Note: Descriptions are shown in the official language in which they were submitted.
~3$~76
DNA STRAND CODING FOR a-ACETOLAC~ATE
DECARBOXYLASE AND YEAST TRANSFORMED WITH THE DNA STRAND
BACKGROUND OF THE INVENTION
5 Field field of the Art
This invention relates to a DNA strand having an
ability in biotechnological production o a~acetolactate
decarboxylase (hereinafter called ~-ALDCase) as produced
by Enterobacter aeroqenes IFO 13534 and also to a yeast
10 belonging to Saccharomyces cerevisiae transformed with
the DNA strand so that its a-acetolactate ~hereinaLter
called a-AL)producing ability is reduced.
Prior art
Alcoholic liquors such as beer, sake, wine, etc.,
15 are generally produced by adding a yeast belonging to
Saccharomyces cerevisiae to a starting material liquid
for fermentation such as wort, fruit juice, etc., and
subjecting the mixture to alcoholic fermentation. In the
fermentation process, the yeast will produce a-AL as the
20 intermediate substance for biosynthesis of valine and
leucine which are amino acids necessary for the growth of
j itself, and leak it inevitably out of the cell, namely
¦ into the fermented liquor. The a-AL which has thus
become to exist in the fermented liquor will change
25 spontaneously to diacetyl (hereinafter called DA) through
B~e non-enzymatical reaction in the fermented liquor.
DA is a substance having strong objectionable odor
called generally as "cooked odor" or "DA odor" and~ in
order to produce an alcoholic liquor excellent in flavor
30 (namely without DA odor), the content of a-AL and DA in
the fermented liquor is required to be decreased to at a
low level so that the total DA content will not finally
exceed the discrimination threshold of DA odor in the
j alcoholic liquor (e.g. 0.05 to 0.1 mg/liter in the case
35 of beer) even if a-AL may be all changed to DA.
While DA in the fermented liquor is converted to
acetoin which is tasteless and odorless relatively
,"
~t~ 7 ~
20375-580
rapidly in the co-presence of yeast, ~-AL in the fermented li~uor
will not be changed by yeast, but it becomes decomposable with
yeast only after it is changed to DA by non-enzymatical chemical
reaction. However, since the convergence reaction from ~-AL to
DA in the fermented liquor proceeds at a very slow rate, this
reaction becomes the rate-limiting step, whereby the fermented
liquor is required to be aged under the co-presence of yeast for
a long time in order to obtain an alcoholic liquor with low
content of ~-AL and DA (namely without DA odor).
~-ALDCase is an enzyme having the property of convert-
ing N-AL to acetoin and has been known to be produced by various
kinds of bacteria such as Enterobacter aerogenes, Bacillus
licheniformis, Lactobacillus casei, Bacillus brevis, Enterobacter
cloacae, Acetobacter bacteria (such as A. rancens, A. aceti,
etc), etc. The principal enzymological properties of the
~-ALDCase produced by Enterobacter aerogenes were investigated
by the present inventors to obtain the results shown below.
Molecular weight: 28000 ~ 29000
Isoelectric point: pH 5.0 ~ 6.0
Optimal pEI: 6.5 ~ 7.5
Optimal temperature: 40 ~ 50C
Thermal stability: stable to around 60C
There is also a report about the enzymological
properties of the ~-ALDCase produced by Enterobacter aerogenes
[European Journal of Biochemistry (Eur. J. Biochem. 14 (1970))
133 - 137].
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 illustrates a nucleotide sequence of the DNA
B
3 ~ ~9~ 6
20375-580
strand codin~ for ~-ALDCase determined in EXPERIMENTAL EXAMPLES,
~1) Cloning of a-ALDCase gene and the amino acid sequence deduced
from the nucleotide sequence;
Fig. 2 illustrates the structure of pAL~5034; and
Fig. 3 illustrates the structure of pIARLl.
