Note: Descriptions are shown in the official language in which they were submitted.
s1 ~34~60 5_
SYNTHETIC ANTIGEN FOR THE DETECTION
OF AIDS RELATED DISEASE
~
With the discovery that the diseases called
lymphadenopathy syndrome and acquired immune deficiency
disease (AIDS) are caused by an infectious retrovirus
designated lymphadenopathy virus (LAV), human T-cell
lymphotropic virus-III (I-ITLV-III), AIDS-related virus
(ARV), or immune deficiency-associated virus (IDAV),
there has become an immediate need to be able to detect
potential vectors of the disease, such as blood from
diseased individuals, which may be employed for
transfusions or from which specific blood factors may
be isolated.
To detect potential vectors of the disease,
it is necessary to have viral proteins and/or
antibodies to such proteins. Because of the hazards
associated with growing the LAV/HTLV-III retrovirus,
there is significant interest in establishing means for
obtaining the viral proteins or their immunologic
equivalents, which means do not necessitate handling
large volumes of live, potentially infectious virus.
In choosing alternatives, one must be concerned with
the fact that the viruses have been reported to be
highly polymorphic, frequently changing as the
retrovirus is passaged.
The various antigens of the retrovirus are
described by Saxinger et al., Science (1985) .
227:1036-1038. See also Gallo et al., ibid. (1984)
224:500; Sarangadharn et al., ibid. 224:506; Barre-
Sinoussi et al., ibid. (1983) 220:868; Montagnier et
al., in Human T-Cell Leukemia/Lymphoma Virus, Gallo,
Essex, Gross, eds. (Cold Spring Harbor Laboratory, Cold
13 4 16 05
Spring Harbor, New York), 1984, p. 363. These may
include, but are not limited to, p13, p18, p25, p36,
gp43, p55, gp65, gp110, etc., where the numbers may
differ depending upon the reporter.
Hopp and Woods, Proc. Natl. Acad. Sci. USA
(1981) 78:3824, describe criteria for selecting
peptides as potential epitopes of polypeptides based on
their relative hydrophilicity. In one study employing
these criteria, a 12-amino acid peptide was synthesized
that bound 9% of antibodies elicited by the native
protein (Hopp, Molec. Inununol. (1981) 18:869). In
general, Hopp/Woods criteria have been shown not to
have a high predictive value. Furtherniore, epitopes
have been demonstrated which are not hydrophilic (Kazim
et al., Biochem. J. (1982) 203:201). Other studies of
polypeptide antigenicity include Green et al., Cell
(1982) 28:477, where peptides were employed which
elicited antibodies, which antibodies were capable of
binding to the native protein, while conversely
antibodies which were elicited by the native protein
failed to bind to the peptides; and Trainer et al.,
Nature (1984) 312:127, whose results with
myohaemerythrin paralleled those of Green et al.
The complete nucleotide sequence of LAV is
reported by Wain-Hobson et al., Cell (1985) 40:9. The
complete sequence for HTLV-III is reported by Muesing
et al., Nature (1985) 313:450, while the complete
sequence for ARV is reported by Sanchez-Pescador et
al., Science (1985) 227:484. All three viruses exhibit
substantial nucleotide homology and are similar with
respect to morphology, cytopathology, requirements for
optimum reverse transcriptase activity, and at least
some antigenic properties (Levy et al., Science (1984)
225:840; Shupbach et al., Science (1984) 224:503), and
hence should be considered isolates of the same virus.
See also, Chang et al., Science (1985) 228:93.
3 1341605
Accurding to the
invention peptide sequences capable of immunologically
mimicking proteins encoded in the 2,~2 and/or env
regions of the LAV/HTLV-III retrovirus are provided as
reagents for use in the screening of blood and blood
products for prior exposure to the retrovirus. The
peptides are of at least 5 amino acids and can be used
in various specific binding assays for the detection of
antibodies to LAV/HTLV-III virus, for the detection of
LAV/HTLV-III antigens, or as immunogens.
For the purpose of this disclosure, a virus
is considered to be the same as or equivalent to
LAV/HTLV-III if it substantially fulfills the following
criteria:
(a) The virus is tropic for T-lymphocytes,
especially T-helper cells (CD4+, according to the
international nomenclature defined in Bernard et al.,
eds. Leucocyte Typing, New York: Springer Verlag,
1984);
(b) The virus is cytopathic for infected
CD4+ cells (rather than transforming, as are HTLV-I and
-II) ;
(c) The virus encodes an RNA-dependent DNA
polymerase (reverse transcriptase) which is
Mg 2+_dependent (optimum concentration 5mM), has a pH
optimum of 7.8, is not inhibitable by actinomycin D,
and can employ oligo(dT)12_18 as a primer for reverse
transcription from its 3' LTR;
(d) The virus bands in a sucrose gradient at
a density of approximately 1.16;
(e) The virus can be labeled with
[3H)-uridine;
(f) The virus is substantially
cross-reactive immunologically with the proteins
encoded by the gaq and env regions of LAV/HTLV-III; and
1341605
4
(g) The virus shares substantial nucleotide
homology (approximately 75-100%) and amino acid
sequence homology (approximately 75-10.0%) with LAV or
HTLV-III.
Novel peptides are provided which immuno-
logically mimic proteins encoded by the LAV/HTLV-III
retrovirus, particularly proteins encoded by the aaq
and/or env regions of the viral genome. To accommodate
strain-to-strain variations among different isolates,
adjustments for conservative substitutions and
selection among the alternatives where non-conservative
substitutions are involveci, may be made. These
peptides can be used individually or together for
detection of the virus or of antibodies to the virus in
a physiological sample. Depending upon the nature of
the test protocol, the peptides may be labeled or
unlabeled, bound to'a solid surface, conjugated to a
carrier or other compounds, or the like.
The peptides of interest will be derived from
the peptides encoded by the caq region or the env
region. These peptides will be primarily derived from
p55 or fragments thereof, e.g., p25 and p18, or gp150
and fragments thereof, e.g., gp4l. These peptides will
be given Roman numerals, but will also be given
numerical designations which are arbitrarily associated
with the manner in which they were produced.
For the gag region, of particular interest
are the coding regions extending from about base pair
(bp) 450 to bp 731, particularly from about bp 450 to
bp 545 (97) and bp 696 to bp 731 (71); from about
bp 900 to bp 1421, particularly from about bp 921 to bp
1016, including bp 921 to bp 1010; bp 972 to bp 1016
(92); and bp 936 to bp 995 (17); or from about bp 1158
to about bp 1400, particularly bp 1164 to bp 1250 (90);
bp 1278 to bp 1385 (88); and bp 1320 to bp 1385 (15),
of the LAV/HTLV-III retrovirus. (Numbering according
to Wain-Hobson et al., supra.)
1341605
F'or the env region, the regions of particular
interest will be those polypeptides encoded within the
bp 7210 to bp 7815 regions, particularly within bp 7231
to bp 7794, more particularly within about bp 7246
5 through bp 7317 (36), bp 7516 through bp 7593 (39),
particularly bp 7543 through bp 7593 (79) and bp 7561
through 7593 (78), bp 7708 through bp 7779 (23), bp
7630 through bp 7689 (40), bp 7498 through bp 7554 (56).
