Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
COMPOSITIONS AND METHODS
OF USING HIV VPR
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Provisional Patent Applications,
Serial
Number 60/193,495, filed March 31, 2000, and Serial Number 60/231,141, filed
September,
8, 2000, each of which is incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates to methods of inhibiting anti-viral response, to
improved
gene delivery methods, to methods of treating individuals who have autoimmune
diseases and
to methods of treating individuals who have diseases, disorders and conditions
associated with
inflamation. The present invention relates to pharmaceutical compositions
useful in such
methods. The present invention relates to improved gene therapy vectors and
compositions
which comprise I-IIV Vpr or a gene encoding the same, and methods of making
and using the
same. The present invention relates to methods for delivering polypeptides to
individuals while
inhibiting the cellular immune response against the vector which contains the
nucleic acid
encoding the desired polypeptide.
BACKGROUND OF THE INVENTION
One promise of gene therapy is the ability to correct genetic defects
responsible for
disease by the addition to an individual of functional genetic material as
well as the ability to
deliver therapeutic proteins using genetic material that encodes such
proteins. There is a great
deal of activity in the development of protocols for treating diseases and
disorders by
administering a nucleic acid which codes for a polypeptide that is either
missing or defective in
an individual. Another promise of gene therapy is as an alternative and
improved means to
deliver therapeutically important proteins to individuals in need of such
proteins. The discovery
1
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
of proteins with therapeutically important functions has led to new treatments
for many diseases
and disorders and the application of gene therapy to deliver such proteins is
also the subject of
much interest.
Among the strategies for delivering genetic material, the use of immunogenic
vectors,
most commonly viral vectors, capable of infecting the individual's cells is
one of the most widely
employed methodologies. Essentially, genetic material that encodes desired
proteins, whether
they be functional forms of defective genes responsible for disease or coding
sequences for
therapeutically useful proteins, is incorporated into the genome of a vector
which has the ability
to infect cells of the individual or otherwise deliver the genetic material to
cells of the individual.
Adenovirus, adeno-associated virus (AAV), vaccinia virus, and simian virus 40
(SV40)
are just a few of the many viruses used to make viral vectors for gene
therapy. In some cases,
the viral vectors are selected for their ability to infect specific tissue to
which delivery of the
genetic material is desired. In some cases, the viral vectors are selected
because they are
attenuated and cause serious limited infections to the individual without
significant pathology.
One of the major problems associated with gene therapy protocols that employ
immunogenic vectors is that an immune response against the vector is induced
in the individual
who is administered the vector. The immune response targets the vector
including cells which
are infected by the vector. The destruction of cells which are infected by the
vector reduces the
efficacy of the treatment. Further, immune responses induced against the
vectors limit the
effectiveness of subsequent doses of the same gene therapeutic composition or
other gene
therapeutic compositions which use the same vector because the immune system
ofthe individual
will recognize the vector from the subsequent doses of the same gene
therapeutic composition
or other gene therapeutic compositions which use the same vector and mount an
immune
response similar to the manner in which a vaccine protects the individual from
subsequent
exposure to a pathogen.
There are two branches to the immune system. The humoral branch of the immune
system involves antibodies which are secreted by B lymphoid cells and
recognize specific
antigens. Binding of antibodies to specific antigens inactivates the antigen.
Antibodies may also
bind to the antigen and activate other immune cells which destroy the bound
antigen.
The cellular branch of the immune system involves specific cell types which
recognize
and destroy cells which display "foreign" antigens. Cytotoxic T cells (also
referred to as
2
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
cytotoxic T lymphocytes or CTLs) are an example of cells in the cellular
branch of the immune
system. CTLs recognize fragments of peptides which are displayed on the plasma
membrane
surface bound to major histocompatibility complex (MHC) molecules. Cells that
display a
peptide which is "foreign" elicit a cellular immune response. Cytotoxic T
cells then destroy the
cell displaying the foreign peptide fragments.
The HIV-1 accessory gene vp~ encodes viral protein R (Vpr) which has been
implicated
in the regulation of many host cellular events including proliferation,
differentiation, apoptosis,
cytokine production, and NF-xB mediated transcription (Levy et al., 1993,
Cell, 72:541-550;
Ayyavoo etal.,1997, Nat. Med., 3:11171123; Stewart etal.,1997, J. Virol.,
71:5579-5592, each
of which is incorporated herein by reference). NF-~cB activation is important
for the induction
of some cytokines and chemokines which specifically expand antigen specific
immune responses.
NF-oB activation also plays an important role in the induction of
proinflammatory cytokines, in
particular tumor necrosis factor-alpha (TNFa), triggered through the CD28
costimulatory
pathway (Moriuchi et al., 1997, J. Immunol., 158:3483-3491; Fraser et al.,
1992, Mol. Cell.
Biol.,12:43 57-4363, each of which is incorporated herein by reference). The
pattern of cytolcine
expression influences the nature and persistence of the inflammatory response.
For instance,
production of interferon-gamma (IFN-y) and TNF are well-suited to induce
enhanced cellular
immunity, while interleukin-4 (IL-4) and IL-10 are associated with helping B
cells develop into
antibody-producing cells (Paul et al., 1994, Cell, 76:241-251, which is
incorporated herein by
reference). Studies using mutant NF-xB binding sites and IkBa competition have
shown that
transcription factors including NF-oB and SP-1 are important for RANTES
(Regulated on
Activation, Normal T Expressed and Secreted) gene expression (Moriuchi et al.,
1997, J.
Immunol., 158:3483-3491, which is incorporated herein by reference).
CD8+ T cells are believed to play an important role in controlling HIV
infection through
CTL induction. Additionally, CD8+ T cells are involved in secretion of several
factors including
the (3-chemokines RANTES, MIP-1 a, MIP-1 (3, and MDC (Brinchman et al.,1990,
J. Immunol.,
114:2961-2966; Gocclu etal.,1996, Science, 270:1811-1815; Paletal.,1997,
Science, 278:695-
698, each of which is incorporated herein by reference). CD8+ CTL is an
important
immunological defense against viral infections.
Chemokines are important for the regulation of lymphocyte recruitment in
infection and
immune activation (Schall et al.,1994, Curr. Opin. Immunol., 6:865-873, which
is incorporated
3
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
herein by reference). T cell activation results in synthesis of certain
chemokines/cytokines which
are necessary for antigen-specific T helper cell as well as for cytotoxic
effector cell expansion
(Weiss et a1.,1994, Cell, 76:263-274, which is incorporated herein by
reference). In addition to
their role in T cell trafficking and immune activation, the (3-chemokines can
inhibit HIV-1
infection in established macrophage cell lines as well as in primary
lymphocytes through
interference with viral coreceptors required for entry (Feng et al., 1996,
Science, 272:872-877;
Dornaz et a1.,1996, Cell, 85:1149-1158, each of wluch is incorporated herein
by reference). For
example, chemokines are produced by some subsets of T cells following T cell
receptor (TCR)
and CD28/CTLA-4 co-ligation (Taub et al., 1996, J. Immunol., 156:2095-2103;
Herold et al.,
1997, J. Immunol., 159:4150-4153, each of which is incorporated herein by
reference).
Induction of T cell proliferation, CTL activation and cytokine secretion
require both the
engagement of the TCR .complex and interaction of either CD28/CTLA-4
costimulatory
molecules with their ligands CD80 or CD86 present on antigen presenting cells
(APCs), or CD40
with the CD40 ligand, to provide the necessary second signal (Fraser et al.,
1994, Immunol.
Today,14:357-362; Crabtree et a1.,1989, Science, 243:355-361; Linsley et
a1.,1993, Ann. Rev.
Immunol., 11:191-212; June et al., 1994, Immunol. Today, 15:321-331, each of
which is
incorporated herein by reference). Studies have shown that T cell activation
through CD28
enhances production of (3-chemokines, yielding anti-viral effects (Carroll et
al., 1997, Science,
276:273-276; Levine et al., 1996, Science, 272:1939-1943; Bisset et al., 1997,
AIDS, 11:485-
491, each of which is incorporated herein by reference). Recruitment and
activation of CD8+
cells at the site of inflammation increases specific CTL precursor frequency
(Stevenson et al.,
1997, Eur. J. Immunol., 27:3259-3268; Doherty et al., 1997, Immunol. Reviews,
159:105-117,
each of which is incorporated herein by reference). Blocking the synthesis of
chemolcines may
ameliorate the symptoms of inflammatory diseases which rely on the synthesis
of chemokines
to recruit cells responsible for the immune response.
Cellular immunity, specifically the MHC-restricted CTL response, is thought to
play an
intrinsic role in protection and clearance of a number of viral infections.
Reduction in the
number of CD8+ T cells in HIV-1 infected individuals has been correlated with
reduced anti-viral
effect and disease progression in parallel with the deterioration of the
immune system
(Mackewicz et al., 1991, J. Clin. Invest., 87:1462-1466; Pantaleo et al.,
1997, Proc. Natl. Acad.
Sci. USA, 94:9848-9853, each of which is incorporated herein by reference).
Information from
4
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
studies on HIV-1 infected long-term non-progressors, uninfected infants born
to H1V-1 infected
mothers, and seronegative individuals repeatedly exposed but as yet uninfected
have supported
the role of CTL responses in controlling viral load and perhaps even limiting
disease progression
(Borrow et al., 1994, J. Virol., 68:6103-6110; Rowland-Jones et al., 1995,
Nat. Med., 1:59-94,
each of which is incorporated herein by reference).
Overexpression and overproduction of cytokines is associated with a number of
disease
conditions. Cytokine overproduction is particularly important to the
pathogenesis of bacterial
septic shock, which is a condition that can develop within a few hours
following infection by
certain gram-negative bacteria, including, but not limited to, E. coli,
Klebsiella pnezrmo~ia,
Pseudomo~as ae~ugihosa, Ehte~obacte~ ae~ogenes, Neisse~ia me~ingitidis, and
various species
of Salmonella, as well as some gram-positive bacteria. Septic shock can occur
following sepsis,
a condition in which pathogenic microorganisms or their toxins are present in
the blood or in
other tissues during infection or contamination. The symptoms of bacterial
septic shock, which
is often fatal, include a drop in blood pressure, fever, diarrhea, and
widespread blood clotting in
various organs. This condition afflicts about 500,000 individuals in the U.S.
annually, and kills
more than 20,000 in the U.S. and one million people world wide each year. The
aimual cost for
treating bacterial septic shock is estimated at $5 - 10 billion. The septic
shoclc develops when
bacterial cell wall endotoxins stimulate macrophages to over produce IL-1 and
T'NFa; it is the
increased levels of IL-1 and TNFa that cause the septic shock symptoms. The
rapid onset of the
condition and the high mortality rate call for methods of prophylactic
treatment, particularly in
situations where patients will be put at risk for septic shock, such as during
and following
surgery. For a review of systemic inflammatory response syndrome, sepsis, and
septic shoclc, see
Peterson & Webster, 2000, J. R. Coll. Surg. Edinb., 45:178-182, which is
incorporated herein
by reference.
Toxic shock is a disease having similax chaxacteristics to septic shock, that
is triggered
by toxins, produced by a variety of organisms, including bacteria, that act as
superantigens.
Superantigens bind simultaneously to a class II MHC molecule and to the V(3
domain of the T
cell receptor, resulting in the activation of all T cells bearing a particular
V(3 domain. Rather than
being internalized, processed, and presented by antigen presenting cells, as
conventional antigens
axe, superantigens bind directly to class II MHC molecules (see Herman et al.,
1991, Ann. Rev.