SUMMARY OF THE INVENTION
. .
The present invention provides a DNA strand having an
ability to biotechnologically produce a-ALDCase, which is useful
for production of alcoholic liquors having no DA odor within by
far shorter period as compared with the prior art method, and a
yeast of which a-AL producing ability is reduced by transforma-
tion with the D~A strand.
More specifically, the DNA strand having an ability to
biotechnologically produce a-ALDCase according to the present
invention is characterized in that it has a nucleotide sequence,
or, in other words, a base sequence coding for a polypeptide
having N-ALDCase activity, of which amino acid sequence, namely
an amino acid sequence of the polypeptide, is substantially from
A to B of the amino acid sequence shown in Fig. 1.
The yeast belonging to Saccharomyces cerevislae
according to the present invention is characterized in that its
a-AL producing ability is reduced by transformation with a DNA
strand which has a nucleotide sequence coding for the polypeptide
having a-ALDCase activity, of which amino acid sequences
substantially from A to B of the amino acid sequence shown in
Fig. 1.
The present invention also relates to the use of the
DNA strand and the yeast.
~31
4 ~$~6
20375-580
The DNA strand according to the present invention can
impart ~-ALDCase producing ability to various microorganisms, for
example, Saccharomyces cerevisiae to reduce its a-AL proaucing
ability (as described in detail below), or it can be effectively
utilized in biotechnological production of a-ALDCase.
Also, since the yeast according to the present
invention is reduced in its ability to produce ~-AL (correctly
leaking of a-AL out of the cell~, if the starting material liquor
for fermentation is fermented with this yeast, the level of a-AL
in the fermented liquor will become very low to give a result
that the aging period required for treatment of a-AL in the
fermented liquor, and therefore the production period of alcoholic
liquor can be remarkably shortened. In the yeast of the present
invention, its a-AL producing ability is reduced probably because
the ~-AL, even if produced within the cell in the fermentation
process, will be converted to acetoin by a-ALDCase also produced
similarly within the cell.
DETAILED DESCRIPTION OF THE INVENTION
a-ALDCase gene
Definition
. .
The DNA strand according to the present invention having
an ability in biotechnological production of a-ALDCase, namely
the ~-ALDCase gene codes for a polypeptide having a-ALDCase
activity, of which amino acid se~uence is substantially ~rom A to
B of the amino acid sequence shown in Fig. 1.
Here, the "DNA strand" means complementary double
strands of polydeo~yribonucleic acid having a certain length.
And, since the "DNA strand" is specified by the amino acid
~: Bl
2'^~6
4a
20375-580
se~uence of the polypeptide encoded thereby and the polypeptide
has a finite length as mentioned above, the DNA strand also has
a finite length. However, while the DNA strand contains a gene
coding for ~-ALDCase and is useful for biotechnological
production of the polypeptide, such biotechnological production
cannot be effected only by the DNA strand having the finite
length, ~ut biotechnological production of the polypeptide is
rendered possible under the state where a DNA strand of a
suitable length is linked upstream to its 5'-side and/or down-
stream to its 3'-side.
Accordingly, the "DNA strand" as mentioned in the
present invention is inclusive, in addition to the DNA strand of
a specific length (the length of A-B in terms of the correspond-
ing amino acid sequence in Fig. 1), of
;2~6
those in the form of a linear DNA or a circular DNA
strand containing the DNA strand of the specific length.
Of the existing forms of the DNA strand according to
the present invention, typical are the plasmid form
containing the DNA strand as a part of the constituent
and the form existing in a microorganism, particularly E.
coli and yeast, as the plasmid form or the integrated
form in the genome.
The preferable existing form of the DNA strand
according to the present invention comprises the DNA
strand of the present invention as a foreign gene linked
to the promoter and the terminator so that the a-ALDCase
gene can be expressed stably in a microorganism, which
exists in the microorganism as the plasmid form or the
integrated form in the genome. As the promoter and the
terminator, known promoters and terminators can be used
in a suitable combination.
