Note: Descriptions are shown in the official language in which they were submitted.
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
NUCLEIC ACIDS AND CORRESPONDING PROTEINS ENTITLED 158P3D2
USEFUL IN TREATMENT AND DETECTION OF CANCER
Field of the Invention
[0001] The invention described herein relates to genes and their encoded
proteins, termed
158P3D2 and variants thereof, expressed in certain cancers, and to diagnostic
and therapeutic
methods and compositions useful in the management of cancers that express
158P3D2.
Background of the Invention
[0002] Cancer is the second leading cause of human death next to coronary
disease.
Worldwide, millions of people die from cancer every year. In the United States
alone, as
reported by the American Cancer Society, cancer causes the death of well over
a half-million
people annually, with over 1.2 million new cases diagnosed per year. While
deaths from heart
disease have been declining significantly, those resulting from cancer
generally are on the rise.
In the early part of the next century, cancer is predicted to become the
leading cause of death.
[0003] Worldwide, several cancers stand out as the leading killers. In
particular, carcinomas
of the lung, prostate, breast, colon, pancreas, and ovary represent the
primary causes of cancer
death. These and virtually all other carcinomas share a cominon lethal
feature. With very few
exceptions, metastatic disease from a carcinoma-is fatal. Moreover, even for
those cancer
patients who initially survive their primary cancers, common experience has
shown that their
lives are dramatically altered. Many cancer patients experience strong
anxieties driven by the
awareness of the potential for recurrence or treatment failure. Many cancer
patients experience
physical debilitations following treatment. Furthermore, many cancer patients
experience a
recurrence.
[0004] Worldwide, prostate cancer is the fourth most prevalent cancer in men.
In North
America and Northern Europe, it is by far the most common cancer in males and
is the second
leading cause of cancer death in men. In the United States alone, well over
30,000 men die
annually of this disease - second only to lung cancer. Despite the magnitude
of these figures,
there is still no effective treatment for metastatic prostate cancer. Surgical
prostatectomy,
radiation therapy, hormone ablation therapy, surgical castration and
chemotherapy continue to
be the main treatment modalities. Unfortunately, these treatments are
ineffective for many and
are often associated with undesirable consequences.
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0005] On the diagnostic front, the lack of a prostate tumor marker that can
accurately detect
early-stage, localized tumors remains a significant limitation in the
diagnosis and management
of this disease. Although the serum prostate specific antigen (PSA) assay has
been a very useful
tool, however its specificity and general utility is widely regarded as
lacking in several important
respects.
[0006] Progress in identifying additional specific markers for prostate cancer
has been
improved by the generation of prostate cancer xenografts that can recapitulate
different stages of
the disease in mice. The LAPC (Los Angeles Prostate Cancer) xenografts are
prostate cancer
xenografts that have survived passage in severe combined immune deficient
(SCID) mice and
have exhibited the capacity to mimic the transition from androgen dependence
to androgen
independence (Klein, et al., Nat. Med. (1997) 3:402). More recently identified
prostate cancer
markers include PCTA-1 (Su, et al., Proc. Natl. Acad. Sci. USA (1996)
93:7252), prostate-
specific membrane (PSM) antigen (Pinto, et al., Clin. Cancer Res. (1996)
9:1445-51), STEAP
(Hubert, et al., Proc. Natl. Acad. Sci. USA (1999) 25:14523-8) and prostate
stem cell antigen
(PSCA) (Reiter, et al., Proc. Natl. Acad. Sci. USA (1998) 95:1735).
[0007] While previously identified markers such as PSA, PSM, PCTA and PSCA
have
facilitated efforts to diagnose and treat prostate cancer, there is need for
the identification of
additional markers and therapeutic targets for prostate and related cancers in
order to further
improve diagnosis and therapy.
[0008] Renal cell carcinoma (RCC) accounts for approximately 3 percent of
adult
malignancies. Once adenomas reach a diameter of 2 to 3 cm., malignant
potential exists. In the
adult, the two principal malignant renal tumors are renal cell adenocarcinoma
and transitional
cell carcinoma of the renal pelvis or urethras. The incidence of renal cell
adenocarcinoma is
estimated at more than 29,000 cases in the United States, and more than 11,600
patients died of
this disease in 1998. Transitional cell carcinoma is less frequent, with an
incidence of
approxiinately 500 cases per year in the United States.
[0009] Surgery has been the primary therapy for renal cell adenocarcinoma for
many
decades. Until recently, metastatic disease has been refractory to any
systemic therapy. With
recent developments in systemic therapies, particularly immunotherapies,
metastatic renal cell
carcinoma may be approached aggressively in appropriate patients with a
possibility of durable
responses. Nevertheless, there is a remaining need for effective therapies for
these patients.
[0010] Of all new cases of cancer in the United States, bladder cancer
represents
approximately 5 percent in men (fifth most common neoplasm) and 3 percent in
women (eighth
2
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
most cominon neoplasm). The incidence is increasing slowly, concurrent with an
increasing
older population. In 1998, there was an estimated 54,500 cases, including
39,500 in men and
15,000 in women. The age-adjusted incidence in the United States is 32 per
100,000 for men
and eight per 100,000 in women. The historic male/female ratio of 3:1 may be
decreasing
related to smoking patterns in women. There were an estimated 11,000 deaths
from bladder
cancer in 1998 (7,800 in men and 3,900 in women). Bladder cancer incidence and
mortality
strongly increase with age and will be an increasing problem as the population
becomes more
elderly.
[0011] Most bladder cancers recur in the bladder. Bladder cancer is managed
with a
combination of transurethral resection of the bladder (TUR) and intravesical
chemotherapy or
immunotherapy. The inultifocal and recurrent nature of bladder cancer points
out the limitations
of TUR. Most muscle-invasive cancers are not cured by TUR alone. Radical
cystectomy and
urinary diversion is the most effective means to eliminate the cancer but
carry an undeniable
impact on urinary and sexual function. There continues to be a significant
need for treatment
modalities that are beneficial for bladder cancer patients.
[0012] An estimated 130,200 cases of colorectal cancer occurred in 2000 in the
United
States, including 93,800 cases of colon cancer and 36,400 of rectal cancer.
Colorectal cancers
are the third most common cancers in men and women. Incidence rates declined
significantly
during 1992-1996 (-2.1 % per year). Research suggests that these declines have
been due to
increased screening and polyp removal, preventing progression of polyps to
invasive cancers.
There were an estimated 56,300 deaths (47,700 from colon cancer, 8,600 from
rectal cancer) in
2000, accounting for about 11% of all U.S. cancer deaths.
[0013] At present, surgery is the most common form of therapy for colorectal
cancer, and for
cancers that have not spread, it is frequently curative. Cheinotherapy, or
chemotherapy plus
radiation, is given before or after surgery to most patients whose cancer has
deeply perforated
the bowel wall or has spread to the lymph nodes. A permanent colostomy
(creation of an
abdominal opening for elimination of body wastes) is occasionally needed for
colon cancer and
is infrequently required for rectal cancer. There continues to be a need for
effective diagnostic
and treatment modalities for colorectal cancer.
[0014] There were an estimated 164,100 new cases of lung and bronchial cancer
in 2000,
accounting for 14% of all U.S. cancer diagnoses. The incidence rate of lung
and bronchial
cancer is declining significantly in men, from a high of 86.5 per 100,000 in
1984 to 70.0 in
3
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
1996. In the 1990s, the rate of increase among women began to slow. In 1996,
the incidence
rate in women was 42.3 per 100,000.
[0015] Lung and bronchial cancer caused an estimated 156,900 deaths in 2000,
accounting
for 28% of all cancer deaths. During 1992-1996, mortality from lung cancer
declined
significantly among men (-1.7% per year) while rates for women were still
significantly
increasing (0.9% per year). Since 1987, more women have died each year of lung
cancer than
breast cancer, which, for over 40 years, was the major cause of cancer death
in women.
Decreasing lung cancer incidence and mortality rates most likely resulted from
decreased
smoking rates over the previous 30 years; however, decreasing smoking patterns
among women
lag behind those of inen. Of concern, although the declines in adult tobacco
use have slowed,
tobacco use in youth is increasing again.
[0016] Treatment options for lung and bronchial cancer are determined by the
type and stage
of the cancer and include surgery, radiation therapy, and chemotherapy. For
many localized
cancers, surgery is usually the treatment of choice. Because the disease has
usually spread by
the time it is discovered, radiation therapy and chemotherapy are often needed
in combination
with surgery. Chemotherapy alone or combined with radiation is the treatment
of choice for
small cell lung cancer; on this regimen, a large percentage of patients
experience remission,
which in some cases is long lasting. There is however, an ongoing need for
effective treatment
and diagnostic approaches for lung and bronchial cancers.
[0017] An estimated 182,800 new invasive cases of breast cancer were expected
to occur
among women in the United States during 2000. Additionally, about 1,400 new
cases of breast
cancer were expected to be diagnosed in men in 2000. After increasing about 4%
per year in the
1980s, breast cancer incidence rates in women have leveled off in the 1990s to
about 110.6 cases
per 100,000.
[0018] In the U.S. alone, there were an estimated 41,200 deaths (40,800 women,
400 men) in
2000 due to breast cancer. Breast cancer ranks second among cancer deaths in
women.
According to the most recent data, mortality rates declined significantly
during 1992-1996 with
the largest decreases in younger women, both white and black. These decreases
were probably
the result of earlier detection and improved treatment.
[0019] Taking into account the medical circumstances and the patient's
preferences,
treatment of breast cancer may involve lumpectomy (local reinoval of the
tumor) and removal of
the lymph nodes under the arm; mastectomy (surgical removal of the breast) and
removal of the
lymph nodes under the arm; radiation therapy; chemotherapy; or hormone
therapy. Often, two
4
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
or more methods are used in combination. Numerous studies have shown that, for
early stage
disease, long-tenn survival rates after lumpectomy plus radiotherapy are
similar to survival rates
after modified radical mastectomy. Significant advances in reconstruction
techniques provide
several options for breast reconstruction after mastectomy. Recently, such
reconstruction has
been done at the saine time as the mastectomy.
[0020] Local excision of ductal carcinoma in situ (DCIS) with adequate
ainounts of
surrounding nonnal breast tissue may prevent the local recurrence of the DCIS.
Radiation to the
breast and/or tamoxifen may reduce the chance of DCIS occurring in the
remaining breast tissue.
This is important because DCIS, if left untreated, may develop into invasive
breast cancer.
Nevertheless, there are serious side effects or sequelae to these treatments.
There is, therefore, a
need for efficacious breast cancer treatments.
[0021] There were an estimated 23,100 new cases of ovarian cancer in the
United States in
2000. It accounts for 4% of all cancers among women and ranks second among
gynecologic
cancers. During 1992-1996, ovarian cancer incidence rates were significantly
declining.
Consequent to ovarian cancer, there were an estimated 14,000 deaths in 2000.
Ovarian cancer
causes more deaths than any other cancer of the female reproductive system.
[0022] Surgery, radiation therapy, and chemotherapy are treatment options for
ovarian
cancer. Surgery usually includes the removal of one or both ovaries, the
fallopian tubes
(salpingo-oophorectomy), and the uterus (hysterectomy). In some very early
tumors, only the
involved ovary will be removed, especially in young women who wish to have
children. In
advanced disease, an attempt is made to remove all intra-abdominal disease to
enhance the effect
of chemotherapy. There continues to be an important need for effective
treatment options for
ovarian cancer.
[0023] There were an estimated 28,300 new cases of pancreatic cancer in the
United States in
2000. Over the past 20 years, rates of pancreatic cancer have declined in men.
Rates among
women have remained approximately constant but may be beginning to decline.
Pancreatic
cancer caused an estimated 28,200 deaths in 2000 in the United States. Over
the past 20 years,
there has been a slight but significant decrease in mortality rates among men
(about -0.9% per
year) while rates have increased slightly among women.
[0024] Surgery, radiation therapy, and chemotherapy are treatment options for
pancreatic
cancer. These treatment options can extend survival and/or relieve symptoms in
many patients
but are not likely to produce a cure for most. There is a significant need for
additional
therapeutic and diagnostic options for pancreatic cancer.
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Summary of the Invention
[0025] The present invention relates to a gene, designated 158P3D2, that has
now been found
to be over-expressed in the cancer(s) listed in Table I. Northern blot
expression analysis of
158P3D2 gene expression in normal tissues shows a restricted expression
pattern in adult
tissues. The nucleotide (Figure 2) and amino acid (Figure. 2, and Figure 3)
sequences of
158P3D2 are provided. The tissue-related profile of 158P3D2 in normal adult
tissues, combined
with the over-expression observed in the tissues listed in Table I, shows that
158P3D2 is
aberrantly over-expressed in at least some cancers, and thus serves as a
useful diagnostic,
prophylactic, prognostic, and/or therapeutic target for cancers of the
tissue(s) such as those listed
in Table I.
[0026] The invention provides polynucleotides corresponding or compleinentary
to all or part
of the 158P3D2 genes, mRNAs, and/or coding sequences, preferably in isolated
form, including
polynucleotides encoding 158P3D2-related proteins and fragments of 4, 5, 6, 7,
8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 contiguous
amino acids; at
least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100 or more than 100
contiguous amino
acids of a 158P3D2-related protein, as well as the peptides/proteins
themselves; DNA, RNA,
DNA/RNA hybrids, and related inolecules, polynucleotides or oligonucleotides
complementary
or having at least a 90% homology to the 158P3D2 genes or mRNA sequences or
parts thereof,
and polynucleotides or oligonucleotides that hybridize to the 158P3D2 genes,
mRNAs, or to
158P3D2-encoding polynucleotides. Also provided are means for isolating cDNAs
and the
genes encoding 158P3D2. Recombinant DNA molecules containing 158P3D2
polynucleotides,
cells transformed or transduced with such molecules, and host-vector systems
for the expression
of 158P3D2 gene products are also provided. The invention further provides
antibodies that
bind to 158P3D2 proteins and polypeptide fragments thereof, including
polyclonal and
monoclonal antibodies, murine and other mammalian antibodies, chimeric
antibodies,
humanized and fully human antibodies, and antibodies labeled with a detectable
marker or
therapeutic agent. In certain embodiments, there is a proviso that the entire
nucleic acid
sequence of Figure 2 is not encoded and/or the entire amino acid sequence of
Figure 2 is not
prepared. In certain embodiments, the entire nucleic acid sequence of Figure 2
is encoded
and/or the entire amino acid sequence of Figure 2 is prepared, either of which
are in respective
human unit dose forms.
[0027] The invention further provides methods for detecting the presence and
status of
158P3D2 polynucleotides and proteins in various biological samples, as well as
methods for
6
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
identifying cells that express 158P3D2. A typical embodiment of this invention
provides
methods for monitoring 158P3D2 gene products in a tissue or heinatology sample
having or
suspected of having some fonn of growth dysregulation such as cancer.
[0028] The invention further provides various immunogenic or therapeutic
compositions and
strategies for treating cancers that express 158P3D2 such as cancers of
tissues listed in Table I,
including therapies aimed at inhibiting the transcription, translation,
processing or function of
158P3D2 as well as cancer vaccines. In one aspect, the invention provides
compositions, and
methods comprising them, for treating a cancer that expresses 158P3D2 in a
human subject
wherein the composition comprises a carrier suitable for human use and a
huinan unit dose of
one or more than one agent that inhibits the production or function of
158P3D2. Preferably, the
carrier is a uniquely human carrier. In another aspect of the invention, the
agent is a moiety that
is immunoreactive with 158P3D2 protein. Non-limiting examples of such moieties
include, but
are not limited to, antibodies (such as single chain, monoclonal, polyclonal,
humanized,
chimeric, or human antibodies), functional equivalents thereof (whether
naturally occurring or
synthetic), and combinations thereof. The antibodies can be conjugated to a
diagnostic or
therapeutic moiety. In another aspect, the agent is a small molecule as
defined herein.
[0029] In another aspect, the agent comprises one or more than one peptide
which comprises
a cytotoxic T lymphocyte (CTL) epitope that binds an HLA class I molecule in a
human to elicit
a CTL response to 158P3D2 and/or one or more than one peptide which comprises
a helper T
lymphocyte (HTL) epitope which binds an HLA class II molecule in a human to
elicit an HTL
response. The peptides of the invention may be on the same or on one or more
separate
polypeptide molecules. In a further aspect of the invention, the agent
comprises one or more
than one nucleic acid molecule that expresses one or more than one of the CTL
or HTL response
stimulating peptides as described above. In yet another aspect of the
invention, the one or more
than one nucleic acid molecule may express a moiety that is immunologically
reactive with
158P3D2 as described above. The one or more than one nucleic acid molecule may
also be, or
encodes, a molecule that inhibits production of 158P3D2. Non-limiting examples
of such
molecules include, but are not limited to, those complementary to a nucleotide
sequence
essential for production of 158P3D2 (e.g., antisense sequences or molecules
that form a triple
helix with a nucleotide double helix essential for 158P3D2 production) or a
ribozyme effective
to lyse 158P3D2 mRNA.
[0030] Note that to determine the starting position of any peptide set forth
in Tables VIII-
XXI and XXII to XLIX (collectively HLA Peptide Tables) respective to its
parental protein, e.g.,
7
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
variant 1, variant 2, etc., reference is made to three factors: the particular
variant, the length of
the peptide in an HLA Peptide Table, and the Search Peptides in Table VII.
Generally, a unique
Search Peptide is used to obtain HLA peptides of a particular for a particular
variant. The
position of each Search Peptide relative to its respective parent molecule is
listed in Table VII.
Accordingly, if a Search Peptide begins at position "X", one must add the
value "X - 1" to each
position in Tables VIII-XXI and XXII to XLIX to obtain the actual position of
the HLA peptides
in their parental molecule. For example, if a particular Search Peptide begins
at position 150 of
its parental molecule, one must add 150 - 1, i.e., 149 to each HLA peptide
amino acid position to
calculate the position of that amino acid in the parent molecule.
[0031] One embodiment of the invention comprises an HLA peptide, that occurs
at least
twice in Tables VIII-XXI and XXII to XLIX collectively, or an oligonucleotide
that encodes the
HLA peptide. Another embodiment of the invention comprises an HLA peptide that
occurs at
least once in Tables VIII-XXI and at least once in tables XXII to XLIX, or an
oligonucleotide
that encodes the HLA peptide.
[0032] Another embodiment of the invention is antibody epitopes, which
comprise a peptide
regions, or an oligonucleotide encoding the peptide region, that has one two,
three, four, or five
of the following characteristics:
i) a peptide region of at least 5 amino acids of a particular peptide of
Figure 3, in any whole
number increment up to the full length of that protein in Figure 3, that
includes an amino acid
position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or
having a value equal to
1.0, in the Hydrophilicity profile of Figure 5;
ii) a peptide region of at least 5 amino acids of a particular peptide of
Figure 3, in any whole
nuinber increment up to the full length of that protein in Figure 3, that
includes an ainino acid
position having a value equal to or less than 0.5, 0.4, 0.3, 0.2, 0.1, or
having a value equal to 0.0,
in the Hydropathicity profile of Figure 6;
iii) a peptide region of at least 5 amino acids of a particular peptide of
Figure 3, in any
whole number increment up to the full length of that protein in Figure 3, that
includes an amino
acid position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9,
or having a value
equal to 1.0, in the Percent Accessible Residues profile ofFigure 7;
iv) a peptide region of at least 5 amino acids of a particular peptide of
Figure 3, in any
whole number increment up to the full length of that protein in Figure 3, that
includes an amino
acid position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9,
or having a value
equal to 1.0, in the Average Flexibility profile of Figure 8; or
8
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
v) a peptide region of at least 5 amino acids of a particular peptide of
Figure 3, in any whole
number increment up to the full length of that protein in Figure 3, that
includes an amino acid
position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or
having a value equal to
1.0, in the Beta-turn profile of Figure 9.
Brief Description of the Figures
[0033] Figure 1 depicts the 158P3D2 SSH sequence of 312 nucleotides.
[0034] Figure 2A depicts the cDNA and amino acid sequence of 158P3D2 variant 1
clone
158P3D2-BCP-1 (also called "158P3D2 v.l" or "158P3D2 variant 1"). The start
methionine is
underlined. The open reading frame extends fiom nucleic acid 849-1835
including the stop
codon.
[0035] Figure 2B depicts the cDNA and amino acid sequence of 158P3D2 variant
2A (also
called "158P3D2 v.2"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 117-827 including the stop codon.
[0036] Figure 2C depicts the cDNA and amino acid sequence of 158P3D2 variant
2B (also
called "158P3D2 v.2"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 2249-2794 including the stop codon.
[0037] Figure 2D depicts the cDNA and ainino acid sequence of 158P3D2 variant
3 (also
called "158P3D2 v.3"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 849-1835 including the stop codon.
[0038] Figure 2E depicts the cDNA and amino acid sequence of 158P3D2 variant 4
(also
called "158P3D2 v.4"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 849-1835 including the stop codon.
[0039] Figure 2F depicts the cDNA and amino acid sequence of 158P3D2 variant
5A (also
called "158P3D2 v.5"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 849-1385 including the stop codon.
[0040] Figure 2G depicts the cDNA and amino acid sequence of 158P3D2 variant
5B (also
called "158P3D2 v.5"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 1289-1834 including the stop codon.
[0041] Figure 2H depicts the cDNA and amino acid sequence of 158P3D2 variant 6
(also
called "158P3D2 v.6"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 849-1835 including the stop codon.
9
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0042] Figure 21 depicts the cDNA and amino acid sequence of 158P3D2 variant 7
(also
called "158P3D2 v.7"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 849-1835 including the stop codon.
[0043] Figure 2J depicts the cDNA and amino acid sequence of 158P3D2 variant 8
(also
called "158P3D2 v.8"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 849-1835 including the stop codon.
[0044] Figure 2K depicts the cDNA and amino acid sequence of 158P3D2 variant
14 (also
called "158P3D2 v.14"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 65-4246 including the stop codon.
[0045] Figure 2L depicts the cDNA and amino acid sequence of 158P3D2 variant
15 (also
called "158P3D2 v.15"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 65-3502 including the stop codon.
[0046] Figure 2M depicts the cDNA and amino acid sequence of 158P3D2 variant
16 (also
called "158P3D2 v.16"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 65-6037 including the stop codon.
[0047] Figure 2N the cDNA and amino acid sequence of 158P3D2 variant 17 (also
called
"158P3D2 v.17"). The codon for the start methionine is underlined. The open
reading frame
extends from nucleic acid 65-6175 including the stop codon.
[0048] Figure 20 depicts the cDNA and amino acid sequence of 158P3D2 variant 1
S(also
called "158P3D2 v.18"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 2932-4764 including the stop codon.
[0049] Figure 2P depicts the cDNA and amino acid sequence of 158P3D2 variant
19 (also
called "158P3D2 v.19"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 65-6001 including the stop codon.
[0050] Figure 2Q depicts the cDNA and amino acid sequence of 158P3D2 variant
20 (also
called "15SP3D2 v.20"). The codon for the start methionine is underlined. The
open reading
frame extends from nucleic acid 65-6121 including the stop codon.
[0051] Figure 2R depicts the cDNA and amino acid sequence of 158P3D2 variants
9 through
v.13, SNP variants of 158P3D2 v.l. The 158P3D2 v.9 through v.13 proteins have
1072 amino
acids. Variants 158P3D2 v.4 through v.20 are variants with single nucleotide
difference from
158P3D2 v.l. 158P3D2 v.10, v.12 and v.13 proteins differ from 158P3D2 v.1 by
one amino
acid. 158P3D2 v.9 and v.11 proteins code for the same protein as v.1. Though
these SNP
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
variants are shown separately, they can also occur in any combinations and in
any of the
transcript variants listed above in Figures 2A-2Q.
[0052] Figure 3A depicts the amino acid sequence of 158P3D2 v.1 clone 158P3D2-
BCP-1 is
shown in Figure 3A; it has 328 amino acids.
[0053] Figure 3B depicts the amino acid sequence of 158P3D2 v.2A; it has 236
amino acids.
[0054] Figure 3C depicts the amino acid sequence of 158P3D2 v.2B; it has 181
amino acids.
[0055] Figure 3D depicts the amino acid sequence of 158P3D2 v.3; it has 328
amino acids.
[0056] Figure 3E depicts the amino acid sequence of 158P3D2 v.4; it has 328
amino acids.
[0057] Figure 3F depicts the amino acid sequence of 158P3D2 v.5A; it has 178
amino acids.
[0058] Figure 3G depicts the amino acid sequence of 158P3D2 v.5B; it has 181
amino acids.
[0059] Figure 3H depicts the amino acid sequence of 158P3D2 v.10; it has 328
amino acids.
[0060] Figure 31 depicts the amino acid sequence of 158P3D2 v.11; it has 328
amino acids.
[0061] Figure 3J depicts the amino acid sequence of 158P3D2 v.12; it has 328
amino acids.
[0062] Figure 3K depicts the amino acid sequence of 158P3D2 v.13; it has 328
amino acids.
[0063] Figure 3L depicts the amino acid sequence of 158P3D2 v.14; it has 1393
amino acids.
[0064] Figure 3M depicts the amino acid sequence of 158P3D2 v.15; it has 1145
amino
acids.
[0065] Figure 3N depicts the ainino acid sequence of 158P3D2 v.16; it has 1990
amino acids.
[0066] Figure 30 depicts the amino acid sequence of 158P3D2 v.17; it has 2036
amino acids.
[0067] Figure 3P depicts the amino acid sequence of 158P3D2 v.18; it has 610
amino acids.
[0068] Figure 3Q depicts the amino acid sequence of 158P3D2 v.19; it has 1978
amino acids.
[0069] Figure 3R depicts the amino acid sequence of 158P3D2 v.20; it has 2018
amino acids.
[0070] As used herein, a reference to 158P3D2 includes all variants thereof,
including those
shown in Figures 2, 3, 10, 11, and 12 unless the context clearly indicates
otherwise.
[0071] Figure 4 is omitted.
[0072] Figure 5(a) - (i). Hydrophilicity amino acid profile of 158P3D2 v.1,
v.2a, v.2b, v.5a,
v.14, v.15, v.16, v.17, and v.18 determined by computer algorithin sequence
analysis using the
method of Hopp and Woods (Hopp, T.P. and Woods, K.R., Proc. Natl. Acad. Sci.
USA (1981)
78:3824-3828) accessed on the Protscale website located on the World Wide Web
through the
ExPasy molecular biology server.
[0073] Figure 6(a) - (i). Hydropathicity amino acid profile of 158P3D2 v.1,
v.2a, v.2b, v.5a,
v.14, v.15, v.16, v.17, and v.18 determined by computer algorithm sequence
analysis using the
method of Kyte and Doolittle (Kyte, J. and Doolittle, R.F., J. Mol. Biol.
(1982) 157:105-132)
11
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
accessed on the ProtScale website located on the World Wide Web through the
ExPasy
molecular biology server.
[0074] Figure 7(a) - (i). Percent accessible residues amino acid profile of
158P3D2 v.1,
v.2a, v.2b, v.5a, v.14, v.15, v.16, v.17, and v.18 determined by computer
algorithm sequence
analysis using the method of Janin (Janin, J., Nature (1979) 277:491-492)
accessed on the
ProtScale website located on the World Wide Web through the ExPasy molecular
biology
server.
[0075] Figure 8(a) - (i). Average flexibility amino acid profile of 158P3D2
v.1, v.2a, v.2b,
v.5a, v.14, v.15, v.16, v.17, and v.18 determined by computer algorithm
sequence analysis using
the method of Bhaskaran and Ponnuswamy (Bhaskaran, R., and Ponnuswamy, P.K.,
Int. J. Pept.
Protein Res. (1988) 32:242-255) accessed on the ProtScale website located on
the World Wide
Web through the ExPasy molecular biology server.
[0076] Figure 9(a) - (i). Beta-turn amino acid profile of 158P3D2 v.1, v.2a,
v.2b, v.5a, v.14,
v.15, v.16, v.17, and v.18 determined by coinputer algorithm sequence analysis
using the
method of Deleage and Roux (Deleage, G. and Roux, B., Protein Engineey-ing
(1987) 1:289-
294) accessed on the ProtScale website located on the World Wide Web through
the ExPasy
molecular biology server.
[0077] Figure 10. Exon compositions of transcript variants of 158P3D2. Variant
158P3D2 v.2, v.14 through v.20 are transcript variants. Compared with 158P3D2
v.1; v.2 had
six additional exons to the 5' erid, an exon 7 longer than exon 1 of 158P3D2
v.1 and an exon 10
shorter than exon 4 of 158P3D2 v.1. Exons 2, 3, 5, 6 and 7 of 158P3D2 v.l are
the same as
exons 8, 9, 11, 12 and 13 of 158P3D2 v.2, respectively. Other variants had
different exon
compositions as shown above. Numbers in "()" underneath the box correspond to
those of
158P3D2 v.1. Black boxes show the same sequence as 158P3D2 v.1. Length of
introns are not
proportional.
[0078] Figure 11. Schematic display of protein variants of 158P3D2. Nucleotide
variant
158P3D2 v.2 and 158P3D2 v.5 potentially coded for two different proteins,
designated as
variants 158P3D2 v.2A and 158P3D2 v.2B, 158P3D2 v.5A and 158P3D2 v.5B,
respectively.
Variant 158P3D2 v.5B shares the same amino acid sequence as variant 158P3D2
v.2B. Variants
158P3D2 v.3 and v.4 were variants with single amino acid variations. Black box
shows the
same sequence as 158P3D2 v.l. Numbers in "()" underneath the black boxes
correspond to
those of 158P3D2 v.l and those underneath the "brick" boxes correspond to
those of v.17.
Single amino acid differences are indicated above the box.
12
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0079] Figure 12. Schematic display of SNP variants of 158P3D2. Variant
158P3D2 v.3
through v.13 are variants with a single nucleotide difference from v.1. Though
these alternative
SNP alleles were shown separately, they could occur in any transcript variants
in any
combination (called haplotype). Numbers in "()" underneath the box correspond
to those of
158P3D2 v.1. '-' indicate single nucleotide deletion. Black boxes show the
same sequence as
158P3D2 v.l. SNPs are indicated above the box.
[0080] Figure 13. Secondary structure and transmembrane domains prediction for
158P3D2 protein variants.
[0081] Figure 13A (SEQ ID NO: 54), Figure 13B (SEQ ID NO: 55), Figure 13C (SEQ
ID NO: 56), Figure 13D (SEQ ID NO: 57), Figure 13E (SEQ ID NO: 58), Figure 13F
(SEQ ID NO: 59), Figure 13G (SEQ ID NO: 60), Figure 13H (SEQ ID NO: 61),
Figure
131 (SEQ ID NO: 62): The secondary structures of 158P3D2 protein variants 1,
2a, 2b, 5a, 14,
15, 16, 17, 18 respectively, were predicted using the HNN - Hierarchical
Neural Network
method (NPS@: Network Protein Sequence Analysis TIBS 2000 March Vol. 25, No 3
[291]:147-150 Combet C., Blanchet C., Geourjon C. and Deleage G.), accessed
from the ExPasy
molecular biology server. This method predicts the presence and location of
alpha helices,
extended strands, and random coils from the primary protein sequence. The
percent of the
protein variant in a given secondary structure is also listed.
[0082] Figure 13J, Figure 13L, Figure 13N, Figure 13P, Figure 13R, Figure 13T,
Figure
13V, Figure 13X, and Figure 13Z: Schematic representation of the probability
of existence of
transmembrane regions of 158P3D2 protein variants 1, 2a, 2b, 5a, 14, 15, 16,
17, 18
respectively, based on the TMpred algorithm of Hofinami and Stoffel which
utilizes TMBASE
(K. Hofinann, W. Stoffel. TMBASE - A database of inembrane spanning protein
segments Biol.
Chem. Hoppe-Seyler 374:166, 1993). Figure 13K, Figure 13M, Figure 130, Figure
13Q,
Figure 13S, Figure 13U, Figure 13W, Figure 13Y, Figure 13AA: Schematic
representation of
the probability of the existence of transmeinbrane regions of 158P3D2 variants
1, 2a, 2b, 5a, 14,
15, 16, 17, 18 respectively, based on the TMHMM algorithm of Sonnhammer, von
Heijne, and
Krogh (Erik L.L. Sonnhammer, Gunnar von Heijne, and Anders Krogh: A hidden
Markov
model for predicting transmembrane helices in protein sequences. In Proc. of
Sixth Int. Conf.
on Intelligent Systems for Molecular Biology, p 175-182 Ed J. Glasgow, T.
Littlejohn, F. Major,
R. Lathrop, D. Sankoff, and C. Sensen Menlo Park, CA: AAAI Press, 1998). The
TMpred and
TMHMM algorithms are accessed from the ExPasy molecular biology server.
13
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0083] Figure 14. 158P3D2 Expression in Normal and Cancer Tissue Specimens.
First
strand cDNA was prepared from a panel of 13 normal tissues (brain, heart,
kidney, liver, lung,
spleen, skeletal muscle, testis, pancreas, colon, stomach) and pools of 4-7
patients from the
following cancer indications: bladder, kidney, colon, lung, pancreas, stomach,
ovary, breast,
multiple cancer metastasis, cervix, lymphoma as well as from a pool of patient-
derived
xenografts (prostate cancer, bladder cancer and kidney cancer). Normalization
was performed
by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers
to 158P3D2,
was performed at 26 and 30 cycles of amplification. Samples were run on an
agarose gel, and
PCR products were quantitated using the Alphalmager software. Results show
strong
expression of 158P3D2 in cancers of the bladder, kidney, colon, lung,
pancreas, stomach, ovary,
breast, cervix, and lymphoma. Low expression was detected in all normal
tissues tested except
in normal stomach. Strong expression was also observed in the cancer
metastasis pool.
[0084] Figure 15. 158P3D2 Expression in bladder cancer patient specimens.
First strand
cDNA was prepared from nonnal bladder, bladder cancer cell lines (UM-UC-3,
TCCSUP, J82)
and a panel of bladder cancer patient specimens. Normalization was performed
by PCR using
primers to actin and GAPDH. Expression level was recorded as no expression (no
signal
detected), low (signal detected at 30x), mediuin (signal detected at 26x),
high (strong signal at
26x). Results show expression of 158P3D2 in the majority of bladder cancer
patient specimens
tested. Very low expression was detected in normal tissues, but no expression
was seen in the
cell lines tested.
[0085] Figure 16. 158P3D2 Expression in bladder cancer patient specimens by
northern blotting. RNA was extracted from normal bladder, bladder cancer cell
lines (UM-
UC-3, J82, SCaBER), bladder cancer patient tumors (T) and their normal
adjacent tissues
(NAT). Northern blot with 10 ug of total RNA were probed with the 158P3D2
sequence. Size
standards in kilobases are on the side. Results show strong expression of
158P3D2 in tumor
tissues, but not in normal nor NAT tissues.
[0086] Figure 17. 158P3D2 Expression in lung cancer patient specimens. First
strand
cDNA was prepared from normal lung, cancer cell line A427 and a panel of lung
cancer patient
specimens. Normalization was performed by PCR using primers to actin and
GAPDH. Semi-
quantitative PCR, using primers to 158P3D2, was performed at 26 and 30 cycles
of
amplification. Expression level was recorded as no expression (no signal
detected), low (signal
detected at 30x), medium (signal detected at 26x), high (strong signal at
26x). 158P3D2 is
14
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
expressed at varying levels in 35/39 (90%) of lung cancer specimens, but not
in all 3 normal
lung tissues tested.
[0087] Figure 18. 158P3D2 Expression in lung cancer patient specimens by
northern
blotting. RNA was extracted from normal lung, A4271ung cancer cell line, and a
panel of lung
cancer patient specimens. Northern blot with 10 ug of total RNA were probed
with the
158P3D2 sequence. Size standards in kilobases are on the side. Results show
strong expression
of 158P3D2 in tumor specimens but not in normal tissues.
[0088] Figure 19. 158P3D2 Expression in cancer metastasis patient specimens.
First
strand cDNA was prepared from normal colon, kidney, liver, lung, pancreas,
stomach and from
a panel of cancer metastasis patient specimens. Norinalization was performed
by PCR using
primers to actin and GAPDH. Seini-quantitative PCR, using primers to 158P3D2,
was
performed at 26 and 30 cycles of amplification. Expression level was recorded
as no expression
(no signal detected), low (signal detected at 30x), medium (signal detected at
26x), high (strong
signal at 26x). Results show expression of 158P3D2 in the majority of patient
cancer metastasis
specimens tested but not in normal tissues.
[0089] Figure 20. 158P3D2 Expression in cervical cancer patient specimens.
First strand
cDNA was prepared from normal cervix, cervical cancer cell line HeLa, and a
panel of cervical
cancer patient specimens. Normalization was performed by PCR using primers to
actin and
GAPDH. Expression level was recorded as no expression (no signal detected),
low (signal
detected at 30x), medium (signal detected at 26x), high (strong signal at
26x). Results show
expression of 158P3D2 in all 14 cervical cancer patient specimens tested. No
expression was
detected in normal cervix nor in the cell line tested.
[0090] Figure 21. 158P3D2 Expression in cervical cancer patient specimens by
northern
blotting. RNA was extracted from normal cervix, cervical cancer cell line
HeLa, and a panel of
cervical cancer patient specimens. Northern blot with 10 ug of total RNA were
probed with the
158P3D2 sequence. Size standards in kilobases are on the side. Results show
strong expression
of 158P3D2 in tumor tissues, but not in normal cervix nor in the cell line.
[0091] Figure 22. 158P3D2 Expression in kidney cancer patient specimens. First
strand
cDNA was prepared from normal kidney, kidney cancer cell lines (769-P, A-498,
CAKI-1), and
a panel of kidney cancer patient specimens. Normalization was performed by PCR
using
primers to actin and GAPDH. Semi-quantitative PCR, using primers to 158P3D2,
was
performed at 26 and 30 cycles of amplification. Expression level was
recordedias no expression
(no signal detected), low (signal detected at 30x), medium (signal detected at
26x), high (strong
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
signal at 26x). 158P3D2 is expressed at varying levels in the majority of
kidney cancer patient
specimens, but not in all 3 normal kidney tissues tested. Low expression was
detected in 2 of 3
cell lines tested.
[0092] Figure 23. 158P3D2 Expression in kidney cancer patient specimens by
northern
blotting. RNA was extracted from normal kidney and a panel of kidney cancer
patient
specimens. Northern blot with 10 ug of total RNA were probed with the 158P3D2
sequence.
Size standards in kilobases are on the side. Results show strong expression of
158P3D2 in
tumor specimens but not in the normal tissue.
[0093] Figure 24. 158P3D2 Expression in stomach cancer patient specimens.
First strand
cDNA was prepared from normal stomach, and a panel of stomach cancer patient
specimens.
Normalization was performed by PCR using primers to actin and GAPDH. Seini-
quantitative
PCR, using primers to 158P3D2, was performed at 26 and 30 cycles of
amplification.
Expression level was recorded as no expression (no signal detected), low
(signal detected at
30x), medium (signal detected at 26x), high (strong signal at 26x). 158P3D2 is
expressed at
varying levels in the majority of stomach cancer patient specimens. Weak
expression was
detected in the 2 normal stomach, and only in 1 of the 2 NAT tissues tested.
[0094] Figure 25. 158P3D2 Expression in stomach cancer patient specimens by
northern
blotting. RNA was extracted from normal stomach and a panel of stomach cancer
patient
specimens. Northern blot with 10 ug of total RNA were probed with the 158P3D2
sequence.
Size standards in kilobases are on the side. Results show strong expression of
158P3D2 in
tumor specimens but not in the normal tissue.
[0095] Figure 26. 158P3D2 Expression in colon cancer patient specimens. First
strand
cDNA was prepared from normal colon, colon cancer cell lines (LoVo, CaCO-2, SK
CO 1, Colo
205, T284), and a panel of colon cancer patient specimens. Normalization was
performed by
PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to
158P3D2,
was performed at 26 and 30 cycles of amplification. Expression level was
recorded as no
expression (no signal detected), low (signal detected at 30x), mediuin (signal
detected at 26x),
high (strong signal at 26x). 158P3D2 is expressed at varying levels in the
majority of colon
cancer patient specimens. But it was weakly expressed in just 2 of 3 normal
tissues, and 3 of 5
cell lines tested.
[0096] Figure 27. 158P3D2 Expression in uterus cancer patient specimens. First
strand
cDNA was prepared from normal uterus and a panel of uterus cancer patient
specimens.
Normalization was performed by PCR using primers to actin and GAPDH. Semi-
quantitative
16
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
PCR, using primers to 158P3D2, was performed at 26 and 30 cycles of
amplification.
Expression level was recorded as no expression (no signal detected), low
(signal detected at
30x), medium (signal detected at 26x), high (strong signal at 26x). Results
show 158P3D2 is
expressed at varying levels in the majority of uterus cancer patient
specimens, but not in normal
uterus.
[0097] Figure 28. 158P3D2 Expression in breast cancer patient specimens. First
strand
cDNA was prepared from normal breast, breast cancer cell lines (MD-MBA-435S,
DU4475,
MCF-7, CAMA- 1, MCF10A), and a panel of breast cancer patient specimens.
Normalization
was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR,
using
primers to 158P3D2, was perfonned at 26 and 30 cycles of amplification.
Expression level was
recorded as no expression (no signal detected), low (signal detected at 30x),
medium (signal
detected at 26x), high (strong signal at 26x). Results show 158P3D2 is
expressed at varying
levels in the majority of breast cancer patient specimens. But it was weakly
expressed in just 2
of 3 normal tissues, and 2 of 5 cell lines tested.
[0098] Figure 29. Serum titer of mice immunized with KLH-peptide encoding
amino acids
315-328 of 158P3D2. Serial dilutions of serum taken from immunized mice were
incubated on
an ELISA plate coated with the 158P3 D2 peptide conjugated to ovalbumin.
Specific bound
antibody was then detected by incubation goat anti-mouse IgG-HRP conjugate and
then
visualized and quantitated by development with TMB substrate and optical
density
determination.
[0099] Figure 30. Validation of 158P3D2 siRNA oligo. Cos-1 cells were
transfected with 1
g pcDNA3-158P3D2, which encodes a full-length 158P3D2 protein fusion with a
Myc/His tag
on the C-terminus, simultaneously with Lipofectamine 2000 reagent (LF2k)
alone, or with
control CT1 oligo (20 nM), 158P3D2.b oligo (20 nM), or no DNA or oligo (No
DNA). After 72
hours, the cells were lysed in 1% Triton buffer, and 50 g of total soluble
cell lysate was
analyzed by Western blotting. The upper panel was blotted with anti-Myc
(1:1000) to detect the
158P3D2-Myc/His fusion protein and the lower panel was developed with anti-
actin. The level
of 158P3D2 was diminished by the 158P3D2 siRNA oligo, whereas no change was
observed
with the control (LF2k) or siRNA oligo CT1. In contrast, no change in the
level of actin was
noted in the cell lysates, indicating that the loading was equivalent in all
lanes.
[0100] Figure 31. Effect of 158P3D2 RNAi on cell proliferation. SCaBER cells
or Cos-1
cells were transfected with Lipofectamine 2000 reagent (LF2K) alone, or with
negative control
Luc4 oligo (20 nM), positive control Eg5 oligo (20 nM) or 158P3D2.b oligo (20
nM). After 48
17
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
hours, the media was replaced and the cells were incubated for 24 hrs, pulsed
with 3H-thymidine
at 1.5 pCi/ml for 14 hrs, harvested onto a filtermat and counted in
scintillation cocktail on a
Microbeta trilux counter. Percentage cell proliferation relative to the LF2k
control (100%) is
shown. The reduction in 158P3D2 levels by the 158P3D2.b siRNA oligo correlated
with
diminished cell proliferation in the SCaBER cells, but no effect was observed
in the 158P3D2-
negative cell line Cos-1.
Detailed Description of the Invention
Outline of Sections
I.) Definitions
II.) 158P3D2 Polynucleotides
II.A.) Uses of 158P3D2 Polynucleotides
II.A. 1. Monitoring of Genetic Abnormalities
II.A.2. Antisense Einbodiments
II.A.3. Primers and Primer Pairs
II.A.4. Isolation of 158P3D2-Encoding Nucleic Acid Molecules
II.A.5. Recoinbinant Nucleic Acid Molecules and Host-Vector
Systems
III.) 158P3D2-related Proteins
III.A.) Motif-bearing Protein Embodiments
III.B.) Expression of 158P3D2-related Proteins
III.C.) Modifications of 158P3D2-related Proteins
III.D.) Uses of 158P3D2-related Proteins
IV.) 158P3D2 Antibodies
V.) 158P3D2 Cellular Immune Responses
VI.) 158P3D2 Transgenic Animals
VII.) Methods for the Detection of 158P3D2
VIII.) Methods for Monitoring the Status of 158P3D2-related Genes and Their
Products
IX.) Identification of Molecules That Interact With 158P3D2
X.) Therapeutic Methods and Compositions
X.A.) Anti-Cancer Vaccines
X.A. 1. Cellular Vaccines
X.A.2. Antibody-based Vaccines
18
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
X.A.3. Nucleic Acid Vaccines:
X.A.4. Ex Vivo Vaccines
X.B.) 158P3D2 as a Target for Antibody-Based Therapy
X.C.) 158P3D2 as a Target for Cellular Immune Responses
X. C. 1. Minigene Vaccines
X.C.2. Combinations of CTL Peptides with Helper Peptides
X.C.3. Combinations of CTL Peptides with T Cell Priming Agents
X.C.4. Vaccine Compositions Comprising DC Pulsed with CTL
and/or HTL Peptides
X.D.) Adoptive Iinmunotherapy
X.E.) Administration of Vaccines for Therapeutic or Prophylactic Purposes
XI.) Diagnostic and Prognostic Einbodiments of 158P3D2.
XII.) Inhibition of 158P3D2 Protein Function
XII.A.) Inhibition of 158P3D2 With Intracellular Antibodies
XII.B.) Inhibition of 158P3D2 with Recombinant Proteins
XII.C.) Inhibition of 158P3D2 Transcription or Translation
XII.D.) General Considerations for Therapeutic Strategies
XIII.) Identification, Characterization and Use of Modulators of 109P1D1
XIII.A.) Methods to Identify and Use Modulators
XIII.B) Gene Expression-related Assays
XIII.C) Expression Monitoring to Identify Compounds that Modify Gene
Expression
XIII.D.) Biological Activity-related Assays
XIII.E.) High Throughput Screening to Identify Modulators
XIII.F.) Use of Soft Agar Growth and Colony Formation to Identify and
Characterize Modulators
XIII.G.) Evaluation of Contact Inhibition and Growth Density Limitation to
Identify and Characterize Modulators
XIII.H.) Evaluation of Growth Factor or Serum Dependence to Identify and
Characterize Modulators
XIII.I.) Use of Tumor-specific Marker Levels to Identify and Characterize
Modulators
XIII.J.) Invasiveness into Matrigel to Identify and Characterize Modulators
19
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
XIII.K.) Evaluation of Tumor Growth In Vivo to Identify and Characterize
Modulators
XIII.L.) In Vitro Assays to Identify and Characterize Modulators
XIII.M.) Binding Assays to Identify and Characterize Modulators
XIII.N.) Competitive Binding to Identify and Characterize Modulators
XIII.O.) Use of Polynucleotides to Down-regulate or Inhibit a Protein of the
Invention
XIII.P.) Iiihibitory and Antisense Nucleotides
XIII.Q.) Ribozymes
XIII.R.) Use of Modulators in Phenotypic Screening
XIII.S.) Use of Modulators to Affect Peptides of the Invention
XIII.T.) Methods of Identifying Characterizing Cancer-associated Sequences
XIV.) KITS/Articles of Manufacture
I.) DEFINITIONS
[0101] Unless otherwise defined, all terms of art, notations and other
scientific terms or
terminology used herein are intended to have the meanings coininonly
understood by those of
skill in the art to which this invention pertains. In some cases, terms with
commonly understood
meanings are defined herein for clarity and/or for ready reference, and the
inclusion of such
definitions herein should not necessarily be construed to represent a
substantial difference over
what is generally understood in the art. Many of the techniques and procedures
described or
referenced herein are well understood and commonly employed using conventional
methodology by those skilled in the art, such as, for example, the widely
utilized molecular
cloning methodologies described in Sambrook et al., Molecular Cloning: A
Laboratory Manual
2nd. edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. As
appropriate, procedures involving the use of commercially available kits and
reagents are
generally carried out in accordance with manufacturer defined protocols and/or
parameters
unless otherwise noted.
[0102] The terms "advanced prostate cancer", "locally advanced prostate
cancer",
"advanced disease" and "locally advanced disease" mean prostate cancers that
have extended
through the prostate capsule, and are meant to include stage C disease under
the American
Urological Association (AUA) system, stage Cl - C2 disease under the Whitmore-
Jewett
system, and stage T3 - T4 and N+ disease under the TNM (tumor, node,
metastasis) system. In
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
general, surgery is not recommended for patients with locally advanced
disease, and these
patients have substantially less favorable outcomes compared to patients
having clinically
localized (organ-confined) prostate cancer. Locally advanced disease is
clinically identified by
palpable evidence of induration beyond the lateral border of the prostate, or
asymmetry or
induration above the prostate base. Locally advanced prostate cancer is
presently diagnosed
pathologically following radical prostatectomy if the tumor invades or
penetrates the prostatic
capsule, extends into the surgical margin, or invades the seminal vesicles.
[0103] "Altering the native glycosylation pattern" is intended for purposes
herein to mean
deleting one or more carbohydrate moieties found in native sequence 158P3D2
(either by
removing the underlying glycosylation site or by deleting the glycosylation by
chemical and/or
enzymatic means), and/or adding one or more glycosylation sites that are not
present in the
native sequence 158P3D2. In addition, the phrase includes qualitative changes
in the
glycosylation of the native proteins, involving a change in the nature and
proportions of the
various carbohydrate moieties present.
[0104] The term "analog" refers to a molecule which is structurally similar or
shares similar
or corresponding attributes with another molecule (e.g., a 158P3D2-related
protein). For
example, an analog of a 158P3D2 protein can be specifically bound by an
antibody or T cell that
specifically binds to 158P3D2.
[0105] The term "antibody" is used in the broadest sense. Therefore, an
"antibody" can be
naturally occurring or man-made such as monoclonal antibodies produced by
conventional
hybridoma technology. Anti-158P3D2 antibodies comprise monoclonal and
polyclonal
antibodies as well as fragments containing the antigen-binding doinain and/or
one or more
complementarity determining regions of these antibodies.
[0106] An "antibody fragment" is defined as at least a portion of the variable
region of the
immunoglobulin molecule that binds to its target, i.e., the antigen-binding
region. In one
embodiment it specifically covers single anti-158P3D2 antibodies and clones
thereof (including
agonist, antagonist and neutralizing antibodies) and anti-158P3D2 antibody
compositions with
polyepitopic specificity.
[0107] The term "codon optimized sequences" refers to nucleotide sequences
that have been
optimized for a particular host species by replacing any codons having a usage
frequency of less
than about 20%. Nucleotide sequences that have been optimized for expression
in a given host
species by elimination of spurious polyadenylation sequences, elimination of
exon/intron
21
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
splicing signals, elimination of transposon-like repeats and/or optimization
of GC content in
addition to codon optimization are referred to herein as an "expression
enhanced sequences."
[0108] A "combinatorial library" is a collection of diverse chemical compounds
generated
by either chemical synthesis or biological synthesis by combining a number of
chemical
"building blocks" such as reagents. For example, a linear combinatorial
chemical library, such
as a polypeptide (e.g., mutein) library, is formed by combining a set of
chemical building blocks
called amino acids in every possible way for a given compound length (i.e.,
the number of
ainino acids in a polypeptide compound). Numerous chemical compounds are
synthesized
through such combinatorial mixing of chemical building blocks (Gallop et al.,
J. Med. Chem.
37(9): 1233-1251 (1994)).
[0109] Preparation and screening of combinatorial libraries is well known to
those of skill in
the art. Such combinatorial chemical libraries include, but are not limited
to, peptide libraries
(see, e.g., U.S. Patent No. 5,010,175, Furka, Pept. Prot. Res. 37:487-493
(1991), Houghton et
al., Nature, 354:84-88 (1991)), peptoids (PCT Publication No WO 91/19735),
encoded peptides
(PCT Publication WO 93/20242), random bio- oligomers (PCT Publication WO
92/00091),
benzodiazepines (U.S. Pat. No. 5,288,514), diversomers such as hydantoins,
benzodiazepines
and dipeptides (Hobbs et al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)),
vinylogous
polypeptides (Hagihara et al., J. Amer. Chem. Soc. 114:6568 (1992)),
nonpeptidal
peptidomimetics with a Beta-D-Glucose scaffolding (Hirschmaim et al., J. Amer.
Chem. Soc.
114:9217-9218 (1992)), analogous organic syntheses of small compound libraries
(Chen et al.,
J. Amer. Chem. Soc. 116:2661 (1994)), oligocarbarnates (Cho, et al., Science
261:1303 (1993)),
and/or peptidyl phosphonates (Campbell et al., J. Org. Chem. 59:658 (1994)).
See, generally,
Gordon et al., J. Med. Chem. 37:1385 (1994), nucleic acid libraries (see,
e.g., Stratagene Corp.),
peptide nucleic acid libraries (see, e.g., U.S. Patent 5,539,083), antibody
libraries (see, e.g.,
Vaughn et al., Nature Biotechnology 14(3): 309-314 (1996), and
PCT/US96/10287),
carbohydrate libraries (see, e.g., Liang et al., Science 274:1520-1522 (1996),
and U.S. Patent
No. 5,593,853), and small organic molecule libraries (see, e.g.,
benzodiazepines, Bauin, C&EN,
Jan 18, page 33 (1993); isoprenoids, U.S. Patent No. 5,569,588;
thiazolidinones and
inetathiazanones, U.S. Patent No. 5,549,974; pyrrolidines,, U.S. Patent Nos.
5,525,735 and
5,519,134; morpholino compounds, U.S. Patent No. 5,506, 337; benzodiazepines,
U.S. Patent
No. 5,288,514; and the like).
[0110] Devices for the preparation of combinatorial libraries are commercially
available
(see, e.g., 357 NIPS, 390 NIPS, Advanced Chem Tech, Louisville KY; Symphony,
Rainin,
22
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Woburn, MA; 433A, Applied Biosystems, Foster City, CA; 9050, Plus, Millipore,
Bedford,
NIA). A number of well-known robotic systems have also been developed for
solution phase
chemistries. These systems include automated workstations such as the
automated synthesis
apparatus developed by Takeda Chemical Industries, LTD. (Osaka, Japan) and
many robotic
systems utilizing robotic arms (Zymate H, Zymark Corporation, Hopkinton,
Mass.; Orca,
Hewlett-Packard, Palo Alto, Calif.), which mimic the manual synthetic
operations performed by
a chemist. Any of the above devices are suitable for use with the present
invention. The nature
and implementation of modifications to these devices (if any) so that they can
operate as
discussed herein will be apparent to persons skilled in the relevant art. In
addition, numerous
combinatorial libraries are themselves commercially available (see, e.g.,
ComGenex, Princeton,
NJ; Asinex, Moscow, RU; Tripos, Inc., St. Louis, MO; ChemStar, Ltd, Moscow,
RU; 3D
Pharmaceuticals, Exton, PA; Martek Biosciences, Columbia, MD; etc.).
[0111] The term "cytotoxic agent" refers to a substance that inhibits or
prevents the
expression activity of cells, function of cells and/or causes destruction of
cells. The term is
intended to include radioactive isotopes chemotherapeutic agents, and toxins
such as small
molecule toxins or enzymatically active toxins of bacterial, fungal, plant or
animal origin,
including fragments and/or variants thereof. Examples of cytotoxic agents
include, but are not
limited to auristatins, auromycins, maytansinoids, yttrium, bisinuth, ricin,
ricin A-chain,
combrestatin, duocarmycins, dolostatins, doxorubicin, daunorubicin, taxol,
cisplatin, cc1065,
ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine,
colchicine,
dihydroxy anthracin dione, actinomycin, diphtheria toxin, Pseudomonas exotoxin
(PE) A, PE40,
abrin, abrin A chain, modeccin A chain, alpha-sarcin, gelonin, mitogellin,
retstrictocin,
phenomycin, enomycin, curicin, crotin, calicheamicin, Sapaonaria officinalis
inhibitor, and
glucocorticoid and other chemotherapeutic agents, as well as radioisotopes
such as At211, I131,
1125, Y90, Re186, Re188, Sm153, Bi212 or 213, P32 and radioactive isotopes of
Lu including
Lu177. Antibodies may also be conjugated to an anti-cancer pro-drug activating
enzyme
capable of converting the pro-drug to its active form.
[0112] The "gene product" is sometimes referred to herein as a protein or
mRNA. For
example, a"gene product of the invention" is sometimes referred to herein as a
"canceramino
acid sequence", "cancer protein", "protein of a cancer listed in Table I", a
"cancer mRNA",
"mRNA of a cancer listed in Table I", etc. In one embodiment, the cancer
protein is encoded by
a nucleic acid of Figure 2. The cancer protein can be a fragment, or
alternatively, be the full-
length protein to the fragment encoded by the nucleic acids of Figure 2. In
one embodiment, a
23
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
cancer amino acid sequence is used to determine sequence identity or
similarity. In another
embodiment, the sequences are naturally occurring allelic variants of a
protein encoded by a
nucleic acid of Figure 2. In another embodiment, the sequences are sequence
variants as further
described herein.
[0113] "Higli throughput screening" assays for the presence, absence,
quantification, or
other properties of particular nucleic acids or protein products are well
known to those of skill in
the art. Similarly, binding assays and reporter gene assays are similarly well
known. Thus, e.g.,
U.S. Patent No. 5,559,410 discloses high throughput screening methods for
proteins; U.S. Patent
No. 5,585,639 discloses high throughput screening methods for nucleic acid
binding (i.e., in
arrays); while U.S. Patent Nos. 5,576,220 and 5,541,061 disclose high
throughput methods of
screening for ligand/antibody binding.
[0114] In addition, high throughput screening systems are commercially
available (see, e.g.,
Amersham Biosciences, Piscataway, NJ; Zymark Corp., Hopkinton, MA; Air
Technical
Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision
Systems, Inc.,
Natick, MA; etc.). These systems typically automate entire procedures,
including all sample and
reagent pipetting, liquid dispensing, timed incubations, and final readings of
the microplate in
detector(s) appropriate for the assay. These configurable systems provide high
throughput and
rapid start up as well as a high degree of flexibility and customization. The
manufacturers of
such systems provide detailed protocols for various high throughput systems.
Thus, e.g.,
Zymark Corp. provides technical bulletins describing screening systeins for
detecting the
modulation of gene transcription, ligand binding, and the like.
[0115] The term "homolog" refers to a molecule which exhibits homology to
another
molecule, by for example, having sequences of chemical residues that are the
same or similar at
corresponding positions.
[0116] "Human Leukocyte Antigen" or "HLA" is a human class I or class II Major
Histocoinpatibility Complex (MHC) protein (see, e.g., Stites, et al.,
Immunology (8th Ed. 1994)
Lange Publishing, Los Altos, CA).
[0117] The terms "hybridize", "hybridizing", "hybridizes" and the like, used
in the context
of polynucleotides, are meant to refer to conventional hybridization
conditions, preferably such
as hybridization in 50% formamide/6XSSC/0.1% SDS/100 g/mi ssDNA, in which
temperatures for hybridization are above 37 degrees C and temperatures for
washing in
O.IXSSC/0.1% SDS are above 55 degrees C.
24
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0118] The phrases "isolated" or "biologically pure" refer to material which
is substantially
or essentially free from components which normally accompany the material as
it is found in its
native state. Thus, isolated peptides in accordance with the invention
preferably do not contain
materials normally associated with the peptides in their in situ environment.
For example, a
polynucleotide is said to be "isolated" when it is substantially separated
from contaminant
polynucleotides that correspond or are complementary to genes other than the
158P3D2 genes or
that encode polypeptides other than 158P3D2 gene product or fragments thereof.
A skilled
artisan can readily employ nucleic acid isolation procedures to obtain an
isolated 158P3D2
polynucleotide. A protein is said to be "isolated," for exainple, when
physical, mechanical or
chemical methods are employed to remove the 158P3D2 proteins from cellular
constituents that
are normally associated with the protein. A skilled artisan can readily employ
standard
purification methods to obtain an isolated 158P3D2 protein. Alternatively, an
isolated protein
can be prepared by chemical means.
[0119] The term "mammal" refers to any organism classified as a mammal,
including mice,
rats, rabbits, dogs, cats, cows, horses and humans. In one embodiment of the
invention, the
mammal is a mouse. In another embodiment of the invention, the mammal is a
human.
[0120] The terms "metastatic prostate cancer" and "inetastatic disease" mean
prostate
cancers that have spread to regional lylnph nodes or to distant sites, and are
meant to include
stage D disease under the AUA system and stage TxNxM+ under the TNM system. As
is the
case with locally advanced prostate cancer, surgery is generally not indicated
for patients with
metastatic disease, and hormonal (androgen ablation) therapy is a preferred
treatment modality.
Patients with metastatic prostate cancer eventually develop an androgen-
refractory state within
12 to 18 months of treatment initiation. Approximately half of these androgen-
refractory
patients die within 6 months after developing that status. The most common
site for prostate
cancer metastasis is bone. Prostate cancer bone metastases are often
osteoblastic rather than
osteolytic (i.e., resulting in net bone formation). Bone metastases are found
most frequently in
the spine, followed by the femur, pelvis, rib cage, skull and humerus. Other
common sites for
metastasis include lymph nodes, lung, liver and brain. Metastatic prostate
cancer is typically
diagnosed by open or laparoscopic pelvic lyinphadenectomy, whole body
radionuclide scans,
skeletal radiography, and/or bone lesion biopsy.
[0121] The term "modulator" or "test compound" or "drug candidate" or
grammatical
equivalents as used herein describe any molecule, e.g., protein, oligopeptide,
small organic
molecule, polysaccharide, polynucleotide, etc., to be tested for the capacity
to directly or
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
indirectly alter the cancer phenotype or the expression of a cancer sequence,
e.g., a nucleic acid
or protein sequences, or effects of cancer sequences (e.g., signaling, gene
expression, protein
interaction, etc.) In one aspect, a modulator will neutralize the effect of a
cancer protein of the
invention. By "neutralize" is meant that an activity of a protein is inhibited
or blocked, along
with the consequent effect on the cell. In another aspect, a modulator will
neutralize the =effect
of a gene, and its corresponding protein, of the invention by normalizing
levels of said protein.
In preferred embodiments, modulators alter expression profiles, or expression
profile nucleic
acids or proteins provided herein, or downstreain effector pathways. In one
embodiment, the
modulator suppresses a cancer phenotype, e.g., to a normal tissue fingerprint.
In another
embodiment, a modulator induced a cancer phenotype. Generally, a plurality of
assay mixtures
is run in parallel with different agent concentrations to obtain a
differential response to the
various concentrations. Typically, one of these concentrations serves as a
negative control, i.e.,
at zero concentration or below the level of detection.
[0122] Modulators, drug candidates or test compounds encompass numerous
chemical
classes, though typically they are organic molecules, preferably small organic
compounds
having a molecular weight of more than 100 and less than about 2,500 Daltons.
