joining Penalty=30,
Randomization Group
Length=0, Cutoff Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window
Size=500 or the
length of the subject nucleotide sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence because of 5' or 3'
deletions,
not because of internal deletions, a manual correction must be made to the
results. This is
because the FASTDB program does not account for 5' and 3' truncations of the
subject sequence
when calculating percent identity. For subject sequences truncated at the 5'
or 3' ends, relative to
the query sequence, the percent identity is corrected by calculating the
number of bases of the
query sequence that are 5' and 3' of the subject sequence, which are not
matched/aligned, as a
percent of the total bases of the query sequence. Whether a nucleotide is
matched/aligned is
determined by results of the FASTDB sequence alignment. This percentage is
then subtracted
from the percent identity, calculated by the above FASTDB program using the
specified
parameters, to arrive at a final percent identity score. This corrected score
is what is used for the
purposes of the present invention. Only bases outside the 5' and 3' bases of
the subject
CA 02308112 2000-04-27
WO 99/23106 PCT/US98h0452
sequence, as displayed by the FASTDB alignment, which are not matched/aligned
with the query
sequence, are calculated for the purposes of manually adjusting the percent
identity score.
For example, a 90 base subject sequence is aligned to a 100 base query
sequence to determine
percent identity. The deletions occur at the 5' end of the subject sequence
and therefore, the
5 FASTDB alignment does not show a matched/alignment of the first 10 bases at
5' end. The 10
unpaired bases represent 10% of the sequence (number of bases at the 5' and 3'
ends not
matched/total number of bases in the query_sequence) so 10% is subtracted from
the percent
identity score calculated by the FASTDB program. If the remaining 90 bases
were perfectly
matched the final percent identity would be 90%. In another example, a 90 base
subject sequence
to is compared with a 100 base query sequence. This time the deletions are
internal deletions so that
there are no bases on the 5' or 3' of the subject sequence which are not
matched/aligned with the
query. In this case the percent identity calculated by FASTDB is not manually
corrected. Once
again, only bases 5' and 3' of the subject sequence which are not
matched/aligned with the query
sequence are manually corrected for. No other manual corrections are to made
for the purposes
of the present invention.
The present application is directed to nucleic acid molecules at least 95%,
96%, 97%,
98% or 99% identical to the nucleic acid sequence shown in SEQ ID NO:1 or to
the nucleic acid
sequence of the deposited cDNA, irrespective of whether they encode a
polypeptide having
Caspase-14 activity. This is because even where a particular nucleic acid
molecule does not
2o encode a polypeptide having Caspase-14 activity, one of skill in the art
would still know how to
use the nucleic acid molecule, for instance, as a hybridization probe or a
polymerase chain
reaction (PCR) primer. Uses of the nucleic acid molecules of the present
invention that do not
encode a polypeptide having Caspase-14 activity include, inter alia, (1)
isolating the Caspase-14
gene or allelic variants thereof in a cDNA library; (2) in situ hybridization
(e.g., "FISH") to
metaphase chromosomal spreads to provide precise chromosomal location of the
Caspase-14
gene, as described in Verma et al., Human Chromosomes: A Manual of Basic
Techniques,
Pergamon Press, New York (1988); and Northern Blot analysis for detecting
Caspase-14 mRNA
expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least 95%,
96%,
97%, 98% or 99% identical to a nucleic acid sequence shown in SEQ ID NO:1 or
to a nucleic acid
sequence of the deposited cDNA which do, in fact, encode a polypeptide having
Caspase-14
protein activity. By "a polypeptide having Caspase-14 activity" is intended
polypeptides
exhibiting Caspase-14 activity in a particular biological assay.
The activity of purified or expressed Caspase-14 is tested by methods known in
the art.
One such method calls for stimulating macrophages with LPS to induce the
expression of pre-
IL1-Beta and then treating with Caspase-14 and ATP. Mature IL1-Beta levels in
the medium are
measured by enzyme-linked immunosorbent assay (ELISA), as described in Li et
al. ( 1995) Cell
80:401, incorporated herein by reference in its entirety.
CA 02308112 2000-04-27
WO 99/23106 PCT/US98120452
I1
Of course, due to the degeneracy of the genetic code, one of ordinary skill in
the art will
immediately recognize that a large number of the nucleic acid molecules having
a sequence at least
95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence of the
deposited cDNA or a
nucleic acid sequence shown in SEQ ID NO:1 will encode a polypeptide "having
Caspase-14
protein activity." In fact, since degenerate variants of these nucleotide
sequences all encode the
same polypeptide, this will be clear to the skilled artisan even without
performing the above
described comparison assay. It will be further recognized in the art that, for
such nucleic acid
molecules that are not degenerate variants, a reasonable number will also
encode a polypeptide
having Caspase-14 protein activity. This is because the skilled artisan is
fully aware of amino
acid substitutions that are either less likely or not likely to significantly
effect protein function
(e.g., replacing one aliphatic amino acid with a second aliphatic amino acid).
For example, guidance concerning how to make phenotypically silent amino acid
substitutions is provided in Bowie, J. U. et al., "Deciphering the Message in
Protein Sequences:
Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein
the authors
indicate that proteins are surprisingly tolerant of amino acid substitutions.
Vectors and Host Cells
The present invention also relates to vectors which include the isolated DNA
molecules of
the present invention, host cells which are genetically engineered with the
recombinant vectors,
2o and the production of Caspase-14 polypeptides or fragments thereof by
recombinant techniques.
The polynucleotides may be joined to a vector containing a selectable marker
for
propagation in a host. Generally, a plasmid vector is introduced in a
precipitate, such as a
calcium phosphate precipitate, or in a complex with a charged lipid. If the
vector is a virus, it
may be packaged in vitro using an appropriate packaging cell line and then
transduced into host
cells.
The DNA insert should be operatively linked to an appropriate promoter, such
as the
phage lambda PL promoter, the E. toll lac, trp and tat promoters, the SV40
early and late
promoters and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be
known to the skilled artisan. The expression constructs will further contain
sites for transcription
initiation, termination and, in the transcribed region, a ribosome binding
site for translation. The
coding portion of the mature transcripts expressed by the constructs will
preferably include a
translation initiating at the beginning and a termination codon (UAA, UGA or
UAG)
appropriately positioned at the end of the polypeptide to be translated.
As indicated, the expression vectors will preferably include at least one
selectable marker.
Such markers include dihydrofolate reductase or neomycin resistance for
eukaryotic cell culture
and tetracycline or ampicillin resistance genes for culturing in E. toll and
other bacteria.
Representative examples of appropriate hosts include, but are not limited to,
bacterial cells, such
as E. toll, Streptomyces and Salmonella typhimurium cells; fungal cells, such
as yeast cells;
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US981Z0452
12
insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such
as CHO, COS and
Bowes melanoma cells; and plant cells. Appropriate culture mediums and
conditions for the
above-described host cells are known in the art.
Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9,
available
from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNHBA, pNH
16a, pNH 18A,
pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540,
pRITS
available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO,
pSV2CAT,
pOG44, pXTI and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
available from Pharmacia. Other suitable vectors will be readily apparent to
the skilled artisan.
1o Introduction of the construct into the host cell can be effected by calcium
phosphate
transfection, DEAE-dextran mediated transfection, cationic lipid-mediated
transfection,
electroporation, transduction, infection or other methods. Such methods are
described in many
standard laboratory manuals, such as Davis et al., Basic Methods In Molecular
Biology ( 1986).
The polypeptide may be expressed in a modified form, such as a fusion protein,
and may
include not only secretion signals, but also additional heterologous
functional regions. For
instance, a region of additional amino acids, particularly charged amino
acids, may be added to
the N-terminus of the polypeptide to improve stability and persistence in the
host cell, during
purification, or during subsequent handling and storage. Also, peptide
moieties may be added to
the polypeptide to facilitate purification. Such regions may be removed prior
to final preparation
of the polypeptide. The addition of peptide moieties to polypeptides to
engender secretion or
excretion, to improve stability and to facilitate purification, among others,
are familiar and routine
techniques in the art. A preferred fusion protein comprises a heterologous
region from
immunoglobulin that is useful to solubilize proteins. For example, EP-A-O 464
533 (Canadian
counterpart 2045869) discloses fusion proteins comprising various portions of
constant region of
immunoglobin molecules together with another human protein or part thereof. In
many cases, the
Fc part in a fusion protein is thoroughly advantageous for use in therapy and
diagnosis and thus
results, for example, in improved pharmacokinetic properties (EP-A 0232 262).
On the other
hand, for some uses it would be desirable to be able to delete the Fc part
after the fusion protein
has been expressed, detected and purified in the advantageous manner
described. This is the case
when Fc portion proves to be a hindrance to use in therapy and diagnosis, for
example when the
fusion protein is to be used as antigen for immunizations. In drug discovery,
for example,
human proteins, such as, hILS-receptor has been fused with Fc portions for the
purpose of
high-throughput screening assays to identify antagonists of hIL-5. See, D.
Bennett et al., Journal
of Molecular Recognition, Vol. 8:52-58 ( 1995) and K. Johanson et al., The
Journal of Biological
Chemistry, Vol. 270, No. 16:9459-9471 ( 1995).
The Caspase-14 protein can be recovered and purified from recombinant cell
cultures by
well-known methods including ammonium sulfate or ethanol precipitation, acid
extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction
CA 02308112 2000-04-27
_ WO 99/23106 PGT/US98120452
13
chromatography, affinity chromatography, hydroxylapatite chromatography and
lectin
chromatography. Most preferably, high performance liquid chromatography
("HPLC") is
employed for purification. Polypeptides of the present invention include
naturally purified
products, products of chemical synthetic procedures, and products produced by
recombinant
techniques from a prokaryotic or eukaryotic host, including, for example,
bacterial, yeast, higher
plant, insect and mammalian cells. Depending upon the host employed in a
recombinant
production procedure, the polypeptides of the present invention may be
glycosylated or may be
non-glycosylated. In addition, polypeptides of the invention may also include
an initial modified
methionine residue, in some cases as a result of host-mediated processes.