Immunol., 9:745-772, which is incorporated herein by reference). Due to this
unique binding
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
ability, superantigens can activate large numbers of T cells regardless of
their antigenic
specificity. A number of bacterial superantigens have been implicated as the
causative agent of
several diseases such as bacterial toxic shock and food poisoning. These
include staphylococcal
enterotoxins (among wlv.ch staphylococcal enterotoxin B (SEB) is most
prevalant), exfoliating
toxins, and toxic-shock syndrome toxin (TSST1); streptococcal pyrogenic
exotoxins SPEA and
SPEC; and Mycoplasma a~th~itidis supernatant (MAS). The large number of T
cells activated
by these superantigens results in excessive production of cytokines derived
from T helper type
1 (Thl ) cells, which include IL-2, IFNy, and TNF[3. TS ST1, for example,
induces extremely high
levels of TNF and IL-1. The resultant systemic reactions are similar to
bacterial septic shock,
including fever, widespread blood clotting, and shock. For reviews of the role
of superantigens
in immunological disease, see Murray et al., 1995, Am. Soc. Microbiol. News,
61:229-235, and
Fraser et al., 2000, Mol. Med. Today, 6:125-32, each of which is incorporated
herein by
reference.
There remains a need for improved gene therapy vectors, compositions, and
methods
which can be used to increase the safety and efficacy of gene therapy
technology. There remains
a need for improved gene therapy vectors, compositions, and methods which can
reduce or
eliminate the immune response against the viral vector which limits the
ability to expose the
individual to subsequent doses of the therapeutic vector, other therapeutics,
or vaccines
employing the same vector. There is a need for methods for delivering
polypeptides to
individuals while inhibiting the cellular immune response against the vector
which encodes the
desired polypeptide. There is a further need for methods for modulating
irrunune responses
associated with inflammatory and autoimmune diseases and disorders, and for
therapeutic and
prophylactic treatment of septic shock, toxic shock and related diseases.
There is also a need for
improved methods of arresting the growth of hyperproliferating cells
associated with such
diseases as cancer.
SUMMARY OF THE INVENTION
The present invention relates to methods of delivering a desired polypeptide
to an
individual. The methods comprise administering to the individual an
inununogenic vector
comprising a nucleic acid encoding the desired polypeptide operably linked to
regulatory
elements in combination with one or more of Vpr protein, a functional fragment
of Vpr protein,
6
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
a nucleic acid encoding Vpr protein operably linked to regulatory elements, or
a nucleic acid
encoding a functional fragment of Vpr protein operably linked to regulatory
elements.
The present invention relates to compositions comprising an iminunogenic
vector that
comprises a nucleic acid encoding the desired polypeptide operably linked to
regulatory
elements; and one or more of Vpr protein, a functional fragment of Vpr
protein, a nucleic acid
encoding Vpr protein operably linked to regulatory elements, or a nucleic acid
encoding a
functional fragment of Vpr protein operably linked to regulatory elements.
The present invention relates to methods for inhibiting an undesirable immune
response
in an individual. The methods comprise administering to the individual in an
amount sufficient
to inhibit an undesirable immune response one or more of Vpr protein, a
functional fragment of
Vpr protein, a nucleic acid encoding Vpr protein operably linked to regulatory
elements, or a
nucleic acid encoding a functional fragment of Vpr protein operably linked to
regulatory
elements.
The present invention relates to methods for inhibiting cellular proliferation
of tumor cells
in an individual. The methods comprise administering to the individual, in an
amount sufficient
to inhibit cellular proliferation, a recombinant adenovirus comprising a
nucleic acid encoding
Vpr protein operably linked to regulatory elements or a nucleic acid encoding
an anti-tumor
fragment of Vpr protein operably linked to regulatory elements.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1 A, 1 B,1 C,1 D,1 E and 1 F, which contain data from Example 1, show
the effect
of treatment with Vpr on cell subsets.
Figures 2A, 2B, 2C, 2D and 2E, which contain data from Example l, show the
effect of
treatment with Vpr on PBMCs.
Figure 3, which contains data from Example 1, depicts MIP-1 a production in
splenocytes
from mice immunized with pNef with or without co-immunization of pVpr.
Figure 4 shows data from immunohistochemical analysis of lymphocyte
infiltration at the
site of antigen expression as set forth in Example 2.
Figures SA, SB, SC and SD show cytotoxic T lymphocyte response induced by pNef
or
pGag-Pol in the presence or absence of pVpr co-immunization from experiments
set forth in
Example 2.
7
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
Figures 6A and 6B show cytokine production in splenocytes obtained from mice
co-
immunized with pNef in the presence or absence of pVpr from experiments set
forth in Example
2.
Figures 7A and 7B show data from experiments in Example 2 analyzing the effect
of
pVpr on humoral responses generated by different antigens.
Figures 8A, 8B, 8C and 8D show data from experiments in Example 2 analyzing
the
effect of Vpr as a virion-associated molecule on expression of costimulatory
molecules on
antigen presenting cells.
Figure 9 is a schematic depiction of the construction of the HIV vp~-
containing adenoviral
vector pAdCMV-vpr.
Figure 10 is a schematic depiction of the generation of Adeno-vp~ recombinant
viral
particles.
Figure 11 presents an immunoblot of Vpr protein as produced in a baculovirus
expression
system (lane 1 ), and as expressed in Adeno-vp~ infected cells (lane 2,
labeled as "Adeno-Vpr
(+)"). Lane 3 (labeled "Adeno-Vpr (-)") presents the negative control protein
extract from
Adeno-lacZ infected cells.
Figure 12 presents an immunofluorescence photograph showing Vpr expression
(red
fluorescence) in a human macrophage cell that has been infected with Adeno-vp~
recombinant
adenovirus.
Figure 13 presents cell cycle analyses of HeLa cells that have been mock
infected,
infected with Adeno-lacZ viral particles, or infected with Adeno-vp~ virus
particles.
Figure 14 presents immunofluorescence data reflecting the level of expression
of
macrophage activation markers CD80 and CD80 in human macrophages that have
been mock
infected, infected with Adeno-lacZ viral particles, or infected with Adeno-vpr
virus particles.
The values presented in association with each histogram indicate the
percentage of the cells in
the sample that are positive for the indicated marker. The vertical axis
presents the number of
events or cells; the horizontal axis is the intensity of fluorescence.
Figure 15 presents data on the levels of chemokine production by human
macrophages
that have been mock infected, infected with Adeno-vp~ viral particles, or
infected with Adeno-
ZacZ virus particles.
Figure 16 presents data on the ability of Vpr to down-regulate the
lymphoproliferation
8
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
of human peripheral blood mononuclear cells (PBMCs) in response to the
mitogenic substances:
tetanus toxoid, phytohemagglutinin (PHA), concanavalin-A (ConA), and the
superantigen
staphylococcal enterotoxin B (SEB).
DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION
As used herein, the terms "protein" and "polypeptide" are used interchangeably
and are
intended to refer to proteinaceous compounds including proteins, polypeptides
and peptides.
As used herein, the term "individual" refers to the vertebrate targeted for
use of the
present invention. Examples of "individuals" contemplated by the present
invention include but
axe not limited to humans, higher order primates, canines, felines, bovines,
equines, ovines,
porcines, avians, and other mammals.
As used herein, the term "immunogenic vector" relates to a vector which
elicits an
immune response. Examples of immunogenic vectors include, but axe not limited
to, viral and
bacterial vectors. Some embodiments of the present invention relate to methods
where the vector
administered to the individual is viral. Examples of viral vectors include,
but are not limited to,
adenoviral vectors; adeno-associated viral vectors; vaccinia viral vectors;
SV40 viral vectors;
Epstein-Barrvirus (EBV) replicon-based vectors (Tsujie etal., 2000,
I~idneyInt., 59:1390-1396);
lentiviral vectors (Buchschacher & Wong-Staal, 2000, Blood,95:2499-2504; Vigna
& Naldini,
2000, J. Gene Med., 2:308-316; Lever, 2000, Curr. Opin. Mol. Ther., 2:488-496)
including, but
not limited to, HIV-based vectors (Buchschacher & Wong-Staal, 2000, supra) and
visna virus
vectors (Berkowitz et al., 2001, Virology, 279:116-129); alphavirus vectors
(Wahlfors et al.,
2000, Gene Ther., 7:472-480), including, but not limited to, Sindbis and
Semliki forest virus-
based vectors (Perri et al., 2000, J. Virol., 74:9802-9807); and flavivirus
vectors (Vaxnavslci &
I~hromykh, 1999, Virology, 255:366-375). Each of the aforementioned viral
vector references
is incorporated herein in its entirety by reference. In a preferred
embodiment, the vector is
adenovirus. Some embodiments of the present invention relate to methods where
the vector
administered to the individual is bacterial. Examples of bacterial vectors
include, but are not
limited to, Salmonella, mycobacterium and BC. Examples of immunogenic vectors
which axe
useful in gene therapy and which can be adapted to the present invention
include recombinant
adenoviral vectors which are described in U.S. Patent No. 5,756,283 and U.S.
Patent No.
5,707,618, which are each incorporated herein by reference.
9
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
As used herein, the term "desired polypeptide" refers to the polypeptide for
which gene
therapy is desired. Examples of "desired polypeptides" include human and non-
human
polypeptides. Examples of human polypeptides contemplated by the present
invention include,
but are not limited to, insulin, growth hormone, the cystic fibrosis
polypeptide.
As used herein, the terms "administration" and "administering" refer to the
delivery of
polypeptides to an individual. "Administration" and "aclininistering" refer to
the delivery of
nucleic acids which encode polypeptides and also to the delivery of
polypeptides to the
individual. The terms include, but are not limited to, delivery routes
including intramuscularly,
intravenously, intranasally, intraperatoneally, intradermally, intrathecally,
intraventricularly,
subcutaneously, transdermally, topically, or by lavage. Modes of
administration contemplated
by this invention include, but are not limited to, the use of a syringe,
intravenous line,
transdermal patch, or needleless injector.
The present invention provides improved gene therapy vectors that employ one
of the
weapons that the HIV virus uses to evade and undermine an infected
individual's immune
system: the Vpr protein and/or a nucleic acid molecule that encodes it. Armed
with this HIV-
derived weapon, gene therapy vectors can be made more effective by reducing an
individual's
immune response against them. Moreover, the present invention uses the HIV Vpr
protein,
and/or a nucleic acid molecule that encodes it, to treat individuals who have
diseases and
conditions associated with undesirable immune responses.
The present invention arises from the surprising discovery that the delivery
of Vpr
polypeptide suppresses cellular immune responses. Vpr suppresses CC
chemolcines and
compromises CD8+ T cell effector function. This has been shown in both mouse
and human
systems. Moreover, Vpr inhibits the synthesis of prototypic Thl type cytokines
and shifts the
antibody response toward a Th2 type bias. The data support the conclusion that
Vpr interferes
with costimulatory molecules involved in immune activation. This has been
shown in both
mouse and human systems. It has also been discovered that Vpr can suppress
lymphoproliferation in response to a variety of mitogenic substances including
superantigens.
Accordingly, when delivered in the context of a gene therapy protocol, Vpr
decreases the immune'
response directed at the gene therapy vector, and cells infected by the same,
resulting in an
increase in the efficacy of the gene therapy protocol. When delivered to an
individual who has
a disease or condition associated with an undesirable immune response such as
an inflammatory
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
or autoimmune disease or tissue or organ transplant, Vpr decreases the immune
response.