Preferred small
molecules are less than 2000, or less than 1500 or less than 1000 or less than
500 D. Candidate
agents coinprise functional groups necessary for structural interaction with
proteins, particularly
hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl
or carboxyl
group, preferably at least two of the functional chemical groups. The
candidate agents often
comprise cyclical carbon or heterocyclic structures and/or aromatic or
polyaromatic structures
substituted with one or more of the above functional groups. Modulators also
comprise
biomolecules such as peptides, saccharides, fatty acids, steroids, purines,
pyrimidines,
derivatives, structural analogs or combinations thereof. Particularly
preferred are peptides. One
class of modulators are peptides, for example of from about five to about 35
amino acids, with
from about five to about 20 amino acids being preferred, and from about 7 to
about 15 being
particularly preferred. Preferably, the cancer modulatory protein is soluble,
includes a non-
transmembrane region, and/or, has an N-terminal Cys to aid in solubility. In
one embodiment,
the C-terminus of the fragment is kept as a free acid and the N-terminus is a
free amine to aid in
coupling, i. e., to cysteine. In one embodiment, a cancer protein of the
invention is conjugated to
an immunogenic agent as discussed herein. In one embodiment, the cancer
protein is conjugated
to BSA. The peptides of the invention, e.g., of preferred lengths, can be
linked to each other or
to other amino acids to create a longer peptide/protein. The modulatory
peptides can be digests
26
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
of naturally occurring proteins as is outlined above, random peptides, or
"biased" random
peptides. In a preferred embodiment, peptide/protein-based modulators are
antibodies, and
fragments thereof, as defined herein.
[0123] Modulators of cancer can also be nucleic acids. Nucleic acid modulating
agents can
be naturally occurring nucleic acids, random nucleic acids, or "biased" random
nucleic acids.
For example, digests of prokaryotic or eukaryotic genomes can be used in an
approach
analogous to that outlined above for proteins.
[0124] The term "monoclonal antibody" refers to an antibody obtained from a
population of
substantially homogeneous antibodies, i.e., the antibodies comprising the
population are
identical except for possible naturally occurring mutations that are present
in minor,amounts.
[0125] A"inotif', as in biological motif of a 158P3D2-related protein, refers
to any pattern
of ainino acids forming part of the primary sequence of a protein, that is
associated with a
particular function (e.g., protein-protein interaction, protein-DNA
interaction, etc) or
modification (e.g., that is phosphorylated, glycosylated or amidated), or
localization (e.g.,
secretory sequence, nuclear localization sequence, etc.) or a sequence that is
correlated with
being immunogenic, either humorally or cellularly. A motif can be either
contiguous or capable
of being aligned to certain positions that are generally correlated with a
certain function or
property. In the context of HLA motifs, "inotif 'refers to the pattern of
residues in a peptide of
defined length, usually a peptide of from about 8 to about 13 amino acids for
a class I HLA
motif and from about 6 to about 25 amino acids for a class II HLA motif, which
is recognized by
a particular HLA molecule. Peptide motifs for HLA binding are typically
different for each
protein encoded by each human HLA allele and differ in the pattern of the
primary and
secondary anchor residues.
[0126] A"pharmaceutical excipient" comprises a material such as an adjuvant, a
carrier, pH-
adjusting and buffering agents, tonicity adjusting agents, wetting agents,
preservative, and the
like.
[0127] "Pharmaceutically acceptable" refers to a non-toxic, inert, and/or
composition that is
physiologically compatible with humans or other mammals.
[0128] The tenn "polynucleotide" means a polymeric form of nucleotides of at
least 10
bases or base pairs in length, either ribonucleotides or deoxynucleotides or a
modified form of
either type of nucleotide, and is meant to include single and double stranded
forms of DNA
and/or RNA. In the art, this term if often used interchangeably with
"oligonucleotide". A
polynucleotide can comprise a nucleotide sequence disclosed herein wherein
thymidine (T), as
27
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
shown for example in Figure 2, can also be uracil (U); this definition
pertains to the differences
between the chemical structures of DNA and RNA, in particular the observation
that one of the
four major bases in RNA is uracil (U) instead of thymidine (T).
[0129] The term "polypeptide" means a polymer of at least about 4, 5, 6, 7, or
8 amino
acids. Throughout the specification, standard three letter or single letter
designations for amino
acids are used. In the art, this term is often used interchangeably with
"peptide" or "protein".
[0130] An HLA "primary anchor residue" is an amino acid at a specific position
along a
peptide sequence which is understood to provide a contact point between the
immunogenic
peptide and the HLA molecule. One to three, usually two, primary anchor
residues within a
peptide of defined lengtli generally defines a"motif' for an immunogenic
peptide. These
residues are understood to fit in close contact with peptide binding groove of
an HLA molecule,
with their side chains buried in specific pockets of the binding groove. In
one embodiment, for
example, the primary anchor residues for an HLA class I molecule are located
at position 2
(from the amino terminal position) and at the carboxyl terminal position of a
8, 9, 10, 11, or 12
residue peptide epitope in accordance with the invention. Alternatively, in
another embodiinent,
the primary anchor residues of a peptide binds an HLA class II molecule are
spaced relative to
each other, rather than to the termini of a peptide, where the peptide is
generally of at least 9
amino acids in length. The primary anchor positions for each motif and
supermotif are set forth
in Table IV. For example, analog peptides can be created by altering the
presence or absence of
particular residues in the primary and/or secondary anchor positions shown in
Table IV. Such
analogs are used to modulate the binding affinity and/or population coverage
of a peptide
comprising a particular HLA motif or supermotif.
[0131] "Radioisotopes" include, but are not limited to the following (non-
limiting exemplary
uses are also set forth):
Examples of Medical Isotopes:
Isotope Describtion of use
Actinium-225 See Thorium-229 (Th-229)
(AC-225)
Actinium-227 Parent of Radium-223 (Ra-223) which is an alpha emitter
(AC-227) used to treat metastases in the skeleton resulting from
cancer (i.e., breast and prostate cancers), and cancer
radioimmunotherapy
Bismuth-212 See Thorium-228 (Th-228)
(Bi-212)
28
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Isotope Description of use
Bismuth-213 See Thorium-229 (Th-229)
(Bi-213)
Cadmium-109 Cancer detection
(Cd- 109)
Cobalt-60 Radiation source for radiotherapy of cancer, for food
(Co-60) irradiators, and for sterilization of medical supplies
Copper-64 A positron emitter used for cancer therapy and SPECT
(Cu-64) imaging
Copper-67 Beta/gamma emitter used in cancer radioimmunotherapy
(Cu-67) and diagnostic studies (i.e., breast and colon cancers, aild
lymphoma)
Dysprosium-166 Cancer radioimmunotherapy
(Dy-166)
Erbium-169 Rheumatoid arthritis treatment, particularly for the small
(Er-169) joints associated with fingers and toes
Europium-152 Radiation source for food irradiation and for sterilization of
(Eu-152) medical supplies ,
Europium-154 Radiation source for food irradiation and for sterilization of
(Eu-154) medical supplies
Gadolinium-153 Osteoporosis detection and nuclear medical quality
(Gd-153) assurance devices
Gold-198 Implant and intracavity therapy of ovarian, prostate, and
(Au-198) brain cancers,#
Holmiuin-166 Multiple myeloma treatment in targeted skeletal therapy,
(Ho-166) cancer radioimmunotherapy, bone marrow ablation, and
rheumatoid arthritis treatment
Iodine-125 Osteoporosis detection, diagnostic imaging, tracer drugs,
(1-125) brain cancer treatment, radiolabeling, tumor imaging,
mapping of receptors in the brain, interstitial radiation
therapy, brachytherapy for treatment of prostate cancer,
determination of glomerular filtration rate (GFR),
determination of plasma volume, detection of deep vein
thrombosis of the legs
Iodine-131 Thyroid function evaluation, thyroid disease detection,
(I-131) treatment of thyroid cancer as well as other non-malignant
thyroid diseases (i.e., Graves disease, goiters, and
hyperthyroidism), treatment of leukemia, lymphoma, and
other forms of cancer (e.g., breast cancer) using
radioimmunotherapy
Iridium-192 Brachytherapy, brain and spinal cord tumor treatment,
(Ir-192) treatment of blocked arteries (i.e., arteriosclerosis and
restenosis), and implants for breast and prostate tumors
1 29
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Isotope Description of use
Lutetium-177 Cancer radioimmunotherapy and treatment of blocked
(Lu-177) arteries (i.e., arteriosclerosis and restenosis)
Molybdenum-99 Parent of Technetium-99m (Tc-99m) which is used for
(Mo-99) imaging the brain, liver, lungs, heart, and other organs.
Currently, Tc-99m is the most widely used radioisotope
used for diagnostic imaging of various cancers and diseases
involving the brain, heart, liver, lungs; also used in
detection of deep vein thrombosis of the legs
Osmium-194 Cancer radioimmunotherapy
(Os-194)
Palladium- 103 Prostate cancer treatment
(Pd-103)
Platinuin-195m Studies on biodistribution and metabolism of cisplatin, a
(Pt-195m) chemotherapeutic drug
Phosphorus-32 Polycythemia rubra vera (blood cell disease) and leukemia
(P-32) treatment, bone cancer diagnosis/treatment; colon,
pancreatic, and liver cancer.treatment; radiolabeling
nucleic acids for in vitro research, diagnosis of superficial
tumors, treatment of blocked arteries (i.e., arteriosclerosis
and restenosis), and intracavity therapy
Phosphorus-33 Leukemia treatment, bone disease diagnosis/treatment,
(P-33) radiolabeling, and treatment of blocked arteries (i.e.,
arteriosclerosis and restenosis)
Radium-223 See Actinium-227 (Ac-227)
(Ra-223)
Rhenium-186 Bone cancer pain relief, rheumatoid arthritis treatment, and
(Re- 186) diagnosis and treatment of lymphoma and bone, breast,
colon, and liver cancers using radioimmunotherapy
Rhenium-188 Cancer diagnosis and treatment using radioimmunotherapy,
(Re-188) bone cancer pain relief, treatment of rheumatoid arthritis,
and treatment of prostate cancer
Rhodium-105 Cancer radioimmunotherapy
(Rh- 105)
Samarium-145 Ocular cancer treatinent
(Sm-145)
Samarium-153 Cancer radioimmunotherapy and bone cancer pain relief
(Sm-153)
Scandium-47 Cancer radioimmunotherapy and bone cancer pain relief
(Sc-47)
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Isotope Descrintion of use
Selenium-75 Radiotracer used in brain studies, imaging of adrenal
(Se-75) cortex by gamma-scintigraphy, lateral locations of steroid
secreting tumors, pancreatic scanning, detection of
hyperactive parathyroid glands, measure rate of bile acid
loss from the endogenous pool
Strontium-85 Bone cancer detection and brain scans
(Sr-85)
Strontium-89 Bone cancer pain relief, multiple myeloma treatment, and
(Sr-89) osteoblastic therapy
Technetium-99m See Molybdenum-99 (Mo-99)
(Tc-99m)
Thoriuin-228 Parent of Bismuth-212 (Bi-212) which is an alpha einitter
(Th-228) used in cancer radioimmunotherapy
Thorium-229 Parent of Actinium-225 (Ac-225) and grandparent of
(Th-229) Bismuth-213 (Bi-213) which are alpha emitters used in
cancer radioiinmunotherapy
Thulium-170 Gamma source for blood irradiators, energy source for
( Tm-l70) iinplanted medical devices
Tin-117m Cancer immunotherapy and bone cancer pain relief
(Sn-117m)
Tungsten-188 Parent for Rhenium-188 (Re-188) which is used for cancer
(W-188) diagnostics/treatment, bone cancer pain relief, rheumatoid
arthritis treatment, and treatment of blocked arteries (i.e.,
arteriosclerosis and restenosis)
Xenon-127 Neuroimaging of brain disorders, high resolution SPECT
(Xe-127) studies, pulmonary function tests, and cerebral blood flow
studies
Ytterbium- 175 Cancer radioimmunotherapy
(Yb-175)
Yttrium-90 Microseeds obtained from irradiating Yttrium-89 (Y-89)
(Y-90) for liver cancer treatment
Yttrium-91 A gamma-emitting label for Yttrium-90 (Y-90) which is
(Y-91) used for cancer radioimmunotherapy (i.e., lymphoma,
breast, colon, kidney, lung, ovarian, prostate, pancreatic,
and inoperable liver cancers)
[0132] By "randomized" or grammatical equivalents as herein applied to nucleic
acids and
proteins is meant that each nucleic acid and peptide consists of essentially
random nucleotides
and amino acids, respectively. These random peptides (or nucleic acids,
discussed herein) can
incorporate any nucleotide or amino acid at any position. The synthetic
process can be designed
31
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
to generate randomized proteins or nucleic acids, to allow the formation of
all or most of the
possible combinations over the length of the sequence, thus forming a library
of randomized
candidate bioactive proteinaceous agents.
[0133] In one embodiment, a library is "fully randomized," with no sequence
preferences or
constants at any position. In another embodiment, the library is a "biased
randoin" library. That
is, some positions within the sequence either are held constant, or are
selected from a limited
number of possibilities. For example, the nucleotides or amino acid residues
are randomized
within a defined class, e.g., of hydrophobic amino acids, hydrophilic
residues, sterically biased
(either small or large) residues, towards the creation of nucleic acid binding
domains, the
creation of cysteines, for cross-linking, prolines for SH-3 domains, serines,
threonines, tyrosines
or histidines for phosphorylation sites, etc., or to purines, etc.
[0134] A "recombinant" DNA or RNA molecule is a DNA or RNA molecule that has
been
subjected to molecular manipulation in vitro.
[0135] Non-limiting examples of small molecules include compounds that bind or
interact
with 158P3D2, ligands including horinones, neuropeptides, chemokines,
odorants,
phospholipids, and functional equivalents thereof that bind and preferably
inhibit 158P3D2
protein function. Such non-limiting small molecules preferably have a
molecular weight of less
than about 10 kDa, more preferably below about 9, about 8, about 7, about 6,
about 5 or about 4
kDa. In certain embodiments, small molecules physically associate with, or
bind, 158P3D2
protein; are not found in naturally occurring metabolic pathways; and/or are
more soluble in
aqueous than non-aqueous solutions
[0136] "Stringency" of hybridization reactions is readily determinable by one
of ordinary
skill in the art, and generally is an empirical calculation dependent upon
probe length, washing
temperature, and salt concentration. In general, longer probes require higher
temperatures for
proper annealing, while shorter probes need lower temperatures. Hybridization
generally
depends on the ability of denatured nucleic acid sequences to reanneal when
complementary
strands are present in an enviromnent below their melting temperature. The
higher the degree of
desired homology between the probe and hybridizable sequence, the higher the
relative
temperature that can be used. As a result, it follows that higher relative
temperatures would tend
to make the reaction conditions more stringent, while lower temperatures less
so. For additional
details and explanation of stringency of hybridization reactions, see Ausubel
et al., Current
Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
32
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0137] "Stringent conditions" or "high stringency conditions", as defined
herein, are
identified by, but not limited to, those that: (1) employ low ionic strength
and high temperature
for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1 %
sodium
dodecyl sulfate at 50oC; (2) employ during hybridization a denaturing agent,
such as formamide,
for example, 50% (v/v) formamide with 0.1 % bovine seruin albumin/0.1 %
Ficoll/0.1 %
polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM
sodium chloride,
75 mM sodium citrate at 42 oC; or (3) employ 50% formamide, 5 x SSC (0.75 M
NaC1, 0.075 M
sodiuin citrate), 50 mM sodium phosphate (pH 6.8), 0.1 % sodium pyrophosphate,
5 x Denhardt's
solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS, and 10% dextran
sulfate at 42
oC, with washes at 42oC in 0.2 x SSC (sodium chloride/sodium. citrate) and 50%
formamide at
55 oC, followed by a high-stringency wash consisting of 0.1 x SSC containing
EDTA at 55 oC.
"Moderately stringent conditions" are described by, but not limited to, those
in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press,
1989, and
include the use of washing solution and hybridization conditions (e.g.,
temperature, ionic
strength and %SDS) less stringent than those described above. An example of
moderately
stringent conditions is overnight incubation at 37oC in a solution comprising:
20% fonnamide, 5
x SSC (150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6),
5 x
Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared
salmon spenn DNA,
followed by washing the filters in 1 x SSC at about 37-5OoC. The skilled
artisan will recognize
how to adjust the temperature, ionic strength, etc. as necessary to
accommodate factors such as
probe length and the like.
[0138] An HLA "supermotif' is a peptide binding specificity shared by HLA
molecules
encoded by two or more HLA alleles. Overall phenotypic frequencies of HLA-
supertypes in
different ethnic populations are set forth in Table IV (F). The non-limiting
constituents of
various supetypes are as follows:
A2: A*0201, A*0202, A*0203, A*0204, A* 0205, A*0206, A*6802, A*6901, A*0207
A3: A3, A1l, A31, A*3301, A*6801, A*0301, A*1101, A*3101
B7: B7, B*3501-03, B*5l, B*5301, B*5401, B*5501, B*5502, B*5601, B*6701,
B*7801,
B*0702, B*5101, B*5602
B44: B*3701, B*4402, B*4403, B*60 (B*4001), B61 (B*4006)
Al: A*0102, A*2604, A*3601, A*4301, A*8001
A24: A*24, A*30, A*2403, A*2404, A*3002, A*3003
33
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
B27: B*1401-02, B*1503, B*1509, B*1510, B*1518, B*3801-02, B*3901, B*3902,
B*3903-04, B*4801-02, B*7301, B*2701-08
B58: B*1516, B*1517, B*5701, B*5702, B58
B62: B*4601, B52, B*1501 (B62), B*1502 (B75), B*1513 (B77)
[0139] Calculated population coverage afforded by different HLA-supertype
combinations
are set forth in Table IV (G).
[0140] As used herein "to treat" or "therapeutic" and grammatically related
terms, refer to
any improveinent of any consequence of disease, such as prolonged survival,
less morbidity,
and/or a lessening of side effects which are the byproducts of an alternative
therapeutic
modality; full eradication of disease is not required.
[0141] A "transgenic animal" (e.g., a mouse or rat) is an animal having cells
that contain a
transgene, which transgene was introduced into the animal or an ancestor of
the animal at a
prenatal, e.g., an einbryonic stage. A "transgene" is a DNA that is integrated
into the genome of
a cell from which a transgenic animal develops.
[0142] As used herein, an HLA or cellular immune response "vaccine" is a
composition that
contains or encodes one or more peptides of the invention. There are nuinerous
embodiments of
such vaccines, such as a cocktail of one or more individual peptides; one or
more peptides of the
invention comprised by a polyepitopic peptide; or nucleic acids that encode
such individual
peptides or polypeptides, e.g., a minigene that encodes a polyepitopic
peptide. The "one or
more peptides" can include any whole unit integer from 1-150 or more, e.g., at
least 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95,
100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 or more peptides of
the invention. The
peptides or polypeptides can optionally be modified, such as by lipidation,
addition of targeting
or other sequences. HLA class I peptides of the invention can be admixed with,
or linked to,
HLA class II peptides, to facilitate activation of both cytotoxic T
lymphocytes and helper T
lymphocytes. HLA vaccines can also comprise peptide-pulsed antigen presenting
cells, e.g.,
dendritic cells.
[0143] The term "variant" refers to a molecule that exhibits a variation from
a described type
or norm, such as a protein that has one or more different amino acid residues
in the
corresponding position(s) of a specifically described protein (e.g., the
158P3D2 protein shown in
Figure 2 or Figure 3. An analog is an example of a variant protein. Splice
isoforms and single
nucleotides polymorphisms (SNPs) are further examples of variants.
34
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0144] The "158P3D2-related proteins" of the invention include those
specifically identified
herein, as well as allelic variants, conservative substitution variants,
analogs and homologs that
can be isolated/generated and characterized without undue experimentation
following the
methods outlined herein or readily available in the art. Fusion proteins that
combine parts of
different 158P3D2 proteins or fragments thereof, as well as fusion proteins of
a 158P3D2
protein and a heterologous polypeptide are also included. Such 158P3D2
proteins are
collectively referred to as the 158P3D2-related proteins, the proteins of the
invention, or
158P3D2. The term "158P3D2-related protein" refers to a polypeptide fiagment
or a 158P3D2
protein sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25,
or more than 25 amino acids; or, at least 30, 35, 40, 45, 50, 55, 60, 65, 70,
80, 85, 90, 95, 100,
105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175,
180, 185, 190, 195,
200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550,
575, or 576 or more
amino acids.
II.) 158P3D2 POLYNUCLEOTIDES
[0145] One aspect of the invention provides polynucleotides corresponding or
coinplementary to all or part of a 158P3D2 gene, mRNA, and/or coding sequence,
preferably in
isolated form, including polynucleotides encoding a 158P3D2-related protein
and fragments
thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or
oligonucleotides complementary to a 158P3D2 gene or mRNA sequence or a part
thereof, and
polynucleotides or oligonucleotides that hybridize to a 158P3D2 gene, mRNA, or
to a 158P3D2
encoding polynucleotide (collectively, "158P3D2 polynucleotides"). In all
instances when
referred to in this section, T can also be U in Figure 2.
[0146] Embodiments of a 158P3D2 polynucleotide include: a 158P3D2
polynucleotide
having the sequence shown in Figure 2, the nucleotide sequence of 158P3D2 as
shown in Figure
2 wherein T is U; at least 10 contiguous nucleotides of a polynucleotide
having the sequence as
shown in Figure 2; or, at least 10 contiguous nucleotides of a polynucleotide
having the
sequence as shown in Figure 2 where T is U. For example, embodiments of
158P3D2
nucleotides comprise, without limitation:
(I) a polynucleotide comprising, consisting essentially of, or consisting of a
sequence as shown in Figure 2, wherein T can also be U;
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
(II) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2A, from nucleotide residue number 849 through
nucleotide
residue number 1835, including the stop codon, wherein T can also be U;
(III) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2B, from nucleotide residue number 117 through
nucleotide
residue number 827, including the stop codon, wherein T can also be U;
(IV) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2C, from nucleotide residue number 2249 through
nucleotide
residue number 2794, including the a stop codon, wherein T can also be U;
(V) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2D, from nucleotide residue number 849 through
nucleotide
residue number 1835, including the stop codon, wherein T can also be U;
(VI) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2E, from nucleotide residue number 849 through
nucleotide
residue number 1835, including the stop codon, wherein T can also be U;
(VII) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2F, from nucleotide residue number 849 through
nucleotide residue
number 1835, including the stop codon, wherein T can also be U;
(VIII) a polynucleotide comprising, consisting essentially of, or consisting
of the
sequence as shown in Figure 2G, from nucleotide residue number 1289 through
nucleotide
residue number 1834, including the stop codon, wherein T can also be U;
(IX) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2H, from nucleotide residue number 849 through
nucleotide
residue number 1835, including the stop codon, wherein T can also be U;
(X) a polynucleotide coinprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 21, from nucleotide residue number 849 through
nucleotide residue
number 1835, including the stop codon, wherein T can also be U;
(XI) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2J, from nucleotide residue number 849 through
nucleotide residue
number 1835, including the stop codon, wherein T can also be U;
(XII) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2K, from nucleotide residue number 65 through
nucleotide residue
number 4246, including the stop codon, wherein T can also be U;
36
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
(XIII) a polynucleotide comprising, consisting essentially of, or consisting
of the
sequence as shown in Figure 2L, from nucleotide residue number 65 through
nucleotide residue
number 3502, including the stop codon, wherein T can also be U;
(XIV) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2M, from nucleotide residue number 65 through
nucleotide residue
number 6037, including the stop codon, wherein T can also be U;
(XV) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 2N, from nucleotide residue nuinber 65 through
nucleotide residue
number 6175, including the stop codon, wherein T can also be U;
(XVI) a polynucleotide comprising, consisting essentially of, or consisting of
the
sequence as shown in Figure 20, from nucleotide residue number 2932 through
nucleotide
residue number 4764, including the stop codon, wherein T can also be U;
(XVII) a polynucleotide comprising, consisting essentially of, or consisting
of the
sequence as shown in Figure 2P, from nucleotide residue number 65 through
nucleotide residue
number 6001, including the stop codon, wherein T can also be U;
(XVIII) a polynucleotide comprising, consisting essentially of, or consisting
of the
sequence as shown in Figure 2Q, from nucleotide residue number 65 through
nucleotide residue
number 6121, including the stop codon, wherein T can also be U;
(XIX) a polynucleotide that encodes a 158P3D2-related prote'in that is at
least 90, 91,
92, 93, 94, 95, 96, 97, 98, 99 or 100% homologous to an entire amino acid
sequence shown in
Figure 2A-Q;
(XX) a polynucleotide that encodes a 158P3D2-related protein that is at least
90, 91,
92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to an entire amino acid
sequence shown in
Figure 2A-Q;
(XXI) a polynucleotide that encodes at least one peptide set forth in Tables
VIII-XXI
and XXII-XLIX;
(XXII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8,
9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35 amino
acids of a peptide of Figures 3A-3R in any whole number increment up to 328,
236, 181, 178,
181, 1393, 1145, 1990, 2036, 610, 1978, and 2018 that includes at least 1, 2,
3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35
amino acid position(s) having a value greater than 0.5 in the Hydrophilicity
profile of Figure 5;
37
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
(XXIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8,
9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35 amino
acids of a peptide of Figures 3A-3R in any whole number increment up to 328,
236, 181, 178,
181, 1393, 1145, 1990, 2036, 610, 1978, and 2018 that includes 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35 amino
acid position(s) having a value less than 0.5 in the Hydropathicity profile of
Figure 6;
(XXIV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8,
9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35 amino
acids of a peptide of Figures 3A-3R in any whole number increment up to 328,
236, 181, 178,
181, 1393, 1145, 1990, 2036, 610, 1978, and 2018 that includes 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35 amino
acid position(s) having a value greater than 0.5 in the Percent Accessible
Residues profile of
Figure 7;
(XXV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8,
9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35 amino
acids of a peptide of Figure 3A-3R in any whole nuinber increinent up to 328,
236, 181, 178,
181, 1393, 1145, 1990, 2036, 610, 1978, and 2018 that includes 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35 amino
acid position(s) having a value greater than 0.5 in the Average Flexibility
profile of Figure 8;
(XXVI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8,
9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35 amino
acids of a peptide of Figure 3A-3R in any whole number increment up to 328,
236, 181, 178,
181, 1393, 1145, 1990, 2036, 610, 1978, and 2018 that includes 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35 amino
acid position(s) having a value greater than 0.5 in the Beta-turn profile of
Figure 9;
(XXVII) a polynucleotide that is fully complementary to a polynucleotide of
any one of
(I)-(XXVI);
(XXVIII) a polynucleotide that is fully complementary to a polynucleotide of
any one of
(I)-(XXVII);
(XXIX) a peptide that is encoded by any of (I) to (XXVIII); and;
(XXX) a composition comprising a polynucleotide of any of (I)-(XXVIII) or
peptide of
(XXIX) together with a pharmaceutical excipient and/or in a human unit dose
form;
38
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
(XXXI) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of
(XXIX) or
a composition of (XXX) in a method to modulate a cell expressing 158P3D2;
(XXXII) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of
(XXIX) or
a composition of (XXX) in a method to diagnose, prophylax, prognose, or treat
an individual
who bears a cell expressing 158P3D2;
(XXIII) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of
(XXIX) or
a composition of (XXX) in a method to diagnose, prophylax, prognose, or treat
an individual
who bears a cell expressing 158P3D2, said cell from a cancer of a tissue
listed in Table I;
(XXXIV) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of
(XXIX) or
a composition of (XXX) in a method to diagnose, prophylax, prognose, or treat
a a cancer;
(XXXV) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of
(XXIX) or
a composition of (XXX) in a method to diagnose, prophylax, prognose, or treat
a a cancer of a
tissue listed in Table I; and;
(XXXVI) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of
(XXIX) or
a composition of (XXX) in a method to identify or characterize a modulator of
a cell expressing
158P3D2.
[0147] As used herein, a range is understood to disclose specifically all
whole unit positions
thereof.
[0148] Typical embodiments of the invention disclosed herein include 158P3D2
polynucleotides that encode specific portions of 158P3D2 mRNA sequences (and
those which
are complementary to such sequences) such as those that encode the proteins
and/or fragments
thereof, for example:
(a) 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130,
135, 140, 145, 150, 155,
160, 165, 170, 175, 180, 185, 190, 195, 200, 225, 250, 255, 260, 265, 270,
275, 280, 285, 290,
295, 300, 305, 310, 315, 320, 325 and 328 or more contiguous amino acids of
158P3D2 variant
1; the maximal lengths relevant for other variants are shown in Figures 2A-2Q
and 3A-3R
respectively.
[0149] For example, representative embodiments of the invention disclosed
herein include:
polynucleotides and their encoded peptides themselves encoding about amino
acid 1 to about
amino acid 10 of the 158P3D2 protein shown in Figure 2 or Figure 3,
polynucleotides encoding
about amino acid 10 to about amino acid 20 of the 158P3D2 protein shown in
Figure 2 or Figure
3, polynucleotides encoding about amino acid 20 to about amino acid 30 of the
158P3D2 protein
39
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 30 to
about amino
acid 40 of the 158P3D2 protein shown in Figure 2 or Figure 3, polynucleotides
encoding about
amino acid 40 to about amino acid 50 of the 158P3D2 protein shown in Figure 2
or Figure 3,
polynucleotides encoding about amino acid 50 to about amino acid 60 of the
158P3D2 protein
shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 60 to
about amino
acid 70 of the 158P3D2 protein shown in Figure 2 or Figure 3, polynucleotides
encoding about
amino acid 70 to about amino acid 80 of the 158P3D2 protein shown in Figure 2
or Figure 3,
polynucleotides encoding about amino acid 80 to about amino acid 90 of the
158P3D2 protein
shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 90 to
about amino
acid 100 of the 158P3D2 protein shown in Figure 2 or Figure 3, in increments
of about 10 amino
acids, ending at the carboxyl terminal amino acid set forth in Figure 2 or
Figure 3. Accordingly,
polynucleotides encoding portions of the amino acid sequence (of about 10
amino acids), of
amino acids, 100 through the carboxyl terminal amino acid of the 158P3D2
protein are
embodiments of the invention. Wherein it is understood that each particular
amino acid position
discloses that position plus or minus five amino acid residues.
[0150] Polynucleotides encoding relatively long portions of a 158P3D2 protein
are also
within the scope of the invention. For example, polynucleotides encoding from
about amino
acid 1(or 20 or 30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50
etc.) of the 158P3D2
protein "or variant" shown in Figare 2 or Figure 3 can be generated by a
variety of techniques
well known in the art. These polynucleotide fragments can include any portion
of the 158P3D2
sequence as shown in Figure 2.
[0151] Additional illustrative einbodiments of the invention disclosed herein
include
158P3D2 polynucleotide fragments encoding one or more of the biological motifs
contained
within a 158P3D2 protein "or variant" sequence, including one or more of the
motif-bearing
subsequences of a 158P3D2 protein "or variant" set forth in Tables VIII-XXI
and XXII-XLIX.
In another embodiment, typical polynucleotide fragments of the invention
encode one or more
of the regions of 158P3D2 protein or variant that exhibit homology to a known
molecule. In
another embodiment of the invention, typical polynucleotide fragments can
encode one or more
of the 158P3D2 protein or variant N-glycosylation sites, cAMP and cGMP-
dependent protein
kinase phosphorylation sites, casein kinase II phosphorylation sites or N-
myristoylation site and
amidation sites.
[0152] Note that to determine the starting position of any peptide set forth
in Tables VIII-
XXI and Tables XXII to XLIX (collectively HLA Peptide Tables) respective to
its parental
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
protein, e.g., variant 1, variant 2, etc., reference is made to three factors:
the particular variant,
the length of the peptide in an HLA Peptide Table, and the Search Peptides
listed in Table VII.
Generally, a unique Search Peptide is used to obtain HLA peptides for a
particular variant. The
position of each Search Peptide relative to its respective parent molecule is
listed in Table VII.
Accordingly, if a Search Peptide begins at position "X", one must add the
value "X minus 1" to
each position in Tables VIII-XXI and Tables XXII-IL to obtain the actual
position of the HLA
peptides in their parental molecule. For example if a particular Search
Peptide begins at position
150 of its parental molecule, one must add 150 - 1, i.e., 149 to each HLA
peptide amino acid
position to calculate the position of that amino acid in the parent molecule.
II.A.) Uses of 158P3D2 Polynucleotides
II.A. 1. Monitoring of Genetic Abnormalities
[0153] The polynucleotides of the preceding paragraphs have a number of
different specific
uses. The huinan 158P3D2 gene maps to the chromosomal location set forth in
the Exainple
entitled "Chromosomal Mapping of 158P3D2." For example, because the 158P3D2
gene maps
to this chromosome, polynucleotides that encode different regions of the
158P3D2 proteins are
used to characterize cytogenetic abnormalities of this chromosoinal locale,
such as abnormalities
that are identified as being associated with various cancers. In certain
genes, a variety of
chromosomal abnormalities including rearrangements have been identified as
frequent
cytogenetic abnormalities in a number of different cancers (see e.g.,
Krajinovic et al., Mutat.
Res. 382(3-4): 81-83 (1998); Johansson et al., Blood 86(10): 3905-3914 (1995)
and Finger et
al., P.N.A.S. 85(23): 9158-9162 (1988)). Thus, polynucleotides encoding
specific regions of the
158P3D2 proteins provide new tools that can be used to delineate, with greater
precision than
previously possible, cytogenetic abnormalities in the chromosomal region that
encodes 158P3D2
that may contribute to the malignant phenotype. In this context, these
polynucleotides satisfy a
need in the art for expanding the sensitivity of chromosomal screening in
order to identify more
subtle and less common chromosomal abnormalities (see e.g., Evans et al., Am.
J. Obstet.
Gynecol 171(4): 1055-1057 (1994)).
[0154] Furthermore, as 158P3D2 was shown to be highly expressed in prostate
and other
cancers, 158P3D2 polynucleotides are used in methods assessing the status of
158P3D2 gene
products in normal versus cancerous tissues. Typically, polynucleotides that
encode specific
regions of the 158P3D2 proteins are used to assess the presence of
perturbations (such as
deletions, insertions, point mutations, or alterations resulting in a loss of
an antigen etc.) in
specific regions of the 158P3D2 gene, such as regions containing one or more
motifs.
41
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Exemplary assays include both RT-PCR assays as well as single-strand
conformation
polymorphism (SSCP) analysis (see, e.g., Marrogi et al., J. Cutan. Pathol.
26(8): 369-378
(1999), both of which utilize polynucleotides encoding specific regions of a
protein to examine
these regions within the protein.
II.A.2. Antisense Embodiments
[0155] Other specifically contemplated nucleic acid related embodiments of the
invention
disclosed herein are genomic DNA, cDNAs, ribozymes, and antisense molecules,
as well as
nucleic acid molecules based on an alternative backbone, or including
alternative bases, whether
derived from natural sources or synthesized, and include molecules capable of
inhibiting the
RNA or protein expression of 158P3D2. For example, antisense molecules can be
RNAs or
other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid
molecules such as
phosphorothioate derivatives that specifically bind DNA or RNA in a base pair-
dependent
manner. A skilled artisan can readily obtain these classes of nucleic acid
molecules using the
158P3D2 polynucleotides and polynucleotide sequences disclosed herein.
[0156] Antisense technology entails the administration of exogenous
oligonucleotides that
bind to a target polynucleotide located within the cells. The term "antisense"
refers to the fact
that such oligonucleotides are complementary to their intracellular targets,
e.g., 158P3D2. See
for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene
Expression,
CRC Press, 1989; and Synthesis 1:1-5 (1988). The 158P3D2 antisense
oligonucleotides of the
present invention include derivatives such as S-oligonucleotides
(phosphorothioate derivatives
or S-oligos, see, Jack Cohen, supra), which exhibit enhanced cancer cell
growth inhibitory
action. S-oligos (nucleoside phosphorothioates) are isoelectronic analogs of
an oligonucleotide
(0-oligo) in which a nonbridging oxygen atom of the phosphate group is
replaced by a sulfur
atom. The S-oligos of the present invention can be prepared by treatment of
the corresponding
0-oligos with 3H-1,2-benzodithiol-3-one-l,1-dioxide, which is a sulfur
transfer reagent. See,
e.g., Iyer, R. P. et al., J. Org. Chem. 55:4693-4698 (1990); and Iyer, R. P.
et al., J. Am. Chem.
Soc. 112:1253-1254 (1990). Additional 158P3D2 antisense oligonucleotides of
the present
invention include morpholino antisense oligonucleotides known in the art (see,
e.g., Partridge et
al., 1996, Antisense & Nucleic Acid Drug Development 6: 169-175).
[0157] The 158P3D2 antisense oligonucleotides of the present invention
typically can be
RNA or DNA that is complementary to and stably hybridizes with the first 100
5' codons or last
100 3' codons of a 158P3D2 genomic sequence or the corresponding mRNA.
Absolute
complementarity is not required, although high degrees of complementarity are
preferred. Use
42
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
of an oligonucleotide complementary to this region allows for the selective
hybridization to
158P3D2 mRNA and not to mRNA specifying other regulatory subunits of protein
kinase. In
one embodiment, 158P3D2 antisense oligonucleotides of the present invention
are 15 to 30-mer
fraginents of the antisense DNA molecule that have a sequence that hybridizes
to 158P3D2
mRNA. Optionally, 158P3D2 antisense oligonucleotide is a 30-mer
oligonucleotide that is
complementary to a region in the first 10 5' codons or last 10 3' codons of
158P3D2.
Alternatively, the antisense molecules are modified to employ ribozyines in
the inhibition of
158P3D2 expression, see, e.g., L. A. Couture & D. T. Stinchcomb; Trends Genet
12: 510-515
(1996).
II.A.3. Primers and Primer Pairs
[0158] Further specific embodiments of these nucleotides of the invention
include primers
and primer pairs, which allow the specific amplification of polynucleotides of
the invention or of
any specific parts thereof, and probes that selectively or specifically
hybridize to nucleic acid
molecules of the invention or to any part thereof. Probes can be labeled with
a detectable
marker, such as, for example, a radioisotope, fluorescent compound,
bioluininescent compound,
a chemiluminescent compound, metal chelator or enzyme. Such probes and primers
are used to
detect the presence of a 158P3D2 polynucleotide in a sample and as a means for
detecting a cell
expressing a 158P3D2 protein.
[0159] Examples of such probes include polypeptides comprising all or part of
the human
158P3D2 cDNA sequence shown in Figure 2. Examples of primer pairs capable of
specifically
amplifying 158P3D2 mRNAs are also described in the Exainples. As will be
understood by the
skilled artisan, a great many different primers and probes can be prepared
based on the
sequences provided herein and used effectively to amplify and/or detect a
158P3D2 inRNA.
[0160] The 158P3D2 polynucleotides of the invention are useful for a variety
of purposes,
including but not limited to their use as probes and primers for the
amplification and/or detection
of the 158P3D2 gene(s), mRNA(s), or fragments thereof; as reagents for the
diagnosis and/or
prognosis of prostate cancer and other cancers; as coding sequences capable of
directing the
expression of 158P3D2 polypeptides; as tools for modulating or inhibiting the
expression of the
158P3D2 gene(s) and/or translation of the 158P3D2 transcript(s); and as
therapeutic agents.
[0161] The present invention includes the use of any probe as described herein
to identify
and isolate a 158P3D2 or 158P3D2 related nucleic acid sequence from a
naturally occurring
source, such as humans or other mammals, as well as the isolated nucleic acid
sequence per se,
which would comprise all or most of the sequences found in the probe used.
43
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
II.A.4. Isolation of 158P3D2-Encoding Nucleic Acid Molecules
[0162] The 158P3D2 cDNA sequences described herein enable the isolation of
other
polynucleotides encoding 158P3D2 gene product(s), as well as the isolation of
polynucleotides
encoding 158P3D2 gene product homologs, alternatively spliced isoforms,
allelic variants, and
mutant forms of a 158P3D2 gene product as well as polynucleotides that encode
analogs of
158P3D2-related proteins. Various molecular cloning methods that can be
employed to isolate
full length cDNAs encoding a 158P3D2 gene are well known (see, for example,
Sambrook, J. et
al., Molecular Cloning: A Laboratory Manual, 2d edition, Cold Spring Harbor
Press, New
York, 1989; Current Protocols in Molecular Biology. Ausubel et al., Eds.,
Wiley and Sons,
1995). For example, lambda phage cloning methodologies can be conveniently
employed, using
commercially available cloning systems (e.g., Lambda ZAP Express, Stratagene).
Phage clones
containing 158P3D2 gene cDNAs can be identified by probing with a labeled
158P3D2 cDNA
or a fragment thereof. For example, in one embodiinent, a 158P3D2 cDNA (e.g.,
Figure 2) or a
portion thereof can be synthesized and used as a probe to retrieve overlapping
and full-length
cDNAs corresponding to a 158P3D2 gene. A 158P3D2 gene itself can be isolated
by screening
genomic DNA libraries, bacterial artificial chromosome libraries (BACs), yeast
artificial
chromosome libraries (YACs), and the like, with 158P3D2 DNA probes or primers.
II.A.5. Recombinant Nucleic Acid Molecules and Host-Vector Systems
[0163] The invention also provides recombinant DNA or RNA molecules containing
a
158P3D2 polynucleotide, a fragment, analog or homologue thereof, including but
not limited to
phages, plasmids, phagemids, cosmids, YACs, BACs, as well as various viral and
non-viral
vectors well known in the art, and cells transformed or transfected with such
recombinant DNA
or RNA molecules. Methods for generating such molecules are well known (see,
for example,
Sambrook et al., 1989, supra).
[0164] The invention further provides a host-vector system comprising a
recombinant DNA
molecule containing a 158P3D2 polynucleotide, fragment, analog or homologue
thereof within a
suitable prokaryotic or eukaryotic host cell. Examples of suitable eukaryotic
host cells include a
yeast cell, a plant cell, or an animal cell, such as a maininalian cell or an
insect cell (e.g., a
baculovirus-infectible cell such as an Sf9 or HighFive cell). Examples of
suitable mammalian
cells include various prostate cancer cell lines such as DU145 and TsuPrl,
other transfectable or
transducible prostate cancer cell lines, primary cells (PrEC), as well as a
number of mammalian
cells routinely used for the expression of recombinant proteins (e.g., COS,
CHO, 293, 293T
cells). More particularly, a polynucleotide comprising the coding sequence of
158P3D2 or a
44
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
fragment, analog or homolog thereof can be used to generate 158P3D2 proteins
or fragments
thereof using any number of host-vector systems routinely used and widely
known in the art.
[0165] A wide range of host-vector systems suitable for the expression of
158P3D2 proteins
or fragments thereof are available, see for example, Sambrook et al., 1989,
supra; Current
Protocols in Molecular Biology, 1995, supra). Preferred vectors for mammalian
expression
include but are not limited to peDNA 3.1 myc-His-tag (Invitrogen) and the
retroviral vector
pSRatkneo (Muller et al., 1991, MCB 11:1785). Using these expression vectors,
158P3D2 can
be expressed in several prostate cancer and non-prostate cell lines, including
for example 293,
293T, rat-1, NIH 3T3 and TsuPrl. The host-vector systems of the invention are
useful for the
production of a 158P3D2 protein or fraginent thereof. Such host-vector systems
can be
employed to study the functional properties of 158P3D2 and 158P3D2 mutations
or analogs.
[0166] Recombinant huinan 158P3D2 protein or an analog or homolog or fragment
thereof
can be produced by inammalian cells transfected with a construct encoding a
158P3D2-related
nucleotide. For example, 293T cells can be transfected with an expression
plasinid encoding
158P3D2 or fragment, analog or homolog thereof, a 158P3D2-related protein is
expressed in the
293T cells, and the recombinant 158P3D2 protein is isolated using standard
purification
methods (e.g., affinity purification using anti-158P3D2 antibodies). In
another einbodiment, a
158P3D2 coding sequence is subcloned into the retroviral vector pSRaMSVtkneo
and used to
infect various mammalian cell lines, such as NIH 3T3, TsuPrl, 293 and rat-1 in
order to
establish 158P3D2 expressing cell lines. Various other expression systems well
known in the art
can also be employed. Expression constructs encoding a leader peptide joined
in frame to a
158P3D2 coding sequence can be used for the generation of a secreted form of
recombinant
158P3D2 protein.
[0167] As discussed herein, redundancy in the genetic code permits variation
in 158P3D2
gene sequences. In particular, it is known in the art that specific host
species often have specific
codon preferences, and thus one can adapt the disclosed sequence as preferred
for a desired host.
For example, preferred analog codon sequences typically have rare codons
(i.e., codons having a
usage fiequency of less than about 20% in known sequences of the desired host)
replaced with
higher frequency codons. Codon preferences for a specific species are
calculated, for example,
by utilizing codon usage tables available on the INTERNET such as at URL
dna. affrc. go. jp/-nakamura/codon.html.
[0168] Additional sequence modifications are known to enhance protein
expression in a
cellular host. These include elimination of sequences encoding spurious
polyadenylation
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
signals, exon/intron splice site signals, transposon-like repeats, and/or
other such well-
characterized sequences that are deleterious to gene expression. The GC
content of the sequence
is adjusted to levels average for a given cellular host, as calculated by
reference to known genes
expressed in the host cell. Where possible, the sequence is modified to avoid
predicted hairpin
secondary mRNA structures. Other useful modifications include the addition of
a translational
initiation consensus sequence at the start of the open reading frame, as
described in Kozak, Mol.
Cell Biol., 9:5073-5080 (1989). Skilled artisans understand that the general
rule that eukaryotic
ribosomes initiate translation exclusively at the 5' proximal AUG codon is
abrogated only under
rare conditions (see, e.g., Kozak PNAS 92(7): 2662-2666, (1995) and Kozak NAR
15(20):
8125-8148 (1987)).
III.) 158P3D2-RELATED PROTEINS
[0169] Another aspect of the present invention provides 158P3D2-related
proteins. Specific
embodiments of 158P3D2 proteins comprise a polypeptide having all or part of
the amino acid
sequence of human 158P3D2 as shown in Figure 2 or Figure 3. Alternatively,
embodiments of
158P3D2 proteins coinprise variant, homolog or analog polypeptides that have
alterations in the
amino acid sequence of 158P3D2 shown in Figure 2 or Figure 3.
[0170] Embodiments of a 158P3D2 polypeptide include: a 158P3D2 polypeptide
having a
sequence shown in Figure 2, a peptide sequence of a 158P3D2 as shown in Figure
2 wherein T
is U; at least 10 contiguous nucleotides of a polypeptide having the sequence
as shown in Figure
2; or, at least 10 contiguous peptides of a polypeptide having the sequence as
shown in Figure 2
where T is U. For example, embodiments of 158P3D2 peptides comprise, without
limitation:
(I) a protein coinprising, consisting essentially of, or consisting of an
amino acid
sequence as shown in Figure 2A-Q or Figure 3A-3R;
(II) a 158P3D2-related protein that is at least 90, 91, 92, 93, 94, 95, 96,
97, 98, 99 or
100% homologous to an entire amino acid sequence shown in Figure 2A-Q or 3A-R;
(III) a 158P3D2-related protein that is at least 90, 91, 92, 93, 94, 95, 96,
97, 98, 99 or
100% identical to an entire amino acid sequence shown in Figure 2A-Q or 3A-R;
(IV) a protein that comprises at least one peptide set forth in Tables VIII to
XLIX,
optionally with a proviso that it is not an entire protein of Figure 2;
(V) a protein that comprises at least one peptide set forth in Tables VIII-
XXI,
collectively, which peptide is also set forth in Tables XXII to XLIX,
collectively, optionally
with a proviso that it is not an entire protein of Figure 2;
46
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
(VI) a protein that comprises at least two peptides selected from the peptides
set forth
in Tables VIII-XLIX, optionally with a proviso that it is not an entire
protein of Figure 2;
(VII) a protein that comprises at least two peptides selected from the
peptides set forth
in Tables VIII to XLIX collectively, with a proviso that the protein is not a
contiguous sequence
from an amino acid sequence of Figure 2;
(VIII) a protein that comprises at least one peptide selected from the
peptides set forth
in Tables VIII-XXI; and at least one peptide selected from the peptides set
forth in Tables XXII
to XLIX, with a proviso that the protein is not a contiguous sequence from an
amino acid
sequence of Figure 2;
(IX) a polypeptide coinprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids
of a protein of
Figure 3A-3R in any whole number increment up to 328, 236, 181, 178, 1393,
1145, 1990,
2036, 610, 1978, and 2018 respectively that includes at least 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35 amino
acid position(s) having a value greater than 0.5 in the Hydrophilicity profile
of Figure 5;
(X) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids
of a protein of
Figure 3A-3R in any whole number increinent up to 328, 236, 181, 178, 1393,
1145, 1990,
2036, 610, 1978, and 2018 respectively that includes at least at least 1, 2,
3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35
amino acid position(s) having a value less than 0.5 in the Hydropathicity
profile of Figure 6;
(XI) a polypeptide coinprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 ainino
acids of a protein of
Figure 3A-3R, in any whole number increment up to 328, 236, 181, 178, 1393,
1145, 1990,
2036, 610, 1978, and 2018 respectively that includes at least at least 1, 2,
3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35
amino acid position(s) having a value greater than 0.5 in the Percent
Accessible Residues profile
of Figure 7;
(XII) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids
of a protein of
Figure 3A-3R, in any whole number increment up to 328, 236, 181, 178, 1393,
1145, 1990,
2036, 610, 1978, and 2018 respectively that includes at least at least 1, 2,
3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35
47
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
amino acid position(s) having a value greater than 0.5 in the Average
Flexibility profile of
Figure 8;
(XIII) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, amino acids of
a protein of Figure
3A-3R in any whole number increinent up to 328, 236, 181, 178, 1393, 1145,
1990, 2036, 610,
1978, and 2018 respectively that includes at least at least 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35 amino acid
position(s) having a value greater than 0.5 in the Beta-turn profile of Figure
9;
(XIV) a peptide that occurs at least twice in Tables VIII-XXI and XXII to
XLIX,
collectively;
(XV) a peptide that occurs at least three times in Tables VIII-XXI and XXII to
XLIX,
collectively;
(XVI) a peptide that occurs at least four times in Tables VIII-XXI and XXII to
XLIX,
collectively;
(XVII) a peptide that occurs at least five times in Tables VIII-XXI and XXII
to XLIX,
collectively;
(XVIII) a peptide that occurs at least once in Tables VIII-XXI, and at least
once in tables
XXII to XLIX;
(XIX) a peptide that occurs at least once in Tables VIII-XXI, and at least
twice in tables
XXII to XLIX;
(XX) a peptide that occurs at least twice in Tables VIII-XXI, and at least
once in tables
XXII to XLIX;
(XXI) a peptide that occurs at least twice in Tables VIII-XXI, and at least
twice in tables
XXII to XLIX;
(XXII) a peptide which comprises one two, three, four, or five of the
following
characteristics, or an oligonucleotide encoding such peptide:
i) a region of at least 5 amino acids of a particular peptide of Figure 3, in
any whole number
increment up to the full length of that protein in Figure 3, that includes an
amino acid position
having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or having a
value equal to 1.0, in
the Hydrophilicity profile of Figure 5;
ii) a region of at least 5 amino acids of a particular peptide of Figure 3, in
any whole number
increment up to the full length of that protein in Figure 3, that includes an
amino acid position
48
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
having a value equal to or less than 0.5, 0.4, 0.3, 0.2, 0.1, or having a
value equal to 0.0, in the
Hydropathicity profile of Figure 6;
iii) a region of at least 5 amino acids of a particular peptide of Figure 3,
in any whole
number increment up to the full length of that protein in Figure 3, that
includes an amino acid
position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or
having a value equal to
1.0, in the Percent Accessible Residues profile of Figure 7;
iv) a region of at least 5 amino acids of a particular peptide of Figure 3, in
any whole
number increment up to the fall length of that protein in Figure 3, that
includes an amino acid
position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or
having a value equal to
1.0, in the Average Flexibility profile of Figure 8; or,
v) a region of at least 5 amino acids of a particular peptide of Figure 3, in
any whole number
increment up to the full length of that protein in Figure 3, that includes an
amino acid position
having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or having a
value equal to 1.0, in
the Beta-turn profile of Figure 9;
(XXIII) a composition comprising a peptide of (I)-(XXII) or an antibody or
binding region
thereof together with a pharmaceutical excipient and/or in a liuman unit dose
form.
(XXIV) a method of using a peptide of (I)-(XXII), or an antibody or binding
region
thereof or a composition of (XXIII) in a method to modulate a cell expressing
158P3D2;
(XXV) a method of using a peptide of (I)-(XXII) or an antibody or binding
region
thereof or a composition of (XXIII) in a method to diagnose, prophylax,
prognose, or treat an
individual who bears a cell expressing 158P3D2;
(XXVI) a method of using a peptide of (I)-(XXII) or an antibody or binding
region
thereof or a coinposition (XXIII) in a method to diagnose, prophylax,
prognose, or treat an
individual who bears a cell expressing 158P3D2, said cell from a cancer of a
tissue listed in
Table I;
(XXVII) a method of using a peptide of (I)-(XXII) or an antibody or binding
region
thereof or a composition of (XXIII) in a method to diagnose, prophylax,
prognose, or treat a
cancer;
(XXVIII) a method of using a peptide of (I)-(XXII) or an antibody or binding
region
thereof or a composition of (XXIII) in a method to diagnose, prophylax,
prognose, or treat a a
cancer of a tissue listed in Table I;
(XXIX) a method of using a a peptide of (I)-(XXII) or an antibody or binding
region thereof
or a composition and;
49
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
(XXIII) in a method to identify or characterize a modulator of a cell
expressing 158P3D2.
[0171] As used herein, a range is understood to specifically disclose all
whole unit positions
thereof.
[0172] Typical embodiments of the invention disclosed herein include 158P3D2
polynucleotides that encode specific portions of 158P3D2 mRNA sequences (and
those which
are complementary to such sequences) such as those that encode the proteins
and/or fragments
thereof, for example:
(a) 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130,
135, 140, 145, 150, 155,
160, 165, 170, 175, 180, 185, 190, 195, 200, 225, 250, 255, 260, 265, 270,
275, 280, 285, 290,
295, 300, 305, 310, 315, 320, 325, and 328 or more contiguous amino acids of
158P3D2 variant
1; the maximal lengths relevant for other variants are shown in Figures 2A-2Q
and 3A-3R.
[0173] In general, naturally occurring allelic variants of human 158P3D2 share
a high
degree of structural identity and homology (e.g., 90% or more homology).
Typically, allelic
variants of a 158P3D2 protein contain conservative amino acid substitutions
within the
158P3D2 sequences described herein or contain a substitution of an amino acid
from a
corresponding position in a homologue of 158P3D2. One class of 158P3D2 allelic
variants are
proteins that share a high degree of homology with at least a small region of
a particular
158P3D2 amino acid sequence, but further contain a radical departure from the
sequence, such
as a non-conservative substitution, truncation, insertion or frame shift. In
comparisons of
protein sequences, the terms, similarity, identity, and homology each have a
distinct meaning as
appreciated in the field of genetics. Moreover, orthology and paralogy can be
important
concepts describing the relationship of members of a given protein family in
one organism to the
members of the same family in other organisms.
[0174] Amino acid abbreviations are provided in Table II. Conservative amino
acid
substitutions can frequently be made in a protein without altering either the
conformation or the
function of the protein. Proteins of the invention can comprise 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12,
13, 14, 15 conservative substitutions. Such changes include substituting any
of isoleucine (I),
valine (V), and leucine (L) for any other of these hydrophobic amino acids;
aspartic acid (D) for
glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice
versa; and serine (S)
for threonine (T) and vice versa. Other substitutions can also be considered
conservative,
depending on the environment of the particular amino acid and its role in the
three-dimensional
structure of the protein. For exainple, glycine (G) and alanine (A) can
frequently be
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
interchangeable, as can alanine (A) and valine (V). Methionine (M), which is
relatively
hydrophobic, can frequently be interchanged with leucine and isoleucine, and
sometimes with
valine. Lysine (K) and arginine (R) are frequently interchangeable in
locations in which the
significant feature of the amino acid residue is its charge and the differing
pK's of these two
amino acid residues are not significant. Still other changes can be considered
"conservative" in
particular environments (see, e.g., Table III herein; pages 13-15
"Biochemistry" 2nd ED. Lubert
Stryer ed (Stanford University); Henikoff et al., PNAS 1992 Vol 89 10915-
10919; Lei et al., J
Biol Chem 1995 May 19; 270(20):11882-6).
[0175] Embodiments of the invention disclosed herein include a wide variety of
art-accepted
variants or analogs of 158P3D2 proteins such as polypeptides having amino acid
insertions,
deletions and substitutions. 158P3D2 variants can be made using methods known
in the art such
as site-directed mutagenesis, alanine scanning, and PCR mutagenesis. Site-
directed mutagenesis
(Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids
Res., 10:6487
(1987)), cassette mutagenesis (Wells et al., Gene, 34:315 (1985)), restriction
selection
mutagenesis (Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986))
or other known
techniques can be performed on the cloned DNA to produce the 158P3D2 variant
DNA.
[0176] Scanning ainino acid analysis can also be employed to identify one or
more amino
acids along a contiguous sequence that is involved in a specific biological
activity such as a
protein-protein interaction. Among the preferred scanning amino acids are
relatively small,
neutral amino acids. Such amino acids include alanine; glycine, serine, and
cysteine. Alanine is
typically a preferred scanning amino acid among this group because it
eliminates the side-chain
beyond the beta-carbon and is less likely to alter the main-chain conformation
of the variant.
Alanine is also typically preferred because it is the most common amino acid.
Further, it is
frequently found in both buried and exposed positions (Creighton, The
Proteins, (W.H. Freeman
& Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)). If alanine substitution
does not yield
adequate amounts of variant, an isosteric amino acid can be used.
[0177] As defined herein, 158P3D2 variants, analogs or homologs, have the
distinguishing
attribute of having at least one epitope that is "cross reactive" with a
158P3D2 protein having an
amino acid sequence of Figure 3. As used in this sentence, "cross reactive"
means that an
antibody or T cell that specifically binds to a 158P3D2 variant also
specifically binds to a
158P3D2 protein having an amino acid sequence set forth in Figure 3. A
polypeptide ceases to
be a variant of a protein shown in Figure 3, when it no longer contains any
epitope capable of
being recognized by an antibody or T cell that specifically binds to the
starting 158P3D2
51
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
protein. Those skilled in the art understand that antibodies that recognize
proteins bind to
epitopes of varying size, and a grouping of the order of about four or five
amino acids,
contiguous or not, is regarded as a typical number of amino acids in a minimal
epitope. See,
e.g., Nair et al., J. Immunol 2000 165(12): 6949-6955; Hebbes et al., Mol
Immunol (1989)
26(9):865-73; Schwartz et al., J Immunol (1985) 135(4):2598-608.
[0178] Other classes of 158P3D2-related protein variants share 70%, 75%, 80%,
85% or
90% or more similarity with an amino acid sequence of Figure 3, or a fragment
thereof. Another
specific class of 158P3D2 protein variants or analogs comprises one or more of
the 158P3D2
biological motifs described herein or presently known in the art. Thus,
encompassed by the
present invention are analogs of 158P3D2 fraginents (nucleic or amino acid)
that have altered
functional (e.g., immunogenic) properties relative to the starting fraginent.
It is to be
appreciated that motifs now or which become part of the art are to be applied
to the nucleic or
ainino acid sequences of Figure 2 or Figure 3.
[0179] As discussed herein, embodiments of the claimed invention include
polypeptides
containing less than the full amino acid sequence of a 158P3D2 protein shown
in Figure 2 or
Figure 3. For example, representative embodiments of the invention comprise
peptides/proteins
having any 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more contiguous amino
acids of a 158P3D2
protein shown in Figure 2 or Figure 3.
[0180] Moreover, representative embodiments of the invention disclosed herein
include
polypeptides consisting of about amino acid 1 to about amino acid 10 of a
158P3D2 protein
shown in Figure 2 or Figure 3, polypeptides consisting of about ainino acid 10
to about amino
acid 20 of a 158P3D2 protein shown in Figure 2 or Figure 3, polypeptides
consisting of about
amino acid 20 to about amino acid 30 of a 158P3D2 protein shown in Figure 2 or
Figure 3,
polypeptides consisting of about amino acid 30 to about amino acid 40 of a
158P3D2 protein
shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 40
to about amino
acid 50 of a 158P3D2 protein shown in Figure 2 or Figure 3, polypeptides
consisting of about
amino acid 50 to about amino acid 60 of a 158P3D2 protein shown in Figure 2 or
Figure 3,
polypeptides consisting of about amino acid 60 to about amino acid 70 of a
158P3D2 protein
shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 70
to about amino
acid 80 of a 158P3D2 protein shown in Figure 2 or Figure 3, polypeptides
consisting of about
amino acid 80 to about amino acid 90 of a 158P3D2 protein shown in Figure 2 or
Figure 3,
polypeptides consisting of about amino acid 90 to about amino acid 100 of a
158P3D2 protein
shown in Figure 2 or Figure 3, etc. throughout the entirety of a 158P3D2 amino
acid sequence.
52
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Moreover, polypeptides consisting of about amino acid 1 (or 20 or 30 or 40
etc.) to about amino
acid 20, (or 130, or 140 or 150 etc.) of a 158P3D2 protein shown in Figure 2
or Figure 3 are
embodiments of the invention. It is to be appreciated that the starting and
stopping positions in
this paragraph refer to the specified position as well as that position plus
or minus 5 residues.
[0181] 158P3D2-related proteins are generated using standard peptide synthesis
technology
or using chemical cleavage methods well known in the art. Alternatively,
recombinant methods
can be used to generate nucleic acid molecules that encode a 158P3D2-related
protein. In one
embodiment, nucleic acid molecules provide a means to generate defined
fragments of a
158P3D2 protein (or variants, homologs or analogs thereof).
III.A.) Motif-bearing Protein Embodiments
[0182] Additional illustrative embodiments of the invention disclosed herein
include
158P3D2 polypeptides comprising the amino acid residues of one or more of the
biological
motifs contained within a 158P3D2 polypeptide sequence set forth in Figure 2
or Figure 3.
Various motifs are known in the art, and a protein can be evaluated for the
presence of such
motifs by a number of publicly available Internet sites (see, e.g., URL
addresses:
pfam.wustl.edu/; searchlauncher.bcm.tmc.edu/seq-search/struc-predict.htinl;
psort.ims.u-
tokyo.ac.jp/; cbs.dtu.dk/; ebi.ac.uk/interpro/scan.html;
expasy.ch/tools/scnpsitl.html;
EpimatrixTM and EpimerTM, Brown University, brown.edu/Researcl-i/TB-
HIV-Lab/epimatrix/epimatrix.html; and BIMAS, biinas.dcrt.nih.gov/.).
[0183] Motif bearing subsequences of all 158P3D2 variant proteins are set
forth and
identified in Tables VIII-XXI and XXII-XLIX.
[0184] Table V sets forth several frequently occurring motifs based on pfam
searches (see
URL address pfam.wustl.edu/). The columns of Table V list (1) motif name
abbreviation, (2)
percent identity found amongst the different member of the motif family, (3)
motif name or
description and (4) most common function; location information is included if
the motif is
relevant for location.
[0185] Polypeptides coinprising one or more of the 158P3D2 motifs discussed
above are
useful in elucidating the specific characteristics of a malignant phenotype in
view of the
observation that the 158P3D2 motifs discussed above are associated with growth
dysregulation
and because 158P3D2 is overexpressed in certain cancers (See, e.g., Table I).