Polypeptide encoded bY the_~n~
As mentioned above, the DNA strand according to the
present invention is specified by the amino acid sequence
of the polypeptide encoded thereby. The polypeptide has
a-ALDCase activity and has an amino acid sequence which
is substantially from A to B of the amino acid sequence
shown in Fig. 1. Here, "amino acid sequence which is
substantialIy from A to B of the amino acid sequence
shown in Fig. 1" indicates that some of the amino acids
may be deleted, substituted or added, etc., so long as
the peptide has a-ALDCase activity.
A typical polypeptide having a-ALDCase activity in
the present invention is from A to B of the amino acid
sequence in Fig. 1, consisting of 260 amino acids, which
amino acid sequence has not been known in the prior art.
Nucleotide sequence of DNA strand
The DNA strand coding for a-ALDCase is one having
; 35 the nucleotide sequence from A to B in Fig. 1 and those
having nucleotide seyuences corresponding to the changes
in amino acid sequence of a-ALDCase as mentioned above or
. .
degenerative isomers thereof. Here, the "degenerative
isomer" means a DN~ strand which is different only in
degenerative codon and can code for the same polypeptide.
For example, relative to the DNA strand having the
nucleotide sequence of A to B in Fig. 1, the DNA chain
having a codon corresponding to any one of the amino
acids changed from, for example, the codon (AAC)
corresponding to Asn at the carboxy terminal end to, for
example, AAT which is in degenerative relationship
therewith, is called the degenerative isomer in the
present invention.
A preferable specific example of the DNA strand
according to the present invention has at least one stop
codon (e.g. TAA) in contact with the 3'-side end.
lS Further, upstream to the 5'~side and/or downstream
to the 3'-side of the DNA strand of the presen.
invention, a DNA strand with a certain length may be
continuo~ls as the non-translation region (the initial
portion downstream of the 3'-side is ordinarily a stop
codon such as TA~).
The nucleotide sequence of the DNA strand shown in
Fig. 1 was determined for the gene coding for the a-
ALDCase cloned from Enterobacter aeroqenes IFO 13534
according to the Ma~am-Gilbert method and the dideoxy
method.
Obtention of DNA strand
One means for obtaining the DNA strand having the
nucleotide sequence coding for the amino acid sequence of
the above a-ALDCase is to synthesize chemically at least
a part of the DNA strand according to the method for
synthesis of polynucleotide..
In view of the fact that the number of amino acids
of a-ALDCase is at least 260, rather than the chemical
synthetic method mentioned above, it would be prefera~le
to obtain the DNA strand from the genomic library of
Enterobacter aeroqenes IFO 13534 according to the method
conventionally used in the field of genetic engineering,
i2~6
for example, the hybridization method with the use of a
suitable probe.
In this invention, the present inventors cloned the
DNA strand of the present invention from the above
genomi~ library by use of the shot gun method, because
the nucleotide sequence coding for the a-ALDCase of
Enterobacter aeroqenes IFO 13534 and the amino acid
sequence of a-ALDCase were not known (see Examples shown
below about its details).
Yeast with reduced in ability to Produce a-acetolactate
The DNA strand of the present invention cloned as
described above contains the genetic information for
making ~-ALDCase, and therefore this can be introduced
into the yeast used generally as the yeast for
fermentation of alcoholic liquors ISaccharomyces
cerevisiae) to transform the yeast, whereby a yeast for
ermentation with reduced a-AL producing ability can be
obtained.
