Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
Use of Multiple Recombination Sites with Unique Specificity
in Recombinational Cloning
BACKGROUND OF THE INVENTION
Field of the Invention
The present invention relates to the fields of biotechnology and molecular
biology. In particular, the present invention relates to joining multiple
nucleic
acid molecules containing recombination sites, preferably using recombination
sites having a unique specificity. The present invention also relates to
cloning
such joined nucleic acid molecules using recombinational cloning methods. The
invention also relates to joining multiple peptides, and combinations of
peptides
and nucleic acid molecules through the use of recombination sites. Other
molecules and compounds or combinations of molecules and compounds may
also be joined through recombination sites according to the invention. Such
peptides, nucleic acids and other molecules and/or compounds (or combinations
thereof] may also be joined or bound through recombination to one or a number
of supports or structures in accordance with the invention.
Related Art
Site-specific Recombinases
Site-specific recombinases are proteins that are present in many organisms
(e.g., viruses and bacteria) and have been characterized as having both
endonuclease and ligase properties. These recombinases (along with associated
proteins in some cases) recognize specific sequences of bases in a nucleic
acid
molecule and exchange the nucleic acid segments flanking those sequences. The
recombinases and associated proteins are collectively referred to as
"recombination proteins" (see, e.g., Landy, A., Current Opinion in
Biotechnology
3:699-707 (1993)).
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-2-
Numerous recombination systems from various organisms have been
described. See, e.g., Hoess, et al., Nucleic Acids Research 14(6):2287 (1986);
Abremski, et al., J Biol. Chem. 261(1):391 (1986); Campbell, J. Bacteriol.
174(23):7495 (1992); Qian, et al., J. Biol. Chem. 267(11):7794 (1992); Araki,
et
al., J. Mol. Biol. 225(1):25 (1992); Maeser and Kahnmann, Mol. Gen. Genet.
230:170-176) (1991); Esposito, et al., Nucl. Acids Res. 25(18):3605 (1997).
Many of these belong to the integrase family of recombinases (Argos, et al.,
EMBO.I. 5:433-440 (1986); Voziyanov, et al., Nucl. Acids Res. 27:930 (1999)).
Perhaps the best studied of these are the Integrase/att system from
bacteriophage
~. (Landy, A. Current Opinions in Genetics and Devel. 3:699-707 (1993)), the
Cre/loxP system frbm bacteriophage P 1 (Hoess and Abremski ( 1990) In Nucleic
Acids and Molecular Biology, vol. 4. Eds.: Eckstein and Lilley,
Berlin-Heidelberg: Springer-Verlag; pp. 90-109) , and the FLP/FRT system from
the Saccharomyces cerevisiae 2 ,u circle plasmid (Broach, et al., Cell 29:227-
234
(1982)).
Transposons
Transposons are mobile genetic elements. Transposons are structurally
variable, being described as simple or compound, but typically encode a
transposition catalyzing enzyme, termed a transposase, flanked by DNA
sequences organized in inverted orientations. For a more thorough discussion
of
the characteristics of transposons, one may consult Mobile Genetic Elements,
D.
J. Sherratt, Ed., Oxford University Press ( 1995) and Mobile DNA, D. E. Berg
and
M. M. Howe, Eds., American Society for Microbiology (1989), Washington, DC
both of which are specifically incorporated herein by reference.
Transposons have been used to insert DNA into target DNA. As a general
rule, the insertion of transposons into target DNA is a random event. One
exception to this rule is the insertion of transposon Tn7. Transposon Tn7 can
integrate itself into a specific site in the E. coli genome as one part of its
life cycle
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-3-
(Stellwagen, A.E., and Craig, N.L. Trends in Biochemical Sciences 23, 486-490,
1998 specifically incorporated herein by reference). This site specific
insertion
has been used in vivo to manipulate the baculovirus genome (Lucklow et al., J.
Virol. 67:4566-4579 (1993) specifically incorporated herein by reference). The
S site specificity of Tn7 is atypical of transposable elements whose hallmark
is
movement to random positions in acceptor DNA molecules. For the purposes of
this application, transposition will be used to refer to random or quasi-
random
movement, unless otherwise specified, whereas recombination will be used to
refer to site specific recombination events. Thus, the site specific insertion
of
Tn7 into the attTn 7 site would be referred to as a recombination event while
the
random insertion of Tn7 would be referred to as a transposition event.
York, et al. (Nucleic Acids Research, 26(8):1927-1933, (1998)) disclose
an in vitro method for the generation of nested deletions based upon an
intramolecular transposition within a plasmid using TnS. A vector containing a
kanamycin resistance gene flanked by two 19 base pair Tn5 transposase
recognition sequences and a target DNA sequence was incubated in vitro in the
presence of purified transposase protein. Under the conditions of low DNA
concentration employed, the intramolecular transposition reaction was favored
and was successfully used to generate a set of nested deletions in the target
DNA.
The authors suggested that this system might be used to generate C-terminal
truncations in a protein encoded by the target DNA by the inclusion of stop
signals in all three reading frames adjacent to the recognition sequences. In
addition, the authors suggested that the inclusion of a His tag and kinase
region
might be used to generate N-terminal deletion proteins for further analysis.
Devine, e1 al., (NucleicAcids Research, 22:3765-3772 (1994) and United
States Patents Nos. 5,677,170 and 5,843,772, all of which are specifically
incorporated herein by reference) disclose the construction of artificial
transposons for the insertion of DNA segments into recipient DNA molecules in
vitro. The system makes use of the insertion-catalyzing enzyme of yeast TY1
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-4-
virus-like particles as a source of transposase activity. The DNA segment of
interest is cloned, using standard methods, between the ends of the
' transposon-like element TY1. In the presence of the TYl insertion-catalyzing
enzyme, the resulting element integrates randomly into a second target DNA
molecule.
Another class of mobile genetic elements are integrons. Integrons
generally consist of a 5'- and a 3'-conserved sequence flanking a variable
sequence. Typically, the 5'-conserved sequence contains the coding information
for an integrase protein. The integrase protein may catalyze site-specific
recombination at a variety of recombination sites including attI, attC as well
as
other types of sites (see Francia et al., J. Bacteriology 181 (21 ):6844-6849,
1999,
and references cited therein).
Recombination Sites
Whether the reactions discussed above are termed recombination,
transposition or integration and are catalyzed by a recombinase or integrase,
they
share the key feature of specific recognition sequences, often termed
"recombination sites," on the nucleic acid molecules participating in the
reactions.
These recombination sites are sections or segments of nucleic acid on the
participating nucleic acid molecules that are recognized and bound by the
recombination proteins during the initial stages of integration or
recombination.
For example, the recombination site for Cre recombinase is loxP which is a 34
base pair sequence comprised of two 13 base pair inverted repeats (serving as
the
recombinase binding sites) flanking an 8 base pair core sequence. (See Figure
1
of Sauer, B., Curr. Opin. Biotech. 5:521-527 (1994).) Other examples of
recognition sequences include the attB, attP, attL, and atlR sequences which
are
recognized by the recombination protein ~, Int. attB is an approximately 25
base
pair sequence containing two 9 base pair core-type Int binding sites and a 7
base
pair overlap region, while attP is an approximately 240 base pair sequence
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-5-
containing core-type Int binding sites and arm-type Int binding sites as well
as
sites for auxiliary proteins integration host factor (IHF), FIS and
excisionase
(Xis). (See Landy, Curr. Opin. Biotech. 3:699-707 (1993).)
Stop Colons and Suppressor tRlVAs
Three colons are used by both eukaryotes and prokaryotes to signal the
end of gene. When transcribed into mRNA, the colons have the following
sequences: UAG (amber), UGA (opal) and UAA (ochre). Under most
circumstances, the cell does not contain any tRNA molecules that recognize
these
colons. Thus, when a ribosome translating an mRNA reaches one of these
colons, the ribosome stalls and falls of the RNA, terminating translation of
the
mRNA. The release of the ribosome from the mRNA is mediated by specific
factors (see S. Mottagui-Tabar, NAR 26(11), 2789, 1998). A gene with an
in-frame stop colon (TAA, TAG, or TGA) will ordinarily encode a protein with
a native carboxy terminus. However, suppressor tRNAs, can result in the
insertion of amino acids and continuation of translation past stop colons.
Mutant tRNA molecules that recognize what are ordinarily stop colons
suppress the termination of translation of an mRNA molecule and are termed
suppressor tRNAs. A number of such suppressor tRNAs have been found.
Examples include, but are not limited to, the .supE, supP, supD, supF and supZ
suppressors which suppress the termination of translation of the amber stop
colon, supB, glT, supL, supN, supC and supM suppressors which suppress the
function of the ochre stop colon and glyT, trpT and Su-9 which suppress the
function of the opal stop colon. In general, suppressor tRNAs contain one or
more mutations in the anti-colon loop of the tRNA that allows the tRNA to base
pair with a colon that ordinarily functions as a stop colon. The mutant tRNA
is
charged with its cognate amino acid residue and the cognate amino acid residue
is inserted into the translating polypeptide when the stop colon is
encountered.
For a more detailed discussion of suppressor tRNAs, the reader may consult
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-6-
Eggertsson, el al., (1988) Microbiological Review 52(3):354-374, and
Engleerg-Kukla, et al. (1996) in Escherichia coli and Salmonella Cellular and
Molecular Biology, Chapter 60, pps 909-921, Neidhardt, et al. eds., ASM Press,
Washington, DC.
Mutations which enhance the efficiency of termination suppressors, i. e.,
increase the read through of the stop codon, have been identified. These
include,
but are not limited to, mutations in the uar gene (also known as the prfA
gene),
mutations in the ups gene, mutations in the sueA, sueB and sueC genes,
mutations in the rpsD (ramA) and rpsE (spcA) genes and mutations in the rplL
gene.
Under ordinary circumstances, host cells would not be expected to be
healthy if suppression of stop codons is too efficient. This is because of the
thousands or tens of thousands of genes in a genome, a significant fraction
will
naturally have one of the three stop codons; complete read-through of these
would result in a large number of aberrant proteins containing additional
amino
acids at their carboxy termini. If some level of suppressing tRNA is present,
there is a race between the incorporation of the amino acid and the release of
the
ribosome. Higher levels of tRNA may lead to more read-through although other
factors, such as the codon context, can influence the efficiency of
suppression.
Organisms ordinarily have multiple genes for tRNAs. Combined with the
redundancy of the genetic code (multiple codons for many of the amino acids),
mutation of one tRNA gene to a suppressor tRNA status does not lead to high
levels of suppression. The TAA stop codon is the strongest, and most difficult
to suppress. The TGA is the weakest, and naturally (in E. coli) leaks to the
extent
of 3%. The TAG (amber) codon is relatively tight, with a read-through of ~1
without suppression. In addition, the amber codon can be suppressed with
efficiencies on the order of 50% with naturally occurring suppressor mutants.
Suppression has been studied for decades in bacteria and bacteriophages.
In addition, suppression is known in yeast, flies, plants and other eukaryotic
cells
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
_7_
including mammalian cells. For example, Capone, et al. (Molecular and Cellular
Biology 6(9):3059-3067, 1986) demonstrated that suppressor tRNAs derived from
mammalian tRNAs could be used to suppress a stop codon in mammalian cells.
A copy of the E. coli chloramphenicol acetyltransferase (cat) gene having a
stop
codon in place of the codon for serine 27 was transfected into mammalian cells
along with a gene encoding a human serine tRNA which had been mutated to
form an amber, ochre, or opal suppressor derivative of the gene. Successful
expression of the cat gene was observed. An inducible mammalian amber
suppressor has been used to suppress a mutation in the replicase gene of polio
virus and cell lines expressing the suppressor were successfully used to
propagate
the mutated virus (Sedivy, et al., (1987) Cell 50: 379-389). The context
effects
on the efficiency of suppression of stop codons by suppressor tRNAs has been
shown to be different in mammalian cells as compared to E. coli (Phillips-
Tones,
et al., (1995) Molecular and Cellular Biology 15(12): 6593-6600, Martin, et
al.,( 1993) Biochemical Society Transactions 21:) Since some human diseases
are
caused by nonsense mutations in essential genes, the potential of suppression
for
gene therapy has long been recognized (see Temple, et al. (1982) Nature
296(5857):537-40). The suppression of single and double nonsense mutations
introduced into the diphtheria toxin A-gene has been used as the basis of a
binary
system for toxin gene therapy (Robinson, et al., (1995) Human Gene Therapy
6:137-143).
Conventional Nucleic Acid Cloning
The cloning of nucleic acid segments currently occurs as a daily routine
in many research labs and as a prerequisite step in many genetic analyses. The
purpose of these clonings is various, however, two general purposes can be
considered: (1) the initial cloning of nucleic acid from large DNA or RNA
segments (chromosomes, YACs, PCR fragments, mRNA, etc.), done in a relative
handful of known vectors such as pUC, pGem, pBlueScript, and (2) the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
_g_
subcloning of these nucleic acid segments into specialized vectors for
functional
analysis. A great deal of time and effort is expended both in the transfer of
nucleic acid segments from the initial cloning vectors to the more specialized
vectors. This transfer is called subcloning.
The basic methods for cloning have been known for many years and have
changed little during that time. A typical cloning protocol is as follows:
(1) digest the nucleic acid of interest with one or two restriction
enzymes;
(2) gel purify the nucleic acid segment of interest when known;
(3 ) prepare the vector by cutting with appropriate restriction enzymes,
treating with alkaline phosphatase, gel purify etc., as appropriate;
(4) ligate the nucleic acid segment to the vector, with appropriate
controls to eliminate background of uncut and self ligated vector;
(5) introduce the resulting vector into an E. coli host cell;
(6) pick selected colonies and grow small cultures overnight;
(7) make nucleic acid minipreps; and
(8) analyze the isolated plasmid on agarose gels (often after diagnostic
restriction enzyme digestion) or by PCR.
The specialized vectors used for subcloning nucleic acid segments are
functionally diverse. These include but are not limited to: vectors for
expressing
nucleic acid molecules in various organisms; for regulating nucleic acid
molecule
expression; for providing tags to aid in protein purification or to allow
tracking
of proteins in cells; for modifying the cloned nucleic acid segment (e.g.,
generating deletions); for the synthesis of probes (e.g., riboprobes); for the
preparation of templates for nucleic acid sequencing; for the identification
of
protein coding regions; for the fusion of various protein-coding regions; to
provide large amounts of the nucleic acid of interest, etc. It is common that
a
particular investigation will involve subcloning the nucleic acid segment of
interest into several different specialized vectors.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-9-
As known in the art, simple subclonings can be done in one day (e.g., the
nucleic acid segment is not large and the restriction sites are compatible
with
those of the subcloning vector). However, many other subclonings can take
several weeks, especially those involving unknown sequences, long fragments,
toxic genes, unsuitable placement of restriction sites, high backgrounds,
impure
enzymes, etc. One of the most tedious and time consuming type of subcloning
involves the sequential addition of several nucleic acid segments to a vector
in
order to construct a desired clone. One example of this type of cloning is in
the
construction of gene targeting vectors. Gene targeting vectors typically
include
two nucleic acid segments, each identical to a portion of the target gene,
flanking
a selectable marker. In order to construct such a vector, it may be necessary
to
clone each segment sequentially, i.e., first one gene fragment is inserted
into the
vector, then the selectable marker and then the second fragment of the target
gene. This may require a number of digestion, purification, ligation and
isolation
steps for each fragment cloned. Subcloning nucleic acid fragments is thus
often
viewed as a chore to be done as few times as possible.
Several methods for facilitating the cloning ofnucleic acid segments have
been described, e.g., as in the following references.
Ferguson, J., et al., Gene 16:191 (1981 ), disclose a family of vectors for
subcloning fragments of yeast nucleic acids. The vectors encode kanamycin
resistance. Clones of longer yeast nucleic acid segments can be partially
digested
and ligated into the subcloning vectors. If the original cloning vector
conveys
resistance to ampicillin, no purification is necessary prior to
transformation, since
the selection will be for kanamycin.
Hashimoto-Gotoh, T., et al., Gene 41:125 (1986), disclose a subcloning
vector with unique cloning sites within a streptomycin sensitivity gene; in a
streptomycin-resistant host, only plasmids with inserts or deletions in the
dominant sensitivity gene will survive streptomycin selection.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-10-
Notwithstanding the improvements provided by these methods, traditional
subclonings using restriction and ligase enzymes are time consuming and
relatively unreliable. Considerable labor is expended, and if two or more days
later the desired subclone can not be found among the candidate plasmids, the
entire process must then be repeated with alternative conditions attempted.
Recombinational Cloning
Cloning systems that utilize recombination at defined recombination sites
have been previously described in the related applications listed above, and
in
U.S. Appl. No. 09/177,387, filed October 23, 1998; U.S. Appl. No. 09/517,466,
filed March 2, 2000; and U.S. Patent Nos. 5,888,732 and 6,143,557, all of
which
are specifically incorporated herein by reference. In brief, the GATEWAYTM
Cloning System, described in this application and the applications referred to
in
the related applications section, utilizes vectors that contain at least one
recombination site to clone desired nucleic acid molecules in vivo or in
vitro'.
More specifically, the system utilizes vectors that contain at least two
different
site-specific recombination sites based on the bacteriophage lambda system
(e.g.,
attl and att2) that are mutated from the wild-type (att0) sites. Each mutated
site
has a unique specificity for its cognate partner att site (i.e., its binding
partner
recombination site) of the same type (for example attB 1 with attP 1, or attL
1 with
allRl ) and will not cross-react with recombination sites of the other mutant
type
or with the wild-type att0 site. Different site specificities allow
directional
cloning or linkage of desired molecules thus providing desired orientation of
the
cloned molecules. Nucleic acid fragments flanked by recombination sites are
cloned and subcloned using the GATEWAYTM system by replacing a selectable
marker (for example, ccdB) flanked by att sites on the recipient plasmid
molecule, sometimes termed the Destination Vector. Desired clones are then
selected by transformation of a ccdB sensitive host strain and positive
selection
for a marker on the recipient molecule. Similar strategies for negative
selection
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-11-
(e.g., use oftoxic genes) can be used in other organisms such as thymidine
kinase
(TK) in mammals and insects.
Mutating specific residues in the core region of the att site can generate
a large number of different att sites. As with the att 1 and att2 sites
utilized in
S GATEWAYTM, each additional mutation potentially creates a novel att site
with
unique specificity that will recombine only with its cognate partner att site
bearing the same mutation and will not cross-react with any other mutant or
wild-type att site. Novel mutated att sites (e.g., attB 1-10, attP 1-10, attR
1-10
and attL 1-10) are described in previous patent application serial number
09/517,466, filed March 2, 2000, which is specifically incorporated herein by
reference. Other recombination sites having unique specificity (i.e., a first
site
will recombine with its corresponding site and will not recombine or not
substantially recombine with a second site having a different specificity) may
be
used to practice the present invention. Examples of suitable recombination
sites
include, but are not limited to, loxP sites; loxP site mutants, variants or
derivatives such as loxP511 (see U.S. Patent No. 5,851,808); frt sites; frt
site
mutants, variants or derivatives; dif sites; dif site mutants, variants or
derivatives;
psi sites; psi site mutants, variants or derivatives; cer sites; and cer site
mutants,
variants or derivatives. The present invention provides novel methods using
such
recombination sites to join or link multiple nucleic acid molecules or
segments
and more specifically to clone such multiple segments (e.g., two, three, four,
five,
seven, ten, twelve, fifteen, twenty, thirty, fifty, seventy-five, one hundred,
two
hundred, etc.) into one or more vectors (e.g., two, three, four, five, seven,
ten,
twelve, etc.) containing one or more recombination sites (e.g., two, three,
four,
five, seven, ten, twelve, fifteen, twenty, thirty, fifty, seventy-five, one
hundred,
two hundred, etc.), such as any GA'rEwAYTM Vector including Destination
Vectors.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-12-
BRIEF SUMMARY OF THE INVENTION
The present invention generally provides materials and methods for
joining or combining two or more (e.g., two, three, four, five, seven, ten,
twelve,
fifteen, twenty, thirty, fifty, seventy-five, one hundred, two hundred, etc.)
segments or molecules of nucleic acid by the recombination reaction between
recombination sites, at least one of which is present on each molecule or
segment.
Such recombination reactions to join multiple nucleic acid molecules according
to the invention may be conducted in vivo (e.g., within a cell, tissue, organ
or
organism) or in vitro (e.g., cell-free systems). Accordingly, the invention
relates
to methods for creating novel or unique combinations of nucleic acid molecules
and to the nucleic acid molecules created by such methods. The invention also
relates to host and host cells comprising the nucleic acid molecules of the
invention. The invention also relates to kits for carrying out the methods of
the
invention, and to compositions for carrying out the methods of the invention
as
well as compositions made while carrying out the methods of the invention.
The nucleic acid molecules created by the methods of the invention may
be used for any purpose known to those skilled in the art. For example, the
nucleic acid molecules of the invention may be used to express proteins or
peptides encoded by the nucleic acid molecules and may be used to create novel
fusion proteins by expressing different sequences linked by the methods of the
invention. Such expression can be accomplished in a cell or by using well
known
in vitro expression/transcription systems. In one aspect, at least one (and
preferably two or more) of the nucleic acid molecules or segments to be joined
by the methods of the invention comprise at least two recombination sites,
although each molecule may comprise multiple recombination sites (e.g., two,
three, four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.).
Such
recombination sites (which may be the same or different) may be located at
various positions in each nucleic acid molecule or segment and the nucleic
acid
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-13-
used in the invention may have various sizes and be in different forms
including
circular, supercoiled, linear, and the like. The nucleic acid molecules used
in the
invention may also comprise one or more vectors or one or more sequences
allowing the molecule to function as a vector in a host cell (such as an
origin of
replication). The nucleic acid molecules of the invention may also comprise
non-coding segments (e.g., intronic, untranslated, or other segments) that
serve
a structural or other non-expressive functions.
In a preferred aspect, the nucleic acid molecules or segments for use in the
invention are linear molecules having at.least one recombination site at or
near
at least one termini of the molecule and preferably comprise at least one
recombination site at or near both termini of the molecule. In another
preferred
aspect, when multiple recombination sites are located on a nucleic acid
molecule
of interest, such sites do not substantially recombine or do not recombine
with
each other on that molecule. In this embodiment, the corresponding binding
partner recombination sites preferably are located on one or more other
nucleic
acid molecules to be linked or joined by the methods of the invention. For
instance, a first nucleic acid molecule used in the invention may comprise at
least
a first and second recombination site and a second nucleic acid molecule may
comprise at least a third and fourth recombination site, wherein the first and
second sites do not recombine with each other and the third and fourth sites
do
not recombine with each other, although the first and third and/or the second
and
fourth sites may recombine.
The nucleic acid molecules to be joined by the methods of the invention
(i.e., the "starting molecules") are used to produce one or more (e.g., two,
three,
four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, seventy-five,
one
hundred, two hundred, etc.) hybrid molecules (e.g., the "product nucleic acid
molecules") containing all or a portion of the starting molecules. The
starting
molecules can be any nucleic acid molecule derived from any source or produced
by any method. Such molecules may be derived from natural sources (such as
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-14-
cells (e.g., prokaryotic cells such as bacterial cells, eukaryotic cells such
as fungal
cells (e.g., yeast cells), plant cells, animals cells (e.g., mammalian cells
such as
human cells), etc.), viruses, tissues, organs from any animal or non-animal
source,
and organisms) or may be non-natural (e.g., derivative nucleic acids) or
synthetically derived. Such molecules may also include prokaryotic and
eukaryotic vectors, plasmids, integration sequences (e.g., transposons), phage
or
viral vectors, phagemids, cosmids, and the like. The segments or molecules for
use in the invention may be produced by any means known to those skilled in
the
art including, but not limited to, amplification such as by PCR, isolation
from
natural sources, chemical synthesis, shearing or restriction digest of larger
nucleic
acid molecules (such as genomic or cDNA), transcription, reverse transcription
and the like, and recombination sites may be added to such molecules by any
means known to those skilled in the art including ligation of adapters
containing
recombination sites, attachment with topoisomerases of adapters containing
recombination sites, attachment with topoisomerases of adapter primers
containing recombination sites, amplification or nucleic acid synthesis using
primers containing recombination sites, insertion or integration of nucleic
acid
molecules (e.g., transponsons or integration sequences) containing
recombination
sites etc. In a preferred aspect, the nucleic acid molecules used in the
invention
are populations of molecules such as nucleic acid libraries or cDNA libraries.
Recombination sites for use in the invention may be any recognition
sequence on a nucleic acid molecule which participates in a recombination
reaction mediated or catalyzed by one or more recombination proteins. In those
embodiments of the present invention utilizing more than one (e.g., two,
three,
four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.)
recombination
sites, such recombination sites may be the same or different and may recombine
with each other or may not recombine or not substantially recombine with each
other. Recombination sites contemplated by the invention also include mutants,
derivatives or variants of wild-type or naturally occurring recombination
sites.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-15-
Preferred recombination site modifications include those that enhance
recombination, such enhancements being selected from the group consisting of
substantially (i) favoring integrative recombination; (ii) favoring excisive
recombination; (iii) relieving the requirement for host factors; (iv)
increasing the
efficiency of co-integrate or product formation; and (v) increasing the
specificity
of co-integrate or product formation.
Preferred modifications to the recombination sites include those that
enhance recombination specificity, remove one or more stop codons, and/or
avoid
hair-pin formation. Desired modifications can also be made to the
recombination
sites to include desired amino acid changes to the transcription or
translation
product (e.g., mRNA or protein) when translation or transcription occurs
across
the modified recombination site. Preferred recombination sites used in
accordance with the invention include att sites, frt sites, dif sites, psi
sites, cer
sites, and lox sites or mutants, derivatives and variants thereof (or
combinations
thereof). Recombination sites contemplated by the invention also include
portions of such recombination sites. Depending on the recombination site
specificity used, the invention allows directional linking of nucleic acid
molecules to provide desired orientations of the linked molecules or
non-directional linking to produce random orientations of the linked
molecules.
In specific embodiments, the recombination sites which recombine with
each other in compositions and used in methods of the invention comprise att
sites having identical seven base pair overlap regions. In specific
embodiments
of the invention, the first three nucleotides of these seven base pair overlap
regions comprise nucleotide sequences selected from the group consisting of
AAA, AAC, AAG, AAT, ACA, ACC, ACG, ACT, AGA, AGC, AGG, AGT,
ATA, ATC, ATG; ATT, CAA, CAC, CAG, CAT, CCA, CCC, CCG, CCT, CGA,
CGC, CGG, CGT, CTA, CTC, CTG CTT, GAA, GAC, GAG, GAT, GCA, GCC,
GCG, GCT, GGA, GGC, GGG, GGT, GTA, GTC, GTG, GTT, TAA, TAC,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-16-
TAG, TAT, TCA, TCC, TCG, TCT, TGA, TGC, TGG, TGT, TTA, TTC, TTG,
and TTT.
Each starting nucleic acid molecule may comprise, in addition to one or
more recombination sites (e.g., two, three, four, five, seven, ten, twelve,
fifteen,
twenty, thirty, fifty, etc.), a variety of sequences (or combinations thereof)
including, but not limited to sequences suitable for use as primer sites
(e.g.,
sequences which a primer such as a sequencing primer or amplification primer
may hybridize to initiate nucleic acid synthesis, amplification or
sequencing),
transcription or translation signals or regulatory sequences such as promoters
or
enhancers, ribosomal binding sites, Kozak sequences, start codons,
transcription
and/or translation termination signals such as stop codons (which may be
optimally suppressed by one or more suppressor tRNA molecules), origins of
replication, selectable markers, and genes or portions of genes which may be
used
to create protein fusion (e.g., N-terminal or carboxy terminal) such as
glutathione
S-transferase (GST), (3-glucuronidase (GUS), histidine tags (HIS6), green
fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent
protein (CFP), open reading frame (ORF) sequences, and any other sequence of
interest which may be desired or used in various molecular biology techniques
including sequences for use in homologous recombination (e.g., for use in gene
targeting).
In one aspect, the invention provides methods for producing populations
of hybrid nucleic acid molecules comprising (a) mixing at least a first
population
of nucleic acid molecules comprising one or more recombination sites with at
least one target nucleic acid molecule comprising one or more recombination
sites; and (b) causing some or all of the nucleic acid molecules of the at
least first
population to recombine with all or some of the target nucleic acid molecules,
thereby forming the populations of hybrid nucleic acid molecules. In certain
specific embodiments of the above methods, the recombination is caused by
mixing the first population of nucleic acid molecules and the target nucleic
acid
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-17-
molecule with one or more recombination proteins under conditions which favor
the recombination to produce hybrid nucleic acid molecules. In other specific
embodiments, methods of the invention further comprise mixing the hybrid
nucleic acid molecules with at least a second population of nucleic acid
molecules
comprising one or more recombination sites to produce a second population of
product nucleic acid molecules. Alternatively, the first population, second
population and target nucleic acid molecules may be mixed together to form a
hybrid population through recombination. In additional specific embodiments,
methods of the invention further comprise selecting for the populations of
hybrid
nucleic acid molecules generated by the methods described above. In yet
additional specific embodiments, methods of the invention further comprise
selecting for the population of hybrid nucleic acid molecules, against the
first
population of nucleic acid molecules, against the target nucleic acid
molecules,
and/or against the second population of nucleic acid molecules.
In related embodiments, the invention provides methods for recombining
a first nucleic acid segment containing a first recombination site, a second
nucleic
acid segment containing a second and third recombination site, and a third
nucleic
acid segment containing a fourth recombination site, wherein the first,
second, or
third nucleic acid segments may be identical nucleic acid segments or
populations
of nucleic acid molecules, such that recombination generates a linear or
closed,
circle product comprising the first, second and third nucleic acid segments.
Further, members of the recombination products may be amplified using
oligonucleotides which either contain or do not contain recombination sites
and
are homologous or degenerate to the first or third nucleic acid segments.
Thus,
for example, by performing amplification with primers specific for the first
and
third nucleic acid segments, a product comprising the first-second-third
hybrid
molecules can be amplified, where other undesired molecules (e.g., products
comprising the first-second hybrid molecules) are not amplified. In this way,
amplification can be used to select for desired products and against undesired
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-18-
products. Such amplification can be designed to select for any desired
products
or intermediates of a recombination reaction. For example, four different
molecules (e.g., A, B, C, and D) can be joined and various intermediate
products
can be selected for (e.g., A-B-C, or A-B) using primers designed to amplify
the
desired products (e.g., primers corresponding to molecules A and C, when A-B-C
is amplified and A and B when A-B is amplified). The resulting amplified
products may then be cloned. In related embodiments, the process described
above can be performed using two or more (e. g. , two, three, four, five, six,
seven,
eight, nine, ten, eleven, twelve, thirteen, fifteen, etc.) nucleic acid
segments.
In another aspect, the invention provides methods of producing
populations of hybrid nucleic acid molecules comprising (a) mixing at least a
first
population of nucleic acid molecules comprising one or more recombination
sites
with at least a second population of nucleic acid molecules comprising one or
more recombination sites; and (b) causing some or all of the nucleic acid
molecules of the at least first population to recombine with all or some
nucleic
acid molecules of the at least second population, thereby forming one or more
populations of hybrid nucleic acid molecules. In certain specific embodiments
of the above methods, recombination is caused by mixing the first population
of
nucleic acid molecules and the second population of nucleic acid molecules
with
one or more recombination proteins under conditions which favor their
recombination. In other specific embodiments, methods of the invention further
comprise mixing the first and second populations of nucleic acid molecules
with
at least a third population of nucleic acid molecules comprising one or more
recombination sites. In additional other specif c embodiments, methods of the
invention further comprise selecting for the population of hybrid nucleic acid
molecules. In yet other specific embodiments, methods of the invention further
comprise selecting for the population of hybrid nucleic acid molecules and
against the first, second, and/or third populations of nucleic acid molecules.
In
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-19-
further specific embodiments, methods of the invention further comprise
selecting for or against cointegrate molecules and/or byproduct molecules.
The invention further includes populations of hybrid nucleic acid
molecules produced by the above methods and populations of recombinant host
cells comprising the above populations of hybrid nucleic acid molecules.
In certain embodiments, the recombination proteins used in the practice
of the invention comprise one or more proteins selected from the group
consisting
of Cre, Int, IHF, Xis, Flp, Fis, Hin, Gin, Cin, Tn3 resolvase, TndX, XerC,
XerD,
and ~C31. In specific embodiments, the recombination sites comprise one or
more recombination sites selected from the group consisting of lox sites; psi
sites;
dif sites; cer sites; frt sites; att sites; and mutants, variants, and
derivatives of
these recombination sites which retain the ability to undergo recombination.
In a specific aspect, the invention allows controlled expression of fusion
proteins by suppression of one or more stop codons. According to the
invention,
one or more starting molecules (e.g., one, two, three, four, five, seven, ten,
twelve, etc.) joined by the invention may comprise one or more stop codons
which may be suppressed to allow expression from a first starting molecule
through the next joined starting molecule. For example, a first-second-third
starting molecule joined by the invention (when each of such first and second
molecules contains a stop codon) can express a tripartite fusion protein
encoded
by the joined molecules by suppressing each of the stop codons. Moreover, the
invention allows selective or controlled fusion protein expression by varying
the
suppression of selected stop codons. Thus, by suppressing the stop codon
between the first and second molecules but not between the second and third
molecules of the first-second-third molecule, a fusion protein encoded by the
first
and second molecule may be produced rather than the tripartite fusion. Thus,
use
of different stop codons and variable control of suppression allows production
of
various fusion proteins or portions thereof encoded by all or different
portions of
the joined starting nucleic acid molecules of interest. In one aspect, the
stop
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-20-
codons may be included anywhere within the starting nucleic acid molecule or
within a recombination site contained by the starting molecule. Preferably,
such
stop codons are located at or near the termini of the starting molecule of
interest,
although such stop codons may be included internally within the molecule. In
another aspect, one or more of the starting nucleic acid molecules may
comprise
the coding sequence of all or a portion of the target gene or open reading
frame
of interest wherein the coding sequence is followed by a stop codon. The stop
codon may then be followed by a recombination site allowing joining of a
second
starting molecule. In some embodiments of this type, the stop codon may be
optionally suppressed by a suppressor tRNA molecule. The genes coding for the
suppressor tRNA molecule may be provided on the same vector comprising the
target gene of interest, on a different vector, or in the chromosome of the
host cell
into which the vector comprising the coding sequence is inserted. In some
embodiments, more than one copy (e.g., two, three, four, five, seven, ten,
twelve,
fifteen, twenty, thirty, fifty, etc. copies) of the suppressor tRNA may be
provided.
In some embodiments, the transcription of the suppressor tRNA may be under the
control of a regulatable (e.g., inducible or repressible) promoter.
Thus, in one aspect, the invention relates to a method of expressing one
or more fusion proteins (e.g., one, two, three, four, five, seven, ten,
twelve,
fifteen, twenty, thirty, fifty, etc.) comprising:
(a) obtaining at least a first nucleic acid molecule comprising at least
one recombination site and at least one stop codon (preferably the
recombination
site and/or stop codon are located at or near a terminus or termini of said
first
nucleic acid molecule), and a second nucleic acid molecule comprising at least
one recombination site (which is preferably located at or near a terminus or
termini of said second nucleic acid molecule);
(b) causing said first and second nucleic acid molecules to recombine
through recombination of said recombination sites, thereby producing a third
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-21-
nucleic acid molecule comprising said at least one stop codon and all or a
portion
of said first and second molecules; and
(c) expressing one or more peptides or proteins (e.g., two, three, four,
five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) encoded by
said third
molecule while suppressing said at least one stop codon.
Further, recombination sites described herein (e.g., recombination sites
having various recombination specificities) may contain stop codons in one,
two
or all three forward or reverse reading frames. Such termination codons may be
suppressed as described above. Further, in appropriate instances, such
recombination sites may be designed so as to eliminate stop codons in one, two
and/or all three forward and/or reverse reading frames.
In another aspect, the invention provides methods of synthesizing proteins
comprising (a) providing at least a first nucleic acid molecule comprising a
coding sequence followed by a stop codon; (b) providing at least a second
nucleic
acid molecule comprising a coding sequence, optionally, followed by a stop
codon; (c) causing recombination such that the nucleic acid molecules are
joined;
(d) inserting said joined nucleic acid molecules into a vector to produce
modified
vectors with the two coding sequences connected in frame; (e) transforming
host
cells which express suppressor tRNAs with the modified vectors; and (f)
causing
expression of the two coding sequences such that fusion proteins encoded by at
least a portion of both of the coding sequences are produced, wherein the
nucleic
acid molecules of (a) and (b) are each flanked by at least one recombination
site.
Further, the fused nucleic acid molecules or the vector may comprise at least
one
suppressible stop codon (e.g., amber, opal and/or ochre codons). In addition,
either the first or second nucleic acid molecule may already be present in the
vector prior to application of the methods described above. In specific
embodiments of the invention, the vectors and/or host cells comprise genes
which
encode at least one suppressor tRNA molecule. In other specific embodiments,
methods of the invention further comprise transforming the host cell with a
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-22-
nucleic acid molecule comprising genes which encode at least one suppressor
tRNA molecule. In yet other specific embodiments, the fusion proteins may
comprise N- or C-terminal tags (e.g., glutathione S-transferase, (3-
glucuronidase,
green fluorescent protein, yellow fluorescent protein, red fluorescent
protein,
cyan fluorescent protein, maltose binding protein, a six histidine tag, an
epitope
tag, etc.) encoded by at least a portion of the vector.
The invention also relates to a method of expressing one or more fusion
proteins (e.g., one, two, three, four, five, seven, ten, twelve, fifteen,
twenty, thirty,
fifty, etc.) comprising:
(a) obtaining at least a first nucleic acid molecule comprising at least
one recombination site (preferably the recombination site is located at or
near a
terminus or termini of said first nucleic acid molecule) and a second nucleic
acid
molecule comprising at least one recombination site (which is preferably
located
at or near a terminus or termini of said second nucleic acid molecule);
(b) causing said at least first and second nucleic acid molecules to
recombine through recombination of said recombination sites, thereby producing
a third nucleic acid molecule comprising all or a portion of said at least
first and
second molecules; and
(c) expressing one or more peptides or proteins (e.g., one, two, three,
four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) encoded
by said
third nucleic acid molecule. In certain such embodiments, at least part of the
expressed fusion protein will be encoded by the third nucleic acid molecule
and
at least another part will be encoded by at least part of the first and/or
second
nucleic acid molecules. Such a fusion protein may be produced by translation
of
nucleic acid which corresponds to recombination sites located between the
first
and second nucleic acid molecules. Thus, fusion proteins may be expressed by
"reading through" mRNA corresponding to recombination sites used to connect
two or more nucleic acid segments. The invention further includes fusion
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-23-
proteins produced by methods of the invention and mRNA which encodes such
fusion proteins.
As discussed below in more detail, the methods discussed above can be
used to prepare fusion proteins which are encoded by different nucleic acid
segments, as well as nucleic acid molecules which encode such fusion proteins.
Thus, in one general aspect, the invention provides methods for producing
fusion
proteins prepared by the expression of nucleic acid molecules generated by
connecting two or more nucleic acid segments. In related embodiments, the
invention provides methods for producing fusion RNAs prepared by the
expression of nucleic acid molecules generated by connecting two or more
nucleic acid segments. These RNAs may be mRNA or may be untranslated
RNAs which have activities other than protein coding functions. Examples of
such RNAs include ribozymes and tRNAs. The invention further provides
nucleic acid molecules produced by methods of the invention, expression
products of these nucleic acid molecules, methods for producing these
expression
products, recombinant host cells which contain these nucleic acid molecules,
and
methods for making these host cells. As discussed below in more detail, the
invention further provides combinatorial libraries which may be screened to
identify nucleic acid molecules and expression products having particular
functions or activities.
In one specific aspect, the present invention provides materials and
methods for joining two nucleic acid molecules or portions thereof, each
ofwhich
contains at least one recombination site, into one or more product nucleic
acid
molecules by incubating the molecules under conditions causing the
recombination of a recombination site present on one nucleic acid molecule
with
a recombination site present on the other nucleic acid molecule. The
recombination sites are preferably located at or near the ends of the starting
nucleic acid molecules. Depending on the location of the recombination sites
within the starting molecules, the product molecule thus created will contain
all
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-24-
or a portion of the first and second starting molecules joined by a
recombination
site (which is preferably a new recombination site). For example,
recombination
between an attB 1 recombination site and an atcP 1 recombination site results
in
generation of an attLl and/or attRl recombination sites.
In another specific aspect, the present invention provides materials and
methods for joining two or more nucleic acid molecules (e.g., two, three,
four,
five seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) into one or
more product
nucleic acid molecules (e.g., one, two, three, four, five seven, ten, twelve,
etc.)
wherein each starting nucleic acid molecule has at least one recombination
site
and at least one of the starting nucleic acid molecules has at least two
recombination sites. The recombination sites preferably are located at or near
one
or both termini of the starting nucleic acid molecules. Thus, the invention
provides a method of joining at least two nucleic acid molecules wherein at
least
a first nucleic acid molecule contains at least one recombination site and at
least
a second nucleic acid molecule contains two or more recombination sites. The
molecules are incubated in the presence of at least one recombination protein
under conditions sufficient to combine all or a portion of the starting
molecules
to create one or more product molecules. The product molecules thus created
will
contain all or a portion of each of the starting molecules joined by a
recombination site (which is preferably a new recombination site).
In another specific aspect, the present invention provides a method to join
at least three nucleic acid molecules (e.g., two, three, four, five seven,
ten, twelve,
fifteen, twenty, thirty, fifty, etc.) wherein the molecules have at least one
recombination site and at least one of the starting nucleic acid molecules
contains
at least two recombination sites. Incubating such molecules in the presence of
at
least one recombination protein provides one or more product molecules (e.g.,
one, two, three, four, five seven, ten, twelve, fifteen, twenty, thirty,
fifty, etc.)
containing all or a portion of the starting molecules, wherein each molecule
is
joined by a recombination site (which is preferably a new recombination site).
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-25-
In another specific embodiment, the present invention provides
compositions and methods for joining two or more nucleic acid molecules (e.g.,
two, three, four, five seven, ten, twelve, fifteen, twenty, thirty, fifty,
etc.), at least
two of which (and preferably all of which) have two or more recombination
sites.
The recombination sites located on each molecule are preferably located at or
near the ends of the starting nucleic acid molecules. According to the method
of
the invention, the two or more nucleic acid molecules or portions thereof are
joined by a recombination reaction (e.g., incubate the molecules in the
presence
of at least one recombination protein) to form one or more product molecules
comprising all or a portion of each starting molecule joined by a
recombination
site (which is preferably a new recombination site).
In another specific aspect, the present invention provides compositions
and methods for joining at least three nucleic acid molecules comprising
providing at least a first, a second and a third nucleic acid molecule,
wherein the
first nucleic acid molecule comprises at least a first recombination site, the
second nucleic acid molecule comprises at least a second and a third
recombination site and the third nucleic acid molecule comprises at least a
fourth
recombination site, wherein the first recombination site is capable of
recombining
with the second recombination site and the third recombination site is capable
of
recombining with the fourth recombination site and conducting at least one
recombination reaction such that the first and the second recombination sites
recombine and the third and the fourth recombination sites recombine, thereby
combining all or a portion of the molecules to make one or more product
molecules.
Thus, the present invention generally relates to a method of combining n
nucleic acid molecules or segments, wherein n is an integer greater than 1
(e.g.,
2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, 20, 30, 40, 50, etc.), comprising the
steps of
providing a 1s' through an n'" nucleic acid molecule or segment, each molecule
from 2 through n-1 having at least two recombination sites and molecules 1 and
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-26-
n having at least one recombination site (and preferably having at least two
recombination sites), and contacting the molecules or segments with one or
more
recombination proteins (e.g., two, three, four, etc.) under conditions
sufficient to
cause all or a portion of the segments or molecules to recombine to form one
or
more product nucleic acid molecules comprising all or a portion of each 1"
through n'" molecule or segment. Joining of molecules through recombination
sites (e.g., interacting a first recombination site on first molecule with a
second
recombination site on a second molecule) preferably creates a new
recombination
site at the junction of the two molecules and may create a new recombination
site
at each junction where each molecule is joined to the next. For example, when
joining a number of molecules (e.g., a first or "x" molecule, a second or "y"
molecule, and a third or "z" molecule) when each molecule has at least two
recombination sites, the first recombination site on the x molecule interacts
with
a second recombination site on the y molecule and the second recombination
site
on the x molecule interacts with a first recombination site on the z molecule
to
create a hybrid nucleic acid molecule comprising y:x:z joined by recombination
sites. Of course, other recombination events may produce hybrid molecules
comprising, for example, x:y:z, x:z:y, y:z:x, z:x:y, and/or z:y:x or fragments
thereof, joined by recombination sites. Additional molecules can be added to
product molecules by recombination between at least one recombination site
located another molecules with one or more recombination sites located on the
product molecule (e.g., interacting a second recombination site on the z
molecule
with a first recombination site on an a molecule, etc. and/or interacting a
first
recombination site on the y molecule with a second recombination site on an f
molecule, etc.). Further, the hybrid nucleic acid molecule comprising y:x:z
(or
other sequences as noted above) can be circularized by the interaction of
recombination sites on the free ends of y and z. Addition of all or a portion
of the
starting molecules may be done sequentially or simultaneously.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-27-
In instances where nucleic acid segments joined by methods of the
invention contain a terminus, or termini, which do not contain recombination
sites, this terminus or termini may be connected to the same nucleic acid
segment
or another nucleic acid molecule using a ligase or a topoisomerase (e.g., a
Vaccinia virus topoisomerase; see U.S. Patent No. 5,766,891, the entire
disclosure of which is incorporated herein by reference).
In addition to joining multiple molecules, the invention also provides a
means to replace one or more molecules (or combinations thereof) contained in
a product molecule. For instance, any one or more n molecules comprising the
product molecule may be replaced or substituted by recombination with all or a
portion of a different molecule (m) which comprises one or more recombination
sites. Thus, in one example, m may replace x in the y:x:z molecule described
above by recombining a first recombination site on m with the first
recombination
site flanking x (e.g., the recombination site between y and x) and recombining
a
second recombination site on m with the second recombination site flanking x
(e.g., the recombination site between x and z), to produce y:m:z. Multiple
substitutions or replacements may be made within or on any nucleic acid
molecule of the invention by recombining one or more recombination sites on
such molecule with one or more recombination sites within or on the molecule
to be substituted. Moreover, one or more deletions (e.g., two, three, four,
five
seven, ten, twelve, etc.) of various sizes on the product molecules of the
invention
may be accomplished by recombining two or more recombination sites within the
molecule of interest for creating the deletion. For example, to create a
deletion
within the y:x:z (or other arrangement thereof) molecule described above,
recombination of the recombination sites flanking the x molecule will create a
new molecule from which x is deleted; that is, the new molecule will comprise
y:z. Thus, multiple deletions, multiple replacements and combinations of
deletions and replacements of various portions of a molecule of interest may
be
accomplished by directed recombination within the molecule of interest.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-28-
Further, the invention also provides a means to insert one or more
molecules (or combinations thereof) into a product molecule. For instance,
using
the molecule y:x:z described above for illustration, molecule w, which
comprises
one or more recombination sites may be inserted between y and x to form a new
molecule: y:w:x:z. In one specific embodiment, molecule w is flanked by loxP
sites and insertion of molecule w is mediated by Cre recombinase between the
loxP sites on the w molecule and corresponding loxP sites on the y and x
molecules. As one skilled in the art would recognize, numerous variations of
the
above are possible and are included within the scope of the invention. For
example, molecule o, which comprises one or more recombination sites may be
inserted between y and x to form a new molecule comprising either y:o:x:z or
y:o:w:x:z, depending on the starting molecule. The methods described herein
can
be used to insert virtually any number of molecules into other molecules.
Further, these methods can be used sequentially, for example, to prepare
1 S molecules having diverse structures.
The product molecules produced by the methods of the invention may
comprise any combination of starting molecules (or portions thereof) and can
be
any size and be in any form (e.g., circular, linear, supercoiled, etc.),
depending
on the starting nucleic acid molecule or segment, the location of the
recombination sites on the molecule, and the order of recombination of the
sites.
Importantly, the present invention provides a means by which populations
of nucleic acid molecules (known or unknown) can be combined with one or
more known or unknown target sequences of interest (e.g., two, three, four,
five
seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) or with other
populations of
nucleic acid molecules (known or unknown), thereby creating populations of
combinatorial molecules (e.g., combinatorial libraries) from which unique
and/or
novel molecules (e.g., hybrid molecules) and proteins or peptides encoded by
these molecules may be obtained and further analyzed.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-29-
In a preferred aspect, the population of nucleic acid molecules used to
create combinatorial libraries according to the invention may comprise a
population of segments or molecules having at least one (and preferably two or
more) recombination sites (e.g., two, three, four, five seven, ten, twelve,
etc.).
Such populations of molecules are preferably obtained from genomic or cDNA
libraries (or portions thereof) or random nucleic acids, amplification
products
(e.g., PCR products generated with various primers) and domains (e.g., nucleic
acids encoding different protein domains from the same or different proteins)
constructed to contain such recombination sites. Thus, in accordance with the
invention, a first population of molecules comprising recombination sites can
be
randomly joined or combined through recombination (by directed and/or random
orientation) with at least one target sequence of interest or with a second
population of molecules comprising recombination sites to produce a third
population of molecules or hybrid molecules.
In accordance with the invention, multiple populations of molecules from
various sources may be combined multiple times to create a new population
which comprises molecules having multiple combinations of sequences. For
instance, a first population, a second population and a third population can
be
recombined to create a fourth population comprising a random population of
tripartite molecules (e.g., some or all of the molecules of the fourth
population
contain all or a portion of the segments from the first, second and third
population).
In a preferred aspect, the newly created population of molecules (e.g., the
third population) created by the combinatorial methods may be preferentially
selected and thus separated or isolated from the original molecules (e.g.,
target
molecules, and first and second population molecules) and from undesired
product molecules (e.g., cointegrates and/or byproduct molecules). Such
selection may be accomplished by assaying or selecting for the presence of a
desired nucleic acid fusion (PCR with diagnostic primers) and/or the presence
of
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-30-
a desired activity of a protein encoded by the desired nucleic acid fusion.
Such
selective may also be accomplished by positive and/or negative selection. One
or more toxic genes (e.g., two, three, four, five seven, ten, etc.) are
preferably
used according to the invention in such negative selection scheme.
Combinations of selection of the desired fusion product (nucleic acid
and/or protein) and positive and/or negative selection may also be used in the
invention. Thus, the invention provides a means for selecting a population of
Product molecules (or even a specific class of product molecules or specific
product molecule) created by recombinational cloning and selecting against a
population of Insert Donors, Vector Donors and Cointegrates or, in similar
fashion, selecting for a population of Insert Donors, Vector Donors,
Byproducts
and/or Cointegrates and selecting against a population of Product molecules
(.see
Figure 1 ).
Referring to Figure 2, in the recombinatorial library methods of the
invention, a first population of molecules of the invention, represented by
segment A, may be provided as one population of Insert Donor molecules while
a second population of molecules, represented by segment B, may be provided
as a second population of Insert Donor molecules. While these segments are
depicted as linear fragments, they may be provided as segments within a larger
molecule, for example, as segments in a plasmid.
Those skilled in the art will appreciated that in this situation, cointegrate
molecules, other than the one shown in Figure 1, may be produced. For example,
cointegrates comprising a segment A and a segment B Insert Donor molecule
may be formed. In addition, cointegrates comprising segment A and/or segment
B Insert Donor molecules and a Vector Donor molecule may be formed. The
selection methods of the present invention permit selection against the Insert
Donor molecules and against the various cointegrate molecules and for the
newly
created population of hybrid molecules which may be referred to as a
population
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-31-
of Product molecules. Conversely, the selection methods may permit selection
against Products and for Insert/Vector Donors, Byproducts, and/or
Cointegrates.
Thus, the invention relates to a method to create a population of hybrid
nucleic acid molecules comprising:
(a) mixing at least a first population of nucleic acid molecules
comprising one or more recombination sites (e.g., two, three, four, five
seven, ten,
twelve, etc.) with at least one target nucleic acid molecule of interest
comprising
one or more recombination sites (e.g., two, three, four, five seven, ten,
twelve,
etc.);
(b) causing (preferably randomly) some or all of the molecules of said
at least first population to recombine with all or some molecules of said
target
molecule of interest, thereby forming a third population of hybrid molecules;
and
(c) optionally selecting specifically for said third population of hybrid
molecules.
In accordance with the invention, the hybrid molecules contained by the
third population preferably comprise all or a portion of a molecule obtained
from
the first population and all or a portion of the target molecule. The
orientation in
which the molecules are joined may be done in a directed or random manner,
depending on the need.
In one aspect, the target molecule used to produce said third population
described above can be a DNA binding domain or a transcription activation
domain, such that the third population of hybrid molecules can be used in
2-hybrid screening methods well known in the art.
The invention more specifically relates to a method of creating a
population of combinatorial molecules comprising:
(a) obtaining at least a first population of nucleic acid molecules
comprising one or more recombination sites (e.g., two, three, four, five
seven, ten,
twelve, etc.) and at least a second population of nucleic acid molecules
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-32-
comprising one or more recombination sites (e. g. , two, three, four, five
seven, ten,
twelve, etc.);
(b) causing (preferably randomly) some or all of the molecules of at
least said first population to recombine with some or all of the molecules of
at
least said second population, thereby creating a third population of hybrid
molecules; and
(c) optionally selecting specifically for said third population of hybrid
molecules.
In accordance with the invention, each or many of the hybrid molecules
contained by the third population preferably comprises all or a portion of a
molecule obtained from the first population and all or a portion of a molecule
obtained from the second population. The orientation which the molecules are
joined may be done in a directed or random manner, depending on the need.
Populations of nucleic acid molecules used in accordance with the
combinatorial methods of the invention can comprise synthetic, genomic, or
cDNA libraries (or portions thereof), random synthetic sequences or degenerate
oligonucleotides, domains and the like. Preferably, the population ofnucleic
acid
molecules used comprises a random population of molecules, each having at
least
two recombination sites which preferably do not recombine with each other and
which are preferably located at or near both termini of each molecule. Random
recombination of populations of molecules by the methods of the invention
provides a powerful technique for generating populations of molecules having
significant sequence diversity. For example, recombination of a first library
having about 1 O6 sequences with a second population having about 1 O6
sequences
results in a third population having about 10'2 sequences.
The invention further provides methods for preparing and screening
combinatorial libraries in which segments of the nucleic acid molecules of the
library members have been altered. Such alterations include mutation,
shuffling,
insertion, and/or deletion of nucleic acid segments. In particular, the
invention
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-33-
provides methods for preparing nucleic acid libraries which contain members
having such alterations and methods for introducing such alterations in
existing
libraries. In a related aspect, the invention includes combinatorial libraries
produced by methods of the invention, methods for screening such libraries to
identify members which encode expression products having particular functions
or activities, and expression products of these libraries (e.g. , RNA,
proteins, etc.).
Further, in aspects related to those described above, the invention
provides methods for generating populations of nucleic acid molecule
containing
one or more (e.g., one, two, three, four, five, ten, fifteen) nucleic acid
segments
which are the same and one or more nucleic acid segments which are derived
from members of one or more populations of nucleic acid molecules. One
method for producing such nucleic acid molecules involves the use of a vector
which contains two recombination sites. A first nucleic acid segment, which
encodes a protein having a particular function or activity (e.g., signal
peptide
activity, DNA binding activity, affinity for a particular ligand, etc.), is
inserted
in the first recombination site and a second nucleic acid segment, which is
derived from a population of nucleic acid molecules, is inserted into the
second
recombination site. Further, these nucleic acid segments are operably linked
to
a sequence which regulates transcription, thereby producing a fusion peptide
and
an RNA molecule produced by the fusion sequence. The resulting combinatorial
library may then be screened to identify nucleic acid molecules which encode
expression products having particular functions or activities (e.g.,
transcriptional
activation activity; DNA binding activity; the ability to form multimers;
localization to a sub-cellular compartments, such as the endoplasmic
reticulum,
the nucleus, mitochondria, chloroplasts, the cell membrane, etc.; etc.). When
three or more (e.g., three, four, five, six, eight, ten, etc.) nucleic acid
segments are
used in methods such as those described above, one or more of the nucleic acid
segments may be kept constant and one or more of the nucleic acid segments may
be derived from members of one or more populations of nucleic acid molecules.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-34-
For example, in constructing a four part molecule, represented by A-B-C-D, A
and D may be known molecules having known functions (e.g., tags such as HIS6,
promoters, transcription or translation signals, selectable markers, etc.)
while
molecules B and C may be derived from one or more populations of nucleic acid
molecules.
Any of the product molecules of the invention may be further
manipulated, analyzed or used in any number of standard molecular biology
techniques or combinations of such techniques (in vitro or in vivo). These
techniques include sequencing, amplification, nucleic acid synthesis, making
RNA transcripts (e.g., through transcription of product molecules using RNA
promoters such as T7 or SP6 promoters), protein or peptide expression (for
example, fusion protein expression, antibody expression, hormone expression
etc.), protein-protein interactions (2-hybrid or reverse 2-hybrid analysis),
homologous recombination or gene targeting, and combinatorial library analysis
1 S and manipulation. The invention also relates to cloning the nucleic acid
molecules of the invention (preferably by recombination) into one or more
vectors (e.g., two, three, four, five seven, ten, twelve, fifteen, twenty,
thirty, fifty,
etc.) or converting the nucleic acid molecules of the invention into a vector
by the
addition of certain functional vector sequences (e.g., origins of
replication). In
a preferred aspect, recombination is accomplished in vitro (e.g., in cell-free
systems) and further manipulation or analysis is performed directly in vitro.
Thus, further analysis and manipulation will not be constrained by the ability
to
introduce the molecules of the invention into a host cell and/or maintained in
a
host cell. Thus, less time and higher throughput may be accomplished by
further
manipulating or analyzing the molecules of the invention directly . in vitro.
Alternatively, in vitro analysis or manipulation can be done after passage
through
host cells or can be done directly in vivo (e.g., while in the host cells,
tissues,
organs, or organisms).