Casein kinase II,
cAMP and camp-dependent protein kinase, and Protein Kinase C, for example, are
enzymes
known to be associated with the development of the malignant phenotype (see
e.g., Chen et al.,
Lab Invest., 78(2): 165-174 (1998); Gaiddon et al., Endocrinology 136(10):
4331-4338 (1995);
53
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Hall et al., Nucleic Acids Research 24(6): 1119-1126 (1996); Peterziel et al.,
Oncogene 18(46):
6322-6329 (1999) and O'Brian, Oncol. Rep. 5(2): 305-309 (1998)). Moreover,
both
glycosylation and myristoylation are protein modifications also associated
with cancer and
cancer progression (see e.g., Dennis et al., Biochein. Biophys. Acta
1473(1):21-34 (1999); Raju
et al., Exp. Cell Res. 235(1): 145-154 (1997)). Amidation is another protein
modification also
associated with cancer and cancer progression (see e.g., Treston et al., J.
Natl. Cancer Inst.
Monogr. (13): 169-175 (1992)).
[0186] In another embodiment, proteins of the invention comprise one or more
of the
immunoreactive epitopes identified in accordance with art-accepted methods,
such as the
peptides set forth in Tables VIII-XXI and XXII-XLIX. CTL epitopes can be
determined using
specific algorithins to identify peptides within a 158P3D2 protein that are
capable of optimally
binding to specified HLA alleles (e.g., Table IV; EpimatrixTM and EpimerTM,
Brown University,
URL brown.edu/Research/TB-HIV-Lab/epimatrix/epimatrix.html; and BIMAS, URL
bimas.dcrt.nih.gov/.) Moreover, processes for identifying peptides that have
sufficient binding
affinity for HLA molecules and which are correlated with being immunogenic
epitopes, are well
known in the art, and are carried out without undue experimentation. In
addition, processes for
identifying peptides that are immunogenic epitopes, are well known in the art,
and are carried
out without undue experimentation either in vitro or in vivo.
[0187] Also known in the art are principles for creating analogs of such
epitopes in order to
modulate immunogenicity. For example, one begins with an epitope that bears a
CTL or HTL
motif (see, e.g., the HLA Class I and HLA Class JI motifs/supermotifs of Table
IV). The
epitope is analoged by substituting out an amino acid at one of the specified
positions, and
replacing it with another amino acid specified for that position. For example,
on the basis of
residues defined in Table IV, one can substitute out a deleterious residue in
favor of any other
residue, such as a preferred residue; substitute a less-preferred residue with
a preferred residue;
or substitute an originally-occurring preferred residue with another preferred
residue.
Substitutions can occur at primary anchor positions or at other positions in a
peptide; see, e.g.,
Table IV.
[0188] A variety of references reflect the art regarding the identification
and generation of
epitopes in a protein of interest as well as analogs thereof. See, for
example, WO 97/33602 to
Chesnut et al.; Sette, Immunogenetics 1999 50(3-4): 201-212; Sette et al., J.
Immunol. 2001
166(2): 1389-1397; Sidney et al., Hum. Iniununol. 1997 58(1): 12-20; Kondo et
al.,
Immunogenetics 1997 45(4): 249-258; Sidney et al., J. Immunol. 1996 157(8):
3480-90; and
54
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Falk et al., Nature 351: 290-6 (1991); Hunt et al., Science 255:1261-3 (1992);
Parker et al., J.
Immunol. 149:3580-7 (1992); Parker et al., J. Immunol. 152:163-75 (1994));
Kast et al., 1994
152(8): 3904-12; Borras-Cuesta et al., Hum. Immunol. 2000 61(3): 266-278;
Alexander et al., J.
Iinmunol. 2000 164(3); 164(3): 1625-1633; Alexander et al., PMID: 7895164, UI:
95202582;
O'Sullivan et al., J. Inununol. 1991 147(8): 2663-2669; Alexander et al.,
Immunity 1994 1(9):
751-761 and Alexander et al., Immunol. Res. 1998 18(2): 79-92.
[0189] Related embodiinents of the invention include polypeptides comprising
combinations
of the different motifs set forth in Table VI, and/or, one or more of the
predicted CTL epitopes
of Tables VIII-XXI and XXII-XLIX, and/or, one or more of the predicted HTL
epitopes of
Tables XLVI-XLIX, and/or, one or more of the T cell binding motifs known in
the art.
Preferred embodiments contain no insertions, deletions or substitutions either
within the motifs
or within the intervening sequences of the polypeptides. In addition,
embodiments which
include a number of either N-terminal and/or C-terminal amino acid residues on
either side of
these motifs may be desirable (to, for example, include a greater portion of
the polypeptide
architecture in which the motif is located). Typically, the number of N-
terininal and/or C-
terminal amino acid residues on either side of a motif is between about 1 to
about 100 amino
acid residues, preferably 5 to about 50 amino acid residues.
[0190] 158P3D2-related proteins are embodied in many forms, preferably in
isolated form.
A purified 158P3D2 protein molecule will be substantially free of other
proteins or molecules
that impair the binding of 158P3D2 to antibody, T cell or other ligand. The
nature and degree of
isolation and purification will depend on the intended use. Embodiments of a
158P3D2-related
proteins include purified 158P3D2-related proteins and functional, soluble
158P3D2-related
proteins. In one embodiment, a functional, soluble 158P3D2 protein or fragment
thereof retains
the ability to be bound by antibody, T cell or other ligand.
[0191] The invention also provides 158P3D2 proteins comprising biologically
active
fragments of a 158P3D2 amino acid sequence shown in Figure 2 or Figure 3. Such
proteins
exhibit properties of the starting 158P3D2 protein, such as the ability to
elicit the generation of
antibodies that specifically bind an epitope associated with the starting
158P3D2 protein; to be
bound by such antibodies; to elicit the activation of HTL or CTL; and/or, to
be recognized by
HTL or CTL that also specifically bind to the starting protein.
[0192] 158P3D2-related polypeptides that contain particularly interesting
structures can be
predicted and/or identified using various analytical techniques well known in
the art, including,
for example, the methods of Chou-Fasman, Gamier-Robson, Kyte-Doolittle,
Eisenberg,
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Karplus-Schultz or Jameson-Wolf analysis, or based on immunogenicity.
Fragments that
contain such structures are particularly useful in generating subunit-specific
anti-158P3D2
antibodies or T cells or in identifying cellular factors that bind to 158P3D2.
For example,
hydrophilicity profiles can be generated, and immunogenic peptide fragments
identified, using
the method of Hopp, T.P. and Woods, K.R., 1981, Proc. Natl. Acad. Sci. U.S.A.
78:3824-3828.
Hydropathicity profiles can be generated, and immunogenic peptide fragments
identified, using
the method of Kyte, J. and Doolittle, R.F., 1982, J. Mol. Biol. 157:105-132.
Percent (%)
Accessible Residues profiles can be generated, and immunogenic peptide
fragments identified,
using the method of Janin J., 1979, Nature 277:491-492. Average Flexibility
profiles can be
generated, and immunogenic peptide fragments identified, using the method of
Bhaskaran R.,
Ponnuswamy P.K., 1988, Int. J. Pept. Protein Res. 32:242-255. Beta-turn
profiles can be
generated, and immunogenic peptide fiagments identified, using the method of
Deleage, G.,
Roux B., 1987, Protein Engineering 1:289-294.
[0193] CTL epitopes can be determined using specific algorithms to identify
peptides within
a 158P3D2 protein that are capable of optimally binding to specified HLA
alleles (e.g., by using
the SYFPEITHI site at World Wide Web URL syfpeithi.bmi-heidelberg.com/; the
listings in
Table IV(A)-(E); EpimatrixTM and EpimerTM, Brown University, URL
(browli.edu/Research/TB-
HIV-Lab/epimatrix/epimatrix.html); and BIMAS, URL bimas.dcrt.nih.gov/).
Illustrating this,
peptide epitopes from 158P3D2 that are presented in the context of human MHC
Class I
molecules, e.g., HLA-A1, A2, A3, A11, A24, B7 and B35 were predicted (see,
e.g., Tables VIII-
XXI, XXII-XLIX). Specifically, the complete amino acid sequence of the 158P3D2
protein and
relevant portions of other variants, i.e., for HLA Class I predictions 9
flanking residues on either
side of a point mutation or exon juction, and for HLA Class II predictions 14
flanking residues
on eitlier side of a point mutation or exon junction corresponding to that
variant, were entered
into the HLA Peptide Motif Search algorithm found in the Bioinformatics and
Molecular
Analysis Section (BIMAS) web site listed above; in addition to the site
SYFPEITHI, at URL
syfpeithi.bmi-heidelberg.com/.
[0194] The HLA peptide motif search algorithm was developed by Dr. Ken Parker
based on
binding of specific peptide sequences in the groove of HLA Class I molecules,
in particular
HLA-A2 (see, e.g., Falk et al., Nature 351: 290-6 (1991); Hunt et al., Science
255:1261-3
(1992); Parker et al., J. Immunol. 149:3580-7 (1992); Parker et al., J.
Immunol. 152:163-75
(1994)). This algorithm allows location and ranking of 8-mer, 9-mer, and 1 0-
mer peptides from
a complete protein sequence for predicted binding to HLA-A2 as well as
numerous other HLA
56
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Class I molecules. Many HLA class I binding peptides are 8-, 9-, 10 or 11 -
mers. For example,
for Class I HLA-A2, the epitopes preferably contain a leucine (L) or
methionine (M) at position
2 and a valine (V) or leucine (L) at the C-terminus (see, e.g., Parker et al.,
J. Inzinunol. (1992)
149:3580-7). Selected results of 158P3D2 predicted binding peptides are shown
in Tables VIII-
XXI and XXII-XLIX herein. In Tables VIII-XXI and XXII-XLVII, selected
candidates, 9-mers
and 10-mers, for each family member are shown along with their location, the
amino acid
sequence of each specific peptide, and an estimated binding score. In Tables
XLVI-XLIX,
selected candidates, 15-mers, for each family member are shown along with
their location, the
amino acid sequence of each specific peptide, and an estimated binding score.
The binding
score corresponds to the estimated half time of dissociation of coinplexes
containing the peptide
at 37oC at pH 6.5. Peptides with the highest binding score are predicted to be
the most tightly
bound to HLA Class I on the cell surface for the greatest period of time and
thus represent the
best immunogenic targets for T-cell recognition.
[0195] Actual binding of peptides to an HLA allele can be evaluated by
stabilization of HLA
expression on the antigen-processing defective cell line T2 (see, e.g., Xue,
et al., Prostate (1997)
30:73-8 and Peshwa, et al., Prostate (1998) 36:129-38). Immunogenicity of
specific peptides
can be evaluated in vitro by stimulation of CD8+ cytotoxic T lyml3hocytes
(CTL) in the
presence of antigen presenting cells such as dendritic cells.
[0196] It is to be appreciated that every epitope predicted by the BIMAS site,
EpimerTM and
EpimatrixTM sites, or specified by the HLA class I or class II motifs
available in the art or which
become part of the art such as set forth in Table IV (or determined using
World Wide Web site
URL syfpeithi.bmi-heidelberg.com/, or BIMAS, bimas.dcrt.nih.gov/) are to be
"applied" to a
158P3D2 protein in accordance with the invention. As used in this context
"applied" means that
a 158P3D2 protein is evaluated, e.g., visually or by computer-based patterns
finding methods, as
appreciated by those of skill in the relevant art. Every subsequence of a
158P3D2 protein of 8,
9, 10, or 11 amino acid residues that bears an HLA Class I motif, or a
subsequence of 9 or more
amino acid residues that bear an HLA Class II motif are within the scope of
the invention.
III.B.) Expression of 158P3D2-related Proteins
[0197] In an embodiment described in the examples that follow, 158P3D2 can be
conveniently expressed in cells (such as 293T cells) transfected with a
commercially available
expression vector such as a CMV-driven expression vector encoding 158P3D2 with
a C-
terminal 6XHis and MYC tag (pcDNA3.1/mycHIS, Invitrogen or Tag5, GenHunter
Corporation,
Nashville TN). The Tag5 vector provides an IgGK secretion signal that can be
used to facilitate
57
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
the production of a secreted 158P3D2 protein in transfected cells. The
secreted HIS-tagged
158P3D2 in the culture media can be purified, e.g., using a nickel column
using standard
techniques.
III.C.) Modifications of 158P3D2-related Proteins
[0198] Modifications of 158P3D2-related proteins such as covalent
modifications are
included within the scope of this invention. One type of covalent modification
includes reacting
targeted amino acid residues of a 158P3D2 polypeptide with an organic
derivatizing agent that is
capable of reacting with selected side chains or the N- or C- terminal
residues of a 158P3D2
protein. Another type of covalent modification of a 158P3D2 polypeptide
included within the
scope of this invention comprises altering the native glycosylation pattern of
a protein of the
invention. Another type of covalent modification of 158P3D2 comprises linking
a 158P3D2
polypeptide to one of a variety of nonproteinaceous polymers, e.g.,
polyethylene glycol (PEG),
polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S.
Patent Nos.
4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
[0199] The 158P3D2-related proteins of the present invention can also be
modified to form a
chimeric molecule comprising 158P3D2 fused to another, heterologous
polypeptide or ainino
acid sequence. Such a chimeric molecule can be synthesized chemically or
recombinantly. A
chimeric molecule can have a protein of the invention fused to another tumor-
associated antigen
or feagment thereof. Alternatively, a protein in accordance with the invention
can comprise a
fusion of fragments of a 158P3D2 sequence (amino or nucleic acid) such that a
molecule is
created that is not, through its length, directly homologous to the amino or
nucleic acid
sequences shown in Figure 2 or Figure 3. Such a chimeric molecule can comprise
multiples of
the same subsequence of 158P3D2. A chimeric molecule can comprise a fusion of
a 158P3D2-
related protein with a polyhistidine epitope tag, which provides an epitope to
which immobilized
nickel can selectively bind, with cytokines or with growth factors. The
epitope tag is generally
placed at the ainino- or carboxyl- terminus of a 158P3D2 protein. In an
alternative embodiment,
the chimeric molecule can comprise a fusion of a 158P3D2-related protein with
an
immunoglobulin or a particular region of an immunoglobulin. For a bivalent
form of the
chimeric molecule (also referred to as an "immunoadhesin"), such a fusion
could be to the Fc
region of an IgG molecule. The Ig fusions preferably include the substitution
of a soluble
(transmembrane domain deleted or inactivated) fonn of a 158P3D2 polypeptide in
place of at
least one variable region within an Ig molecule. In a preferred embodiment,
the
immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2
and CH3
58
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
regions of an IgGI molecule. For the production of immunoglobulin fusions see,
e.g., U.S.
Patent No. 5,428,130 issued June 27, 1995.
III.D.) Uses of 158P3D2-related Proteins
[0200] The proteins of the invention have a number of different specific uses.
As 158P3D2
is highly expressed in prostate and other cancers, 15SP3D2-related proteins
are used in methods
that assess the status of 158P3D2 gene products in normal versus cancerous
tissues, thereby
elucidating the malignant phenotype. Typically, polypeptides from specific
regions of a
158P3D2 protein are used to assess the presence of perturbations (such as
deletions, insertions,
point mutations etc.) in those regions (such as regions containing one or more
motifs).
Exemplary assays utilize antibodies or T cells targeting 158P3D2-related
proteins comprising
the amino acid residues of one or more of the biological motifs contained
within a 158P3D2
polypeptide sequence in order to evaluate the characteristics of this region
in normal versus
cancerous tissues or to elicit an immune response to the epitope.
Alternatively, 158P3D2-related
proteins that contain the amino acid residues of one or more of the biological
motifs in a
158P3D2 protein are used to screen for factors that interact with that region
of 158P3D2.
[0201] 158P3D2 protein fragments/subsequences are particularly useful in
generating and
characterizing domain-specific antibodies (e.g., antibodies recognizing an
extracellular or
intracellular epitope of a 158P3D2 protein), for identifying agents or
cellular factors that bind to
158P3D2 or a particular structural domain thereof, and in various therapeutic
and diagnostic
contexts, including but not limited to diagnostic assays, cancer vaccines and
methods of
preparing such vaccines.
[0202] Proteins encoded by the 158P3D2 genes, or by analogs, homologs or
fragments
thereof, have a variety of uses, including but not limited to generating
antibodies and in methods
for identifying ligands and other agents and cellular constituents that bind
to a 158P3D2 gene
product. Antibodies raised against a 158P3D2 protein or fragment thereof are
useful in
diagnostic and prognostic assays, and imaging methodologies in the management
of human
cancers characterized by expression of 158P3D2 protein, such as those listed
in Table I. Such
antibodies can be expressed intracellularly and used in methods of treating
patients with such
cancers. 158P3D2-related nucleic acids or proteins are also used in generating
HTL or CTL
responses.
[0203] Various immunological assays useful for the detection of 158P3D2
proteins are used,
including but not limited to various types of radioimmunoassays, enzyme-linked
immunosorbent
assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA),
immunocytochemical
59
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
methods, and the like. Antibodies can be labeled and used as immunological
imaging reagents
capable of detecting 158P3D2-expressing cells (e.g., in radioscintigraphic
imaging methods).
158P3D2 proteins are also particularly useful in generating cancer vaccines,
as further described
herein.
IV.) 158P3D2 ANTIBODIES
[02041 Another aspect of the invention provides antibodies that bind to
158P3D2-related
proteins. Preferred antibodies specifically bind to a 158P3D2-related protein
and do not bind (or
bind weakly) to peptides or proteins that are not 158P3D2-related proteins
under physiological
conditions. In this context, examples of physiological conditions include: 1)
phosphate buffered
saline; 2) Tris-buffered saline containing 25mM Tris and 150 iuM NaCl; or
normal saline (0.9%
NaCI); 4) animal serum such as human serum; or, 5) a combination of any of 1)
through 4);
these reactions preferably taking place at pH 7.5, alternatively in a range of
pH 7.0 to 8.0, or
alternatively in a range of pH 6.5 to 8.5; also, these reactions taking place
at a temperature
between 4 C to 37 C. For example, antibodies that bind 158P3D2 can bind
158P3D2-related
proteins such as the homologs or analogs thereof.
[0205] 158P3D2 antibodies of the invention are particularly useful in cancer
(see, e.g., Table
I) diagnostic and prognostic assays, and imaging methodologies. Similarly,
such antibodies are
useful in the treatment, diagnosis, and/or prognosis of other cancers, to the
extent 158P3D2 is
also expressed or overexpressed in these other cancers. Moreover,
intracellularly expressed
antibodies (e.g., single chain antibodies) are therapeutically useful in
treating cancers in which
the expression of 158P3D2 is involved, such as advanced or metastatic prostate
cancers.
[0206] The invention also provides various immunological assays useful for the
detection
and quantification of 158P3D2 and mutant 158P3D2-related proteins. Such assays
can comprise
one or more 158P3D2 antibodies capable of recognizing and binding a 158P3D2-
related protein,
as appropriate. These assays are performed within various immunological assay
formats well
known in the art, including but not limited to various types of
radioiminunoassays, enzyme-
linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays
(ELIFA), and
the like.
[0207] Immunological non-antibody assays of the invention also comprise T cell
immunogenicity assays (inhibitory or stimulatory) as well as major
histocompatibility complex
(MHC) binding assays.
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0208] In addition, immunological imaging methods capable of detecting
prostate cancer
and other cancers expressing 158P3D2 are also provided by the invention,
including but not
limited to radioscintigraphic imaging methods using labeled 158P3D2
antibodies. Such assays
are clinically useful in the detection, monitoring, and prognosis of 158P3D2
expressing cancers
such as prostate cancer.
[0209] 158P3D2 antibodies are also used in methods for purifying a 158P3D2-
related
protein and for isolating 158P3D2 homologues and related molecules. For
example, a method
of purifying a 158P3D2-related protein comprises incubating a 158P3D2
antibody, which has
been coupled to a solid matrix, with a lysate or other solution containing a
158P3D2-related
protein under conditions that pennit the 158P3D2 antibody to bind to the
158P3D2-related
protein; washing the solid matrix to eliminate impurities; and eluting the
158P3D2-related
protein from the coupled antibody. Other uses of 158P3D2 antibodies in
accordance with the
invention include generating anti-idiotypic antibodies that mimic a 158P3D2
protein.
[0210] Various methods for the preparation of antibodies are well known in the
art. For
example, antibodies can be prepared by immunizing a suitable mammalian host
using a
158P3D2-related protein, peptide, or fragment, in isolated or immunoconjugated
form
(Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane (1988);
Harlow,
Antibodies, Cold Spring Harbor Press, NY (1989)). In addition, fusion proteins
of 158P3D2 can
also be used, such as a 158P3D2 GST-fusion protein. In a particular
embodiment, a GST fusion
protein comprising all or most of the amino acid sequence of Figure 2 or
Figure 3 is produced,
then used as an immunogen to generate appropriate antibodies. In another
embodiment, a
158P3D2-related protein is synthesized and used as an immunogen.
[0211] In addition, naked DNA immunization techniques known in the art are
used (with or
without purified 158P3D2-related protein or 158P3D2 expressing cells) to
generate an immune
response to the encoded immunogen (for review, see Donnelly et al., 1997, Ann.
Rev. Immunol.
15: 617-648).
[0212] The amino acid sequence of a 158P3D2 protein as shown in Figure 2 or
Figure 3 can
be analyzed to select specific regions of the 158P3D2 protein for generating
antibodies. For
example, hydrophobicity and hydrophilicity analyses of a 158P3D2 ainino acid
sequence are
used to identify hydrophilic regions in the 158P3D2 structure. Regions of a
158P3D2 protein
that show immunogenic structure, as well as other regions and domains, can
readily be identified
using various other methods known in the art, such as Chou-Fasman, Garnier-
Robson, Kyte-
Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis. Hydrophilicity
profiles can be
61
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
generated using the method of Hopp, T.P. and Woods, K.R., 1981, Proc. Natl.
Acad. Sci. U.S.A.
78:3824-3828. Hydropathicity profiles can be generated using the method of
Kyte, J. and
Doolittle, R.F., 1982, J. Mol. Biol. 157:105-132. Percent (%) Accessible
Residues profiles can
be generated using the method of Janin J., 1979, Nature 277:491-492. Average
Flexibility
profiles can be generated using the method of Bhaskaran R., Ponnuswamy P.K.,
1988, Int. J.
Pept. Protein Res. 32:242-255. Beta-turn profiles can be generated using the
method of
Deleage, G., Roux B., 1987, Protein Engineering 1:289-294. Thus, each region
identified by
any of these programs or methods is within the scope of the present invention.
Methods for the
generation of 158P3D2 antibodies are further illustrated by way of the
examples provided
herein. Methods for preparing a protein or polypeptide for use as an immunogen
are well known
in the art. Also well known in the art are methods for preparing immunogenic
conjugates of a
protein with a carrier, such as BSA, KLH or other carrier protein. In some
circumstances, direct
conjugation using, for example, carbodiimide reagents are used; in other
instances linking
reagents such as those supplied by Pierce Chemical Co., Rockford, IL, are
effective.
Administration of a 158P3D2 immunogen is often conducted by injection over a
suitable time
period and with use of a suitable adjuvant, as is understood in the art.
During the immunization
schedule, titers of antibodies can be taken to determine adequacy of antibody
formation.
[0213] 158P3D2 monoclonal antibodies can be produced by various means well
known in
the art. For example, immortalized cell lines that secrete a desired
monoclonal antibody are
prepared using the standard hybridoma technology of Kohler and Milstein or
modifications that
immortalize antibody-producing B cells, as is generally known. Immortalized
cell lines that
secrete the desired antibodies are screened by immunoassay in which the
antigen is a 158P3D2-
related protein. When the appropriate immortalized cell culture is identified,
the cells can be
expanded and antibodies produced either from in vitro cultures or from ascites
fluid.
[0214] The antibodies or fragments of the invention can also be produced, by
recombinant
means. Regions that bind specifically to the desired regions of a 158P3D2
protein can also be
produced in the context of chimeric or complementarity-determining region
(CDR) grafted
antibodies of multiple species origin. Humanized or human 158P3D2 antibodies
can also be
produced, and are preferred for use in therapeutic contexts. Methods for
humanizing murine and
other non-human antibodies, by substituting one or more of the non-human
antibody CDRs for
corresponding human antibody sequences, are well known (see for example, Jones
et al., 1986,
Nature 321: 522-525; Riechmann et al., 1988, Nature 332: 323-327; Verhoeyen et
al., 1988,
62
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Science 239: 1534-1536). See also, Carter et al., 1993, Proc. Natl. Acad. Sci.
USA 89: 4285 and
Sims et al., 1993, J. Immunol. 151: 2296.
[0215] Methods for producing fully human monoclonal antibodies include phage
display
and transgenic methods (for review, see Vaughan et al., 1998, Nature
Biotechnology 16: 535-
539). Fully human 158P3D2 monoclonal antibodies can be generated using cloning
technologies employing large human Ig gene combinatorial libraries (i.e.,
phage display)
(Griffiths and Hoogenboom, Building an in vitro immune system: human
antibodies from phage
display libraries. In: Protein Engineering of Antibody Molecules for
Prophylactic and
Therapeutic Applications in Man, Clark, M. (Ed.), Nottinghain Academic, pp 45-
64 (1993);
Burton and Barbas, Human Antibodies from combinatorial libraries. Id., pp 65-
82). Fully
human 158P3D2 monoclonal antibodies can also be produced using transgenic mice
engineered
to contain human immunoglobulin gene loci as described in PCT Patent
Application
W098/24893, Kucherlapati and Jakobovits et al., published December 3, 1997
(see also,
Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4): 607-614; U.S. patents
6,162,963 issued 19
December 2000; 6,150,584 issued 12 November 2000; and, 6,114598 issued 5
September 2000).
This method avoids the in vitro manipulation required with phage display
technology and
efficiently produces high affinity authentic human antibodies.
[0216] Reactivity of 158P3D2 antibodies with a 158P3D2-related protein can be
established
by a number of well known means, including Western blot, immunoprecipitation,
ELISA, and
FACS analyses using, as appropriate, 158P3D2-related proteins, 158P3D2-
expressing cells or
extracts thereof. A 158P3D2 antibody or fragment thereof can be labeled with a
detectable
marker or conjugated to a second molecule. Suitable detectable markers
include, but are not
limited to, a radioisotope, a fluorescent compound, a bioluminescent
coinpound,
chemiluminescent compound, a metal chelator or an enzyme. Further, bi-specific
antibodies
specific for two or more 158P3D2 epitopes are generated using methods
generally known in the
art. Homodimeric antibodies can also be generated by cross-linking techniques
known in the art
(e.g., Wolff et al., Cancer Res. 53: 2560-2565).
V.) 158P3D2 CELLULAR IMMUNE RESPONSES
[0217] The mechanism by which T cells recognize antigens has been delineated.
Efficacious peptide epitope vaccine compositions of the invention induce a
therapeutic or
prophylactic immune responses in very broad segments of the world-wide
population. For an
63
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
understanding of the value and efficacy of compositions of the invention that
induce cellular
immune responses, a brief review of immunology-related technology is provided.
[0218] A complex of an HLA molecule and a peptidic antigen acts as the ligand
recognized
by HLA-restricted T cells (Buus, S. et al., Cel147:1071, 1986; Babbitt, B. P.
et al., Nature
317:359, 1985; Townsend, A. and Bodmer, H., Annu. Rev. Immunol. 7:601, 1989;
Germain, R.
N., Annu. Rev. Immunol. 11:403, 1993). Through the study of single amino acid
substituted
antigen analogs and the sequencing of endogenously bound, naturally processed
peptides,
critical residues that correspond to motifs required for specific binding to
HLA antigen
molecules have been identified and are set forth in Table IV (see also, e.g.,
Southwood, et al., J.
Immunol. 160:3363, 1998; Rammensee, et al., Immunogenetics 41:178, 1995;
Rammensee et
al., SYFPEITHI, access via World Wide Web at URL
(134.2.96.221/scripts.hlaserver.dll/home.htm); Sette, A. and Sidney, J. Curr.
Opin. Immunol.
10:478, 1998; Engelhard, V. H., Curr. Opin. Immunol. 6:13, 1994; Sette, A. and
Grey, H. M.,
Curr. Opin. Immunol. 4:79, 1992; Sinigaglia, F. and Hammer, J. Curr. Biol.
6:52, 1994; Ruppert
et al., Cell 74:929-937, 1993; Kondo et al., J. Immunol. 155:4307-4312, 1995;
Sidney et al., J.
Immunol. 157:3480-3490, 1996; Sidney et al., Human Immunol. 45:79-93, 1996;
Sette, A. and
Sidney, J. Iinmunogenetics 1999 Nov; 50(3-4):201-12, Review).
[0219] Furthermore, x-ray crystallographic analyses of HLA-peptide complexes
have
revealed pockets within the peptide binding cleft/groove of HLA molecules
which
accommodate, in an allele-specific mode, residues borne by peptide ligands;
these residues in
turn determine the HLA binding capacity of the peptides in which they are
present. (See, e.g.,
Madden, D.R. Armu. Rev. Immunol. 13:587, 1995; Smith, et al., Immunity 4:203,
1996;
Fremont et al., Immunity 8:305, 1998; Stem et al., Structure 2:245, 1994;
Jones, E.Y. Curr.
Opin. Immunol. 9:75, 1997; Brown, J. H. et al., Nature 364:33, 1993; Guo, H.
C. et al., Proc.
Natl. Acad. Sci. USA 90:8053, 1993; Guo, H. C. et al., Nature 360:364, 1992;
Silver, M. L. et
al., Nature 360:367, 1992; Matsumura, M. et al., Science 257:927, 1992; Madden
et al., Cell
70:1035, 1992; Fremont, D. H. et al., Science 257:919, 1992; Saper, M. A.,
Bjorkman, P. J. and
Wiley, D. C., J. Mol. Biol. 219:277, 1991.)
[0220] Accordingly, the definition of class I and class II allele-specific HLA
binding motifs,
or class I or class II supermotifs allows identification of regions within a
protein that are
correlated with binding to particular HLA antigen(s).
[0221] Thus, by a process of HLA motif identification, candidates for epitope-
based
vaccines have been identified; such candidates can be further evaluated by HLA-
peptide binding
64
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
assays to determine binding affinity and/or the time period of association of
the epitope and its
corresponding HLA molecule. Additional confirmatory work can be perfonned to
select,
amongst these vaccine candidates, epitopes with preferred characteristics in
terms of population
coverage, and/or immunogenicity.
[0222] Various strategies can be utilized to evaluate cellular immunogenicity,
including:
1) Evaluation of primary T cell cultures from normal individuals (see, e.g.,
Wentworth, P. A. et al., Mol. Immunol. 32:603, 1995; Celis, E. et al., Proc.
Natl. Acad. Sci.
USA 91:2105, 1994; Tsai, V. et al., J. Immunol. 158:1796, 1997; Kawashima, I.
et al., Human
Immunol. 59:1, 1998). This procedure involves the stimulation of peripheral
blood lymphocytes
(PBL) from normal subjects with a test peptide in the presence of antigen
presenting cells in
vitro over a period of several weeks. T cells specific for the peptide become
activated during
this time and are detected using, e.g., a lymphokine- or 51 Cr-release assay
involving peptide
sensitized target cells.
2) Immunization of HLA transgenic mice (see, e.g., Wentworth, P. A. et al., J.
Immunol. 26:97, 1996; Wentworth, P. A. et al., Int. Immunol. 8:651, 1996;
Alexander, J. et al.,
J. Immunol. 159:4753, 1997). For example, in such methods peptides in
incomplete Freund's
adjuvant are administered subcutaneously to HLA transgenic mice. Several weeks
following
immunization, splenocytes are removed and cultured in vitro in the presence of
test peptide for
approximately one week. Peptide-specific T cells are detected using, e.g., a
51 Cr-release assay
involving peptide sensitized target cells and target cells expressing
endogenously generated
antigen.
3) Demonstration of recall T cell responses from immune individuals who have
been either effectively vaccinated and/or from chronically ill patients (see,
e.g., Rehermann, B.
et al., J. Exp. Med. 181:1047, 1995; Doolan, D. L. et al., Immunity 7:97,
1997; Bertoni, R. et
al., J. Clin. Invest. 100:503, 1997; Threlkeld, S. C. et al., J. Immunol.
159:1648, 1997;
Diepolder, H. M. et al., J. Virol. 71:6011, 1997). Accordingly, recall
responses are detected by
culturing PBL from subjects that have been exposed to the antigen due to
disease and thus have
generated an inunune response "naturally", or from patients who were
vaccinated against the
antigen. PBL from subjects are cultured in vitro for 1-2 weeks in the presence
of test peptide
plus antigen presenting cells (APC) to allow activation of "memory" T cells,
as compared to
"naive" T cells. At the end of the culture period, T cell activity is detected
using assays
including 51 Cr release involving peptide-sensitized targets, T cell
proliferation, or lyinphokine
release.
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
VI.) 158P3D2 TRANSGENIC ANIMALS
[0223] Nucleic acids that encode a 158P3D2-related protein can also be used to
generate
either transgenic animals or "knock out" animals that, in turn, are useful in
the development and
screening of therapeutically useful reagents. In accordance with established
techniques, cDNA
encoding 158P3D2 can be used to clone genomic DNA that encodes 158P3D2. The
cloned
genomic sequences can then be used to generate transgenic animals containing
cells that express
DNA that encode 158P3D2. Methods for generating transgenic animals,
particularly animals
such as mice or rats, have become conventional in the art and are described,
for exainple, in U.S.
Patent Nos. 4,736,866 issued 12 April 1988, and 4,870,009 issued 26 September
1989.
Typically, particular cells would be targeted for 158P3D2 transgene
incorporation with tissue-
specific enhancers.
[0224] Transgenic aniinals that include a copy of a transgene encoding 158P3D2
can be
used to examine the effect of increased expression of DNA that encodes
158P3D2. Such
animals can be used as tester animals for reagents thought to confer
protection from, for
example, pathological conditions associated with its overexpression. In
accordance with this
aspect of the invention, an animal is treated with a reagent and a reduced
incidence of a
pathological condition, compared to untreated animals that bear the transgene,
would indicate a
potential therapeutic intervention for the pathological condition.
[0225] Alternatively, non-human homologues of 158P3D2 can be used to construct
a
158P3D2 "knock out" animal that has a defective or altered gene encoding
158P3D2 as ,a result
of homologous recombination between the endogenous gene encoding 158P3D2 and
altered
genomic DNA encoding 158P3D2 introduced into an embryonic cell of the animal.
For
example, cDNA that encodes 158P3D2 can be used to clone genomic DNA encoding
158P3D2
in accordance with established techniques. A portion of the genomic DNA
encoding 158P3D2
can be deleted or replaced with another gene, such as a gene encoding a
selectable marker that
can be used to monitor integration. Typically, several kilobases of unaltered
flanking DNA
(both at the 5' and 3' ends) are included in the vector (see, e.g., Thomas and
Capecchi, Cell,
51:503 (1987) for a description of homologous recombination vectors). The
vector is introduced
into an embryonic stem cell line (e.g., by electroporation) and cells in which
the introduced
DNA has homologously recombined with the endogenous DNA are selected (see,
e.g., Li et al.,
Cell, 69:915 (1992)). The selected cells are then injected into a blastocyst
of an animal (e.g., a
mouse or rat) to form aggregation chimeras (see, e.g., Bradley, in
Teratocarcinomas and
Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford,
1987), pp. 113-
66
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
152). A chimeric embryo can then be implanted into a suitable pseudopregnant
female foster
animal, and the embryo brought to term to create a "knock out" animal. Progeny
harboring the
homologously recombined DNA in their germ cells can be identified by standard
techniques and
used to breed animals in which all cells of the animal contain the
homologously recombined
DNA. Knock out animals can be characterized, for example, for their ability to
defend against
certain pathological conditions or for their development of pathological
conditions due to
absence of a 158P3D2 polypeptide.
VII.) METHODS FOR THE DETECTION OF 158P3D2
[0226] Another aspect of the present invention relates to methods for
detecting 158P3D2
polynucleotides and 158P3D2-related proteins, as well as methods for
identifying a cell that
expresses 158P3D2. The expression profile of 158P3D2 makes it a diagnostic
marker for
metastasized disease. Accordingly, the status of 158P3D2 gene products
provides information
useful for predicting a variety of factors including susceptibility to
advanced stage disease, rate
of progression, and/or tumor aggressiveness. As discussed in detail herein,
the status of
158P3D2 gene products in patient samples can be analyzed by a variety
protocols that are well
known in the art including immunohistochemical analysis, the variety of
Northern blotting
techniques including in situ hybridization, RT-PCR analysis (for example on
laser capture
micro-dissected samples), Western blot analysis and tissue array analysis.
[0227] More particularly, the invention provides assays for the detection of
158P3D2
polynucleotides in a biological sample, such as serum, bone, prostate, and
other tissues, urine,
semen, cell preparations, and the like. Detectable 158P3D2 polynucleotides
include, for
example, a 15SP3D2 gene or fragment thereof, 158P3D2 mRNA, alternative splice
variant
158P3D2 mRNAs, and recombinant DNA or RNA molecules that contain a 158P3D2
polynucleotide. A number of methods for amplifying and/or detecting the
presence of 158P3D2
polynucleotides are well known in the art and can be employed in the practice
of this aspect of
the invention.
[0228] In one embodiment, a method for detecting a 158P3D2 mRNA in a
biological sample
comprises producing cDNA from the sample by reverse transcription using at
least one primer;
amplifying the cDNA so produced using a 158P3D2 polynucleotides as sense and
antisense
primers to amplify 158P3D2 cDNAs therein; and detecting the presence of the
amplified
158P3D2 cDNA. Optionally, the sequence of the amplified 158P3D2 cDNA can be
determined.
67
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0229] In another embodiment, a method of detecting a 158P3D2 gene in a
biological
sample comprises first isolating genomic DNA from the sample; amplifying the
isolated
genomic DNA using 158P3D2 polynucleotides as sense and antisense primers; and
detecting the
presence of the amplified 158P3D2 gene. Any number of appropriate sense and
antisense probe
combinations can be designed from a 158P3D2 nucleotide sequence (see, e.g.,
Figure 2) and
used for this purpose.
[0230] The invention also provides assays for detecting the presence of a
158P3D2 protein
in a tissue or other biological sample such as serum, semen, bone, prostate,
urine, cell
preparations, and the like. Methods for detecting a 158P3D2-related protein
are also well
known and include, for example, immunoprecipitation, immunohistochemical
analysis, Western
blot analysis, molecular binding assays, ELISA, ELIFA and the like. For
example, a method of
detecting the presence of a 158P3D2-related protein in a biological sample
comprises first
contacting the sample with a 158P3D2 antibody, a 158P3D2-reactive fragment
thereof, or a
recombinant protein containing an antigen-binding region of a 158P3D2
antibody; and then
detecting the binding of 158P3D2-related protein in the sample.
[0231] Methods for identifying a cell that expresses 158P3D2 are also within
the scope of
the invention. In one embodiment, an assay for identifying a cell that
expresses a 158P3D2 gene
comprises detecting the presence of 158P3D2 mRNA in the cell. Methods for the
detection of
particular mRNAs in cells are well known and include, for example,
hybridization assays using
complementary DNA probes (such as in situ hybridization using labeled 158P3D2
riboprobes,
Northern blot and related techniques) and various nucleic acid amplification
assays (such as RT-
PCR using complementary primers specific for 158P3D2, and other amplification
type detection
methods, such as, for example, branched DNA, SISBA, TMA and the like).
Alternatively, an
assay for identifying a cell that expresses a 158P3D2 gene comprises detecting
the presence of
158P3D2-related protein in the cell or secreted by the cell. Various methods
for the detection of
proteins are well known in the art and are employed for the detection of
158P3D2-related
proteins and cells that express 158P3D2-related proteins.
[0232] 158P3D2 expression analysis is also useful as a tool for identifying
and evaluating
agents that modulate 158P3D2 gene expression. For example, 158P3D2 expression
is
significantly upregulated in prostate cancer, and is expressed in cancers of
the tissues listed in
Table I. Identification of a molecule or biological agent that inhibits
158P3D2 expression or
over-expression in cancer cells is of therapeutic value. For example, such an
agent can be
68
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
identified by using a screen that quantifies 158P3D2 expression by RT-PCR,
nucleic acid
hybridization or antibody binding.
VIII.) METHODS FOR MONITORING THE STATUS OF 158P3D2-RELATED GENES
AND THEIR PRODUCTS
[0233] Oncogenesis is known to be a inultistep process where cellular growth
becomes
progressively dysregulated and cells progress from a normal physiological
state to precancerous
and then cancerous states (see, e.g., Alers et al., Lab Invest. 77(5): 437-438
(1997) and Isaacs et
al., Cancer Surv. 23: 19-32 (1995)). In this context, examining a biological
sample for evidence
of dysregulated cell growth (such as aberrant 158P3D2 expression in cancers)
allows for early
detection of such aberrant physiology, before a pathologic state such as
cancer has progressed to
a stage that therapeutic options are more limited and or the prognosis is
worse. In such
examinations, the status of 158P3D2 in a biological sample of interest can be
compared, for
example, to the status of 158P3D2 in a corresponding normal sample (e.g., a
sample from that
individual or alternatively another individual that is not affected by a
pathology). An alteration
in the status of 158P3D2 in the biological sainple (as coinpared to the normal
sample) provides
evidence of dysregulated cellular growth. In addition to using a biological
sample that is not
affected by a pathology as a noi7nal sample, one can also use a predetermined
normative value
such as a predetermined normal level of mRNA expression (see, e.g., Grever et
al., J. Comp.
Neurol. 1996 Dec 9; 376(2): 306-14 and U.S. Patent No. 5,837,501) to compare
158P3D2 status
in a sample.
[0234] The term "status" in this context is used according to its art accepted
meaning and
refers to the condition or state of a gene and its products. Typically,
skilled artisans use a
number of parameters to evaluate the condition or state of a gene and its
products. These
include, but are not limited to the location of expressed gene products
(including the location of
158P3D2 expressing cells) as well as the level, and biological activity of
expressed gene
products (such as 158P3D2 mRNA, polynucleotides and polypeptides). Typically,
an alteration
in the status of 158P3D2 comprises a change in the location of 158P3D2 and/or
158P3D2
expressing cells and/or an increase in 158P3D2 inRNA and/or protein
expression.
[0235] 158P3D2 status in a sample can be analyzed by a number of means well
known in
the art, including without limitation, immunohistochemical analysis, in situ
hybridization, RT-
PCR analysis on laser capture micro-dissected samples, Western blot analysis,
and tissue array
analysis. Typical protocols for evaluating the status of a 158P3D2 gene and
gene products are
69
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
found, for exainple in Ausubel et al. eds., 1995, Current Protocols In
Molecular Biology, Units 2
(Northern Blotting), 4(Southern Blotting), 15 (Immunoblotting) and 18 (PCR
Analysis). Thus,
the status of 158P3D2 in a biological sample is evaluated by various methods
utilized by skilled
artisans including, but not limited to genomic Southern analysis (to examine,
for example
perturbations in a 158P3D2 gene), Northern analysis and/or PCR analysis of
158P3D2 mRNA
(to examine, for example alterations in the polynucleotide sequences or
expression levels of
158P3D2 mRNAs), and, Western and/or immunohistochemical analysis (to examine,
for
example alterations in polypeptide sequences, alterations in polypeptide
localization within a
sample, alterations in expression levels of 158P3D2 proteins and/or
associations of 158P3D2
proteins with polypeptide binding partners). Detectable 158P3D2
polynucleotides include, for
example, a 158P3D2 gene or fraginent thereof, 158P3D2 mRNA, alternative splice
variants,
158P3D2 mRNAs, and recombinant DNA or RNA molecules containing a 158P3D2
polynucleotide.
[0236] The expression profile of 158P3D2 makes it a diagnostic marker for
local and/or
metastasized disease, and provides information on the growth or oncogenic
potential of a
biological sample. In particular, the status of 158P3D2 provides information
useful for
predicting susceptibility to particular disease stages, progression, and/or
tumor aggressiveness.
The invention provides methods and assays for determining 158P3D2 status and
diagnosing
cancers that express 158P3D2, such as cancers of the tissues listed in Table
I. For example,
because 158P3D2 mRNA is so highly expressed in prostate and other cancers
relative to normal
prostate tissue, assays that evaluate the levels of 158P3D2 mRNA transcripts
or proteins in a
biological sample can be used to diagnose a disease associated with 158P3D2
dysregulation, and
can provide prognostic information useful in defining appropriate therapeutic
options.
[0237] The expression status of 158P3D2 provides information including the
presence, stage
and location of dysplastic, precancerous and cancerous cells, predicting
susceptibility to various
stages of disease, and/or for gauging tumor aggressiveness. Moreover, the
expression profile
makes it useful as an imaging reagent for metastasized disease. Consequently,
an aspect of the
invention is directed to the various molecular prognostic and diagnostic
methods for examining
the status of 158P3D2 in biological samples such as those from individuals
suffering from, or
suspected of suffering from a pathology characterized by dysregulated cellular
growth, such as
cancer.
[0238] As described above, the status of 158P3D2 in a biological sainple can
be examined
by a number of well-known procedures in the art. For example, the status of
158P3D2 in a
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
biological sample taken from a specific location in the body can be examined
by evaluating the
sample for the presence or absence of 158P3D2 expressing cells (e.g., those
that express
158P3D2 mRNAs or proteins). This examination can provide evidence of
dysregulated cellular
growth, for example, when 158P3D2-expressing cells are found in a biological
sample that does
not normally contain such cells (such as a lymph node), because such
alterations in the status of
158P3D2 in a biological sample are often associated with dysregulated cellular
growth.
Specifically, one indicator of dysregulated cellular growth is the metastases
of cancer cells from
an organ of origin (such as the prostate) to a different area of the body
(such as a lymph node).
In this context, evidence of dysregulated cellular growth is important for
example because occult
lymph node metastases can be detected in a substantial proportion of patients
with prostate
cancer, and such metastases are associated with known predictors of disease
progression (see,
e.g., Murphy et al., Prostate 42(4): 315-317 (2000);Su et al., Semin. Surg.
Oncol. 18(1): 17-28
(2000) and Freeman et al., J Urol 1995 Aug 154(2 Pt 1):474-8).
[0239] In one aspect, the invention provides methods for monitoring 158P3D2
gene
products by determining the status of 158P3D2 gene products expressed by cells
from an
individual suspected of having a disease associated with dysregulated cell
growth (such as
hyperplasia or cancer) and then comparing the status so determined to the
status of 158P3D2
gene products in a corresponding normal sample. The presence of aberrant
158P3D2 gene
products in the test sample relative to the normal sample provides an
indication of the presence
of dysregulated cell growth within the cells of the individual.
[0240] In another aspect, the invention provides assays useful in determining
the presence of
cancer in an individual, comprising detecting a significant increase in
158P3D2 mRNA or
protein expression in a test cell or tissue sample relative to expression
levels in the
corresponding normal cell or tissue. The presence of 158P3D2 mRNA can, for
example, be
evaluated in tissues including but not limited to those listed in Table I. The
presence of
significant 158P3D2 expression in any of these tissues is useful to indicate
the emergence,
presence and/or severity of a cancer, since the corresponding normal tissues
do not express
158P3D2 mRNA or express it at lower levels.
[0241] In a related embodiment, 158P3D2 status is determined at the protein
level rather
than at the nucleic acid level. For example, such a method comprises
determining the level of
158P3D2 protein expressed by cells in a test tissue sample and comparing the
level so
determined to the level of 158P3D2 expressed in a corresponding normal sample.
In one
embodiment, the presence of 158P3D2 protein is evaluated, for example, using
71
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
immunohistochemical methods. 158P3D2 antibodies or binding partners capable of
detecting
158P3D2 protein expression are used in a variety of assay formats well known
in the art for this
purpose.
[0242] In a further embodiment, one can evaluate the status of 158P3D2
nucleotide and
amino acid sequences in a biological sample in order to identify perturbations
in the structure of
these molecules. These perturbations can include insertions, deletions,
substitutions and the
like. Such evaluations are useful because perturbations in the nucleotide and
amino acid
sequences are observed in a large number of proteins associated with a growth
dysregulated
phenotype (see, e.g., Marrogi et al., 1999, J. Cutan. Pathol. 26(8):369-378).
For exainple, a
mutation in the sequence of 158P3D2 may be indicative of the presence or
promotion of a
tumor. Such assays therefore have diagnostic and predictive value where a
mutation in
158P3D2 indicates a potential loss of function or increase in tumor growth.
[0243] A wide variety of assays for observing perturbations in nucleotide and
amino acid
sequences are well known in the art. For example, the size and structure of
nucleic acid or
amino acid sequences of 158P3D2 gene products are observed by the Northern,
Southern,
Western, PCR and DNA sequencing protocols discussed herein. In addition, other
methods for
observing perturbations in nucleotide and amino acid sequences such as single
strand
conformation polymorphism analysis are well known in the art (see, e.g., U.S.
Patent Nos.
5,382,510 issued 7 September 1999, and 5,952,170 issued 17 January 1995).
[0244] Additionally, one can examine the methylation status of a 158P3D2 gene
in a
biological sample. Aberrant demethylation and/or hypermethylation of CpG
islands in gene 5'
regulatory regions frequently occurs in immortalized and transformed cells,
and can result in
altered expression of various genes. For example, promoter hypermethylation of
the pi-class
glutathione S-transferase (a protein expressed in normal prostate but not
expressed in >90% of
prostate carcinomas) appears to permanently silence transcription of this gene
and is the most
frequently detected genomic alteration in prostate carcinomas (De Marzo et
al., Am. J. Pathol.
155(6): 1985-1992 (1999)). In addition, this alteration is present in at least
70% of cases of
high-grade prostatic intraepithelial neoplasia (PIN) (Brooks et al., Cancer
Epidemiol.
Biomarkers Prev., 1998, 7:531-536). In another exaiuple, expression of the
LAGE-I tumor
specific gene (which is not expressed in normal prostate but is expressed in
25-50% of prostate
cancers) is induced by deoxy-azacytidine in lymphoblastoid cells, suggesting
that tumoral
expression is due to demethylation (Lethe et al., Int. J. Cancer 76(6): 903-
908 (1998)). A
variety of assays for examining methylation status of a gene are well known in
the art. For
72
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
example, one can utilize, in Southern hybridization approaches, methylation-
sensitive restriction
enzymes that cannot cleave sequences that contain methylated CpG sites to
assess the
methylation status of CpG islands. In addition, MSP (methylation specific PCR)
can rapidly
profile the methylation status of all the CpG sites present in a CpG island of
a given gene. This
procedure involves initial modification of DNA by sodium bisulfite (which will
convert all
unmethylated cytosines to uracil) followed by amplification using primers
specific for
methylated versus unmethylated DNA. Protocols involving methylation
interference can also be
found for example in Current Protocols In Molecular Biology, Unit 12,
Frederick M. Ausubel et
al. eds., 1995.
[0245] Gene amplification is an additional method for assessing the status of
158P3D2.
Gene amplification is measured in a sainple directly, for example, by
conventional Southern
blotting or Northern blotting to quantitate the transcription of mRNA (Thomas,
1980, Proc. Natl.
Acad. Sci. USA, 77:5201-5205), dot blotting (DNA analysis), or in situ
hybridization, using an
appropriately labeled probe, based on the sequences provided herein.
Alternatively, antibodies
are employed that recognize specific duplexes, including DNA duplexes, RNA
duplexes, and
DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn are
labeled and
the assay carried out where the duplex is bound to a surface, so that upon the
formation of
duplex on the surface, the presence of antibody bound to the duplex can be
detected.
[0246] Biopsied tissue or peripheral blood can be conveniently assayed for the
presence of
cancer cells using for example, Northern, dot blot or RT-PCR analysis to
detect 158P3D2
expression. The presence of RT-PCR amplifiable 158P3D2 mRNA provides an
indication of
the presence of cancer. RT-PCR assays are well known in the art. RT-PCR
detection assays for
tumor cells in peripheral blood are currently being evaluated for use in the
diagnosis and
management of a number of human solid tumors. In the prostate cancer field,
these include RT-
PCR assays for the detection of cells expressing PSA and PSM (Verkaik et al.,
1997, Urol. Res.
25:373-384; Ghossein et al., 1995, J. Clin. Oncol. 13:1195-2000; Heston et
al., 1995, Clin.
Chem. 41:1687-1688).
[0247] A further aspect of the invention is an assessment of the
susceptibility that an
individual has for developing cancer. In one embodiment, a method for
predicting susceptibility
to cancer comprises detecting 158P3D2 mRNA or 158P3D2 protein in a tissue
sample, its
presence indicating susceptibility to cancer, wherein the degree of 158P3D2
mRNA expression
correlates to the degree of susceptibility. In a specific embodiment, the
presence of 158P3D2 in
prostate or other tissue is examined, with the presence of 158P3D2 in the
sample providing an
73
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
indication of prostate cancer susceptibility (or the emergence or existence of
a prostate tumor).
Similarly, one can evaluate the integrity 158P3D2 nucleotide and amino acid
sequences in a
biological sample, in order to identify perturbations in the structure of
these molecules such as
insertions, deletions, substitutions and the like. The presence of one or more
perturbations in
158P3D2 gene products in the sample is an indication of cancer susceptibility
(or the emergence
or existence of a tumor).
[0248] The invention also comprises methods for gauging tumor aggressiveness.
In one
embodiment, a method for gauging aggressiveness of a tumor comprises
determining the level
of 158P3D2 mRNA or 158P3D2 protein expressed by tumor cells, comparing the
level so
determined to the level of 158P3D2 mRNA or 158P3D2 protein expressed in a
corresponding
normal tissue taken from the same individual or a normal tissue reference
sample, wherein the
degree of 158P3D2 mRNA or 158P3D2 protein expression in the tumor sample
relative to the
normal sample indicates the degree of aggressiveness. In a specific
embodiment, aggressiveness
of a tumor is evaluated by determining the extent to which 158P3D2 is
expressed in the tumor
cells, with higher expression levels indicating more aggressive tumors.
Another embodiment is
the evaluation of the integrity of 158P3D2 nucleotide and amino acid sequences
in a biological
sample, in order to identify perturbations in the structure of these molecules
such as insertions,
deletions, substitutions and the like. The presence of one or more
perturbations indicates more
aggressive tumors.
[0249] Another embodiment of the invention is directed to methods for
observing the
progression of a malignancy in an individual over time. In one embodiment,
methods for
observing the progression of a malignancy in an individual over time comprise
determining the
level of 158P3D2 mRNA or 158P3D2 protein expressed by cells in a sample of the
tumor,
comparing the level so determined to the level of 158P3D2 mRNA or 158P3D2
protein
expressed in an equivalent tissue sample taken from the same individual at a
different time,
wherein the degree of 158P3D2 mRNA or 158P3D2 protein expression in the tumor
sample
over time provides information on the progression of the cancer. In a specific
embodiment, the
progression of a cancer is evaluated by determining 158P3D2 expression in the
tumor cells over
time, where increased expression over time indicates a progression of the
cancer. Also, one can
evaluate the integrity 158P3D2 nucleotide and amino acid sequences in a
biological sample in
order to identify perturbations in the structure of these molecules such as
insertions, deletions,
substitutions and the like, where the presence of one or more perturbations
indicates a
progression of the cancer.
74
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0250] The above diagnostic approaches can be combined with any one of a wide
variety of
prognostic and diagnostic protocols known in the art. For example, another
embodiment of the
invention is directed to methods for observing a coincidence between the
expression of
158P3D2 gene and 158P3D2 gene products (or perturbations in 158P3D2 gene and
158P3D2
gene products) and a factor that is associated with malignancy, as a means for
diagnosing and
prognosticating the status of a tissue sample. A wide variety of factors
associated with
malignancy can be utilized, such as the expression of genes associated with
malignancy (e.g.,
PSA, PSCA and PSM expression for prostate cancer etc.) as well as gross
cytological
observations (see, e.g., Bocking et al., 1984, Anal. Quant. Cytol. 6(2):74-88;
Epstein, 1995,
Hum. Pathol. 26(2):223-9; Thorson et al., 1998, Mod. Pathol. 11(6):543-51;
Baisden et al.,
1999, Am. J. Surg. Pathol. 23(8):918-24). Methods for observing a coincidence
between the
expression of 158P3D2 geiie and 158P3D2 gene products (or perturbations in
158P3D2 gene
and 158P3D2 gene products) and another factor that is associated with
malignancy are useful,
for example, because the presence of a set of specific factors that coincide
with disease provides
information crucial for diagnosing and prognosticating the status of a tissue
sainple.
[0251] In one embodiment, methods for observing a coincidence between the
expression of
158P3D2 gene and 158P3D2 gene products (or perturbations in 158P3D2 gene and
158P3D2
gene products) and another factor associated with malignancy entails detecting
the
overexpression of 158P3D2 mRNA or protein in a tissue sample, detecting the
overexpression
of PSA mRNA or protein in a tissue sample (or PSCA or PSM expression), and
observing a
coincidence of 158P3D2 mRNA or protein and PSA mRNA or protein overexpression
(or PSCA
or PSM expression). In a specific embodiment, the expression of 158P3D2 and
PSA mRNA in
prostate tissue is examined, where the coincidence of 158P3D2 and PSA mRNA
overexpression
in the sample indicates the existence of prostate cancer, prostate cancer
susceptibility or the
emergence or status of a prostate tumor.
[0252] Methods for detecting and quantifying the expression of 158P3D2 mRNA or
protein
are described herein, and standard nucleic acid and protein detection and
quantification
technologies are well known in the art. Standard methods for the detection and
quantification of
158P3D2 mRNA include in situ hybridization using labeled 158P3D2 riboprobes,
Northenl blot
and related techniques using 158P3D2 polynucleotide probes, RT-PCR analysis
using primers
specific for 158P3D2, and other amplification type detection methods, such as,
for example,
branched DNA, SISBA, TMA and the like. In a specific embodiment, semi-
quantitative RT-
PCR is used to detect and quantify 158P3D2 mRNA expression. Any number of
primers
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
capable of amplifying 158P3D2 can be used for this purpose, including but not
limited to the
various primer sets specifically described herein. In a specific embodiment,
polyclonal or
monoclonal antibodies specifically reactive with the wild-type 158P3D2 protein
can be used in
an immunohistocheinical assay of biopsied tissue.
IX.) IDENTIFICATION OF MOLECULES THAT INTERACT WITH 158P3D2
[0253] The 158P3D2 protein and nucleic acid sequences disclosed herein allow a
skilled
artisan to identify proteins, small molecules and other agents that interact
with 158P3D2, as well
as pathways activated by 158P3D2 via any one of a variety of art accepted
protocols. For
example, one can utilize one of the so-called interaction trap systems (also
referred to as the
"two-hybrid assay"). In such systems, molecules interact and reconstitute a
transcription factor
which directs expression of a reporter gene, whereupon the expression of the
reporter gene is
assayed. Other systems identify protein-protein interactions in vivo through
reconstitution of a
eukaryotic transcriptional activator, see, e.g., U.S. Pateiat Nos. 5,955,280
issued 21 September
1999, 5,925,523 issued 20 July 1999, 5,846,722 issued 8 December 1998 and
6,004,746 issued
21 December 1999. Algorithms are also available in the art for genome-based
predictions of
protein function (see, e.g., Marcotte, et al., Nature 402: 4 November 1999, 83-
86).
[0254] Alternatively one can screen peptide libraries to identify molecules
that interact with
158P3D2 protein sequences. In such methods, peptides that bind to 158P3D2 are
identified by
screening libraries that encode a random or controlled collection of amino
acids. Peptides
encoded by the libraries are expressed as fusion proteins of bacteriophage
coat proteins, the
bacteriophage particles are then screened against the 158P3D2 protein(s).
[0255] Accordingly, peptides having a wide variety of uses, such as
therapeutic, prognostic
or diagnostic reagents, are thus identified without any prior information on
the structure of the
expected ligand or receptor molecule. Typical peptide libraries and screening
methods that can
be used to identify molecules that interact with 158P3D2 protein sequences are
disclosed for
example in U.S. Patent Nos. 5,723,286 issued 3 March 1998 and 5,733,731 issued
31 March
1998.
[0256] Alternatively, cell lines that express 158P3D2 are used to identify
protein-protein
interactions mediated by 158P3D2. Such interactions can be examined using
immunoprecipitation techniques (see, e.g., Hamilton B.J., et al. Biochem.
Biophys. Res.
Commun. 1999, 261:646-51). 158P3D2 protein can be immunoprecipitated from
158P3D2-
expressing cell lines using anti-158P3D2 antibodies. Alternatively, antibodies
against His-tag
76
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
can be used in a cell line engineered to express fusions of 158P3D2 and a His-
tag (vectors
mentioned above). The immunoprecipitated complex can be examined for protein
association
by procedures such as Western blotting, 35S-methionine labeling of proteins,
protein
microsequencing, silver staining and two-dimensional gel electrophoresis.
[0257] Small molecules and ligands that interact with 158P3D2 can be
identified through
related embodiments of such screening assays. For example, small molecules can
be identified
that interfere with protein function, including molecules that interfere with
158P3D2's ability to
mediate phosphorylation and de-phosphorylation, interaction with DNA or RNA
molecules as
an indication of regulation of cell cycles, second messenger signaling or
tumorigenesis.
Similarly, small molecules that modulate 158P3D2-related ion channel, protein
pump, or cell
communication functions are identified and used to treat patients that have a
cancer that
expresses 158P3D2 (see, e.g., Hille, B., Ionic Channels of Excitable Membranes
2nd Ed.,
Sinauer Assoc., Sunderland, MA, 1992). Moreover, ligands that regulate 158P3D2
function can
be identified based on their ability to bind 158P3D2 and activate a reporter
construct. Typical
methods are discussed for example in U.S. Patent No. 5,928,868 issued 27 July
1999, and
include methods for forming hybrid ligands in which at least one ligand is a
small molecule. In
an illustrative embodiment, cells engineered to express a fusion protein of
158P3D2 and a DNA-
binding protein are used to co-express a fusion protein of a hybrid
ligand/small molecule and a
cDNA library transcriptional activator protein. The cells further contain a
reporter gene, the
expression of which is conditioned on the proximity of the first and second
fusion proteins to
each other, an event that occurs only if the hybrid ligand binds to target
sites on both hybrid
proteins. Those cells that express the reporter gene are selected and the
unknown small
molecule or the unknown ligand is identified. This method provides a means of
identifying
modulators, which activate or inhibit 158P3D2.
[0258] An embodiment of this invention comprises a method of screening for a
molecule
that interacts with a 158P3D2 amino acid sequence shown in Figure 2 or Figure
3, comprising
the steps of contacting a population of molecules with a 158P3D2 amino acid
sequence,
allowing the population of molecules and the 158P3D2 amino acid sequence to
interact under
conditions that facilitate an interaction, determining the presence of a
molecule that interacts
with the 158P3D2 amino acid sequence, and then separating molecules that do
not interact with
the 158P3D2 amino acid sequence from molecules that do. In a specific
embodiment, the
method further comprises purifying, characterizing and identifying a molecule
that interacts with
the 158P3D2 amino acid sequence. The identified molecule can be used to
modulate a function
77
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
performed by 158P3D2. In a preferred embodiment, the 158P3D2 ainino acid
sequence is
contacted with a library of peptides.
X.) THERAPEUTIC METHODS AND COMPOSITIONS
[0259] The identification of 158P3D2 as a protein that is normally expressed
in a restricted
set of tissues, but which is also expressed in cancers such as those listed in
Table I, opens a
number of therapeutic approaches to the treatment of such cancers.
[0260] Of note, targeted antitumor therapies have been useful even when the
targeted protein
is expressed on normal tissues, even vital normal organ tissues. A vital organ
is one that is
necessary to sustain life, such as the heart or colon. A non-vital organ is
one that can be
removed whereupon the individual is still able to survive. Examples of non-
vital organs are
ovary, breast, and prostate.
[0261] For example, HerceptinD is an FDA approved pharmaceutical that has as
its active
ingredient an antibody which is immunoreactive with the protein variously
known as HER2,
HER2/neu; and erb-b-2. It is marketed by Genentech and has been a commercially
successful
antitumor agent. Herceptin sales reached almost $400 million in 2002.