The peptides of interest will include at
least five, sometimes six, sometimes eight, sometimes
12, usually fewer than about 50, more usually fewer
than about 35, and preferably fewer than about 25 amino
acids included within a sequence coded for by the
LAV/HTLV-III retrovirus. In each instance, desirably
the oligopeptide will be as small as possible, while
still maintaining substantially all of the sensitivity
of the larger peptide. In some instances it may be
desirable to join two or more oligopeptides which are
non-overlapping in the same peptide structure or as
individual peptides, which separately or together
provide equivalent sensitivity to the parent.
The peptides may be modified by introducing
conservative or non-conservative substitutions in the
peptides, usually fewer than 20 number percent, more
usually fewer than 10 number percent of the peptides
being exchanged. In those situations where regions are
found to be polymorphic, it may be desirable to vary
one or more particular amino acids to more effectively
mimic the differing epitopes of the different
retroviral strains. In many instances to provide
chemical and physical stability, methionine may be
replaced by norleucine (Nor).
It should be understood that the polypeptides
employed in the subject invention need not be identical
to any particular LAV/HTLV-III polypeptide sequence, so
long as the subject compounds are able to provide for
immunological competition with proteins of at least one
of the strains of the LAV/HTLV-III retrovirus.
1341fi0'S
6
Therefore, the subject polypeptides may be subject to
various changes, such as insertions, deletions, and
substitutions, either conservative or non-conservative,
where such changes might provide for certain advantages
in their use. By conservative substitutions is
intended combinations such as gly, ala; val, ile, leu;
asp, glu; asn, gln; ser, thr; lys, arg; and phe, tyr.
Usually, the sequence will not differ by more than
twenty percent from the sequence of at least one strain
of an LAV/HTLV-III retrovirus except where additional
amino acids may be added at either terminus for the
purpose of providing an "arm" by which the peptides of
this invention may be conveniently immobilized. The
arms will usually be at least 1 amino acid and may be
50 or more amino acids, more often 1 to 10 amino acids.
In addition, one or two amino acids may be
added to the termini of an oligopeptide or peptide to
provide for ease of linking of peptides one to another,
for coupling to a support or larger peptide, for
reasons to be discussed subsequently, for modifying the
physical or chemical properties of the peptide or
oligopeptide, or the like.
Amino acids such as tyrosine, cysteine,
lysine, glutamic or aspartic acid, or the like, may be
introduced at the C- or N-terminus of the peptide or
oligopeptide to provide for a useful functionality for
linking. Of particular interest is the presence of
from 1 to 3 cysteines at the C- or N-terminus for
linking to a support. The cysteine could be linked
through a disulfide linkage to a dithio- or thio-
functionalized support on a thioether linkage to an
activated olefin support.
In addition, the peptide or oligopeptide
sequences may differ from the natural sequence by the
sequence being modified by terminal-NH2 acylation,
e.g., acetylation, or thioglycolic acid amidation,
terminal-carboxy amidation, e.g., ammonia, methylamine,
etc. In some instances, these modifications may
13 4 1605
7
provide sites for linking to a support or other
molecule.
The peptides and oligopeptides of interest
will now be considered. The first peptides of interest
will be derived from the gal region, particularly the
protein referred to as p25 and p18.
The peptides for p25 are as follows:
The peptide I(15) encoded in the region
bp 1320 to bp 1385 will have the following amino acid
sequence, where oligopeptides included within the
following sequence will include linear epitopes within
such sequence:
(I) (15)
Y-Asp-Cys-Lys-Thr-Ile-Leu-Lys-Ala-Leu-
Gly-Pro-Ala-Ala-Thr-Leu-Glu-Glu-Met-Met-
Thr-Ala-Cys-X, where X is OH or NH2,
wherein the amino terminal Y, e.g., Tyr or Cys, if
present, is added to facilitate coupling of the peptide
to a protein carrier.
The next peptide II (17) will be encoded by
the region extending from about bp 936 to bp 995 and
will have the following sequence, where oligopeptides
included within the following sequence will include
linear epitopes within such sequence:
(II) (17)
Y-Leu-Lys-Glu-Thr-Ile-Asn-Glu-Glu-Ala-
Ala-Glu-Trp-Asp-Arg-Val-His-Pro-Val-His-
Ala-X, where X is OH or NH2,
wherein the amino terminal Y has been defined
previously.
Of particular interest is the oligopeptide
IIa:
8 13 4 1605
(IIa)
Y-Ala-Ala-Glu-Trp-Asp-Arg-Z-X,
wherein X and Y have been defined previously and Z is a
bond, an aniino acid which provides a means of linking,
e.g., cysteine, tyrosine, etc., or taken together with
X provides a functional group which may be used for
linking, e.g., an olefin as in allyl or maleimidyl,
dithio, etc.
The next peptide of interest, III (92), will
be encoded by the region extending from about bp 972 to
bp 1016 and will have the following sequence, where
oligopeptides included within the following sequence
will include linear epitopes within such sequence:
(III) (92)
Y-Asp-Arg-Val-His-Pro-Val-His-Ala-Gly-Pro-
Ile-Ala-Pro-Gly-Gln-X,
wherein X, Y and Z have been defined previously.
Preferably, this peptide will have no more
than about 15 amino acids encoded by the LAV/HTLV III
genome.
The next peptide, IV (90), will be encoded by
the region extending from about bp 1164 to bp 1250 and
will have the following sequence, where oligopeptides
included within the following sequence will include
linear epitopes within such sequence:
(IV) (90)
Y-Tyr-Ser-Pro-Thr-Ser-Ile-Leu-Asp-Ile-Arg-
Gln-Gly-Pro-Lys-Glu-Pro-Phe-Arg-Asp-Tyr-Val-
Asp-Arg-Phe-Tyr-Lys-Thr-Leu-Arg-Z-X,
wherein X, Y and Z have been defined previously.
Preferably, this peptide will have no more
than about 29 amino acids encoded by the LAV/HTLV III
genome.
13 4 1605
9
The peptide, V (88), will be encoded by the
region extending from about bp 1278 to bp 1385 and will
have the following sequence, where oligopeptides
included within the following sequence will include
linear epitopes within such sequence:
(V) (88)
Y-Asn-Trp-Nor-Thr-Glu-Thr-Leu-Leu-Val-Gln-
Asn-Ala-Asn-Pro-Asp-Cys-Lys-Thr-Ile-Leu-Lys-
Ala-Leu-Gly-Pro-Ala-Ala-Thr-Leu-Glu-Glu-Nor-
Nor-Thr-Ala-Cys-X,
wherein X and Y have been defined previously.
The next peptides of interest will be derived
from the _q!2,2 protein region referred to as p18.
The next peptide of interest, VI (97), will
be encoded by the region extending from about bp 450
through bp 545 and will have the following sequence,'
where oligopeptides included within the following
sequence will include linear epitopes within such
sequence:
(VI) (97)
Y-Arg-Glu-Leu-Glu-Arg-Phe-Ala-Val-Asn-Pro-Gly-
Leu-Leu-Glu-Thr-Ser-Glu-Gly-Cys-Arg-Gln-Ile-
Leu-Gly-Gln-Leu-Gln-Pro-Ser-Leu-Gln-Thr-X,
wherein X and Y have been defined previously.