Nucleic acid synthesis steps, according to the invention, may comprise:
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-35-
(a) mixing a nucleic acid molecule of interest or template with one or
more primers (e.g., one, two, three, four, five seven, ten, twelve, fifteen,
twenty,
thirty, fifty, etc.) and one or more nucleotides (e.g., one, two, three, or
four) to
form a mixture; and
(b) incubating said mixture under conditions sufficient to synthesize
a nucleic acid molecule complementary to all or a portion of said molecule or
template.
The synthesized molecule may then be used as a template for further
synthesis of a nucleic acid molecule complementary to all or a portion of the
first
synthesized molecule. Accordingly, a double stranded nucleic acid molecule
(e.g., DNA) may be prepared. Preferably, such second synthesis step is
preformed in the presence of one or more primers and one or more nucleotides
under conditions sufficient to synthesize the second nucleic acid molecule
complementary to all or a portion of the first nucleic acid molecule.
Typically,
synthesis of one or more nucleic acid molecules (e.g., one, two, three, four,
five
seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) is performed in the
presence
of one or more polymerases (preferably DNA polymerases which may be
thermostable or mesophilic), although reverse transcriptases may also be used
in
such synthesis reactions. Accordingly, the nucleic acid molecules used as
templates for the synthesis of additional nucleic acid molecules may be RNA,
mRNA, DNA or non-natural or derivative nucleic acid molecules. Nucleic acid
synthesis, according to the invention, may be facilitated by incorporating one
or
more primer sites (e.g., two, three, four, five, seven, ten, twelve, fifteen,
twenty,
thirty, fifty, etc.) into the product molecules through the use of starting
nucleic
acid molecules containing such primer sites. Thus, by the methods of the
invention, primer sites may be added at one or a number of desired locations
in
the product molecules, depending on the location of the primer site within the
starting molecule and the order of addition of the starting molecule in the
product
molecule.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-36-
Sequencing steps, according to the invention, may comprise:
(a) mixing a nucleic acid molecule to be sequenced with one or more
primers (e.g., one, two, three, four, five seven, ten, twelve, fifteen,
twenty, thirty,
fifty, etc.), one or more nucleotides (e.g., one, two, three, or four) and one
or
more termination agents (e.g., one, two, three, four, or five) to form a
mixture;
(b) incubating said mixture under conditions sufficient to synthesize
a population of molecules complementary to all or a portion of said molecules
to
be sequenced; and
(c) separating said population to determine the nucleotide sequence
of all or a portion of said molecule to be sequenced.
Such sequencing steps are preferably performed in the presence of one or
more polymerases (e.g. , DNA polymerases and/or reverse transcriptases) and
one
or more primers. Preferred terminating agents for sequencing include
derivative
nucleotides such as dideoxynucleotides (ddATP, ddTTP, ddGTP, ddCTP and
derivatives thereof). Nucleic acid sequencing, according to the invention, may
be facilitated by incorporating one or more sequencing primer sites (e.g.,
one,
two, three, four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty,
etc.) into the
product molecules through the use of starting nucleic acid molecules
containing
such primer sites. Thus, by the methods of the invention, sequencing primer
sites
may be added at one or a number of desired locations in the product molecules,
depending on the location of the primer site within the starting molecule and
the
order of addition of the starting molecule in the product molecule.
Protein expression steps, according to the invention, may comprise:
(a) obtaining a nucleic acid molecule to be expressed which comprises
one or more expression signals (e.g., one, two, three, or four); and
(b) expressing all or a portion of the nucleic acid molecule under
control of said expression signal thereby producing a peptide or protein
encoded
by said molecule or portion thereof.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-3 7-
In this context, the expression signal may be said to be operably linked to
the sequence to be expressed. The protein or peptide expressed can be
expressed
in a host cell (in vivo), although expression may be conducted in vitro (e.g.,
in
cell-free expression systems) using techniques well known in the art. Upon
expression of the protein or peptide, the protein or peptide product may
optionally
be isolated or purified. Moreover, the expressed protein or peptide may be
used
in various protein analysis techniques including 2-hybrid interaction, protein
functional analysis, and agonist/antagonist-protein interactions (e.g.,
stimulation
or inhibition of protein function through drugs, compounds or other peptides).
Further, expressed proteins or peptides may be screened to identify those
which
have particular biological activities. Examples of such activities include
binding
affinity for nucleic acid molecules (e.g., DNA or RNA) or proteins or
peptides.
In particular, expressed proteins or peptides may be screened to identify
those
with binding affinity for other proteins or themselves. Proteins or peptides
which
have binding affinities for themselves will generally be capable of forming
multimers or aggregates. Proteins or peptides which have binding affinities
for
themselves and/or other proteins will often be capable of forming or
participating
in the formation of mufti-protein complexes such as antibodies, splicesomes,
mufti-subunit enzymes, mufti-subunit enzymes, ribosomes, etc. Further included
within the scope of the invention are the expressed proteins or peptides
described
above, nucleic acid molecules which encodes these proteins, methods for making
these nucleic acid molecules, methods for producing recombinant host cells
which contain these nucleic acid molecules, recombinant host cells produced by
these methods, and methods for producing the expressed proteins or peptides.
The novel and unique hybrid proteins or peptides (e.g., fusion proteins)
produced by the invention and particularly from expression of the
combinatorial
molecules of the invention may generally be useful for any number of
applications. More specifically, as one skilled in the art would recognize,
hybrid
proteins or peptides of the invention may be designed and selected to identify
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-3 8-
those which to perform virtually any function. Examples of applications for
which these proteins may be used include therapeutics, industrial
manufacturing
(e.g., microbial synthesis of amino acids or carbohydrates), small molecule
identification and purification (e.g., by affinity chromatography), etc.
S Protein expression, according to the invention, may be facilitated by
incorporating one or more transcription or translation signals (e.g., one,
two,
three, four, five, seven, ten, twelve, fifteen, etc.) or regulatory sequences,
start
codons, termination signals, splice donor/acceptor sequences (e.g., intronic
sequences) and the like into the product molecules through the use of starting
nucleic acid molecules containing such sequences. Thus, by the methods of the
invention, expression sequences may be added at one or a number of desired
locations in the product molecules, depending on the location of such
sequences
within the starting molecule and the order of addition of the starting
molecule in
the product molecule.
In another aspect, the invention provides methods for performing
homologous recombination between nucleic acid molecules comprising (a)
mixing at least a first nucleic acid molecule which comprises one or more
recombination sites with at least one target nucleic acid molecule, wherein
the
first and target nucleic acid molecules have one or more homologous sequences;
and (b) causing the first and target nucleic acid molecules to recombine by
homologous recombination. In specific embodiments of the invention, the
homologous recombination methods of the invention result in transfer of all or
a portion of the first nucleic acid molecule into the target nucleic acid
molecule.
In certain specific embodiments of the invention, the first nucleic acid
molecule
comprises two or more sequences which are homologous to sequences of the
target nucleic acid molecule. In other specific embodiments, the homologous
sequences of the first nucleic acid molecule flank at least one selectable
marker
and/or one or more recombination sites. In yet other specific embodiments, the
homologous sequences of the first nucleic acid molecule flank at least one
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-39-
selectable marker flanked by recombination sites. In additional specific
embodiments, the homologous sequences of the first nucleic acid molecule flank
a nucleic acid segment which regulates transcription.
Further, homologous recombination, according to the invention, may
comprise:
(a) mixing at least a first nucleic acid molecule of the invention
(which is preferably a product molecule) comprising one or more recombination
sites (e.g., one, two, three, four, five, seven, ten, twelve, fifteen, twenty,
thirty,
fifty, etc.) with at least one target nucleic acid molecule (e.g., one, two,
three,
four, five, seven, ten, twelve, etc.), wherein said first and target molecules
have
one or more homologous sequences (e.g., one, two, three, four, five, seven,
etc.);
and
(b) causing said first and target nucleic acid molecules to recombine
by homologous recombination.
Such homologous recombination may occur in vitro (e.g., in cell-free
systems), but preferably is accomplished in vivo (e.g., in a host cell).
Preferably,
homologous recombination causes transfer of all or a portion of a nucleic acid
molecule of the invention containing recombination sites (the first nucleic
acid
molecule) into one or more positions of the target nucleic acid molecule
containing homologous sequences (e.g., one, two, three, four, five, seven,
etc.).
Selection of such homologous recombination may be facilitated by positive or
negative selection (e.g., using selectable markers) to select for a desired
product
and/or against an undesired product. In a preferred aspect, the nucleic acid
molecule of the invention comprises at least one selectable marker and at
least
two sequences which are homologous to the target molecule. Preferably, the
first
molecule comprises at least two homologous sequences flanking at least one
selectable marker.
The present invention thus facilitates construction of gene targeting
nucleic acid molecules or vectors which may be used to knock-out or mutate a
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-40-
sequence or gene of interest (or alter existing sequences, for example to
convert
a mutant sequence to a wild-type sequence), particularly genes or sequences
within a host or host cells such as animals (including animals, such as
humans),
plants" insects, bacteria, yeast, and the like or sequences of adventitious
agents
such as viruses within such host or host cells. Such gene targeting may
preferably comprise targeting a sequence on the genome of such host cells.
Such
gene targeting may be conducted in vitro (e.g., in a cell-free system) or in
vivo
(e.g., in a host cell). Thus, in a preferred aspect, the invention relates to
a method
of targeting or mutating a nucleotide sequence or a gene comprising:
(a) obtaining at least one nucleic acid molecule of the invention
comprising one or more recombination sites (and preferably one or more
selectable markers) wherein said molecule comprises one or more nucleotide
sequences homologous to the target gene or nucleotide sequence of interest
(said
one or more homologous sequences preferably flank one or more selectable
markers e.g., one, two, three, four, five, seven, ten, etc.) on the molecule
of the
invention); and
(b) contacting said molecule with one or more target genes or
nucleotide sequences of interest (e.g., one, two, three, four, five, seven,
ten,
twelve, fifteen, twenty, thirty, fifty, etc.) under conditions sufficient to
cause
homologous recombination at one or more sites e.g., one, two, three, four,
five,
seven, ten, etc.) between said target nucleotide sequence or gene of interest
and
said molecule of the invention, thereby causing insertion of all or a portion
of the
molecule of the invention within the target nucleotide sequence or gene.
Such targeting method may cause deletion, activation, inactivation, partial
inactivation, or partial activation of the target nucleic acid or gene such
that an
expression product (typically a protein or peptide) normally expressed by the
target nucleic acid or gene is not produced or produced at a higher or lower
level
or to the extent produced is has an altered protein sequence which may result
in
more or less activity or in an inactive or partially inactive expression
product.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-41-
The selectable marker preferably present on the molecule of the invention
facilitates selection of candidates (for example host cells) in which the
homologous recombination event was successful. Thus, the present invention
provides a method to produce host cells, tissues, organs, and animals (e.g.,
transgenic animals) containing the modified nucleic acid or gene produced by
the
targeting methods of the invention. The modified nucleic acid or gene
preferably
comprises at least one recombination site and/or at least one selectable
marker
provided by the nucleic acid molecule of the invention.
Thus, the present invention more specifically relates to a method of
targeting or mutating a nucleic acid or a gene comprising:
(a) obtaining at least one nucleic acid molecule of the invention
comprising one or more recombination sites (e.g., one, two, three, four, five,
seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) and at least one
selectable
marker (e.g., one, two, three, four, five, seven, ten, etc.) flanked by one or
more
sequences homologous to the target nucleic acid or gene of interest (e.g.,
one,
two, three, four, five, seven, ten, etc.);
(b) contacting said molecule with one or more target nucleic acids or
genes of interest (e.g., one, two, three, four, five, seven, ten, twelve,
fifteen,
twenty, thirty, fifty, etc.) under conditions sufficient to cause homologous
recombination at one or more sites between the target nucleic acid or gene of
interest and the nucleic acid molecule, thereby causing insertion of all or a
portion
of the nucleic acid molecule of the invention (and preferably causing
insertion of
at least one selectable marker and/or at least one recombination site) within
the
target nucleic acid or gene of interest; and
(c) optionally selecting for the target nucleic acid or gene of interest
comprising all or a portion of the nucleic acid molecule of the invention or
for a
host cell containing the target nucleic acid or gene containing all or a
portion of
the nucleic acid molecule of the invention.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-42-
Preferably, selectable markers used in the methods described above are
positive selection markers (e.g., antibiotic resistance markers such as
ampicillin,
tetracycline, kanamycin, neomycin. and G-418 resistance markers).
In one general aspect, the invention provides methods for targeting or
S mutating a target gene or nucleotide sequence comprising, (a) obtaining at
least
one first nucleic acid molecule comprising one or more recombination sites and
one or more selectable markers, wherein the first nucleic acid molecule
comprises
one or more nucleotide sequences homologous to the target gene or nucleotide
sequence; and (b) contacting the first nucleic acid molecule with one or more
target genes or nucleotide sequences under conditions sufficient to cause
homologous recombination at one or more sites between the target gene or
nucleotide sequence and the first nucleic acid molecule, thereby causing
insertion
of all or a portion of the first nucleic acid molecule within the target gene
or
nucleotide sequence. In certain specific embodiments of the invention, the
first
nucleic acid molecule comprises at least one selectable marker flanked by the
homologous sequences. In other specific embodiments, the selectable marker is
flanked by the homologous sequences. In additional specific embodiments, the
target gene or nucleotide sequence is inactivated as a result of the
homologous
recombination. In yet additional specific embodiments, methods ofthe invention
further comprise selecting for a host cell containing the target gene or
nucleotide
sequence.
In some specific embodiments, one or more of the one or more nucleotide
sequences of the first nucleic acid molecule which are homologous to the
target
gene or nucleotide sequence will not be 100% identical to the target gene or
nucleotide sequence. In other words, the nucleic acid segments which
facilitate
homologous recombination need not necessarily share 100% sequence identity.
However, in general, these nucleic acid segments will share at least 70%
identity
(e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least
95%, at least 97%, at least 98%, or at least 99%) in their regions of
homology.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-43-
The use of nucleic acid segments to facilitate homologous recombination
which do not share 100% sequence identity to the nucleic acid with which they
are to recombine (i.e., the target gene or nucleotide sequence) can be
advantageous under a number of instances. One example of such an instance is
where the homologous nucleic acids correspond to part of a target nucleotide
sequence which is a gene and homologous recombination results in the
introduction one or more sequence alterations in the target nucleotide
sequence.
In a related example, the homologous nucleic acids may correspond to a target
nucleotide sequence which represents an entire gene. Thus, homologous
recombination results in replacement of the target gene. Another example of
such
an instance is where one seeks to perform homologous recombination on an
organism which has different nucleotide sequences at the site where homologous
recombination is to occur as compared to the one or more homologous nucleotide
sequences of the first nucleic acid molecule. The differences in these
sequences
may result, for example, when an organism in which homologous recombination
is intended to occur is of a different strain or species than the organism
from
which the homologous nucleotide sequences of the first nucleic acid molecule
are
obtained or where the organism has a different genotype at the recombination
locus.
Further, the length of the homologous regions which facilitate
recombination can vary in size, but, will generally be at least 15 nucleotides
in
length (e.g., at least 20 nucleotides, at least SO nucleotides, at least 100
nucleotides, at least 200 nucleotides, at least 400 nucleotides, at least 600
nucleotides, at least 800 nucleotides, at least 1000 nucleotides, at least
1500
nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least
3000
nucleotides, at least 3500 nucleotides, at least 4000 nucleotides at least
4500
nucleotides, at least 5000 nucleotides, at least 5500 nucleotides, at least
6000
nucleotides, at least 6000 nucleotides, etc.).
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-44-
The invention further provides recombinant host cells produced by the
methods described herein, which may be prokaryotic (e.g., bacteria), or
eukaryotic (e.g., fungal (e.g., yeasts), plant, or animal (e.g., insect,
mammalian
including human, etc.) hosts).
In another aspect of the invention, recombination sites introduced into
targeted nucleic acids or genes according to the invention may be used to
excise,
replace, or remove all or a portion of the nucleic acid molecule inserted into
the
target nucleic acid or gene of interest. Thus, the invention allows for in
vitro or
in vivo removal of such nucleic acid molecules and thus may allow for
reactivation of the target nucleic acid or gene. In some embodiments, after
identification and isolation of a nucleic acid or gene containing the
alterations
introduced as above, a selectable marker present on the molecule of the
present
invention may be removed.
The present invention also provides methods for cloning the starting or
product nucleic acid molecules of the invention into one or more vectors or
converting the product molecules of the invention into one or more vectors. In
one aspect, the starting molecules are recombined to make one or more product
molecules and such product molecules are cloned (preferably by recombination)
into one or more vectors. In another aspect, the starting molecules are cloned
directly into one or more vectors such that a number of starting molecules are
joined within the vector, thus creating a vector containing the product
molecules
of the invention. In another aspect, the starting molecules are cloned
directly into
one or more vectors such that the starting molecules are not joined within the
vector (i.e., the starting molecules are separated by vector sequences). In
yet
another aspect, a combination of product molecules and starting molecules may
be cloned in any order into one or more vectors, thus creating a vector
comprising
a new product molecule resulting from a combination of the original starting
and
product molecules.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-45-
Thus, the invention relates to a method of cloning comprising:
(a) obtaining at least one nucleic acid molecule ofthe invention (e.g.,
one, two, three, four, five, seven, ten, twelve, etc.) comprising
recombination
sites; and
(b) transferring all or a portion of said molecule into one or more
vectors (e.g., one, two, three, four, five, seven, ten, twelve, fifteen,
etc.).
Preferably, such vectors comprise one or more recombination sites (e.g.,
one, two, three, four, five, seven, ten, twelve, fifteen, twenty, thirty,
fifty, etc.)
and the transfer of the molecules into such vectors is preferably accomplished
by
recombination between one or more sites on the vectors (e.g., one, two, three,
four, five, seven, ten, etc.) and one or more sites on the molecules of the
invention
(e.g., one, two, three, four, five, seven, ten, etc.). In another aspect, the
product
molecules of the invention may be converted to molecules which function as
vectors by including the necessary vector sequences (e.g., origins of
replication).
Thus, according to the invention, such vectors sequences may be incorporated
into the product molecules through the use of starting molecules containing
such
sequences. Such vector sequences may be added at one or a number of desired
locations in the product molecules, depending on the location of the sequence
within the starting molecule and the order of addition of the starting
molecules
in the product molecule. Thus, the invention allows custom construction of a
desired vector by combining (preferably through recombination) any number of
functional elements that may be desired into the vector. The product molecule
containing the vector sequences may be in linear form or may be converted to a
circular or supercoiled form by causing recombination of recombination sites
within the product molecule or by ligation techniques well known in the art.
Preferably, circularization of such product molecule is accomplished by
recombining recombination sites at or near both termini of the product
molecule
or by ligating the termini of the product molecule to circularize the
molecule. As
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-46-
will be recognized, linear or circular product molecules can be introduced
into
one or more hosts or host cells for further manipulation.
Vector sequences useful in the invention, when employed, may comprise
one or a number of elements and/or functional sequences and/or sites (or
combinations thereof) including one or more sequencing or amplification
primers
sites (e.g., one, two, three, four, five, seven, ten, etc.), one or more
sequences
which confer translation termination suppressor activities (e.g., one, two,
three,
four, five, seven, ten, etc.) such as sequences which encode suppressor tRNA
molecules, one or more selectable markers (e.g., one, two, three, four, five,
seven,
or ten toxic genes, antibiotic resistance genes, etc.), one or more
transcription or
translation sites or signals (e.g., one, two, three, four, five, seven, ten,
etc.), one
or more transcription or translation termination sites (e.g., one, two, three,
four,
five, seven, ten, twelve, etc.), one or more splice sites (e.g., one, two,
three, four,
five, seven, ten, etc.) which allows for the excision, for example, of RNA
corresponding to recombination sites or protein translated from such sites,
one or
more tag sequences (e.g., HIS6, GST, GUS, GFP, YFP, CFP, epitope tags, etc.),
one or more restriction enzyme sites (e.g., multiple cloning sites), one or
more
origins of replication (e.g., one, two, three, four, five, seven, ten, etc.),
one or
more recombination sites (or portions thereof) (e.g., one, two, three, four,
five,
seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.), etc. The vector
sequences
used in the invention may also comprise stop codons which may be suppressed
to allow expression of desired fusion proteins as described herein. Thus,
according to the invention, vector sequences may be used to introduce one or
more of such elements, functional sequences and/or sites into any of the
nucleic
acid molecule of the invention, and such sequences may be used to further
manipulate or analyze such nucleic acid molecule. For example, primer sites
provided by a vector (preferably located on both sides of the insert cloned in
such
vector) allow sequencing or amplification of all or a portion of a product
molecule cloned into the vector.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-47-
Additionally, transcriptional or regulatory sequences contained by the
vector allows expression of peptides, polypeptides or proteins encoded by all
or
a portion of the product molecules cloned to the vector. Likewise, genes,
portions of genes or sequence tags (such as GUS, GST, GFP, YFP, CFP, His tags,
epitope tags and the like) provided by the vectors allow creation of
populations
of gene fusions with the product molecules cloned in the vector or allows
production of a number of peptide, polypeptide or protein fusions encoded by
the
sequence tags provided by the vector in combination with the product sequences
cloned in such vector. Such genes, portions of genes or sequence tags may be
used in combination with optionally suppressed stop codons to allow controlled
expression of fusion proteins encoded by the sequence of interest being cloned
into the vector and the vector supplied gene or tag sequence.
In a construct, the vector may comprise one or more recombination sites,
one or more stop codons and one or more tag sequences. In some embodiments,
the tag sequences may be adjacent to a recombination site. Optionally, a
suppressible stop codon may be incorporated into the sequence of the tag or in
the
sequence of the recombination site in order to allow controlled addition of
the tag
sequence to the gene of interest. In embodiments of this type, the gene of
interest
may be inserted into the vector by recombinational cloning such that the tag
and
the coding sequence of the gene of interest are in the same reading frame.
The gene of interest may be provided with translation initiation signals
(e.g., Shine-Delgarno sequences, Kozak sequences and/or IRES sequences) in
order to permit the expression of the gene with a native N-terminal when the
stop
codon is not suppressed. Further, recombination sites which reside between
nucleic acid segments which encode components of fusion proteins may be
designed either to not encode stop codons or to not encode stop codons in the
fusion protein reading frame. The gene of interest may also be provided with a
stop codon (e.g., a suppressible stop codon) at the 3'-end of the coding
sequence.
Similarly, when a fusion protein is produced from multiple nucleic acid
segments
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-48-
(e.g., three, four, five, six, eight, ten, etc. segments), nucleic acid which
encodes
stop codons can be omitted between each nucleic acid segment and, if desired,
nucleic acid which encodes a stop codon can be positioned at the 3' end of the
fusion protein coding region.
In some embodiments, a tag sequence may be provided at both the N- and
C-terminals of the gene of interest. Optionally, the tag sequence at the
N-terminal may be provided with a stop codon and the gene of interest may be
provided with a stop codon and the tag at the C-terminal may be provided with
a stop codon. The stop codons may be the same or different.
In some embodiments, the stop codon of the N-terminal tag is different
from the stop codon of the gene of interest. In embodiments of this type,
suppressor tRNAs corresponding to one or both of the stop codons may be
provided. When both are provided, each of the suppressor tRNAs may be
independently provided on the same vector, on a different vector, or in the
host
cell genome. The suppressor tRNAs need not both be provided in the same way,
for example, one may be provided on the vector contain the gene of interest
while
the other may be provided in the host cell genome.
Depending on the location of the expression signals (e.g., promoters),
suppression of the stop codon(s) during expression allows production of a
fusion
peptide having the tag sequence at the N- and/or C-terminus of the expressed
protein. By not suppressing the stop codon(s), expression of the sequence of
interest without the N- and/or C-terminal tag sequence may be accomplished.
Thus, the invention allows through recombination efficient construction of
vectors containing a gene or sequence of interest (e.g., one, two, three,
four, five,
six, ten, or more ORF's) for controlled expression of fusion proteins
depending
on the need.
Preferably, the starting nucleic acid molecules or product molecules of the
invention which are cloned or constructed according to the invention comprise
at least one open reading frame (ORF) (e.g., one, two, three, four, five,
seven, ten,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-49-
twelve, or fifteen ORFs). Such starting or product molecules may also comprise
functional sequences (e.g., primer sites, transcriptional or translation sites
or
signals, termination sites (e.g. , stop codons which may be optionally
suppressed),
origins of replication, and the like, and preferably comprises sequences that
regulate gene expression including transcriptional regulatory sequences and
sequences that function as internal ribosome entry sites (IRES). Preferably,
at
least one of the starting or product molecules and/or vectors comprise
sequences
that function as a promoter. Such starting or product molecules and/or vectors
may also comprise transcription termination sequences, selectable markers,
restriction enzyme recognition sites, and the like.
In some embodiments, the starting or product and/or vectors comprise two
copies of the same selectable marker, each copy flanked by two recombination
sites. In other embodiments, the starting or product and/or vectors comprise
two
different selectable markers each flanked by two recombination sites. In some
embodiments, one or more of the selectable markers may be a negative
selectable
marker (e.g., ccdB, kicB, Herpes simplex thymidine kinase, cytosine deaminase,
etc.).
In one aspect, the invention provides methods of cloning nucleic acid
molecules comprising (a) providing a first nucleic acid segment flanked by a
first
and a second recombination site; (b) providing a second nucleic acid segment
flanked by a third and a fourth recombination site, wherein either the first
or the
second recombination site is capable of recombining with either the third or
the
fourth recombination site; (c) conducting a recombination reaction such that
the
two nucleic acid segments are recombined into a single nucleic acid molecule;
and (d) cloning the single nucleic acid molecule. In certain specific
embodiments
of these methods, the first recombination site is not capable of recombining
with
the second and fourth recombination sites and the second recombination site is
not capable of recombining with the first and third recombination sites.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-50-
In a specific aspect, the invention provides a method of cloning
comprising providing at least a first nucleic acid molecule comprising at
least a
first and a second recombination site and at least a second nucleic acid
molecule
comprising at least a third and a fourth recombination site, wherein either
the first
or the second recombination site is capable of recombining with either the
third
or the fourth recombination site and conducting a recombination reaction such
that the two nucleic acid molecules are recombined into one or more product
nucleic acid molecules and cloning the product nucleic acid molecules into one
or more vectors. Preferably, the recombination sites flank the first and/or
second
nucleic acid molecules. Moreover, the cloning step is preferably accomplished
by the recombination reaction of the product molecule into a vector comprising
one or more recombination sites, although such cloning steps may be
accomplished by standard ligation reactions well known in the art. In one
aspect,
the cloning step comprises conducting a recombination reaction between the
sites
in the product nucleic acid molecule that did not react in the first
recombination
reaction with a vector having recombination sites capable of recombining with
the unreacted sites.
In another aspect, the invention provides methods of cloning nucleic acid
molecules comprising (a) providing a first nucleic acid segment flanked by at
least a first and a second recombination sites and a second nucleic acid
segment
flanked by at least a third and a fourth recombination sites, wherein none of
the
recombination sites flanking the first and second nucleic acid segments are
capable of recombining with any of the other sites flanking the first and
second
nucleic acid segments; (b) providing a vector comprising at least a fifth,
sixth,
seventh and eighth recombination sites, wherein each of the at least fifth,
sixth,
seventh and eighth recombination sites is capable of recombining with one of
the
at least first, second, third and/or fourth recombination sites; and (c)
conducting
a recombination reaction such that the two nucleic acid segments are
recombined
into the vector thereby cloning the first and the second nucleic acid
segments.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-51-
In another specific aspect, the invention provides a method of cloning
comprising providing at least a first nucleic acid molecule comprising at
least a
first and a second recombination site and at least a second nucleic acid
molecule
comprising at least a third and a fourth recombination site, wherein none of
the
first, second, third or fourth recombination sites is capable of recombining
with
any of the other sites, providing one or more vectors (e.g., two, three, four,
five,
seven, ten, twelve, etc.), comprising at least a fifth, sixth, seventh and
eighth
recombination site, wherein each of the fifth, sixth, seventh and eighth
recombination sites are capable of recombining with one of the first, second,
third
or fourth recombination site, and conducting a recombination reaction such
that
at least said first and second molecules are recombined into said vectors. In
a
further aspect, the method may allow cloning of at least one additional
nucleic
acid molecule (e.g., at least a third nucleic acid molecule), wherein said
molecule
is flanked by a ninth and a tenth recombination site and wherein the vector
comprises an eleventh and a twelfth recombination site each of which is
capable
of recombining with either the ninth or the tenth recombination site.
The invention also specifically relates to a method of cloning comprising
providing a first, a second and a third nucleic acid molecule, wherein the
first
nucleic acid molecule is flanked by at least a first and a second
recombination
sites, the second nucleic acid molecule is flanked by at least a third and a
fourth
recombination sites and the third nucleic acid molecule is flanked by at least
a
fifth and a sixth recombination sites, wherein the second recombination site
is
capable of recombining with the third recombination site and the fourth
recombination site is capable of recombining with the fifth recombination
site,
providing a vector having at least a seventh and an eighth recombination
sites,
wherein the seventh recombination site is capable of reacting with the first
recombination site and the eighth recombination site is capable of reacting
with
the sixth recombination site, and conducting at least one recombination
reaction
such that the second and the third recombination sites recombine, the fourth
and
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-52-
the fifth recombination sites recombine, the first and the seventh
recombination
sites recombine and the sixth and the eighth recombination sites recombine
thereby cloning the first, second and third nucleic acid segments in said
vector.
In another specific aspect, the invention provides a method of cloning
comprising providing at least a first, a second and a third nucleic acid
molecule,
wherein the first nucleic acid molecule is flanked by a first and a second
recombination site, the second nucleic acid molecule is flanked by a third and
a
fourth recombination site and the third nucleic acid molecule is flanked by a
fifth
and a sixth recombination site, wherein the second recombination site is
capable
of recombining with the third recombination site and none of the first,
fourth,
fifth or sixth recombination sites is capable of recombining with any of the
first
through sixth recombination sites, providing one or more vectors comprising a
seventh and an eighth recombination site flanking at least a first selectable
marker
and comprising a ninth and a tenth recombination site flanking at least a
second
selectable marker wherein none of the seventh through tenth recombination
sites
can recombine with any of the seventh through tenth recombination sites,
conducting at least one recombination reaction such that the second and the
third
recombination sites recombine, the first and the fourth recombination sites
recombine with the seventh and the eighth recombination sites and the fifth
and
the sixth recombination sites recombine with the ninth and the tenth
recombination sites thereby cloning the first, second and third nucleic acid
segments. In some embodiments, the selectable markers may be the same or may
be different. Moreover, the one or more selectable markers (e. g. , two,
three, four,
five, seven, etc.) may be negative selectable markers.
The invention also provides methods of cloning n nucleic acid segments,
wherein n is an integer greater than 1, comprising (a) providing n nucleic
acid
segments, each segment flanked by two recombination sites which do not
recombine with each other; (b) providing a vector comprising 2n recombination
sites, wherein each of the 2n recombination sites is capable of recombining
with
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-53-
one of the recombination sites flanking one of the nucleic acid segments; and
(c)
conducting a recombination reaction such that the n nucleic acid segments are
recombined into the vector thereby cloning the n nucleic acid segments. In
specific embodiments, the recombination reaction between the n nucleic acid
segments and the vector is conducted in the presence of one or more
recombination proteins under conditions which favor the recombination. In
other
specific embodiments, n is 2, 3, 4, or 5.
Thus, the invention generally provides a method of cloning n nucleic acid
molecules, wherein n is an integer greater than I , comprising the steps of
providing n nucleic acid molecules, each molecule comprising at least one and
preferably two recombination sites (the two recombination sites preferably
flank
the n nucleic acid molecule), providing at least one vector comprising one or
more recombination sites (and preferably 2n recombination sites) wherein the
vector containing recombination sites is capable of recombining with the
recombination sites of the n molecules, and conducting a recombination
reaction
such that the n nucleic acid molecules are inserted into said vectors thereby
cloning the n nucleic acid segments. The n molecules may be inserted next to
or
adjoining each other in the vector and/or may be inserted at different
positions
within the vector. The vectors used for cloning according to the invention
preferably comprise n copies of the same or different selectable marker, each
copy of which is flanked by at least two recombination sites. Preferably, one
or
more of the selectable markers are negative selectable markers.
The invention also generally relates to a method of cloning n nucleic acid
molecules, wherein n is an integer greater than 1, comprising the steps of
providing a 1 S' through an n'" nucleic acid molecules, each molecule flanked
by
at least two recombination sites, wherein the recombination sites are selected
such
that one of the two recombination sites flanking the i'" segment, n;, reacts
with
one of the recombination sites flanking the n;_,th segment and the other
recombination site flanking the i'" segment, n;, reacts with one of the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-54-
recombination sites flanking the n;+,th segment, providing a vector comprising
at
least two recombination sites wherein one of the two recombination sites on
the
vector react with one of the sites on the 15' nucleic acid segment and another
site
on the vector reacts with a recombination site on the h'" nucleic acid
segment.
The nucleic acid molecules/segments cloned by the methods of the
invention can be different types and can have different functions depending on
the need and depending on the functional elements present. In one aspect, at
least
one of the nucleic acid segments cloned according to the invention is operably
linked to a sequence which is capable ofregulating transcription (e.g.,
apromoter,
an enhancer, a repressor, etc.). For example, at least one of the nucleic acid
segments may be operably linked to a promoter which is either an inducible
promoter or a constitutive promoter. In yet other specific embodiments,
translation of an RNA produced from the cloned nucleic acid segments results
in
the production of either a fusion protein or all or part of a single protein.
In
additional specific embodiments, at least one of the nucleic acid segments
encodes all of part of an open reading frame and at least one of the nucleic
acid
segments contains a sequence which is capable of regulating transcription
(e.g.,
a promoter, an enhancer, a repressor, etc.). In further specific embodiments,
at
least one of the nucleic acid segments produces a sense RNA strand upon
transcription and at least one of the nucleic acid segments produces an
antisense
RNA strand upon transcription. In related embodiments, the sense RNA and
antisense RNA have at least one complementary region and are capable of
hybridizing to each other. In other specific embodiments, transcription of at
least
two of the nucleic acid segments results in the production of a single RNA or
two
separate RNAs. In various specific embodiments, these nucleic acid segments
may be connected to each other or may be spatially separated within the same
nucleic acid molecule. In specific embodiments, the nucleic acid segments
comprise nucleic acid molecules of one or more libraries. Further, these
libraries
may comprise cDNA, synthetic DNA, or genomic DNA. In addition, the nucleic
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-55-
acid molecules of these libraries may encode variable domains of antibody
molecules (e. g. , variable domains of antibody light and heavy chains). In
specific
embodiments, the invention provides screening methods for identifying nucleic
acid molecules which encode proteins having binding specificity for one or
more
antigens and/or proteins having one or more activities (e.g., secretion from a
cell,
sub-cellular localization (e.g., localization to the endoplasmic reticulum,
the
nucleus, mitochondria, chloroplasts, the cell membrane, etc.), ligand binding
activity (e.g., small molecules, binding activities for nucleic acids, cell
surface
receptors, soluble proteins, metal ions, structural elements, protein
interaction
domains, etc.), enzymatic activity, etc.). Further, nucleic acid
molecules/segments cloned using methods of the invention may have one or more
of the activities referred to above.
In another aspect, the invention provides methods of cloning at least one
nucleic acid molecule comprising (a) providing at least a first, a second and
a
third nucleic acid segments, wherein the first nucleic acid segment is flanked
by
at least a first and a second recombination sites, the second nucleic acid
segment
is flanked by at least a third and a fourth recombination sites and the third
nucleic
acid segment is flanked by at least a fifth and a sixth recombination sites,
wherein
the second recombination site is capable of recombining with the third
recombination site and none of the first, fourth, fifth or sixth recombination
sites
is capable of recombining with any of the first through sixth recombination
sites;
(b) providing a vector comprising at least a seventh and an eighth
recombination
sites flanking at least a first negative selectable marker and comprising at
least a
ninth and a tenth recombination sites flanking at least a second negative
selectable marker, wherein none of the seventh through tenth recombination
sites
can recombine with any of the seventh through tenth recombination sites; (c)
conducting a first recombination reaction such that the second and the third
recombination sites recombine; and (d) conducting a second recombination
reaction such that the first and the fourth recombination sites recombine with
the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-56-
seventh and the eighth recombination sites and the fifth and the sixth
recombination sites recombine with the ninth and the tenth recombination sites
thereby cloning the first, second and third nucleic acid segments. In related
embodiments, the first and second recombination reactions are conducted in the
presence of one or more recombination proteins under conditions which favor
the
recombination. Such first and second recombination reactions may be carried
out
simultaneously or sequentially.
In another aspect, the invention provides methods of cloning at least one
nucleic acid molecule comprising (a) providing a first, a second and a third
nucleic acid segment, wherein the first nucleic acid segment is flanked by a
first
and a second recombination site, the second nucleic acid segment is flanked by
a third and a fourth recombination site and the third nucleic acid segment is
flanked by a fifth and a sixth recombination site, wherein the second
recombination site is capable of recombining with the third recombination site
and the fourth recombination site is capable of recombining with the fifth
recombination site; (b) providing a vector comprising a seventh and an eighth
recombination site; and (c) conducting at least one recombination reaction
such
that the second and the third recombination sites recombine and the fourth and
the
fifth recombination sites recombine and the first and the sixth recombination
sites
recombine with the seventh and the eighth recombination sites respectively,
thereby cloning the first, second and third nucleic acid segments. In related
embodiments, the recombination reaction is conducted in the presence of one or
more recombination proteins under conditions which favor the recombination.
In specific embodiments, the recombination sites which recombine with each
other comprise att sites having identical seven base pair overlap regions.
In another aspect, the invention provides methods of cloning n nucleic
acid fragments, wherein n is an integer greater than 2, comprising (a)
providing
a 1s' through an n'" nucleic acid segment, each segment flanked by two
recombination sites, wherein the recombination sites are selected such that
one
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-57-
of the two recombination sites flanking the i'" segment, n;, reacts with one
of the
recombination sites flanking the n;_,th segment and the other recombination
site
flanking the i'" segment reacts with one of the recombination sites flanking
the
n'+"" segment; (b) providing a vector comprising at least two recombination
sites,
wherein one of the two recombination sites on the vector reacts with one of
the
sites on the 15' nucleic acid segment and another site on the vector reacts
with a
recombination site on the n'" nucleic acid segment; and (c) conducting at
least one
recombination reaction such that all of the nucleic acid fragments are
recombined
into the vector. In specific embodiments, the recombination reaction is
conducted
in the presence of one or more recombination proteins under conditions which
favor the recombination.
In specific embodiments of the methods described above, multiple nucleic
acid segments are inserted into another nucleic acid molecules. While numerous
variations of such methods are possible, in specific embodiments, nucleic acid
segments which contain recombination sites having different specificities
(e.g.,
attL 1 and attL2) are inserted into a vector which contains more than one set
of
cognate recombination sites (e.g., attRl and attR2), each set of which flanks
negative selection markers. Thus, recombination at cognate sites results can
be
used to select for nucleic acid molecules which have undergone recombination
at one or more of the recombination sites. The nucleic acid segments which are
inserted into the vector may be the same or different. Further, these nucleic
acid
segments may encode expression products or may be transcriptional control
sequences. When the nucleic acid segments encode expression products, vectors
of the invention may be used to amplify the copy number or increase expression
of encoded products. Further, when nucleic acid segments are inserted in both
direct and inverted orientations, vectors of the invention may be used, for
example, to express RNAi, as described elsewhere herein. When the nucleic acid
segments encode sequence which regulate transcription (e.g., promoters,
enhancers, etc.), vectors ofthe invention may be used to place multiple
regulatory
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-5 8-
elements in operable linkage with nucleic acid that encodes expression
products.
Vectors of this nature may be used to increased expression of expression
products, for example, by providing multiple binding sites for proteins which
activate transcription. Similarly, vectors of this nature may be used to
decrease
S expression of expression products, for example, by providing multiple
binding
sites for proteins which inhibit transcription. Vectors of this nature may be
used
to increased or decrease the expression of expression products, for example,
by
the expression of multiple copies of nucleic acid molecules which encode
factors
involved in the regulation of transcription. Other embodiments related to the
above would be apparent to one skilled in the art.
In another aspect, the invention provides methods of cloning at least one
nucleic acid molecule comprising (a) providing a first population of nucleic
acid
molecules wherein all or a portion of such molecules are flanked by at least a
first
and a second recombination sites; (b) providing at least one nucleic acid
segment
flanked by at least a third and a fourth recombination sites, wherein either
the first
or the second recombination site is capable of recombining with either the
third
or the fourth recombination site; (c) conducting a recombination reaction such
that all or a portion of the nucleic acid molecules in the population are
recombined with the segment to form a second population of nucleic acid
molecules; and (d) cloning the second population of nucleic acid molecules. In
related embodiments, the recombination reaction is conducted in the presence
of
one or more recombination proteins under conditions which favor the
recombination. In specific embodiments, the second population of nucleic acid
molecules encodes a fusion protein. In related embodiments, the nucleic acid
segment encodes a polypeptide which comprises a sequence (preferably an
N-terminal and/or a C-terminal tag sequence) encoding all or a portion of the
following: the Fc portion of an immunoglobin, an antibody, a (3-glucuronidase,
a fluorescent protein (e.g., green fluorescent protein, yellow fluorescent
protein,
red fluorescent protein, cyan fluorescent protein, etc.), a transcription
activation
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-59-
domain, a protein or domain involved in translation, protein localization tag,
a
protein stabilization or destabalization sequence, a protein interaction
domains,
a binding domain for DNA, a protein substrate, a purification tag (e. g., an
epitope
tag, maltose binding protein, a six histidine tag, glutathione S-transferase,
etc.),
and an epitope tag.
In another aspect, the invention provides methods of cloning at least one
nucleic acid molecule comprising (a) providing a first population of nucleic
acid
molecules wherein all or a portion of such molecules are flanked by at least a
first
and a second recombination site; (b) providing a second population of nucleic
acid molecules wherein all or a portion of such molecules are flanked by a
third
and a fourth recombination site, wherein either the first or the second
recombination site is capable of recombining with either the third or the
fourth
recombination site; (c) conducting a recombination reaction such that all or a
portion of the molecules in the first population is recombined with one or
more
molecules from the second population to form a third population of nucleic
acid
molecules; and (d) cloning the third population of nucleic acid molecules. In
related embodiments, the recombination reaction is conducted in the presence
of
one or more recombination proteins under conditions which favor the
recombination.
Thus, the invention generally provides methods of joining at least two
segments of nucleic acid (including joining populations of nucleic acid
molecules), comprising (a) providing at least two segments of nucleic acid
(one
or both of which may be derived from a population or library of molecules),
each
segment comprising at least one recombination site capable of recombining with
a recombination site present on another (or second) segment; and (b)
contacting
the segments with one or more recombination proteins under conditions causing
recombination between the recombination sites, thereby joining the segments.
The invention further provides composition comprising the joined nucleic acid
segments (or population of segments) prepared by such methods, hosts or host
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-60-
cells comprising such joined nucleic acid segments (which may be populations
of host cells or recombinant host cells), and methods of making such hosts or
host
cells (such as by transforming or transfecting such cells with product
molecules
of the invention). In specific embodiments, the methods of the invention
further
S comprises inserting the joined nucleic acid segments into one or more
vectors.
The invention also relates to hosts or host cells containing such vectors. In
additional specific embodiments, at least one of the two segments of nucleic
acid
encodes an expression product (e.g, a selectable marker, an enzyme, a
ribozyme,
etc.) having one or more identifiable activities. In yet other specific
embodiments, at least one of the two segments of nucleic acid contains all or
part
of an open reading frame (ORF). In another aspect, at least one of the two
segments of nucleic acid contains a sequence which is capable of regulating
transcription (e.g., a promoter, an enhancer, a repressor, etc.). In a
specific
aspect, one segment encodes an ORF and the other encodes a sequence capable
of regulating transcription and/or translation and the recombination reaction
allows such sequences to be operably linked. In yet other additional specific
embodiments, one or more of the nucleic acid segments encode a selectable
marker or contains an origin of replication. In further specific embodiments,
some or all of the nucleic acid segments comprise nucleic acid molecules of
one
or more libraries. In certain specific embodiments, the one or more libraries
comprise polynucleotides which encode variable domains of antibody molecules.
In related embodiments, at least one of the nucleic acid segments encodes a
polypeptide linker for connecting variable domains of antibody molecules
and/or
one or more libraries comprise polynucleotides which encode variable domains
of antibody light and heavy chains. In specific embodiments, methods of the
invention further comprises at least one screening step to identify nucleic
acid
molecules which encode proteins having one or more identifiable activities
(e.g.,
binding specificities for one or more antigens, enzymatic activities,
activities
associated with selectable markers, etc.). Thus, the invention can be used to
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-61-
produce modified expression products (by variably linking different segments
and/or replacing and/or deleting segments) and analyzing the expression
products
for desired activities. According to the invention, portions of genes and/or a
number of genes can be linked to express novel proteins or novel compounds and
to select for activities of interest. As described herein, substitution and/or
deletions of such linked molecules can also be used to produce altered or
modified proteins or compounds for testing. In one aspect, biological pathways
can be modified by the methods of the invention to, for example, use different
enzymes or mutant enzymes in a particular pathway (e.g., link different
enzymes
or mutant enzymes which participate in reactions in the same biological
pathway). Such modification to biological pathways according to the invention
leads to ( 1 ) the production of potentially novel compounds such as
antibiotics or
carbohydrates or (2) unique post-translational modification of proteins (e.g.,
glycosylation, sialation, etc.). The invention also allows for production of
novel
enzymes by manipulating or changing subunits of multimeric enzyme complexes.
In other specific embodiments, the invention also provides methods of altering
properties of a cell comprising introducing into the cell nucleic acid
segments
produced by the methods described herein. In certain specific embodiments,
cells
altered or produced by methods of the invention are either fungal cells or
bacterial cells (e.g., Escherichia coli).
The invention further provides methods for altering biological pathways
and generating new biological pathways. For example, genes encoding products
involved in the production of a particular pathway (e.g., a pathway which
leads
to the production of an antibiotic) may be altered using methods of the
invention.
These alterations include the deletion, replacement, and/or mutation of one or
more genes which encode products that participate in the pathway. In addition,
regions of genes may be deleted or exchanged following by screening to
identify,
for example, pathway products having particular features (e.g., a particular
methylation pattern). Further, genes of different organisms which perform
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-62-
similar but different functions may be combined to produce novel products.
Further, these products may be identified by screening for specific functional
properties (e.g., the ability to inhibit an enzymatic reaction, binding
affinity for
a particular ligand, antimicrobial activity, antiviral activity, etc.). Thus,
the
invention provides, in one aspect, screening methods for identifying compounds
which are produced by expression products of nucleic acid molecules of the
invention.
Further, when the nucleic acid segments which encode one or more
expression products involved in a particular biological pathway or process
have
been assembled into one or more nucleic acid molecules, regions of these
molecules (e.g., regions which encode expression products) may be deleted or
replaced to generate nucleic acid molecules which, for example, express
additional expression products, altered expression products, or which do not
express one or more expression product involved in the biological pathway or
process. Further, nucleic acid segments which encode one or more expression
products involved in a particular biological pathway or process may be deleted
or inserted as'a single unit. These methods find application in the production
and
screening of novel products. In particular, the invention also includes novel
products produced by the expression products ofnucleic acid molecules
described
herein.
In another aspect, the invention provides methods for preparing and
identifying nucleic acid molecules containing two or more nucleic acid
segments
which encode gene products involved in the same biological process or
biological
pathway, as well as unrelated biological processes or biological pathways,
comprising (a) providing a first population of nucleic acid molecules
comprising
at least one recombination site capable of recombining with other nucleic acid
molecules in the first population; (b) contacting the nucleic acid molecules
of the
first population with one or more recombination proteins under conditions
which
cause the nucleic acid molecules to recombine and create a second population
of
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-63-
nucleic acid molecules; and (c) screening the second population of nucleic
acid
molecules to identify a nucleic acid molecule which encodes two or more
products involved in the same process or pathway. In specific embodiments of
the invention, the nucleic acid molecules which encodes two or more products
involved in the same process or pathway encode two different domains of a
protein or protein complex. In other specific embodiments, the protein is a
single-chain antigen-binding protein. In yet other specific embodiments, the
protein complex comprises an antibody molecule or multivalent antigen-binding
protein comprising at least two single-chain antigen-binding protein. The
invention further provides methods similar to those described above for
preparing
and identifying nucleic acid molecules containing two or more nucleic acid
segments which encode gene products involved in different or unrelated
biological processes or biological pathways.
Methods of the invention may also be employed to determine the
expression profile of genes in cells and/or tissues. In one embodiment, RNA
may
be obtained from cells and/or tissues and used to generate cDNA molecules.
These cDNA molecules may then be linked to each other and sequenced to
identify genes which are expressed in cells and/or tissues, as well as the
prevalence of RNA species in these cells and/or tissues. Thus, in one aspect,
the
invention provides methods for identifying genes expressed in particular cells
and/or tissues and the relative quantity of particular RNA species present in
these
cells and/or tissues as compared to the quantity of other RNA species. As
discussed below, such methods may be used for a variety of applications
including diagnostics, gene discovery, the identification of genes expressed
in
specific cell and/or tissue types, the identification of genes which are over-
or
under-expressed in particular cells (e.g., cells associated with a
pathological
condition), the screening of agents to identify agents (e.g., therapeutic
agents)
which alter gene expression, etc. Further, it will often be possible to
identify the
gene from which a particular RNA species or segment is transcribed by
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-64-
comparison of the sequence data obtained by methods of the invention to
nucleic
acid sequences cataloged in public databases. Generally, about 10 nucleotides
or
so of sequence data will be required to identify the gene from which RNA has
been transcribed.
Thus, in a specific aspect, the invention provides methods for determining
gene expression profiles in cells or tissues comprising (a) generating at
least one
population of cDNA molecules from RNA obtained from the cells or tissues,
wherein the individual cDNA molecules of the population comprise at least two
recombination sites capable of recombining with at least one recombination
site
present on the individual members of the same or a different population of
cDNA
molecules; (b) contacting the nucleic acid molecules of (a) with one or more
recombination proteins under conditions which cause the nucleic acid molecules
to join; and (c) determining the sequence of the joined nucleic acid
molecules.
In specific embodiments of the invention, the joined cDNA molecules are
inserted into vectors which contain sequencing primer binding sites flanking
the
insertion sites. In yet other specific embodiments, the joined cDNA molecules
are separated by attB recombination sites. In additional specific embodiments,
the joined cDNA molecules contain between about 10 and about 30 nucleotides
which corresponds to the RNA obtained from the cell or tissue.
Once the sequences.of cDNA corresponding to RNA expression products
have been determined, these sequences can be compared to databases which
contain the sequences of known genes to determine which genes are expressed
in the particular cells and/or tissues and the expression levels of individual
genes.
Further, the expression levels of genes can be determined using methods of the
invention under particular conditions to determine if these conditions result
in the
alteration of the expression of one or more genes. Examples of such conditions
include decreased activity of cellular gene expression products, nutrient
limitation
and/or deprivation, heat shock, low temperatures, contact with solutions
having
low or high ionic strengths, exposure to chemical agents (e.g., antibiotics,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-65-
chemotherapeutic agents, metal ions, mutagens, etc.), ionizing radiation, etc.
Thus, the invention provides methods for identifying genes which exhibit
alterations in expression as a result of specific stimuli.
The invention further provides methods for identifying genes involved in
cellular metabolism (e.g., pathological conditions). For example, methods of
the
invention can be used to determine the expression profile of cells of a
particular
strain or cells which exhibit an aberrant phenotype. The expression profile of
cells of the particular strain or cells which exhibit the aberrant phenotype
is
compared to the expression profile of cells of another strain or cells which
do not
exhibit the aberrant phenotype, referred to herein as "reference cells." By
comparison of expression profiles of genes of cells of the particular strain
or cells
which exhibit the aberrant phenotype to appropriate reference cells,
expression
characteristics of associated with the strain or aberrant phenotype can be
determined. Thus, in one specific aspect, the invention provides diagnostic
methods, wherein the gene expression profiles of cells of a patient which
exhibit
an aberrant phenotype (e.g., cancerous) is compared to the gene expression
profiles of cells which do not exhibit the aberrant phenotype (i. e. ,
reference cells).
In another specific aspect, the invention provides methods for screening
therapeutic agents (e.g., immunostimulatory agent) comprising (a) exposing
cells
(e.g., human cells) to a candidate therapeutic agent, (b) determining the gene
expression profile of the exposed cells, (c) comparing the gene expression
profile
to the gene expression profile of cells which have not been exposed to the
candidate therapeutic agent (i. e., reference cells). The invention further
includes
therapeutic agents identified by the methods described above.
In another aspect, the invention provides a means for attaching or binding
through recombination molecules and/or compounds or population of molecules
and/or compounds to other molecules, compounds and/or supports (preferably
solid or semisolid). Suitable molecules and compounds for use in the present
invention include, but are not limited to, proteins, polypeptides, or
peptides,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-66-
chemical compounds, drugs, lipids, lipoproteins, carbohydrates, hormones,
steroids, antibodies (or portions thereofj, antigens, enzymes (e.g.,
nucleases,
polymerases, etc.), polysaccharides, nucleosides and derivatives thereof,
nucleotides and derivatives thereof, amino acids and derivatives thereof,
fatty
S acids, receptors, ligands, haptens, small molecules (e.g., activation groups
such
as -COOH), binding molecules (e.g., biotin, avidin, strepavidin, Protein A,
Protein B, etc.), growth factors, metal ions, cytokines, ribozymes, or nucleic
acid
molecules (e.g., RNA, DNA, DNA/RNA hybrids, cDNA or cDNA libraries,
double stranded nucleic acids, single stranded nucleic acids, linear nucleic
acids,
circular nucleic acids, supercoiled nucleic acids and the like) and
combinations
of two or more of the foregoing. In specific embodiments, molecules may be
linked to supports either directly or indirectly. Further, molecules may be
linked
to supports by either covalently or non-covalently. For purposes of
illustration,
one example of the indirect non-covalent linkage of a nucleic acid molecule to
a
support is where a protein which exhibits high binding affinity for nucleic
acid
molecules is directly linked to a support. The support containing this protein
is
then contacted with the nucleic acid molecules under appropriate conditions.
resulting in the non-covalent attachment of the nucleic acid molecules to the
support through the protein. This association between nucleic acid
molecule/protein interaction can be either sequence specific or non-sequence
specific.
In another aspect, the invention provides supports comprising (either
bound or unbound to the support) at least one first nucleic acid molecule,
wherein
the first nucleic acid molecule comprises one or more recombination sites or
portions thereof. In specific embodiments, supports of the invention further
comprise at least one second nucleic acid molecule or at least one peptide or
protein molecule or other compound bound to the supports through the
recombination site on the first nucleic acid molecule.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-67-
The invention also relates to supports of the invention which comprise
(either bound or unbound to the support) one or more components selected from
the group consisting of one or more nucleic acid molecules comprising at least
one recombination site, one or more recombination proteins, and one or more
peptides or compounds comprising at least one recombination site.
In another aspect, the invention provides methods for attaching or binding
one or more nucleic acid molecules, protein or peptide molecules, or other
compounds to supports comprising (a) obtaining at least one nucleic acid
molecule, protein or peptide molecule, other compounds, or population of such
molecules or compounds comprising at least one recombination site and
obtaining supports comprising at least one recombination site; and (b) causing
some or all of the recombination sites on the at least one nucleic acid
molecule,
protein or peptide molecule, other compounds, or population of such molecules
or compounds to recombine with all or a portion of the recombination sites
I 5 comprising the supports. In specific embodiments of the invention, the
methods
further comprise attaching or binding one or more nucleic acid molecules to
the
supports. In other specific embodiments, only one nucleic acid molecule is
directly linked to the support. In yet other specific embodiments, the nucleic
acid
molecules form microarrays. In even more specific embodiments, the
microarrays form a DNA chip. The invention further provides supports prepared
by the methods described above. In specific embodiments, the support of the
invention are either solid or semisolid. Further, as discussed above, nucleic
acid
molecules may be linked to supports either directly or indirectly. As also
discussed above, nucleic acid molecules may be linked to supports either
covalently or non-covalently. In addition, nucleic acid molecules may be
linked
to supports through linkage to a protein or small molecule (e.g., a molecule
having an activation group such as -COOH). Further, nucleic acid molecules may
be linked to supports through linkages which are either labile or non-labile.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-68-
In another aspect, the invention provides methods for linking or
connecting two or more molecules or compounds of interest, comprising (a)
providing at least a first and a second molecule or compound of interest, each
of
the first and second molecules or compounds of interest comprising at least
one
recombination site; (b) causing some or all of the recombination sites on the
first
molecule or compound of interest to recombine with some or all of the
recombination sites on the second molecule or compound of interest. In
specific
embodiments of the invention, the methods further comprising attaching nucleic
acids comprising recombination sites to the first and the second molecules or
compounds of interest. In other specific embodiments, at least one of the
molecules or compounds of interest comprises a protein or peptide, a nucleic
acid,
a carbohydrate, a steroid, or a lipid.
In some embodiments, one or more of the compounds and/or molecules
of the invention (e.g., two, three, four, five, seven, ten, twelve, fifteen,
twenty,
thirty, fifty, etc.) may comprise one or more recombination sites (e.g., two,
three,
four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) or
portions thereof.
Such molecules and/or compounds may be unlabeled or detectably labeled by
methods well known in the art. Detectable labels include, but are not limited
to,
radioactive labels, mass labels, fluorescent labels, chemiluminescent labels,
bioluminescent labels, and enzyme labels. Use of such labels may allow for the
detection of the presence or absence of labeled molecules and/or compounds on
a support. Thus, the invention generally relates to attaching to a support any
number of molecules and/or compounds or populations of molecules and/or
compounds by recombination and the supports made by this method. Such
compounds and/or molecules can thus be attached to a support or structure via
a
nucleic acid linker containing a recombination site or portion thereof. Such
linkers are preferably small (e.g., 5, 20, 30, 50, 100, 200, 300, 400, or 500
base
pairs in length).
