Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
RSV PROTEINS, ANTIBODIES,
COMPOSITIONS, METHODS AND USES
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates to at least one respiratory syncytial virus
(RSV) protein or
fragment thereof, and antibodies, including specified portions or variants,
specific therefore, as well
as nucleic acids encoding such RSV proteins, fragments, antibodies,
complementary nucleic acids,
vectors, host cells, and methods of making and using thereof, including
therapeutic formulations,
administration and devices.
RELATED ART
Respiratory syncytial virus (RSV) is a Parmixovirus of the Pneumovirus genus
which
commonly infects the upper and lower respiratory tract. It is so contagious
that by age two, a large
percentage of children have been infected by it. Moreover, by age four,
virtually all humans have an
immunity to RSV. Typically, RSV infections are mild, remaining localized in
the upper respiratory
2 0 tract and causing symptoms similar to a common cold which require no
extensive treatment.
However, in some subjects, e.g., immunosuppressed individuals such as infants,
elderly persons or
patients with underlying cardiopulmonary diseases, the virus may penetrate to
the lower respiratory
tract requiring hospitalization and breathing support. In some of these cases,
RSV infection may
cause permanent lung damage or even be life threatening. In the United States
alone, RSV results in
2 5 about 90,000 hospitalizations each year, and results in about 4500 deaths.
RSV appeaxs in two major strain subgroups, A and B, primarily based on
serological
differences associated with the attachment glycoprotein, G. The major surface
glycoprotein, i.e., the
90 kI) G protein, can differ up to 50% at the amino acid level between
isolates. By contrast, a
potential therapeutic target, the 70 kD fusion (F) protein, is highly
conserved across different RSV
3 0 strains, about i.e., 89% on the amino acid level. Moreover, it is known
that antibodies elicited
against F-protein of a given type are cross-reactive with the other type.
The F-protein is a heterodimer, generated from a linear precursor, consisting
of disulfide-
linked fragments of 48 and 23 kD respectively. Inhibition of syncytia
formation by polyclonal
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
antibodies is associated with significant reaction to the 23 kD fragment. As
noted, while RSV
infections are usually mild, in some individuals RSV infections may be life
threatening.
However, notwithstanding the previous published reports of humanized and Fab
fragments
specific to RSV, there still exists a significant need for improved anti-RSV
antibodies having
improved therapeutic potential, in particular anti- RSV antibodies which
possess high affinity and
specificity for the RSV F-protein which effectively neutralize and prevent RSV
infection.
Non-human mammalian, chimeric, polyclonal (e.g., sera) and/or monoclonal
antibodies
(Mabs) and fragments (e.g., proteolytic digestion or fusion protein products
thereof) are potential
therapeutic agents that are being investigated in some cases to attempt to
treat certain diseases.
However, such antibodies or fragments can elicit an immune response when
administered to humans.
Such an immune response can result in an immune complex-mediated clearance of
the antibodies or
fragments from the circulation, and make repeated administration unsuitable
for therapy, thereby
reducing the therapeutic benefit to the patient and limiting the
readministration of the antibody or
fragment. For example, repeated administration of antibodies or fragments
comprising non-human
portions can lead to serum sickness and/or anaphalaxis. In order to avoid
these and other problems, a
number of approaches have been taken to reduce the immunogenicity of such
antibodies and portions
thereof, including chimerization and humanization, as well known in the art.
These and other
approaches, however, still can result in antibodies or fragments having some
immunogenicity, low
affinity, low avidity, or with problems in cell culture, scale up, production,
and/or low yields. Thus,
2 0 such antibodies or fragments can be less than ideally suited for
manufacture or use as therapeutic
proteins.
Accordingly, there is a need to provide RSV proteins or antibodies or
fragments that
overcome one more of these problems, as well as improvements over known
proteins or antibodies or
fragments thereof.
2 5 SUMMARY OF THE INVENTION
The present invention provides isolated human, primate, rodent, mammalian,
chimeric, or
human RSV proteins, antibodies, immunoglobulins, cleavage products and other
specified portions
and variants thereof, as well as RSV protein or antibody compositions,
encoding or complementary
3 0 nucleic acids, vectors, host cells, compositions, formulations, devices,
transgenic animals, transgenic
plants, and methods of making and using thereof, as described and enabled
herein, in combination
with what is known in the art.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
The present invention also provides at least one isolated RSV antibody as
described herein.
An antibody according to the present invention can include any protein or
peptide containing
molecule that comprises at least a portion of an immunoglobulin molecule, such
as but not limited to
at least one complementarity determinng region (CDR) (also termed the
hypervariable region or HV)
of a heavy or light chain variable region, or a ligand binding portion
thereof, a heavy chain or light
chain variable region, a heavy chain or light chain constant region, a
framework region, or any
portion thereof, wherein the antibody can be incorporated into an antibody of
the present invention.
An antibody of the invention can include or be derived from any mammal, such
as but not limited to a
human, a mouse, a rabbit, a rat, a rodent, a primate, or any combination
thereof, and the like.
The present invention provides, in one aspect, isolated nucleic acid molecules
comprising,
complementary, or hybridizing to, a polynucleotide encoding specific RSV
proteins or antibodies,
comprising at least one specified sequence, domain, portion or variant
thereof. The present invention
further provides recombinant vectors comprising at least one of said RSV
protein or antibody
encoding or complementary nucleic acid molecules, host cells containing such
nucleic acids and/or
recombinant vectors, as well as methods of making and/or using such antibody
nucleic acids, vectors
and/or host cells.
At least one antibody of the invention binds at least one specified epitope
specific to at least
one RSV protein, subunit, fragment, portion or any combination thereof. The at
least one epitope
can comprise at least one antibody binding region that comprises at least one
portion of said protein,
2 0 which epitope is preferably comprised of at least 1-5 amino acids of at
least one portion thereof, such
as but not limited to, at least one functional, extracellular, soluble,
hydrophillic, external or
cytoplasmic domain of said protein, or any portion thereof.
The at least one antibody can optionally comprise at least one specified
portion of at least one
complementarity determining region (CDR) (e.g., CDR1, CDR2 or CDR3 of the
heavy or light chain
2 5 variable region) and optionally at least one constant or variable
framework region or any portion
thereof. The at least one antibody amino acid sequence can further optionally
comprise at least one
specified substitution, insertion or deletion as described herein or as known
in the art.
The present invention also provides at least one isolated RSV protein or
antibody as
described herein, wherein the antibody has at least one activity, such as, but
not limited to any known
3 0 RSV biological activity. A(n) RSV protein antibody can thus be screened
for a corresponding
activity according to known methods, such as but not limited to, at least one
biological activity
towards a RSV protein or protein related function.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
The present invention further provides at least one RSV anti-idiotype antibody
to at least one
RSV antibody of the present invention. The anti-idiotype antibody includes any
protein or peptide
containing molecule that comprises at least a portion of an immunoglobulin
molecule, such as but not
limited to at least one complementarity determinng region (CDR) of a heavy or
light chain or a ligand
binding portion thereof, a heavy chain or light chain variable region, a heavy
chain or light chain
constant region, a framework region, or any portion thereof, that can be
incorporated into an antibody
of the present invention. An antibody of the invention can include or be
derived from any mammal,
such as but not limited to a human, a mouse, a rabbit, a rat, a rodent, a
primate, and the like. The
present invention provides, in one aspect, isolated nucleic acid molecules
comprising,
complementary, or hybridizing to, a polynucleotide encoding at least one RSV
anti-idiotype antibody,
comprising at least one specified sequence, domain, portion or variant
thereof. The present invention
further provides recombinant vectors comprising said RSV anti-idiotype
antibody encoding nucleic
acid molecules, host cells containing such nucleic acids and/or recombinant
vectors, as well as
methods of making and/or using such anti-idiotype antiobody nucleic acids,
vectors and/or host cells.
The present invention also provides at least one method for expressing at
least one RSV
protein or antibody, or RSV anti-idiotype antibody, in a host cell, comprising
culturing a host cell as
described herein under conditions wherein at least one RSV antibody is
expressed in detectable
and/or recoverable amounts.
The present invention also provides at least one composition comprising (a) an
isolated RSV
2 0 protein or antibody encoding nucleic acid and/or protein or antibody as
described herein; and (b) a
suitable carrier or diluent. The carrier or diluent can optionally be
pharmaceutically acceptable, such
as but not limited to known carriers or diluents. The composition can
optionally further comprise at
least one further compound, protein or composition.
The present invention further provides at least one RSV protein or antibody
method or
2 5 composition, for administering a therapeutically effective amount to
modulate or treat at least one
RSV related condition in a cell, tissue, organ, animal or patient and/or,
prior to, subsequent to, or
during a related condition, as known in the art and/or as described herein.
The present invention also provides at least one composition, device and/or
method of
delivery of a therapeutically or prophylactically effective amount of at least
one RSV protein or
3 0 antibody, according to the present invention.
The present invention further provides at least one RSV protein or antibody
method or
composition, for diagnosing at least one RSV related condition in a cell,
tissue, organ, animal or
patient and/or, prior to, subsequent to, or during a related condition, as
known in the art and/or as
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
described herein.
The present invention also provides at least one composition, device andlor
method of
delivery for diagnosing of at least one RSV protein or antibody, according to
the present invention.
Also provided is an isolated nucleic acid encoding at least one isolated
mammalian RSV
protein; an isolated nucleic acid vector comprising the isolated nucleic acid,
and/or a prokaryotic or
eukaryotic host cell comprising the isolated nucleic acid. The host cell can
optionally be at least one
selected from prokaryotic or eukaryotic cells, or fusion cells thereof, e.g.,
but not limited to,
mammalian, plant or insect, such as but not limited to, CHO, myeloma, or
lymphoma cells, bacterial
cells, yeast cells, silk worm cells, or any derivative, immortalized or
transformed cell thereof. Also
provided is a method for producing at least one RSV protein, comprising
translating the protein
encoding nucleic acid under conditions in vitro, in vivo or in situ, such that
the RSV protein is
expressed in detectable or recoverable amounts.
Also provided is a composition comprising at least one isolated mammalian RSV
protein and
at least one pharmaceutically acceptable carrier or diluent. The composition
can optionally further
comprise an effective amount of at least one compound or protein selected from
at least one of a
detectable label or reporter, a TNF antagonist, an antirheumatic, a muscle
relaxant, a narcotic, a non-
steroid inflammatory drug (LATHE), an analgesic, an anesthetic, a sedative, a
local anethetic, a
neuromuscular blocker, an antimicrobial, an antipsoriatic, a corticosteriod,
an anabolic steroid, an
erythropoietin, an immunization, an immunoglobulin, an immunosuppressive, a
growth hormone, a
2 0 hormone replacement drug, a radiopharmaceutical, an antidepressant, an
antipsychotic, a stimulant,
an asthma medication, a beta agonist, an inhaled steroid, an epinephrine or
analog, a cytokine, or a
cytokine antagonist.
Also provided is a method for diagnosing or treating a RSV related condition
in a cell, tissue,
organ or animal, comprising contacting or administering a composition
comprising an effective
2 5 amount of at least one isolated mammalian RSV protein of the invention
with, or to, the cell, tissue,
organ or animal. The method can optionally further comprise using an effective
amount of
0.0000001-500 mglkilogram of the cells, tissue, organ or animal. The method
can optionally further
comprise using the contacting or the administrating by at least one mode
selected from parenteral,
subcutaneous, intramuscular, intravenous, intrarticular, intrabronchial,
intraabdominal, intracapsular,
3 0 intracartilaginous, intracavitary, intracelial, intracelebellar,
intracerebroventricular, intracolic,
intracervical, intragastric, intrahepatic, intramyocardial, intraosteal,
intrapelvic, intrapericardiac,
intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal,
intrarenal, intraretinal,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus,
vaginal, rectal, buccal,
sublingual, intranasal, or transdermal. The method can optionally further
comprise administering,
prior, concurrently or after the contacting or administering, at least one
composition comprising an
effective amount of at least one compound or protein selected from at least
one of a detectable label
or reporter, a TNF antagonist, an antirheumatic, a muscle relaxant, a
narcotic, an anti-inflammatory, a
non-steroid inflammatory drug (NTHE), an analgesic, an anesthetic, a sedative,
a local anethetic, a
neuromuscular blocker, an antimicrobial, an antipsoriatic, a corticosteriod,
an anabolic steroid, an
erythropoietin, an immunization, an immunoglobulin, an immunosuppressive, a
hormone, a hormone
replacement drug, a radiopharmaceutical, an antidepressant, an antipsychotic,
a stimulant, an asthma
medication, a beta agonist, an inhaled steroid, an epinephrine or analog, a
cytokine, or a cytokine
antagonist.
Also provided is at least one medical device, comprising at least one isolated
mammalian
RSV protein of the invention, wherein the device is suitable to contacting or
administerting the at
least one RSV protein by at least ones mode selected from parenteral,
subcutaneous, intramuscular,
intravenous, intrarticular, intrabronchial, intraabdominal, intracapsular,
intracartilaginous,
intracavitary, intracelial, intracelebellar, intracerebroventricular,
intracolic, intracervical, intra~astric,
intrahepatic, intramyocardial, intraosteal, intrapelvic, intrapericardiac,
intraperitoneal, intrapleural,
intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal,
intraspinal, intrasynovial,
intrathoracic, intrauterine, intravesical, bolus, vaginal, rectal, buccal,
sublingual, intranasal, or
2 0 transdermal.
Also provided is an article of manufacture for human pharmaceutical or
diagnostic use,
comprising packaging material and a container comprising a solution or a
lyophilized form of at least
one isolated mammalian RSV protein of the present invention. The article of
manufacture can
optionally comprise having the container as a component of a parenteral,
subcutaneous,
2 5 intramuscular, intravenous, intrarticular, intrabronchial, intraabdominal,
intracapsular,
intracartilaginous, intracavitary, intracelial, intracelebellar,
intracerebroventricular, intracolic,
intracervical, intragastric, intrahepatic, intramyocardial, intraosteal,
intrapelvic, intrapericardiac,
intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal,
intrarenal, intraretinal,
intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus,
vaginal, rectal, buccal,
3 0 sublingual, intranasal, or transdermal delivery device or system.
Also provided is a method for producing at least one isolated mammalian RSV
protein of the
present invention, comprising providing a host cell or transgenic animal or
transgenic plant or plant
cell capable of expressing in recoverable amounts the protein. Further
provided in the present
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
invention is at least one RSV protein produced by the above method.
In another aspect, the present invention provides at least one isolated
mammalian RSV
antibody, comprising at least one variable region comprising an amino acid
sequence of SEQ ID
NOS:7-12, any portion of Figures 3-4 or encoded by any portion of Figures 2A-G
or 5A-F .
In another aspect, the present invention provides at least one isolated
mammalian RSV
antibody, comprising all of the heavy chain or all of the light chain
complementarity determining
regions (CDR) amino acid sequences comprising an amino acid sequence of SEQ )D
NOS:1-6, any
portion of Figures 3-4 or encoded by any portion of Figures 2A-G or 5A-F .
In another aspect, the present invention provides at least one isolated
mammalian RSV
antibody, comprising at least one heavy chain or light chain CDR having the
amino acid sequence of
at least part of at least one of SEQ >D NOS: 1-6.
In other aspect the present invention provides at least one isolated mammalian
RS V
antibody, comprising at least one human CDR, wherein the antibody specifically
binds at least one
epitope comprising at least 1-3, to the entire amino acid sequence of any know
RSV protein, such as
the F glycoprotein.
The at least one antibody can optionally further at least one of: bind RSV
with an affinity of
at least one selected from at least 10-9 M, at least 10-1° M, at least
10-11 M, or at least 10-1' M;
substantially neutralizes at least one activity of at least one RSV protein.
Also provided is an isolated
nucleic acid encoding at least one isolated mammalian RSV antibody; an
isolated nucleic acid vector
2 0 comprising the isolated nucleic acid, andlor a prokaryotic or eukaryotic
host cell comprising the
isolated nucleic acid. The host cell can optionally be at least one selected
from prokaryotic or
eukaryotic cells, or fusion cells thereof, e.g., but not limited to,
mammalian, plant or insect, such as
but not limited to, CHO, myeloma, or lymphoma cells, bacterial cells, yeast
cells, silk worm cells, or
any derivative, immortalized or transformed cell thereof. Also provided is a
method for producing at
2 5 least one RSV antibody, comprising translating the antibody encoding
nucleic acid under conditions
in vitro, in vivo or in situ, such that the RSV antibody is expressed in
detectable or recoverable
amounts.
Also provided is a composition comprising at least one isolated mammalian RSV
antibody
and at least one pharmaceutically acceptable carrier or diluent. The
composition can optionally
3 0 further comprise an effective amount of at least one compound or protein
selected from at least one of
a detectable label or reporter, a TNF antagonist, an antirheumatic, a muscle
relaxant, a narcotic, a
non-steroid inflammatory drug (NTHE), an analgesic, an anesthetic, a sedative,
a local anethetic, a
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
neuromuscular blocker, an antimicrobial, an antipsoriatic, a corticosteriod,
an anabolic steroid, an
erythropoietin, an immunization, an immunoglobulin, an immunosuppressive, a
growth hormone, a
hormone replacement drug, a radiopharmaceutical, an antidepressant, an
antipsychotic, a stimulant,
an asthma medication, a beta agonist, an inhaled steroid, an epinephrine or
analog, a cytokine, or a
cytokine antagonist.
The present invention further provides an anti-idiotype antibody or fragment
that specifically
binds at least one isolated mammalian RSV antibody of the present invention.
Also provided is a method for diagnosing or treating a RSV related condition
in a cell, tissue,
organ or animal, comprising contacting or administering a composition
comprising an effective
amount of at least one isolated mammalian RSV antibody of the invention with,
or to, the cell, tissue,
organ or animal. The method can optionally further comprise using an effective
amount of 0.0001-
500 mg/kilogram of the cells, tissue, organ or animal. The method can
optionally further comprise
using the contacting or the administrating by at least one mode selected from
parenteral,
subcutaneous, intramuscular, intravenous, intrarticular, intrabronchial,
intraabdominal, intracapsular,
intracartilaginous, intracavitary, intracelial, intracelebellar,
intracerebroventricular, intracolic,
intracervical, intragastric, intrahepatic, intramyocardial, intraosteal,
intrapelvic, intrapericardiac,
intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal,
intrarenal, intraretinal,
intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus,
vaginal, rectal, buccal,
sublingual, intranasal, or transdermal. The method can optionally further
comprise administering,
2 0 prior, concurrently or after the contacting or administering, at least one
composition comprising an
effective amount of at least one compound or protein selected from at least
one of a detectable label
or reporter, a TNF antagonist, an antirheumatic, a muscle relaxant, a
narcotic, an anti-inflammatory, a
non-steroid inflammatory drug (NTHE), an analgesic, an anesthetic, a sedative,
a local anethetic, a
neuromuscular Mocker, an antimicrobial, an antipsoriatic, a corticosteriod, an
anabolic steroid, an
2 5 erythropoietin, an immunization, an immunoglobulin, an immunosuppressive,
a hormone, a hormone
replacement drug, a radiopharmaceutical, an antidepressant, an antipsychotic,
a stimulant, an asthma
medication, a beta agonist, an inhaled steroid, an epinephrine or analog, a
cytokine, or a cytokine
antagonist.
Also provided is at least one medical device, comprising at least one isolated
mammalian
3 0 RSV antibody of the invention, wherein the device is suitable to
contacting or administerting the at
least one RSV antibody by at least one mode selected from parenteral,
subcutaneous, intramuscular,
intravenous, intrarticular, intrabronchial, intraabdominal, intracapsular,
intracartilaginous,
intracavitary, intracelial, intracelebellar, intracerebroventricular,
intracolic, intracervical, intragastric,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
intrahepatic, intramyocardial, intraosteal, intrapelvic, intrapericardiac,
intraperitoneal, intrapleural,
intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal,
intraspinal, intrasynovial,
intrathoracic, intrauterine, intravesical, bolus, vaginal, rectal, buccal,
sublingual, intranasal, or
transdermal.
Also provided is an article of manufacture for human pharmaceutical or
diagnostic use,
comprising packaging material and a container comprising a solution or a
lyophilized form of at least
one isolated mammalian RSV antibody of the present invention. The article of
manufacture can
optionally comprise having the container as a component of a parenteral,
subcutaneous,
intramuscular, intravenous, intrarticular, intrabronchial, intraabdominal,
intracapsular,
intracartilaginous, intracavitary, intracelial, intracelebellar,
intracerebroventricular, intracolic,
intracervical, intragastric, intrahepatic, intramyocardial, intraosteal,
intrapelvic, intrapericardiac,
intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal,
intrarenal, intraretinal,
intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus,
vaginal, rectal, buccal,
sublingual, intranasal, or transdermal delivery device or system.
Also provided is a method for producing at least one isolated mammalian RSV
antibody of
the present invention, comprising providing a host cell or transgenic animal
or transgenic plant or
plant cell capable of expressing in recoverable amounts the antibody. Further
provided in the present
invention is at least one RSV antibody produced by the above method.
The present invention further provides any invention described herein.
2 0 DESCRIPTION OF THE FIGURES
Figure 1 shows two heavy chain and three light chain antibody amino acid
sequences of the
present invention.
Figure 2A-G shows a non-limiting example of two heavy chain region encoding
DNA
2 5 sequences encoding an RSV antibody of the present invention.
Figure 3 shows a non-limiting example of two heavy chain amino acid sequences
corresponding to the DNA sequences in Figure 2A-G, where CDRl, 2 &3, variable
and constant
regions and a signal peptide are shown, as well as variations between the
alternative sequences are
shown.
3 0 Figure 4 shows a non-limiting example of four different light chain amino
acid sequences
that can be used in an RSV antibody of the present invention, where CDRl, 2
&3, variable and
constant regions and a signal peptide are shown, as well as variations between
the alternative
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
sequences are shown.
Figure 5A-F shows a non-limiting example of four altrenative light chain
region encoding
DNA sequences encoding an RSV antibody of the present invention, corresponding
to the amino acid
sequence in Figure 4.
5 DESCRIPTION OF THE INVENTION
The present invention provides isolated, recombinant and/or synthetic RSV
human, primate,
rodent, mammalian, chimeric, humanized or CDR-grafted, antibodies and RSV anti-
idiotype
antibodies thereto, as well as compositions and encoding nucleic acid
molecules comprising at least
one polynucleotide encoding at least one RSV antibody or anti-idiotype
antibody. The present
10 invention further includes, but is not limited to, methods of making and
using such nucleic acids and
antibodies and anti-idiotype antibodies, including diagnostic and therapeutic
compositions, methods
and devices.
As used herein, an "respiratory syncytial virus antibody," "RSV antibody," and
the like
include any protein or peptide containing molecule that comprises at least a
portion of an
immunoglobulin molecule, such as but not limited to at least one
complementarity determinng region
(CDR) of a heavy or light chain or a ligand binding portion thereof, a heavy
chain or light chain
variable region, a heavy chain or light chain constant region, a framework
regionx or any portion ,
fragment or variant thereof, or at least one portion of an RSV receptor or
binding protein, which can
be incorporated into a RSV antibody of the present invention.
2 0 Antibodies can include one or more of at least one CDR, at least one
variable region, at least
one constant region, at least one heavy chain (e.g., Yu Yz, Ys, Ya~ 1~~ an az~
8, ~), at least one light chain
(e.g., x and ~,), or any portion or fragment thereof, and can further comprise
interchain and intrachain
disulfide bonds, hinge regions, glycosylation sites that can be separated by a
hinge region, as well as
heavy chains and light chains. Light chains typically have a molecular weight
of about 25Kd and
2 5 heavy chains typically range from 50K-77Kd. Light chains can exist in two
distinct forms or
isotypes, kappa (x) and lambda (7~), which can combine with any of the heavy
chain types. All light
chains have at least one variable region and at least one constant region. The
IgG antibody is
considered a typical antibody structure and has two intrachain disulfide bonds
in the light chain (one
in variable region and one in the constant region), with four in the heavy
chain, and such bond
3 0 encompassing a peptide loop of about 60-70 amino acids comprising a
"domain"of about 110 amino
acids in the chain. IgG antibodies can be characterized into four classes,
IgGl, IgG2, IgG3 and IgG4.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
1l
Each immunoglobulin class has a different set of functions. The following
table summarizes the
Physicochemical properties of each of the immunoglobuling classes and
subclasses.
Property IgGl IgG2 IgG3 IgG4 IgM IgAl IgA2SIg IgD IgE
A
Heavy Chain yl ~yl ~yl ~yl p, cc1 a2 a1 b a
/
~,2
Mean Serum 9 3 1 0.5 1.5 3.0 0.5 0.05 0.030.00005
conc.
(m ml)
Sedimentation7s 7s 7s 7s 19s 7s 7s lls 7s 8s
constant
Mol. Wt. 146 146 170 146 970 160 160 385 184 188
(X 10 )
Half Life 21 20 7 21 10 6 6 ? 3 2
(days)
% intravascular45 45 45 45 80 42 42 Trac 75 50
distribution a
Carbohydrate2-3 2-3 2-3 ( 12 7-11 7-117-11 9-1412
(%) ~ ~ ~ 2-3 ~ ~ ~
~
The following table summarizes non-limiting examples of antibody effector
functions for
human antibody classes and subclasses.
Effector functionI I I I G4 I I I I E
Gl G2 G3 M A D
Complement ++ + +++ +++ - - -
fixation
Placentaltransfer+ + + + - - - -
Bindinto Sta +++ +++ - +++ - - - -
h A
Binding to ~ ~ +++ +++ - - - -
Strep G +++ +++
Accordingly, the type of antibody or fragment thereof can be selected for use
according to the present
invention based on the desired characteristics and functions that are desired
for a particular
therapeutic or diagnostic use, such as but not limited to serum half life,
intravascular distribution,
complement fixation, etc.