Herceptin is a treatment
for HER2 positive metastatic breast cancer. However, the expression of HER2 is
not limited to
such tumors. The same protein is expressed in a number of normal tissues. In
particular, it is
known that HER2/neu is present in normal kidney and heart, thus these tissues
are present in all
human recipients of Herceptin. The presence of HER2/neu in normal kidney is
also confirmed
by Latif, Z., et al., B.J.U. International (2002) 89:5-9. As shown in this
article (which evaluated
whether renal cell carcinoma should be a preferred indication for anti-HER2
antibodies such as
Herceptin) both protein and mRNA are produced in benign renal tissues.
Notably, HER2/neu
protein was strongly overexpressed in benign renal tissue.
[0262] Despite the fact that HER2/neu is expressed in such vital tissues as
heart and kidney,
Herceptin is a very useful, FDA approved, and commercially successful drug.
The effect of
Herceptin on cardiac tissue, i.e., "cardiotoxicity," has merely been a side
effect to treatment.
When patients were treated with Herceptin alone, significant cardiotoxicity
occurred in a very
low percentage of patients.
[0263] Of particular note, although kidney tissue is indicated to exhibit
normal expression,
possibly even higher expression than cardiac tissue, kidney has no appreciable
Herceptin side
effect whatsoever. Moreover, of the diverse array of normal tissues in which
HER2 is
expressed, there is very little occurrence of any side effect. Only cardiac
tissue has manifested
78
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
any appreciable side effect at all. A tissue such as kidney, where HER2/neu
expression is
especially notable, has not been the basis for any side effect.
[0264] Furthermore, favorable therapeutic effects have been found for
antitumor therapies
that target epidermal growth factor receptor (EGFR). EGFR is also expressed in
numerous
normal tissues. There have been very limited side effects in normal tissues
following use of
anti-EGFR therapeutics.
[0265] Thus, expression of a target protein in normal tissue, even vital
normal tissue, does
not defeat the utility of a targeting agent for the protein as a therapeutic
for certain tumors in
which the protein is also overexpressed.
[0266] Accordingly, therapeutic approaches that inhibit the activity of a
158P3D2 protein
are useful for patients suffering from a cancer that expresses 158P3D2. These
therapeutic
approaches generally fall into two classes. One class comprises various
methods for inhibiting
the binding or association of a 158P3D2 protein with its binding partner or
with other proteins.
Another class comprises a variety of methods for inhibiting the transcription
of a 158P3D2 gene
or translation of 158P3D2 mRNA.
X.A.) Anti-Cancer Vaccines
[0267] The invention provides cancer vaccines comprising a 158P3D2-related
protein or
158P3D2-related nucleic acid. In view of the expression of 158P3D2, cancer
vaccines prevent
and/or treat 158P3D2-expressing cancers with minimal or no effects on non-
target tissues. The
use of a tumor antigen in a vaccine that generates humoral and/or cell-
mediated immune
responses as anti-cancer therapy is well known in the art and has been
employed in prostate
cancer using human PSMA and rodent PAP immunogens (Hodge et al., 1995, Int. J.
Cancer
63:231-237; Fong et al., 1997, J. Immunol. 159:3113-3117).
[0268] Such methods can be readily practiced by employing a 158P3D2-related
protein, or a
158P3D2-encoding nucleic acid molecule and recombinant vectors capable of
expressing and
presenting the 158P3D2 immunogen (which typically comprises a number of
antibody or T cell
epitopes). Skilled artisans understand that a wide variety of vaccine systems
for delivery of
immunoreactive epitopes are known in the art (see, e.g., Heryln et al., Ann
Med 1999 Feb
31(1):66-78; Maruyama et al., Cancer Immunol Immunother 2000 Jun 49(3):123-32)
Briefly,
such methods of generating an immune response (e.g., humoral and/or cell-
mediated) in a
mammal, comprise the steps of: exposing the mammal's immune system to an
immunoreactive
epitope (e.g., an epitope present in a 158P3D2 protein shown in Figure 3 or
analog or homolog
thereof) so that the mammal generates an immune response that is specific for
that epitope (e.g.,
79
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
generates antibodies that specifically recognize that epitope). In a preferred
method, a 158P3D2
immunogen contains a biological motif, see e.g., Tables VIII-XXI and XXII-
XLIX, or a peptide
of a size range from 158P3D2 indicated in Figure 5, Figure 6, Figure 7, Figure
8, and Figure 9.
[0269] The entire 158P3D2 protein, immunogenic regions or epitopes thereof can
be
combined and delivered by various means. Such vaccine coinpositions can
include, for
example, lipopeptides (e.g.,Vitiello, A. et al., J. Clin. Invest. 95:341,
1995), peptide
compositions encapsulated in poly(DL-lactide-co-glycolide) ("PLG")
microspheres (see, e.g.,
Eldridge, et al., Molec. Immunol. 28:287-294, 1991: Alonso et al., Vaccine
12:299-306, 1994;
Jones et al., Vaccine 13:675-681, 1995), peptide compositions contained in
immune stimulating
complexes (ISCOMS) (see, e.g., Takahashi et al., Nature 344:873-875, 1990; Hu
et al., Clin Exp
Immunol. 113:235-243, 1998), multiple antigen peptide systems (MAPs) (see
e.g., Tam, J. P.,
Proc. Natl. Acad. Sci. U.S.A. 85:5409-5413, 1988; Tam, J.P., J. Iinmunol.
Methods 196:17-32,
1996), peptides formulated as multivalent peptides; peptides for use in
ballistic delivery systems,
typically crystallized peptides, viral delivery vectors (Perkus, M. E. et al.,
In: Concepts in
vaccine development, Kaufinann, S. H. E., ed., p. 379, 1996; Chakrabarti, S.
et al., Nature
320:535, 1986; Hu, S. L. et al., Nature 320:537, 1986; Kieny, M.-P. et al.,
AIDS
Bio/Technology 4:790, 1986; Top, F. H. et al., J. Infect. Dis. 124:148, 1971;
Chanda, P. K. et
al., Virology 175:535, 1990), particles of viral or synthetic origin (e.g.,
Kofler, N. et al., J.
Immunol. Methods. 192:25, 1996; Eldridge, J. H. et al., Sem. Hematol. 30:16,
1993; Falo, L. D.,
Jr. et al., Nature Med. 7:649, 1995), adjuvants (Warren, H. S., Vogel, F. R.,
and Chedid, L. A.
Annu. Rev. Immunol. 4:369, 1986; Gupta, R. K. et al., Vaccine 11:293, 1993),
liposomes
(Reddy, R. et al., J. Immunol. 148:1585, 1992; Rock, K. L., Immunol. Today
17:131, 1996), or,
naked or particle absorbed cDNA (Ulmer, J. B. et al., Science 259:1745, 1993;
Robinson, H. L.,
Hunt, L. A., and Webster, R. G., Vaccine 11:957, 1993; Shiver, J. W. et al.,
In: Concepts in
-vaccine development, Kaufinann, S. H. E., ed., p. 423, 1996; Cease, K. B.,
and Berzofsky, J. A.,
Annu. Rev. Immunol. 12:923, 1994 and Eldridge, J. H. et al., Sem. Hematol.
30:16, 1993).
Toxin-targeted delivery technologies, also known as receptor mediated
targeting, such as those
of Avant Immunotherapeutics, Inc. (Needham, Massachusetts) may also be used.
[0270] In patients with 158P3D2-associated cancer, the vaccine compositions of
the
invention can also be used in conjunction with other treatments used for
cancer, e.g., surgery,
chemotherapy, drug therapies, radiation therapies, etc. including use in
combination with
immune adjuvants such as IL-2, IL-12, GM-CSF, and the like.
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
X.A.I. Cellular Vaccines
[0271] CTL epitopes can be determined using specific algorithms to identify
peptides within
158P3D2 protein that bind corresponding HLA alleles (see e.g., Table IV;
EpimerTM and
EpimatrixTM, Brown University (URL brown.edu/Research/TB-
HIV-Lab/epimatrix/epimatrix.html); and, BIMAS, (URL bimas.dcrt.nih.gov/;
SYFPEITHI at
URL syfpeithi.bmi-heidelberg.com/). In a preferred embodiment, a 158P3D2
immunogen
contains one or more amino acid sequences identified using techniques well
known in the art,
such as the sequences shown in Tables VIII-XXI and XXII-XLIX or a peptide of
8, 9, 10 or 11
amino acids specified by an HLA Class I motif/supermotif (e.g., Table IV (A),
Table IV (D), or
Table IV (E)) and/or a peptide of at least 9 amino acids that comprises an HLA
Class II
motif/supennotif (e.g., Table IV (B) or Table IV (C)). As is appreciated in
the art, the HLA
Class I binding groove is essentially closed ended so that peptides of only a
particular size range
can fit into the groove and be bound, generally HLA Class I epitopes are 8, 9,
10, or 11 amino
acids long. In contrast, the HLA Class II binding groove is essentially open
ended; therefore a
peptide of about 9 or more amino acids can be bound by an HLA Class II
molecule. Due to the
binding groove differences between HLA Class I and II, HLA Class I motifs are
length specific,
i.e., position two of a Class I motif is the second amino acid in an amino to
carboxyl direction of
the peptide. The ainino acid positions in a Class II motif are relative only
to each other, not the
overall peptide, i.e., additional amino acids can be attached to the amino
and/or carboxyl termini
of a motif-bearing sequence. HLA Class II epitopes are often 9, 10, 11, 12,
13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, or 25 amino acids long, or longer than 25 amino
acids.
X.A.2. Antibody-based Vaccines
[0272] A wide variety of methods for generating an immune response in a
maminal are
known in the art (for example as the first step in the generation of
hybridomas). Methods of
generating an immune response in a mammal comprise exposing the mammal's
immune system
to an immunogenic epitope on a protein (e.g., a 158P3D2 protein) so that an
immune response is
generated. A typical embodiment consists of a method for generating an immune
response to
158P3D2 in a host, by contacting the host with a sufficient amount of at least
one 158P3D2 B
cell or cytotoxic T-cell epitope or analog thereof; and at least one periodic
interval thereafter re-
contacting the host with the 158P3D2 B cell or cytotoxic T-cell epitope or
analog thereof. A
specific embodiment consists of a method of generating an immune response
against a
158P3D2-related protein or a man-made multiepitopic peptide comprising:
administering
158P3D2 immunogen (e.g., a 158P3D2 protein or a peptide fragment thereof, a
158P3D2 fusion
81
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
protein or analog etc.) in a vaccine preparation to a human or another mammal.
Typically, such
vaccine preparations further contain a suitable adjuvant (see, e.g., U.S.
Patent No. 6,146,635) or
a universal helper epitope such as a PADRETM peptide (Epimmune Inc., San
Diego, CA; see,
e.g., Alexander et al., J. Immunol. 2000 164(3); 164(3): 1625-1633; Alexander
et al., Immunity
1994 1(9): 751-761 and Alexander et al., Immunol. Res. 1998 18(2): 79-92). An
alternative
method comprises generating an iinmune response in an individual against a
158P3D2
immunogen by: administering in vivo to muscle or skin of the individual's body
a DNA
molecule that coinprises a DNA sequence that encodes a 158P3D2 immunogen, the
DNA
sequence operatively linked to regulatory sequences which control the
expression of the DNA
sequence; wherein the DNA molecule is taken up by cells, the DNA sequence is
expressed in the
cells and an immune response is generated against the immunogen (see, e.g.,
U.S. Patent No.
5,962,428). Optionally a genetic vaccine facilitator such as anionic lipids;
saponins; lectins;
estrogenic compounds; hydroxylated lower alkyls; dimethyl sulfoxide; and urea
is also
administered. In addition, an antiidiotypic antibody can be administered that
mimics 158P3D2,
in order to generate a response to the target antigen.
X.A.3. Nucleic Acid Vaccines:
[0273] Vaccine coinpositions of the invention include nucleic acid-mediated
modalities.
DNA or RNA that encode protein(s) of the invention can be administered to a
patient. Genetic
immunization methods can be einployed to generate prophylactic or therapeutic
humoral and
cellular immune responses directed against cancer cells expressing 158P3D2.
Constructs
comprising DNA encoding a 158P3D2-related protein/immunogen and appropriate
regulatory
sequences can be injected directly into muscle or skin of an individual, such
that the cells of the
muscle or skin take-up the construct and express the encoded 158P3D2
protein/imm.unogen.
Alternatively, a vaccine comprises a 158P3D2-related protein. Expression of
the 158P3D2-
related protein immunogen results in the generation of prophylactic or
therapeutic humoral and
cellular immunity against cells that bear a 158P3D2 protein. Various
prophylactic and
therapeutic genetic immunization techniques known in the art can be used (for
review, see
information and references published at Internet address genweb.com). Nucleic
acid-based
delivery is described, for instance, in Wolff et. al., Science 247:1465 (1990)
as well as U.S.
Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647;
WO 98/04720.
Examples of DNA-based delivery technologies include "naked DNA", facilitated
(bupivicaine,
polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-
mediated ("gene
gun") or pressure-mediated delivery (see, e.g., U.S. Patent No. 5,922,687).
82
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0274] For therapeutic or prophylactic immunization purposes, proteins of the
invention can
be expressed via viral or bacterial vectors. Various viral gene delivery
systems that can be used
in the practice of the invention include, but are not limited to, vaccinia,
fowlpox, canarypox,
adenovirus, influenza, poliovirus, adeno-associated virus, lentivirus, and
sindbis virus (see, e.g.,
Restifo, 1996, Curr. Opin. Immunol. 8:658-663; Tsang et al. J. Natl. Cancer
Inst. 87:982-990
(1995)). Non-viral delivery systems can also be employed by introducing naked
DNA encoding
a 158P3D2-related protein into the patient (e.g., intramuscularly or
intradermally) to induce an
anti-tumor response.
[0275] Vaccinia virus is used, for example, as a vector to express nucleotide
sequences that
encode the peptides of the invention. Upon introduction into a host, the
recombinant vaccinia
virus expresses the protein immunogenic peptide, and thereby elicits a host
immune response.
Vaccinia vectors and methods useful in iinmunization protocols are described
in, e.g., U.S.
Patent No. 4,722,848. Another vector is BCG (Bacille Calmette Guerin). BCG
vectors are
described in Stover et al., Nature 351:456-460 (1991). A wide variety of other
vectors useful for
therapeutic administration or immunization of the peptides of the invention,
e.g., adeno and
adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors,
detoxified anthrax
toxin vectors, and the like, will be apparent to those skilled in the art from
the description herein.
[0276] Thus, gene delivery systems are used to deliver a 158P3D2-related
nucleic acid
molecule. In one embodiment, the full-length human 158P3D2 cDNA is employed.
In another
embodiment, 158P3D2 nucleic acid molecules encoding specific cytotoxic T
lymphocyte (CTL)
and/or antibody epitopes are employed.
X.A.4. Ex Vivo Vaccines
[0277] Various ex vivo strategies can also be employed to generate an immune
response.
One approach involves the use of antigen presenting cells (APCs) such as
dendritic cells (DC) to
present 158P3D2 antigen to a patient's immune system. Dendritic cells express
MHC class I
and II molecules, B7 co-stiinulator, and IL- 12, and are thus highly
specialized antigen
presenting cells. In prostate cancer, autologous dendritic cells pulsed with
peptides of the
prostate-specific membrane antigen (PSMA) are being used in a Phase I clinical
trial to
stimulate prostate cancer patients' immune systems (Tjoa et al., 1996,
Prostate 28:65-69;
Murphy et al., 1996, Prostate 29:371-380). Thus, dendritic cells can be used
to present
158P3D2 peptides to T cells in the context of MHC class I or II molecules. In
one embodiment,
autologous dendritic cells are pulsed with 158P3D2 peptides capable of binding
to MHC class I
and/or class II molecules. In another embodiment, dendritic cells are pulsed
with the complete
83
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
158P3D2 protein. Yet another embodiment involves engineering the
overexpression of a
158P3D2 gene in dendritic cells using various implementing vectors known in
the art, such as
adenovirus (Arthur et al., 1997, Cancer Gene Ther. 4:17-25), retrovirus
(Henderson et al., 1996,
Cancer Res. 56:3763-3770), lentivirus, adeno-associated virus, DNA
transfection (Ribas et al.,
1997, Cancer Res. 57:2865-2869), or tumor-derived RNA,transfection (Ashley et
al., 1997, J.
Exp. Med. 186:1177-1182). Cells that express 158P3D2 can also be engineered to
express
immune modulators, such as GM-CSF, and used as immunizing agents.
X.B.) 158P3D2 as a Target for Antibody-based TherapX
[0278] 158P3D2 is an attractive target for antibody-based therapeutic
strategies. A number
of antibody strategies are known in the art for targeting both extracellular
and intracellular
molecules (see, e.g., complement and ADCC mediated killing as well as the use
of intrabodies).
Because 158P3D2 is expressed by cancer cells of various lineages relative to
corresponding
normal cells, systemic administration of 158P3D2-im.munoreactive compositions
are prepared
that exhibit excellent sensitivity without toxic, non-specific and/or non-
target effects caused by
binding of the immunoreactive composition to non-target organs and tissues.
Antibodies
specifically reactive with domains of 158P3D2 are useful to treat 158P3D2-
expressing cancers
systemically, either as conjugates with a toxin or therapeutic agent, or as
naked antibodies
capable of inhibiting cell proliferation or function.
[0279] 158P3D2 antibodies can be introduced into a patient such that the
antibody binds to
158P3D2 and modulates a function, such as an interaction with a binding
partner, and
consequently mediates destruction of the tumor cells and/or inhibits the
growth of the tumor
cells. Mechanisms by which such antibodies exert a therapeutic effect can
include coinplement-
mediated cytolysis, antibody-dependent cellular cytotoxicity, modulation of
the physiological
function of 158P3D2, inhibition of ligand binding or signal transduction
pathways, modulation
of tumor cell differentiation, alteration of tumor angiogenesis factor
profiles, and/or apoptosis.
[0280] Those skilled in the art understand that antibodies can be used to
specifically target
and bind immunogenic molecules such as an iminunogenic region of a 158P3D2
sequence
shown in Figure 2 or Figure 3. In addition, skilled artisans understand that
it is routine to
conjugate antibodies to cytotoxic agents (see, e.g., Slevers et al. Blood
93:11 3678-3684 (June 1,
1999)). When cytotoxic and/or therapeutic agents are delivered directly to
cells, such as by
conjugating them to antibodies specific for a molecule expressed by that cell
(e.g., 158P3D2),
the cytotoxic agent will exert its known biological effect (i.e.,
cytotoxicity) on those cells.
84
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0281] A wide variety of compositions and methods for using antibody-cytotoxic
agent
conjugates to kill cells are known in the art. In the context of cancers,
typical methods entail
administering to an animal having a tumor a biologically effective ainount of
a conjugate
comprising a selected cytotoxic and/or therapeutic agent linked to a targeting
agent (e.g., an anti-
158P3D2 antibody) that binds to a marker (e.g., 158P3D2) expressed, accessible
to binding or
localized on the cell surfaces. A typical einbodiment is a method of
delivering a cytotoxic
and/or therapeutic agent to a cell expressing 158P3D2, comprising conjugating
the cytotoxic
agent to an antibody that immunospecifically binds to a 158P3D2 epitope, and,
exposing the cell
to the antibody-agent conjugate. Another illustrative embodiment is a method
of treating an
individual suspected of suffering from metastasized cancer, comprising a step
of administering
parenterally to said individual a pharmaceutical composition comprising a
therapeutically
effective amount of an antibody conjugated to a cytotoxic and/or therapeutic
agent.
[0282] Cancer immunotherapy using anti-158P3D2 antibodies can be done in
accordance
with various approaches that have been successfully employed in the treatment
of other types of
cancer, including but not limited to colon cancer (Arlen et al., 1998, Crit.
Rev. Immunol.
18:133-138), multiple myeloma (Ozaki et al., 1997, Blood 90:3179-3186,
Tsunenari et al., 1997,
Blood 90:2437-2444), gastric cancer (Kasprzyk et al., 1992, Cancer Res.
52:2771-2776), B-cell
lymphoma (Funakoshi et al., 1996, J. Immunother. Emphasis Tumor Immunol. 19:93-
101),
leukemia (Zhong et al., 1996, Leuk. Res. 20:581-589), colorectal cancer (Moun
et al., 1994,
Cancer Res. 54:6160-6166; Velders et al., 1995, Cancer Res. 55:4398-4403), and
breast cancer
(Shepard et al., 1991, J. Clin. Iminunol. 11:117-127). Some therapeutic
approaches involve
conjugation of naked antibody to a toxin or radioisotope, such as the
conjugation of Y91 or 1131
to anti-CD20 antibodies (e.g., ZevalinTM, IDEC Pharmaceuticals Corp. or
BexxarTM, Coulter
Pharmaceuticals), while others involve co-adininistration of antibodies and
other therapeutic
agents, such as HerceptinTM (trastuzumab) with paclitaxel (Genentech, Inc.).
The antibodies
can be conjugated to a therapeutic agent. To treat prostate cancer, for
exainple, 158P3D2
antibodies can be administered in conjunction with radiation, chemotherapy or
hormone
ablation. Also, antibodies can be conjugated to a toxin such as calicheamicin
(e.g., MylotargTM,
Wyeth-Ayerst, Madison, NJ, a recombinant hunlanized IgG4 kappa antibody
conjugated to
antitumor antibiotic calicheamicin) or a maytansinoid (e.g., taxane-based
Tumor-Activated
Prodrug, TAP, platform, IminunoGen, Cambridge, MA, also see e.g., US Patent
5,416,064).
[0283] Although 158P3D2 antibody therapy is useful for all stages of cancer,
antibody
therapy can be particularly appropriate in advanced or metastatic cancers.
Treatment with the
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
antibody therapy of the invention is indicated for patients who have received
one or more rounds
of chemotherapy. Alternatively, antibody therapy of the invention is combined
with a
chemotherapeutic or radiation regimen for patients who have not received
chemotherapeutic
treatment. Additionally, antibody therapy can enable the use of reduced
dosages of concomitant
chemotherapy, particularly for patients who do not tolerate the toxicity of
the chemotherapeutic
agent very well. Fan et al. (Cancer Res. 53:4637-4642, 1993), Prewett et al.
(International J. of
Onco. 9:217-224, 1996), and Hancock et al. (Cancer Res. 51:4575-4580, 1991)
describe the use
of various antibodies together with chemotherapeutic agents.
[0284] Although 158P3D2 antibody therapy is useful for all stages of cancer,
antibody
therapy can be particularly appropriate in advanced or metastatic cancers.
Treatment with the
antibody therapy of the invention is indicated for patients who have received
one or more rounds
of cheinotherapy. Alternatively, antibody therapy of the invention is combined
with a
chemotherapeutic or radiation regimen for patients who have not received
chemotherapeutic
treatment. Additionally, antibody therapy can enable the use of reduced
dosages of concomitant
chemotherapy, particularly for patients who do not tolerate the toxicity of
the cheinotherapeutic
agent very well.
[0285] Cancer patients can be evaluated for the presence and level of 158P3D2
expression,
preferably using immunohistochemical assessments of tumor tissue, quantitative
158P3D2
imaging, or other techniques that reliably indicate the presence and degree of
158P3D2
expression. Immunohistochemical analysis of tumor biopsies or surgical
specimens is preferred
for this purpose. Methods for immunohistochemical analysis of tumor tissues
are well known in
the art.
[0286] Anti-158P3D2 monoclonal antibodies that treat prostate and other
cancers include
those that initiate a potent immune response against the tumor or those that
are directly
cytotoxic. In this regard, anti-158P3D2 monoclonal antibodies (mAbs) can
elicit tumor cell
lysis by either compleinent-mediated or antibody-dependent cell cytotoxicity
(ADCC)
mechanisms, both of which require an intact Fc portion of the immunoglobulin
molecule for
interaction with effector cell Fc receptor sites on complement proteins. In
addition, anti-
158P3D2 mAbs that exert a direct biological effect on tumor growth are useful
to treat cancers
that express 158P3D2. Mechanisms by which directly cytotoxic mAbs act include:
inhibition of
cell growth, modulation of cellular differentiation, modulation of tumor
angiogenesis factor
profiles, and the induction of apoptosis. The mechanism(s) by which a
particular anti-158P3D2
mAb exerts an anti-tumor effect is evaluated using any number of in vitro
assays that evaluate
86
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
cell death such as ADCC, ADMMC, complement-mediated cell lysis, and so forth,
as is
generally known in the art.
[0287] In some patients, the use of murine or other non-human monoclonal
antibodies, or
human/mouse chimeric mAbs can induce moderate to strong immune responses
against the non-
huinan antibody. This can result in clearance of the antibody from circulation
and reduced
efficacy. In the most severe cases, such an immune response can lead to the
extensive formation
of iinmune complexes which, potentially, can cause renal failure. Accordingly,
preferred
monoclonal antibodies used in the therapeutic methods of the invention are
those that are either
fully human or humanized and that bind specifically to the target 158P3D2
antigen with high
affinity but exhibit low or no antigenicity in the patient.
[0288] Therapeutic methods of the invention contemplate the administration of
single anti-
158P3D2 mAbs as well as coinbinations, or cocktails, of different mAbs. Such
mAb cocktails
can have certain advantages inasmuch as they contain niAbs that target
different epitopes,
exploit different effector mechanisms or combine directly cytotoxic mAbs with
mAbs that rely
on immune effector functionality. Such mAbs in combination can exhibit
synergistic
therapeutic effects. In addition, anti-158P3D2 mAbs can be administered
concomitantly with
other therapeutic modalities, including but not limited to various
chemotherapeutic agents,
androgen-blockers, immune modulators (e.g., IL-2, GM-CSF), surgery or
radiation. The anti-
158P3D2 mAbs are administered in their "naked" or unconjugated form, or can
have a
therapeutic agent(s) conjugated to them.
[0289] Anti-158P3D2 antibody formulations are administered via any route
capable of
delivering the antibodies to a tumor cell. Routes of administration include,
but are not limited
to, intravenous, intraperitoneal, intramuscular, intratumor, intradermal, and
the like. Treatment
generally involves repeated administration of the anti-158P3D2 antibody
preparation, via an
acceptable route of administration such as intravenous injection (IV),
typically at a dose in the
range of about 0.1, .2, .3, .4, .5, .6, .7, .8, .9., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 15, 20, or 25 mg/kg body
weight. In general, doses in the range of 10-1000 mg mAb per week are
effective and well
tolerated.
[0290] Based on clinical experience with the HerceptinTM mAb in the treatment
of metastatic
breast cancer, an initial loading dose of approximately 4 mg/kg patient body
weight IV,
followed by weekly doses of about 2 mg/kg IV of the anti-158P3D2 mAb
preparation represents
an acceptable dosing regimen. Preferably, the initial loading dose is
administered as a 90-
minute or longer infusion. The periodic maintenance dose is administered as a
30 minute or
87
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
longer infusion, provided the initial dose was well tolerated. As appreciated
by those of skill in
the art, various factors can influence the ideal dose regimen in a particular
case. Such factors
include, for example, the binding affinity and half life of the Ab or niAbs
used, the degree of
158P3D2 expression in the patient, the extent of circulating shed 158P3D2
antigen, the desired
steady-state antibody concentration level, frequency of treatment, and the
influence of
chemotherapeutic or other agents used in combination with the treatment method
of the
invention, as well as the health status of a particular patient.
[0291] Optionally, patients should be evaluated for the levels of 15SP3D2 in a
given sample
(e.g., the levels of circulating 158P3D2 antigen and/or 158P3D2 expressing
cells) in order to
assist in the determination of the most effective dosing regimen, etc. Such
evaluations are also
used for monitoring purposes throughout therapy, and are useful to gauge
therapeutic success in
combination with the evaluation of other parameters (for example, urine
cytology and/or
ImmunoCyt levels in bladder cancer therapy, or by analogy, serum PSA levels in
prostate cancer
therapy).
[0292] Anti-idiotypic anti-158P3D2 antibodies can also be used in anti-cancer
therapy as a
vaccine for inducing an immune response to cells expressing a 158P3D2-related
protein. In
particular, the generation of anti-idiotypic antibodies is well known in the
art; this methodology
can readily be adapted to generate anti-idiotypic anti-158P3D2 antibodies that
mimic an epitope
on a 158P3D2-related protein (see, for example, Wagner et al., 1997, Hybridoma
16: 33-40;
Foon et al., 1995, J. Clin. Invest. 96:334-342; Herlyn et al., 1996, Cancer
Immunol.
Immunother. 43:65-76). Such an anti-idiotypic antibody can be used in cancer
vaccine
strategies.
X.C.) 158P3D2 as a Target for Cellular hnmune Responses
[0293] Vaccines and methods of preparing vaccines that contain an
immunogenically
effective ainount of one or more HLA-binding peptides as described herein are
further
embodiments of the invention. Furthermore, vaccines in accordance with the
invention
encompass compositions of one or more of the claimed peptides. A peptide can
be present in a
vaccine individually. Alternatively, the peptide can exist as a homopolymer
comprising
multiple copies of the same peptide, or as a heteropolymer of various
peptides. Polymers have
the advantage of increased immunological reaction and, where different peptide
epitopes are
used to make up the polymer, the additional ability to induce antibodies
and/or CTLs that react
with different antigenic determinants of the pathogenic organism or tumor-
related peptide
88
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
targeted for an immune response. The composition can be a naturally occurring
region of an
antigen or can be prepared, e.g., recombinantly or by chemical synthesis.
[0294] Carriers that can be used with vaccines of the invention are well known
in the art,
and include, e.g., thyroglobulin, albumins such as hu.man serum albumin,
tetanus toxoid,
polyamino acids such as poly 1-lysine, poly 1-glutamic acid, influenza,
hepatitis B virus core
protein, and the like. The vaccines can contain a physiologically tolerable
(i.e., acceptable)
diluent such as water, or saline, preferably phosphate buffered saline. The
vaccines also
typically include an adjuvant. Adjuvants such as incomplete Freund's adjuvant,
aluminum
phosphate, aluminum hydroxide, or alum are examples of materials well known in
the art.
Additionally, as disclosed herein, CTL responses can be primed by conjugating
peptides of the
invention to lipids, such as tripalmitoyl-S-glycerylcysteinlyseryl- serine
(P3CSS). Moreover, an
adjuvant such as a synthetic cytosine-phosphorothiolated-guanine-containing
(CpG)
oligonucleotides has been found to increase CTL responses 10- to 100-fold.
(see, e.g., Davila
and Celis, J. Immunol. 165:539-547 (2000)).
[0295] Upon immunization with a peptide composition in accordance with the
invention, via
injection, aerosol, oral, transdermal, transmucosal, intrapleural,
intrathecal, or other suitable
routes, the immune system of the host responds to the vaccine by producing
large amounts of
CTLs and/or HTLs specific for the desired antigen. Consequently, the host
becomes at least
partially immune to later development of cells that express or overexpress
158P3D2 antigen, or
derives at least some therapeutic benefit when the antigen was tumor-
associated.
[0296] In some embodiments, it may be desirable to combine the class I peptide
components
with components that induce or facilitate neutralizing antibody and or helper
T cell responses
directed to the target antigen. A preferred embodiment of such a composition
comprises class I
and class II epitopes in accordance with the invention. An alternative
embodiment of such a
composition comprises a class I and/or class II epitope in accordance with the
invention, along
with a cross reactive HTL epitope such as PADRET"~ (Epimmune, San Diego, CA)
molecule
(described e.g., in U.S. Patent Number 5,736,142).
[0297] A vaccine of the invention can also include antigen-presenting cells
(APC), such as
dendritic cells (DC), as a vehicle to present peptides of the invention.
Vaccine compositions can
be created in vitro, following dendritic cell mobilization and harvesting,
whereby loading of
dendritic cells occurs in vitro. For example, dendritic cells are transfected,
e.g., with a minigene
in accordance with the invention, or are pulsed with peptides. The dendritic
cell can then be
administered to a patient to elicit immune responses in vivo. Vaccine
compositions, either
89
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
DNA- or peptide-based, can also be administered in vivo in combination with
dendritic cell
mobilization whereby loading of dendritic cells occurs in vivo.
[0298] Preferably, the following principles are utilized when selecting an
array of epitopes
for inclusion in a polyepitopic composition for use in a vaccine, or for
selecting discrete epitopes
to be included in a vaccine and/or to be encoded by nucleic acids such as a
minigene. It is
preferred that each of the following principles be balanced in order to make
the selection. The
inultiple epitopes to be incorporated in a given vaccine composition may be,
but need not be,
contiguous in sequence in the native antigen from which the epitopes are
derived.
1.) Epitopes are selected which, upon administration, mimic immune responses
that
have been observed to be correlated with tumor clearance. For HLA Class I this
includes 3-4
epitopes that come from at least one tumor associated antigen (TAA). For HLA
Class II a
similar rationale is employed; again 3-4 epitopes are selected from at least
one TAA (see, e.g.,
Rosenberg et al., Science 278:1447-1450). Epitopes from one TAA may be used in
coinbination
with epitopes from one or more additional TAAs to produce a vaccine that
targets tumors with
varying expression patterns of frequently-expressed TAAs.
2.) Epitopes are selected that have the requisite binding affinity established
to be
correlated with immunogenicity: for HLA Class I an IC50 of 500 nM or less,
often 200 nM or
less; and for Class II an IC50 of 1000 nM or less.
3.) Sufficient supermotif bearing-peptides, or a sufficient array of allele-
specific
motif-bearing peptides, are selected to give broad population coverage. For
example, it is
preferable to have at least 80% population coverage. A Monte Carlo analysis, a
statistical
evaluation known in the art, can be employed to assess the breadth, or
redundancy of, population
coverage.
4.) When selecting epitopes from cancer-related antigens it is often useful to
select
analogs because the patient may have developed tolerance to the native
epitope.
5.) Of particular relevance are epitopes referred to as "nested epitopes."
Nested
epitopes occur where at least two epitopes overlap in a given peptide
sequence. A nested
peptide sequence can comprise B cell, HLA class I and/or HLA class II
epitopes. When
providing nested epitopes, a general objective is to provide the greatest
number of epitopes per
sequence. Thus, an aspect is to avoid providing a peptide that is any longer
than the amino
terminus of the amino terminal epitope and the carboxyl terminus of the
carboxyl terminal
epitope in the peptide. When providing a multi-epitopic sequence, such as a
sequence
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
comprising nested epitopes, it is generally important to screen the sequence
in order to insure
that it does not have pathological or other deleterious biological properties.
6.) If a polyepitopic protein is created, or when creating a minigene, an
objective is
to generate the smallest peptide that encompasses the epitopes of interest.
This principle is
similar, if not the same as that employed when selecting a peptide comprising
nested epitopes.
However, with an artificial polyepitopic peptide, the size minimization
objective is balanced
against the need to integrate any spacer sequences between epitopes in the
polyepitopic protein.
Spacer amino acid residues can, for example, be introduced to avoid junctional
epitopes (an
epitope recognized by the immune system, not present in the target antigen,
and only created by
the man-made juxtaposition of epitopes), or to facilitate cleavage between
epitopes and thereby
enhance epitope presentation. Junctional epitopes are generally to be avoided
because the
recipient may generate an immune response to that non-native epitope. Of
particular concern is
a junctional epitope that is a "dominant epitope." A dominant epitope may lead
to such a
zealous response that immune responses to other epitopes are diminished or
suppressed.
7.) Where the sequences of multiple variants of the same target protein are
present,
potential peptide epitopes can also be selected on the basis of their
conservancy. For example, a
criterion for conseivancy may define that the entire sequence of an HLA class
I binding peptide
or the entire 9-mer core of a class II binding peptide be conserved in a
designated percentage of
the sequences evaluated for a specific protein antigen.
X.C. 1. Minigene Vaccines
[0299] A number of different approaches are available which allow simultaneous
delivery of
multiple epitopes. Nucleic acids encoding the peptides of the invention are a
particularly useful
embodiment of the invention. Epitopes for inclusion in a minigene are
preferably selected
according to the guidelines set forth in the previous section. A preferred
means of administering
nucleic acids encoding the peptides of the invention uses minigene constructs
encoding a peptide
comprising one or multiple epitopes of the invention.
[0300] The use of multi-epitope minigenes is described below and in, Ishioka
et al., J.
Immunol. 162:3915-3925, 1999; An, L. and Whitton, J. L., J. Virol. 71:2292,
1997; Thomson,
S. A. et al., J. Immunol. 157:822, 1996; Whitton, J. L. et al., J. Virol.
67:348, 1993; Hanke, R. et
al., Vaccine 16:426, 1998. For example, a multi-epitope DNA plasmid encoding
supermotif-
and/or motif-bearing epitopes derived 158P3D2, the PADRE universal helper T
cell epitope or
multiple HTL epitopes from 158P3D2 (see e.g., Tables VIII-XXI and XXII to
XLIX), and an
91
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
endoplasmic reticulum-translocating signal sequence can be engineered. A
vaccine may also
comprise epitopes that are derived from other TAAs.
[0301] The immunogenicity of a multi-epitopic minigene can be confirmed in
transgenic
mice to evaluate the magnitude of CTL induction responses against the epitopes
tested. Further,
the immunogenicity of DNA-encoded epitopes in vivo can be correlated with the
in vitro -
responses of specific CTL lines against target cells transfected with the DNA
plasmid. Thus,
these experiments can show that the minigene serves to both: 1.) generate a
CTL response and
2.) that the induced CTLs recognized cells expressing the encoded epitopes.
[0302] For example, to create a DNA sequence encoding the selected epitopes
(ininigene)
for expression in human cells, the ainino acid sequences of the epitopes may
be reverse
translated. A human codon usage table can be used to guide the codon choice
for each amino
acid. These epitope-encoding DNA sequences may be directly adjoined, so that
when translated,
a continuous polypeptide sequence is created. To optimize expression and/or
immunogenicity,
additional elements can be incorporated into the minigene design. Examples of
amino acid
sequences that can be reverse translated and included in the minigene sequence
include: HLA
class I epitopes, HLA class II epitopes, antibody epitopes, a ubiquitination
signal sequence,
and/or an endoplasmic reticulum targeting signal. In addition, HLA
presentation of CTL and
HTL epitopes may be improved by including synthetic (e.g., poly-alanine) or
naturally-
occurring flanking sequences adjacent to the CTL or HTL epitopes; these larger
peptides
comprising the epitope(s) are within the scope of the invention.
[0303] The minigene sequence may be converted to DNA by assembling
oligonucleotides
that encode the plus and minus strands of the minigene. Overlapping
oligonucleotides (30-100
bases long) may be synthesized, phosphorylated, purified and annealed under
appropriate
conditions using well known techniques. The ends of the oligonucleotides can
be joined, for
example, using T4 DNA ligase. This synthetic minigene, encoding the epitope
polypeptide, can
then be cloned into a desired expression vector.
[0304] Standard regulatory sequences well known to those of skill in the art
are preferably
included in the vector to ensure expression in the target cells. Several
vector elements are
desirable: a promoter with a down-stream cloning site for minigene insertion;
a polyadenylation
signal for efficient transcription termination; an E. coli origin of
replication; and an E. coli
selectable marker (e.g., ampicillin or kanamycin resistance). Numerous
promoters can be used
for this purpose, e.g., the human cytomegalovirus (hCMV) promoter. See, e.g.,
U.S. Patent Nos.
5,580,859 and 5,589,466 for other suitable promoter sequences.
92
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0305] Additional vector modifications may be desired to optimize minigene
expression and
immunogenicity. In some cases, introns are required for efficient gene
expression, and one or
more synthetic or naturally-occurring introns could be incorporated into the
transcribed region of
the minigene. The inclusion of mRNA stabilization sequences and sequences for
replication in
mammalian cells may also be considered for increasing minigene expression.
[0306] Once an expression vector is selected, the minigene is cloned into the
polylinker
region downstream of the promoter. This plasmid is transformed into an
appropriate E. coli
strain, and DNA is prepared using standard techniques. The orientation and DNA
sequence of
the minigene, as well as all other elements included in the vector, are
confirmed using restriction
mapping and DNA sequence analysis. Bacterial cells harboring the correct
plasmid can be
stored as a master cell bank and a working cell bank.
[0307] In addition, immunostimulatory sequences (ISSs or CpGs) appear to play
a role in
the iinmunogenicity of DNA vaccines. These sequences may be included in the
vector, outside
the minigene coding sequence, if desired to eilliance immunogenicity.
[0308] In some embodiments, a bi-cistronic expression vector which allows
production of
both the minigene-encoded epitopes and a second protein (included to enhance
or decrease
iinmunogenicity) can be used. Examples of proteins or polypeptides that could
beneficially
enhance the immune response if co-expressed include cytokines (e.g., IL-2, IL-
12, GM-CSF),
cytokine-inducing molecules (e.g., LeIF), costiinulatory molecules, or for HTL
responses, pan-
DR binding proteins (PADRET"', Epimmune, San Diego, CA). Helper (HTL) epitopes
can be
joined to intracellular targeting signals and expressed separately from
expressed CTL epitopes;
this allows direction of the HTL epitopes to a cell compartment different than
that of the CTL
epitopes. If required, this could facilitate more efficient entry of HTL
epitopes into the HLA
class II pathway, thereby improving HTL induction. In contrast to HTL or CTL
induction,
specifically decreasing the immune response by co-expression of
immunosuppressive molecules
(e.g., TGF-(3) may be beneficial in certain diseases.
[0309] Therapeutic quantities of plasmid DNA can be produced for example, by
fermentation in E. coli, followed by purification. Aliquots from the working
cell bank are used
to inoculate growth medium, and grown to saturation in shaker flasks or a
bioreactor according
to well-known techniques. Plasmid DNA can be purified using standard
bioseparation
technologies such as solid phase anion-exchange resins supplied by QIAGEN,
Inc. (Valencia,
California). If required, supercoiled DNA can be isolated from the open
circular and linear
fonns using gel electrophoresis or other methods.
93
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0310] Purified plasmid DNA can be prepared for injection using a variety of
formulations.
The simplest of these is reconstitution of lyophilized DNA in sterile
phosphate-buffer saline
(PBS). This approach, known as "naked DNA," is currently being used for
intramuscular (IM)
administration in clinical trials. To maximize the immunotherapeutic effects
of minigene DNA
vaccines, an alternative method for formulating purified plasmid DNA may be
desirable. A
variety of methods have been described, and new techniques may become
available. Cationic
lipids, glycolipids, and fusogenic liposomes can also be used in the
formulation (see, e.g., as
described by WO 93/24640; Mannino & Gould-Fogerite, BioTechniques 6(7): 682
(1988); U.S.
Pat No. 5,279,833; WO 91/06309; and Felgner, et al., Proc. Nat'l Acad. Sci.
USA 84:7413
(1987). In addition, peptides and compounds referred to collectively as
protective, interactive,
non-condensing compounds (PINC) could also be complexed to purified plasmid
DNA to
influence variables such as stability, intramuscular dispersion, or
trafficking to specific organs or
cell types.
[0311] Target cell sensitization can be used as a functional assay for
expression and HLA
class I presentation of minigene-encoded CTL epitopes. For example, the
plasmid DNA is
introduced into a mammalian cell line that is suitable as a target for
standard CTL chromium
release assays. The transfection method used will be dependent on the final
fonnulation.
Electroporation can be used for "naked" DNA, whereas cationic lipids allow
direct in vitro
transfection. A plasinid expressing green fluorescent protein (GFP) can be co-
transfected to
allow enrichinent of transfected cells using fluorescence activated cell
sorting (FACS). These
cells are then chromium-51 (51 Cr) labeled and used as target cells for
epitope-specific CTL
lines; cytolysis, detected by 51 Cr release, indicates both production of, and
HLA presentation of,
minigene-encoded CTL epitopes. Expression of HTL epitopes may be evaluated in
an
analogous manner using assays to assess HTL activity.
[0312] In vivo immunogenicity is a second approach for functional testing of
minigene
DNA formulations. Transgenic mice expressing appropriate human HLA proteins
are
immunized with the DNA product. The dose and route of administration are
formulation
dependent (e.g., IM for DNA in PBS, intraperitoneal (i.p.) for lipid-complexed
DNA). Twenty-
one days after immunization, splenocytes are harvested and restimulated for
one week in the
presence of peptides encoding each epitope being tested. Thereafter, for CTL
effector cells,
assays are conducted for cytolysis of peptide-loaded, 51 Cr-labeled target
cells using standard
techniques. Lysis of target cells that were sensitized by HLA loaded with
peptide epitopes,
corresponding to minigene-encoded epitopes, demonstrates DNA vaccine fiinction
for in vivo
94
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
induction of CTLs. Immunogenicity of HTL epitopes is confirmed in transgenic
mice in an
analogous manner.
[0313] Alternatively, the nucleic acids can be administered using ballistic
delivery as
described, for instance, in U.S. Patent No. 5,204,253. Using this technique,
particles comprised
solely of DNA are administered. In a further alternative embodiment, DNA can
be adhered to
particles, such as gold particles.
[0314] Minigenes can also be delivered using other bacterial or viral delivery
systems well
known in the art, e.g., an expression construct encoding epitopes of the
invention can be
incorporated into a viral vector such as vaccinia.
X.C.2. Combinations of CTL Peptides with Helper Peptides
[0315] Vaccine compositions comprising CTL peptides of the invention can be
modified,
e.g., analoged, to provide desired attributes, such as improved serum half
life, broadened
population coverage or enhanced immunogenicity.
[0316] For instance, the ability of a peptide to induce CTL activity can be
enhanced by
linking the peptide to a sequence which contains at least one epitope that is
capable of inducing
a T helper cell response. Although a CTL peptide can be directly linked to a T
helper peptide,
often CTL epitope/HTL epitope conjugates are linked by a spacer molecule. The
spacer is
typically comprised of relatively small, neutral molecules, such as amino
acids or amino acid
inimetics, which are substantially uncharged under physiological conditions.
The spacers are
typically selected from, e.g., Ala, Gly, or other neutral spacers of nonpolar
amino acids or
neutral polar ainino acids. It will be understood that the optionally present
spacer need not be
comprised of the same residues and thus may be a hetero- or homo-oligomer.
When present, the
spacer will usually be at least one or two residues, more usually three to six
residues and
sometimes 10 or more residues. The CTL peptide epitope can be linked to the T
helper peptide
epitope either directly or via a spacer either at the amino or carboxy
terminus of the CTL
peptide. The amino terminus of either the immunogenic peptide or the T helper
peptide may be
acylated.
[0317] In certain embodiments, the T helper peptide is one that is recognized
by T helper
cells present in a majority of a genetically diverse population. This can be
accomplished by
selecting peptides that bind to many, most, or all of the HLA class II
molecules. Examples of
such amino acid bind many HLA Class II molecules include sequences from
antigens such as
tetanus toxoid at positions 830-843 QYIKANSKFIGITE; (SEQ ID NO: 63),
Plasmodium
falciparunl circumsporozoite (CS) protein at positions 378-398
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
DIEKKIAKMEKASSVFNVVNS; (SEQ ID NO: 64), and Streptococcus 18kD protein at
positions 116-131 GAVDSILGGVATYGAA; (SEQ ID NO: 65). Other examples include
peptides bearing a DR 1-4-7 supermotif, or either of the DR3 motifs.
[0318] Alternatively, it is possible to prepare synthetic peptides capable of
stiinulating T
helper lyinphocytes, in a loosely HLA-restricted fashion, using amino acid
sequences not found
in nature (see, e.g., PCT publication WO 95/07707). These synthetic compounds
called Pan-
DR-binding epitopes (e.g., PADRETM, Epimmune, Inc., San Diego, CA) are
designed, most
preferably, to bind most HLA-DR (human HLA class II) molecules. For instance,
a pan-DR-
binding epitope peptide having the formula: xKXVAAWTLKAAx (SEQ ID NO: 66),
where
"X" is either cyclohexylalanine, phenylalanine, or tyrosine, and a is either d-
alanine or 1-alanine,
has been found to bind to most HLA-DR alleles, and to stimulate the response
of T helper
lymphocytes from most individuals, regardless of their HLA type. An
alternative of a pan-DR
binding epitope comprises all "L" natural amino acids and can be provided in
the form of
nucleic acids that encode the epitope.
[0319] HTL peptide epitopes can also be modified to alter their biological
properties. For
exainple, they can be modified to include d-amino acids to increase their
resistance to proteases
and thus extend their serum half life, or they can be conjugated to other
molecules such as lipids,
proteins, carbohydrates, and the like to increase their biological activity.
For example, a T
helper peptide can be conjugated to one or more palmitic acid chains at either
the amino or
carboxyl termini.
X.C.3. Combinations of CTL Peptides with T Cell Priming Agents
[0320] In some embodiments it may be desirable to include in the
pharmaceutical
compositions of the invention at least one component which primes B
lyinphocytes or T
lyinphocytes. Lipids have been identified as agents capable of priming CTL in
vivo. For
example, palmitic acid residues can be attached to the s-and a- amino groups
of a lysine residue
and then linked, e.g., via one or more linking residues such as Gly, Gly-Gly-,
Ser, Ser-Ser, or the
like, to an iminunogenic peptide. The lipidated peptide can then be
administered either directly
in a micelle or particle, incorporated into a liposome, or emulsified in an
adjuvant, e.g.,
incomplete Freund's adjuvant. In a preferred embodiment, a particularly
effective immunogenic
composition comprises palmitic acid attached to a- and a- amino groups of Lys,
which is
attached via linkage, e.g., Ser-Ser, to the amino terminus of the immunogenic
peptide.
[0321] As another example of lipid priming of CTL responses, E. coli
lipoproteins, such as
tripalmitoyl-S-glycerylcysteinlyseryl- serine (P3CSS) can be used to prime
virus specific CTL
96
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
when covalently attached to an appropriate peptide (see, e.g., Deres, et al.,
Nature 342:561,
1989). Peptides of the invention can be coupled to P3CSS, for example, and the
lipopeptide
administered to an individual to prime specifically an immune response to the
target antigen.
Moreover, because the induction of neutralizing antibodies can also be primed
with P3CSS-
conjugated epitopes, two such coinpositions can be combined to more
effectively elicit both
humoral and cell-mediated responses.
X.C.4. Vaccine Compositions Comprising DC Pulsed with CTL and/or HTL
Peptides
[0322] An embodiment of a vaccine composition in accordance with the invention
comprises ex vivo administration of a cocktail of epitope-bearing peptides to
PBMC, or'isolated
DC therefrom, from the patient's blood. A phannaceutical to facilitate
harvesting of DC can be
used, such as ProgenipoietinTM (Pharmacia-Monsanto, St. Louis, MO) or GM-
CSF/IL-4. After
pulsing the DC with peptides and prior to reinfusion into patients, the DC are
washed to remove
unbound peptides. In this embodiment, a vaccine comprises peptide-pulsed DCs
which present
the pulsed peptide epitopes complexed with HLA molecules on their surfaces.
[0323] The DC can be pulsed ex vivo with a cocktail of peptides, some of which
stiinulate
CTL responses to 158P3D2. Optionally, a helper T cell (HTL) peptide, such as a
natural or
artificial loosely restricted HLA Class II peptide, can be included to
facilitate the CTL response.
Thus, a vaccine in accordance with the invention is used to treat a cancer
which expresses or
overexpresses 158P3D2.
X.D.) Adoptive Iinmunotherapy
[0324] Antigenic 158P3D2-related peptides are used to elicit a CTL and/or HTL
response ex
vivo, as well. The resulting CTL or HTL cells, can be used to treat tumors in
patients that do not
respond to other conventional forms of therapy, or will not respond to a
therapeutic vaccine
peptide or nucleic acid in accordance with the invention. Ex vivo CTL or HTL
responses to a
particular antigen are induced by incubating in tissue culture the patient's,
or genetically
compatible, CTL or HTL precursor cells together with a source of antigen-
presenting cells
(APC), such as dendritic cells, and the appropriate immunogenic peptide. After
an appropriate
incubation time (typically about 7-28 days), in which the precursor cells are
activated and
expanded into effector cells, the cells are infused back into the patient,
where they will destroy
(CTL) or facilitate destruction (HTL) of their specific target cell (e.g., a
tumor cell). Transfected
dendritic cells may also be used as antigen presenting cells.
97
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
X.E.) Administration of Vaccines for Therapeutic or Prophylactic Purposes
[0325] Phannaceutical and vaccine compositions of the invention are typically
used to treat
and/or prevent a cancer that expresses or overexpresses 158P3D2. In
therapeutic applications,
peptide and/or nucleic acid compositions are administered to a patient in an
amount sufficient to
elicit an effective B cell, CTL and/or HTL response to the antigen and to cure
or at least partially
arrest or slow symptoms and/or complications. An amount adequate to accomplish
this is
defined as "therapeutically effective dose." Amounts effective for this use
will depend on, e.g.,
the particular composition administered, the manner of administration, the
stage and severity of
the disease being treated, the weight and general state of health of the
patient, and the judginent
of the prescribing physician.
[0326] For pharmaceutical compositions, the iminunogenic peptides of the
invention, or
DNA encoding them, are generally administered to an individual already bearing
a tumor that
expresses 158P3D2. The peptides or DNA encoding them can be administered
individually or
as fusions of one or more peptide sequences. Patients can be treated with the
immunogenic
peptides separately or in conjunction with other treatments, such as surgery,
as appropriate.
[0327] For therapeutic use, administration should generally begin at the first
diagnosis of
158P3D2-associated cancer. This is followed by boosting doses until at least
symptoms are
substantially abated and for a period thereafter. The embodiment of the
vaccine composition
(i.e., including, but not limited to embodiments such as peptide cocktails,
polyepitopic
polypeptides, minigenes, or TAA-specific CTLs or pulsed dendritic cells)
delivered to the
patient may vary according to the stage of the disease or the patient's health
status. For
example, in a patient with a tumor that expresses 158P3D2, a vaccine
comprising 158P3D2-
specific CTL may be more efficacious in killing tumor cells in patient with
advanced disease
than alternative embodiments.
[0328] It is generally important to provide an amount of the peptide epitope
delivered by a
mode of administration sufficient to stimulate effectively a cytotoxic T cell
response;
compositions which stimulate helper T cell responses can also be given in
accordance with this
embodiment of the invention.
[0329] The dosage for an initial therapeutic immunization generally occurs in
a unit dosage
range where the lower value is about 1, 5, 50, 500, or 1,000 gg and the higher
value is about
10,000; 20,000; 30,000; or 50,000 g. Dosage values for a human typically
range from about
500 g to about 50,000 g per 70 kilogram patient. Boosting dosages of between
about 1.0 g
to about 50,000 g of peptide pursuant to a boosting regimen over weeks to
months may be
98
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
administered depending upon the patient's response and condition as determined
by measuring
the specific activity of CTL and HTL obtained from the patient's blood.
Administration should
continue until at least clinical symptoms or laboratory tests indicate that
the neoplasia, has been
eliminated or reduced and for a period thereafter. The dosages, routes of
administration, and
dose schedules are adjusted in accordance with methodologies known in the art.
[0330] In certain embodiments, the peptides and compositions of the present
invention are
employed in serious disease states, that is, life-threatening or potentially
life threatening
situations. In such cases, as a result of the minimal amounts of extraneous
substances and the
relative nontoxic nature of the peptides in preferred compositions of the
invention, it is possible
and may be felt desirable by the treating physician to administer substantial
excesses of these
peptide compositions relative to these stated dosage amounts.
[0331] The vaccine compositions of the invention can also be used purely as
prophylactic
agents. Generally the dosage for an initial prophylactic immunization
generally occurs in a unit
dosage range where the lower value is about 1, 5, 50, 500, or 1000 g and the
higher value is
about 10,000; 20,000; 30,000; or 50,000 g. Dosage values for a human
typically range from
about 500 g to about 50,000 g per 70 kilogram patient. This is followed by
boosting dosages
of between about 1.0 g to about 50,000 g of peptide administered at defined
inteivals from
about four weeks to six months after the initial administration of vaccine.
The immunogenicity
of the vaccine can be assessed by measuring the specific activity of CTL and
HTL obtained from
a sample of the patient's blood.
[0332] The phannaceutical coinpositions for therapeutic treatment are intended
for
parenteral, topical, oral, nasal, intrathecal, or local (e.g., as a cream or
topical ointment)
administration. Preferably, the pharmaceutical compositions are adininistered
parentally, e.g.,
intravenously, subcutaneously, intradermally, or intrainuscularly. Thus, the
invention provides
compositions for parenteral adininistration wliich comprise a solution of the
immunogenic
peptides dissolved or suspended in an acceptable carrier, preferably an
aqueous carrier.
[0333] A variety of aqueous carriers may be used, e.g., water, buffered water,
0.8% saline,
0.3% glycine, hyaluronic acid and the like. These compositions may be
sterilized by
conventional, well-known sterilization techniques, or may be sterile filtered.
The resulting
aqueous solutions may be packaged for use as is, or lyophilized, the
lyophilized preparation
being combined with a sterile solution prior to administration.
[0334] The compositions may contain pharmaceutically acceptable auxiliary
substances as
required to approximate physiological conditions, such as pH-adjusting and
buffering agents,
99
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
tonicity adjusting agents, wetting agents, preservatives, and the like, for
example, sodium
acetate, sodium lactate, sodium chloride, potassium chloride, calcium
chloride, sorbitan
monolaurate, triethanolamine oleate, etc.
[0335] The concentration of peptides of the invention in the pharmaceutical
fonnulations
can vary widely, i.e., from less than about 0.1%, usually at or at least about
2% to as much as
20% to 50% or more by weight, and will be selected primarily by fluid volumes,
viscosities, etc.,
in accordance with the particular mode of administration selected.
[0336] A human unit dose form of a composition is typically included in a
pharmaceutical
composition that comprises a human unit dose of an acceptable carrier, in one
embodiment an
aqueous carrier, and is administered in a volume/quantity that is known by
those of skill in the
art to be used for administration of such compositions to humans (see, e.g.,
Remington's
Pharmaceutical Sciences, 17th Edition, A. Gennaro, Editor, Mack Publishing
Co., Easton,
Pennsylvania, 1985). For example a peptide dose for initial immunization can
be from about 1
to about 50,000 g, generally 100-5,000 g, for a 70 kg patient. For example,
for nucleic acids
an initial immunization may be performed using an expression vector in the
form of naked
nucleic acid administered IM (or SC or ID) in the amounts of 0.5-5 mg at
multiple sites. The
nucleic acid (0.1 to 1000 g) can also be adininistered using a gene gun.
Following an
incubation period of 3-4 weeks, a booster dose is then administered. The
booster can be
recombinant fowlpox virus administered at a dose of 5-107 to 5x109 pfu.
[0337] For antibodies, a treatment generally involves repeated administration
of the anti-
158P3D2 antibody preparation, via an acceptable route of administration such
as intravenous
injection (IV), typically at a dose in the range of about 0.1 to about 10
mg/kg body weight. In
general, doses in the range of 10-500 mg mAb per week are effective and well
tolerated.
Moreover, an initial loading dose of approximately 4 mg/kg patient body weight
IV, followed by
weekly doses of about 2 mg/kg IV of the anti- 158P3D2 mAb preparation
represents an
acceptable dosing regimen. As appreciated by those of skill in the art,
various factors can
influence the ideal dose in a particular case. Such factors include, for
example, half life of a
composition, the binding affinity of an Ab, the immunogenicity of a substance,
the degree of
158P3D2 expression in the patient, the extent of circulating shed 158P3D2
antigen, the desired
steady-state concentration level, frequency of treatment, and the influence of
chemotherapeutic
or other agents used in combination with the treatment method of the
invention, as well as the
health status of a particular patient. Non-limiting preferred human unit doses
are, for example,
500 g - Img, Img - 50mg, 50mg - 100mg, 100mg - 200mg, 200mg - 300mg, 400mg -
500mg,
100
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
500mg - 600mg, 600ing - 700mg, 700mg - 800mg, 800mg - 900mg, 900mg - lg, or
lmg -
700mg. In certain embodiments, the dose is in a range of 2-5 mg/kg body
weight, e.g., with
follow on weekly doses of 1-3 mg/kg; 0.5mg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10mg/kg
body weight
followed, e.g., in two, three or four weeks by weekly doses; 0.5 - 10mg/kg
body weight, e.g.,
followed in two, three or four weeks by weekly doses; 225, 250, 275, 300, 325,
350, 375, 400mg
m2 of body area weekly; 1-600mg m2 of body area weekly; 225-400mg m2 of body
area
weekly; these does can be followed by weekly doses for 2, 3, 4, 5, 6, 7, 8, 9,
19, 11, 12 or more
weeks.
[0338] In one embodiment, human unit dose forms of polynucleotides comprise a
suitable
dosage range or effective amount that provides any therapeutic effect. As
appreciated by one of
ordinary skill in the art a therapeutic effect depends on a number of factors,
including the
sequence of the polynucleotide, molecular weight of the polynucleotide and
route of
administration. Dosages are generally selected by the physician or other
health care professional
in accordance with a variety of parameters known in the art, such as severity
of symptoms,
history of the patient and the like. Generally, for a polynucleotide of about
20 bases, a dosage
range may be selected from, for example, an independently selected lower limit
such as about
0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300,
400 or 500 mg/kg up to
an independently selected upper limit, greater than the lower limit, of about
60, 80, 100, 200,
300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000
or 10,000
mg/kg. For example, a dose may be about any of the following: 0.1 to 100
mg/kg, 0.1 to 50
mg/kg, 0.1 to 25 mg/kg, 0.1 to 10 mg/kg, 1 to 500 mg/kg, 100 to 400 mg/kg, 200
to 300 mg/kg,
1 to 100 mg/kg, 100 to 200 mg/kg, 300 to 400 mg/kg, 400 to 500 mg/kg, 500 to
1000 mg/kg,
500 to 5000 mg/kg, or 500 to 10,000 mg/kg. Generally, parenteral routes of
administration may
require higher doses of polynucleotide compared to more direct application to
the nucleotide to
diseased tissue, as do polynucleotides of increasing length.
[0339] In one embodiment, human unit dose forms of T-cells comprise a suitable
dosage
range or effective amount that provides any therapeutic effect. As appreciated
by one of
ordinary skill in the art, a therapeutic effect depends on a nuinber of
factors. Dosages are
generally selected by the physician or other health care professional in
accordance with a variety
of parameters known in the art, such as severity of symptoms, history of the
patient and the like.
A dose maybe about 104 cells to about 106 cells, about 106 cells to about 108
cells, about 108
to about 1011 cells, or about 108 to about 5 x 1010 cells. A dose may also
about 106 cells/m2 to
about 1010 cells/m2, or about 106 cells/m2 to about 108 cells/m2.
101
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0340] Proteins(s) of the invention, and/or nucleic acids encoding the
protein(s), can also be
administered via liposomes, which may also serve to: 1) target the proteins(s)
to a particular
tissue, such as lymphoid tissue; 2) to target selectively to diseases cells;
or, 3) to increase the
half-life of the peptide composition. Liposomes include emulsions, foams,
micelles, insoluble
monolayers, liquid crystals, phospholipid dispersions, larnellar layers and
the like. In these
preparations, the peptide to be delivered is incorporated as part of a
liposome, alone or in
conjunction with a molecule which binds to a receptor prevalent among lymphoid
cells, such as
monoclonal antibodies which bind to the CD45 antigen, or with other
therapeutic or
immunogenic compositions. Thus, liposomes either filled or decorated with a
desired peptide of
the invention can be directed to the site of lymphoid cells, where the
liposomes then deliver the
peptide compositions. Liposomes for use in accordance with the invention are
formed from
standard vesicle-forming lipids, which generally include neutral and
negatively charged
phospholipids and a sterol, such as cholesterol. The selection of lipids is
generally guided by
consideration of, e.g., liposome size, acid lability and stability of the
liposomes in the blood
stream. A variety of methods are available for preparing liposomes, as
described in, e.g., Szoka,
et al., Ann. Rev. Biophys. Bioeng. 9:467 (1980), and U.S. Patent Nos.