Caspase-14 Polypeptides and Fragments
The invention further provides an isolated Caspase-14 polypeptide having the
amino acid
sequence encoded by the deposited cDNA, or the amino acid sequence in SEQ ID
N0:2, or a
peptide or polypeptide comprising a portion of the above polypeptides.
15 It will be recognized in the art that some amino acid sequences of the
Caspase-14
polypeptide can be varied without significant effect of the structure or
function of the protein. If
such differences in sequence are contemplated, it should be remembered that
there will be critical
areas on the protein which determine activity.
Thus, the invention further includes variations of the Caspase-14 polypeptide
which show
2o substantial Caspase-14 polypeptide activity or which include regions of
Caspase-14 protein such
as the protein portions discussed below. Such mutants include deletions,
insertions, inversions,
repeats, and type substitutions. As indicated above, guidance concerning which
amino acid
changes are likely to be phenotypically silent can be found in Bowie, J.U., et
al., "Deciphering
the Message in Protein Sequences: Tolerance to Amino Acid Substitutions,"
Science
25 247:1306-1310 (1990).
Based on the x-ray crystal structure of ICE, several amino acid residues
critical for
binding and catalysis have been identified. See, for example, Walker et al.,
Cell 78:343 ( 1994)..
These residues include the catalytic diad Cys-258 and His-210, and Gly-211
that stabalizes the
tetrahydral intermediate. Arg-152, Gln-256, Arg-314, and Ser-320 form the
binding pocket for
3o the S 1 substrate. These seven residues are conserved in all caspases thus
far characterized
including Caspase-14. Furthermore, the QAC(R/Q/G)G motif conserved in all
caspases is
conserved in Caspase-14 (residues 256-260 in SEQ ID N0:2). Thus, polypeptide
variants of the
invention preferrably include those that retain the above-described residues
which are conserved
among all caspases.
35 To map caspase-8 processing sites within Caspase-14, potential aspartate
cleavage sites
were mutated and tested as caspase-8 substrates. Productive cleavage was found
to require Asp-
289 as alteration of this residue abolished processing, data not shown.
Therefore, Caspase-14
must be cleaved by caspase-8 following Asp-289 to yield an active
heterodimeric enzyme.
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US9812045Z
14
Notably, this aspartate residue is found in the sequence context LEED
(residues 286 to 289 in
SEQ ID N0:2) which is the preferred substrate for caspase-8 cleavage.
Accordingly, Caspase-14
polypeptide variants which include amino acids in the region of 286 to 289
preferrably retain an
Asp residue at the position corresponding to Asp-289 in the full-length
Caspase-14 polypeptide
shown as SEQ ID N0:2.
Thus, the fragment, derivative or analog of the polypeptide of SEQ ID N0:2, or
that
encoded by the deposited cDNA, may be (i) one in which one or more of the
amino acid residues
are substituted with a conserved or non-conserved amino acid residue
(preferably a conserved
amino acid residue) and such substituted amino acid residue may or may not be
one encoded by
1 o the genetic code, or (ii) one in which one or more of the amino acid
residues includes a
substituent group, or (iii) one in which the mature polypeptide is fused with
another compound,
such as a compound to increase the half life of the polypeptide (for example,
polyethylene
glycol), or (iv) one in which the additional amino acids are fused to the
mature polypeptide, such
as an IgG Fc fusion region peptide or leader or secretory sequence or a
sequence which is
employed for purification of the mature polypeptide or a proprotein sequence.
Such fragments,
derivatives and analogs are deemed to be within the scope of those skilled in
the art from the
teachings herein.
Of particular interest are substitutions of charged amino acids with another
charged amino
acid and with neutral or negatively charged amino acids. The latter results in
proteins with
2o reduced positive charge to improve the characteristics of the Caspase-14
protein. The prevention
of aggregation is highly desirable. Aggregation of proteins not only results
in a loss of activity
but can also be problematic when preparing pharmaceutical formulations,
because they can be
immunogenic. (Pinckard et al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins
et ar., Diabetes
36:838-845 (1987); Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377
( 1993)).
The replacement of amino acids can also change the selectivity of binding to
cell surface
receptors. Van Ostade et al., Nature 361:266-268 ( 1993) describes certain
mutations resulting in
selective binding of TNF-mutants to only one of the two known types of TNF
receptors. Thus,
the Caspase-14 of the present invention may include one or more amino acid
substitutions,
3o deletions or additions, either from natural mutations or human
manipulation.
As indicated, changes are preferably of a minor nature, such as conservative
amino acid
substitutions that do not significantly affect the folding or activity of the
protein (see Table 1 ).
CA 02308112 2000-04-27
WO 99/23106 PCT/US98I20452
TABLE 1. Conservative Amino Acid Substitutions.
Aromatic Phenylalanine
Tryptophan
Tyrosine
Hydrophobic ~ Leucine
Isoleucine
Valine
Polar I Glutamine
Asparagine
Basic ~ Arginine
Lysine
Histidine
Acidic ~ Aspartic Acid
Glutamic Acid
Small ~ Alanine
Serine
Threonine
Methionine
Glycine
Amino acids in the Caspase-14 protein of the present invention that are
essential for
5 function can be identified by methods known in the art, such as site-
directed mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085
(1989)). The
latter procedure introduces single alanine mutations at every residue in the
molecule. The
resulting mutant molecules are then tested for biological activity such as
receptor binding or in
vitro, or in vitro proliferative activity. Sites that are critical for ligand-
receptor binding can also be
10 determined by structural analysis such as crystallization, nuclear magnetic
resonance or
photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 ( 1992) and de
Vos et al. Science
255:306-312 ( 1992)).
The polypeptides of the present invention are preferably provided in an
isolated form. By
"isolated polypeptide" is intended a polypeptide removed from its native
environment. Thus, a
1s polypeptide produced and/or contained within a recombinant host cell is
considered isolated for
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US98120452
16
purposes of the present invention. Also intended as an "isolated polypeptide"
are polypeptides
that have been purified, partially or substantially, from a recombinant host
cell. For example, a
recombinantly produced version of the Caspase-14 polypeptide can be
substantially purified by
the one-step method described in Smith and Johnson, Gene 67: 31-40 ( 1988).
The polypeptides of the present invention include the polypeptide encoded by
the
deposited eDNA; a polypeptide comprising amino acids about 1 to about 377 in
SEQ ID N0:2; a
polypeptide comprising amino acids about 2 to about 377; a polypeptide
comprising amino acids
from about 96 to about 270; and a polypeptide comprising amino acids from
about 289 to about
377, as well as poiypeptides which are at least 95% identical, still more
preferably at least 96%,
l0 97%, 98% or 99% identical to those described above and also include
portions of such
polypeptides with at least 30 amino acids and more preferably at least 50
amino acids.
By a polypeptide having an amino acid sequence at least, for example, 95%
"identical" to
a reference amino acid sequence of the Caspase-14 polypeptide is intended that
the amino acid
sequence of the polypeptide is identical to the reference sequence except that
the polypeptide
15 sequence may include up to five amino acid alterations per each 100 amino
acids of the reference
amino acid of the Caspase-14 polypeptide. In other words, to obtain a
polypeptide having an
amino acid sequence at least 95% identical to a reference amino acid sequence,
up to 5% of the
amino acid residues in the reference sequence may be deleted or substituted
with another amino
acid, or a number of amino acids up to 5% of the total amino acid residues in
the reference
2o sequence may be inserted into the reference sequence. These alterations of
the reference sequence
may occur at the amino or carboxy terminal positions of the reference amino
acid sequence or
anywhere between those terminal positions, interspersed either individually
among residues in the
reference sequence or in one or more contiguous groups within the reference
sequence.
As a practical matter, whether any particular polypeptide is at least 95%,
96%, 97%, 98%
25 or 99% identical to, for instance, the amino acid sequence shown in SEQ ID
N0:2 or to the amino
acid sequence encoded by deposited cDNA clone can be determined conventionally
using known
computer programs such the Bestfit program (Wisconsin Sequence Analysis
Package, Version 8
for Unix, Genetics Computer Group, University Research Park, 575 Science
Drive, Madison,
WI 53711). When using Bestfit or any other sequence alignment program to
determine whether a
30 particular sequence is, for instance, 95% identical to a reference sequence
according to the present
invention, the parameters are set, of course, such that the percentage of
identity is calculated over
the full length of the reference amino acid sequence and that gaps in homology
of up to 5% of the
total number of amino acid residues in the reference sequence are allowed.
Preferrably a polypeptide having an amino acid sequence at least, for example,
95%
35 "identical" to a query amino acid sequence of the present invention, it is
intended that the amino
acid sequence of the subject polypeptide is identical to the query sequence
except that the subject
polypeptide sequence may include up to five amino acid alterations per each
100 amino acids of
the query amino acid sequence. In other words, to obtain a polypeptide having
an amino acid
CA 02308112 2000-04-27
WO 99/23106 PCT/US98120452
17
sequence at least 95% identical to a query amino acid sequence, up to S% of
the amino acid
residues in the subject sequence may be inserted, deleted, (indels) or
substituted with another
amino acid. These alterations of the reference sequence may occur at the amino
or carboxy
terminal positions of the reference amino acid sequence or anywhere between
those terminal
positions, interspersed either individually among residues in the reference
sequence or in one or
more contiguous groups within the reference sequence.
As a practical matter, whether any particular polypeptide is at least 90%,
95%, 96%,
97%, 98% or 99% identical to, for instance, the amino acid sequences shown in
Table I or to the
amino acid sequence encoded by deposited DNA clone can be determined
conventionally using
known computer programs. A preferred method for determining the best overall
match between a
query sequence (a sequence of the present invention) and a subject sequence,
also referred to as a
global sequence alignment, can be determined using the FASTDB computer program
based on the
algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245). In a
sequence alignment the
query and subject sequences are either both nucleotide sequences or both amino
acid sequences.