Yeast
The yeast to be transformed in the present invention
may be a yeast belonging to Saccharomyces cerevisiae as
described in "The ~easts, a Taxonomic Study" third
edition (Yarrow, D., ed. by N.J.W. Kreger-Van Rijo
Elsevier Science Publishers B.V., Amsterdam (1984),
p.379) and its synonym or a mutant, but for the purpose
of the present invention, a yeast for fermentation of
alcoholic liquors belonging to Saccharomyces cerevisiae,
specifically beer yeast, wine yeast, sake yeast, etc.,
are preferred. Specific examples may include wine yeast:
ATCC 38637, ATCC 38638, beer yeast: ATCC 26292, ATCC
2704, ATCC 32634, sake yeast: ATCC 4134, ATCC 26421, etc.
To further comment on the properties of these yeasts
for fermentation, as the result of selection and pure
cultivation over long years for the properties suitable
for fermentation, namely efficient fermentation of the
starting material liquid for fermentation, production of
alcoholic liquors with good flavor and stable genetic
properties, etc., as the index, they have become
polyploids which will undergo geneticall~ cross-
segregation with extreme difficulty and have lost spore
forming ability substantially completely. For example,
in the case of beer yeast practically used, ~hile it is
enhanced in the ability to assimilate maltose,
maltotriose which are sugar components in the wort, it
has lost its wild nature, for example, it is crystal
violet sensitive, etc.
Transformation
It has been confirmed for the first time by the
present inventors that transformation of a yeast with the
DNA strand of the present invention resulted in reduction
of its a-AL producing ability. However, the procedure or
the method itself for preparation of the transformant can
be one conventionally employed in the field of molecular
biology, bioengineerin~ or genetic engineering, and
therefore the present invention may be practiced
according to these conventional techniques except for
those as described below.
For expression ~f the gene of the DNA strand of the
present invention in a yeast, it is first required that
the gene should be carried on the plasmid vector existing
stably in the yeast. As the plasmid vector to be used in
this operation, all of the various kinds known in the art
such as YRp, YEp, YCp, YIp, etc., can be used. These
plasmid vectors are not only known in iiteratures, but
also they can be constructed with ease.
On the other hand, for the gene of the DNA strand of
the present invention to be expressed in a yeast, the
~enetic information possessed by the gene is required to
be transcribed and translated. For that purpose, as the
unit for controlling transcription and translation, a
promoter and a terminater may be linked upstream to the
~35 5'-side and downstream to the 3'-side of the DNA strand
;of the present invention, respectively. As such promoter
and terminator, various kinds such as ADH, GAPDH, PHO,
.
.
~ t~ Z76
g
GAL, PGK, ENO, TRP, HIP, etc., have been already known
and any of these can be utilized also in the present
invention. These are not only known in literatures, but
also they can be prepared with ease.
AS the marker for selecting the transformant to be
obtained by the present invention, a resistant gene to
G418, hygromycin B, a combination of methotrexate and
sulfanylamide, tunicamycin, ethionine, compactin, copper
ion, etc., can be employed.
For having the DNA strand of the present invention
held more stably in a yeast, this can be also integrated
into the genome of the yeast. In this case, for making
easier integration of the DNA strand of the present
invention carried on the plasmid vector into the genome,
it is desirable to insert a DNA having high homology with
the genome DNA into the plasmid vector, and examples of
DNA for this purpose may include rRNA gene, ~O gene, etc.
Among them, it has been known that rRNA gene is
repeated tandemly for about 140 times in haploid yeast
genome (Journal of Molecular Biology 40, 261-277 (1969)).
Due to this specific feature, when this sequence is
utilized as the target sequence for recombination, there
are the following advantages as compared with the case
when utilizing other gene sequence. l. It is expected
that th~ transformation frequency may be elevated. 2.
The change in the corresponding trait o~ the target
sequence by recombination may be considered to be
negligible. 3~ By use of the plasmid having the
structure as shown in Examples (pIARL lin Fig. 3~, it
becomes possible to integrate a plural number of foreign
genes into the genome by repeating a series of operations
of incorporation of plasmid and excision of the vector
se~uence.