Infection with adeno-associated virus results in the growth arrest and cell
death of newly-
established cultures of malignant human tumors, and to have a transient
antiproliferative effect
on diploid human fibroblasts (Bantel-Schaal & Stohr, 1992, J. Virol., 66:773-
779, which is
incorporated herein by reference). It has now been discovered that recombinant
adenovirus
infection induces cell cycle arrest in tumor-derived cells, and that
expression of Vpr enhances
this effect, to induce a dramatic accumulation of cells in the G2/M phase of
the cell cycle.
Accordingly, the delivery of Vpr in the context of viral vectors or
recombinant viral particles
having cell growth arresting properties, can be used to enhance cell cycle
arrest for the treatment
of diseases characterized by hyperproliferating cells, including, but not
limited to cancer.
The amino acid sequence of Vpr and the DNA sequence that encodes it are
described in
U.S. Patent No. 5,874,225, issued on February 23, 1999, which is incorporated
herein by
reference, including the patents and publications referred to therein.
Functional fragments of Vpr
are described in PCT/LTS94/02191, filed February 22,1994, PCT/US95/12344,
filed September
21, 1995, and PCT/LJS98/16890, filed August 14, 1998, which are each
incorporated herein by
reference, together with the respective corresponding U.S. National Stage
applications claiming
priority thereto, and U. S. PatentNo. 5,763,190, issued June 9,1998, which is
incorporated herein
by reference. U.S. Serial 081167,608, filed December 15, 1993, and
PCT/LTS94/00899, filed
January 26, 1994, which are each incorporated herein by reference, describe
recombinant viral
particles which include functional fragments of Vpr protein as part of the
viral particle.
One aspect of the present invention relates to methods of delivering a~desired
polypeptide
to an individual comprising administering to the individual an immunogenic
vector comprising
a nucleic acid encoding the desired polypeptide operably linked to regulatory
elements in
combination with either the Vpr polypeptide, or a functional fragment thereof,
or a nucleic acid
encoding Vpr, or a functional fragment thereof, operably linlced to regulatory
elements, or a
combination thereof. According to one aspect of the invention, Vpr protein, or
a functional
fragment thereof, is delivered to an individual in combination with the
delivery of an
immunogenic vector for delivering the coding sequence of a desired protein in
a gene therapy
protocol. The Vpr may be delivered as a protein, or a functional fragment
thereof, or as a nucleic
acid molecule with the coding sequence for Vpr protein, or a functional
fragment thereof, or any
combination thereof. The Vpr may be delivered in the same formulation as the
gene therapy
11
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
vector or separately. The Vpr may be delivered simultaneously, prior to or
subsequent to delivery
of the gene therapy vector. In some preferred embodiments, the immunogenic
vector comprises
a nucleic acid molecule with the coding sequence for Vpr protein or a
functional fragment
thereof. In some preferred embodiments, the immunogenic vector comprises Vpr
protein or a
functional fragment thereof. In some preferred embodiments, the immunogenic
vector comprises
a nucleic acid molecule with the coding sequence for Vpr protein and/or a
functional fragment
thereof and Vpr protein and/or a functional fragment thereof itself. Once
delivered to the
individual, the nucleic acid encoding the desired polypeptide is expressed and
the desired
polypeptide is synthesized within the individual. The presence of the Vpr
protein, either
delivered as a protein or as a nucleic acid molecule "prodrug" which is
expressed, inhibits the
immune response directed at the immunogenic vector.
The present invention provides improved gene therapy compositions and methods.
Through gene therapy, polypeptides which are either absent, produced in
diminished quantities,
or produced in a mutant form in an individual may be replaced using a vector
comprising a
nucleic acid encoding the desired polypeptide. The desired polypeptide
compensates for the lack
of the desired polypeptide. Upon administration of the vector to the
individual, the individual
generates an immune response against the vector. The delivery of Vpr, either a
protein or as a
nucleic acid molecule "prodrug", in combination with the gene therapy vector
that encodes the
desired polypeptide inhibits the immune response directed at the immunogenic
vector and
therefore increases the efficacy of the gene therapy treatment.
The present invention also provides a method of treating individuals suffering
from
diseases and conditions characterized by undesirable immune responses such as
autoimmune/inflammatory diseases and condition and organ/tissue/cell
transplantation
procedures. According to the invention, methods of treating an individual with
a disease or
condition associated with an undesirable immune response comprise
administering to the
individual Vpr protein or a functional fragment thereof or a nucleic acid
encoding Vpr protein
or a functional fragment thereof or a combination of two or more of the same.
When a nucleic
acid encoding Vpr protein or a functional fragment thereof is delivered to an
individual, the
coding sequence is operably linked to regulatory elements. The Vpr may be
delivered as a
protein or a functional fragment thereof or as a nucleic acid molecule with
the coding sequence
for Vpr protein or a functional fragment thereof any combination thereof. In
some embodiments,
12
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
the Vpr is delivered as a nucleic acid molecule with the coding sequence for
Vpr protein and/or
a functional fragment thereof. In some embodiments, the Vpr and/or a
functional fragment
thereof is delivered as a protein. Once delivered to the individual, the
presence of the Vpr
protein, either delivered as a protein or produced by the expression of the
nucleic acid molecule
that encodes it, inhibits the undesirable immune response.
As used herein, "inhibit" in reference to an undesirable immune response,
refers to any
interference with the undesirable immune response resulting in a decrease of
the response. For
example, the term "inhibit" in this context includes both the elimination and
reduction of the
undesirable immune response.
According to some embodiments of the present invention, methods are provided
for
treating individuals suffering from autoimmune diseases and disorders. T cell
mediated
autoimmune diseases include rheumatoid arthritis (RA), multiple sclerosis
(MS), Sjogren's
syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune
thyroiditis,
reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis,
dermatomyositis, psoriasis,
vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis.
Each of these
diseases is characterized by T cell receptors that bind to endogenous antigens
and initiate the
inflammatory cascade associated with autoimmune diseases.
According to some embodiments of the present invention, methods are provided
for
treating individuals who require immunosuppression such as those undergoing
transplantation
procedure including cell, tissue and organ transplants. In such instances
rejection of the
transplanted material is reduced and the severity or incidence of side effects
such as graft versus
host disease may be lessened.
According to other embodiments, immune suppression can be induced to prevent
damage
resulting from inflammation. For example, following spinal cord injuries, a
cascade of events
leads to inflammation of the spinal cord and surrounding tissues. Use of the
present invention
may both inhibit inflammation of the spinal cord and associated problems and
allow delivery of
a therapeutic polypeptide (give example) to the individual. For instance, if
an axonal guidance
protein is the desired polypeptide, use of the present invention may both
inhibit the inflammation
of the spinal cord and stimulate axonal regrowth.
According to further embodiments of the invention, methods are provided for
inlubiting
an undesirable immune response in an individual wherein the inhibition
effectuates a
13
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
prophylactic and/or 'therapeutic treatment of the individual against diseases
in which toxins
induce the overproduction of inflammatory cytokines such as IL-1 and TNFa.
Such diseases
include, but are not limited to, septic shock or sepsis, in particular
bacterial septic shock or
sepsis, and toxic shock, in particular bacterial toxic shock.
As used herein, "septic shock" refers to the systemic symptoms that occur in
an individual
due to the high levels of inflammatory cytokines secreted principally by
macrophages in response
to endotoxin exposure, including, but not limited to exposure to gram-negative
endotoxin, also
known as lipopolysaccharide (LPS). These systemic symptoms include decreased
blood
pressure, fever, diarrhea, hypoglycemia, and widespread blood clotting.
As used herein, "toxic shock" refers to the systemic symptoms that are quite
similar to
septic shocl~, but are triggered by superantigen-induced activation and
expansion of T cells.
Toxic shock includes, but is not limited to, the food poisoning effects of
Staphylococcus au~eus
exotoxins SEA, SEB, SEC, SED, and SEE, as well as, the toxic shock syndrome
caused by
Staphylococcus au~eus TSST1, often associated with wound infection and tampon
use.
As used herein, the term "prophylactic" in reference to treatment of an
undesirable
immune response, means that the component is administered prior to an
undesirable immune
response, and that the treatment prevents the occurrence of the undesirable
immune response, or
decreases the magiutude of the undesirable immune response if it does occur.
Preferably, the
prophylactic treatment prevents mortality due to the undesirable immune
response.
As used herein, the term "therapeutic" in reference to treatment of an
undesirable immune
response,.means that the component is administered during the undesirable
immune response,
and that the treatment relieves or lessens that undesirable immune response.
Preferably, the
prophylactic treatment prevents mortality due to the undesirable immune
response.
According to other embodiments of the invention, methods axe provided for
arresting the
growth of cells (inhibiting cellular proliferation), such as
hyperproliferating cells, such as cancer.
As used herein, the term "inhibit" in reference to the cellular proliferation
of a cell, refers
to disruption of a cell's progression through the cell cycle. Inhibition of
cellular proliferation can
be monitored by such means as cell cycle analysis by fluorescence activated
cell sorting of
propidium iodide-stained cells, or by use of animal tumor models, wherein the
size, rate of
growth or other characteristics of tumors may be assessed.
As used herein, "anti-tumor fragment" in reference to Vpr protein, refers to
fragments of
14
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
Vpr that will inhibit cellular proliferation of a replicating cell.
As discussed above, in some embodiments, Vpr is delivered alone and in some
embodiments, Vpr is delivered in combination with a therapeutic gene including
immunogenic
vectors.
In some embodiments of the present invention, a combination of one or more of
Vpr, a
functional fragment thereof, a nucleic acid encoding Vpr, or a nucleic acid
encoding a functional
fragment of Vpr is administered to a patient.
In some embodiments of the present invention, Vpr or a functional fragment
thereof is
administered as a protein. In some embodiments, the Vpr or a functional
fragment thereof is
administered to the individual in the same formulation as the nucleic acid
encoding the desired
polypeptide. In other embodiments, the Vpr or a functional fragment thereof is
administered to
the individual in a separate formulation than the nucleic acid encoding the
desired polypeptide.
In some embodiments, the formulation containing the Vpr or a functional
fragment thereof is
administered to the individual at the same time as the formulation containing
the nucleic acid
encoding the desired polypeptide. In some embodiments, Vpr or a functional
fragment thereof
is delivered as a protein incorporated within an immunogenic vector.
In some embodiments of the present invention, a nucleic acid that encodes Vpr
or a
functional fragment thereof is administered. In some embodiments of the
present invention, the
desired polypeptide is encoded by a first nucleic acid wlule the Vpr or a
functional fragment
thereof is encoded by a second nucleic acid. In some embodiments, the nucleic
acid that encodes
Vpr or a functional fragment thereof is administered to the individual in the
same formulation
as the nucleic acid encoding the desired polypeptide. In other embodiments,
the nucleic acid that
encodes Vpr or a functional fragment thereof is administered to the individual
in a sepaxate
formulation than the nucleic acid encoding the desired polypeptide. In some
embodiments, the
formulation containing the nucleic acid that encodes Vpr or a functional
fragment thereof is
administered to the individual at the same time as the formulation containing
the nucleic acid
encoding the desired polypeptide. In a preferred embodiment of the present
invention, the nucleic
acid that encodes Vpr or a functional fragment thereof and the desired
polypeptide are encoded
by the same nucleic acid which is a genome of an immunogenic vector. In some
embodiments,
the nucleic acid that encodes Vpr or a functional fragment thereof is
administered free of an
immunogenic vector that encodes a desired polypeptide.