The result of said global sequence alignment is in percent identity. Preferred
parameters used in a
FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=l,
Joining
Penalty=20, Randomization Group Length=0, Cutoff Score=1, Window Size=sequence
length,
Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the
subject amino
acid sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence due to N- or C-
terminal
deletions, not because of internal deletions, a manual correction must be made
to the results. This
is because the FASTDB program does not account for N- and C-terminal
truncations of the
subject sequence when calculating global percent identity. For subject
sequences truncated at the
N- and C-termini, relative to the query sequence, the percent identity is
corrected by calculating
the number of residues of the query sequence that are N- and C-terminal of the
subject sequence,
which are not matched/aligned with a corresponding subject residue, as a
percent of the total
bases of the query sequence. Whether a residue is matchedlaligned is
determined by results of th_e
FASTDB sequence alignment. This percentage is then subtracted from the percent
identity,
calculated by the above FASTDB program using the specified parameters, to
arnve at a final
percent identity score. This final percent identity score is what is used for
the purposes of the
present invention. Only residues to the N- and C-termini of the subject
sequence, which are not
matched/aligned with the query sequence, are considered for the purposes of
manually adjusting
the percent identity score. That is, only query residue positions outside the
farthest N- and C-
terminal residues of the subject sequence.
For example, a 90 amino acid residue subject sequence is aligned with a 100
residue
query sequence to determine percent identity. The deletion occurs at the N-
terminus of the subject
sequence and therefore, the FASTDB alignment does not show a
matching/alignment of the first
10 residues at the N-terminus. The 10 unpaired residues represent 10% of the
sequence (number
CA 02308112 2000-04-27
_ wo ~n3io6 rc~rnrs9ano4sz
1g
of residues at the N- and C- termini not matched/total number of residues in
the query sequence)
so 10% is subtracted from the percent identity score calculated by the FASTDB
program. If the
remaining 90 residues were perfectly matched the final percent identity would
be 90%. In another
example, a 90 residue subject sequence is compared with a 100 residue query
sequence. This
time the deletions are internal deletions so there are no residues at the N-
or C-termini of the
subject sequence which are not matched/aligned with the query. In this case
the percent identity
calculated by FASTDB is not manually corrected. Once again, only residue
positions outside the
N- and C-terminal ends of the subject sequence, as displayed in the FASTDB
alignment, which
are not matched/aligned with the query sequence are manually corrected for. No
other manual
1 o corrections are to made for the purposes of the present invention.
The polypeptide of the present invention is useful as a molecular weight
marker on
SDS-PAGE gels or on molecular sieve gel filtration columns using methods well
known to those
of skill in the art.
In another aspect, the invention provides a peptide or polypeptide comprising
an
15 epitope-bearing portion of a polypeptide of the invention. The epitope of
this polypeptide portion
is an immunogenic or antigenic epitope of a polypeptide described herein. An
"immunogenic
epitope" is defined as a part of a protein that elicits an antibody response
when the whole protein
is the immunogen. On the other hand, a region of a protein molecule to which
an antibody can
bind is defined as an "antigenic epitope." The number of immunogenic epitopes
of a protein
20 generally is less than the number of antigenic epitopes. See, for instance,
Geysen et al., Proc.
Natl. Acad. Sci. USA 81:3998- 4002 (1983).
As to the selection of peptides or polypeptides bearing an antigenic epitope
(i.e., that
contain a region of a protein molecule to which an antibody can bind), it is
well known in that art
that relatively short synthetic peptides that mimic part of a protein sequence
are routinely capable
25 of eliciting an antiserum that reacts with the partially mimicked protein.
See, for instance,
Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R.A. (1983)
Antibodies that react with
predetermined sites on proteins. Science 219: 660-666. Peptides capable of
eliciting _
protein-reactive sera are frequently represented in the primary sequence of a
protein, can be
characterized by a set of simple chemical rules, and are confined neither to
immunodominant
3o regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or
carboxyl terminals.
Antigenic epitope-bearing peptides and polypeptides of the invention are
therefore useful
to raise antibodies, including monoclonal antibodies, that bind specifically
to a polypeptide of the
invention. See, for instance, Wilson et al., Cell 37:767-778 (1984) at 777.
Antigenic epitope-bearing peptides and polypeptides of the invention
preferably contain a
35 sequence of at least seven, more preferably at least nine and most
preferably between about at
least about 15 to about 30 amino acids contained within the amino acid
sequence of a polypeptide
of the invention.
CA 02308112 2000-04-27
WO 99/23106 PCf/US98120452
19
Non-limiting examples of antigenic polypeptides or peptides that can be used
to generate
Caspase-14 -specific antibodies include: a polypeptide comprising amino acid
residues from about
35 to about 71 in SEQ ll~ N0:2; a polypeptide comprising amino acid residues
from about 79 to
about 99 in SEQ ID N0:2; a polypeptide comprising amino acid residues from
about 110 to about
138 in SEQ ID N0:2, a polypeptide comprising amino acid residues from about
173 to about 202
in SEQ ID N0:2, a polypeptide comprising amino acid residues from about 221 to
about 250 in
SEQ ID N0:2, a polypeptide comprising amino acid residues from about 259 to
about 297 in
SEQ ID N0:2, a polypeptide comprising amino acid residues from about 305 to
about 318 in
SEQ ID N0:2, a polypeptide comprising amino acid residues from about 343 to
about 370 in
1o SEQ ID N0:2. As indicated above, the inventors have determined that the
above polypeptide
fragments are antigenic regions of the Caspase-14 protein (see Figure 2).
The epitope-bearing peptides and polypeptides of the invention may be produced
by any
conventional means. Houghten, R. A. (1985) General method for the rapid solid-
phase synthesis
of large numbers of peptides: specificity of antigen-antibody interaction at
the level of individual
amino acids. Proc. Natl. Acad Sci. USA 82:5131-S 135. This "Simultaneous
Multiple Peptide
Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to
Houghten et al.
( 1986).
As one of skill in the art will appreciate, Caspase-14 polypeptides of the
present invention
and the epitope-bearing fragments thereof described above can be combined with
parts of the
constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
These fusion
proteins facilitate purification and show an increased half life in vivo. This
has been shown,
e.g., for chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and
various domains of the constant regions of the heavy or light chains of
mammalian
immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84- 86 ( 1988)).
Fusion proteins
that have a disulfide-linked dimeric structure due to the IgG part can also be
more efficient in
binding and neutralizing other molecules than the monomeric Caspase-14 protein
or protein
fragment alone (Fountoulakis et al., J. Biochem 270:3958-3964 ( 1995)).
Cancer Diagnosis and Prognosis
3o Breast carcinoma cells (MCF7) and Embryonic kidney cells (293) were
transfected with
an expression vector encoding the full-length Caspase-14 polypeptide and
assayed for apoptosis.
Like other caspases, Caspase-14 was able to induce cell death. However, unlike
caspase-4 and -
5, removal of the prodomain was not necessary to induce apoptosis.
Furthermore, apoptosis
induced by Caspase-14 was efficiently blocked by virally encoded caspase
inhibitors p35 and
CrmA.
To address whether Caspase-14 is productively processed by caspase-8 (the
apical
caspase involved in proximal death receptor signalling), Caspase-14 was
incubated with caspase-
8 and the emergence of active Caspase-14 was assessed by reaction with
biotinylated-YVAD cmk
CA 02308112 2000-04-27
_ WO 99/Z3106 PCT/US98120452
which covalently binds the catalytic cysteine within the large subunit of
proteolytically competent
(active) caspases. Caspase-8 processing of Caspase-14 led to the generation of
two subunits.
One of the subunits was the prodomain plus the large catalytic subunit (pro +
large) and the other
was the small catalytic subunit. This is similar to the activation of caspase-
1 in which the p45
5 zymogen must initially be processed to a stable p35 pro + large subunit.
Further processing,
namely cleavage between the pro and large subunit, is highly dilutional
sensitive and very
inefficient in vitro such that in vitro translated zymogens do not undergo
complete processing.
Given the low concentration of in vitro-translated Caspase-14, it was not
surprising that caspase-
8 processed it only to the pro+large and small subunits. Regardless, caspase-8
processed
1o Caspase-14 was efficiently labelled with biotinylated YVAD, indicative of
generation of active
Caspase-14.
It is believed that certain tissues in mammals with cancer express
significantly depressed
levels of the Caspase-14 protein and mRNA encoding the Caspase-14 protein when
compared to
a corresponding "standard" mammal, i.e., a mammal of the same species not
having the cancer.
15 Further, it is believed that depressed levels of the Caspase-14 protein can
be detected in certain
body fluids (e.g., sera, plasma, urine, and spinal fluid) from mammals with
cancer when
compared to sera from mammals of the same species not having the cancer. Thus,
the invention
provides a diagnostic method useful during tumor diagnosis, which involves
assaying the
expression level of the gene encoding the Caspase-14 protein in mammalian
cells or body fluid
2o and comparing the gene expression level with a standard Caspase-14 gene
expression level,
whereby a decrease in the gene expression level over the standard is
indicative of certain tumors.
Where a tumor diagnosis has already been made according to conventional
methods, the
present invention is useful as a prognostic indicator, whereby patients
exhibiting depressed
Caspase-14 gene expression will experience a worse clinical outcome relative
to patients
expressing the gene at a higher level.
By "assaying the expression level of the gene encoding the Caspase-14 protein"
is
intended qualitatively or quantitatively measuring or estimating the level of
the Caspase-14 protein
or the level of the mRNA encoding the Caspase-14 protein in a first biological
sample either
directly (e.g., by determining or estimating absolute protein level or mRNA
level) or relatively
(e.g., by comparing to the Caspase-14 protein level or mRNA level in a second
biological
sample).
Preferably, the Caspase-14 protein level or mRNA level in the first biological
sample is
measured or estimated and compared to a standard Caspase-14 protein level or
mRNA level, the
standard being taken from a second biological sample obtained from an
individual not having the
cancer. As will be appreciated in the art, once a standard Caspase-14 protein
level or mRNA
level is known, it can be used repeatedly as a standard for comparison.
By "biological sample" is intended any biological sample obtained from an
individual, cell
line, tissue culture, or other source which contains Caspase-14 protein or
mRNA. Biological
CA 02308112 2000-04-27
WO 99/23106 PCT/US98I20452
21
samples include mammalian body fluids (such as sera, plasma, urine, synovial
fluid and spinal
fluid) which contain secreted Caspase-14 protein, and particularly fibroblast
tissue.
The present invention is useful for detecting cancer in mammals. In particular
the
invention is useful during diagnosis of the of following types of cancers in
mammals: breast,
ovarian, prostate, bone, liver, lung, pancreatic, and skin. Preferred mammals
include monkeys,
apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly
preferred are humans.