Antibody diversity is generated by at Teat 5 mechanisms, including (1) the use
of multiple
genes encoding parts of the antibody; (2) somatic mutation, e.g., primordial V
gene mutation during
B-cell ontogeny to produce different V genes in different B-cell clones; (3)
somatic recombination,
e.g., gene segments J1-Jn recombine to join the main part of the V-region gene
during B-cell
ontogeny; (4) gene conversion where sections of DNA from a number of pseudo V
region can be
copied into the V region to alter the DNA sequence; and (5) nucleotide
addition, e.g., when V and J
regions are cut, before joining, and extra nucleotides rna.y be inserted to
code for additional amino
acids. Non-limiting examples include, but are not limited to, (i) the
selection/recombination of VK, J,
and Cx regions from germ line to B-cell clones to generate kappa chains; (ii)
selectionlrecombination
2 0 of V~,, J, and C~, regions from germ line to B-cell clones to generate
lambda chains; (iii)
selectionlrecombination of VH, D1-D30 and JHl-JH6 genes to form a functional
VDJ gene encoding a
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
12
heavy chain variable region. The above mechanisms work in a coordinated
fashion to generate
antibody diversity and specificity.
The term "antibody "is further intended to encompass antibodies, digestion
fragments,
specified portions and variants thereof, including antibody mimetics or
comprising portions of
antibodies that mimic the structure and/or function of an anitbody or
specified fragment or portion
thereof, including single chain antibodies and fragments thereof. Functional
fragments include
antigen-binding fragments that bind to a mammalian RSV. For example, antibody
fragments capable
of binding to RSV or portions thereof, including, but not limited to Fab
(e.g., by papain digestion),
Fab' (e.g., by pepsin digestion and partial reduction) and F(ab')2 (e.g., by
pepsin digestion), facb
(e.g., by plasmin digestion), pFc' (e.g., by pepsin or plasmin digestion), Fd
(e.g., by pepsin digestion,
partial reduction and reaggregation), Fv or scFv (e.g., by molecular biology
techniques) fragments,
are encompassed by the invention (see, e.g., Colligan, Immunology, supra).
Such fragments can be produced by enzymatic cleavage, synthetic or recombinant
techniques,
as known in the art andlor as described herein. Antibodies can also be
produced in a variety of
truncated forms using antibody genes in which one or more stop codons have
been introduced
upstream of the natural stop site. For example, a combination gene encoding a
F(ab')2 heavy chain
portion can be designed to include DNA sequences encoding the CHl domain
and/or hinge region of
the heavy chain. The various portions of antibodies can be joined together
chemically by
conventional techniques, or can be prepared as a contiguous protein using
genetic engineering
2 0 techniques.
As used herein, the term "human antibody" refers to an antibody in which
substantially every
part of the protein (e.g., CDR, framework, CL, CH domains (e.g., CH1, CH2,,
CH3), hinge, (VL, VH)) is
substantially non-immunogenic in humans, with only minor sequence changes or
variations.
Similarly, antibodies designated primate (monkey, babboon, chimpanzee, etc.),
rodent (mouse, rat,
2 5 rabbit, guinea pid, hamster, and the like) and other mammals designate
such species, sub-genus,
genus, sub-family, family specific antibodies. Further, chimeric antibodies
include any combination
of the above. Such changes or variations optionally and preferably retain or
reduce the
immunogenicity in humans or other species relative to non-modified antibodies.
Thus, a human
antibody is distinct from a chimeric or humanized antibody. It is pointed out
that a human antibody
3 0 can be produced by a non-human animal or prokaryotic or eukaryotic cell
that is capable of
expressing functionally rearranged human immunoglobulin (e.g., heavy chain
and/or light chain)
genes. Further, when a human antibody is a single chain antibody, it can
comprise a linker peptide
that is not found in native human antibodies. For example, an Fv can comprise
a linker peptide, such
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
13
as two to about eight glycine or other amino acid residues, which connects the
variable region of the
heavy chain and the variable region of the light chain. Such linker peptides
are considered to be of
human origin.
Bispecific, heterospecific, heteroconjugate or similar antibodies can also be
used that are
monoclonal, preferably human or humanized, antibodies that have binding
specificities for at least
two different antigens. In the present case, one of the binding specificities
is for at least one RSV
protein, the other one is for any other antigen. Methods for making bispecific
antibodies are known
in the art. Traditionally, the recombinant production of bispecific antibodies
is based on the co-
expression of two immunoglobulin heavy chain-light chain pairs, where the two
heavy chains have
different specificities (Milstein and Cuello, Nature 305:537 (1983)). Because
of the random
assortment of immunoglobulin heavy and light chains, these hybridomas
(quadromas) produce a
potential mixture of 10 different antibody molecules, of which only one has
the correct bispecific
structure. The purification of the correct molecule, which is usually done by
affinity chromatography
steps, is rather cumbersome, and the product yields are low. Similar
procedures are disclosed, e.g., in
WO 93/08829, US Patent Nos, 6210668, 6193967, 6132992, 6106833, 6060285,
6037453, 6010902,
5989530, 5959084, 5959083, 5932448, 5833985, 5821333, 5807706, 5643759,
5601819, 5582996,
5496549, 4676980, WO 91/00360, WO 92/00373, EP 03089, Traunecker et al., EMBO
J. 10:3655
(1991), Suresh et al., Methods in Enzymology 121:210 (1986), each entirely
incorporated herein by
reference.
2 0 Such antibodies optionally further affect a specific ligand, such as but
not limited to where
such antibody modulates, decreases, increases, antagonizes, angonizes,
mitigates, aleviates, blocks,
inhibits, abrogates and/or interferes with at least one RSV activity or
binding, or with RSV receptor
activity or binding, in vitro, in situ and/or in vivo. As a non-limiting
example, a suitable RSV
antibody, specified portion or variant of the present invention can bind at
least one RSV, or specified
2 5 portions, variants or domains thereof . A suitable RSV antibody, specified
portion, or variant can
also optionally affect at least one of RSV activity or function, such as but
not limited to, RNA, DNA
or protein synthesis, RSV release, RSV receptor signaling, membrane RSV
cleavage, RSV activity,
RSV production and/or synthesis.
RSV antibodies (also termed RSV antibodies) useful in the methods and
compositions of the
3 0 present invention can optionally be characterized by high affinity binding
to RSV and optionally and
preferably having low toxicity. In particular, an antibody, specified fragment
or variant of the
invention, where the individual components, such as the variable region,
constant region and
framework, individually and/or collectively, optionally and preferably possess
low immunogenicity,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
14
is useful in the present invention. The antibodies that can be used in the
invention are optionally
characterized by their ability to treat patients for extended periods with
measurable alleviation of
symptoms and low and/or acceptable toxicity. Low or acceptable immunogenicity
and/or high
affinity, as well as other suitable properties, can contribute to the
therapeutic results achieved. "Low
immunogenicity" is defined herein as raising significant HAHA, HACA or HAMA
responses in less
than about 75%, or preferably less than about 50°Io of the patients
treated and/or raising low titres in
the patient treated (less than about 300, preferably less than about 100
measured with a double
antigen enzyme inununoassay) (Elliott et al., Lancet 344:1125-1127 (1994),
entirely incorporated
herein by reference).
Utility
The isolated nucleic acids of the present invention can be used for production
of at least one
RSV antibody or specified variant thereof, which can be used to measure or
effect in an cell, tissue,
organ or animal (including mammals and humans), to diagnose, monitor,
modulate, treat, alleviate,
help prevent the incidence of, or reduce the symptoms of, at least one RSV
condition, selected from,
but not limited to, at least one of an immune disorder or disease, a
cardiovascular disorder or disease,
an infectious, malignant, and/or neurologic disorder or disease, or other
known or specified RSV
related condition.
Such a method can comprise administering an effective amount of a composition
or a
pharmaceutical composition comprising at least one RSV antibody to a cell,
tissue, organ, animal or
2 0 patient in need of such modulation, treatment, alleviation, prevention, or
reduction in symptoms,
effects or mechanisms. The effective amount can comprise an amount of about
0.001 to 500 mg/kg
per single (e.g., bolus), multiple or continuous administration, or to achieve
a serum concentration of
0.01-5000 ~,g/ml serum concentration per single, multiple, or continuous
adminstration, or any
effective range or value therein, as done and determined using known methods,
as described herein or
2 5 known in the relevant arts.
Citations
All publications or patents cited herein are entirely incorporated herein by
reference as they
show the state of the art at the time of the present invention and/or to
provide description and
enablement of the present invention. Publications refer to any scientific or
patent publications, or any
3 0 other information available in any media format, including all recorded,
electronic or printed formats.
The following references are entirely incorporated herein by reference:
Ausubel, et al., ed., Current
Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987-2001);
Sambrook, et al.,
Molecular Cloning: A Laboratory Manual, 2°a Edition, Cold Spring
Harbor, NY (1989); Harlow and
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
Lane, antibodies, a Laboratory Manual, Cold Spring Harbor, NY ( 1989);
Colligan, et al., eds.,
Current Protocols in Immunology, John Wiley & Sons, Inc., NY (1994-2001);
Colligan et al., Current
Protocols in Protein Science, John Wiley & Sons, NY, NY, (1997-2001).
Antibodies of the Present Invention
At least one RSV antibody of the present invention can be optionally produced
by a cell line,
a mixed cell line, an immortalized cell or clonal population of immortalized
cells, as well known in
the art. See, e.g., Ausubel, et al., ed., Current Protocols in Molecular
Biology, John Wiley & Sons,
Inc., NY, NY (1987-2001); Sambrook, et al., Molecular Cloning: A Laboratory
Manual, 2°d Edition,
Cold Spring Harbor, NY (1989); Harlow and Lane, antibodies, a Laboratory
Manual, Cold Spring
10 Harbor, NY (1989); Colligan, et al., eds., Current Protocols in Immunology,
John Wiley & Sons, Inc.,
NY (1994-2001); Colligan et al., Current Protocols in Protein Science, John
Wiley & Sons, NY, NY,
(1997-2001), each entirely incorporated herein by reference.
Human antibodies that are specific for human RSV proteins or fragments thereof
can be
raised against an appropriate immunogenic antigen, such as isolated and/or RSV
protein or a portion
15 thereof (including synthetic molecules, such as synthetic peptides). Other
specific or general
mammalian antibodies can be similarly raised. Preparation of immunogenic
antigens, and
monoclonal antibody production can be performed using any suitable technique.
In one approach, a hybridoma is produced by fusing a suitable immortal cell
line (e.g., a
myeloma cell line such as, but not limited to, Sp2/0, Sp2/0-AG14, NSO, NS1,
NS2, AE-1, L.S, >243,
2 0 P3X63Ag8.653, Sp2 SA3, Sp2 MAI, Sp2 SS 1, Sp2 SAS, U937, MLA 144, ACT 1V,
MOLT4, DA-1,
JLTRKAT, WEHI, K-562, COS, RAJI, N1H 3T3, HL-60, MLA 144, NAMAIWA, NEURO 2A,
or the
like, or heteromylomas, fusion products thereof, or any cell or fusion cell
derived therefrom, or any
other suitable cell line as known in the art. See, e.g., www.atcc.org,
www.lifetech.com., and the like,
with antibody producing cells, such as, but not limited to, isolated or cloned
spleen, peripheral blood,
2 5 lymph, tonsil, or other immune or B cell containing cells, or any other
cells expressing heavy or light
chain constant or variable or framework or CDR sequences, either as endogenous
or heterologous
nucleic acid, as recombinant or endogenous, viral, bacterial, algal,
prokaryotic, amphibian, insect,
reptilian, fish, mammalian, rodent, equine, ovine, goat, sheep, primate,
eukaryotic, genomic DNA,
cDNA, rDNA, mitochondrial DNA or RNA, chloroplast DNA or RNA, hnRNA, mRNA,
tRNA,
3 0 single, double or triple stranded, hybridized, and the like or any
combination thereof. See, e.g.,
Ausubel, supra, and Colligan, Immunology, supra, chapter 2, entirely
incorporated herein by
reference.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
16
Antibody producing cells can also be obtained from the peripheral blood or,
preferably the
spleen or lymph nodes, of humans or other suitable animals that have been
immunized with the
antigen of interest. Any other suitable host cell can also be used for
expressing heterologous or
endogenous nucleic acid encoding an antibody, specified fragment or variant
thereof, of the present
invention. The fused cells (hybridomas) or recombinant cells can be isolated
using selective culture
conditions or other suitable known methods, and cloned by limiting dilution or
cell sorting, or other
known methods. Cells which produce antibodies with the desired specificity can
be selected by a
suitable assay (e.g., ELISA).
Other suitable methods of producing or isolating antibodies of the requisite
specificity can be
used, including, but not limited to, methods that select recombinant antibody
from a peptide or
protein library (e.g., but not limited to, a bacteriophage, ribosome,
oligonucleotide, RNA, cDNA, or
the like, display library; e.g., as available from Cambridge antibody
Technologies, Cambridgeshire,
UK; MorphoSys, Martinsreid/Planegg, DE; Biovation, Aberdeen, Scotland, UK;
BioInvent, Lund,
Sweden; Dyax Corp., Enzon, Affymax/Biosite; Xoma, Berkeley, CA; Ixsys. See,
e.g., EP 368,684,
PCTlGB91/01134; PCT/GB92/01755; PCT/GB92/002240; PCT/GB92/00883;
PCT/GB93/00605; US
08/350260(5/12/94); PCT/GB94/01422; PCT/GB94/02662; PCT/GB97/01835; (CAT/MRC);
W090114443; W090/14424; W090/14430; PCT/US94/1234; W092/18619; WO96/07754;
(Scripps); EP 614 989 (MorphoSys); W095/16027 (BioInvent); W088/06630;
W090/3809 (Dyax);
US 4,704,692 (Enzon); PCT/LJS91/02989 (Affymax); W089/06283; EP 371 998; EP
550 400;
2 0 (Xoma); EP 229 046; PCT/US91/07149 (Ixsys); or stochastically generated
peptides or proteins - US
5723323, 5763192, 5814476, 5817483, 5824514, 5976862, WO 86105803, EP 590 689
(Ixsys, now
Applied Molecular Evolution (AME), each entirely incorporated herein by
reference) or that rely
upon immunization of transgenic animals (e.g., SCID mice, Nguyen et al.,
Microbiol. Tinmunol.
41:901-907 (1997); Sandhu et al., Crit. Rev. Biotechnol. 16:95-118 (1996);
Eren et al., Immunol.
2 5 93:154-161 (1998), each entirely incorporated by reference as well as
related patents and
applications) that are capable of producing a repertoire of human antibodies,
as known in the art
andlor as described herein. Such techniques, include, but are not limited to,
ribosome display (Hanes
et al., Proc. Natl. Acad. Sci. USA, 94:4937-4942 (May 1997); Hanes et al.,
Proc. Natl. Acad. Sci.
USA, 95:14130-14135 (Nov. 1998)); single cell antibody producing technologies
(e.g., selected
3 0 lymphocyte antibody method ("SLAM") (US pat. No. 5,627,052, Wen et al., J.
Immunol. 17:887-892
(1987); Babcook et al., Proc. Natl. Acad. Sci. USA 93:7843-7848 (1996)); gel
microdroplet and flow
cytometry (Powell et al., Biotechnol. 8:333-337 (1990); One Cell Systems,
Cambridge, MA; Gray et
al., J. Imm. Meth. 182:155-163 (1995); Kenny et al., Bio/Technol. 13:787-790
(1995)); B-cell
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
17
selection (Steenbakkers et al., Molec. Biol. Reports 19:125-134 (1994); Jonak
et al., Progress
Biotech, Vol. 5, In Vitro Immunization in Hybridoma Technology, Borrebaeck,
ed., Elsevier Science
Publishers B.V., Amsterdam, Netherlands (1988)).
Methods for engineering or humanizing non-human or human antibodies can also
be used and
are well known in the art. Generally, a humanized or engineered antibody has
one or more amino acid
residues from a source which is non-human, e.g., but not limited to mouse,
rat, rabbit, non-human
primate or other mammal. These human amino acid residues are often referred to
as "import"
residues, which are typically taken from an "import" variable, constant or
other domain of a known
human sequence. Known human Ig sequences are disclosed, e.g.,
www.ncbi.nlm.nih.gov/entrez/query.fcgi; www.atcc.org/phage/hdb.html;
www.sciquest.coml;
www.abcam.com/; www.antibodyresource.com/onlinecomp.html;
www.public.iastate.edu/~pedro/research tools.html; www.mgen.uni-
heidelberg.de/SD/TT/IT.html;
www.whfreeman.com/immunology/CHOS/kuby05.htm;
www.library.thinkquest.org/12429/ImmunelAntibody.html;
www.hhmi.org/grants/lectures/1996/vlab/;
www.path.cam.ac.uk/~mrc7/mikeimages.html;
www.antibodyresource.com/;
mcb.harvard.edu/BioLinks/Immunology.html.www.immunologylink.com/;
pathbox.wustl.edu/~hcenterlindex.html; www.biotech.ufl.edu/~hcl/;
www.pebio.com/pa/340913/340913.html; www.nal.usda.gov/awic/pubslantibody/;
2 0 www.m.ehime-u.ac.jp/~yasuhito/Elisa.html; www.biodesign.com/table.asp;
www.icnet.uk/axp/facs/davies/links.html;
www.biotech.ufl.edu/~fccllprotocol.html; www.isac-
net.org/sites~eo.html; aximtl.imt.uni-marburg.de/~rek/AEPStart.html;
baserv.uci.kun.nl/ jraats/linksl.html; www.recab.uni-
hd.de/immuno.bme.nwu.edu/; www.mrc-
cpe.cam.ac.uk/imt-doc/public/INTRO.html; www.ibt.unam.mx/vir~ mice.html;
imgt.cnusc.fr:8104/;
2 5 www.biochem.ucl.ac.uk/~martin/abs/index.html; antibody.bath.ac.uk/;
abgen.cvm.tamu.edu/lab/wwwabgen.html;
www.unizh.ch/~honegger/AHOseminar/SlideOl.html;
www.cryst.bbk.ac.uk/~ubcg07s/; www.nimr.mrc.ac.uk/CC/ccaewg/ccaewg.htm;
www.path.cam.ac.uk/~mrc7lhumanisation/TAFi~IP.html;
www.ibt.unam.mx/vir/structure/stat aim.html;
www.biosci.missouri.edu/smithgp/index.html;
3 0 www.cryst.bioc.cam.ac.uk/~finolina/Web-pages/Peptlspottech.html;
www.jerini.de/fr_products.htm;
www.patents.ibm.com/ibm.html.Kabat et al., Sequences of Proteins of
Immunological Interest, U.S.
Dept. Health (1983), each entirely incorporated herein by reference.
Such imported sequences can be used to reduce immunogenicity or reduce,
enhance or
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
18
modify binding, affinity, on-rate, off rate, avidity, specificity, half life,
or any other suitable
characteristic, as known in the art. Generally part or all of the non-human or
human CDR sequences
are maintained while the non-human sequences of the variable and constant
regions are replaced with
human or other amino acids. antibodies can also optionally be humanized with
retention of high
affinity for the antigen and other favorable biological properties. To achieve
this goal, humanized
antibodies can be optionally prepared by a process of analysis of the parental
sequences and various
conceptual humanized products using three-dimensional models of the parental
and humanized
sequences. Three-dimensional immunoglobulin models are commonly available and
are familiar to
those skilled in the art. Computer programs are available which illustrate and
display probable three-
dimensional conformational structures of selected candidate immunoglobulin
sequences. Inspection
of these displays permits analysis of the likely role of the residues in the
functioning of the candidate
immunoglobulin sequence, i.e., the analysis of residues that influence the
ability of the candidate
immunoglobulin to bind its antigen. In this way, FR residues can be selected
and combined from the
consensus and import sequences so that the desired antibody characteristic,
such as increased affinity
for the target antigen(s), is achieved. In general, the CDR residues are
directly and most substantially
involved in influencing antigen binding. Humanization or engineering of
antibodies of the present
invention can be performed using any known method, such as but not limited to
those described in,
Winter (Jones et al., Nature 321:522 (1986); Rieehmann et al., Nature 332:323
(1988); Verhoeyen et
al., Science 239:1534 (1988)), Sims et al., J. Immunol. 151: 2296 (1993);
Chothia and Lesk, J. Mol.
2 0 Biol. 196:901 (1987), Carter et al., Proc. Natl. Acad. Sci. U.S.A. 89:4285
(1992); Presta et al., J.
Immunol. 151:2623 (1993), US patent Nos: 5723323, 5976862, 5824514, 5817483,
5814476,
5763192, 5723323, 5,766886, 5714352, 6204023, 6180370, 5693762, 5530101,
5585089, 5225539;
4816567, PCT/: US98/16280, US96/18978, US91/09630, US91/05939, US94/01234,
GB89/01334,
GB91/01134, GB92/01755; W090/14443, W090/14424, W090/14430, EP 229246, each
entirely
2 5 incorporated herein by reference, included references cited therein.
The RSV antibody can also be optionally generated by immunization of a
transgenic animal
(e.g., mouse, rat, hamster, non-human primate, and the like) capable of
producing a repertoire of
human antibodies, as described herein and/or as known in the art. Cells that
produce a human RSV
antibody can be isolated from such animals and immortalized using suitable
methods, such as the
3 0 methods described herein.
Transgenic mice that can produce a repertoire of human antibodies that bind to
human
antigens can be produced by known methods (e.g., but not limited to, U.S. Pat.
Nos: 5,770,428,
5,569,825, 5,545,806, 5,625,126, 5,625,825, 5,633,425, 5,661,016 and 5,789,650
issued to Lonberg et
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
19
al.; Jakobovits et al. WO 98/50433, Jakobovits et al. WO 98/24893, Lonberg et
al. WO 98/24884,
Lonberg et al. WO 97/13852, Lonberg et al. WO 94/25585, Kucherlapate et al. WO
96/34096,
Kucherlapate et al. EP 0463 151 B 1, Kucherlapate et al. EP 0710 719 Al,
Surani et al. US. Pat. No.
5,545,807, Bruggemann et al. WO 90/04036, Bruggemann et al. EP 0438 474 B 1,
Lonberg et al. EP
0814 259 A2, Lonberg et al. GB 2 272 440 A, Lonberg et al. Nature 368:856-859
( 1994), Taylor et
al., Ifzt. Irnmunol. 6(4)579-591 (1994), Green et al, Natuz-e Gerzeti.cs 7:13-
21 (1994), Mendez et al.,
Nature Genetics 15:146-156 (1997), Taylor et al., Nucleic Acids Research
20(23):6287-6295 (1992),
Tuaillon et al., Proc Natl Acad Sei USA 90(8)3720-3724 ( 1993), Lonberg et
al., Int Rev Inzznunol
13(1):65-93 (1995) and Fishwald et al., Nat Biotechrzol 14(7):845-851 (1996),
which are each entirely
incorporated herein by reference). Generally, these mice comprise at least one
transgene comprising
DNA from at least one human immunoglobulin locus that is functionally
rearranged, or which can
undergo functional rearrangement. The endogenous immunoglobulin loci in such
mice can be
disrupted or deleted to eliminate the capacity of the animal to produce
antibodies encoded by
endogenous genes.
Screening antibodies for specific binding to similar proteins or fragments can
be conveniently
achieved using peptide display libraries. This method involves the screening
of large collections of
peptides for individual members having the desired function or structure.
antibody screening of peptide
display libraries is well known in the art. The displayed peptide sequences
can be from 3 to 5000 or
more amino acids in length, frequently from 5-100 amino acids long, and often
from about 8 to 25
2 0 amino acids long. In addition to direct chemical synthetic methods for
generating peptide libraries,
several recombinant DNA methods have been described. One type involves the
display of a peptide
sequence on the surface of a bacteriophage or cell. Each bacteriophage or cell
contains the nucleotide
sequence encoding the particular displayed peptide sequence. Such methods are
described in PCT
Patent Publication Nos. 91117271, 91/18980, 91/19818, and 93/08278. Other
systems for generating
2 5 libraries of peptides have aspects of both in vitro chemical synthesis and
recombinant methods. See,
PCT Patent Publication Nos. 92/05258, 92/14843, and 96/19256. See also, U.S.
Patent Nos. 5,658,754;
and 5,643,768. Peptide display libraries, vector, and screening kits are
commercially available from
such suppliers as Invitrogen (Carlsbad, CA), and Cambridge antibody
Technologies (Cambridgeshire,
UK). See, e.g., U.S. Pat. Nos. 4704692, 4939666, 4946778, 5260203, 5455030,
5518889, 5534621,
3 0 5656730, 5763733, 5767260, 5856456, assigned to Enzon; 5223409, 5403484,
5571698, 5837500,
assigned to Dyax, 5427908, 5580717, assigned to Affymax; 5885793, assigned to
Cambridge antibody
Technologies; 5750373, assigned to Genentech, 5618920, 5595898, 5576195,
5698435, 5693493,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
5698417, assigned to Xoma, Colligan, supra; Ausubel, supra; or Sambrook,
supra, each of the above
patents and publications entirely incorporated herein by reference.
Antibodies of the present invention can also be prepared using at least one
RSV antibody
encoding nucleic acid to provide transgenic animals or mammals, such as goats,
cows, horses, sheep,
5 and the like, that produce such antibodies in their milk. Such animals can
be provided using known
methods. See, e.g., but not limited to, US patent nos. 5,827,690; 5,849,992;
4,873,316; 5,849,992;
5,994,616; 5,565,362; 5,304,489, and the like, each of which is entirely
incorporated herein by
reference.