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-69-
Accordingly, the present invention encompasses a support comprising one
or a number of recombination sites (or portions thereof) which can be used
according to this aspect of the invention. Thus, one or a number of nucleic
acid
molecules, or proteins, peptides and/or other molecules and/or compounds
having
one or more recombination sites or portions thereof which are to be added or
attached or bound to the support are recombined by a recombination reaction
with
the recombination-site-containing support, thereby creating a support
containing
one or more nucleic acid molecules, or protein, peptides and/or other
molecules
and/or compounds of interest. The recombination reaction in binding the
molecule and/or compound of interest to the support is preferably accomplished
in vitro by contacting the support and the molecule and/or compound of
interest
with at least one recombination protein under conditions sufficient to cause
recombination of at least one recombination site on the molecule and/or
compound of interest with at least one recombination site present on the
support.
This aspect of the invention is particularly useful in creating arrays of
nucleic
acids, or proteins and/or other molecules and/or compounds on one or more
supports (e.g., two, three, four, five, seven, ten, twelve, etc.) in that it
facilitates
binding of a number of the same or different nucleic acids, or proteins and/or
other molecules and/or compounds of interest through recombination to the
support or various parts of the support. Thus, the invention relates to a
method
of attaching or binding one or more (e.g., two, three, four, five, seven, ten,
twelve,
fifteen, twenty, thirty, fifty, etc.) nucleic acid, or protein molecules
and/or other
molecules and/or compounds to a support comprising:
(a) obtaining at least a first molecule and/or compound or population
of molecules and/or compounds comprising at least one recombination site
(e.g.,
the starting nucleic acid molecules of the invention) and obtaining a support
comprising at least one recombination site (which may also be the starting
molecules of the invention); and
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-70-
(b) causing some or all of the recombination sites on said at least first
molecule and/or compound or population of molecules and/or compounds to
recombine with all or a portion of the recombination sites on the support.
Once the molecules and/or compounds are added to the support, the
presence or absence or position of such molecules and/or compounds on the
support can be determined (for example by using detectable labels).
Additionally, the molecules and/or compounds bound to the support may be
further manipulated by well known techniques.
In addition to joining one or multiple molecules and/or compounds to a
support in accordance with the invention, the invention also allows
replacement,
insertion, or deletion of one or more molecules and/or compounds contained by
the support. As discussed herein, causing recombination of specific sites
within
a molecule and/or compound of interest, all or a portion of molecule and/or
compound may be removed or replaced with another molecule or compound of
interest. This process may also be applied to molecules and/or compounds
having recombination site which are attached to the support. Thus,
recombination may be used to remove or replace all or a portion of the
molecule
and/or compound of the interest from the support, in addition to adding all or
part
of molecules to supports.
The molecules and/or compounds added to the support or removed from
the support may be further manipulated or analyzed in accordance with the
invention and as described herein. For example, further analysis or
manipulation
of molecules and/or compounds bound to or removed from the support include
sequencing, hybridization (DNA, RNA etc.), amplification, nucleic acid
synthesis, protein or peptide expression, protein-DNA interactions (2-hybrid
or
reverse 2-hybrid analysis), interaction or binding studies with other
molecules
and/or compounds, homologous recombination or gene targeting, and
combinatorial library analysis and manipulation. Such manipulation may be
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-71-
accomplished while the molecules and/or compounds are bound to the support or
after the molecules and/or compounds are removed from the support.
In accordance with the invention, any solid or semi-solid supports may be
used and sequences containing recombination sites (or portions thereof) may be
added by well known techniques for attaching nucleic acids to supports.
Furthermore, recombination sites may be added to nucleic acid, protein
molecules
and/or other molecules and/or compounds of interest by techniques well known
in the art. Moreover, any wild-type or mutant recombination sites or
combinations of the same or different recombination sites may be used for
adding
and removing molecules and/or compounds of interest to or from a support.
The invention also relates to any support comprising one or more
recombination sites (e. g. , two, three, four, five, seven, ten, twelve,
fifteen, twenty,
thirty, fifty, etc.) or portions thereof and to supports comprising nucleic
acid,
protein molecules and/or other molecules and/or compounds having one or more
recombination sites (or portions thereof) bound to said support.
The invention also relates to compositions comprising such supports of
the invention. Such compositions may further comprise one or more
recombination proteins (preferably site specific recombination proteins),
suitable
buffers (e.g., for causing recombination), nucleic acid, protein molecules
and/or
other molecules and/or compounds, preferably comprising recombination sites
which may be unbound to the support, and any other reagents used for
recombining recombination sites according to the invention (and combinations
thereof). The invention also relates to compositions for use in further
manipulating or analyzing the supports of the invention or the nucleic acid or
protein molecules or other molecules and/or compounds attached thereto.
Further
manipulation and analysis may be preformed on the nucleic acids, proteins,
and/or other molecules and/or compounds while bound to the support or after
removal from the support. Such compositions may comprise suitable buffers and
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-72-
enzymes such as restriction enzymes, polymerases, ligases, recombination
proteins, and the like.
In another aspect, the present invention provides a means for attaching or
binding one or more (e.g., two, three, four, five, seven, ten, twelve,
fifteen,
S twenty, thirty, fifty, etc.) molecules and/or compounds or populations of
molecules and/or compounds to one or more of the same or different molecules
and/or compounds or populations of molecules and/or compounds. Thus, the
invention generally relates to connecting any number of molecules and/or
compounds or population of molecules and/or compounds by recombination. As
described herein, such linked molecules and/or compounds may be unlabeled or
detectably labeled. Further, such linked molecules and/or compounds may be
linked to either covalently or non-covalently. Suitable molecules and/or
compounds include, but are not limited to, those described herein such as
nucleic
acids, proteins or peptides, chemical compounds, drugs, lipids, lipoproteins,
hormones, etc. In one aspect, the same molecules and/or compounds, or the same
type of molecules and/or compounds (e.g., protein-protein, nucleic acid-
nucleic
acid, etc.) may be linked through recombination. Thus, in one aspect, small
molecules and/or proteins may be linked to recombination sites and then linked
to each other in various combinations.
In another aspect, different molecules and/or compounds or different types
of molecules and/or compounds (e.g., protein-nucleic acid, nucleic acid-
ligand,
protein-ligand, etc.) may be linked through recombination. Additionally, the
molecules and/or compounds linked through recombination (e.g., protein-
protein,
protein-ligand, etc.) may be attached to a support or structure through
recombination as described herein. Thus, the molecules and/or compounds
(optionally linked to a support) produced are linked by one or more
recombination sites (or portions thereof). Such recombination sites (or
portions
thereof) may be attached to molecules such as proteins, peptides,
carbohydrates,
steroids and/or lipids or combinations thereof using conventional technologies
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-73-
and the resulting recombination-site-containing molecules and/or compounds
may be linked using the methods of the present invention. Further, the
resultant
linked molecules and/or compounds may be attached via one or more of the
recombination sites to other molecules and/or compounds comprising
S recombination sites. For example, a nucleic acid comprising a recombination
site
may be attached to a molecule of interest and a second nucleic acid comprising
a compatible recombination site may be attached to a second molecule of
interest.
Recombination between the sites results in the attachment of the two molecules
via a small nucleic acid linker. The nucleic acid linker may be any length
depending on the need but preferably is small (e.g., from about 5 to about 500
bps
in length). Using this methodology, proteins, peptides, nucleic acids,
carbohydrates, steroids and/or lipids or combinations thereof may be attached
to
proteins, peptides, nucleic acids, carbohydrates, steroids and/or lipids or
combinations thereof. Thus, the present invention provides a method of
connecting two or more molecules and/or compounds, comprising the steps of:
(a) obtaining at least a first and a second molecule and/or compound,
each of said molecules and/or compounds comprising at least one recombination
site (or portion thereof); and
(b) causing some or all of the recombination sites (or portions thereof)
on said first molecule and/or compound to recombine with all or a portion of
the
recombination sites (or portions thereof) on said second molecule and/or
compound.
In some preferred embodiments, a recombination site may be attached to
a molecule of interest using conventional conjugation technology. For example,
oligonucleotides comprising the recombination site can be synthesized so as to
include one or more reactive functional moieties (e.g., two, three, four,
five,
seven, ten, etc.) which may be the same or different. Suitable reactive
functional
moieties include, but are not limited to, amine groups, epoxy groups, vinyl
groups, thiol groups and the like. The synthesis of oligonucleotides
comprising
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-74-
one or more reactive functional moieties is routine in the art. Once
synthesized,
oligonucleotides comprising one or more reactive functional moieties may be
attached to one or more reactive groups (e.g., two, three, four, five, seven,
ten,
etc.) present on the molecule or compound of interest. The oligonucleotides
may
be attached directly by reacting one or more of the reactive functional
moieties
with one or more of the reactive functional groups. In some embodiments, the
attachment may be effected using a suitable linking group capable of reacting
with one or more of the reactive functional moieties present on the
oligonucleotide and with one or more of the reactive groups present on the
molecule of interest. In other embodiments, both direct attachment and
attachment through a linking group may be used. Those skilled in the art will
appreciate that the reactive functional moieties on the oligonucleotide may be
the
same or different as the reactive functional moieties on the molecules and/or
compounds of interest. Suitable reagents and techniques for conjugation of the
oligonucleotide to the molecule of interest may be found in Hermanson,
Bioconjugate Technigues, Academic Press Inc., San Diego, CA, 1996.
The present invention also relates to kits for carrying out the methods of
the invention, and particularly for use in creating the product nucleic acid
molecules of the invention or other linked molecules and/or compounds of the
invention (e.g., protein-protein, nucleic acid-protein, etc.), or supports
comprising
such product nucleic acid molecules or linked molecules and/or compounds. The
invention also relates to kits for adding and/or removing and/or replacing
nucleic
acids, proteins and/or other molecules and/or compounds to or from one or more
supports, for creating and using combinatorial libraries of the invention, and
for
carrying out homologous recombination (particularly gene targeting) according
to the methods of the invention. The kits of the invention may also comprise
further components for further manipulating the recombination site-containing
molecules and/or compounds produced by the methods of the invention. The kits
of the invention may comprise one or more nucleic acid molecules of the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-75-
invention (particularly starting molecules comprising one or more
recombination
sites and optionally comprising one or more reactive functional moieties), one
or
more molecules and/or compounds of the invention, one or more supports of the
invention and/or one or more vectors of the invention. Such kits may
optionally
comprise one or more additional components selected from the group consisting
of one or more host cells (e.g., two, three, four, five etc.), one or more
reagents
for introducing (e.g., by transfection or transformation) molecules or
compounds
into one or more host cells, one or more nucleotides, one or more polymerases
and/or reverse transcriptases (e.g., two, three, four, five, etc.), one or
more
suitable buffers (e.g., two, three, four, five, etc.), one or more primers
(e.g., two,
three, four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.),
one or more
terminating agents (e.g., two, three, four, five, seven, ten, etc.), one or
more
populations of molecules for creating combinatorial libraries (e.g., two,
three,
four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) and one
or more
. combinatorial libraries (e.g., two, three, four, five, seven, ten, twelve,
fifteen,
twenty, thirty, fifty, etc.). The kits of the invention may also contain
directions
or protocols for carrying out the methods of the invention.
In another aspect the invention provides kits for joining, deleting, or
replacing nucleic acid segments, these kits comprising at least one component
selected from the group consisting of ( 1 ) one or more recombination proteins
or
compositions comprising one or more recombination proteins, and (2) at least
one
nucleic acid molecule comprising one or more recombination sites (preferably a
vector having at least two different recombination specificities). The kits of
the
invention may also comprise one or more components selected from the group
consisting of (a) additional nucleic acid molecules comprising additional
recombination sites; (b) one or more enzymes having ligase activity; (c) one
or
more enzymes having polymerase activity; (d) one or more enzymes having
reverse transcriptase activity; (e) one or more enzymes having restriction
endonuclease activity; (f) one or more primers; (g) one or more nucleic acid
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-76-
libraries; (h) one or more supports; (i) one or more buffers; (j) one or more
detergents or solutions containing detergents; (k) one or more nucleotides;
(1) one
or more terminating agents; (m) one or more transfection reagents; (n) one or
more host cells; and (o) instructions for using the kit components.
Further, kits of the invention may contain one or more recombination
proteins selected from the goup consisting of Cre, Int, IHF, Xis, Flp, Fis,
Hin,
Gin, Cin, Tn3 resolvase, ~C31, TndX, XerC, and XerD.
In addition, recombination sites of kits of the invention will generally
have different recombination specificities each comprising att sites with
different
seven base pair overlap regions. In specific embodiments of the invention, the
first three nucleotides of these seven base pair overlap regions comprise
nucleotide sequences selected from the group consisting of AAA, AAC, AAG,
AAT, ACA, ACC, ACG, ACT, AGA, AGC, AGG, AGT, ATA, ATC, ATG;
ATT, CAA, CAC, CAG, CAT, CCA, CCC, CCG, CCT, CGA, CGC, CGG, CGT,
CTA, CTC, CTG CTT, GAA, GAC, GAG, GAT, GCA, GCC, GCG, GCT, GGA,
GGC, GGG, GGT, GTA, GTC, GTG, GTT, TAA, TAC, TAG, TAT, TCA, TCC,
TCG, TCT, TGA, TGC, TGG, TGT, TTA, TTC, TTG, and TTT.
In specific embodiments, kits of the invention contain compositions
comprising one or more recombination proteins capable of catalyzing
recombination between att sites. In related embodiments, these compositions
comprise one or more recombination proteins capable of catalyzing attB x attP
(BP) reactions, attL x attR (LR) reactions, or both BP and LR reactions.
Nucleic acid libraries supplied with kits of the invention may comprise
cDNA or genomic DNA. Further, these libraries may comprise polynucleotides
which encode variable domains of antibody light and heavy chains.
The invention also relates to compositions for carrying out the methods
of the invention and to compositions created while carrying out the methods of
the invention. In particular, the invention includes nucleic acid molecules
prepared by methods of the invention, methods for preparing host cells which
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
_77_
contain these nucleic acid molecules, host cells prepared by these methods,
and
methods employing these host cells for producing products (e.g., RNA, protein,
etc.) encoded by these nucleic acid molecules, products encoded by these
nucleic
acid molecules (e.g., RNA, protein, etc.).
The compositions, methods and kits of the invention are preferably
prepared and carried out using a phage-lambda site-specific recombination
system and more preferably with the GATEwAVTM Recombinational Cloning
System available from Invitrogen Corp., Life Technologies Division (Rockville,
Maryland). The GATEWAYTM Cloning Technology Instruction Manual
(Invitrogen Corp., Life Technologies Division) describes in more detail the
systems and is incorporated herein by reference in its entirety.
Other preferred embodiments of the invention will be apparent to one or
ordinary skill in the art in light of what is known in the art, in light of
the
following drawings and description of the invention, and in light of the
claims.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a schematic representation of the basic recombinational
cloning reaction.
Figure 2 is a schematic representation of the use of the present invention
to clone two nucleic acid segments by performing an LR recombination reaction.
Figure 3 is a schematic representation of the use of the present invention
to clone two nucleic acid segments by joining the segments using an LR
reaction
and then inserting the joined fragments into a Destination Vector using a BP
recombination reaction.
Figure 4 is a schematic representation of the use of the present invention
to clone two nucleic acid segments by performing a BP reaction followed by an
LR reaction.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
_7g_
Figure 5 is a schematic representation of two nucleic acid segments
having attB sites being cloned by performing a first BP reaction to generate
an
attL site on one segment and an attR on the other followed by an LR reaction
to
combine the segments. In variations of this process, P1, P2, and/or P3 can be
oligonucleotides or linear stretches of nucleotides.
Figure 6 is a schematic representation of the cloning of two nucleic acid
segments into two separate sites in a Destination Vector using an LR reaction.
Figure 7 is a schematic representation of the cloning of two nucleic acid
segments into two separate sites in a vector using a BP reaction.
Figure 8 is a schematic representation of the cloning of three nucleic acid
segments into three vectors using BP reactions, cloning the three segments
into
a single vector using an LR reaction, and generating segments separated by
attB
sites.
Figure 9 is a schematic representation of the cloning ofthree nucleic acid
segments into a single vector using a BP reaction and generating segments
separated by attR sites.
Figure 10 is a schematic representation of adding one or more of the same
or different molecules (nucleic acid, protein/peptide, carbohydrate, and/or
other
compounds) to a support (shaded box) by recombination. The open boxes
represent recombination sites.
Figure 11 is a schematic representation of joining multiple molecules
and/or compounds (A and B). Labels used in this figure correspond to those in
Figure 10. The addition of A and B can be simultaneous or sequential.
Figure 12 is a schematic representation of deleting a portion of a
molecule or compound (A) from a support. Labels used in this figure correspond
to those in Figure 10.
Figure 13 is a schematic representation of replacing a portion of a
molecule or compound (A) with a second molecule or compound (C). Labels
used in this figure correspond to those in Figure 10.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
_79_
Figure 14A is a plasmid map showing a construct for providing a
C-terminal fusion to a gene of interest. SupF encodes a suppressor function.
Thus, when supF is expressed, a GUS-GST fusion protein is produced. In
variations of this molecules, GUS can be any gene.
Figure 14B is a schematic representation of method for controlling both
gene suppression and expression. The T7 RNA polymerase gene contains one or
more (two are shown) amber stop codons (labeled "am") in place of tyrosine
codons. Leaky (uninduced) transcription from the inducible promoter makes
insufficient supF to result in the production of active T7 RNA polymerase.
Upon
induction, sufficient supF is produced to make active T7 RNA polymerase, which
results in increased expression of .supF, which results in further increased
expression of T7 RNA polymerase. The T7 RNA polymerase further induces
expression of Gene. Further, expression of supF results in the addition of a
C-terminal tag to the Gene expression product by suppression of the
intervening
amber stop codon.
Figure 15 is a plasmid map showing a construct for the production of N
and/or C-terminal fusions of a gene of interest. Circled numbers represent
amber,
ochre, or opal stop codons. Suppression of these stop codons result in
expression
of fusion tags on the N-terminus, the C-terminus, or both termini. In the
absence
of suppression, native protein is produced.
Figure 16 is a schematic representation ofthe single step insertion offour
separate DNA segments into a Destination Vector using LR reactions. In
particular, a first DNA segment having an attL 1 site at the 5' end and an
attL3 site
at the 3' end is linked to a second DNA segment having an attR3 site at the 5'
end
and an attL4 site at the 3' end. The second DNA segment is then linked to a
third
DNA segment having an attR4 site at the 5' end and an attLS site at the 3'
end.
The third DNA segment is then linked to a fourth DNA segment having an atlRS
site at the 5' end and an attL2 site at the 3' end. Thus, upon reaction with
LR
CLONASE~~M, the first, second, third, and fourth DNA segments are inserted
into
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-80-
a Destination Vector which contains a ccdB gene flanked by attRl and attR2
sites. The inserted DNA segments are separated from each other and vector
sequences by attBl, attB3, attB4, attBS, and attB2 sites.
Figures 17A and 17B show schematic representations of the construction
of a lux operon prepared according to the methods set out below in Example 18.
In accordance with the invention, one or more genes of the operon can be
replaced or deleted through recombination to construct one or more modified
operons and then tested for activity and/or effect on host cells.
Alternatively,
other genes (including variants and mutants) can be used in the initial
construction of the operon to replace one or more genes of interest, thereby
producing one or more modified operons.
Figure 18 is a schematic representation of the insertion of six separate
DNA segments into a vector using a two step, one vector process. In
particular,
a first DNA segment (DNA-A) having an attL 1 site at the 5' end and an attL3
site
at the 3' end is linked to a second DNA segment (DNA-B) having an attR3 site
at the 5' end and an attL4 site at the 3' end. The second DNA segment is then
linked to a third DNA segment (DNA-C) having an attR4 site at the 5' end and
an attLS site at the 3' end. A fourth DNA segment (DNA-D) having an attRl site
at the 5' end and an attL3 site at the 3' end is linked to a fifth DNA segment
(DNA-E) having an attR3 site at the 5' end and an attL4 site at the 3' end.
The
fifth DNA segment is then linked to a sixth DNA segment (DNA-F) having an
attR4 site at the ~S' end and an attL2 site at the 3' end. The two resulting
molecules (i. e., DNA-A-DNA-B-DNA-C and DNA-D-DNA-E-DNA-F) are then
inserted into the insertion vector. Each of the above reactions is catalyzed
by LR
2S CLONASETM. An LR reaction is also used to insert the joined DNA segments
into
a Destination Vector which contains a ccdB gene flanked by attRl and attR2
sites. The inserted DNA segments are separated from each other and the vector
by attBl, attB3, attB4, attBS, and attB2 sites. As described in Figure 6, for
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-81-
example, the assembled segments may be inserted into contiguous or
non-contiguous sites.
Figure 19 is a schematic representation of the insertion of six separate
DNA segments into a vector using a two step, two vector process. In
particular,
a first DNA segment (DNA-A) having an attB 1 site at the 5' end and an attL3
site
at the 3' end is linked to a second DNA segment (DNA-B) having an attR3 site
at the 5' end and an attL4 site at the 3' end. The second DNA segment is then
linked to a third DNA segment (DNA-C) having an attR4 site at the 5' end and
an attBS site at the 3' end. The linked DNA segments are then inserted into a
vector which contains attPl and attPS sites. Further, a fourth DNA segment
(DNA-D) having an attBS site at the 5' end and an attL3 site at the 3' end is
linked to a fifth DNA segment (DNA-E) having an attR3 site at the 5' end and
an
atlL4 site at the 3' end. The fifth DNA segment is then linked to a sixth DNA
segment (DNA-F) having an attR4 site at the 5' end and an attB2 site at the 3'
end. The linked DNA segments are then inserted into a vector which contains
attP l and attP2 sites.
After construction of the two plasmids as described, each of which
contains three inserted DNA segments, these plasmids are reacted with LR
CLONASETM to generate another plasmid which contains the six DNA segments
flanked by attB sites (i. e., B 1-DNA-A=B3-DNA-B-B4-DNA-C-BS-DNA-D-B3-
B 1-DNA-E-B4-DNA-F-B2).
Figure 20A is a schematic representation of an exemplary vector of the
invention which contains two different DNA inserts, the transcription of which
is driven in different directions by T7 promoters. Depending on the type of
transcripts which are to be produced, either of DNA-A and/or DNA-B may be in
an orientation which results in the production of either sense or anti-sense
RNA.
Figure 20B is a schematic representation of an exemplary vector of the
invention which contains one DNA insert, the transcription of which is driven
in
two different directions by T7 promoters. Thus, RNA produced by transcription
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-82-
driven by one promoter will be sense RNA and RNA produced by transcription
driven by the other promoter will be anti-sense RNA.
Figure 20C is a schematic representation of an exemplary vector of the
invention which contains two different DNA inserts having the same nucleotide
sequence (i. e., DNA-A), the transcription of which are driven in different
directions by two separate T7 promoters. In this example, RNA produced by
transcription driven by one promoter will be sense RNA and RNA produced by
transcription driven by the other promoter will be anti-sense RNA.
Figure 20D is a schematic representation of an exemplary vector of the
invention which contains two DNA inserts having the same nucleotide sequence
(i. e., DNA-A) in opposite orientations, the transcription of which is driven
by one
T7 promoter. A transcription termination signal is not present between the two
copies of DNA-A and the DNA-A inserts. Transcription of one segment
produces a sense RNA and of the other produces an anti-sense RNA. The RNA
produced from this vector will undergo intramolecular hybridization and, thus,
will form a double-stranded molecule with a hairpin turn.
Figure 20E is a schematic representation of two exemplary vectors of the
invention, each of which contains a DNA insert having the same nucleotide
sequence (i. e., DNA-A). Transcription of these inserts results in the
production
of sense and anti-sense RNA which may then hybridize to form double stranded
RNA molecules.
Figure 21A is a schematic representation of an exemplary vector of the
invention which contains three inserts, labeled "promoter," "coding sequence,"
and "Kan~." In this example, the inserted promoter drives expression of the
coding sequence. Further, an inserted DNA segment confers resistance to
kanamycin upon host cells which contain the vector. As discussed below in more
detail, a considerable number of vector components (e. g. , a selectable
marker (for
example a kanamycin resistance gene) cassette, an on cassette, a promoter
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-83-
cassette, a tag sequence cassette, and the like) can be inserted into or used
to
construct vectors of the invention.
Figure 21B is a schematic representation of an exemplary vector of the
invention which contains four inserts, labeled "promoter l," "coding sequence
1,"
"promoter 2," and "coding sequence 2." In this example, promoter 1 drives
expression of coding sequence 1 and promoter 2 drives expression of coding
sequence 2.
Figure 21C is a schematic representation of an exemplary vector of the
invention for homologous recombination. This vector which contains four
inserts, labeled "5' homology," , "NEO," "DNA-A," and "3' homology." The 5'
and 3' homology regions, in this example, are homologous to a chromosomal
region selected for insertion of a neomycin resistance marker ("NEO") and a
DNA segment ("DNA-A"). Targeting vectors of this type can be designed to
insert, delete and/or replace nucleic acid present in targeted nucleic acid
molecules.
Figures 22A and 22B show a schematic representation of processes for
preparing targeting vectors of the invention.
Figure 23 shows mRNA amplified with random-primed first strand
reverse transcription, then random-primed with PCR. These amplification
products are split into n pools, and each pool is amplified with random
primers
with a different pair of attB sites. The "R" suffix shows that some of the
attB
sites can be in inverted orientation. attB sites with either the standard or
reverse
orientations are used in separate pools to generate amplification products
where
the attB sites are linked in either standard or inverted orientation. When
these
sites react with inverted attP sites, attR sites are formed in the Entry
Clones
instead of attL sites. Hence, reacting pools with standard or inverted attRs
will
generate mixtures of molecules flanked by attR and attL sites. The
amplification
products are sized by gel purification, then cloned with the GATEWAYT"'' BP
reaction to make Entry Clones, each containing small inserts planked by attL
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-84-
sites, attR sites, or attL and attR, depending on the orientation of the attB
sites
and attP sites used. When Entry Clones are mixed together, the inserts clone
form a concatamer that can be cloned into a suitable Destination Vector, to
give
n inserts, each separated by an attB site. Sequencing a number of concatamers
generates a profile of mRNA molecules present in the original sample.
Figures 24A-24C show the sequences of a number of att sites (SEQ ID
NOs:I-36) suitable for use in methods and compositions of the invention.
Figures 25A-25B show a collection of Entry Clones which contain inserts
including, N-terminal tags or sequences (N-tag), open reading frames (ORF), C-
terminal tags or sequences (C-tag), selectable markers (amp), origins of
plasmid
replication (ori) and other vector elements (for example a IoxP site). Each
Entry
Clone vector element insert is flanked by attL or attR sites such that the
vector
elements can be linked together and form a new vector construct in an LR
Clonase reaction (shown in Figure 25B).
Figure 26A-26B show a process for constructing attP DONOR plasmids
containing attP sites of any orientation and specificity. Figure 26A shows
four
arrangements of attP sites in attP DONOR plasmids consisting of two
orientations of direct repeat and two orientations of inverted repeat attP
sites.
The four attP DONOR plasmids shown in Figure 26A can be used as templates
for PCR reactions with PCR primers that would anneal specifically to the core
of
an attP site and thus create an attL or attR site of any desired specificity
at the
ends of the PCR products. For each new attP DONOR vector to be constructed,
two such PCR products are generated, one consisting of the plasmid backbone
(ori-kan) and a second consisting of the ccdB and cat genes. The PCR products
are reacted together in LR Clonase reactions to generate new plasmids with
attP
sites of any orientation with any att site specificity.
Figure 27A shows a process for linking two nucleic acid segments, A and
B. The segments are cloned in two similarly configured plasmids. Each segment
is flanked by two recombination sites. One of the recombination sites on each
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-85-
plasmid is capable of reacting with its cognate partner on the other plasmid,
whereas the other two recombination sites do not react with any other site
present.
Each plasmid carries a unique origin of replication which may or may not be
conditional. Each plasmid also carries both positive and negative selectable
markers (+smX and smY, respectively) to enable selection against, and for
elements linked to a particular marker. Lastly, each plasmid carries a third
recombination site (loxP in this example), suitably positioned to enable
deletion
of undesired elements and retention of desired elements. In this example, the
two
plasmids are initially fused at L2 and R2 via a Gateway LxR reaction. This
results in the juxtaposition of segments A and B via a B2 recombination site,
and
the juxtapostion of sml and oriB via a P2 recombination site. The two loxP
sites
in the backbone that flank a series of plasmid elements are depicted in the
second
panel. Addition of the Cre protein will resolve the single large plasmid into
two
smaller ones. One of these will be the desired plasmid which carries the
linked
A and B segments with oriA now linked to sm2 and +sm4. The other carries a
set of dispensable and/or undesirable elements. Transformation of an
appropriate
host and subsequent imposition of appropriate genetic selections will result
in
loss of the undesired plasmid, while the desired plasmid is maintained.
Figure 27B shows a process for linking two chimeric nucleic acid
segments, A-B and C-D, constructed as shown above in Figure 27A. The
segments are cloned in two similarly configured plasmids. Each segment is
flanked by two recombination sites. One of these on each plasmid is capable of
reacting with its cognate partner on the other plasmid, whereas the other two
recombination sites do not react with any other site present. In this example,
the
two plasmids are initially fused at L2 and R2 via a Gateway LxR reaction. This
results in the juxtaposition of segments A and B via a B2 recombination site,
and
the juxtapostion of sml and oriB via a P2 recombination site. The two loxP
sites
in the backbone that flank a series of plasmid elements are depicted in the
second
panel. Addition of the Cre protein will resolve the single large plasmid into
two
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-86-
smaller ones. One of these will be the desired plasmid which carries the
linked
A-B and C-D segments with oriA now linked to sm2 and +sm4. The other
carries a set of dispensable and /or undesirable elements. Transformation of
an
appropriate host and subsequent imposition of appropriate genetic selections
will
result in loss of the undesired plasmid, whilst the desired plasmid is
maintained.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
In the description that follows, a number of terms used in recombinant
nucleic acid technology are utilized extensively. In order to provide a clear
and
more consistent understanding of the specification and claims, including the
scope to be given such terms, the following definitions are provided.
Gene: As used herein, the term "gene" refers to a nucleic acid which
contains information necessary for expression of a polypeptide, protein, or
untranslated RNA (e.g., rRNA, tRNA, anti-sense RNA). When the gene encodes
a protein, it includes the promoter and the structural gene open reading frame
sequence (ORF), as well as other sequences involved in expression of the
protein.
Of course, as would be clearly apparent to one skilled in the art, the
transcriptional and translational machinery required for production of the
gene
product is not included within the definition of a gene. When the gene encodes
an untranslated RNA, it includes the promoter and the nucleic acid which
encodes
the untranslated RNA.
Structural Gene: As used herein, the phrase "structural gene" refers to
refers to a nucleic acid which is transcribed into messenger RNA that is then
translated into a sequence of amino acids characteristic of a specific
polypeptide.
Host: As used herein, the term "host" refers to any prokaryotic or
eukaryotic organism that is a recipient of a replicable expression vector,
cloning
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
_87_
vector or any nucleic acid molecule. The nucleic acid molecule may contain,
but
is not limited to, a structural gene, a transcriptional regulatory sequence
(such as
a promoter, enhancer, repressor, and the like) and/or an origin of
replication. As
used herein, the terms "host," "host cell," "recombinant host" and
"recombinant
host cell" may be used interchangeably. For examples of such hosts, see
Maniatis
et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory,
Cold Spring Harbor, New York (1982).
Transcriptional Regulatory Sequence: As used herein, the phrase
"transcriptional regulatory sequence" refers to a functional stretch of
nucleotides
contained on a nucleic acid molecule, in any configuration or geometry, that
act
to regulate the transcription of (1) one or more structural genes (e.g., two,
three,
four, five, seven, ten, etc.) into messenger RNA or (2) one or more genes into
untranslated RNA. Examples of transcriptional regulatory sequences include,
but
are not limited to, promoters, enhancers, repressors, and the like.
Promoter: As used herein, a promoter is an example of a transcriptional
regulatory sequence, and is specifically a nucleic acid generally described as
the
5'-region of a gene located proximal to the start codon or nucleic acid which
encodes untranslated RNA. The transcription of an adjacent nucleic acid
segment
is initiated at the promoter region. A repressible promoter's rate of
transcription
decreases in response to a repressing agent. An inducible promoter's rate of
transcription increases in response to an inducing agent. A constitutive
promoter's rate of transcription is not specifically regulated, though it can
vary
under the influence of general metabolic conditions.
Insert: As used herein, the term "insert" refers to a desired nucleic acid
segment that is a part of a larger nucleic acid molecule. In many instances,
the
insert will be introduced into the larger nucleic acid molecule. For example,
the
nucleic acid segments labeled ccdB and DNA-A in Figure 2, are nucleic acid
inserts with respect to the larger nucleic acid molecule shown therein. In
most
instances, the insert will be flanked by recombination sites (e.g., at least
one
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
_88_
recombination site at each end). In certain embodiments, however, the insert
will
only contain a recombination site on one end.
Target Nucleic Acid Molecule: As used herein, the phrase "target
nucleic acid molecule" refers to a nucleic acid segment of interest,
preferably
nucleic acid which is to be acted upon using the compounds and methods of the
present invention. Such target nucleic acid molecules preferably contain one
or
more genes (e.g., two, three, four, five, seven, ten, twelve, fifteen, twenty,
thirty,
fifty, etc.) or portions of genes.
Insert Donor: As used herein, the phrase "Insert Donor" refers to one of
the two parental nucleic acid molecules (e.g., RNA or DNA) of the present
invention which carries the Insert (see Figure 1 ). The Insert Donor molecule
comprises the Insert flanked on both sides with recombination sites. The
Insert
Donor can be linear or circular. In one embodiment of the invention, the
Insert
Donor is a circular nucleic acid molecule, optionally supercoiled, and further
comprises a cloning vector sequence outside of the recombination signals. When
a population of Inserts or population of nucleic acid segments are used to
make
the Insert Donor, a population of Insert Donors result and may be used in
accordance with the invention.
Product: As used herein, the term "Product" refers to one the desired
daughter molecules comprising the A and D sequences which is produced after
the second recombination event during the recombinational cloning process (see
Figure 1). The Product contains the nucleic acid which was to be cloned or
subcloned. In accordance with the invention, when a population of Insert
Donors
are used, the resulting population of Product molecules will contain all or a
' portion of the population of Inserts of the Insert Donors and preferably
will
contain a representative population of the original molecules of the Insert
Donors.
Byproduct: As used herein, the term "Byproduct" refers to a daughter
molecule (a new clone produced after the second recombination event during the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-89-
recombinational cloning process) lacking the segment which is desired to be
cloned or subcloned.
Cointegrate: As used herein, the term "Cointegrate" refers to at least one
recombination intermediate nucleic acid molecule of the present invention that
contains both parental (starting) molecules. Cointegrates may be linear or
circular. RNA and polypeptides may be expressed from cointegrates using an
appropriate host cell strain, for example E. coli DB3.1 (particularly E. coli
LIBRARY EFFICIENCY~ DB3.1TM Competent Cells), and selecting for both
selection markers found on the cointegrate molecule.
Recognition Sequence: As used herein, the phrase "recognition
sequence" refers to a particular sequence to which a protein, chemical
compound,
DNA, or RNA molecule (e.g., restriction endonuclease, a modification
methylase,
or a recombinase) recognizes and binds. In the present invention; a
recognition
sequence will usually refer to a recombination site. For example, the
recognition
sequence for Cre recombinase is loxP which is a 34 base pair sequence
comprising two 13 base pair inverted repeats (serving as the recombinase
binding
sites) flanking an 8 base pair core sequence. (See Figure 1 of Sauer, B.,
Current
Opinion in Biotechnology 5:521-527 (1994).) Other examples of recognition
sequences are the attB, attP, attL, and attR sequences which are recognized by
the recombinase enzyme ~, Integrase. attB is an approximately 25 base pair
sequence containing two 9 base pair core-type Int binding sites and a 7 base
pair
overlap region. attP is an approximately 240 base pair sequence containing
core-type Int binding sites and arm-type Int binding sites as well as sites
for
auxiliary proteins integration host factor (IHF), FIS and excisionase (Xis).
(See
Landy, Current Opinion in Biotechnology 3:699-707 (1993).) Such sites may
also be engineered according to the present invention to enhance production of
products in the methods of the invention. For example, when such engineered
sites lack the P 1 or H 1 domains to make the recombination reactions
irreversible
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-90-
(e.g., attR or attP), such sites may be designated attR' or attP' to show that
the
domains of these sites have been modified in some way.
Recombination Proteins: As used herein, the phrase "recombination
proteins" includes excisive or integrative proteins, enzymes, co-factors or
associated proteins that are involved in recombination reactions involving one
or
more recombination sites (e.g., two, three, four, five, seven, ten, twelve,
fifteen,
twenty, thirty, fifty, etc.), which may be wild-type proteins (see Landy,
Current
Opinion in Biotechnology 3:699-707 (1993)), or mutants, derivatives (e.g.,
fusion
proteins containing the recombination protein sequences or fragments thereof),
fragments, and variants thereof. Examples of recombination proteins include
Cre,
Int, IHF, Xis, Flp, Fis, Hin, Gin, ~C31, Cin, Tn3 resolvase, TndX, XerC, XerD,
TnpX, Hjc, Gin, SpCCEl, and ParA.
Recombination Site: A used herein, the phrase "recombination site"
refers to a recognition sequence on a nucleic acid molecule which participates
in
an integration/recombination reaction by recombination proteins. Recombination
sites are discrete sections or segments of nucleic acid on the participating
nucleic
acid molecules that are recognized and bound by a site-specific recombination
protein during the initial stages of integration or recombination. For
example, the
recombination site for Cre recombinase is loxP which is a 34 base pair
sequence
comprised of two 13 base pair inverted repeats (serving as the recombinase
binding sites) flanking an 8 base pair core sequence. (See Figure 1 of Sauer,
B.,
Curr. Opin. Biotech. 5:521-527 (1994).) Other examples of recognition
sequences include the attB, attP, attL, and attR sequences described herein,
and
mutants, fragments, variants and derivatives thereof, which are recognized by
the
recombination protein ~, Int and by the auxiliary proteins integration host
factor
(IHF), FIS and excisionase (Xis). (See Landy, Curr. Opin. Biotech. 3:699-707
(1993).)
Recombination sites may be added to molecules by any number of known
methods. For example, recombination sites can be added to nucleic acid
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-91-
molecules by blunt end ligation, PCR performed with fully or partially random
primers, or inserting the nucleic acid molecules into an vector using a
restriction
site which flanked by recombination sites.
Recombinational Cloning: As used herein, the phrase "recombinational
cloning" refers to a method, such as that described in U.S. Patent Nos.
5,888,732
and 6,143,557 (the contents of which are fully incorporated herein by
reference),
whereby segments of nucleic acid molecules or populations of such molecules
are
exchanged, inserted, replaced, substituted or modified, in vitro or in vivo.
Preferably, such cloning method is an in vitro method.
Repression Cassette: As used herein, the phrase "repression cassette"
refers to a nucleic acid segment that contains a repressor or a selectable
marker
present in the subcloning vector.
Selectable Marker: As used herein, the phrase "selectable marker" refers
to a nucleic acid segment that allows one to select for or against a molecule
(e.g.,
a replicon) or a cell that contains it, often under particular conditions.
These
markers can encode an activity, such as, but not limited to, production of
RNA,
peptide, or protein, or can provide a binding site for RNA, peptides,
proteins,
inorganic and organic compounds or compositions and the like. Examples of
selectable markers include but are not limited to: (1) nucleic acid segments
that
encode products which provide resistance against otherwise toxic compounds
(e.g., antibiotics); (2) nucleic acid segments that encode products which are
otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic
markers);
(3) nucleic acid segments that encode products which suppress the activity of
a
gene product; (4) nucleic acid segments that encode products which can be
readily identified (e.g., phenotypic markers such as ((3-galactosidase, green
fluorescent protein (GFP), yellow flourescent protein (YFP), red fluorescent
protein (RFP), cyan fluorescent protein (CFP), and cell surface proteins); (5)
nucleic acid segments that bind products which are otherwise detrimental to
cell
survival and/or function; (6) nucleic acid segments that otherwise inhibit the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-92-
activity of any of the nucleic acid segments described in Nos. 1-5 above
(e.g.,
antisense oligonucleotides); (7) nucleic acid segments that bind products that
modify a substrate (e. g., restriction endonucleases); (8) nucleic acid
segments that
can be used to isolate or identify a desired molecule (e. g. , specific
protein binding
S sites); (9) nucleic acid segments that encode a specific nucleotide sequence
which
can be otherwise non-functional (e.g., for PCR amplification of subpopulations
of molecules); (10) nucleic acid segments, which when absent, directly or
indirectly confer resistance or sensitivity to particular compounds; and/or
(11)
nucleic acid segments that encode products which either are toxic (e.g.,
Diphtheria toxin) or convert a relatively non-toxic compound to a toxic
compound (e.g., Herpes simplex thymidine kinase, cytosine deaminase) in
recipient cells; (12) nucleic acid segments that inhibit replication,
partition or
heritability of nucleic acid molecules that contain them; and/or (13) nucleic
acid
segments that encode conditional replication functions, e.g., replication in
certain
hosts or host cell strains or under certain environmental conditions (e.g.,
temperature, nutritional conditions, etc.).
Selection Scheme: As used herein, the phrase "selection scheme" refers
to any method which allows selection, enrichment, or identification of a
desired
nucleic acid molecules or host cells contacting them (in particular Product or
Products) from a mixture containing an Entry Clone or Vector, a Destination
Vector, a Donor Vector, an Expression Clone or Vector, any intermediates
(e.g.,
a Cointegrate or a replicon), and/or Byproducts). In one aspect, selection
schemes of the invention rely on one or more selectable markers. The selection
schemes of one embodiment have at least two components that are either linked
or unlinked during recombinational cloning. One component is a selectable
marker. The other component controls the expression in vitro or in vivo of the
selectable marker, or survival of the cell (or the nucleic acid molecule,
e.g., a
replicon) harboring the plasmid carrying the selectable marker. Generally,
this
controlling element will be a repressor or inducer of the selectable marker,
but
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-93-
other means for controlling expression or activity of the selectable marker
can be
used. Whether a repressor or activator is used will depend on whether the
marker
is for a positive or negative selection, and the exact arrangement of the
various
nucleic acid segments, as will be readily apparent to those skilled in the
art. In
some preferred embodiments, the selection scheme results in selection of or
enrichment for only one or more desired nucleic acid molecules (such as
Products). As defined herein, selecting for a nucleic acid molecule includes
(a)
selecting or enriching for the presence of the desired nucleic acid molecule
(referred to as a "positive selection scheme"), and (b) selecting or enriching
against the presence of nucleic acid molecules that are not the desired
nucleic acid
molecule (referred to as a "negative selection scheme").
In one embodiment, the selection schemes (which can be carned out in
reverse) will take one of three forms, which will be discussed in terms of
Figure 1. The first, exemplified herein with a selectable marker and a
repressor
therefore, selects for molecules having segment D and lacking segment C. The
second selects against molecules having segment C and for molecules having
segment D. Possible embodiments of the second form would have a nucleic acid
segment carrying a gene toxic to cells into which the in vitro reaction
products
are to be introduced. A toxic gene can be a nucleic acid that is expressed as
a
toxic gene product (a toxic protein or RNA), or can be toxic in and of itself.
(In
the latter case, the toxic gene is understood to carry its classical
definition of
"heritable trait".)
Examples of such toxic gene products are well known in the art, and
include, but are not limited to, restriction endonucleases (e.g., DpnI, Nla3,
etc.);
apoptosis-related genes (e.g., ASK1 or members of the bcl-2/ced 9 family);
retroviral genes; including those of the human immunodeficiency virus (HIV);
defensins such as NP-1; inverted repeats or paired palindromic nucleic acid
sequences; bacteriophage lytic genes such as those from ~X 174 or
bacteriophage
T4; antibiotic sensitivity genes such as rpsL; antimicrobial sensitivity genes
such
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-94-
as pheS; plasmid killer genes' eukaryotic transcriptional vector genes that
produce
a gene product toxic to bacteria, such as GATA-1; genes that kill hosts in the
absence of a suppressing function, e.g., kicB, ccdB, X174 E (Liu, Q. et al.,
Curr. Biol. 8:1300-1309 (1998)); and other genes that negatively affect
replicon
stability and/or replication. A toxic gene can alternatively be selectable in
vitro,
e.g., a restriction site.
Many genes coding for restriction endonucleases operably linked to
inducible promoters are known, and may be used in the present invention. (See,
e.g., U.S. Patent Nos. 4,960,707 (DpnI and DpnII); 5,000,333, 5,082,784 and
5,192,675 (KpnI); 5,147,800 (NgoAIII and NgoAI); 5,179,015 (FspI and HaeIII):
5,200,333 (HaeII and TaqI); 5,248,605 (HpaII); 5,312,746 (CIaI); 5,231,021 and
5,304,480 (XhoI and XhoII); 5,334,526 (AIuI); 5,470,740 (NsiI); 5,534,428
(SstIlSacI); 5,202,248 (NcoI); 5,139,942 (NdeI); and 5,098,839 (PacI). (See
also
Wilson, G.G., Nucl. Acids Res. 19:2539-2566 (1991); and Lunnen, K.D., et al.,
Gene 74:25-32 (1988).)
In the second form, segment D carries a selectable marker. The toxic gene
would eliminate transformants harboring the Vector Donor, Cointegrate, and
Byproduct molecules, while the selectable marker can be used to select for
cells
containing the Product and against cells harboring only the Insert Donor.
The third form selects for cells that have both segments A and D in cis on
the same molecule, but not for cells that have both segments in trans on
different
molecules. This could be embodied by a selectable marker that is split into
two
inactive fragments, one each on segments A and D.
The fragments are so arranged relative to the recombination sites that
when the segments are brought together by the recombination event, they
reconstitute a functional selectable marker. For example, the recombinational
event can link a promoter with a structural nucleic acid molecule (e.g., a
gene),
can link two fragments of a structural nucleic acid molecule, or can link
nucleic
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-95-
acid molecules that encode a heterodimeric gene product needed for survival,
or
can link portions of a replicon.
Site-Specific Recombinase: As used herein, the phrase "site-specific
recombinase" refers to a type of recombinase which typically has at least the
following four activities (or combinations thereof): (1) recognition of
specific
nucleic acid sequences; (2) cleavage of said sequence or sequences; (3)
topoisomerase activity involved in strand exchange; and (4) ligase activity to
reseal the cleaved strands of nucleic acid. (See Sauer, B., Current Opinions
in
Biotechnology 5:521-527 (1994).) Conservative site-specific recombination is
distinguished from homologous recombination and transposition by a high degree
of sequence specificity for both partners. The strand exchange mechanism
involves the cleavage and rejoining of specific nucleic acid sequences in the
absence of DNA synthesis (Landy, A. (1989) Ann. Rev. Biochem. 58:913-949).
Homologous Recombination: As used herein, the phrase "homologous
recombination" refers to the process in which nucleic acid molecules with
similar
nucleotide sequences associate and exchange nucleotide strands. A nucleotide
sequence of a first nucleic acid molecule which is effective for engaging in
homologous recombination at a predefined position of a second nucleic acid
molecule will therefore have a nucleotide sequence which facilitates the
exchange
of nucleotide strands between the first nucleic acid molecule and a defined
position of the second nucleic acid molecule. Thus, the first nucleic acid
will
generally have a nucleotide sequence which is sufficiently complementary to a
portion of the second nucleic acid molecule to promote nucleotide base
pairing.
Homologous recombination requires homologous sequences in the two
recombining partner nucleic acids but does not require any specific sequences.
As indicated above, site-specific recombination which occurs, for example, at
recombination sites such as att sites, is not considered to be "homologous
recombination," as the phrase is used herein.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-96-
Vector: As used herein, the terms "vector" refers to a nucleic acid
molecule (preferably DNA) that provides a useful biological or biochemical
property to an insert. Examples include plasmids, phages, autonomously
replicating sequences (ARS), centromeres, and other sequences which are able
to replicate or be replicated in vitro or in a host cell, or to convey a
desired
nucleic acid segment to a desired location within a host cell. A vector can
have
one or more restriction endonuclease recognition sites (e.g., two, three,
four, five,
seven, ten, etc.) at which the sequences can be cut in a determinable fashion
without loss of an essential biological function of the vector, and into which
a
nucleic acid fragment can be spliced in order to bring about its replication
and
cloning. Vectors can further provide primer sites (e.g., for PCR),
transcriptional
and/or translational initiation and/or regulation sites, recombinational
signals,
replicons, selectable markers, etc. Clearly, methods of inserting a desired
nucleic
acid fragment which do not require the use of recombination, transpositions or
restriction enzymes (such as, but not limited to, uracil N-glycosylase (UDG)
cloning of PCR fragments (U.S. Patent No. 5,334,575 and 5,888,795, both of
which are entirely incorporated herein by reference), T:A cloning, and the
like)
can also be applied to clone a fragment into a cloning vector to be used
according
to the present invention. The cloning vector can further contain one or more
selectable markers (e.g., two, three, four, five, seven, ten, etc.) suitable
for use in
the identification of cells transformed with the cloning vector.
Subcloning Vector: As used herein, the phrase "subcloning vector"
refers to a cloning vector comprising a circular or linear nucleic acid
molecule
which includes, preferably, an appropriate replicon. In the present invention,
the
subcloning vector (segment D in Figure 1) can also contain functional and/or
regulatory elements that are desired to be incorporated into the final product
to
act upon or with the cloned nucleic acid insert (segment A in Figure 1 ). The
subcloning vector can also contain a selectable marker (preferably DNA).
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-97-
Vector Donor: As used herein, the phrase "Vector Donor" refers to one
of the two parental nucleic acid molecules (e.g., RNA or DNA) of the present
invention which carries the nucleic acid segments comprising the nucleic acid
vector which is to become part of the desired Product. The Vector Donor
comprises a subcloning vector D (or it can be called the cloning vector if the
Insert Donor does not already contain a cloning vector) and a segment C
flanked
by recombination sites (see Figure 1 ). Segments C and/or D can contain
elements
that contribute to selection for the desired Product daughter molecule, as
described above for selection schemes. The recombination signals can be the
same or different, and can be acted upon by the same or different
recombinases.
In addition, the Vector Donor can be linear or circular.
Primer: As used herein, the term "primer" refers to a single stranded or
double stranded oligonucleotide that is extended by covalent bonding of
nucleotide monomers during amplification or polymerization of a nucleic acid
1 S molecule (e. g., a DNA molecule). In one aspect, the primer may be a
sequencing
primer (for example, a universal sequencing primer). In another aspect, the
primer may comprise a recombination site or portion thereof.
Adapter: As used herein, the term "adapter" refers to an oligonucleotide
or nucleic acid fragment or segment (preferably DNA) which comprises one or
more recombination sites (or portions of such recombination sites) which in
accordance with the invention can be added to a circular or linear Insert
Donor
molecule as well as other nucleic acid molecules described herein. When using
portions of recombination sites, the missing portion may be provided by the
Insert Donor molecule. Such adapters may be added at any location within a
circular or linear molecule, although the adapters are preferably added at or
near
one or both termini of a linear molecule. Preferably, adapters are positioned
to
be located on both sides (flanking) a particular nucleic acid molecule of
interest.
In accordance with the invention, adapters may be added to nucleic acid
molecules of interest by standard recombinant techniques (e.g., restriction
digest
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-98-
and ligation). For example, adapters may be added to a circular molecule by
first
digesting the molecule with an appropriate restriction enzyme, adding the
adapter
at the cleavage site and reforming the circular molecule which contains the
adapters) at the site of cleavage. In other aspects, adapters may be added by
homologous recombination, by integration of RNA molecules, and the like.
Alternatively, adapters may be ligated directly to one or more and preferably
both
termini of a linear molecule thereby resulting in linear molecules) having
adapters at one or both termini. In one aspect of the invention, adapters may
be
added to a population of linear molecules, (e.g., a cDNA library or genomic
DNA
which has been cleaved or digested) to form a population of linear molecules
containing adapters at one and preferably both termini of all or substantial
portion
of said population.
Adapter-Primer: As used herein, the phrase "adapter-primer" refers to
a primer molecule which comprises one or more recombination sites (or portions
of such recombination sites) which in accordance with the invention can be
added
to a circular or linear nucleic acid molecule described herein. When using
portions of recombination sites, the missing portion may be provided by a
nucleic
acid molecule (e.g., an adapter) of the invention. Such adapter-primers may be
added at any location within a circular or linear molecule, although the
adapter-primers are preferably added at or near one or both termini of a
linear
molecule. Examples of such adapter-primers and the use thereof in accordance
with the methods of the invention are shown in Example 8 herein. Such adapter-
primers may be used to add one or more recombination sites or portions thereof
to circular or linear nucleic acid molecules in a variety of contexts and by a
variety of techniques, including but not limited to amplification (e.g., PCR),
ligation (e.g., enzymatic or chemical/synthetic ligation), recombination
(e.g.,
homologous or non-homologous (illegitimate) recombination) and the like.
Template: As used herein, the term "template" refers to a double
stranded or single stranded nucleic acid molecule which is to be amplified,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-99-
synthesized or sequenced. In the case of a double-stranded DNA molecule,
denaturation of its strands to form a first and a second strand is preferably
performed before these molecules may be amplified, synthesized or sequenced,
or the double stranded molecule may be used directly as a template. For single
stranded templates, a primer complementary to at least a portion of the
template
hybridizes under appropriate conditions and one or more polypeptides having
polymerase activity (e.g., two, three, four, five, or seven DNA polymerases
and/or reverse transcriptases) may then synthesize a molecule complementary to
all or a portion of the template. Alternatively, for double stranded
templates, one
or more transcriptional regulatory sequences (e.g., two, three, four, five,
seven or
more promoters) may be used in combination with one or more polymerases to
make nucleic acid molecules complementary to all or a portion of the template.
The newly synthesized molecule, according to the invention, may be of equal or
shorter length compared to the original template. Mismatch incorporation or
strand slippage during the synthesis or extension of the newly synthesized
molecule may result in one or a number of mismatched base pairs. Thus, the
synthesized molecule need not be exactly complementary to the template.
Additionally, a population of nucleic acid templates may be used during
synthesis
or amplification to produce a population of nucleic acid molecules typically
representative of the original template population.
Incorporating: As used herein, the term "incorporating" means
becoming a part of a nucleic acid (e.g., DNA) molecule or primer.
Library: As used herein, the term "library" refers to a collection of
nucleic acid molecules (circular or linear). In one embodiment, a library may
comprise a plurality of nucleic acid molecules (e.g., two, three, four, five,
seven,
ten, twelve, fifteen, twenty, thirty, fifty, one hundred, two hundred, five
hundred
one thousand, five thousand, or more), which may or may not be from a common
source organism, organ, tissue, or cell. In another embodiment, a library is
representative of all or a portion or a significant portion of the nucleic
acid
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-100-
content of an organism (a "genomic" library), or a set of nucleic acid
molecules
representative of all or a portion or a significant portion of the expressed
nucleic
acid molecules (a cDNA library or segments derived therefrom) in a cell,
tissue,
organ or organism. A library may also comprise nucleic acid molecules having
S random sequences made by de novo synthesis, mutagenesis of one or more
nucleic acid molecules, and the like. Such libraries may or may not be
contained
in one or more vectors (e.g., two, three, four, five, seven, ten, twelve,
fifteen,
twenty, thirty, fifty, etc.).
Amplification: As used herein, the term "amplification" refers to any in
vitro method for increasing the number of copies of a nucleic acid molecule
with
the use of one or more polypeptides having polymerase activity (e.g., one,
two,
three, four or more nucleic acid polymerases or reverse transcriptases).
Nucleic
acid amplification results in the incorporation of nucleotides into a DNA
and/or
RNA molecule or primer thereby forming a new nucleic acid molecule
complementary to a template. The formed nucleic acid molecule and its template
can be used as templates to synthesize additional nucleic acid molecules. As
used
herein, one amplification reaction may consist of many rounds of nucleic acid
replication. DNA amplification reactions include, for example, polymerase
chain
reaction (PCR). One PCR reaction may consist of 5 to 100 cycles of
denaturation
and synthesis of a DNA molecule.
Nucleotide: As used herein, the term "nucleotide" refers to a
base-sugar-phosphate combination. Nucleotides are monomeric units of a nucleic
acid molecule (DNA and RNA). The term nucleotide includes ribonucleoside
triphosphates ATP, UTP, CTG, GTP and deoxyribonucleoside triphosphates such
as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such
derivatives include, for example, [aS]dATP, 7-deaza-dGTP and 7-deaza-dATP.
The term nucleotide as used herein also refers to dideoxyribonucleoside
triphosphates (ddNTPs) and their derivatives. Illustrated examples of
dideoxyribonucleoside triphosphates include, but are not limited to, ddATP,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-101-
ddCTP, ddGTP, ddITP, and ddTTP. According to the present invention, a
"nucleotide" may be unlabeled or detectably labeled by well known techniques.
Detectable labels include, for example, radioactive isotopes, fluorescent
labels,
chemiluminescent labels, bioluminescent labels and enzyme labels.
Nucleic Acid Molecule: As used herein, the phrase "nucleic acid
molecule" refers to a sequence of contiguous nucleotides (riboNTPs, dNTPs or
ddNTPs, or combinations thereof) of any length which may encode a full-length
polypeptide or a fragment of any length thereof, or which may be non-coding.
As used herein, the terms "nucleic acid molecule" and "polynucleotide" may be
used interchangeably and include both RNA and DNA.
Oligonucleotide: As used herein, the term "oligonucleotide" refers to a
synthetic or natural molecule comprising a covalently linked sequence of
nucleotides which are joined by a phosphodiester bond between the 3' position
of the pentose of one nucleotide and the 5' position of the pentose of the
adjacent
nucleotide.
Polypeptide: As used herein, the term "polypeptide" refers to a sequence
of contiguous amino acids, of any length. The terms "peptide," "oligopeptide,"
or "protein" may be used interchangeably herein with the term "polypeptide."