Total cellular RNA can be isolated from a biological sample using the single-
step
guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and
Sacchi, Anal.
Biochem. 162:156-159 (1987). Levels of mRNA encoding the Caspase-14 protein
are then
l0 assayed using any appropriate method. These include Northern blot analysis
(Harada et al., Cell
63: 303-312 ( 1990)), S 1 nuclease mapping (Fujita et al., Cell 49: 357- 367 (
1987)), the
polymerase chain reaction (PCR), reverse transcription in combination with the
polymerase chain
reaction (RT-PCR) (Makino et al., Technique 2: 295-301 ( 1990)), and reverse
transcription in
combination with the ligase chain reaction (RT-LCR).
Assaying CASPASE-14 protein levels in a biological sample can occur using
antibody-based techniques. For example, Caspase-14 protein expression in
tissues can be
studied with classical immunohistological methods (Jalkanen, M., et al., J.
Cell. Biol.
101: 976-985 ( 1985); Jalkanen, M., et al., J. Cell . Biol. 105: 3087-3096 (
1987)).
Other antibody-based methods useful for detecting Caspase-14 protein gene
expression
2o include immunoassays, such as the enzyme linked immunosorbent assay (ELISA)
and the
radioimmunoassay (RIA).
Suitable labels are known in the art and include enzyme labels, such as,
Glucose oxidase,
and radioisotopes, such as iodine ('ZSI,'z'I), carbon ('4C), sulfur (35S),
tritium (3H), indium
("ZIn), and technetium (~''"Tc), and fluorescent labels, such as fluorescein
and rhodamine, and
biotin.
Caspase-14 Binding Molecules and Assays
This invention also provides a method for identification of molecules, such as
receptor
molecules, that bind Caspase-14. Genes encoding proteins that bind Caspase-14,
such as receptor
proteins, can be identified by numerous methods known to those of skill in the
art, for example,
ligand panning and FACS sorting. Such methods are described in many laboratory
manuals such
as, for instance, Coligan et al., Current Protocols in Immunology 1(2):
Chapter 5 ( 1991).
For instance, expression cloning may be employed for this purpose. To this end
polyadenylated RNA is prepared from a cell responsive to Caspase-14, a cDNA
library is created
from this RNA, the library is divided into pools and the pools are transfected
individually into
cells that are not responsive to Caspase-14. The transfected cells then are
exposed to labeled
Caspase-14. (Caspase-14 can be labeled by a variety of well-known techniques
including
standard methods of radio-iodination or inclusion of a recognition site for a
site-specific protein
CA 02308112 2000-04-27
WO 99/23106 PCT/US98120452
22
kinase.) Following exposure, the cells are fixed and binding of Caspase-14 is
determined. These
procedures conveniently are carried out on glass slides.
Pools are identified of cDNA that produced Caspase-14-binding cells. Subpools
are
prepared from these positives, transfected into host cells and screened as
described above. Using
an iterative sub-pooling and re-screening process, one or more single clones
that encode the
putative binding molecule, such as a receptor molecule, can be isolated.
Alternatively a labeled ligand can be photoaffinity linked to a cell extract,
such as a
membrane or a membrane extract, prepared from cells that express a molecule
that it binds, such
as a receptor molecule. Cross-linked material is resolved by polyacryla.mide
gel electrophoresis
("PAGE") and exposed to X-ray film. The labeled complex containing the ligand-
receptor can be
excised, resolved into peptide fragments, and subjected to protein
microsequencing. The amino
acid sequence obtained from microsequencing can be used to design unique or
degenerate
oligonucleotide probes to screen cDNA libraries to identify genes encoding the
putative receptor
molecule.
IS Polypeptides of the invention also can be used to assess Caspase-14 binding
capacity of
Caspase-14 binding molecules, such as receptor molecules, in cells or in cell-
free preparations.
Agonists and Antagonists - Assays and Molecules
The invention also provides a method of screening compounds to identify those
which
enhance or block the action of Caspase-14, such as its interaction with
CASPASE-14-binding
molecules such as receptor molecules. An agonist is a compound which increases
the natural
biological functions of Caspase-14 or which functions in a manner similar to
Caspase-14, while
antagonists decrease or eliminate such functions.
For example, a cellular compartment, such as a membrane or a preparation
thereof, may
be prepared from a cell that expresses a molecule that binds Caspase-14, such
as a molecule of a
signaling or regulatory pathway modulated by Caspase-14. The preparation is
incubated with
labeled Caspase-14 in the absence or the presence of a candidate molecule
which may be a
Caspase-14 agonist or antagonist. The ability of the candidate molecule to
bind the binding
molecule is reflected in decreased binding of the labeled ligand. Molecules
which bind
gratuitously, i.e., without inducing the effects of Caspase-14 on binding the
Caspase-14 binding
molecule, are most likely to be good antagonists. Molecules that bind well and
elicit effects that
are the same as or closely related to Caspase-14 are agonists.
Caspase-14-like effects of potential agonists and antagonists may be measured,
for
instance, by determining activity of a second messenger system following
interaction of the
candidate molecule with a cell or appropriate cell preparation, and comparing
the effect with that
of Caspase-14 or molecules that elicit the same effects as Caspase-14. Second
messenger
systems that may be useful in this regard include but are not limited to
proteolysis of downstream
caspases.
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US98120452
23
Another example of an assay for Caspase-14 antagonists is a competitive assay
that
combines Caspase-14 and a potential antagonist with membrane-bound Caspase-14
receptor
molecules or recombinant Caspase-14 receptor molecules under appropriate
conditions for a
competitive inhibition assay. Caspase-14 can be labeled, such as by
radioactivity, such that the
number of Caspase-14 molecules bound to a receptor molecule can be determined
accurately to
assess the effectiveness of the potential antagonist.
The agonist may be employed for instance to enhance the action of Caspase-14
polypeptides.
The antagonists may be employed for instance to inhibit the action of Caspase-
14
polypeptides, for example, in the treatment of Alzheimer's disease,
Parkinson's disease,
rheumatoid arthritis, septic shock, sepsis, stroke, CNS inflammation,
osteoporosis, ischemia,
reperfusion injury, cell death associated with cardiovascular disease,
polycystic kidney disease,
apoptosis of endothelial cells in cardiovascular disease, degenerative liver
disease, MS and head
injury damage.
The agonists and antagonists may be employed in a composition with a
pharmaceutically
acceptable carrier, e.g., as hereinafter described.
Therapeutics
The novel mammalian effector designated Caspase-14 of the present invention,
is a
catalytically active structural homologue of Caspase-4, and other caspases,
that enhance TNFR-1,
TRAIL and CD-95 induced apoptosis. Apoptosis is a useful regulator of cell
growth and
proliferation. Thus, Caspase-14 is useful in the treatment of cancers,
particularly of the skin.
Such cancers include melanomas.
Modes of administration
It will be appreciated that conditions caused by a decrease in the standard or
normal level
of Caspase-14 activity in an individual, can be treated by administration of
Caspase-14 protein.
Thus, the invention further provides a method of treating an individual in
need of an increased
level of Caspase-14 activity comprising administering to such an individual a
pharmaceutical
composition comprising an effective amount of an isolated Caspase-14
poiypeptide of the
invention, particularly a mature form of the Caspase-14, effective to increase
the Caspase-14
activity level in such an individual.
As a general proposition, the total pharmaceutically effective amount of
Caspase-14
polypeptide administered parenterally per dose will be in the range of about 1
p.g/kg/day to 10
. mg/kg/day of patient body weight, although, as noted above, this will be
subject to therapeutic
discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most
preferably for
humans between about 0.01 and 1 mg/kg/day for the hormone. If given
continuously, the
Caspase-14 polypeptide is typically administered at a dose rate of about 1
p.g/kg/hour to about 50
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US98120452
24
p.g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous
infusions, for
example, using a mini-pump. An intravenous bag solution may also be employed.
Pharmaceutical compositions containing the Caspase-14 of the invention may be
administered orally, rectally, parenterally, intracistemally, intravaginally,
intraperitoneally,
topically (as by powders, ointments, drops or transdermal patch), bucally, or
as an oral or nasal
spray. By "pharmaceutically acceptable Garner" is meant a non-toxic solid,
semisolid or liquid
filler, diluent, encapsulating material or formulation auxiliary of any type.
The term "parenteral"
as used herein refers to modes of administration which include intravenous,
intramuscular,
intraperitoneal, intrasternal, subcutaneous and intraarticular injection and
infusion.
Chromosome Assays
The nucleic acid molecules of the present invention are also valuable for
chromosome
identification. The sequence is specifically targeted to and can hybridize
with a particular location
on an individual human chromosome. The mapping of DNAs to chromosomes
according to the
present invention is an important first step in correlating those sequences
with genes associated
with disease.
In certain preferred embodiments in this regard, the cDNA herein disclosed is
used to
clone genomic DNA of a Caspase-14 protein gene. This can be accomplished using
a variety of
well known techniques and libraries, which generally are available
commercially. The genomic
DNA then is used for in situ chromosome mapping using well known techniques
for this
purpose.
In addition, in some cases, sequences can be mapped to chromosomes by
preparing PCR
primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3
untranslated region of
the gene is used to rapidly select primers that do not span more than one exon
in the genomic
DNA, thus complicating the amplification process. These primers are then used
for PCR
screening of somatic cell hybrids containing individual human chromosomes.
Fluorescence in situ hybridization ("FISH") of a cDNA clone to a metaphase
chromosomal spread can be used to provide a precise chromosomal location in
one step. This
technique can be used with probes from the cDNA as short as 50 or 60 bp. For a
review of this
technique, see Verma et al., Human Chromosomes: A Manual Of Basic Techniques,
Pergamon
Press, New York ( 1988).
Once a sequence has been mapped to a precise chromosomal location, the
physical
position of the sequence on the chromosome can be correlated with genetic map
data. Such data
are found, for example, in V. McKusick, Mendelian Inheritance In Man,
available on-line
through Johns Hopkins University, Welch Medical Library. The relationship
between genes and
diseases that have been mapped to the same chromosomal region are then
identified through
linkage analysis (coinheritance of physically adjacent genes).