Also, the DNA strand which can be used for
transformation of a yeast in the present invention can
also code for a polypeptide different from the
polypeptide of A to B shown in Fig. 1, so long as it has
a-ALDCase activity, as mentioned previously. Examples of
such polypeptide may include the polypeptide of A to B
shown in Fig. 1 to which one or more of amino acids have
been inserted or added, from which one or more amino
acids have been deleted or substituted with other amino
acids, and also a-ALDCase produced by Bacillus
licheniformis, Lactobacillus casei, Bacillus brevis,
Enterobactor cloacae, Acetobacter bacteria (Ao rancens,
A. aceti, etc)etc. Such DNA strands would be readily
available by utilizing contemporary genetic engineering
techniques.
Transformation of a yeast with the plasmid thus
prepared can be done according to any method suited for
the purpose conventionally used in the field of genetic
engineering or bioengineering, for example, the
spheroplast method [proceedings of National Academy of
Sciences of the United States of America (Proc. Natl.
Sci. USA), 75, 1929 (1978)~, the lithium acetate method
~Journal of Bacteriology (J. Bacteriol.), 153, 163
(1983)], etc.
The yeast of the present invention thus obtained is
the same as the yeast before transformation in its geno
type or phenotype except for the new trait according to
the genetic information introduced by the DNA strand of
the present invention (that is, endowed with a ALDCase
producing ability to consequently decompose a-~L within
the cell, thereby lowering the amount of a~AL leaked out
of the cell), the trait derived from the vector used and
the defective corresponding trait due to the defect of a
part of the genetic information during recombination of
the gene which might have sometimes occurred. Further,
the beer yeast obtained by integrating the DNA strand of
the present invention into the yeast genome by use of YIp
type plasmid, followed by excision of unnecessary vector
sequence (see Example t6) shown below about its details~
has no trait derived from the vector employed. Thus, the
yeast of the present invention is substantially the same
$2~6
as the yeast for fermentation conventionally usedO
Accordingly, the yeast according to the present invention
can be used under essentially the same fermentation
conditions for the yeast for fermentation of the prior
art, besides it has reduced a-AL producing ability in the
fermented liquor, and therefore the a-AL content in the
fermented liquor is consequently low, whereb~ the aging
period of the fermented liquor required for its treatment
can be remarkably shortened.
EXPERIMENTAL EXAMPLES
(1) Cloninq of a-ALDCase qene
(i) Purification of chromosomal DNA of a-ALDCase
producing strain
By culturing under aeration Enterobacter aeroqenes
IFO 13534 (procured from Institute for Fermentation,
Osaka, Japan) in L-medium containing 0.5~ glucose at 37C
for 10 hours, 0.5 9 of wet microorganism cells was
obtained.
This was resuspended in 5 ml of saline EDTA buffer
[0.15 M NaCl, 0.1 M EDTA (pH 8.0)]. Subsequently, it was
treated with 400 ~g/ml of lysozyme (produced by Seikagaku
Kogyo), 20 ~g/ml of ribonuclease A (produced by Sigma
Co.) at 37C for 20 minutes. Next, it was treated with
0.5% of sodium dodecylsulfate (SDS) and 500 ~g/ml of
proteinase K (produced by Sigma Co.) dt 65C for 4 hours.
This was loaded onto a previously prepared sucrose
density gradient solution (50 mM tris-HCl ~pH 7.4), 0.1 M
NaCl, 5 mM EDTA, 0c1% SDS, 5~20% sucrose), and subjected
to centrifugation by Hitachi Ultra-centrifugal Rotor RPS
27 at 25 krpm at 20C for 3 hours. After fractionation
in fractions each of 2.5 ml, the fractions were examined
for molecular weight according to 0.4% agarose gel
electrophoresis and the ~ractions containing high
molecular weight DNA were collected. This was
precipitated with ethanol and the precipitate was
dissolved in l ml of TE buffer (10 mM tris-HCl (pH B.0),
,, rr~J~
2~
12
1 mM EDTA) and dialyzed against one liter of TE buffer~
300 ~9 of chromosomal DNA was obtained.