The next peptide of interest VII (71) will be
encoded by the region extending from about bp 696 to
bp 731. This peptide will include any oligopeptides
coding for linear epitopes with the following amino
acid sequence:
(VII) (71)
Y-Asp-Thr-Gly-His-Ser-Ser-Gln-Val-Ser-Gln-
Asn-Tyr,
wherein Y has been defined previously.
13 4 1 605
The next polypeptides of interest will be
those derived from the env region, from gp110
(110kDa1).
The next peptide of interest, VIII, will be
5 encoded by the region extending from about bp 7246
through bp 7317 arid while coming within the general
limitations indicated previously, will preferably have
no more than 24 ami*no acids encoded by the LAV/HTLV III
genome.
10 The peptide of interest will generally have
the following amino acid sequence, where oligopeptides
included within the following sequence will include
linear epitopes within such sequence:
(VIII) (36)
Val-Lys-Ile-Glu-Pro-Leu-Gly-Val-Ala-Pro-
Thr-Lys-Ala-Lys-Arg-Arg-Val-Val-Gln-Arg-
Glu-Lys-Arg-Ala-Z-X, where X is OH or NH2,
wherein the carboxy terminal Z, e.g., Cys, if present,
is an amino acid added to facilitate coupling of the
peptide to a protein carrier.
Of particular interest is where 6,
conveniently up to 4, of the naturally occurring
C-terminal amino acids are deleted or substituted.
Oligopeptides contained within the above
sequence of particular interest include:
(VIIIa) (49)
Y-Arg-Val-Val-Gln-Ar.g-Glu-Lys-Arg-Z-X
(VIIIb) (50)
Y-Pro-Thr-Lys-Ala-Lys-Arg-Arg-Val-Val-
Gln-Arg-Glu-Lys-Arg-X.
The next peptides of interest will be derived
from the env region known as gp4l.
1341605
11
The next peptide, IX (56), will be encoded by
the region extending from about bp 7498 to bp 7554,
where oligopeptides included within the following
sequence will include linear epitopes within such
sequence:
(IX) (56)
Ile-Lys-Gln-Leu-Gln-Ala-Arg-Ile-Leu-
Ala-Val-Glu-Arg-Tyr-Leu-Lys-Asp-Gln-Gln-Z-X,
wherein X, Y and Z have been defined previously.
Uligopeptides contained within the above
sequence of particular interest include:
(IXa) (56/39)
Y-Arg-Ile-Leu-Ala-Val-Glu-Arg-Tyr-Leu-
Lys-Asp-Gln-Gln-Z-X
and
(IXb) (39/56)
Y-Ile-Lys-Gln-Leu-Gln-Ala-Arg-Ile-Leu-Z-X.
The next peptide of interest, X (39), will
be encoded by the region from about bp 7516 through
bp 7593 and has the following amino acid sequence,
where oligopeptides included within the following
sequence will include linear epitopes within such
sequence:
(X) (39)
Arg-Ile-Leu-Ala-Val-Glu-Arg-Tyr-Leu-Lys-
Asp-Gln-Gln-Leu-Leu-Gly-Ile-Trp-Gly-Cys-
Ser-Gly-Lys-Leu-Ile-Cys-X, where X is OH or NH2.
The next peptide, XI (40), will be encoded by
the region extending from about'bp 7630 to 7689 where
12 1341605
oligopeptides included within the following sequence
will include linear epitopes within such sequence:
(XI) (40)
Y-Lys-Ser-Leu-Glu-Gln-Ile-Trp-Asn-Asn-
Met-Thr-Trp-Met-Glu-Trp-Asp-Arg-Glu-
Ile-Asn-Z-X,
wherein Y, X and Z have been defined previously.
The next peptide of interest, XII (23), will
be encoded by the region extending from about bp 7708
through bp 7779. This peptide will include any
oligopeptides coding for linear epitopes within the
following amino acid sequence:
(XII) (23)
Y-His-Ser-Leu-Ile-Glu-Glu-Ser-Gln-Asn-
Gln-Gln-Glu-Lys-Asn-Glu-Gln-Glu-Leu-Leu-
Glu-Leu-Asp-Lys-Trp-Z-X,
wherein X, Y and Z have been defined previously.
The next peptide of interest, XIII (79), will
be encoded by the region extending from about bp 7543
through bp 7593. This peptide will include any
oligopeptides coding for linear epitopes within the
following amino acid sequence:
(XIII) (79)
Y-Lys-Asp-Gln-Gln-Leu-Leu-Gly-Ile-Trp-Gly-
Cys-Ser-Gly-Lys-Leu-Ile-Cys-X,
wherein X and Y have been previously defined.
The next peptide of interest, XIIIa (78),
will be encoded by the region extending from about
bp 7561 through bp 7593. This peptide will include any
oligopeptide coding for linear epitopes within the
following amino acid sequence:
13 1341645
(XIIIa) (78)
Gly-Ile-Trp-Gly-Cys-Ser-Gly-Lys-Leu-Ile-Cys.
Of particular interest is the use of the
mercaptan group of cysteines or thioglycolic acids used
for acylating terminal amino groups or the like for
linking two of the peptides or oligopeptides or
combinations thereof by a disulfide linkage or a longer
linkage. To achieve this, compounds may be employed
having bis-haloacetyl groups, nitroarylhalides, or the
like, where the reagents are specific for thio groups.
Thus, the linking between the two mercapto groups of
the different peptides or oligopeptides may be a single
bond or a linking group of at least two, usually at
least four, and not more than about 16, usually not
more than about 14 carbon atoms. Of particular
interest, is where a member of a sequence from the c.ca
region is linked to a member from the env region.
These chimeric peptides which may include non-amino
acid linkages, may be further modified as will be
described for the peptides and oligopeptides.
The subject peptides may be employed linked
to a soluble macromolecular (e.g., a5kDa1) carrier.
Conveniently, the carrier may be a poly(amino acid),
either naturally occurring or synthetic, to which
antibodies are unlikely to be encountered in human
serum. Illustrative polypeptides include
poly-L-lysine, bovine serum albumin, keyhole limpet
hemocyanin, bovine gamma globulin, etc. The choice is
primarily one of convenience and availability.
With such conjugates, there will be at least
one molecule of at least one subject peptide per
macromolecule and not more than about 1 per 0.5kDa1,
usually not more than about 1 per 2kDal of the
macromolecule. One or more different peptides may be
linked to the same macroniolecule.
The manner of linking is conventional,
employing such reagents as P-maleimidobenzoic acid,
13 4 1605
14
p-methyldithiobenzoic acid, maleic acid anhydride,
succinic acid anhydride, glutaraldehyde, etc. The
linkage may occur at the N-terminus, C-terminus or at a
site intermediate the ends of the molecule. The
subject peptide may be derivatized for linking, may be
linked while bound to a support, or the like.