CA 02308112 2000-04-27
WO 99/23106 PGT/US98120452
Next, it is necessary to determine the differences in the cDNA or genomic
sequence
between affected and unaffected individuals. If a mutation is observed in some
or all of the
affected individuals but not in any normal individuals, then the mutation is
likely to be the
causative agent of the disease.
Drug Screening
Caspase 14, or biologically or immunologically active fragments thereof, are
used for
screening compounds in any of a variety of drug screening techniques. The
CASPASE-14
polypeptide or fragment employed in such a test is either free in solution,
affixed to a solid
to support, borne on a cell surface or located intracellularly. One method of
drug screening utilizes
eukaryotic or prokaryotic host cells which are stably transformed with
recombinant nucleic acids
expressing CASPASE-14 or a fragment thereof. Drugs are screened against such
transformed
cells in competitive binding assays. Such cells, either in viable or fixed
form, can be used for
standard binding assays. One may measure, for example, the formation of
complexes between
15 CASPASE-14 and the agent being tested. Alternatively, one can examine the
diminution in
complex formulation between CASPASE-14 and its target cell, the monocyte or
macrophage,
caused by the agent being tested.
Thus, the present invention provides methods of screening for drugs, natural
inhibitors or
any other agents which can affect inflammation and disease. These methods
comprise contacting
2o such an agent with a CASPASE-14 polypeptide or fragment thereof and
assaying 1) for the
presence of a complex between the agent and the CASPASE-14 polypeptide or
fragment, or 2)
for the presence of a complex between the CASPASE-14 polypeptide or fragment
and the cell, by
methods well known in the art. In such competitive binding assays, the CASPASE-
14
polypeptide or fragment is typically labeled. After suitable incubation, free
CASPASE-14
25 polypeptide or fragment is separated from that present is bound form, and
the amount of free or
uncomplexed label is a measure of the ability of the particular agent to bind
the CASPASE-14 or
to interfere with the CASPASE-14/cell complex and agent complex.
Another technique for drug screening provides high throughout screening for
compounds
having suitable binding affinity to the CASPASE-14 polypeptide and is
described in detail in
3o European Patent Application 84/03564, published on September 13, 1984,
incorporated herein by
reference. Briefly stated, a plurality of different peptide test compounds are
synthesized on a
solid substrate, such as plastic pins or some other surface. The peptide test
compounds are
reacted with CASPASE-14 polypeptide and washed. Bound CASPASE-14 polypeptide
is then
detected by methods well known in the art. Purified CASPASE-14 can also be
coated directly
onto plates for use in the aforementioned drug screening techniques. In
addition, non-
neutralizing antibodies can be used to capture the peptide and immobilize it
on the solid support.
The invention also contemplates the use of competitive drug screening assays
in which
neutralizing antibodies capable of binding CASPASE-14 specifically compete
with a test
CA 02308112 2000-04-27
- WO 99/23106 PCT/US98~20452
26
compound for binding to CASPASE-14 polypeptides or fragments thereof. In this
manner, the
antibodies can be used to detect the presence of any peptide which shares one
or more antigenic
determinants with CASPASE-14.
Having generally described the invention, the same will be more readily
understood by
reference to the following examples, which are provided by way of illustration
and are not
intended as limiting.
Examples
to Example l: Expression and Purification of Caspase-14 in E. coli
The bacterial expression vector pQE60 is used for bacterial expression in this
example.
(QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311 ). pQE60 encodes
ampicillin
antibiotic resistance ("Amp"') and contains a bacterial origin of replication
("ori"), an IPTG
inducible promoter, a ribosome binding site ("RBS"), six codons encoding
histidine residues that
15 allow affinity purification using nickel-nitrilo-tri-acetic acid ("Ni-NTA")
affinity resin sold by
QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites.
These elements are
arranged such that an inserted DNA fragment encoding a polypeptide expresses
that polypeptide
with the six His residues (i.e., a "6 X His tag") covalently linked to the
carboxyl terminus of that
polypeptide.
2o The DNA sequence encoding the desired portion of the Caspase-14 protein is
amplified
from the deposited cDNA clone using PCR oligonucleotide primers which anneal
to the amino
terminal sequences of the desired portion of the Caspase-14 protein and to
sequences in the
deposited construct 3' to the cDNA coding sequence. Additional nucleotides
containing
restriction sites to facilitate cloning in the pQE60 vector are added to the
5' and 3' sequences,
25 respectively.
For cloning the protein, the 5' primer has the sequence 5' CGC ~ATGG
CTGAAGACAAACACAAC 3' (SEQ ID N0:3) containing the underlined NcoI restriction
site
followed by 17 (i.e., 47-63) nucleotides complementary to the amino terminal
coding sequence.of
the Caspase-14 sequence in Figure 1. One of ordinary skill in the art would
appreciate, of
3o course, that the point in the protein coding sequence where the 5' primer
begins may be varied to
amplify a DNA segment encoding any desired portion of the complete protein in
a shorter or
longer form. The 3' primer has the sequence 5' CGC AAG CTT AACATGGATGCTGTGCTG
3' (SEQ ID N0:4) containing the underlined HindIII restriction site followed
by 18 (i.e., 1230-
1247) nucleotides complementary to the 3' end of the coding sequence
immediately before the
35 stop codon in the Caspase-14 DNA sequence in Figure 1, with the coding
sequence aligned with
the restriction site so as to maintain its reading frame with that of the six
His codons in the pQE60
vector.
CA 02308112 2000-04-27
WO 99/23106 PCT/US98120452
27
The amplified Caspase-14 DNA fragment and the vector pQE60 are digested with
NcoIlHindIII and the digested DNAs are then ligated together. Insertion of the
Caspase-14 DNA
into the restricted pQE60 vector places the Caspase-14 protein coding region
downstream from
the IPTG-inducible promoter and in-frame with an initiating AUG and the six
histidine codons.
The ligation mixture is transformed into competent E. coli cells using
standard procedures
such as those described in Sambrook et al., Molecular Cloning: a Laboratory
Manual, 2nd Ed;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY ( 1989). E. coli
strain M15/rep4,
containing multiple copies of the plasmid pREP4, which expresses the lac
repressor and confers
kanamycin resistance ("Kan"'), is used in carrying out the illustrative
example described herein.
1o This strain, which is only one of many that are suitable for expressing
Caspase-14 protein, is
available commercially from QIAGEN, Inc., supra. Transformants are identified
by their ability
to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA
is isolated from
resistant colonies and the identity of the cloned DNA confirmed by restriction
analysis, PCR and
DNA sequencing.
Clones containing the desired constructs are grown overnight ("O/N") in liquid
culture in
LB media supplemented with both ampicillin ( 100 p,g/ml) and kanamycin (25
pg/ml). The O/N
culture is used to inoculate a large culture, at a dilution of approximately
1:25 to 1:250. The cells
are grown to an optical density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-b-D-
thiogalactopyranoside ("IPTG") is then added to a final concentration of 1 mM
to induce
2o transcription from the Iac repressor sensitive promoter, by inactivating
the IacI repressor. Cells
subsequently are incubated further for 3 to 4 hours. Cells then are harvested
by centrifugation.
The cells are then stirred for 3-4 hours at 4 C in 6M guanidine-HCI, pH 8. The
cell debris
is removed by centrifugation, and the supernatant containing the Caspase-14
protein is loaded
onto a nickel-nitrilo-tri-acetic acid ("NiNTA") affinity resin column
(available from QIAGEN,
Inc., supra). Proteins with a 6 x His tag bind to the NI-NTA resin with high
affinity and can be
purified in a simple one-step procedure (for details see: The
QIAexpressionist, 1995, QIAGEN,
Inc., supra). Briefly the supernatant is loaded onto the column in 6 M
guanidine-HCI, pHB, the
column is first washed with 10 volumes of 6 M guanidine-HCI, pHB, then washed
with 10
volumes of 6 M guanidine-HCl gH6, and finally the Caspase-14 is eluted with 6
M guanidine-
3o HCI, pHS.
The purified protein is then renatured by dialyzing it against
phosphatebuffered saline
(PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCI. Alternatively, the
protein can be
successfully refolded while immobilized on the Ni-NTA column. The recommended
conditions
are as follows: renature using a linear 6M-1M urea gradient in 500 mM NaCI,
20% glycerol, 20
3s mM Tris/HCl pH7.4, containing protease inhibitors. The renaturation should
be performed over
a period of 1.5 hours or more. After renaturation the proteins can be eluted
by the addition of 250
mM immidazole. Immidazole is removed by a final dialyzing step against PBS or
50 mM sodium
acetate pH6 buffer plus 200 mM NaCI. The purified protein is stored at 4 C or
frozen at -80 C.
CA 02308112 2000-04-27
WO 99/23106 PCT/US981Z0452
28
Example 2: Cloning and Expression of Caspase-14 protein in a Baculovirus
Expression System
In this illustrative example, the plasmid shuttle vector pA2 is used to insert
the cloned
DNA encoding the complete protein into a baculovirus to express the Caspase-14
protein, using
standard methods as described in Summers et al., A Manual of Methods for
Baculovirus Vectors
and Insect Cell Culture Procedures, Texas Agricultural Experimental Station
Bulletin No. 1555
( 1987). This expression vector contains the strong polyhedrin promoter of the
Autographa
californica nuclear polyhedrosis virus (AcMNPV) followed by convenient
restriction sites such as
BamHI and Asp718. The polyadenylation site of the simian virus 40 ("SV40") is
used for
efficient polyadenylation. For easy selection of recombinant virus, the
plasmid contains the beta-
galactosidase gene from E. coli under control of a weak Drosophila promoter in
the same
orientation, followed by the polyadenylation signal of the polyhedrin gene.
The inserted genes
are flanked on both sides by viral sequences for cell-mediated homologous
recombination with
wild-type viral DNA to generate viable virus that express the cloned
polynucleotide.
Many other baculovirus vectors could be used in place of the vector above,
such as
pAc373, pVL941 and pAcIMI, as one skilled in the art would readily appreciate,
as long as the
construct provides appropriately located signals for transcription,
translation, secretion and the
like, including a signal peptide and an in-frame AUG as required. Such vectors
are described, for
instance, in Luckow et al., Virology 170:31-39.