Antibodies of the present invention can additionally be prepared using at
least one RSV
10 antibody encoding nucleic acid to provide transgenic plants and cultured
plant cells (e.g., but not
limited to tobacco and maize) that produce such antibodies, specified portions
or variants in the plant
parts or in cells cultured therefrom. As a non-limiting example, transgenic
tobacco leaves expressing
recombinant proteins have been successfully used to provide large amounts of
recombinant proteins,
e.g., using an inducible promoter. See, e.g., Cramer et al., Curr. Top.
Microbol. Immunol. 240:95-
15 118 (1999) and references cited therein. Also, transgenic maize have been
used to express
mammalian proteins at commercial production levels, with biological activities
equivalent to those
produced in other recombinant systems or purified from natural sources. See,
e.g., Hood et al., Adv.
Exp. Med. Biol. 464:127-147 (1999) and references cited therein. antibodies
have also been
produced in large amounts from transgenic plant seeds including antibody
fragments, such as single
2 0 chain antibodies (scFv's), including tobacco seeds and potato tubers. See,
e.g., Conrad et al., Plant
Mol. Biol. 38:101-109 (1998) and reference cited therein. Thus, antibodies of
the present invention
can also be produced using transgenic plants, according to know methods. See
also, e.g., Fischer et
al., Biotechnol. Appl. Biochem. 30:99-108 (Oct., 1999), Ma et al., Trends
Biotechnol. 13:522-7
(1995); Ma et al., Plant Physiol. 109:341-6 (1995); Whitelam et al., Biochem.
Soc. Trans. 22:940-944
2 5 (1994); and references cited therein. See, also generally for plant
expression of antibodies, but not
limited to, Each of the above references is entirely incorporated herein by
reference.
The antibodies of the invention can bind human RSV with a wide range of
affinities (KD). In
a preferred embodiment, at least one human mAb of the present invention can
optionally bind human
RSV with high affinity. For example, a human mAb can bind human RSV with a KD
equal to or less
3 0 than about 10-' M, such as but not limited to, 0.1-9.9 (or any range or
value therein) X 10-', 10-$, 10-
9,10-1°, 10u1, 10_12 , 10-13 or any range or value therein.
The affinity or avidity of an antibody for an antigen can be determined
experimentally using
any suitable method. (See, for example, Berzofsky, et al., "Antibody-Antigen
Interactions," In
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
21
Furzdanzerztal Irnrnurzology, Paul, W. E., Ed., Raven Press: New York, NY
(1984); Kuby, Janis
Inznzunology, W. H. Freeman and Company: New York, NY (1992); and methods
described herein).
The measured affinity of a particular antibody-antigen interaction can vary if
measured under
different conditions (e.g., salt concentration, pH). Thus, measurements of
affinity and other antigen-
s binding parameters (e.g., KD, Ka, Ka) are preferably made with standardized
solutions of antibody and
antigen, and a standardized buffer, such as the buffer described herein.
Nucleic Acid Molecules
Using the information provided herein, such as the nucleotide sequences
encoding at least 70-
100% of the contiguous amino acids of at least one of any 5-500 amino acid
portion of SEQ ID
NOS:7-12, any portion of Figures 3-4 or encoded by any portion of Figures 2A-G
or 5A-F , specified
fragments, variants or consensus sequences thereof, or a deposited vector
comprising at least one of
these sequences, a nucleic acid molecule of the present invention encoding at
least one RSV antibody
can be obtained using methods described herein or as known in the art.
Nucleic acid molecules of the present invention can be in the form of RNA,
such as mRNA,
hnRNA, tRNA or any other form,'or in the form of DNA, including, but not
limited to, cDNA and
genomic DNA obtained by cloning or produced synthetically, or any combinations
thereof. The
DNA can be triple-stranded, double-stranded or single-stranded, or any
combination thereof. Any
portion of at least one strand of the DNA or RNA can be the coding strand,
also known as the sense
strand, or it can be the non-coding strand, also referred to as theanti-sense
strand.
2 0 Isolated nucleic acid molecules of the present invention can include
nucleic acid molecules
comprising an open reading frame (ORF), optionally with one or more introns,
e.g., but not limited
to, at least one specified portion of at least one CDR, as CDRl, CDR2 and/or
CDR3 of at least one
heavy chain or light chain; nucleic acid molecules comprising the coding
sequence for an RSV
antibody or variable region (e.g., any 5-500 amino acid portion of SEQ ID
NOS:7-12, any portion of
2 5 Figures 3-4 or encoded by any portion of Figures 2A-G or 5A-F ); and
nucleic acid molecules which
comprise a nucleotide sequence substantially different from those described
above but which, due to
the degeneracy of the genetic code, still encode at least one RSV antibody as
described herein and/or
as known in the art. Of course, the genetic code is well known in the art.
Thus, it would be routine
for one skilled in the art to generate such degenerate nucleic acid variants
that code for specific RSV
3 0 antibodies of the present invention. See, e.g., Ausubel, et al., supra,
and such nucleic acid variants are
included in the present invention. Non-limiting examples of isolated nucleic
acid molecules of the
present inveniton include the CDR sequences of any 5-500 amino acid portion of
SEQ ID NOS:7-12,
any portion of Figures 3-4 or encoded by any portion of Figures 2A-G or 5A-F ,
corresponding to
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
22
non-limiting examples of a nucleic acid encoding, respectively, HC CDR1, HC
CDR2, HC CDR3,
LC CDRl, LC CDR2, LC CDR3, HC variable region and LC variable region.
As indicated herein, nucleic acid molecules of the present invention which
comprise a
nucleic acid encoding an RSV antibody can include, but are not limited to,
those encoding the amino
acid sequence of an antibody fragment, by itself; the coding sequence for the
entire antibody or a
portion thereof; the coding sequence for an antibody, fragment or portion, as
well as additional
sequences, such as the coding sequence of at least one signal leader or fusion
peptide, with or without
the aforementioned additional coding sequences, such as at least one intron,
together with additional,
non-coding sequences, including but riot limited to, non-coding 5' and 3'
sequences, such as the
transcribed, non-translated sequences that play a role in transcription, mRNA
processing, including
splicing and polyadenylation signals (for example - ribosome binding and
stability of mRNA); an
additional coding sequence that codes for additional amino acids, such as
those that provide
additional functionalities. Thus, the sequence encoding an antibody can be
fused to a marker
sequence, such as a sequence encoding a peptide that facilitates purification
of the fused antibody
comprising an antibody fragment or portion.
Polynucleotides Which Selectively Hybridize to a Polynucleotide as Described
Herein
The present invention provides isolated nucleic acids that hybridize under
selective
hybridization conditions to a polynucleotide disclosed herein. Thus, the
polynucleotides of this
2 0 embodiment can be used for isolating, detecting, andlor quantifying
nucleic acids comprising such
polynucleotides. For example, polynucleotides of the present invention can be
used to identify, isolate,
or amplify partial or full-length clones in a deposited library. In some
embodiments, the polynucleotides
are genomic or cDNA sequences isolated, or otherwise complementary to, a cDNA
from a human or
mammalian nucleic acid library.
2 5 Preferably, the cDNA library comprises at least 80% full-length sequences,
preferably at least
85% or 90% full-length sequences, and more preferably at least 95% full-length
sequences. The cDNA
libraries can be normalized to increase the representation of rare sequences.
Low or moderate
stringency hybridization conditions are typically, but not exclusively,
employed with sequences having a
reduced sequence identity relative to complementary sequences. Moderate and
high stringency
3 0 conditions can optionally be employed for sequences of greater identity.
Low stringency conditions
allow selective hybridization of sequences having about 70% sequence identity
and can be employed to
identify orthologous or paralogous sequences.
Optionally, polynucleotides of this invention will encode at least a portion
of an antibody
encoded by the polynucleotides described herein. The p~~ynucleotides of this
invention embrace nucleic
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
23
acid sequences that can be employed for selective hybridization to a
polynucleotide encoding an
antibody of the present invention. See, e.g., Ausubel, supra; Colligan, supra,
each entirely incorporated
herein by reference.
Construction of Nucleic Acids
The isolated nucleic acids of the present invention can be made using (a)
recombinant methods,
(b) synthetic techniques, (c) purification techniques, or combinations
thereof, as well-known in the art.
The nucleic acids can conveniently comprise sequences in addition to a
polynucleotide of the
present invention. For example, a multi-cloning site comprising one or more
endonuclease restriction
sites can be inserted into the nucleic acid to aid in isolation of the
polynucleotide. Also, translatable
sequences can be inserted to aid in the isolation of the translated
polynucleotide of the present invention.
For example, a hexa-histidine marker sequence provides a convenient means to
purify the proteins of
the present invention. The nucleic acid of the present invention - excluding
the coding sequence - is
optionally a vector, adapter, or linker for cloning and/or expression of a
polynucleotide of the present
invention.
Additional sequences can be added to such cloning and/or expression sequences
to optimize
1
their function in cloning and/or expression, to aid in isolation of the
polynucleotide, or to improve the
introduction of the polynucleotide into a cell. Use of cloning vectors,
expression vectors, adapters, and
linkers is well known in the art. (See, e.g., Ausubel, supra; or Sambrook,
supra)
Recombinant Methods for Constructing Nucleic Acids
2 0 The isolated nucleic acid compositions of this invention, such as RNA,
cDNA, genomic DNA,
or any combination thereof, can be obtained from biological sources using any
number of cloning
methodologies known to those of skill in the art. In some embodiments,
oligonucleotide probes that
selectively hybridize, under stringent conditions, to the polynucleotides of
the present invention are used
to identify the desired sequence in a cDNA or genomic DNA library. The
isolation of RNA, and
2 5 construction of cDNA and genomic libraries, is well known to those of
ordinary skill in the art. (See,
e.g., Ausubel, supra; or Sambrook, supra)
Nucleic Acid Screening and Isolation Methods
A cDNA or genomic library can be screened using a probe based upon the
sequence of a
polynucleotide of the present invention, such as those disclosed herein.
Probes can be used to hybridize
3 0 with genomic DNA or cDNA sequences to isolate homologous genes in the same
or different organisms.
Those of skill in the art will appreciate that various degrees of stringency
of hybridization can be
employed in the assay; and either the hybridization or the wash medium can be
stringent. As the
conditions for hybridization become more stringent, there must be a greater
degree of complementarity
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
24
between the probe and the target for duplex formation to occur. The degree of
stringency can be
controlled by one or more of temperature, ionic strength, pH and the presence
of a partially denaturing
solvent such as formamide. For example, the stringency of hybridization is
conveniently varied by
changing the polarity of the reactant solution through, for example,
manipulation of the concentration of
formamide within the range of 0% to 50%. The degree of complementarity
(sequence identity) required
for detectable binding will vary in accordance with the stringency of the
hybridization medium andlor
wash medium. The degree of complementarity will optimally be 100%, or 70-100%,
or any range or
value therein. However, it should be understood that minor sequence variations
in the probes and
primers can be compensated for by reducing the stringency of the hybridization
and/or wash medium.
Methods of amplification of RNA or DNA are well known in the art and can be
used
according to the present invention without undue experimentation, based on the
teaching and
guidance presented herein.
Known methods of DNA or RNA amplification include, but are not limited to,
polymerase
chain reaction (PCR) and related amplification processes (see, e.g., U.S.
Patent Nos. 4,683,195,
4,683,202, 4,800,159, 4,965,188, to Mullis, et al.; 4,795,699 and 4,921,794 to
Tabors et al; 5,142,033
to Innis; 5,122,464 to Wilson, et al.; 5,091,310 to Innis; 5,066,584 to
Gyllensten, et al; 4,889,818 to
Gelfand, et al; 4,994,370 to Silver, et al; 4,766,067 to Biswas; 4,656,134 to
Ringold) and RNA
mediated amplification that usesanti-sense RNA to the target sequence as a
template for double-
stranded DNA synthesis (U.S. Patent No. 5,130,238 to Malek, et al, with the
tradename NASBA), the
2 0 entire contents of which references are incorporated herein by reference.
(See, e.g., Ausubel, supra;
or Sambrook, supra.)
For instance, polymerase chain reaction (PCR) technology can be used to
amplify the sequences
of polynucleotides of the present invention and related genes directly from
genomic DNA or cDNA
libraries. PCR and other in vitro amplification methods can also be useful,
for example, to clone nucleic
2 5 acid sequences that code for proteins to be expressed, to make nucleic
acids to use as probes for
detecting the presence of the desired mRNA in samples, for nucleic acid
sequencing, or for other
purposes. Examples of techniques sufficient to direct persons of skill through
in vitro amplification
methods are found in Berger, supra, Sambrook, supra, and Ausubel, supra, as
well as Mullis, et al., U.S.
Patent No. 4,683,202 (1987); and Innis, et al., PCR Protocols A Guide to
Methods and Applications,
3 0 Eds., Academic Press Inc., San Diego, CA (1990). Commercially available
kits for genomic PCR
amplification are known in the art. See, e.g., Advantage-GC Genomic PCR Kit
(Clontech).
Additionally, e.g., the T4 gene 32 protein (Boehringer Mannheim) can be used
to improve yield of long
PCR products.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
Synthetic Methods for Constructing Nucleic Acids
The isolated nucleic acids of the present invention can also be prepared by
direct chemical
synthesis by known methods (see, e.g., Ausubel, et al., supra). Chemical
synthesis generally produces a
single-stranded oligonucleotide, which can be converted into double-stranded
DNA by hybridization
5 with a complementary sequence, or by polymerization with a DNA polymerase
using the single strand
as a template. One of skill in the art will recognize that while chemical
synthesis of DNA can be limited
to sequences of about 100 or more bases, longer sequences can be obtained by
the ligation of shorter
sequences.
Recombinant Expression Cassettes
10 The present invention further provides recombinant expression cassettes
comprising a nucleic
acid of the present invention. A nucleic acid sequence of the present
invention, for example a cDNA or
a genomic sequence encoding an antibody of the present invention, can be used
to construct a
recombinant expression cassette that can be introduced into at least one
desired host cell. A
recombinant expression cassette will typically comprise a polynucleotide of
the present invention
15 operably linked to transcriptional initiation regulatory sequences that
will direct the transcription of the
polynucleotide in the intended host cell. Both heterologous and non-
heterologous (i.e., endogenous)
promoters can be employed to direct expression of the nucleic acids of the
present invention.
In some embodiments, isolated nucleic acids that serve as promoter, enhancer,
or other elements
can be introduced in the appropriate position (upstream, downstream or in
intron) of a non-heterologous
2 0 form of a polynucleotide of the present invention so as to up or down
regulate expression of a
polynucleotide of the present invention. For example, endogenous promoters can
be altered in vivo or ifz
vitro by mutation, deletion and/or substitution.
Vectors And Host Cells
The present invention also relates to vectors that include isolated nucleic
acid molecules of
2 5 the present invention, host cells that are genetically engineered with the
recombinant vectors, and the
production of at least one RSV antibody by recombinant techniques, as is well
known in the art. See,
e.g., Sambrook, et al., supra; Ausubel, et al., supra, each entirely
incorporated herein by reference.
The polynucleotides can optionally be joined to a vector containing a
selectable marker for
propagation in a host. Generally, a plasmid vector is introduced in a
precipitate, such as a calcium
3 0 phosphate precipitate, or in a complex with a charged lipid. If the vector
is a virus, it can be
packaged in vitro using an appropriate packaging cell line and then transduced
into host cells.
The DNA insert should be operatively linked to an appropriate promoter. The
expression
constructs will further contain sites for transcription initiation,
termination and, in the transcribed
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
26
region, a ribosome binding site for translation. The coding portion of the
mature transcripts
expressed by the constructs will preferably include a translation initiating
at the beginning and a
termination codon (e.g., UAA, UGA or UAG) appropriately positioned at the end
of the mRNA to be
translated, with UAA and UAG preferred for mammalian or eukaryotic cell
expression.
Expression vectors will preferably but optionally include at least one
selectable marker.
Such markers include, e.g., but not limited to, methotrexate (MTX),
dihydrofolate reductase (DHFR,
US Pat.Nos. 4,399,216; 4,634,665; 4,656,134; 4,956,288; 5,149,636; 5,179,017,
ampicillin, neomycin
(G418), mycophenolic acid, or glutamine synthetase (GS, US Pat.Nos. 5,122,464;
5,770,359;
5,827,739) resistance for eukaryotic cell culture, and tetracycline or
ampicillin resistance genes for
culturing in E. coli and other bacteria or prokaryotics (the above patents are
entirely incorporated
hereby by reference). Appropriate culture mediums and conditions for the above-
described host cells
are known in the art. Suitable vectors will be readily apparent to the skilled
artisan. Introduction of a
vector construct into a host cell can be effected by calcium phosphate
transfection, DEAF-dextran
mediated transfection, cationic lipid-mediated transfection, electroporation,
transduction, infection or
other known methods. Such methods are described in the art, such as Sambrook,
supra, Chapters 1-4
and 16-18; Ausubel, supra, Chapters 1, 9, 13, 15, 16.
At least one antibody of the present invention can be expressed in a modified
form, such as a
fusion protein, and can include not only secretion signals, but also
additional heterologous functional
regions. For instance, a region of additional amino acids, particularly
charged amino acids, can be
2 0 added to the N-terminus of an antibody to improve stability and
persistence in the host cell, during
purification, or during subsequent handling and storage. Also, peptide
moieties can be added to an
antibody of the present invention to facilitate purification. Such regions can
be removed prior to final
preparation of an antibody or at least one fragment thereof. Such methods are
described in many
standard laboratory manuals, such as Sambrook, supra, Chapters 17.29-17.42 and
18.1-18.74;
2 5 Ausubel, supra, Chapters 16, 17 and 18.
Those of ordinary skill in the art are knowledgeable in the numerous
expression systems
available for expression of a nucleic acid encoding a protein of the present
invention.
Alternatively, nucleic acids of the present invention can be expressed in a
host cell by turning
on (by manipulation) in a host cell that contains endogenous DNA encoding an
antibody of the present
3 0 invention. Such methods are well known in the art, e.g., as described in
US patent Nos. 5,580,734,
5,641,670, 5,733,746, and 5,733,761, entirely incorporated herein by
reference.
Illustrative of cell cultures useful for the production of the antibodies,
specified portions or
variants thereof, are mammalian cells. Mammalian cell systems often will be in
the form of monolayers
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
27
of cells although mammalian cell suspensions or bioreactors can also be used.
A number of suitable
host cell lines capable of expressing intact glycosylated proteins have been
developed in the art, and
include the COS-1 (e.g., ATCC CRL 1650), COS-7 (e.g., ATCC CRL-1651), HEK293,
BHK21 (e.g.,
ATCC CRL-10), CHO (e.g., ATCC CRL 1610) and BSC-1 (e.g., ATCC CRL-26) cell
lines, Cos-7
cells, CHO cells, hep G2 cells, P3X63Ag8.653, SP2/0-Agl4, 293 cells, HeLa
cells and the like,
which are readily available from, for example, American Type Culture
Collection, Manassas, Va
(www.atcc.org). Preferred host cells include cells of lymphoid origin such as
myeloma and
lymphoma cells. Particularly preferred host cells are P3X63Ag8.653 cells (ATCC
Accession
Number CRL-1580) and SP2/0-Agl4 cells (ATCC Accession Number CRL-1851). In a
particularly
preferred embodiment, the recombinant cell is a P3X63Ab8.653 or a SP2/0-Agl4
cell.
Expression vectors for these cells can include one or more of the following
expression control
sequences, such as, but not limited to an origin of replication; a promoter
(e.g., late or early SV40
promoters, the CMV promoter (US Pat.Nos. 5,168,062; 5,385,839), an HSV tk
promoter, a pgk
(phosphoglycerate kinase) promoter, an EF-1 alpha promoter (US Pat.No.
5,266,491), at least one
human immunoglobulin promoter; an enhancer, andlor processing information
sites, such as ribosome
binding sites, RNA splice sites, polyadenylation sites (e.g., an SV40 large T
Ag poly A addition site),
and transcriptional terminator sequences. See, e.g., Ausubel et al., supra;
Sambrook, et al., supra. Other
cells useful for production of nucleic acids or proteins of the present
invention are known and/or
available, for instance, from the American Type Culture Collection Catalogue
of Cell Lines and
2 0 Hybridomas (www.atcc.org) or other known or commercial sources.
When eukaryotic host cells are employed, polyadenlyation or transcription
terminator sequences
are typically incorporated into the vector. An example of a terminator
sequence is the polyadenlyation
sequence from the bovine growth hormone gene. Sequences for accurate splicing
of the transcript can
also be included. An example of a splicing sequence is the VP1 intron from
SV40 (Sprague, et al., J.
2 5 Virol. 45:773-781 (1983)). Additionally, gene sequences to control
replication in the host cell can be
incorporated into the vector, as known in the art.
Purification of an Antibody
An RSV antibody can be recovered and purified from recombinant cell cultures
by well-
3 0 known methods including, but not limited to, protein A purification,
ammonium sulfate or ethanol
precipitation, acid extraction, anion or cation exchange chromatography,
phosphocellulose
chromatography, hydrophobic interaction chromatography, affinity
chromatography, hydroxylapatite
chromatography and lectin chromatography. High performance liquid
chromatography ("HPLC") can
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
28
also be employed for purification. See, e.g., Colligan, Current Protocols in
Immunology, or Current
Protocols in Protein Science, John Wiley & Sons, NY, NY, (1997-2001), e.g.,
Chapters 1, 4, 6, 8, 9,
10, each entirely incorporated herein by reference.
Antibodies of the present invention include naturally purified products,
products of chemical
synthetic procedures, and products produced by recombinant techniques from a
eukaryotic host,
including, for example, yeast, higher plant, insect and mammalian cells.
Depending upon the host
employed in a recombinant production procedure, the antibody of the present
invention can be
glycosylated or can be non-glycosylated, with glycosylated preferred. Such
methods are described in
many standard laboratory manuals, such as Sambrook, supra, Sections 17.37-
17.42; Ausubel, supra,
Chapters 10, 12, 13, 16, 18 and 20, Colligan, Protein Science, supra, Chapters
12-14, all entirely
incorporated herein by reference.
RSV Proteins and Antibodies
The isolated proteins and antibodies of the present invention comprise at
least one protein
and/or antibody amino acid sequence disclosed or described herein encoded by
any suitable
polynucleotide, or any at least one isolated or prepared protein antibody.
Preferably, the at least one
protein has at least one RSV activity and the at least one antibody binds
human RSV and, thereby
partially or substantially modulates at least one structural or biological
activity of at least one RSV
protein.
2 0 As used herein, the term "RSV protein" refers to a protein as described
herein that has at least
one RSV-dependent activity, such as 5-10000%, of the activity of a known or
other RSV protein or
active portion thereof, preferably by at least about 10, 20, 30, 40, 50, 55,
60, 65, 70, 75, 80, 85, 90, 91,
92, 93, 94, 95, 96, 97, 98, 99, 100% or more, depending on the assay. The
capacity of a RSV protein to
have at least one RSV-dependent activity is preferably assessed by at least
one suitable RSV protein or
2 5 receptor assay, as described herein and/or as known in the art.
As used herein, the term "neutralizing antibody" refers to an antibody that
can inhibit at least
one RSV-dependent activity by about 5-120%, preferably by at least about 10,
20, 30, 40, 50, 55, 60, 65,
70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% or more depending
on the assay. The
capacity of an RSV antibody to inhibit an RSV-dependent activity is preferably
assessed by at least one
3 0 suitable RSV protein or receptor assay, as described herein and/or as
known in the art. An antibody of
the invention can be of any class (IgG, IgA, IgM, IgE, IgD, etc.) or isotype
and can comprise a kappa or
lambda light chain. In one embodiment, the human antibody comprises an IgG
heavy chain or defined
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
29
fragment, for example, at least one of isotypes, IgGl, IgG2, IgG3 or IgG4.
Antibodies of this type can
be prepared by employing a transgenic mouse or other trangenic non-human
mammal comprising at
least one human light chain (e.g., IgG, IgA~ and IgM (e.g., ~yl, ~2, 'y3, 'y4)
transgenes as described herein
and/or as known in the art. In another embodiment, the human RSV human
antibody comprises an IgGl
heavy chain and a IgGl Olight chain.
At least one antibody of the invention binds at least one specified epitope
specific to at least
one RSV protein, subunit, fragment, portion or any combination thereof. The at
least one epitope
can comprise at least one antibody binding region that comprises at least one
portion of the protein,
which epitope can optionally comprise at least one portion of at least one
extracellular, soluble,
hydrophillic, external or cytoplasmic portion of the protein. The at least one
specified epitope can
comprise any combination of at least one amino acid sequence of at least 1-3
amino acids to the entire
specified portion of contiguous amino acids of any RSV protein, such as the F
glycoprotein.