Hybridization: As used herein, the terms "hybridization" and
"hybridizing" refer to base pairing of two complementary single-stranded
nucleic
acid molecules (RNA and/or DNA) to give a double stranded molecule. As used
herein, two nucleic acid molecules may hybridize, although the base pairing is
not completely complementary. Accordingly, mismatched bases do not prevent
hybridization of two nucleic acid molecules provided that appropriate
conditions,
well known in the art, are used. In some aspects, hybridization is said to be
under
"stringent conditions." By "stringent conditions," as the phrase is used
herein, is
meant overnight incubation at 42°C in a solution comprising: 50%
formamide,
5x SSC (750 mM NaCI, 75mM trisodium citrate), 50 mM sodium phosphate (pH
7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 pg/ml denatured,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-102-
sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at
about 65°C.
Other terms used in the fields of recombinant nucleic acid technology and
molecular and cell biology as used herein will be generally understood by one
of
ordinary skill in the applicable arts.
Overview
The present invention relates to methods, compositions and kits for the
recombinational joining of two or more segments or nucleic acid molecules or
other molecules and/or compounds (or combinations thereof). The invention also
relates to attaching such linked nucleic acid molecules or other molecules
and/or
compounds to one or more supports or structures preferably through
recombination sites or portions thereof. Thus, the invention generally relates
to
linking any number of nucleic acids or other molecules andlor compounds via
nucleic acid linkers comprising one or more recombination sites (e.g., two,
three,
1 S four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.) or
portions thereof.
The linked products produced by the invention may comprise any number
of the same or different nucleic acids or other molecules and/or compounds,
depending on the starting materials. Such starting materials include, but are
not
limited to, any nucleic acids (or derivatives thereof such as peptide nucleic
acids
(PNAs)), chemical compounds, detectably labeled molecules (such as fluorescent
molecules and chemiluminescent molecules), drugs, peptides or proteins,
lipids,
carbohydrates and other molecules and/or compounds comprising one or more
recombination sites or portions thereof. Through recombination of such
recombination sites according to the invention, any number or combination of
such starting molecules and/or compounds can be linked to make linked products
of the invention. In addition, deletion or replacement of certain portions or
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-103-
components of the linked products of the invention can be accomplished by
recombination.
In some embodiments, the joined segments may be inserted into a
different nucleic acid molecule such as a vector, preferably by
recombinational
cloning methods but also by homologous recombination. Thus, in some
embodiments, the present invention relates to the construction of nucleic acid
molecules (RNA or DNA) by combining two or more segments of nucleic acid
(e.g., two, three, four, five, seven, ten, twelve, fifteen, twenty, thirty,
fifty, etc.)
by a recombination reaction and inserting the joined two or more segments into
a vector by recombinational cloning.
In embodiments where the joined nucleic acid molecules are to be further
combined with an additional nucleic acid molecule by a recombination reaction,
the timing of the two recombination events, i. e. , the joining of the
segments and
the insertion of the segments into a vector, is not critical. That is to say,
it is not
critical to the present invention, for example, whether the two or more
nucleic
acid segments are joined together before insertion into the vector or whether
one
recombination site on each segment first reacts with a recombination site on
the
vector and subsequently the recombination sites on the nucleic acid segments
react with each other to join the segments. Moreover, the nucleic acid
segments
can be cloned in any one or a number of positions within the vector and do not
need to be inserted adjacent to each other, although, in some embodiments,
joining of two or more of such segments within the vector is preferred.
In accordance with the invention, recombinational cloning allows efficient
selection and identification of molecules (particularly vectors) containing
the
combined nucleic acid segments. Thus, two or more nucleic acid segments of
interest can be combined and, optionally, inserted into a single vector
suitable for
further manipulation of the combined nucleic acid molecule.
In a fundamental embodiment, at least two nucleic acid segments, each
comprising at least one recombination site, are contacted with suitable
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-104-
recombination proteins to effect the joining of all or a portion of the two
molecules, depending on the position of the recombination sites in the
molecules.
Each individual nucleic acid segment may comprise a variety of sequences
including, but not limited to sequences suitable for use as primer sites
(e.g.,
sequences for which a primer such as a sequencing primer or amplification
primer
may hybridize to initiate nucleic acid synthesis, amplification or
sequencing),
transcription or translation signals or regulatory sequences such as promoters
and/or enhancers, ribosomal binding sites, Kozak sequences, start codons,
termination signals such as stop codons, origins of replication, recombination
sites (or portions thereof), selectable markers, and genes or portions of
genes to
create protein fusions (e.g., N-terminal or C-terminal) such as GST, GUS, GFP,
YFP, CFP, maltose binding protein, 6 histidines (HIS6), epitopes, haptens and
the
like and combinations thereof. The vectors used for cloning such segments may
also comprise these functional sequences (e.g., promoters, primer sites,
etc.).
After combination of the segments comprising such sequences and optimally the
cloning of the sequences into one or more vectors (e.g., two, three, four,
five,
seven, ten, twelve, fifteen, etc.), the molecules may be manipulated in a
variety
of ways, including sequencing or amplification of the target nucleic acid
molecule
(i.e., by using at least one of the primer sites introduced by the integration
sequence), mutation of the target nucleic acid molecule (i. e. , by insertion,
deletion
or substitution in or on the target nucleic acid molecule), insertion into
another
molecule by homologous recombination, transcription of the target nucleic acid
molecule, and protein expression from the target nucleic acid molecule or
portions thereof (i.e., by expression of translation and/or transcription
signals
contained by the segments and/or vectors).
The present invention also relates to the generation of combinatorial
libraries using the recombinational cloning methods disclosed. Thus, one or
more
of the nucleic acid segments joined may comprise a nucleic acid library. Such
a
library may comprise, for example, nucleic acid molecules corresponding to
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-105-
permutations of a sequence coding for a peptide, polypeptide or protein
sequence.
The permutations can be joined to another nucleic acid segment consisting of a
single sequence or, alternatively, the second nucleic acid segment may also be
a
library corresponding to permutation of another peptide, polypeptide or
protein
sequence such that joining of the two segments may produce a library
representing all possible combinations of all the permutations of the two
peptide,
polypeptide or proteins sequences. These nucleic acid segments may be
contiguous or non-contiguous. Numerous examples of the use of combinatorial
libraries are known in the art. (See, e.g., Waterhouse, et al., Nucleic Acids
Res.,
1993, Vol. 21, No. 9, 2265-2266, Tsurushita, et al., Gene, 1996, Vol. 172 No.
1,
59-63, Persson, Int. Rev. Immunol. 1993 10:2-3 153-63, Chanock, et al., Infect
Agents Dis 1993 Jun 2:3 118-31, Burioni, et al., Res Virol 1997 Mar-Apr 148:2
161-4, Leung, Thromb. Haemost. 1995 Jul 74:1 373-6, Sandhu, Crit. Rev.
Biotechnol. 1992,12:5-6 437-62 and United States patents 5,733,743, 5,871,907
and 5,858,657, all of which are specifically incorporated herein by
reference.)
When one or more nucleic acid segments used in methods and
compositions of the invention are mutated, these segments may contain either
( 1 ) a specified number of mutations or (2) an average specified number of
mutations. Further, these mutations may be scored with reference to the
nucleic
acid segments themselves or the expression products (e.g., polypeptides of
such
nucleic acid segments. For example, nucleic acid molecules of a library may be
mutated to produce nucleic acid molecules which are, on average, at least 50%,
at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least
80%,
at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least
98%,
or at least 99% identical to corresponding nucleic acid molecules of the
original
library. Similarly, nucleic acid molecules of a library may be mutated to
produce
nucleic acid molecules which, encode polypeptides that are, on average, at
least
SO%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at
least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at
least
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-106-
98%, or at least 99% identical to polypeptides encoded by corresponding
nucleic
acid molecules of the original library.
Recombination Sites
Recombination sites for use in the invention may be any nucleic acid that
S can serve as a substrate in a recombination reaction. Such recombination
sites
may be wild-type or naturally occurring recombination sites, or modified,
variant,
derivative, or mutant recombination sites. Examples of recombination sites for
use in the invention include, but are not limited to, phage-lambda
recombination
sites (such as attP, attB, attL, and attR and mutants or derivatives thereof)
and
recombination sites from other bacteriophage such as phi80, P22, P2,186, P4
and
P1 (including lox sites such as IoxP and IoxP511). Mutated att sites (e.g.,
attB
1-10, attP 1-10, attR 1-10 and attL 1-10) are described in Example 9 below and
in previous patent U.S. Appl. No. 60/136,744, filed May 28,1999, and U.S.
Appl.
No. 09/517,466, filed March 2, 2000, which are specifically incorporated
herein
by reference. Other recombination sites having unique specificity (i. e., a
first site
will recombine with its corresponding site and will not recombine with a
second
site having a different specificity) are known to those skilled in the art and
may
be used to practice the present invention. Corresponding recombination
proteins
for these systems may be used in accordance with the invention with the
indicated
recombination sites. Other systems providing recombination sites and
recombination proteins for use in the invention include the FLP/FRT system
from
Saccharomyces cerevisiae, the resolvase family (e.g., y8, TndX, TnpX, Tn3
resolvase, Hin, Hjc, Gin, SpCCEI, ParA, and Cin), and IS231 and other Bacillus
thuringiensis transposable elements. Other suitable recombination systems for
use in the present invention include the XerC and XerD recombinases and the
psi,
dif and cer recombination sites in E. coli. Other suitable recombination sites
may
be found in United States patent no. 5,851,808 issued to Elledge and Liu which
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-107-
is specifically incorporated herein by reference. Preferred recombination
proteins
and mutant, modified, variant, or derivative recombination sites for use in
the
invention include those described in U.S. Patent Nos. 5,888,732 and 6,143,557,
and in U.S. application no. 09/438,358 (filed November 12, 1999), based upon
United States provisional application no. 60/108,324 (filed November 13,1998),
and U.S. application no. 09/517,466 (filed March 2, 2000), based upon U.S.
provisional application no. 60/136,744 (filed May 28, 1999), as well as those
associated with the GATEWAYTM Cloning Technology available from Invitrogen
Corp., Life Technologies Division (Rockville, MD), the entire disclosures of
all
of which are specifically incorporated herein by reference in their
entireties.
Representative examples of recombination sites which can be used in the
practice of the invention include att sites referred to above. The inventors
have
determined that att sites which specifically recombine with other att sites
can be
constructed by altering nucleotides in and near the 7 base pair overlap
region.
Thus, recombination sites suitable for use in the methods, compositions, and
vectors of the invention include, but are not limited to, those with
insertions,
deletions or substitutions of one, two, three, four, or more nucleotide bases
within
the 15 base pair core region (GCTTTTTTATACTAA (SEQ ID N0:37)), which
is identical in all four wild-type lambda att sites, attB, attP, attL and attR
(see
U.S. Application Nos. 08/663,002, filed June 7, 1996 (now U.S. Patent No.
5,888,732) and 09/177,387, filed October 23, 1998, which describes the core
region in further detail, and the disclosures of which are incorporated herein
by
reference in their entireties). Recombination sites suitable for use in the
methods,
compositions, and vectors of the invention also include those with insertions,
deletions or substitutions of one, two, three, four, or more nucleotide bases
within
the 15 base pair core region (GCTTTTTTATACTAA (SEQ ID N0:37)) which
are at least 50% identical, at least 55% identical, at least 60% identical, at
least
65% identical, at least 70% identical, at least 75% identical, at least 80%
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-108-
identical, at least 85% identical, at least 90% identical, or at least 95%
identical
to this 15 base pair core region.
Analogously, the core regions in attB 1, attP 1, attL 1 and attR 1 are
identical to one another, as are the core regions in attB2, attP2, attL2 and
attR2.
$ Nucleic acid molecules suitable for use with the invention also include
those
which comprising insertions, deletions or substitutions of one, two, three,
four,
or more nucleotides within the seven base pair overlap region (TTTATAC, which
is defined by the cut sites for the integrase protein and is the region where
strand
exchange takes place) that occurs within this 15 base pair core region
(GCTTTTTTATACTAA (SEQ ID N0:37)). Examples of such mutants,
fragments, variants and derivatives include, but are not limited to, nucleic
acid
molecules in which (1) the thymine at position 1 of the seven by overlap
region
has been deleted or substituted with a guanine, cytosine, or adenine; (2) the
thymine at position 2 of the seven by overlap region has been deleted or
substituted with a guanine, cytosine, or adenine; (3) the thymine at position
3 of
the seven by overlap region has been deleted or substituted with a guanine,
cytosine, or adenine; (4) the adenine at position 4 of the seven by overlap
region
has been deleted or substituted with a guanine, cytosine, or thymine; (5) the
thymine at position 5 of the seven by overlap region has been deleted or
substituted with a guanine, cytosine, or adenine; (6) the adenine at position
6 of
the seven by overlap region has been deleted or substituted with a guanine,
cytosine, or thymine; and (7) the cytosine at position 7 of the seven by
overlap
region has been deleted or substituted with a guanine, thymine, or adenine; or
any
combination of one or more such deletions and/or substitutions within this
seven
by overlap region. The nucleotide sequences of the above described seven base
pair core region are set out below in Table 1.
As described below in Examples 9-12, altered att sites have been
constructed which demonstrate that (1) substitutions made within the first
three
positions of the seven base pair overlap (TTTATAC) strongly affect the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-109-
specificity of recombination, (2) substitutions made in the last four
positions
(TTTATAC) only partially alter recombination specificity, and (3) nucleotide
substitutions outside of the seven by overlap, but elsewhere within the 15
base
pair core region, do not affect specificity of recombination but do influence
the
S efficiency of recombination. Thus, nucleic acid molecules and methods of the
invention include those which comprising or employ one, two, three, four,
five,
six, eight, ten, or more recombination sites which affect recombination
specificity, particularly one or more (e.g., one, two, three, four, five, six,
eight,
ten, twenty, thirty, forty, fifty, etc.) different recombination sites that
may
correspond substantially to the seven base pair overlap within the 15 base
pair
core region, having one or more mutations that affect recombination
specificity.
Particularly preferred such molecules may comprise a consensus sequence such
as NNNATAC, wherein "N" refers to any nucleotide (i.e., may be A, G, T/U or
C). Preferably, if one of the first three nucleotides in the consensus
sequence is
a T/LJ, then at least one of the other two of the first three nucleotides is
not a T/LJ.
The core sequence of each att site (attB, attP, attL and attR) can be
divided into functional units consisting of integrase binding sites, integrase
cleavage sites and sequences that determine specificity. As discussed below in
Example 12, specificity determinants are defined by the first three positions
following the integrase top strand cleavage site. These three positions are
shown
with underlining in the following reference sequence: CAACTTTTTTATAC
AAAGTTG (SEQ ID N0:38). Modification of these three positions (64 possible
combinations) which can be used to generate att sites which recombine with
high
specificity with other att sites having the same sequence for the first three
nucleotides of the seven base pair overlap region are shown in Table 1.
Table 1. Modifications of the First Three Nucleotides of the att Site Seven
Base Pair Overlap Region which Alter Recombination Specificity.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-110-
AAA CAA GAA TAA
AAC CAC GAC TAC
AAG CAG GAG TAG
AAT CAT GAT TAT
ACA CCA GCA TCA
ACC CCC GCC TCC
ACG CCG GCG TCG
ACT CCT GCT TCT
AGA CGA GGA TGA
AGC CGC GGC TGC
AGG CGG GGG TGG
AGT CGT GGT TGT
ATA CTA GTA TTA
ATC CTC GTC TTC
ATG CTG GTG TTG
ATT CTT GTT TTT
Representative examples of seven base pair att site overlap regions
suitable for in methods, compositions and vectors of the invention are shown
in
Table 2. The invention further includes nucleic acid molecules comprising one
or more (e.g., one, two, three, four, five, six, eight, ten, twenty, thirty,
forty, fifty,
etc.) nucleotides sequences set out in Table 2. Thus, for example, in one
aspect,
the invention provides nucleic acid molecules comprising the nucleotide
sequence
GAAATAC, GATATAC, ACAATAC, or TGCATAC. However, in certain
embodiments, the invention will not include nucleic acid molecules which
comprise att site core regions set out herein in Figures 24A-24C or in Example
9.
Table 2. Representative Examples of Seven Base Pair att Site Overlap
Regions Suitable for with the Invention.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-111-
AAAATAC CAAATAC GAAATAC TAAATAC
AACATAC CACATAC GACATAC TACATAC
AAGATAC CAGATAC GAGATAC TAGATAC
AATATAC CATATAC GATATAC TATATAC
ACAATAC CCAATAC GCAATAC TCAATAC
ACCATAC CCCATAC GCCATAC TCCATAC
ACGATAC CCGATAC GCGATAC TCGATAC
ACTATAC CCTATAC GCTATAC TCTATAC
AGAATAC CGAATAC GGAATAC TGAATAC
AGCATAC CGCATAC GGCATAC TGCATAC
AGGATAC CGGATAC GGGATAC TGGATAC
AGTATAC CGTATAC GGTATAC TGTATAC
ATAATAC CTAATAC GTAATAC TTAATAC
ATCATAC CTCATAC GTCATAC TTCATAC
ATGATAC CTGATAC GTGATAC TTGATAC
ATTATAC CTTATAC GTTATAC TTTATAC
As noted above, alterations of nucleotides located 3' to the three base pair
region discussed above can also affect recombination specificity. For example,
alterations within the last four positions of the seven base pair overlap can
also
affect recombination specificity.
The invention thus provides recombination sites which recombine with
a cognate partner, as well as molecules which contain these recombination
sites
and methods for generating, identifying, and using these sites. Methods which
can be used to identify such sites are set out below in Example 12. Examples
of
such recombinations sites include att sites which contain 7 base pairs overlap
regions which associate and recombine with cognate partners. The nucleotide
sequences of specific examples of such 7 base pair overlap regions are set out
above in Table 2.
Further embodiments of the invention include isolated nucleic acid
molecules comprising a nucleotide sequence at least 50% identical, at least
60%
identical, at least 70% identical, at least 75% identical, at least 80%
identical, at
least 85% identical, at least 90% identical, or at least 95% identical to the
nucleotide sequences of the seven by overlap regions set out above in Table 2
or
the 15 base pair core region shown in SEQ ID N0:37, as well as a nucleotide
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-112-
sequence complementary to any of these nucleotide sequences or fragments,
variants, mutants, and derivatives thereof. Additional embodiments of the
invention include compositions and vectors which contain these nucleic acid
molecules, as well as methods for using these nucleic acid molecules.
By a polynucleotide having a nucleotide sequence at least, for example,
95% "identical" to a reference nucleotide sequence encoding a particular
recombination site or portion thereof is intended that the nucleotide sequence
of
the polynucleotide is identical to the reference sequence except that the
polynucleotide sequence may include up to five point mutations (e.g.,
insertions,
substitutions, or deletions) per each 100 nucleotides of the reference
nucleotide
sequence encoding the recombination site. For example, to obtain a
polynucleotide having a nucleotide sequence at least 95% identical to a
reference
attB 1 nucleotide sequence (SEQ ID NO:S), up to 5% of the nucleotides in the
attB 1 reference sequence may be deleted or substituted with another
nucleotide,
or a number of nucleotides up to 5% of the total nucleotides in the attB 1
reference sequence may be inserted into the attB 1 reference sequence. These
mutations of the reference sequence may occur at the 5' or 3' terminal
positions
of the reference nucleotide sequence or anywhere between those terminal
positions, interspersed either individually among nucleotides in the reference
sequence or in one or more contiguous groups within the reference sequence.
As a practical matter, whether any particular nucleic acid molecule is at
least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%
identical to, for instance, a given recombination site nucleotide sequence or
portion thereof can be determined conventionally using known computer
programs such as DNAsis software (Hitachi Software, San Bruno, California) for
initial sequence alignment followed by ESEE version 3.0 DNA/protein sequence
software (cabot@trog.mbb.sfu.ca) for multiple sequence alignments.
Alternatively, such determinations may be accomplished using the BESTFIT
program (Wisconsin Sequence Analysis Package, Genetics Computer Group,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-113-
University Research Park, 575 Science Drive, Madison, WI 53711), which
employs a local homology algorithm (Smith and Waterman, Advances in Applied
Mathematics 2: 482-489 (1981)) to find the best segment of homology between
two sequences. When using DNAsis, ESEE, BESTFIT or any other sequence
alignment program to determine whether a particular sequence is, for instance,
95% identical to a reference sequence according to the present invention, the
parameters are set such that the percentage of identity is calculated over the
full
length of the reference nucleotide sequence and that gaps in homology of up to
5% of the total number of nucleotides in the reference sequence are allowed.
As noted above, the invention further provides, in one aspect, methods for
constructing and/or identifying recombination sites suitable for use with
nucleic
acid molecules of the invention, as well as recombination sites constructed
and/or
identified by these methods. In brief, the invention provides methods for
constructing and/or identifying recombination sites which are capable of
recombining with other recombination sites. For example, the invention
provides
methods for constructing recombination sites and identifying whether these
recombination sites recombine with other recombination sites. Recombination
sites which are screened for recombination activity and specificity can be
constructed by any number of means, including site-directed mutagenesis and
random nucleic acid synthesis.
The invention further provides "single use" recombination sites which
undergo recombination one time and then either undergo recombination with low
frequency (e.g., have at least five fold, at least ten fold, at least fifty
fold, at least
one hundred fold, or at least one thousand fold lower recombination activity
in
subsequent recombination reactions) or are essentially incapable of undergo
recombination. The invention also provides methods for making and using
nucleic acid molecules which contain such single use recombination sites and
molecules which contain these sites. Examples of methods which can be used to
generate and identify such single use recombination sites are set out below.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-114-
The att system core integrase binding site comprises an interrupted seven
base pair inverted repeat having the following nucleotide sequence:
______~.......<-_____
caactttnnnnnnnaaagttq (SEQ ID N0:39),
as well as variations thereof which can comprise either perfect or imperfect
repeats.
The repeat elements can be subdivided into two distal and/or proximal
"domains" composed of caac/gttg segments (underlined), which are distal to the
central undefined sequence (the nucleotides of which are represented by the
letter
"n"), and ttt/aaa segments, which are proximal to the central undefined
sequence.
Alterations in the sequence composition of the distal and/or proximal
domains on one or both sides of the central undefined region can affect the
outcome of a recombination reaction. The scope and scale of the effect is a
function of the specific alterations made, as well as the particular
recombinational
event (e.g., LR vs. BP reactions).
For example, it is believed that an attB site altered to have the following
nucleotide sequence:
______~.......<-_____
caactttnnnnnnnaaacaag (SEQ ID N0:40),
will functionally interact with a cognate attP and generate attL and attR.
However, whichever of the latter two recombination sites acquires the segment
containing "caag" (located on the left side of the sequence shown above) will
be
rendered non-functional to subsequent recombination events. The above is only
one of many possible alterations in the core integrase binding sequence which
can
render att sites non-functional after engaging in a single recombination
event.
Thus, single use recombination sites may be prepared by altering nucleotides
in
the seven base pair inverted repeat regions which abut seven base pair overlap
regions of att sites. This region is represented schematically as:
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-115-
CAAC TTT [Seven Base Pair Overlap Region] AAA GTTG.
In generating single use recombination sites, one, two, three, four or more
of nucleotides of the sequences CAACTTT or AAAGTTG (i.e., the seven base
pair inverted repeat regions) may be substituted with other nucleotides or
deleted
altogether. These seven base pair inverted repeat regions represent
complementary sequences with respect to each other. Thus, alterations may be
made in either seven base pair inverted repeat region in order to generate
single
use recombination sites. Further, when DNA is double stranded and one seven
base pair inverted repeat region is present, the other seven base pair
inverted
repeat region will also be present on the other strand.
Using the sequence CAACTTT for illustration, examples of seven base
pair inverted repeat regions which can form single use recombination sites
include, but are not limited to, nucleic acid molecules in which (1) the
cytosine
at position 1 of the seven base pair inverted repeat region has been deleted
or
substituted with a guanine, adenine, or thymine; (2) the adenine at position 2
of
the seven base pair inverted repeat region has been deleted or substituted
with a
guanine, cytosine, or thymine; (3) the adenine at position 3 of the seven base
pair
inverted repeat region has been deleted or substituted with a guanine,
cytosine,
or thymine; (4) the cytosine at position 4 of the seven base pair inverted
repeat
region has been deleted or substituted with a guanine, adenine, or thymine;
(5) the
thymine at position 5 of the seven base pair inverted repeat region has been
deleted or substituted with a guanine, cytosine, or adenine; (6) the thymine
at
position 6 of the seven base pair inverted repeat region has been deleted or
substituted with a guanine, cytosine, or adenine; and (7) the thymine at
position
7 of the seven base pair inverted repeat region has been deleted or
substituted
with a guanine, cytosine, or adenine; or any combination of one, two, three,
four,
or more such deletions and/or substitutions within this seven base pair
region.
Representative examples of nucleotide sequences of the above described seven
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-116-
base pair inverted repeat regions are set out below in Table 3.
Table 3.
aagaaaa aagagcg aagagaa aagatat
ccgccac ccgcctc ccgcaca ccgcttt
ggtggga ggtgctc ggtgata ggtgtat
ttctttg ttctctc ttctgaa ttctttt
aatacac aatagcg aataaca aatatat
CCtCgga cctcccg CCtCdCa CCtCttt
ggcgaaa ggcgccg ggcggaa ggcgtat
ttgtcac ttgtgcg ttgtaca ttgtttt
acaagga acaaccg acaaata acaattt
caccttg caccaga caccgaa cacctat
gaggcac gagggcg gaggaca gaggttt
tattgga tattaga tattaca tatttat
agaaaaa agaaaga agaagaa agaattt
cgcccac cgccctc cgccaca cgccttt
gcgggga gcgggcg gcggata gcggtat
tcttttg tcttccg tcttgaa tcttttt
ataacac ataactc ataaaca ataattt
ctccaaa ctccgcg ctccata ctcctat
gtgggga gtggccg gtgggaa gtggtat
tgttttg tgttctc tgttaca tgttttt
Representative examples of nucleotide sequences which form single use
recombination sites may also be prepared by combining a nucleotide sequence
set
out in Table 4, Section 1, with a nucleotide sequence set out in Table 4,
Section
2. Single use recombination sites may also be prepared by the insertion of one
or more (e.g., one, two, three, four, five six, seven, etc.) nucleotides
internally
within these regions.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-117-
Table
4.
Section Section
1 2
(CAAG) (TTT)
aaaa cccc gggg tttt aaa cca ttc
aaac ccca ggga ttta aac cac ttg
$ aaag ccct gggc tttc aag cgc tat
aaat cccg gggt tttg aat ctc tct
aaca ccac ggag ttat aca ggg tgt
aaga ccgc ggtg ttct aga gga
aata cctc ggcg ttgt ata ggc
acaa cacc gagg tatt caa ggt
agaa cgcc gcgg tctt gaa gag
ataa ctcc gtgg tgtt taa gcg
caaa accc aggg attt ccc gtg
gaaa gccc CGG cttt ccg ttt
1$ taaa tccc tggg gttt cct tta
In most instances where one seeks to prevent recombination events with
respect to a particular nucleic acid segment, the altered sequence will be
located
proximally to the nucleic acid segment. Using the following schematic for
illustration:
= $' Nucleic Acid Segment 3' = caac ttt [Seven Base Pair Overlap Region] AAA
GTTG,
the lower case nucleotide sequence which represent a seven base pair inverted
repeat region (i.e., caac ttt) will generally have a sequence altered by
insertion,
deletion, and/or substitution to form a single use recombination site when one
seeks to prevent recombination at the 3' end (i. e. , proximal end with
respect to the
2$ nucleic acid segment) of the nucleic acid segment shown. Thus, a single
recombination reaction can be used, for example, to integrate the nucleic acid
segments into another nucleic acid molecule, then the recombination site
becomes
effectively non-functional, preventing the site from engaging in further
recombination reactions. Similarly, single use recombination sites can be
position at both ends of a nucleic acid segment so that the nucleic acid
segment
can be integrated into another nucleic acid molecule, or circularized, and
will
remain integrated, or circularized even in the presence of recombinases.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-118-
A number of methods may be used to screen potential single use
recombination sites for functional activity (e.g., undergo one recombination
event
followed by the failure to undergo subsequent recombination events). For
example, with respect to the screening of recombination sites to identify
those
which become non-functional after a single recombination event, a first
recombination reaction may be performed to generate a plasmid in which a
negative selection marker is linked to one or more potentially defective
recombination sites. The plasmid may then be reacted with another nucleic acid
molecule which comprises a positive selection marker similarly linked to
recombination sites. Thus, this selection system is designed such that
molecules
which recombine are susceptible to negative selection and molecules which do
not recombine may be selected fro by positive selection. Using such a system,
one may then directly select for desired single use core site mutants.
As one skilled in the art would recognize, any number of screening assays
may be designed which achieve the same results as those described above. In
many instances, these assays will be designed so that an initial recombination
event takes place and then recombination sites which are unable to engage in
subsequent recombination events are identified or molecules which contain such
recombination sites are selected for. A related screening assay would result
in
selection against nucleic acid molecule which have undergone a second
recombination event. Further, as noted above, screening assays can be designed
where there is selection against molecules which have engaged in subsequent
recombination events and selection for those which have not engaged in
subsequent recombination events.
Single use recombination sites are especially useful for either decreasing
the frequency of or preventing recombination when either large number of
nucleic
acid segments are attached to each other or multiple recombination reactions
are
performed. Thus, the invention further includes nucleic acid molecules which
contain single use recombination sites, as well as methods for performing
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-119-
recombination using these sites.
Construction and Uses Nucleic Acid Molecules of the Invention
As discussed below in more detail, in one aspect, the invention provides
a modular system for constructing nucleic acid molecules having particular
functions or activities. The invention further provides methods for combining
populations of nucleic acid molecules with one or more known or unknown target
sequences of interest (e.g., two, three, four, five seven, ten, twelve,
fifteen,
twenty, thirty, fifty, etc.) or with other populations of nucleic acid
molecules
(known or unknown), thereby creating populations of combinatorial molecules
(e.g., combinatorial libraries) from which unique and/or novel molecules
(e.g.,
hybrid molecules) and proteins or peptides encoded by these molecules may be
obtained and further analyzed.
The present invention also includes methods for preparing vectors
containing more than one nucleic acid insert (e.g., two, three, four, five,
six, eight,
ten, twelve, fifteen, twenty, thirty, forty, fifty, etc. inserts). In one
general
embodiment of the invention, vectors of the invention are prepared as follows.
Nucleic acid molecules which are to ultimately be inserted into the
Destination
Vector are obtained (e.g., purchased, prepared by PCR or by the preparation of
cDNA using reverse transcriptase). Suitable recombination sites are either
incorporated into the S' and 3' ends of the nucleic acid molecules during
synthesis
or added later. When one seeks to prepare a vector containing multiple nucleic
acid inserts, these inserts can be inserted into a vector in either one
reaction
mixture or a series of reaction mixtures. For example, as shown in Figure 16,
multiple nucleic acid segments can be linked end to end and inserted into a
vector
using reactions performed, for example, in a single reaction mixture. The
nucleic
acid segments in this reaction mixture can be designed so that recombination
sites
on their S' and 3' ends result in their insertion into a Destination Vector in
a
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-120-
specific order and a specific 5' to 3' orientation. Alternatively, nucleic
acid
segments can be designed so that they are inserted into a Destination Vector
without regard to order, orientation (i.e., 5' to 3' orientation), the number
of
inserts, and/or the number of duplicate inserts.
Further, in some instances, one or more of the nucleic acid segments will
have a recombination site on only one end. Also, if desired, this end, or
these
ends, may be linked to other nucleic acid segments by the use of, for example,
ligases or topoisomerases. As an example, a linear nucleic acid molecule with
an
attRl site on its 5' terminus can be recombined with a Destination Vector
containing a ccdB gene flanked by an attLl site and an attL2 site. Before,
during, or after an LR reaction, the Destination Vector can be cut, for
example,
by a restriction enzyme on the side of the attR2 site which is opposite to the
ccdB
gene. Thus, the Destination Vector will be linear after being cut and
undergoing
recombination. Further, the attRl site of the nucleic acid molecule will
undergo
recombination with the attLl site of the Destination Vector to produce a
linear
vector which contains the nucleic acid molecule. The resulting linear product
can
then be circularized using an enzyme such as a ligase or topoisomerases.
Using the embodiment shown in Figure 16 to exemplify another aspect
of the invention, a first DNA segment having an attL 1 site at the 5' end and
an
attL3 site at the 3' end is attached by recombination to a second DNA segment
having an attR3 site at the 5' end and an attL4 site at the 3' end. A third
DNA
segment having an attR4 site at the 5' end and an attLS site at the 3' end is
attached by recombination with the attL4 site on the 3' end of the second DNA
segment. A fourth DNA segment having an attRS site at the 5' end and an attL2
site at the 3' end is attached by recombination with the attLS site on the 3'
end of
the third DNA segment. The Destination Vector contains an attRl site and an
attR2 site which flanks a ccdB gene. Thus, upon reaction with LR CLONASETM,
the first, second, third, and fourth DNA segments are inserted into the
insertion
vector but are flanked or separated by attB 1, attB3, attB4, attBS, and attB2
sites.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-121-
A similar process involving assembly of the lux operon is shown in Figures
17A-17B and described below in Example 18.
As one skilled in the art would recognize, multiple variations of the
process shown in Figure 16 are possible. For example, various combinations of
attB, attP, attL, and attR sites, as well as other recombination sites, can be
used.
Similarly, various selection markers, origins of replication, promoters, and
other
genetic elements can be used. Further, regions which allow for integration
into
eukaryotic chromosomes (e.g., transposable elements) can be added to these
vectors.
One example of a multi-reaction process for inserting multiple DNA
segments into a vector is shown in Figure 18. In this exemplary embodiment,
three DNA segments recombine with each other in two separate reaction
mixtures. The products generated in these mixtures are then mixed together
under conditions which facilitate both recombination between the products of
the
two reaction mixtures and insertion of the linked product into a vector (e.g.,
a
Destination Vector). This embodiment has the advantages that the (1) DNA
segments can be inserted directly into a Destination Vector without prior
insertion
into another vector, and (2) the same att sites, as well as other
recombination
sites, can be used to prepare each of the linked DNA segments for insertion
into
the vector.
As one skilled in the art would recognize, multiple variations of the
processes described herein are possible. For example, single use recombination
sites can be used to connect individual nucleic acid segments. Thus,
eliminating
or reducing potential problems associated with arrays of nucleic acid segments
engaging in undesired recombination reactions. Further, the processes
described
above can be used to connect large numbers of individual nucleic acid
molecules
together in a varying ways. For example, nucleic acid segments can be
connected
randomly, or in a specified order, both with or without regard to 5' to 3'
orientation of the segments.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-122-
Further, identical copies of one or more nucleic acid segments can be
incorporated into another nucleic acid molecule. Thus, the invention also
provides nucleic acid molecules which contain multiple copies of a single
nucleic
acid segment. Further, the selection of recombination sites positioned at the
5'
and 3' ends of these segments can be used to determine the exact number of
identical nucleic acid segments which are connected and then inserted, for
example, into a vector. Such vectors may then be inserted into a host cell
where
they can, for example, replicate autonomously or integrate into one or more
nucleic acid molecules which normally reside in the host cell (e.g., integrate
by
site-specific recombination or homologous recombination).
Nucleic acid molecules which contain multiple copies of a nucleic acid
segment may be used, for example, to amplify the copy number of a particular
gene. Thus, the invention also provides methods for gene amplification,
nucleic
acid molecules which contain multiple copies of a nucleic acid segment, and
host
cells which contain nucleic acid molecules of the invention.
As another example, two different nucleic acid segments can be connected
using processes of the invention. Recombination sites can be positioned on
these
segments, for example, such that the segments alternate upon attachment (e.g.,
Segment A+Segment B+Segment A+Segment B, etc.). A nucleic acid molecule
having such a structure will be especially useful for when one seeks to use
increased copy number of a nucleic acid to increase the amount of expression
product produced. In such an instance, "Segment A" can be, for example, a
nucleic acid molecule comprising an inducible promoter and "Segment B" can be,
for example, a nucleic acid molecule comprising an ORF. Thus, cells can be
prepared which contain the above construct and do not express substantial
quantities of the product of Segment B in the absence of the inducing signal
but
produce high levels of this product upon induction. Such a system will be
especially useful when the Segment B expression product is toxic to cells.
Thus,
the methods set out above can be used for the construction and maintenance of
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-123-
cells which contain Segment B in the absence of deleterious effects resulting
from
the Segment B expression product. Further, induction of expression of the ORF
residing in Segment B can then be used, for example, to transiently produce
high
levels of the Segment B expression product.
Another example of a mufti-step process for inserting multiple DNA
segments into a vector is shown in Figure 19. In this embodiment, three DNA
segments are linked to each other in separate recombination reactions and then
inserted into separate vectors using LR and BP CLONASETM reactions. After
construction of these two vectors, the inserted DNA segments are transferred
to
another vector using an LR reaction. This results in all six DNA segments
being
inserted into a single Destination Vector. As one skilled in the art would
recognize, numerous variations of the process shown in Figure 19 are possible
and are included within the scope of the invention.
The number of genes which may be connected using methods of the
invention in a single step will in general be limited by the number of
recombination sites with different specificities which can be used. Further,
as
described above and represented schematically in Figures 18 and 19,
recombination sites can be chosen so as to link nucleic acid segments in one
reaction and not engage recombination in later reactions. For example, again
using the process set out in Figure 18 for reference, a series of concatamers
of
ordered nucleic acid segments can be prepared using attL and attR sites and LR
Clonase~. These concatamers can then be connected to each other and,
optionally, other nucleic acid molecules using another LR reaction. Numerous
variations of this process are possible.
Similarly, single use recombination sites may be used to prevent nucleic
acid segments, once incorporated into another nucleic acid molecule, from
engaging in subsequent recombination reactions. The use of single use
recombination sites allows for the production of nucleic acid molecules
prepared
from an essentially limitless number of individual nucleic acid segments.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-124-
In one aspect, the invention further provides method for combining
nucleic acid molecules in a single population with each other or with other
molecules , or populations of molecules, thereby creating populations of
combinatorial molecules from which unique and/or novel molecules (e.g., hybrid
molecules) and proteins or peptides encoded by these molecules may also be
obtained and further analyzed. The invention further provides methods for
screening populations of nucleic acid molecules to identify those which have
particular activities or which encode expression products (e.g., RNAs or
polypeptides) which have particular activities. Thus, methods of the invention
can be used to combine nucleic acid segments which encode functional domains
(e.g., SH3 domains, antibody binding sites, transmembrane domains, signal
peptides, enzymatic active sites) in various combinations with each other and
to
identify products of these methods which have particular activities.
For example, nucleic acid segments which contain transcriptional
regulatory sequences can be identified by the following methods. The nucleic
acid molecules of a genomic DNA library are modified to contain recombination
sites on their 5' and 3' termini. These nucleic acid molecules are then
inserted
into a Destination Vector such that they are located 5' to a selectable
marker.
Thus, expression of the selectable marker will occur in vectors where the
marker
is in operable linkage with a nucleic acid molecule which activates its
transcription. The invention thus further provides isolated nucleic acid
molecules
which are capable of activating transcription. In many instances, these
nucleic
acid molecules which activate transcription will be identified using methods
and/or compositions of the invention.
Further, because some transcriptional regulatory sequences activate gene
expression in a tissue-specific manner, methods of the invention can be used
to
identify tissue-specific transcriptional regulatory sequences. For example,
when
one seeks to identify transcriptional regulatory sequences which activate
transcription in a specific cell or tissue type, the above screening process
can be
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-125-
performed in cells of that cell or tissue type. Similarly, when one seeks to
identify regulatory sequences which activate transcription in cells at a
particular
time, at a particular stage of development, or incubated under particular
conditions (e.g., at a particular temperature), the above screening process
can be
performed in cells at an appropriate time, at the particular stage of
development
or incubated under the particular conditions. Once a sequence which activates
transcription has been identified using such methods, the transcriptional
regulatory sequences can then be tested to determine if it is capable of
activating
transcription in other cells types or under conditions other than those which
resulted in its identification and/or selection. Thus, in one general aspect,
the
invention provides methods for constructing and/or identifying transcriptional
regulatory sequences, as well as nucleic acid molecules which contain
transcriptional regulatory sequences identified by methods of the invention in
operable linkage with nucleic acid segments which encode expression products
and methods for preparing such molecules.
Methods similar to those described above can also be used to identify
origins of replication. Thus, the invention further includes methods for
identifying nucleic acid molecules which contain origins of replication, as
well
as nucleic acid molecules which contain origins of replication identified by
methods of the invention and methods for preparing such molecules.
As discussed below in Example 1, the invention is thus particularly suited
for the construction of combinatorial libraries. For example, methods of the
invention can also be used to "shuffle" nucleic acid molecules which encode
domains and regions of proteins to generate new nucleic acid molecules which
can be used to express proteins having specific properties or activities. In
such
embodiments, nucleic acid segments which encode portions of proteins are
joined
and then screened for one or more properties or activities.
The nucleic acid segments in these combinatorial libraries may be
prepared by any number of methods, including reverse transcription of mRNA.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-126-
Altered forms of the nucleic acid segments in these libraries may be generated
using methods such as error prone PCR. In many applications, it will be
desirable for the nucleic acid segments in these libraries to encode
subportions
of protein. When this is the case, the methods can be adjusted to generate
populations of nucleic acid segments the majority of which do not contain full
length ORFs. This can be done, for example, by shearing the cDNA library and
then separating the sheared molecules (e.g., using polyacrylamide or agarose
gel
electrophoresis). Fragments between, for example, 300 and 600 nucleotides in
length (fragments which potentially encode 100 to 200 amino acid residues) may
then be recombined and inserted into a vector in operable linkage with a
transcriptional regulatory sequence. Polypeptide expression products of the
individual members of such a combinatorial library may then be screened to
identify those with particular properties or activities.
The invention further provides methods for producing combinatorial
libraries generated using exon nucleic acid derived from genomic DNA.
Intron/exon splice boundaries are known in the art; thus the locations of
exons in
genomic DNA can be identified using routine, art-known methods without undue
experimentation. Further, primers corresponding to intron/exon splice
boundaries
can be used to generate nucleic acid molecules which correspond to exon
sequences. Further, these nucleic acid molecules may then be connected to each
other to generate combinatorial libraries comprising nucleic acid molecules
which
correspond to exon sequences. For example, primers corresponding to
intron/exon splice boundaries can be used to generate nucleic acid molecules
which correspond to exon sequences using PCR. Recombination sites may then
be added to the termini of the resulting PCR products using ligases or
amplifying
the sequences using primers containing recombination sites. The PCR products
may then be connected to each other using recombination reactions and inserted
into an expression vector. The resulting combinatorial library may then be
screened to identify nucleic acid molecules which, for example, encode
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-127-
polypeptides having particular functions or activities. Further, recombination
sites in expression products (e.g., RNA or protein) of nucleic acid molecules
of
the combinatorial library can be removed by splicing as described elsewhere
herein.
Further, nucleic acid molecules used to produce combinatorial libraries,
as well as the combinatorial libraries themselves, may be mutated to produce
nucleic acid molecules which are, on average, at least 50%, at least 55%, at
least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at
least
90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%
identical to the corresponding original nucleic acid molecules. Similarly,
nucleic
acid molecules used to produce combinatorial libraries may be mutated to
produce nucleic acid molecules which, encode polypeptides that are, on
average,
are at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at
least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at
least
97%, at least 98%, or at least 99% identical to polypeptides encoded by the
corresponding original nucleic acid molecules.
In one aspect the invention provides methods for generating and
identifying dominant/negative suppressors of biological processes or
biological
pathways. For example, combinatorial libraries described above can be screened
for dominantlnegative activity. In general, dominant/negative activity results
in
the suppression of a biological process or biological pathway. In most
instances,
dominant/negative suppressors exhibit their affects through interaction with
cellular components. For example, many dominant/negative suppressors contain
domains having binding activities associated with one or more cellular
proteins
but do not have other activities associated with the cellular proteins. While
not
intending to be bound by theory, upon expression in a cell, dominant/negative
suppressors generally interact with one or more cellular ligands and block
activation by cellular proteins. Thus, one mechanism by which
dominant/negative suppressors are believed to interfere with normal cellular
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-128-
processes is by ligand sequestration.
Dominant/negative activity can be conferred by mutations in a wild-type
protein such as an alteration of a single amino acid residue or a deletion of
an
entire region of the protein. Oury et al., J. Biol. Chem. 275:22611-22614
(2000),
for example, describe a dominant/negative receptor where dominant/negative
activity results from the deletion of a single amino acid residue.
Protein fragments can also have dominant/negative activity. For example,
McNellis et al., Plant Cell 8:1491-1503 (1996), describe an N-terminal
fragment
of constitutive photomorphogenic 1 protein (COP 1 ) which has
dominant/negative
activity when expressed in Arabidopsis seedlings.
Any number of assays can be used to screen for dominant/negative
activities. Maemura et al., J. Biol. Chem. 274:31565-31570 (1999), for
example,
describe a deletion mutant of a transcription factor referred to as
endothelial PAS
domain protein 1 (EPAS 1 ) which has dominantlnegative activity. In
particular,
Maemura et al. demonstrated that expression of the EPAS 1 mutant in cells
inhibits induction of VEGF mRNA production, an activity associated with
wild-type EPAS 1.
The invention also provides methods for identifying nucleic acid
molecules which encode polypeptides having particular functions or activities,
as well as nucleic acid molecules produced by these methods, expression
products
of these nucleic acid molecules, and host cells which contain these nucleic
acid
molecules. Such functions or activities include secretion from cells,
enzymatic
activities, ligand binding activities (e.g., binding affinity for metal ions,
cell
surface receptors, nucleic acids, soluble proteins), and the ability to target
the
expression product to a sub-cellular localization (e.g., localization to
mitochondria, chloroplasts, endoplasmic reticulum, etc.). Assays for
identifying
these nucleic acid molecules will generally be designed to identify the
function
of activity associated with the polypeptide.
The invention also provides methods for identifying nucleic acid
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-129-
molecules which encode polypeptides having regions which interact with other
polypeptides. One example of such a method involves the use of two hybrid
assays. (See, e.g., Fields et al., U.S. Patent No. 5,667,973, the entire
disclosure
of which is incorporated herein by reference.) More specifically, nucleic acid
molecules can be prepared using methods of the invention which encode a fusion
protein between a polypeptide (e.g., a Gal4N-terminal domain) that exhibits a
particular function when in close proximity with another polypeptide (e.g., a
Gal4C-terminal domain) and protein or region of a protein for which a ligand
is
sought. Other nucleic acid molecules are then prepared which encode fusions
between the other polypeptide referred to in the previous sentence and protein
segments encoded by a combinatorial library. Thus, nucleic acid segments in
the
combinatorial library which encode desired ligands can be identified by
screening
for activities associated conferred by bringing the two polypeptides into
close
proximity with each other.
Phage and bacterial surface display libraries may also be generated by
methods of the invention to identify domains which have particular functional
activities (e.g., binding activity for a particular ligand). For example, Kim
et al.,
Appl. Environ. Microbiol. 66:788-793 (2000), describe a bacterial surface
display
method for the selectively screening for improved variants of carboxymethyl
cellulase (CMCase). According to this method, a library of mutated CMCase
genes is generated by DNA shuffling and fused to the ice nucleation protein
(Inp)
gene, which results in the fusion proteins being displayed on the bacterial
cell
surface.
The invention thus provide methods for identifying nucleic acid segments
which encode proteins or protein regions that interact with other proteins or
have
particular functional activities, as well as nucleic acid segments identified
by such
methods and polypeptide expression products of these nucleic acid segments. In
one aspect, methods of the invention involve generating combinatorial
libraries
and screening these libraries to identify individual nucleic acid molecules
which
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-130-
encode expression products that interact with a particular protein or have a
particular activity. In many instances, the combinatorial libraries described
above
will encode fusion proteins.
Thus, methods of the invention can be used to prepare and identify nucleic
$ acid molecules which encode proteins and protein variants having particular
properties, functions or activities. One example of a protein property which
is
readily assayable is solubility. For example, fluorescence generated by GFP is
quenched when an insoluble GFP fusion protein is produced. Further,
alterations
in a relatively small number of amino acid residues of a protein (e.g., one,
two,
three, four, etc.), when appropriately positioned, can alter the solubility of
that
protein. Thus, combinatorial libraries which express GFP fusion proteins can
be
used to isolate proteins and protein variants which have altered solubility.
In one
specific example, a combinatorial library designed to express GFP fused with
variants of a single, insoluble polypeptide can be used to isolate nucleic
acid
1 S molecules which encode soluble variants of the polypeptide.
Methods of the invention can be used to construct nucleic acid molecules
which contain two or more nucleic acid segments, wherein expression one
nucleic
acid segment is facilitated by the expression product of one of the other
nucleic
acid segments. For example, one nucleic acid segment may be operably linked
to a T7 polymerase promoter and another nucleic acid segments encodes a T7
polymerase. Thus, the nucleic acid segment operably linked to the T7
polymerase promoter will be expressed upon expression of the T7 polymerase.
Numerous variations of such systems fall within the scope of the invention.
For
example, nucleic acid encoding components or having particular activities
referred to above can reside in a vector into which one or more the nucleic
acid
segments are inserted.
Methods of the invention can also be used to construct nucleic acid
molecules which encode more than one subunit of a multi-subunit enzyme.
Further, expression of each of the subunits of this enzyme may be regulated by
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-131-
the same promoter or different promoter. When the same promoter is used to
drive expression of nucleic acid which encode two or more proteins, the mRNA
may contain, for example one or more internal ribosome entry sites (IRES)
which
allow for translation of protein encoded by RNA which is 3' to the 5' most
coding
sequence.
Methods of the invention can be used to construct nucleic acid molecules
and cells which contain a wide variety of specific inserts. Thus, in one
aspect,
methods of the invention can be used to prepare nucleic acid molecules and
cells
which contain multiple genes encode specific products. These methods allow for
the generation of nucleic acid molecules and organisms which have specific
characteristics. For example, as discussed below in Example 18, nucleic acids
which contain all of the genes involved in a particular biological pathway can
be
prepared. Such genes may each be linked to different transcriptional
regulatory
sequences or one or more copies of the same transcriptional regulatory
sequence.
In addition, genes involved in the same or different biological pathways or
biological processes may be operably linked to transcriptional regulatory
sequences which facilitate transcription in the presence of the same or
different
inducing agents, under the same or different environmental conditions (e.g.,
temperature), or in the same or different cell types. Further, when genes
encode
polypeptide expression products involved in a pathway or process, one or more
of these expression products may be expressed as fusion proteins.
Additionally,
cells can be constructed using methods of the invention which contain inserted
nucleic acid segments that encode gene products involved in more than one
different biological pathway or biological process.
One may also use methods of the invention, for example, to modify one
or more particular nucleic acid segments in a multi-nucleic acid segment array
constructed with a multisite recombination system. Using the lux operon
construct shown in Figure 17B for illustration, where each gene is flanked by
attB sites having different recombination specificities, one or more specific
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-132-
nucleic acid segments in the molecule may be substituted with another nucleic
acid segment. For example, the second coding region in the lux operon
construct
shown in Figure 17B, luxD, can be replaced by reacting the vector containing
the
operon with an appropriate plasmid (e.g., a pDONR plasmid), such that IuxD is
substituted with an element comprising attRx-ccdB-cat-attRy to create a vector
(i. e. , an output construct) wherein the locus previously occupied by luxD
becomes
an acceptor site for Entry clones with an attLx-gene-attLy configuration. The
product vector may then be reacted with an attLx-gene-attLy Entry clone, which
will result in the replacement of the attRx-ccdB-cat-attRy cassette with the
new
gene flanked by attBx and attBy. In related embodiments, populations of Entry
clones with the general configuration of attLx-gene-attLy may be reacted with
the product vector, prepared as described above, such that a population of
output
constructs is generated and for any given construct in the population the
segment
comprising attRx-ccdB-cat-attRy will have been replaced by another nucleic
acid
segment flanked by attBx and attBy. In any given output construct within the
population, the attRx-ccdB-cat-attRy cassette will have been replaced by a new
gene flanked by attBx and attBy. Thus, the composition of a given nucleic acid
segment array can be permuted in a parallel manner, while other genes in the
operon construct remain substantially unaffected by these manipulations.
Further, nucleic acids segments which encode expression products
involved in one or more specific biological processes or pathways may be
recombined on supports. For example, a first nucleic acid molecule which has
a free end on which there is a recombination site and encodes one of three
enzymes involved in a biological pathway or process can be attached to a
support.
Nucleic acid molecules of a library having recombination sites on at least one
end
which are capable of recombining with the nucleic acid molecule attached to
the
support can then be contacted with the support under conditions which
facilitate
recombination, leading to the attachment of a second nucleic acid molecule to
the
first nucleic acid molecule. A similar process can be used to attached a third
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-133-
nucleic acid molecule to the free end of the second nucleic acid molecule.
These
resulting nucleic acid products may then be either released from the support
prior
to assaying for biological activity or such assaying may be performed while
the
nucleic acid products remain attached the support. Examples of assays which
can
be performed are hybridization assays to detect whether specific nucleic acid
molecules are present, assays for polypeptide expression products of the
connected nucleic acid molecules, or assays for end products produced by the
polypeptide expression products (e.g., taxol, amino acids, carbohydrates,
etc.) of
the connected nucleic acid molecules.
In embodiments related to the above, nucleic acid segments may be cycled
on and off the supports described above. Thus, after a second nucleic acid
molecule has recombined with the first nucleic acid molecule, a second
recombination reaction, for example, could be used to release the second
nucleic
acid molecule.
Thus, in one aspect, the invention provides methods for performing
recombination between nucleic acid molecules wherein at least one of the
nucleic
acid molecules is bound to a support. The invention further provides methods
for
identifying nucleic acid molecules involved in the same biological process or
pathway by recombining these nucleic acid molecules on supports (e.g., solid
and
semi-solid supports). The invention thus provides methods for screening
nucleic
acid libraries to identify nucleic acid molecules which encode expression
products involved in particular biological processes or pathways, as well as
nucleic acid molecules identified by these methods, expressions products
produced from the nucleic acid molecules, and products produced by these
biological processes or pathways.
The phrases "biochemical pathway" and "biological pathway" refer to any
series of related biochemical reactions that are carried out by an organism or
cell.
Such pathways may include but are not limited to biosynthetic or
biodegradation
pathways, or pathways of energy generation or conversion.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-134-
Nucleic acid molecules of the invention can be used for a wide variety of
applications. For example, methods of the invention can be used to prepare
Destination Vectors which contain all of the structural genes of an operon. As
discussed below in Example 18 the lux operon has been reconstructed using
nucleic acids encoding the luxCDABE genes obtained from the bioluminescent
bacterium Vibrio fischeri.
Further, as noted above, expression products of nucleic acid molecules of
the invention, including multiple proteins which are part of the same or
different
biological pathway or process, can be produced as fusion proteins. These
fusion
proteins may contain amino acids which facilitate purification (e.g., 6 His
tag),
"target" the fusion protein to a particular cellular compartment (e.g., a
signal
peptide), facilitate solubility (e.g., maltose binding protein), and/or alter
the
characteristics of the expression product of the cloned gene (e.g., the Fc
portion
of an antibody molecule, a green flourescent protein (GFP), a yellow
fluorescent
protein (YFP), or a cyan flourescent protein (CFP)).
Methods of the invention can also be used to prepare nucleic acid
molecule which, upon expression, produce fusion proteins having more than one
property, function, or activity. One example of such a nucleic acid molecule
is
a molecule which encodes a three component fusion protein comprising a
polypeptide of interest, Domain II of Pseudomonas exotoxin, and a polypeptide
which promotes binding of the fusion protein to a cell type of interest.
Domain
II of Pseudomonas exotoxin often confers upon fusion proteins the ability to
translocate across cell membranes. Thus, the expression product could be
designed so that it both localizes to a particular cell-type and crosses the
cell
membrane. An expression product of this type would be especially useful when,
for example, the polypeptide of interest is cytotoxic (e.g., induced
apoptosis).
Nucleic acid molecules which encode proteins similar to those described above
are described in Pastan et al., U.S. Patent No. 5,328,984.
Further, the expression product can be produced in such a manner as to
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-135-
facilitate its export from the cell. For example, these expression products
can be
fusion proteins which contain a signal peptide which results in export of the
protein from the cell. One application where cell export may be desirable is
where the proteins that are to be exported are enzymes which interact with
extracellular substrates.
In one aspect, the invention provides methods for preparing nucleic acid
molecules which encode one or more expression products involved in the same
or different biological pathway or process, as well as cells which contain
these
nucleic acid molecules and the resulting products of such biological pathways
or
processes. For example, methods of the invention can be used to construct
cells
which export multiple proteins involved in the same or different biological
processes. Thus, in one aspect, the invention provides a system for cloning
multiple nucleic acid segments in a cell, which export one or more gene
products
of the expression products of these nucleic acid segments (e.g., two, three,
four,
five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.). Further,
these
expression products may perform functions (e.g., catalyze chemical reactions)
in
extracellular media (e.g., culture media, soils, salt water marshes, etc.).
When nucleic acid molecules are prepared and/or expressed using
methods of the invention, these nucleic acid molecules may encode expression
products which are involved in the same or different processes (e.g.,
biosynthetic
pathways, degradation pathway). As explained below, when one seeks to provide
a wide range of functional characteristics to an organism, the nucleic acid
molecules may encode expression products which confer relatively unrelated
properties upon the organism.
Further, nucleic acid molecules can be prepared using methods of the
invention which encode all of parts of biosynthetic pathways that lead to
desired
end products. Further, methods of the invention can be used to generate
nucleic
acid molecules which encode expression products having unique properties.
Thus, the invention also provides methods generating novel end products of
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-136-
biological pathways or processes. In this regard, methods of the invention are
useful for generating an identifying novel compounds, including therapeutic
agents. Thus, in one aspect, the invention further provides drug discovery
methods and therapeutic agents identified by these methods.