The compounds may be employed as labeled or
unlabeled compounds depending upon their use. (By
label is intended a molecule which provides, directly
or indirectly, a detectable signal.) Various labels
may be employed, such as radionuclides, enzymes,
fluorescers, chemiluminescers, enzyme substrates,
cofactors or inhibitors, particles, e.g., magnetic
particles, combinations of ligands and receptors, e.g.,
biotin and avidin, or the like. In addition, the
peptides may be modified in a variety of ways for
binding to a surface, e.g., microtiter plate, glass
beads, chromatographic surface, e.g., paper, cellulose,
silica gel, or the like. The particular manner in
which the polypeptides are joined to another compound
or surface is conventional and finds ample illustration
in the literature. See, for example, U.S. Patent Nos.
4,371,515; 4,487,715; and patents cited therein.
Various assay protocols may be employed for
detecting the presence of either antibodies to
retroviral proteins or retroviral proteins themselves.
Of particular interest is using the peptide as the
labeled reagent, where the label allows for a
detectable signal, or binding the peptide, either
directly or indirectly to a surface, where antibody to
the peptide in the sample will become bound to the
peptide on the surface. The presence of human antibody
bound to the peptide can then be detected by employing
a xenogeneic antibody specific for human immuno-
globulin, normally both human IgM and IgG, or a labeled
protein specific for immune complexes, e.g., Rf factor
or S. aureus protein A.
13 4 1605
Various heterogeneous protocols may be
employed, either competitive or non-competitive.
Peptide may be bound to a surface or support
("support") and labeled antibody allowed to compete
5 with antibody in the sample for the limited amount of
bound peptide. The amount of label bound to the
support would be related to the amount of competitive
antibody in the sample.
Antibody could be bound to the support and
10 the sample combined with labeled peptide. After
contact of the reaction mixture with the bound
antibody, the amount of label bound to the support
would relate to the amount of cognate antibody in the
sample.
15 Xenogeneic anti-human antibody, e.g.,
antibodies to the Fc of IgG and IgM (immunoglobulins),
could be bound to a support. The sample would be
contacted with the immunoglobulins and labeled peptide,
whereby the amount of labeled peptide bound to the
support would be indicative of the presence of the
cognate antibodies.
Alternatively, homogeneous assays can be
employed where the peptide is bound to an enzyme,
fluorescer, or other label, where the binding of
antibody to the peptide results in being able to
discriminate between the label involved with a specific
binding pair complex and label which is not involved in
the complex. For assays involving such techniques, see
for example U.S. Patent Nos. 3,817,837; 3,850,752;
3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074;
and 4,098,876.
As an illustration of the subject invention
the subject peptides may be conjugated to a fluorescent
molecule, such as fluorescein, rhodamine or
umbelliferone. Various techniques may be used for
detecting complex formation with antibodies, e.g.,
fluorescence polarization. In this assay the
1344605
16
fluorescence polarization is different between
complexed and uncomplexed peptide conjugate.
Apparatuses areavailable for measuring changes in
fluorescence olarization e. TM
p , g., TDx supplied by Abbott
Laboratories, Chicago, IL.
Illustrative of an assay technique is the use
of sample containers, e.g., microtiter plate wells,
where the subject polypeptides or conjugates thereof
are adhered to the container bottom and/or walls either
covalently or non-covalently. The sample, normally
human blood or serum diluted in an appropriately
buffered medium, is added to the container and a
sufficient tinie allowed for complex formation between
the polypeptide(s) and any cognate antibodies in the
sample. The supernatant is removed and the container
washed to remove non-specifically bound proteins.
A labeled specific binding protein which
specifically binds to the complex is employed for
detection. To the container may be added xenogeneic
antisera to human immunoglobulin, particularly
anti-(human IgM and IgG) in an appropriately buffered
medium. The xenogeneic antisera will normally be
labeled with a detectable label, e.g., radionuclide or
enzyme. Instead of antisera, proteins specific for the
immune complex may be employed, e.g., S. aureus protein
A. The label may then be detected. For example, with
an enzyme, after removal of non-specifically bound
enzyme label, a developer solution is added. The
developer solution will contain an enzyme substrate and
possibly enzyme cofactors, chromogens, etc., which,
upon reaction, provide a colored or fluorescent product
which may be detected colorimetrically or
fluorimetrically, respectively.
The peptides can be prepared in a wide
variety of ways. The peptides, because of their
relatively short size, may be synthesized in solution
or on a solid support in accordance with conventional
techniques. Various automatic synthesizers are
1341605
17
commercially available today and can be used in
accordance with known protocols. See, for example,
Stewart and Young, Solid Phase Peptide Synthesis, 2nd
ed., Pierce Chemical Co., 1984; and Tam et al., J. Am.
Chem. Soc. (1983) 105:6442.
Alternatively, hybrid DNA technology may be
employed where a synthetic gene may be prepared by
employing single strands which code for the polypeptide
or substantially complementary strands thereof, where
the single strands overlap and can be brought together
in an annealing medium so as to hybridize. The
hybridized strands may then be ligated to form the
complete gene and by choice of appropriate termini, the
gene may be inserted into expression vectors, which are
readily available today. See, for example, Maniatis et
al., Molecular Cloning, A Laboratory Manual, CSH, Cold
Spring Harbor Laboratory, 1982. Or, the region of the
viral genome coding for the peptide may be cloned by
conventional recombinant DNA techniques and expressed
(see Maniatis, supra).
DNA coding sequences which may be used for
expressing peptides I - XIII are:
I (15) (TAT)GATTGTAAGACTATTTTAAAAGCATTGGGACCAG
CAGCTACACTAGAAGAAATGATGACAGCATGT
II (17) (TGT)TTAAAAGAGACCATCAATGAGGAAGCTGCAGAAT
GGGATAGAGTGCATCCAGTGCATGCA
III (92) GATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCA
GGCCAG
IV (90) TATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCA
AAAGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAA
ACTCTAAGA
1341605
18
V (88) AATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAAC
CCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCA
GCTACACTAGAAGAAATGATGACAGCATGT
VI (97) AGGGAGCTAGAACGATTCGCTGTTAATCCTGGCCTGTTA
GAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTA
CAACCATCCCTTCAGACA
VII (71) GACACAGGACACAGCAGCCAGGTCAGCCAAAATTAC
VIII (36) GTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCA
AAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCA(TGT)
IX (56) ATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGA
TACCTAAAGGATCAACAG(TGT)
X (39) AGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAG
CTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGC
XI (40) (TGT)AAATCTCTGGAACAGATTTGGAATAACATGACCT
GGATGGAGTGGGACAGAGAAATTAAC(TGT)
XII (23) (TGT)CATTCCTTAATTGAAGAATCGCAAAACCAGCAAG
AAAAGAATGAACAAGAATTATTGGAATTAGATAAATGG
(GGA)
XIII (79) AAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGA
AAACTCATTTGC
Fragments from these sequences may be
employed for expression of peptide fragments,
conservative base changes can be made, where the
modified codon(s) code for the same amino acid(s), or
non-conservative changes in the coding sequence may be
made, where the resulting amino acid may be a
conservative or non-conservative change.