(ii) Preparation oE cosmid library
120 ~9 of the chromosomal DNA obtained in ~i) was
partially digested with a restriction enzyme Sau3AI to
about 40 kbp. This was loaded onto a previously prepared
r ~ sucrose density gradient solution (20 mM tris-HCl (8 0)~
1 M NaC1, 5 mM EDTA, 10~40% sucrose) and subjected to
centrifugation by Hitachi Ultra-centrifugal Rotor RPS 27
at 26 krpm at 20C for 22 hours. After fractionation in
fractions of each 0.5 ml, the fractions were examined for
molecular weight by 0.4% agarose gel electrophoresis and
the fractions containing DNA fragments of about 40 kbp
were collected. After ethanol precipitation OL the
fractions, the precipitate was dissolved in 500 ~l of TE
buffer and dialyzed against one liter of TE buffer.
0.2 ~g of the DNA fragments of about 40 kbp obtained
was ligated with 0.3 ~lg oE a cosmid pJB8 Arm ~produced by
Amersham International) by T4 ligase. This DNA was in
vitro packaged by use of A DNA in v tro packaying kit
(produced by Amersham International) and was used to
transfect E. coli DHl ~F-, gyrA96, recAl, relAl?, endAl,
thi-l, hsdRl7, supE44, A-) [Journal of Molecular Biology
(J. Mol. Biol.), 166 557-580 (1983): ATCC 33849] to
obtain a cosmid library of E. aeroaenes genome.
(iii) Screaning of a-ALDCase gene holding transductant
By selecting transductants exhibiting a-ALDCase
activity from the cosmid library obtained in (ii~, a-
ALDCase gene holding transductants were obtained.
Specifically, 300 transductants from cosmid library
were inoculated one by one onto L-agar medium containing
50 ~g/ml of ampicillin and 0.5~ of glucose, followed by
cultivation at 37C for 8 hours, and each culture was
assayed for a-A~DCase activity. That is, each
transductant was suspended in l ml of 30 mM potassium
phosphate buffer (pH 6.2) and vortexed vigorously with
addition of lO ul of toluene for 30 seconds. For the
~3$27
cell suspension, a-ALDCase activity was assayed following
the method of Godfredsen et al. [Carlsberg. Research
Communication (Carlsberg. Res. Commun., 47, 93 (1982)~.
As the result, two a-ALDCase activity holding
transductants were obtained. The plasmids of the clones
obtained were designated as pCA3 and pCA13, respectively.
(iv) Determination of a-ALDCase gene DNA nucleotide
sequence
By carrying out subcloning from pCA13, the DNA
fragment of 1.4kbp excised with restriction enzymes BamHI
and EcoRV was turned out to code for u-ALDCase. To the
EcoRV cleavage site was ligated HindIII linker
(dCAAGCTTG: produced by Takara Shuzo Co., Japan), and the
ligated product was inserted between the cleavage sites
of Bam~I and HindIII of a plasmid pUC9 (produced by
Pharmacia Co.) to construct a plasmid, which was
designated as pUAR5.
For the BamHI-EcoRV fragment, DNA nucleotide
sequence was determined according to the dideoxy [Proc.
Natl. Acad. Sci. USA, 74, 5463 (1977)] and the Maxam-
Gilbert method [Proc. Natl. Acad. Sci. USA, 74, 560
(1977)] (Fig. 1). As the result of analysis of this
nucleotide sequence, an open reading frame oE 780bp wa~
found to exist. Here, it may be estimated that a protein
having 260 amino acids and a molecular weight of 29000 is
encoded, and the molecular weight was found to be
substantially coincident with the above molecular weight
of a-ALDCase.