The at least one antibody of the present invention can preferably comprise at
least one
antigen-binding region that comprises at least one human complementarity
determining region
(CDR1, CDR2 and CDR3) or variant of at least one heavy chain variable region
and/or at least one
human complementarity determining region (CDR1, CDR2 and CDR3) or variant of
at least one light
chain variable region. As a non-limiting example, the antibody can comprise at
least one of the heavy
chain CDRs of at least one SEQ ID NOS:1, 2 or3; at least one light chain CDR
of at least one of SEQ
ID NOS:4,5 and/or 6. In a particular embodiment, the protein and antibody can
have an antigen-
2 0 binding region that comprises at least a portion of at least one heavy
chain (HC) CDR (i.e., HC
CDR1, HC CDR2 and/or HC CDR3) having the amino acid sequence of the
corresponding HC CDRs
l, 2 andlor 3. In another particular embodiment, the antibody or antigen-
binding portion or variant
can have at least one antigen-binding region that comprises at least a portion
of at least one light
chain (LC) CDR (i.e., LC CDR1, LC CDR2 and/or LC CDR3). In a preferred
embodiment the three
2 5 heavy chain CDRs and the three light chain CDRs of the anitbody or antigen-
binding fragment have
the amino acid sequence of the corresponding CDR of at least one of mAb H1L1,
H1L2, H2L1,
H2,L2, H1L3, H2L3, , , as described herein. Such antibodies can be prepared by
chemically joining
together the various portions (e.g., CDRs, framework) of the antibody using
conventional techniques,
by preparing and expressing a (i.e., one or more) nucleic acid molecule that
encodes the antibody
3 0 using conventional techniques of recombinant DNA technology or by using
any other suitable
method.
The RSV antibody can comprise at least one of a heavy or light chain variable
region having
a defined amino acid sequence. For example, in a preferred embodiment, the RSV
antibody
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
comprises at least one of at least one heavy chain variable region, optionally
having the amino acid
sequence of at least one of SEQ ID NOS:7, 8 and/or 9; and/or at least one
light chain variable region,
optionally having the amino acid sequence of at least one of SEQ m NOS:9, 10
and/or 11.
Antibodies that bind to human RSV and that comprise a defined heavy or light
chain variable region
5 can be prepared using suitable methods, such as phage display (Katsube, Y.,
et al. , hzt J Mol. Med,
1(5):863-868 (1998)) or methods that employ transgenic animals, as known in
the art and/or as
described herein. For example, a transgenic mouse, comprising a functionally
rearranged human
immunoglobulin heavy chain transgene and a transgene comprising DNA from a
human
immunoglobulin light chain locus that can undergo functional rearrangement,
can be immunized with
10 human RSV or a fragment thereof to elicit the production of antibodies. If
desired, the antibody
producing cells can be isolated and hybridomas or other immortalized antibody-
producing cells can
be prepared as described herein and/or as known in the art. Alternatively, the
antibody, specified
portion or variant can be expressed using the encoding nucleic acid or portion
thereof in a suitable
host cell.
15 The invention also relates to antibodies, antigen-binding fragments,
immunoglobulin chains
and CDRs comprising amino acids in a sequence that is substantially the same
as an amino acid
sequence described herein. Preferably, such antibodies or antigen-binding
fragments and antibodies
comprising such chains or CDRs can bind human RSV with high affinity (e.g., KD
less than or equal
to about 10-9 M). Amino acid sequences that are substantially the same as the
sequences described
2 0 herein include sequences comprising conservative amino acid substitutions,
as well as amino acid
deletions and/or insertions. A conservative amino acid substitution refers to
the replacement of a first
amino acid by a second amino acid that has chemical and/or physical properties
(e.g, charge,
structure, polarity, hydrophobicity/ hydrophilicity) that are similar to those
of the first amino acid.
Conservative substitutions include replacement of one amino acid by another
within the following
2 5 groups: lysine (K), arginine (R) and histidine (H); aspartate (D) and
glutamate (E); asparagine (N),
glutamine (Q), serine (S), threonine (T), tyrosine (Y), K, R, H, D and E;
alanine (A), valine (V),
leucine (L), isoleucine (I), proline (P), phenylalanine (F), tryptophan (W),
methionine (M), cysteine
(C) and glycine (G); F, W and Y; C, S and T.
Amino Acid Codes
3 0 The amino acids that make up RSV antibodies of the present invention are
often abbreviated.
The amino acid designations can be indicated by designating the amino acid by
its single letter code,
its three letter code, name, or three nucleotide codon(s) as is well
understood in the art (see Alberts,
B., et al., Molecular Biology of The Cell, Third Ed., Garland Publishing,
Inc.,New York, 1994):
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
31
SINGLE LETTER THREE LETTER NAME THREE NUCLEOT)DE
CODE CODE CODON(S)
A Ala Alanine GCA, GCC, GCG, GCU
C Cys Cysteine UGC, UGU
D As As artic acid GAC, GAU
E Glu Glutamic acid GAA, GAG
F Phe Phenylanine UUC, UUU
G Gly Glycine GGA, GGC, GGG, GGU
H His Histidine CAC, CAU
I Ile Isoleucine AUA, AUC, AUU
K Lys L sine AAA AAG
L Leu Leucine UUA, UUG, CUA, CUC,
CUG, CUU
M Met Methionine AUG
N Asn As ara ine AAC, AAU
p Pro Proline CCA, CCC, CCG, CCU
Q Gln Glutamine CAA, CAG
R Arg Arginine AGA, AGG, CGA, CGC,
CGG, CGU
S Ser Serine AGC, AGU, UCA, UCC,
UCG, UCU
T Thr Threonine ACA, ACC, ACG, ACU
V Val Valine GUA, GUC, GUG, GUU
W T Try to han UGG
y T r Tyrosine UAC, UAU
An RSV antibody of the present invention can include one or more amino acid
substitutions,
deletions or additions, either from natural mutations or human manipulation,
as specified herein.
Of course, the number of amino acid substitutions a skilled artisan would make
depends on
many factors, including those described above. Generally speaking, the number
of amino acid
substitutions, insertions or deletions for any given RSV antibody, fragment or
variant will not be
more than 40, 30, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5,
4, 3, 2, 1, such as 1-30 or any
range or value therein, as specified herein.
Amino acids in an RSV antibody of the present invention that are essential for
function can
be identified by methods known in the art, such as site-directed mutagenesis
or alanine-scanning
mutagenesis (e.g., Ausubel, supra, Chapters 8, 15; Cunningham and Wells,
Science 244:1081-1085
( 1989)). The latter procedure introduces single alanine mutations at every
residue in the molecule.
The resulting mutant molecules are then tested for biological activity, such
as, but not limited to at
least one RSV neutralizing activity. Sites that are critical for antibody
binding can also be identified
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
32
by structural analysis such as crystallization, nuclear magnetic resonance or
photoaffinity labeling
(Smith, et al., J. Mol. Biol. 224:899-904 (1992) and de Vos, et al., Science
255:306-312 (1992)).
RSV proteins of the present invention can include, but are not limited to, at
least one portion,
sequence or combination selected from 3-100 to all of the contiguous amino
acids of at least one of
any known RSV F protein. RSV antibodies of the present invention can include,
but are not limited
to, at least one portion, sequence or combination selected from 5 to all of
the contiguous amino acids
of at least one of any 5-500 amino acid portion of SEQ m NOS:1-12, any portion
of Figures 3-4 or
encoded by any portion of Figures 2A-G or 5A-F , preferably and optionally
including at least one of
the corresponding CDRs.
Non-limiting variants that can enhance or maintain at least one of the listed
activities include,
but are not limited to, any of the above polypeptides, further comprising at
least one mutation
corresponding to at least one substitution selected from the group consisting
of 1-50 amino acids of
of at least one of any 5-500 amino acid portion of SEQ )D NOS:7-12, any
portion of Figures 3-4 or
encoded by any portion of Figures 2A-G or 5A-F .
A(n) RSV antibody can further optionally comprise a polypeptide of at least
one of 70-100%
of the contiguous amino acids of at least one of any 5-500 amino acid portion
of SEQ )D NOS:7-12,
any portion of Figures 3-4 or encoded by any portion of Figures 2A-G or 5A-F ,
or any variant
thereof.
In one embodiment, the amino acid sequence of a RSV protein or antibody has
about 70-
2 0 100% identity (e.g., 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82,
83, 84, 85, 86, 87, 88, 89, 90,
91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or any range or value therein) to the
amino acid sequence of the
corresponding chain of at least one of any 5-500 amino acid portion of SEQ 1D
NOS:7-12, any
portion of Figures 3-4 or encoded by any portion of Figures 2A-G or 5A-F .
Preferably, 70-100%
amino acid identity (i.e., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or any
range or value therein) is
2 5 determined using a suitable computer algorithm, as known in the art.
Exemplary heavy chain and light chain variable regions sequences are provided
in SEQ ll~
NOS: 7-12. The proteins and antibodies of the present invention, or specified
variants thereof, can
comprise any number of contiguous amino acid residues from an antibody of the
present invention,
wherein that number is selected from the group of integers consisting of from
10-100% of the number of
3 0 contiguous residues in an RSV protein or antibody. Optionally, this
subsequence of contiguous amino
acids is at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120,
130, 140, 150, 160, 170, 180, 190,
200, 210, 220, 230, 240, 250 or more amino acids in length, or any range or
value therein. Further, the
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
33
number of such subsequences can be any integer selected from the group
consisting of from 1 to 20,
such as at least 2, 3, 4, or 5.
As those of skill will appreciate, the present invention includes at least one
biologically active
protein or antibody of the present invention. Biologically active proteins or
antibodies have a specific
activity at least 20%, 30%, or 40%, and preferably at least 50%, 60%, or 70%,
and most preferably at
least 80%, 90%, or 95%-1000% of that of the native (non-synthetic), endogenous
or related and known
protein or antibody. Methods of assaying and quantifying measures of enzymatic
activity and substrate
specificity, are well known to those of skill in the art.
In another aspect, the invention relates to RSV proteins or antibodies of the
invention, as
described herein, which are modified by the covalent attachment of a moiety.
Such modification can
produce a RSV protein or anibody with improved pharmacokinetic properties
(e.g., increased in vivo
serum half-life). The organic moiety can be a linear or branched hydrophilic
polymeric group, fatty
acid group, or fatty acid ester group. In particular embodiments, the
hydrophilic polymeric group can
have a molecular weight of about 800 to about 120,000 Daltons and can be a
polyalkane glycol (e.g.,
polyethylene glycol (PEG), polypropylene glycol (PPG)), carbohydrate polymer,
amino acid polymer
or polyvinyl pyrolidone, and the fatty acid or fatty acid ester group can
comprise from about eight to
about forty carbon atoms.
The modified proteins and antibodies of the invention can comprise one or more
organic
moieties that are covalently bonded, directly or indirectly, to the antibody
or protein. Each organic
2 0 moiety that is bonded to the protein or antibody of the invention can
independently be a hydrophilic
polymeric group, a fatty acid group or a fatty acid ester group. As used
herein, the term "fatty acid"
encompasses mono-carboxylic acids and di-carboxylic acids. A "hydrophilic
polymeric group," as
the term is used herein, refers to an organic polymer that is more soluble in
water than in octane. For
example, polylysine is more soluble in water than in octane. Thus, a RSV
antibody or protein
2 5 modified by the covalent attachment of polylysine is encompassed by the
invention. Hydrophilic
polymers suitable for modifying antibodies or proteins of the invention can be
linear or branched and
include, for example, polyalkane glycols (e.g., PEG, monomethoxy-polyethylene
glycol (mPEG),
PPG and the like), carbohydrates (e.g., dextran, cellulose, oligosaccharides,
polysaccharides and the
like), polymers of hydrophilic amino acids (e.g., polylysine, polyarginine,
polyaspartate and the like),
3 0 polyalkane oxides (e.g., polyethylene oxide, polypropylene oxide and the
like) and polyvinyl
pyrolidone. Preferably, the hydrophilic polymer that modifies the protein or
antibody of the
invention has a molecular weight of about 800 to about 150,000 Daltons as a
separate molecular
entity. For example PEGsooo and PEGzo,ooo, Wherein the subscript is the
average molecular weight of
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
34
the polymer in Daltons, can be used. The hydrophilic polymeric group can be
substituted with one to
about six alkyl, fatty acid or fatty acid ester groups. Hydrophilic polymers
that are substituted with a
fatty acid or fatty acid ester group can be prepared by employing suitable
methods. For example, a
polymer comprising an amine group can be coupled to a carboxylate of the fatty
acid or fatty acid
ester, and an activated carboxylate (e.g., activated with N, N-carbonyl
diimidazole) on a fatty acid or
fatty acid ester can be coupled to a hydroxyl group on a polymer.
Fatty acids and fatty acid esters suitable for modifying antibodies of the
invention can be
saturated or can contain one or more units of unsaturation. Fatty acids that
are suitable for modifying
antibodies of the invention include, for example, n-dodecanoate (Cl~,
laurate), n-tetradecanoate (Cla,
myristate), n-octadecanoate (C18, stearate), n-eicosanoate (Czo, arachidate) ,
n-docosanoate (CZZ,
behenate), n-triacontanoate (C~o), n-tetracontanoate (C4o), cis-~9-
octadecanoate (C18, oleate), all cis-
~5,8,11,14-eicosatetraenoate (CZo, arachidonate), octanedioic acid,
tetradecanedioic acid,
octadecanedioic acid, docosanedioic acid, and the like. Suitable fatty acid
esters include mono-esters
of dicarboxylic acids that comprise a lineal or branched lower alkyl group.
The lower alkyl group
can comprise from one to about twelve, preferably one to about six, carbon
atoms.
The modified human proteins and antibodies can be prepared using suitable
methods, such as
by reaction with one or more modifying agents. A "modifying agent" as the term
is used herein,
refers to a suitable organic group (e.g., hydrophilic polymer, a fatty acid, a
fatty acid ester) that
comprises an activating group. An "activating group" is a chemical moiety or
functional group that
2 0 can, under appropriate conditions, react with a second chemical group
thereby forming a covalent
bond between the modifying agent and the second chemical group. For example,
amine-reactive
activating groups include electrophilic groups such as tosylate, mesylate,
halo (chloro, bromo, fluoro,
iodo), N-hydroxysuccinimidyl esters (NHS), and the like. Activating groups
that can react with
thiols include, for example, maleimide, iodoacetyl, acrylolyl, pyridyl
disulfides, 5-thiol-2,-
2 5 nitrobenzoic acid thiol (TNB-thiol), and the like. An aldehyde functional
group can be coupled to
amine- or hydrazide-containing molecules, and an azide group can react with a
trivalent phosphorous
group to form phosphoramidate or phosphorimide linkages. Suitable methods to
introduce activating
groups into molecules are known in the art (see for example, Hermanson, G. T.,
Bioconjugate
Techraiques, Academic Press: San Diego, CA (1996)). An activating group can be
bonded directly to
3 0 the organic group (e.g., hydrophilic polymer, fatty acid, fatty acid
ester), or through a linker moiety,
for example a divalent Cl-C12 group wherein one or more carbon atoms can be
replaced by a
heteroatom such as oxygen, nitrogen or sulfur. Suitable linker moieties
include, for example,
tetraethylene glycol, -(CHZ)3-, -NH-(CHZ)6-NH-, -(CHZ)Z-NH- and -CHZ-O-CHZ-CHZ-
O-CHZ-CHZ-O-
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
CH-NH-. Modifying agents that comprise a linker moiety can be produced, for
example, by reacting
a mono-Boc-alkyldiamine (e.g., mono-Boc-ethylenediamine, mono-Boc-
diaminohexane) with a fatty
acid in the presence of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC)
to form an amide
bond between the free amine and the fatty acid carboxylate. The Boc protecting
group can be
removed from the product by treatment with trifluoroacetic acid (TFA) to
expose a primary amine
that can be coupled to another carboxylate as described, or can be reacted
with malefic anhydride and
the resulting product cyclized to produce an activated maleimido derivative of
the fatty acid. (See,
for example, Thompson, et al., WO 92/16221 the entire teachings of which are
incorporated herein
by reference.)
10 Modified proteins or antibodies of the invention can be produced by
reacting the protein or
antibody with a modifying agent. For example, the organic moieties can be
bonded to the antibody or
protein in a non-site specific manner by employing an amine-reactive modifying
agent, for example,
an NHS ester of PEG. Modified RSV proteins or antibodies can also be prepared
by reducing
disulfide bonds (e.g., infra-chain disulfide bonds) of the protein and
antibody. The reduced protein
15 and antibody can then be reacted with a thiol-reactive modifying agent to
produce the modified
antibody of the invention. Modified proteins and antibodies comprising an
organic moiety that is
bonded to specific sites of an antibody of the present invention can be
prepared using suitable
methods, such as reverse proteolysis (Fisch et al., Biocozzjugate Chem., 3:147-
153 (1992); Werlen et
al., Bioconjugate Chem., 5:411-417 (1994); Kumaran et al., Protein Sci.
6(10):2233-2241 (1997);
2 0 Itoh et al., Bioorg. Chern., 24(1): 59-68 (1996); Capellas et al.,
Biotechrzol. Bioeng., 56(4):456-463
(1997)), and the methods described in Hermanson, G. T., Bioconjugate
Techniques, Academic Press:
San Diego, CA (1996).
IDIOTYPE ANTIBODIES TO RSV ANTIBODY COMPOSITIONS
In addition to monoclonal or chimeric RSV antibodies, the present invention is
also
2 5 directed to an idiotypic (Id) antibody specific for such antibodies of the
invention. An anti-Id
antibody is an antibody that recognizes unique determinants generally
associated with the
antigen-binding region of another antibody. The Id can be prepared by
immunizing an animal of the
same species and genetic type (e.g. mouse strain) as the source of the Id
antibody with the antibody or
a CDR containing region thereof. The immunized animal will recognize and
respond to the idiotypic
3 0 determinants of the immunizing antibody and produce an anti-Id antibody.
The anti-Id antibody may
also be used as an "immunogen" to induce an immune response in yet another
animal, producing a
so-called anti-Id antibody.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
36
RSV PROTEIN AND ANTIBODY COMPOSITIONS
The present invention also provides at least one RSV antibody or protein
composition
comprising at least one, at least two, at least three, at least four, at least
five, at least six or more RSV
antibodies or proteins thereof, as described herein andlor as known in the art
that are provided in a
non-naturally occurring composition, mixture or form. Such compositions
comprise non-naturally
occurring compositions comprising at least one or two RSV antibody or protein
amino acid sequences
selected from the group consisting of 5-100% of the contiguous amino acids of
any 5-500 amino acid
portion of SEQ m NOS:7-12, any portion of Figures 3-4 or encoded by any
portion of Figures 2A-G
or 5A-F , or specified fragments, domains or variants thereof. Preferred RSV
antibody compositions
include at least one or two full length, fragments, domains or variants as at
least one CDR containing
portions of the RSV antibody sequence of 70-100% of any 5-500 amino acid
portion of SEQ m
NOS:7-12, any portion of Figures 3-4 or encoded by any portion of Figures 2A-G
or 5A-F , or
specified fragments, domains or variants thereof. Further preferred
compositions comprise 40-99%
of at least one of 70-100% of any 5-500 amino acid portion of SEQ ID NOS:7-12,
any portion of
Figures 3-4 or encoded by any portion of Figures 2A-G or 5A-F , or specified
fragments, domains or
variants thereof. Such composition percentages are by weight, volume,
concentration, molarity, or
molality as liquid or dry solutions, mixtures, suspension, emulsions or
colloids, as known in the art or
as described herein.
RSV antibody or protein compositions of the present invention can further
comprise at least
2 0 one of any suitable and effective amount of a composition or
pharmaceutical composition comprising
at least one RSV antibody to a cell, tissue, organ, animal or patient in need
of such modulation,
treatment or therapy, optionally further comprising at least one selected from
at least one TNF
antagonist (e.g., but not limited to a TNF antibody or fragment, a soluble TNF
receptor or fragment,
fusion proteins thereof, or a small molecule TNF antagonist), an antirheumatic
(e.g., methotrexate,
2 5 auranofin, aurothioglucose, azathioprine, etanercept, gold sodium
thiomalate, hydroxychloroquine
sulfate, leflunomide, sulfasalzine), a muscle relaxant, a narcotic, a non-
steroid inflammatory drug
(NSAID), an analgesic, an anesthetic, a sedative, a local anethetic, a
neuromuscular blacker, an
antimicrobial (e.g., aminoglycoside, an antifungal, an antiparasitic, an
antiviral, a carbapenem,
cephalosporin, a flurorquinolone, a macrolide, a penicillin, a sulfonamide, a
tetracycline, another
3 0 antimicrobial), an antipsoriatic, a corticosteriod, an anabolic steroid, a
diabetes related agent, a
mineral, a nutritional, a thyroid agent, a vitamin, a calcium related hormone,
an antidiarrheal, an
antitussive, an antiemetic, an antiulcer, a laxative, an anticoagulant, an
erythropieitin (e.g., epoetin
alpha), a filgrastim (e.g., G-CSF, Neupogen), a sargramostim (GM-CSF,
Leukine), an immunization,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
37
an immunoglobulin, an immunosuppressive (e.g., basiliximab, cyclosporine,
daclizumab), a growth
hormone, a hormone replacement drug, an estrogen receptor modulator, a
mydriatic, a cycloplegic, an
alkylating agent, an antimetabolite, a mitotic inhibitor, a
radiophannaceutical, an antidepressant,
antimanic agent, an antipsychotic, an anxiolytic, a hypnotic, a
sympathomimetic, a stimulant,
donepezil, tacrine, an asthma medication, a beta agonist, an inhaled steroid,
a leukotriene inhibitor, a
methylxanthine, a cromolyn, an epinephrine or analog, dornase alpha
(Pulmozyme), a cytokine or a
cytokine antagonist. Non-limiting examples of such cytokines include, but are
not limted to, any of
1L-1 to IL-23. Suitable dosages are well known in the art. See, e.g., Wells et
al., eds.,
Pharmacotherapy Handbook, 2°a Edition, Appleton and Lange, Stamford, CT
(2000); PDR
Pharmacopoeia, Tarascon Pocket Pharmacopoeia 2000, Deluxe Edition, Tarascon
Publishing, Loma
Linda, CA (2000), each of which references are entirely incorporated herein by
reference.
Subh compositions can also include toxin molecules that are associated, bound,
co-
formulated or co-administered with at least one antibody or protein of the
present invention. The
toxin can optionally act to selectively kill the pathologic cell or tissue.
The pathologic cell can be a
cancer or other cell. Such toxins can be, but are not limited to, purified or
recombinant toxin or toxin
fragment comprising at least one functional cytotoxic domain of toxin, e.g.,
selected from at least one
of ricin, diphtheria toxin, a venom toxin, or a bacterial toxin. The term
toxin also includes both
endotoxins and exotoxins produced by any naturally occurring, mutant or
recombinant bacteria or
viruses which may cause any pathological condition in humans and other
maxmnals, including toxin
2 0 shock, which can result in death. Such toxins may include, but are not
limited to, enterotoxigenic E.
eoli heat-labile enterotoxin (LT), heat-stable enterotoxin (ST), Shigella
cytotoxin, Aeromo»as
enterotoxins, toxic shock syndrome toxin-1 (TSST-1), Staphylococcal
enterotoxin A (SEA), B (SEB),
or C (SEC), Streptococcal enterotoxins and the like. Such bacteria include,
but are not limited to,
strains of a species of enterotoxigenic E. coli (ETEC), enterohemorrhagie E.
coli (e.g., strains of
2 5 serotype 0157:H7), Staphylococcus species (e.g., Staphylococcus aureus,
Staphylococcus pyoge»es),
Shigella species (e.g., Shigella dyse»teriae, Shigella flexneri, Shigella
boydii, a»d Shigella. so»nei.),
Salrnorzella species (e.g., Salmo»ella typhi, Salmo»ella cholera-suis,
Salrnozzella enteritidis),
Clostridium species (e.g., Clostridium perfri»gens, Clostridium dijizcile,
Clostridiurn botulirtutzt),
Camphlobacter species (e.g., Carnplzlobacter jejuni, Catnphlobacter fetus),
Heliobacter species,
3 0 (e.g., Heliobacter pylori), Aerornojzas species (e.g., Aeromorzas sobria,
Aero»tonas hydroplzila,
Aerornonas caviae), Pleiso»zonas slzigelloides, Yersi»a eztterocolitica, Vibr-
ios species (e.g., Vibrios
cholerae, Vibrios parahemolyticus), Klebsiella species, Pseudonzorzas
aerugi»osa, and Streptococci.
See, e.g., Stein, ed., INTERNAL MEDICINE, 3rd ed., pp 1-13, Little, Brown and
Co., Boston,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
38
(1990); Evans et al., eds., Bacterial Infections of Humans: Epidemiology and
Control, 2d. Ed., pp
239-254, Plenum Medical Book Co., New York (1991); Mandell et al, Principles
and Practice of
Infectious Diseases, 3d. Ed., Churchill Livingstone, New York (1990); Berkow
et al, eds., The Merck
Manual, 16th edition, Merck and Co., Rahway, N.J., 1992; Wood et al, FEMS
Microbiology
Immunology, 76:121-134 (1991); Marrack et al, Science, 248:705-711 (1990), the
contents of which
references are incorporated entirely herein by reference.
RSV antibody or protein compounds, compositions or combinations of the present
invention can further comprise at least one of any suitable auxiliary, such
as, but not limited to,
diluent, binder, stabilizer, buffers, salts, lipophilic solvents,
preservative, adjuvant or the like.
Pharmaceutically acceptable auxiliaries are preferred. Non-limiting examples
of, and methods of
preparing such sterile solutions are well known in the art, such as, but
limited to, Gennaro, Ed.,
Remington's Pharmaceutical Sciences, 18~' Edition, Mack Publishing Co.
(Easton, PA) 1990.
Pharmaceutically acceptable carriers can be routinely selected that are
suitable for the mode of
administration, solubility andlor stability of the RSV antibody or protein
composition as well known
in the art or as described herein.