The coding sequence may be extended at either
the 5'- or 3'-terminus or both termini to extend the
13 41 605
19
peptide, while retaining its epitopic site. The
extension may provide for an arm for linking, e.g., to
a label, such as an enzyme, for joining two or all of
the peptides together in the same chain, for providing
antigenic activity, or the like.
For expression, the coding sequence will be
provided with start and stop codons, promoter and
terminator regions and usually a replication system to
provide an expression vector for expression in a
cellular host, e.g., prokaryotic or eukaryotic,
bacterial, yeast, mammal, etc.
The sequences by themselves, fragments
thereof, or larger sequences, usually at least 15
bases, preferably at least 18 bases, may be used as
probes for detectioii of retroviral RNA or proviral DNA.
Numerous techniques are described, such as the
Grunstein-Hogness technique, Southern technique,
Northern technique, dot-blot, improvements thereon, as
well as other methodology. See, for example,
WO 83/02277 and Berent et al., Biotechniques (1985)
3:208.
Conveniently, the polypeptides may be
prepared as fused proteins, where the polypeptide may
be the N- or C-terminus of the fused polypeptide. The
resulting fused protein could be used directly by
itself as the reagent or the subject polypeptide may be
cleaved from all or a portion of the remaining sequence
of the fused protein. With a polypeptide where there
are no internal methionines, by introducing a
methionine at the fusion site, the polypeptide may be
cleaved employing cyanogen bromide. Where there is an
internal methionine, it would be necessary to provide
for a proteolytic cleavage site, e.g., poly-lysine
and/or -arginine or combinations thereof, or the
internal methionine could be substituted with an amino
acid such as leucine and an N-terminal methionine added
for cyanogen bromide cleavage. A wide variety of
proteases, including dipeptidases, are well known and
;3 41 605
the appropriate processing signal could be introduced
at the proper site. The processing signal may have
tandem repeats so as to insure cleavage, since the
presence of one or more extraneous amino acids will not
5 interfere with the utility of the subject polypeptides.
Depending upon the nature of the assay, the
physiological sample, e.g., saliva, blood, plasma, or
serum, may be pretreated by dilution into an assay
medium, which will usually be an aqueous buffered
10 medium employing one of a variety of buffers, such as
phosphate, tris, or the like. A preferred diluent is
blotto (5% w/v nonfat dry milk, .01% thimerosal, .01%
Antifoam A in .01 M sodium phosphate, pH 7.2, and .15 M
NaCl). Usually the pH will be in the range of about 6
15 to 9. The sample will then be combined with the
reagent in accordance with the appropriate protocol and
sufficient time allowed for binding. Where a
heterogeneous system is used, usually the stages will
be followed by washes, to minimize non-specific
20 binding. At the end of the procedure, the label will
be detected in accordance with conventional ways.
Besides the use of the subject peptides and
their analogs in assays, the subject peptides may also
find use by themselves or in combination in vaccines.
The peptides may be formulated in a convenient manner,
generally at concentrations in the range of lug to
20mg/kg of host. Physiologically acceptable media may
be used as carriers, such as sterile water, saline,
phosphate buffered saline, and the like. Adjuvants may
be employed, such as aluminum hydroxide gel, or the
like. Administration may be by injection, e.g.,
intramuscularly, peritoneally, subcutaneously,
intravenously, etc. Administration may be one or a
plurality of times, usually at one to four week
intervals.
The following examples are offered by way of
illustration and not by way of limitation.
13 41605
21
EXPERIMENTAL
Peptides 15, 71, 88, 90, 92 and 97 were
assembled on a t-butyloxycarbonyl (BOC)-methylbenzyl-
cysteine-phenyl-acetamidomethyl (PAM) polystyrene/di-
vinylbenzene resin (Applied Biosystems, Inc., Foster
City, CA). For carboxamide peptides 78 and 79
p-methylbenzhydrylamine polystyrene/divinylbenzene was
used. Symmetrical anhydride couplings were carried out
in an Applied Biosystems 430A synthesizer, except that
glutamine and asparagine were coupled as hydroxybenzo-
triazole esters. Benzyl based side chain protection
and BOC alpha-amine protection were used. Tryptophan
was protected by the formyl moiety, methionine was
protected by its sulfoxide, and dinitrophenol was used
for protecting histidine. Protecting groups were
removed by conventional procedures.
Peptide 36 was assembled on a benzhydrylamine
polystyrene/divinylbenzene resin in a Beckman 990
peptide synthesizer (Beckman Instruments, La Brea, CA).
Benzyl based side chain protection and BOC alpha-amine
protection were used. All the residues were added by
the direct dicyclohexylcarbodiimide method, except for
glutamine which was coupled as the hydroxybenzotriazole
ester.
Peptide 39 was synthesized on a benzhydryl-
amine resin as described for peptide 36 with asparagine
also being coupled as the ester.
When the peptides were radiolabeled, it was
by acetylating the amino terminus with 3H-acetic acid
and an excess of dicyclohexylcarbodiimide.
The peptides were deprotected and cleaved
from the resin by the Tam "low-high" HF protocol (Tam
et al., supra). Peptides 36, 39, 79, 78, 88, 90, 92
and 97 were extracted from the resin in 5% acetic acid
and subjected to gel filtration chromatography in 5%
acetic acid. Peptides 15 and 71 were extracted in 0.5M
ammonium carbonate/0.OO1M dithiothreitol (DTT) and
13 41 605
22
chromatographed in 0.05M ammonium carbonate/0.005M
B-mercaptoethanol. Fractions containing the peptide
were pooled and lyophilized. The integrity of the
synthetic products was assured by ninhydrin monitoring
after each coupling and by analytical reverse phase
chromatography and amino acid analysis.
Peptides 90, 92 and 97 were polymerized by
oxidation of their sulfhydryls to intermolecular
disulfides. Briefly, the lyophilized reduced peptide
was dissolved in minimal 6M guanidine HC1/0.1M sodium
phosphate, pH 9.0, and allowed to oxidize overnight at
room temperature.
Peptides 15, 23, 36, 40, 49, 50 and 56
synthesized above were conjugated to bovine serum
albumin (BSA) which had been derivatized with
N-succinimidyl-4-(N-maleimidomethyl)-cyclohexane-
1-carboxylate (SMCC), essentially as described by
Ishikawa et al., J. of Immunoassay (1983) 4:209.
To 2m1 of a BSA solution (20mg/ml in 0.1M
potassium phosphate, pH 7.0) at 30 C was added 1.5m1 of
an SMCC solution (8mg/ml in dimethylformamide). The
mixture was stirred magnetically for lhr, after which
it was centrifuged to remove any precipitated albumin.
The clarified mixture was then subjected to gel filtra-
tion on SephadexxG-25 equilibrated in O.1M potassium
phosphate, pH 6Ø The protein-containing fractions,
as determined by their absorbance at 280nm, were pooled
and stored frozen at -70 C until needed.