(2) Introduction of a-ALDCase qene into yeast
(i) Construction of ADHl promoter
From Saccharomyces cerevisiae 5288C [(ar suc2r mal,
gal2, CUP1): Biochemical and Biophysical Research
Communications (Biochem. Biophys. Res. Commun.), 50, 18S-
191 (1973): ATCC26108], chromosomal DNA was prepared
according to a conventional method. According to the
same method as described in Example (1) (ii), a DNA
fragment of about 10 kbp was obtained by partial
.
7~
1~
digestion with the restriction enzyme Sau3AI. This was
ligated with pBR322 cleaved with the restriction enzyme
BamHI by T4 ligase to construct a genomic library. The
synthetic oligomer corresponding to the nucleotide
sequence from the seventh to the 36th in the coding
region of ADHl gene [Journal of Biological Chemistry (J.
B. C.) 257, 3018 (1982)] was end-labelled with 32p and by
use of this as probe, ADHl gene was cloned from the
genomic library. Further 7 this was cleaved with
restriction enzymes SphI and Sau3AI to obtain a DNA
fragment of 542 bp containing the promoter and a part of
the coding region of the ADHl gene. By treating the
Sau3AI end of this fragment with an endonuclease Bal31 to
have the coding region completely lost, and thereafter
HindIII linker (dCAAGCTTG: produced by Takara Shuzo Co.,
Japan) was ligated therewith. This DNA fragment was used
as ADHl promoter.
(ii) Construction of expression vector and introduction
into yeast
By using basically the plasmid YEpl3 (Gene, 8, 121
(1979): ATCC37115~, an expression vector was constructed
according to the following procedure.
First, SalI-SacI fragment and XhoI-SmaI fragment
existing on both ends of the LEU2 gene of YEpl3 were
removed. By this, the plasmi~became to have no cleavage
site of the restriction enzymes XhoI, SacI, SmaI and
BglII, but have only one cleavage site of the restriction
enzyme SalI. Next, between the HindIII site derived from
pBR322 and the HindIII site derived from 2 ~m DNA in the
plasmid, the synthetic oligonucleotide 41 mer was
inserted. The synthetic oligonucleotide has the
following nucleotide sequence containing the cleavage
site of the restriction enzymes SacI, SmaI, BglII and
XhoI. In the present invention, this plasmid was
designated as YEpl3K.
.
..
~9~276
AGCTTATGATTACGAGCTCCCGGGCAGATCTCGGCCTCGAG
ATACTAATGCTCGAGGGCCCGTCTAGAGCCGGAGCTCTCGA
Next, the SphI-~indIII fragment of YEpl3K was
substituted with the ADHl promoter prepared in (i) to
construct an expression plasmid vector pAK503.
The plasmid pUAR5 having the a-ALDCase gene fragment
obtained in (1) (iv) was cleaved with the restriction
enzyme HincII and after addition of HindIII linker
(dCAAGCTTG~ produced by Takara Shuzo Co., Japan), cleaved
with the restriction enzymes HindIII and BamHI. The
HindIII-BglII fragment of pAK503 was replaced with the a-
ALDCase gene fragment of 940 bp obtained to construct a
plasmid pAL503.
Further, pUC-4K (produced by Pharmacia Co.)
containing the G418 resistant gene was cleaved with the
restriction enzyme SalI, and the fragment containing the
G418 resistant gene obtained was inserted at the SalI
site of pAL503 to construct the desired plasmid pALG5034
tFi9. 2).
When pALG5034 was introduced into yeast [TD4 (a,
his, ura, leu, trp; a mutant strain of Saccharomyces
cerevisiae S288C and beer yeast IF0 0751 strain]
according to the lithium acetate method [Journal of
Bacteriology (J. Bacteriol.) 153, 163, (1983)], a-ALDCase
activities of 1.9-3.3. U/mg protein and 1.8-3.5 V/mg
protein were exhibited, respectively.
The IFO 0751 transformed with pALG5034 is called
SKB101 and the TD4 strain containing pALG5034 is called
SKB102.