Pharmaceutical excipients and additives useful in the present composition
include but are not
limited to proteins, peptides, amino acids, lipids, and carbohydrates (e.g.,
sugars, including
monosaccharides, di-, tri-, tetra-, and oligosaccharides; derivatized sugars
such as alditols, aldonic
acids, esterified sugars and the like; and polysaccharides or sugar polymers),
which can be present
2 0 singly or in combination, comprising alone or in combination 1-99.99% by
weight or volume.
Exemplary but non-limiting protein excipients include serum albumin such as
human serum albumin
(HSA), recombinant human albumin (rHA), gelatin, casein, and the like.
Representative amino
acid/antibody components, which can also function in a buffering capacity,
include alanine, glycine,
arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine,
leucine, isoleucine, valine,
2 5 methionine, phenylalanine, aspartame, and the like. One preferred amino
acid is glycine.
Carbohydrate excipients suitable for use in the invention include, for
example,
monosaccharides such as fructose, maltose, galactose, glucose, D-mannose,
sorbose, and the like;
disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like;
polysaccharides, such as
raffmose, melezitose, maltodextrins, dextrans, starches, and the like; and
alditols, such as mannitol,
3 0 xylitol, maltitol, lactitol, xylitol sorbitol (glucitol), myoinositol and
the like. Preferred carbohydrate
excipients for use in the present invention are mannitol, trehalose, and
raffmose.
RSV antibody or protein compositions can also include a buffer or a pH
adjusting agent;
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
39
typically, the buffer is a salt prepared from an organic acid or base.
Representative buffers include
organic acid salts such as salts of citric acid, ascorbic acid, gluconic acid,
carbonic acid, tartaric acid,
succinic acid, acetic acid, or phthalic acid; Tris, tromethamine
hydrochloride, or phosphate buffers.
Preferred buffers for use in the present compositions are organic acid salts
such as citrate.
Additionally, RSV antibody or protein compositions of the invention can
include polymeric
excipients/additives such as polyvinylpyrrolidones, ficolls (a polymeric
sugar), dextrates (e.g.,
cyclodextrins, such as 2-hydroxypropyl-(3-cyclodextrin), polyethylene glycols,
flavoring agents,
antimicrobial agents, sweeteners, antioxidants, antistatic agents, surfactants
(e.g., polysorbates such
as "TWEEN 20" and "TWEEN 80"), lipids (e.g., phospholipids, fatty acids),
steroids (e.g.,
cholesterol), and chelating agents (e.g., EDTA).
These and additional known pharmaceutical excipients and/or additives suitable
for use in the
RSV antibody or protein compositions according to the invention are known in
the art, e.g., as listed
in "Remington: The Science & Practice of Pharmacy", 19"' ed., Williams &
Williams, (1995), and in
the "Physician's Desk Reference", 52°d ed., Medical Economics,
Montvale, NJ (1998), the
disclosures of which are entirely incorporated herein by reference. Preferrred
carrier or excipient
materials are carbohydrates (e.g., saccharides and alditols) and buffers
(e.g., citrate) or polymeric
agents.
Formulations
As noted above, the invention provides for stable formulations, which is
preferably a
2 0 phosphate buffer with saline or a chosen salt, as well as preserved
solutions and formulations
containing a preservative as well as mufti-use preserved formulations suitable
for pharmaceutical or
veterinary use, comprising at least one RSV antibody or protein in a
pharmaceutically acceptable
formulation. Preserved formulations contain at least one known preservative or
optionally selected
from the group consisting.of at least one phenol, m-cresol, p-cresol, o-
cresol, chlorocresol, benzyl
2 5 alcohol, phenylmercuric nitrite, phenoxyethanol, formaldehyde,
chlorobutanol, magnesium chloride
(e.g., hexahydrate), alkylparaben (methyl, ethyl, propyl, butyl and the like),
benzalkonium chloride,
benzethonium chloride, sodium dehydroacetate and thimerosal, or mixtures
thereof in an aqueous
diluent. Any suitable concentration or mixture can be used as known in the
art, such as 0.001-5%, or
any range or value therein, such as, but not limited to 0.001, 0.003, 0.005,
0.009, 0.01, 0.02, 0.03,
3 0 0.05, 0.09, 0.1, 0.2, 0.3, 0.4., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2,
1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0,
2.1,2.2,2.3,2.4,2.5,2.6,2.7,2.8,2.9,3.0,3.1,3.2,3.3,3.4,3.5,3.6,3.7,3.8,3.9,4.0
,4.3,4.5,4.6,
4.7, 4.8, 4.9, or any range or value therein. Non-limiting examples include,
no preservative, 0.1-2%
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
m-cresol (e.g., 0.2, 0.3. 0.4, 0.5, 0.9, 1.0%), 0.1-3% benzyl alcohol (e.g.,
0.5, 0.9, l.l., 1.5, 1.9, 2.0,
2.5%), 0.001-0.5% thimerosal (e.g., 0.005, 0.01), 0.001-2.0% phenol (e.g.,
0.05, 0.25, 0.28, 0.5, 0.9,
1.0%), 0.0005-1.0% alkylparaben(s) (e.g., 0.00075, 0.0009, 0.001, 0.002,
0.005, 0.0075, 0.009, 0.01,
0.02, 0.05, 0.075, 0.09, 0.1, 0.2, 0.3, 0.5, 0.75, 0.9, 1.0%), and the like.
5 As noted above, the invention provides an article of manufacture, comprising
packaging material and at least one vial comprising a solution of at least one
RSV antibody or protein
with the prescribed buffers and/or preservatives, optionally in an aqueous
diluent, wherein said
packaging material comprises a label that indicates that such solution can be
held over a period of 1,
2, 3, 4, 5, 6, 9, 12, 18, 20, 24, 30, 36, 40, 48, 54, 60, 66, 72 hours or
greater. The invention further
10 comprises an article of manufacture, comprising packaging material, a first
vial comprising
lyophilized at least one RSV antibody or protein, and a second vial comprising
an aqueous diluent of
prescribed buffer or preservative, wherein said packaging material comprises a
label that instructs a
patient to reconstitute the at least one RSV antibody or protein in the
aqueous diluent to form a
solution that can be held over a period of twenty-four hours or greater.
15 The at least one RSVantibody or protein used in accordance with the present
invention can be
produced by recombinant means, including from mammalian cell or transgenic
preparations, or can
be purified from other biological sources, as described herein or as known in
the art.
The range of at least one RSV antibody in at least one product of the present
invention
includes amounts yielding upon reconstitution, if in a wet/dry system,
concentrations from about 1.0
2 0 ng/ml to about 1000 mg/ml, although lower and higher concentrations are
operable and are dependent
on the intended delivery vehicle, e.g., solution formulations will differ from
transdermal patch,
pulmonary, transmucosal, or osmotic or micro pump methods.
The range of at least one RSV antibody in at least one product of the present
invention
includes amounts yielding upon reconstitution, if in a wet/dry system,
concentrations from about 1.0
2 5 ~.glml to about 1000 mg/ml, although lower and higher concentrations are
operable and are dependent
on the intended delivery vehicle, e.g., solution formulations will differ from
transdermal patch,
pulmonary, transmucosal, or osmotic or micro pump methods.
Preferably, the aqueous diluent optionally further comprises a
pharmaceutically acceptable
preservative. Preferred preservatives include those selected from the group
consisting of phenol, m-
3 0 cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkylparaben
(methyl, ethyl, propyl, butyl and
the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate
and thimerosal, or
mixtures thereof. The concentration of preservative used in the formulation is
a concentration
sufficient to yield an microbial effect. Such concentrations are dependent on
the preservative
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
41
selected and are readily determined by the skilled artisan.
Other excipients, e.g. isotonicity agents, buffers, antioxidants, preservative
enhancers, can be
optionally and preferably added to the diluent. An isotonicity agent, such as
glycerin, is commonly
used at known concentrations. A physiologically tolerated buffer is preferably
added to provide
improved pH control. The formulations can cover a wide range of pHs, such as
from about pH 4 to
about pH 10, and preferred ranges from about pH 5 to about pH 9, and a most
preferred range of
about 6.0 to about 8Ø Preferably the formulations of the present invention
have pH between about
6.8 and about 7.8. Preferred buffers include phosphate buffers, most
preferably sodium phosphate,
particularly phosphate buffered saline (PBS).
Other additives, such as a pharmaceutically acceptable solubilizers like Tween
20
(polyoxyethylene (20) sorbitan monolaurate), Tween 40 (polyoxyethylene (20)
sorbitan
monopalmitate), Tween 80 (polyoxyethylene (20) sorbitan monooleate), Platonic
F68
(polyoxyethylene polyoxypropylene block copolymers), and PEG (polyethylene
glycol) or non-ionic
surfactants such as polysorbate 20 or 80 or poloxamer 184 or 188, Pluronic~
polyls, other block co-
polymers, and chelators such as EDTA and EGTA can optionally be added to the
formulations or
compositions to reduce aggregation. These additives are particularly useful if
a pump or plastic
container is used to administer the formulation. The presence of
pharmaceutically acceptable
surfactant mitigates the propensity for the protein to aggregate.
The formulations of the present invention can be prepared by a process which
2 0 comprises mixing at least one RSV antibody or protein and a preservative
selected from the group
consisting of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl
alcohol, alkylparaben, (methyl,
ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium
chloride, sodium
dehydroacetate and thimerosal or mixtures thereof in an aqueous diluent.
Mixing the at least one
RSV antibody or protein and preservative in an aqueous diluent is carried out
using conventional
2 5 dissolution and mixing procedures. To prepare a suitable formulation, for
example, a measured
amount of at least one RSV antibody or protein in buffered solution is
combined with the desired
preservative in a buffered solution in quantities sufficient to provide the
protein and preservative at
the desired concentrations. Variations of this process would be recognized by
one of ordinary skill in
the art. For example, the order the components are added, whether additional
additives are used, the
3 0 temperature and pH at which the formulation is prepared, are all factors
that can be optimized for the
concentration and means of administration used.
The claimed formulations can be provided to patients as clear solutions or as
dual
vials comprising a vial of lyophilized at least one RSV antibody or protein
that is reconstituted with a
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
42
second vial containing water, a preservative and/or excipients, preferably a
phosphate buffer and/or
saline and a chosen salt, in an aqueous diluent. Either a single solution vial
or dual vial requiring
reconstitution can be reused multiple times and can suffice for a single or
multiple cycles of patient
treatment and thus can provide a more convenient treatment regimen than
currently available.
The present claimed articles of manufacture are useful for administration over
a
period of immediately to twenty-four hours or greater. Accordingly, the
presently claimed articles of
manufacture offer significant advantages to the patient. Formulations of the
invention can optionally
be safely stored at temperatures of from about 2 to about 40°C and
retain the biologically activity of
the protein for extended periods of time, thus, allowing a package label
indicating that the solution
can be held and/or used over a period of 6, 12, 18, 24, 36, 48, 72, or 96
hours or greater. If preserved
diluent is used, such label can include use up to 1-12 months, one-half, one
and a half, and/or two
years.
The solutions of at least one RSV antibody or protein in the invention can be
prepared by a process that comprises mixing at least one antibody or protein
in an aqueous diluent.
Mixing is carried out using conventional dissolution and mixing procedures. To
prepare a suitable
diluent, for example, a measured amount of at least one antibody or protein in
water or buffer is
combined in quantities sufficient to provide the protein and optionally a
preservative or buffer at the
desired concentrations. Variations of this process would be recognized by one
of ordinary skill in the
art. For example, the order the components are added, whether additional
additives are used, the
2 0 temperature and pH at which the formulation is prepared, are all factors
that can be optimized for the
concentration and means of administration used.
The claimed products can be provided to patients as clear solutions or as dual
vials
comprising a vial of lyophilized at least one RSV antibody or protein that is
reconstituted with a
second vial containing the aqueous diluent. Either a single solution vial or
dual vial requiring
2 5 reconstitution can be reused multiple times and can suffice for a single
or multiple cycles of patient
treatment and thus provides a more convenient treatment regimen than currently
available.
The claimed products can be provided indirectly to patients by providing to
pharmacies, clinics, or other such institutions and facilities, clear
solutions or dual vials comprising a
vial of lyophilized at least one RSV antibody or protein that is reconstituted
with a second vial
3 0 containing the aqueous diluent. The clear solution in this case can be up
to one liter or even larger in
size, providing a large reservoir from which smaller portions of the at least
one antibody or protein
solution can be retrieved one or multiple times for transfer into smaller
vials and provided by the
pharmacy or clinic to their customers and/or patients.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
43
Recognized devices comprising these single vial systems include those pen-
injector
devices for delivery of a solution such as BD Pens, BD Autojector°,
Humaject°° NovoPen°, B-
D"Pen, AutoPen°, and OptiPen°, GenotropinPeri , Genotronorm
Pen°, Humatro Pen", Reco-Pen°,
Roferon Pen°, Biojector°, iject°, J-tip Needle-Free
Injector°, Intraject°, Medi-Ject°, e.g., as made or
developed by Becton Dickensen (Franklin Lakes, NJ, www.bectondickenson.com),
Disetronic
(Burgdorf, Switzerland, www.disetronic.com; Bioject, Portland, Oregon
(www.bioject.com);
National Medical Products , Weston Medical (Peterborough, UK, www.weston-
medical.com), Medi-
Ject Corp (Minneapolis, MN, www.mediject.com). Recognized devices comprising a
dual vial
system include those pen-injector systems for reconstituting a lyophilized
drug in a cartridge for
delivery of the reconstituted solution such as the HumatroPen°.
The products presently claimed include packaging material. The packaging
material
provides, in addition to the information required by the regulatory agencies,
the conditions under
which the product can be used. The packaging material of the present invention
provides instructions
to the patient to reconstitute the at least one RSV antibody or protein in the
aqueous diluent to form a
solution and to use the solution over a period of 2-24 hours or greater for
the two vial, webdry,
product. For the single vial, solution product, the label indicates that such
solution can be used over a
period of 2-24 hours or greater. The presently claimed products are useful for
human pharmaceutical
product use.
The formulations of the present invention can be prepared by a process that
2 0 comprises mixing at least one RSV antibody or protein and a selected
buffer, preferably a phosphate
buffer containing saline or a chosen salt. Mixing the at least one antibody or
protein and buffer in an
aqueous diluent is carried out using conventional dissolution and mixing
procedures. To prepare a
suitable formulation, for example, a measured amount of at least one antibody
or protein in water or
buffer is combined with the desired buffering agent in water in quantities
sufficient to provide the
2 5 protein and buffer at the desired concentrations. Variations of this
process would be recognized by
one of ordinary skill in the art. For example, the order the components are
added, whether additional
additives axe used, the temperature and pH at which the formulation is
prepared, are all factors that
can be optimized for the concentration and means of administration used.
The claimed stable or preserved formulations can be provided to patients as
clear
3 0 solutions or as dual vials comprising a vial of lyophilized at least one
RSV antibody or protein that is
reconstituted with a second vial containing a preservative or buffer and
excipients in an aqueous
diluent. Either a single solution vial or dual vial requiring reconstitution
can be reused multiple times
and can suffice for a single or multiple cycles of patient treatment and thus
provides a more
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
44
convenient treatment regimen than currently available.
At least one RSV antibody or protein in either the stable or preserved
formulations or
solutions described herein, can be administered to a patient in accordance
with the present invention
via a variety of delivery methods including SC or IM injection; transdermal,
pulmonary,
transmucosal, implant, osmotic pump, cartridge, micro pump, or other means
appreciated by the
skilled artisan, as well-known in the art.
Therapeutic Applications
The present invention also provides a method for modulating or treating at
least one
RSV related disease, in a cell, tissue, organ, animal, or patient, as known in
the art or as described
herein, using at least one antibody or protein of the present invention.
The present invention also provides a method for modulating or treating at
least one adult or
pediatric RSV related disease, in a cell, tissue, organ, animal, or patient
including, but not limited to,
lower respiratory infections, pneumonia, tracheobronchitis, bronchiolitis,
bronchitis, and any related
infections or inflammatory disorders, such as but not limited to at least one
of, or at least one
inflammation related to, systemic inflammatory response syndrome, sepsis
syndrome, gram positive
sepsis, gram negative sepsis, culture negative sepsis, fungal sepsis,
neutropenic fever, urosepsis,
meningococcemia, adult respiratory distress syndrome, allergic rhinitis,
perennial rhinitis, asthma,
systemic anaphalaxis, receptor hypersensitivity reactions, chronic obstructive
pulmonary disease
(COPD), hypersensitivity pneumonitis, granulomas due to intracellular
organisms, drug sensitivity,
2 0 cachexia, cystic fibrosis, neonatal chronic lung disease; at least one
infectious disease in a cell,
tissue, organ, animal or patient, including, but not limited to, at least one
of: acute or chronic
bacterial infection, acute and chronic parasitic or infectious processes,
including bacterial, viral and
fungal infections, HIV infection, HIV neuropathy, meningitis, hepatitis (A,B
or C, or the like), septic
arthritis, peritonitis, pneumonia, epiglottitis, e. coli 0157:h7, hemolytic
uremic syndrome,
2 5 thrombolytic thrombocytopenic purpura, malaria, dengue hemorrhagic fever,
leishmaniasis, leprosy,
toxic shock syndrome, streptococcal myositis, gas gangrene, mycobacterium
tuberculosis,
mycobacterium avium intracellulare, pneumocystis carinii pneumonia, pelvic
inflammatory disease,
orchitis, epidydimitis, legionella, lyme disease, influenza a, epstein-barr
virus, vital-associated
hemaphagocytic syndrome, vital encephalitis, aseptic meningitis, and the like.
Such a method can
3 0 optionally comprise administering an effective amount of a composition or
pharmaceutical
composition comprising at least one RSV antibody or protein to a cell, tissue,
organ, animal or patient
in need of such modulation, treatment or therapy.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
Any method of the present invention can comprise administering an effective
amount of a
composition or pharmaceutical composition comprising at least one RSV antibody
or protein to a
cell, tissue, organ, animal or patient in need of such modulation, treatment
or therapy. Such a method
can optionally further comprise co-administration or combination therapy for
treating such diseases,
5 wherein the administering of said at least one RSV antibody or protein,
specified portion or variant
thereof, further comprises administering, before concurrently, and/or after,
at least one selected from
at least one TNF antagonist (e.g., but not limited to a TNF antibody or
fragment, a soluble TNF
receptor or fragment, fusion proteins thereof, or a small molecule TNF
antagonist), an antirheumatic
(e.g., methotrexate, auranofm, aurothioglucose, azathioprine, etanercept, gold
sodium thiomalate,
10 hydroxychloroquine sulfate, leflunomide, sulfasalzine), a muscle relaxant,
a narcotic, a non-steroid
inflammatory drug (NSA)D), an analgesic, an anesthetic, a sedative, a local
anethetic, a
neuromuscular blocker, an antimicrobial (e.g., aminoglycoside, an antifungal,
an antiparasitic, an
antiviral, a carbapenem, cephalosporin, a flurorquinolone, a macrolide, a
penicillin, a sulfonamide, a
tetracycline, another antimicrobial), an antipsoriatic, a corticosteriod, an
anabolic steroid, a diabetes
15 related agent, a nuneral, a nutritional, a thyroid agent, a vitamin, a
calcium related hormone, an
antidiarrheal, an antitussive, an antiemetic, an antiulcer, a laxative, an
anticoagulant, an erythropieitin
(e.g., epoetin alpha), a filgrastim (e.g., G-CSF, Neupogen), a sargramostim
(GM-CSF, Leukine), an
immunization, an immunoglobulin, an immunosuppressive (e.g., basiliximab,
cyclosporine,
daclizumab), a growth hormone, a hormone replacement drug, an estrogen
receptor modulator, a
2 0 mydriatic, a cycloplegic, an alkylating agent, an antimetabolite, a
mitotic inhibitor, a
radiopharmaceutical, an antidepressant, antimanic agent, an antipsychotic, an
anxiolytic, a hypnotic, a
sympathomimetic, a stimulant, donepezil, tacrine, an asthma medication, a beta
agonist, an inhaled
steroid, a leukotriene inhibitor, a methylxanthine, a cromolyn, an epinephrine
or analog, dornase
alpha (Pulmozyme), a cytokine or a cytokine antagonist. Suitable dosages are
well known in the art.
2 5 See, e.g., Wells et al., eds., Pharmacotherapy Handbook, 2nd Edition,
Appleton and Lange, Stamford,
CT (2000); PDR Pharmacopoeia, Tarascon Pocket Pharmacopoeia 2000, Deluxe
Edition, Tarascon
Publishing, Loma Linda, CA (2000), each of which references are entirely
incorporated herein by
reference.
TNF antagonists suitable for compositions, combination therapy, co-
administration, devices
3 0 and/or methods of the present invention (further comprising at least one
anti body, specified portion
and variant thereof, of the present invention), include, but are not limited
to, TNF antibodies, antigen-
binding fragments thereof, and receptor molecules which bind specifically to
TNF; compounds which
prevent and/or inhibit TNF synthesis, TNF release or its action on target
cells, such as thalidomide,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
46
tenidap, phosphodiesterase inhibitors (e.g, pentoxifylline and rolipram), A2b
adenosine receptor
agonists and A2b adenosine receptor enhancers; compounds which prevent and/or
inhibit TNF
receptor signalling, such as mitogen activated protein (MAP) kinase
inhibitors; compounds which
block and/or inhibit membrane TNF cleavage, such as metalloproteinase
inhibitors; compounds
which block and/or inhibit TNF activity, such as angiotensin converting enzyme
(ACE) inhibitors
(e.g., captopril); and compounds which block and/or inhibit TNF production
and/or synthesis, such as
MAP kinase inhibitors.
As used herein, a "tumor necrosis factor antibody," "TNF antibody," "TNFa
antibody," or
fragment and the like decreases, blocks, inhibits, abrogates or interferes
with TNFa activity izz vitro,
izz situ andlor preferably in vivo. For example, a suitable TNF human antibody
of the present
invention can bind TNFa and includes TNF antibodies, antigen-binding fragments
thereof, and
specified mutants or domains thereof that bind specifically to TNFa. A
suitable TNF anttibody or
fragment can also decrease block, abrogate, interfere, prevent andlor inhibit
TNF RNA, DNA or
protein synthesis, TNF release, TNF receptor signaling, membrane TNF cleavage,
TNF activity, TNF
production and/or synthesis.
Chimeric antibody cA2 consists of the antigen binding variable region of the
high-affinity
neutralizing mouse human TNFa IgGl antibody, designated A2, and the constant
regions of a human
IgGI, kappa immunoglobulin. The human IgGl Fc region improves allogeneic
antibody effector
function, increases the circulating serum half life and decreases the
immunogenicity of the antibody.
2 0 The avidity and epitope specificity of the chimeric antibody cA2 is
derived from the variable region
of the marine antibody A2. In a particular embodiment, a preferred source for
nucleic acids encoding
the variable region of the marine antibody A2 is the A2 hybridoma cell line.
Chimeric A2 (cA2) neutralizes the cytotoxic effect of both natural and
recombinant human
TNFa in a dose dependent manner. From binding assays of chimeric antibody cA2
and recombinant
2 5 human TNFo~, the affinity constant of chimeric antibody cA2 was calculated
to be 1.04x101°M-1.
Preferred methods for determining monoclonal antibody specificity and affinity
by competitive
inhibition can be found in Harlow, et al., antibodies: A Laboratory Manual,
Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, 1988; Colligan et al., eds.,
Current Protocols in
1»zmunology, Greene Publishing Assoc. and Wiley Interscience, New York, (1992-
2000); Kozbor et
3 0 al.,1»zmurzol. Today, 4:72-79 (1983); Ausubel et al., eds. Current
Protocols irz Molecular Biology,
Wiley Interscience, New York (1987-2000); and Muller, Meth. Enzyznol., 92:589-
601 (1983), which
references are entirely incorporated herein by reference.
In a particular embodiment, marine monoclonal antibody A2 is produced by a
cell line
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
47
designated c 134A. Chimeric antibody cA2 is produced by a cell line designated
c 168A.
Additional examples of monoclonal TNF antibodies that can be used in the
present invention
are described in the art (see, e.g., U.S. Patent No. 5,231,024; Moller, A. et
al., Cytokizze 2(3):162-169
(1990); U.S. Application No. 07/943,852 (filed September 11, 1992); Rathjen et
al., International
Publication No. WO 91/02078 (published February 21, 1991); Rubin et al., EPO
Patent Publication
No. 0 218 868 (published April 22, 1987); Yone et al., EPO Patent Publication
No. 0 288 088
(October 26, 1988); Liang, et al., Bioclzem. Biophys. Res. Cozzzrn. 137:847-
854 (1986); Meager, et al.,
Hybridoma 6:305-311 (1987); Fendly et al., Hybridozna 6:359-369 (1987);
Bringman, et al.,
Hybridozzza 6:489-507 (1987); and Hirai, et al., J. Immuzzol. Meth. 96:57-62
(1987), which references
are entirely incorporated herein by reference).
TNF Receptor Molecules
Preferred TNF receptor molecules useful in the present invention are those
that bind TNFoc
with high affinity (see, e.g., Feldmann et al., International Publication No.
WO 92/07076 (published
April 30, 1992); Schall et al., Cell 61:361-370 (1990); and Loetscher et al.,
Cell 61:351-359 (1990),
which references are entirely incorporated herein by reference) and optionally
possess low
immunogenicity. In particular, the 55 kDa (p55 TNF-R) and the 75 kDa (p75 TNF-
R) TNF cell
surface receptors are useful in the present invention. Truncated forms of
these receptors, comprising _
the extracellular domains (ECD) of the receptors or functional portions
thereof (see, e.g., Corcoran et
al., Eur. J. Bioclaern. 223:831-840 (1994)), are also useful in the present
invention. Truncated forms
2 0 of the TNF receptors, comprising the ECD, have been detected in urine and
serum as 30 kDa and 40
kDa TNFa inhibitory binding proteins (Engelmann, H. et al., J. Biol. Clzem.