The cDNA sequence encoding the full length Caspase-14 protein in the deposited
clone,
including the AUG initiation codon shown in Figure 1' (SEQ ID N0:2), is
amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
The 5' primer has
the sequence 5' CGC GGA TCC GCCATCATGGCTGAAGACAAACAC 3' (SEQ ID NO:S)
containing the underlined BamHI restriction enzyme site, an efficient signal
for initiation of
translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol.
196:947-950 ( 1987),
followed by 17 (i.e., 43-60) bases of the sequence of the complete Caspase-14
protein shown in
Figure 1, beginning with the AUG initiation codon. The 3' primer has the
sequence 5' CGC
GGT ACCAACATGGATGCTGTGCTG 3' (SEQ ID N0:6) containing the underlined, Asp718
3o restriction site followed by 17 (1230-1247) nucleotides complementary to
the 3' noncoding
sequence in Figure 1.
The amplified fragment is isolated from a 1 % agarose gel using a commercially
available
kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment then is digested
with BamHI and
Asp718 and again is purified on a 1 % agarose gel.
The plasmid is digested with the restriction enzymes BamHI and Asp718 and
optionally,
can be dephosphorylated using calf intestinal phosphatase, using routine
procedures known in the
art. The DNA is then isolated from a 1 % agarose gel using a commercially
available kit
("Geneclean" BIO 101 Inc., La Jolla, Ca.).
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US98120452
29
Fragment and the dephosphorylated plasmid are ligated together with T4 DNA
ligase. E.
coli HB 101 or other suitable E. coli hosts such as XL-1 Blue (Stratagene
Cloning Systems, La
Jolla, CA) cells are transformed with the ligation mixture and spread on
culture plates. Bacteria
are identified that contain the plasmid with the human Caspase-14 gene using
the PCR method, in
which one of the primers that is used to amplify the gene and the second
primer is from well
within the vector so that only those bacterial colonies containing the Caspase-
I4 gene fragment
will show amplification of the DNA. The sequence of the cloned fragment is
confirmed by DNA
sequencing. This plasmid is designated herein pBac Caspase-14.
Five El,g of the plasmid pBac Caspase-14 is co-transfected with 1.0 ltg of a
commercially
1o available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA",
Pharmingen, San
Diego, CA.), using the lipofection method described by Felgner et al., Proc.
Natl. Acad. Sci.
USA 84:7413-7417 ( 1987). 1 ~,g of BaculoGoldTM virus DNA and 5 ~g of the
plasmid pBac
Caspase-14 are mixed in a sterile well of a microtiter plate containing 50 p,l
of serum-free Grace's
medium (Life Technologies Inc., Gaithersburg, MD). Afterwards, 10 p.l
Lipofectin plus 90 p.l
15 Grace's medium are added, mixed and incubated for 15 minutes at room
temperature. Then the
transfection mixture is added drop-wise to SP9 insect cells (ATCC CRL 1711 )
seeded in a 35 mm
tissue culture plate with 1 ml Grace's medium without serum. The plate is
rocked back and forth
to mix the newly added solution. The plate is then incubated for 5 hours at 27
C. After 5 hours
the transfection solution is removed from the plate and 1 ml of Grace's insect
medium
20 supplemented with 10% fetal calf serum is added. The plate is put back into
an incubator and
cultivation is continued at 27 C for four days.
After four days the supernatant is collected and a plaque assay is performed,
as described
by Summers and Smith, supra. An agarose gel with "Blue Gal" (Life Technologies
Inc.,
Gaithersburg) is used to allow easy identification and isolation of gal-
expressing clones, which
25 produce blue-stained plaques. (A detailed description of a "plaque assay"
of this type can also be
found in the user's guide for insect cell culture and baculovirology
distributed by Life
Technologies Inc., Gaithersburg, page 9-10). After appropriate incubation,
blue stained plagues
are picked with the dp of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant
viruses is then resuspended in a microcentrifuge tube containing 200 ~1 of
Grace's medium and
3o the suspension containing the recombinant baculovirus is used to infect S~
cells seeded in 35 mm
dishes. Four days later the supernatants of these culture dishes are harvested
and then they are
stored at 4 C. The recombinant virus is called V- Caspase-14.
To verify the expression of the Caspase-14 gene, Sf9 cells are grown in
Grace's medium
supplemented with 10% heat inactivated FBS. The cells are infected with the
recombinant
35 baculovirus V- Caspase-14 at a multiplicity of infection ("MOI") of about
2. Six hours later the
medium is removed and is replaced with SF900 II medium minus methionine and
cysteine
(available from Life Technologies Inc., Rockville, MD). If radiolabeled
proteins are desired, 42
hours later, 5 p.Ci of 35S-methionine and 5 ~,Ci 35S-cysteine (available from
Amersham) are
CA 02308112 2000-04-27
WO 99/23106 PGT/US98120452
added. The cells are further incubated for 16 hours and then they are
harvested by centrifugation.
The proteins in the supernatant as well as the intracellular proteins are
analyzed by SDS-PAGE
followed by autoradiography (if radiolabeled). Microsequencing of the amino
acid sequence of
the amino terminus of purified protein may be used to determine the amino
terminal sequence of
the mature protein and thus the cleavage point and length of the secretory
signal peptide should
one exist.
Example 3: Cloning and Expression of Caspase-14 in Mammalian Cells
A typical mammalian expression vector contains the promoter element, which
mediates the
10 initiation of transcription of mRNA, the protein coding sequence, and
signals required for the
termination of transcription and polyadenylation of the transcript. Additional
elements include
enhancers, Kozak sequences and intervening sequences flanked by donor and
acceptor sites for
RNA splicing. Highly efficient transcription can be achieved with the early
and late promoters
from SV40, the long terminal repeats (LTRS) from Retroviruses, e.g., RSV,
HTLVI, HIVI and
1s the early promoter of the cytomegalovirus (CMV). However, cellular elements
can also be used
(e:g., the human actin promoter). Suitable expression vectors for use in
practicing the present
invention include, for example, vectors such as PSVL and PMSG (Pharmacia,
Uppsala,
Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBCI2MI (ATCC 67109).
Mammalian host cells that could be used include, human Hela 293, H9 and Jurkat
cells, mouse
2o NIH3T3 and C127 cells, Cos 1, Cos 7 and CV 1, quail QC1-3 cells, mouse L
cells and Chinese
hamster ovary (CHO) cells.
Alternatively, the gene can be expressed in stable cell lines that contain the
gene integrated
into a chromosome. The co-transfection with a selectable marker such as dhfr,
gpt, neomycin, or
hygromycin allows the identification and isolation of the transfected cells.
25 The transfected gene can also be amplified to express large amounts of the
encoded
protein. The DHFR (dihydrofolate reductase) marker is useful to develop cell
lines that carry
several hundred or even several thousand copies of the gene of interest.
Another useful selection
marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J.
227:277-279 (1991);
Bebbington et al., BiolTechnology 10:169-175 (1992)). Using these markers, the
mammalian
3o cells are grown in selective medium and the cells with the highest
resistance are selected. These
cell lines contain the amplified genes) integrated into a chromosome. Chinese
hamster ovary
(CHO) and NSO cells are often used for the production of proteins.
The expression vectors pC 1 and pC4 contain the strong promoter (LTR) of the
Rous
Sarcoma Virus (Cullen et al., Molec. Cell. Biol. 5:438-447 ( 1985)) plus a
fragment of the CMV-
enhancer (Boshart et al., Cell 41:521-530 (1985)). Multiple cloning sites,
e.g., with the
restriction enzyme cleavage sites BamHI, XbaI and Asp718, facilitate the
cloning of the gene of
interest. The vectors contain in addition the 3' intron, the polyadenylation
and termination signal
of the rat preproinsulin gene.
CA 02308112 2000-04-27
WO 99/23106 PCT/US98720452
31
Example 3(a): Cloning and Expression of Caspase-14 in COS Cells
The expression plasmid, pCaspase-14 HA, is made by cloning a cDNA encoding
Caspase-14 into the expression vector pcDNA1/Amp or pcDNAIII (which can be
obtained from
Invitrogen, Inc., San Diego, CA).
The expression vector pcDNAI/amp contains: ( I ) an E. coli origin of
replication effective
for propagation in E. coli and other prokaryotic cells; (2) an ampicillin
resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40 origin of
replication for
propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40
intron; (5) several
1o codons encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate
purification) followed
by a termination codon and polyadenylation signal arranged so that a cDNA can
be conveniently
placed under expression control of the CMV promoter and operably linked to the
SV40 intron and
the polyadenylation signal by means of restriction sites in the polylinker.
The HA tag
corresponds to an epitope derived from the influenza hemagglutinin protein
described by Wilson
15 et al., Cell 37:767-778 ( 1984). The fusion of the HA tag to the target
protein allows easy
detection and recovery of the recombinant protein with an antibody that
recognizes the HA
epitope. pcDNAIII contains, in addition, the selectable neomycin marker.
A DNA fragment encoding the Caspase-14 is cloned into the polylinker region of
the
vector so that recombinant protein expression is directed by the CMV promoter.
The plasmid
20 construction strategy is as follows. The Caspase-14 cDNA of the deposited
clone is amplified
using primers that contain convenient restriction sites, much as described
above for construction
of vectors for expression of Caspase-I4 in E. coli. Suitable primers include
the following, which
are used in this example. The 5' primer, containing the underlined SmaI site,
a Kozak sequence,
an AUG start codon and 16 bases of 5' coding region of the complete Caspase-14
has the
25 following sequence: 5' CGCCCCGGGGCCATCATGGCTGAAGACAAACAC 3' (43-60)
(SEQ ID N0:7). The 3' primer, containing the underlined XbaI site, a stop
codon, and 18 by of
3' coding sequence has the following sequence (at the 3' end): 5' CGC T_T_
CTAGA TCA AGC
GTA GTC TGG GAC GTC GTA TGG GTAGTTGCCAGGAAAGAGGT 3' (1157-1173) (SEQ
ID N0:8).