Examples of end products which can be produced by biological pathways
or processes reconstituted and/or altered by methods of the invention include
chemotherapeutic agents (e.g., antibiotics, antivirals, taxol), carbohydrates,
nucleotides, amino acids, lipids, ribosomes, and membrane-bound organelles, as
well as novel forms of each. Thus, the methods of the invention can be used to
prepare nucleic acids which confer upon cells the ability to produce a wide
variety of natural compounds, as well as modified forms of these compounds.
Examples of such compounds include those which fall into the following broad
classes: anti-bacterial therapeutics, anti-viral therapeutics, anti-parasitic
therapeutics, anti-fungal therapeutics, anti-malarial therapeutics, amebicide
therapeutics, and anti-neoplastic therapeutics.
Due to the rapid rate at which microorganisms are developing resistance
to antibiotics, there is a great need for the development of new antibiotics.
Further, it has been postulated that microorganisms will develop resistance
more
slowly to novel antibiotics for which there is no naturally occurring
equivalent.
Thus, in one aspect, the invention provides methods for producing novel
antibiotics, as well as antibiotics produced by methods of the invention.
One example of an organism which can be produced using methods of the
invention is an organism which produces novel antibiotic agents. Stassi et
al.,
Proc. Natl. Acad. Sci. USA 95:7305-7309 (1998) describe the production ofnovel
ethyl-substituted erythromycin derivatives produced by genetically engineered
cells of Saccharopolyspora erythracea. Thus, methods of the invention can be
used to insert into the cell genetic elements which encode proteins that
generate
novel antibiotics. The invention further includes cells produced by these
methods
and methods for using such cells to produce antibiotics, as well as
antibiotics
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-137-
produced by the methods of the invention.
Nucleic acid molecules encoding products involved in biosynthetic
pathways for numerous therapeutic agents are known in the art. For example,
genes and enzymes involved in the biosynthesis of (3-lactam antibiotics are
described, for example, in Martin, Appl. Microbiol. Biotechnol. 5O(1):1-15
(1998). Thus, in specific aspects, the invention includes methods for
producing
these antibiotics and altered forms of these antibiotics, as well as the
antibiotics
themselves.
The invention further provides methods for producing anti-bacterial
therapeutics, anti-viral therapeutics, anti-parasitic therapeutics, anti-
fungal
therapeutics, anti-malarial therapeutics, amebicide therapeutics, and
anti-neoplastic therapeutics and altered forms of such agents, as well as the
agents
themselves. Examples of anti-bacterial therapeutics include compounds such as
penicillins, ampicillin, amoxicillin, cyclacillin, epicillin, methicillin,
nafcillin,
1 S oxacillin, cloxacillin, dicloxacillin, flucloxacillin, carbenicillin,
cephalexin,
cepharadine, cefadoxil, cefaclor, cefoxitin, cefotaxime, ceftizoxime,
cefinenoxine,
ceftriaxone, moxalactam, imipenem, clavulanate, timentin, sulbactam,
erythromycin, neomycin, gentamycin, streptomycin, metronidazole,
chloramphenicol, clindamycin, lincomycin, quinolones, rifampin, sulfonamides,
bacitracin, polymyxin B, vancomycin, doxycycline, methacycline, minocycline,
tetracycline, amphotericin B, cycloserine, ciprofloxacin, norfloxacin,
isoniazid,
ethambutol, and nalidixic acid, as well as derivatives and altered forms of
each
of these compounds.
Examples of anti-viral therapeutics include acyclovir, idoxuridine,
ribavirin, trifluridine, vidirabine, dideoxucytidine, dideoxyinosine,
zidovudine
and gancyclovir, as well as derivatives and altered forms of each of these
compounds.
Examples of anti-parasitic therapeutics include bithionol,
diethylcarbamazine citrate, mebendazole, metrifonate, niclosamine, niridazole,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-138-
oxamniquine (and other quinine derivatives), piperazine citrate, praziquantel,
pyrantel pamoate and thiabendazole, as well as derivatives and altered forms
of
each of these compounds.
Examples of anti-fungal therapeutics include amphotericin B,
clotrimazole, econazole nitrate, flucytosine, griseofulvin, ketoconazole and
miconazole, as well as derivatives and altered forms of each of these
compounds.
Anti-fungal compounds also include aculeacin A and papulocandin B. (See, e.g.,
Komiyama et al., Biol. Pharm. Bull. (1998) 21(10):1013-1019).)
Examples of anti-malarial therapeutics include chloroquine HCI,
primaquine phosphate, pyrimethamine, quinine sulfate, and quinacrine HCI, as
well as derivatives and altered forms of each of these compounds.
Examples of amebicide therapeutics include dehydroemetine
dihydrochloride, iodoquinol, and paramomycin sulfate, as well as derivatives
and
altered forms of each of these compounds.
Examples of anti-neoplastic therapeutics include aminoglutethimide,
azathioprine, bleomycin sulfate, busulfan, carmustine, chlorambucil,
cisplatin,
cyclophosphamide, cyclosporine, cytarabidine, dacarbazine, dactinomycin,
daunorubicin, doxorubicin, taxol, etoposide, fluorouracil, interferon-a,
lomustine,
mercaptopurine, methotrexate, mitotane, procarbazine HCI, thioguanine,
vinblastine sulfate and vincristine sulfate, as well as derivatives and
altered forms
of each of these compounds.
Additional anti-microbial agents include peptides. Examples of
anti-microbial peptides are disclosed in Hancock et al. , U.S. Patent 6,040,43
5 and
Hancock et al., Proc. Natl. Acad. Sci. USA 97:8856-8861 (2000).
Nucleic acid molecules can also be prepared using the methods of the
invention which encode more than one subunit of a multi-protein complex.
Examples of such multi-protein complexes include splicesomes, ribosomes, the
human 26S proteasome, and yeast RNA polymerase III. (See, e.g., Saito et al.,
Gene 203(2):241-250 (1997); Flores et al., Proc. Natl. Acad. Sci. USA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-139-
96(14):7815-7820 (1999).)
Methods of the invention can also be used for the partial synthesis of
non-naturally occurring products, as well as variants of these products (e.g.,
novel
variants). For example, microorganisms which express enzymes which catalyze
particular reactions can be supplied with precursors which these organisms do
not
normally produce. In cases where these precursors act as substrates for
enzymes
expressed by the microorganisms, novel compounds may be produced. "Feeding"
processes of this type have been used in the past to produce novel
antibiotics. In
one aspect, feeding of this type is used in combination with microorganisms
which express enzymes encoded by combinatorial libraries described above.
Methods of the invention can be used to either ( 1 ) introduce a new
pathway into a cells or (2) alter an existing cellular pathway so that, for
example,
one or more additional catalytic steps (e.g., two, three, four, five, seven,
ten, etc.)
occur during product synthesis. One example of such an application of methods
of the invention involves the modification of a protein which is naturally
produced by a cell. In this example, genes encoding one or more catalytic
steps
which alter the protein (e.g., encode enzymes involved in post-translation
modification reactions) are introduced into the cell. For example, nucleic
acids
which encode enzymes involved in ADP-ribosylation, glycosylation, sialylation,
acetylation, ubiquination, serine to D-alanine conversion, biotinylation,
acylation,
amidation, formylation, carboxylation, GPI anchor formation, hydroxylation,
methylation, myristoylation, oxidation, proteolytic processing,
phosphorylation,
prenylatiorl, racemization, selenoylation, sulfation, arginylation can be
inserted
into the cell. Post-translational modifications of proteins are discussed in
PROTEINS-STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton,
W. H. Freeman and Company, New York,1993; WOId, F., POST-TRANSLATIONAL
PROTEIN MODIFICATIONS: PERSPECTIVES AND PROSPECTS, pgs. 1-12 in
Post-translational Covalent Modification of Proteins, B. C. Johnson, Ed.,
Academic Press, New York, 1983; Seifter et al., "Analysis for Protein
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-140-
Modifications and Nonprotein Cofactors", Meth. Enrymol. (1990) 182:626-646
and Rattan et al., "Protein Synthesis: Post-translational Modifications and
Aging", Ann. NYAcad. Sci. (1992) 663:48-62.
Methods of the invention can be used, for example, to produce cells which
contain nucleic acid molecules which encode proteins involved in signaling
pathways. Further, these cells may be used to screen agents which modulate
cell
signaling. For example, cells may be produced using methods of the invention
which express all of the components necessary for responding to tumor necrosis
factors (TNFs). These cells can then be used to screen agents which either
induce
TNF mediated responses (TNF agonists) or block TNF mediated responses (TNF
antagonists). Thus, included within the scope of the invention are methods for
producing cells which can be used to screen for agonists and antagonists of
cellular ligands, as well as cells produced by such methods. Further included
within the scope of the invention are methods for using cells of the invention
to
identify agonists and antagonists of cellular ligands and agonists and
antagonists
identified by methods of the invention.
As noted above, methods of the invention can also be used to generate
nucleic acids and cells which produce nutrients such as carbohydrates and
amino
acids. Carbohydrates and amino acids, as well as other carbon sources, can be
used for a number of purposes. For example, carbohydrates and amino acids to
prepare culture medium components for growing microorganisms, mammalian
cells, and plant cells. Further, these compounds can be added to food products
for both humans and liverstock. One specific example of a use of carbohydrates
and amino acids is in the preparation of nutritional formula for infants.
(See, e.g.,
Highman et al., U.S. PatentNo. 6,120,814.) Thus, the invention further
provides
food products (e.g., infant formula) made using carbon sources produced using
methods of the invention.
Carbon sources which can be produced using cells prepared using
methods of the invention include carbohydrates (e.g., glucose, fructose,
lactose,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-141-
molasses, cellulose hydrolyzates, crude sugar hydrolyzates, and starch
hydrolyzates), organic acids (e.g., pyruvic acid, acetic acid, fumaric acid,
malic
acid, and lactic acid), alcohols (glycerol, 1,3,-propanediol, and ethanol),
lipids,
fatty acids, nucleotides, nucleosides, and amino acids. (See, e.g., Skraly et
al.,
Appl. Environ Microbiol. 64:98-105 (1998).)
One example of an organism which can be produced using methods of the
invention is an organism which has acquired the ability to produce ethanol.
Deng
et al., Appl. Environ. Microbiol. 65:523-528 (1999), for example, describe
Cyanobacteria which have been engineered to produce ethanol. Thus, methods
of the invention can be used to insert into cell genetic elements which encode
proteins involved in the production of ethanol. The invention further includes
cells produced by these methods and methods for using such cells to produce
ethanol.
Another example of an organism which can be produced using methods
1 S of the invention is an organism which has acquired the ability to produce
either
poly(3-hydroxyalkanoates) or increased amounts of poly(3-hydroxyalkanoates).
Poly(3-hydroxyalkanoates) are compounds which, on extraction from cells, have
plastic like properties. (See, e.g., Madison et al., Microbiol. Molec. Biol.
Rev.
63:21-53 (1999).) Thus, methods of the invention can be used to insert into
cell
genetic elements which encode proteins involved in the production of
poly(3-hydroxyalkanoates). The invention further includes cells produced by
these methods and methods for using such cells to produce
poly(3-hydroxyalkanoates), poly(3-hydroxyalkanoates) derivatives, and
compounds formed from poly(3-hydroxyalkanoates).
Amino acids which can be produced using cells prepared using methods
of the invention include phenylalanine, tryptophan, tyrosine, leucine,
isoleucine,
valine, glutamine, asparagine, arginine, lysine, histidine, aspartic acid,
glutamic
acid, alanine, proline, serine, threonine, methionine, cysteine, and glycine.
Genes
and enzymes involved in the biosynthesis of amino acids and amino acid
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-142-
precursors in a considerable number of organism are known in the art. (See,
e.g.,
G.N. Cohen, "The Common Pathway to Lysine, Methionine and Threonine," pp.
147-171 in Amino Acids: Biosynthesis and Genetic Regulation, K.M. Hemnann
and R.L. Somerville, eds., Addison-Welesley Publishing Co., Inc., Reading,
Mass. (1983).)
In addition to altering cells to produce new compounds, methods of the
invention can also be used to engineer cells so that they either overproduce
or
underproduce products of the cells normal metabolism. For example, Donnelly
et al., U.S. Patent No. 5,770,435 described a mutant strain of E coli which
produce increased amounts of succinic acid. Methods of the invention can be
used, for example, to construct nucleic acid molecules which encode enzymes in
the succinic acid biosynthetic pathway. Further, the expression of one or more
of these enzymes can be regulated at the transcriptional level. Thus, the
introduction of these nucleic acid molecules into the above described E. coli
cells
will effectively result in an amplification of one or more genes in the
succinic
acid biosynthetic pathway. Further, one or more of these genes can be operably
linked to an inducible promoter (e.g., the lacI promoter) so that increased
succinic
acid occurs only in the presence of the inducing signal (e.g., IPTG).
Methods of the invention can also be used to generate nucleic acids and
cells which produce components and precursors that can be used in
manufacturing processes. Examples of such components include plastics,
plastic-like compounds (e.g., polyketides), soaps, fertilizers, papers,
synthetic
rubber, dyes, inks, etc. The invention further includes components and
precursors
produced by methods and cells of the invention.
Similarly, nucleic acid molecules prepared by the methods of the
invention can also be used to down regulate expression of, for example, one or
more endogenous genes. One example of this is when nucleic acid inserts
prepared by methods of the invention are transcribed to produce antisense RNA.
Again, nucleic acid molecules which encode antisense RNAs may be operably
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-143-
linked to a regulatable promoter.
Thus, the invention further includes methods for producing cells which
either overproduce or underproduce products of the cells normal metabolism, as
well as cells produced by these methods.
As noted above, nucleic acid molecules prepared by methods of the
invention can be used to alter the physical characteristics of an organism so
that
the organism has particular characteristics. For example, a cell which lacks
specific enzymes required to produce either recombinant or native proteins
having particular glycosylation patterns can be introduced into the cell using
the
vectors of the invention. Glycosylation patterns of proteins has been found to
be,
to some extent, cell-type and species specific. (See, e.g., Jarvis et al.,
Curr. Opin.
Biotechnol. 9:528-533 (1998).) Thus, in one aspect, the invention provides
methods for producing cells which exhibit altered glycosylation pathways, as
well
as cells produced by these methods and glycosylated compounds produced by
these cells. This process is generally termed "glycosylation engineering."
Stanley, Glycobiology 2:99-107 (1992).
For example, bacterial cells which do not glycosylate proteins may be
modified using methods of the invention to produce enzymes which glycosylate
proteins. Examples of such enzymes include N-acetylglucosaminlytransferases
III and V, ~i1,4-galactosyltransferase, a2,6-sialyltransferase,
a2,3-sialyltransferase, a1,3-fucosyltransferase III and VI, and
a1,2-mannosyltransferase.
In another aspect, the invention provides methods for producing cells
which exhibit altered metabolic properties leading to increased production of
compounds synthesized by these cells, as well as cells produced by these
methods
and products produced by these cells. One example of such methods result in
the
production of cells which produce increased quantities of precursors for
biological pathways. This process is referred to herein as metabolic
channeling
or funneling. For example, when one seeks to produce a cell which produces
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-144-
increased amounts of serine, nucleic acid molecules which encode enzymes of
pathways which lead to the production of 3-phosphoglycerate can be inserted
into
the cell. Optionally, nucleic acid molecules which encode enzymes involved in
the conversion of 3-phosphoglycerate to serine can also be inserted into the
cell.
Parameters useful for consideration when engineering cells which contain
increased intracellular concentrations of precursor pools an compounds include
the rate limiting set in the particular pathway and pathway fluxes. (See,
e.g.,
Kholodenko et al., Biotechnol. Bioeng. 59:239-247 (1997).)
Polyketides represent a large family of diverse compounds synthesized
from 2-carbon units through a series of condensations and subsequent
modifications. Polyketides are produced in many types of organisms, including
fungi and numerous bacteria, in particular, the actinomycetes. There are a
wide
variety of polyketide structures and polyketides encompasses numerous
compounds with diverse activities. (See, e.g., PCT publication Nos. WO
93/13663; WO 95/08548; WO 96/40968; 97/02358; and 98/27203; U.S. Pat. Nos.
4,874,748; 5,063,155; 5,098,837; 5,149,639; 5,672,491; and 5,712,146; and Fu
et al., 1994, Biochemistry 33:9321-9326; McDaniel et al., 1993, Science
262:1546-1550; and Rohr, 1995, Angew. Chem. Int. Ed. Engl. 34:881-888, each
of which is incorporated herein by reference.)
Polyketide synthases (PKSs) assemble structurally diverse natural
products using a common mechanistic strategy that relies on a cysteine residue
to anchor the polyketide during a series of decarboxylative condensation
reactions
that build the final reaction product. PKSs generally catalyze the assembly of
complex natural products from simple precursors such as propionyl-CoA and
methylmalonyl-CoA, in a biosynthetic process that closely parallels fatty acid
biosynthesis. Examples of polyketides include callystatin A, ansatrienin A,
actinorhodin, rapamycin, methymycin, and pikromycin.
In one aspect, the invention provides methods for preparing nucleic acid
molecules which encode one or more PKSs, as well as cells which contain these
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-145-
nucleic acid molecules and the resulting polyketide products. The invention
furtherprovides methods for generating novel PKSs using combinatorial
libraries
and products produced by these novel PKSs (e.g., novel macrolide antibiotics),
as well methods for producing these novel PKS products.
Methods of the invention can also be used to construct strains of
microorganisms which are useful for decreasing the toxicity of various agents.
Such agents include petroleum-based pollutants (e.g., chlorinated and
non-chlorinated aliphatic compounds (e.g., CS-C36), chlorinated and
non-chlorinated aromatic compounds (e.g., C9-Cz2), crude oil, refined oil,
fuel oils ,
(e.g., Nos. 2, 4 and 6 fuel oils), diesel oils, gasoline, hydraulic oils,
kerosene,
benzene, toluene, ethylbenzene and xylenes, trimethylbenzenes, naphthalene,
anthracene,acenaphthene,acenaphthylene,benzo(a)anthracene,benzo(a)pyrene,
benzo(b)fluoranthene, benzo(g,h,i)perylene, benzo(k)fluoranthene, pyrene,
methylene chloride, 1,1-dichloroethane, chloroform, 1,2-dichloropropane,
dibromochloromethane, 1,1,2-trichloroethane, 2-chloroethylvinyl ether,
tetrachloroethene (PCE), chlorobenzene, 1,2-dichloroethane,
1,1,1-trichloroethane, bromodichloromethane, trans-1,3-dichloropropene,
cis-1,3-dichloropropene, bromoform, chloromethane, bromomethane, vinyl
chloride, chloroethane, 1,1-dichloroethene, trans-1,2-dichloroethene,
trichloroethene (TCE), dichlorobenzenes, cis-1,2-dichloroethene,
dibromomethane, 1,4-dichlorobutane, 1,2,3-trichloropropane,
bromochloromethane, 2,2-dichloropropane, 1,2-dibromoethane,
1,3-dichloropropane, bromobenzene, chlorotoluenes, trichlorobenzenes,
trans-1,4-dichloro-2-butene and butylbenzenes).
One example of an organism which can be produced using methods of the
invention is an organism which degrades toluene. Panke et al., Appl. Environ.
Microbiol. 64:748-751 (1998) describe strains of Pseudomonas putida which
converts toluene, as well as several toluene derivatives, to benzoates. Thus,
methods of the invention can be used to insert into cell genetic elements
which
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-146-
encode proteins that convert toluene, as well as derivatives thereof, to less
toxic
compounds. The invention further includes cells produced by these methods and
methods for using such cells to convert toluene, as well as several toluene
derivatives, to less toxic compounds.
Methods of the invention can also be used to prepare organism suitable
for the detoxifying non-petroleum agents such as heavy metal ions (e. g. ,
mercury,
copper, cadmium, silver, gold, tellurite, selenite, and uranium). Methods by
which mercury, for example, can be detoxified include reduction of mercury
ions
to generate metallic mercury and through volatilization. Genes involved in the
detoxification by bacterial are described in Miller, "Bacterial Detoxification
of
Hg(II) and Organomercurials", Essays Biochem. 34:17-30 (1999).
Another example of a heavy metal ion detoxification system has been
identified in a strain ofRhodobacter sphaeroide (see O'Gara et al., Appl.
Environ.
Microbiol. 63(12):4713-4720 (1997)). Tellurite-resistance in this strain
appears
to be conferred by two loci. The first genetic locus contains four genes; two
of
these genes (i.e., trgA and trgB) confer increased tellurite-resistance when
inserted into another bacterium. Disruption of another gene at this locus,
cysK
(cysteine synthase), results in decreased tellurite resistance. The second
genetic
locus contains the telA gene. Inactivation of telA results in a significant
decreased tellurite resistance compared to the wild-type strain.
Microorganisms which are capable of detoxifying agents are described,
for example, in Perriello, U.S. Patent No. 6,110,372. Microorganisms suitable
for bioremediation applications include those of the Pseudomonadaceae family,
the Actinomycetes family, the Micrococcaceae family, the Vibrionaceae family,
the Rhizobiaceae family, the Cytophagaceae family, and the Corynebacterium
family. Specific examples of organisms suitable for use after modification
using
the methods of the invention for bioremediation applications include
Pseudomonas rubrisubalbicans, Pseudomonas aeruginosa, Yariovorax
paradoxus, Nocardia asteroides, Deinococcus radiodurans, Nocardia restricta,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-147-
Chryseobacterium indologenes, Comamonas acidovorans, Acidovorax delafieldii,
Rhodococcus rhodochrous, Rhodococcus erytlropolis, Aureobacterium
esteroaromaticum, Aureobacterium saperdae, Micrococcus varians, Micrococcus
kristinae, Aeromonas caviae, Stenotrophomonas maltophilia, Sphingobacterium
thalpophilum, Clavibacter michiganense, Alcaligenes xylosoxydans,
Corynebacterium aquaticum B and Cytophaga johnsonae.
Organisms suitable for bioremediation further include plants. Meagher
et al., U.S. Patent No. 5,965,796, for example, describes transgenic plants
which
express a metal ion resistance protein and reduce metal ions such as those of
copper, mercury, gold, cadmium, lead and silver. Further, genes encoding
phytochelatins can be introduced into plants to increase phytochelatin
synthesis.
Phytochelatins are glutathione derivatives which detoxify metal ions through
sequestration. Genes from a number of plant species involved in phytochelatin
synthesis are discussed in Corbett, "Phytochelatin Biosynthesis and Function
in
Heavy-Metal Detoxification'; Curr. Opin. Plant Biol. 3(3):211-216 (2000).
Specific plants suitable for bioremediation applications after modification
by methods of the invention include Lepidium sativum, Brassica juncea,
Brassica
oleracea, Brassica rapa, Acena saliva, Triticum aestivum, Helianthus annuus,
Colonial bentgrass, Kentucky bluegrass, perennial ryegrass, creeping
bentgrass,
Bermudagrass, Buffalograss, centipedegrass, switch grass, Japanese lawngrass,
coastal panicgrass, spinach, sorghum, tobacco and corn. Methods for generating
transgenic plants are known in the art and, as noted above, are described, for
example, in Meagher et al., U.S. Patent No. 5,965,796.
Methods of the invention can also be used to prepare organisms which
have diverse characteristics and contain a considerable number of inserted
genes.
As noted above, methods of the invention can be used to insert an almost
unlimited number of nucleic acid segments into cells. For example, in one
specific embodiment, the invention provides methods for producing cells which
express pesticidal proteins (e.g., pesticidal proteins of Bacillus
thurginiensis).
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-148-
(See, e.g., Schnepfetal., Microbiol. Molec. Biol. Rev. 62:775-806 (1998).)
Thus,
methods of the invention can be used to insert into cell genetic elements
which
encode pesticidal proteins. The invention further includes cells produced by
these
methods and methods for using such cells to produce pesticidal proteins. The
invention further includes methods for using cells (e.g., bacterial or plant
cells)
and pesticidal proteins produced by methods of the invention to control insect
populations. In certain embodiments, cells produced by methods of the
invention
and used in methods of the invention will be plant cells.
Thus, in one aspect, methods of the invention may be used to prepare
nucleic acid molecules which contain one or more ORFs and/or nucleic acid
segments which encode one or more non-protein expression products (e.g.,
functional RNAs such as tRNAs or ribozymes). In most embodiments of the
invention, the number of ORFs and/or nucleic acid segments which encode one
or more non-protein expression products will generally range between about 1
and about 300 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40,
45, 50, 55,
60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180,
190,
200, 225, 250, 275, 300, etc.). Nucleic acid molecules which contain one or
more
ORFs and/or nucleic acid segments which encode one or more non-protein
expression products will be especially useful for altering organisms to have
specified characteristics such as those described above.
Depending on a number of factors, including the number of functional
segments present, the size of nucleic acid molecules of the invention will
vary
considerably in size but, in general, will range between from about 0.5 kb to
about 300 kb (e.g., about 0.5 kb, about 1 kb, about 2 kb, about 3 kb, about 4
kb,
about 5 kb, about 7 kb, about 10 kb, about 12 kb, about 15 kb, about 20 kb,
about
40 kb, about 60 kb, about 80 kb, about 100 kb, about 200 kb, about 300 kb,
etc.).
In a specific embodiment, the invention further provides methods for
introducing nucleic acid molecules of the invention into animals (e.g.,
humans)
and animal cells (e.g., human cells), as part of a gene therapy protocol. Gene
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-149-
therapy refers to therapy performed by the administration to a subject of an
expressed or expressible nucleic acid molecule. In many embodiment of the
invention, nucleic acid molecules of the invention will encoded one or more
proteins which mediates at least one therapeutic effect. Thus, the invention
provide nucleic acid molecules and methods for use in gene therapy.
Nucleic acid molecules of the invention can be used to prepare gene
therapy vectors designed to replace genes which reside in the genome of a
cell,
to delete such genes, or to insert a heterologous gene or groups of genes.
When
nucleic acid molecules of the invention function to delete or replace a gene
or
genes, the gene or genes being deleted or replaced may lead to the expression
of
either a "normal" phenotype or an aberrant phenotype. One example of an
aberrant phenotype is the disease cystic fibrosis. Further, the gene therapy
vectors may be either stably maintained (e.g., integrate into cellular nucleic
acid
by homologous recombination) or non-stably maintained in cells.
Further, nucleic acid molecules of the invention may be used to suppress
"abnormal" phenotypes or complement or supplement "normal" phenotypes
which result from the expression of endogenous genes. One example of a nucleic
acid molecule of the invention designed to suppress an abnormal phenotype
would be where an expression product of the nucleic acid molecule has
dominant/negative activity. An example of a nucleic acid molecule of the
invention designed to supplement a normal phenotype would be where
introduction of the nucleic acid molecule effectively results in the
amplification
of a gene resident in the cell.
Further, nucleic acid molecules of the invention may be used to insert into
cells nucleic acid segments which encode expression products involved in each
step of particular biological pathways (e.g., biosynthesis of amino acids such
as
lysine, threonine, etc.) or expression products involved in one or a few steps
of
such pathways. These nucleic acid molecules can be designed to, in effect,
amplify genes encoding expression products in such pathways, insert genes into
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-150-
cells which encode expression products involved in pathways not normally found
in the cells, or to replace one or more genes involved one or more steps of
particular biological pathways in cells. Thus, gene therapy vectors of the
invention may contain nucleic acid which results in the production one or more
S products (e.g., one, two, three, four, five, eight, ten, fifteen, etc.).
Such vectors,
especially those which lead to the production of more than one product, will
be
particularly useful for the treatment of diseases and/or conditions which
result
from the expression and/or lack of expression of more than one gene or for the
treatment of more than one diseases and/or conditions.
Thus, in related aspects, the invention provides gene therapy vectors
which express one or more expression products (e.g., one or more fusion
proteins), methods for producing such vectors, methods for performing gene
therapy using vectors of the invention, expression products of such vector
(e.g.,
encoded RNA and/or proteins), and host cells which contain vectors of the
invention.
For general reviews of the methods of gene therapy, see Goldspiel et al. ,
1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95;
Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993,
Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem.
62:191-217; May,1993, TIBTECH 11(5):155-215). Methods commonly known
in the art of recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John
Wiley
& Sons, NY; and Kriegler, 1990, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY.
Delivery of the nucleic acid molecules of the invention into a patient may
be either direct, in which case the patient is directly exposed to the nucleic
acid
or nucleic acid carrying vectors, or indirect, in which case, cells are first
transformed with the nucleic acid in vitro, then transplanted into the
patient.
These two approaches are known, respectively, as in vivo or ex vivo gene
therapy.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-151-
In a specific embodiment, nucleic acid molecules of the invention are
directly administered in vivo, where they are expressed to produce one or more
expression products. This can be accomplished by any of numerous methods
known in the art, such as by constructing an expression vector and
administering
it so that they become intracellular (e.g., by infection using defective or
attenuated retroviral vectors or other viral vectors (see U.S. Patent No.
4,980,286), by direct injection of naked DNA, by use of microparticle
bombardment (e.g., a gene gun; Biolistic, Dupont), by coating with lipids or
cell-
surface receptors or transfecting agents, encapsulation in liposomes,
microparticles, or microcapsules, or by administering them in linkage to a
peptide
which is known to enter the nucleus, by administering it in linkage to a
ligand
subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol.
Chem. 262:4429-4432) (which can be used to target cell types specifically
expressing the receptors), etc.). In another embodiment, nucleic acid
molecules
of the invention can be targeted in vivo for cell specific uptake and
expression,
by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180
dated
April 16, 1992 (Wu et al.); WO 92/22635 dated December 23, 1992 (Wilson et
al.); W092/20316 datedNovember26,1992 (Findeis etal.); W093/14188 dated
July 22, 1993 (Clarke et al. ), WO 93/20221 dated October 14, 1993 (Young)).
Alternatively, nucleic acid molecules of the invention can be introduced
intracellularly and incorporated within host cell DNA for expression, by
homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci.
USA 86:8932-8935; Zijlstra et a1.,1989, Nature 342:435-438). Example of such
nucleic acid construct suitable for such an application are shown in Figures
21 C
and 22B.
In another specific embodiment, viral vectors that contains nucleic acid
sequences encoding an antibody or other antigen-binding protein of the
invention
are used. For example, a retroviral vector can be used (see Miller et al.,
1993,
Meth. Enzymol. 217:581-599). These retroviral vectors have been used to delete
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-152-
retroviral sequences that are not necessary for packaging of the viral genome
and
integration into host cell DNA. The nucleic acid sequences encoding the
antibody to be used in gene therapy are cloned into one or more vectors, which
facilitates delivery of the gene into a patient. More detail about retroviral
vectors
$ can be found in Boesen et al., 1994, Biotherapy 6:291-302, which describes
the
use of a retroviral vector to deliver the mdrl gene to hematopoietic stem
cells in
order to make the stem cells more resistant to chemotherapy. Other references
illustrating the use of retroviral vectors in gene therapy are: Clowes et al.,
1994,
J. Clin. Invest. 93:644-651; Kiem etal.,1994, Blood 83:1467-1473; Salmons and
Gunzberg, 1993, Human Gene Therapy 4:129-141; and Grossman and Wilson,
1993, Curr. Opin. in Genetics and Devel. 3:110-114.
Adenoviruses are other viral vectors that can be used in gene therapy.
Adenoviruses are especially attractive vehicles for delivering genes to
respiratory
epithelia and the use of such vectors are included within the scope of the
invention. Adenoviruses naturally infect respiratory epithelia where they
cause
a mild disease. Other targets for adenovirus-based delivery systems are liver,
the
central nervous system, endothelial cells, and muscle. Adenoviruses have the
advantage of being capable of infecting non-dividing cells. Kozarsky and
Wilson, 1993, Current Opinion in Genetics and Development 3:499-503 present
a review of adenovirus-based gene therapy. Bout et al., 1994, Human Gene
Therapy 5:3-10 demonstrated the use of adenovirus vectors to transfer genes to
the respiratory epithelia of rhesus monkeys. Other instances of the use of
adenoviruses in gene therapy can be found in Rosenfeld et al., 1991, Science
252:431-434; Rosenfeld et al., 1992, Cell 68:143-155; Mastrangeli et al.,
1993,
J. Clin. Invest. 91:225-234; PCT Publication Nos. W094/12649 and
WO 96/17053; U.S. Patent No. 5,998,205; and Wang et al., 1995, Gene Therapy
2:775-783, the disclosures of all of which are incorporated herein by
reference in
their entireties. In a one embodiment, adenovirus vectors are used.
Adeno-associated virus (AAV) and Herpes viruses, as well as vectors
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-153-
prepared from these viruses have also been proposed for use in gene therapy
(Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; U.S. Patent No.
5,436,146; Wagstaff et al., Gene Ther. 5:1566-70 (1998)). Herpes viral vectors
are particularly useful for applications where gene expression is desired in
nerve
cells.
Another approach to gene therapy involves transferring a gene to cells in
tissue culture by such methods as electroporation, lipofection, calcium
phosphate
mediated transfection, or viral infection. Usually, the method of transfer
includes
the transfer of a selectable marker to the cells. The cells are then placed
under
selection to isolate those cells that have taken up and are expressing the
transferred gene. Those cells are then delivered to a patient.
In this embodiment, the nucleic acid is introduced into a cell prior to
administration in vivo of the resulting recombinant cell. Such introduction
can
be carried out by any method known in the art, including but not limited to
transfection, electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell fusion,
chromosome-mediated gene transfer, microcell-mediated gene transfer,
spheroplast fusion, etc. Numerous techniques are known in the art for the
introduction of foreign genes into cells (see, e.g., Loeffler and Behr, 1993,
Meth.
Enzymol. 217:599-618; Cohen etal.,1993, Meth. Enzymol. 217:618-644; Cline,
1985, Pharmac. Ther. 29:69-92) and may be used in accordance with the present
invention, provided that the necessary developmental and physiological
functions
of the recipient cells are not disrupted. The technique should provide for the
stable transfer of the nucleic acid to the cell, so that the nucleic acid is
expressible
by the cell and, optionally, heritable and expressible by its cell progeny.
The resulting recombinant cells can be delivered to a patient by various
methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or
progenitor cells) will generally be administered intravenously. The amount of
cells envisioned for use depends on the desired effect, patient state, etc.,
and can
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-154-
be determined by one skilled in the art.
Cells into which a nucleic acid can be introduced for purposes of gene
therapy encompass any desired, available cell type, and include but are not
limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts,
muscle
cells, hepatocytes; blood cells such as T-lymphocytes, B-lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular hematopoietic
stem
or progenitor cells (e.g., as obtained from bone marrow, umbilical cord blood,
peripheral blood, fetal liver, etc.).
In a certain embodiment, the cell used for gene therapy is autologous to
the patient.
In an embodiment in which recombinant cells are used in gene therapy,
nucleic acid sequences encoding an antibody or other antigen-binding protein
are
introduced into the cells such that they are expressible by the cells or their
progeny, and the recombinant cells are then administered in vivo for
therapeutic
effect. In a specific embodiment, stem or progenitor cells are used. Any stem
and/or progenitor cells which can be isolated and maintained in vitro can
potentially be used in accordance with this embodiment of the present
invention
(see, e.g., PCT Publication WO 94/08598, dated April 28, 1994; Stemple and
Anderson, 1992, Cell 71:973-985; Rheinwald, 1980, Meth. Cell Bio. 21A:229;
and Pittelkow and Scott, 1986, Mayo Clinic Proc. 61:771).
In a specific embodiment, nucleic acid molecules to be introduced for
purposes of gene therapy comprises an inducible promoter operably linked to
the
coding region, such that expression of the nucleic acid molecules are
controllable
by controlling the presence or absence of the appropriate inducer of
transcription.
The nucleic acid molecules of the invention can also be used to produce
transgenic organisms (e.g., animals and plants). Animals of any species,
including, but not limited to, mice, rats, rabbits, hamsters, guinea pigs,
pigs,
micro-pigs, goats, sheep, cows and non-human primates (e.g., baboons, monkeys,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-155-
and chimpanzees) may be used to generate transgenic animals. Further, plants
of
any species, including but not limited to Lepidium sativum, Brassica juncea,
Brassica oleracea, Brassica rapa, Acena sativa, Triticum aestivum, Helianthus
annuus, Colonial bentgrass, Kentucky bluegrass, perennial ryegrass, creeping
bentgrass, Bermudagrass, Buffalograss, centipedegrass, switch grass, Japanese
lawngrass, coastal panicgrass, spinach, sorghum, tobacco and corn, may be used
to generate transgenic plants.
Any technique known in the art may be used to introduce nucleic acid
molecules of the invention into organisms to produce the founder lines of
transgenic organisms. Such techniques include, but are not limited to,
pronuclear
microinjection(Patersonetal.,Appl. Microbiol. Biotechnol. 40:691-698 (1994);
Carver et al., Biotechnology (N~ 11:1263-1270 (1993); Wright et al.,
Biotechnology (N~ 9:830-834 (1991); and Hoppe etal., U.S. Pat. No. 4,873,191
(1989)); retrovirus mediated gene transfer into germ lines (Van der Putten et
al.,
Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts or embryos; gene
targeting in embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation of cells or embryos (Lo, Mol. Cell. Biol. 3:1803-1814 (1983));
introduction of the polynucleotides of the invention using a gene gun (see,
e.g.,
Ulmer et al., Science 259:1745 (1993); introducing nucleic acid constructs
into
embryonic pluripotent stem cells and transferring the stem cells back into the
blastocyst; and sperm-mediated gene transfer (Lavitrano et al., Cell 57:717-
723
( 1989); etc. For a review of such techniques, see Gordon, "Transgenic
Animals,"
Intl. Rev. Cytol. 115:171-229 (1989), which is incorporated by reference
herein
in its entirety. Further, the contents of each of the documents recited in
this
paragraph is herein incorporated by reference in its entirety. See also, U.S.
Patent
No. 5,464,764 (Capecchi et al., Positive-Negative Selection Methods and
Vectors); U.S. Patent No. 5,631,153 (Capecchi et al., Cells and Non-Human
Organisms Containing Predetermined Genomic Modifications and Positive-
Negative Selection Methods and Vectors for Making Same); U.S. Patent No.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-156-
4,736,866 (Leder et al., Transgenic Non-Human Animals); and U.S. Patent No.
4,873,191 (Wagner et al., Genetic Transformation of Zygotes); each of which is
hereby incorporated by reference in its entirety.
Any technique known in the art may be used to produce transgenic clones
containing nucleic acid molecules of the invention, for example, nuclear
transfer
into enucleated oocytes of nuclei from cultured embryonic, fetal, or adult
cells
induced to quiescence (Campell et al., Nature 380:64-66 (1996); Wilmut et al.,
Nature 385:810-813 (1997)), each of which is herein incorporated by reference
in its entirety).
The present invention provides for transgenic organisms that carry nucleic
acid molecules of the invention in all their cells, as well as organisms which
carry
these nucleic acid molecules, but not all their cells, i.e., mosaic organisms
or
chimeric. The nucleic acid molecules of the invention may be integrated as a
single copy or as multiple copies such as in concatamers, e.g., head-to-head
tandems or head-to-tail tandems. The nucleic acid molecules of the invention
may also be selectively introduced into and activated in a particular cell
type by
following, for example, the teaching of Lasko et al. (Lasko et al., Proc.
Natl.
Acad. Sci. USA 89:6232-6236 (1992)). The regulatory sequences required for
such a cell-type specific activation will depend upon the particular cell type
of
interest, and will be apparent to those of skill in the art. When it is
desired that
nucleic acid molecules of the invention be integrated into the chromosomal
site
of the endogenous gene, this will normally be done by gene targeting. Briefly,
when such a technique is to be utilized, vectors containing some nucleotide
sequences homologous to the endogenous gene are designed for the purpose of
integrating, via homologous recombination with chromosomal sequences, into
and disrupting the function of the nucleotide sequence of the endogenous gene.
Nucleic acid molecules of the invention may also be selectively introduced
into
a particular cell type, thus inactivating the endogenous gene in only that
cell type,
by following, for example, the teaching of Gu et al. (Gu et al., Science
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-157-
265:103-106 (1994)). The regulatory sequences required for such a cell-type
specific inactivation will depend upon the particular cell type of interest,
and will
be apparent to those of skill in the art. The contents of each of the
documents
recited in this paragraph is herein incorporated by reference in its entirety.
Once transgenic organisms have been generated, the expression of the
recombinant gene may be assayed utilizing standard techniques. Initial
screening
may be accomplished by Southern blot analysis or PCR techniques to analyze
organism tissues to verify that integration of nucleic acid molecules of the
invention has taken place. The level of mRNA expression of nucleic acid
molecules of the invention in the tissues of the transgenic organisms may also
be
assessed using techniques which include, but are not limited to, Northern blot
analysis of tissue samples obtained from the organism, in situ hybridization
analysis, and reverse transcriptase-PCR (rt-PCR). Samples of tissue may which
express nucleic acid molecules of the invention also be evaluated
immunocytochemically or immunohistochemically using antibodies specific for
the expression product of these nucleic acid molecules.
Once the founder organisms are produced, they may be bred, inbred,
outbred, or crossbred to produce colonies of the particular organism. Examples
of such breeding strategies include, but are not limited to: outbreeding of
founder
organisms with more than one integration site in order to establish separate
lines;
inbreeding of separate lines in order to produce compound transgenic organisms
that express nucleic acid molecules of the invention at higher levels because
of
the effects of additive expression of each copy of nucleic acid molecules of
the
invention; crossing of heterozygous transgenic organisms to produce organisms
homozygous for a given integration site in order to both augment expression
and
eliminate the need for screening of organisms by DNA analysis; crossing of
separate homozygous lines to produce compound heterozygous or homozygous
lines; and breeding to place the nucleic acid molecules of the invention on a
distinct background that is appropriate for an experimental model of interest.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-158-
Transgenic and "knock-out" organisms of the invention have uses which
include, but are not limited to, model systems (e.g., animal model systems)
useful
in elaborating the biological function of expression products of nucleic acid
molecules of the invention, studying conditions and/or disorders associated
with
aberrant expression of expression products of nucleic acid molecules of the
invention, and in screening for compounds effective in ameliorating such
conditions and/or disorders.
As one skilled in the art would recognize, in many instances when nucleic
acid molecules of the invention are introduced into metazoan organisms, it
will
be desirable to operably link sequences which encode expression products to
tissue-specific transcriptional regulatory sequences (e.g., tissue-specific
promoters) where production of the expression product is desired. Such
promoters can be used to facilitate production of these expression products in
desired tissues. A considerable number of tissue-specific promoters are known
1 S in the art. Further, methods for identifying tissue-specific
transcriptional
regulatory sequences are described elsewhere herein.
Host Cells
The invention also relates to host cells comprising one or more of the
nucleic acid molecules or vectors of the invention (e.g., two, three, four,
five,
seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.), particularly those
nucleic
acid molecules and vectors described in detail herein. Representative host
cells
that may be used according to this aspect of the invention include, but are
not
limited to, bacterial cells, yeast cells, plant cells and animal cells.
Preferred
bacterial host cells include Escherichia spp. cells (particularly E. coli
cells and
most particularly E. coli strains DH10B, Stbl2, DHSa, DB3, DB3.1 (preferably
E. coli LIBRARY EFFICIENCY~ DB3.1TM Competent Cells; Invitrogen Corp.,
Life Technologies Division, Rockville, MD), DB4 and DBS (see U.S.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-159-
Application No. 09/518,188, filed on March 2, 2000, and U.S. Provisional
Application No. 60/122,392, filed on March 2,1999, the disclosures of which
are
incorporated by reference herein in their entireties), Bacillus spp. cells
(particularly B. subtilis and B. megaterium cells), Streptomyces spp. cells,
Erwinia spp. cells, Klebsiella spp. cells, Serratia spp. cells (particularly
S.
marcessans cells), Pseudomonas spp. cells (particularly P. aeruginosa cells),
and
Salmonella spp. cells (particularly S. typhimurium and S. typhi cells).
Preferred
animal host cells include insect cells (most particularly Drosophila
melanogaster
cells, Spodoptera frugiperda Sf9 and SfZ 1 cells and Trichoplusa High-Five
cells),
nematode cells (particularly C. elegans cells), avian cells, amphibian cells
(particularly Xenopus laevis cells), reptilian cells, and mammalian cells
(most
particularly NIH3T3, CHO, COS, VERO, BHK and human cells). Preferred
yeast host cells include Saccharomyces cerevisiae cells and Pichia pastoris
cells.
These and other suitable host cells are available commercially, for example,
from
Invitrogen Corp., Life Technologies Division (Rockville, Maryland), American
Type Culture Collection (Manassas, Virginia), and Agricultural Research
Culture
Collection (NRRL; Peoria, Illinois).
Methods for introducing the nucleic acid molecules and/or vectors of the
invention into the host cells described herein, to produce host cells
comprising
one or more of the nucleic acid molecules and/or vectors of the invention,
will be
familiar to those of ordinary skill in the art. For instance, the nucleic acid
molecules and/or vectors of the invention may be introduced into host cells
using
well known techniques of infection, transduction, electroporation,
transfection,
and transformation. The nucleic acid molecules and/or vectors of the invention
may be introduced alone or in conjunction with other the nucleic. acid
molecules
and/or vectors and/or proteins, peptides or RNAs. Alternatively, the nucleic
acid
molecules and/or vectors of the invention may be introduced into host cells as
a
precipitate, such as a calcium phosphate precipitate, or in a complex with a
lipid.
Electroporation also may be used to introduce the nucleic acid molecules
and/or
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-160-
vectors of the invention into a host. Likewise, such molecules may be
introduced
into chemically competent cells such as E. col i. If the vector is a virus, it
may be
packaged in vitro or introduced into a packaging cell and the packaged virus
may
be transduced into cells. Thus nucleic acid molecules of the invention may
contain and/or encode one or more packaging signal (e.g., viral packaging
signals
which direct the packaging of viral nucleic acid molecules). Hence, a wide
variety of techniques suitable for introducing the nucleic acid molecules
and/or
vectors of the invention into cells in accordance with this aspect of the
invention
are well known and routine to those of skill in the art. Such techniques are
reviewed at length, for example, in Sambrook, J., et al., Molecular Cloning, a
Laboratory Manual, 2nd Ed., Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press, pp. 16.30-16.55 (1989), Watson, J.D., et al., Recombinant
DNA, 2nd Ed., New York: W.H. Freeman and Co., pp. 213-234 (1992), and
Winnacker, E.-L., From Genes to Clones, New York: VCH Publishers (1987),
which are illustrative of the many laboratory manuals that detail these
techniques
and which are incorporated by reference herein in their entireties for their
relevant
disclosures.
Polymerises
Polymerises for use in the invention include but are not limited to
~ polymerises (DNA and RNA polymerises), and reverse transcriptases. DNA
polymerises include, but are not limited to, Thermus thermophilus (Tth) DNA
polymerise, Thermus aquaticus (Taq) DNA polymerise, Thermotoga
neopolitana (Tne) DNA polymerise, Thermotoga maritima (Tma) DNA
polymerise, Thermococcus litoralis (Tli or VENTTM) DNA polymerise,
Pyrococcus furiosus (Pfu) DNA polymerise, DEEPVENTTM DNA polymerise,
Pyrococcus woosii (Pwo) DNA polymerise, Pyrococcus sp KOD2 (KOD) DNA
polymerise, Bacillus sterothermophilus (Bst) DNA polymerise, Bacillus
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-161-
caldophilus (Bca) DNA polymerise, Sulfolobus acidocaldarius (Sac) DNA
polymerise, Thermoplasma acidophilum (Tic) DNA polymerise, Thermusflavus
(TfllTub) DNA polymerise, Thermus ruber (Tru) DNA polymerise, Thermus
brockianus (DYNAZYMETM) DNA polymerise, Methanobacterium
thermoautotrophicum (Mth) DNA polymerise, mycobacterium DNA polymerise
(Mtb, Mlep), E. coli pol I DNA polymerise, TS DNA polymerise, T7 DNA
polymerise, and generally pol I type DNA polymerises and mutants, variants and
derivatives thereof. RNA polymerises such as T3, T5, T7 and SP6 and mutants,
variants and derivatives thereof may also be used in accordance with the
invention.
The nucleic acid polymerises used in the present invention may be
mesophilic or thermophilic, and are preferably thermophilic. Preferred
mesophilic DNA polymerises include Pol I family of DNA polymerises (and
their respective Klenow fragments) any of which may be isolated from organism
such as E. coli, H. influenzae, D. radiodurans, H. pylori, C. aurantiacus, R.
prowazekii, T. pallidum, Synechocystis sp., B. subtilis, L. lactis, S.
pneumoniae,
M. tuberculosis, M. leprae, M. smegmatis, Bacteriophage L5, phi-C31 , T7, T3,
T5, SP01, SP02, mitochondrial from S. cerevisiae MIP-1, and eukaryotic C.
elegans, and D. melanogaster (Astatke, M. et al., 1998, J. Mol. Biol. 278,
147-165), pol III type DNA polymerise isolated from any sources, and mutants,
derivatives or variants thereof, and the like. Preferred thermostable DNA
polymerises that may be used in the methods and compositions of the invention
include Taq, Tne, Tma, Pfu, KOD, Tfl, Tth, Stoffel fragment, VENTTM and
DEEPVENTTM DNA polymerises, and mutants, variants and derivatives thereof
(U.5. Patent No. 5,436,149; U.S. Patent 4,889,818; U.S. Patent 4,965,188; U.S.
Patent 5,079,352; U.S. Patent 5,614,365; U.S. Patent 5,374,553; U.S. Patent
5,270,179; U.S. Patent 5,047,342; U.S. PatentNo. 5,512,462; WO 92/06188; WO
92/06200; WO 96/10640; WO 97/09451; Barnes, W.M., Gene 112:29-35 (1992);
Lawyer, F.C., et al., PCR Meth. Appl. 2:275-287 (1993); Flaman, J.-M, et al.,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-162-
Nucl. Acids Res. 22(15):3259-3260 (1994)).
Reverse transcriptases for use in this invention include any enzyme
having reverse transcriptase activity. Such enzymes include, but are not
limited
to, retroviral reverse transcriptase, retrotransposon reverse transcriptase,
hepatitis
B reverse transcriptase, cauliflower mosaic virus reverse transcriptase,
bacterial
reverse transcriptase, Tth DNA polymerase, Taq DNA polymerase (Saiki, R.K.,
et al., Science 239:487-491 (1988); U.S. Patent Nos. 4,889,818 and 4,965,188),
Tne DNA polymerase (WO 96/ 10640 and WO 97/09451 ), Tma DNA polymerase
(U. S. Patent No. 5,374,553) and mutants, variants or derivatives thereof
(see,
e.g., WO 97/09451 and WO 98/47912). Preferred enzymes for use in the
invention include those that have reduced, substantially reduced or eliminated
RNase H activity. By an enzyme "substantially reduced in RNase H activity" is
meant that the enzyme has less than about 20%, more preferably less than about
15%, 10% or 5%, and most preferably less than about 2%, of the RNase H
activity of the corresponding wild-type or RNase H+ enzyme such as wild-type
Moloney Murine Leukemia Virus (M-MLV), Avian Myeloblastosis Virus (AMV)
or Rous Sarcoma Virus (RSV) reverse transcriptases. The RNase H activity of
any enzyme may be determined by a variety of assays, such as those described,
for example, in U.S. Patent No. 5,244,797, in Kotewicz, M.L., et al., Nucl.
Acids
Res. 16:265 (1988) and in Gerard, G.F., et al., FOCUS 14(5):91 (1992), the
disclosures of all of which are fully incorporated herein by reference.
Particularly
preferred polypeptides for use in the invention include, but are not limited
to,
M-MLV H- reverse transcriptase, RSV H- reverse transcriptase, AMV H- reverse
transcriptase, RAV (rous-associated virus) H- reverse transcriptase, MAV
(myeloblastosis-associated virus) H' reverse transcriptase and HIV H- reverse
transcriptase. (See U.S. Patent No. 5,244,797 and WO 98/47912). It will be
understood by one of ordinary skill, however, that any enzyme capable of
producing a DNA molecule from a ribonucleic acid molecule (i. e., having
reverse
transcriptase activity) may be equivalently used in the compositions, methods
and
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-163-
kits of the invention.
The enzymes having polymerase activity for use in the invention may be
obtained commercially, for example from Invitrogen Corp., Life Technologies
Division (Rockville, Maryland), Perkin-Elmer (Branchburg, New Jersey), New
England BioLabs (Beverly, Massachusetts) or Boehringer Mannheim
Biochemicals (Indianapolis, Indiana). Enzymes having reverse transcriptase
activity for use in the invention may be obtained commercially, for example,
from Invitrogen Corp., Life Technologies Division (Rockville, Maryland),
Pharmacia (Piscataway, New Jersey), Sigma (Saint Louis, Missouri) or
Boehringer Mannheim Biochemicals (Indianapolis, Indiana). Alternatively,
polymerases or reverse transcriptases having polymerase activity may be
isolated
from their natural viral or bacterial sources according to standard procedures
for
isolating and purifying natural proteins that are well-known to one of
ordinary
skill in the art (see, e.g., Houts, G.E., et al., J. Virol. 29:517 (1979)). In
addition,
such polymerases/reverse transcriptases may be prepared by recombinant DNA
techniques that are familiar to one of ordinary skill in the art (see, e.g.,
Kotewicz,
M.L., et al., Nucl. Acids Res. 16:265 (1988); U.S. Patent No. 5,244,797; WO
98/47912; Soltis, D.A., and Skalka, A.M., Proc. Natl. Acad. Sci. USA
85:3372-3376 (1988)). Examples of enzymes having polymerase activity and
reverse transcriptase activity may include any of those described in the
present
application.
Supports and Arrays
Supports for use in accordance with the invention may be any support or
matrix suitable for attaching nucleic acid molecules comprising one or more
recombination sites or portions thereof. Such molecules may be added or bound
(covalently or non-covalently) to the supports of the invention by any
technique
or any combination of techniques well known in the art. Supports of the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-164-
invention may comprise nitrocellulose, diazocellulose, glass, polystyrene
(including microtitre plates), polyvinylchloride, polypropylene, polyethylene,
polyvinylidenedifluoride (PVDF), dextran, Sepharose, agar, starch and nylon.
Supports of the invention may be in any form or configuration including beads,
filters, membranes, sheets, frits, plugs, columns and the like. Solid supports
may
also include mufti-well tubes (such as microtitre plates) such as 12-well
plates,
24-well plates, 48-well plates, 96-well plates, and 384-well plates. Preferred
beads are made of glass, latex or a magnetic material (magnetic, paramagnetic
or
superparamagnetic beads).
In a preferred aspect, methods of the invention may be used to prepare
arrays of proteins or nucleic acid molecules (RNA or DNA) or arrays of other
molecules, compounds, and/or substances. Such arrays may be formed on
microplates, glass slides or standard blotting membranes and may be referred
to
as microarrays or gene-chips depending on the format and design of the array.
Uses for such arrays include gene discovery, gene expression profiling,
genotyping (SNP analysis, pharmacogenomics, toxicogenetics), and the
preparation of nanotechnology devices.
Synthesis and use of nucleic acid arrays and generally attachment of
nucleic acids to supports have been described (see, e.g., U.S. Patent No.
5,436,327, U.S. PatentNo. 5,800,992, U.S. PatentNo. 5,445,934, U.S. PatentNo.
5,763,170, U.S. Patent No. 5,599,695 and U.S. Patent No. 5,837,832). An
automated process for attaching various reagents to positionally defined sites
on
a substrate is provided in Pirrung, et al. U.S. Patent No. 5,143,854 and
Barrett,
et al. U. S. Patent No. 5,252,743. For example, disulfide-modified
oligonucleotides can be covalently attached to solid supports using disulfide
bonds. (See Rogers et al., Anal. Biochem. 266:23-30 (1999).) Further,
disulfide-modified oligonucleotides can be peptide nucleic acid (PNA) using
solid-phase synthesis. (See Aldrian-Herrada et al., J. Pept. Sci. 4:266-281
(1998).) Thus, nucleic acid molecules comprising one or more recombination
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-165-
sites or portions thereof can be added to one or more supports (or can be
added
in arrays on such supports) and nucleic acids, proteins or other molecules
and/or
compounds can be added to such supports through recombination methods of the
invention. Conjugation of nucleic acids to a molecule of interest are known in
the
$ art and thus one of ordinary skill can produce molecules and/or compounds
comprising recombination sites (or portions thereof) for attachment to
supports
(in array format or otherwise) according to the invention.
Essentially, any conceivable support may be employed in the invention.
The support may be biological, non-biological, organic, inorganic, or a
combination of any of these, existing as particles, strands, precipitates,
gels,
sheets, tubing, spheres, containers, capillaries, pads, slices, films, plates,
slides,
etc. The support may have any convenient shape, such as a disc, square,
sphere,
circle, etc. The support is preferably flat but may take on a variety of
alternative
surface configurations. For example, the support may contain raised or
depressed
regions which may be used for synthesis or other reactions. The support and
its
surface preferably form a rigid support on which to carry out the reactions
described herein. The support and its surface are also chosen to provide
appropriate light-absorbing characteristics.' For instance, the support may be
a
polymerized Langmuir Blodgett film, functionalized glass, Si, Ge, GaAs, GaP,
SiOz, SIN4, modified silicon, or any one of a wide variety of gels or polymers
such as (poly)tetrafluoroethylene, (poly)vinylidenedifluoride, polystyrene,
polycarbonate, or combinations thereof. Other support materials will be
readily
apparent to those of skill in the art upon review of this disclosure. In a
preferred
embodiment the support is flat glass or single-crystal silicon.
Thus, the invention provides methods for preparing arrays of nucleic acid
molecules attached to supports. In some embodiments, these nucleic acid
molecules will have recombination sites at one or more (e.g., one, two, three
or
four) of their termini. In some additional embodiments, one nucleic acid
molecule will be attached directly to the support, or to a specific section of
the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-166-
support, and one or more additional nucleic acid molecules will be indirectly
attached to the support via attachment to the nucleic acid molecule which is
attached directly to the support. In such cases, the nucleic acid molecule
which
is attached directly to the support provides a site of nucleation around which
a
nucleic acid array may be constructed.