4,235,871, 4,501,728,
4,837,028, and 5,019,369.
[0341] For targeting cells of the immune system, a ligand to be incorporated
into the
liposome can include, e.g., antibodies or fragments thereof specific for cell
surface determinants
of the desired immune system cells. A liposome suspension containing a peptide
may be
administered intravenously, locally, topically, etc. in a dose which varies
according to, inter alia,
the manner of administration, the peptide being delivered, and the stage of
the disease being
treated.
[0342] For solid compositions, conventional nontoxic solid carriers may be
used which
include, for example, pharmaceutical grades of mannitol, lactose, starch,
magnesium stearate,
sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate,
and the like. For
oral administration, a pharmaceutically acceptable nontoxic composition is
formed by
incorporating any of the normally employed excipients, such as those carriers
previously listed,
and generally 10-95% of active ingredient, that is, one or more peptides of
the invention, and
more preferably at a concentration of 25%-75%.
[0343] For aerosol administration, immunogenic peptides are preferably
supplied in finely
divided form along with a surfactant and propellant. Typical percentages of
peptides are about
0.01%-20% by weight, preferably about 1%-10%. The surfactant must, of course,
be nontoxic,
102
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
and preferably soluble in the propellant. Representative of such agents are
the esters or partial
esters of fatty acids containing from about 6 to 22 carbon atoms, such as
caproic, octanoic,
lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with
an aliphatic polyhydric
alcohol or its cyclic anhydride. Mixed esters, such as mixed or natural
glycerides may be
employed. The surfactant may constitute about 0.1 %-20% by weight of the
coinposition,
preferably about 0.25-5%. The balance of the composition is ordinarily
propellant. A carrier
can also be included, as desired, as with, e.g., lecithin for intranasal
delivery.
XI.) DIAGNOSTIC AND PROGNOSTIC EMBODIMENTS OF 158P3D2
[0344] As disclosed herein, 158P3D2 polynucleotides, polypeptides, reactive
cytotoxic T
cells (CTL), reactive helper T cells (HTL) and anti-polypeptide antibodies are
used in well
known diagnostic, prognostic and therapeutic assays that examine conditions
associated with
dysregulated cell growth such as cancer, in particular the cancers listed in
Table I (see, e.g., both
its specific pattern of tissue expression as well as its overexpression in
certain cancers as
described for example in the Example entitled "Expression analysis of 158P3D2
in normal
tissues, and patient specimens").
[0345] 158P3D2 can be analogized to a prostate associated antigen PSA, the
archetypal
marker that has been used by medical practitioners for years to identify and
monitor the presence
of prostate cancer (see, e.g., Merrill et al., J. Urol. 163(2): 503-5120
(2000); Polascik et al., J.
Urol. Aug; 162(2):293-306 (1999) and Fortier et al., J. Nat. Cancer Inst.
91(19): 1635-
1640(1999)). A variety of other diagnostic markers are also used in similar
contexts including
p53 and K-ras (see, e.g., Tulchinsky et al., Int J Mol Med 1999 Jul 4(1):99-
102 and Minimoto et
al., Cancer Detect Prev 2000;24(l):1-12). Therefore, this disclosure of
158P3D2
polynucleotides and polypeptides (as well as 158P3D2 polynucleotide probes and
anti-158P3D2
antibodies used to identify the presence of these molecules) and their
properties allows skilled
artisans to utilize these molecules in methods that are analogous to those
used, for exainple, in a
variety of diagnostic assays directed to examining conditions associated with
cancer.
[0346] Typical embodiments of diagnostic methods which utilize the 158P3D2
polynucleotides, polypeptides, reactive T cells and antibodies are analogous
to those methods
from well-established diagnostic assays, which einploy, e.g., PSA
polynucleotides, polypeptides,
reactive T cells and antibodies. For example, just as PSA polynucleotides are
used as probes
(for example in Northern analysis, see, e.g., Sharief et al., Biochem. Mol.
Biol. Int. 33(3):567-
74(1994)) and primers (for example in PCR analysis, see, e.g., Okegawa et al.,
J. Urol. 163(4):
103
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
1189-1190 (2000)) to observe the presence and/or the level of PSA mRNAs in
methods of
monitoring PSA overexpression or the metastasis of prostate cancers, the
158P3D2
polynucleotides described herein can be utilized in the same way to detect
158P3D2
overexpression or the metastasis of prostate and other cancers expressing this
gene.
Alternatively, just as PSA polypeptides are used to generate antibodies
specific for PSA which
can then be used to observe the presence and/or the level of PSA proteins in
methods to monitor
PSA protein overexpression (see, e.g., Stephan et aL, Urology 55(4):560-3
(2000)) or the
metastasis of prostate cells (see, e.g., Alanen et al., Pathol. Res. Pract.
192(3):233-7 (1996)), the
158P3D2 polypeptides described herein can be utilized to generate antibodies
for use in
detecting 158P3D2 overexpression or the metastasis of prostate cells and cells
of other cancers
expressing this gene.
[0347] Specifically, because metastases involves the movement of cancer cells
from an
organ of origin (such as the lung or prostate gland etc.) to a different area
of the body (such as a
lymph node), assays which examine a biological sample for the presence of
cells expressing
158P3D2 polynucleotides and/or polypeptides can be used to provide evidence of
metastasis.
For example, when a biological sample fiom tissue that does not normally
contain 158P3D2-
expressing cells (lymph node) is found to contain 158P3D2-expressing cells
such as the
158P3D2 expression seen in LAPC4 and LAPC9, xenografts isolated from lymph
node and
bone metastasis, respectively, this finding is indicative of metastasis.
[0348] Alternatively 158P3D2 polynucleotides and/or polypeptides can be used
to provide
evidence of cancer, for example, when cells in a biological sample that do not
normally express
158P3D2 or express 158P3D2 at a different level are found to express 158P3D2
or have an
increased expression of 158P3D2 (see, e.g., the 158P3D2 expression in the
cancers listed in
Table I and in patient samples etc. shown in the accompanying Figures). In
such assays, artisans
may further wish to generate supplementary evidence of metastasis by testing
the biological
sample for the presence of a second tissue restricted marker (in addition to
158P3D2) such as
PSA, PSCA etc. (see, e.g., Alanen et al., Pathol. Res. Pract. 192(3): 233-237
(1996)).
[0349] The use of immunohistochemistry to identify the presence of a 158P3D2
polypeptide
within a tissue section can indicate an altered state of certain cells within
that tissue. It is well
understood in the art that the ability of an antibody to localize to a
polypeptide that is expressed
in cancer cells is a way of diagnosing presence of disease, disease stage,
progression and/or
tumor aggressiveness. Such an antibody can also detect an altered distribution
of the
polypeptide within the cancer cells, as compared to corresponding non-
malignant tissue.
104
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0350] The 158P3D2 polypeptide and immunogenic compositions are also useful in
view of
the phenomena of altered subcellular protein localization in disease states.
Alteration of cells
from normal to diseased state causes changes in cellular morphology and is
often associated
with changes in subcellular protein localization/distribution. For example,
cell membrane
proteins that are expressed in a polarized manner in nonnal cells can be
altered in disease,
resulting in distribution of the protein in a non-polar manner over the whole
cell surface.
[0351] The phenomenon of altered subcellular protein localization in a disease
state has been
demonstrated with MUC1 and Her2 protein expression by use of
immunohistochemical means.
Normal epithelial cells have a typical apical distribution of MUC1, in
addition to some
supranuclear localization of the glycoprotein, whereas malignant lesions often
demonstrate an
apolar staining pattern (Diaz et al, The Breast Journal, 7; 40-45 (2001);
Zhang et al, Clinical
Cancer Research, 4; 2669-2676 (1998): Cao, et al, The Journal of
Histocheinistry and
Cytochemistry, 45: 1547-1557 (1997)). In addition, norinal breast epithelium
is either negative
for Her2 protein or exhibits only a basolateral distribution whereas malignant
cells can express
the protein over the whole cell surface (De Potter, et al, International
Journal of Cancer, 44; 969-
974 (1989): McCormick, et al, 117; 935-943 (2002)). Alternatively,
distribution of the protein
may be altered from a surface only localization to include diffuse cytoplasmic
expression in the
diseased state. Such an example can be seen witli MUC1 (Diaz, et al, The
Breast Journal, 7: 40-
45 (2001)). '
[0352] Alteration in the localization/distribution of a protein in the cell,
as detected by
immunohistochemical methods, can also provide valuable information concerning
the
favorability of certain treatment modalities. This last point is illustrated
by a situation where a
protein may be intracellular in normal tissue, but cell surface in malignant
cells; the cell surface
location makes the cells favorably amenable to antibody-based diagnostic and
treatinent
regimens. When such an alteration of protein localization occurs for 158P3D2,
the 158P3D2
protein and immune responses related thereto are very useful. Accordingly, the
ability to
determine whether alteration of subcellular protein localization occurred for
24P4C12 make the
158P3D2 protein and immune responses related thereto very useful. Use of the
158P3D2
compositions allows those skilled in the art to make important diagnostic and
therapeutic
decisions.
[0353] Immunohistochemical reagents specific to 158P3D2 are also useful to
detect
metastases of tumors expressing 158P3D2 when the polypeptide appears in
tissues where
158P3D2 is not normally produced.
105
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0354] Thus, 158P3D2 polypeptides and antibodies resulting from immune
responses
thereto are useful in a variety of important contexts such as diagnostic,
prognostic, preventative
and/or therapeutic purposes known to those skilled in the art.
[0355] Just as PSA polynucleotide fragments and polynucleotide variants are
employed by
skilled artisans for use in methods of monitoring PSA, 158P3D2 polynucleotide
fragments and
polynucleotide variants are used in an analogous manner. In particular,
typical PSA
polynucleotides used in methods of monitoring PSA are probes or primers which
consist of
fragments of the PSA eDNA sequence. Illustrating this, primers used to PCR
amplify a PSA
polynucleotide must include less than the whole PSA sequence to function in
the polyinerase
chain reaction. In the context of such PCR reactions, skilled artisans
generally create a variety
of different polynucleotide fragments that can be used as primers in order to
amplify different
portions of a polynucleotide of interest or to optimize amplification
reactions (see, e.g., Caetano-
Anolles, G. Biotechniques 25(3): 472-476, 478-480 (1998); Robertson et al.,
Methods Mol.
Biol. 98:121-154 (1998)). An additional illustration of the use of such
fragments is provided in
the Exainple entitled "Expression analysis of 158P3D2 in normal tissues, and
patient
specimens," where a 158P3D2 polynucleotide fragment is used as a probe to show
the
expression of 158P3D2 RNAs in cancer cells. In addition, variant
polynucleotide sequences are
typically used as primers and probes for the corresponding mRNAs in PCR and
Northern
analyses (see, e.g., Sawai et al., Fetal Diagn. Ther. 1996 Nov-Dec 11(6):407-
13 and Current
Protocols In Molecular Biology, Volume 2, Unit 2, Frederick M. Ausubel et al.
eds., 1995)).
Polynucleotide fragments and variants are useful in this context where they
are capable of
binding to a target polynucleotide sequence (e.g., a 158P3D2 polynucleotide
shown in Figure 2
or variant thereof) under conditions of high stringency.
[0356] Furthermore, PSA polypeptides which contain an epitope that can be
recognized by
an antibody or T cell that specifically binds to that epitope are used in
methods of monitoring
PSA. 158P3D2 polypeptide fragments and polypeptide analogs or variants can
also be used in
an analogous manner. This practice of using polypeptide fragments or
polypeptide variants to
generate antibodies (such as anti-PSA antibodies or T cells) is typical in the
art with a wide
variety of systems such as fusion proteins being used by practitioners (see,
e.g., Current
Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubel et al.
eds., 1995). In
this context, each epitope(s) functions to provide the architecture with which
an antibody or T
cell is reactive. Typically, skilled artisans create a variety of different
polypeptide fragments
that can be used in order to generate immune responses specific for different
portions of a
106
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
polypeptide of interest (see, e.g., U.S. Patent No. 5,840,501 and U.S. Patent
No. 5,939,533). For
example it may be preferable to utilize a polypeptide comprising one of the
158P3D2 biological
motifs discussed herein or a motif-bearing subsequence which is readily
identified by one of
skill in the art based on motifs available in the art. Polypeptide fragments,
variants or analogs
are typically useful in this context as long as they comprise an epitope
capable of generating an
antibody or T cell specific for a target polypeptide sequence (e.g., a 158P3D2
polypeptide
shown in Figure 3).
[0357] As shown herein, the 158P3D2 polynucleotides and polypeptides (as well
as the
158P3D2 polynucleotide probes and anti-158P3D2 antibodies or T cells used to
identify the
presence of these molecules) exhibit specific properties that make them useful
in diagnosing
cancers such as those listed in Table I. Diagnostic assays that measure the
presence of 158P3D2
gene products, in order to evaluate the presence or onset of a disease
condition described herein,
such as prostate cancer, are used to identify patients for preventive measures
or further
monitoring, as has been done so successfully with PSA. Moreover, these
materials satisfy a
need in the art for molecules having similar or complementary characteristics
to PSA in
situations where, for example, a definite diagnosis of metastasis of prostatic
origin cannot be
made on the basis of a test for PSA alone (see, e.g., Alanen et al., Pathol.
Res. Pract. 192(3):
233-237 (1996)), and consequently, materials such as 158P3D2 polynucleotides
and
polypeptides (as well as the 158P3D2 polynucleotide probes and anti-158P3D2
antibodies used
to identify the presence of these molecules) need to be employed to confirm a
metastases of
prostatic origin.
[0358] Finally, in addition to their use in diagnostic assays, the 158P3D2
polynucleotides
disclosed herein have a number of other utilities such as their use in the
identification of
oncogenetic associated chromosomal abnormalities in the chromosomal region to
which the
158P3D2 gene maps (see the Example entitled "Chromosomal Mapping of 158P3D2"
below).
Moreover, in addition to their use in diagnostic assays, the 158P3D2-related
proteins and
polynucleotides disclosed herein have other utilities such as their use in the
forensic analysis of
tissues of unknown origin (see, e.g., Takahama K Forensic Sci Int 1996 Jun
28;80(1-2): 63-9).
[0359] Additionally, 158P3D2-related proteins or polynucleotides of the
invention can be
used to treat a pathologic condition characterized by the over-expression of
158P3D2. For
example, the amino acid or nucleic acid sequence of Figure 2 or Figure 3, or
fragments of either,
can be used to generate an iinmune response to a 158P3D2 antigen. Antibodies
or other
107
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
molecules that react with 158P3D2 can be used to modulate the function of this
molecule, and
thereby provide a therapeutic benefit.
XII.) INHIBITION OF 158P3D2 PROTEIN FUNCTION
[0360] The invention includes various methods and compositions for inhibiting
the binding
of 158P3D2 to its binding partner or its association with other protein(s) as
well as methods for
inhibiting 158P3D2 function.
XII.A.) Inhibition of 158P3D2 With Intracellular Antibodies
[0361] In one approach, a recombinant vector that encodes single chain
antibodies that
specifically bind to 158P3D2 are introduced into 158P3D2 expressing cells via
gene transfer
technologies. Accordingly, the encoded single chain anti-158P3D2 antibody is
expressed
intracellularly, binds to 158P3D2 protein, and thereby inhibits its function.
Methods for
engineering such intracellular single chain antibodies are well known. Such
intracellular
antibodies, also known as "intrabodies", are specifically targeted to a
particular compartment
within the cell, providing control over where the inhibitory activity of the
treatment is focused.
This technology has been successfully applied in the art (for review, see
Richardson and
Marasco, 1995, TIBTECH vol. 13). Intrabodies have been shown to virtually
eliminate the
expression of otherwise abundant cell surface receptors (see, e.g., Richardson
et al., 1995, Proc.
Natl. Acad. Sci. USA 92: 3137-3141; Beerli et al., 1994, J. Biol. Chein. 289:
23931-23936;
Deshane et al., 1994, Gene Ther. 1: 332-337).
[0362] Single chain antibodies comprise the variable domains of the heavy and
light chain
joined by a flexible linker polypeptide, and are expressed as a single
polypeptide. Optionally,
single chain antibodies are expressed as a single chain variable region
fragment joined to the
light chain constant region. Well-known intracellular trafficking signals are
engineered into
recombinant polynucleotide vectors encoding such single chain antibodies in
order to target
precisely the intrabody to the desired intracellular coinpartment. For
example, intrabodies
targeted to the endoplasmic reticulum (ER) are engineered to incorporate a
leader peptide and,
optionally, a C-terminal ER retention signal, such as the KDEL amino acid
motif. Intrabodies
intended to exert activity in the nucleus are engineered to include a nuclear
localization signal.
Lipid moieties are joined to intrabodies in order to tether the intrabody to
the cytosolic side of
the plasma membrane. Intrabodies can also be targeted to exert function in the
cytosol. For
example, cytosolic intrabodies are used to sequester factors within the
cytosol, thereby
preventing them from being transported to their natural cellular destination.
108
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0363] In one embodiment, intrabodies are used to capture 158P3D2 in the
nucleus, thereby
preventing its activity within the nucleus. Nuclear targeting signals are
engineered into such
158P3D2 intrabodies in order to achieve the desired targeting. Such 158P3D2
intrabodies are
designed to bind specifically to a particular 158P3D2 domain. In another
embodiment, cytosolic
intrabodies that specifically bind to a 158P3D2 protein are used to prevent
158P3D2 from
gaining access to the nucleus, thereby preventing it from exerting any
biological activity within
the nucleus (e.g., preventing 158P3D2 from forming transcription complexes
with other factors).
[0364] In order to specifically direct the expression of such intrabodies to
particular cells,
the transcription of the intrabody is placed under the regulatory control of
an appropriate tumor-
specific promoter and/or enhancer. In order to target intrabody expression
specifically to
prostate, for example, the PSA promoter and/or promoter/enhancer can be
utilized (See, for
example, U.S. Patent No. 5,919,652 issued 6 July 1999).
XII.B.) Inhibition of 158P3D2 with Recombinant Proteins
[0365] In another approach, recombinant molecules bind to 158P3D2 and thereby
inhibit
158P3D2 function. For example, these recoinbinant molecules prevent or inhibit
158P3D2 from
accessing/binding to its binding partner(s) or associating with other
protein(s). Such
recombinant molecules can, for example, contain the reactive part(s) of a
158P3D2 specific
antibody molecule. In a particular embodiment, the 158P3D2 binding domain of a
158P3D2
binding partner is engineered into a dimeric fusion protein, whereby the
fusion protein
coinprises two 158P3D2 ligand binding domains linked to the Fc portion of a
human IgG, such
as human IgGl. Such IgG portion can contain, for example, the CH2 and CH3
domains and the
hinge region, but not the CH1 domain. Such dimeric fusion proteins are
administered in soluble
form to patients suffering from a cancer associated with the expression of
158P3D2, whereby
the dimeric fusion protein specifically binds to 158P3D2 and blocks 158P3D2
interaction with a
binding partner. Such dimeric fusion proteins are further combined into
multimeric proteins
using known antibody linking technologies.
XII.C.) Inhibition of 158P3D2 Transcription or Translation
[0366] The present invention also comprises various methods and compositions
for
inhibiting the transcription of the 158P3D2 gene. Similarly, the invention
also provides methods
and compositions for inhibiting the translation of 158P3D2 mRNA into protein.
[0367] In one approach, a method of inhibiting the transcription of the
158P3D2 gene
comprises contacting the 158P3D2 gene with a 158P3D2 antisense polynucleotide.
In another
approach, a method of inhibiting 158P3D2 mRNA translation comprises contacting
a 158P3D2
109
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
mRNA with an antisense polynucleotide. In another approach, a 158P3D2 specific
ribozyme is
used to cleave a 158P3D2 message, thereby inhibiting translation. Such
antisense and ribozyme
based methods can also be directed to the regulatory regions of the 158P3D2
gene, such as
158P3D2 promoter and/or enhancer elements. Similarly, proteins capable of
inhibiting a
158P3D2 gene transcription factor are used to inhibit 158P3D2 mRNA
transcription. The
various polynucleotides and compositions useful in the aforementioned methods
have been
described above. The use of antisense and ribozyme molecules to inhibit
transcription and
translation is well known in the art.
[03681 Other factors that inhibit the transcription of 158P3D2 by interfering
with 158P3D2
transcriptional activation are also useful to treat cancers expressing
158P3D2. Similarly, factors
that interfere with 158P3D2 processing are useful to treat cancers that
express 158P3D2. Cancer
treatment methods utilizing such factors are also within the scope of the
invention.
XII.D.) General Considerations for Therapeutic Strategies
[0369] Gene transfer and gene therapy technologies can be used to deliver
therapeutic
polynucleotide molecules to tumor cells synthesizing 15 8P3D2 (i.e.,
antisense, ribozyme,
polynucleotides encoding intrabodies and other 158P3D2 inhibitory molecules).
A number of
gene therapy approaches are known in the art. Recombinant vectors encoding
158P3D2
antisense polynucleotides, ribozymes, factors capable of interfering with
158P3D2 transcription,
and so forth, can be delivered to target tumor cells using such gene therapy
approaches.
[0370] The above therapeutic approaches can be combined with any one of a wide
variety of
surgical, chemotherapy or radiation therapy regimens. The therapeutic
approaches of the
invention can enable the use of reduced dosages of chemotherapy (or other
therapies) and/or less
frequent administration, an advantage for all patients and particularly for
those that do not
tolerate the toxicity of the chemotherapeutic agent well.
[0371] The anti-tumor activity of a particular composition (e.g., antisense,
ribozyme,
intrabody), or a combination of such compositions, can be evaluated using
various in vitro and
in vivo assay systems. In vitro assays that evaluate therapeutic activity
include cell growth
assays, soft agar assays and other assays indicative of tumor promoting
activity, binding assays
capable of detennining the extent to which a therapeutic composition will
inhibit the binding of
158P3D2 to a binding partner, etc.
[0372] In vivo, the effect of a 158P3D2 therapeutic composition can be
evaluated in a
suitable animal model. For example, xenogenic prostate cancer models can be
used, wherein
human prostate cancer explants or passaged xenograft tissues are introduced
into immune
110
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
compromised animals, such as nude or SCID mice (Klein et al., 1997, Nature
Medicine 3: 402-
408). For example, PCT Patent Application W098/16628 and U.S. Patent 6,107,540
describe
various xenograft models of human prostate cancer capable of recapitulating
the development of
primary tumors, micrometastasis, and the formation of osteoblastic metastases
characteristic of
late stage disease. Efficacy can be predicted using assays that measure
inhibition of tumor
forination, tumor regression or metastasis, and the like.
[0373] In vivo assays that evaluate the promotion of apoptosis are useful in
evaluating
therapeutic compositions. In one embodiment, xenografts from tumor bearing
mice treated with
the therapeutic composition can be examined for the presence of apoptotic foci
and compared to
untreated control xenograft-bearing mice. The extent to which apoptotic foci
are found in the
tumors of the treated mice provides an indication of the therapeutic efficacy
of the composition.
[0374] The therapeutic compositions used in the practice of the foregoing
methods can be
formulated into pharmaceutical compositions comprising a carrier suitable for
the desired
delivery method. Suitable carriers include any material that when combined
with the therapeutic
composition retains the anti-tumor function of the therapeutic composition and
is generally non-
reactive with the patient's immune system. Examples include, but are not
limited to, any of a
number of standard pharmaceutical carriers such as sterile phosphate buffered
saline solutions,
bacteriostatic water, and the like (see, generally, Remington's Pharmaceutical
Sciences 16th
Edition, A. Osal., Ed., 1980).
[0375] Therapeutic formulations can be solubilized and administered via any
route capable
of delivering the therapeutic composition to the tumor site. Potentially
effective routes of
administration include, but are not liinited to, intravenous, parenteral,
intraperitoneal,
intramuscular, intratumor, intradermal, intraorgan, orthotopic, and the like.
A preferred
fonnulation for intravenous injection comprises the therapeutic composition in
a solution of
preserved bacteriostatic water, sterile unpreseived water, and/or diluted in
polyvinylchloride or
polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP.
Therapeutic
protein preparations can be lyophilized and stored as sterile powders,
preferably under vacuum,
and then reconstituted in bacteriostatic water (containing for example, benzyl
alcohol
preservative) or in sterile water prior to injection.
[0376] Dosages and administration protocols for the treatment of cancers using
the
foregoing methods will vary with the method and the target cancer, and will
generally depend on
a number of other factors appreciated in the art.
111
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
XIII.) IDENTIFICATION, CHARACTERIZATION AND USE OF MODULATORS OF
158P3D2
XIII.A.) Methods to Identify and Use Modulators
[0377] In one embodiment, screening is performed to identify modulators that
induce or
suppress a particular expression profile, suppress or induce specific
pathways, preferably
generating the associated phenotype thereby. In another embodiment, having
identified
differentially expressed genes important in a particular state; screens are
performed to identify
modulators that alter expression of individual genes, either increase or
decrease. In another
embodiment, screening is performed to identify modulators that alter a
biological function of the
expression product of a differentially expressed gene. Again, having
identified the importance
of a gene in a particular state, screens are performed to identify agents that
bind and/or modulate
the biological activity of the gene product.
[03781 In addition, screens are done for genes that are induced in response to
a candidate
agent. After identifying a modulator (one that suppresses a cancer expression
pattern leading to a normal expression pattern, or a modulator of a cancer
gene that leads to expression of the gene
as in normal tissue) a screen is performed to identify genes that are
specifically modulated in
response to the agent. Comparing expression profiles between normal tissue and
agent-treated
cancer tissue reveals genes that are not expressed in normal tissue or cancer
tissue, but are
expressed in agent treated tissue, and vice versa. These agent-specific
sequences are identified
and used by methods described herein for cancer genes or proteins. In
particular these
sequences and the proteins they encode are used in marking or identifying
agent-treated cells. In
addition, antibodies are raised against the agent-induced proteins and used to
target novel
therapeutics to the treated cancer tissue sample.
XIII.B.) Gene Expression-related Assays
[0379] Proteins, nucleic acids, and antibodies of the invention are used in
screening assays.
The cancer-associated proteins, antibodies, nucleic acids, modified proteins
and cells containing
these sequences are used in screening assays, such as evaluating the effect of
drug candidates on
a"gene expression profile," expression profile of polypeptides or alteration
of biological
function. In one embodiment, the expression profiles are used, preferably in
conjunction with
high throughput screening techniques to allow monitoring for expression
profile genes after
treatment with a candidate agent (e.g., Davis, GF, et al, J Biol Screen 7:69
(2002); Zlokarnik, et
al., Science 279:84-8 (1998); Heid, Genome Res 6:986-94,1996).
112
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0380] The cancer proteins, antibodies, nucleic acids, modified proteins and
cells containing
the native or modified cancer proteins or genes are used in screening assays.
That is, the present
invention comprises methods for screening for compositions which modulate the
cancer
phenotype or a physiological function of a cancer protein of the invention.
This is done on a
gene itself or by evaluating the effect of drug candidates on a "gene
expression profile" or
biological function. In one embodiment, expression profiles are used,
preferably in conjunction
with high throughput screening techniques to allow monitoring after treatment
with a candidate
agent, see Zlokamik, supra.
[0381] A variety of assays are executed directed to the genes and proteins of
the invention.
Assays are run on an individual nucleic acid or protein level. That is, having
identified a
particular gene as up regulated in cancer, test compounds are screened for the
ability to modulate
gene expression or for binding to the cancer protein of the invention.
"Modulation" in this
context includes an increase or a decrease in gene expression. The preferred
amount of
modulation will depend on the original change of the gene expression in normal
versus tissue
undergoing cancer, with changes of at least 10%, preferably 50%, more
preferably 100-300%,
and in some embodiments 300-1000% or greater. Thus, if a gene exhibits a 4-
fold increase in
cancer tissue coinpared to normal tissue, a decrease of about four-fold is
often desired; similarly,
a 10-fold decrease in cancer tissue compared to normal tissue a target value
of a 10-fold increase
in expression by the test compound is often desired. Modulators that
exacerbate the type of gene
expression seen in cancer are also useful, e.g., as an upregulated target in
further analyses.
[0382] The amount of gene expression is monitored using nucleic acid probes
and the
quantification of gene expression levels, or, alternatively, a gene product
itself is monitored,
e.g., through the use of antibodies to the cancer protein and standard
immunoassays. Proteomics
and separation techniques also allow for quantification of expression.
XIII.C.) Expression Monitoring to Identify Coinbounds that Modify Gene
Expression
[0383] In one embodiment, gene expression monitoring, i.e., an expression
profile, is
monitored simultaneously for a number of entities. Such profiles will
typically involve one or
more of the genes of Figure 2. In this embodiment, e.g., cancer nucleic acid
probes are attached
to biochips to detect and quantify cancer sequences in a particular cell.
Alternatively, PCR can
be used. Thus, a series, e.g., wells of a microtiter plate, can be used with
dispensed primers in
desired wells. A PCR reaction can then be performed and analyzed for each
well.
[0384] Expression monitoring is performed to identify compounds that modify
the
expression of one or more cancer-associated sequences, e.g., a polynucleotide
sequence set out
113
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
in Figure 2. Generally, a test modulator is added to the cells prior to
analysis. Moreover,
screens are also provided to identify agents that modulate cancer, modulate
cancer proteins of
the invention, bind to a cancer protein of the invention, or interfere with
the binding of a cancer
protein of the invention and an antibody or other binding partner.
[0385] In one embodiment, high throughput screening methods involve providing
a library
containing a large number of potential therapeutic compounds (candidate
compounds). Such
"combinatorial chemical libraries" are then screened in one or more assays to
identify those
library members (particular chemical species or subclasses) that display a
desired characteristic
activity. The compounds thus identified can serve as conventional "lead
compounds," as
compounds for screening, or as therapeutics.
[0386] In certain embodiments, combinatorial libraries of potential modulators
are screened
for an ability to bind to a cancer polypeptide or to modulate activity.
Conventionally, new
chemical entities with useful properties are generated by identifying a
chemical compound
(called a "lead compound") with some desirable property or activity, e.g.,
inhibiting activity,
creating variants of the lead compound, and evaluating the property and
activity of those variant
compounds. Often, high throughput screening (HTS) methods are employed for
such an
analysis.
[0387] As noted above, gene expression monitoring is conveniently used to test
candidate
modulators (e.g., protein, nucleic acid or small molecule). After the
candidate agent has been
added and the cells allowed to incubate for a period, the sample containing a
target sequence to
be analyzed is, e.g., added to a biochip.
[0388] If required, the target sequence is prepared using known techniques.
For example, a
sample is treated to lyse the cells, using known lysis buffers,
electroporation, etc., with
purification and/or amplification such as PCR performed as appropriate. For
example, an in
vitro transcription with labels covalently attached to the nucleotides is
performed. Generally,
the nucleic acids are labeled with biotin-FITC or PE, or with cy3 or cy5.
[0389] The target sequence can be labeled with, e.g., a fluorescent, a
cheiniluminescent, a
chemical, or a radioactive signal, to provide a means of detecting the target
sequence's specific
binding to a probe. The label also can be an enzyme, such as alkaline
phosphatase or
horseradish peroxidase, which when provided with an appropriate substrate
produces a product
that is detected. Alternatively, the label is a labeled compound or small
molecule, such as an
enzyme inhibitor, that binds but is not catalyzed or altered by the enzyme.
The label also can be
a moiety or compound, such as, an epitope tag or biotin which specifically
binds to streptavidin.
114
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
For the example of biotin, the streptavidin is labeled as described above,
thereby, providing a
detectable signal for the bound target sequence. Unbound labeled streptavidin
is typically
removed prior to analysis.
[0390] As will be appreciated by those in the art, these assays can be direct
hybridization
assays or can coinprise "sandwich assays", which include the use of multiple
probes, as is
generally outlined in U.S. Patent Nos. 5, 681,702; 5,597,909; 5,545,730;
5,594,117; 5,591,584;
5,571,670; 5,580,731; 5,571,670; 5,591,584; 5,624,802; 5,635,352; 5,594,118;
5,359,100; 5,124,
246; and 5,681,697. In this embodiment, in general, the target nucleic acid is
prepared as
outlined above, and then added to the biochip comprising a plurality of
nucleic acid probes,
under conditions that allow the formation of a hybridization complex.
[0391] A variety of hybridization conditions are used in the present
invention, including
high, moderate and low stringency conditions as outlined above. The assays are
generally run
under stringency conditions which allow formation of the label probe
hybridization complex
only in the presence of target. Stringency can be controlled by altering a
step parameter that is a
therinodynamic variable, including, but not limited to, temperature, formamide
concentration,
salt concentration, cha6tropic salt concentration pH, organic solvent
concentration, etc. These
parameters may also be used to control non-specific binding, as is generally
outlined in U.S.
Patent No. 5,681,697. Thus, it can be desirable to perform certain steps at
higher stringency
conditions to reduce non-specific binding.
[0392] The reactions outlined herein can be accomplished in a variety of ways.
Components
of the reaction can be added simultaneously, or sequentially, in different
orders, with preferred
embodiments outlined below. In addition, the reaction may include a variety of
other reagents.
These include salts, buffers, neutral proteins, e.g., albumin, detergents,
etc. which can be used to
facilitate optimal hybridization and detection, and/or reduce nonspecific or
background
interactions. Reagents that otherwise improve the efficiency of the assay,
such as protease
inhibitors, nuclease inhibitors, anti-microbial agents, etc., may also be used
as appropriate,
depending on the sample preparation methods and purity of the target. The
assay data are
analyzed to determine the expression levels of individual genes, and changes
in expression
levels as between states, forming a gene expression profile.
XIII.D.) Biological Activity-related Assays
[0393] The invention provides methods identify or screen for a compound that
modulates
the activity of a cancer-related gene or protein of the invention. The methods
comprise adding a
test compound, as defined above, to a cell comprising a cancer protein of the
invention. The
115
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
cells contain a recombinant nucleic acid that encodes a cancer protein of the
invention. In
another embodiment, a library of candidate agents is tested on a plurality of
cells.
[0394] In one aspect, the assays are evaluated in the presence or absence or
previous or
subsequent exposure of physiological signals, e.g., hormones, antibodies,
peptides, antigens,
cytokines, growth factors, action potentials, pharmacological agents including
chemotherapeutics, radiation, carcinogenics, or other cells (i.e., cell-cell
contacts). In another
example, the determinations are made at different stages of the cell cycle
process. In this way,
compounds that modulate genes or proteins of the invention are identified.
Compounds with
pharmacological activity are able to enhance or interfere with the activity of
the cancer protein
of the invention. Once identified, similar structures are evaluated to
identify critical structural
features of the coinpound.
[0395] In one embodiment, a method of modulating (e.g., inhibiting) cancer
cell division is
provided; the method comprises administration of a cancer modulator. In
another embodiment,
a method of modulating (e.g., inhibiting) cancer is provided; the method
comprises
administration of a cancer modulator. In a further embodiment, methods of
treating cells or
individuals with cancer are provided; the method comprises administration of a
cancer
modulator.
[0396] In one embodiment, a method for modulating the status of a cell that
expresses a
gene of the invention is provided. As used herein status comprises such art-
accepted parameters
such as growth, proliferation, survival, function, apoptosis, senescence,
location, enzymatic
activity, signal transduction, etc. of a cell. In one embodiment, a cancer
inhibitor is an antibody
as discussed above. In another embodiment, the cancer inhibitor is an
antisense molecule. A
variety of cell growth, proliferation, and metastasis assays are known to
those of skill in the art,
as described herein.
XIII.E.) High Throug_hput Screening to Identify Modulators
[0397] The assays to identify suitable modulators are amenable to high
throughput
screening. Preferred assays thus detect enhancement or inhibition of cancer
gene transcription,
inhibition or enhancement of polypeptide expression, and inhibition or
enhancement of
polypeptide activity.
[0398] In one embodiment, modulators evaluated in high throughput screening
methods are
proteins, often naturally occurring proteins or fragments of naturally
occurring proteins. Thus,
e.g., cellular extracts containing proteins, or random or directed digests of
proteinaceous cellular
extracts, are used. In this way, libraries of proteins are made for screening
in the methods of the
116
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
invention. Particularly preferred in this embodiment are libraries of
bacterial, fungal, viral, and
mammalian proteins, with the latter being preferred, and human proteins being
especially
preferred. Particularly useful test compound will be directed to the class of
proteins to which the
target belongs, e.g., substrates for enzymes, or ligands and receptors.
XIII.F.) Use of Soft Aizar Growth and Colony Formation to Identify and
Characterize
Modulators
[0399] Normal cells require a solid substrate to attach and grow. When cells
are
transformed, they lose this phenotype and grow detached from the substrate.
For example,
transformed cells can grow in stirred suspension culture or suspended in semi-
solid media, such
as semi-solid or soft agar. The transformed cells, when transfected with
tLUnor suppressor genes,
can regenerate normal phenotype and once again require a solid substrate to
attach to and grow.
Soft agar growth or colony formation in assays are used to identify modulators
of cancer
sequences, which when expressed-in host cells, inhibit abnormal cellular
proliferation and
transfonnation. A modulator reduces or eliminates the host cells' ability to
grow suspended in
solid or semisolid media, such as agar.
[0400] Techniques for soft agar growth or colony formation in suspension
assays are
described in Freshney, Culture of Animal Cells a Manual of Basic Technique
(3rd ed., 1994).
See also, the methods section of Garkavtsev et al. (1996), supra.
XIII.G.) Evaluation of Contact Inhibition and Growth Density Limitation to
Identify and
Characterize Modulators
[0401] Normal cells typically grow in a flat and organized pattern in cell
culture until they
touch other cells. When the cells touch one another, they are contact
iiihibited and stop growing.
Transformed cells, however, are not contact inhibited and continue to grow to
high densities in
disorganized foci. Thus, transformed cells grow to a higher saturation density
than
corresponding normal cells. This is detected morphologically by the formation
of a disoriented
monolayer of cells or cells in foci. Alternatively, labeling index with (3H)-
thymidine at
saturation density is used to measure density limitation of growth, similarly
an MTT or Alamar
blue assay will reveal proliferation capacity of cells and the the ability of
inodulators to affect
same. See Freshney (1994), supra. Transformed cells, when transfected with
tumor suppressor
genes, can regenerate a normal phenotype and become contact inhibited and
would grow to a
lower density.
[0402] In this assay, labeling index with 3H)-thymidine at saturation density
is a preferred
method of measuring density limitation of growth. Transformed host cells are
transfected with a
117
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
cancer-associated sequence and are grown for 24 hours at saturation density in
non-limiting
medium conditions. The percentage of cells labeling with (3H)-thyinidine is
determined by
incorporated cpm.
[0403] Contact independent growth is used to identify modulators of cancer
sequences,
which had led to abnormal cellular proliferation and transformation. A
modulator reduces or
eliminates contact independent growth, and returns the cells to a normal
phenotype.
XIII.H.) Evaluation of Growth Factor or Serum Dependence to Identify and
Characterize
Modulators
[0404] Transformed cells have lower serum dependence than their normal
counterparts (see,
e.g., Temin, J. Natl. Cancer Inst. 37:167-175 (1966); Eagle et al., J. Exp.
Med 131:836-879
(1970)); Freshney, supra. This is in part due to release of various growth
factors by the
transformed cells. The degree of growth factor or serum dependence of
transformed host cells
can be compared with that of control. For example, growth factor or serum
dependence of a cell
is monitored in methods to identify and characterize compounds that modulate
cancer-associated
sequences of the invention.
XIII.I.) Use of Tumor-specific Marker Levels to Identify and Characterize
Modulators
[0405] Tumor cells release an increased amount of certain factors (hereinafter
"tumor
specific markers") than their non-nal counterparts. For exainple, plasminogen
activator (PA) is
released from human glioma at a higher level than from normal brain cells
(see, e.g., Gullino,
Angiogenesis, Tumor Vascularization, and Potential Interference with Tumor
Growth, in
Biological Responses in Cancer, pp. 178-184 (Mihich (ed.) 1985)). Similarly,
Tumor
Angiogenesis Factor (TAF) is released at a higher level in tumor cells than
their normal
counterparts. See, e.g., Folkman, Angiogenesis and Cancer, Sem Cancer Biol.
(1992)), while
bFGF is released from endothelial tumors (Ensoli, B et al).
[0406] Various techniques which measure the release of these factors are
described in
Freshney (1994), supra. Also, see, Unkless et al., J. Biol. Chem. 249:4295-
4305 (1974);
Strickland & Beers, J. Biol. Chem. 251:5694-5702 (1976); Whur et al., Br. J.
Cancer 42:305 312
(1980); Gullino, Angiogenesis, Tumor Vascularization, and Potential
Interference with Tumor
Growth, in Biological Responses in Cancer, pp. 178-184 (Mihich (ed.) 1985);
Freshney,
Anticancer Res. 5:111-130 (1985). For example, tumor specific marker levels
are monitored in
methods to identify and characterize compounds that modulate cancer-associated
sequences of
the invention.
118
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
XIII.J.) Invasiveness into Matrigel to Identify and Characterize Modulators
[0407] The degree of invasiveness into Matrigel or an extracellular matrix
constituent can be
used as an assay to identify and characterize compounds that modulate cancer
associated
sequences. Tumor cells exhibit a positive correlation between malignancy and
invasiveness of
cells into Matrigel or some other extracellular inatrix constituent. In this
assay, tumorigenic
cells are typically used as host cells. Expression of a tumor suppressor gene
in these host cells
would decrease invasiveness of the host cells. Techniques described in Cancer
Res. 1999;
59:6010; Freshney (1994), supra, can be used. Briefly, the level of invasion
of host cells is
measured by using filters coated with Matrigel or some other extracellular
matrix constituent.
Penetration into the gel, or through to the distal side of the filter, is
rated as invasiveness, and
rated histologically by nuinber of cells and distance moved, or by prelabeling
the cells with 1251
and counting the radioactivity on the distal side of the filter or bottom of
the dish. See, e.g.,
Freshney (1984), supra.
XIII.K.) Evaluation of Tumor Growth In Vivo to Identify and Characterize
Modulators
[0408] Effects of cancer-associated sequences on cell growth are tested in
transgenic or
immune-suppressed organisms. Transgenic organisms are prepared in a variety of
art-accepted
ways. For example, knock-out transgenic organisms, e.g., mammals such as mice,
are made, in
which a cancer gene is disrupted or in which a cancer gene is inserted. Knock-
out transgenic
mice are made by insertion of a marker gene or other heterologous gene into
the endogenous
cancer gene site in the mouse genome via homologous recombination. Such mice
can also be
made by substituting the endogenous cancer gene with a mutated version of the
cancer gene, or
by mutating the endogenous cancer gene, e.g., by exposure to carcinogens.
[0409] To prepare transgenic chimeric animals, e.g., mice, a DNA construct is
introduced
into the nuclei of embryonic stem cells. Cells containing the newly engineered
genetic lesion
are injected into a host mouse embryo, which is re-implanted into a recipient
female. Some of
these embryos develop into chimeric mice that possess germ cells some of which
are derived
from the mutant cell line. Therefore, by breeding the chimeric mice it is
possible to obtain a
new line of mice containing the introduced genetic lesion (see, e.g., Capecchi
et al., Science
244:1288 (1989)). Chimeric mice can be derived according to US Patent
6,365,797, issued 2
April 2002; US Patent 6,107,540 issued 22 August 2000; Hogan et al.,
Manipulating the Mouse
Embryo: A laboratory Manual, Cold Spring Harbor Laboratory (1988) and
Teratocarcinomas
and Embryonic Stem Cells: A Practical Approach, Robertson, ed., IRL Press,
Washington, D.C.,
(1987).
119
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0410] Alternatively, various immune-suppressed or immune-deficient host
animals can be
used. For example, a genetically athymic "nude" mouse (see, e.g., Giovanella
et aL, J. Natl.
Cancer Inst. 52:921 (1974)), a SCID mouse, a thymectornized mouse, or an
irradiated mouse
(see, e.g., Bradley et al., Br. J. Cancer 38:263 (1978); Selby et al., Br. J.
Cancer 41:52 (1980))
can be used as a host. Transplantable tumor cells (typically about 106 cells)
injected into
isogenic hosts produce invasive tumors in a high proportion of cases, while
normal cells of
similar origin will not. In hosts which developed invasive tumors, cells
expressing cancer-
associated sequences are injected subcutaneously or orthotopically. Mice are
then separated into
groups, including control groups and treated experimental groups) e.g.,
treated with a
modulator). After a suitable length of time, preferably 4-8 weeks, tumor
growth is measured
(e.g., by volume or by its two largest dimensions, or weight) and compared to
the control.
Tuinors that have statistically significant reduction (using, e.g., Student's
T test) are said to have
inhibited growth.
XIII.L.) In Vitro Assays to Identify and Characterize Modulators
[0411] Assays to identify compounds with modulating activity can be performed
in vitro.
For example, a cancer polypeptide is first contacted with a potential
modulator and incubated for
a suitable amount of time, e.g., from 0.5 to 48 hours. In one embodiment, the
cancer
polypeptide levels are detennined in vitro by measuring the level of protein
or mRNA. The
level of protein is measured using iinmunoassays such as Western blotting,
ELISA and the like
with an antibody that selectively binds to the cancer polypeptide or a
fragment thereof. For
measurement of mRNA, ainplification, e.g., using PCR, LCR, or hybridization
assays, e. g.,
Northern hybridization, RNAse protection, dot blotting, are preferred. The
level of protein or
mRNA is detected using directly or indirectly labeled detection agents, e.g.,
fluorescently or
radioactively labeled nucleic acids, radioactively or enzymatically labeled
antibodies, and the
like, as described herein.
[0412] Alternatively, a reporter gene system can be devised using a cancer
protein promoter
operably linked to a reporter gene such as luciferase, green fluorescent
protein, CAT, or P-gal.
The reporter construct is typically transfected into a cell. After treatment
with a potential
modulator, the amount of reporter gene transcription, translation, or activity
is measured
according to standard techniques known to those of skill in the art (Davis GF,
supra; Gonzalez,
J. & Negulescu, P. Curr. Opin. Biotechnol. 1998: 9:624).
[0413] As outlined above, in vitro screens are done on individual genes and
gene products.
That is, having identified a particular differentially expressed gene as
important in a particular
120
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
state, screening of modulators of the expression of the gene or the gene
product itself is
performed.
[0414] In one embodiment, screening for modulators of expression of specific
gene(s) is
performed. Typically, the expression of only one or a few genes is evaluated.
In another
embodiment, screens are designed to first find compounds that bind to
differentially expressed
proteins. These compounds are then evaluated for the ability to modulate
differentially
expressed activity. Moreover, once initial candidate compounds are identified,
variants can be
further screened to better evaluate structure activity relationships.
XIII.M.) Binding Assays to Identify and Characterize Modulators
[0415] In binding assays in accordance with the invention, a purified or
isolated gene
product of the invention is generally used. For example, antibodies are
generated to a protein of
the invention, and immunoassays are run to deterinine the ainount and/or
location of protein.
Alternatively, cells comprising the cancer proteins are used in the assays.
[0416] Thus, the methods comprise combining a cancer protein of the invention
and a
candidate compound such as a ligand, and determining the binding of the
compound to the
cancer protein of the invention. Preferred embodiments utilize the human
cancer protein; animal
models of human disease of can also be developed and used. Also, other
analogous mammalian
proteins also can be used as appreciated by those of skill in the art.
Moreover, in some
embodiments variant or derivative cancer proteins are used.
[0417] Generally, the cancer protein of the invention, or the ligand, is non-
diffusibly bound
to an insoluble support. The support can, e.g., be one having isolated sample
receiving areas (a
microtiter plate, an array, etc.). The insoluble supports can be made of any
composition to
which the compositions can be bound, is readily separated from soluble
material, and is
otherwise compatible with the overall method of screening. The surface of such
supports can be
solid or porous and of any convenient shape.
[0418] Examples of suitable insoluble supports include microtiter plates,
arrays, membranes
and beads. These are typically made of glass, plastic (e.g., polystyrene),
polysaccharide, nylon,
nitrocellulose, or TeflonTM, etc. Microtiter plates and arrays are especially
convenient because a
large number of assays can be carried out simultaneously, using small amounts
of reagents and
samples. The particular manner of binding of the composition to the support is
not crucial so
long as it is compatible with the reagents and overall methods of the
invention, maintains the
activity of the composition and is nondiffusable. Preferred methods of binding
include the use
of antibodies which do not sterically block either the ligand binding site or
activation sequence
121
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
when attaching the protein to the support, direct binding to "sticky" or ionic
supports, chemical
crosslinking, the synthesis of the protein or agent on the surface, etc.
Following binding of the
protein or ligand/binding agent to the support, excess unbound material is
removed by washing.
The sample receiving areas may then be blocked through incubation with bovine
serum albumin
(BSA), casein or other innocuous protein or other moiety.
[0419] Once a cancer protein of the invention is bound to the support, and a
test compound
is added to the assay. Alternatively, the candidate binding agent is bound to
the support and the
cancer protein of the invention is then added. Binding agents include specific
antibodies, non-
natural binding agents identified in screens of chemical libraries, peptide
analogs, etc.
[0420] Of particular interest are assays to identify agents that have a low
toxicity for human
cells. A wide variety of assays can be used for this purpose, including
proliferation assays,
cAMP assays, labeled in vitro protein-protein binding assays, electrophoretic
mobility shift
assays, immunoassays for protein binding, functional assays (phosphorylation
assays, etc.) and
the like.
[0421] A determination of binding of the test coinpound (ligand, binding
agent, modulator,
etc.) to a cancer protein of the invention can be done in a number of ways.
The test compound .
can be labeled, and binding determined directly, e.g., by attaching all or a
portion of the cancer
protein of the invention to a solid support, adding a labeled candidate
compound (e.g., a
fluorescent label), washing off excess reagent, and determining whether the
label is present on
the solid support. Various blocking and washing steps can be utilized as
appropriate.
[0422] In certain embodiments, only one of the components is labeled, e.g., a
protein of the
invention or ligands labeled. Alternatively, more than one component is
labeled with different
labels, e.g., 1125, for the proteins and a fluorophor for the compound.
Proximity reagents, e.g.,
quenching or energy transfer reagents are also useful.
XIII.N.) Competitive Binding to Identify and Characterize Modulators
[0423] In one embodiment, the binding of the "test compound" is determined by
competitive
binding assay with a "competitor." The competitor is a binding moiety that
binds to the target
molecule (e.g., a cancer protein of the invention). Competitors include
compounds such as
antibodies, peptides, binding partners, ligands, etc. Under certain
circumstances, the
competitive binding between the test compound and the coinpetitor displaces
the test compound.
In one embodiment, the test compound is labeled. Either the test compound, the
competitor, or
both, is added to the protein for a time sufficient to allow binding.
Incubations are performed at
a temperature that facilitates optimal activity, typically between four and 40
C. Incubation
122
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
periods are typically optimized, e.g., to facilitate rapid high throughput
screening; typically
between zero and one hour will be sufficient. Excess reagent is generally
removed or washed
away. The second component is then added, and the presence or absence of the
labeled
component is followed, to indicate binding.
[0424] In one embodiment, the competitor is added first, followed by the test
compound.
Displacement of the competitor is an indication that the test compound is
binding to the cancer
protein and thus is capable of binding to, and potentially modulating, the
activity of the cancer
protein. In this embodiment, either component can be labeled. Thus, e.g., if
the competitor is
labeled, the presence of label in the post-test coinpound wash solution
indicates displacement by
the test compound. Alternatively, if the test compound is labeled, the
presence of the label on
the support indicates displacement.
[0425] In an alternative embodiment, the test compound is added first, with
incubation and
washing, followed by the competitor. The absence of binding by the competitor
indicates that
the test compound binds to the cancer protein with higher affinity than the
competitor. Thus, if
the test coinpound is labeled, the presence of the label on the support,
coupled with a lack of
competitor binding, indicates that the test compound binds to and thus
potentially modulates the
cancer protein of the invention.
[0426] Accordingly, the competitive binding methods comprise differential
screening to
identity agents that are capable of modulating the activity of the cancer
proteins of the invention.
In this embodiment, the methods comprise combining a cancer protein and a
competitor in a first
sample. A second sainple comprises a test compound, the cancer protein, and a
competitor. The
binding of the competitor is determined for both samples, and a change, or
difference in binding
between the two samples indicates the presence of an agent capable of binding
to the cancer
protein and potentially modulating its activity. That is, if the binding of
the competitor is
different in the second sample relative to the first sample, the agent is
capable of binding to the
cancer protein.
[0427] Alternatively, differential screening is used to identify drug
candidates that bind to
the native cancer protein, but cannot bind to modified cancer proteins. For
example the structure
of the cancer protein is modeled and used in rational drug design to
synthesize agents that
interact with that site, agents which generally do not bind to site-modified
proteins. Moreover,
such drug candidates that affect the activity of a native cancer protein are
also identified by
screening drugs for the ability to either enhance or reduce the activity of
such proteins.
123
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0428] Positive controls and negative controls can be used in the assays.
Preferably control
and test samples are performed in at least triplicate to obtain statistically
significant results.
Incubation of all samples occurs for a time sufficient to allow for the
binding of the agent to the
protein. Following incubation, samples are washed free of non-specifically
bound material and
the amount of bound, generally labeled agent determined. For example, where a
radiolabel is
employed, the samples can be counted in a scintillation counter to determine
the amount of
bound compound.
[0429] A variety of other reagents can be included in the screening assays.
These include
reagents like salts, neutral proteins, e.g., albumin, detergents, etc. which
are used to facilitate
optimal protein-protein binding and/or reduce non-specific or background
interactions. Also
reagents that otherwise improve the efficiency of the assay, such as protease
inhibitors, nuclease
inhibitors, anti-microbial agents, etc., can be used. The mixture of
components is added in an
order that provides for the requisite binding.
XIII.O.) Use of Polynucleotides to Down-regulate or Inhibit a Protein of the
Invention
[0430] Polynucleotide modulators of cancer can be introduced into a cell
containing the
target nucleotide sequence by formation of a conjugate with a ligand-binding
molecule, as
described in WO 91/04753. Suitable ligand-binding molecules include, but are
not limited to,
cell surface receptors, growth factors, other cytokines, or other ligands that
bind to cell surface
receptors. Preferably, conjugation of the ligand binding molecule does not
substantially
interfere with the ability of the ligand binding molecule to bind to its
corresponding molecule or
receptor, or block entry of the sense or antisense oligonucleotide or its
conjugated version into
the cell. Alternatively, a polynucleotide modulator of cancer can be
introduced into a cell
containing the target nucleic acid sequence, e.g., by formation of a
polynucleotide-lipid
complex, as described in WO 90/10448. It is understood that the use of
antisense molecules or
knock out and knock in models may also be used in screening assays as
discussed above, in
addition to methods of treatment.
XIII.P.) Inhibitory and Antisense Nucleotides
[0431] In certain embodiments, the activity of a cancer-associated protein is
down-regulated,
or entirely inhibited, by the use of antisense polynucleotide or inhibitory
small nuclear RNA
(snRNA), i.e., a nucleic acid complementary to, and which can preferably
hybridize specifically
to, a coding mRNA nucleic acid sequence, e.g., a cancer protein of the
invention, mRNA, or a
subsequence thereof. Binding of the antisense polynucleotide to the mRNA
reduces the
translation and/or stability of the mRNA.
124
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0432] In the context of this invention, antisense polynucleotides can
comprise naturally
occurring nucleotides, or synthetic species formed from naturally occurring
subunits or their
close homologs. Antisense polynucleotides may also have altered sugar moieties
or inter-sugar
linkages. Exemplary among these are the phosphorothioate and other sulfur
containing species
which are known for use in the art. Analogs are comprised by this invention so
long as they
function effectively to hybridize with nucleotides of the invention. See,
e.g., Isis
Pharmaceuticals, Carlsbad, CA; Sequitor, Inc., Natick, MA.
[0433] Such antisense polynucleotides can readily be synthesized using
recombinant means,
or can be synthesized in vitro. Equipment for such synthesis is sold by
several vendors,
including Applied Biosystems. The preparation of other oligonucleotides such
as
phosphorothioates and alkylated derivatives is also well known to those of
skill in the art.
[0434] Antisense molecules as used herein include antisense or sense
oligonucleotides.
Sense oligonucleotides can, e.g., be employed to block transcription by
binding to the anti-sense
strand. The antisense and sense oligonucleotide comprise a single stranded
nucleic acid
sequence (either RNA or DNA) capable of binding to target mRNA (sense) or DNA
(antisense)
sequences for cancer molecules. Antisense or sense oligonucleotides, according
to the present
invention, comprise a fragment generally at least about 12 nucleotides,
preferably from about 12
to 30 nucleotides. The ability to derive an antisense or a sense
oligonucleotide, based upon a
cDNA sequence encoding a given protein is described in, e.g., Stein &Cohen
(Cancer Res.
48:2659 (1988 and van der Krol et al. (BioTechniques 6:958 (1988)).
XIII.Q.) Ribozymes
[0435] In addition to antisense polynucleotides, ribozymes can be used to
target and inhibit
transcription of cancer-associated nucleotide sequences. A ribozyme is an RNA
molecule that
catalytically cleaves other RNA molecules. Different kinds of ribozymes have
been described,
including group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNase P,
and axhead
ribozymes (see, e.g., Castanotto et aL, Adv. in Pharmacology 25: 289-317
(1994) for a general
review of the properties of different ribozymes).
[0436] The general features of hairpin ribozymes are described, e.g., in
Hampel et al., Nucl.
Acids Res. 18:299-304 (1990); European Patent Publication No. 0360257; U.S.
Patent No.
5,254,678. Methods of preparing are well known to those of skill in the art
(see, e.g., WO
94/26877; Ojwang et al., Proc. Natl. Acad. Sci. USA 90:6340-6344 (1993);
Yamada et al.,
Human Gene Therapy 1:39-45 (1994); Leavitt et al., Proc. Natl. Acad Sci. USA
92:699- 703
125
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
(1995); Leavitt et al., Human Gene Therapy 5: 1151-120 (1994); and Yamada et
al., Virology
205: 121-126 (1994)).
XIII.R.) Use of Modulators in Phenotypic Screenin~
[0437] In one embodiment, a test compound is administered to a population of
cancer cells,
which have an associated cancer expression profile. By "administration" or
"contacting" herein
is meant that the modulator is added to the cells in such a manner as to allow
the modulator to
act upon the cell, whether by uptake and intracellular action, or by action at
the cell surface. In
some embodiinents, a nucleic acid encoding a proteinaceous agent (i.e., a
peptide) is put into a
viral construct sucll as an adenoviral or retroviral construct, and added to
the cell, such that
expression of the peptide agent is accomplished, e.g., PCT US97/01019.
Regulatable gene
therapy systems can also be used. Once the modulator has been administered to
the cells, the
cells are washed if desired and are allowed to incubate under preferably
physiological conditions
for some period. The cells are then harvested and a new gene expression
profile is generated.
Thus, e.g., cancer tissue is screened for agents that modulate, e.g., induce
or suppress, the cancer
phenotype. A change in at least one gene, preferably many, of the expression
profile indicates
that the agent has an effect on cancer activity. Similarly, altering a
biological function or a
signaling pathway is indicative of modulator activity. By defining such a
signature for the
cancer phenotype, screens for new drugs that alter the phenotype are devised.
With this
approach, the drug target need not be known and need not be represented in the
original
gene/protein expression screening platform, nor does the level of transcript
for the target protein
need to change. The modulator inhibiting function will serve as a surrogate
marker.
[04381 As outlined above, screens are done to assess genes or gene products.
That is, having
identified a particular differentially expressed gene as important in a
particular state, screening
of modulators of either the expression of the gene or the gene product itself
is performed.
XIII.S.) Use of Modulators to Affect Peptides of the Invention
[0439] Measurements of cancer polypeptide activity, or of the cancer phenotype
are
performed using a variety of assays. For example, the effects of modulators
upon the function
of a cancer polypeptide(s) are measured by examining parameters described
above. A
physiological change that affects activity is used to assess the influence of
a test compound on
the polypeptides of this invention. When the functional outcomes are
determined using intact
cells or animals, a variety of effects can be assesses such as, in the case of
a cancer associated
with solid tumors, tumor growth, tumor metastasis, neovascularization, hormone
release,
transcriptional changes to both known and uncharacterized genetic markers
(e.g., by Northern
126
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
blots), changes in cell metabolism such as cell growth or pH changes, and
changes in
intracellular second messengers such as cGNIP.
XIII.T.) Methods of Identifying Characterizing Cancer-associated Sequences
[0440] Expression of various gene sequences is correlated with cancer.
Accordingly,
disorders based on mutant or variant cancer genes are determined. In one
embodiment, the
invention provides methods for identifying cells containing variant cancer
genes, e.g.,
determining the presence of, all or part, the sequence of at least one
endogenous cancer gene in a
cell. This is accomplished using any nuinber of sequencing techniques. The
invention
comprises methods of identifying the cancer genotype of an individual, e.g.,
determining all or
part of the sequence of at least one gene of the invention in the individual.
This is generally
done in at least one tissue of the individual, e.g., a tissue set forth in
Table I, and may include the
evaluation of a number of tissues or different samples of the same tissue. The
method may
include comparing the sequence of the sequenced gene to a known cancer gene,
i.e., a wild-type
gene to determine the presence of family members, homologies, mutations or
variants. The
sequence of all or part of the gene can then be coinpared to the sequence of a
known cancer gene
to determine if any differences exist. This is done using any number of known
homology
programs, such as BLAST, Bestfit, etc. The presence of a difference in the
sequence between
the cancer gene of the patient and the known cancer gene correlates with a
disease state or a
propensity for a disease state, as outlined herein.
[0441] In a preferred embodiment, the cancer genes are used as probes to
determine the
number of copies of the cancer gene in the genome. The cancer genes are used
as probes to
determine the chromosomal localization of the cancer genes. Information such
as chromosomal
localization finds use in providing a diagnosis or prognosis in particular
when chromosomal
abnormalities such as translocations, and the like are identified in the
cancer gene locus.
XIV.) KITS/ARTICLES OF MANUFACTURE
[0442] For use in the laboratory, prognostic, prophylactic, diagnostic and
therapeutic
applications described herein, kits are within the scope of the invention.
Such kits can comprise
a carrier, package, or container that is compartmentalized to receive one or
more containers such
as vials, tubes, and the like, each of the container(s) coinprising one of the
separate elements to
be used in the method, along with a label or insert comprising instructions
for use, such as a use
described herein. For example, the container(s) can comprise a probe that is
or can be detectably
labeled. Such probe can be an antibody or polynucleotide specific for a
protein or a gene or
127
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
message of the invention, respectively. Where the method utilizes nucleic acid
hybridization to
detect the target nucleic acid, the kit can also have containers containing
nucleotide(s) for
amplification of the target nucleic acid sequence. Kits can comprise a
container comprising a
reporter, such as a biotin-binding protein, such as avidin or streptavidin,
bound to a reporter
molecule, such as an enzymatic, fluorescent, or radioisotope label; such a
reporter can be used
with, e.g., a nucleic acid or antibody. The kit can include all or part of the
amino acid sequences
in Figure 2 or Figure 3 or analogs thereof, or a nucleic acid molecule that
encodes such amino
acid sequences.
[0443] The kit of the invention will typically comprise the container
described above and
one or more other containers associated therewith that comprise materials
desirable from a
commercial and user standpoint, including buffers, diluents, filters, needles,
syringes; carrier,
package, container, vial and/or tube labels listing contents and/or
instructions for use, and
package inserts with instructions for use.