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
In some embodiments, the Vpr coding sequence is delivered separately from or
free of
an immunogenic vector. Compositions and methods for delivering proteins to
cells by direct
DNA administration have been reported using a variety of protocols. Examples
of such methods
are described in U.S. Patent No. S,S93,972, U.S. Patent No. 5,739,118, U.S.
Patent No.
S,S80,8S9, U.S. Patent No. S,S89,466, U.S. Patent No. 5,703,OSS, U.S. Patent
No. 5,622,712,
U.S. Patent No. S,4S9,127, U.S. Patent No. 5,676,954, U.S. Patent No.
5,614,503, and PCT
Application PCT/US9S/12502, which are each incorporated herein by reference.
Compositions
and methods for delivering proteins to cells by direct DNA administration are
also described in
PCT/US90/O1 S 1 S, PCT/LTS93/02338, PCT/US93/04813 l, and PCT/US94/00899,
which are each
incorporated herein by reference. In addition to the delivery protocols
described in those
applications, alternative methods of delivering DNA are described in U.S.
PatentNos. 4,94S,OS0
and 5,036,006, which are both incorporated herein by reference. Nucleic acid
molecules can also
be delivered using liposome-mediated DNA transfer such as that which is
described in U.S.
Patent No. 4,235,871, U.S. Patent No. 4,241,046 and U.S. Patent No. 4,394,448,
which are each
incorporated herein by reference.
Formulations comprising an immunogenic vector comprising the nucleic acid
having a
sequence encoding the desired polypeptide are made up according to the mode
and site of
administration. Such formulation is well within the skill in the art. In
addition to nucleic acids
and optionally polypeptides, the formulation may also include buffers,
excipients, stabilizers,
carriers and diluents.
The pharmaceutical composition comprising Vpr protein or a fragment thereof
and a
pharmaceutically acceptable carrier or diluent may be formulated by one having
ordinary slcill
in the art with compositions selected depending upon the chosen mode of
administration.
Suitable pharmaceutical carriers are described in the most recent edition of
~Re~zi~gtoh's
Pharmaceutical Sciences, A. Osol, a standard reference text in this field,
which is incorporated
herein by reference.
For parenteral administration, the Vpr protein can be, for example, formulated
as a
solution, suspension, emulsion or lyophilized powder in association with a
pharmaceutically
acceptable parenteral vehicle. Examples of such vehicles are water, saline,
Ringer's solution,
dextrose solution, and S% human serum albumin. Liposomes and nonaqueous
vehicles such as
fixed oils may also be used. The vehicle or lyophilized powder may contain
additives that
16
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
maintain isotonicity (e.g., sodium chloride, mannitol) and chemical stability
(e.g., buffers and
preservatives). The formulation is sterilized by commonly used techniques. For
example, a
parenteral composition suitable for administration by injection is prepared by
dissolving 1.5%
by weight of active ingredient in 0.9% sodium chloride solution. a
The pharmaceutical compositions comprising Vpr protein, or fragments thereof
may be
administered by any means that enables the active agent to reach the agent's
site of action in the
body of a mammal. Because proteins are subject to being digested when
administered orally,
parenteral administration, i.e., intravenous, subcutaneous, intramuscular,
would ordinarily be
used to optimize absorption.
The dosage administered varies depending upon factors such as: pharmacodynamic
characteristics; its mode and route of administration; age, health, and weight
of the recipient;
nature and extent of symptoms; kind of concurrent treatment; and frequency of
treatment.
Usually, a daily dosage of Vpr protein can be about 0.1 to 100 milligrams per
kilogram of body
weight. Ordinarily 0.5 to 50, and preferably 1 to 10 milligrams per kilogram
per day given in
divided doses 1 to 6 times a day or in sustained release form is effective to
obtain desired results.
Another aspect of the present invention relates to pharmaceutical compositions
that
comprise a nucleic acid molecule that encodes Vpr and a pharmaceutically
acceptable carrier or
diluent. According to the present invention, genetic material that encodes Vpr
protein is
delivered to an individual in an expressible form. The genetic material, DNA
or RNA, is taken
up by the cells of the individual and expressed. Vpr that is thereby produced
can inhibit immune
responses, either those directed at an immunogenic vector or another
undesirable immune
response such as those associated with autoimmune and inflammatory disease and
conditions and
transplantation procedures. Thus, pharmaceutical compositions comprising
genetic material that
encodes Vpr are useful in the same manner as pharmaceutical compositions
comprising Vpr
protein. Vpr or. nucleic acid molecule with a Vpr coding sequence may be
incorporated into an
immunogenic vector.
Nucleotide sequences that encode Vpr protein operably linked to regulatory
elements
necessary for expression in the individual's cell may be delivered as
pharmaceutical compositions
using a number of strategies which include, but axe not limited to, either
viral vectors such as
adenovirus or retrovirus vectors or direct nucleic acid transfer. Methods of
delivery of nucleic
acids encoding proteins of interest using viral vectors axe widely reported. A
recombinant viral
17
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
vector such as a retrovirus vector or adenovirus vector is prepared using
routine methods and
starting materials. The recombinant viral vector comprises a nucleotide
sequence that encodes
Vpr. Such a vector is combined with a pharmaceutically acceptable carrier or
diluent. The
resulting pharmaceutical preparation may be administered to an individual.
Once an individual
is infected with the viral vector, Vpr is produced in the infected cells.
Alternatively, a molecule which comprises a nucleotide sequence that encodes
Vpr can
be administered as a pharmaceutical composition without the use of infectious
vectors. The
nucleic acid molecule may be DNA or RNA, preferably DNA. The DNA molecule may
be linear
or circular, it is preferably a plasmid. The nucleic acid molecule is combined
with a
pharmaceutically acceptable carrier or diluent.
According to the invention, the pharmaceutical composition comprising a
nucleic acid
sequence that encodes Vpr protein may be administered directly into the
individual or delivered
ex vivo into removed cells ofthe individual which are reimplanted after
administration. By either
route, the genetic material is introduced into cells which are present in the
body of the individual.
Preferred routes of administration include intramuscular, intraperitoneal,
intradermal and
subcutaneous injection. Alternatively, the pharmaceutical composition may be
introduced by
various means into cells that are removed from the individual. Such means
include, for example,
transfection, electroporation and microprojectile bombardment. After the
nucleic acid molecule
is taken up by the cells, they are reimplanted into the individual.
The pharmaceutical compositions according to this aspect of the present
invention
comprise about 1 ng to 1 Omg of nucleic acid in the formulation; in some
embodiments, about 0.1
to about 2000 micrograms of DNA. In some preferred embodiments, the
pharmaceutical
compositions contain about 1 to about 1000 micrograms of DNA. In some
preferred
embodiments, the pharmaceutical compositions contain about 1 to about 500
micrograms of
DNA. In some preferred embodiments, the pharmaceutical compositions contain
about 25 to
about 250 micrograms of DNA. Most preferably, the pharmaceutical compositions
contain about
100 micrograms DNA.
The pharmaceutical compositions according to this aspect of the present
invention axe
formulated according to the mode of administration to be used. One having
ordinary skill in the
art can readily formulate a nucleic acid molecule that encodes Vpr. In cases
where injection is
the chosen mode of administration, a sterile, isotonic, non-pyrogenic
formulation is used.
18
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
Generally, additives for isotonicity can include sodium chloride, dextrose,
mannitol, sorbitol and
lactose. Isotonic solutions such as phosphate buffered saline are preferred.
Stabilizers include
gelatin and albumin.
Regulatory elements for nucleic acid expression include promoters, initiation
codons, stop
codons, and polyadenylation signals. It is necessary that these regulatory
elements be operably
linked to the sequence that encodes the desired polypeptides and optionally
the Vpr polypeptide
and that the regulatory elements are operable in the individual to whom the
nucleic acids are
administered. For example, the initiation and termination codons must be in
frame with the
coding sequence. Promoters and polyadenylation signals used must also be
functional within the
cells of the individual.
Examples of promoters useful to practice the present invention include, but
are not
limited to, promoters from Simian Virus 40 (SV40), Mouse Mammary Tumor Virus
(MMTV),
Human hnmunodeficiency Virus (HIV) such as the HIV Long Terminal Repeat (LTR)
promoter,
Moloney marine leukemia virus (M-MuLV), avian leukosis virus (ALV),
Cytomegalovirus
(CMV) such as the CMV immediate early promoter, Epstein Barn Virus (EBV), Rous
Sarcoma
Virus (RSV), as well as promoters from human genes such as human actin, human
myosin,
human hemoglobin, human muscle~creatine kinase (MCI~), and human
metallothionein.
Examples of polyadenylation signals useful to practice the present invention
include, but
are not limited to, SV40 polyadenylation signals and retroviral LTR
polyadenylation signals. In
particular, the SV40 polyadenylation signal which is in pCEP4 plasmid
(Invitrogen, San Diego
CA), referred to as the SV40 polyadenylation signal, is used.
EXAMPLES
Example l: IiIV-1 Vpr Suppresses CC Chemokines and Compromises CD8+ Effector
Function in vivo.
Methods
Effect of Vpr on cell surface molecules assessed by flow cytometry:
Recombinant Vpr protein
containing supernatant and control supernatants were prepared and the
concentration of Vpr in
the supernatant was determined by Levy et al., 1995, J. Virol., 69:1243-1252,
which is
incorporated herein by reference. Normal human peripheral blood mononuclear
cells (PBMC)
were purified by standard Ficoll-Hypaque and the lymphocytes were stimulated
with 5 ~.g/mL
19
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
of phytohemagglutinin (PHA) and then treated with different concentrations of
Vpr protein.
Twenty-four and 48 hours post treatment, 2 x 105 cells were stained with
fluorescein
isothiocyanate- (FITC) or phycoerythrin- (PE) labeled monoclonal antibodies
(mAbs) to human
CD3, CD4, CDB, CD25, CD28, CD40, CD45RA, CD80, CD86, HLA-DR, and CTLA-4
(Pharmingen, San Diego, CA), followed by washes in phosphate-buffered saline
(PBS). Cells
were fixed with 2% paraformaldehyde and analyzed by a fluorescence activated
cell sorter
(FAGS) (Becton-Dickinson, CA).
Effect of Vpr on [3-chemokine production and chemokine receptor CCR-S: Normal
human
PMBCs were stimulated with 5 ~,g/mL of PHA and then treated with different
concentrations of
Vpr.protein. Twenty-four and 48 hours post treatment, supernatants were
collected and assayed
for (3-chemokine production by ELISA using a combination of capture and
detection antibodies.
Recombinant proteins (standards) and capture and detection antibodies were
purchased from
Intergen (Purchase, N~, and the assay was performed according to the
manufacturer's
instructions. Vpr-treated cells were analyzed fox CCR-5 expression by double-
staining with anti-
Mac and anti-CCR-5 mAbs purchased from Pharmingen (San Diego, CA). Cells were
analyzed
by FACS and the data were processed using Cell Quest Software (Becton
Dickinson, CA).
Results
Figures 1 A, 1 B, 1 C, l D, 1 E and 1 F show the effect of treatment with Vpr
on cell subsets.