The peptides synthesized above were dissolved
in 0.1M sodium phosphate, pH 8.0 to a concentration of
5mg/ml (peptide 36), 8mg/ml (peptide 15) or 1.6mg/ml
(peptide 39). To 1.5m1 of each solution was added 2mg
of solid DTT. The solutions were stirred for 30min at
30 C, after which they were subjected to gel filtration
chromatography on Sephadex G-10, equilibrated in 0.1M
potassium phosphate, pH 6Ø The tritium-containing
fractions, as determined by scintillography of
aliquots, were pooled and mixed with lml (0.5m1 for
* Trade Mark
1341605
23
peptide V) of SMCC-derivatized BSA. The resultant
mixtures were stirred at 30 C for 12hr and then
dialyzed exhaustively against water.
The other peptides were prepared in
accordance with the procedures described above and
conjugated to BSA in accordance with the above
described procedures. The ratio of peptide to BSA was
determined by employing radiotracers in accordance with
conventional ways.
mols peptide
mol BSA
I (15) 14
II (17) 5
VIII (36) 9
IX (56) 17
X (39) 6
XI (40) 18
XII (23) 30 *
* may be erroneous and could be as high as 55.
Analysis by ELISA
The lyophilized peptide or protein/peptide
conjugate was dissolved in 6M guanidine HC1. The
guanidine solutions were diluted in 0.05M
carbonate/bicarbonate buffer (pH 9.6) to a final
peptide concentration of 8 to 40ug/ml just prior to
plating in the 96-well plates. Fifty ul of peptide
solution were aliquoted per microtiter well and
incubated at 4 C overnight. Plates were then blocked
with BLOTTO (5% [w/v] nonfat dry milk/0.01$
thimerosal/0.01% antifoam A in 0.O1M sodium phosphate,
pH 7.2/0.15M sodium chloride) for one hour at 37 C.
Sera were diluted 1:100 with a 1:1 mixture of BLOTTO
and PBS (0.O1M sodium phosphate, pH 7.3/0.15M NaCl),
and 50u1 of diluted sera was added to each well and
incubated for one hour at 37 C. The sera were removed
13 4 1605
24
and the plates were washed three times in wash buffer
(0.15M NaCl/0.05% (w/v) Tween 20) before adding 100u1
of the goat anti-human IgG/horseradish peroxidase
conjugate (50% stock diluted 1:10,000 in 50mM sodium
citrate/0.05$ Tween 20/1% heat-inactivated normal goat
serum; obtained from Antibodies, Inc., Davis, CA) for
one hour at 37 C. The conjugate was removed and the
plates washed three times with 0.15M NaCl/0.05$ (w/v)
Tween 20* The ELISA was developed by adding 100u1 per
well of substrate solution (10mg
3,3',5,5'-tetramethylbenzidine in 50m1 0.05M sodium
citrate, pH 7.0) for 30min at room temperature.
Reactions were stopped with 100u1 per well of 3N H2SO4-
and the optical density at 450nm determined by an
automated ELISA reader.
Summary of Table 1
Table 1 gives ELISA results for all petpides
that are immunoreactive.
Peptides 49 and 50 are part of peptide 36.
Peptide 56 partially overlaps peptide 39.
Peptide 49-BSA reactive with 10/10 positve
sera; not reactive with 2/2 negative sera.
Peptide 50-BSA reactive with 10/10 positive
sera; not reactive with 2/2 negative sera.
Peptide 56-BSA reactive with 10/10 positive
sera; not reactive wtih 2/2 negative sera.
Peptide 40-BSA reactive with 10/10 positive
sera; not reactive with 2/2 negative sera.
Peptide 23-BSA reactive with 10/10 positive
sera; not reactive with 2/2 negative sera.
Peptide 15-BSA reactive with 10/10 positive
sera; not reactive with 2/2 negative sera.
Peptide 36-BSA reactive with 9/10 positive
sera; not reactive with 2/2 negative-sera.
In a larger panel, peptide 56 which partially
overlaps peptide 39, is not reactive with all sera that
are reactive with peptide 39. This suggests that there
* Trade Mark
1341605
are at least two reactive epitopes within peptide 39 or
that peptides 39 and 56 contain non overlapping
reactive epitopes.
Peptide 23 (both conjugated to BSA and
5 unconjugated) was further tested against a larger panel
of sera (23 positives, 8 negatives) and displays a
sensitivity of 80-90%.
Summary of Table 2
10 Table 2 shows that two of the peptides
derived from the cag region (#15 and #17) are reactive
with LAV seropositive sera that are poorly reactive or
unreactive with peptide 39. This supports the use of a
combination of _qa2 and env peptides to produce a more
15 sensitive assay.
Summary of Table 3
Table 3 compares results obtained with
peptides 15-BSA and 39 with results obtained with these
20 peptides physically mixed (15-BSA + 39) or chemically
combined (thiol-oxidized 15 + 39).
The result obtained when positive samples are
assayed with either the physical or chemical
combination of peptides 15 and 39 is generally higher
25 than that obtained with either peptide alone. This is
clearly demonstrated with samples 126, 131, 135, 138
and 1296.
Summary of Table 4
Table 4 compares results obtained with
peptides 71, 78, 79, 88, 90, 92 and 97 in an ELISA
assay. All of the peptides except one provide better
than 70% correlation for positives and two peptides had
100% correlation.
13 41605
~
N r 1~ t0 = 01 J CO N Q1 ~ ~
N O O zt Vl N l!1 %O tP1M N
'~-. =.. p~ U1 V1 1~ O O O
d = = ~ Z r
G. O N O O r O ~ O O O O
1 a ~ ~O P N O h r vl P Pf %D
N ~O r p~ O ~O f~ O~ O Yf O N N
m ^ N O N ^ .+ O O O
I O ~O h Qf O ~O e'- W Yf N V Yf
< ~O =? h N N vl h N ~D N
N . = = . . ~
CO O r O ~ r r O O r ~ O O O
1 1~ v Q N h 1~ N f~ N 1~ V Lfl
y ~D O ~O ~O ~O Pf N
m ^ ='= O O r N ^ N N ~ O O
P rf ^ ~O a0 Ot ~f %O vf N u1 EO
~O n t'f O r r= N a n
o In o a ~o .o eo M ~ O o
Q ^ ^ o o r r r r r o
za _
~ O 1 1~ O n {O O%
N N N N O ^ ~
W E'~ N ~O N f7 N Hf
61 ^ N C. O O O O O r N O O
,'+ F--1 1 Lff fp9 < O~ N ~ O ^ ~ /=Caf OI N N
a OA N O~ PI N v N 1~ O O
O ^ O O O O r O r r O d
~ .7 F=1
(V 7H.r 1 P. ~O Yf tO 1, N O ~ N
1-4 Q~ N ~O ~t ~n N N ~
> n In wl o
W W m ^ ^ o 0 0 0 0 0 ^ r o 0
p~ u- o~ ao u- .. a P. %o o% v m a
O N Lf! /'f Ff Yi
A ~
1 N ~ < f9 r ^ r r
m O r O O O O O O N N O O j
Qi E"1 ~=
U ul~v .+
N
H H p r
H W p v o
N H1 V- Y- H VI N YI N M p v L
TL 61 Oi 07 N 61 N di 6) 61 01 = O 01
?. ~ -N 2*t v+
A E-~ 0
H v
Ha
0
44 OI a
Ot N O O O O OI O
cp = N
W > O CO O uf N v) O
r'1 N N O O ~ O
O f/~ < Y .= r r r = = ~ .