[0444] A label can be present on or with the container to indicate that the
coiuposition is
used for a specific therapy or non-therapeutic application, such as a
prognostic, prophylactic,
diagnostic or laboratory application, and can also indicate directions for
either in vivo or in vitro
use, such as those described herein. Directions and or other infonnation can
also be included on
an insert(s) or label(s) which is included with or on the kit. The label can
be on or associated
with the container. A label a can be on a container when letters, numbers or
other characters
forming the label are molded or etched into the container itself; a label can
be associated with a
container when it is present within a receptacle or carrier that also holds
the container, e.g., as a
package insert. The label can indicate that the coinposition is used for
diagnosing, treating,
prophylaxing or prognosing a condition, such as a neoplasia of a tissue set
forth in Table I.
[0445] The terms "kit" and "article of manufacture" can be used as synonyms.
[0446] In another embodiment of the invention, an article(s) of manufacture
containing
compositions, such as amino acid sequence(s), small molecule(s), nucleic acid
sequence(s),
and/or antibody(s), e.g., materials useful for the diagnosis, prognosis,
prophylaxis and/or
treatment of neoplasias of tissues such as those set forth in Table I is
provided. The article of
manufacture typically comprises at least one container and at least one label.
Suitable containers
include, for example, bottles, vials, syringes, and test tubes. The containers
can be formed from
a variety of materials such as glass, metal or plastic. The container can hold
amino acid
sequence(s), small molecule(s), nucleic acid sequence(s), cell population(s)
and/or antibody(s).
In one embodiment, the container holds a polynucleotide for use in examining
the mRNA
128
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
expression profile of a cell, together with reagents used for this purpose. In
another
embodiment a container comprises an antibody, binding fragment thereof or
specific binding
protein for use in evaluating protein expression ofl 58P3D2 in cells and
tissues, or for relevant
laboratory, prognostic, diagnostic, prophylactic and therapeutic purposes;
indications and/or
directions for such uses can be included on or with such container, as can
reagents and other
compositions or tools used for these purposes. In another embodiment, a
container comprises
materials for eliciting a cellular or humoral immune response, together with
associated
indications and/or directions. In another embodiment, a container comprises
materials for
adoptive immunotherapy, such as cytotoxic T cells (CTL) or helper T cells
(HTL), together with
associated indications and/or directions; reagents and other compositions or
tools used for such
purpose can also be included.
[0447] The container can alternatively hold a composition that is effective
for treating,
diagnosis, prognosing or prophylaxing a condition and can have a sterile
access port (for
exainple the container can be an intravenous solution bag or a vial having a
stopper pierceable
by a hypodermic injection needle). The active agents in the composition can be
an antibody
capable of specifically binding 158P3D2 and modulating the function of 15
8P3D2.
[0448] The article of manufacture can further comprise a second container
comprising a
phannaceutically-acceptable buffer, such as phosphate-buffered saline,
Ringer's solution and/or
dextrose solution. It can further include other materials desirable from a
commercial and user
standpoint, including other buffers, diluents, filters, stirrers, needles,
syringes, and/or package
inserts with indications and/or instructions for use.
Examples
[0449] Various aspects of the invention are further described and illustrated
by way of the
several exainples that follow, none of which is intended to limit the scope of
the invention.
Example 1
SSH-Generated Isolation of a cDNA Fraglnent of the 158P3D2 Gene
[0450] To isolate genes that are over-expressed in bladder cancer we used the
Suppression
Subtractive Hybridization (SSH) procedure using cDNA derived from bladder
cancer tissues,
including invasive transitional cell carcinoma. The 158P3D2 SSH cDNA sequence
was derived
from a bladder cancer pool minus normal bladder cDNA subtraction. Included in
the driver
were also cDNAs derived from 9 other normal tissues. The 158P3D2 cDNA was
identified as
129
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
highly expressed in the bladder cancer tissue pool, with lower expression seen
in a restricted set
of normal tissues.
[0451] The SSH DNA sequence of 312 bp (Figure 1) shows identity to the fer-1-
like 4 (C.
elegans) (FER1L4) mRNA. A 158P3D2 cDNA clone 158P3D2-BCP1 of 1994 bp was
isolated
from bladder cancer cDNA, revealing an ORF of 328 amino acids (Figure 2,
Figure 3).
[0452] Amino acid sequence analysis of 158P3D2 reveals 100% identity over 328
amino
acid region to dJ477O4.1.1, a novel protein similar to otoferlin and
dysferlin, isoform 1 protein
(GenBank Accession CAB 89410.1).
[0453] The 158P3D2 protein has a transmeiubrane domain of 23 residues between
amino
acids 292-313 predicted by the SOSUI Signal program.
Materials and Methods
Human Tissues:
[0454] The patient cancer and normal tissues were purchased from different
sources such as
the NDRI (Philadelphia, PA). mRNA for some of the normal tissues were
purchased from
Clontech, Palo Alto, CA.
RNA Isolation:
[0455] Tissues were homogenized in Trizol reagent (Life Technologies, Gibco
BRL) using
ml/ g tissue isolate total RNA. Poly A RNA was purified from total RNA using
Qiagen's
Oligotex mRNA Mini and Midi kits. Total and mRNA were quantified by
spectrophotometric
analysis (O.D. 260/280 iun) and analyzed by gel electrophoresis.
Oligonucleotides:
[0456] The following HPLC purified oligonucleotides were used.
DPNCDN (cDNA synthesis primerl:
5'TTTTGATCAAGCTT303' (SEQ ID NO: 67)
Adaptor 1:
5'CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAG3'
(SEQ ID NO: 68)
3'GGCCCGTCCTAGS' (SEQ ID NO: 69)
130
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Adaptor 2:
5'GTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAG3'
(SEQ ID NO: 70)
3'CGGCTCCTAG5' (SEQ ID NO: 71)
PCR primer 1:
5'CTAATACGACTCACTATAGGGC3' (SEQ ID NO: 72)
Nested primer (NP)l:
5'TCGAGCGGCCGCCCGGGCAGGA3' (SEQ ID NO: 73)
Nested primer (NP)2:
5'AGCGTGGTCGCGGCCGAGGA3' (SEQ ID NO: 74)
Suppression Subtractive Hybridization:
[0457] Suppression Subtractive Hybridization (SSH) was used to identify cDNAs
corresponding to genes that may be differentially expressed in bladder cancer.
The SSH
reaction utilized cDNA from bladder cancer and normal tissues.
[0458] The gene 158P3D2 sequence was derived from a bladder cancer pool minus
normal
bladder cDNA subtraction. The SSH DNA sequence (Figure 1) was identified.
[0459] The cDNA derived from of pool of nonnal bladder tissues was used as the
source of
the "driver" cDNA, while the cDNA from a pool of bladder cancer tissues was
used as the
source of the "tester" cDNA. Double stranded cDNAs corresponding to tester and
driver
cDNAs were synthesized from 2 g of poly(A)+ RNA isolated from the relevant
xenograft
tissue, as described above, using CLONTECH's PCR-Select cDNA Subtraction Kit
and 1 ng of
oligonucleotide DPNCDN as primer. First- and second-strand synthesis were
carried out as
described in the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1,
Catalog No.
K1804-1). The resulting eDNA was digested with Dpn II for 3 hrs at 37 C.
Digested cDNA
was extracted with phenol/chloroform (1:1) and ethanol precipitated.
[0460] Driver cDNA was generated by combining in a 1:1 ratio Dpn II digested
cDNA from
the relevant tissue source (see above) with a mix of digested cDNAs derived
from the nine
normal tissues: stomach, skeletal muscle, lung, brain, liver, kidney,
pancreas, small intestine,
and heart.
131
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0461] Tester cDNA was generated by diluting 1 l of Dpn II digested cDNA from
the
relevant tissue source (see above) (400 ng) in 5 l of water. The diluted eDNA
(2 l, 160 ng)
was then ligated to 2 1 of Adaptor 1 and Adaptor 2 (10 M), in separate
ligation reactions, in a
total volume of 10 l at 16 C overnight, using 400 u of T4 DNA ligase
(CLONTECH). Ligation
was terminated with 1 gl of 0.2 M EDTA and heating at 72 C for 5 min.
[0462] The first hybridization was perforined by adding 1.5 1(600 ng) of
driver cDNA to
each of two tubes containing 1.5 l (20 ng) Adaptor 1- and Adaptor 2- ligated
tester cDNA. In a
final volume of 4 l, the samples were overlaid with mineral oil, denatured in
an MJ Research
thermal cycler at 98 C for 1.5 minutes, and then were allowed to hybridize for
8 hrs at 68 C. The
two hybridizations were then mixed together with an additional 1 l of fresh
denatured driver
cDNA and were allowed to hybridize overnight at 68 C. The second hybridization
was then
diluted in 200 l of 20 mM Hepes, pH 8.3, 50 mM NaCl, 0.2 mM EDTA, heated at
70 C for 7,
min. and stored at -20 C.
PCR Amplification, Cloningand Sequencing of Gene Fragments Generated from SSH:
[0463] To amplify gene fiagments resulting from SSH reactions, two PCR
amplifications
were performed. In the primary PCR reaction 1 l of the diluted final
hybridization mix was
added to 1 l of PCR primer 1(10 M), 0.5 l dNTP mix (10 M), 2.5 1 10 x
reaction buffer
(CLONTECH) and 0.5 150 x Advantage cDNA polymerase Mix (CLONTECH) in a fmal
volume of 25 l. PCR 1 was conducted using the following conditions: 75 C for
5 min., 94 C
for 25 sec., then 27 cycles of 94 C for 10 sec, 66 C for 30 sec, 72 C for 1.5
min. Five separate
primary PCR reactions were performed for each experiment. The products were
pooled and
diluted 1:10 with water. For the secondary PCR reaction, 1 l from the pooled
and diluted
primary PCR reaction was added to the same reaction mix as used for PCR 1,
except that
primers NP 1 and NP2 (10 gM) were used instead of PCR primer 1. PCR 2 was
performed using
10-12 cycles of 94 C for 10 sec, 68 C for 30 sec, and 72 C for 1.5 minutes.
The PCR products
were analyzed using 2% agarose gel electrophoresis.
[0464] The PCR products were inserted into pCR2.1 using the T/A vector cloning
kit
(Invitrogen). Transformed E. coli were subjected to blue/white and ampicillin
selection. White
colonies were picked and arrayed into 96 well plates and were grown in liquid
culture overnight.
To identify inserts, PCR amplification was performed on 1 ml of bacterial
culture using the
conditions of PCRl and NP 1 and NP2 as primers. PCR products were analyzed
using 2%
agarose gel electrophoresis.
132
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0465] Bacterial clones were stored in 20% glycerol in a 96 well format.
Plasmid DNA was
prepared, sequenced, and subjected to nucleic acid homology searches of the
GenBank, dBest,
and NCI-CGAP databases.
RT-PCR Expression Analysis:
[0466] First strand cDNAs can be generated from 1 g of mRNA with oligo (dT)
12-18
priming using the Gibco-BRL Superscript Preamplification system. The
manufacturer's protocol
was used which included an incubation for 50 min at 42 C with reverse
transcriptase followed
by RNAse H treatment at 37 C for 20 min. After completing the reaction, the
volume can be
increased to 200 l with water prior to normalization. First strand cDNAs from
16 different
norinal human tissues can be obtained from Clontech.
[0467] Normalization of the first strand cDNAs from multiple tissues was
performed by
using the primers 5'atatcgccgcgctcgtcgtcgacaa3' (SEQ ID NO: 75) and
5'agccacacgcagctcattgtagaagg 3' (SEQ ID NO: 76) to amplify 0-actin. First
strand cDNA (5
l) were amplified in a total volume of 50 l containing 0.4 M primers, 0.2 M
each dNTPs,
IXPCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM MgC12, 50 mM KC1, pH8.3) and 1X
Klentaq DNA polymerase (Clontech). Five l of the PCR reaction can be removed
at 18, 20,
and 22 cycles and used for agarose gel electrophoresis. PCR was performed
using an MJ
Research thermal cycler under the following conditions: Initial denaturation
can be at 94 C for
15 sec, followed by a 18, 20, and 22 cycles of 94 C for 15, 65 C for 2 min, 72
C for 5 sec. A
final extension at 72 C was carried out for 2 min. After agarose gel
electrophoresis, the band
intensities of the 283 b.p. (3-actin bands from multiple tissues were compared
by visual
inspection. Dilution factors for the first strand cDNAs were calculated to
result in equal (3-actin
band intensities in all tissues after 22 cycles of PCR. Three rounds of
normalization can be
required to achieve equal band intensities, in all tissues after 22 cycles of
PCR.
[0468] To determine expression levels of the 158P3D2 gene, 5 l of normalized
first strand
cDNA were analyzed by PCR using 26, and 30 cycles of ainplification. Semi-
quantitative
expression analysis can be achieved by comparing the PCR products at cycle
nuinbers that give
light band intensities. The primers used for RT-PCR were designed using the
158P3D2 SSH
sequence and are listed below:
158P3D2.1
5' CATCTATGTGAAGAGCTGGGTGAA 3' (SEQ ID NO: 77)
133
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
158P3D2.2
5' AGGTAGTCAAAGCGGAACACAAAG 3' (SEQ ID NO: 78)
[0469] Additional primers were also designed to test for expression of the
different splice
variants and these are listed below:
Primer Name Sequeiice
158P3D2 ex. 17 - R GTCCTCCCAGCAACTCCACACA (SEQ ID NO: 79)
158P3D2 ex. 26 - F TGTCCCTTCCACCCAACGTGTGC (SEQ ID NO: 80)
158P3D2 ex. 28 - R TCCTCCATCTCTCCTTCCTCCTCAG (SEQ ID NO: 81)
158P3D2 ex. 9- F CAGAAACTGGTGGGAGTCAACA (SEQ ID NO: 82)
158P3D2 ex.1 - F ATGGCTCTGACGGTAAGCGTGC (SEQ ID NO: 83)
158P3D2 ex.10 - F ATAGGCACCTTCAGGATGGACC (SEQ ID NO: 84)
158P3D2 ex.10 - R TCCATCCTGAAGGTGCCTATCC (SEQ ID NO: 85)
,
158P3D2 ex.16 - F CAGAGGAGGAGAAAGAGGAGG (SEQ ID NO: 86)
158P3D2 ex.16 - R TCCTCTTTCTCCTCCTCTGG (SEQ ID NO: 87)
158P3D2 ex.21 - F AGATCCAGAGTCTAATGCTCACG (SEQ ID NO: 88)
158P3D2 ex.21 - R CGTGAGCATTAGACTCTGGATC (SEQ ID NO: 89)
158P3D2 ex.27 - F AAGGTGTGGAGTCTGAGGTC (SEQ ID NO: 90)
158P3D2 ex.27 - R ACCTCAGACTCCACACCTTGC (SEQ ID NO: 91)
158P3D2 ex.34 - R ACTCTGACCAGGAGCTTGATG (SEQ ID NO: 92)
158P3D2 ex.40 - F ACACGGAGGATGTGGTTCTGG (SEQ ID NO: 93)
158P3D2 ex.43 - F TTGAGCTGCTGACTGTGGAGGAG (SEQ ID NO: 94)
158P3D2 ex.43 - R TCCTCCACAGTCAGCAGCTC (SEQ ID NO: 95)
158P3D2 ex.44 - R TGAGTGTCCAAGGTCAGCGAG (SEQ ID NO: 96)
158P3D2 ex.7 - F AGAGAATGAGCTGGAGCTTGAGC (SEQ ID NO: 97)
158P3D2 ex.7 - R TCAAGCTCCAGCTCATTCTCTTC (SEQ ID NO: 98)
AGS-25 long RT PCR-3' TAACACCAGAAAGTTCCACGTCAG (SEQ ID NO: 99)
AGS-25 long RT PCR-5' TGACGGTCGCCGTATTTGATC (SEQ ID NO: 100)
AGS-25 short RT PCR-3' GATTGGCTGCCGAGGCTTGA (SEQ ID NO: 101)
AGS-25 short RT PCR-5' TGACGGTCGCCGTATTTGATC (SEQ ID NO: 102)
134
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0470] A typical RT-PCR expression analysis is shown in Figure 14. RT-PCR
expression
analysis was performed on first strand cDNAs generated using pools of tissues
from multiple
samples. The cDNAs were shown to be normalized using beta-actin PCR. Results
show strong
expression of 158P3D2 in bladder cancer pool, kidney cancer pool and cancer
metastasis pool.
Expression of 158P3D2 is also detected in colon cancer pool, lung cancer pool,
ovary cancer
pool, breast cancer pool, pancreas cancer pool and prostate metastases to
lymph node, and vital
poo12, but not vital pool 1.
Example 2
Full Length Cloning of 158P3D2
[0471] The 158P3D2 SSH cDNA sequence was derived from a bladder cancer pool
minus
normal bladder cDNA subtraction. The SSH cDNA sequence (Figure 1) was
designated
158P3D2. The full-length cDNA clone 158P3D2 v.1 clone 158P3D2-BCP1 and 158P3D2-
BCP2 (Figure 2) were cloned from bladder cancer pool cDNA.
[0472] Additional 158P3D2 splice and SNP variants have been identified and
these are
listed in Figure 2 and Figure 3.
Examble 3
Chromosomal Manping of 158P3D2
[0473] Chromosomal localization can implicate genes in disease pathogenesis.
Several
chromosome mapping approaches are available including fluorescent in situ
hybridization
(FISH), human/hamster radiation hybrid (RH) panels (Walter et al., 1994;
Nature Genetics
7:22; Research Genetics, Huntsville Al), human-rodent somatic cell hybrid
panels such as is
available from the Coriell Institute (Camden, New Jersey), and genomic viewers
utilizing
BLAST homologies to sequenced and mapped genoinic clones (NCBI, Bethesda,
Maryland).
[0474] 158P3D2 maps to chromosome 8, using 158P3D2 sequence and the NCBI BLAST
tool located on the World Wide Web at:
(ncbi.nlm.nih.gov/genome/seq/page.cgi?F=HsBIast.html&&ORG=Hs).
135
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Example 4
Exbression Analysis of 158P3D2 in Normal Tissues and Patient Specimens
[0475] Expression analysis by RT-PCR demonstrated that 158P3D2 is strongly
expressed in
multiple cancer patient specimens, but unrestricted normal tissues (Figure
14). First strand
cDNA was prepared from a panel of 13 normal tissues (brain, heart, kidney,
liver, lung, spleen,
skeletal muscle, testis, pancreas, colon, stomach) and pools of 4-7 patients
from the following
cancer indications: bladder, kidney, colon, lung, pancreas, stomach, ovary,
breast, multiple
cancer metastasis, cervix, lyinphoma as well as from a pool of patient-derived
xenografts
(prostate cancer, bladder cancer and kidney cancer). Normalization was
performed by PCR
using primers to actin and GAPDH. Semi-quantitative PCR, using primers to
158P3D2, was
performed at 26 and 30 cycles of amplification. Samples were run on an agarose
gel, and PCR
products were quantitated using the Alphalmager software. Results show strong
expression of
158P3D2 in cancers of the bladder, kidney, colon, lung, pancreas, stomach,
ovary, breast,
cervix, and lymphoma. Strong expression was also observed in the cancer
metastasis pool. Low
expression was detected in all normal tissues tested except in nonnal stomach.
[0476] Expression of 158P3D2 in bladder cancer patient specimens and human
normal
tissues is shown in Figure 15. First strand cDNA was prepared from normal
bladder, bladder
cancer cell lines (UM-UC-3, TCCSUP, J82) and a panel of bladder cancer patient
specimens.
Normalization was performed by PCR using primers to actin and GAPDH.
Expression level
was recorded as no expression (no signal detected), low (signal detected at
30x), medium (signal
detected at 26x), high (strong signal at 26x). Results show expression of
158P3D2 in the
majority of bladder cancer patient specimens tested. Very low expression was
detected in normal
tissues, but no expression was seen in the cell lines tested.
[0477] Northern blot analysis of 158P3D2 in bladder specimens is shown in
Figure 16.
RNA was extracted from normal bladder, bladder cancer cell lines (UM-UC-3,
J82, SCaBER),
bladder cancer patient tuinors (T) and their normal adjacent tissues (NAT).
Northern blot with
g of total RNA were probed with the 158P3D2 sequence. Size standards in
kilobases are on
the side. Results show strong expression of 158P3D2 in tumor tissues, but not
in normal, nor
NAT tissues.
[0478] Figure 17 shows158P3D2 expression in lung cancer patient specimens.
First strand
cDNA was prepared from normal lung, cancer cell line A427 and a panel of lung
cancer patient
specimens. Normalization was performed by PCR using primers to actin and
GAPDH. Semi-
quantitative PCR, using primers to 158P3D2, was performed at 26 and 30 cycles
of
136
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
amplification. Expression level was recorded as no expression (no signal
detected), low (signal
detected at 30x), medium (signal detected at 26x), high (strong signal at
26x). 158P3D2 is
expressed at varying levels in 35/39 (90%) of lung cancer specimens, but not
in all 3 normal
lung tissues tested.
[0479] Northern blot analysis of 158P3D2 expression in lung cancer patient
specimens is
shown in Figure 18. RNA was extracted from normal lung, A427 lung cancer cell
line, and a
panel of lung cancer patient specimens. Northern blot with 10 g of total RNA
were probed
with the 158P3D2 sequence. Size standards in kilobases are on the side.
Results show strong
expression of 158P3D2 in tumor specimens but not in normal tissues.
[0480] Figure 19 shows 158P3D2 expression in cancer metastasis patient
specimens. First
strand cDNA was prepared from normal colon, kidney, liver, lung, pancreas,
stomach and from
a panel of cancer metastasis patient specimens. Normalization was performed by
PCR using
primers to actin and GAPDH. Semi-quantitative PCR, using primers to 158P3D2,
was
performed at 26 and 30 cycles of amplification. Expression level was recorded
as no expression
(no signal detected), low (signal detected at 30x), medium (signal detected at
26x), high (strong
signal at 26x). Results show expression of 158P3D2 in the majority of patient
cancer metastasis
specimens tested but not in normal tissues.
[0481] Figure 20 shows 158P3D2 expression in cervical cancer patient
specimens. First
strand cDNA was prepared from normal cervix, cervical cancer cell line HeLa,
and a panel of
cervical cancer patient specimens. Norinalization was performed by PCR using
primers to actin
and GAPDH. Expression level was recorded as no expression (no signal
detected), low (signal
detected at 30x), medium (signal detected at 26x), high (strong signal at
26x). Results show
expression of 158P3D2 in all 14 cervical cancer patient specimens tested. No
expression was
detected in normal cervix or in the cell line tested.
[0482] Northern blot analysis of 158P3D2 expression in cervical cancer patient
specimens is
shown in Figure 21. RNA was extracted from normal cervix, cervical cancer cell
line HeLa, and
a panel of cervical cancer patient specimens. Northern blot with 10 g of
total RNA were
probed with the 158P3D2 sequence. Size standards in kilobases are on the side.
Results show
strong expression of 158P3D2 in tumor tissues, but not in norinal cervix nor
in the cell line.
[0483] Figure 22 shows 158P3D2 expression in kidney cancer patient specimens.
First
strand eDNA was prepared from normal kidney, kidney cancer cell lines (769-P,
A-498, CAKI-
1), and a panel of kidney cancer patient specimens. Normalization was
performed by PCR using
primers to actin and GAPDH. Semi-quantitative PCR, using primers to 158P3D2,
was
137
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
performed at 26 and 30 cycles of amplification. Expression level was recorded
as no expression
(no signal detected), low (signal detected at 30x), medium (signal detected at
26x), high (strong
signal at 26x). 158P3D2 is expressed at varying levels in the majority of
kidney cancer patient
specimens, but not in a113 normal kidney tissues tested. Low expression was
detected in 2 of 3
cell lines tested.
[0484] Figure 23 shows 158P3D2 expression in kidney cancer patient specimens
by northern
blotting. RNA was extracted from normal kidney and a panel of kidney cancer
patient
specimens. Northern blot with 10 g of total RNA were probed with the 158P3D2
sequence.
Size standards in kilobases are on the side. Results show strong expression of
158P3D2 in
tumor specimens but not in the normal tissue.
[0485] Figure 24 shows 158P3D2 expression in stomach cancer patient specimens.
First
strand cDNA was prepared from normal stomach, and a panel of stomach cancer
patient
specimens. Norinalization was performed by PCR using primers to actin and
GAPDH. Semi-
quantitative PCR, using priiners to 158P3D2, was performed at 26 and 30 cycles
of
amplification. Expression level was recorded as no expression (no signal
detected), low (signal
detected at 30x), medium (signal detected at 26x), high (strong signal at
26x). 158P3D2 is
expressed at varying levels in the majority of stomach cancer patient
specimens. Weak
expression was detected in the 2 normal stomach, and only in 1 of the 2 NAT
tissues tested.
[0486] Figure 25 shows 158P3D2 expression in stomach cancer patient specimens
by
northern blotting. RNA was extracted from normal stoinach and a panel of
stomach cancer
patient specimens. Northern blot with 10 g of total RNA were probed with the
158P3D2
sequence. Size standards in kilobases are on the side. Results show strong
expression of
158P3D2 in tumor specimens but not in the norinal tissue.
[0487] Figure 26 shows 158P3D2 expression in colon cancer patient speciinens.
First strand
cDNA was prepared from normal colon, colon cancer cell lines (LoVo, CaCO-2, SK
CO 1, Colo
205, T284), and a panel of colon cancer patient specimens. Normalization was
performed by
PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to
158P3D2,
was performed at 26 and 30 cycles of amplification. Expression level was
recorded as no
expression (no signal detected), low (signal detected at 30 xs), medium
(signal detected at 26x),
high (strong signal at 26x). 158P3D2 is expressed at varying levels in the
majority of colon
cancer patient specimens. But it was weakly expressed in just 2 of 3 normal
tissues, and 3 of 5
cell lines tested.
138
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0488] Figure 27 shows 158P3D2 expression in uterus cancer patient specimens.
First
strand cDNA was prepared from normal uterus and a panel of uterus cancer
patient specimens.
Normalization was perfonned by PCR using primers to actin and GAPDH. Semi-
quantitative
PCR, using primers to 158P3D2, was performed at 26 and 30 cycles of
amplification.
Expression level was recorded as no expression (no signal detected), low
(signal detected at
30x), medium (signal detected at 26x), high (strong signal at 26x). Results
show 158P3D2 is
expressed at varying levels in the majority of uterus cancer patient
specimens, but not in normal
uterus.
[0489] Figure 28 shows 158P3D2 expression in breast cancer patient specimens.
First
strand cDNA was prepared from normal breast, breast cancer cell lines (MD-MBA-
435S,
DU4475, MCF-7, CAMA-l, MCFlOA), and a panel of breast cancer patient
specimens.
Normalization was performed by PCR using primers to actin and GAPDH. Semi-
quantitative
PCR, using primers to 158P3D2, was performed at 26 and 30 cycles of
ainplification.
Expression level was recorded as no expression (no signal detected), low
(signal detected at
30x), medium (signal detected at 26x), high (strong signal at 26x). Results
show 158P3D2 is
expressed at varying levels in the majority of breast cancer patient
specimens. But it was
weakly expressed in just 2 of 3 normal tissues, and 2 of 5 cell lines tested.
[0490] The restricted expression of 158P3D2 in normal tissues and the
expression detected
in bladder cancer, kidney cancer, colon cancer, lung cancer, pancreas cancer,
stomach cancer,
ovary cancer, breast cancer, uterus cancer, cervical cancer and lymphoma
suggest that 158P3D2
is a potential therapeutic target and a diagnostic marker for the treatment of
human cancers.
Example 5
Transcript Variants of 158P3D2
[0491] Transcript variants are variants of mature inRNA from the same gene
which arise by
alternative transcription or alternative splicing. Alternative transcripts are
transcripts from the
same gene but start transcription at different points. Splice variants are
mRNA variants spliced
differently from the same transcript. In eukaryotes, when a multi-exon gene is
transcribed from
genomic DNA, the initial RNA is spliced to produce functional mRNA, which has
only exons
and is used for translation into an amino acid sequence. Accordingly, a given
gene can have
zero to many alternative transcripts and each transcript can have zero to many
splice variants.
Each transcript variant has a unique exon makeup, and can have different
coding and/or non-
coding (5' or 3' end) portions, from the original transcript. Transcript
variants can code for
139
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
similar or different proteins with the same or a similar function or can
encode proteins with
different functions, and can be expressed in the same tissue at the same time,
or in different
tissues at the same time, or in the same tissue at different times, or in
different tissues at
different times. Proteins encoded by transcript variants can have similar or
different cellular or
extracellular localizations, e.g., secreted versus intracellular.
[0492] Transcript variants are identified by a variety of art-accepted
methods. For example,
alternative transcripts and splice variants are identified by full-length
cloning experiment, or by
use of full-length transcript and EST sequences. First, all human ESTs were
grouped into
clusters which show direct or indirect identity with each other. Second, ESTs
in the same
cluster were further grouped into sub-clusters and assembled into a consensus
sequence. The
original gene sequence is compared to the consensus sequence(s) or other full-
length sequences.
Each consensus sequence is a potential splice variant for that gene. Even when
a variant is
identified that is not a full-length clone, that portion of the variant is
very useful for antigen
generation and for further cloning of the full-length splice variant, using
techniques known in
the art.
[0493] Moreover, computer programs are available in the art that identify
transcript variants
based on genomic sequences. Genomic-based transcript variant identification
programs include
FgenesH (A. Salamov and V. Solovyev, "Ab initio gene finding in Drosophila
genomic DNA,"
Genome Research. 2000 April;10(4):516-22); Grail (URL compbio.ornl.gov/Grail-
bin/EmptyGrailForm) and GenScan (URL genes.mit.edu/GENSCAN.html). For a
general
discussion of splice variant identification protocols see., e.g., Southan, C.,
A genomic
perspective on human proteases, FEBS Lett. 2001 Jun 8; 498(2-3):214-8; de
Souza, S.J., et al.,
Identification of human chromosome 22 transcribed sequences with ORF expressed
sequence
tags, Proc. Natl Acad Sci U S A. 2000 Nov 7; 97(23):12690-3.
[0494] To further confirm the parameters of a transcript variant, a variety of
techniques are
available in the art, such as full-length cloning, proteomic validation, PCR-
based validation, and
5' RACE validation, etc. (see e.g., Proteomic Validation: Brennan, S.O., et
al., Albumin banks
peninsula: a new termination variant characterized by electrospray mass
spectrometry, Biochem
Biophys Acta. 1999 Aug 17;1433(1-2):321-6; Ferranti P, et al., Differential
splicing of pre-
messenger RNA produces multiple forms of mature caprine alpha(sl)-casein, Eur
J Biochem.
1997 Oct 1;249(1):1-7. For PCR-based Validation: Wellmann S, et al., Specific
reverse
transcription-PCR quantification of vascular endothelial growth factor (VEGF)
splice variants
by LightCycler technology, Clin Chem. 2001 Apr;47(4):654-60; Jia, H.P., et
al., Discovery of
140
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
new human beta-defensins using a genomics-based approach, Gene. 2001 Jan 24;
263(1-2):211-
8. For PCR-based and 5' RACE Validation: Brigle, K.E., et al., Organization of
the murine
reduced folate carrier gene and identification of variant splice forms,
Biochem Biophys Acta.
1997 Aug 7; 1353(2): 191-8).
[0495] It is known in the art that genomic regions are modulated in cancers.
When the
genomic region to which a gene maps is modulated in a particular cancer, the
alternative
transcripts or splice variants of the gene are modulated as well. Disclosed
herein is that
158P3D2 has a particular expression profile related to cancer. Alternative
transcripts and splice
variants of 158P3D2 may also be involved in cancers in the same or different
tissues, thus
serving as tumor-associated markers/antigens.
[0496] Using the full-length gene and EST sequences, six transcript variants
were identified,
designated as 158P3D2 v.2, v.14 through v.18. The boundaries of the exon in
the original
transcr ipt, 158P3D2 v.l were shown in Table LI. Exon compositions of the
variants are shown
in Figure 10. Each different combination of exons in spatial order, e.g., exon
1 of v.2 and exons
3, 4, 5 and 6 of v.1, is a potential splice variant.
[0497] Tables LII(a)-(f) through LV(a)-(f) are set forth on a variant-by-
variant bases. Tables
LII(a)-(f) show nucleotide sequence of the transcript variants. Tables LIII(a)-
(f) show the
alignment of the respective transcript variant with nucleic acid sequence of
158P3D2 v.l.
Tables LIV(a)-(f) lay out amino acid translation of the transcript variants
for the identified
reading frame orientation. Tables LV(a)-(f) displays alignments of the amino
acid sequence
encoded by the splice variant with that of 158P3D2 v.1.
Example 6
Sing-le Nucleotide Pol nrphisms of 158P3D2
[0498] A Single Nucleotide Polymorphism (SNP) is a single base pair variation
in a
nucleotide sequence at a specific location. At any given point of the genome,
there are four
possible nucleotide base pairs: A/T, C/G, G/C and T/A. Genotype refers to the
specific base pair
sequence of one or more locations in the genome of an individual. Haplotype
refers to the base
pair sequence of more than one location on the same DNA molecule (or the same
chromosome
in higher organisms), often in the context of one gene or in the context of
several tightly linked
genes. SNP that occurs on a cDNA is called cSNP. This cSNP may change amino
acids of the
protein encoded by the gene and thus change the functions of the protein. Some
SNP cause
inherited diseases; others contribute to quantitative variations in phenotype
and reactions to
141
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
environmental factors including diet and drugs among individuals. Therefore,
SNP and/or
combinations of alleles (called haplotypes) have many applications, including
diagnosis of
inherited diseases, determination of drug reactions and dosage, identification
of genes
responsible for diseases, and analysis of the genetic relationship between
individuals (P.
Nowotny, J. M. Kwon and A. M. Goate, " SNP analysis to dissect human traits,"
Curr. Opin.
Neurobiol. 2001 Oct; 11(5):637-641; M. Pirmohamed and B. K. Park, "Genetic
susceptibility to
adverse drug reactions," Trends Pharmacol. Sci. 2001 Jun; 22(6):298-305; J. H.
Riley, C. J.
Allan, E. Lai and A. Roses, " The use of single nucleotide polymorphisms in
the isolation of
common disease genes," Pharmacogenomics. 2000 Feb; l(l):39-47; R. Judson, J.
C. Stephens
and A. Windemuth, "The predictive power of haplotypes in clinical response,"
Plaarrnacogenomics (2000) 1(1):15-26).
[0499] SNP are identified by a variety of art-accepted methods (P. Bean, "The
promising
voyage of SNP target discovery," Am. Clin. Lab. 2001 Oct-Nov; 20(9):18-20; K.
M. Weiss, "In
search of human variation," Genome Res. 1998 Jul; 8(7):691-697; M. M. She,
"Enabling large-
scale pharmacogenetic studies by high-throughput mutation detection and
genotyping
technologies," Clin. Chem. 2001 Feb; 47(2):164-172). For example, SNP can be
identified by
sequencing DNA fragments that show polymorphism by gel-based methods such as
restriction
fraginent length polymorphism (RFLP) and denaturing gradient gel
electrophoresis (DGGE).
They can also be discovered by direct sequencing of DNA samples pooled from
different
individuals or by comparing sequences from different DNA samples. With the
rapid
accumulation of sequence data in public and private databases, one can
discover SNP by
comparing sequences using computer programs (Z. Gu, L. Hillier and P. Y. Kwok,
"Single
nucleotide polymorphism hunting in cyberspace," Hum. Mutat. 1998; 12(4):221-
225). SNP can
be verified and genotype or haplotype of an individual can be determined by a
variety of
methods including direct sequencing and high throughput microarrays (P. Y.
Kwok, "Methods
for genotyping single nucleotide polymorphisms," Annu. Rev. Genomics Hum.
Genet. 2001;
2:235-258; M. Kokoris, K. Dix, K. Moynihan, J. Mathis, B. Erwin, P. Grass, B.
Hines and A.
Duesterhoeft, "High-throughput SNP genotyping with the Masscode system," Mol.
Diagn. 2000
Dec; 5(4):329-340).
[0500] Using the methods described above, twelve SNP were identified in the
original
transcript, 158P3D2 v.1, at positions 1155 (T/C), 1152 (G/A), 960 (G/T) and
1236 (G/-), 519
(A/G), 440 (T/A), 971 (T/C), 150 (C/G), 1022 (C/A), 1148 (G/A), 1691 (G/T) and
1692 (A/G).
The transcripts or proteins with alternative allele were designated as variant
158P3D2 v.3
142
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
through v.13, respectively. Figure 12 shows the schematic alignment of the SNP
variants.
Figure 11 shows the schematic alignment of protein variants, corresponding to
nucleotide
variants. Nucleotide variants that code for the same amino acid sequence as
v.1 are not shown in
Figure 11. These alleles of the SNP, though shown separately here, can occur
in different
combinations (haplotypes) and in any one of the transcript variants (such as
158P3D2 v.17) that
contains the site of the SNP.
Example 7
Production of Recombinant 158P3D2 in Proka , otic Systems
[0501] To express recombinant 158P3D2 and 158P3D2 variants in prokaryotic
cells, the full
or partial length 158P3D2 and 158P3D2 variant cDNA sequences are cloned into
any one of a
variety of expression vectors known in the art. One or more of the following
regions of
158P3D2 variants are expressed: the full length sequence presented in Figures
2 and 3, or any 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30 or more
contiguous amino acids from 158P3D2, variants, or analogs thereof.
A. In vitro transcription and translation constructs:
[0502] pCRII: To generate 158P3D2 sense and anti-sense RNA probes for RNA in
situ
investigations, pCRII constructs (Invitrogen, Carlsbad CA) are generated
encoding either all or
fraginents of the 158P3D2 cDNA. The pCRII vector has Sp6 and T7 promoters
flanking the
insert to drive the transcription of 158P3D2 RNA for use as probes in RNA in
situ hybridization
experiments. These probes are used to analyze the cell and tissue expression
of 158P3D2 at the
RNA level. Transcribed 158P3D2 RNA representing the cDNA amino acid coding
region of the
158P3D2 gene is used during in vitro translation systems such as the TnTTM
Coupled
Reticulolysate System (Promega, Corp., Madison, WI) to synthesize 158P3D2
protein.
B. Bacterial Constructs:
[0503] pGEX Constructs: To generate recombinant 158P3D2 proteins in bacteria
that are
fused to the Glutathione S-transferase (GST) protein, all or parts of the
158P3D2 cDNA protein
coding sequence are cloned into the pGEX family of GST-fusion vectors
(Amersham Pharmacia
Biotech, Piscataway, NJ). These constructs allow controlled expression of
recombinant
158P3D2 protein sequences with GST fused at the amino-terminus and a six
histidine epitope
(6X His) at the carboxyl-terminus. The GST and 6X His tags permit purification
of the
recombinant fusion protein from induced bacteria with the appropriate affinity
matrix and allow
recognition of the fusion protein with anti-GST and anti-His antibodies. The
6X His tag is
143
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
generated by adding 6 histidine codons to the cloning primer at the 3' end,
e.g., of the open
reading frame (ORF). A proteolytic cleavage site, such as the PreScissionTM
recognition site in
pGEX-6P-1, may be employed such that it permits cleavage of the GST tag from
158P3D2-
related protein. The ampicillin resistance gene and pBR322 origin permits
selection and
maintenance of the pGEX plasmids in E. coli.
[0504] pMAL Constructs: To generate, in bacteria, recombinant 158P3D2 proteins
that are
fused to maltose-binding protein (MBP), all or parts of the 158P3D2 cDNA
protein coding
sequence are fused to the MBP gene by cloning into the pMAL-c2X and pMAL-p2X
vectors
(New England Biolabs, Beverly, MA). These constructs allow controlled
expression of
recombinant 158P3D2 protein sequences with MBP fused at the amino-terminus and
a 6X His
epitope tag at the carboxyl-terminus. The MBP and 6X His tags perinit
purification of the
recombinant protein from induced bacteria with the appropriate affinity matrix
and allow
recognition of the fusion protein with anti-MBP and anti-His antibodies. The
6X His epitope tag
is generated by adding 6 histidine codons to the 3' cloning primer. A Factor
Xa recognition site
permits cleavage of the pMAL tag from 158P3D2. The pMAL-c2X and pMAL-p2X
vectors are
optimized to express the recoinbinant protein in the cytoplasm or periplasm
respectively.
Periplasm expression enhances folding of proteins with disulfide bonds.
[0505] pET Constructs: To express 158P3D2 in bacterial cells, all or parts of
the 158P3D2
cDNA protein coding sequence are cloned into the pET family of vectors
(Novagen, Madison,
WI). These vectors allow tightly controlled expression of recombinant 158P3D2
protein in
bacteria with and without fusion to proteins that enhance solubility, such as
NusA and
thioredoxin (Trx), and epitope tags, such as 6X His and S-Tag TM that aid
purification and
detection of the recoinbinant protein. For example, constructs are made
utilizing pET NusA
fusion system 43.1 such that regions of the 158P3D2 protein are expressed as
amino-terininal
fusions to NusA. The cDNA encoding amino acids 155-290 and amino acids 260-328
of
158P3D2 each were cloned into the pET-21b vector. The recombinant proteins can
be used to
generate rabbit polyclonal antibodies.
C. Yeast Constructs:
[0506] pESC Constructs: To express 158P3D2 in the yeast species Saccharonayces
cerevisiae for generation of recombinant protein and functional studies, all
or parts of the
158P3D2 cDNA protein coding sequence are cloned into the pESC family of
vectors each of
which contain 1 of 4 selectable markers, HIS3, TRP1, LEU2, and URA3
(Stratagene, La Jolla,
CA). These vectors allow controlled expression from the same plasmid of up to
2 different
144
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
genes or cloned sequences containing either F1agTM or Myc epitope tags in the
same yeast cell.
This system is useful to confirm protein-protein interactions of 158P3D2. In
addition,
expression in yeast yields similar post-translational modifications, such as
glycosylations and
phosphorylations, that are found when expressed in eukaryotic cells.
[0507] pESP Constructs: To express 158P3D2 in the yeast species
Saccharomycespombe,
all or parts of the 158P3D2 cDNA protein coding sequence are cloned into the
pESP family of
vectors. These vectors allow controlled high level of expression of a 158P3D2
protein sequence
that is fused at either the amino terminus or at the carboxyl terminus to GST
which aids
purification of the recombinant protein. A F1agTM epitope tag allows detection
of the
recombinant protein with anti- F1agTM antibody.
Example 8
Production of Recombinant 158P3D2 in Higher Eukaryotic Systems
A. Mammalian Constructs:
[0508] To express recombinant 158P3D2 in eukaryotic cells, the full or partial
length
158P3D2 cDNA sequences, or variants thereof, can be cloned into any one of a
variety of
expression vectors known in the art. One or more of the following regions of
158P3D2 are
expressed in these constructs, amino acids 1 to 328, or any 8, 9, 10, 11, 12,
13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino
acids from 158P3D2
v.1, v.3, v.4, v.10, v.12 and v.13; amino acids 1 to 236, or any 8, 9, 10, 11,
12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous
amino acids from
158P3D2 v.2A; amino acids 1 to 181, or any 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 158P3D2
v.2B or v.5B;
amino acids 1 to 178, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25,
26, 27, 28, 29, 30 or more contiguous amino acids from 158P3D2 v.5A; amino
acids 1 to 2036,
or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30 or
more contiguous amino acids from 158P3D2 v.17; amino acids 1 to 1990, or any
8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or
more contiguous amino
acids from 158P3D2 v.16; amino acids 1 to 1145, or any 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids
from 158P3D2
v.15; amino acids 1 to 1393, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 158P3D2 v.14;
amino acids 1 to
610, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,23, 24,
25, 26, 27, 28, 29, 30
145
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
or more contiguous amino acids from 158P3D2 v.18; or any 8, 9, 10, 11, 12, 13,
14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino
acids from 282P1 G3
variants, or analogs thereof.
[0509] The constructs can be transfected into any one of a wide variety of
mammalian cells
such as 293T cells. Transfected 293T cell lysates can be probed with the anti-
158P3D2
polyclonal serum, described herein.
[0510] pcDNA4/HisMax Constructs: To express 158P3D2 in mammalian cells, a
158P3D2
ORF, or portions thereof, of 158P3D2 are cloned into pcDNA4/HisMax Version A
(Invitrogen,
Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV)
promoter and the
SP 16 translational enhancer. The recombinant protein has XpressTM and six
histidine (6X His)
epitopes fused to the amino-terminus. The pcDNA4/HisMax vector also contains
the bovine
growth hormone (BGH) polyadenylation signal and transcription termination
sequence to
enhance mRNA stability along with the SV40 origin for episomal replication and
simple vector
rescue in cell lines expressing the large T antigen. The Zeocin resistance
gene allows for
selection of mammalian cells expressing the protein and the ampicillin
resistance gene and
ColE1 origin permits selection and maintenance of the plasinid in E. coli.
[0511] pcDNA3.1/MycHis Constructs: To express 158P3D2 in mammalian cells, a
158P3D2 ORF, or portions thereof, of 158P3D2 with a consensus Kozak
translation initiation
site was cloned into pcDNA3.1/MycHis Version A (Invitrogen, Carlsbad, CA).
Protein
expression is driven from the cytomegalovirus (CMV) promoter. The recombinant
proteins
have the myc epitope and 6X His epitope fused to the carboxyl-terminus. The
pcDNA3.1/MycHis vector also contains the bovine growth hormone (BGH)
polyadenylation
signal and transcription termination sequence to enhance mRNA stability, along
with the SV40
origin for episomal replication and simple vector rescue in cell lines
expressing the large T
antigen. The Neomycin resistance gene can be used, as it allows for selection
of inammalian
cells expressing the protein and the ampicillin resistance gene and ColEl
origin permits
selection and maintenance of the plasmid in E. coli. Figure 19 shows
expression of
15 8P3D2.pcDNA3. 1/mychis in transiently transfected 293T cells.
[0512] pcDNA3.1/CT-GFP-TOPO Construct: To express 158P3D2 in mammalian cells
and
to allow detection of the recombinant proteins using fluorescence, a 158P3D2
ORF, or portions
thereof, with a consensus Kozak translation initiation site are cloned into
pcDNA3.1/CT-GFP-
TOPO (Invitrogen, CA). Protein expression is driven from the cytomegalovirus
(CMV)
promoter. The recombinant proteins have the Green Fluorescent Protein (GFP)
fused to the
146
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
carboxyl-terminus facilitating non-invasive, in vivo detection and cell
biology studies. The
pcDNA3.1 CT-GFP-TOPO vector also contains the bovine growth hormone (BGH)
polyadenylation signal and transcription termination sequence to enhance mRNA
stability along
with the SV40 origin for episomal replication and simple vector rescue in cell
lines expressing
the large T antigen. The Neoinycin resistance gene allows for selection of
mammalian cells that
express the protein, and the ampicillin resistance gene and ColEl origin
permits selection and
maintenance of the plasmid in E. coli. Additional constructs with an ainino-
terminal GFP fusion
are made in pcDNA3.1/NT-GFP-TOPO spanning the entire length of a 158P3D2
protein.
[0513] PAPtag: A 158P3D2 ORF, or portions thereof, is cloned into pAPtag-5
(GenHunter
Corp. Nashville, TN). This construct generates an alkaline phosphatase fusion
at the carboxyl-
terminus of a 158P3D2 protein while fusing the IgGx signal sequence to the
amino-terminus.
Constructs are also generated in which alkaline phosphatase with an amino-
terminal IgGK signal
sequence is fused to the amino-terminus of a 158P3D2 protein. The resulting
recombinant
158P3D2 proteins are optimized for secretion into the media of transfected
mammalian cells and
can be used to identify proteins such as ligands or receptors that interact
with 158P3D2 proteins.
Protein expression is driven from the CMV promoter and the recombinant
proteins also contain
myc and 6X His epitopes fused at the carboxyl-terminus that facilitates
detection and
purification. The Zeocin resistance gene present in the vector allows for
selection of
mainmalian cells expressing the recombinant protein and the ampicillin
resistance gene permits
selection of the plasmid in E. coli.
[0514] t~~ ag5: A 158P3D2 ORF, or portions thereof, is cloned into pTag-5.
This vector is
similar to pAPtag but without the alkaline phosphatase fusion. This construct
generates
158P3D2 protein with an amino-terminal IgGK signal sequence and myc and 6X His
epitope
tags at the carboxyl-terminus that facilitate detection and affinity
purification. The resulting
recombinant 158P3D2 protein is optimized for secretion into the media of
transfected
mammalian cells, and is used as immunogen or ligand to identify proteins such
as ligands or
receptors that interact with the 158P3D2 proteins. Protein expression is
driven from the CMV
promoter. The Zeocin resistance gene present in the vector allows for
selection of mammalian
cells expressing the protein, and the ampicillin resistance gene permits
selection of the plasmid
in E. coli.
[0515] PsecFc: A 158P3D2 ORF, or portions thereof, is also cloned into psecFc.
The
psecFc vector was assembled by cloning the human iminunoglobulin Gl (IgG) Fc
(hinge, CH2,
CH3 regions) into pSecTag2 (Invitrogen, California). This construct generates
an IgGl Fc
147
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
fusion at the carboxyl-terminus of the 158P3D2 proteins, while fusing the IgGK
signal sequence
to N-terminus. 158P3D2 fusions utilizing the murine IgGl Fc region are also
used. The
resulting recombinant 158P3D2 proteins are optimized for secretion into the
media of
tra.nsfected inammalian cells, and can be used as immunogens or to identify
proteins such as
ligands or receptors that interact with 158P3D2 protein. Protein expression is
driven from the
CMV promoter. The hygromycin resistance gene present in the vector allows for
selection of
mainmalian cells that express the recombinant protein, and the ampicillin
resistance gene
permits selection of the plasmid in E. coli.
[0516] bSRa Constructs: To generate mammalian cell lines that express 158P3D2
constitutively, 158P3D2 ORF, or portions thereof, of 158P3D2 were cloned into
pSRa
constructs. Amphotropic and ecotropic retroviruses were generated by
transfection of pSRa
constructs into the 293T-10A1 packaging line or co-transfection of pSRa and a
helper plasmid
(containing deleted packaging sequences) into the 293 cells, respectively. The
retrovirus is used
to infect a variety of mammalian cell lines, resulting in the integration of
the cloned gene,
158P3D2, into the host cell-lines. Protein expression is driven from a long
terminal repeat
(LTR). The Neomycin resistance gene present in the vector allows for selection
of maminalian
cells that express the protein, and the ampicillin resistance gene and ColEl
origin permit
selection and maintenance of the plasmid in E. coli. The retroviral vectors
can thereafter be used
for infection and generation of various cell lines using, for example, PC3,
NIH 3T3, TsuPrl, 293
or rat-1 cells.
[0517] Additional pSRa constructs are made that fuse an epitope tag such as
the FLAGTM
tag to the carboxyl-terminus of 158P3D2 sequences to allow detection using
anti-Flag
antibodies. For example, the FLAGTM sequence 5' gat tac aag gat gac gac gat
aag 3' (SEQ ID
NO: 103) is added to cloning primer at the 3' end of the ORF. Additional pSRa
constructs are
made to produce both amino-terminal and carboxyl-tenninal GFP and myc/6X His
fusion
proteins of the full-length 158P3D2 proteins.
[0518] Additional Viral Vectors: Additional constructs are made for viral-
mediated delivery
and expression of 158P3D2. High virus titer leading to high level expression
of 158P3D2 is
achieved in viral delivery systems such as adenoviral vectors and herpes
amplicon vectors. A
158P3D2 coding sequences or fragments thereof are amplified by PCR and
subcloned into the
AdEasy shuttle vector (Stratagene). Recombination and virus packaging are
performed
according to the manufacturer's instructions to generate adenoviral vectors.
Alternatively,
148
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
158P3D2 coding sequences or fragments thereof are cloned into the HSV-1 vector
(Imgenex) to
generate herpes viral vectors. The viral vectors are thereafter used for
infection of various cell
lines such as PC3, NIH 3T3, 293 or rat-1 cells.
[0519] Regulated Expression Systems: To control expression of 158P3D2 in
maminalian
cells, coding sequences of 158P3D2, or portions thereof, are cloned into
regulated mammalian
expression systems such as the T-Rex Systein (Invitrogen), the GeneSwitch
System (Invitrogen)
and the tightly-regulated Ecdysone System (Sratagene). These systems allow the
study of the
temporal and concentration dependent effects of recombinant 158P3D2. These
vectors are
thereafter used to control expression of 158P3D2 in various cell lines such as
PC3, NIH 3T3,
293 or rat-1 cells.
B. Baculovirus Expression Systems
[0520] To generate recombinant 158P3D2 proteins in a baculovirus expression
system,
158P3D2 ORF, or portions thereof, are cloned into the baculovirus transfer
vector pBlueBac 4.5
(Invitrogen), which provides a His-tag at the N-terminus. Specifically,
pBlueBac-158P3D2 is
co-transfected with helper plasmid pBac-N-Blue (Invitrogen) into SF9
(Spodoptera f ugiperda)
insect cells to generate recombinant baculovirus (see Invitrogen instruction
manual for details).
Baculovirus is then collected from cell supernatant and purified by plaque
assay.
[0521] Recombinant 158P3D2 protein is then generated by infection of HighFive
insect cells
(Invitrogen) with purified baculovirus. Recombinant 158P3D2 protein can be
detected using
anti-158P3D2 or anti-His-tag antibody. 158P3D2 protein can be purified and
used in various
cell-based assays or as iminunogen to generate polyclonal and monoclonal
antibodies specific
for 158P3D2 which are used for diagnostic and therapeutic purposes.
Exainple 9
Antigenicity Profiles and Secondary Structure
[0522] Figure 5A-I, Figure 6A-I, Figure 7A-I, Figure 8A-I, and Figure 9A-I
depict
graphically five amino acid profiles of 158P3D2 variants 1, 2a, 2b, 5a, 14,
15, 16, 17, 18 ,(A)
through (I) respectively, each assessment available by accessing the ProtScale
website on the
ExPasy molecular biology server.
[0523] These profiles: Figure 5, Hydrophilicity, (Hopp T.P., Woods K.R., 1981.
Proc. Natl.
Acad. Sci. U.S.A. 78:3824-3828); Figure 6, Hydropathicity, (Kyte J., Doolittle
R.F., 1982. J.
Mol. Biol. 157:105-132); Figure 7, Percentage Accessible Residues (Janin J.,
1979 Nature
277:491-492); Figure 8, Average Flexibility, (Bhaskaran R., and Ponnuswamy
P.K., 1988. Int. J.
149
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Pept. Protein Res. 32:242-255); Figure 9, Beta-turn (Deleage, G., Roux B. 1987
Protein
Engineering 1:289-294); and optionally others available in the art, such as on
the ProtScale
website, were used to identify antigenic regions of each of the 158P3D2
variant proteins. Each
of the above amino acid profiles of 158P3D2 variants were generated using the
following
ProtScale parameters for analysis: 1) A window size of 9; 2) 100% weight of
the window edges
compared to the window center; and, 3) ainino acid profile values normalized
to lie between 0
and 1.
[0524] Hydrophilicity (Figure 5), Hydropathicity (Figure 6) and Percentage
Accessible
Residues (Figure 7) profiles were used to detennine stretches of hydrophilic
amino acids (i.e.,
values greater than 0.5 on the Hydrophilicity and Percentage Accessible
Residues profile, and
values less than 0.5 on the Hydropathicity profile). Such regions are likely
to be exposed to the
aqueous environment, be present on the surface of the protein, and thus
available for immune
recognition, such as by antibodies.
[0525] Average Flexibility (Figure 8) and Beta-turn (Figure 9) profiles
determine stretches
of amino acids (i.e., values greater than 0.5 on the Beta-turn profile and the
Average Flexibility
profile) that are not constrained in secondary structures such as beta sheets
and alpha helices.
Such regions are also more likely to be exposed on the protein and thus
accessible to imrnune
recognition, sucll as by antibodies.
[0526] Antigenic sequences of the 158P3D2 variant proteins indicated, e.g., by
the profiles
set forth in Figure 5, Figure 6, Figure 7, Figure 8, and/or Figure 9 are used
to prepare
immunogens, either peptides or nucleic acids that encode them, to generate
therapeutic and
diagnostic anti=158P3D2 antibodies. The immunogen can be any 5, 6, 7, 8, 9,
10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more than 50
contiguous amino
acids, or the corresponding nucleic acids that encode tliem, from the 158P3D2
protein variants
listed in Figures 2 and 3. In particular, peptide immunogens of the invention
can comprise, a
peptide region of at least 5 amino acids of Figures 2 and 3 in any whole
number increment that
includes an amino acid position having a value greater than 0.5 in the
Hydrophilicity profiles of
Figure 5; a peptide region of at least 5 ainino acids of Figures 2 and 3 in
any whole number
increment that includes an amino acid position having a value less than 0.5 in
the Hydropathicity
profile of Figures 6 ; a peptide region of at least 5 amino acids of Figures 2
and 3 in any whole
number increment that includes an amino acid position having a value greater
than 0.5 in the
Percent Accessible Residues profiles of Figure 7; a peptide region of at least
5 amino acids of
Figures 2 and 3 in any whole number increment that includes an amino acid
position having a
150
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
value greater than 0.5 in the Average Flexibility profiles on Figure 8 ; and,
a peptide region of at
least 5 amino acids of Figures 2 and 3 in any whole number increment that
includes an amino
acid position having a value greater than 0.5 in the Beta-turn profile of
Figures 9. Peptide
immunogens of the invention can also comprise nucleic acids that encode any of
the forgoing.
[0527] All immunogens of the invention, peptide or nucleic acid, can be
embodied in human
unit dose form, or coinprised by a composition that includes a pharmaceutical
excipient
compatible with human physiology.
[0528] The secondary structures of 158P3D2 protein variants 1, 2a, 2b, 5a, 14,
15, 16, 17,
and 18, namely the predicted presence and location of alpha helices, extended
strands, and
random coils, are predicted from their primary amino acid sequences using the
HNN -
Hierarchical Neural Network method (NPS@: Network Protein Sequence Analysis
TIBS 2000
March Vol. 25, No 3 [291]:147-150 Combet C., Blanchet C., Geourjon C. and
Deleage G.,
accessed from the ExPasy molecular biology server. The analysis indicates that
158P3D2
variant 1 is composed of 32.93% alpha helix, 18.29% extended strand, and
48.78% random coil
(Figure 13A). 158P3D2 variant 2a is composed of 25.58% alpha helix, 18.22%
extended strand,
and 55.93% random coil (Figure 13B). 158P3D2 variant 2b is composed of 44.75%
alpha helix,
11.60% extended strand, and 43.65% random coil (Figure 13C). 158P3D2 variant
5a is
composed of 9.55% alpha helix, 26.40% extended strand, and 64.04% random coil
(Figure
13D). 158P3D2 variant 14 is composed of 33.88% alpha helix, 13.42% extended
strand, and
52.69% random coil (Figure 13E). 158P3D2 variant 15 is composed of 33.28%
alpha helix,
15.11% extended strand, and 51.62% random coil (Figure 13F). 158P3D2 variant
16 is
composed of 32.76% alpha helix, 14.47% extended strand, and 52.76% random coil
(Figure
13G). 158P3D2 variant 17 is composed of 32.86% alpha helix, 14.69% extended
strand, and
52.46% random coil (Figure 13H). 158P3D2 variant 18 is composed of 27.21%
alpha helix,
14.75% extended strand, and 58.03% random coil (Figure 131).
[0529] Analysis for the potential presence of transmeinbrane domains in the
158P3D2
variant proteins 1, 2a, 2b, 5a, 14, 15, 16, 17, and 18, was carried out using
a variety of
transmembrane prediction algorithms accessed from the ExPasy molecular biology
server.
Shown graphically in figures 13L, 13N, 13P, 13R, 13T, 13V, 13X, 13Z are the
results of
analysis of variants 1, 2a, 2b, 5a, 14, 15, 16, 17, and 18, respectively,
using the TMpred
program. Shown graphically in figures 13K, 13M, 130, 13Q, 13S, 13U, 13W, 13Y,
13AA are
the results of analysis of variants 1, 2a, 2b, 5a, 14, 15, 16, 17, and 18,
respectively using the
TMHMM program. Both programs predict the presence of 1 transmembrane domain in
variant
151
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
1, Both programs predict that variants 2a, 2b, 5a, and 18 lack transmembrane
domains and are
soluble proteins. The TMpred program predicts that variants 14, 15, 16, and 17
have 2
transmembrane domains of which the more carboxy-terminal transmembrane has a
higher
probability of existence. The TMHMM program predicts that variants 14 and 15
do not encode
transmembrane domains and variants 16 and 17 contain 1 transmembrane domain.
Analyses of
the variants using other structural prediction programs are summarized in
Table VI and Table L.
Exainple 10
Generation of 158P3D2 Polyclonal Antibodies
[0530] Polyclonal antibodies can be raised in a mammal, for example, by one or
more
injections of an immunizing agent and, if desired, an adjuvant. Typically, the
immunizing agent
and/or adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal
injections. In addition to immunizing with a full length 158P3D2 protein
variant, computer
algorithms are employed in design of immunogens that, based on amino acid
sequence analysis
contain characteristics of being antigenic and available for recognition by
the iinmune system of
the immunized host (see the Example entitled "Antigenicity Profiles and
Secondary Structure").
Such regions would be predicted to be hydrophilic, flexible, in beta-turn
conformations, and be
exposed on the surface of the protein (see, e.g., Figure 5, Figure 6, Figure
7, Figure 8, or Figure
9 for amino acid profiles that indicate such regions of 158P3D2 protein
variant 1 or other protein
variants).
[0531] For example, recombinant bacterial fusion proteins or peptides
containing
hydrophilic, flexible, beta-turn regions of 158P3D2 protein variants are used
as antigens to
generate polyclonal antibodies in New Zealand White rabbits or monoclonal
antibodies as
described in Example 11 ("Generation of Monoclonal Antibodies"). For example,
in 158P3D2
variant 1, such regions include, but are not limited to, amino acids 1-25,
amino acids 37-54,
amino acids 60-73, amino acids 187-225, and amino acids 235-271. An
extracellular epitope
peptide encoding amino acids 315 to 328 is also used to generate antibodies
that bind to the
extracellular region of 158P3D2 protein. It is useful to conjugate the
immunizing agent to a
protein known to be immunogenic in the mainmal being immunized. Exainples of
such
immunogenic proteins include, but are not limited to, keyhole limpet
hemocyanin (KLH), serum
albumin, bovine thyroglobulin, and soybean trypsin inhibitor. In one
embodiment, a peptide
encoding amino acids 315-328 of 158P3D2 variant 1 was conjugated to KLH and
used to
immunize a rabbit. Alternatively the immunizing agent may include all or
portions of the
152
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
158P3D2 variant proteins, analogs or fusion proteins thereof. For example, the
158P3D2 variant
1 amino acid sequence can be fused using recombinant DNA tech.niques to any
one of a variety
of fusion protein partners that are well known in the art, such as glutathione-
S-transferase (GST)
and HIS tagged fusion proteins.
[0532] In one embodiment, amino acids 155-290 of 158P3D2 variant lwere fused
to His
using recombinant techniques and the pET21b expression vector. In another
embodiment,
amino acids 260-328 were cloned into the pET21b expression vector. The
proteins are then
expressed, purified, and used to iminunize rabbits. Such fusion proteins are
purified from
induced bacteria using the appropriate affinity matrix.
[0533] Other recombinant bacterial fusion proteins that may be employed
include maltose
binding protein, LacZ, thioredoxin, NusA, or an immunoglobulin constant region
(see the
section entitled "Production of 158P3D2 in Prokaryotic Systeins" and Current
Protocols In
Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubul et al. eds., 1995;
Linsley, P.S.,
Brady, W., Urnes, M., Grosmaire, L., Damle, N., and Ledbetter, L. (1991)
J.Exp. Med. 174,
561-566).