The invention further provides methods for linking supports to each other
and for linking molecules bound to the same support together. Using Figure 11
for non-limiting illustration of one embodiment of such a process, a
recombination site designated RS6 can be positioned at the end of the RSS site
on
the A/B composition shown attached to the support in the lower portion of the
figure. Further, an identical composition may also be attached to another part
of
the same or different support. Recombination between the RS6 sites can then be
used to connect the two compositions, thereby forming either a linkage between
two compositions attached to the same support or two compositions attached to
the different support. The invention thus provides methods for cross-linking
compounds attached to the same support by linking one or more compositions
bound to the support using recombination sites. The invention also provides
methods for cross-linking separate supports by linking one or more
compositions
bound to these supports suing recombination sites.
In one aspect, the invention provides supports containing nucleic acid
molecules which are produced by methods of the invention. In many
embodiments, the nucleic acid molecules of these supports will contain at
least
one recombination site. In some embodiments, this recombination site will have
undergone recombination prior to attachment of the nucleic acid molecule to
the
support. These bound nucleic acid molecules are useful, for example, for
identifying other nucleic acid molecules (e.g., nucleic acid molecules which
hybridize to the bound nucleic acid molecules under stringent hybridization
conditions) and proteins which have binding affinity for the bound nucleic
acid
molecules. Expression products may also be produced from these bound nucleic
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-167-
acid molecules while the nucleic acid molecules remain bound to the support.
Thus, compositions and methods of the invention can be used to identify
expression products and products produced by these expression products.
In other embodiments, nucleic acid molecules bound to supports will
undergo recombination after attachment of the nucleic acid molecule to the
support. As already discussed, these bound nucleic acid molecules may thus be
used to identify nucleic acid molecules which encode expression products
involved in one or a specified number of biological processes or pathways.
Further, nucleic acid molecules attached to supports may be released from
these supports. Methods for releasing nucleic acid molecules include
restriction
digestion, recombination, and altering conditions (e.g., temperature, salt
concentrations, etc.) to induce the dissociation of nucleic acid molecules
which
have hybridized to bound nucleic acid molecules. Thus, methods of the
invention
include the use of supports to which nucleic acid molecules have been bound
for
the isolation of nucleic acid molecules.
As noted above, in one aspect, the invention provides methods for
screening nucleic acid libraries to identifying nucleic acid molecules which
encode expression products involved in the same biological processes or
pathways. In specific embodiments, such methods involve ( 1 ) attaching a
nucleic
acid molecule comprising at least one recombination site to a support, (2)
contact
the bound nucleic acid molecule with a library of nucleic acid molecules,
wherein
individual nucleic acid molecules of the library comprise at least one
recombination site, under conditions which facilitate recombination between
the
bound nucleic acid molecule 'and nucleic acid molecules of the library, and
(3) screening for either expression products of the nucleic acid molecule
formed
by recombination or products produced by the expression products of these
nucleic acid molecules.
Examples of compositions which can be formed by binding nucleic acid
molecules to supports are "gene chips," often referred to in the art as "DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-168-
microarrays" or "genome chips" (see U.S. Patent Nos. 5,412,087 and 5,889,165,
and PCT Publication Nos. WO 97/02357, WO 97/43450, WO 98/20967,
WO 99/05574, WO 99/05591, and WO 99/40105, the disclosures of which are
incorporated by reference herein in their entireties). In various embodiments
of
the invention, these gene chips may contain two- and three-dimensional nucleic
acid arrays described herein.
The adressability of nucleic acid arrays of the invention means that
molecules or compounds which bind to particular nucleotide sequences can be
attached to the arrays. Thus, components such as proteins and other nucleic
acids
can be attached to specific locations/positions in nucleic acid arrays of the
invention.
Thus, in one aspect, the invention provides affinity purification methods
comprising ( 1 ) providing a support to which nucleic acid molecules
comprising
at least one recombination site are bound, (2) attaching one or more
additional
nucleic acid molecules to the support using recombination reactions,
(3) contacting the support with a composition containing molecules or
compounds which have binding affinity for nucleic acid molecules bound to the
support, under conditions which facilitate binding of the molecules or
compounds
to the nucleic acid molecules bound to the support, (4) altering the
conditions to
facilitate the release of the bound molecules or compounds, and (5) collecting
the
released molecules or compounds.
Methods of Nucleic Acid Synthesis, Amplification and Sequencing
The present invention may be used in combination with any method
involving the synthesis of nucleic acid molecules, such as DNA (including
cDNA) and RNA molecules. Such methods include, but are not limited to,
nucleic acid synthesis methods, nucleic acid amplification methods and nucleic
acid sequencing methods. Such methods may be used to prepare molecules (e.g.,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-169-
starting molecules) used in the invention or to further manipulate molecules
or
vectors produced by the invention.
Nucleic acid synthesis methods according to this aspect of the invention
may comprise one or more steps (e.g., two, three, four, five, seven, ten,
twelve,
fifteen, etc.). For example, the invention provides a method for synthesizing
a
nucleic acid molecule comprising (a) mixing a nucleic acid template (e.g., a
nucleic acid molecules or vectors of the invention) with one or more primers
(e.g., two, three, four, five, seven, ten, twelve, fifteen, twenty, thirty,
fifty, etc.)
and one or more enzymes (e.g., two, three, four, five, seven, etc.) having
polymerase or reverse transcriptase activity to form a mixture; and (b)
incubating
the mixture under conditions sufficient to make a first nucleic acid molecule
complementary to all or a portion of the template. According to this aspect of
the
invention, the nucleic acid template may be a DNA molecule such as a cDNA
molecule or library, or an RNA molecule such as a mRNA molecule. Conditions
su~cient to allow synthesis such as pH, temperature, ionic strength, and
incubation times may be optimized by those skilled in the art. If desired,
recombination sites may be added to such synthesized molecules during or after
the synthesis process (see, e.g., U.S. Patent Application No. 09/177,387 filed
10/23/98 based on U.S. provisional patent application no. 60/065,930 filed
October 24, 1997).
In accordance with the invention, the target or template nucleic acid
molecules or libraries may be prepared from nucleic acid molecules obtained
from natural sources, such as a variety of cells, tissues, organs or
organisms.
Cells that may be used as sources of nucleic acid molecules may be prokaryotic
(bacterial cells, including those of species of the genera Escherichia,
Bacillus,
Serratia, Salmonella, Staphylococcus, Streptococcus, Clostridium, Chlamydia,
Neisseria, Treponema, Mycoplasma, Borrelia, Legionella, Pseudomonas,
Mycobacterium, Helicobacter, Erwinia, Agrobacterium, Rhizobium, and
Streptomyces) or eukaryotic (including fungi (especially yeast's), plants,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-170-
protozoans and other parasites, and animals including insects (particularly
Drosophila spp. cells), nematodes (particularly Caenorhabditis elegans cells),
and mammals (particularly human cells)).
Of course, other techniques of nucleic acid synthesis which may be
advantageously used will be readily apparent to one of ordinary skill in the
art.
In other aspects of the invention, the invention may be used in
combination with methods for amplifying or sequencing nucleic acid molecules.
Nucleic acid amplification methods according to this aspect of the invention
may
include the use of one or more polypeptides having reverse transcriptase
activity,
in methods generally known in the art as one-step (e.g., one-step RT-PCR) or
two-step (e.g., two-step RT-PCR) reverse transcriptase-amplification
reactions.
For amplification of long nucleic acid molecules (i. e., greater than about 3-
5 Kb
in length), a combination of DNA polymerases may be used, as described in WO
98/06736 and WO 95/16028.
Amplification methods according to the invention may comprise one or
more steps (e.g., two, three, four, five, seven, ten, etc.). For example, the
invention provides a method for amplifying a nucleic acid molecule comprising
(a) mixing one or more enzymes with polymerase activity (e.g., two, three,
four,
five, seven, ten, etc.) with one or more nucleic acid templates (e.g., two,
three,
four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, one hundred,
etc.); and
(b) incubating the mixture under conditions sufficient to allow the enzyme
with
polymerase activity to amplify one or more nucleic acid molecules
complementary to all or a portion of the templates. The invention also
provides
nucleic acid molecules amplified by such methods. If desired, recombination
sites may be added to such amplified molecules during or after the
amplification
process (see, e.g., U.S. Patent Application No. 09/177,387 filed 10/23/98
based
on U.S. provisional patent application no. 60/065,930 filed October 24, 1997).
General methods for amplification and analysis of nucleic acid molecules
or fragments are well known to one of ordinary skill in the art (see, e.g.,
U.S. Pat.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-171-
Nos. 4,683,195; 4,683,202; and 4,800,159; Innis, M.A., et al., eds., PCR
Protocols: A Guide to Methods and Applications, San Diego, California:
Academic Press, Inc. (1990); Griffin, H.G., and Griffin, A.M., eds., PCR
Technology: Current Innovations, Boca Raton, Florida: CRC Press (1994)). For
example, amplification methods which may be used in accordance with the
present invention include PCR (LJ.S. Patent Nos. 4,683,195 and 4,683,202),
Strand Displacement Amplification (SDA; U.S. Patent No. 5,455,166; EP 0 684
315), andNucleic Acid Sequence-Based Amplification (NASBA; U.S. PatentNo.
5,409,818; EP 0 329 822).
Typically, these amplification methods comprise: (a) mixing one or more
enzymes with polymerase activity with the nucleic acid sample in the presence
of one or more primers, and (b) amplifying the nucleic acid sample to generate
a collection of amplified nucleic acid fragments, preferably by PCR or
equivalent
automated amplification technique.
Following amplification or synthesis by the methods of the present
invention, the amplified or synthesized nucleic acid fragments may be isolated
for further use or characterization. This step is usually accomplished by
separation of the amplified or synthesized nucleic acid fragments by size or
by
any physical or biochemical means including gel electrophoresis, capillary
electrophoresis, chromatography (including sizing, affinity and
immunochromatography), density gradient centrifugation and immunoadsorption.
Separation of nucleic acid fragments by gel electrophoresis is particularly
preferred, as it provides a rapid and highly reproducible means of sensitive
separation of a multitude of nucleic acid fragments, and permits direct,
simultaneous comparison of the fragments in several samples of nucleic acids.
One can extend this approach, in another preferred embodiment, to isolate and
characterize these fragments or any nucleic acid, fragment amplified or
synthesized by the methods of the invention. Thus, the invention is also
directed
to isolated nucleic acid molecules produced by the amplification or synthesis
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-172-
methods of the invention.
In this embodiment, one or more of the amplified or synthesized nucleic
acid fragments are removed from the gel which was used for identification (see
above), according to standard techniques such as electroelution or physical
excision. The isolated unique nucleic acid fragments may then be inserted into
standard vectors, including expression vectors, suitable for transfection or
transformation of a variety of prokaryotic (bacterial) or eukaryotic (yeast,
plant
or animal including human and other mammalian) cells. Alternatively, nucleic
acid molecules produced by the methods of the invention may be further
characterized, for example by sequencing (i.e., determining the nucleotide
sequence of the nucleic acid fragments), by methods described below and others
that are standard in the art (see, e.g., U.S. Patent Nos. 4,962,022 and
5,498,523,
which are directed to methods of DNA sequencing).
Nucleic acid sequencing methods according to the invention may
comprise one or more steps. For example, the invention may be combined with
a method for sequencing a nucleic acid molecule comprising (a) mixing an
enzyme with polymerase activity with a nucleic acid molecule to be sequenced,
one or more primers, one or more nucleotides, and one or more terminating
agents (such as a dideoxynucleotides) to form a mixture; (b) incubating the
mixture under conditions sufficient to synthesize a population of molecules
complementary to all or a portion of the molecule to be sequenced; and (c)
separating the population to determine the nucleotide sequence of all or a
portion
of the molecule to be sequenced.
Nucleic acid sequencing techniques which may be employed include
dideoxy sequencing methods such as those disclosed in U.S. Patent Nos.
4,962,022 and 5,498,523.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-173-
Kits
In another aspect, the invention provides kits which may be used in
conjunction with the invention. Kits according to this aspect of the invention
may comprise one or more containers, which may contain one or more
components selected from the group consisting of one or more nucleic acid
molecules or vectors of the invention, one or more primers, the molecules
and/or
compounds of the invention, supports of the invention, one or more
polymerases,
one or more reverse transcriptases, one or more recombination proteins (or
other
enzymes for carrying out the methods of the invention), one or more buffers,
one
or more detergents, one or more restriction endonucleases, one or more
nucleotides, one or more terminating agents (e.g., ddNTPs), one or more
transfection reagents, pyrophosphatase, and the like.
A wide variety of nucleic acid molecules or vectors of the invention can
be used with the invention. Further, due to the modularity of the invention,
these
nucleic acid molecules and vectors can be combined in wide range of ways.
Examples of nucleic acid molecules which can be supplied in kits of the
invention
include those that contain promoters, signal peptides, enhancers, repressors,
selection markers, transcription signals, translation signals, primer
hybridization
sites (e.g., for sequencing or PCR), recombination sites, restriction sites
and
polylinkers, sites which suppress the termination of translation in the
presence of
a suppressor tRNA, suppressor tRNA coding sequences, sequences which encode
domains and/or regions (e.g., 6 His tag) for the preparation of fusion
proteins,
origins of replication, telomeres, centromeres, and the like. Similarly,
libraries
can be supplied in kits of the invention. These libraries may be in the form
of
replicable nucleic acid molecules or they may comprise nucleic acid molecules
which are not associated with an origin of replication. As one skilled in the
art
would recognize, the nucleic acid molecules of libraries, as well as other
nucleic
acid molecules, which are not associated with an origin of replication either
could
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-174-
be inserted into other nucleic acid molecules which have an origin of
replication
or would be an expendable kit components.
Further, in some embodiments, libraries supplied in kits of the invention
may comprise two components: (1 ) the nucleic acid molecules of these
libraries
and (2) 5' and/or 3' recombination sites. In some embodiments, when the
nucleic
acid molecules of a library are supplied with 5' and/or 3' recombination
sites, it
will be possible to insert these molecules into vectors, which also may be
supplied as a kit component, using recombination reactions. In other
embodiments, recombination sites can be attached to the nucleic acid molecules
of the libraries before use (e.g. , by the use of a ligase, which may also be
supplied
with the kit). In such cases, nucleic acid molecule which contain
recombination
sites or primers which can be used to generate recombination sites may be
supplied with the kits.
Vector supplied in kits of the invention can vary greatly. In most
instances, these vectors will contain an origin of replication, at least one
selectable marker, and at least one recombination site. For example, vectors
supplied in kits of the invention can have four separate recombination sites
which
allow for insertion of nucleic acid molecules at two different locations. A
vector
of this type is shown schematically in Figure 6. Other attributes of vectors
supplied in kits of the invention are described elsewhere herein.
Kits of the invention can also be supplied with primers. These primers
will generally be designed to anneal to molecules having specific nucleotide
sequences. For example, these primers can be designed for use in PCR to
amplify a particular nucleic acid molecule. Further, primers supplied with
kits
of the invention can be sequencing primers designed to hybridize to vector
sequences. Thus, such primers will generally be supplied as part of a kit for
sequencing nucleic acid molecules which have been inserted into a vector.
One or more buffers (e. g. , one, two, three, four, five, eight, ten, fifteen)
may be supplied in kits of the invention. These buffers may be supplied at a
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-175-
working concentrations or may be supplied in concentrated form and then
diluted
to the working concentrations. These buffers will often contain salt, metal
ions,
co-factors, metal ion chelating agents, etc. for the enhancement of activities
of the
stabilization of either the buffer itself or molecules in the buffer. Further,
these
buffers may be supplied in dried or aqueous forms. When buffers are supplied
in a dried form, they will generally be dissolved in water prior to use.
Examples
of buffers suitable for use in kits of the invention are set out in the
following
examples.
Supports suitable for use with the invention (e.g., solid supports,
semi-solid supports, beads, mufti-well tubes, etc., described above in more
detail)
may also be supplied with kits of the invention. Exemplary uses of supports in
processes of the invention are shown in Figures 10-13.
Kits of the invention may contain virtually any combination of the
components set out above or described elsewhere herein. As one skilled in the
art would recognize, the components supplied with kits of the invention will
vary
with the intended use for the kits. Thus, kits may be designed to perform
various
functions set out in this application and the components of such kits will
vary
accordingly.
It will be understood by one of ordinary skill in the relevant arts that other
suitable modifications and adaptations to the methods and applications
described
herein are readily apparent from the description of the invention contained
herein
in view of information known to the ordinarily skilled artisan, and may be
made
without departing from the scope of the invention or any embodiment thereof.
Having now described the present invention in detail, the same will be more
clearly understood by reference to the following examples, which are included
herewith for purposes of illustration only and are not intended to be limiting
of
the invention.
The entire disclosures of U.S. Appl. No. 08/486,139 (now abandoned),
filed June 7, 1995, U.S. Appl. No. 08/663,002, filed June 7, 1996 (now U.S.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-176-
Patent No. 5,888,732), U.S. Appl. No. 09/233,492, filed January 20, 1999, U.S.
PatentNo. 6,143,557, issuedNovember 7, 2000, U.S. Appl. No. 60/065,930, filed
October 24,1997, U.S. Appl. No. 09/177,387 filed October 23,1998, U.S. Appl.
No. 09/296,280, filed April 22, 1999, U.S. Appl. No. 09/296,281, filed April
22,
1999, U.S. Appl. No. 60/108,324, filed November 13, 1998,U.S. Appl. No.
09/438,358, filed November 12, 1999, U.S. Appl. No. 09/695,065, filed October
25, 2000, U.S. Appl. No. 09/432,085 filed November 2, 1999, U.S. Appl. No.
60/122,389, filed March 2, 1999, U.S. Appl. No. 60/126,049, filed March 23,
1999, U.S. Appl. No. 60/136,744, filed May 28, 1999, U.S. Appl. No.
60/122,392, filed March 2, 1999, and U.S. Appl. No. 60/161,403, filed October
25, 1999, are herein incorporated by reference.
Examples
Example l: Simultaneous Cloning of Two NucleicAcid Segments Using an
LR Reaction
Two nucleic acid segments may be cloned in a single reaction using
methods of the present invention. Methods of the present invention may
comprise the steps of providing a first nucleic acid segment flanked by a
first and
a second recombination site, providing a second nucleic acid segment flanked
by
a third and a fourth recombination site, wherein either the first or the
second
recombination site is capable of recombining with either the third or the
fourth
recombination site, conducting a recombination reaction such that the two
nucleic
acid segments are recombined into a single nucleic acid molecule and cloning
the
single nucleic acid molecule.
With reference to Figure 2, two nucleic acid segments flanked by
recombination sites may be provided. Those skilled in the art will appreciate
that
the nucleic acid segments may be provided either as discrete fragments or as
part
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-177-
of a larger nucleic acid molecule and may be circular and optionally
supercoiled
or linear. The sites can be selected such that one member of a reactive pair
of
sites flanks each of the two segments.
By "reactive pair of sites," what is meant is two recombination sites that
can, in the presence of the appropriate enzymes and cofactors, recombine. For
example, in some preferred embodiments, one nucleic acid molecule may
comprise an attR site while the other comprises an attL site that reacts with
the
attR site. As the products of an LR reaction are two molecules, one of which
comprises an attB site and one of which comprises an attP site, it is possible
to
arrange the orientation of the starting attL and attR sites such that, after
joining,
the two starting nucleic acid segments are separated by a nucleic acid
sequence
that comprises either an attB site or an attP site.
In some preferred embodiments, the sites may be arranged such that the
two starting nucleic acid segments are separated by ari attB site after the
recombination reaction. In other preferred embodiments, recombination sites
from other recombination systems may be used. For example, in some
embodiments one or more of the recombination sites may be a lox site or
derivative. In some preferred embodiments, recombination sites from more than
one recombination system may be used in the same construct. For example, one
or more of the recombination sites may be an att site while others may be lox
sites. Various combinations of sites from different recombination systems may
occur to those skilled in the art and such combinations are deemed to be
within
the scope of the present invention.
As shown in Figure 2, nucleic acid segment A (DNA-A) may be flanked
by recombination sites having unique specificity, for example attLl and attL3
sites and nucleic acid segment B (DNA-B) may be flanked by recombination sites
attR3 and attL2. For illustrative purposes, the segments are indicated as DNA.
This should not be construed as limiting the nucleic acids used in the
practice of
the present invention to DNA to the exclusion of other nucleic acids. In
addition,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-178-
in this and the subsequent examples, the designation of the recombination
sites
(i.e., L1, L3, R1, R3, etc.) is merely intend to convey that the recombination
sites
used have different specificities and should not be construed as limiting the
invention to the use of the specifically recited sites. One skilled in the art
could
readily substitute other pairs of sites for those specifically exemplified.
The attR3 and attL3 sites comprise a reactive pair of sites. Other pairs of
unique recombination sites may be used to flank the nucleic acid segments. For
example, lox sites could be used as one reactive pair while another reactive
pair
may be att sites and suitable recombination proteins included in the reaction.
Likewise, the recombination sites discussed above can be used in various
combinations. In this embodiment, the only critical feature is that, of the
recombination sites flanking each segment, one member of a reactive pair of
sites,
in this example an LR pair L3 and R3, is present on one nucleic acid segment
and
the other member of the reactive pair is present on the other nucleic acid
segment.
The two segments may be contacted with the appropriate enzymes and a
Destination Vector.
The Destination Vector comprises a suitable selectable marker flanked by
two recombination sites. In some embodiments, the selectable marker may be a
negative selectable marker (such as a toxic gene, e.g., ccdB). One site in the
Destination Vector will be compatible with one site present on one of the
nucleic
acid segments while the other compatible site present in the Destination
Vector
will be present on the other nucleic acid segment.
Absent a recombination between the two starting nucleic acid segments,
neither starting nucleic acid segment has recombination sites compatible with
both the sites in the Destination Vector. Thus, neither starting nucleic acid
segment can replace the selectable marker present in the Destination Vector.
The reaction mixture may be incubated at about 25 °C for from
about 60
minutes to about 16 hours. All or a portion of the reaction mixture will be
used
to transform competent microorganisms and the microorganisms screened for the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-179-
presence of the desired construct.
In some embodiments, the Destination Vector comprises a negative
selectable marker and the microorganisms transformed are susceptible to the
negative selectable marker present on the Destination Vector. The transformed
5. microorganisms will be grown under conditions permitting the negative
selection
against microorganisms not containing the desired recombination product.
In Figure 2, the resulting desired product consists of DNA-A and DNA-B
separated by an attB3 site and cloned into the Destination Vector backbone. In
this embodiment, the same type of reaction (i. e. , an LR reaction) may be
used to
combine the two fragments and insert the combined fragments into a Destination
Vector.
In some embodiments, it may not be necessary to control the orientation
of one or more of the nucleic acid segments and recombination sites of the
same
specificity can be used on both ends of the segment.
With reference to Figure 2, if the orientation of segment A with respect
to segment B were not critical, segment A could be flanked by L 1 sites on
both
ends oriented as inverted repeats and the end of segment B to be joined to
segment A could be equipped with an R1 site. This might be useful in
generating
additional complexity in the formation of combinatorial libraries between
segments A and B. That is, the joining of the segments can occur in various
orientations and given that one or both segments joined may be derived from
one
or more libraries, a new population or library comprising hybrid molecules in
random orientations may be constructed according to the invention.
Although, in the present examples, the recombination between the two
starting nucleic acid segments is shown as occurring before the recombination
reactions with the Destination Vector, the order of the recombination
reactions
is not important. Thus, in some embodiments, it may be desirable to conduct
the
recombination reaction between the segments and isolate the combined segments.
The combined segments can be used directly, for example, may be amplified,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-180-
sequenced or used as linear expression elements as taught by Sykes, et al.
(Nature
Biotechnology 17:355-359, 1999). In some embodiments, the joined segments
may be encapsulated as taught by Tawfik, et al. (Nature Biotechnology
16:652-656,1998) and subsequently assayed for one or more desirable
properties.
In some embodiments, the combined segments may be used for in vitro
expression of RNA by, for example, including a promoter such as the T7
promoter or SP6 promoter on one of the segments. Such in vitro expressed RNA
may optionally be translated in an in vitro translation system such as rabbit
reticulocyte lysate.
Optionally, the joined segments may be further reacted with a Destination
Vector resulting in the insertion of the combined segments into the vector. In
some instances, it may be desirable to isolate an intermediate comprising one
of
the segments and the vector. For insertion of the segments into a vector, it
is not
critical to the practice of the present invention whether the recombination
reaction .
joining the two segments occurs before or after the recombination reaction
between the segments and the Destination Vector.
According to the invention, all three recombination reactions preferably
occur (i.e., the reaction between segment A and the Destination Vector, the
reaction between segment B and the Destination Vector, and the reaction
between
segment A and segment B) in order to produce a nucleic acid molecule in which
both of the two starting nucleic acid segments are now joined in a single
molecule. In some embodiments, recombination sites may be selected such that,
after insertion into the vector, the recombination sites flanking the joined
segments form a reactive pair of sites and the joined segments may be excised
from the vector by reaction of the flanking sites with suitable recombination
proteins.
With reference to Figure 2, if the L2 site on segment B were replaced by
an L1 site in the opposite orientation with respect to segment B (i.e., the
long
portion of the box indicating the recombination site was not adjacent to the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-181-
segment) and the R2 site in the vector were replaced by an R1 site in opposite
orientation, the recombination reaction would produce an attP 1 site in the
vector.
The attP 1 site would then be capable of reaction with the attB 1 site on the
other
end of the joined segments. Thus, the joined segments could be excised using
the
recombination proteins appropriate for a BP reaction.
This embodiment of the invention is particularly suited for the
construction of combinatorial libraries. In some preferred embodiments, each
of
the nucleic acid segments in Figure 2 may represent libraries, each of which
may
have a known or unknown nucleic acid sequence to be screened. In some
embodiments, one or more of the segments may have a sequence encoding one
or more permutations of the amino acid sequence of a given peptide,
polypeptide
or protein. In some embodiments, each segment may have a sequence that
encodes a protein domain or a library representing various permutations of the
sequence of protein domain. For example, one segment may represent a library
of mutated forms of the variable domain of an antibody light chain while the
other segment represents a library of mutated forms of an antibody heavy
chain.
Thus, recombination would generate a population of molecules (e.g.,
antibodies,
single-chain antigen-binding proteins, etc.) each potentially containing a
unique
combination of sequences and, therefore, a unique binding specificity.
In other preferred embodiments, one of the segments may represent a
single nucleic acid sequence while the other represents a library. The result
of
recombination will be a population of sequences all of which have one portion
in
common and are varied in the other portion. Embodiments of this type will be
useful for the generation of a library of fusion constructs. For example, DNA-
A
may comprise a regulatory sequence for directing expression (i.e., a promoter)
and a sequence encoding a purification tag. Suitable purification tags
include, but
are not limited to, glutathione S-transferase (GST), the maltose binding
protein
(MBP), epitopes, defined amino acid sequences such as epitopes, haptens, six
histidines (HIS6), and the like. DNA-B may comprise a library of mutated forms
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-182-
of a protein of interest. The resultant constructs could be assayed for a
desired
characteristic such as enzymatic activity or ligand binding.
Alternatively, DNA-B might comprise the common portion of the
resulting fusion molecule. In some embodiments, the above described methods
may be used to facilitate the fusion of promoter regions or transcription
termination signals to the 5'-end or 3'-end of structural genes, respectively,
to
create expression cassettes designed for expression in different cellular
contexts,
for example, by adding a tissue-specific promoter to a structural gene.
In some embodiments, one or more of the segments may represent a
sequence encoding members of a random peptide library. This approach might
be used, for example, to generate a population of molecules with a certain
desirable characteristic. For example, one segment might contain a sequence
coding for a DNA binding domain while the other segment represents a random
protein library. The resulting population might be screened for the ability to
1 S modulate the expression of a target gene of interest. In other
embodiments, both
segments may represent sequences encoding members of a random protein library
and the resultant synthetic proteins (e.g., fusion proteins) could be assayed
for
any desirable characteristic such as, for example, binding a specific ligand
or
receptor or possessing some enzymatic activity.
It is not necessary that the nucleic acid segments encode an amino acid
sequence. For example, both of the segments may direct the transcription of an
RNA molecule that is not translated into protein. This will be useful for the
construction of tRNA molecules, ribozymes and anti-sense molecules.
Alternatively, one segment may direct the transcription of an untranslated RNA
molecule while the other codes for a protein. For example, DNA-A may direct
the transcription of an untranslated leader sequence that enhances protein
expression such as the encephalomyocarditis virus leader sequence (EMC leader)
while DNA-B encodes a peptide, polypeptide or protein of interest. In some
embodiments, a segment comprising a leader sequence might further comprise
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-183-
a sequence encoding an amino acid sequence. For example, DNA-A might have
a nucleic acid sequence corresponding to an EMC leader sequence and a
purification tag while DNA-B has a nucleic acid sequence encoding a peptide,
polypeptide or protein of interest.
The above process is especially useful for the preparation of combinatorial
libraries of single-chain antigen-binding proteins. Methods for preparing
single-chain antigen-binding proteins are known in the art. (See, e.g., PCT
Publication No. WO 94/07921, the entire disclosure of which is incorporated
herein by reference.) Using the constructs shown in Figure 6 for illustration,
DNA-A could encode, for example, mutated forms of the variable domain of an
antibody light chain and DNA-B could encode, for example, mutated forms of the
variable domain of an antibody light chain. Further, the intervening nucleic
acid
between DNA-A and DNA-B could encode a peptide linker for connecting the
light and heavy chains. Cells which express the single-chain antigen-binding
proteins can then be screened to identify those which produce molecules that
bind
to a particular antigen.
Numerous variation of the above are possible. For example, instead of
using a construct illustrated in Figure 6, a constructs such as that
illustrated in
Figure 2 could be used with the linker peptide coding region being embedded in
the recombination site. This is one an example of recombination site embedded
functionality discussed above.
As another example, single-chain antigen-binding proteins composed of
two antibody light chains and two antibody heavy chains can also be produced.
These single-chain antigen-binding proteins can be designed to associate and
form multivalent antigen binding complexes. Using the constructs shown in
Figure 2 again for illustration, DNA-A and DNA-B could each encode, for
example, mutated forms of the variable domain of an antibody light chain. At
the
same site in a similar vector or at another site in a vector which is designed
for
the insertion of four nucleic acid inserts, DNA-A and DNA-B could each encode,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-184-
for example, mutated forms of the variable domain of an antibody heavy chain.
Cells which express both single-chain antigen-binding proteins could then be
screened to identify, for example, those which produce multivalent
antigen-binding complexes having specificity for a particular antigen.
Thus, the methods of the invention can be used, for example, to prepare
and screen combinatorial libraries to identify cells which produce antigen-
binding
proteins (e.g., antibodies and/or antibody fragments or antibody fragment
complexes comprising variable heavy or variable light domains) having
specificities for particular epitopes. The methods of the invention also
methods
for preparing antigen-binding proteins and antigen-binding proteins prepared
by
the methods of the invention.
Example 2: Simultaneous Cloning of Two Nucleic Acid Fragments Using
an LR Reaction to Join the Segments and a BP Reaction to
Insert the Segments into a Vector
As shown in Figure 3, a first nucleic acid segment flanked by an attB
recombination site and an attL recombination site may be joined to a second
nucleic acid segment flanked by an attR recombination site that is compatible
with the attL site present on the first nucleic acid segment and flanked by an
attB
site that may be the same or different as the attB site present on the first
segment.
Figure 3 shows an embodiment wherein the two attB sites are different. The two
segments may be contacted with a vector containing attP sites in a BP
reaction.
A subsequent LR reaction would generate a product consisting of DNA-A
and DNA-B separated by either an attP site or an attB site (the product of the
LR
reaction) and cloned into the vector backbone. In the embodiment shown in
Figure 3, the attL and attR sites are arranged so as to generate an attB site
between the segments upon recombination. In other embodiments, the attL and
the attR may be oriented differently so as to produce an attP site between the
segments upon recombination. In preferred embodiments, after recombination,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-185-
the two segments may be separated by an attB site.
Those skilled in the art can readily optimize the conditions for conducting
the reactions described above without the use of undue experimentation. In a
typical reaction from about 50 ng to about 1000 ng of vector may be contacted
with the fragments to be cloned under suitable reaction conditions. Each
fragment may be present in a molar ratio of from about 25:1 to about 1:25
vector:fragment. In some embodiments, one or more of the fragments may be
present at a molar ratio of from about 10:1 to 1:10 vector:fragment. In a
preferred
embodiment, each fragment may be present at a molar ratio of about 1:1
vector:fragment.
Typically, the nucleic acid may be dissolved in an aqueous buffer and
added to the reaction mixture. One suitable set of conditions is 4 ~l
CLONASET"'
enzyme mixture (e.g., Invitrogen Corp., Life Technologies Division, Cat. Nos.
11791-019 and 11789-013), 4 p1 SX reaction buffer and nucleic acid and water
to a final volume of 20 p1. This will typically result in the inclusion of
about 200
ng of Int and about 80 ng of IHF in a 20 p1 BP reaction and about 1 SO ng Int,
about 25 ng IHF and about 30 ng Xis in a 20 ~,1 LR reaction.
In some preferred embodiments, particularly those in which attL sites are
to be recombined with attR sites, the final reaction mixture may include about
SOmM Tris HCI, pH 7.5, about 1mM EDTA, about lmg/ml BSA, about 75mM
NaCI and about 7.SmM spermidine in addition to recombination enzymes and the
nucleic acids to be combined. In other preferred embodiments, particularly
those
in which an attB site is to be recombined with an attP site, the final
reaction
mixture may include about 25mM Tris HCI, pH 7.5, about SmM EDTA, about
lmg/ml bovine serum albumin (BSA), about 22mM NaCI, and about 5 mM
spermidine.
When it is desired to conduct both a BP and an LR reaction without
purifying the nucleic acids in between, the BP reaction can be conducted first
and
then the reaction conditions adjusted to about 50 mM NaCI, about 3.8 mM
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-186-
spermidine, about 3.4 mM EDTA and about 0.7 mg/ml by the addition of the LR
CLONASE~ enzymes and concentrated NaCI. The reaction solution may be
incubated at suitable temperature such as, for example, 25°C for from
about 60
minutes to 16 hours. After the recombination reaction, the solution may be
used
to transform competent host cells and the host cells screened as described
above.
One example of a "one-tube" reaction protocol, which facilitates the
transfer of PCR products directly to Expression Clones in a two-step reaction
performed in a single tube follows. This process can also be used to transfer
a
gene from one Expression Clone plasmid backbone to another. The Expression
Clone is first be linearized within the plasmid backbone to achieve the
optimal
topology for the BP reaction and to eliminate false-positive colonies due to
co-transformation.
Twenty-five ~l BP reaction mixture is prepared in a 1.5 ml tube with the
following components:
attB DNA (100-200 ng) 1-12.5 ~1
attP DNA (pDONR201) 150 ng/~,1 2.5 ~1
BP Reaction Buffer 5.0 ~1
TE to 20 ~1
BP Clonase 5.0 u1
Total vol. , 25 ~1
The contents of the tube is mixed and incubated for 4 hours, or longer, at
25°C. If the PCR product is amplified from a plasmid template
containing
selectable markers present on the GATEWAYS pDONR or pDEST vectors (i.e.,
kan' or amp'), the PCR product may be treated with the restriction
endonuclease
DpnI to degrade the plasmid. Such plasmids are a potential source of false-
positive colonies in the transformation of GA'rEwAYTM reactions. Further, when
the template for PCR or starting Expression Clone has the same selectable
marker
as the final Destination Vector (e.g., amp'), plating on LB plates containing
100
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-187-
~,g/ml ampicillin can be used to determine the amount of false positive
colonies
carried over to the LR reaction step.
Five ~1 of the reaction mixture is transferred to a separate tube to which
is added 0.5 p1 Proteinase K Solution. This tube is then incubate for 10
minutes
at 37°C. One hundred p1 of competent cells are then transformed with 1-
2 ~1 of
the mixture and plated on LB plates containing 50 ~g/ml kanamycin. This yields
colonies for isolation of individual Entry Clones and for assessment of the BP
Reaction efficiency.
The following components are added to the remaining 20 ~1 BP reaction
described above:
NaCI 0.75 M 1 ~1
Destination Vector 150 ng/pl 3 ~1
L_R Clonase 6 u1
Total vol. 30 p,1
The mixture is then incubate at 25°C for 2 hours, after which 3 ~1
of
proteinase K solution, followed by a further incubation of 10 minutes at
37°C.
1-2 ~1 of this mixtures is then used to transform 100 ~l competent cells,
which
are then plated on LB plates containing 100 pg/ml ampicillin.
Example 3: Cloning of PCR Products Using Fragments by Converting attB
Sites into a Reactive Pair of attL and attR Sites in a BP
Reaction and Subsequent LR Reaction
A similar strategy to that described in Example 2 can be used to
recombine two PCR products and clone them simultaneously into a vector
backbone. Since attL and attR sites are 100 and 125 base pairs long,
respectively, it may be desirable to incorporate attB sites into the PCR
primers
since an attB site is 25 base pairs in length. Depending on the orientation of
the
attB site with respect to the nucleic acid segment being transferred, attB
sites can
be converted to either an attL or attR site by the BP reaction. Thus, the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-188-
orientation of the attB site in the attB PCR primer determines whether the
attB
site is converted to attL or attR. This affords the GATEWAYTM system and
methods of the invention great flexibility in the utilization of multiple att
sites
with unique specificity.
As shown in Figure 4, two segments (e.g., PCR products) consisting of
segment A flanked by mutated attB sites each having a different specificity
(e.g.,
by attB 1 and attB3) and segment B flanked by mutated attB sites of different
specificity, wherein one of the attB sites present on segment A is the same as
one
of the attB sites present on segment B (e.g., segment B may contain attB3 and
attB2 sites) may be joined and inserted into a vector. The segments may be
reacted either individually or together with two attP site containing vectors
in a
BP reaction. Alternatively, the attP sites might be present on linear
segments.
One vector contains attP sites compatible with the attB sites present on
segment
A (e.g., attPl and attP3 sites). The other vector contains attP sites
compatible
with the attB sites present on segment B (e.g., attP3 and attP2 sites). When
linear segments are used to provide the attP sites, each attP site may be
provided
on a segment. The orientations of the attB3 and attP3 sites are such that an
attR3
site would be generated at the 5'-end of the DNA-B segment and an attL3 site
generated at the 3'-end of segment A. The resulting entry clones are mixed
with
a Destination Vector in a subsequent LR reaction to generate a product
consisting
of DNA-A and DNA-B separated by an attB3 site and cloned into the Destination
Vector backbone.
This basic scheme has been used to link two segments, an attL 1-fragment
A-attL3 entry clone that is reacted with an attR3-fragment B-attL2 entry
clone,
and to insert the linked fragments into the destination vector. To generate
the
appropriate entry clones, two attP Donor vectors were constructed consisting
of
attPl-ccdB-attP3 and attP3R-ccdB-attP2 such that they could be reacted with
appropriate attB PCR products in order to convert the attB sites to attL and
attR
sites. The designation attP3R is used to indicated that the orientation of the
attP3
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-189-
site is such that reaction with a DNA segment having a cognate attB site will
result in the production of an attR site on the segment. This is represented
schematically in Figure 4 by the reversed orientation of the stippled and
lined
sections of the attB3 on segment B as compared to segment A. On segment B the
stippled portion is adjacent to the segment while on segment A the lined
portion
is adjacent to the segment.
This methodology was exemplified by constructing a DNA segment in
which the tetracycline resistance gene (tet) was recombined with the
(3-galactosidase gene such that the two genes were separated by an attB site
in the
product. The tet gene was PCR amplified with 5'-attB 1 and 3'-attB3 ends. The
lacZ gene was PCR amplified with 5'-attB3R and 3'-attB2 ends. The two PCR
products were precipitated with polyethylene glycol (PEG). The B 1-tet-B3 PCR
product was mixed with an attPl-ccdB-attP3 donor vector and reacted with BP
CLONASE~ using a standard protocol to generate an attLl-tet-attL3 entry clone.
A correct tet entry clone was isolated and plasmid DNA prepared using standard
techniques. In a similar fashion, the attB3R-lacZ-attB2 PCR product was mixed
with an attP3R-ccdB-attP2 donor vector and reacted With BP CLONASET~'' to
generate an attR3-lacZ-attL2 entry clone.
In order to join the two segments in a single vector, an LR CLONASETM
reaction was prepared in a reaction volume of 20 ~1 containing the following
components: 60 ng (25 fmoles) of the supercoiled tet entry clone; 75 ng (20
fmoles) of the supercoiled IacZ entry clone; 150 ng (35 fmoles) of pDEST6
(described in PCT Publication WO 00/52027, the entire disclosure of which is
incorporated herein by reference) linearized with NcoI; 4 ~l reaction buffer
and
4 ~1 Of LR CLONASE~. The final reaction mixture contained 51 mM Tris~HCl,
1 mM EDTA, 1 mg/ml BSA, 76 mM NaCI, 7.5 mM spermidine, 160 ng of Int,
ng of IHF and 35 ng of Xis. The reaction was incubated at 25°C
overnight
and stopped with 2 ~l of proteinase K solution (2 mg/ml). A 2 ~1 aliquot was
used to transform 100 ~1 of E coli DHSa LE cells and plated on LB plates
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-190-
containing ampicillin and XGaI. Approximately 35,000 colonies were generated
in the transformation mixture with cells at an efficiency of 1.6 x 108 cfu/~g
of
pUC DNA. All the colonies appeared blue indicating the presence of the lacZ
gene. 24 colonies were streaked onto plates containing tetracycline and XGaI.
All of the colonies tested, 24/24, were resistant to tetracycline. 12 colonies
were
used to inoculate 2 ml of LB broth containing ampicillin for mini preps. 12/12
minipreps contained a supercoiled plasmid of the correct size (7 kb).
In some embodiments, such as that shown in Figure 5, two segments can
be reacted with a vector containing a single recombination site in order to
convert
one of the recombination sites on the segments into a different recombination
site.
In some embodiments, segments containing attB sites may be reacted with a
target vector having attP sites. For example, segments A and B are reacted
either
together or separately with a vector having an attP3 site in order to convert
the
attB3 sites on the segments into an attL3 and an attR3, respectively. This is
done
so that the subsequent LR reaction between the two segments results in their
being joined by an attB site. The segments may be joined with the attP site
containing vector before, simultaneously with or after the recombination
reaction
to convert the sites to generate a co-integrate molecule consisting of DNA-A
flanked by attLl and attL3 and DNA-B flanked by attR3 and attL2. A
subsequent LR reaction will generate a product clone consisting of DNA-A and
DNA-B separated by attB3 cloned into a vector backbone.
In some embodiments, an attP site designed to convert the attB used to
link the segments to a reactive pair of attL and attR sites may be provided as
shorter segments such as restriction fragments, duplexes of synthetic
oligonucleotides or PCR fragments. Reactions involving a linear fragment in a
BP reaction may require longer incubation times, such a overnight incubation.
The conversion of attB sites to attL or attR sites can also be accomplished
solely by PCR. PCR primers containing attL or attR sites can be used to
amplify
a segment having an attB site on the end. Since the sequence of attL and attR
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-191-
sites contains a portion of the sequence of an attB site, the attB site in
this case
serves as an overlap region to which the attL or attR PCR primer can anneal.
Extension of the annealed attL or attR primer through to the end of the PCR
product will generate a fusion template for PCR amplification of the full
length
PCR product using flanking primers that anneal to the ends of the attL or attR
sites. The primers for the PCR reaction may be provided as single stranded
oligonucleotides. In some preferred embodiments, the primers may be provided
as a duplex, for example, as the product of a PCR reaction to amplify either
an
attL or attR site.
Example 4: Cloning of Two or More NucleicAcid Fragments into Different
Places in the Same Vector
Two or more nucleic acid fragments can be cloned simultaneously into
different regions of a vector having multiple sets of recombination sites each
flanking a selectable marker. In some embodiments, one or more of the
selectable markers may be a negative selectable marker.
As shown in Figure 6, two nucleic acid segments A and B which may be
present as discrete fragments or as part of a larger nucleic acid molecule
such as
a plasmid, can be simultaneously cloned into the same destination vector.
Nucleic acid segment A (DNA-A) flanked by recombination sites that do not
recombine with each other (e.g., attLl and attL2) and nucleic acid segment B
(DNA-B) flanked by recombination sites that do not recombine with each other
and do not recombine with the sites flanking segment A (e.g., attL3 and attL4)
may be combined with a Destination Vector in an LR reaction. The Destination
Vector will contain two pairs of recombination sites, each pair selected to
recombine with the sites flanking one of the segments. As an example, Figure 6
shows two pairs of attR sites (attRl lattR2 and attR3/attR4) each flanking a
ccdB
negative selectable marker. The three nucleic acids can be combined in a
single
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-192-
LR reaction. The resulting product will consist of DNA-A and DNA-B flanked
by pairs of attB sites and cloned into distinct regions of the Destination
Vector.
As shown in Figure 7, an analogous method for inserting nucleic acid
segments into a vector can be accomplished using a BP reaction. For example,
DNA-A flanked by recombination sites attB 1 and attB2 can be combined with
DNA-B flanked by recombination sites attB3 and attB4 and a vector containing
attP sites in a BP reaction. The resulting product would consist of DNA-A and
DNA-B cloned between pairs of attL sites into distinct regions of the vector.
In
some embodiments, it may be desirable to insert the segments into the target
vector sequentially and isolate an intermediate molecule comprising only one
of
the segments.
It is not necessary that all of the sites be derived form the same
recombination system. For example, one segment may be flanked by lox sites
while the other segment is flanked by att sites. A segment may have a lox site
on
one end and an att site on the other end or an frt site on one end. Various
combinations of sites may be envisioned by those skilled in the art and such
combinations are within the scope of the present invention.
In some embodiments, it may be desirable to isolate intermediates in the
reaction shown in Figures 6 and 7. For example, it may be desirable to isolate
a
vector having only one of the segments inserted. The intermediate might be
used
as is or might serve as the substrate in a subsequent recombination reaction
to
insert the second segment.
In some embodiments, the present invention is a method of cloning n
nucleic acid segments, wherein n is an integer greater than 1, comprising the
steps
of providing n nucleic acid segments, each segment flanked by two unique
recombination sites, providing a vector comprising 2n recombination sites
wherein each of the 2n recombination sites is capable of recombining with one
of the recombination sites flanking one of the nucleic acid segments and
conducting a recombination reaction such that the n nucleic acid segments are
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-193-
recombined into the vector thereby cloning the n nucleic acid segments. In
further embodiments, the vector comprises n copies of a selectable marker each
copy flanked by two recombination sites. In other embodiments, the vector
comprises two or more different selectable markers each flanked by two
recombination sites. In some embodiments, one or more of the selectable
markers may be a negative selectable marker.
In some embodiments, the present invention provides a, method of
cloning, comprising the steps of providing a first, a second and a third
nucleic
acid segment, wherein the first nucleic acid segment is flanked by a first and
a
second recombination site, the second nucleic acid segment is flanked by a
third
and a fourth recombination site and the third nucleic acid segment is flanked
by
a fifth and a sixth recombination site, wherein the second recombination site
is
capable of recombining with the third recombination site and none of the
first,
fourth, fifth or sixth recombination sites is capable of recombining with any
of
the first through sixth recombination sites, providing a vector comprising a
seventh and an eighth recombination site flanking a first selectable marker
and
comprising a ninth and a tenth recombination site flanking a second selectable
marker wherein none of the seventh through tenth recombination sites can
recombine with any of the seventh through tenth recombination sites,
conducting
a first recombination reaction such that the second and the third
recombination
sites recombine and conducting a second recombination reaction such that the
first and the fourth recombination sites recombine with the seventh and the
eighth
recombination sites respectively and the fifth and the sixth recombination
sites
recombine with the ninth and the tenth recombination sites thereby cloning the
first, second and third nucleic acid segments.
In some embodiments, a nucleic acid segment may comprise a sequence
that functions as a promoter. In some embodiments, the first and the second
nucleic acid segments may comprise a sequence encoding a polypeptide and the
recombination places both polypeptides in the same reading frame. In some
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-194-
embodiments, a nucleic acid segment may comprise a sequence that functions as
a transcription termination sequence.
The present invention provides an extremely versatile method for the
modular construction of nucleic acids and proteins. Both the inserted nucleic
acid
segments and the vector can contain sequences selected so as to confer desired
characteristics on the product molecules. In those embodiments exemplified in
Figures 6 and 7, in addition to the inserted segments, one or more of the
portions
of the vector adjacent to the inserted segments as well as the portion of the
vector
separating the inserted segments can contain one or more selected sequences.
In some embodiments, the selected sequences might encode ribozymes,
epitope tags, structural domains, selectable markers, internal ribosome entry
sequences, promoters, enhancers, recombination sites and the like. In some
preferred embodiments, the portion of the vector separating the inserted
segments
may comprise one or more selectable markers flanked by a reactive pair of
recombination sites in addition to the recombination sites used to insert the
nucleic acid segments.
This methodology will be particularly well suited for the construction of
gene targeting vectors. For example, the segment of the vector between the
pairs
of recombination sites may encode one or more a selectable markers such as the
neomycin resistance gene. Segments A and B may contain nucleic acid
sequences selected so as to be identical or substantially identical to a
portion of
a gene target that is to be disrupted. After the recombination reaction, the
Destination Vector will contain two portions of a gene of interest flanking a
positive selectable marker. The vector can then be inserted into a cell using
any
conventional technology, such as transfection, whereupon the portions of the
gene
of interest present on the vector can recombine with the homologous portions
of
the genomic copy of the gene. Cells containing the inserted vector can be
selected based upon one or more characteristics conferred by the selectable
marker, for example, in the case when the selectable marker is the neomycin
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-195-
resistance gene, their resistance to G-418.
In some embodiments, one or more a negative selectable markers may be
included in the portion of the Destination Vector that does not contain the
target
gene segments and the positive selectable marker. The presence of one or more
negative selectable markers permits the selection against cells in which the
entire
Destination Vector was inserted into the genome or against cells in which the
Destination Vector is maintained extrachromosomally.
In some preferred embodiments, additional recombination sites may be
positioned adjacent to the recombination sites used to insert the nucleic acid
segments. Molecules of this type will be useful in gene targeting application
where it is desirable to remove the selectable marker from the targeted gene
after
targeting, the so called "hit and run" methodology. Those skilled in the art
will
appreciate that the segments containing homologous sequence need not
necessarily correspond to the sequence of a gene. In some instances, the
sequences may be selected to be homologous to a chromosomal location other
than a gene.
This methodology is also well suited for the construction of bi-cistronic
expression vectors. In some embodiments, expression vectors containing
bi-cistronic expression elements where two structural genes are expressed from
a single promoter and are separated by an internal ribosome entry sequence
(IRES, see Encarnacion, Current Opinion in Biotechnology 10:458-464 (1999),
specifically incorporated herein by reference). Such vectors can be used to
express two proteins from a single construct.
In some embodiments, it may not be necessary to control the orientation
of one or more of the nucleic acid segments and recombination sites of the
same
specificity can be used on both ends of the segment. With reference to Figure
6,
if the orientation of segment A with respect to segment B were not critical,
segment A could be flanked by L1 sites on both ends and the vector equipped
with two R1 sites. This might be useful in generating additional complexity in
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-196-
the formation of combinatorial libraries between segments A and B.
Example 5: Combining Multiple Fragments into a Single Site in a Vector
In some embodiments, the present invention provides a method of cloning
n nucleic acid segments, wherein n is an integer greater than 1, comprising
the
steps of providing a 1 S' through an n'" nucleic acid segment, each segment
flanked
by two unique recombination sites, wherein the recombination sites are
selected
such that one of the two recombination sites flanking the a segment, n;,
reacts
with one of the recombination sites flanking the n;_,th segment and the other
recombination site flanking the n segment reacts with one of the recombination
sites flanking the n;+,th segment, providing a vector comprising at least two
recombination sites wherein one of the two recombination sites on the vector
reacts with one of the sites on the 1 S' nucleic acid segment and another site
on the
vector reacts with a recombination site on the n'" nucleic acid segment. It is
a
further obj ect of the present invention to provide a method of cloning,
comprising
the steps of providing a first, a second and a third nucleic acid segment,
wherein
the first nucleic acid segment is flanked by a first and a second
recombination
site, the second nucleic acid segment is flanked by a third and a fourth
recombination site and the third nucleic acid segment is flanked by a fifth
and a
sixth recombination site, wherein the second recombination site is capable of
recombining with the third recombination site and the fourth recombination
site
is capable of recombining with the fifth recombination site, providing a
vector
having at least a seventh and an eighth recombination site such that the
seventh
recombination site is capable of reacting with the first recombination site
and the
eighth recombination site is capable of reacting with the sixth recombination
site
and conducting at least one recombination reaction such that the second and
the
third recombination sites recombine, the fourth and the fifth recombination
sites
recombine, the first and the seventh recombination sites recombine and the
sixth
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-197-
and the eighth recombination sites recombine thereby cloning the first, second
and third nucleic acid segments. In some embodiments, at least one nucleic
acid
segment comprises a sequence that functions as a promoter.
In some embodiments, at least two nucleic acid segments comprise
sequences encoding a polypeptide and the recombination places both
polypeptides in the same reading frame. In some embodiments, at least one
nucleic acid segment comprises a sequence that functions as a transcription
termination sequence. In some embodiments, at least one fragment comprises an
origin of replication. In some embodiments, at least one fragment comprises a
sequence coding for a selectable marker.
This embodiment is exemplified in Figures 8 and 9 for the case when n=3.
In this embodiment, the present invention provides a method of cloning,
comprising the steps of providing a first, a second and a third nucleic acid
segment, wherein the first nucleic acid segment is flanked by a first and a
second
recombination site, the second nucleic acid segment is flanked by a third and
a
fourth recombination site and the third nucleic acid segment is flanked by a
fifth
and a sixth recombination site, wherein the second recombination site is
capable
of recombining with the third recombination site and the fourth recombination
site is capable of recombining with the fifth recombination site, providing a
vector comprising a seventh and an eighth recombination site and conducting at
least one recombination reaction such that the second and the third
recombination
sites recombine and the fourth and the fifth recombination sites recombine and
the first and the sixth recombination sites recombine with the seventh and the
eighth recombination sites respectively, thereby cloning the first, second and
third
nucleic acid segments.
As discussed above, when the orientation of a given segment is not
critical, the invention may be modified by placing recombination sites having
the
same specificity on both ends of the given segment and adjusting the
recombination sites of the adj acent segments and/or the recombination sites
in the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-198-
vector accordingly.
In addition to the utilities discussed above for the combination of two
fragments in a single vector, embodiments of this type will be useful for the
construction of vectors from individual fragments containing various
functions.
Thus, the invention provides a modular method for the construction of vectors.
In some embodiments, at least one nucleic acid segment comprises a
sequence that functions as a promoter. In some embodiments, at least two
nucleic
acid segments comprise a sequence encoding a polypeptide and the
recombination places both polypeptides in the same reading frame. In some
embodiments, at least one nucleic acid segment comprises a sequence that
functions as a transcription termination sequence. In some embodiments, at
least
one fragment comprises an origin of replication. In some embodiments, at least
one fragment comprises a sequence coding for a selectable marker. In some
embodiments, a fragment may comprise sequence coding for more than one
function. In some embodiments, a fragment may comprise sequence coding for
an origin of replication and sequence encoding a selectable marker.
When multiple nucleic acid segments are inserted into vectors using
methods of the invention, expression of these segments may be driven by the
same regulatory sequence or different regulatory sequences. Figure 20A shows
one example of a vector which contains two inserted DNA segments, the
expression of which is driven by different promoters (i.e., two different T7
promoters).
The methods of the invention may also be used to produce constructs
which allow for silencing of genes in vivo. One method of silencing genes
involves the production of involves the production of double-stranded RNA,
termed RNA interference (RNAi). (See, e.g., Mette et al., EMBO J.,
19: 5194-5201 (2000)). Methods of the invention can be used in a number of
ways to produce molecules such as RNAi. Thus, expression products of nucleic
acid molecules of the invention can be used to silence gene expression.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-199-
One example of a construct designed to produce RNAi is shown in Figure
20B. In this construct, a DNA segment is inserted into a vector such that RNA
corresponding to both strands are produced as two separate transcripts.
Another
example of a construct designed to produce RNAi is shown in Figure 20C. In
this construct, two copies of a DNA segment are inserted into a vector such
that
RNA corresponding to both strands are again produced. Yet another example of
a construct designed to produce RNAi is shown in Figure 20D. In this
construct,
two copies of a DNA segment are inserted into a vector such that RNA
corresponding to both strands are produced as a single transcript. The
exemplary
vector system shown in shown in Figure 20E comprises two vectors, each of
which contain copies of the same DNA segment. Expression of one of these
DNA segments results in the production of sense RNA while expression of the
other results in the production of an anti-sense RNA. RNA strands produced
from vectors represented in Figures 20B-20E will thus have complementary
nucleotide sequences and will generally hybridize either to each or
intramolecularly under physiological conditions.
Nucleic acid segments designed to produce RNAi, such as the vectors
represented in Figures 20B-20E, need not correspond to the full-length gene or
open reading frame. For example, when the nucleic acid segment corresponds to
an ORF, the segment may only correspond to part of the ORF (e.g., 50
nucleotides at the 5' or 3' end of the ORF). Further, while Figures 20B-20E
show
vectors designed to produce RNAi, nucleic acid segments may also perform the
same function in other forms (e.g., when inserted into the chromosome of a
host
cell).
Gene silencing methods involving the use of compounds such as RNAi
and antisense RNA, for examples, are particularly useful for identifying gene
functions. More specifically, gene silencing methods can be used to reduce or
prevent the expression of one or more genes in a cell or organism. Phenotypic
manifestations associated with the selective inhibition of gene functions can
then
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-200-
be used to assign role to the "silenced" gene or genes. As an example, Chuang
et al., Proc. Natl. Acad. Sci. (USA) 97:4985-4990 (2000), have demonstrated
that
in vivo production of RNAi can alter gene activity in Arabidopsis thaliana.
Thus,
the invention provides methods for regulating expression of nucleic acid
molecules in cells and tissues comprising the expression of RNAi and antisense
RNA. The invention further provides methods for preparing nucleic acid
molecules which can be used to produce RNA corresponding to one or both
strands of a DNA molecule.