(!~ Nr r r N ^ N r C O
o d ~ ~
cn d W
t1 Cry r r
~7C H - L r L r L r L r L r L r L r L r_ L r L r O b
Q= ~õ~ O i6 Of0 0 0 4 O q O 4 O A O16 O A O q X X
~ W \ 7 \ 7 \~ \ 7 \ 7 \ O \ 7 \ 7
X p \ 7 \ O Y C-
p X p X p X p X p X p x p X p X X ~ N N. vl
A Np 4 QVI i0 VQI N QVI W Yf t! Vf A N N N C N A{11 ~ V L ~ O
bN A~
U ~ < O < O < O < O < ~ < I < < 01 Y 0! 3!
J L J t J t J t J L J L J t J C J L J t S L = t
.-~
O
--~ ~ N V O f7 r a N
~ ~ ~ ^ ^ r r .~ ... ^ 1 O O O N
E 1 ~p > ci N ~p
1341605
r ~ N Y1 N V' L1
r p ~+1 N O O
O N O O O O O
N V O~ ~D N O~ %D
1 ~O O R N O
J O N O O r O O
Q'.
',zõ~ H 1 \O Or ~O N P N N
tn O O O O O O O
rn w
M H
t~ A
H~ Hz o
W 6 ~ w N m a w o v
;X4
H ~ o
~ O u
H
v~ H
W U
A W '"
H H ~~
W p r o ~ r O O N
O r O = O N ~
Q1 N
O r r ~ N O O
0 a A
0
`vx vx \x a~~N !" ~
O U] ~ CY CY C W i0 LO
0 Nmp Atpn i0appp ~Y ~~
C ocAL J.G JL Sr St
UO W 5 r Ot V ^ ^ O~
~, p01 O N gfl ~ N
y N y~ r ~ ~O ~O
oa
1341605
o" z
M p o
H Q~
A F N
U v
F x
~ WA 0 ~ e~v, v o~ ~ ~
M ao v o ~ v v ~
r = . ^
Cn W 0 r N ~ O r r r C N O C G p p
Wx F
A F
F C~i N o~ ~o v ~ ~ ~ t ' ~ N
N O~ ~ p
W W N A w r r C C C C A C. C O O C.
a m
:21
Fcn
1-4 Cn N
04 N
.'3' Q~i 0 ~O Mf ~q PI r'f ~ ~.Nj ~ 0 < V N
O O
O ^ O r ^ ^ O O O O o
a ~n
H
00 W ^
N A 7r~ 1 . ~ N ~ ~ ~ N ~ 10 ~O O ~ ~ ED
> 42 C2, 0 O O O C. p ^ = . , ,
O O O
O O
1-4
z
H N
I ~
A
O~ W L> LO > o> L>
M Z 9 Or Or dr
~q N N N N y" Nr ~=r N~
~ ~ m d m m d ai oo 00 00 00
c~ O c ca ca cn CO.
U 0
u)
cn a
A H ¾ a
H~a ~^ o 0 o N o _
W x O 14 O m ~ ~
~ N f7 M O ~ ra'1 O O N
a U F r ^ r . O , _ N o
0 " r ly '=, r .
O O W N N O O= O O
H
a ~ r r r r
cn t=a W L r L r L r L r L r L r L r L q b q ~0
H Q~ H O q O~0 010 0 0 O O O q L r
p4 C=~ E..~= \7 \3 \7 \~ \Z \, 0 7 0 ~ G 0 01
x
x X01 X Y
O1
~X oX V% laX OX 9X
C Y C O C Y C O C Y C 01 C 01 ~ ~ H ~ N ~ N ~ u-
~0 N r0 M A N ~0 N A N i0 N
QQpQ ~O H i0 N 0 9 a.~ 0 ar L a+ L ~r L
C) G4 E E E E QE Eo N oE C O =r 01 r 01 r N r 01
f0 ar
< < O NO ~ O N V ~ O < < a ~ ~0 a,+ ~0 s+ 10 a~
V a 0 J t J t J Z J l J Z J t J~ J= SC m S t S L S L S t
N
(z~ ~ ^ ^ ^ ~ ~ ^ uNf P. ~ o~i ~ P. n a
= AD ^ kO %D %o ~D
H
1341605
V
m
N
v _
~ 1~ !V ~O P- N
X N O ~ O% P1 Y7 S~ 'O 16 .6 N 01
O = =
1 ~ N C N C C ~ C C C C ~ ~
r
O
t`
O O O O
v v v v v v
N N N N N N N N
A A C A A C C A G C C C A A
M
O N do %O in r !V N N N b ~
rf e'1 N ~ O Yf Uf Yf O O N
O ~- ~- O -
O ~
1'9 O N N O e1 N ~ r
G1 1 -
N ~ ~ o 0 o e o 0 0 0 0 0 0 0
N
q
0
N N N N N N N M N N tl1 N N N
GGG Yf Y1 ~1 ~1 !~ ~ ~s ~ !~ ~ ~ ~1 >1
C
O
u
N
L~
O, O O f'1 Pf Qt N Nf 1D p .- N O h
> O O V' 10 O 4) 1-~ PI '? RI O N N
r O N ~ N N N O
m O Q~ N N
N. .
- O
.