3o The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested
with SmaI
and XbaI and then ligated. The ligation mixture is transformed into E. coli
strain SURE
(available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La
Jolla, CA
92037), and the transformed culture is plated on ampicillin media plates which
then are incubated
to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from
resistant colonies
35 and examined by restriction analysis or other means for the presence of the
Caspase-14-encoding
fragment.
For expression of recombinant Caspase-14, COS cells are transfected with an
expression
vector, as described above, using DEAE-DEXTRAN, as described, for instance, in
Sambrook et
CA 02308112 2000-04-27
_ WO 99/23106 PGT/US98120452
32
al., Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press,
Cold Spring
Harbor, New York (1989). Cells are incubated under conditions for expression
of Caspase-14
by the vector.
Expression of the Caspase-14-HA fusion protein is detected by radiolabeling
and
immunoprecipitation, using methods described in, for example Harlow et al.,
Antibodies: A
Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New
York ( 1988). To this end, two days after transfection, the cells are labeled
by incubation in media
containing 35S-cysteine for 8 hours. The cells and the media are collected,
and the cells are
washed and lysed with detergent-containing RIPA buffer: 150 mM NaCI, 1 % NP-
40, 0.1 %
1o SDS, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited
above. Proteins are
precipitated from the cell lysate and from the culture media using an HA-
specific monoclonal
antibody. The precipitated proteins then are analyzed by SDS-PAGE and
autoradiography. An
expression product of the expected size is seen in the cell lysate, which is
not seen in negative
controls.
Example 3(b): Cloning and Expression of Caspase-14 in CXO Cells
The vector pC4 is used for the expression of Caspase-14 protein. Plasmid pC4
is a
derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146). The plasmid
contains the
mouse DHFR gene under control of the SV40 early promoter. Chinese hamster
ovary- or other
2o cells lacking dihydrofolate activity that are transfected with these
plasmids can be selected by
growing the cells in a selective medium (alpha minus MEM, Life Technologies)
supplemented
with the chemotherapeutic agent methotrexate. The amplification of the DHFR
genes in cells
resistant to methotrexate (MTX) has been well documented (see, e.g., Alt, F.
W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J Biol. Chem. 253:1357-1370,
Hamlin, J. L. and
Ma, C. 1990, Biochem. et Biophys. Acta, 1097:107-143, Page, M. J. and
Sydenham, M.A.
1991, Biotechnology 9:64-68). Cells grown in increasing concentrations of MTX
develop
resistance to the drug by overproducing the target enzyme, DHFR, as a result
of amplification of
the DHFR gene. If a second gene is linked to the DHFR gene, it is usually co-
amplified and
over-expressed. It is known in the art that this approach may be used to
develop cell lines
3o carrying more than 1,000 copies of the amplified gene(s). Subsequently,
when the methotrexate
is withdrawn, cell lines are obtained which contain the amplified gene
integrated into one or more
chromosomes) of the host cell.
Plasmid pC4 contains for expressing the gene of interest the strong promoter
of the long
terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen et al., Molec. Cell.
Biol. 5:438-447
(1985)) plus a fragment isolated from the enhancer of the immediate early gene
of human
cytomegalovirus (CMV) (Boshart et al., Cell 41:521-530 (1985)). Downstream of
the promoter
are BamHI, XbaI, and Asp718 restriction enzyme cleavage sites that allow
integration of the
genes. Behind these cloning sites the plasmid contains the 3' intron and
polyadenylation site of
CA 02308112 2000-04-27
_ WO 99/Z3106 PGT/US98120452
33
the rat preproinsulin gene. Other high efficiency promoters can also be used
for the expression,
e.g., the human -actin promoter, the SV40 early or late promoters or the long
terminal repeats
from other retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and Tet-On
gene expression
systems and similar systems can be used to express the Caspase-14 in a
regulated way in
mammalian cells (Gossen, M., & Bujard, H. 1992, Proc. Natl. Acad. Sci. USA 89:
5547-5551 ).
For the polyadenylation of the mRNA other signals, e.g., from the human growth
hormone or
globin genes can be used as well. Stable cell lines carrying a gene of
interest integrated into the
chromosomes can also be selected upon co-transfection with a selectable marker
such as gpt,
6418 or hygromycin. It is advantageous to use more than one selectable marker
in the
1o beginning, e.g., G418 plus methotrexate.
The plasmid pC4 is digested with the restriction enzymes BamHI and Asp718 and
then
dephosphorylated using calf intestinal phosphatase by procedures known in the
art. The vector is
then isolated from a 1 % agarose gel.
The DNA sequence encoding the complete Caspase-14 protein is amplified using
PCR
15 oligonucleotide primers corresponding to the 5' and 3' sequences of the
gene. The 5' primer has
the sequence 5' CGC GGA TCC GCCATCATGGCTGAAGACAAACAC 3' (SEQ 1D N0:9)
containing the underlined BamI restriction enzyme site, an efficient signal
for initiation of
translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol.
196:947-950 ( 1987),
followed by 17 (i.e., 43-60) bases of the sequence of the complete Caspase-14
protein shown in
2o Figure l, beginning with the AUG initiation codon. The 3' primer has the
sequence 5' CGC
GGT ACCAACATGGATGCTGTGCTG 3' (SEQ ID NO:10} containing the underlined, Asp718
restriction site followed by 17 (1230-1247) nucleotides complementary to the
3' noncoding
sequence in Figure 1.
The amplified fragment is digested with the endonucleases BamHI and Asp718 and
then
25 purified again on a 1 % agarose gel. The isolated fragment and the
dephosphorylated vector are
then ligated with T4 DNA ligase. E. coli HB101 or XL-1 Blue cells are then
transformed and
bacteria are identified that contain the fragment inserted into plasmid pC4
using, for instance,
restriction enzyme analysis.
Chinese hamster ovary cells lacking an active DHFR gene are used for
transfection. 5 ~,g
30 of the expression plasmid pC4 is cotransfected with O.S ~.g of the plasmid
pSV2-neo using
lipofectin (Felgner et al., supra). The plasmid pSV2neo contains a dominant
selectable marker,
the neo gene from Tn5 encoding an enzyme that confers resistance to a group of
antibiotics
including 6418. The cells are seeded in alpha minus MEM supplemented with 1
mg/ml 6418.
After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates
(Greiner, Germany)
35 in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of metothrexate
plus 1 mg/ml 6418.
After about 10-14 days single clones are trypsinized and then seeded in 6-well
petri dishes or 10
ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200
nM, 400 nM, 800
nM). Clones growing at the highest concentrations of methotrexate are then
transferred to new 6-
CA 02308112 2000-04-27
_ WO 99/Z3106 PGT/US98120452
34
well plates containing even higher concentrations of methotrexate ( 1 N.M, 2
~.M, 5 N,M, 10 ~.M,
20 ~.M). The same procedure is repeated until clones are obtained which grow
at a concentration
of 100 - 200 ~tM. Expression of the desired gene product is analyzed, for
instance, by SDS-
PAGE and Western blot or by reverse phase HPLC analysis.
Example 4: Tissue distribution of Caspase-14 mRNA expression
Northern blot analysis is carried out to examine Caspase-14 gene expression in
human
tissues, using methods described by, among others, Sambrook et al., cited
above. A cDNA
probe containing the entire nucleotide sequence of the Caspase-14 protein (SEQ
ID NO:I) is
labeled with 32P using the rediprimeTM DNA labeling system (Amersham Life
Science),
according to manufacturer's instructions. After labeling, the probe is
purified using a CHROMA
SPIN- 100TM column (Clontech Laboratories, Inc.), according to manufacturer's
protocol
number PT1200-1. The purified labeled probe is then used to examine various
human tissues for
Caspase-14 mRNA.
Multiple Tissue Northern (MTN) blots containing various human tissues (H) or
human
immune system tissues (IM) can be obtained from Clontech and are examined with
the labeled
probe using ExpressHybTM hybridization solution (Clontech) according to
manufacturer's
protocol number PT1190-1. Following hybridization and washing, the blots are
mounted and
exposed to film at -70 C overnight, and films developed according to standard
procedures.
2o Experiments performed substantially as above revealed that Caspase-14 is
expressed
constitutively in a variety of human tissues. Caspase-14 was highly expressed
in HeLa cells, but
not in transformed hematopoietic cell lines including Burkitt's lymphoma, Raji
cells or im
promyelocytic leukemia HL-60 cells.
2s It will be clear that the invention may be practiced otherwise than as
particularly described
in the foregoing description and examples.
Numerous modifications and variations of the present invention are possible in
light of the
above teachings and, therefore, are within the scope of the appended claims.
The entire disclosure of all publications (including patents, patent
applications, journal
30 articles, laboratory manuals, books, or other documents) cited herein are
hereby incorporated by
reference.
CA 02308112 2000-04-27
_ WO 99/23106 PCTNS98120452
1
SEQUENCE LISTING
<110> Human Genome Sciences, Inc. et al.