Figures 1A, 1B, 1C and 1D show a 50% reduction in the number of CD8+ T cells
expressing
CD28, CD45RA, and HLA-DR following treatment with 40 pg/mL Vpr. Figures 1 E
and 1 F
show a significant reduction in the number of CD8+ T cells expressing
activation marker CD25
(IL-2R) following treatment of activatedperipheral blood mononuclear cells
(PBMCs) with Vpr.
Figures 2A, 2B, 2C, 2D and 2E show the effect of treatment with Vpr on PBMCs.
Figures 2A, 2B and 2C show that treatment with Vpr decreases the secretion of
MIP- I a, MIP-1 (3,
and RANTES. Figures 2D and 2E shows that Vpr treatment of PBMCs increased the
expression
of the chemolcine receptor CCR-5 significantly.
Figure 3 depicts MIP-1 a production in splenocytes from mice immunized with
pNef with
or without co-immunization ofpVpr. Splenocytes from mice co-immunized with
pNef and pVpr
produced significantly less MIP-la than did splenocytes from mice immunized
with pNef and
control vector.
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
Example 2: Vpr Specifically Interferes with the Induction of Cell-Mediated
Immune
Responses ih vivo.
To investigate the effect of Vpr on immune activation in vivo, a DNA vaccine
model
system was used. DNA immunization has been used to induce immune responses to
foreign
antigens of interest i~c vivo through inoculation of the host with plasmids
encoding pathogens or
tumor antigens (Tang et a1.,1992, Nature, 356:152-4; Ayyavoo et a1.,1997,
AIDS,11:1433-44;
Kim et al., 1998, Oncogene,17:3125-35, each of which is incorporated herein by
reference). 1~
vivo injection of plasmid results in protein production in local transfected
muscle cells as well
as in directly transfected APCs (Kim et al., 1998, supra; Chattergoon et al.,
1998, J. Immunol.,
160: 5707-5718; Manickan, 1997. J. Leukoc. Biol., 61:125-132; Condom 1996,
Nat. Med., 2:
1122-1128, each of which is incorporated herein by reference). This technique
elicits both
humoral and cellular responses to the specific immunizing antigens in aumal
models and
humans (Letvin et al., 1997, Proc. Natl. Acad. Sci. USA, 94: 9378-9383;
Torres, et al., 1999,
Vaccine, 18: 805-814; Boyer et al., 1999, Clin. Immunol., 90: 100-107, each of
which is
incorporated herein by reference). To investigate Vpr modulation of immune
activation ih vivo,
mice were co-immunized with different HIV-1 plasmid encoded antigens in the
presence and
absence of Vpr plasmid and measured the immune responses (cellular and
humoral) induced by
the immunizing antigen. The results demonstrate that Vpr specifically
interferes with the
induction of cell-mediated immune responses ih vivo. Furthermore, Vpr
specifically iWibited
the synthesis of prototypic Thl type cytokines and shifted the antibody
response towards a Th2
type bias. Further studies demonstrated that Vpr either as recombinant protein
or as virion-
associated molecule down regulated the expression of CD40 and CD80, but not CD
11 a
supporting that Vpr specifically interferes with costimulatory molecules
involved in immune
activation. These data support that in vivo Vpr can specifically and
significantly interfere with
the development of antigen specific immunity.
Materials and Methods
Cells: HeLa, RD, and NIH3T3 cells, obtained from the American Type Culture
Collection
(ATCC, Manassas, VA), were grown in monolayers, at 37 ° C in 5% CO2, in
Dulbecco's modified
Eagle's medium (DMEM),10% fetal bovine serum (FBS),1 % penicillin, 1 %
streptomycin and
1% L-glutamine. P815 cells, obtained from ATCC, were maintained as suspension
cultures in
RPMI 1640, 10% FBS, 1% penicillin, 1% streptomycin and 1% L-glutamine, at
37°C with 5%
21
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
CO2.
Macrophage preparation: BALB/c (female, 8-week old) mice were injected with
RPMI 1640
and the peritoneal macrophages were isolated by lavage method (Shiratsuchi et
al., 1998,
Biochem. Biophys. Res. Commun., 246:549-555, which is incorporated herein by
reference).
The cells in the fluid were collected by centrifugation, washed with Hank's
balanced salt solution
(Life Technologies Inc. Rockville, MD), and cultivated in a 6 well plate with
RPMII640
medium, containing 10 mM Hepes (pH 7.0). Non-adherent cells were washed out of
the plate,
and the remaining adherent cells were removed from the plate and analyzed for
surface antigen
expression by FACS analysis.
Cloning and expression of DNA vaccine constructs: Plasmids expressing HIV-1
antigens Vpr,
Nef, Gag-pol and Vif were constructed using appropriate polymerase chain
reaction (PCR)
primers as described (Ayyavoo, et al., 1997 , supra, and Mahalingam et al.,
1997, J. Virol.,
71:6339-6347, which are incorporated herein by reference). All the plasmids
were sequenced
to verify the coding region, and further analyzed for protein expression by
immunoprecipitation
using specific antibodies. To further examine the expression and trafficking
of Vpr antigen in
vivo, we have fused Vpr in frame with green fluorescent protein (GFP) and
cloned vp~-GFP into
a eukaryotic expression vector as described (Muthumani et al., 2000, DNA Cell
Biol., 19:179-
188, which is incorporated herein by reference).
Mice: BALB/c female mice, aged 6-8 weeks, were purchased from Haxlan Sprague
Dawley, Inc.,
(Indianapolis, IN). The mice were housed in a temperature-controlled, light-
cycled room, as per
the guidelines of National Institutes of Health and the University of
Pennsylvania.
DNA inoculation: A facilitated DNA inoculation protocol which results in
increased protein
expression levels from plasmid-delivered genes in vivo was utilized.
Specifically, the quadriceps
muscles of BALB/c mice were injected with 100 ~.l of 0.25% bupivacaine-HCL
(Sigma, MO)
using a 27-gauge needle. Forty eight hours later, 100 qg of the DNA construct
of interest, in
PBS, was injected into the same region of the muscle as the bupivacaine
injection. Mice were
given one injection followed by a boost two weeks later. Two weeks after the
second injection,
half of the mice in each group were sacrificed for their spleens, and the
remaining mice were
given a second boost with the appropriate DNA construct.
In vivo expression of Vpr by immunostaining: Eight- to ten-week-old BALB/c
mice were
immunized with 100 ~g of Vpr-GFP expression plasmid (pcVpr-GFP) or control
vector
22
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
(pcDNA3) as described above. Three days post inj ection mice were sacrificed
and the quadriceps
muscle and regional lymph node (popliteal & inguinal femoral) were removed.
Muscle and
lymph nodes were cryopreserved and 0.2 micron sections were prepared for
staining. Staining
for Vpr was performed on frozen tissue sections by fixing them with methanol
at room
temperature for 30 minutes, blocked and incubated for 90 minutes with Vpr-
specific antiserum
(1:100) or pre-immune serum. After washing with PBS, the sections were
incubated for 90
minutes with PE-conjugated affinty purified F(ab)'2 fragment of goat anti-
rabbit IgG (ICN
Biochemicals, CA) diluted at 1:500 in PBS. Slides were washed with PBS,
stained with DAPI
(0.1% in PBS; Sigma, St. Louis, MO), washed again, and mounted using a fade-
resistant
mounting medium (Ted Pella Inc., Redding, CA). All incubations were carried
out at 37°C in
a humidification chamber. Hematoxylin and eosin (H&E) staining was performed
as described
(T.C. Sheehem and B.B. Hrapchak, 1980, Theory and Practice of Histotechnology,
St. Louis,
MO, C.B. Mosby Co., which is incorporated herein by reference).
Cytotoxic T lymphocyte assay: Recombinant vaccinia viruses (vMN462, vVl~l,
VV:gag,
vTFnef, vSCB) were obtained from the NIH AIDS Research and Reference Reagent
Program and
P815 cell line was obtained from ATCC. A five hour 5'Cr release assay was
performed using
vaccinia-infected targets. The effectors were stimulated for 24 hours with Con
A (Sigma, MO)
at 2 ~,g/ml concentration followed by specific stimulation with vaccinia-
infected P815 cells,
which were fixed with 0.1% glutaraldehyde for 2-3 days. A standard chromium
release assay
was performed in which the target cells were labeled with 100 ~Ci/ml Na2
S'Cr04 for 2 hours and
incubated with the stimulated effector splenocytes for 6 hours at 37 °
C. CTL activity was
determined at effectoraarget (E:T) ratios ranging from 50:1 to 5:1. Percent
specific lysis was
determined from the formula:
100X {experimental release - spontaneous release/ maximum release -
spontaneous release}.
Maximum release was determined by lysis of target cells in 1% Triton X-100
containing
medium.
EI~ISA: Fiftymicroliters ofrecombinantNef (Intracel, MA) or purified prostate
specific antigen
(PSA) protein (Fitzgerald Industries, MA) diluted in 0.1 M carbonate-
bicarbonate buffer (pH 9.5)
to 2 ~g/ml concentration was adsorbed onto microtiter wells overnight at
4°C as described (Kim
et al., 1998, supra). Mouse sera (pre-immune and post-immune) were diluted and
incubated for
1 hour at 37 °C, then incubated with horseradish peroxidase (HRP)-
conjugated goat anti-mouse
23
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
IgG (Sigma, MO). The plates were washed and developed with 3'3'5'5' TMB buffer
and the
plates were read at OD4so~
Effect of virion-associated Vpr on mouse peritoneal macrophages: To assess the
effect of
Vpr on APCs, we infected mouse macrophages with amphotropic pseudotype viruses
either
containing or lacking Vpr. Constructs pNL43 R+E-, pNL43 R E- and pV SV-G-Env
were obtained
from NIH AIDS RRRP, which are contributed by Dr. Landau. Virus preparation was
done by
cotransfecting RD cells with pVSV-G-Env and pNL43.HSA.R E- or pNL43.HSA.R+E-.
Seventy
two hours post transfection supernatant was collected, concentrated and
assayed for virus
production by measuring p24 antigen production. Cells were infected with 10 pg
p24 antigen
equivalents ofviruses (Akkina et al.,1996, J. Virol., 70:2581-2585, which is
incorporated herein
by reference). VSV-G-Env-complemented pseudotype viruses infect macrophages in
single
round infection, which allows the study of the virion-associated Vpr-mediated
effects. Forty
eight hours post infection cells were analyzed for the expression of
costimulatory molecules
(CD40, CD80) and surface antigens (CDll la) as described below.
Multicolor Flow Cytometry Analysis: Single cell suspensions were washed in PBS
(pH 7.2)
containing 0.2% bovine serum albumin and 0.1 % NaN3. Cells were incubated with
goat IgG to
block binding of Ig to FcyR and stained with FITC-, PE- or Cy5-labeled
antibodies and IgG
control antibody for 60 minutes. Cells were washed with PBS and fixed with 2%
paraformaldehyde and analyzed using a fluorescence activated cell sorter
(Becleton-Dickinson,
CA). FITC-, PE- or Cy5-labeled mouse mAbs to CD 1 I a, CD80 and CD40 were
purchased from
PharMingen, CA and Coulter, FL. Data were analyzed using CELL Quest program
(Beclcton-
Dickinson, CA).