r L r L r L r L r L r L r L r L r L r L r
0 O r L.
~ d \ O q O q O~0 o A O q O q O q O N O A O~tl O~0
>r >r CX Vx 9X ~7~t ~x 9x ax oX ~X ~X ~x Vx
=rl 0 +-o qm cm em cm cm cm cJI cm Cm Cm Cm Cm
+~ L N L. YI i0 N i0 N i0 N q N q N /6 N ~b N O N N N '0 N A N
rNC ~~ A pE pE QE QE QE QE QE pE QE
O O Q O O < 8 < 6 < O < O < < < < O <~ < O < d <
C) d Y d Y J t J L J t J t J t J t J L J L J t J t -J L J t
M V O N ~ YI 1p P {b Ct O N
L O 1 O N N N N N N N N N Pf NI NI
W N vf ~= V r .. ~ .-. ~ ~ .- .- ~ r- ~
aa
13 41 605
N
x 9
O C O O O
O
0 C= 0 0
H 04
^ a M Ln Y1
0 0 0 0
0 0 0 0
an - ~ O
O ~ o
0 C. 0
n
a
'r` C C C
%. C
C
O
V
~
T N
! O%
~ 40 C C C
O
r ~ r
.d r O '0 '0
i0 7 7 7
x x x
rO LO LO
~ N L M L a+ L y L
~ '- CI r O r ~i r d1
Q Y d1 {b/ m d Y m Y
U xt xt St rL
N p ly
%O O1 O1 O1
W Y `p ao cc ao
cC
H
1341605
1 1 O CO N=-+ m 00 m %~o L+'1 %O 01, u'1 N M 7=--~ %D L/1 %O ~,o O M u'1 N O M
a0 1 N M rn a0 N rr .4 .7 O~Y M O Q~ M .-~ O--+ 00 r- Lr1 J611 ao N t- r- I O
00
t~ 1 u'1~70N.i.-~ Z NN.--~O. NOZO0000~00 I N r=+
I . . . . . . . . . . . . . . . . . . . . 1 . \
I O %D I
1
(~!] j ~A p~p ~p -.:r %D ,--4 M -,Y N%O ~t ID tV (- O 00 N --,T ~7 N M O %O N
M I
V) O~ I -.7 O 00 ~,O -zr ~ CG cO1 00 ID -:T 00 00 =-+ m Ln "O I-O N 1- N. u'1 -
T N~O 00 I O 00
C', f~ 1 C1 0p O N=--~ M m OZ Ln ~--~ u"1 O c'n M u1 --I 1- Lf'1 Z cV --1--4.-
+ N.--~ ,-+ 1 M =-+
1 . . . . . . . . . . . . . . . . 1 . \
d i N.~ N.-~ .-~ ~ I O o0
V) I I
H I I
a
~O O--1 %.O %O Lr1 N O u1 %0 N 1~ 00 L/1 N 00 =--~ ~ oO O-4 ON O vl O(
r+ 1 t- un ~ .., -1 M M Ln -4 00 cn .p O Orn o0 r+ 00 7 A A O 00 O% N.G 0 00
1.- 1 0 00
.7..~ n 1 ~t fll tr1 -.T NV1 N M N-4 Vl M M N1 N M.--4 M',Z, Z r+ O O-4 ~--~ -
4 O O I N ~--~
Q I , . 1 . \
1 1 O ~
I I "a
z
H 1 I
I I
po 1 00 . - 4 NUr1 t- L!1 O u'1 I : r O-+ 1~0 ON -4 ~O N cM N-7 O vl Wl O r=+
N I
r- r- I Lf1 ~t O O% r, v1 cY1 00 1.0 oo N NO'~ ON O N~Y Vl A A~D r- ON - u1 N
u1 N I O 00
O, u'1 C~1 M M M~T N i~ M O~ 1O N M M N f~ N',~ z.--~ =--~ ~~--4 ~~ I fV ~
'p I . . . . . . . . . . . . . . . . . . . . . . . . I . \
V 1 N N N = N~ ~~ =--~ = N I 0 00
tC '~
I I
ON 1
r, I O N N ao =+ 00 r- O~o 00 N O~o N M n ao 00 %.O -=+ oo N O-4 00 M I
00 1 =-i =-r t- ON OLr1 Ln 00 v1 Lr1 17 rY t` N A~T O% u'1 A N O M N rn Orn -
O% oo 1 O 00
ao 11,0 O% Mr- (N M.-~.-+cNOM r- t-~7 Z ^~--~0 z00- 0 0 1 cV ~+
~ I \
1\ I .-i ~ . ~ . . . . . . . . ~ . . . N N . . . . . . . I O cn
ri 1
M I I '-"
I
r~ Q 1
O+ a .o O ir1 ~o N m - . T O MU.1 % O ~--~ ;r m Lf'1 O% .-r Oo M f- m - - T
O1% u1 O-+ i
vl O t, 00 O0 L!1 -.t Ln N 7 CM c*1 00 O m M.7 ON A O.-y - 1- %C ui %O N O oD
w0 0% N rn cl1 00 =-4 %D =-~ ~o 00 0~ O N C. 1~ a0 O Z Z~O ~o u) ~7 M~Y V1 ~1
t~ =-+
~ E 4 . . ~ ~ . . . ~ . . . . . . . . I O V1
U) 1 I ""
ww 1 1
a%A 1~--4 0 u"1%CN.-+Odo OoC00~nO~DON N.--i v10oN.-40~.71-
Q N 1 0 cNONNC=1NM0--+Ln Ln 0 o00 ~r- mr- tncocor- Lnr- I O 00
wpq O~ 1 N N ~ r+ '~ r+r+ ~--~0=-+~"7O:G OOOOOOOO ~--~ =-+
N H 1 . . . . . . . . . . . . . . . . . . . . . . . . . . I . \
oN Hz i O
tA 6 I I ~
W I I
Afj+ 1 I
N O I I
H
048 u) a~ l
wo ~a a I I
a ~-+ =r+ 1 I
H 'b " I
L*a U 41 =H 1 I N N 7
O W 6 m 1 tn m cn m cn cn (n (D m cn w u) tn m w (n ED rn m v) 1 6 r1 =~
H !+ o I N N Gl G1 C1 C- Cl N Ol GJ C- Gl N C- U1 Gl G/ N N Cl o 0 0 0 0 0 0 o
I ~+ a+~
z w =r1 a 7, 7+ D+ >1 >+ D+ 71 71 7, >, 7~ 7, f. R~~~ G 1/. G I rl ~ r1
oA wo I
U) p 1,,, I i G cn o
~-4W o v 1 i 0 w
dEx~ U~ I
4-4 ~ a
I 0 41
00 I
U f=+ I
. ~ i G-0 . u
w ,I G
o I 1 w " o Ol
Z I 1 o u H a.+
I r- O'T Ln oo ~t Ln M--T Ln 1- 0 -4 ao cn .-4 .-~ Orn a+ .-4 r1 -11 I'D I+1
Cd N Gl
W ~ 1 N M N N N M('M LP1 ul u1 Lf1 fV N M t=1 l+l fYl O CV ~ M .-I ln -7 ~ ~r-
+ ( 7 Y+ U)
.-4 -, . . 4 . -4 .-4 .-1 .-r .-4 u') .-, >+ z Z Z ~o %o Z Z Z U t*+
a- I I
E~-~ ~n I I
1341605
32
FOOTNOTES TO TABLES 1-3
1
Prepared as described in U.K. application Serial No. 83/24800,
filed September 15, 1983.
2
Radiolabeled LAV antigens were disrupted in R1PA buffer (Gilead
et al., Nature (1976) 264:263) and then were reacted with human
serum. The resultant immune complexes were separated by binding
to a Staphylococcus aureus adsorbent (Kessler, J. Immunology
(1975) 115:1617) followed by multiple washings.
Immuneprecipitated antigens were analyzed by SDS polyacrylamide
gel electrophoresis (Laemmli, Nature (1970) 227:680) followed by
fluorography. Presence of either a p25 or gp43 band was
considered necessary and sufficient to confirm a sample as
seropositive.
3 LAS = lymphadenopathy syndrome.
4 N.D. = not determined.
It is evident from the foregoing results that
by employing one or a combination of peptides of the
subject invention, a sensitive accurate test for the
presence of antibodies to AIDS is provided. The
subject peptides can be used by themselves or in
combination with a screening assay or confirmatory
assay, where the complete lysate or complete antigens
may be employed as an independent procedure. Further-
more, because of the specificities of the peptides, one
would anticipate that the DNA sequences coding for the
peptides would also find similar specificity in a DNA
hybridization assay. Thus, the subject invention
allows for the detection of patients who have been
exposed to the retroviral etiologic agent of lymph-
adenopathy syndrome and/or AIDS.
Although the foregoing invention has been
described in some detail by way of illustration and
example for purposes of clarity of understanding, it
will be obvious that certain changes and modifications
1341605
33 =
may be practiced within the scope of the appended
claims.
10
20
30