Similarly, the invention relates to compounds and methods for gene
silencing involving ribozymes. In particular, the invention provides antisense
RNA/ribozymes fusions which comprise (1) antisense RNA corresponding to a
target gene and (2) one or more ribozymes which cleave RNA (e.g., hammerhead
ribozyme, hairpin ribozyme, delta ribozyme, Tetrahymena L-21 ribozyme, etc.).
Further, provided by the invention are vectors which express these fusions,
methods for producing these vectors, and methods for using these vector to
suppress gene expression.
In one embodiment, a Destination Vector is constructed which encodes
a ribozyme located next to a ccdB gene, wherein the a ccdB gene is flanked by
attR sites. An LR reaction is used to replace the ccdB gene with a nucleic
acid
molecule which upon expression produces an antisense RNA molecule. Thus, the
expression product will result in the production of an antisense sequence
fused
to the ribozyme by an intervening sequence encoded by an attB site. As
discussed below in Example 13, this attB site can be removed from the
transcript
(e.g., using intron and exon slice sequences), if desired, or, in certain
cases,
nucleic acid which encodes the ribozyme can be embedded in the attB site.
Expression of antisense molecules fused to ribozymes can be used, for
example, to cleave specific RNA molecules in a cell. This is so because the
antisense RNA portion of the transcript can be designed to hybridize to
particular
mRNA molecules. Further, the ribozyme portion of the transcript can be
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-201-
designed to cleave the RNA molecule to which it has hybridized. For example,
the ribozyme can be one which cleaves double-stranded RNA (e.g., Tetrahymena
L-21 ribozyme).
Example 6: Use oJSuppressor tRNAs to Generate Fusion Proteins
The recently developed recombinational cloning techniques described
above permit the rapid movement of a target nucleic acid from one vector
background to one or more other vector backgrounds. Because the recombination
event is site specific, the orientation and reading frame of the target
nucleic acid
can be controlled with respect to the vector. This control makes the
construction
of fusions between sequences present on the target nucleic acid and sequences
present on the vector a simple matter.
In general terms, a gene may be expressed in four forms: native at both
amino and carboxy termini, modified at either end, or modified at both ends. A
construct containing the target gene of interest may include the N-terminal
methionine ATG codon, and a stop codon at the carboxy end, of the open reading
frame, or ORF, thus ATG - ORF - stop. Frequently, the gene construct will
include translation initiation sequences, tis, that may be located upstream of
the
ATG that allow expression of the gene, thus tis - ATG - ORF - stop. Constructs
of this sort allow expression of a gene as a protein that contains the same
amino
and carboxy amino acids as in the native, uncloned, protein. When such a
construct is fused in-frame with an amino-terminal protein tag, e.g., GST, the
tag
will have its own tis, thus tis - ATG - tag - tis - ATG - ORF - stop, and the
bases
comprising the tis of the ORF will be translated into amino acids between the
tag
and the ORF. In addition, some level of translation initiation may be expected
in the interior of the mRNA (i.e., at the ORF's ATG and not the tag's ATG)
resulting in a certain amount of native protein expression contaminating the
desired protein.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-202-
DNA (lower case): tisl - atg - tag - tis2 - atg - orf - stop
RNA (lower case, italics): tisl - atg - tag - tis2 - atg - orf - stop
Protein (upper case): ATG - TAG - TIS2 - ATG - ORF (tisl and stop are not
translated) + contaminating ATG - ORF (translation of ORF beginning at tis2).
Using recombinational cloning, it is a simple matter for those skilled in
the art to construct a vector containing a tag adjacent to a recombination
site
permitting the in frame fusion of a tag to the C- andlor N-terminus of the ORF
of
interest.
Given the ability to rapidly create a number of clones in a variety of
vectors, there is a need in the art to maximize the number of ways a single
cloned
gene can be expressed without the need to manipulate the gene construct
itself.
The present invention meets this need by providing materials and methods for
the
controlled expression of a C- and/or N-terminal fusion to a target gene using
one
or more suppressor tRNAs to suppress the termination of translation at a stop
codon. Thus, the present invention provides materials and methods in which a
gene construct is prepared flanked with recombination sites.
The construct is prepared with a sequence coding for a stop codon
preferably at the C-terminus of the gene encoding the protein of interest. In
some
embodiments, a stop codon can be located adjacent to the gene, for example,
within the recombination site flanking the gene. The target gene construct can
be transferred through recombination to various vectors which can provide
various C-terminal orN-terminal tags (e.g., GFP, GST, His Tag, GUS, etc.) to
the
gene of interest. When the stop codon is located at the carboxy terminus of
the
gene, expression of the gene with a "native" carboxy end amino acid sequence
occurs under non-suppressing conditions (i.e., when the suppressor tRNA is not
expressed) while expression of the gene as a carboxy fusion protein occurs
under
suppressing conditions. The present invention is exemplified using an amber
suppressor supF, which is a particular tyrosine tRNA gene (tyrT) mutated to
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-203-
recognize the UAG stop codon. Those skilled in the art will recognize that
other
suppressors and other stop codons could be used in the practice of the present
invention.
In the present example, the gene coding for the suppressing tRNA has
been incorporated into the vector from which the target gene is to be
expressed.
In other embodiments, the gene for the suppressor tRNA may be in the genome
of the host cell. In still other embodiments, the gene for the suppressor may
be
located on a separate vector and provided in traps. In embodiments of this
type,
the vector containing the suppressor gene may have an origin of replication
selected so as to be compatible with the vector containing the gene construct.
The selection and preparation of such compatible vectors is within ordinary
skill
in the art. Those skilled in the art will appreciate that the selection of an
appropriate vector for providing the suppressor tRNA in traps may include the
selection of an appropriate antibiotic resistance marker. For example, if the
vector expressing the target gene contains an antibiotic resistance marker for
one
antibiotic, a vector used to provide a suppressor tRNA may encode resistance
to
a second antibiotic. This permits the selection for host cells containing both
vectors.
In some preferred embodiments, more than one copy of a suppressor
tRNA may be provided in all of the embodiments described above. For example,
a host cell may be provided that contains multiple copies of a gene encoding
the
suppressor tRNA. Alternatively, multiple gene copies of the suppressor tRNA
under the same or different promoters may be provided in the same vector
background as the target gene of interest. In some embodiments, multiple
copies
of a suppressor tRNA may be provided in a different vector than the one use to
contain the target gene of interest. In other embodiments, one or more copies
of
the suppressor tRNA gene may be provided on the vector containing the gene for
the protein of interest and/or on another vector and/or in the genome of the
host
cell or in combinations of the above. When more than one copy of a suppressor
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-204-
tRNA gene is provided, the genes may be expressed from the same or different
promoters which may be the same or different as the promoter used to express
the
gene encoding the protein of interest.
In some embodiments, two or more different suppressor tRNA genes may
be provided. In embodiments of this type one or more of the individual
suppressors may be provided in multiple copies and the number of copies of a
particular suppressor tRNA gene may be the same or different as the number of
copies of another suppressor tRNA gene. Each suppressor tRNA gene,
independently of any other suppressor tRNA gene, may be provided on the vector
used to express the gene of interest and/or on a different vector and/or in
the
genome of the host cell. A given tRNA gene may be provided in more than one
place in some embodiments. For example, a copy of the suppressor tRNA may
be provided on the vector containing the gene of interest while one or more
additional copies may be provided on an additional vector and/or in the genome
of the host cell. When more than one copy of a suppressor tRNA gene is
provided, the genes may be expressed from the same or different promoters
which may be the same or different as the promoter used to express the gene
encoding the protein of interest and may be the same or different as a
promoter
used to express a different tRNA gene.
With reference to Figure 14, the GUS gene was cloned in frame with a
GST gene separated by the TAG codon. The plasmid also contained a supF gene
expressing a suppressor tRNA. The plasmid was introduced into a host cell
where approximately 60 percent of the GUS gene was expressed as a fusion
protein containing the GST tag. In control experiments, a plasmid containing
the
same GUS-stop codon-GST construct did not express a detectable amount of a
fusion protein when expressed from a vector lacking the supF gene. In this
example, the supF gene was expressed as part of the mRNA containing the
GUS-GST fusion. Since tRNAs are generally processed from larger RNA
molecules, constructs of this sort can be used to express the suppressor tRNAs
of
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-205-
the present invention. In other embodiments, the RNA containing the tRNA
sequence may be expressed separately from the mRNA containing the gene of
interest.
In some embodiments of the present invention, the target gene of interest
and the gene expressing the suppressor tRNA may be controlled by the same
promoter. In other embodiments, the target gene of interest may be expressed
from a different promoter than the suppressor tRNA. Those skilled in the art
will
appreciate that, under certain circumstances, it may be desirable to control
the
expression of the suppressor tRNA and/or the target gene of interest using a
regulatable promoter. For example, either the target gene of interest and/or
the
gene expressing the suppressor tRNA may be controlled by a promoter such as
the lac promoter or derivatives thereof such as the tac promoter. In the
embodiment shown, both the target gene of interest and the suppressor tRNA
gene are expressed from the T7 RNA polymerase promoter. Induction of the T7
RNA polymerase turns on expression of both the gene of interest (GUS in this
case) and the supF gene expressing the suppressor tRNA as part of one RNA
molecule.
In some preferred embodiments, the expression of the suppressor tRNA
gene may be under the control of a different promoter from that of the gene of
interest. In some embodiments, it may be possible to express the suppressor
gene
before the expression of the target gene. This would allow levels of
suppressor
to build up to a high level, before they are needed to allow expression of a
fusion
protein by suppression of a the stop codon. For example, in embodiments of the
invention where the suppressor gene is controlled by a promoter inducible with
IPTG, the target gene is controlled by the T7 RNA polymerase promoter and the
expression of the T7 RNA polymerase is controlled by a promoter inducible with
an inducing signal other than IPTG, e.g., NaCI, one could turn on expression
of
the suppressor tRNA gene with IPTG prior to the induction of the T7 RNA
polymerase gene and subsequent expression of the gene of interest. In some
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-206-
preferred embodiments, the expression of the suppressor tRNA might be induced
about 15 minutes to about one hour before the induction of the T7 RNA
polymerase gene. In a preferred embodiment, the expression of the suppressor
tRNA may be induced from about 15 minutes to about 30 minutes before
induction of the T7 RNA polymerase gene. In the specific example shown, the
expression of the T7 RNA polymerase gene is under the control of a salt
inducible promoter. A cell line having an inducible copy .of the T7 RNA
polymerase gene under the control of a salt inducible promoter is commercially
available from Invitrogen Corp., Life Technologies Division under the
designation of the BL21 SI strain.
In some preferred embodiments, the expression of the target gene of
interest and the suppressor tRNA can be arranged in the form of a feedback
loop.
For example, the target gene of interest may be placed under the control of
the T7
RNA polymerase promoter while the suppressor gene is under the control of both
the T7 promoter and the lac promoter, and the T7 RNA polymerase gene itself is
transcribed by both the T7 promoter and the lac promoter, and the T7 RNA
polymerase gene has an amber stop mutation replacing a normal tyrosine stop
codon, e.g., the 28'" codon (out of 883). No active T7 RNA polymerase can be
made before levels of suppressor are high enough to give significant
suppression.
Then expression of the polymerase rapidly rises, because the T7 polymerase
expresses the suppressor gene as well as itself. In other preferred
embodiments,
only the suppressor gene is expressed from the T7 RNA polymerase promoter.
Embodiments of this type would give a high level of suppressor without
producing an excess amount of T7 RNA polymerase. In other preferred
embodiments, the T7 RNA polymerase gene has more than one amber stop
mutation (see, e.g., Figure 14B). This will require higher levels of
suppressor
before active T7 RNA polymerase is produced.
In some embodiments of the present invention it may be desirable to have
more than one stop codon suppressible by more than one suppressor tRNA. With
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-207-
reference to Figure 15, a vector may be constructed so as to permit the
regulatable
expression of N- and/or C-terminal fusions of a protein of interest from the
same
construct. A first tag sequence, TAG 1 in Figure 15, is expressed from a
promoter
represented by an arrow in the figure. The tag sequence includes a stop codon
in
the same reading frame as the tag. The stop codon 1, may be located anywhere
in the tag sequence and is preferably located at or near the C-terminal of the
tag
sequence. The stop codon may also be located in the recombination site RS, or
in the internal ribosome entry sequence (IRES). The construct also includes a
gene of interest (GENE) which includes a stop codon 2. The first tag and the
gene of interest are preferably in the same reading frame although inclusion
of a
sequence that causes frame shifting to bring the first tag into the same
reading
frame as the gene of interest is within the scope of the present invention.
Stop
codon 2 is in the same reading frame as the gene of interest and is preferably
located at or near the end of the coding sequence for the gene. Stop codon 2
may
optionally be located within the recombination site RSZ. The construct also
includes a second tag sequence in the same reading frame as the gene of
interest
indicated by TAG2 in Figure 15 and the second tag sequence may optionally
include a stop codon 3 in the same reading frame as the second tag. A
transcription terminator may be included in the construct after the coding
sequence of the second tag (not shown in Figure 15). Stop codons 1, 2 and 3
may
be the same or different. In some embodiments, stop codons 1, 2 and 3 are
different. In embodiments where 1 and 2 are different, the same construct may
be used to express an N-terminal fusion, a C-terminal fusion and the native
protein by varying the expression of the appropriate suppressor tRNA. For
example, to express the native protein, no suppressor tRNAs are expressed and
protein translation is controlled by the IRES. When an N-terminal fusion is
desired, a suppressor tRNA that suppresses stop codon 1 is expressed while a
suppressor tRNA that suppresses stop codon 2 is expressed in order to produce
a C-terminal fusion. In some instances it may be desirable to express a doubly
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-208-
tagged protein of interest in which case suppressor tRNAs that suppress both
stop
codon 1 and stop codon 2 may be expressed.
The present invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding, it will be
obvious to one of ordinary skill in the art that the same can be performed by
modifying or changing the invention within a wide and equivalent range of
conditions, formulations and other parameters without affecting the scope of
the
invention or any specific embodiment thereof, and that such modifications or
changes are intended to be encompassed within the scope of the appended
claims.
Example 7: Testing Functionality of Entry and Destination Vectors
As part of assessment of the functionality of particular vectors of the
invention, it is important to functionally test the ability of the vectors to
recombine. This assessment can be carried out by performing a recombinational
cloning reaction by transforming E. coli and scoring colony forming units.
However, an alternative assay may also be performed to allow faster, more
simple
assessment of the functionality of a given Entry or Destination Vector by
agarose
gel electrophoresis. The following is a description of such an in vitro assay.
Materials and Methods:
Plasmid templates pEZC1301 and pEZC1313 (described in PCT
Publication WO 00/52027, the entire disclosure of which is incorporated herein
by reference), each containing a single wild-type att site, were used for the
generation of PCR products containing attL or attR sites, respectively.
Plasmid
templates were linearized with AIwNI, phenol extracted, ethanol precipitated
and
dissolved in TE to a concentration of 1 ng/~1.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-209-
PCR primers (capital letters represent base changes from wild-tvpel:
attL 1 gggg agcct gcttttttGtacAaa gttggcatta taaaaaagca ttgc (SEQ ID
N0:41)
attL2 gggg agcct gctttCttGtacAaa gttggcatta taaaaaagca ttgc (SEQ ID
N0:42)
attL right tgttgccggg aagctagagt as (SEQ ID N0:43)
attRl gggg Acaag ttTgtaCaaaaaagc tgaacgaga aacgtaaaat (SEQ ID
N0:44)
attR2 gggg Acaag ttTgtaCaaGaaagc tgaacgaga aacgtaaaat (SEQ ID
N0:45)
attR right ca gacggcatga tgaacctgaa (SEQ ID N0:46)
PCR primers were dissolved in TE to a concentration of 500 pmol/~1. Primer
mixes were prepared, consisting of attL 1 + attLright primers, attL2 +
attLright
primers, attRl + attRright primers, and attR2 + attRright primers, each mix
containing 20 pmol/pl of each primer.
PCR reactions:
1 ~1 plasmid template (1 ng)
1 ~l primer pairs (20 pmoles of each)
3 p1 of HZO
45 p1 of Platinum PCR SuperMix~ (Invitrogen Corp., Life Technologies
Division)
Cycling conditions (performed in MJ thermocycler):
95°C/2 minutes
94°C/30 seconds
25 cycles of 58°C/30 seconds and 72°C/1.5 minutes
72 ° C/5 minutes
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-210-
°C/hold
The resulting attL PCR product was 1.5 kb, and the resulting attR PCR
product was 1.0 kb.
PCR reactions were PEG/MgCl2 precipitated by adding 150 ~,1 H20 and
5 100 ~1 of 3x PEG/ MgCl2 solution followed by centrifugation. The PCR
products
were dissolved in 50 ~1 of TE. Quantification of the PCR product was performed
by gel electrophoresis of 1 ~1 and was estimated to be 50-100 ng/~1.
Recombination reactions of PCR products containing attL or attR sites
with GATEWAYTM plasmids was performed as follows:
8 ~1 of H20
2 p1 of attL or attR PCR product (100-200 ng)
2 ~.1 of GATEWAYTM plasmid (100 ng)
4 p1 of Sx Destination buffer
4 ~1 of GATEWAYTM LR ClonaseTM Enzyme Mix
20 p1 total volume (the reactions can be scaled down to a 5 ~l total
volume by adjusting the volumes of the components to about'/4 of those shown
above, while keeping the stoichiometries the same).
Clonase reactions were incubated at 25°C for 2 hours. Two ~1 of
proteinase K (2 mg/ml) was added to stop the reaction. Ten ~1 was then run on
a 1 % agarose gel. Positive control reactions were performed by reacting attL
1
PCR product (1.0 kb) with attRl PCR product (1.5 kb) and by similarly reacting
attL2 PCR product with attR2 PCR product to observe the formation of a larger
(2.5 kb) recombination product. Negative controls were similarly performed by
reacting attL 1 PCR product with attR2 PCR product and vice versa or reactions
of attL PCR product with an attL plasmid, etc.
In alternative assays, to test attB Entry vectors, plasmids containing single
attP sites were used. Plasmids containing single att sites could also be used
as
recombination substrates in general to test all Entry and Destination vectors
(i. e.,
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-211-
those containing attL, attR , attB and attP sites). This would eliminate the
need
to do PCR reactions.
Results:
Destination and Entry plasmids when reacted with appropriate
att-containing PCR products formed linear recombinant molecules that could be
easily visualized on an agarose gel when compared to control reactions
containing no attL or attR PCR product. Thus, the functionality of Destination
and Entry vectors constructed according to the invention may be determined,
for
example, by carrying out the linearization assay described above.
Example 8: PCR Cloning Using Universal Adapter-Primers
As described herein, the cloning of PCR products using the
GATEWAYTM PCR Cloning System (Invitrogen Corp., Life Technologies
Division; Rockville, MD) requires the addition of attB sites (attB 1 and
attB2) to
the ends of gene-specific primers used in the PCR reaction. Available data
suggested that the user add 29 by (25 by containing the attB site plus four G
residues) to the gene-specific primer. It would be advantageous to high volume
users of the GATEWAYTM PCR Cloning System to generate attB-containing
PCR product using universal attB adapter-primers in combination with shorter
gene-specific primers containing a specified overlap to the adapters. The
following experiments demonstrate the utility of this strategy using universal
attB
adapter-primers and gene-specific primers containing overlaps of various
lengths
from 6 by to 18 bp. The results demonstrate that gene-specific primers with
overlaps of 10 by to 18 by can be used successfully in PCR amplifications with
universal attB adapter-primers to generate full-length PCR products. These PCR
products can then be successfully cloned with high fidelity in a specified
orientation using the GATEWAYTM PCR Cloning System.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-212-
Methods and Results:
To demonstrate that universal attB adapter-primers can be used with gene-
specific primers containing partial attB sites in PCR reactions to generate
full-
length PCR product, a small 256 by region of the human hemoglobin cDNA was
chosen as a target so that intermediate sized products could be distinguished
from
full-length products by agarose gel electrophoresis.
The following oligonucleotides were used:
B1-Hgb: GGGG ACA AGT TTG TAC AAA AAA GCA GGC T-5'-Hgb*
(SEQ ID N0:47)
B2 -Hgb : GGGG ACC ACT TTG TAC AAG
AAA GCT GGG T-3
' -Hgb*
(SEQ ID N0:48)
18B1-Hgb: TG TAC AAA AAA GCA GGC T-5'-Hgb
(SEQ ID N0:49)
18B2-Hgb: TG TAC AAG AAA GCT GGG T-3'-Hgb
(SEQ ID N0:50)
15B1-Hgb: AC AAA AAA GCA
GGC T-5'-Hgb
(SEQ ID N0:51)
15B2-Hgb: AC AAG AAA GCT GGG T-3'-Hgb
(SEQ ID N0:52)
1281-Hgb: AA A AA GCA GGC T-5'-Hgb
(SEQ ID N0:53)
12B2-Hgb: AG A AA GCT GGG T-3'-Hgb
(SEQ ID N0:54)
11B1-Hgb: A A AA GCA GGC T-5'-Hgb
(SEQ ID N0:55)
11B2-Hgb: G A AA GCT GGG T-3'-Hgb
(SEQ ID N0:56)
lOBl-Hgb: AA A GCA GGC T-5'-Hgb
(SEQ ID N0:57)
1082-Hgb: A AA GCT GGG T-3'-Hgb
(SEQ ID N0:58)
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-213-
9B1-Hgb: AA GCAGGC T-5'-Hgb
9B2-Hgb: AA GCTGGG T-3'-Hgb
8B1-Hgb: A GCAGGC T-5'-Hgb
8B2-Hgb: A GCTGGG T-3'-Hgb
$ 7B1-Hgb: GCAGGC T-5'-Hgb
7B2-Hgb: GCTGGG T-3'-Hgb
6B1-Hgb: CA GGC T-5'-Hgb
6B2-Hgb: CT GGG T-3'-Hgb
attBl adapter: GGGG ACA AGT TTG TAC AAA AAA GCA GGC T
(SEQ ID N0:47)
attB2 adapter: GGGG ACC ACT TTG TAC AAG AAA GCT GGG T
(SEQ ID N0:48)
* -5'-Hgb - GTC ACT AGC CTG TGG AGC AAG A (SEQ ID
N0:59)
1$ ** -3'-Hgb - AGG ATG GCA GAG GGA GAC GAC A (SEQ ID
N0:60)
The aim of these experiments was to develop a simple and efficient
universal adapter PCR method to generate attB containing PCR products suitable
for use in the GATEWAYTM PCR Cloning System. The reaction mixtures and
thermocycling conditions should be simple and efficient so that the universal
adapter PCR method could be routinely applicable to any PCR product cloning
application.
PCR reaction conditions were initially found that could successfully
amplify predominately full-length PCR product using gene-specific primers
2$ containing 18 by and 1$ by overlap with universal attB primers. These
conditions are outlined below:
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-214-
pmoles of gene-specific primers
10 pmoles of universal attB adapter-primers
1 ng of plasmid containing the human hemoglobin cDNA.
100 ng of human leukocyte cDNA library DNA.
5 5 p,1 of l Ox PLATINUM Taq HiFi~ reaction buffer (Invitrogen Corp., Life
Technologies Division)
2 ~1 of 50 mM MgS04
1 ~1 of 10 mM dNTPs
0.2 ~1 Of PLATINUM Taq HiFi~ (1.0 unit)
10 Hz0 to SO ~1 total reaction volume
Cycling conditions:
95°C/5 min
94°C/15 sec
25 x 50°C/30 sec
68°C/1 min
68°C/5 min
5°C/hold
To assess the efficiency of the method, 2 ~1 (1/25) of the 50 ~1 PCR
reaction was electrophoresed in a 3 % Agarose-1000 gel. With overlaps of 12 by
or less, smaller intermediate products containing one or no universal attB
adapter
predominated the reactions. Further optimization of PCR reaction conditions
was
obtained by titrating the amounts of gene-specific primers and universal attB
adapter-primers. The PCR reactions were set up as outlined above except that
the
amounts of primers added were:
0, 1, 3 or 10 pmoles of gene-specific primers
0, 10, 30 or 100 pmoles of adapter-primers
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-215-
Cycling conditions:
95°C/3 min
94°C/15 sec
25 x 50°C/45 sec
68°C/1 min
68°C/5 min
°C/hold
The use of limiting amounts of gene-specific primers (3 pmoles) and
excess adapter-primers (30 pmoles) reduced the amounts of smaller intermediate
5 products. Using these reaction conditions the overlap necessary to obtain
predominately full-length PCR product was reduced to 12 bp. The amounts of
gene-specific and adapter-primers was further optimized in the following PCR
reactions:
0, 1, 2 or 3 pmoles of gene-specific primers
0, 30, 40 or 50 pmoles of adapter-primers
Cycling conditions:
95°C/3 min
94°C/15 sec
25 x 48°C/1 min
68°C/1 min
68°C/5 min
5°C/hold
The use of 2 pmoles of gene-specific primers and 40 pmoles of adapter-
primers further reduced the amounts of intermediate products and generated
predominately full-length PCR products with gene-specific primers containing
an 11 by overlap. The success of the PCR reactions can be assessed in any PCR
application by performing a no adapter control. The use of limiting amounts of
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-216-
gene-specific primers should give faint or barely visible bands when 1/25 to
1/10
of the PCR reaction is electrophoresed on a standard agarose gel. Addition of
the
universal attB adapter-primers should generate a robust PCR reaction with a
much higher overall yield of product.
PCR products from reactions using the 18 bp, 15 bp, 12 bp, 11 by and
by overlap gene-specific primers were purified using the CONCERT~ Rapid
PCR Purification System (PCR products greater than 500 by can be PEG
precipitated). The purified PCR products were subsequently cloned into an attP
containing plasmid vector using the GATEWAYT"" PCR Cloning System
10 (Invitrogen Corp., Life Technologies Division; Rockville, MD) and
transformed
into E. coli. Colonies were selected and counted on the appropriate antibiotic
media and screened by PCR for correct inserts and orientation.
Raw PCR products (unpurified) from the attB adapter PCR of a plasmid
clone of part of the human beta-globin (Hgb) gene were also used in
GATEWAYT"" PCR Cloning System reactions. PCR products generated with the
full attB B 1 B2-Hgb, the 12B 1 B2, 11 B 1 B2 and 1 OB 1 B2 attB overlap Hgb
primers were successfully cloned into the GATEWAYT"" pENTR21 attP vector
(described in PCT Publication WO 00/52027, the entire disclosure of which is
incorporated herein by reference). 24 colonies from each (24 x 4 = 96 total)
were
tested and each was verified by PCR to contain correct inserts. The cloning
efficiency expressed as cfu/ml is shown below:
Primer Used cfu/ml
Hgb full attB 8,700
Hgb 12 by overlap21,000
Hgb 11 by overlap20,500
Hgb 10 by overlap13,500
GFP control 1.300
Interestingly, the overlap PCR products cloned with higher efficiency than
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-217-
did the full attB PCR product. Presumably, and as verified by visualization on
agarose gel, the adapter PCR products were slightly cleaner than was the full
attB
PCR product. The differences in colony output may also reflect the proportion
of PCR product molecules with intact attB sites.
Using the attB adapter PCR method, PCR primers with 12 by attB
overlaps were used to amplify cDNAs of different sizes (ranging from 1 to 4
kb)
from a leukocyte cDNA library and from first strand cDNA prepared from HeLa
total RNA. While three of the four cDNAs were able to be amplified by this
method, a non-specific amplification product was also observed that under some
conditions would interfere with the gene-specific amplification. This non-
specific
product was amplified in reactions containing the attB adapter-primers alone
without any gene-specific overlap primers present. The non-specific
amplification
product was reduced by increasing the stringency of the PCR reaction and
lowering the attB adapter PCR primer concentration.
1 S These results indicate that the adapter-primer PCR approach described in
this Example will work well for cloned genes. These results also demonstrate
the
development of a simple and efficient method to amplify PCR products that are
compatible with the GATEWAYT"~ PCR Cloning System that allows the use of
shorter gene-specific primers that partially overlap universal attB adapter-
primers. In routine PCR cloning applications, the use of 12 by overlaps is
recommended. The methods described in this Example can thus reduce the
length of gene-specific primers by up to 17 residues or more, resulting in a
significant savings in oligonucleotide costs for high volume users of the
GATEWAYT"~ PCR Cloning System. In addition, using the methods and assays
described in this Example, one of ordinary skill can, using only routine
experimentation, design and use analogous primer-adapters based on or
containing other recombination sites or fragments thereof, such as attL, attR,
attP, lox, FRT, etc.
As an alternative to adding 29 bases to the ends of PCR primers, attB
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-218-
PCR products can be generated with primers containing as few as 12 bases of
attB added to template-specific primers using a two-step PCR protocol. In the
first step template-specific primers containing 12 bases of attB are used in
10
cycles of PCR to amplify the target gene. A portion of this PCR reaction is
transferred to a second PCR reaction containing universal attB adapter primers
to amplify the full-attB PCR product.
Template-specific primers with 12 bases of attBl and attB2 at their 5'-
ends are designed as shown below:
12 attB 1: AA AAA GCA GGC TNN (SEQ ID N0:139)- forward template-
specific primer
12 attB2: A GAA AGC TGG GTN (SEQ ID N0:140)- reverse template-
specific primer
The template-specific part of the primers is generally be designed to have
a Tm of greater than 50°C. The optimal annealing temperature is
determined by
the Tm of the template-specific part of the primer.
attB 1 adapter primer: GGGGACAAGTTTGTACAAAAAAGCAGGCT (SEQ
ID N0:47)
attB2 adapter primer: GGGGACCACTTTGTACAAGAAAGCTGGGT (SEQ
ID N0:48)
A 50 ~1 PCR reaction containing 10 pmoles of each template-specific
primer and the appropriate amount of template DNA is prepared. Tubes
containing this PCR reaction mixture are placed in a thermal cycler at
95°C and
incubated for 2 minutes.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-219-
Ten cycles of PCR are performed as follows:
Denature 94°C for 15 seconds
Annea150-60°C for 30 seconds
Extend 68°C for 1 minute/kb of target amplicon
Ten ~1 of the PCR reaction product is transferred to a 40 p1 PCR reaction
mixture containing 40 pmoles each of the attB 1 and attB2 adapter primers.
Tubes containing this mixtures are then placed in a thermal cycler at
95°C and
incubated for 1 minute.
Five cycles of PCR are performed as follows:
Denature 94°C for 15 seconds
Annea145°C for 30 seconds
Extend 68°C for 1 minute/kb of target amplicon
Fifteen to twenty cycles of PCR are then performed as follows:
Denature 94°C for 15 seconds
Annea155°C for 30 seconds
Extend 68°C for 1 minute/kb of target amplicon
The amplification products are then analyzed by agarose gel
electrophoresis.
Example 9: MutationalAnalysis of the BacteriophageLambda attL and attR
Sites: Determinants of att Site Specificity in Site-specific
Recombination
To investigate the determinants of att site specificity, the bacteriophage
lambda attL and attR sites were systematically mutagenized and examined to
define precisely which mutations produce unique changes in att site
specificity.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-220-
As noted herein, the determinants of specificity have previously been
localized
to the 7 by overlap region (TTTATAC, which is defined by the cut sites for the
integrase protein and is the region where strand exchange takes place) within
the
15 by core region (GCTTTTTTATACTAA (SEQ ID N0:37)) that is identical in
all four lambda att sites, attB, attP, attL and attR.
Therefore, to examine the effect of att sequence on site specificity, mutant
attL and attR sites were generated by PCR and tested in an in vitro site-
specific
recombination assay. In this way all possible single base pair changes within
the
7 by overlap region of the core att site were generated as well as five
additional
changes outside the 7 by overlap but within the 15 by core att site. Each attL
PCR substrate was tested in the in vitro recombination assay with each of the
attR
PCR substrates.
Methods
To examine both the efficiency and specificity of recombination of mutant
attL and attR sites, a simple in vitro site-specific recombination assay was
developed. Since the core regions of attL and attR lie near the ends of these
sites,
it was possible to incorporate the desired nucleotide base changes within PCR
primers and generate a series of PCR products containing mutant attL and attR
sites. PCR products containing attL and attR sites were used as substrates in
an
in vitro reaction with GATEwAYTM LR CLONASETM Enzyme Mix (Invitrogen
Corp., Life Technologies Division, Rockville, MD). Recombination between a
1.5 kb attL PCR product and a 1.0 kb attR PCR product resulted in a 2.5 kb
recombinant molecule that was monitored using agarose gel electrophoresis and
ethidium bromide staining.
Plasmid templates pEZC 1301 and pEZC 1313 (described in PCT
Publication WO 00/52027, the entire disclosure of which is incorporated herein
by reference), each containing a single wild-type attL or attR site,
respectively,
were used for the generation of recombination substrates. The following list
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-221-
shows primers used in PCR reactions to generate the attL PCR products that
were
used as substrates in LR CLONASETM reactions (capital letters represent
changes
from the wild-type sequence, and the underline represents the 7 by overlap
region
within the 15 by core att site; a similar set of PCR primers was used to
prepare
the attR PCR products containing matching mutations):
GATEwAYT"~ sites (note: attL2 sequence in GATEwAYTM plasmids begins "accca"
while the attL2 site in this example begins "agcct"to reflect wild-type attL
outside the core region.)
attLl: gggg agcct gcttttttGtacAaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:41)
attL2: gggg agcct gctttCttGtacAaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:42)
Wild-type:
attLO: gggg agcct gcttttttatactaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:61)
Single base changes from wild-type
attLTlA: gggg agcct gctttAttatactaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:62)
attLTlC: gggg agcct gctttCttatactaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:63)
attLTlG: gggg agcct gctttGttatactaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:64)
attLT2A: gggg agcct gcttttAtatactaa gttggcatta taaaaa-
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-222-
agca ttgc (SEQ ID N0:65)
attLT2C: gggg agcct gcttttCtatactaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:66)
attLT2G: gggg agcct gcttttGtatactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:67)
attLT3A: gggg agcct gctttttAatactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:68)
attLT3C: gggg agcct gctttttCatactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:69)
attLT3G: gggg agcct gctttttGatactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:70)
attLA4C: gggg agcct gcttttttCtactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:71)
attLA4G: gggg agcct gcttttttGtactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:72)
attLA4T: gggg agcct gcttttttTtactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:73)
attLTSA: gggg agcct gcttttttaAactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:74)
attLTSC: gggg agcct gcttttttaCactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:75)
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-223-
attLTSG: gggg agcct gcttttttaGactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:76)
attLA6C: gggg agcct gcttttttatCctaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:77)
attLA6G: gggg agcct gcttttttatGctaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:78)
attLA6T: gggg agcct gcttttttatTctaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:79)
attLC7A: gggg agcct gcttttttataAtaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:80)
attLC7G: gggg agcct gcttttttataGtaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:81)
attLC7T: gggg agcct gcttttttataTtaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:82)
Single base changes outside of the 7 by overlap:
attL8: gggg agcct Acttttttatactaa gttggcatta taaaa-
aagca ttgc (SEQ ID N0:83)
attL9: gggg agcct gcCtttttatactaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:84)
attLlO: gggg agcct gcttCtttatactaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:85)
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-224- '
attLl4: gggg agcct gcttttttatacCaa gttggcatta taaaaa-
agca ttgc (SEQ ID N0:86)
attLl5: gggg agcct gcttttttatactaG gttggcatta taaaaa-
agca ttgc (SEQ ID N0:87)
Note: Additional vectors wherein the first nine bases are gggg agcca (i.e.,
substituting an adenine for the thymine in the position immediately preceding
the
15-by core region), which may or may not contain the single base pair
substitutions (or deletions) outlined above, can also be used in these
experiments.
Recombination reactions of attL- and attR-containing PCR products was
performed as follows:
8 w1 of H20
2 ~1 of attL PCR product (100 ng)
2 ~,1 of attR PCR product (100 ng)
4 ~1 of 5x buffer
4 ~1 of GATEWAYT~~ LR CLONASE~ Enzyme Mix
~1 total volume
CLONASE~ reactions were incubated at 25°C for 2 hours.
2 ~1 of 1 OX CLONASETM stop solution (proteinase K, 2 mg/ml) were added to
stop
the reaction. '
20 10 ~1 of the reaction mixtures were run on a 1 % agarose gel.
Results
Each attL PCR substrate was tested in the in vitro recombination assay
with each of the attR PCR substrates. The results indicate that changes within
the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-225-
first three positions of the 7 by overlap (TTTATAC) strongly altered the
specificity of recombination. These mutant att sites each recombined as well
as
the wild-type, but only with their cognate partner mutant; they did not
recombine
detectably with any other att site mutant. In contrast, changes in the last
four
positions (TTTATAC) only partially altered specificity; these mutants
recombined with their cognate mutant as well as wild-type att sites and
recombined partially with all other mutant att sites except for those having
mutations in the first three positions of the 7 by overlap. Changes outside of
the
7 by overlap were found not to affect specificity of recombination, but some
did
influence the efficiency of recombination.
Based on these results, the following rules for att site specificity were
determined:
~ Only changes within the 7 by overlap affect specificity.
~ Changes within the first 3 positions strongly affect specificity.
~ Changes within the last 4 positions weakly affect specificity.
Mutations that affected the overall efficiency of the recombination
reaction were also assessed by this method. In these experiments, a slightly
increased (less than 2-fold) recombination efficiency with attLT 1 A and
attLC7T
substrates was observed when these substrates were reacted with their cognate
attR partners. Also observed were mutations that decreased recombination
efficiency (approximately 2-3 fold), including attLA6G, attL 14 and attL 15.
These mutations presumably reflect changes that affect.Int protein binding at
the
core att site.
The results of these experiments demonstrate that changes within the first
three positions of the 7 by overlap (TTTATAC) strongly altered the specificity
of recombination (i. e. , att sequences with one or more mutations in the
first three
thymidines would only recombine with their cognate partners and would not
cross-react with any other att site mutation). In contrast, mutations in the
last
four positions (TTTATAC) only partially altered specificity (i.e., att
sequences
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-226-
with one or more mutations in the last four base positions would cross-react
partially with the wild-type att site and all other mutant att sites, except
for those
having mutations in one or more of the first three positions of the 7 by
overlap).
Mutations outside of the 7 by overlap were not found to affect specificity of
recombination, but some were found to influence (i. e. , to cause a decrease
in) the
efficiency of recombination.
Example 10: Discovery of Att Site Mutations That Increase the Cloning
Efficiency of GATEWAY"'''Cloning Reactions
In experiments designed to understand the determinants of att site
specificity, point mutations in the core region of attL were made. Nucleic
acid
molecules containing these mutated attL sequences were then reacted in an LR
reaction with nucleic acid molecules containing the cognate attR site (i. e.,
an attR
site containing a mutation corresponding to that in the attL site), and
recombinational efficiency was determined as described above. Several
mutations
located in the core region of the att site were noted that either slightly
increased
(less than 2-fold) or decreased (between 2-4-fold) the efficiency of the
recombination reaction (Table 5).
Table
5. Effects
of attL
mutations
on Recombination
Reactions.
Site Sequence SE Effect on
ID Recombination
attLO agcctgcttttttatactaagttggcatta88 N/A
attL5 agcctgctttAttatactaagttggcatta89 slightly
increased
attL6 agcctgcttttttataTtaagttggcatta90 slightly
increased
attLl3 agcctgcttttttatGctaagttggcatta91 decreased
attLl4 agcctgcttttttatacCaagttggcatta92 decreased
attLl5 agcctgcttttttatactaGgttggcatta93 decreased
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-227-
consensus CAACTTnnTnnnAnnAAGTTG 94 N/A
It was also noted that these mutations presumably reflected changes that
either increased or decreased, respectively, the relative affinity of the
integrase
protein for binding the core att site. A consensus sequence for an integrase
core-
binding site (CAACTTNNT) has been inferred in the literature but not directly
tested (see, e.g., Ross and Landy, Cell 33:261-272 (1983)). This consensus
core
integrase-binding sequence was established by comparing the sequences of each
of the four core att sites found in attP and attB as well as the sequences of
five
non-att sites that resemble the core sequence and to which integrase has been
shown to bind in vitro. These experiments suggest that many more att site
mutations might be identified which increase the binding of integrase to the
core
att site and thus increase the efficiency of GATEWAYTM cloning reactions.
Example 11: Effects of Core Region Mutations on Recombination Efficiency
To directly compare the cloning efficiency of mutations in the att site core
region, single base changes were made in the attB2 site of an attBl-tet-attB2
PCR product. Nucleic acid molecules containing these mutated attB2 sequences
were then reacted in a BP reaction with nucleic acid molecules containing non-
cognate attP sites (i.e., wild-type attP2), and recombinational efficiency was
determined as described above. The cloning efficiency of these mutant attB2
containing PCR products compared to standard attB 1-tet-attB2 PCR product are
shown in Table 6.
Table
6.
Efficiency
of
Recombination
With
Mutated
attB2
Sites.
Site Sequence SEQ MutationCloning
ID Efficiency
NO.
attBO tcaagtta t~ataa-aaaagcaggct95
attB ggggacaagttt acaaaaaagcaggct47
1
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-228-
attB2 ggggaccacttt acaa aaagctgggt48 100%
attB2.1ggggaAcacttt acaa aaagctgggt96 CAA 40%
attB2.2ggggacAacttt caa aaagctgggt97 CAA 131%
attB2.3ggggaccCcttt acaa aaagctgggt98 A-~C 4%
attB2.4ggggaccaAttt acaa aaagctgggt99 CAA 11%
attB2.5ggggaccacGtt acaa aaagctgggt100 TAG 4%
attB2.6ggggaccactGt caa aaagctgggt101 TAG 6%
attB2.7ggggaccacttG caa aaagctgggt102 TAG 1%
attB2.8ggggaccactttTtacaa 103 G~'I' 0.5%
aaagctgggt
As noted above, a single base change in the attB2.2 site increased the
cloning efficiency of the attB 1-tet-attB2.2 PCR product to 131 % compared to
the
attBl-tet-attB2 PCR product. Interestingly, this mutation changes the
integrase
core binding site of attB2 to a sequence that matches more closely the
proposed
consensus sequence.
Additional experiments were performed to directly compare the cloning
efficiency of an attB 1-tet-attB2 PCR product with a PCR product that
contained
attB sites containing the proposed consensus sequence of an integrase core
binding site. The following attB sites were used to amplify attB-tet PCR
products:
attBl ggggacaagtttatacaaaaaagcaggct(SEQIDN0:47)
attBl.6 ggggacaaCtttgtacaaaaaagTTggct (SEQIDN0:104)
attB2 ggggaccactttatacaaaaaagctgggt (SEQ ID N0:48)
attB2.10 ggggacAactttQtacaaaaaagTtgggt (SEQIDNO:105)
BP reactions were carried out between 300 ng (100 fmoles) of
pDONR201 (Invitrogen Corp., Life Technologies Division, Cat. No.11798-O 14)
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-229-
with 80 ng (80 fmoles) of attB-tet PCR product in a 20 p1 volume with
incubation
for 1.5 hours at 25 °C, creating pENTR201-tet Entry clones. A
comparison of the
cloning efficiencies of the above-noted attB sites in BP reactions is shown in
Table 7.
a a onm a icien c o eachons.
PCR roduct CFU/ml Fold Increase
B 1-tet-B2 7,500
B 1.6-tet-B2 12,000 1.6 x
B1-tet-B2.10 20,900 2.8 x
B1.6-tet-B2.10 30,100 4.0 x
These results demonstrate that attB PCR products containing sequences
that perfectly match the proposed consensus sequence for integrase core
binding
sites can produce Entry clones with four-fold higher efficiency than standard
GATEWAYS attB 1 and attB2 PCR products.
The entry clones produced above were then transferred to pDEST20
(Invitrogen Corp., Life Technologies Division, Cat. No. 11807-013) via LR
reactions (300 ng (64 fmoles) pDEST20 mixed with 50 ng (77 fmoles) of the
respective pENTR201-tet Entry clone in 20 ~l volume; incubated for a 1 hour
incubation at 25 ° C). The efficiencies of cloning for these reactions
are compared
in Table 8.
a a omn icienc o eachons.
ENTR201-tet CFU/ml Fold Increase
x
DEST20
L1-tet-L2 5,800
L 8,000 1.4
1.6-tet-L2
Ll-tet-L2.10 10,000 1.7
L 9,300 1.6
1.6-tet-L2.10
These results demonstrate that the mutations introduced into attB 1.6 and
attB2.10 that transfer with the gene into entry clones slightly increase the
efficiency of LR reactions. Thus, the present invention encompasses not only
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-230-
mutations in attB sites that increase recombination efficiency, but also to
the
corresponding mutations that result in the attL sites created by the BP
reaction.
To examine the increased cloning efficiency of the attB 1.6-tet-attB2.10
PCR product over a range of PCR product amounts, experiments analogous to
those described above were performed in which the amount of attB PCR product
was titrated into the reaction mixture. The results are shown in Table 9.
a a itration tt ro ucts.
o a
Amount PCR product CFU/m Fold Increase
of 1
attB
PCR
product
(ng)
20 attBl-tet-attB2 3,500 6.1
attBl.6-tet-attB2.1021,500
50 attBl-tet-attB2 9,800 5.0
attB 1.6-tet-attB2.1049 000
100 attBl-tet-attB2 18,800 2.8
attB 1.6-tet-attB2.1053 000
200 attBl-tet-attB2 19,000 2.5
I ( attB 1.6-tet-attB2.1048,000
I
These results demonstrate that as much as a six-fold increase in cloning
1 S efficiency is achieved with the attB 1.6-tet-attB2.10 PCR product as
compared to
the standard attB 1-tet-attB2 PCR product at the 20 ng amount.
Example 12: Determination of attB Sequence Requirements for Optimum
Recombination Efficiency
To examine the sequence requirements for attB and to determine which
attB sites would clone with the highest efficiency from populations of
degenerate
attB sites, a series of experiments was performed. Degenerate PCR primers were
designed which contained five bases of degeneracy in the B-arm of the attB
site.
These degenerate sequences would thus transfer with the gene into Entry clone
in BP reactions and subsequently be transferred with the gene into expression
clones in LR reactions. The populations of degenerate attB and attL sites
could
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-231-
thus be cycled from attB to attL back and forth for any number of cycles. By
altering the reaction conditions at each transfer step (for example, by
decreasing
the reaction time and/or decreasing the concentration of DNA) the reaction can
be made increasingly more stringent at each cycle and thus enrich for
populations
of attB and attL sites that react more efficiently.
The following degenerate PCR primers were used to amplify a 500 by
fragment from pUCl8 which contained the IacZ alpha fragment (only the attB
portion of each primer is shown):
attBl:
GGGG ACAAGTTTGTACAAA AAAGC AGGCT (SEQ ID N0:47)
attBlnl6-20:
GGGG ACAAGTTTGTACAAA nnnnn AGGCT (SEQ ID N0:106)
attBln21-25:
GGGG ACAAGTTTGTACAAA AAAGC nnnnn (SEQ ID N0:107)
a t tB2
GGGG ACCACTTTGTACAAG AAAGC TGGGT (SEQ ID N0:48)
attB2n16-20:
GGGG ACCACTTTGTACAAG nnnnn TGGGT (SEQ ID N0:108)
attB2n21-25:
GGGG ACCACTTTGTACAAG AAAGC nnnnn (SEQ ID N0:109)
The starting population size of degenerate att sites is 45 or 1024
molecules. Four different populations were transferred through two BP
reactions
and two LR reactions. Following transformation of each reaction, the
population
of transformants was amplified by growth in liquid media containing the
appropriate selection antibiotic. DNA was prepared from the population of
clones by alkaline lysis miniprep and used in the next reaction. The results
of the
BP and LR cloning reactions are shown below.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-232-
BP-1, overnight reactions:
cfu/ml percent of control
attBl-lacZa-attB2 78,500 100
attB 1 n 16-20-lacZa-attB21,140 1. 5
attB 1 n21-25-lacZa-attB211,100 14
attBl-IacZa-attB2n16-20710 0.9
attBl-lacZa-attB2n21-2516,600 ~ 21
~
LR-1, pENTR201-lacZa x pDEST20/EcoRI, 1 hour reactions
cfu/ml percent of control
attLl-lacZa-attL2 20,000 100
attL 1 n1 6-20-lacZa-attL22,125 11
attLln21-25-lacZa-attL22,920 15
attLl-lacZa-attL2n16-203,190 16
attLl-lacZa-attL2n21-251,405 7
BP-2, pEXP20-lacZa/ScaI x pDONR201, 1 hour reactions
cfu/ml percent of control
attBl-lacZa-attB2 48,600 100
attBlnl6-20-lacZa-attB222,800 47
attBln21-25-lacZa-attB231,500 65
attBl-lacZa-attB2n16-2042,400 87
attBl-lacZa-attB2n21-2534,500 71
~
LR-2, pENTR201-lacZa x pDEST6/NcoI, 1 hour reactions
cfulml percent of control
attLl-lacZa-attL2 23,000 100
attL 1 n 16-20-lacZa-attL249,000 213
attL 1 n21-25-lacZa-attL218,000 80
attLl-lacZa-attL2n16-2037,000 160
~ttLl-lacZa-attL2n21-25~57,000 250
These results demonstrate that at each successive transfer, the cloning
efficiency of the entire population of att sites increases, and that there is
a great
deal of flexibility in the definition of an attB site. Specific clones may be
isolated
ftom the above reactions, tested individually for recombination efficiency,
and
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-233-
sequenced. Such new specificities may then be compared to known examples to
guide the design of new sequences with new recombination specificities. In
addition, based on the enrichment and screening protocols described herein,
one
of ordinary skill can easily identify and use sequences in other recombination
sites (e.g., other att sites, lox, FRT, etc.), that result in increased
specificity in the
recombination reactions using nucleic acid molecules containing such
sequences.
Example 13: Embedding of Functional Components in Recombination Sites
Recombination sites used with the invention may also have embedded
functions or properties. An embedded functionality is a function or property
conferred by a nucleotide sequence in a recombination site which is not
directly
associated with recombination efficiency or specificity. For example,
recombination sites may contain protein coding sequences (e.g., intein coding
sequences), intron/exon splice sites, origins of replication, and/or stop
codons.
In generally, the longer the stretch of nucleic acid which makes up a
recombination site the more amendable the site will be to the incorporation of
embedded functions or properties. On the contrary, longer recombination sites
will be more likely to have features (e.g., stop codons) which interfere with
desired functions or properties. Further, recombination sites which have more
than one (e.g., two, three, four, five, etc.) embedded functions or properties
may
also be prepared.
As explained below, in one aspect, the invention provides methods for
removing nucleotide sequences encoded by recombination sites from RNA
molecules. One example of such a method employs the use of intron/exon splice
sites to remove RNA encoded by recombination sites from RNA transcripts.
Again, as explained below, nucleotide sequences which encode these intron/exon
splice sites may be fully or partially embedded in the recombination sites
which
encode sequences excised from RNA molecules or these intron/exon splice sites
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-234-
may be encoded by adjacent nucleic acid sequence. Similarly, one intron/exon
splice sites may be encoded by recombination site and another intron/exon
splice
sites may be encoded by other nucleotide sequences (e.g., nucleic acid
sequences
of the vector or a nucleic acid of interest). Nucleic acid splicing is
discussed in
the following publications: R. Reed, Curr. Opin. Genet. Devel. 6:215-220 (
1996);
S. Mount, Nucl. Acids. Res. 10:459-472, (1982); P. Sharp, Cell 77:805-815,
(1994); K. Nelson and M. Green, Genes and Devel. 23:319-329 (1988); and T.
Cooper and W. Mattox, Am. J. Hum. Genet. 61:259-266 (1997).
In some instances it will be advantageous to remove either RNA
corresponding to recombination sites from RNA transcripts or amino acid
residues encoded by recombination sites. Removal of such sequences can be
performed in several ways and can occur at either the RNA or protein level.
One
instance where it will generally be advantageous to remove RNA transcribed
from a recombination site will be where a nucleic acid molecule which an ORF
is inserted into a vector in an orientation which is intended to result in the
expression of a fusion protein (e.g., GFP) between amino acid residues encoded
by the ORF and amino acid residues encoded by the vector (e.g., GFP). In such
an instance, the presence of an intervening recombination site between the ORF
and the vector coding sequences may result in the recombination site ( 1 )
contributing codons to the mRNA which results in the inclusion of additional
amino acid residues in the expression product, (2) contributing a stop codon
to
the mRNA which prevents the production of the desired fusion protein, and/or
(3)
shifting the reading frame of the mRNA such that the two protein are not fused
"in-frame."
One method for removing recombination sites from mRNA molecules
involves the use intron/exon splice sites (i.e., splice donor and splice
acceptor
sites). Splice sites can be suitably positioned in a number of locations.
Using a
Destination Vector designed to express an inserted ORF with an N-terminal GFP
fusion, as an example, the first splice site could be encoded for by vector
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-235-
sequences located,3' to the GFP coding sequences and the second splice site
could
be partially embedded in the recombination site which separates the GFP coding
sequences from the coding sequences of the ORF. Further, the second splice
site
either could abut the 3' end of the recombination site or could be positioned
a
short distance (e.g., 2, 4, 8, 10, 20 nucleotides) 3' to the recombination
site. In
addition, depending on the length of the recombination site, the second splice
site
could be fully embedded in the recombination site.
A modification of the method described above involves the connection of
multiple nucleic acid segments which, upon expression, results in the
production
of a fusion protein. In one specific example, one nucleic acid segment encodes
GFP and another nucleic acid segment which contains an ORF of interest. Each
of these segments is flanked by recombination sites. In addition, the nucleic
acid
segments which encodes GFP contains an intron/exon splice site near its 3'
terminus and the nucleic acid segments which contains the ORF of interest also
contains an intron/exon splice site near its 5' terminus. Upon recombination,
the
nucleic acid segment which encodes GFP is positioned 5' to the nucleic acid
segment which encodes the ORF of interest. Further, these two nucleic acid
segments are separated by a recombination site which is flanked by intron/exon
splice sites. Excision of the intervening recombination site thus occurs after
transcription of the fusion mRNA. Thus, in one aspect, the invention is
directed
to methods for removing RNA transcribed from recombination sites from
transcripts generated from nucleic acids described herein.
One method which could be used to introduce intron/exon splice sites into
nucleic acid segments is by the use of PCR. For example, primers could be used
to generate nucleic acid segments corresponding to an ORF of interest and
containing both a recombination site and an intron/exon splice site.
The above methods can also be used to remove RNA corresponding to
recombination sites when the nucleic acid segment which is recombined with
another nucleic acid segment encodes RNA which is not produced in a
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-236-
translatable format. One example of such an instance is where a nucleic acid
segment is inserted into a vector in a manner which results in the production
of
antisense RNA. As discussed below, this antisense RNA may be fused, for
example, with RNA which encodes a ribozyme. Thus, the invention also
provides methods for removing RNA corresponding to recombination sites from
such molecules.
The invention further provides methods for removing amino acid
sequences encoded by recombination sites from protein expression products by
protein splicing. Nucleotide sequences which encode protein splice sites may
be
fully or partially embedded in the recombination sites which encode amino acid
sequences excised from proteins or protein splice sites may be encoded by
adjacent nucleotide sequences. Similarly, one protein splice site may be
encoded
by a recombination site and another protein splice sites may be encoded by
other
nucleotide sequences (e.g., nucleic acid sequences of the vector or a nucleic
acid
of interest).
It has been shown that protein splicing can occur by excision of an intein
from a protein molecule and ligation of flanking segments. (See, e.g.,
Derbyshire
et al., Proc. Natl. Acad Sci. (USA) 95:1356-1357 (1998).) In brief, inteins
are
amino acid segments which are post-translationally excised from proteins by a
self catalytic splicing process. A considerable number of intein consensus
sequences have been identified. (See, e.g., Perler, NucleicAcids Res. 27:346-
347
(1999).)
Similar to intron/exon splicing, N- and C-terminal intein motifs have been
shown to be involved in protein splicing. Thus, the invention further provides
compositions and methods for removing amino acid residues encoded by
recombination sites from protein expression products by protein splicing. In
particular, this aspect of the invention is related to the positioning of
nucleic acid
sequences which encode intein splice sites on both the 5' and 3' end of
recombination sites positioned between two coding regions. Thus, when the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-237-
protein expression product is incubated under suitable conditions, amino acid
residues encoded these recombination sites will be excised.
Protein splicing may be used to remove all or part of the amino acid
sequences encoded by recombination sites. Nucleic acid sequence which encode
inteins may be fully or partially embedded in recombination sites or may adj
acent
to such sites. In certain circumstances, it may be desirable to remove
considerable numbers of amino acid residues beyond the N- and/or C-terminal
ends of amino acid sequences encoded by recombination sites. In such
instances,
intein coding sequence may be located a distance (e.g., 30, 50, 75, 100, etc.
nucleotides) 5' and/or 3' to the recombination site.
While conditions suitable for intein excision will vary with the particular
intein, as well as the protein which contains this intein, Chong et al., Gene
192:271-281 (1997), have demonstrated that a modified Saccharomyces
cerevisiae intein, referred to as Sce VMA intein, can be induced to undergo
self cleavage by a number of agents including 1,4-dithiothreitol (DTT),
(3-mercaptoethanol, and cysteine. For example, intein excision/splicing can be
induced by incubation in the presence of 30 mM DTT, at 4°C for 16
hours.
Example 14: Removal of att Sites from RNA Transcripts by Pre-mRNA
Splicing in Eukaryotic Cells
Consensus RNA sequences in metazoan cells needed for removal of
introns by splicing of pre-mRNA transcripts normally contain the following
three elements:
1). At the 5' end of the intron: exon-AG~GTRAGT-intron; where ~ denotes the
border between the intron and exon, and R = purine nucleotide. This element
is referred to herein as (GT);
2). At the 3' end of the intron: intron-Yn-N-CAG G-exon; where Yn = a
pyrimidine-rich sequence of 10-12 nucleotides. This element is referred to
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-238-
herein as (Yn-AG);
3). At the branch point within the intron, ~20-40 bases 5' to (Yn-AG):
YNRA*Y; where Y is a pyrimidine nucleotide and A* is the branch point
adenosine that participates in the initial transesterification reaction to
form an
RNA lariat. This element is referred to herein as (BP-A*).