Results
Effect of Vpr on mouse cells: The effect of Vpr on immune activation ih vivo
was examined
using a mouse model. Although Vpr is known to alter the cell cycle events in
human cells of
different lineages, it is important to demonstrate that HIV-1 Vpr can exert
similar effects in
marine cells. Both HeLa (human) and NIH3T3 (mouse) cells were transfected with
Vpr
expression plasmids and compared for Vpr subcellular localization and its
ability to inhibit cell
proliferation. HeLa and NIH3T3 cells, maintained in Dulbecco's Modified
Eagle's medium
(DMEM) containing 10% FBS, were transfected with a CMV Vpr expression plasmid
or a
control vector plasmid. Localization of Vpr was detected by indirect
immunofluorescence as
24
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
described in the methods. Results of the subcellular localization of Vpr in
human and marine
cells by indirect immunofluorescence assay indicate a similar Vpr localization
pattern in both
human and marine cells. HeLa and NIH3T3 cells were transfected with HIV-1-Vpr
expression
vector, stained with anti-Vpr antibody followed by PE-conjugated goat anti-
rabbit secondary
antibody. The same fields were stained by DAPI (nuclear) staining. In an
effort to further
confirm whether Vpr exhibits a similar localization pattern in mouse primary
cells, mouse
peritoneal macrophages were infected with HIV-1 complemented with VSV-G-Env
and stained
for Vpr localization. Results of the subcellular localization of virion-
associated Vpr mouse
peritoneal macrophages indicate that in mouse primary cells Vpr showed a
nuclear localization
pattern similar to that in human primary cells. Mouse peritoneal macrophages
(4 x 106 cells)
were isolated and infected with VSV-G-Env complemented HIV-1 vp~+ and HIV-1
vp~ viruses.
Infected cells containing virion-associated Vpr were visualized by indirect
immunofluorescence
using Vpr-specific antibody and photographed under FITC filter.
In addition to the cellular localization of Vpr in human and mouse cells, the
effect of Vpr
for one of its well-characterized biological functions, cell-cycle arrest was
also tested. The ability
of different Vpr molecules (which differ in their biological function) to
inhibit cell proliferation
in human and marine cell lines was tested. The results are shown in Table 1.
These results
indicate that Vpr molecules modulate cell proliferation in both human and
marine cell lines in
a similar manner, suggesting that Vpr exerts similar effects on the basic
cellular machinery of
each cell type. Taken together, the localization and cell proliferation
analyses in these two cell
lines support the appropriateness of a marine model for further in vivo immune
studies.
~n vivo expression of Vpr in mouse tissues: Six- to ten-week-old mice were
immunized with
50 qg of Vpr-GFP expression plasmid, GFP expression plasmid, or the control
vector plasmid
in quadricepts muscle. Mice were sacrificed after 72 hours and the quadricepts
muscle and the
regional lymph node were removed and frozen in OCT (Vector Laboratories Inc.,
CA). The
frozen sections were cut into 0.2 micron sections and expression of Vpr-GFP
was visualized
directly by fluorescence microscopy under the FITC filter. Results demonstrate
that expression
of Vpr is detected in both the muscle and in the regional lymph node.
The expression and localization of Vpr ih vivo was evaluated. Mice were
immunized into
the right quadriceps muscles with pVpr-GFP, pGFP or pcDNA3 vector plasmid.
Three days post
immunization, mice were sacrificed and the right quadriceps muscle was frozen
in OTC and
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
sectioned. Sections were viewed directly and photographed for Vpr-GFP
expression using FITC
filter. Slides from control vector; GFP plasmid; and pVpr-GFP immunized mice
muscle sections
were compared at 40X magnification. In muscle sections Vpr-GFP showed a
dramatic and
distinct nuclear staining comparable to GFP staining. As expected, staining
with pre-immune
sera or staining of sections from the control vector-immunized mice did not
show any specific
staining. These results indicate that in vivo expression of Vpr does result in
nuclear localization
in the muscle fiber of a living animal as expected.
The expression and distribution of Vpr in inguinal lymph nodes in vivo was
evaluated.
Mice were immunized into the right quadriceps muscle with pVpr-GFP. Five days
post
immunization, mice were sacrificed and the popliteal and inguinal lymph nodes
proximal to the
site of injection were harvested and sectioned. Sections were viewed directly
under FITC filter
for Vpr-GFP expression and photographed. The same section was counter stained
with anti-Vpr
antibodies followed by PE-conjugated goat anti-rabbit secondary antibody. To
identify the cell
types expressing Vpr-GFP, adjacent section was stained with hematoxylin and
eosin.
DNA immunization results in migration of transfected local APCs to the
regional lymph
node to present antigen to T cells. To identify the cells expressing Vpr
antigen in the lymphoid
organ (lymph node) in vivo further studies were performed. Direct
visualization of Vpr-GFP was
performed in lymph node sections obtained from pVpr-GFP inoculated mice.
Furthermore, to
confirm the specificity of stained cells, we also performed immunofluorescence
using specific
anti-Vpr antibody or pre-immune sera followed by PE-conjugated anti-rabbit
IgG. Further
analysis of antigen expressing cell types by H&E staining from these lymph
node sections
indicates that most of the cells expressing Vpr antigen axe ACPs.
Effect of Vpr on lymphocyte recruitment and immune activation ih vivo: Inj
ection of antigen
expression cassettes can result in lymphocyte infiltration at the site of
injection. Ten-week-old
BALB/c mice were co-immunized with a Vpr expression plasmid (pVpr) and
different HIV-1
antigen immunization constructs (pGag or pNef). As an example of responses
observed with
these antigens, pNef immunization in muscle resulted in significant
infiltration of lymphocytes
and macrophages at the immunization site.
The results shown in Figure 4 axe of immunohistochemical analysis of
lymphocyte
infiltration at the site of antigen expression. Frozen muscle sections from
naive, pNef, and pNef
plus pVpr immunized mice (n=4) were prepared seven days post immunization and
stained with
26
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
anti-CD4 (CD4) and anti CD8 (CD8) antibodies. Row H&E represents the sections
stained with
hematoxylin and eosin stain for visualization of infiltrating lymphocytes. The
nuclei are shown
in blue and the cytoplasm is shown in red stain; CD4 and CD8 indicate the
sections stained with
anti-CD4 or anti-CD8 antibodies. The positive cells are stained brown and the
number of
positive cells is indicated inside each panel. Five panels were examined for
each staining for
each experiment. Similar results were obtained in multiple experiments. In
order to determine
whether Vpr interferes with the trafficking and recruitment of lymphocytes to
the inflammatory
site, we analyzed muscle sections of mice immunized with pNef in the presence
or absence of
pVpr on day 7 as described in methods. Figure 4, row H&E shows that the number
of infiltrating
lymphocytes is much higher in mice immunized with pNef alone or pNef and
control plasmid,
whereas, pVpr co-immunization reduced lymphocyte infiltration dramatically. To
further
delineate the effect of pVpr on CD4+ versus CD8~ cells, specific
immunohistochemical staining
was performed as shown for CD4 and CD8 cells. The CD4: CD8 ratio was
determined by
averaging 5 different fields (20X magnification). The CD4:CD8 ratio is lower
in pNef
immunized mice (2:1 ) compared to pVpr co-immunization (3 :1 ). Similar
results were observed
with pGag and pVpr co-immunization also. Overall, it is clearly evident that
both T cell
populations were affected by pVpr co-immunization.
Vpr modulates the antigen-driven CD8+ mediated cytotoxic T lymphocyte (CTL)
response:
To investigate whether a correlation exists between the Vpr-mediated effects
on T cell
xecruitment and cellular immunity, splenocytes collected from mice co-
immunized with HIV-1
antigen plasmids and Vpr plasmid were assayed for antigen specific CTL
activity. Nef specific
CTL activity measured in pNef and pVpr co-immunized mice was suppressed
significantly in
comparison to mice immunized with pNef alone. The results are shown in Figures
SA, SB, SC
and SD which show cytotoxic T lymphocyte response induced by pNef or pGag-Pol
in the
presence or absence of pVpr co-immunization. BALB/c mice were immunized with
100 ~,g of
pNef and control vector or 100 p.g of pNef and pVpr. Splenocyctes were
obtained from the mice
(n=4) 2 weeks after the first and second boost and antigen specific CTL assay
was performed in
a 6 hour SICr release method. The graphs represent the percentage of specific
lysis induced by
subtracting the non specific lysis measured by assay using the target cells
infected with control
recombinant vaccinia. Figures SA and SB represent the specific lysis (%)
induced by pNef
vaccine in the presence or absence of pVpr co-immunization, two weeks after
first and second
27
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
boost, respectively. Figures SC and SD are the same described above except
here the antigen
expression plasmid is pGag-Pol instead of pNef. These studies were repeated 4
times with
similar results. Mice immunized with pNef and control vector exhibited 37% and
53% specific
lysis at a 50:1 effector: target ratio after the second and third injections,
respectively. In contrast,
mice receiving equal amounts of pNef and pVpr resulted in less than 17% and
19% specific lysis
at a 50:1 effector: target ratio after second and third immunizations,
respectively. Similar results
were observed after co-immunization of pGag-Pol with pVpr. This finding
supports that the
immune suppressive effect of Vpr is not dependent on anyparticular antigen. To
further examine
the specificity of the Vpr effect, we co-immunized mice with pNef and pGag-Pol
and pNef and
pEnv and assayed again for Nef specif c CTL activity. Results indicate that
neither pGag-Pol nor
pEnv had any effect on Nef specific CTL activity, indicating that decreased
CTL activity was
mediated specifically and solely by Vpr. Furthermore, co-immunization of pVpr
with pNef or
pGag-Pol results in similar inhibition of antigen specific CTL responses
suggesting that Vpr as
a cell associated/cell free molecule or as a virion-associated molecule
mediates the same effect
in vivo.
The pattern of cytokine expression influences the nature and persistence of
the
inflammatory response. For instance, production of IFN-y and TNFa, axe well
suited to enhance
cellular immunity, whereas IL-4 and IL-10 are important for humoral immunity.
The ih vivo
effects of Vpr on the release of the cytokines IL-4 and IFN-~y from antigen
stimulated splenocytes
collected from immunized mice was examined. Figures 6A and 6B show cytokine
production
in splenocytes obtained from mice co-immunized with pNef in the presence and
absence of pVpr.
Splenocyctes harvested from mice immunized with pNef with or without pVpr were
stimulated
with P 815 cells infected with vaccinia expressing Nef (vTFnef) for 2 days.
Cell-free supernatants
were collected and assayed for the production of IL-4 and INF-y by capture
ELISA following the
manufacturer's instructions (Intracel, MA). Figures 6A and 6B show that
splenocytes of mice
co-immunized with pVpr and pNef and stimulated with specific antigen produced
significantly
less IFN-y compared to mice immunized with pNef and control vector. In
contrast, no change
was observed in IL-4 production in either group. Mice immunized with pNef in
the presence of
pVpr produced five fold less IFN-~y (19.9 pg/ml), whereas mice immunized with
pNef and control
vector produced 95.3 pg/ml of IFN-y. Tn parallel with recent i~ vitr°o
studies that treatment of
PBMCs with Vpr suppressed production of certain cytokines (IL-2, IL-12, TNFa),
this study
28
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
provides the first in vivo evidence that the Vpr-mediated immunosuppressive
effect is targeted
in particular at Thl-mediated cellular immunity.
Effect of Vpr on humoral responses: Since co-immunization of pVpr resulted in
down-
regulation of CTL responses, the effect of Vpr on humoral responses was also
tested by
measuring Nef specific antibodies elicited by pNef immunization in the
presence or absence of
pVpr by ELISA. Figures 7A and 7B show the effect of pVpr on humoral responses
generated
by different antigens. Mice (n=4) were co-immunized with 100 ~,g pNef or pPSA
and 100 ~,g
of control vector or pVpr intramuscularly at day 0 and boosted on day 14 and
again on day 28.