[0534] In addition to bacterial derived fusion proteins, mainmalian expressed
protein
antigens are also used. These antigens are expressed from mammalian expression
vectors such
as the Tag5 and Fc-fusion vectors (see the section entitled "Production of
Recombinant
158P3D2 in Eukaryotic Systems"), and retain post-translational modifications
such as
glycosylations found in native protein. In one embodiment, ainino acids 1-236
of 158P3D2
variant 2a is cloned into the Tag5 mammalian secretion vector, and expressed
in 293T cells.
The recombinant protein is purified by metal chelate chromatography from
tissue culture
supernatants of 293T cells stably expressing the recoinbinant vector. The
purified Tag5
158P3D2 protein is then used as immunogen.
[0535] During the iinmunization protocol, it is usefal to mix or emulsify the
antigen in
adjuvants that enhance the immune response of the host animal. Examples of
adjuvants include,
but are not limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).
[0536] In a typical protocol, rabbits are initially immunized subcutaneously
with up to 200
g, typically 100-200 g, of fusion protein or peptide conjugated to KLH mixed
in complete
Freund's adjuvant (CFA). Rabbits are then injected subcutaneously every two
weeks with up to
200 g, typically 100-200 g, of the immunogen in incoinplete Freund's
adjuvant (IFA). Test
153
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
bleeds are taken approximately 7-10 days following each immunization and used
to monitor the
titer of the antiserum by ELISA.
[0537] To test reactivity and specificity of iminune serum, such a rabbit
serum derived from
immunization with the His-fusion of 158P3D2 variant 1 protein, the full-length
158P3D2 variant
1 cDNA was cloned into pCDNA 3.1 myc-his expression vector (Invitrogen, see
the Example
entitled "Production of Recombinant 158P3D2 in Eukaryotic Systems"). After
transfection of
the constructs into 293T cells, cell lysates are probed with the anti-158P3D2
serum and with
anti-His antibody (Santa Cruz Biotechnologies, Santa Cruz, CA) to deterinine
specific reactivity
to denatured 158P3D2 protein using the Western blot technique. In addition,
the immune serum
is tested by fluorescence microscopy, flow cytometry and immunoprecipitation
against 293T
and other recombinant 158P3D2-expressing cells to determine specific
recognition of native
protein. Western blot, immunoprecipitation, fluorescent microscopy, and flow
cytometric
techniques using cells that endogenously express 158P3D2 are also carried out
to test reactivity
and specificity.
[0538] Anti-serum from rabbits immunized with 158P3D2 variant fusion proteins,
such as
GST and MBP fusion proteins, are purified by depletion of antibodies reactive
to the fusion
partner sequence by passage over an affinity column containing the fusion
partner either alone or
in the context of an irrelevant fusion protein. For example, antiserum derived
from a GST-
158P3D2 variant 1 fusion protein is first purified by passage over a coluinn
of GST protein
covalently coupled to AffiGel matrix (BioRad, Hercules, Calif.). The antiserum
is then affinity
purified by passage over a column composed of a MBP-158P3D2 fusion protein
covalently
coupled to Affigel matrix. The serum is then fii.rther purified by protein G
affinity
chromatography to isolate the IgG fraction. Sera from other His-tagged
antigens and peptide
immunized rabbits as well as fusion partner depleted sera are affinity
purified by passage over a
column matrix composed of the original protein immunogen or free peptide.
Example 11
Generation of 158P3D2 Monoclonal Antibodies (mAbs)
[0539] In one embodiment, therapeutic mAbs to 158P3D2 variants comprise those
that react
with epitopes specific for each variant protein or specific to sequences in
common between the
variants that would disrupt or modulate the biological function of the 158P3D2
variants, for
example those that would disrupt the interaction with ligands and binding
partners.
Immunogens for generation of such mAbs include those designed to encode or
contain the entire
154
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
158P3D2 protein variant sequence, regions predicted to contain functional
motifs, and regions of
the 158P3D2 protein variants predicted to be antigenic from computer analysis
of the amino acid
sequence (see, e.g., Figure 5, Figure 6, Figure 7, Figure 8, or Figure 9, and
the Example entitled
"Antigenicity Profiles and Secondary Structure"). Immunogens include peptides,
recombinant
bacterial proteins, and mammalian expressed Tag 5 proteins and human and
murine IgG FC
fusion proteins. In addition, cells engineered to express high levels of a
respective 158P3D2
variant, such as Ratl-158P3D2 variant 1 or 300.19-158P3D2 variant lmurine Pre-
B cells, were
used to immunize mice.
[0540] To generate mAbs to a 158P3D2 variant, mice are first immunized
intraperitoneally
(IP) with, typically, 10-50 g of protein immunogen or 107 158P3D2-expressing
cells mixed in
complete Freund's adjuvant. Mice are then subsequently immunized IP every 2-4
weeks with,
typically, 10-50 g of protein immunogen or 107 cells mixed in incomplete
Freund's adjuvant.
Alternatively, MPL-TDM adjuvant is used in immunizations. In addition to the
above protein
and cell-based immunization strategies, a DNA-based iminunization protocol is
employed in
which a mammalian expression vector encoding a 158P3D2 variant sequence is
used to
immunize mice by direct injection of the plasmid DNA. For example, amino acids
1-400 of
158P3D2 of variant 15 is cloned into the Tag5 mammalian secretion vector and
the recoinbinant
vector will then be used as immunogen. In another example the same amino acids
are cloned
into an Fc-fusion secretion vector in which the 158P3D2 variant 15 sequence is
fused at the
amino-terminus to an IgK leader sequence and at the carboxyl-terminus to the
coding sequence
of the human or murine IgG Fc region. This recombinant vector is then used as
iinmunogen.
The plasmid immunization protocols are used in combination with purified
proteins expressed
from the same vector and with cells expressing the respective 158P3D2 variant.
[0541] During the immunization protocol, test bleeds are taken 7-10 days
following an
injection to monitor titer and specificity of the immune response. Once
appropriate reactivity
and specificity is obtained as determined by ELISA, Westenl blotting,
immunoprecipitation,
fluorescence microscopy, and flow cytometric analyses, fusion and hybridoma
generation is then
carried out with established procedures well known in the art (see, e.g.,
Harlow and Lane, 1988).
[0542] In one embodiment for generating 158P3D2 monoclonal antibodies, a
peptide
encoding amino acids 315-328 of 158P3D2 variant 1 was coupled to KLH and use
to iinmunize
mice. Balb C mice were immunized with l0 g of the KLH-peptide mixed in
adjuvant. Mice
were subsequently immunized over several weeks with the KLH-peptide. ELISA
using the
peptide coupled to a different carrier, ovalbumin, determined the titer of
serum from the
155
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
immunized mice (See Figure 29). Reactivity and specificity of the serum to
full length
158P3D2 variant 1 protein was monitored by flow cytometry and Western blotting
using
recombinant 158P3D2 variant 1-expressing cells and cells endogenously
expressing 158P3D2
variant 1 protein. Mice showing the strongest reactivity were rested and given
a final injection
of antigen and sacrificed for fusion. The lymph nodes of the sacrificed mice
were harvested and
fused to SPO/2 myeloma cells using standard procedures (Harlow and Lane,
1988).
Supernatants from HAT selected growth wells were analyzed by flow cytometry to
identify
specific- 1 58P3D2 surface binding MAbs. Supernatants were also screened by
ELISA, Western
blot, immunoprecipitation, and fluorescent microscopy to identify 158P3D2
specific antibody-
producing clones.
[0543] In other embodiments, 158P3D2 variant specific MAbs are generated by
employing
immunogens that encode amino acid sequences unique to each variant or created
by unique
junctions from alternative splicing of exons. For example, a peptide encoding
amino acids
1018-1035 of 158P3D2 variant 15 is coupled to KLH and used to immunize mice.
In another
example, amino acids 1375-1393 of 158P3D2 variant 14 is coupled to KLH and
used to
immunize mice. Hybridomas resulting from fusion of the B-cells from the mice
are screened on
cells expressing the respective 158P3D2 variant protein from which the antigen
was derived
and cross-screened on cells expressing the other variant proteins to identify
variant specific
MAbs and MAbs that may recognize more than 1 variant.
[0544] The binding affinity of 158P3D2 variant specific monoclonal antibodies
was
determined using standard technologies. Affinity measurements quantify the
strength of
antibody to epitope binding and are used to help define which 158P3D2 variant
monoclonal
antibodies preferred for diagnostic or therapeutic use, as appreciated by one
of skill in the art.
The BlAcore system (Uppsala, Sweden) is a preferred method for determining
binding affinity.
The BlAcore system uses surface plasmon resonance (SPR, Welford K. 1991, Opt.
Quant. Elect.
23:1; Morton and Myszka, 1998, Methods in Enzymology 295: 268) to monitor
biomolecular
interactions in real time. BIAcore analysis conveniently generates association
rate constants,
dissociation rate constants, equilibrium dissociation constants, and affinity
constants.
[0545] In addition, equilibrium binding analysis of a dilution series of the
MAb was also
used to determine affinity defined by the dissociation constant (KD). The KD
is determined by
non-linear regression of the equilibrium binding data of the concentration
series. The KD is
defined as the concentration at which half-maximal binding of the MAb to the
antigen is attained
under equilibrium conditions.
156
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Example 12
HLA Class I and Class II Binding Assays
[0546] HLA class I and class II binding assays using purified HLA molecules
are performed
in accordance with disclosed protocols (e.g., PCT publications WO 94/20127 and
WO
94/03205; Sidney et al., Current Protocols in Iinmunology 18.3.1 (1998);
Sidney, et aL, J.
Immunol. 154:247 (1995); Sette, et al., Mol. Immunol. 31:813 (1994)). Briefly,
purified MHC
molecules (5 to 500 nM) are incubated with various unlabeled peptide
inhibitors and 1-10 nM
125I-radiolabeled probe peptides as described. Following incubation, MHC-
peptide complexes
are separated from free peptide by gel filtration and the fraction of peptide
bound is detennined.
Typically, in preliminary experiments, each MHC preparation is titered in the
presence of fixed
amounts of radiolabeled peptides to determine the concentration of HLA
molecules necessary to
bind 10-20% of the total radioactivity. All subsequent inhibition and direct
binding assays are
perfonned using these HLA concentrations.
[0547] Since under these conditions [label]<[HLA] and IC50_[HLA], the measured
IC50
values are reasonable approximations of the true KD values. Peptide inhibitors
are typically
tested at concentrations ranging from 120 g/ml to 1.2 ng/ml, and are tested
in two to four
completely independent experiments. To allow coinparison of the data obtained
in different
experiments, a relative binding figure is calculated for each peptide by
dividing the IC50 of a
positive control for inhibition by the IC50 for each tested peptide (typically
unlabeled versions
of the radiolabeled probe peptide). For database purposes, and inter-
experiment comparisons,
relative binding values are compiled. These values can subsequently be
converted back into
IC50 nM values by dividing the IC50 nM of the positive controls for inhibition
by the relative
binding of the peptide of interest. This method of data compilation is
accurate and consistent for
comparing peptides that have been tested on different days, or with different
lots of purified
MHC.
[0548] Binding assays as outlined above may be used to analyze HLA supermotif
and/or
HLA motif-bearing peptides (see Table IV).
Exainple 13
Identification of HLA Supermotif- and Motif-Bearing CTL Candidate Epitopes
[0549] HLA vaccine compositions of the invention can include multiple
epitopes. The
multiple epitopes can comprise multiple HLA supermotifs or motifs to achieve
broad population
157
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
coverage. This example illustrates the identification and confirmation of
supermotif- and motif-
bearing epitopes for the inclusion in such a vaccine composition. Calculation
of population
coverage is performed using the strategy described below.
[0550] Computer searches and algorithms for identification of supermotif
and/or motif-
bearing epitopes
[0551] The searches performed to identify the motif-bearing peptide sequences
in the
Example entitled "Antigenicity Profiles" and Tables VIII-XXI and XXII-XLIX
employ the
protein sequence data from the gene product of 158P3D2 set forth in Figures 2
and 3, the
specific search peptides used to generate the tables are listed in Table VII.
[0552] Computer searches for epitopes bearing HLA Class I or Class II
supermotifs or
motifs are performed as follows. All translated 158P3D2 protein sequences are
analyzed using a
text string search software program to identify potential peptide sequences
containing
appropriate HLA binding motifs; such prograins are readily produced in
accordance with
information in the art in view of known motif/supermotif disclosures.
Furthermore, such
calculations can be made mentally.
[0553] Identified A2-, A3-, and DR-supermotif sequences are scored using
polynomial
algorithms to predict their capacity to bind to specific HLA-Class I or Class
II molecules. These
polynomial algoritluns account for the impact of different amino acids at
different positions, and
are essentially based on the premise that the overall affinity (or AG) of
peptide-HLA molecule
interactions can be approximated as a linear polynomial function of the type:
"OG"=alixa2ixa3i...... xani
where aji is a coefficient which represents the effect of the presence of a
given amino acid
(j) at a given position (i) along the sequence of a peptide of n amino acids.
The crucial
assumption of this method is that the effects at each position are essentially
independent of each
other (i.e., independent binding of individual side-chains). When residue j
occurs at position i in
the peptide, it is assumed to contribute a constant amount ji to the free
energy of binding of the
peptide irrespective of the sequence of the rest of the peptide.
[0554] The method of derivation of specific algorithm coefficients has been
described in
Gulukota et al., J. Mol. Biol. 267:1258-126, 1997; (see also Sidney et al.,
Human Immunol.
45:79-93, 1996; and Southwood et al., J. Immunol. 160:3363-3373, 1998).
Briefly, for all i
positions, anchor and non-anchor alike, the geometric mean of the average
relative binding
(ARB) of all peptides carrying j is calculated relative to the remainder of
the group, and used as
the estimate of ji. For Class II peptides, if multiple alignments are
possible, only the highest
158
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
scoring alignment is utilized, following an iterative procedure. To calculate
an algorithm score
of a given peptide in a test set, the ARB values corresponding to the sequence
of the peptide are
multiplied. If this product exceeds a chosen threshold, the peptide is
predicted to bind.
Appropriate thresholds are chosen as a function of the degree of stringency of
prediction desired.
Selection of HLA-A2 supertype cross-reactive peptides
[0555] Protein sequences from 158P3D2 are scanned utilizing motif
identification software,
to identify 8-, 9- 10- and 11-mer sequences containing the HLA-A2-supermotif
main anchor
specificity. Typically, these sequences are then scored using the protocol
described above and
the peptides corresponding to the positive-scoring sequences are synthesized
and tested for their
capacity to bind purified HLA-A*0201 molecules in vitro (HLA-A*0201 is
considered a
prototype A2 supertype molecule).
[0556] These peptides are then tested for the capacity to bind to additional
A2-supertype
molecules (A*0202, A*0203, A*0206, and A*6802). Peptides that bind to at least
three of the
five A2-supertype alleles tested are typically deemed A2-supertype cross-
reactive binders.
Preferred peptides bind at an affinity equal to or less than 500 nM to three
or more HLA-A2
supertype molecules.
Selection of HLA-A3 supermotif-bearing epitopes
[0557] The 158P3D2 protein sequence(s) scanned above is also examined for the
presence
of peptides with the HLA-A3-supermotif primary anchors. Peptides corresponding
to the HLA
A3 supermotif-bearing sequences are then synthesized and tested for binding to
HLA-A*0301
and HLA-A*1101 molecules, the molecules encoded by the two most prevalent A3-
supertype
alleles. The peptides that bind at least one of the two alleles with binding
affinities of 5500 nM,
often <_ 200 nM, are then tested for binding cross-reactivity to the other
common A3 -supertype
alleles (e.g., A*3101, A*3301, and A*6801) to identify those that can bind at
least three of the
five HLA-A3-supertype molecules tested.
Selection of HLA-B7 supermotif bearing epitopes
[0558] The 158P3D2 protein(s) scanned above is also analyzed for the presence
of 8-, 9- 10-
, or 11-mer peptides with the HLA-B7-supermotif. Corresponding peptides are
synthesized and
tested for binding to HLA-B*0702, the molecule encoded by the most common B7-
supertype
allele (i.e., the prototype B7 supertype allele). Peptides binding B*0702 with
IC50 of 5500 nM
are identified using standard methods. These peptides are then tested for
binding to other
common B7-supertype molecules (e.g., B*3501, B*5101, B*5301, and B*5401).
Peptides
capable of binding to three or more of the five B7-supertype alleles tested
are thereby identified.
159
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Selection of Al and A24 motif-bearina epitopes
[0559] To further increase population coverage, HLA-Al and -A24 epitopes can
also be
incorporated into vaccine compositions. An analysis of the 158P3D2 protein can
also be
performed to identify HLA-A1- and A24-motif-containing sequences.
[0560] High affinity and/or cross-reactive binding epitopes that bear other
motif and/or
supermotifs are identified using analogous methodology.
Example 14
Confirmation of ImmunogenicitX
[0561] Cross-reactive candidate CTL A2-supermotif-bearing peptides that are
identified as
described herein are selected to confirm in vitro immunogenicity. Confirmation
is performed
using the following methodology:
Target Cell Lines for Cellular Screening:
[0562] The .221A2.1 cell line, produced by transferring the HLA-A2.1 gene into
the HLA-
A, -B, -C null mutant human B-lymphoblastoid cell line 721.221, is used as the
peptide-loaded
target to measure activity of HLA-A2.1-restricted CTL. This cell line is grown
in RPMI-1640
medium supplemented with antibiotics, sodium pyruvate, nonessential ainino
acids and 10%
(v/v) heat inactivated FCS. Cells that express an antigen of interest, or
transfectants comprising
the gene encoding the antigen of interest, can be used as target cells to
confinn the ability of
peptide-specific CTLs to recognize endogenous antigen.
Primary CTL Induction Cultures:
[0563] Generation of Dendritic Cells (DC): PBMCs are thawed in RPMI with 30
g/ml
DNAse, washed twice and resuspended in complete medium (RPMI-1640 plus 5% AB
human
serum, non-essential amino acids, sodium pyruvate, L-glutamine and
penicillin/streptomycin).
The monocytes are purified by plating 10 x 106 PBMC/well in a 6-well plate.
After 2 hours at
37 C, the non-adherent cells are removed by gently shaking the plates and
aspirating the
supernatants. The wells are washed a total of three times with 3 ml RPMI to
remove most of the
non-adherent and loosely adherent cells. Three ml of complete medium
containing 50 nghnl of
GM-CSF and 1,000 U/ml of IL-4 are then added to each well. TNFa, is added to
the DCs on day
6 at 75 ng/ml and the cells are used for CTL induction cultures on day 7.
[0564] Induction of CTL with DC and Peptide: CD8+ T-cells are isolated by
positive
selection with Dynal inununomagnetic beads (Dynabeads M-450) and the detacha-
bead
reagent. Typically about 200-250x106 PBMC are processed to obtain 24x106 CD8+
T-cells
160
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
j
(enough for a 48-well plate culture). Briefly, the PBMCs are thawed in RPMI
with 30gg/ml
DNAse, washed once with PBS containing 1% human AB serum and resuspended in
PBS/1 %
AB serum at a concentration of 20x106cells/ml. The magnetic beads are washed 3
times with
PBS/AB serum, added to the cells (140 1 beads/20x106 cells) and incubated for
1 hour at 4 C
with continuous mixing. The beads and cells are washed 4x with PBS/AB serum to
remove the
nonadherent cells and resuspended at 100x106 cells/ml (based on the original
cell number) in
PBS/AB serum containing 100g1/ml detacha-bead reagent and 30 g/ml DNAse. The
mixture
is incubated for 1 hour at room temperature with continuous mixing. The beads
are washed
again with PBS/AB/DNAse to collect the CD8+ T-cells. The DC are collected and
centrifuged
at 1300 rpm for 5-7 minutes, washed once with PBS with 1% BSA, counted and
pulsed with
40gg/ml of peptide at a cell concentration of 1-2x106/ml in the presence of 3
g/m1132-
microglobulin for 4 hours at 20 C. The DC are then irradiated (4,200 rads),
washed 1 time with
medium and counted again.
[0565] Setting up induction cultures: 0.25 ml cytokine-generated DC (at lx105
cells/ml) are
co-cultured with 0.25m1 of CD8+ T-cells (at 2x106 cell/ml) in each well of a
48-well plate in the
presence of 10 ng/ml of IL-7. Recombinant human IL-10 is added the next day at
a final
concentration of 10 ng/ml and rhuman IL-2 is added 48 hours later at 10 IUhnl.
[0566] Restimulation of the induction cultures with peptide-pulsed adherent
cells: Seven
and fourteen days after the priinary induction, the cells are restimulated
with peptide-pulsed
adherent cells. The PBMCs are thawed and washed twice with RPMI and DNAse. The
cells are
resuspended at 5x106 cells/ml and irradiated at -4200 rads. The PBMCs are
plated at 2x106 in
0.5 ml complete medium per well and incubated for 2 hours at 37 C. The plates
are washed
twice with RPMI by tapping the plate gently to remove the nonadherent cells
and the adherent
cells pulsed with 10 g/ml of peptide in the presence of 3 gg/ml 132
microglobulin in 0.25m1
RPMI/5%AB per well for 2 hours at 37 C. Peptide solution from each well is
aspirated and the
wells are washed once with RPMI. Most of the media is aspirated from the
induction cultures
(CDB+ cells) and brought to 0.5 ml with fresh media. The cells are then
transferred to the wells
containing the peptide-pulsed adherent cells. Twenty four hours later
recombinant human IL-10
is added at a final concentration of 10 ng/ml and recombinant human IL2 is
added the next day
and again 2-3 days later at 50IU/ml (Tsai et al., Critical Reviews in
Immunology 18(1-2):65-75,
1998). Seven days later, the cultures are assayed for CTL activity in a 51Cr
release assay. In
some experiments the cultures are assayed for peptide-specific recognition in
the in situ IFN?
161
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
ELISA at the time of the second restimulation followed by assay of endogenous
recognition
7 days later. After expansion, activity is measured in both assays for a side-
by-side comparison.
Measurement of CTL lytic activity by 51 Cr release.
[0567] Seven days after the second restimulation, cytotoxicity is determined
in a standard (5
hr) 51 Cr release assay by assaying individual wells at a single E:T. Peptide-
pulsed targets are
prepared by incubating the cells with 10 g/ml peptide overnight at 37 C.
[0568] Adherent target cells are removed from culture flasks with trypsin-
EDTA. Target
cells are labeled with 200gCi of 51Cr sodium chromate (Dupont, Wilmington, DE)
for 1 hour at
37 C. Labeled target cells are resuspended at 106 per ml and diluted 1:10 with
K562 cells at a
concentration of 3.3x106/ml (an NK-sensitive erythroblastoma cell line used to
reduce non-
specific lysis). Target cells (100 gl) and effectors (100 1) are plated in 96
well round-bottom
plates and incubated for 5 hours at 37 C. At that time, 100 g.l of supernatant
are collected from
each well and percent lysis is determined according to the formula:
[0569] [(cpm of the test sample- cpm of the spontaneous 51Cr release
sample)/(cpm of the
maxima151 Cr release sample- cpm of the spontaneous 51 Cr release sample)] x
100.
[0570] Maxiinum and spontaneous release are detennined by incubating the
labeled targets
with 1 1o Triton X-100 and media alone, respectively. A positive culture is
defined as one in
which the specific lysis (sample- background) is 10% or higher in the case of
individual wells
and is 15% or more at the two highest E:T ratios when expanded cultures are
assayed.
In situ Measurement of Human IFNy Production as an Indicator of Pgptide-
specific and
Endogenous Reco ition
[0571] Immulon 2 plates are coated with mouse anti-human IFNy monoclonal
antibody (4
g/ml 0.1M NaHCO3, pH8.2) overnight at 4 C. The plates are washed with Ca2+,
Mg2+-free
PBS/0.05% Tween 20 and blocked with PBS/10% FCS for two hours, after which the
CTLs
(100 1/well) and targets (100 1/well) are added to each well, leaving einpty
wells for the
standards and blanks (which received media only). The target cells, either
peptide-pulsed or
endogenous targets, are used at a concentration of 1x106 cells/ml. The plates
are incubated for
48 hours at 37 C with 5% C02.
[0572] Recombinant human IFN-gamma is added to the standard wells starting at
400 pg or
1200pg/100 microliter/well and the plate incubated for two hours at 37 C. The
plates are
washed and 100 l of biotinylated mouse anti-human IFN-gamma monoclonal
antibody (2
microgram/ml in PBS/3%FCS/0.05% Tween 20) are added and incubated for 2 hours
at room
temperature. After washing again, 100 microliter HRP-streptavidin (1:4000) are
added and the
162
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
plates incubated for one hour at room temperature. The plates are then washed
6x with wash
buffer, 100 microliter/well developing solution (TMB 1:1) are added, and the
plates allowed to
develop for 5-15 minutes. The reaction is stopped with 50 microliter/well 1M
H3P04 and read
at OD450. A culture is considered positive if it measured at least 50 pg of
IFN-gamma/well
above background and is twice the background level of expression.
CTL Expansion.
[0573] Those cultures that demonstrate specific lytic activity against peptide-
pulsed targets
and/or tumor targets are expanded over a two week period with anti-CD3.
Briefly, 5x104 CDB+
cells are added to a T25 flask containing the following: 1x106 irradiated
(4,200 rad) PBMC -
(autologous or allogeneic) per ml, 2x105 irradiated (8,000 rad) EBV-
transformed cells per ml,
and OKT3 (anti-CD3) at 30ng per ml in RPMI-1640 containing 10% (v/v) human AB
serum,
non-essential ainino acids, sodium pyruvate, 25 M 2-mercaptoethanol, L-
glutamine and
penicillin/streptomycin. Recombinant human IL2 is added 24 hours later at a
final concentration
of 2001U/ml and every three days thereafter with fresh media at 501U/ml. The
cells are split if
the cell concentration exceeds lx106/ml and the cultures are assayed between
days 13 and 15 at
E:T ratios of 30, 10, 3 and 1:1 in the 51Crrelease assay or at 1x106/ml in the
in situ IFNy assay
using the same targets as before the expansion.
[0574] Cultures are expanded in the absence of anti-CD3+ as follows. Those
cultures that
demonstrate specific lytic activity against peptide and endogenous targets are
selected and 5x104
CD8+ cells are added to a T25 flask containing the following: 1x106 autologous
PBMC per ml
which have been peptide-pulsed with 10 g/ml peptide for two hours at 37 C and
irradiated
(4,200 rad); 2x105 irradiated (8,000 rad) EBV-transformed cells per ml RPMI-
1640 containing
10%(v/v) human AB serum, non-essential AA, sodium pyruvate, 25mM 2-ME, L-
glutamine
and gentamicin.
Immuno egnicity of A2 supermotif-bearingpeptides
[0575] A2-supermotif cross-reactive binding peptides are tested in the
cellular assay for the
ability to induce peptide-specific CTL in normal individuals. In this
analysis, a peptide is
typically considered to be an epitope if it induces peptide-specific CTLs in
at least individuals,
and preferably, also recognizes the endogenously expressed peptide.
[0576] Iminunogenicity can also be confirmed using PBMCs isolated from
patients bearing
a tumor that expresses 158P3D2. Briefly, PBMCs are isolated from patients, re-
stimulated with
peptide-pulsed monocytes and assayed for the ability to recognize peptide-
pulsed target cells as
well as transfected cells endogenously expressing the antigen.
163
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Evaluation of A*03/A11 immuno enicity
[0577] HLA-A3 supermotif-bearing cross-reactive binding peptides are also
evaluated for
immunogenicity using methodology analogous for that used to evaluate the
immunogenicity of
the HLA-A2 supermotif peptides.
Evaluation of B7 iminuno egnicity
[0578] Iinmunogenicity screening of the B7-supertype cross-reactive binding
peptides
identified as set forth herein are confirmed in a manner analogous to the
confirmation of A2-and
A3-supermotif-bearing peptides.
[0579] Peptides bearing other supermotifs/motifs, e.g., HLA-A1, HLA-A24 etc.
are also
confirmed using similar methodology
Example 15
Impleinentation of the Extended Subermotif to Improve the BindingCapacity of
Native
Epitopes by CreatingAnalogs
[0580] HLA motifs and supermotifs (comprising primary and/or secondary
residues) are
useful in the identification and preparation of highly cross-reactive native
peptides, as
demonstrated herein. Moreover, the definition of HLA motifs and supermotifs
also allows one
to engineer highly cross-reactive epitopes by identifying residues within a
native peptide
sequence which can be analoged to confer upon the peptide certain
characteristics, e.g., greater
cross-reactivity within the group of HLA molecules that comprise a supertype,
and/or greater
binding affinity for some or all of those HLA molecules. Examples of analoging
peptides to
exhibit modulated binding affinity are set forth in this example.
Analoging at Primary Anchor Residues
[0581] Peptide engineering strategies are implemented to further increase the
cross-
reactivity of the epitopes. For example, the main anchors of A2-supermotif-
bearing peptides are
altered, for example, to introduce a preferred L, I, V, or M at position 2,
and I or V at the C-
terminus.
[0582] To analyze the cross-reactivity of the analog peptides, each engineered
analog is
initially tested for binding to the prototype A2 supertype allele A*0201,
then, if A*0201 binding
capacity is maintained, for A2-supertype cross-reactivity.
164
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0583] Alternatively, a peptide is confirmed as binding one or all supertype
members and
then analoged to modulate binding affinity to any one (or more) of the
supertype members to
add population coverage.
[0584] The selection of analogs for immunogenicity in a cellular screening
analysis is
typically further restricted by the capacity of the parent wild type (WT)
peptide to bind at least
weakly, i.e., bind at an IC50 of 5000nM or less, to three of more A2 supertype
alleles. The
rationale for this requirement is that the WT peptides must be present
endogenously in sufficient
quantity to be biologically relevant. Analoged peptides have been shown to
have increased
immunogenicity and cross-reactivity by T cells specific for the parent epitope
(see, e.g.,
Parkhurst et al., J. Immunol. 157:2539, 1996; and Pogue et al., Proc. Natl.
Acad. Sci. USA
92:8166, 1995).
[0585] In the cellular screening of these peptide analogs, it is important to
confirm that
analog-specific CTLs are also able to recognize the wild-type peptide and,
when possible, target
cells that endogenously express the epitope.
Analoging of HLA-A3 and B7-supermotif-bearing peptides
[0586] Analogs of HLA-A3 supermotif-bearing epitopes are generated using
strategies
similar to those employed in analoging HLA-A2 supermotif-bearing peptides. For
example,
peptides binding to 3/5 of the A3-supertype molecules are engineered at
primary anchor residues
to possess a preferred residue (V, S, M, or A) at position 2.
[0587] The analog peptides are then tested for the ability to bind A*03 and A*
11 (prototype
A3 supertype alleles). Those peptides that demonstrate <_ 500 nM binding
capacity are then
confirmed as having A3-supertype cross-reactivity.
[0588] Similarly to the A2- and A3- motif bearing peptides, peptides binding 3
or more B7-
supertype alleles can be improved, where possible, to achieve increased cross-
reactive binding
or greater binding affinity or binding half life. B7 supermotif-bearing
peptides are, for example,
engineered to possess a preferred residue (V, I, L, or F) at the C-terminal
primary anchor
position, as demonstrated by Sidney et al. (J. Immunol. 157:3480-3490, 1996).
[0589] Analoging at primary anchor residues of other motif and/or supermotif-
bearing
epitopes is performed in a like inanner.
[0590] The analog peptides are then be confirmed for immunogenicity, typically
in a cellular
screening assay. Again, it is generally important to demonstrate that analog-
specific CTLs are
also able to recognize the wild-type peptide and, when possible, targets that
endogenously
express the epitope.
165
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Analoging at Secondary Anchor Residues
[0591] Moreover, HLA supermotifs are of value in engineering highly cross-
reactive
peptides and/or peptides that bind HLA molecules with increased affinity by
identifying
particular residues at secondary anchor positions that are associated with
such properties. For
example, the binding capacity of a B7 supermotif-bearing peptide with an F
residue at position 1
is analyzed. The peptide is then analoged to, for example, substitute L for F
at position 1. The
analoged peptide is evaluated for increased binding affinity, binding half
life and/or increased
cross-reactivity. Such a procedure identifies analoged peptides with enhanced
properties.
[0592] Engineered analogs with sufficiently improved binding capacity or cross-
reactivity
can also be tested for immunogenicity in HLA-B7-transgenic mice, following for
exainple, IFA
immunization or lipopeptide immunization. Analoged peptides are additionally
tested for the
ability to stimulate a recall response using PBMC from patients with 158P3D2-
expressing
tumors.
Other analo in strategies
[0593] Another form of peptide analoging, unrelated to anchor positions,
involves the
substitution of a cysteine with a-amino butyric acid. Due to its cheinical
nature, cysteine has the
propensity to form disulfide bridges and sufficiently alter the peptide
structurally so as to reduce
binding capacity. Substitution of a-amino butyric acid for cysteine not only
alleviates this
problem, but has been shown to improve binding and crossbinding capabilities
in some instances
(see, e.g., the review by Sette et al., In: Persistent Viral Infections, Eds.
R. Abmed and I. Chen,
John Wiley & Sons, England, 1999).
[0594] Thus, by the use of single amino acid substitutions, the binding
properties and/or
cross-reactivity of peptide ligands for HLA supertype molecules can be
modulated.
Example 16
Identification and confirmation of 158P3D2-derived sequences with HLA-DR
binding motifs
[0595] Peptide epitopes bearing an HLA class II supermotif or motif are
identified and
confirmed as outlined below using methodology similar to that described for
HLA Class I
peptides.
Selection of HLA-DR-supermotif-bearing gpitopes.
[0596] To identify 158P3D2-derived, HLA class II HTL epitopes, a 158P3D2
antigen is
analyzed for the presence of sequences bearing an HLA-DR-motif or supermotif.
Specifically,
166
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
15-mer sequences are selected comprising a DR-supermotif, comprising a 9-mer
core, and three-
residue N- and C-terminal flanking regions (15 amino acids total).
[0597] Protocols for predicting peptide binding to DR molecules have been
developed
(Southwood et al., J. Itumunol. 160:3363-3373, 1998). These protocols,
specific for individual
DR molecules, allow the scoring, and ranking, of 9-mer core regions. Each
protocol not only
scores peptide sequences for the presence of DR-supennotif primary anchors
(i.e., at position 1
and position 6) within a 9-mer core, but additionally evaluates sequences for
the presence of
secondary anchors. Using allele-specific selection tables (see, e.g.,
Southwood et al., ibid.), it
has been found that these protocols efficiently select peptide sequences with
a high probability
of binding a particular DR molecule. Additionally, it has been found that
performing these
protocols in tandem, specifically those for DRl, DR4w4, and DR7, can
efficiently select DR
cross-reactive peptides.
[0598] The 158P3D2-derived peptides identified above are tested for their
binding capacity
for various common HLA-DR molecules. All peptides are initially tested for
binding to the DR
molecules in the primary panel: DRl, DR4w4, and DR7. Peptides binding at least
two of these
three DR molecules are then tested for binding to DR2w2 (31, DR2w2 (32,
DR6w19, and DR9
molecules in secondary assays. Finally, peptides binding at least two of the
four secondary
panel DR molecules, and thus cumulatively at least four of seven different DR
molecules, are
screened for binding to DR4w15, DR5w1 1, and DR8w2 molecules in tertiary
assays. Peptides
binding at least seven of the ten DR molecules comprising the primary,
secondary, and tertiary
screening assays are considered cross-reactive DR binders. 158P3D2-derived
peptides found to
bind common HLA-DR alleles are of particular interest.
Selection of DR3 motif pebtides
[0599] Because HLA-DR3 is an allele that is prevalent in Caucasian, Black, and
Hispanic
populations, DR3 binding capacity is a relevant criterion in the selection of
HTL epitopes.
Thus, peptides shown to be candidates may also be assayed for their DR3
binding capacity.
However, in view of the binding specificity of the DR3 motif, peptides binding
only to DR3 can
also be considered as candidates for inclusion in a vaccine formulation.
[0600] To efficiently identify peptides that bind DR3, target 158P3D2 antigens
are analyzed
for sequences carrying one of the two DR3 -specific binding motifs reported by
Geluk et al. (J.
Immunol. 152:5742-5748, 1994). The corresponding peptides are then synthesized
and
confirmed as having the ability to bind DR3 with an affinity of 1 M or
better, i.e., less than 1
167
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
M. Peptides are found that meet this binding criterion and qualify as HLA
class II high affinity
binders.
[0601] DR3 binding epitopes identified in this manner are included in vaccine
compositions
with DR supermotif-bearing peptide epitopes.
[0602] Similarly to the case of HLA class I motif-bearing peptides, the class
II motif-bearing
peptides are analoged to improve affinity or cross-reactivity. For example,
aspartic acid at
position 4 of the 9-mer core sequence is an optimal residue for DR3 binding,
and substitution for
that residue often iinproves DR 3 binding.
Examble 17
Immunogenicity of 158P3D2-derived HTL epitobes
[0603] This example determines immunogenic DR supermotif- and DR3 motif-
bearing
epitopes among those identified using the methodology set forth herein.
[0604] Immunogenicity of HTL epitopes are confirmed in a manner analogous to
the
determination of immunogenicity of CTL epitopes, by assessing the ability to
stimulate HTL
responses and/or by using appropriate transgenic mouse models. Iminunogenicity
is determined
by screening for: 1.) in vitro primary induction using normal PBMC or 2.)
recall responses from
patients who have 158P3D2-expressing tumors.
Example 18
Calculation of phenotypic frequencies of HLA-supertypes
in various ethnic backarounds to determine breadth of population coverage
[0605] This example illustrates the assessment of the breadth of population
coverage of a
vaccine composition comprised of multiple epitopes comprising multiple
supermotifs and/or
motifs.
[0606] In order to analyze population coverage, gene frequencies of HLA
alleles are
determined. Gene frequencies for each HLA allele are calculated from antigen
or allele
frequencies utilizing the binomial distribution formulae gf--1-(SQRT(1-af))
(see, e.g., Sidney et
al., Human Immunol. 45:79-93, 1996). To obtain overall phenotypic frequencies,
cumulative
gene frequencies are calculated, and the cumulative antigen frequencies
derived by the use of the
inverse formula [af'--l-(1-Cgf)2].
168
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0607] Where frequency data is not available at the level of DNA typing,
correspondence to
the serologically defined antigen frequencies is assumed. To obtain total
potential supertype
population coverage no linkage disequilibrium is assumed, and only alleles
confirmed to belong
to each of the supertypes are included (minimal estimates). Estimates of total
potential coverage
achieved by inter-loci combinations are made by adding to the A coverage the
proportion of the
non-A covered population that could be expected to be covered by the B alleles
considered (e.g.,
total=A+B*(1-A)). Confirmed members of the A3-like supertype are A3, All, A31,
A*3301,
and A*6801. Although the A3-like supertype may also include A34, A66, and
A*7401, these
alleles were not included in overall frequency calculations. Likewise,
confinned members of the
A2-like supertype family are A*0201, A*0202, A*0203, A*0204, A*0205, A*0206,
A*0207,
A*6802, and A*6901. Finally, the B7-like supertype-confirmed alleles are: B7,
B*3501-03,
B51, B*5301, B*5401, B*5501-2, B*5601, B*6701, and B*7801 (potentially also
B*1401,
B*3504-06, B*4201, and B*5602).
[0608] Population coverage acllieved by combining the A2-, A3- and B7-
supertypes is
approximately 86% in five major ethnic groups. Coverage may be extended by
including
peptides bearing the Al and A24 motifs. On average, Al is present in 12% and
A24 in 29% of
the population across five different major ethnic groups (Caucasian, North
American Black,
Chinese, Japanese, and Hispanic). Together, these alleles are represented with
an average
frequency of 39% in these same ethnic populations. The total coverage across
the major
ethnicities when Al and A24 are combined with the coverage of the A2-, A3- and
B7-supertype
alleles is >95%, see, e.g., Table IV (G). An analogous approach can be used to
estimate
population coverage achieved with combinations of class II motif-bearing
epitopes.
[0609] Iinmunogenicity studies in humans (e.g., Bertoni et al., J. Clin.
Invest. 100:503,
1997; Doolan et al., Immunity 7:97, 1997; and Threlkeld et al., J. Immunol.
159:1648, 1997)
have shown that highly cross-reactive binding peptides are almost always
recognized as
epitopes. The use of highly cross-reactive binding peptides is an important
selection criterion in
identifying candidate epitopes for inclusion in a vaccine that is immunogenic
in a diverse
population.
[0610] With a sufficient number of epitopes (as disclosed herein and from the
art), an
average population coverage is predicted to be greater than 95% in each of
five major ethnic
populations. The game theory Monte Carlo simulation analysis, which is known
in the art (see
e.g., Osborne, M.J. and Rubinstein, A. "A course in game theory" MIT Press,
1994), can be used
to estimate what percentage of the individuals in a population comprised of
the Caucasian, North
169
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
American Black, Japanese, Chinese, and Hispanic ethnic groups would recognize
the vaccine
epitopes described herein. A preferred percentage is 90%. A more preferred
percentage is 95%.
Examnle 19
CTL Recognition Of Endogenously Processed Antigens After Priming
[0611] This example corifirms that CTL induced by native or analoged peptide
epitopes
identified and selected as described herein recognize endogenously
synthesized, i.e., native
antigens.
[0612] Effector cells isolated fiom transgenic mice that are immunized with
peptide
epitopes, for example HLA-A2 supermotif-bearing epitopes, are re-stimulated in
vitro using
peptide-coated stimulator cells. Six days later, effector cells are assayed
for cytotoxicity and the
cell lines that contain peptide-specific cytotoxic activity are further re-
stimulated. An additional
six days later, these cell lines are tested for cytotoxic activity on 51Cr
labeled Jurkat-A2.1/Kb
target cells in the absence or presence of peptide, and also tested on 51Cr
labeled target cells
bearing the endogenously synthesized antigen, i.e., cells that are stably
transfected with
158P3D2 expression vectors.
[0613] The results demonstrate that CTL lines obtained from animals primed
with peptide
epitope recognize endogenously synthesized 158P3D2 antigen. The choice of
transgenic mouse
model to be used for such an analysis depends upon the epitope(s) that are
being evaluated. In
addition to HLA-A*0201/kb transgenic mice, several other transgenic mouse
models including
mice with human A11, which may also be used to evaluate A3 epitopes, and B7
alleles have
been characterized and others (e.g., transgenic mice for HLA-A1 and A24) are
being developed.
HLA-DRl and HLA-DR3 mouse models have also been developed, which may be used
to
evaluate HTL epitopes.
Example 20
Activity Of CTL-HTL Conjugated Epitopes In Transgenic Mice
[0614] This example illustrates the induction of CTLs and HTLs in transgenic
mice, by use
of a 158P3D2-derived CTL and HTL peptide vaccine compositions. The vaccine
composition
used herein comprises peptides to be administered to a patient with a 158P3D2-
expressing
tumor. The peptide composition can comprise multiple CTL and/or HTL epitopes.
The
epitopes are identified using methodology as described herein. This example
also illustrates that
enhanced immunogenicity can be achieved by inclusion of one or more HTL
epitopes in a CTL
170
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
vaccine composition; such a peptide composition can comprise an HTL epitope
conjugated to a
CTL epitope. The CTL epitope can be one that binds to multiple HLA family
members at an
affinity of 500 nM or less, or analogs of that epitope. The peptides may be
lipidated, if desired.
[0615] Inamunization procedures: Immunization of transgenic mice is performed
as
described (Alexander et al., J. Immunol. 159:4753-4761, 1997). For example,
A2/Kb mice,
which are transgenic for the human HLA A2.1 allele and are used to confirm the
immunogenicity of HLA-A*0201 motif- or HLA-A2 supermotif-bearing epitopes, and
are
primed subcutaneously (base of the tail) with a 0.1 ml of peptide in
Incomplete Freund's
Adjuvant, or if the peptide composition is a lipidated CTL/HTL conjugate, in
DMSO/saline, or
if the peptide composition is a polypeptide, in PBS or Incomplete Freund's
Adjuvant. Seven
days after priming, splenocytes obtained from these animals are restimulated
with syngenic
irradiated LPS-activated lymphoblasts coated with peptide.
[0616] Cell lines: Target cells for peptide-specific cytotoxicity assays are
Jurkat cells
transfected with the HLA-A2.1/Kb chimeric gene (e.g., Vitiello et al., J. Exp.
Med. 173:1007,
1991)
[0617] In vitro CTL activation: One week after priming, spleen cells (30x106
cells/flask) are
co-cultured at 37 C with syngeneic, irradiated (3000 rads), peptide coated
lymphoblasts (10x106
cells/flask) in 10 ml of culture medium/T25 flask. After six days, effector
cells are harvested
and assayed for cytotoxic activity.
[0618] Assay for c3qotoxic activity: Target cells (1.0 to 1.5x106) are
incubated at 37 C in
the presence of 200 l of 51Cr. After 60 minutes, cells are washed three times
and resuspended
in R10 medium. Peptide is added where required at a concentration of 1 g/ml.
For the assay,
104 51Cr-labeled target cells are added to different concentrations of
effector cells (final volume
of 200 l) in U-bottom 96-well plates. After a six hour incubation period at
37 C, a 0.1 ml
aliquot of supematant is removed from each well and radioactivity is
determined in a
Micromedic automatic gamma counter. The percent specific lysis is determined
by the formula:
percent specific release = 100 x (experimental release - spontaneous
release)/(maximum release
- spontaneous release). To facilitate comparison between separate CTL assays
run under the
same conditions, % 51Cr release data is expressed as lytic units/106 cells.
One lytic unit is
arbitrarily defined as the number of effector cells required to achieve 30%
lysis of 10,000 target
cells in a six hour 51Cr release assay. To obtain specific lytic units/106,
the lytic units/106
obtained in the absence of peptide is subtracted from the lytic units/106
obtained in the presence
of peptide. For example, if 30% 51Cr release is obtained at the effector (E):
target (T) ratio of
171
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
50:1 (i.e., 5x105 effector cells for 10,000 targets) in the absence of peptide
and 5:1 (i.e., 5x10~
effector cells for 10,000 targets) in the presence of peptide, the specific
lytic units would be:
[(1/50,000)-(1/500,000)] x 106 =18 LU.
[0619] The results are analyzed to assess the magnitude of the CTL responses
of animals
injected with the immunogenic CTL/HTL conjugate vaccine preparation and are
compared to
the magnitude of the CTL response achieved using, for example, CTL epitopes as
outlined
above in the Example entitled "Confirmation of Immunogenicity." Analyses
similar to this may
be performed to confirm the immunogenicity of peptide conjugates containing
multiple CTL
epitopes and/or multiple HTL epitopes. In accordance with these procedures, it
is found that a
CTL response is induced, and concomitantly that an HTL response is induced
upon
administration of such compositions.
Examble 21
Selection of CTL and HTL epitopes for inclusion in a 158P3D2-specific vaccine.
[0620] This example illustrates a procedure for selecting peptide epitopes for
vaccine
compositions of the invention. The peptides in the composition can be in the
form of a nucleic
acid sequence, either single or one or more sequences (i.e., minigene) that
encodes peptide(s), or
can be single and/or polyepitopic peptides.
[0621] The following principles are utilized when selecting a plurality of
epitopes for
inclusion in a vaccine composition. Each of the following principles is
balanced in order to
make the selection.
[0622] Epitopes are selected which, upon administration, mimic immune
responses that are
correlated with 158P3D2 clearance. The number of epitopes used depends on
observations of
patients who spontaneously clear 158P3D2. For example, if it has been observed
that patients
who spontaneously clear 158P3D2-expressing cells generate an immune response
to at least
three (3) epitopes from 158P3D2 antigen, then at least three epitopes should
be included for
HLA class I. A similar rationale is used to determine HLA class II epitopes.
[0623] Epitopes are often selected that have a binding affinity of an IC50 of
500 nM or less
for an HLA class I molecule, or for class II, an IC50 of 1000 nM or less; or
HLA Class I peptides
with high binding scores from the BIMAS web site, at URL bimas.dcrt.nih.gov/.
[0624] In order to achieve broad coverage of the vaccine through out a diverse
population,
sufficient supermotif bearing peptides, or a sufficient array of allele-
specific motif bearing
peptides, are selected to give broad population coverage. In one embodiment,
epitopes are
172
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
selected to provide at least 80% population coverage. A Monte Carlo analysis,
a statistical
evaluation known in the art, can be employed to assess breadth, or redundancy,
of population
coverage.
[0625] When creating polyepitopic compositions, or a minigene that encodes
same, it is
typically desirable to generate the smallest peptide possible that encompasses
the epitopes of
interest. The principles employed are similar, if not the same, as those
employed when selecting
a peptide comprising nested epitopes. For example, a protein sequence for the
vaccine
composition is selected because it has maximal number of epitopes contained
within the
sequence, i.e., it has a high concentration of epitopes. Epitopes may be
nested or overlapping
(i.e., frame shifted relative to one another). For example, with overlapping
epitopes, two 9-mer
epitopes and one 10-mer epitope can be present in a 10 amino acid peptide.
Each epitope can be
exposed and bound by an HLA molecule upon administration of such a peptide. A
multi-
epitopic, peptide can be generated synthetically, recombinantly, or via
cleavage from the native
source. Alternatively, an analog can be made of this native sequence, whereby
one or more of
the epitopes comprise substitutions that alter the cross-reactivity and/or
binding affinity
properties of the polyepitopic peptide. Such a vaccine composition is
administered for
therapeutic or prophylactic purposes. This embodiment provides for the
possibility that an as
yet undiscovered aspect of immune system processing will apply to the native
nested sequence
and thereby facilitate the production of therapeutic or prophylactic immune
response-inducing
vaccine compositions. Additionally such an embodiment provides for the
possibility of motif-
bearing epitopes for an HLA makeup that is presently unknown. Furthermore,
this embodiinent
(absent the creating of any analogs) directs the immune response to multiple
peptide sequences
that are actually present in 158P3D2, thus avoiding the need to evaluate any
junctional epitopes.
Lastly, the embodiment provides an economy of scale when producing nucleic
acid vaccine
compositions. Related to this embodiment, computer programs can be derived in
accordance
with principles in the art, which identify in a target sequence, the greatest
number of epitopes per
sequence length.
[0626] A vaccine composition comprised of selected peptides, when
administered, is safe,
efficacious, and elicits an immune response similar in magnitude to an immune
response that
controls or clears cells that bear or overexpress 158P3D2.
173
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Example 2
Construction of "Minigene" Multi-Epitope DNA Plasmids
[0627] This example discusses the construction of a minigene expression
plasmid.
Minigene plasmids may, of course, contain various configurations of B cell,
CTL and/or HTL
epitopes or epitope analogs as described herein.
[0628] A minigene expression plasmid typically includes multiple CTL and HTL
peptide
epitopes. In the present example, HLA-A2, -A3, -B7 supermotif-bearing peptide
epitopes and
HLA-Al and -A24 motif-bearing peptide epitopes are used in conjunction with DR
supermotif-
bearing epitopes and/or DR3 epitopes. HLA class I supermotif or motif-bearing
peptide
epitopes derived 158P3D2, are selected such that multiple supermotifs/motifs
are represented to
ensure broad population coverage. Similarly, HLA class II epitopes are
selected from 158P3D2
to provide broad population coverage, i.e., both HLA DR-1-4-7 supermotif-
bearing epitopes and
HLA DR-3 motif-bearing epitopes are selected for inclusion in the minigene
construct. The
selected CTL and HTL epitopes are then incorporated into a minigene for
expression in an
expression vector.
[0629] Such a construct may additionally include sequences that direct the HTL
epitopes to
the endoplasmic reticulum. For exasnple, the Ii protein may be fused to one or
more HTL
epitopes as described in the art, wherein the CLIP sequence of the Ii protein
is removed and
replaced with an HLA class II epitope sequence so that HLA class II epitope is
directed to the
endoplasmic reticulum, where the epitope binds to an HLA class II molecules.
[0630] This example illustrates the methods to be used for construction of a
ininigene-
bearing expression plasmid. Other expression vectors that may be used for
minigene
compositions are available and known to those of skill in the art.
[0631] The minigene DNA plasmid of this exainple contains a consensus Kozak
sequence
and a consensus murine kappa Ig-light chain signal sequence followed by CTL
and/or HTL
epitopes selected in accordance with principles disclosed herein. The sequence
encodes an open
reading frame fused to the Myc and His antibody epitope tag coded for by the
pcDNA 3.1 Myc-
His vector.
[0632] Overlapping oligonucleotides that can, for example, average about 70
nucleotides in
length with 15 nucleotide overlaps, are synthesized and HPLC-purified. The
oligonucleotides
encode the selected peptide epitopes as well as appropriate linker
nucleotides, Kozak sequence,
and signal sequence. The final multiepitope minigene is assembled by extending
the
overlapping oligonucleotides in three sets of reactions using PCR. A
Perkin/ Elmer 9600 PCR
174
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
machine is used and a total of 30 cycles are performed using the following
conditions: 95 C for
15 sec, annealing temperature (5 below the lowest calculated Tm of each
primer pair) for 30
sec, and 72 C for 1 min.
[0633] For example, a minigene is prepared as follows. For a first PCR
reaction, 5 g of
each of two oligonucleotides are annealed and extended: In an example using
eight
oligonucleotides, i.e., four pairs of primers, oligonucleotides 1+2, 3+4, 5+6,
and 7+8 are
combined in 100 l reactions containing Pfu polymerase buffer (lx= 10 inM KCL,
10 mM
(NH4)2SO4, 20 mM Tris-chloride, pH 8.75, 2 mM MgSO4, 0.1% Triton X-100, 100
g/ml
BSA), 0.25 mM each dNTP, and 2.5 U of Pfu polyinerase. The full-length dimer
products are
gel-purified, and two reactions containing the product of 1+2 and 3+4, and the
product of 5+6
and 7+8 are mixed, annealed, and extended for 10 cycles. Half of the two
reactions are then
mixed, and 5 cycles of annealing and extension carried out before flanking
primers are added to
amplify the full length product. The full-length product is gel-purified and
cloned into pCR-
blunt (Invitrogen) and individual clones are screened by sequencing.
Example 23 The Plasmid Construct and the Degree to Which It Induces Immuno eg
nicity_
[0634] The degree to which a plasmid construct, for example a plasmid
constructed in
accordance with the previous Example, is able to induce immunogenicity is
confirmed in vitro
by determining epitope presentation by APC following transduction or
transfection of the APC
with an epitope-expressing nucleic acid construct. Such a study determines
"antigenicity" and
allows the use of human APC. The assay determines the ability of the epitope
to be presented
by the APC in a context that is recognized by a T cell by quantifying the
density of epitope-HLA
class I complexes on the cell surface. Quautitation can be performed by
directly measuring the
amount of peptide eluted from the APC (see, e.g., Sijts, et al., J. Inanaunol.
156:683-692, 1996;
Deinotz et al., Nature 342:682-684, 1989); or the number of peptide-HLA class
I complexes can
be estimated by measuring the amount of lysis or lyinphokine release induced
by diseased or
transfected target cells, and then determiiiing the concentration of peptide
necessary to obtain
equivalent levels of lysis or lymphokine release (see, e.g., Kageyama et al.,
J. Inamunol.
154:567-576, 1995).
[0635] Alternatively, immunogenicity is confinned through in vivo injections
into mice and
subsequent in vitro assessment of CTL and HTL activity, which are analyzed
using cytotoxicity
175
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
and proliferation assays, respectively, as detailed e.g., in Alexander et al.,
Inaynunity 1:751-761,
1994.
[0636] For example, to confirm the capacity of a DNA minigene construct
containing at
least one HLA-A2 supermotif peptide to induce CTLs in vivo, HLA-A2.1/Kb
transgenic mice,
for example, are iinmunized intramuscularly with 100 g of naked cDNA. As a
means of
comparing the level of CTLs induced by cDNA ixmnunization, a control group of
animals is also
immunized with an actual peptide composition that comprises multiple epitopes
synthesized as a
single polypeptide as they would be encoded by the minigene.
[0637] Splenocytes fiom immunized animals are stimulated twice with each of
the
respective compositions (peptide epitopes encoded in the minigene or the
polyepitopic peptide),
then assayed for peptide-specific cytotoxic activity in a 51Cr release assay.
The results indicate
the magnitude of the CTL response directed against the A2-restricted epitope,
thus indicating the
in vivo immunogenicity of the minigene vaccine and polyepitopic vaccine.
[0638] It is, therefore, found that the minigene elicits immune responses
directed toward the
HLA-A2 supernlotif peptide epitopes as does the polyepitopic peptide vaccine.
A similar
analysis is also performed using other HLA-A3 and HLA-B7 transgenic mouse
models to assess
CTL induction by HLA-A3 and HLA-B7 motif or supermotif epitopes, whereby it is
also found
that the minigene elicits appropriate immune responses directed toward the
provided epitopes.
[0639] To confirm the capacity of a class II epitope-encoding minigene to
induce HTLs in
vivo, DR transgenic mice, or for those epitopes that cross react with the
appropriate mouse MHC
molecule, I-Ab-restricted mice, for example, are immunized intramuscularly
with 100 g of
plasmid DNA. As a means of comparing the level of HTLs induced by DNA
immunization, a
group of control animals is also immunized with an actual peptide composition
emulsified in
complete Freund's adjuvant. CD4+ T cells, i.e., HTLs, are purified from
splenocytes of
immunized animals and stimulated with each of the respective compositions
(peptides encoded
in the minigene). The HTL response is measured using a 3H-thymidine
incorporation
proliferation assay, (see, e.g., Alexander et al. Immunity 1:751-761, 1994).
The results indicate
the magnitude of the HTL response, thus demonstrating the in vivo
immunogenicity of the
minigene.
[0640] DNA minigenes, constructed as described in the previous Example, can
also be
confirmed as a vaccine in combination with a boosting agent using a prime
boost protocol. The
boosting agent can consist of recombinant protein (e.g., Barnett, et al., Aids
Res. and Human
Retroviruses 14, Supplement 3:S299-S309, 1998) or recombinant vaccinia, for
example,
176
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
expressing a minigene or DNA encoding the complete protein of interest (see,
e.g., Hanke et al.,
Vaccine 16:439-445, 1998; Sedegah et al., Proc. Natl. Acad. Sci USA 95:7648-
53, 1998; Hanke
and McMichael, Inzmunol. Letters 66:177-181, 1999; and Robinson et al., Nature
Med. 5:526-
34, 1999).
[0641] For example, the efficacy of the DNA minigene used in a prime boost
protocol is
initially evaluated in transgeiiic mice. In this example, A2.1/Kb transgenic
mice are iminunized
IM with 100 g of a DNA minigene encoding the immunogenic peptides including
at least one
HLA-A2 supermotif-bearing peptide. After an incubation period (ranging from 3-
9 weeks), the
mice are boosted IP with 107 pfu/mouse of a recombinant vaccinia virus
expressing the saine
sequence encoded by the DNA minigene. Control mice are immunized with 100 g
of DNA or
recombinant vaccinia witllout the minigene sequence, or with DNA encoding the
minigene, but
without the vaccinia boost. After an additional incubation period of two
weeks, splenocytes
from the mice are immediately assayed for peptide-specific activity in an
ELISPOT assay.
Additionally, splenocytes are stimulated in vitro with the A2-restricted
peptide epitopes encoded
in the minigene and recombinant vaccinia, then assayed for peptide-specific
activity in an alpha,
beta and/or gamina IFN ELISA.
[0642] It is found that the minigene utilized in a prime-boost protocol
elicits greater immune
responses toward the HLA-A2 supermotif peptides than with DNA alone. Such an
analysis can
also be performed using HLA-A11 or HLA-B7 transgenic mouse models to assess
CTL
induction by HLA-A3 or HLA-B7 motif or supermotif epitopes. The use of prime
boost
protocols in humans is described below in the Example entitled "Induction of
CTL Responses
Using a Prime Boost Protocol."
Example 24
Peptide Compositions for Prophylactic Uses
[0643] Vaccine compositions of the present invention can be used to prevent
158P3D2
expression in persons who are at risk for tumors that bear this antigen. For
example, a
polyepitopic peptide epitope composition (or a nucleic acid comprising the
same) containing
multiple CTL and HTL epitopes such as those selected in the above Examples,
which are also
selected to target greater than 80% of the population, is administered to
individuals at risk for a
158P3D2-associated tumor.
[0644] For example, a peptide-based composition is provided as a single
polypeptide that
encompasses multiple epitopes. The vaccine is typically administered in a
physiological
177
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
solution that comprises an adjuvant, such as Incomplete Freunds Adjuvant. The
dose of peptide
for the initial immunization is from about 1 to about 50,000 g, generally 100-
5,000 g, for a 70
kg patient. The initial administration of vaccine is followed by booster
dosages at 4 weeks
followed by evaluation of the magnitude of the immune response in the patient,
by techniques
that determine the presence of epitope-specific CTL populations in a PBMC
sample. Additional
booster doses are administered as required. The coinposition is found to be
both safe and
efficacious as a prophylaxis against 158P3D2-associated disease.
[0645] Alternatively, a composition typically comprising transfecting agents
is used for the
administration of a nucleic acid-based vaccine in accordance with
methodologies known in the
art and disclosed herein.
Example 25
Polyebitobic Vaccine Compositions Derived from Native 158P3D2 Sequences
[0646] A native 158P3D2 polyprotein sequence is analyzed, preferably using
computer
algorithms defined for each class I and/or class II supermotif or motif, to
identify "relatively
short" regions of the polyprotein that comprise multiple epitopes. The
"relatively short" regions
are preferably less in length than an entire native antigen. This relatively
short sequence that
contains multiple distinct or overlapping, "nested" epitopes can be used to
generate a minigene
construct. The construct is engineered to express the peptide, which
corresponds to the native
protein sequence. The "relatively short" peptide is generally less than 250
amino acids in
length, often less than 100 amino acids in length, preferably less than 75
amino acids in length,
and more preferably less than 50 amino acids in length. The protein sequence
of the vaccine
composition is selected because it has maximal number of epitopes contained
within the
sequence, i.e., it has a high concentration of epitopes. As noted herein,
epitope motifs may be
nested or overlapping (i.e., frame shifted relative to one another). For
example, with
overlapping epitopes, two 9-mer epitopes and one 10-mer epitope can be present
in a 10 amino
acid peptide. Such a vaccine composition is adininistered for therapeutic or
prophylactic
purposes.
[0647] The vaccine composition will include, for example, multiple CTL
epitopes from
158P3D2 antigen and at least one HTL epitope. This polyepitopic native
sequence is
administered either as a peptide or as a nucleic acid sequence which encodes
the peptide.
Alternatively, an analog can be made of this native sequence, whereby one or
more of the
178
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
epitopes comprise substitutions that alter the cross-reactivity and/or binding
affinity properties
of the polyepitopic peptide.
[0648] The embodiment of this example provides for the possibility that an as
yet
undiscovered aspect of immune system processing will apply to the native
nested sequence and
thereby facilitate the production of therapeutic or prophylactic immune
response-inducing
vaccine compositions. Additionally, such an embodiment provides for the
possibility of motif-
bearing epitopes for an HLA makeup(s) that is presently unknown. Furthermore,
this
embodiment (excluding an analoged einbodiment) directs the immune response to
multiple
peptide sequences that are actually present in native 158P3D2, thus avoiding
the need to
evaluate any junctional epitopes. Lastly, the embodiment provides an economy
of scale when
producing peptide or nucleic acid vaccine compositions.
[0649] Related to this embodiment, computer programs are available in the art
which can be
used to identify in a target sequence, the greatest nuinber of epitopes per
sequence length.