265:1531-1536 (1990)).
TNF receptor multimeric molecules and TNF irnmunoreceptor fusion molecules,
and derivatives and
fragments or portions thereof, are additional examples of TNF receptor
molecules which are useful in
the methods and compositions of the present invention. The TNF receptor
molecules which can be
2 5 used in the invention are characterized by their ability to treat patients
for extended periods with good
to excellent alleviation of symptoms and low toxicity. Low immunogenicity
and/or high affinity, as
well as other undefined properties, can contribute to the therapeutic results
achieved.
TNF receptor multimeric molecules useful in the present invention comprise all
or a
functional portion of the ECD of two or more TNF receptors linked via one or
more polypeptide
3 0 linkers or other nonpeptide linkers, such as polyethylene glycol (PEG).
The multimeric molecules
can further comprise a signal peptide of a secreted protein to direct
expression of the multimeric
molecule. These multimeric molecules and methods for their production have
been described in U.S.
Application No. 08/437,533 (filed May 9, 1995), the content of which is
entirely incorporated herein
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
48
by reference.
TNF immunoreceptor fusion molecules useful in the methods and compositions of
the
present invention comprise at least one portion of one or more immunoglobulin
molecules and all or a
functional portion of one or more TNF receptors. These immunoreceptor fusion
molecules can be
assembled as monomers, or hetero- or homo-multimers. The immunoreceptor fusion
molecules can
also be monovalent or multivalent. An example of such a TNF immunoreceptor
fusion molecule is
TNF receptor/IgG fusion protein. TNF immunoreceptor fusion molecules and
methods for their
production have been described in the art (Lesslauer et al., Eur. J. Immuzzol.
21:2883-2886 (1991);
Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88:10535-10539 (1991); Peppel et
al., J. Exp. Med.
174:1483-1489 (1991); Kolls et al., Proc. Natl. Acad. Sci. USA 91:215-219
(1994); Butler et al.,
Cytokine 6(6):616-623 (1994); Baker et al., Eur. J. Inzrzzunol. 24:2040-2048
(1994); Beutler et al.,
U.S. Patent No. 5,447,851; and U.S. Application No. 08/442,133 (filed May 16,
1995), each of which
references are entirely incorporated herein by reference). Methods for
producing immunoreceptor
fusion molecules can also be found in Capon et al.., U.S. Patent No.
5,116,964; Capon et al., U.S.
Patent No. 5,225,538; and Capon et al., Nature 337:525-531 (1989), which
references are entirely
incorporated herein by reference.
A functional equivalent, derivative, fragment or region of TNF receptor
molecule refers to
the portion of the TNF receptor molecule, or the portion of the TNF receptor
molecule sequence
which encodes TNF receptor molecule, that is of sufficient size and sequences
to functionally
2 0 resemble TNF receptor molecules that can be used in the present invention
(e.g., bind TNF~ with
high affinity and possess low immunogenicity). A functional equivalent of TNF
receptor molecule
also includes modified TNF receptor molecules that functionally resemble TNF
receptor molecules
that can be used in the present invention (e.g., bind TNF~ with high affinity
and possess low
immunogenicity). For example, a functional equivalent of TNF receptor molecule
can contain a
2 5 "SILENT" codon or one or more amino acid substitutions, deletions or
additions (e.g., substitution of
one acidic amino acid for another acidic amino acid; or substitution of one
codon encoding the same
or different hydrophobic amino acid for another codon encoding a hydrophobic
amino acid). See
Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing
Assoc. and Wiley-
Interscience, New York (1987-2000).
3 0 Cytokines include any known cytokine. See, e.g., CopewithCytokines.com.
Cytokine
antagonists include, but are not limited to, any antibody, fragment or
mimetic, any soluble receptor,
fragment or mimetic, any small molecule antagonist, or any combination
thereof.
Therapeutic Treatments. Any method of the present invention can comprise a
method for
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
49
treating a RSV mediated disorder or disease, comprising administering an
effective amount of a
composition or pharmaceutical composition comprising at least one RSV antibody
or protein to a
cell, tissue, organ, animal or patient in need of such modulation, treatment
or therapy. Such a method
can optionally further comprise co-administration or combination therapy for
treating such disorders
or diseases, wherein the administering of said at least one RSV antibody or
protein, further comprises
administering, before concurrently, and/or after, at least one selected from
at least one at least one
selected from at least one TNF antagonist (e.g., but not limited to a TNF
antibody or fragment, a
soluble TNF receptor or fragment, fusion proteins thereof, or a small molecule
TNF antagonist), an
antirheumatic (e.g., methotrexate, auranofin, aurothioglucose, azathioprine,
etanercept, gold sodium
thiomalate, hydroxychloroquine sulfate, leflunomide, sulfasalzine), a muscle
relaxant, a narcotic, a
non-steroid inflammatory drug (NSA)I~), an analgesic, an anesthetic, a
sedative, a local anethetic, a
neuromuscular blocker, an antimicrobial (e.g., aminoglycoside, an antifungal,
an antiparasitic, an
antiviral, a carbapenem, cephalosporin, a flurorquinolone, a macrolide, a
penicillin, a sulfonamide, a
tetracycline, another antimicrobial), an antipsoriatic, a corticosteriod, an
anabolic steroid, a diabetes
related agent, a mineral, a nutritional, a thyroid agent, a vitamin, a calcium
related hormone, an
antidiarrheal, an antitussive, an antiemetic, an antiulcer, a laxative, an
anticoagulant, an erythropieitin
(e.g., epoetin alpha), a filgrastim (e.g., G-CSF, Neupogen), a sargramostim
(GM-CSF, Leukine), an
immunization, an immunoglobulin, an immunosuppressive (e.g., basiliximab,
cyclosporine,
daclizumab), a growth hormone, a hormone replacement drug, an estrogen
receptor modulator, a
2 0 mydriatic, a cycloplegic, an alkylating agent, an antimetabolite, a
mitotic inhibitor, a
radiopharmaceutical, an antidepressant, antimanic agent, an antipsychotic, an
anxiolytic, a hypnotic, a
sympathomimetic, a stimulant, donepezil, tacrine, an asthma medication, a beta
agonist, an inhaled
steroid, a leukotriene inhibitor, a methylxanthine, a cromolyn, an epinephrine
or analog, dornase
alpha (Pulmozyme), a cytokine or a cytokine antagonist.
2 5 Protein Dosing
Typically, treatment of pathologic conditions is effected by administering an
effective amount
or dosage of at least one RSV protein composition that total, on average, a
range from at least about
0.001 ng to 500 milligrams of at least one RSV protein per kilogram of patient
per dose, and preferably
from at least about 0.1 ng to 100 milligrams antibody /kilogram of patient per
single or multiple
3 0 administration, depending upon the specific activity of contained in the
composition. Alternatively, the
effective serum concentration can comprise O.OOOlng -0.05 mg/ml serum
concentration per single or
multiple adminstration. Suitable dosages are known to medical practitioners
and will, of course, depend
upon the particular disease state, specific activity of the composition being
administered, and the
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
particular patient undergoing treatment. In some instances, to achieve the
desired therapeutic amount, it
can be necessary to provide for repeated administration, i.e., repeated
individual administrations of a
particular monitored or metered dose, where the individual administrations are
repeated until the desired
daily dose or effect is achieved.
5 Preferred doses of at least one protein can optionally include 0.1, 0.2,
0.3, 0.4, 0.5, 0.6, 0.7, 0.8,
0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56, 57, 58,
59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
79, 80, 81, 82, 83, 84, 85, 86, 87,
88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and/or 100-500 micrograms or
10 milligrams/kg/administration, or any range, value or fraction thereof, or
to achieve a serum
concentration of 0.1, 0.5, 0.9, 1.0, l.l, 1.2, 1.5, 1.9, 2.0, 2.5, 2.9, 3.0,
3.5, 3.9, 4.0, 4.5, 4.9, 5.0, 5.5, 5.9,
6.0, 6.5, 6.9, 7.0, 7.5, 7.9, 8.0, 8.5, 8.9, 9.0, 9.5, 9.9, 10, 10.5, 10.9,
11, 11.5, 11.9, 20, 12.5, 12.9, 13.0,
13.5, 13.9, 14.0, 14.5, 4.9, 5.0, 5.5., 5.9, 6.0, 6.5, 6.9, 7.0, 7.5, 7.9,
8.0, 8.5, 8.9, 9.0, 9.5, 9.9, 10, 10.5,
10.9,11,11.5,11.9,12,12.5,12.9,13.0,13.5,13.9,14,14.5,15,15.5,15.9,16,16.5,16.9
,17>17.5,
15 17.9, 18, 18.5, 18.9, 19, 19.5, 19.9, 20, 20.5, 20.9, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 96, 100, 200, 300, 400, 500, 600, 700, 800,
900, 1000, 1500, 2000, 2500,
3000, 3500, 4000, 4500, and/or 5000 ng or pg/ml serum concentration per single
or multiple
administration, or any range, value or fraction thereof.
Alternatively, the dosage administered can vary depending upon known factors,
such as the
2 0 pharmacodynamic characteristics of the particular agent, and its mode and
route of administration;
age, health, and weight of the recipient; nature and extent of symptoms, kind
of concurrent treatment,
frequency of treatment, and the effect desired. Usually a dosage of active
ingredient can be about 0.1
~g to 100 milligrams per kilogram of body weight. Ordinarily 0.0001 to 50, and
preferably 0.001 to
10 milligrams per kilogram per administration or in sustained release form is
effective to obtain
2 5 desired results.
As a non-limiting example, treatment of humans or animals can be provided as a
one-time or
periodic dosage of at least one antibody of the present invention 0.1 to 100
~g/kg, such as 0.5, 0.9,
1.0, 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23,24, 25, 26, 27,
28, 29, 30, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700,
800, 900, 1000, 2000 or 3000
3 0 ~g/kg, per day, or 0.1 to 100 mg/kg, such as 0.5, 0.9, 1.0, 1.1, 1.5, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 45,
50, 60, 70, 80, 90 or 100
mg/kg, per day, on at least one of day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or
40, or alternatively or
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
51
additionally, at least one of week 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 51, or 52, or alternatively or additionally, at least one of 1, 2, 3,
4, 5, 6" 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 years, or any combination thereof, using
single, infusion or repeated
doses.
Dosage forms (composition) suitable for internal administration generally
contain from about
0.00001 milligram to about 500 milligrams of active ingredient per unit or
container. In these
pharmaceutical compositions the active ingredient will ordinarily be present
in an amount of about
0.5-99.999% by weight based on the total weight of the composition.
Typically, treatment of pathologic conditions is effected by administering an
effective amount or dosage
of at least one RSV antibody composition that total, on average, a range from
at least about 0.00001 to
500 milligrams of at least one RSVantibody per kilogram of patient per dose,
and preferably from at
least about 0.0001 to 100 milligrams antibody /kilogram of patient per single
or multiple administration,
depending upon the specific activity of contained in the composition.
Alternatively, the effective serum
concentration can comprise 0.0001-500 pg/ml serum concentration per single or
multiple adminstration.
Suitable dosages are known to medical practitioners and will, of course,
depend upon the particular
disease state, specific activity of the composition being administered, and
the particular patient
undergoing treatment. In some instances, to achieve the desired therapeutic
amount, it can be necessary
to provide for repeated administration, i.e., repeated individual
administrations of a particular monitored
2 0 or metered dose, where the individual administrations are repeated until
the desired daily dose or effect
is achieved.
Antibody Dosing
Typically, treatment of pathologic conditions is effected by administering an
effective amount
or dosage of at least one RSV antibody composition that total, on average, a
range from at least about
2 5 0.001 ng to 500 milligrams of at least one RSVantibody per kilogram of
patient per dose, and preferably
from at least about 0.1 ng to 100 milligrams antibody /kilogram of patient per
single or multiple
administration, depending upon the specific activity of contained in the
composition. Alternatively, the
effective serum concentration can comprise O.OOOlng -0.05 mg/ml serum
concentration per single or
multiple adminstration. Suitable dosages are known to medical practitioners
and will, of course, depend
3 0 upon the particular disease state, specific activity of the composition
being administered, and the
particular patient undergoing treatment. In some instances, to achieve the
desired therapeutic amount, it
can be necessary to provide for repeated administration, i.e., repeated
individual administrations of a
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
52
particular monitored or metered dose, where the individual administrations are
repeated until the desired
daily dose or effect is achieved.
Preferred doses of at least one antibody can optionally include 0.1, 0.2, 0.3,
0.4, 0.5, 0.6, 0.7,
0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
77, 78, 79, 80, 81, 82, 83, 84, 85,
86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and/or 100-500
mg/kg/administration, or any range,
value or fraction thereof, or to achieve a serum concentration of 0.1, 0.5,
0.9, 1.0, 1.1, 1.2, 1.5, 1.9, 2.0,
2.5, 2.9, 3.0, 3.5, 3.9, 4.0, 4.5, 4.9, 5.0, 5.5, 5.9, 6.0, 6.5, 6.9, 7.0,
7.5, 7.9, 8.0, 8.5, 8.9, 9.0, 9.5, 9.9, 10,
10.5, 10.9, 11, 11.5, 11.9, 20, 12.5, 12.9, 13.0, 13.5, 13.9, 14.0, 14.5, 4.9,
5.0, 5.5., 5.9, 6.0, 6.5, 6.9, 7.0,
7.5, 7.9, 8.0, 8.5, 8.9, 9.0, 9.5, 9.9, 10, 10.5, 10.9, 11, 11.5, 11.9, 12,
12.5, 12.9, 13.0, 13.5, 13.9, 14,
14.5, 15, 15.5, 15.9, 16, 16.5, 16.9, 17, 17.5, 17.9, 18, 18.5, 18.9, 19,
19.5, 19.9, 20, 20.5, 20.9, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85,
90, 96, 100, 200, 300, 400, 500,
600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, and/or
5000 ~.g/ml serum
concentration per single or multiple administration, or any range, value or
fraction thereof.
Alternatively, the dosage administered can vary depending upon known factors,
such as the
pharmacodynamic characteristics of the particular agent, and its mode and
route of administration;
age, health, and weight of the recipient; nature and extent of symptoms, kind
of concurrent treatment,
frequency of treatment, and the effect desired. Usually a dosage of active
ingredient can be about 0.1
2 0 to 100 milligrams per kilogram of body weight. Ordinarily 0.1 to 50, and
preferably 0.1 to 10
milligrams per kilogram per administration or in sustained release form is
effective to obtain desired
results.
As a non-limiting example, treatment of humans or animals can be provided as a
one-time or
periodic dosage of at least one antibody of the present invention 0.1 to 100
mg/kg, such as 0.5, 0.9,
2 5 1.0, 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 40, 45, 50, 60, 70, 80, 90 or 100 mg/kg, per day, on at least one
of day 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, or 40, or alternatively or additionally, at least one of week
1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37,
3 0 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52, or
alternatively or additionally, at least one
of 1, 2, 3, 4, 5, 6" 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
years, or any combination
thereof, using single, infusion or repeated doses.
Dosage forms (composition) suitable for internal administration generally
contain from about
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
53
0.1 milligram to about 500 milligrams of active ingredient per unit or
container. In these
pharmaceutical compositions the active ingredient will ordinarily be present
in an amount of about
0.5-99.999% by weight based on the total weight of the composition.
Administration
For parenteral administration, the antibody or protein can be formulated as a
solution,
suspension, emulsion or lyophilized powder in association, or separately
provided, with a
pharmaceutically acceptable parenteral vehicle. Examples of such vehicles are
water, saline, Ringer's
solution, dextrose solution, and 1-10% human serum albumin. Liposomes and
nonaqueous vehicles
such as fixed oils can also be used. The vehicle or lyophilized powder can
contain additives that
maintain isotonicity (e.g., sodium chloride, mannitol) and chemical stability
(e.g., buffers and
preservatives). The formulation is sterilized by laiown or suitable
techniques.
Suitable pharmaceutical carriers are described in the most recent edition of
Remington's
Pharmaceutical Sciences, A. Osol, a standard reference text in this field.
Alternative Administration
Many known and developed modes of can be used according to the present
invention for
administering pharmaceutically effective amounts of at least one RSV antibody
according to the
present invention. While pulmonary administration is used in the following
description, other modes
of administration can be used according to the present invention with suitable
results.
RSV antibodies of the present invention can be delivered in a Garner, as a
solution, emulsion,
2 0 colloid, or suspension, or as a dry powder, using any of a variety of
devices and methods suitable for
administration by inhalation or other modes described here within or known in
the art.
Parenteral Formulations and Administration
Formulations for parenteral administration can contain as common excipients
sterile water or
saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable
origin, hydrogenated
2 5 naphthalenes and the like. Aqueous or oily suspensions for injection can
be prepared by using an
appropriate emulsifier or humidifier and a suspending agent, according to
known methods. Agents
for injection can be a non-toxic, non-orally administrable diluting agent such
as aquous solution or a
sterile injectable solution or suspension in a solvent. As the usable vehicle
or solvent, water, Ringer's
solution, isotonic saline, etc. are allowed; as an ordinary solvent, or
suspending solvent, sterile
3 0 involatile oil can be used. For these purposes, any kind of involatile oil
and fatty acid can be used,
including natural or synthetic or semisynthetic fatty oils or fatty acids;
natural or synthetic or
semisynthtetic mono- or di- or tri-glycerides. Parental administration is
known in the art and
includes, but is not limited to, conventional means of injections, a gas
pressured needle-less injection
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
54
device as described in U.S. Pat. No. 5,851,198, and a laser perforator device
as described in U.S. Pat.
No. 5,839,446 entirely incorporated herein by reference.
Alternative Delivery
The invention further relates to the administration of at least one RSV
antibody by parenteral,
subcutaneous, intramuscular, intravenous, intrarticular, intrabronchial,
intraabdominal, intracapsular,
intracartilaginous, intracavitary, intracelial, intracelebellar,
intracerebroventricular, intracolic,
intracervical, intragastric, intrahepatic, intramyocardial, intraosteal,
intrapelvic, intrapericardiac,
intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal,
intrarenal, intraretinal,
intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus,
vaginal, rectal, buccal,
sublingual, intranasal, or transdermal means. At least one RSV antibody
composition can be prepared
for use for parenteral (subcutaneous, intramuscular or intravenous) or any
other administration
particularly in the form of liquid solutions or suspensions; for use in
vaginal or rectal administration
particularly in semisolid forms such as, but not limited to, creams and
suppositories; for buccal, or
sublingual administration such as, but not limited to, in the form of tablets
or capsules; or intranasally
such as, but not limited to, the form of powders, nasal drops or aerosols or
certain agents; or
transdermally such as not limited to a gel, ointment, lotion, suspension or
patch delivery system with
chemical enhancers such as dimethyl sulfoxide to either modify the skin
structure or to increase the
drug concentration in the transdermal patch (Junginger, et al. In "Drug
Permeation Enhancement";
Hsieh, D. S., Eds., pp. 59-90 (Marcel Dekker, Inc. New York 1994, entirely
incorporated herein by
2 0 reference), or with oxidizing agents that enable the application of
formulations containing proteins
and peptides onto the skin (WO 98/53847), or applications of electric fields
to create transient
transport pathways such as electroporation, or to increase the mobility of
charged drugs through the
skin such as iontophoresis, or application of ultrasound such as sonophoresis
(U.S. Pat. Nos.
4,309,989 and 4,767,402) (the above publications and patents being entirely
incorporated herein by
2 5 reference).
Pulmonary/Nasal Administration
For pulmonary administration, preferably at least one RSV antibody composition
is delivered
in a particle size effective for reaching the lower airways of the lung or
sinuses. According to the
invention, at least one RSV antibody can be delivered by any of a variety of
inhalation or nasal
3 0 devices known in the art for administration of a therapeutic agent by
inhalation. These devices
capable of depositing aerosolized formulations in the sinus cavity or alveoli
of a patient include
metered dose inhalers, nebulizers, dry powder generators, sprayers, and the
like. Other devices
suitable for directing the pulmonary or nasal administration of antibodies are
also known in the art.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
All such devices can use of formulations suitable for the administration for
the dispensing of
antibody in an aerosol. Such aerosols can be comprised of either solutions
(both aqueous and non
aqueous) or solid particles. Metered dose inhalers like the Ventoliri metered
dose inhaler, typically
use a propellent gas and require actuation during inspiration (See, e.g., WO
94/16970, WO
5 98/35888). Dry powder inhalers like Turbuhaler~ (Astray, Rotahaler°
(Glaxo), Diskus° (Glaxo),
Spiros~ inhaler (Data), devices marketed by Inhale Therapeutics, and the
Spinhaler° powder inhaler
(Fisons), use breath-actuation of a mixed powder (US 4668218 Astra, EP 237507
Astra, WO
97/25086 Glaxo, WO 94/08552 Dura, US 5458135 Inhale, WO 94106498 Fisons,
entirely
incorporated herein by reference). Nebulizers like AERx~ Aradigm, the
Ultravent° nebulizer
10 (Mallinckrodt), and the Acorn II° nebulizer (Marquest Medical
Products) (US 5404871 Aradigm,
WO 97/22376), the above references entirely incorporated herein by reference,
produce aerosols from
solutions, while metered dose inhalers, dry powder inhalers, etc. generate
small particle aerosols.
These specific examples of commercially available inhalation devices are
intended to be a
representative of specific devices suitable for the practice of this
invention, and are not intended as
15 limiting the scope of the invention. Preferably, a composition comprising
at least one RSV antibody
is delivered by a dry powder inhaler or a sprayer. There are a several
desirable features of an
inhalation device for administering at least one antibody of the present
invention. For example,
delivery by the inhalation device is advantageously reliable, reproducible,
and accurate. The
inhalation device can optionally deliver small dry particles, e.g. less than
about 10 ~,m, preferably
2 0 about 1-5 ~,m, for good respirability.
Administration of RSV antibody Compositions as a Spray
A spray including RSV antibody composition can be produced by forcing a
suspension or
solution of at least one RSV antibody through a nozzle under pressure. The
nozzle size and
configuration, the applied pressure, and the liquid feed rate can be chosen to
achieve the desired
2 5 output and particle size. An electrospray can be produced, for example, by
an electric field in
connection with a capillary or nozzle feed. Advantageously, particles of at
least one RSV antibody
composition delivered by a sprayer have a particle size less than about 10
Vim, preferably in the range
of about 1 ~,m to about 5 Vim, and most preferably about 2 ~,m to about 3 ~,m.
Formulations of at least one RSV protein or antibody composition suitable for
use with a
3 0 sprayer typically include antibody or protein compositions in an aqueous
solution at a concentration
of about 0.0000001 mg to about 1000 mg of at least one RSV antibody or protein
composition per ml
of solution or mg/gm, or any range or value therein, e.g., but not lmited to,
.1, .2., .3, .4, .5, .6, .7, .8,
.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
56
30, 40, 45, 50, 60, 70, 80, 90 or 100 ng or ~.g or mg/ml or ng or ~.g or
mg/gm. The formulation can
include agents such as an excipient, a buffer, an isotonicity agent, a
preservative, a surfactant, and,
preferably, zinc. The formulation can also include an excipient or agent for
stabilization of the
antibody composition, such as a buffer, a reducing agent, a bulk protein, or a
carbohydrate. Bulk
proteins useful in formulating antibody compositions include albumin,
protamine, or the like.
Typical carbohydrates useful in formulating antibody compositions include
sucrose, mannitol,
lactose, trehalose, glucose, or the like. The antibody composition formulation
can also include a
surfactant, which can reduce or prevent surface-induced aggregation of the
antibody or protein
composition caused by atomization of the solution in forming an aerosol.
Various conventional
surfactants can be employed, such as polyoxyethylene fatty acid esters and
alcohols, and
polyoxyethylene sorbitol fatty acid esters. Amounts will generally range
between 0.001 and 14°Io by
weight of the formulation. Especially preferred surfactants for purposes of
this invention are
polyoxyethylene sorbitan monooleate, polysorbate 80, polysorbate 20, or the
like. Additional agents
known in the art for formulation of a protein such as RSV antibodies, or
specified portions or
variants, can also be included in the formulation.
Administration of RSV antibody compositions by a Nebulizer
antibody composition can be administered by a nebulizer, such as jet nebulizer
or an
ultrasonic nebulizer. Typically, in a jet nebulizer, a compressed air source
is used to create a high-
velocity air jet through an orifice. As the gas expands beyond the nozzle, a
low-pressure region is
2 0 created, which draws a solution of antibody composition through a
capillary tube connected to a
liquid reservoir. The liquid stream from the capillary tube is sheared into
unstable filaments and
droplets as it exits the tube, creating the aerosol. A range of
configurations, flow rates, and baffle
types can be employed to achieve the desired performance characteristics from
a given jet nebulizer.
In an ultrasonic nebulizer, high-frequency electrical energy is used to create
vibrational, mechanical
2 5 energy, typically employing a piezoelectric transducer. This energy is
transmitted to the formulation
of antibody composition either directly or through a coupling fluid, creating
an aerosol including the
antibody composition. Advantageously, particles of antibody composition
delivered by a nebulizer
have a particle size less than about 10 ~.m, preferably in the range of about
1 ~m to about 5 Vim, and
most preferably about 2 ~.m to about 3 Vim.