Underlined sequences shown above are those highly conserved and are
generally believed to be required for splicing activity; other nucleotides in
the
consensus sequences are less highly conserved.
1. attB Splicing
These splicing elements can be combined with GATEwAYTM att-site-
containing vectors in at least the following three ways to remove attB 1 sites
by
RNA splicing.
Method 1: (GT)---(BP-A*)[attBl](Yn-AG)--ORF
In this method, the (BP-A*) element is located just 5' to the end of attB 1,
and the (Yn-AG) consensus is merged with the 3'-end of the attB 1 sequence,
exploiting the flexibility of the 5 nucleotides flanking the core of the attB
sequence. The (GT) consensus can be positioned conveniently ten or more -
nucleotides upstream from (BP-A*) element.
This arrangement has the advantage that it requires a minimum sequence
addition between the 3' end of the attB 1 site and the sequence encoding the
ORF.
A potential difficulty with the use of this approach is that the pyrimidine-
rich
sequence in (Yn-AG) overlaps with the attB 1 sequence, which is relatively
purine
rich. Thus, in certain instances, sufficient nucleotide changes (to C or T) in
the
attB 1 site to permit efficient splicing may not be compatible with efficient
BxP
recombination.
Sequences positioned S' to the recombination cleavage site within attB 1
are contributed in Expression Clones by the Destination Vector, while
sequences
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-239-
3' to this site are derived (in most cases) from an attB-PCR product. If the
splicing reaction is intended to fuse RNA encoding an N-terminal protein
(contributed by a Destination Vector) to RNA encoding another ORF
(contributed by an Entry Clone), the positioning of (GT) and (Yn-AG) will
generally be positioned so that the spliced product maintains the desired
translational reading frame.
Method 2: (GT)---(BP-A*)[attBl](Yn-AG)--ORF
In this method, the (Yn-AG) consensus is immediately next to the attB 1
site; consequently the branch point A* in (BP-A*) element will generally need
to be close to the attB 1 site. Thus, the distance from AG in (Yn-AG) will
generally be no more than about 40 nucleotides.
The (Yn-AG) sequence can be added as part of a primer adapter, assuming
the Entry Clone is constructed using attB-PCR. Further, this primer can be
designed using a consensus (Yn-AG) sequence which favors efficient splicing.
In some instances, the presence of the attB 1 sequence between (BP-A*) and (Yn-
AG) may interfere with splicing. If such cases, the attB 1 sequence can be
mutated to accommodate a more optimal splicing sequence.
Method 3: (GT)---[attBl]-(BP-A*)---(Yn-AG)--ORF
This method employs an arrangement which allows one to choose an
optimal splicing sequence and spacing for the combined elements comprising
(BP-A*)---(Yn-AG). The minimum size for this combination is expected to be
about 20 nucleotides. Therefore this sequence will normally be added to PCR
products as an attB 1-primer adapter of about 45-50 nucleotides.
Similar considerations apply to designing sequences that allow splicing
to remove the attB2 site from mRNA. But since in this case (BP-A*) and (Yn-
AG) can be contributed by the Destination Vector, the most attractive option
is:
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-240-
ORF-(GT)[attB2]--(BP-A*)--(Yn-AG), where the sequence between (GT)
and attB2 is minimized, to reduce the size of the attB2-PCR adapter primer.
Minimized sequences suitable for use in particular cases can be determined
experimentally using methods described herein.
Another way to produce a vector that splices attB sites is to construct a
vector directly that contains splicing signals flanking the attB 1 and attB2
sites.
The main difference from the approaches described above is that any sequences
added there using attB primer adapters (as in B and C) could be pre-installed
into
the vector itself next to a multiple cloning site positioned between the attB
sites.
2. attL Splicing
The sequences encoding attL 1 and attL2 sites may be removed from
transcripts by RNA splicing. However, the 100 nucleotide length of attL
imposes
a constraint on the options for arranging the splicing sequence elements. This
distance is generally too great for the placement of attLl between (BP-A*) and
(Yn-AG). One alternative which can be employed is that either or both of these
elements can be embedded in a mutated version of attLl. Another approach is
that these elements (i. e., (BP-A*) and (Yn-AG)) can be contributed by an attB-
adapter primer and (GT) can be provided by the attP Donor plasmid. By
recombining these elements in a B x P reaction an entry clone with splice
sites for
splicing attB 1 is created.
Similarly, for splicing of attL2, there is no practical limit to the length of
sequence allowed between (GT) and (BP-A*). So (GT) could be provided on the
attB2 adapter primer, while (BP-A*) and (Yn-AG) would be contributed by the
attP Donor Vector. For such uses, the attP Donor Vector will generally need to
contain a eukaryotic promoter and the rrnB transcription termination sequences
will generally need to be removed. The potential for an adverse effect of the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-241-
attL2 sequence between (GT) and (BP-A*) seems low, but may need to be
determined on a case by case basis.
A potential advantage of splicing attL sequences from Entry Clone
transcripts is that users could clone and express PCR products directly as
Entry
Clones, without need for further subcloning into a Destination Vector.
Further,
the presence of a termination codon in our attL 1 sequence, which appears
difficult to remove without diminishing L x R recombination, would be of no
consequence to translation of ORFs fused with N-terminal peptides.
The above describes some applications of RNA splicing with the
GATEWAYS system, which is to remove attB 1 between ORF and N-terminal
sequences and to remove attB2 sequences between ORF sequences and C-
terminal sequences of protein fusions. Other applications would be apparent to
one skilled in the art. Further, one such application is the use of the RNA
splicing process to remove att sequences interposed (as a result of performing
a
GATEWAYS recombination-based subcloning reaction) between the sequences
encoding multiple protein domains in a eukaryotic expression vector, where the
ORFs encoding the various domains are separated by an att site sequence. Such
vectors can be constructed readily by GATEWAYTM recombination with att sites
of multiple specificities, such as attl, att2, att3, att4, etc. Although this
approach
permits rapid construction of protein fusions, as well as shuffling of DNA
sequences encoding protein domains, the recombination products typically will
contain 25 by attB sites (or 100 by attL sites) intervening between these
domains,
whose removal often will be desirable. The RNA splicing mechanism described
is one way to remove these intervening sequences. The use of splicing to
remove
att sites between multiple protein domains also makes it practical to make
these
constructs using GA'rEwAYTM recombination reactions between attB and attP
sites, which yield attL and attR sites. This is because either type of att
sequence
(attB or attL) could be removed by an RNA splicing reaction in a properly
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-242-
designed vector. In other situations, it will be useful to remove by splicing
attR
and/or attP sites as well.
A second application addresses the common problem of obtaining copies
of large or rare mRNAs. Some mRNAs are difficult to reverse transcribe (into
cDNA) in their entirety due to their large size and/or low abundance. Often,
one
or both ends of the cDNA can be obtained, but the entire sequence as one
molecule is unobtainable. When two or more different portions of the cDNA are
available which together constitute the entire mRNA sequence, the sequence of
these cDNA sequences can be determined and PCR primers synthesized. Then
using attB-primers each non-overlapping portion of the entire transcript can
be
amplified by PCR. These amplified sequences then can be combined in the
proper order using GA'rEwAYTM recombination. Such a recombination product
will comprise the various sequences in their proper order, but separated by
att
sites. Given the appropriate transcription promoter and termination signals,
such
constructs can be used to prepare RNA either in vitro for use in an in vitro
splicing reaction, or to transfect metazoan cells with an appropriate
construct
allowing transcription followed by RNA splicing within the cell. In this
manner,
transcripts of the authentic mRNA can then be produced. Such mRNA transcripts
can be used directly for studies of biological function of the protein encoded
by
the spliced transcript. Alternatively, because the transcripts can be produced
in
abundance with this approach, it becomes more feasible to produce a cDNA copy
of the spliced RNA. This cDNA, which lacks the intervening att sequences, is
useful for producing the encoded protein in cells lacking the proper splicing
machinery, such as E. coli.
A third application of this technology makes it possible to produce
replicas of mRNAs that are difficult to obtain due to their low abundance or
lack
of suitable tissue sources. Most metazoan genes encoding proteins consist of
exons sequences separated by intron sequences. Whenever exon-intron borders
of a gene can be predicted accurately from genomic DNA sequences by
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-243-
bioinformatic algorithms, PCR products flanked by att site sequences can be
synthesized that contain the exon sequences. With proper design of the att
sequences flanking these products, they can be linked each together in the
proper
order, while preserving the correct translational reading frame, using GATEWAY
recombination. By including the appropriate transcription signals, these
constructs can serve as templates to synthesize an RNA transcript containing
the
ordered exon sequences, each separated by an att sequence. Given that the
appropriate splicing signals are included in these constructs, the transcripts
produced will be processed by the splicing reactions of metazoan cells to
yield
nucleic acids which correspond to naturally produced mRNA sequences. In this
manner one can eliminate the need first to isolate mRNA from cells. Further,
cells producing such mRNA from splicing of transcripts made as described above
can be used directly for studies of biological function or as a source of a
desired
mRNA to produce its cDNA. Alternatively, these constructs could be spliced in
vitro using properly constituted splicing extracts.
Example I S: Determination of Gene Expression Profiles of Cells
The invention further provides compositions and methods for cloning and
sequencing multiple cDNA molecules. In general, these methods involve
generating concatamers of cDNA molecules and performing sequencing reactions
on these molecule to determine the nucleotide sequences of the individual
inserts.
Such methods are particularly useful for determining the gene expression
profile
of particular cells and/or tissues. One example of such a method,.as well as a
vector produced by the described method, are shown in Figure 23.
The vector shown in Figure 23 contains a series of relatively short cDNA
inserts (e.g.,10,15, 20, 25, 30, 45, or 50 nucleotides in length) connected to
each
other by attB sites. The vector shown in Figure 23 also contains sequencing
primer sites adjacent to each side of the cDNA insertion site.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-244-
Nucleic acid molecules which represent genes expressed in a cell or tissue
may be broken into relatively small fragments in a number of ways, including
mechanical shearing, digestion with one or a combination of restriction
enzymes
(e.g., NIaIII, Sau3A, etc.), or digestion with an endonuclease having little
or no
sequence specificity (e.g., Micrococcal nuclease, DNAseI, etc.). The
conditions
will generally be adjusted so that nucleic acid fragments of a specific
average size
are produced. Further, if desired, nucleic acid fragments of a particular size
can
be isolated before insertion into a vector. Methods of separating nucleic acid
molecules based on size are known in the art and include the column
chromatography and gel electrophoresis (e.g., agarose and polyacrylamide gel
electrophoresis).
Nucleotide sequence data may be obtained by sequencing nucleic acids
connected by methods of the invention and inserted in a sequencing vector
using
standard methods known in the art. In most instances, neither the 5' to 3'
orientation of the nucleic acid inserts in the sequencing vector nor the
strand
which is sequenced will not be relevant for determining the gene expression
profile of a cell or tissue. This is so because it will generally be possible
to
identity of the mRNA from which the sequenced nucleic acid was derived
regardless of the orientation of the sequenced nucleic acid segment or strand
which is sequenced.
Thus, the invention provides methods for determining the gene expression
profile of cells and/or tissues. In one aspect, the invention provides methods
for
determining the gene expression profile of cells and/or tissues, comprising
(a) generating one or more populations of cDNA molecules from RNA obtained
from the cells and/or tissues, wherein the individual cDNA molecules of these
populations comprise at least two recombination sites capable of recombining
with at least one recombination site present on the individual members of the
same or a different population of cDNA molecules, (b) contacting the nucleic
acid molecules of (a) with one or more recombination proteins under conditions
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-245-
which cause the nucleic acid molecules to join, and (c) determining the
sequence
of the joined nucleic acid molecules.
Example 16: Use of GATEWAYTM System to Clone the Tet and LacZ Genes
The following attB sites was added to PCR primers which were
synthesized by standard methods. The attB 1 and attB2 sites were shown as the
standard GATEWAYTM reading frame (see GATEWAYS GATEWAYTM Cloning
Technology Instruction Manual (Invitrogen Corp., Life Technologies Division))
and is indicated below. The reading frame of attBS may be altered as
appropriate. The selection of a reading frame can be used to generate fusion
proteins.
attBl (5' -end of fragment A)
GGGG ID NO:110)
ACA
ACT
TTG
TAC
AAA
AAA
GTT
GNN
(SEQ
attb5 (3'-end of fragment A):
GGGG CAA CTT TGT ATA ATA AAG TTG (SEQ NO:111)
A ID
attBSR (5' -end of fragment B)
GGGG CAA CTT TAT TAT ACA AAG TTG (SEQ N0:112)
A ID
attb2 (3' -end of fragment B)
GGG AAC TTT GTA TAATAA AGT TGN (SEQ N0:113)
AC ID
Nucleic acid fragments encoding the tet gene (primed with 5'-attB 1 and
3'-attBS) and the IacZ gene (primed with 5'-attBSR and 3'-attB2) were
amplified
by PCR and precipitated using polyethylene glycol as follows. 150 ~1 of TE is
added to a SO ~l PCR reaction, followed by the addition of 100 ~1 of 30%
PEG8000, 30mM MgClz. The solution is then mixed an centrifuged at about
10,000 x g at room temperature for 15 minutes. The PEG solution is then
removed and the pellet id dissolved in TE.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-246-
The B1-tet-BS PCR product was mixed with an attPl-ccdB-attPS donor
vector (pDONR-P1/PS) and reacted with BP CLONASET''~ using a standard
protocol (see Example 3 herein) to generate an attLl-tet-attLS entry clone.
The
BSR-lacZ-B2 PCR product was mixed with an attPSR-ccdB-attP2 donor vector
(pDONR-PSR/P2) and reacted With BP CLONASE~ to generate an attRS-lacZ-
attL2 entry clone.
After incubation for 1-4 hours at 25°C, 2 ~1 of Proteinase K (2
mg/ml)
was added stop the BP reactions. DHSa cells were then transformed with the LR
vectors (i.e., entry clones) and plated on LB-Kan plates. The plates were
incubated overnight at 25°C. Miniprep DNA was prepared from individual
DHSa colonies and quantitated by agarose gel electrophoresis.
An LR CLONASETM reaction was prepared in a reaction volume of 20 ~1
containing the following components:
60 ng (25 fmoles) of the supercoiled tet entry clone
75 ng (20 fmoles) of the supercoiled lacZ entry clone
150 ng (35 fmoles) ofpDEST6 (described in PCT Publication WO 00/52027,
the entire disclosure of which is incorporated herein by reference) linearized
with NcoI
4 ~l of LR4 reaction buffer
4 w1 Of LR CLONASE~
The reaction was incubated at 25°C overnight and stopped with 2 ~1
of
proteinase K solution (2 mg/ml). 2 ~l was used to transform 100 ~1 of LE DHSa
cells and plated on LBamp plates containing XGaI. Approximately 35,000
colonies were generated in the transformation mixture with cells at an
efficiency
of 1.6 x 10g cfu/~g of pUC DNA. All the colonies appeared blue indicating the
presence of the lacZ gene. 24 colonies were streaked onto plates containing
tetracycline and XGaI. 24 out of 24 colonies were tetracycline resistant. 15
colonies were used to inoculate 2 ml of LB amp broth for mini preps. 15/15
minipreps contained a supercoiled plasmid of the correct size (8.8 kb). Three
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-247-
miniprep DNAs were digested with EcoRV . A banding pattern was observed that
was consistent with the two fragments cloned in the correct orientation.
The resulting nucleic acid product consists of the two fragments linked
together and cloned into the destination vector. The structure of these two
fragments, as the are inserted into the destination vector, is as follows
(arrows
indicate the orientation of attB sites with respect to the overlap sequence):
attB 1-~tetfattB 5-lacZ~attB2
Example 17: Use of GATEWAYT'H System to Clone the Tet, LacZ and Neo
Genes
The following attB sites are added to PCR primers which are synthesized
by standard methods. The attB 1 and attB2 sites are shown as the standard
GATEWAYTM reading frame (see GATEWAYTT'' GATEWAYTM Cloning Technology
Instruction Manual (Invitrogen Corp., Life Technologies Division) and is
indicated below. The reading frame of attBS and attB21 may be specified by the
user.
attB 1 (S'-end of fragment A):
GGGG ACA ACT TTG TAC AAA AAA GTT GNN (SEQ ID N0:114)
attBS (3'-end of fragment A)
GGGG A CAA CTT TGT ATA ATA AAG TTG (SEQ ID NO:111)
attBS (3'-end of fragment A)
GGGG A CAA CTT TGT ATA ATA AAG TTG (SEQ ID NO:111)
attBSR (5'-end of fragment B):
GGGG A CAA CTT TAT TAT ACA AAG TTG (SEQ ID N0:112)
attB21 R (3'-end of fragment B):
GGG A CAA CTT TTT AAT ACA AAG TTG (SEQ ID NO:115)
attB21 (5'-end of fragment C):
GGGG A CAA CTT TGT ATT AAA AAG TTG (SEQ ID N0:116)
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-248-
attB2 (3'-end of fragment C):
GGGG AC AAC TTT GTA TAA TAA AGT TGN (SEQ ID N0:117)
Nucleic acid fragments encoding the tet gene (primed with 5'-attB 1 and
3'-attBS), the Neo gene (primed with S'-attBSR and 3'-attB2lR), and the IacZ
gene (primed with 5'-attB21 and 3'-attB2) were amplified by PCR and
precipitated using polyethylene glycol.
The B1-tet-BS PCR product was mixed with an attPl-ccdB-attPS donor
vector (pDONR-P1/PS) and reacted with BP CLONASETM using a standard
protocol to generate an attLl-tet-attL3 entry clone. The BSR-Neo-B21R PCR
product was mixed with an attPSR-ccdB-attP2lR donor vector (pDONR-
PSR/P21 R) and reacted Wlth BP CLONASE~ to generate an attRS-Neo-attR21
entry clone. The B21-lacZ-B2 PCR product was mixed with an attP21-ccdB-
attP2 donor vector (pDONR-P21 /P2) and reacted with BP CLONASE~ to generate
an attL21-lacZ-attL2 entry clone.
1$ An LR CLOrrasET"'' reaction was prepared in a reaction volume of 20 ~1
containing the following components:
40 ng (17 fmoles) of the supercoiled tet entry clone
50 ng (19 fmoles) of the supercoiled or linear (VSpI digested) Neo entry clone
75 ng (20 fmoles) of the supercoiled lacZ entry clone
150 ng (35 fmoles) of pDEST6 linearized with NcoI
4 ~1 of LR4 reaction buffer (200 mM Tris HCl (pH7.5), 4.75 mM EDTA, 4.8
mg/ml BSA, 445 mM NaCI, 47.5 mM spermidine)
4 ~1 of LR CLONASETM
The reaction was incubated at 25 ° C overnight and stopped with 2
~.1 of
proteinase K solution (2 mg/ml). Two ~1 was used to transform 100 ~1 of DHSa
LE cells and plated on LBamp plates containing XGaI. Approximately 3,200
colonies were generated in the transformation mixture with supercoiled entry
clones. 5,300 colonies were generated in the transformation mixture with the
reaction containing the YspI digested Neo entry clone. The efficiency of the
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-249-
competent cells was 1.2 x 10g cfu/~g of pUC DNA. All the colonies appeared
blue indicating the presence of the IacZ gene. Nine colonies were streaked
onto
tet plates containing XGaI. Nine out of 9 colonies were tetracycline
resistant.
Nine colonies were used to inoculate 2 ml of LBamp broth for mini preps. Nine
out of 9 minipreps contained a supercoiled plasmid of the correct size (11
kb).
Nine miniprep DNAs were digested with EcoRV. A banding pattern was
observed that was consistent with the three fragments cloned in the correct
orientation.
The resulting nucleic acid product consists of the three fragments linked
together and cloned into the destination vector. The structure of these three
fragments, as the are inserted into the destination vector, is as follows
(arrows
indicate the orientation of attB sites with respect to the overlap sequence):
attB 1-~tett-attBS-Neo-attB21-llacZE-attB2
Example 18: Use of the GATEwAYT"' and Multiple att Sites with Different
Specificities to Clone a Lux Operon
The lux operon genes (IuxA, IuxB, luxC, luxD and IuxE) of Vibrio
fischeria genomic DNA were amplified using the primers listed immediately
below that introduced an optimal Shine-Delgarno and Kozak sequence
(ggaggtatataccatg (SEQ ID NO:118)) at the 5'-end and a T7 promoter and stop
codon (gaagctatagtgagtcgtatta) at the 3'-end of each ORF.
Table 10. SD 5' and T7 3' lux primers.
SD 5'luxA ggaggtatataccatgAAGTTTGGAAATATTTGTTTTTC (SEQ
ID N0:119)
T7 3'luxA gaagctatagtgagtcgtattaTTTAGGTTCTTTTAAGAAAG
GAGCGAC (SEQ ID N0:120)
SD 5'luxB ggaggtatataccatgAAATTTGGATTATTTTTTCTAAAC
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-250-
(SEQ ID N0:121)
T7 3'luxB gaagctatagtgagtcgtattaTGGTAAATTCATTTCGATTT
TTTGG (SEQ ID N0:122)
SD 5'luxC ggaggtatataccatgAATAAATGTATTCCAATGATAATTAA
TGG (SEQ ID N0:123)
T7 3'luxC gaagctatagtgagtcgtattaTGGGACAAAAACTAAAAACT
TATCTTCC (SEQ ID N0:124)
SD 5'luxD ggaggtatataccatgAAAGATGAAAGTGCTTTTTTTACGATTG
(SEQ ID N0:125)
T7 3'luxD gaagctatagtgagtcgtattaAGCCAATTCTAATAATTCAT
TTTC (SEQ ID N0:126)
SD 5'luxE ggaggtatataccatgACTGTCCATACTGAATATAAAAGAAATC
(SEQ ID N0:127)
T7 3'luxE gaagctatagtgagtcgtattaAATCCTTGATATTCTTTTGT
ATGACATTAGC (SEQ ID N0:128)
The PCR products were further amplified with attB-SD and attB-T7
adapter primers listed immediately below utilizing the Shine-Delgarno and T7
promoter sequences as primer sites to add attB sites to the ends of the PCR
products.
Table 11. attB SD and T7 adapter primers.
B1.6 SD GGGGACAACTTTGTACAAAAAAGTTGAAggaggtatataccatg
(SEQ ID N0:129)
B5 T7 GGGGACAACTTTGTATAATAAAGTTGgaagctatagtgagtcgt
(SEQ ID N0:130)
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-251-
B5R SD GGGGACAACTTTATTATACAAAGTTGAAggaggtatataccatg
(SEQ ID N0:131 )
B11 T7 GGGGACAACTTTGTATAGAAAAGTTGgaagctatagtgagtcgt
(SEQ ID N0:132)
B11R SD GGGGACAACTTTTCTATACAAAGTTGAAggaggtatataccatg
(SEQ ID N0:133)
B17 T7 GGGGACAACTTTGTATACAAAAGTTGgaagctatagtgagtcgt
(SEQ ID N0:134)
B17R SD GGGGACAACTTTTGTATACAAAGTTGAAggaggtatataccatg
(SEQ ID N0:135)
B21 T7 GGGGACAACTTTGTATTAAAAAGTTGgaagctatagtgagtcgt
(SEQ ID N0:136)
B21R SD GGGGACAACTTTTTAATACAAAGTTGAAggaggtatataccatg
(SEQ ID N0:137)
B2.10 T7 GGGGACAACTTTGTACAAGAAAGTTGgaagctatagtgagtcgt
(SEQ ID N0:138)
In this way the following attB PCR products were generated:
attB 1.6-SD-IuxC-T7-attBS
attBSR-SD-luxD-T7-attB 11
attB 11 R-SD-luxA-T7-attB 17
attB 17R-SD-luxB-T7-attB21
attB21 R-SD-luxE-T7-attB2.10
Each attB PCR product was precipitated with polyethylene glycol and
reacted with the appropriate attP plasmid to generate Entry Clones of each lux
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-252-
ORF.
Table 12. BP Reaction Setup
1 2 3 4 5 6 7 8 9 10
TE 7~1 7g1 7g1 7g17~1 7P17~1 7g17~1 7~1
attBl-IuxC-attBS2 2
~1 ~I
(10 ng/~1)
attPl-attPS 2 2
~.1 ~1
(150 ng/gl)
attBSR-luxD-attBll 2 2
~I g1
(10 ng/~1)
attPSR-attPl 2 2
l ~l g1
(150 ng/~.1)
attBllR-IuxA-attBl7 2 2
ltl g1
(10 ng/~1)
attPl7R-attPl7 2 2
~1 ~1
(150 ng/~I)
attB 17R-ZuxB-attB21 2 2
~1 ~1
(10 ng/gl)
attPl7R-attP21 2 2
~1 ~1
(150 ng/ltl)
attB2lR-luxE-attB2 2 2
g1 ~1
(10 ng/~1)
attP21 R-attP2 2 2
g ~
l 1
(150 ng/gl)
BP Buffer 4 4 4 4 4 4 4 4 4 4
~1 ~1 ~1 ~1 ~1 ~1 ~1 ~1 ~1 g1
BP Clonase Storage4 --- 4 ---4 ---4 ---4 ---
~1 ~.1 g1 ~1 ~1
Buffer
~BP Clonase --- 4 --- 4 --- 4 --- 4 --- 4
g1 g1 ~1 g1 ~l
The reactions were incubated at 25°C overnight. Each reaction was
stopped by the addition of 2 ~l of Proteinase K (2 mg/ml) solution and
incubated
10 minutes at 37 °C. Two ~1 of each reaction was used to transform
LEDHSa
cells. One hundred ~1 ( 1 / 10) of each transformation was plated on LB agar
containing 50 ~g/ml kanamycin. The appropriate pENTR-lux clone was isolated
from each reaction as determined by rapid miniprep analysis.
The luxA Entry Clone (pENTR-luxA) was digested with VspI to linearize
the plasmid in the plasmid backbone. Equal amounts (40 ng) of each of the five
lux Entry Clones were mixed with 150 ng of pDESTI4 in a single LR reaction
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-253-
containing LR4 buffer and LR Clonase. Negative control reactions were prepared
consisting of a no Clonase reaction and a no pENTRIuxA reaction.
TahlP 1'~ T.R Reaction Setuu
1 2 3
TE ___ 4 ~1 __-
pENTRIuxC (20 ng/~1) 4 ~1 4 ~1 4 ~1
pENTRIuxD (20 ng/~1) 4 ~1 4 ~1 4 ~.1
pENTRIuxA/VspI cut (20 4 ~.1 --- 4 ~1
ng/~1)
pENTRIuxB (20 ng/~1) 4 ~1 4 ~1 4 ~l
pENTRIuxE (20 ng/wl) 4 ~1 4 ~1 4 ~1
pDESTI4/NcoI (150 ng/~1)1 ~1 1 ~.1 1 w1
LR4 Buffer 8 ~1 8 ~1 8 ~1
LR Clonase Storage Buffer8 ~.1 --- ---
LR Clonase --- 8 w1 8 ~l
The reactions were incubated at 25°C overnight. Each reaction was
stopped by the addition of 4 ~1 Proteinase K (2 mg/ml) solution and incubated
for
10 minutes at 37°C. Two ~1 of each reaction was used to transform
LEDHSa
cells. One hundred ~1 (1/10) of each transformation was plated on LB agar
containing 100 ~g/ml ampicillin.
The transformations generated no colonies for reaction 1 (no clonase),
approximately 200 colonies for reaction 2 (no pENTRIuxA DNA) and
approximately 2500 colonies for reaction 3 (complete reaction). Ten colonies
were picked from reaction 3 and examined by miniprep analysis. All 10 clones
were determined to be correct based on size of the supercoiled plasmid DNA
(10.3 kb) and by diagnostic restriction digests. The synthetic lux operon
construct was transformed into BL21 SI cells and luciferase activity was
monitored by luminometry. Four independent isolates were demonstrated to
generate titratable salt-inducible light in BL21 SI cells. No light was
detected in
BL21 SI cells containing pUC DNA. Since the light output was generated and
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-254-
detected in live E. coli cells the functional activity of all five lux genes
was
confirmed.
Examplel9: Generation of pDONR Vectors.
As in the example above (lux operon cloning), a collection of vector
element Entry Clones was generated by attB PCR cloning. The Entry Clones
were designed such that when a set of 4 vector element Entry Clones are
reacted
together, each vector element is linked together to assemble a new vector
(Figure
26A-26B). In this example two new attP DONOR vectors were constructed.
The following set of attB PCR products was generated:
attB21 R-attP 1-ccdB-cat-attP2-attBS
attBSR-kan-attB 11
attBSR-amp-attB 11
attB 11 R-loxP-attB 17
attB 17R-pUC ori-attB21
Each attB PCR product was purified by PEG precipitation and reacted
with the appropriate attP plasmid to generate Entry Clones of each vector
element
as follows:
Table 14. BP Reaction Setup
1 2 3 4 5 6 7 8 9 10
TE 7 7 7 7 7 7 7 7 7 7
g1 ~1 ~1 ~l ~1 ~1 ~1 ~1 w1 ~1
attB2lR-attPl-ccdB-2 2
g1 g1
cat-attP2-attBS
(10
ng/~l)
attP2lR-attPS 2 2
(150 g1 g1
ng/~I)
attBSR-kan-attBll 2 2
(10 g1 ~l
ng/~1)
attPSR-attPl 2 2
l (150 g1 p1
~ nt~wl)
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-255-
attBSR-amp-attBl 2 2
l (10 ~1 ~1
ng/p l)
attPSR-attPll 2 2
(150 ~l ~1
ng/~1)
attB 11 R-loxP-attB 2 2
17 ~ ~1
1
(10 ng/~1)
attP 11 R-attP 2 2
17 ( 150 ~tlp
l
ng/pl)
attBl7R-pUC ori- 2 2
p1 ~l
attB21 (10 ng/pl)
attP 17R-attP21 2 2
( 150 ~.l ~l
ng/~1)
BP Buffer 4 4 4 4 4 4 4 4 4 4
~1 ~1 w1 ~,l ~1 ~1 p1 ~1 p1 ~l
BP Clonase Storage4 -- 4 --- 4 -- 4 --- 4 ---
~1 p1 ~1 p1 ~1
Buffer
RP Clonase --- 4 -- 4 ---4 ---~ ~ ~
~l ~1 ~1 4 --- 4
p1 w1
The reactions were incubated at 25°C overnight. Each reaction was
stopped by the addition of 2 ~,1 of Proteinase K (2 mg/ml) solution and
incubated
10 minutes at 37 °C. Two ~l of each reaction was used to transform
LEDHSa
cells. 100 w1 (1/10) of each transformation was plated on LB agar containing
50
pg/ml kanamycin. Colonies were picked and used to isolate the following
pENTR clones by rapid miniprep analysis:
pENTR-attR21-attPl-ccdB-cat-attP2-attLS (isolated from reaction 2)
pENTR-attRS-kan-attLl l (isolated from reaction 4)
pENTR-attRS-amp-attLl l (isolated from reaction 6)
pENTR-attRl l-IoxP-attLl7 (isolated from reaction 8)
pENTR-attRl7-ori-attL211 (from reaction 10)
The attR21-attPl-ccdB-cat-attP2-attLS Entry Clone was digested with
YspI to linearize the plasmid in the plasmid backbone. Equal amounts (40 ng)
of
each of four Entry Clones were mixed in a single LR reaction containing LR4
buffer and LR Clonase. Negative control reactions were prepared consisting of
a no Clonase reaction and reactions containing no pENTR-attR21-attPl-ccdB-
cat-attP2-attLS DNA.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-256-
Table 15. LR Reaction Setup
1 2 3 4
TE --- 4 -- ---
~
1
pENTR-attR21-attP1-ccdB-cat-attP2-attLS4 ~l --- 4 4
VspI ~1 ~,1
cut (20 ng/pl)
pENTR-attRS-kan-attLll (20 ng/~1) 4 p1 4 4 ---
p1 p1
pENTR-attRS-amp-attLll (20 ng/~1) --- --- -- 4
p1
pENTR-attRl l-loxP-attLl7 (20 ng/~1)4 p1 4 4 4
p1 ~l p1
pENTR-attRl7-ori-attL211 (20 ng/pl)4 ~,1 4 4 4
~l p1 p1
LR4 Buffer 8 ~,1 8 8 8
~,1 ~,1 ~1
LR Clonase Storage Buffer 8 ~1 --- -- ---
LR Clonase --- 8 8 8
~ ~.1 ~~
1
The reactions were incubated at 25 °C overnight. Four ~,1 of
proteinase
K (2 mg/ml) solution was added to each reaction and 2 ~1 used to transform
DB3.1 cells. One hundred ~1 (1/10) of the transformation was plated on LB agar
containing 20 pg/ml chloramphenicol and SO pg/ml kanamycin (reactions 1, 2
and 3) or 20 ~g/ml chloramphenicol and 100 ~g/ml ampicillin (reaction 4).
The transformations generated approximately 5000 and 10,000 colonies
for reactions 3 and 4, respectively compared to the negative controls of
approximately 500 colonies for reaction 1 (no clonase) and 80 colonies for
reaction 2 (no pENTR-attR21-attPl-ccdB-cat-attP2-attLS DNA). Six colonies
were picked from both reactions 3 and 4 and examined by miniprep analysis. All
of the clones were determined to be correct based on size of the supercoiled
plasmid DNA and by diagnostic restriction digests. The assembled vectors were
shown to be functional by testing their ability to clone attB PCR products.
Example 20: Construction of attP DONOR plasmids for Multisite Gateway
Four attP DONOR plasmids were constructed which contain the
following arrangements of attP sites (Figure 26A):
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-257-
attPx~ccdB-cat~attPy
attPx~ccdB-cat~attPy
attPx~ccdB-cat~attPy
attPx~ccdB-cat~attPy
The plasmids were constructed by PCR amplification of attP sites and
attP DONOR vectors using primers containing compatible restriction
endonuclease sites. Each PCR product was digested with the appropriate
restriction enzyme. The digested attP DONOR vector PCR products were
dephosphorylated and ligated to the digested attP sites. The products of the
ligations consisted of plasmids containing of attP sites cloned into the
pDONOR
vector in both orientations.
The attP plasmids described above were subsequently used as templates
for PCR reactions (Figure 26B). PCR was performed using primers that would
anneal specifically to the core of an attP site and thus create an attL or
attR site
of any desired specificity at the ends of the PCR products (see the primers
used
in the methods of Example 9). For each new attP DONOR vector two such PCR
products were generated, one consisting of the plasmid backbone (ori-kan) and
a second consisting of the ccdB and cat genes. The PCR products were generated
and reacted together in LR Clonase reactions to generate new plasmids
containing
attP sites of any orientation and specificity.
All publications, patents and patent applications mentioned in this
specification are indicative of the level of skill of those skilled in the art
to which
this invention pertains, and are herein incorporated by reference to the same
extent as if each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by reference.
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-1-
SEQUENCE LISTING
<110> Cheo, David
Brasch, Michael A.
Temple, Gary F.
Hartley, James L.
Byrd, Devon R.N.
<120> Use of Multiple Recombination Sites with Unique Specificity in
Recombinational Cloning
<130> 0942.501PC02
<140> To Be Assigned
<141> 2000-12-11
<150> US 60/169,983
<151> 1999-12-10
<150> US 60/188,020
<151> 2000-03-09
<160> 140
<170> PatentIn version 3.0
<210> 1
<211> 27
<212> DNA
<213> attBO
<400> 1
agcctgcttt tttatactaa cttgagc 27
<210> 2
<211> 27
<212> DNA
<213> attPO
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-2-
<400> 2
gttcagcttt tttatactaa gttggca 27
<210> 3
<211> 27
<212> DNA
<213> attLO
<400> 3
agcctgcttt tttatactaa gttggca 27
<210> 4
<211> 27
<212> DNA
<213> attRO
<400> 4
gttcagcttt tttatactaa cttgagc 27
<210> 5
<211> 25
<212> DNA
<213> attB1
<400> 5
agcctgcttt tttgtacaaa cttgt 25
<210> 6
<211> 27
<212> DNA
<213> attP1
<400> 6
gttcagcttt tttgtacaaa gttggca 27
<210> 7
<211> 27
<212> DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-3-
<213> attL1
<400> 7
agcctgcttt tttgtacaaa gttggca 27
<210> 8
<211> 25
<212> DNA
<213> attR1
<400> 8
gttcagcttt tttgtacaaa cttgt 25
<210> 9
<211> 25
<212> DNA
<213> attB2
<400> 9
acccagcttt cttgtacaaa gtggt 25
<210> 10
<211> 27
<212> DNA
<213> attP2
<400> 10
gttcagcttt cttgtacaaa gttggca 27
<210> 11
<211> 27
<212> DNA
<213> attL2
<400> 11
acccagcttt cttgtacaaa gttggca 27
<210> 12
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-4-
<211> 25
<212> DNA
<213> attR2
<400> 12
gttcagcttt cttgtacaaa gtggt 25
<210> 13
<211> 22
<212> DNA
<213> attB5
<400> 13
caactttatt atacaaagtt gt 22
<210> 14
<211> 27
<212> DNA
<213> attP5
<400> 14
gttcaacttt attatacaaa gttggca 27
<210> 15
<211> 24
<212> DNA
<213> attL5
<400> 15
caactttatt atacaaagtt ggca 24
<210> 16
<211> 25
<212> DNA
<213> attR5
<400> 16
gttcaacttt attatacaaa gttgt 25
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-5-
<210> 17
<211> 22
<212> DNA
<213> attBll
<400> 17
caacttttct atacaaagtt gt 22
<210> 18
<211> 27
<212> DNA
<213> attPll
<400> 18
gttcaacttt tctatacaaa gttggca 27
<210> 19
<211> 24
<212> DNA
<213> attLll
<400> 19
caacttttct atacaaagtt ggca 24
<210> 20
<211> 25
<212> DNA
<213> attRll
<400> 20
gttcaacttt tctatacaaa gttgt 25
<210> 21
<211> 22
<212> DNA
<213> attBl7
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-6-
<400> 21
caacttttgt atacaaagtt gt 22
<210> 22
<211> 27
<212> DNA
<213> attPl7
<400> 22
gttcaacttt tgtatacaaa gttggca 27
<210> 23
<211> 24
<212> DNA
<213> attLl7
<400> 23
caacttttgt atacaaagtt ggca 24
<210>24
<211>25
<212>DNA
<213>attRl7
<400> 24
gttcaacttt tgtatacaaa gttgt 25
<210> 25
<211> 22
<212> DNA
<213> attBl9
<400> 25
caactttttc gtacaaagtt gt 22
<210> 26
<211> 27
<212> DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
<213> attPl9
<400> 26
gttcaacttt ttcgtacaaa gttggca 27
<210> 27
<211> 24
<212> DNA
<213> attLl9
<400> 27
caactttttc gtacaaagtt ggca 24
<210> 28
<211> 25
<212> DNA
<213> attRl9
<400> 28
gttcaacttt ttcgtacaaa gttgt 25
<210> 29
<211> 22
<212> DNA
<213> attB20
<400> 29
caactttttg gtacaaagtt gt
22
<210> 30
<211> 27
<212> DNA
<213> attP20
<400> 30
gttcaacttt ttggtacaaa gttggca 27
<210> 31
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
_g_
<211> 24
<212> DNA
<213> attL20
<400> 31
caactttttg gtacaaagtt ggca 24
<210> 32
<211> 25
<212> DNA
<213> attR20
<400> 32
gttcaacttt ttggtacaaa gttgt 25
<210> 33
<211> 22
<212> DNA
<213> attB21
<400> 33
caacttttta atacaaagtt gt 22
<210> 34
<211> 27
<212> DNA
<213> attP21
<400> 34
gttcaacttt ttaatacaaa gttggca 27
<210> 35
<211> 24
<212> DNA
<213> attL21
<400> 35
caacttttta atacaaagtt ggca 24
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-9-
<210> 36
<211> 25
<212> DNA
<213> attR21
<400> 36
gttcaacttt ttaatacaaa gttgt 25
<210> 37
<211> 15
<212> DNA
<213> 15 by Core Region
<400> 37
gcttttttat actaa 15
<210> 38
<211> 21
<212> DNA
<213> Reference Sequence
<400> 38
caactttttt atacaaagtt g 21
<210> 39
<211> 21
<212> DNA
<213> att system core integrase binding site
<220>
<221> misc feature
<222> (8)..()
<223> n is any nucleotide
<220>
<221> misc feature
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-10-
<222> (9)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (10)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (11)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (12)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (13)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (14)..()
<223> n is any nucleotide
<400> 39
caactttnnn nnnnaaagtt g 21
<210> 40
<211> 17
<212> DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-11-
<213> attB altered site
<220>
<221> misc feature
<222> (8)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (9)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (10)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (11)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (12)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (13)..()
<223> n is any nucleotide
<220>
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-12-
<221> misc feature
<222> (14)..()
<223> n is any nucleotide
<400> 40
caactttnnn nnnnaaa 17
<210> 41
<211> 48
<212> DNA
<213> attL1 PCR Primer
<400> 41
ggggagcctg cttttttgta caaagttggc attataaaaa agcattgc 48
<210> 42
<211> 48
<212> DNA
<213> attL2 PCR Primer
<400> 42
ggggagcctg ctttcttgta caaagttggc attataaaaa agcattgc 48
<210> 43
<211> 22
<212> DNA
<213> attL right PCR Primer
<400> 43
tgttgccggg aagctagagt as 22
<210> 44
<211> 43
<212> DNA
<213> attR1 PCR Primer
<400> 44
ggggacaagt ttgtacaaaa aagctgaacg agaaacgtaa aat 43
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-13-
<210> 45
<211> 43
<212> DNA
<213> attR2 PCR Primer
<400> 45
ggggacaagt ttgtacaaga aagctgaacg agaaacgtaa aat 43
<210> 46
<211> 22
<212> DNA
<213> attR right PCR Primer
<400> 46
cagacggcat gatgaacctg as 22
<210> 47
<211> 29
<212> DNA
<213> attB1 / B1-Hgb
<400> 47
ggggacaagt ttgtacaaaa aagcaggct 29
<210> 48
<211> 29
<212> DNA
<213> attB2 / B2-Hgb
<400> 48
ggggaccact ttgtacaaga aagctgggt 29
<210> 49
<211> 18
<212> DNA
<213> 18B1-Hgb
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-14-
<400> 49
tgtacaaaaa agcaggct 18
<210> 50
<211> 18
<212> DNA
<213> 18B2-Hgb
<400> 50
tgtacaagaa agctgggt 18
<210> 51
<211> 15
<212> DNA
<213> 15B1-Hgb
<400> 51
acaaaaaagc aggct 15
<210> 52
<211> 15
<212> DNA
<213> 15B2-Hgb
<400> 52
acaagaaagc tgggt 15
<210> 53
<211> 12
<212> DNA
<213> 12B1-Hgb
<400> 53
aaaaagcagg ct 12
<210> 54
<211> 12
<212> DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-15-
<213> 12B2-Hgb
<400> 54
agaaagctgg gt 12
<210> 55
<211> 11
<212> DNA
<213> 11B1-Hgb
<400> 55
aaaagcaggc t 11
<210> 56
<211> 11
<212> DNA
<213> 11B2-Hgb
<400> 56
gaaagctggg t 11
<210> 57
<211> 10
<212> DNA
<213> 10B1-Hgb
<400> 57
aaagcaggct 10
<210> 58
<211> 10
<212> DNA
<213> 10B2-Hgb
<400> 58
aaagctgggt 10
<210> 59
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-16-
<211> 22
<212> DNA
<213> 5'-Hgb
<400> 59
gtcactagcc tgtggagcaa ga 22
<210>60
<211>22
<212>DNA
<213>3'-Hgb
<400> 60
aggatggcag agggagacga ca 22
<210>61
<211>48
<212>DNA
<213>PCR Primer attLO
<400> 61
ggggagcctg cttttttata ctaagttggc attataaaaa agcattgc 48
<210> 62
<211> 48
<212> DNA
<213> PCR Primer attLTlA
<400> 62
ggggagcctg ctttattata ctaagttggc attataaaaa agcattgc 48
<210> 63
<211> 48
<212> DNA
<213> PCR Primer attLTlC
<400> 63
ggggagcctg ctttcttata ctaagttggc attataaaaa agcattgc 48
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-17-
<210> 64
<211> 48
<212> DNA
<213> PCR Primer attLTlG
<400> 64
ggggagcctg ctttgttata ctaagttggc attataaaaa agcattgc 48
<210> 65
<211> 48
<212> DNA
<213> PCR Primer attLT2A
<400> 65
ggggagcctg cttttatata ctaagttggc attataaaaa agcattgc 48
<210> 66
<211> 48
<212> DNA
<213> PCR Primer attLT2C
<400> 66
ggggagcctg cttttctata ctaagttggc attataaaaa agcattgc 48
<210> 67
<211> 48
<212> DNA
<213> PCR Primer attLT2G
<400> 67
ggggagcctg cttttgtata ctaagttggc attataaaaa agcattgc 48
<210> 68
<211> 48
<212> DNA
<213> PCR Primer attLT3A
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-18-
<400> 68
ggggagcctg ctttttaata ctaagttggc attataaaaa agcattgc 48
<210> 69
<211> 48
<212> DNA
<213> PCR Primer attLT3C
<400> 69
ggggagcctg ctttttcata ctaagttggc attataaaaa agcattgc 48
<210> 70
<211> 48
<212> DNA
<213> PCR Primer attLT3G
<400> 70
ggggagcctg ctttttgata ctaagttggc attataaaaa agcattgc 48
<210> 71
<211> 48
<212> DNA
<213> PCR Primer attLA4C
<400> 71
ggggagcctg cttttttcta ctaagttggc attataaaaa agcattgc 48
<210> 72
<211> 48
<212> DNA
<213> PCR Primer attLA4G
<400> 72
ggggagcctg cttttttgta ctaagttggc attataaaaa agcattgc 48
<210> 73
<211> 48
<212> DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-19-
<213> PCR Primer attLA4T
<400> 73
ggggagcctg ctttttttta ctaagttggc attataaaaa agcattgc 48
<210> 74
<211> 48
<212> DNA
<213> PCR Primer attLTSA
<400> 74
ggggagcctg cttttttaaa ctaagttggc attataaaaa agcattgc 48
<210> 75
<211> 48
<212> DNA
<213> PCR Primer attLTSC
<400> 75
ggggagcctg cttttttaca ctaagttggc attataaaaa agcattgc 48
<210> 76
<211> 48
<212> DNA
<213> PCR Primer attLTSG
<400> 76
ggggagcctg cttttttaga ctaagttggc attataaaaa agcattgc 48
<210> 77
<211> 48
<212> DNA
<213> PCR Primer attLA6C
<400> 77
ggggagcctg cttttttatc ctaagttggc attataaaaa agcattgc 48
<210> 78
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-20-
<211> 48
<212> DNA
<213> PCR Primer attLA6G
<400> 78
ggggagcctg cttttttatg ctaagttggc attataaaaa agcattgc 48
<210> 79
<211> 48
<212> DNA
<213> PCR Primer attLA6T
<400> 79
ggggagcctg cttttttatt ctaagttggc attataaaaa agcattgc 48
<210> 80
<211> 48
<212> DNA
<213> PCR Primer attLC7A
<400> 80
ggggagcctg cttttttata ataagttggc attataaaaa agcattgc 48
<210> 81
<211> 48
<212> DNA
<213> PCR Primer attLC7G
<400> 81
ggggagcctg cttttttata gtaagttggc attataaaaa agcattgc 48
<210> 82
<211> 48
<212> DNA
<213> PCR Primer attLC7T
<400> 82
ggggagcctg cttttttata ttaagttggc attataaaaa agcattgc 48
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-21-
<210> 83
<211> 48
<212> DNA
<213> PCR Primer attL8
<400> 83
ggggagccta cttttttata ctaagttggc attataaaaa agcattgc 48
<210> 84
<211> 48
<212> DNA
<213> PCR Primer attL9
<400> 84
ggggagcctg cctttttata ctaagttggc attataaaaa agcattgc 48
<210> 85
<211> 48
<212> DNA
<213> PCR Primer attLlO
<400> 85
ggggagcctg cttctttata ctaagttggc attataaaaa agcattgc 48
<210> 86
<211> 48
<212> DNA
<213> PCR Primer attLl4
<400> 86
ggggagcctg cttttttata ccaagttggc attataaaaa agcattgc 48
<210>87
<211>48
<212>DNA
<213>PCR Primer attLlS
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-22-
<400> 87
ggggagcctg cttttttata ctaggttggc attataaaaa agcattgc 48
<210> 88
<211> 30
<212> DNA
<213> attLO
<400> 88
agcctgcttt tttatactaa gttggcatta 30
<210> 89
<211> 30
<212> DNA
<213> attL5
<400> 89
agcctgcttt attatactaa gttggcatta 30
<210> 90
<211> 30
<212> DNA
<213> attL6
<400> 90
agcctgcttt tttatattaa gttggcatta 30
<210> 91
<211> 30
<212> DNA
<213> attLl3
<400> 91
agcctgcttt tttatgctaa gttggcatta 30
<210> 92
<211> 30
<212> DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-23-
<213> attLl4
<400> 92
agcctgcttt tttataccaa gttggcatta 30
<210> 93
<211> 30
<212> DNA
<213> attLl5
<400> 93
agcctgcttt tttatactag gttggcatta 30
<210> 94
<211> 21
<212> DNA
<213> Consensus Sequence
<220>
<221> misc feature
<222> (7)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (8)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (10)..()
<223> n is any nucleotide
<220>
<221> misc feature
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-24-
<222> (11)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (12)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (14)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (15)..()
<223> n is any nucleotide
<400> 94
caacttnntn nnannaagtt g 21
<210> 95
<211> 25
<212> DNA
<213> attBO
<400> 95
tcaagttagt ataaaaaagc aggct 25
<210> 96
<211> 29
<212> DNA
<213> attB2.1
<400> 96
ggggaacact ttgtacaaga aagctgggt 29
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-25-
<210> 97
<211> 29
<212> DNA
<213> attB2.2
<400> 97
ggggacaact ttgtacaaga aagctgggt 29
<210> 98
<211> 29
<212> DNA
<213> attB2.3
<400> 98
ggggacccct ttgtacaaga aagctgggt 29
<210> 99
<211> 29
<212> DNA
<213> attB2.4
<400> 99
ggggaccaat ttgtacaaga aagctgggt 29
<210> 100
<211> 29
<212> DNA
<213> attB2.5
<400> 100
ggggaccacg ttgtacaaga aagctgggt 29
<210> 101
<211> 29
<212> DNA
<213> attB2.6
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-26-
<400> 101
ggggaccact gtgtacaaga aagctgggt 29
<210> 102
<211> 29
<212> DNA
<213> attB2.7
<400> 102
ggggaccact tggtacaaga aagctgggt 29
<210> 103
<211> 29
<212> DNA
<213> attB2.8
<400> 103
ggggaccact ttttacaaga aagctgggt 29
<210> 104
<211> 29
<212> DNA
<213> attBl.6
<400> 104
ggggacaact ttgtacaaaa aagttggct 29
<210> 105
<211> 29
<212> DNA
<213> attB2.10
<400> 105
ggggacaact ttgtacaaga aagttgggt 29
<210> 106
<211> 29
<212> DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-27-
<213> attb1n16-20
<220>
<221> misc feature
<222> (20)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (21)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (22)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (23)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (24)..()
<223> n is any nucleotide
<400> 106
ggggacaagt ttgtacaaan nnnnaggct 29
<210>107
<211>29
<212>DNA
<213>attb1n21-25
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-28-
<220>
<221> misc feature
<222> (25)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (26)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (27)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (28)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (29)..()
<223> n is any nucleotide
<400> 107
ggggacaagt ttgtacaaaa aagcnnnnn 29
<210> 108
<211> 29
<212> DNA
<213> attb2n16-20
<220>
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-29-
<221> misc feature
<222> (20)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (21)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (22)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (23)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (24)..()
<223> n is any nucleotide
<400> 108
ggggaccact ttgtacaagn nnnntgggt 29
<210> 109
<211> 29
<212> DNA
<213> attb2n21-25
<220>
<221> misc feature
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-30-
<222> (25)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (26)..()
<223> n is any nucleotide
<220>
<221> mist feature
<222> (27)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (28)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (29)..()
<223> n is any nucleotide
<400> 109
ggggaccact ttgtacaaga aagcnnnnn 29
<210> 110
<211> 28
<212> DNA
<213> attbl (5'-end of fragment a)
<220>
<221> misc feature
<222> (27)..()
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-31-
<223> n is any nucleotide
<220>
<221> misc feature
<222> (28)..()
<223> n is any nucleotide
<400> 110
ggggacaact ttgtacaaaa aagttgnn 28
<210> 111
<211> 26
<212> DNA
<213> attb5 (3'-end of fragment a)
<400> 111
ggggacaact ttgtataata aagttg 26
<210> 112
<211> 26
<212> DNA
<213> attb5r (5'-end of fragment b)
<400> 112
ggggacaact ttattataca aagttg 26
<210> 113
<211> 26
<212> DNA
<213> attb2 (3'-end of fragment b)
<220>
<221> misc feature
<222> (26)..()
<223> n is any nucleotide
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-32-
<400> 113
gggacaactt tgtataataa agttgn 26
<210> 114
<211> 28
<212> DNA
<213> attbl (5'-end of fragment a)
<220>
<221> mist feature
<222> (27)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (28)..()
<223> n is any nucleotide
<400> 114
ggggacaact ttgtacaaaa aagttgnn 28
<210> 115
<211> 25
<212> DNA
<213> attb2lR (3'-end of fragment b)
<400> 115
gggacaactt tttaatacaa agttg 25
<210> 116
<211> 26
<212> DNA
<213> attb2l (5'-end of fragment c)
<400> 116
ggggacaact ttgtattaaa aagttg 26
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-33-
<210> 117
<211> 27
<212> DNA
<213> attb2 (3'-end of fragment c)
<220>
<221> misc feature
<222> (27)..()
<223> n is any nucleotide
<400> 117
ggggacaact ttgtataata aagttgn 27
<210> 118
<211> 16
<212> DNA
<213> optimal Shine-Delgarno and Kozak sequence
<400> 118
ggaggtatat accatg 16
<210> 119
<211> 39
<212> DNA
<213> SD 5' luxA
<400> 119
ggaggtatat accatgaagt ttggaaatat ttgtttttc 39
<210> 120
<211> 49
<212> DNA
<213> T7 3' luxA
<400> 120
gaagctatag tgagtcgtat tatttaggtt cttttaagaa aggagcgac 49
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-34-
<210>121
<211>40
<212>DNA
<213>SD 5'
luxB
<400> 121
ggaggtatat accatgaaat ttggattatt ttttctaaac 40
<210>122
<211>47
<212>DNA
<213>T7 3' luxB
<400> 122
gaagctatag tgagtcgtat tatggtaaat tcatttcgat tttttgg 47
<210> 123
<211> 45
<212> DNA
<213> SD 5' luxC
<400> 123 -
ggaggtatat accatgaata aatgtattcc aatgataatt aatgg 45
<210> 124
<211> 50
<212> DNA
<213> T7 3' luxC
<400> 124
gaagctatag tgagtcgtat tatgggacaa aaactaaaaa cttatcttcc 50
<210> 125
<211> 44
<212> DNA
<213> SD 5' luxD
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-35-
<400> 125
ggaggtatat accatgaaag atgaaagtgc tttttttacg attg 44
<210> 126
<211> 46
<212> DNA
<213> T7 3' luxD
<400> 126
gaagctatag tgagtcgtat taagccaatt ctaataattc attttc 46
<210> 127
<211> 44
<212> DNA
<213> SD 5' luxE
<400> 127
ggaggtatat accatgactg tccatactga atataaaaga aatc 44
<210> 128
<211> 53
<212> DNA
<213> T7 3' luxE
<400> 128
gaagctatag tgagtcgtat taaatccttg atattctttt gtatgacatt agc 53
<210> 129
<211> 44
<212> DNA
<213> B1.6 SD
<400> 129
ggggacaact ttgtacaaaa aagttgaagg aggtatatac catg 44
<210> 130
<211> 44
<212> DNA
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-36-
<213> B5 T7
<400> 130
ggggacaact ttgtataata aagttggaag ctatagtgag tcgt 44
<210> 131
<211> 44
<212> DNA
<213> B5R SD
<400> 131
ggggacaact ttattataca aagttgaagg aggtatatac catg 44
<210> 132
<211> 44
<212> DNA
<213> B11 T7
<400> 132
ggggacaact ttgtatagaa aagttggaag ctatagtgag tcgt 44
<210> 133
<211> 44
<212> DNA
<213> B11R SD
<400> 133
ggggacaact tttctataca aagttgaagg aggtatatac catg 44
<210> 134
<211> 44
<212> DNA
<213> B17 T7
<400> 134
ggggacaact ttgtatacaa aagttggaag ctatagtgag tcgt 44
<210> 135
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-37-
<211> 44
<212> DNA
<213> B17R SD
<400> 135
ggggacaact tttgtataca aagttgaagg aggtatatac catg 44
<210> 136
<211> 44
<212> DNA
<213> B21 T7
<400> 136
ggggacaact ttgtattaaa aagttggaag ctatagtgag tcgt 44
<210> 137
<211> 44
<212> DNA
<213> B21R SD
<400> 137
ggggacaact ttttaataca aagttgaagg aggtatatac catg 44
<210> 138
<211> 44
<212> DNA
<213> B2.10 T7
<400> 138
ggggacaact ttgtacaaga aagttggaag ctatagtgag tcgt 44
<210> 139
<211> 14
<212> DNA
<213> 12 attB1 Forward Template-Specific Primer
<220>
CA 02392753 2002-05-27
WO 01/42509 PCT/US00/33546
-38-
<221> misc feature
<222> (13)..()
<223> n is any nucleotide
<220>
<221> misc feature
<222> (14)..()
<223> n is any nucleotide
<400> 139
aaaaagcagg ctnn 14
<210> 140
<211> 13
<212> DNA
<213> 12 attB2 ReverseTemplate-Specific Primer
<220>
<221> misc feature
<222> (13)..()
<223> n is any nucleotide
<400> 140
agaaagctgg gtn 13