Example 26
Polyepitopic Vaccine Compositions from Multiple Antigens
[0650] The 158P3D2 peptide epitopes of the present invention are used in
conjunction with
epitopes from other target tumor-associated antigens, to create a vaccine
composition that is
useful for the prevention or treatment of cancer that expresses 158P3D2 and
such other antigens.
For example, a vaccine composition can be provided as a single polypeptide
that incorporates
multiple epitopes from 158P3D2 as well as tumor-associated antigens that are
often expressed
with a target cancer associated with 158P3D2 expression, or can be
administered as a
composition comprising a cocktail of one or more discrete epitopes.
Alternatively, the vaccine
can be administered as a minigene construct or as dendritic cells which have
been loaded with
the peptide epitopes in vitro.
Example 27
Use of peptides to evaluate an immune response
[0651] Peptides of the invention may be used to analyze an immune response for
the
presence of specific antibodies, CTL or HTL directed to 158P3D2. Such an
analysis can be
performed in a manner described by Ogg et al., Science 279:2103-2106, 1998. In
this Example,
peptides in accordance with the invention are used as a reagent for diagnostic
or prognostic
purposes, not as an immunogen.
179
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0652] In this example highly sensitive human leukocyte antigen tetrameric
complexes
("tetramers") are used for a cross-sectional analysis of, for example, 158P3D2
HLA-A*0201-
specific CTL frequencies from HLA A*0201-positive individuals at different
stages of disease
or following iinmunization comprising a 158P3D2 peptide containing an A*0201
motif.
Tetrameric complexes are synthesized as described (Musey et al., N. Engl. J.
Med. 337:1267,
1997). Briefly, purified HLA heavy chain (A*0201 in this example) and (32-
microglobulin are
synthesized by ineans of a prokaryotic expression system. The heavy chain is
modified by
deletion of the transmembrane-cytosolic tail and COOH-terminal addition of a
sequence
containing a BirA enzymatic biotinylation site. The heavy chain, (32-
microglobulin, and peptide
are refolded by dilution. The 45-kD refolded product is isolated by fast
protein liquid
chromatography and then biotinylated by BirA in the presence of biotin (Sigma,
St. Louis,
Missouri), adenosine 5' triphosphate and magnesium. Streptavidin-phycoerythrin
conjugate is
added in a 1:4 molar ratio, and the tetrameric product is concentrated to 1
mg/ml. The resulting
product is referred to as tetramer-phycoerythrin.
[0653] For the analysis of patient blood samples, approximately one million
PBMCs are
centrifuged at 300g for 5 minutes and resuspended in 50 l of cold phosphate-
buffered saline.
Tri-color analysis is perfonned with the tetramer-phycoerythrin, along with
anti-CD8-Tricolor,
and anti-CD38. The PBMCs are incubated with tetramer and antibodies on ice for
30 to 60 min
and then washed twice before formaldehyde fixation. Gates are applied to
contain >99.98% of
control samples. Controls for the tetramers include both A*0201-negative
individuals and
A*0201 -positive non-diseased donors. The percentage of cells stained with the
tetramer is then
determined by flow cytometry. The results indicate the number of cells in the
PBMC sample
that contain epitope-restricted CTLs, thereby readily indicating the extent of
immune response to
the 158P3D2 epitope, and thus the status of exposure to 158P3D2, or exposure
to a vaccine that
elicits a protective or therapeutic response.
Exam-ple 28
Use of Pebtide Epitopes to Evaluate Recall Responses
[0654] The peptide epitopes of the invention are used as reagents to evaluate
T cell
responses, such as acute or recall responses, in patients. Such an analysis
may be performed on
patients who have recovered from 158P3D2-associated disease or who have been
vaccinated
with a 158P3D2 vaccine.
180
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0655] For example, the class I restricted CTL response of persons who have
been
vaccinated may be analyzed. The vaccine may be any 158P3D2 vaccine. PBMC are
collected
from vaccinated individuals and HLA typed. Appropriate peptide epitopes of the
invention that,
optimally, bear supermotifs to provide cross-reactivity with multiple HLA
supertype family
members, are then used for analysis of samples derived from individuals who
bear that HLA
type.
[0656] PBMC from vaccinated individuals are separated on Ficoll-Histopaque
density
gradients (Sigma Chemical Co., St. Louis, MO), washed three times in HBSS
(GIBCO
Laboratories), resuspended in RPMI-1640 (GIBCO Laboratories) supplemented with
L-
glutamine (2mM), penicillin (50U/ml), streptoinycin (50 g/inl), and Hepes
(10mM) containing
10% heat-inactivated human AB serum (coinplete RPMI) and plated using micro
culture formats.
A synthetic peptide comprising an epitope of the invention is added at 10
g/ml to each well and
HBV core 128-140 epitope is added at 1 g/ml to each well as a source of T
cell help during the
first week of stimulation.
[0657] In the microculture format, 4 x 105 PBMC are stimulated with peptide in
8 replicate
cultures in 96-well round bottom plate in 100 l/well of complete RPMI. On
days 3 and 10, 100
1 of complete RPMI and 20 U/ml final concentration of rIL-2 are added to each
well. On day 7
the cultures are transferred into a 96-well flat-bottom plate and
restirnulated with peptide, rIL-2
and 105 irradiated (3,000 rad) autologous feeder cells. The cultures are
tested for cytotoxic
activity on day 14. A positive CTL response requires two or more of the eight
replicate cultures
to display greater than 10% specific 51Cr release, based on comparison with
non-diseased
control subjects as previously described (Rehermann, et al., Nature Med.
2:1104,1108, 1996;
Rehermann et al., J. Clin. Invest. 97:1655-1665, 1996; and Rehermann et al. J.
Clin. Invest.
98:1432-1440, 1996).
[0658] Target cell lines are autologous and allogeneic EBV-transfonned B-LCL
that are
either purchased from the American Society for Histocompatibility and
Immunogenetics (ASHI,
Boston, MA) or established from the pool of patients as described (Guilhot, et
al. J Vir ol.
66:2670-2678, 1992).
[0659] Cytotoxicity assays are performed in the following manner. Target cells
consist of
either allogeneic HLA-matched or autologous EBV-transformed B lymphoblastoid
cell line that
are incubated overnight with the synthetic peptide epitope of the invention at
10 M, and labeled
181
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
with 100 Ci of 51Cr (Amersham Corp., Arlington Heights, IL) for 1 hour after
which they are
washed four times with HBSS.
[0660] Cytolytic activity is determined in a standard 4-h, split well 51Cr
release assay using
U-bottomed 96 well plates containing 3,000 targets/well. Stimulated PBMC are
tested at
effector/target (E/T) ratios of 20-50:1 on day 14. Percent cytotoxicity is
deteimined from the
formula: 100 x [(experimental release-spontaneous release)/maximum release-
spontaneous
release)]. Maxiinum release is determined by lysis of targets by detergent (2%
Triton X-100;
Sigma Chemical Co., St. Louis, MO). Spontaneous release is <25% of maximuin
release for all
experiments.
[0661] The results of such an analysis indicate the extent to which HLA-
restricted CTL
populations have been stimulated by previous exposure to 158P3D2 or a 158P3D2
vaccine.
[0662] Similarly, Class II restricted HTL responses may also be analyzed.
Purified PBMC
are cultured in a 96-well flat bottom plate at a density of 1.5x105 cells/well
and are stimulated
with 10 g/mi synthetic peptide of the invention, whole 158P3D2 antigen, or
PHA. Cells are
routinely plated in replicates of 4-6 wells for each condition. After seven
days of culture, the
medium is reinoved and replaced with fresh medium containing l0U/ml IL-2. Two
days later, 1
Ci 3H-thymidine is added to each well and incubation is continued for an
additional 18 hours.
Cellular DNA is then harvested on glass fiber mats and analyzed for 3H-
thymidine
incorporation. Antigen-specific T cell proliferation is calculated as the
ratio of 3H-thymidine
incorporation in the presence of antigen divided by the 3H-thymidine
incorporation in the
absence of antigen.
Examble 29
Induction of Specific CTL Response In Humans
[0663] A human clinical trial for an immunogenic composition comprising CTL
and HTL
epitopes of the invention is set up as an IND Phase I, dose escalation study
and carried out as a
randomized, double-blind, placebo-controlled trial. Such a trial is designed,
for example, as
follows:
[0664] A total of about 27 individuals are enrolled and divided into 3 groups:
Group I: 3 subjects are injected with placebo and 6 subjects are injected with
5 g of
peptide composition;
182
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Group II: 3 subjects are injected with placebo and 6 subjects are injected
with 50 g peptide
coinposition;
Group III: 3 subjects are injected with placebo and 6 subjects are injected
with 500 g of
peptide composition.
[0665] After 4 weeks following the first injection, all subjects receive a
booster inoculation
at the same dosage.
[0666] The endpoints measured in this study relate to the safety and
tolerability of the
peptide composition as well as its immunogenicity. Cellular immune responses
to the peptide
composition are an index of the intrinsic activity of this the peptide
composition, and can
therefore be viewed as a measure of biological efficacy. The following
suinmarize the clinical
and laboratory data that relate to safety and efficacy endpoints.
[0667] Safety: The incidence of adverse events is monitored in the placebo and
drug
treatment group and assessed in terms of degree and reversibility.
[0668] Evaluation of Vaccine Efficacy: For evaluation of vaccine efficacy,
subjects are bled
before and after injection. Peripheral blood mononuclear cells are isolated
from fresh
heparinized blood by Ficoll-Hypaque density gradient centrifugation, aliquoted
in freezing
media and stored frozen. Samples are assayed for CTL and HTL activity.
[0669] The vaccine is found to be both safe and efficacious.
Example 30
Phase II Trials In Patients Expressing 158P3D2
[0670] Phase II trials are performed to study the effect of administering the
CTL-HTL
peptide compositions to patients having cancer that expresses 158P3D2. The
main objectives of
the trial are to deteimine an effective dose and regimen for inducing CTLs in
cancer patients that
express 158P3D2, to establish the safety of inducing a CTL and HTL response in
these patients,
and to see to what extent activation of CTLs improves the clinical picture of
these patients, as
manifested, e.g., by the reduction and/or shrinking of lesions. Such a study
is designed, for
example, as follows:
[0671] The studies are performed in inultiple centers. The trial design is an
open-label,
uncontrolled, dose escalation protocol wherein the peptide conlposition is
administered as a
single dose followed six weeks later by a single booster shot of the same
dose. The dosages are
50, 500 and 5,000 micrograms per injection. Drug-associated adverse effects
(severity and
reversibility) are recorded.
183
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0672] There are three patient groupings. The first group is injected with 50
micrograms of
the peptide composition and the second and third groups with 500 and 5,000
micrograins of
peptide composition, respectively. The patients within each group range in age
from 21-65 and
represent diverse ethnic backgrounds. All of them have a tumor that expresses
158P3D2.
[0673] Clinical manifestations or antigen-specific T-cell responses are
monitored to assess
the effects of administering the peptide compositions. The vaccine composition
is found to be
both safe and efficacious in the treatment of 158P3D2-associated disease.
Example 31
Induction of CTL Responses Using a Prime Boost Protocol
[0674] A prime boost protocol similar in its underlying principle to that used
to confirm the
efficacy of a DNA vaccine in transgenic mice, such as described above in the
Example entitled
"The Plasmid Construct and the Degree to Which It Induces Immunogenicity," can
also be used
for the administration of the vaccine to humans. Such a vaccine regimen can
include an initial
administration of, for example, naked DNA followed by a boost using
recombinant virus
encoding the vaccine, or recombinant protein/polypeptide or a peptide mixture
administered in
an adjuvant.
[0675] For example, the initial immunization may be performed using an
expression vector,
such as that constructed in the Example entitled "Construction of "Minigene"
Multi-Epitope
DNA Plasmids" in the fonn of naked nucleic acid administered IM (or SC or ID)
in the amounts
of 0.5-5 mg at multiple sites. The nucleic acid (0.1 to 1000 g) can also be
administered using a
gene gun. Following an incubation period of 3-4 weeks, a booster dose is then
administered.
The booster can be recombinant fowlpox virus administered at a dose of 5-107
to 5x109 pfu. An
alternative recombinant virus, such as an MVA, canarypox, adenovirus, or adeno-
associated
virus, can also be used for the booster, or the polyepitopic protein or a
mixture of the peptides
can be administered. For evaluation of vaccine efficacy, patient blood samples
are obtained
before immunization as well as at intervals following administration of the
initial vaccine and
booster doses of the vaccine. Peripheral blood mononuclear cells are isolated
from fresh
hepariiiized blood by Ficoll-Hypaque density gradient centrifugation,
aliquoted in freezing
media and stored fiozen. Samples are assayed for CTL and HTL activity.
[0676] Analysis of the results indicates that a magnitude of response
sufficient to achieve a
therapeutic or protective immunity against 158P3D2 is generated.
184
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Example 32
Administration of Vaccine Compositions Using Dendritic Cells (DC)
[0677] Vaccines comprising peptide epitopes of the invention can be
administered using
APCs, or "professional" APCs such as DC. In this example, peptide-pulsed DC
are
administered to a patient to stimulate a CTL response in vivo. In this method,
dendritic cells are
isolated, expanded, and pulsed with a vaccine comprising peptide CTL and HTL
epitopes of the
invention. The dendritic cells are infused back into the patient to elicit CTL
and HTL responses
in vivo. The induced CTL and HTL then destroy or facilitate destruction,
respectively, of the
target cells that bear the 158P3D2 protein from which the epitopes in the
vaccine are derived.
[0678] For example, a cocktail of epitope-comprising peptides is administered
ex vivo to
PBMC, or isolated DC therefrom. A pharmaceutical to facilitate harvesting of
DC can be used,
such as ProgenipoietinTM (Monsanto, St. Louis, MO) or GM-CSF/IL-4. After
pulsing the DC
with peptides, and prior to reinfusion into patients, the DC are washed to
remove unbound
peptides.
[0679] As appreciated clinically, and readily determined by one of skill based
on clinical
outcomes, the number of DC reinfused into the patient can vary (see, e.g.,
Nature Med. 4:328,
1998; Nature Med. 2:52, 1996 and Prostate 32:272, 1997). Although 2-50 x 106
DC per patient
are typically administered, larger number of DC, such as 107 or 108 can also
be provided. Such
cell populations typically contain between 50-90% DC.
[0680] In some embodiments, peptide-loaded PBMC are injected into patients
without
purification of the DC. For example, PBMC generated after treatinent with an
agent such as
ProgenipoietinTM are injected into patients without purification of the DC.
The total number of
PBMC that are administered often ranges from 108 to 1010. Generally, the cell
doses injected
into patients is based on the percentage of DC in the blood of each patient,
as determined, for
example, by immunofluorescence analysis with specific anti-DC antibodies.
Thus, for example,
if ProgenipoietinTM mobilizes 2% DC in the peripheral blood of a given
patient, and that patient
is to receive 5 x 106 DC, then the patient will be injected with a total of
2.5 x 108 peptide-loaded
PBMC. The percent DC mobilized by an agent such as ProgenipoietinTM is
typically estimated
to be between 2-10%, but can vary as appreciated by one of skill in the art.
185
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Ex vivo activation of CTL/HTL responses
[0681] Alternatively, ex vivo CTL or HTL responses to 158P3D2 antigens can be
induced by
incubating, in tissue culture, the patient's, or genetically compatible, CTL
or HTL precursor cells
together with a source of APC, such as DC, and immunogenic peptides. After an
appropriate
incubation time (typically about 7-28 days), in which the precursor cells are
activated and
expanded into effector cells, the cells are infused into the patient, where
they will destroy (CTL)
or facilitate destruction (HTL) of their specific target cells, i.e., tumor
cells.
Example 33
An Alternative Method of Identifying; and Confirming Motif-Bearing Peptides
[0682] Another method of identifying and confirming motif-bearing peptides is
to elute
them from cells bearing defined MHC molecules. For example, EBV transformed B
cell lines
used for tissue typing have been extensively characterized to determine which
HLA molecules
they express. In certain cases these cells express only a single type of HLA
molecule. These
cells can be transfected with nucleic acids that express the antigen of
interest, e.g., 158P3D2.
Peptides produced by endogenous antigen processing of peptides produced as a
result of
transfection will then bind to HLA molecules within the cell and be
transported and displayed on
the cell's surface. Peptides are then eluted from the HLA molecules by
exposure to mild acid
conditions and their amino acid sequence determined, e.g., by mass spectral
analysis (e.g., Kubo
et al., J. Ilnnaunol. 152:3913, 1994). Because the majority of peptides that
bind a particular
HLA molecule are motif-bearing, this is an alternative modality for obtaining
the motif-bearing
peptides correlated with the particular HLA molecule expressed on the cell.
[0683] Alternatively, cell lines that do not express endogenous HLA molecules
can be
transfected with an expression construct encoding a single HLA allele. These
cells can then be
used as described, i.e., they can then be transfected with nucleic acids that
encode 158P3D2 to
isolate peptides corresponding to 158P3D2 that have been presented on the cell
surface.
Peptides obtained from such an analysis will bear motif(s) that correspond to
binding to the
single HLA allele that is expressed in the cell.
[0684] As appreciated by one in the art, one can perform a similar analysis on
a cell bearing
more than one HLA allele and subsequently determine peptides specific for each
HLA allele
expressed. Moreover, one of skill would also recognize that means other than
transfection, such
as loading with a protein antigen, can be used to provide a source of antigen
to the cell.
186
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Example 34
Comblementary Polynucleotides
[0685] Sequences complementary to the 158P3D2-encoding sequences or any parts
thereof,
are used to detect, decrease, or inhibit expression of naturally occurring
158P3D2. Although use
of oligonucleotides comprising from about 15 to 30 base pairs is described,
essentially the same
procedure is used with smaller or with larger sequence fragments. Appropriate
oligonucleotides
are designed using, e.g., OLIGO 4.06 software (National Biosciences) and the
coding sequence
of 158P3D2. To inhibit transcription, a complementary oligonucleotide is
designed from the
most unique 5' sequence and used to prevent promoter binding to the coding
sequence. To
inhibit translation, a complementary oligonucleotide is designed to prevent
ribosomal binding to
a 158P3D2-encoding transcript.
Example 35
Purification ofNaturally-occurriniz or Recombinant 158P3D2
Using 158P3D2-Specific Antibodies
[0686] Naturally occurring or recombinant 158P3D2 is substantially purified by
iminunoaffinity chromatography using antibodies specific for 158P3D2. An
immunoaffinity
column is constructed by covalently coupling anti-158P3D2 antibody to an
activated
chromatographic resin, such as CNBr-activated SEPHAROSE (Amersham Pharmacia
Biotech).
After the coupling, the resin is blocked and washed according to the
manufacturer's instructions.
[0687] Media containing 158P3D2 are passed over the immunoaffinity column, and
the
column is washed under conditions that allow the preferential absorbance of
158P3D2 (e.g.,
high ionic strength buffers in the presence of detergent). The column is
eluted under conditions
that disrupt antibody/158P3D2 binding (e.g., a buffer of pH 2 to pH 3, or a
high concentration of
a chaotrope, such as urea or thiocyanate ion), and GCR.P is collected.
Example 36
Identification of Molecules Which Interact with 158P3D2
[0688] 158P3D2, or biologically active fragments thereof, are labeled with 121
1 Bolton-
Hunter reagent. (See, e.g., Bolton et al. (1973) Biochein. J. 133:529.)
Candidate molecules
previously arrayed in the wells of a multi-well plate are incubated with the
labeled 158P3D2,
washed, and any wells with labeled 158P3D2 complex are assayed. Data obtained
using
187
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
different concentrations of 158P3D2 are used to calculate values for the
number, affinity, and
association of 158P3D2 with the candidate molecules.
Examble 37
In Vivo Assay for 158P3D2 Tumor Growth Promotion
In vivo assay of 3T3 cell growth by recombinant expression of 158P3D2.
[0689] To address the determination of 158P3D2 to accelerate the growth of non-
tuinorigenic cells in an in vivo mouse model, non-transformed 3T3 cells are
prepared by
infection with either a virus containing an empty vector control (Neo gene
alone) or with a
vector containing the 158P3D2 full-length gene. 3T3 cells are selected for
survival in G-418,
and expression of 158P3D2 confirined by Northern blot analysis. To assess the
growth of these
cells, 1 x 106 158P3D2 expressing 3T3 cells or 1 x 106 Neo control are mixed
with Matrigel ,
then injected intratibially or subcutaneously in SCID mice and allowed to grow
for 30 days. The
growth of these cells is assessed on day 30 by visual inspection and by
necropsy. The 158P3D2
expressing 3T3 cells show a potent effect in coinparison to the 3T3-Neo cells,
indicating that the
158P3D2 protein enhanced the growth of the cells in Matrigel . 158P3D2
promotes the growth
of non-tumorigenic cells and provides a growth advantage in vivo that mimics
the role of this
protein in human malignancies.
Examble 38
158P3D2 Monoclonal Antibody-mediated Inhibition of Bladder, Lung, Colon
and Breast and other Tumors In Vivo
[0690] The significant expression of 158P3D2 in cancer tissues, together with
its restrictive
expression in normal tissues makes 158P3D2 a good target for antibody therapy.
Similarly,
158P3D2 is a target for T cell-based immunotherapy. Thus, the therapeutic
efficacy of anti-
158P3D2 MAbs in human bladder cancer xenograft mouse models is evaluated by
using
recombinant cell lines such as J82-158P3D2 (see, e.g., Kaighn, M.E., et al.,
Invest Urol, 1979.
17(1): p. 16-23), as well as human bladder xenograft models (SCaBER).
[0691] Antibody efficacy on tumor growth and metastasis formation is studied,
e.g., in a
mouse orthotopic bladder cancer xenograft model. The antibodies can be
unconjugated, as
discussed in this Example, or can be conjugated to a therapeutic modality (see
below), as
appreciated in the art. Anti-158P3D2 MAbs inhibit formation of bladder
xenografts. Anti-
188
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
158P3D2 MAbs retard the growth of established orthotopic tumors and prolong
survival of
tumor-bearing mice. MAb effects on tumor growth in mouse models support the
utility of anti-
158P3D2 MAbs in the treatment of local and advanced stages of bladder cancer
(see, e.g.,
Saffran, D., 2001, et al., PNAS 10:1073-1078).
[0692] Administration of the anti-158P3D2 MAbs leads to retardation of
established
orthotopic tumor growth and inhibition of metastasis to distant sites,
resulting in a significant
prolongation in the survival of tumor-bearing mice. Therefore, 158P3D2 is an
attractive target
for iminunotherapy, and anti- 1 58P3D2 MAbs have therapeutic potential for the
treatment of
local and metastatic cancer. This example demonstrates that unconjugated
158P3D2
monoclonal antibodies are effective to inhibit the growth of human bladder
tuinor xenografts
grown in SCID mice; accordingly, a coinbination of such efficacious MAbs is
also effective.
MAb-toxin conjugates
[0693] Another embodiment of MAb therapy is through the use of toxin
conjugation of
MAbs for targeted delivery of cytotoxic agents to cells expressing the protein
target. Major
advances have been made in the clinical application of MAb toxin conjugates
with the
developinent of Mylotarg for acute myeloid leukeinia (Bross, P.F., et al.,
2001, Clin. Cancer
Res. 7:1490-1496). Mylotarg is a humanized MAb directed to CD33 which is
conjugated to a
highly potent DNA-alkylating agent (calichemicin) via an acid labile hydrazone
bond (Hamann,
P.R., et al., 2002, Bioconjug. Chem. 13:40-46; ibid., 13:47-58). Additional
toxins for MAb
conjugation in development include maytansinoid, doxorubicin, taxoids and the
potent synthetic
dolastatin 10 analogs auristatin E and monomethylauristatin E (Doronina, S.O.,
et al., 2003,
Nature Biotech. 21:778-784; Ross, S., et al., 2002, Cancer Res. 62:2546-2553;
Francisco, J.A.,
et el., 2003, Blood 102 :1458-1465 ; Mao, W., et al., 2004, Cancer Res. 64:781-
788). Such
applications have potential to deliver a cytotoxic agent to cells expressing
the protein target of
the MAb. Internalization of the target protein upon MAb binding is important
for toxin delivery,
and the mechanism spares the non-targeted tissues from the potentially harmful
effects of the
cytotoxic agent.
[0694] 158P3D2 MAbs conjugated to toxins are used to induce cell killing in
vitro using
established protocols for cytotoxicity assays and clonogenic assays (Doronina,
S.O., et al., 2003,
Nature Biotech. 21:778-784; Mao, W., et al., 2004, Cancer Res. 64:781-788).
Toxin conjugated
anti-158P3D2 'MAbs induce cytotoxicity of cells expressing endogenous 158P3D2
(SCaBER
cells) and recombinant 158P3D2 (PC3-158P3D2, 3T3-158P3D2, Rat-1-158P3D2 and
B300.19-
158P3D2). This methodology allows confirmation that the toxin conjugated MAb
is functional
189
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
against cells expressing the 158P3D2 protein on their surface versus those
that do not express
the target.
[0695] The MAb toxin conjugates are tested for their ability to inhibit tumor
growth in vivo.
Antibody efficacy on tumor growth and metastasis formation is studied, e.g.,
in a mouse
orthotopic bladder cancer xenograft model, a mouse lung cancer xenograft
model, or mouse
colon or breast cancer xenograft model. Administration of the anti- 15 8P3D2
MAbs led to
retardation of established orthotopic tumor growth and inhibition of
metastasis to distant sites,
resulting in a significant prolongation in the survival of tumor-bearing mice.
These studies
indicate that 15SP3D2 is an attractive target for iminunotherapy and
demonstrate the therapeutic
potential of toxin-conjugated anti-158P3D2 MAbs for the treatment of local and
metastatic
cancer. This example demonstrates that toxin-conjugated 158P3D2 monoclonal
antibodies are
effective to inhibit the growth of human bladder, lung, breast and colon tumor
xenografts grown
in SCID mice; accordingly, a combination of such efficacious MAbs is also
effective. The
methodology allows the targeted delivery of a cytotoxin using a plasma stable
linker in a MAb-
toxin conjugate. Such a mechanism of action reduces the potential harmful
effects of the toxin
on non-targeted tissues.
Tumor inhibition using multiple unconjugated or toxin-conjugated 158P3D2 MAbs
Materials and Methods
158P3D2 Monoclonal Antibodies:
[0696] Monoclonal antibodies were raised against 158P3D2 as described in the
Example
entitled "Generation of 158P3D2 Monoclonal Antibodies (MAbs)." The antibodies
are
characterized by ELISA, Western blot, FACS, and immunoprecipitation for their
capacity to
bind 158P3D2. Epitope mapping data for the anti-158P3D2 MAbs, as determined by
ELISA
and Western analysis, recognize epitopes on the 158P3D2 protein.
Immunohistochemical
analysis of bladder cancer tissues and cells with these antibodies is
performed.
[0697] The monoclonal antibodies are purified from ascites or hybridoma tissue
culture
supernatants by Protein-G Sepharose chromatography, dialyzed against PBS,
filter sterilized,
and stored at -20 C. Protein determinations are performed by a Bradford assay
(Bio-Rad,
Hercules, CA). A therapeutic monoclonal antibody or a cocktail comprising a
mixture of
individual monoclonal antibodies is prepared and used for the treatment of
mice receiving
subcutaneous or orthotopic injections of SCaBER or J82-158P3D2 tumor
xenografts.
190
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0698] The MAbs to 158P3D2 are conjugated to various different toxins (listed
above) using
any of a variety of methods described elsewhere in the art (Hamann, P.R., et
al., 2002,
Bioconjug. Chem. 13:40-46; ibid., 13:47-58; Doronina, S.O., et al., 2003,
Nature Biotech.
21:778-784; Ojima, I., et al. 2002, J. Med. Chem. 45:5620-5623; Dubowchik, G.
M., et al.,
2002, Bioconjug. Chem. 13:855-869; King, H. D., 2002, J. Med. Chem 45:4336-
4343; Ross, S.,
et al., 2002, Cancer Res. 62:2546-2553; Francisco, J.A., et el., 2003, Blood
102 :1458-1465 ;
Mao, W., et al., 2004, Cancer Res. 64:781-788).
Cell Lines
[0699] The bladder carcinoma cell lines, J82 and SCaBER, as well as the
fibroblast line NIH
3T3 (American Type Culture Collection) are maintained in media supplemented
with L-
glutamine and 10% FBS. J82-158P3D2 and 3T3-158P3D2 cell populations are
generated by
retroviral gene transfer as described in Hubert, R.S., et al., Proc. Natl.
Acad. Sci. USA, 1999,
96(25):14523.
Xenogyaft Mouse Models
[0700] Subcutaneous (s.c.) tumors are generated by injection of 1 x 106 cancer
cells mixed at
a 1:1 dilution with Matrigel (Collaborative Research) in the right flank of
male SCID mice.
To test antibody efficacy on tumor formation, i.p. antibody injections are
started on the same
day as tumor-cell injections. As a control, mice are injected with either
purified mouse IgG
(ICN) or PBS; or a purified monoclonal antibody that recognizes an irrelevant
protein not
expressed in human cells. Tumor sizes are determined by caliper measurements,
and the tumor
volume is calculated as: Length x Width x Height. Mice with s.c. tumors
greater than 1.5 cm in
diameter are sacrificed.
[0701] Orthotopic injections are performed under anesthesia by using
ketainine/xylazine.
For bladder orthotopic studies, an incision is made through the abdomen to
expose the bladder,
and tuinor cells (5 x 105) mixed with Matrigel are injected into the bladder
wall in a 10- l
voluine. To monitor tumor growth, mice are palpated and blood is collected on
a weekly basis
to measure BTA levels. For prostate orthopotic models, an incision is made
through the
abdominal muscles to expose the bladder and seminal vesicles, which then are
delivered through
the incision to expose the dorsal prostate. Tumor cells, e.g., SCaBER cells (5
x 105) mixed with
Matrigel are injected into the bladder in a 10-gl volume (Yoshida Y et al,
Anticancer Res.
1998, 18:327; Ahn et al, Tumor Biol. 2001, 22:146). The mice are segregated
into groups for
the appropriate treatments, with anti-158P3D2 or control MAbs being injected
i.p.
191
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Anti-158P3D2 MAbs Inhibit Growth of 158P3D2-Expressin Xenojzraft-Cancer Tumors
[0702] The effect of anti-158P3D2 MAbs on tumor formation is tested on the
growth and
progression of bladder cancer xenografts using SCaBER and J82-158P3D2
orthotopic models.
As compared with the s.c. tumor model, the orthotopic model, which requires
injection of tumor
cells directly in the mouse bladder, and prostate, respectively, results in a
local tumor growth,
development of metastasis in distal sites, deterioration of mouse health, and
subsequent death
(Saffran, D., et al., PNAS supra; Fu, X., et al., Int J Cancer, 1992. 52(6):
p. 987-90; Kubota, T.,
J Cell Biochem., 1994. 56(1): p. 4-8). The features make the orthotopic model
more
representative of human disease progression and allowed us to follow the
therapeutic effect of
MAbs on clinically relevant end points.
[0703] ' Accordingly, tuinor cells are injected into the mouse bladder, or
lung, and 2 days
later, the mice are segregated into two groups and treated with either: a) 200-
500 g of anti-
158P3D2 MAb, or b) PBS three times per week for two to five weeks.
[0704] A major advantage of the orthotopic cancer models is the ability to
study the
development of metastases. Formation of metastasis in mice bearing established
orthotopic
tumors is studies by IHC analysis on lung sections using an antibody against a
tumor-specific
cell-surface protein such as anti-cytokeratin 20 for bladder cancer models
(Lin S et al, Cancer
Detect Prev. 2001;25:202).
[0705] Mice bearing established orthotopic tumors are administered 1000 g
injections of
either anti-158P3D2 MAb or PBS over a 4-week period. Mice in both groups are
allowed to
establish a high tumor burden, to ensure a high frequency of metastasis
formation in mouse
lungs. Mice then are killed and their bladders, livers, bone and lungs are
analyzed for the
presence of tuinor cells by IHC analysis.
[0706] Anti-158P3D2 antibodies inhibit the formation of tumors, retard the
growth of
already established tumors, and prolong the survival of treated mice.
Moreover, anti-158P3D2
MAbs demonstrate a dramatic iiihibitory effect on the spread of local bladder
tumors to distal
sites, even in the presence of a large tumor burden. Thus, anti-158P3D2 MAbs
are efficacious
on major clinically relevant end points (tumor growth), prolongation of
survival, and health.
Example 39
Therapeutic and Diap-llostic use of Anti-158P3D2 Antibodies in Humans.
[0707] Anti-158P3D2 monoclonal antibodies are safely and effectively used for
diagnostic,
prophylactic, prognostic and/or therapeutic purposes in humans. Western blot
and
192
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
immunohistochemical analysis of cancer tissues and cancer xenografts with anti-
158P3D2 mAb
show strong extensive staining in carcinoma but significantly lower or
undetectable levels in
normal tissues. Detection of 158P3D2 in carcinoma and in metastatic disease
demonstrates the
usefulness of the mAb as a diagnostic and/or prognostic indicator. Anti-
158P3D2 antibodies are
therefore used in diagnostic applications such as immunohistochemistry of
kidney biopsy
specimens to detect cancer from suspect patients.
[0708] As determined by flow cytometry, anti-158P3D2 mAb specifically binds to
carcinoma cells. Thus, anti-158P3D2 antibodies are used in diagnostic whole
body imaging
applications, such as radioimmunoscintigraphy and radioimmunotherapy, (see,
e.g., Potamianos
S., et. al. Anticancer Res 20(2A):925-948 (2000)) for the detection of
localized and metastatic
cancers that exhibit expression of 158P3D2. Shedding or release of an
extracellular domain of
15 8P3D2 into the extracellular milieu, such as that seen for alkaline
phosphodiesterase B 10
(Meerson, N. R., Hepatology 27:563-568 (1998)), allows diagnostic detection of
158P3D2 by
anti-158P3D2 antibodies in seruin and/or urine samples from suspect patients.
[0709] Anti-158P3D2 antibodies that specifically bind 158P3D2 are used in
therapeutic
applications for the treatment of cancers that express 158P3D2. Anti-158P3D2
antibodies are
used as an unconjugated modality and as conjugated form in which the
antibodies are attached to
one of various therapeutic or imaging modalities well known in the art, such
as a prodrugs,
enzymes or radioisotopes. In preclinical studies, unconjugated and conjugated
anti-158P3D2
antibodies are tested for efficacy of tumor prevention and growth inhibition
in the SCID mouse
cancer xenograft models, e.g., kidney cancer models AGS-K3 and AGS-K6, (see,
e.g., the
Example entitled "158P3D2 Monoclonal Antibody-mediated Inhibition of Bladder
and Lung
Tumors In Vivo "). Either conjugated and unconjugated anti-158P3D2 antibodies
are used as a
therapeutic modality in human clinical trials either alone or in combination
with other treatments
as described in following Examples.
Example 40
Human Clinical Trials for the Treatment and Diagnosis of
Human Carcinomas through use of Human Anti-158P3D2 Antibodies In vivo
[0710] Antibodies are used in accordance with the present invention which
recognize an
epitope on 158P3D2, and are used in the treatment of certain tumors such as
those listed in
Table I. Based upon a number of factors, including 158P3D2 expression levels,
tumors such as
193
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
those listed in Table I are presently preferred indications. In connection
with each of these
indications, three clinical approaches are successfully pursued.
[0711] Adjunctive therapy: In adjunctive therapy, patients are treated with
anti-158P3D2
antibodies in combination with a chemotherapeutic or antineoplastic agent
and/or radiation
therapy. Primary cancer targets, such as those listed in Table I, are treated
under standard
protocols by the addition anti-158P3D2 antibodies to standard first and second
line therapy.
Protocol designs address effectiveness as assessed by reduction in tumor mass
as well as the
ability to reduce usual doses of standard chemotherapy. These dosage
reductions allow
additional and/or prolonged therapy by reducing dose-related toxicity of the
chemotherapeutic
agent. Anti-158P3D2 antibodies are utilized in several adjunctive clinical
trials in combination
with the chemotherapeutic or antineoplastic agents adriamycin (advanced
prostrate carcinoma),
cisplatin (advanced head and neck and lung carcinomas), taxol (breast cancer),
and doxorubicin
(preclinical).
[0712] Monotherapy: In connection with the use of the anti-158P3D2 antibodies
in
monotlierapy of tumors, the antibodies are administered to patients without a
chemotherapeutic
or antineoplastic agent. In one embodiment, monotherapy is conducted
clinically in end stage
cancer patients with extensive metastatic disease. Patients show some disease
stabilization.
Trials demonstrate an effect in refractory patients with cancerous tumors.
[0713] Imaging Agent: Through binding a radionuclide (e.g., iodine or yttriuin
(I131, Y9o) to
anti-158P3D2 antibodies, the radiolabeled antibodies are utilized as a
diagnostic and/or imaging
agent. In such a role, the labeled antibodies localize to both solid tumors,
as well as, metastatic
lesions of cells expressing 158P3D2. In connection with the use of the anti-
158P3D2 antibodies
as imaging agents, the antibodies are used as an adjunct to surgical treatment
of solid tumors, as
both a pre-surgical screen as well as a post-operative follow-up to determine
what tumor remains
and/or returns. In one embodiment, a(111 In)-158P3D2 antibody is used as an
imaging agent in a
Phase I human clinical trial in patients having a carcinoma that expresses
158P3D2 (by analogy
see, e.g., Divgi et al. J. Natl. Cancer Inst. 83:97-104 (1991)). Patients are
followed with
standard anterior and posterior gamma camera. The results indicate that
primary lesions and
metastatic lesions are identified.
Dose and Route of Administration
[0714] As appreciated by those of ordinary skill in the art, dosing
considerations can be
determined through comparison with the analogous products that are in the
clinic. Thus, anti-
158P3D2 antibodies can be administered with doses in the range of 5 to 400
mg/m 2, with the
194
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
lower doses used, e.g., in connection with safety studies. The affinity of
anti-158P3D2
antibodies relative to the affinity of a known antibody for its target is oile
parameter used by
those of skill in the art for determining analogous dose regimens. Further,
anti-158P3D2
antibodies that are fully human antibodies, as coinpared to the chimeric
antibody, have slower
clearance; accordingly, dosing in patients with such fully huinan anti-158P3D2
antibodies can
be lower, perhaps in the range of 50 to 300 mg/m2 , and still remain
efficacious. Dosing in
mg/m2 , as opposed to the conventional measurement of dose in mg/kg, is a
measurement based
on surface area and is a convQnient dosing measurement that is designed to
include patients of
all sizes from infants to adults.
[0715] Three distinct delivery approaches are useful for delivery of anti-
158P3D2
antibodies. Conventional intravenous delivery is one standard delivery
technique for many
tumors. However, in connection with tumors in the peritoneal cavity, such as
tumors of the
ovaries, biliary duct, other ducts, and the like, intraperitoneal
administration may prove
favorable for obtaining higli dose of antibody at the tumor and to also
minimize antibody
clearance. In a similar manner, certain solid tumors possess vasculature that
is appropriate for
regional perfusion. Regional perfusion allows for a high dose of antibody at
the site of a tumor
and minimizes short term clearance of the antibody.
Clinical Development Plan (CDP)
[0716] Overview: The CDP follows and develops treatments of anti-158P3D2
antibodies in
connection with adjunctive therapy, monotherapy, and as an imaging agent.
Trials initially
demonstrate safety and thereafter confirm efficacy in repeat doses. Trails are
open label
comparing standard chemotherapy with standard therapy plus anti-158P3D2
antibodies. As will
be appreciated, one criteria that can be utilized in connection with
enrollment of patients is
158P3D2 expression levels in their tumors as determined by biopsy.
[0717] As with any protein or antibody infusion-based therapeutic, safety
concerns are
related primarily to (i) cytokine release syndrome, i.e., hypotension, fever,
shaking, chills; (ii)
the development of an immuriogenic response to the material (i.e., development
of human
antibodies by the patient to the antibody therapeutic, or HAHA response); and,
(iii) toxicity to
normal cells that express 158P3D2. Standard tests and follow-up are utilized
to monitor each of
these safety concerns. Anti-158P3D2 antibodies are found to be safe upon human
administration.
195
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Examble 41
Human Clinical Trial Adjunctive Therapy with
Human Anti-158P3D2 Antibody and Chemotherapeutic Agent
[0718] A phase I human clinical trial is initiated to assess the safety of six
intravenous doses
of a human anti-158P3D2 antibody in connection with the treatment of a solid
tumor, e.g., a
cancer of a tissue listed in Table I. In the study, the safety of single doses
of anti-158P3D2
antibodies when utilized as an adjunctive therapy to an antineoplastic or
cheinotherapeutic agent
as defined herein, such as, without limitation: cisplatin, topotecan,
doxorubicin, adriamycin,
taxol, or the like, is assessed. The trial design includes delivery of six
single doses of an anti-
158P3D2 antibody with dosage of antibody escalating from approximately about
25 Mg/M 2 to
about 275 Mg/M 2 over the course of the treatment in accordance with the
following schedule:
Day 0 Day 7 Day 14 Day 21 Day 28 Day 35
mAb Dose 25 75 125 175 225 275
mg/in 2 mg/m 2 Mg/M 2 Mg/M 2 Mg/M 2 mg/m 2
Chemotherapy + + + + + +
(standard dose)
[0719] Patients are closely followed for one-week following each
administration of antibody
and chemotherapy. In particular, patients are assessed for the safety concerns
mentioned above:
(i) cytokine release syndrome, i.e., hypotension, fever, shaking, cllills;
(ii) the development of an
immunogenic response to the material (i.e., development of human antibodies by
the patient to
the human antibody therapeutic, or HAHA response); and, (iii) toxicity to
normal cells that
express 158P3D2. Standard tests and follow-up are utilized to monitor each of
these safety
concerns. Patients are also assessed for clinical outcome, and particularly
reduction in tumor
mass as evidenced by MRI or other imaging.
[0720] The anti-158P3D2 antibodies are demonstrated to be safe and
efficacious, Phase II
trials confirm the efficacy and refine optimum dosing.
196
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
Example 42
Human Clinical Trial: Monotheraby with Human Anti-158P3D2 Antibody
[0721] Anti-158P3D2 antibodies are safe in connection with the above-discussed
adjunctive
trial, a Phase II human clinical trial confirms the efficacy and optimum
dosing for monotherapy.
Such trial is accomplished, and entails the same safety and outcome analyses,
to the above-
described adjunctive trial with the exception being that patients do not
receive chemotherapy
concurrently with the receipt of doses of anti-158P3D2 antibodies.
Example 43
Human Clinical Trial: Diagnostic Imaging with Anti-158P3D2 Antibody
[0722] Once again, as the adjunctive therapy discussed above is safe within
the safety
criteria discussed above, a human clinical trial is conducted concerning the
use of anti-158P3D2
antibodies as a diagnostic imaging agent. The protocol is designed in a
substantially similar
manner to those described in the art, such as in Divgi et al. J. .Natl. Cancer
Inst. 83:97-104
(1991). The antibodies are found to be both safe and efficacious when used as
a diagnostic
modality.
Example 44
158P3D2 Functional Assays
[0723] 158P3D2 protein, and variants thereof, is a member of a family of
related proteins,
the ferlins. This family of membrane proteins is characterized by the presence
of intracellular
C2 domains, so named by their homology to a conserved protein kinase C (PKC)
inotif. The
canonical C2 domain is a 130 amino acid long Ca2+ dependent membrane targeting
inodule that
is found in proteins involved in signal transduction or membrane trafficking
(Rizo, J. and
Sudhof, T.C., J. Biol. Chem. 273, 15879-82 (1998)). The function of the C2
domain amongst
the >100 proteins identified to date varies between these proteins, however a
common feature is
that the C2 domain has been shown to bind to phospholipids, particularly
phosphatidylserine and
phosphatidylcholine. In some cases, the C2 domain may not bind to Ca2+ or to
phospholipids
but rather to other proteins (Rizo, J. and Sudhof, T.C., J. Biol. Chem. 273,
15879-82 (1998)).
158P3D2, and variants thereof, are Ca2+ binding proteins with the capacity to
bind to both
phospholipids and to proteins. The different variants of 158P3D2, which
express different
numbers of C2 domains, have different functions with respect to the unique
combinations of
expressed C2 regions.
197
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
[0724] Dysferlin is a member of this family of C2 containing proteins that has
a function in
muscle membrane repair. Human mutation of dysferlin leads to specific
autosomal recessive
muscular dystrophies (limb-girdle MD type 2B and Miyoshi myopathy) (reviewed
in Bansal, D.
and Campbell, K.P., Trends in Cell Biol. 14, 206-213). Dysferlin is localized
in the plasma
membrane of cells where it interacts with annexin Al and A2, and is also found
in vesicles.
Membrane disruption (for example in muscle) causes an increase of localized
Ca2} at the wound
site and an accumulation of vesicles containing dysferlin. The dysferlin
protein facilitates both
docking and fusion of the vesicles with the plasma membrane through
interaction with the
annexins and/or other membrane-associated proteins. Fusion between the repair
vesicles and the
plasma membrane seals the wound (Bansal, D. and Campbell, K.P., Trends in Cell
Biol. 14,
206-213).
[0725] 158P3D2 protein, and variants thereof, functions in a similar fashion
as dysferlin by
inducing repair of cellular plasma membranes following their disruption. Given
the high rate of
cell division and stress conditions such as hypoxia and reduced nutrient
supply during tumor
formation, membrane repair becomes a critical component of tumor survival.
Expression of
158P3D2, and variants thereof, on tumors provides an advantage for such cells
to grow under
stressful conditions such as hypoxia or nutrient deprivation.
[0726] The C2 domain of the lipid phosphatase/tumor suppressor PTEN is
regulated by
threonine phosphorylation (Raftopolou, M., et al., 2004, Science, 303, 1179-
81). This
phosphorylation event inhibits cell migration independent of the lipid
phosphatase activity,
which may relate to the tumor suppressive activity of PTEN. However, given the
regulation of
C2-induced function by phosphorylation, the status of that phosphorylation
event alters the
migratory capacity of the cell. 158P3D2 protein, and variants thereof, reside
in the plasma
membrane of tumor cells as C2-containing regulators of cell migration due to
alterations in the
phosphorylation status of 158P3D2. Upon phosphorylation of 158P3D2, the C2
domains
influence the migratory capacity of 158P3D2-positive tumor cells, conferring
an advantage for
them to migrate to distal sites to seek secondary growth (metastasis).
158P3D2, and variants
thereof, also bind to signal transduction proteins, providing important
signaling cascades for
tumor cells that confer a growth advantage and increased capacity for cell
migration and
adhesion. Such advantages are key elements for increased survival and
metastasis for bladder,
lung, colon and breast cancer cells.
[0727] Enhanced proliferation and entry into S-phase of tumor cells relative
to normal cells
is a hallmark of the cancer cell phenotype. To address the effect of
expression of 158P3D2 on
198
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
the proliferation rate of normal cells, two rodent cell lines (3T3 and Rat-1)
are infected with
virus containing the 158P3D2 gene and stable cells expressing 158P3D2 antigen
are derived, as
well as empty vector control cells expressing the selection marker neomycin
(Neo). The cells
are grown overnight in 0.5% FBS and then compared to cells treated with 10%
FBS. The cells
are evaluated for proliferation at 18-96 hr post-treatment by a 3H-thymidine
incorporation assay
and for cell cycle analysis by a BrdU incorporation/propidium iodide staining
assay. Rat-1 cells
expressing the 158P3D2 antigen grow effectively in low serum concentrations
(0.1%) compared
to the Rat-l-Neo cells. Similar data are obtained for the 3T3 cells expressing
158P3D2 versus
Neo only. To assess cell proliferation by another methodology, the cells are
stained with BrdU
and propidium iodide. Briefly, cells are labeled with 10 ~M BrdU, washed,
trypsinized and
fixed in 0.4% paraformaldehyde and 70% ethanol. Anti-BrdU-FITC (Pharmigen) is
added to the
cells, the cells are washed and then incubated with 10 ~ g/ml propidium iodide
for 20 min prior
to washing and analysis for fluorescence at 488 nm. An increase in labeling of
cells in S-phase
(DNA synthesis phase of the cell cycle) in 3T3 cells that express the 158P3D2
protein is
observed relative to control cells. This confirms the results of those
measured by 3H-thymidine
incorporation. Accordingly, 158P3D2 expressing cells have increased potential
for growth as
tumor cells in vivo during stress, including nutrient deprivation, hypoxia or
reduced osmolarity.
Example 45
158P3D2 RNA Interference (RNAi)
[0728] RNA interference (RNAi) technology is implemented to a variety of cell
assays
relevant to oncology. RNAi is a post-transcriptional gene silencing mechanism
activated by
double-stranded RNA (dsRNA). RNAi induces specific mRNA degradation leading to
changes
in protein expression and subsequently in gene function. In mammalian cells,
these dsRNAs
called short interfering RNA (siRNA) have the correct composition to activate
the RNAi
pathway targeting for degradation, specifically some mRNAs. See, Elbashir
S.M., et al.,
Duplexes of 2 1 -nucleotide RNAs Mediate RNA interference in Cultured
Mammalian Cells,
Nature 411(6836):494-8 (2001). Thus, RNAi technology is used successfully in
mammalian
cells to silence targeted genes.
[0729] Loss of cell proliferation control is a hallmark of cancerous cells;
thus, assessing the
role of 158P3D2 in cell survival/proliferation assays is relevant.
Accordingly, RNAi was used
to investigate the function of the 158P3D2 antigen. To generate siRNA for
158P3D2,
algorithms were used that predict oligonucleotides that exhibit the critical
molecular parameters
199
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
(G:C content, melting temperature, etc.) and have the ability to significantly
reduce the
expression levels of the 158P3D2 protein when introduced into cells.
Accordingly, one targeted
sequence for the 158P3D2 siRNA is: 5' CCTCGGCAGCCAATCAGCTAT 3' (SEQ ID NO:
104)(oligo 158P3D2.b). In accordance with this Example, 158P3D2 siRNA
compositions are
used that comprise siRNA (double stranded, short interfering RNA) that
correspond to the
nucleic acid ORF sequence of the 158P3D2 protein or subsequences thereof.
Thus, siRNA
subsequences are used in this manner are generally 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,31, 32, 33, 34, 35 or more
than 35 contiguous
RNA nucleotides in length. These siRNA sequences are complementary and non-
complementary to at least a portion of the mRNA coding sequence. In a
preferred embodiment,
the subsequences are 19-25 nucleotides in length, most preferably 21-23
nucleotides in length.
In preferred embodiments, these siRNA achieve knockdown of 158P3D2 antigen in
cells
expressing the protein and have functional effects as described below.
[0730] The selected siRNA (158P3D2.b oligo) was tested in numerous cell lines
in the
thymidine incorporation/proliferation assay (measures 3H-Thy uptake and
incorporation into
DNA). Moreover, this 158P3D2.b oligo achieved knockdown of 158P3D2 antigen in
cells
expressing the protein and had functional effects as described below using the
following
protocols.
[07311 Mammalian siRNA transfections: The day before siRNA transfection, the
different cell lines were plated in media (RPMI 1640 with 10% FBS w/o
antibiotics) at 2x103
cells/well in 80 ~1(96 well plate format) for the survival/MTS assay. In
parallel with the
158P3D2 specific siRNA oligo, the following sequences were included in every
experiment as
controls: a) Mock transfected cells with Lipofectamine 2000 (Invitrogen,
Carlsbad, CA) and
annealing buffer (no siRNA); b) Luciferase-4 specific siRNA (targeted
sequence: 5'-
AAGGGACGAAGACGAACACUUCTT-3') (SEQ ID NO: 105); and, c) Eg5 specific siRNA
(targeted sequence: 5'-AACTGAAGACCTGAAGACAATAA-3') (SEQ ID NO: 106). SiRNAs
were used at 10nM and 10 g/ml Lipofectamine 2000 final concentration.
[0732] The procedure was as follows: The siRNAs were first diluted in OPTIMEM
(serum-
free transfection media, Invitrogen) at 0.luM ~M (10-fold concentrated) and
incubated 5-10
min RT. Lipofectamine 2000 was diluted at 10 ~g/ml (10-fold concentrated) for
the total
number transfections and incubated 5-10 minutes at room temperature (RT).
Appropriate
amounts of diluted 10-fold concentrated Lipofectamine 2000 were mixed 1:1 with
diluted 10-
fold concentrated siRNA and incubated at RT for 20-30" (5-fold concentrated
transfection
200
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
solution). 20 ~ls of the 5-fold concentrated transfection solutions were added
to the respective
samples and incubated at 37 C for 96 hours before analysis.
[0733] 3H-Thymidine incorporation assay: The proliferation assay is a 3H-
thymidine
incorporation method for determining the proliferation of viable cells by
uptake and
incorporation of label into DNA.
[0734] The procedure was as follows: Cells growing in log phase are
trypsinized, washed,
counted and plated in 96-well plates at 1000-4000 cells/well in 10% FBS. After
4-8 hrs, the
media is replaced. The cells are incubated for 24-72 hrs, pulsed with 3H-Thy
at 1.5 ~ Ci/ml for
14 hrs, harvested onto a filtermat and counted in scintillation cocktail on a
Microbeta trilux or
other counter.
[0735] To address the validation of the 158P3D2 siRNA in reducing the
expression of
158P3D2 protein in cells, Cos-1 cells were transfected with pCDNA.3 vector
expressing a
Myc/His-tagged version of 158P3D2 alone (LF2k) or together with siRNA for
either CTI
(bacterial negative control) or 158P3D2 oligo (1 58P3D2.b). For additional
control, a mock
transfection was also included (No DNA). Western blot analysis using an
antibody to the Myc
tag on 158P3D2 protein showed that the 158P3D2 siRNA significantly reduced the
expression
level of 158P3D2 protein (Figure 30). These data show that the specific
158P3D2.b siRNA will
have utility to probe the function of 158P3D2 protein in cells.
[0736] In order to address the function of 158P3D2 in cells, 158P3D2 was
silenced by
transfecting the endogenously expressing 158P3D2 cell lines (SCaBER, a bladder
cancer cell
line) with the 158P3D2 specific siRNA (158P3D2.b) along with negative siRNA
controls (Luc4,
targeted sequence not represented in the human genome) and a positive siRNA
control (targeting
Eg5) (See Figure 31). SCaBER cells were shown to express 158P3D2 by Northern
blot of total
cellular RNA. The results indicated that when these cells were treated with
siRNA specifically
targeting the 158P3D2 mRNA, the resulting "158P3D2 deficient cells" showed
diminished cell
proliferation as measured by this assay (see oligo 158P3D2.b treated cells).
This effect is likely
caused by an active induction of apoptosis. The reduced viability is measured
by the decreased
uptake of labeled thyinidine.
[0737] As control, Cos-1 cells, a cell line with no detectable expression of
158P3D2 mRNA
or protein (by Western blot), was also treated with the panel of siRNAs
(including oligo
158P3D2.b) and no phenotype was observed (Figure 31). This result reflects the
fact that the
specific protein knockdown in the SCaBER cells is not a function of general
toxicity, since the
Cos-1 cells did not respond to the 158P3D2.b oligo. The differential response
of the two cell
201
1
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
lines to the Eg5 control is a reflection of differences in levels of cell
transfection and
responsiveness of the cell lines to oligo treatment (Figure 31).
[0738] Together, these data indicate that 158P3D2, and variants thereof, play
important roles
in the proliferation of cancer cells and that the lack of 158P3D2 clearly
decreases the survival
potential of these cells. It is to be noted that 158P3D2 is constitutively
expressed in many tumor
cell lines. 158P3D2 serves a role in malignancy; it expression is a primary
indicator of disease,
where such disease is often characterized by high rates of uncontrolled cell
proliferation and
diminished apoptosis. Correlating cellular phenotype with gene knockdown
following RNAi
treatments is 'important, and allows one to draw valid conclusions and rule
out toxicity or other
non-specific effects of these reagents. To this end, assays to measure the
levels of expression of
both protein and mRNA for the target after RNAi treatments are important,
including Western
blotting, FACS staining with antibody, immunoprecipitation, Northern blotting
or RT-PCR
(Taqinan or standard methods). Any phenotypic effect of the siRNAs in these
assays should be
correlated with the protein and/or mRNA knockdown levels in the same cell
lines. Knockdown
of 158P3D2 is achieved using the 158P3D2.b oligo as measured by Western
blotting and RT-
PCR analysis.
[0739] Another method to analyze 158P3D2 related cell proliferation is
performing
clonogenic assays. In these assays, a defined number of cells are plated onto
the appropriate
matrix and the number of colonies forn-ied after a period of growth following
siRNA treatment is
counted.
[0740] In 158P3D2 cancer target validation, complementing the cell
survival/proliferation
analysis with apoptosis and cell cycle profiling studies are considered. The
biochemical
hallmark of the apoptotic process is genomic DNA fragmentation, an
irreversible event that
commits the cell to die. A method to observe fragmented DNA in cells is the
immunological
detection of histone-complexed DNA fragments by an immunoassay (i.e., cell
death detection
ELISA) which measures the enrichment of histone-complexed DNA fragments (mono-
and
oligo-nucleosomes) in the cytoplasm of apoptotic cells. This assay does not
require pre-labeling
of the cells and can detect DNA degradation in cells that do not proliferate
in vitro (i.e., freshly
isolated tumor cells).
[0741] The most important effector molecules for triggering apoptotic cell
death are
caspases. Caspases are proteases that when activated cleave numerous
substrates at the carboxy-
terminal site of an aspartate residue mediating very early stages of apoptosis
upon activation.
All caspases are synthesized as pro-enzymes and activation involves cleavage
at aspartate
202
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
residues. In particular, caspase 3 seems to play a central role in the
initiation of cellular events
of apoptosis. Assays for determination of caspase 3 activation detect early
events of apoptosis.
Following RNAi treatments, Western blot detection of active caspase 3 presence
or proteolytic
cleavage of products (i.e., PARP) found in apoptotic cells further support an
active induction of
apoptosis. Because the cellular mechanisms that result in apoptosis are
complex, each has its
advantages and limitations. Consideration of other criteria/endpoints such as
cellular
morphology, chromatin condensation, membrane blebbing, apoptotic bodies help
to further
support cell death as apoptotic. Since not all the gene targets that regulate
cell growth are anti-
apoptotic, the DNA content of permeabilized cells is measured to obtain the
profile of DNA
content or cell cycle profile. Nuclei of apoptotic cells contain less DNA due
to the leaking out to
the cytoplasm (sub-Gl population). In addition, the use of DNA stains (i.e.,
propidium iodide)
also differentiates between the different phases of the cell cycle in the cell
population due to the
presence of different quantities of DNA in GO/G1, S and G2/M. In these studies
the
subpopulations can be quantified.
[0742] For the 158P3D2 gene, RNAi studies facilitate the understanding of the
contribution
of the gene product in cancer pathways. Such active RNAi molecules have use in
identifying
assays to screen for mAbs that are active anti-tumor therapeutics. Further,
siRNA are
administered as therapeutics to cancer patients for reducing the malignant
growth of several
cancer types, including those listed in Table 1. When 158P3D2 (and variants)
plays a role in
cell survival, cell proliferation, tumorigenesis, or apoptosis, it is used as
a target for diagnostic,
prognostic, preventative and/or therapeutic purposes.
Example 46
Homology Comparison of 158P3D2 to known Sequences
[0743] The 158P3D2 v.17 protein has 2036 amino acids with a calculated
molecular weight
of 227.6 kDa and a pI of 5.64. 158P3D2 is predicted to be a predominantly
cytoplasmic protein
with plasma membrane association. 158P3D2 contains a single transmeinbrane
region from
amino acids 2000-2022 with high probability that the amino-terminus resides
outside, consistent
with the topology of a type I transmembrane protein. Based on the TMpred
algorithin of
Hofinann and Stoffel which utilizes TMBASE (K. Hofinann, W. Stoffel, TMBASE -
A
database of membrane spanning protein segments Biol. Chem. Hoppe-Seyler
374:166, 1993),
158P3D2 contains a primary transmembrane region froin amino acids 2003-2020
(contiguous
amino acids with values greater than 0 on the plot have high probability of
being transmembrane
203
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
regions) with an orientation in which the amino terminus resides inside and
the carboxyl
terminus outside (type II). Another transmembrane algorithm indicated that
158P3D2 contains a
transmembrane domain from amino acids 2003-2022, with the N-terminus oriented
intracellularly consistent with a type II topology (HMMTop). The transmembrane
prediction
algorithms are accessed through the ExPasy molecular biology server.
[0744] By use of the PubMed website of the N.C.B.I., it was found at the
protein level that
158P3D2 v.17 shows 60% homology and 40% identity with human otoferlin, a
member of the
ferlin family of plasma membrane proteins. Further, 158P3D2 v.17 shows 50%
homology and
30% identity with dysferlin, another member of the ferlin family, and 80%
homology and 75%
identity with the murine gene Fer-l-like 4.
[0745] The ferlins are a family of transmembrane proteins that have function
in membrane
trafficking, including the repair of cell membranes. Mutation of human
otoferlin leads to a
specific form of nonsyndromic autosomal recessive deafness (DFNB9) and
mutations in
dysferlin lead to two subtypes of muscular dystrophies (reviewed in Bansal, D.
and Campbell,
K.P., Trends in Cell Biol. 14, 206-213). The major feature of the ferlin
family includes multiple
C2 domains (conserved PKC homologous region) that function in both Ca2+
dependent and Ca2+
independent phospholipid binding, as well as protein binding. The mechanism of
action for
dysferlin includes the repair of muscle cell membrane disruptions through
dysferlin-containing
cell vesicles. Such vesicles are tethered to the site of inembrane tears
(where Ca2+
concentrations are increased) via dysferlin molecules that interact with
plasma membrane
associated annexin Al and annexin A2 molecules. The vesicles provide the lipid
bilayer
material to seal the wound.
[0746] 158P3D2 associates with cell vesicles and the plasma membrane thereby
providing a
means for tumor cells to repair membranes during tumor growth and metastasis.
Such a
functional advantage can be exemplified by the increased stress that tumors
experience,
including increased hypoxia, decreased nutrition and increases in free radical
fonnation. These
stresses can alter membrane integrity, thereby increasing the need for robust
plasma membrane
repair mechanisms. In addition, the C2 domains of 158P3D2, and variants
thereof, regulate
migration of tumor cells expressing this protein. The regulation of the C2
domains occurs
through the phosphorylation of threonine residues (Raftopolou, M., et al.,
2004, Science, 303,
1179-81) and modulates the ability of the expressing cells to migrate. This
signal transduction
property of the 158P3D2 protein expressed in tumor cells enhances their
ability to migrate
during metastases, facilitates their homing to distal sites (lymph nodes), and
promotes
204
CA 02588564 2007-05-22
WO 2006/055004 PCT/US2004/039083
interactions with other cells during the formation of tumor masses. Further,
the C2 domains of
158P3D2 play a role in membrane trafficking though interaction with Ca2+,
phosphatidylserine
and phosphatidylcholine (Rizo, J. and Sudhof, T.C., J. Biol. Chem. 273, 15879-
82 (1998).
These interactions are crucial for subsequent membrane metabolism and
interaction. Taken
together, the 158P3D2 protein significantly promotes unregulated growth of
cancer cells,
contributing to their viability and metastatic advantage in vivo.
[0747] The present invention is not to be limited in scope by the embodiments
disclosed
herein, which are intended as single illustrations of individual aspects of
the invention, and any
that are functionally equivalent are within the scope of the invention.
Various modifications to
the models and methods of the invention, in addition to those described
herein, will become
apparent to those skilled in the art from the foregoing description and
teachings, and are
similarly intended to fall within the scope of the invention. Such
modifications or other
embodiments can be practiced without departing from the true scope and spirit
of the invention.
205