The sera samples were collected at 0 and 28 days post immunization and assayed
for anti-Nef
(Figure 7A) and anti-PSA (Figure 7B) specific antibodies at different
dilutions. The O.D. values
of the pre-immune sera were subtracted from the post-immune sera to account
for non-specific
binding. These experiments were repeated 3 times with similar results. As
shown in Figure 7A,
co-immunization of pVpr with pNef did not alter the Nef specific antibody
titers. Since, pNef
by itself does not induce a very high titered antibody response, a plasmid
encoding prostate
specific antigen (pPSA) which generated a significantly higher humoral
response was selected.
Mice were immunized with pPSA in the presence of pVpr or control plasmid. The
sera from the
immunized animals were analyzed for the presence of PSA-specific antibodies by
ELISA. The
results presented in Figure 7B show that pPSA alone or in the presence of pVpr
induce similar
titered antibody responses. The O.D. value for pPSA with vector control or
pPSA with pVpr was
0.707 and 0.69, respectively, at a serum dilution of 1:128, which titers
accordingly with higher
sera dilutions. To reconcile this result with the effects of Vpr on CD8 cell
function, antibody
subsets as an indicator of the Thl vs Th2 phenotype were examined. The
relative ratios of IgGl
to IgG2a and IgG2a to IgGl were determined in the presence or absence of pVpr
coin] ection and
are shown in Table 2. The pPSA immunized group had a IgG2a/IgGl ratio of 0.8.
On the other
hand, coinjection of pVpr decreased the relative ratio to 0.2, indicating a
shift towards a Th2
response. The 4-fold reduction seen in IgG2a/IgGl ratio with pVpr coinjection
indicates that Vpr
significantly affects the Thl type response.
Effect of. Vpr on expression of costimulatory molecules of APCs associated
with T cell
activation: The generation of a T cell immune response is a complex process
that requires the
engagement of T cells with professional APCs. APCs (including B cells,
macrophages and
dendritic cells) drive antigen-specific immune responses through the up
regulation of CD40,
29
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
CD80, and CD86 costimulatory molecules as they interact with T cells during
initial activation
events. To examine Vpr effects on APCs; mouse peritoneal macrophages were
infected with
VSV-G-Env-complemented HIV-1 vp~+ virus or HIV-1 vp~ virus, and the effect of
Vpr on
costimulatory molecule expression, using an equal number of live cells from
both groups was
examined. Figures 8A, 8B, 8C, and 8D show the effect of Vpr, as a virion-
associated molecule,
on the expression of costimulatory molecules on antigen presenting cells.
Mouse peritoneal
macrophages (4 x 106 cells) were infected with VSV-complemented HIV-1 vp~+
virus or HIV-1
vp~' virus. Two days post infection equal number of cells (1 x 106) were gated
for GFP and their
expression of CD40 and CD80 was determined. Vpr+ represents macrophages
infected with
HIV-1 vp~+ virus, and Vpr represents macrophages infected with HIV-1 vpr~
virus. These
experiments were repeated 3 times and similar results were obtained. The
percentage of cells
expressing the respective antigens is shown in each panel. As shown in Figures
8A, 8B, 8C, and
8D, the presence of virion-associated Vpr specifically lowered expression of
CD40 and CD80
molecules compared to the HIV-1 vp~ virus infected cells. However, expression
of CD1 1b (a
macrophage marker) is not affected suggesting that Vpr interferes specifically
with costimulatory
events. Vpr induced down regulation of these important costimulatory molecules
supports that
Vpr interferes with early activation events critical for immune induction.
Discussion
In this study, the role of Vpr, a virion-associated HIV-1 protein, on immune
activation
was examined. To address the effect of Vpr on host immunity ih vivo, we used
the DNA
vaccination model system. In vivo co-immunization results in multiple plasmids
being delivered
and expressed together in cells in vivo and the expressed foreign antigens are
in part taken up by
local professional APCs including macrophages and dendritic cells (DCs)
through direct
transfection mechanisms. Macrophages process the aritigen(s) and effectively
induce specific
immune response to foreign antigens. These studies demonstrate that expression
of Vpr can
effectively decrease CTL effector function of a co-expressed antigen in vivo.
In support it was
also observed that Vpr inhibits expression of costimulatory molecules on APCs.
These date
support that Vpr targets CTL effector function at least in part by interfering
with costimulatory
molecule expression APCs. Combined with effects on cytokines, these Vpr
mediated events
would compromise in particular local T cell activation, expansion and T cell
survival. Such
compromise would be expected to benefit the virus at the ultimate expense of
the host. This
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
hypothesis is supported by the data presented here.
Vpr in vivo effects are likely to contribute to an impairment of a localized
targeted
cellular immune response. Expansion of HIV-1 antigen-specific, CD4~ T
lymphocytes results
in effective maintenance of the immune system and contributes to control of
viremia. The
presence of a virus-specific, CD8+ T cell response is essential for virus
clearance in many viral
infection models. Additionally, CD8+ T cells can inhibit HIV-1 replication in
vitro. Recent
evidence suggests that CD8+ T cells can contribute significantly to control
viral load in vivo. The
reduction in the number of CD8+ T cells in HIV-1 infected patients has been
correlated with
reduced anti-viral effect and disease progression in parallel with the
deterioration of the immune
system. 11~ this respect, the data presented here provide ih vivo evidence
that CD8 effector
function is a target of HIV-1 Vpr.
Table 1: Comparison of Vpr-mediated cell cycle arrest in human and mouse
cells.
Vpr mutants HeLa (human) NIH3T3 (mouse)
Vpr'v' ++ ++
aL-A ++ ++
E21, 24P ++ ++
A30L - -
A59P - -
L67S - -
H71 Y - -
G75A ++ ++
C76S ++ . ++
I~95A - -
HeLa and NIH3 T3 cells were transfected with 10 ~g of different Vpr expression
constructs using
DOTAP. Transfected cells were selected and analyzed for cell growth and cell
cycle arrest by
FACS.
31
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
Table 2: Effect of Vpr on the relative ratio of IgGl and IgG2a.
Plasmids UsedIgGl (Th2) IgG2a (Thl) IgG1/IgG2a IgG2a/IgGl
pPSA 0.461 ~ 0.0150.372 ~ 0.0261.2 0.8
pVpr 0.006 ~ 0.0020.002 ~ 0.014NA NA
pPSA + pVpr 0.460 ~ 0.010.100 ~ 0.0024.6 0.2
ELISAwas performed using PSA-coated (2 ~g/ml) 96-well microtiter plates. After
blocl~ing the
plates for 1 hour with blocking buffer, 50 ~g of diluted sera (1:100) were
added and incubated
for 37°C for 1 hour. For the determination of relative levels of PSA-
specific IgG subclasses,
anti-mouse IgGl and IgG2a conjugated with HRP (Zymed, CA) were substituted for
anti-mouse
IgG-HRP. This was followed by addition of ABTS (horseradish peroxidase
substrate) solution,
and read at 405 nm using a Dynatec MR5000 plate reader. The relative ratio of
IgGl to IgG2a
was calculated as IgG subclass O.D./ total O.D. value. The number of animals
used in this
experiment to obtain SD was n=4. Similar results were observed in multiple
sets of experiments.
NA, not applicable.
Example 3: Construction of Adenoviral Vector pAdCMV-vpr.
Adenoviral vectors pAdCMV-vp~ and pAdCMV-lacZwere constructed using pAd. CMV-
linkl, which is a type 5, E1-deleted, E3-defective adenovirus vector, in which
inserted genes are
under the transcriptional control of the cytomegaovirus (CMV) promoter (Davis
et al., 1998,
Gene Therapy, 5:1148-1152, which is incorporated herein by reference). The
construction of
pAdCMV-ZacZ (expressing E. coli (3-galactosidase) has been described
previously in Davis et al.,
1998, supra. The construction of pAdCMV-vp~ is described below and represented
schematically in Figure 9.
The proviral construct of HIV-1 strain 89.6 was used as the template, and the
primers
used were: 5'AA.AAGCTTGATGGAACAAGCCCCAGAAGACC 3' (SEQ ID NO:1),
containing a HindIII restriction site, and 5' AATCTAGACTAGGATTTACTGGCTCCATTT
3' (SEQ ID N0:2), containing a XbaI restriction site. The restriction sites
are indicated by
underlining. The polymerase chain reaction (PCR) cycling conditions were:
94°C for 4 minutes,
30 cycles of (94°C for 1 minute, 54°C for 45 seconds,
72°C for 30 seconds), and extension at
72°C for 9 minutes, in a Stratagene-Robocycler Gradient-40 cycler using
Taq DNA polymerase
(Boehringer Mannheim, IN). The PCR product was purified with a PCR
purification kit (Qiagen,
CA) according to the manufacturer's protocol. The purified PCR product and the
pAd.CMV-
Linkl vector were digested with restriction enzymes HindIII and XbaI (New
England Biolabs,
MA), and the respective fragments of 300 by and 6.7 kb were resolved in and
cut from an agarose
32
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
gel, and purified with a gel purification kit (Qiagen, CA) according to the
manufacturer's
protocol. Ligation of the two fragments was carried out at a 1:1 molar xatio
using T4 DNA ligase
(New England Biolabs, MA), followed by transformation into competent bacteria
Stbl2 (Life
Technologies, MD). Positive clones were identified by restriction enzyme
digestion with HindIII
and XbaI (Davis et al., supra). The correct, vpf°-containing clone was
confirmed by DNA
sequencing.
Example 4: Generation of Adeno-vpr and Adeno-ZacZ Recombinant Viral Particles.
Recombinant viral particles were generated in 293 cells and purified according
to the
method described by Davis et al., l 998, supra. The schematic representation
of the viral particle
generation is presented in Figure 10. Briefly, the pAdCMV-vpr plasmid was
linearized with
NheI (New England Biolabs, MA), and resolved in and purified from a low-
melting agarose gel.
Adenoviral construct sub360 (Davis et al.,1998, supra) was linearized with
CIaI (New England
Biolabs, ME). The linearized pAdCMV-vpr and sub360 were co-transfected into
293 cells using
DOTAP transfection agent (Boehringer Mannheim, IN). 20 hours after
transfection, the cell
cultures were overlaid with agar. After 5 days, the cultures were monitored
for plaque
formations. Plaques were propagated in 293 cells and tested for vp~ insertion
into the viral
genome by PCR and Southern blot analyses. Large quantities of Adeno-vpr virus
was purified
by the CsCl2 density gradient centrifugation method. Titers of the stoclcs
were tested by plaque
formation in 293 cells with agar overlay. The recombinant adenoviral particle
concentration was
determined by measuring the optical density at 260nm, and was expressed as
optical particle
units (OPU), as described by Mittereder et al., 1996, J. Virol., 70:7498-7509,
which is
incorporated herein by reference. Adeno-lacZviral particles were similarly
generated and titered.
Example 5: Transduction (Infection) of Macrophages with Adeno-vpr and Adeno-
lacZ
Recombinant Viral Particles.