3 0 Formulations of at least one RSV antibody suitable for use with a
nebulizer, either jet or
ultrasonic, typically include a concentration of about 0.1 mg to about 100 mg
of at least one RSV
antibody protein per ml of solution. The formulation can include agents such
as an excipient, a
buffer, an isotonicity agent, a preservative, a surfactant, and, preferably,
zinc. The formulation can
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
57
also include an excipient or agent for stabilization of the at least one RSV
antibody composition, such
as a buffer, a reducing agent, a bulk protein, or a carbohydrate. Bulk
proteins useful in formulating at
least one RSV antibody compositions include albumin, protamine, or the like.
Typical carbohydrates
useful in formulating at least one RSV antibody include sucrose, mannitol,
lactose, trehalose,
glucose, or the like. The at least one RSV antibody formulation can also
include a surfactant, which
can reduce or prevent surface-induced aggregation of the at least one RSV
antibody caused by
atomization of the solution in forming an aerosol. Various conventional
surfactants can be employed,
such as polyoxyethylene fatty acid esters and alcohols, and polyoxyethylene
sorbital fatty acid esters.
Amounts will generally range between 0.001 and 4% by weight of the
formulation. Especially
preferred surfactants for purposes of this invention are polyoxyethylene
sorbitan mono-oleate,
polysorbate 80, polysorbate 20, or the like. Additional agents known in the
art for formulation of a
protein such as antibody protein can also be included in the formulation.
Administration of RSV antibody compositions By A Metered Dose Inhaler
In a metered dose inhaler (MDI), a propellant, at least one RSV antibody, and
any excipients
or other additives are contained in a canister as a mixture including a
liquefied compressed gas.
Actuation of the metering valve releases the mixture as an aerosol, preferably
containing particles in
the size range of less than about 10 p,m, preferably about 1 ~,m to about 5
~,m, and most preferably
about 2 ~m to about 3 Vim. The desired aerosol particle size can be obtained
by employing a
formulation of antibody composition produced by various methods known to those
of skill in the art,
2 0 including jet-milling, spray drying, critical point condensation, or the
like. Preferred metered dose
inhalers include those manufactured by 3M or Glaxo and employing a
hydrofluorocarbon propellant.
Formulations of at least one RSV antibody for use with a metered-dose inhaler
device will
generally include a finely divided powder containing at least one RSV antibody
as a suspension in a
non-aqueous medium, for example, suspended in a propellant with the aid of a
surfactant. The
2 5 propellant can be any conventional material employed for this purpose,
such as chlorofluorocarbon, a
hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including
trichlorofluoromethane,
dichlorodifluoromethane, dichlorotetrafluoroethanol and 1,1,1,2-
tetrafluoroethane, HFA-134a
(hydrofluroalkane-134a), HFA-227 (hydrofluroalkane-227), or the like.
Preferably the propellant is a
hydrofluorocarbon. The surfactant can be chosen to stabilize the at least one
RSV antibody as a
3 0 suspension in the propellant, to protect the active agent against chemical
degradation, and the like.
Suitable surfactants include sorbitan trioleate, soya lecithin, oleic acid, or
the like. In some cases
solution aerosols are preferred using solvents such as ethanol. Additional
agents known in the art for
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
58
formulation of a protein such as protein can also be included in the
formulation.
One of ordinary skill in the art will recognize that the methods of the
current invention can be
achieved by pulmonary administration of at least one RSV antibody compositions
via devices not
described herein.
Oral Formulations and Administration
Formulations for oral rely on the co-administration of adjuvants (e.g.,
resorcinols and
nonionic surfactants such as polyoxyethylene oleyl ether and n-
hexadecylpolyethylene ether) to
increase artificially the permeability of the intestinal walls, as well as the
co-administration of
enzymatic inhibitors (e.g., pancreatic trypsin inhibitors,
diisopropylfluorophosphate (DFF) and
trasylol) to inhibit enzymatic degradation. The active constituent compound of
the solid-type dosage
form for oral administration can be mixed with at least one additive,
including sucrose, lactose,
cellulose, mannitol, trehalose, raffmose, maltitol, dextran, starches, agar,
arginates, chitins, chitosans,
pectins, gum tragacanth, gum arabic, gelatin, collagen, casein, albumin,
synthetic or semisynthetic
polymer, and glyceride. These dosage forms can also contain other types) of
additives, e.g., inactive
diluting agent, lubricant such as magnesium stearate, paraben, preserving
agent such as sorbic acid,
ascorbic acid, .alpha.-tocopherol, antioxidant such as cysteine,
disintegrator, binder, thickener,
buffering agent, sweetening agent, flavoring agent, perfuming agent, etc.
Tablets and pills can be further processed into enteric-coated preparations.
The liquid
preparations for oral administration include emulsion, syrup, elixir,
suspension and solution
.2 0 preparations allowable for medical use. These preparations can contain
inactive diluting agents
ordinarily used in said field, e.g., water. Liposomes have also been described
as drug delivery
systems for insulin and heparin (U.S. Pat. No. 4,239,754). More recently,
microspheres of artificial
polymers of mixed amino acids (proteinoids) have been used to deliver
pharmaceuticals (U.S. Pat.
No. 4,925,673). Furthermore, carrier compounds described in U.S. Pat. No.
5,879,681 and U.S. Pat.
2 5 No. 5,5,871,753 are used to deliver biologically active agents orally are
known in the art.
Mucosal Formulations and Administration
For absorption through mucosal surfaces, compositions and methods of
administering at least
one RSV antibody include an emulsion comprising a plurality of submicron
particles, a
mucoadhesive macromolecule, a bioactive peptide, and an aqueous continuous
phase, which
3 0 promotes absorption through mucosal surfaces by achieving mucoadhesion of
the emulsion particles
(U.S. Pat. Nos. 5,514,670). Mucous surfaces suitable for application of the
emulsions of the present
invention can include corneal, conjunctival, buccal, sublingual, nasal,
vaginal, pulmonary, stomachic,
intestinal, and rectal routes of administration. Formulations for vaginal or
rectal administration, e.g.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
59
suppositories, can contain as excipients, for example, polyalkyleneglycols,
vaseline, cocoa butter, and
the like. Formulations for intranasal administration can be solid and contain
as excipients, for
example, lactose or can be aqueous or oily solutions of nasal drops. For
buccal administration
excipients include sugars, calcium stearate, magnesium stearate,
pregelinatined starch, and the like
(U.S. Pat. Nos. 5,849,695).
Transdermal Formulations and Administration
For transdermal administration, the at least one RSV antibody is encapsulated
in a delivery
device such as a liposome or polymeric nanoparticles, microparticle,
microcapsule, or microspheres
(referred to collectively as microparticles unless otherwise stated). A number
of suitable devices are
known, including microparticles made of synthetic polymers such as polyhydroxy
acids such as
polylactic acid, polyglycolic acid and copolymers thereof, polyorthoesters,
polyanhydrides, and
polyphosphazenes, and natural polymers such as collagen, polyamino acids,
albumin and other
proteins, alginate and other polysaccharides, and combinations thereof (U.S.
Pat. Nos. 5,814,599).
Prolonged Administration and Formulations
It can be sometimes desirable to deliver the compounds of the present
invention to the subject
over prolonged periods of time, for example, for periods of one week to one
year from a single
administration. Various slow release, depot or implant dosage forms can be
utilized. For example, a
dosage form can contain a pharmaceutically acceptable non-toxic salt of the
compounds that has a
2 0 low degree of solubility in body fluids, for example, (a) an acid addition
salt with a polybasic acid
such as phosphoric acid, sulfuric acid, citric acid, tartaric acid, tannic
acid, pamoic acid, alginic acid,
polyglutamic acid, naphthalene mono- or di-sulfonic acids, polygalacturonic
acid, and the like; (b) a
salt with a polyvalent metal canon such as zinc, calcium, bismuth, barium,
magnesium, aluminum,
copper, cobalt, nickel, cadmium and the like, or with an organic cation formed
from e.g., N,N'-
2 5 dibenzyl-ethylenediamine or ethylenediamine; or (c) combinations of (a)
and (b) e.g. a zinc tannate
salt. Additionally, the compounds of the present invention or, preferably, a
relatively insoluble salt
such as those just described, can be formulated in a gel, for example, an
aluminum monostearate gel
with, e.g. sesame oil, suitable for injection. Particularly preferred salts
are zinc salts, zinc tannate
salts, pamoate salts, and the like. Another type of slow release depot
formulation for injection would
3 0 contain the compound or salt dispersed for encapsulated in a slow
degrading, non-toxic, non-
antigenic polymer such as a polylactic acid/polyglycolic acid polymer for
example as described in
U.S. Pat. No. 3,773,919. The compounds or, preferably, relatively insoluble
salts such as those
described above can also be formulated in cholesterol matrix silastic pellets,
particularly for use in
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
animals. Additional slow release, depot or implant formulations, e.g. gas or
liquid liposomes are
known in the literature (U.S. Pat. Nos. 5,770,222 and "Sustained and
Controlled Release Drug
Delivery Systems", J. R. Robinson ed., Marcel Dekker, Inc., N.Y., 1978).
5 Having generally described the invention, the same will be more readily
understood by
reference to the following examples, which are provided by way of illustration
and are not intended
as limiting.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
61
Example 1: Expression and Purification of a RSV Protein or Antibody in E. cola
The bacterial expression vector pQE60 is used for bacterial expression in this
example.
(QIAGEN, Inc., Chatsworth, CA). pQE60 encodes ampicillin antibiotic resistance
("Ampr") and
contains a bacterial origin of replication ("ori"), an IPTG inducible
promoter, a ribosome binding site
("RBS"), six codons encoding histidine residues that allow affinity
purification using nickel-nitrilo-
tri-acetic acid ("Ni-NTA") affinity resin sold by QIAGEN, Inc., and suitable
single restriction enzyme
cleavage sites. These elements are arranged such that a DNA fragment encoding
a protein or
antibody can be inserted in such a way as to produce that protein or antibody
with the six His
residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of
that protein or antibody.
However, a protein or antibody coding sequence can optionally be inserted such
that translation of
the six His codons is prevented and, therefore, a protein or antibody is
produced with no 6 X His tag.
The nucleic acid sequence encoding the desired portion of a RSV protein or
antibody lacking
the hydrophobic leader sequence is amplified from the deposited cDNA clone
using PCR
oligonucleotide primers (based on the sequences presented, e.g., as presented
in at least one of SEQ
ID NOS:7-12, or any portion thereof or nucleic acid encoding thereof, or any
portion of Figs 2-5 ,
which anneal to the amino terminal encoding DNA sequences of the desired
portion of a RSV
protein or antibody and to sequences in the deposited construct 3' to the cDNA
coding sequence.
Additional nucleotides containing restriction sites to facilitate cloning in
the pQE60 vector axe added
2 0 to the 5' and 3' sequences, respectively.
For cloning a RSV protein or antibody, the 5' and 3' primers have nucleotides
corresponding
or complementary to a portion of the coding sequence of a RSV, e.g., as
presented in at least one of
SEQ ID NOS:1-12, or any portion thereof or nucleic acid encoding thereof, or
any portion of Figs 2-
5, according to known method steps. One of ordinary skill in the art would
appreciate, of course, that
2 5 the point in a protein or antibody coding sequence where the 5' primer
begins can be vaxied to
amplify a desired portion of the complete protein or antibody shorter or
longer than the mature form.
The amplified RSV nucleic acid fragments and the vector pQE60 axe digested
with
appropriate restriction enzymes and the digested DNAs are then ligated
together. Insertion of the
RSV DNA into the restricted pQE60 vector places a RSV protein or antibody
coding region
3 0 including its associated stop codon downstream from the 1PTG-inducible
promoter and in-frame with
an initiating AUG codon. The associated stop codon prevents translation of the
six histidine codons
downstream of the insertion point.
The ligation mixture is transformed into competent E. coli cells using
standard procedures
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
62
such as those described in Sambrook, et al., 1989; Ausubel, 1987-1998. E. coli
strain M15/rep4,
containing multiple copies of the plasmid pREP4, which expresses the lac
repressor and confers
kanamycin resistance ("Kanr"), is used in carrying out the illustrative
example described herein. This
strain, which is only one of many that are suitable for expressing RSV protein
or antibody, is
available commercially from QIAGEN, Inc. Transformants are identified by their
ability to grow on
LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated
from resistant
colonies and the identity of the cloned DNA confirmed by restriction analysis,
PCR and DNA
sequencing.
Clones containing the desired constructs are grown overnight ("O/N") in liquid
culture in LB
media supplemented with both ampicillin ( 100 [~glml) and kanamycin (25
~glml). The O/N culture is
used to inoculate a large culture, at a dilution of approximately 1:25 to
1:250. The cells are grown to
an optical density at 600 nm ("OD600") of between 0.4 and 0.6. Isopropyl-b-D-
thiogalactopyranoside
("IPTG") is then added to a final concentration of 1 mM to induce
transcription from the lac repressor
sensitive promoter, by inactivating the lacI repressor. Cells subsequently are
incubated further for 3
to 4 hours. Cells then are harvested by centrifugation.
The cells are then stirred for 3-4 hours at 4°C in 6M guanidine-HCI,
pH8. The cell debris is
removed by centrifugation, and the supernatant containing the RSV is dialyzed
against 50 mM Na-
acetate buffer pH6, supplemented with 200 mM NaCI. Alternatively, a protein or
antibody can be
successfully refolded by dialyzing it against 500 mM NaCI, 20% glycerol, 25 mM
Tris/HCl pH7.4,
2 0 containing protease inhibitors.
If insoluble protein is generated, the protein is made soluble according to
known method
steps. After renaturation the protein or antibody is purified by ion exchange,
hydrophobic interaction
and size exclusion chromatography. Alternatively, an affinity chromatography
step such as an
antibody column is used to obtain pure RSV protein or antibody. The purified
protein or antibody is
2 5 stored at 4°C or frozen at -40°C to -120°C.
Example 2: Cloning and Expression of a RSV Polypeptide in a Baculovirus
Expression System
In this illustrative example, the plasmid shuttle vector pA2 GP is used to
insert the cloned
3 0 DNA encoding the mature protein or antibody into a baculovirus to express
a RSV protein or
antibody, using a baculovirus leader and standard methods as described in
Summers, et al., A Manual
of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas
Agricultural
Experimental Station Bulletin No. 1555 (1987). This expression vector contains
the strong
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
63
polyhedrin promoter of the Autographs californica nuclear polyhedrosis virus
(AcMNPV) followed
by the secretory signal peptide (leader) of the baculovirus gp67 protein or
antibody and convenient
restriction sites such as BamHI, Xba I and Asp718. The polyadenylation site of
the simian virus 40
("SV40") is used for efficient polyadenylation. For easy selection of
recombinant virus, the plasmid
contains the beta-galactosidase gene from E. coli under control of a weak
Drosophila promoter in the
same orientation, followed by the polyadenylation signal of the polyhedrin
gene. The inserted genes
are flanked on both sides by viral sequences for cell-mediated homologous
recombination with wild-
type viral DNA to generate viable virus that expresses the cloned
polynucleotide.
Other baculovirus vectors are used in place of the vector above, such as
pAc373, pVL941 and
pAcIMl, as one skilled in the art would readily appreciate, as long as the
construct provides
appropriately located signals for transcription, translation, secretion and
the like, including a signal
peptide and an in-frame AUG as required. Such vectors are described, for
instance, in Luckow, et al.,
Virology 170:31-39.
The cDNA sequence encoding the mature RSV protein or antibody in the deposited
or other
clone, lacking the AUG initiation codon and the naturally associated
nucleotide binding site, is
amplified using PCR oligonucleotide primers corresponding to the 5' and 3'
sequences of the gene.
Non-limiting examples include 5' and 3' primers having nucleotides
corresponding or complementary
to a portion of the coding sequence of a RSV protein or antibody, e.g., as
presented in at least one of
SEQ ~ NOS:1-12, or any portion thereof or nucleic acid encoding thereof, or
any portion of Figs 2-
2 0 5, according to known method steps.
The amplified fragment is isolated from a 1% agarose gel using a commercially
available kit
(e.g., "Geneclean," BIO 101 Inc., La Jolla, CA). The fragment then is then
digested with the
appropriate restriction enzyme and again is purified on a 1% agarose gel. This
fragment is designated
herein "F1".
2 5 The plasmid is digested with the corresponding restriction enzymes and
optionally, can be
dephosphorylated using calf intestinal phosphatase, using routine procedures
known in the art. The
DNA is then isolated from a 1% agarose gel using a commercially available kit
("Geneclean" BIO
101 Inc., La Jolla, CA). This vector DNA is designated herein "V 1".
Fragment F1 and the dephosphorylated plasmid V1 are ligated together with T4
DNA ligase.
3 0 E. coli HB 101 or other suitable E. coli hosts such as XL-1 Blue
(Stratagene Cloning Systems, La
Jolla, CA) cells are transformed with the ligation mixture and spread on
culture plates. Bacteria are
identified that contain the plasmid with the human RSV gene using the PCR
method, in which one of
the primers that is used to amplify the gene and the second primer is from
well within the vector so
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
64
that only those bacterial colonies containing the RSV gene fragment will show
amplification of the
DNA. The sequence of the cloned fragment is confirmed by DNA sequencing. This
plasmid is
designated herein pBac RSV .
Five [ug of the plasmid pBacRSV is co-transfected with 1.0 ~g of a
commercially available
linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San
Diego, CA), using
the lipofection method described by Felgner, et al., Proc. Natl. Acad. Sci.
USA 84:7413-7417 (1987).
1 ~g of BaculoGoldTM virus DNA and 5 ~g of the plasmid pBac RSV are mixed in a
sterile well of a
microtiter plate containing 50 ~l of serum-free Grace's medium (Life
Technologies, Inc., Rockville,
MD). Afterwards, 10 ~.1 Lipofectin plus 90 ~.1 Grace's medium are added, mixed
and incubated for
15 minutes at room temperature. Then the transfection mixture is added drop-
wise to Sf9 insect cells
(ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's
medium without serum.
The plate is rocked back and forth to mix the newly added solution. The plate
is then incubated for 5
hours at 27°C. After 5 hours the transfeetion solution is removed from
the plate and 1 ml of Grace's
insect medium supplemented with 10% fetal calf serum is added. The plate is
put back into an
incubator and cultivation is continued at 27°C for four days.
After four days the supernatant is collected and a plaque assay is performed,
according to
known methods. An agarose gel with "Blue Gal" (Life Technologies, Inc.,
Rockville, MD) is used to
allow easy identification and isolation of gal-expressing clones, which
produce blue-stained plaques.
(A detailed description of a "plaque assay" of this type can also be found in
the user's guide for insect
2 0 cell culture and baculovirology distributed by Life Technologies, Inc.,
Rockville, MD, page 9-10).
After appropriate incubation, blue stained plaques are picked with a
micropipettor tip (e.g.,
Eppendorf). The agar containing the recombinant viruses is then resuspended in
a microcentrifuge
tube containing 200 ~,l of Grace's medium and the suspension containing the
recombinant baculovirus
is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture
2 5 dishes are harvested and then they are stored at 4°C. The
recombinant virus is called V-RSV.
To verify the expression of the RSV gene, Sf9 cells are grown in Grace's
medium
supplemented with 10% heat-inactivated FBS. The cells are infected with the
recombinant
baculovirus V-RSV at a multiplicity of infection ("MOI") of about 2. Six hours
later the medium is
removed and is replaced with SF900 II medium minus methionine and cysteine
(available, e.g., from
3 0 Life Technologies, Inc., Rockville, MD). If radiolabeled protein or
antibodys are desired, 42 hours
later, 5 mCi of 35S-methionine and 5 mCi 35S-cysteine (available from
Amersham) are added. The
cells are further incubated for 16 hours and then they are harvested by
centrifugation. The protein or
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
antibodys in the supernatant as well as the intracellular protein or antibodys
are analyzed by SDS-
PAGE followed by autoradiography (if radiolabeled). Microsequencing of the
amino acid sequence
of the amino terminus of purified protein or antibody can be used to determine
the amino terminal
sequence of the mature protein or antibody and thus the cleavage point and
length of the secretory
5 signal peptide.
Example 3: Cloning and Expression of RSV protein or antibody in Mammalian
Cells
A typical mammalian expression vector contains at least one promoter element,
which
mediates the initiation of transcription of mRNA, the antibody coding
sequence, and signals required
10 for the termination of transcription and polyadenylation of the transcript.
Additional elements
include enhancers, Kozak sequences and intervening sequences flanked by donor
and acceptor sites
for RNA splicing. Highly efficient transcription can be achieved with the
early and late promoters
from SV40, the long terminal repeats (LTRS) from Retroviruses, e.g., RSV,
HTLVI, HIVI and the
early promoter of the cytomegalovirus (CMV). However, cellular elements can
also be used (e.g., the
15 human actin promoter). Suitable expression vectors for use in practicing
the present invention
include, for example, vectors such as pIRESlneo, pRetro-Off, pRetro-On, PLXSN,
or pLNCX
(Clonetech Labs, Palo Alto, CA), pcDNA3.1 (+/-), pcDNA/Zeo (+/-) or
pcDNA3.l/Hygro (+/-)
(Invitrogen), PSVL and PMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC
37152), pSV2dhfr
(ATCC 37146) and pBCI2MI (ATCC 67109). Mammalian host cells that could be used
include
2 0 human Hela 293, H9 and Jurkat cells, mouse N1H3T3 and 0127 cells, Cos l,
Cos 7 and CV 1, quail
QCl-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
Alternatively, the gene can be expressed in stable cell lines that contain the
gene integrated
into a chromosome. The co-transfection with a selectable marker such as dhfr,
gpt, neomycin, or
hygromycin allows the identification and isolation of the transfected cells.
2 5 The transfected gene can also be amplified to express large amounts of the
encoded protein
or antibody, e.g., as a desired portion of at least one of any 5-500 amino
acid portion of SEQ ID
NOS:1-12, any portion of Figures 3-4 or encoded by any portion of Figures 2A-G
or 5A-F . The
DHFR (dihydrofolate reductase) marker is useful to develop cell lines that
carry several hundred or
even several thousand copies of the gene of interest. Another useful selection
marker is the enzyme
3 0 glutamine synthase (GS) (Murphy, et al., Biochem. J. 227:277-279 (1991);
Bebbington, et al.,
Bio/Technology 10:169-175 (1992)). Using these markers, the mammalian cells
are grown in
selective medium and the cells with the highest resistance are selected. These
cell lines contain the
amplified genes) integrated into a chromosome. Chinese hamster ovary (CHO) and
NSO cells are
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
66
used for the production of antibodies or proteins of the present invention.
The expression vectors pCl and pC4 contain the strong promoter (LTR) of the
Rous Sarcoma
Virus (Cullen, et al., Molec. Cell. Biol. 5:438-447 (1985)) plus a fragment of
the CMV-enhancer
(Boshart, et al., Cell 41:521-530 (1985)). Multiple cloning sites, e.g., with
the restriction enzyme
cleavage sites BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors
contain in addition the 3' intron, the polyadenylation and termination signal
of the rat preproinsulin
gene.
Cloning and Expression in CHO Cells
The vector pC4 is used for the expression of RSV antibody or protein, e.g.,
using a coding
sequence for at least one of any 5-500 amino acid portion of SEQ ID NOS:1-12,
any portion of
Figures 3-4 or encoded by any portion of Figures 2A-G or 5A-F . Plasmid pC4 is
a derivative of the
plasmid pSV2-dhfr (ATCC Accession No. 37146). The plasmid contains the mouse
DHFR gene
under control of the SV40 early promoter. Chinese hamster ovary- or other
cells lacking
dihydrofolate activity that are transfected with these plasmids can be
selected by growing the cells in
a selective medium (e.g., alpha minus MEM, Life Technologies, Gaithersburg,
MD) supplemented
with the chemotherapeutic agent methotrexate. The amplification of the DHFR
genes in cells
resistant to methotrexate (MTX) has been well documented (see, e.g., F. W.
Alt, et al., J. Biol. Chem.
253:1357-1370 (1978); J. L. Hamlin and C. Ma, Biochem. et Biophys. Acta
1097:101-113 (1990);
and M. J. Page and M. A. Sydenham, Biotechnology 9:64-68 (1991)). Cells grown
in increasing
2 0 concentrations of MTX develop resistance to the drug by overproducing the
target enzyme, DHFR, as
a result of amplification of the DHFR gene. If a second gene is linked to the
DHFR gene, it is usually
co-amplified and over-expressed. It is known in the art that this approach can
be used to develop cell
lines carrying more than 1,000 copies of the amplified gene(s). Subsequently,
when the methotrexate
is withdrawn, cell lines are obtained that contain the amplified gene
integrated into one or more
2 5 chromosomes) of the host cell.
Plasmid pC4 contains coding DNA for expressing the gene of interest (e.g.,
encoding at least
one of SEQ IDN NOS: l-12) under control of the strong promoter of the long
terminal repeat (LTR)
of the Rous Sarcoma Virus (Cullen, et al., Molec. Cell. Biol. 5:438-447
(1985)) plus a fragment
isolated from the enhancer of the immediate early gene of human
cytomegalovirus (CMV) (Boshart,
3 0 et al., Cell 41:521-530 (1985)). Downstream of the promoter are BamHI,
XbaI, and Asp718
restriction enzyme cleavage sites that allow integration of the genes. Behind
these cloning sites the
plasmid contains the 3' intron and polyadenylation site of the rat
preproinsulin gene. Other high
efficiency promoters can also be used for the expression, e.g., the human b-
actin promoter, the SV40
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
67
early or late promoters or the long terminal repeats from other retroviruses,
e.g., H1V and HTLVI.
Clontech's Tet-Off and Tet-On gene expression systems and similar systems can
be used to express
the RSV in a regulated way in mammalian cells (M. Gossen, and H. Bujard, Proc.