<120> CASPASE-19 Polypeptides
<130> PF377PCT
<140> Unassigned
<141> 1998-08-29
<150> 60/063,592
<151> 1997-10-30
<150> 60/076,050
<151> 1998-02-26
<160> 10
<170> Patentln Ver. 2.0
<210> 1
<211> 2043
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (43)..(1173)
<400> 1
ggcgtccttc aaggcagtag gaagatacta agcttattat ct atg get gaa gac 59
Met Ala Glu Asp
1
aaacac aacaaaaac ccacttaag atgttggaa tctttgggc aaagaa 102
LysHis AsnLysAsn ProLeuLys MetLeuGlu SerLeuGly LysGlu
10 15 20
ctcatt tctggcctt ttggatgac tttgtggaa aaaaatgtc ctgaaa 150
LeuIle SerGlyLeu LeuAspAsp PheValGlu LysAsnVal LeuLys
25 30 35
ttggag gaagaggag aagaaaaaa atttatgat gccaaactt caagac 198
LeuGlu GluGluGlu LysLysLys IleTyrAsp AlaLysLeu GlnAsp
40 45 50
aaagcc cgggtcttg gttgattct atacgacag aaaaaccaa gaggca 246
LysAla ArgValLeu ValAspSer IleArgGln LysAsnGln GluAla
55 60 65
ggtcaa gtctttgtt caaactttc ctaaacata gacaaaaat tccacc 299
GlyGln ValPheVal GlnThrPhe LeuAsnIle AspLysAsn SerThr
70 75 80
agtata aaagetcct gaggaaact gtggetgga ccagatgag tcagtg 342
SerIle LysAlaPro GluGluThr ValAlaGly ProAspGlu SerVal
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US98r10452
2
85 90 95 100
gga tct gca get acc ctc aag ctt tgc cct cat gaa gaa ttc ctg aaa 390
Gly Ser Ala Ala Thr Leu Lys Leu Cys Pro His Glu Glu Phe Leu Lys
105 110 115
ctg tgt aaa gaa agg get gga gag atc tat cca ata aag gag aga aag 438
Leu Cys Lys Glu Arg Ala Gly Glu Ile Tyr Pro Ile Lys Glu Arg Lys
120 125 130
gac cgc act cgt ctg get ctc atc ata tgc aac aca gag ttt gat cat 986
Asp Arg Thr Arg Leu Ala Leu Ile Ile Cys Asn Thr Glu Phe Asp His
135 140 195
atgcct cccaggaat gggget gcccttgacatc cttgga atgaagcag 534
MetPro ProArgAsn GlyAla AlaLeuAspIle LeuGly MetLysGln
150 155 160
ctgctt gagggtctt ggctac actgtggaagtg gaagag aaactcaca 582
LeuLeu GluGlyLeu GlyTyr ThrValGluVal GluGlu LysLeuThr
165 170 175 180
gccagg gacatggaa tcagtg ctgtggaaattt getgca cgtgaagag 630
AlaArg AspMetGlu SerVal LeuTrpLysPhe AlaAla ArgGluGlu
185 190 195
cacaaa tcctcagac agtaca ttcttggtgttc atgtct catggcatc 678
HisLys SerSerAsp SerThr PheLeuValPhe MetSer HisGlyIle
200 205 210
ctggat gggatctgt gggact atgcacagtgag gaagaa ccagatgtg 726
LeuAsp GlyIleCys GlyThr MetHisSerGlu GluGlu ProAspVal
215 220 225
ttacct tatgatacc atcttc cggacattcaac aaccgt aattgcctc 774
LeuPro TyrAspThr IlePhe ArgThrPheAsn AsnArg AsnCysLeu
230 235 240
agtcta aaggacaaa cctaaa gtcatcattgtc caggcc tgcagaggt 822
SerLeu LysAspLys ProLys ValIleIleVal GlnAla CysArgGly
245 250 255 260
gcaaat cgtggggaa ttgtgg gtcagtgactct ccacca gccttggca 870
AlaAsn ArgGlyGlu LeuTrp ValSerAspSer ProPro AlaLeuAla
265 270 275
gacagc ttttcacag tcatcc gagaacctggaa gatgat getgtttac 918
AspSer PheSerGln SerSer GluAsnLeuGlu AspAsp AlaValTyr
280 285 . 290
aagacc catgtagag aaagac ttcattgetttc tgttcc tcaactcca 966
LysThr HisValGlu LysAsp PheIleAlaPhe CysSer SerThrPro
295 300 305
cataat gtgtcctgg agagac ataaaaaaaggt tctctc ttcattaca 1014
HisAsn ValSerTrp ArgAsp IleLysLysGly SerLeu PheIleThr
310 315 320
CA 02308112 2000-04-27
_ WO 99/23106 PCT/US98120452
3
cgactc atcaca tgcttccaa aaatat gettggtgc tgtcatctt gag 1062
ArgLeu IleThr CysPheGln LysTyr AlaTrpCys CysHisLeu Glu
325 330 335 340
gaagta tttagg aaggtacca caatca tttgaaaaa ccaaatgtt aaa 1110
GluVal PheArg LysValPro GlnSer PheGluLys ProAsnVal Lys
395 350 355
gcccag atgccc actgttgaa cgactc tctatgaca agatatttc tac 1158
AlaGln MetPro ThrValGlu ArgLeu SerMetThr ArgTyrPhe Tyr
360 365 370
ctcttt cctggc aactgaaaataaa atcacaggaa ttatcagctt
1213
attcaaccat
LeuPhe ProGly Asn
375
caagaagcat ttttatcagc acagcatcca tgtttaacct tttgtctttc attaaagtga 1273
aaacatatga actgttcttt ggggtcctct aagaaagaat agaatttcaa ttaaaacaat 1333
ggatggatgg aaataaagta gaagaagaaa actggatttt cttgttatat tgcatataat 1393
gcctgcactt tactgagtga agagaactag tcatgacttg ccctcagcag cagggtgaaa 1453
ggagatggtg cacatctgga gacaaggacc aaaaactggg tcacctgctc ctttgatcac 1513
tcatcaaacc ttgcaactag aattatttgg aagactattt ctaatttatt atttaaccaa 1573
catcatgggt ccaagttcaa ttttttttca gcaaagttgt tatggtacct atgcatcttt 1633
cttcttatcc ataaattaat ttgcctttct tgttgatgat ttttcattcc agatttccca 1693
agcttcagga aaattttgtt atttagcaaa cacttggtaa ttgtctaaaa taaattgggc 1753
ctttgattta agatggtata attgggtgtg cttgtataga aagacagaca ttattagata 1813
cagaacatcc aagagtgtgg gaaatgtcag caatgggaaa gaaaatgtta aattttctgg 1873
aaagtgaatg tcagtagagg aattttagca acatggccat ctgagccact gactaaggag 1933
atgtaccact tcaattacat acatgcagaa tgctgaatag atatatcagg acatgctgaa 1993
ctgtattaca aataaaatga ttctctagat atcaaaaaaa aaaaaaaaaa 2043
<210> 2
<211> 377
<212> PRT
<213> Homo Sapiens
<900> 2
Met Ala Glu Asp Lys His Asn Lys Asn Pro Leu Lys Met Leu Glu Ser
1 5 10 15
Leu Gly Lys Glu Leu Ile Ser Gly Leu Leu Asp Asp Phe Val Glu Lys
20 25 30
CA 02308112 2000-04-27
WO 99/23106 PCT/US98120452
4
Asn Val Leu Lys Leu Glu Glu Glu Glu Lys Lys Lys Ile Tyr Asp Ala
35 90 45
Lys Leu Gln Asp Lys Ala Arg Val Leu Val Asp Ser Ile Arg Gln Lys
50 55 60
Asn Gln Glu Ala Gly Gln Val Phe Val Gln Thr Phe Leu Asn Ile Asp
65 70 75 80
Lys Asn Ser Thr Ser Ile Lys Ala Pro Glu Glu Thr Val Ala Gly Pro
85 90 95
Asp Glu Ser Val Gly Ser Ala Ala Thr Leu Lys Leu Cys Pro His Glu
100 105 110
Glu Phe Leu Lys Leu Cys Lys Glu Arg Ala Gly Glu Ile Tyr Pro Ile
115 120 125
Lys Glu Arg Lys Asp Arg Thr Arg Leu Ala Leu Ile Ile Cys Asn Thr
130 135 190
Glu Phe Asp His Met Pro Pro Arg Asn Gly Ala Ala Leu Asp Ile Leu
145 150 155 160
Gly Met Lys Gln Leu Leu Glu Gly Leu Gly Tyr Thr Val Glu Val Glu
165 170 175
Glu Lys Leu Thr Ala Arg Asp Met Glu Ser Val Leu Trp Lys Phe Ala
180 185 190
Ala Arg Glu Glu His Lys Ser Ser Asp Ser Thr Phe Leu Val Phe Met
195 200 205
Ser His Gly Ile Leu Asp Gly Ile Cys Gly Thr Met His Ser Glu Glu
210 215 220
Glu Pro Asp Val Leu Pro Tyr Asp Thr Ile Phe Arg Thr Phe Asn Asn
225 230 235 240
Arg Asn Cys Leu Ser Leu Lys Asp Lys Pro Lys Val. Ile Ile Val Gln
245 250 255
Ala Cys Arg Gly Ala Asn Arg Gly Glu Leu Trp Val Ser Asp Ser Pro
260 265 270
Pro Ala Leu Ala Asp Ser Phe Ser Gln Ser Ser Glu Asn Leu Glu Asp
275 280 285
Asp Ala Val Tyr Lys Thr His Val Glu Lys Asp Phe Ile Ala Phe Cys
290 295 300
Ser Ser Thr Pro His Asn Val Ser Trp Arg Asp Ile Lys Lys Gly Ser
305 310 315 320
Leu Phe Ile Thr Arg Leu Ile Thr Cys Phe Gln Lys Tyr Ala Trp Cys
325 330 335
CA 02308112 2000-04-27
_ WO 99/Z3106 PGT/US98720452
Cys His Leu Glu Glu Val Phe Arg Lys Val Pro Gln Ser Phe Glu Lys
340 345 350
Pro Asn Val Lys Ala Gln Met Pro Thr Val Glu Arg Leu Ser Met Thr
355 360 365
Arg Tyr Phe Tyr Leu Phe Pro Gly Asn
370 375
<210> 3 _
<211> 26
<212> DNA
<213> Homo sapiens
<900> 3
cgcccatggc tgaagacaaa cacaac 26
<210> 4
<211> 27
<212> DNA
<213> Homo sapiens
<400> 4
cgcaagctta acatggatgc tgtgctg 27
<210> 5
<211> 33
<212> DNA
<213> Homo sapiens
<400> 5
cgcggatccg ccatcatggc tgaagacaaa cac 33
<210> 6
<211> 27
<212> DNA
<213> Homo sapiens
<400> 6
cgcggtacca acatggatgc tgtgctg 27
<210> 7
<211> 33
<212> DNA
<213> Homo sapiens
<400> 7
cgccccgggg ccatcatggc tgaagacaaa cac 33
<210> 8
CA 02308112 2000-04-27
_ WO 99123106 PCT/US98120452
<211> 56
<212> DNA
<213> Homo Sapiens
6
<900> 8
cgctctagat caagcgtagt ctgggacgtc gtatgggtag ttgccaggaa agaggt 56
<210> 9
<211> 33
<212> DNA
<213> Homo Sapiens
<400> 9
cgcggatccg ccatcatggc tgaagacaaa cac 33
<210> 10
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 10
cgcggtacca acatggatgc tgtgctg 27