Isolation of Human Macrophages
Human PBMCs were isolated from fresh whole blood by density gradient
centrifugation
with Ficoll-Hypaque (Pharmacia, NJ). The PBMC-containing interface was removed
with a
Pasteur pipet, and transfered to a new tube, and washed with unsupplemented
RPMI medium,
three times with centrifugation at 1500g for 5 minutes. After the final wash,
the cells were
33
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
resuspended, at a concentration of 2x106/ ml, in 10% human AB serum in RPMI
with 1%
penicillin-streptomycin and 1 % glutamine. The cells were incubated at
37°C in polysterene T-75
flasks for 5 days. After the incubation, the cells were washed with RPMI for 3
times to remove
non-adherent cells. The adherent monocytes were detached with ethylenediamine
tetra-acetic
acid (EDTA). The purity of the cell populations, thus isolated, was >98%
CD14+, CD3-, as
determined by immunofluorescence staining. The cells were incubated in 6-well
plates at a
density of 1x106 cells/ml in RPMI medium supplemented with 10% human serum, as
previously
described in Montaner et al.,1997, J. Leukoc. Biol., 62:126-32, which is
incorporated herein by
reference.
Transduction of macrophages with viral particles
Macrophages were seeded into 6 well tissue culture plates at 2x106 cells per
well. Cells
were transduced with 501 of recombinant virus (either Adeno-vpr or Adeno-lacZ
(negative
control)) per Sx105 cells (MOI, 2 to 4), in serum-free DMEM medium, and
incubated for 90
minutes at 37°C, after which, lml of DMEM with 10% human serum was
added to each well.
Transduction was confirmed through X-gal detection of (3-galactosidase (~i-
gal) expression from
the isogenic control Adeno-lacZ vector. X-gal assays were performed under
conditions of low
pH to inhibit any endogenous (3-gal activity.
Example 6: Vpr Protein Expression in Macrophages Transduced with Adeno-vpr
Viral
Particles.
Protein Preparation
Macrophages were infected with recombinant viral particles as described in
Example 5.
Up to 2x106 cells were collected 48 hours post infection, washed twice in ice-
cold PBS, and
extracted in 500,1 of lysis buffer containing SOmM HEPES (pH 7.0), 150mM
Na.CI, SmM
EDTA, 0.1%NonidetP-40, 0.2mMPefabloc,100mMNa3V0~ lOmMl3-glycerophosphate,1mM
NaF, and 10~,g/ml (each) of aprotinin, pepstatin, and leupeptin, for 30
minutes at 0°C, after
sonication. Cell lysates were centrifuged for lOmin at 0°C. The cell
extracts were dialysed
against 20mM Tris (pH 7.5), SmM Nacl, 10% glycerol, O.lmM EDTA, 1mM DTT. The
final
protein concentrations of the extracts were measured using the Bradford
reagent (Bio-Rad, CA),
using pooled bovine gamma globulin as the standard.
34
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
Immunobotting Analysis
Immunoblotting ("western") analyses confirmed that Vpr expression was achieved
in cells
transduced with Adeno-vp~ recombinant viral particles, using an enhanced-
chemiluminescence
(ECL) detection system (Figure 11). hnmunoblotting was performed after
denaturing SDS-
PAGE (Laemmli, 1970) of control and Vpr protein from different sources.
Bxiefly, 100~,g of
protein extract from cells infected with Adeno-vpr or Adeno-lacZ, or 20~g of
purified baculo-
Vpr protein, produced using the BaculoGold baculovirus expression system from
Pharmingen
(CA) (Muthumani et al., 2000, J. Leukoc. Biol., 68:366-72, which is
incorporated herein by
reference), were loaded and separated on SDS, 12% polyacrylamide gels. The
gels were
electroblotted to PVDF membranes (Immobilon P; Millipore, CA) and stained with
Ponceau Red
to control for equal transfer. Filters were blocked in blocking buffer,
containing 3% nonfat dry
milk and 0.05% Tween 20. After washing, the filters were incubated with anti-
Vpr antibodies
(1:1,000) in blocking solution overnight at 4°C. After being washed
twice, the filters were
incubated with a 1:500 dilution of a horseradish peroxidase-conjugated
secondary antibody
(Boehringer Mannheim, IN). After the f nal washings, immunoreactivity was
visualized using
the ECL system (Amersham Pharmacia Biotech Ltd., NJ).
Example 7: Sub-Cellular Localization of Vpr Protein by Immunofluorescence.
Human macrophages were maintained in DMEM containing 10% human serum and
seeded onto poly-L-lysine-coated Falcon glass culture slides (Becton-
Dickinson, NJ), at a density
of 1X1 OS cells/ml. Twenty four hours later, the cells were infected with
Adeno-vpr viral particles
in serum-free medium for 2 hours, after which, the medium was replaced with
serum-containing
medium. 24 hours post infection, the cells were washed with PBS and fixed with
methanol at
room temperature for 30 minutes. Adeno-vpr infected cells were fixed and
stained with
polyclonal anti-Vpr antibody (1:500 dilution), followed by PE-conjugated
secondary rabbit
antibody staining as described previously (Muthumani et al., 2000, DNA Cell
Biol., supra.),
stained with DAPI for nuclear staining, and photographed under an
immunofluorescence
microscope. Vpr expression was seen as red fluorescence in the
immunofluorescence photograph
in Figure 12.
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
Example 8: Vpr Protein Enhances G2/M Cell Cycle Arrest.
HeLa cells were obtained from ATCC, and were grown in monolayers at
37°C in 5%
CO2, in DMEM, containing 10% FB S, 1 % penicillin, 1 % streptomycin, and 1 % L-
glutamine.
HeLa cells (1x106), grown in 35mm-diameter dishes, were infected with Adeno-
vp~ and Adeno-
lacZ. 48. hours post infection, cells were washed with 2X with PBS, and
trypsinized for
harvesting. The cells were then incubated with 1 mg/ml RNaseA and 10%
propidium iodide in
PBS for 30 minutes. Cellular DNA content in the fixed cells was determined
with a FACScan
flow cytometer and analyzed with the ModFit LT program (Becton Dickinson, CA).
Percentage
of cells in G2/M was assessed and compared to that of mock infected and Adeno-
lacZ infected
cells. The results, as presented in Figure 13, show that the Adeno-ZacZ viral
particles induce a
shift into G2/M phase, and that Vpr expression from Adeno-vp~ viral infection
enhances the
G2/M phase arrest. Similar results were obtained following infection of the
human prostate
cancer cell line LNCaP (ATCC # CRL-1740), where a 50% increase in G2/M phase
cells was
effected by infection with Adeno-vp~. Vpr thus enhances the cell growth
arresting properties of
adenovirus particles.
Example 9: Analysis of the Effect of Adeno-vpr Viral Particles on Macrophages
by FRCS.
FRCS analysis was performed on infected and mock infected cells to determine
if the
viral particles affected the expression of macrophage activation markers.
Human macrophages
were mock infected, or infected with either Adeno-lacZ or Adeno-vp~ virus
particles, as
described in Example 5, above. 48 hours post infection, cells were harvested
and single cell
suspensions were washed in PBS (pH 7.2), containing 0.2% bovine serum albumin
(BSA) and
0.1 % NaN3. Cells were incubated with goat IgG, to block binding of Ig to
Fc(3R, and stained with
FITC- and PE-conjugated antibodies or IgG control antibody for 60 minutes.
Cells were washed
with PBS and fixed with 2% paraformaldehyde and analyzed on a fluorescence
activated cell
sorter (Beckton-Dickinson, CA). FITC-conjugated anti-CD80 and anti-CD86 mAbs,
or a PE-
conjugated anti-CD14 mAb, purchased from PharMingen (CA) and Coulter (FL).
Data were
analyzed using the CELL Quest program (Beckton-Dickinson, CA).
The results presented in Fig. 14 show the data for CD80 and CD86 expression.
While
Adeno-lacZ infection caused a 5.8% and 3.8% decrease in CD80 and CD86
expression,
respectively, Vpr expression, in the context of Adeno-vp~ infection, yielded a
21.2% and 26.1
36
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
decrease in CD80 and CD86 expression, respectively. Thus, Vpr expression down-
regulates the
expression of macrophage activation markers. These data, generated in human
macrophages,
further support the conclusion that Vpr interferes with costimulatory
molecules involved in
immune activation.
Example 10: Effect of Adeno-vpr Infection on the Secretion of Chemokines by
Macrophages.
Macrophages were mock infected, or infected with Adeno-vpr or Adeno-lacZ, as
described in Example 5. Quantitation of the level of chemokines present in the
supernatant was
done using a capture ELISA. Specifically, levels of MIP-la, MIP-1(3, and
RANTES were
measured in the culture supernatants of the infected macrophages. Chemokine
assay kits were
purchased from R&D Systems (MN), and the assays were performed according to
the
manufacturer's protocol. Supernatants from the infected cell cultures were
added to the wells
in triplicate at different dilutions and incubated at 37 ° C for 2 - 3
hours, followed by washing and
incubation with detection antibodies for 1 hour. Bound antibodies were
developed by the
addition of TMB peroxidase substrate and detected at 450 nm in an ELISA plate
reader. The
results, presented in Figure 15, reveal that the presence of Vpr protein
significantly suppressed
the level of chemokine expression induced by adenoviral infection. These
results in human
macrophages further substantiate the effectiveness of Vpr as an inhibitor of
cellular immune
responses against gene therapy vectors.
Example. 1I: Effect of Adeno-vpr Infection on the Lymphoproliferation of
PBMCs.
Proliferation assays are usedto assess the overall immunocompetence
ofperipheral blood
mononuclear cells, and to detect dividing cells as a function of a test
antigen. PBMCs were
isolated from heparinized blood of normal donors by Ficoll-Hypaque. The
isolated cells were
suspended at a concentration of 1x106 cells/ml in R10 medium. 100 ~1 aliquots,
containing
1x105 cells, were immediately added to the wells of a 96-well, round-bottom
microtiter plate.
100 ~.1 of Adeno-ZacZ or Adeno-vp~, at a concentraton of 10 viral particles
per cell, was added
to each well, in triplicate. Mock-, Adeno-lacZ , or Adeno-vp~-infected PBMCs
were then
separately incubated with the following different mitogenic substances:
tetanus toxoid,
phytohemagglutinin (PHA), concanavalin-A (ConA), and the superantigen
staphylococcal
37
CA 02408904 2002-11-12
WO 01/74163 PCT/USO1/10028
enterotoxin B (SEB). Additionally, to verify the health of the cells, 5 ~,g/ml
of PHA (a non-
specific stimulator) was used as a positive control in three wells. Medium
alone was used to
assess the background level of growth. The cells were incubated at 37
°C in a CO~ incubator for
three days. After three days incubation, 1 ~Ci of tritiated thymidine was
added to each well,
followed by overnight (12 -18 hours) incubation. The plate was harvested on an
automatic 96-
well cell harvester, and the amount of incorporated tritiated thymidine was
measured in a
microbeta counter (Wallace, Turku, Finland), according to Kim et al., 1997,
Nat. Biotechnol.
1997 Jul;15(7):641-6, which is incorporated herein by reference. The results
are presented in
Figure 16. The values for each condition (Delta CPM) represent the change in
incorporated cpm
over the baseline incorporated cpm for cells not treated with mitogen. The
results, confirm the
suppressive effect of Vpr on lymphoproliferation, including the ability of Vpr
to suppress
lymphoproliferation in response to superantigen SEB.
The foregoing examples are meant to illustrate the invention and are not to be
construed
to limit the invention in any way. Those skilled in the art will recognize
modifications that are
within the spirit and scope of the invention. All references cited herein are
hereby incorporated
by reference in their entirety.
38