Natl. Acad. Sci.
USA 89: 5547-5551 (1992)). For the polyadenylation of the mRNA other signals,
e.g., from the
human growth hormone or globin genes can be used as well. Stable cell lines
carrying a gene of
interest integrated into the chromosomes can also be selected upon co-
transfection with a selectable
marker such as gpt, 6418 or hygromycin. It can be advantageous to use more
than one selectable
marker in the beginning, e.g., G418 plus methotrexate.
The plasmid pC4 is digested with restriction enzymes and then dephosphorylated
using calf
intestinal phosphatase by procedures known in the art. The vector is then
isolated from a 1 % agarose
gel.
The DNA sequence encoding the desired RSV antibody or protein is used, e.g.,
DNA or RNA
coding for at least one of any 5-500 amino acid portion of SEQ ID NOS:1-12,
any portion of Figures
3-4 or encoded by any portion of Figures 2A-G or 5A-F , corresponding to at
least one portion of at
least one RSV antibody protein of the present invention, according to known
method steps.
The isolated encoding DNA and the dephosphorylated vector are then ligated
with T4 DNA
ligase. E. coli HB 101 or XL,-1 Blue cells are then transformed and bacteria
are identified that contain
the fragment inserted into plasmid pC4 using, for instance, restriction enzyme
analysis.
Chinese hamster ovary (CHO) cells lacking an active DHFR gene are used for
transfection. 5
2 0 ~,g of the expression plasmid pC4 is cotransfected with 0.5 ~.g of the
plasmid pSV2-neo using
lipofectin. The plasmid pSV2neo contains a dominant selectable marker, the neo
gene from Tn5
encoding an enzyme that confers resistance to a group of antibiotics including
6418. The cells are
seeded in alpha minus MEM supplemented with 1 ~.g /ml 6418. After 2 days, the
cells are
trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha
minus MEM
2 5 supplemented with 10, 25, or 50 ng/ml of methotrexate plus 1 ~g /ml 6418.
After about 10-14 days
single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml
flasks using different
concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). Clones
growing at the
highest concentrations of methotrexate are then transferred to new 6-well
plates containing even
higher concentrations of methotrexate (1 mM, 2 mM, 5 mM, 10 mM, 20 mM). The
same procedure
3 0 is repeated until clones are obtained that grow at a concentration of 100 -
200 mM. Expression of the
desired gene product is analyzed, for instance, by SDS-PAGE and Western blot
or by reverse phase
HPLC analysis.
Example 2: Generation of Antibodies Reactive With Human RSV Using Transgenic
Mice
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
68
Summary
Transgenic mice have been used that contain human heavy and light chain
immunoglobulin
genes to generate high affinity, completely human, monoclonal antibodies that
can be used
therapeutically to inhibit the action of RSV for the treatment of one or more
RSV-mediated disease.
(CBA/J x C57/BL6/J) FZ hybrid mice containing human variable and constant
region antibody
transgenes for both heavy and light chains are immunized with human
recombinant RSV (Taylor et
al., Intl. Immunol. 6:579-591 (1993); Lonberg, et al., Nature 368:856-859
(1994); Neuberger, M.,
Nature Biotech. 14:826 (1996); Fishwild, et al., Nature Biotechnology 14:845-
851 (1996)). Several
fusions yield one or more panels of completely human RSV reactive IgG
monoclonal antibodies. The
completely human RSV antibodies are further characterized. All are IgGlK. Such
antibodies are
found to have affinity constants somewhere between 1x109 and 9x1012. The high
affinities of these
fully human monoclonal antibodies make them suitable candidates for
therapeutic applications in
RSV related diseases, pathologies or disorders.
Abbreviations
BSA - bovine serum albumin
COZ - carbon dioxide
DMSO - dimethyl sulfoxide
EIA - enzyme immunoassay
FBS - fetal bovine serum
2 0 H202 - hydrogen peroxide
HRP - horseradish peroxidase\
~ - interadermal
Ig - immunoglobulin
RSV - respiratory syncytial virus
2 5 IP - intraperitoneal
IV - intravenous
Mab - monoclonal antibody
OD - optical density
OPD - o-Phenylenediamine dihydrochloride
3 0 PEG - polyethylene glycol
PSA - penicillin, streptomycin, amphotericin
RT - room temperature
SQ - subcutaneous
v/v - volume per volume
3 5 w/v - weight per volume
Materials and Methods
Animals
Transgenic mice that can express human antibodies are known in the art (and
are
4 0 commecially available (e.g., from GenPharm International, San Jose, CA;
Abgenix, Freemont, CA,
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
69
and others) that express human immunoglobulins but not mouse IgM or Igx. For
example, such
transgenic mice contain human sequence transgenes that undergo V(D)J joining,
heavy-chain class
switching, and somatic mutation to generate a repertoire of human sequence
immunoglobulins
(Lonberg, et al., Nature 368:856-859 (1994)). The light chain transgene can be
derived, e.g., in part
from a yeast artificial chromosome clone that includes nearly half of the
germline human VK region.
In addition, the heavy-chain transgene can encode both human ~, and human
~yl(Fishwild, et al.,
Nature Biotechnology 14:845-851 (1996)) and/or ~y3 constant regions. Mice
derived from appropriate
genotopic lineages can be used in the immunization and fusion processes to
generate fully human
monoclonal antibodies to RSV.
Immunization
One or more immunization schedules using at least one RSV protein as an
immunogen as
generated according to know methods (e.g., as provided in Example 1) can be
used to generate the
RSV human hybridomas. The first several fusions can be performed after the
following exemplary
immunization protocol, but other similar known protocols can be used. Several
14-20 week old
female and/or surgically castrated transgenic male mice are immunized IP
and/or ID with 1-1000 ~.g
of recombinant human RSV protein emulsified with an equal volume of TITERMA~~
or complete
Freund's adjuvant in a final volume of 100-400~tL (e.g., 200). Each mouse can
also optionally receive
1-10 ~,g in 100 ~,L physiological saline at each of 2 SQ sites. The mice can
then be immunized 1-7,
5-12, 10-18, 17-25 andlor 21-34 days later IP (1-400 ~,g) and SQ (1-400 ~g x
2) with RSV
2 0 emulsified with an equal volume of TITERMAX or incomplete Freund's
adjuvant. Mice can be bled
12-25 and 25-40 days later by retro-orbital puncture without coagulant. The
blood is then allowed to
clot at RT for one hour and the serum is collected and titered using an RSV
EIA assay according to
known methods. Fusions are performed when repeated injections do not cause
titers to increase. At
that time, the mice can be given a final IV booster injection of 1-400 ~,g RSV
diluted in 100 ~,L
2 5 physiological saline. Three days later, the mice can be euthanized by
cervical dislocation and the
spleens removed aseptically and immersed in 10 mL of cold phosphate buffered
saline (PBS)
containing 100 U/mL penicillin, 100 ~,g/mL streptomycin, and 0.25 ~,g/mL
amphotericin B (PSA).
The splenocytes are harvested by sterilely perfusing the spleen with PSA-PBS.
The cells are washed
once in cold PSA-PBS, counted using Trypan blue dye exclusion and resuspended
in RPMI 1640
3 0 media containing 25 mM Hepes.
Cell Fusion
Fusion can be carried out at a 1:1 to 1:10 ratio of murine myeloma cells to
viable spleen cells
according to known methods, e.g., as known in the art. As a non-limiting
example, spleen cells and
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
myeloma cells can be pelleted together. The pellet can then be slowly
resuspended, over 30 seconds,
in 1 mL of 50% (w/v) PEG/PBS solution (PEG molecular weight 1,450, Sigma) at
37 °C. The fusion
can then be stopped by slowly adding 10.5 mL of RPMI 1640 medium containing 25
mM Hepes (37
°C) over 1 minute. The fused cells are centrifuged for 5 minutes at 500-
1500 rpm. The cells are then
resuspended in HAT medium (RPMI 1640 medium containing 25 mM Hepes, 10% Fetal
Clone I
serum (Hyclone), 1 mM sodium pyruvate, 4 mM L-glutamine, 10 ~,g/mL gentamicin,
2.5% Origen
culturing supplement (Fisher), 10% 653-conditioned RPMI 1640/Hepes media, 50
~,M
2-mercaptoethanol, 100 ~,M hypoxanthine, 0.4 p,M aminopterin, and 16 ~.M
thymidine) and then
plated at 200 ~.L/well in fifteen 96-well flat bottom tissue culture plates.
The plates are then placed
10 in a humidified 37 °C incubator containing 5% COZ and 95% air for 7-
10 days.
Detection of Human IgG RSV antibodies in Mouse Serum
Solid phase EIA's can be used to screen mouse sera for human IgG antibodies
specific for
human RSV protein. Briefly, plates can be coated with RSV protein at 2 ~,g/mL
in PBS overnight.
After washing in 0.15M saline containing 0.02% (v/v) Tween 20, the wells can
be blocked with 1%
15 (w/v) BSA in PBS, 200 ~.Llwell for 1 hour at RT. Plates are used
immediately or frozen at -20 °C for
future use. Mouse serum dilutions are incubated on the RSV coated plates at 50
~,L/well at RT for 1
hour. The plates are washed and then probed with 50 ~,L/well HRP-labeled goat
human IgG, Fe
specific diluted 1:30,000 in 1% BSA-PBS for 1 hour at RT. The plates can again
be washed and 100
~,L/well of the citrate-phosphate substrate solution (O.1M citric acid and
0.2M sodium phosphate,
2 0 0.01% HZOZ and 1 mg/mL OPD) is added for 15 minutes at RT. Stop solution
(4N sulfuric acid) is
then added at 25 ~,L/well and the OD's are read at 490 nm via an automated
plate spectrophotometer.
Detection of Completely Human Immunoglobulins in Hybridoma Supernates
Growth positive hybridomas secreting fully human immunoglobulins can be
detected using a
suitable EIA. Briefly, 96 well pop-out plates (VWR, 610744) can be coated with
10 ~g/mL goat
2 5 human IgG Fc in sodium carbonate buffer overnight at 4 °C. The
plates are washed and blocked with
1% BSA-PBS for one hour at 37°C and used immediately or frozen at -20
°C. Undiluted hybridoma
supernatants are incubated on the plates for one hour at 37°C. The
plates are washed and probed with
HRP labeled goat human kappa diluted 1:10,000 in 1% BSA-PBS for one hour at
37°C. The plates
are then incubated with substrate solution as described above.
3 0 Determination of Fully Human RSV Reactivity
Hybridomas, as above, can be simultaneously assayed for reactivity to RSV
using a suitable
RIA or other assay. For example, supernatants are incubated on goat human IgG
Fc plates as above,
washed and then probed with radiolabled RSV with appropriate counts per well
for 1 hour at RT.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
71
The wells are washed twice with PBS and bound radiolabled RSV is quantitated
using a suitable
counter.
Human IgGlK RSV secreting hybridomas can be expanded in cell culture and
serially
subcloned by limiting dilution. The resulting clonal populations can be
expanded and cryopreserved
in freezing medium (95% FBS, 5% DMSO) and stored in liquid nitrogen.
Isotyping
Isotype determination of the antibodies can be accomplished using an EIA in a
format similar
to that used to screen the mouse immune sera for specific titers. RSV protein
can be coated on 96-
well plates as described above and purified antibody at 2 ~,glmL can be
incubated on the plate for one
hour at RT. The plate is washed and probed with HRP labeled goat human IgGI or
HRP labeled goat
human IgG3 diluted at 1:4000 in 1% BSA-PBS for one hour at RT. The plate is
again washed and
incubated with substrate solution as described above.
Binding Kinetics of Human Human RSV antibodies With Human RSV
Binding characteristics for antibodies can be suitably assessed using an RSV
capture EIA and
BIAcore technology, for example. Graded concentrations of purified human RSV
antibodies can be
assessed for binding to EIA plates coated with 2 ~,g/mL of RSV in assays as
described above. The
OD's can be then presented as semi-log plots showing relative binding
efficiencies.
Quantitative binding constants can be obtained, e.g., as follows, or by any
other known
suitable method. A BIAcore CM-5 (carboxymethyl) chip is placed in a BIAcore
2000 unit. HBS
2 0 buffer (0.01 M HEPES, 0.15 M NaCI, 3 mM EDTA, 0.005% vlv P20 surfactant,
pH 7.4) is flowed
over a flow cell of the chip at 5 p,L/minute until a stable baseline is
obtained. A solution (100 ~L) of
15 mg of EDC (N-ethyl-N'-(3-dimethyl-aminopropyl)-carbodiimide hydrochloride)
in 200 ~,L water
is added to 100 ~.L of a solution of 2.3 mg of NHS (N-hydroxysuccinimide) in
200 ~,L water. Forty
(40) p,L of the resulting solution is injected onto the chip. Six p,L of a
solution of human RSV (15
2 5 ~.g/mL in 10 mM sodium acetate, pH 4.8) is injected onto the chip,
resulting in an increase of ca. 500
RU. The buffer is changed to TBS/Ca/MgBSA running buffer (20 mM Tris, 0.15 M
sodium
chloride, 2 mM calcium chloride, 2 mM magnesium acetate, 0.5% Triton X-100, 25
~.glmL BSA, pH
7.4) and flowed over the chip overnight to equilibrate it and to hydrolyze or
cap any unreacted
succinimide esters.
3 0 Antibodies are dissolved in the running buffer at 33.33, 16.67, 8.33, and
4.17 nM. The flow
rate is adjusted to 30 ~,L/min and the instrument temperature to 25 ~C. Two
flow cells are used for
the kinetic runs, one on which RSV protein had been immobilized (sample) and a
second,
underivatized flow cell (blank). 120 ~,L of each antibody concentration is
injected over the flow cells
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
72
at 30 ~L/min (association phase) followed by an uninterrupted 360 seconds of
buffer flow
(dissociation phase). The surface of the chip is regenerated (respiratory
syncytial virus /antibody
complex dissociated) by two sequential injections of 30 ~,L each of 2 M
guanidine thiocyanate.
Analysis of the data is done using BIA evaluation 3.0 or CLAMP 2.0, as known
in the art.
For each antibody concentration the blank sensogram is subtracted from the
sample sensogram. A
global fit is done for both dissociation (kd, sec 1) and association (ka, mol-
1 sec 1) and the dissociation
constant (KD, mol) calculated (kd/ka). Where the antibody affinity is high
enough that the RUs of
antibody captured are >100, additional dilutions of the antibody are run.
Results and Discussion
Generation of Human RSV Monoclonal antibodies
Several fusions are performed and each fusion is seeded in 15 plates (1440
wells/fusion) that
yield several dozen antibodies specific for human RSV protein. Of these, some
are found to consist of
a combination of human and mouse Ig chains. The remaining hybridomas secret
RSV antibodies
consisting solely of human heavy and light chains. Of the human hybridomas all
are expected to be
IgGlK.
Binding Kinetics of Human Human RSV antibodies
ELISA analysis confirms that purified antibody from most or all of these
hybridomas bind
RSV protein in a concentration-dependent manner. Figures 1-2 show the results
of the relative
binding efficiency of these antibodies. In this case, the avidity of the
antibody for its cognate antigen
2 0 (epitope) is measured. It should be noted that binding RSV directly to the
EIA plate can cause
denaturation of the protein and the apparent binding affinities cannot be
reflective of binding to
undenatured protein. Fifty percent binding is found over a range of
concentrations.
Quantitative binding constants are obtained using BIAcore analysis of the
human antibodies
and reveals that several of the human monoclonal antibodies are very high
affinity with KD in the
2 5 range of 1x10-$ to 7x10-la
Conclusions
Several fusions are performed utilizing splenocytes from hybrid mice
containing human
variable and constant region antibody transgenes that are immunized with human
RSV. A set of
several completely human RSV reactive IgG monoclonal antibodies of the IgGlK
isotype are
3 0 generated. The completely human RSV antibodies are further characterized.
Several of generated
antibodies have affinity constants between 1x108 and 9x1012. The unexpectedly
high affinities of
these fully human monoclonal antibodies make them suitable for therapeutic
applications in RSV-
dependent diseases, pathologies or related conditions.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
73
It will be clear that the invention can be practiced otherwise than as
particularly described in
the foregoing description and examples.
Numerous modifications and variations of the present invention are possible in
light of the
above teachings and, therefore, are within the scope of the appended claims.
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
SEQUENCE LIST:~NG
<110> Centocor InC.
SCallon, Bernard J.
<120> RSV PROTEINS, ANTIBODIES, COMPOSITIONS, METHODS AND USES
<130> CEN0203
<140> 60/336081
<141> 2001-11-02
<150> 60/336081
<151> 2001-11-02
<160> 24
<170> PatentIn version 3.1
<210> 1
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 1
Gly
Tyr
Thr
Met
His
1 5
<210> 2
<211> 17
<212> PRT
<213> Homo Sapiens
<400> 2
Ser Ile Thr Gly Gly Ser Asn Phe Ile Asn Tyr Ser Asp Ser Val Lys
1 5 10 15
Gly
<210> 3
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 3
Ala Pro Ile Ala Pro Pro Tyr Phe Asp His
1 5 10
<210> 4
1
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
<211>11
<212>PRT
<213>Homo Sapiens
<400>4
Arg Ala Thr Gln Ser Val Ser Asn Phe Leu Asn
1 5 10
<210> 5
<211> 7
<212> PRT
<213> Homo Sapiens
<400> 5
Asp Ala Ser Thr Ser Gln Ser
1 5
<210> 6
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 6
Gln Ala Ser Ile Asn Thr Pro Leu
1 5
<210> 7
<211> 120
<212> PRT
<213> Homo Sapiens
<400> 7
Glu Val Gln Leu Leu Glu Glu Ser Gly Gly Gly Leu Val Arg Leu Pro
1 5 10 15
Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Thr Thr Leu Ser Gly
20 25 30
Tyr Thr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
35 40 45
Val Ser Ser Ile Thr Gly Gly Ser Asn Phe Ile Asn Tyr Ser Asp Ser
50 55 60
Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu
65 70 75 80
2
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
Tyr Leu Gln Met Asn Ser Leu Thr Ala Glu Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Thr Ala Pro Ile Ala Pro Pro Tyr Phe Asp His Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210> 8
<211> 119
<212> PRT
<213> Homo Sapiens
<400> 8
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Arg Leu Pro Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Thr Thr Leu Ser Gly Tyr
20 25 30
Thr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ser Ile Thr Gly Gly Ser Asn Phe Ile Asn Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Thr Ala Glu Asp Thr Ala Val Tyr Tyr Cys
g5 90 95
Ala Thr Ala Pro Ile Ala Pro Pro Tyr Phe Asp His Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210> 9
<211> 106
<212> PRT
<213> Homo Sapiens
3
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
<400> 9
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Thr Gln Ser Val Ser Asn Phe
~0 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Glu Ala Pro Thr Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Thr Ser Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Met Asp Phe Ser Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Leu Ala Met Tyr Tyr Cys Gln Ala Ser Ile Asn Thr Pro Leu
85 90 95
Phe Gly Gly Gly Thr Arg Ile Asp Met Arg
100 105
<210> 10
<211> 106
<212> PRT
<213> Homo Sapiens
<400> 10
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Thr Gln Ser Val Ser Asn Phe
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Glu Ala Pro Thr Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Thr Ser Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Met Asp Phe Ser Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
4
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
Glu Asp Leu Ala Met Tyr Tyr Cys Gln Ala Ser Ile Asn Thr Pro Leu
85 90 95
Phe Gly Gly Gly Thr Arg Val Asp Ile Lys
100 105
<210> 11
<211> 106
<212> PRT
<213> Homo sapiens
<400> 11
Asp Ala Glu Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Thr Gln Ser Val Ser Asn Phe
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Glu Ala Pro Thr Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Thr Ser Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Met Asp Phe Ser Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Leu Ala Met Tyr Tyr Cys Gln Ala Ser Ile Asn Thr Pro Leu
85 90 95
Phe Gly Gly Gly Thr Arg Ile Asp Met Arg
100 105
<210> 12
<211> 105
<212> PRT
<213> Homo sapiens
<400> 12
Ala Glu Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp
1 5 10 15
Arg Val Thr Ile Thr Cys Arg Ala Thr Gln Ser Val Ser Asn Phe Leu
20 25 30
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
Asn Trp Tyr Gln Gln Lys Pro Gly Glu Ala Pro Thr Leu Leu Ile Tyr
35 40 45
Asp Ala Ser Thr Ser Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser
50 55 60
Gly Ser Gly Met Asp Phe Ser Leu Thr Ile Ser Ser Leu Gln Pro Glu
65 70 75 80
Asp Leu Ala Met Tyr Tyr Cys Gln Ala Ser Ile Asn Thr Pro Leu Phe
85 90 95
Gly Gly Gly Thr Arg Ile Asp Met Arg
100 105
<210> 13
<211> 15
<212> DNA
<213> Homo Sapiens
<400> 13
ggctatacca tgcac 15
<210> 14
<211> 51
<212> DNA
<213> Homo Sapiens
<400> 14
tccattactg gaggtagcaa cttcataaac tactcagact cagtgaaggg c 51
<210> 15
<211> 33
<212> DNA
<213> Homo Sapiens
<400> 15
accgccccta tagcaccgcc ctactttgac cac 33
<210> 16
<211> 33
<212> DNA
<213> Homo Sapiens
<400> 16
cgggcaactc agagtgttag taacttttta aat 33
6
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
<210> 17
<211> 21
<212> DNA
<213> Homo sapiens
<400> 17
gatgcatcca cttcgcaaag t 21
<210> 18
<211> 24
<212> DNA
<213> Homo Sapiens
<400> 18
caagcgagta tcaatacccc gctt 24
<210> 19
<211> 360
<212> DNA
<213> Homo Sapiens
<400> 19
gaggtgcagctgctcgaggagtctgggggaggcctggtcaggcctggcgggtccctaaga 60
ctctcgtgtgcagcctctggaaccaccctcagtggctataccatgcactgggtccgccag 120
gctccagggaaggggctggagtgggtctcatccattactggaggtagcaacttcataaac 180
tactcagactcagtgaagggccgattcaccatctccagagacaacgccaagaactcactt 240
tatctgcaaatgaacagcctgacagccgaggacacggctgtctattattgtgcgaccgcc 300
cctatagcaccgccctactttgaccactggggccagggtaccttagtcaccgtctcctca 360
<210> 20
<211> 357
<212> DNA
<213> Homo
Sapiens
<400> 20
gaggtgcagctgctcgagtctgggggaggcctggtcaggcctggcgggtccctaagactc 60
tcgtgtgcagcctctggaaccaccctcagtggctataccatgcactgggtccgccaggct 120
ccagggaaggggctggagtgggtctcatccattactggaggtagcaacttcataaactac 180
tcagactcagtgaagggccgattcaccatctccagagacaacgccaagaactcactttat 240
ctgcaaatgaacagcctgacagccgaggacacggctgtctattattgtgcgaccgcccct 300
atagcaccgccctactttgaccactggggccagggtaccttagtcaccgtctcctca 357
7
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
<210> 21
<211> 318
<212> DNA
<213> HomoSapiens
<400> 21
gatatccagatgacccagtctccatcctccctgtctgcatctgtaggagacagagtcacc 60
atcacttgccgggcaactcagagtgttagtaactttttaaattggtatcagcagaagcca 120
ggggaagcccctacgctcctgatctatgatgcatccacttcgcaaagtggggtcccatca 180
aggttcagtggcagtggatctgggatggatttcagtctcaccatcagcagtctgcagcct 240
gaagatcttgcaatgtattactgtcaagcgagtatcaataccccgcttttcggcggaggg 300
accagaatag atatgaga 318
<210>
22
<211>
318
<212>
DNA
<213>
Homo
Sapiens
<400>
22
gatatccagatgacccagtc tccatcctccctgtctgcatctgtaggagacagagtcacc 60
atcacttgccgggcaactca gagtgttagtaactttttaaattggtatcagcagaagcca 120
ggggaagcccctacgctcct gatctatgatgcatccacttcgcaaagtggggtcccatca 180
aggttcagtggcagtggatc tgggatggatttcagtctcaccatcagcagtctgcagcct 240
gaagatcttgcaatgtatta ctgtcaagcgagtatcaataccccgcttttcggcggaggg 300
accagagtggacatcaaa 318
<210> 23
<211> 318
<212> DNA
<213> Homo Sapiens
<400> 23
gatgccgagctgacccagtc tccatcctccctgtctgcatctgtaggagacagagtcacc 60
atcacttgccgggcaactca gagtgttagtaactttttaaattggtatcagcagaagcca 120
ggggaagcccctacgctcct gatctatgatgcatccacttcgcaaagtggggtcccatca 180
aggttcagtggcagtggatc tgggatggatttcagtctcaccatcagcagtctgcagcct 240
gaagatcttgcaatgtatta ctgtcaagcgagtatcaataccccgcttttcggcggaggg 300
accagaatagatatgaga 318
8
CA 02466025 2004-04-30
WO 03/063767 PCT/US02/34154
<210> 24
<211> 315
<212> DNA
<213> Homosapiens
<400> 24
gccgagctgacccagtctccatcctccctgtctgcatctg taggagacagagtcaccatc 60
acttgccgggcaactcagagtgttagtaactttttaaatt ggtatcagcagaagccaggg 120
gaagcccctacgctcctgatctatgatgcatccacttcgc aaagtggggtcccatcaagg 180
ttcagtggcagtggatctgggatggatttcagtctcacca tcagcagtctgcagcctgaa 240
gatcttgcaatgtattactgtcaagcgagtatcaataccc cgcttttcggcggagggacc 300
agaatagatatgaga 315
9