The a-ALDCase gene has three ATG's which is the
translation initiation codon continuously at its 5'-end
of the coding region. After removing one or two of the
three ATG's from the 5'-side by treatment with
endonuclease Bal31 from the HincII site of the 5'-side of
the a-ALDCase gene fragment, the genetic information of
the obtained fragments was expressed within the yeast TD4
16
to see the effect on the activity. As the result, no
great difference in enzyme activity of the ALDCase
obtained was recognized.
(3) Fermentation test ~Confirmation of reduction in
amount of diacetyl produced)
Fermentation tests were conducted for the two kinds
of yeasts of the TD4 and the IFO 0751 into which a-
ALDCase gene had been introduced as described in t2)-
(ii), and reduction of the amounts of the total diacetyl
(hereinafter called TDA: TDA consists of vicinal
diketones and acetohydroxy acids, mainly DA and its
precursor a-AL) in the fermented wort by these
transformed yeasts was confirmed according to the
following method.
(i) Obtention of a-ALDCase producing yeast cells
The two kinds of yeasts transformed with pALG5034 as
described above (SKBl01 and SKBl02) and the respective
host yeasts (IFO 0751 and TD4) were cultured in YPD
medium. For the strains having introduced pALG5034,
G418 was added into the medium to 600 ~g/ml.
The respective cells grown by shaking cultivation at
30C for 16 hours were collected by centrifugation at
3000 x q for 10 minutes, washed with distilled water and
then provided for fermentation test.
(ii) Fermentation test
To a wort prepared to 11 P was added the yeast
obtained in (i) to a yeast addition ratio of 0.5~ (wet.
w/v) and, after sufficient aeration, stationary
fermentation was carried out at 8C for 7 days. After
completion of fermentation, the cells were removed by
centrifugation at 3000 x q for 10 minutes and filtration,
and the filtrate was subjected to measurement of amount
TDA (total diacetyl amount).
The results were as shown in the following Table.
In fermentation by use of the yeast of the present
invention, it can be seen that TDA amount in the
fermentted yeast is reduced to a great extent as compared
$~
with control strains.
~: , :
: : :
~ 35
`
. ~.
~_t~J~ ~76
18
The in amount of total diacetyl (TDA) in the fermented wort
Strain ~ (mg/liter)
TD4 (9 0.26
(~ 0.30
AYerage 0.28
TD4 + pALG5034 (D 0.03
(SKB 10~) ~ 0.05
l O Ave~age 0.04
_
IFO0751 q) 0.28
0.28
(~) 0.32
Avera~e 0.29
IFO 0751 + pALG5034 (D <0.04
15(SKB 101) (~3 0 07
Average < 0.06
t4) Construction of inteqration_type ~lasmid
(i) Structure and characteristic of plasmid pIARLl
In order to have the a-ALDCase gene held stably
within the yeast, a plasmid pIARLl having no autovomously
replicating ability which can be held by the yeast only
through integration into the genome was constructed. The
plasmid has the G418 resistant gene and the ~-
galactosidase gene as the markers within yeast and also
has rRNA gene sequence as the sequence necessary for the
plasmid to be integrated into the genomeDNA by homologous
recombination. The u-ALDCase gene is rRNA gene sequence
sandwiched between the ADHl promoter at 5'-end and HIPl
terminatorat 3'- end, and the combined fragment is
inserted in the rRNA gene sequence. The plasmid, in
order to be integrated efficiently into the rRNA gene on
the chromosome, is cleaved previously at the KpnI site
within the rRNA gene sequence before used for
transformation. As the result, in the transformant
obtained, the rRNA gene sequence derived from the plasmid
~ ~62~
19
exists next to that existing originally in the
chromosome. Accordingly, when the transformant is grown
in a complete medium, spontaneous recombination between
the two rRNA gene sequences occurs, whereby G418
sensitive, Lac~ cells will appearO ~ part of these will
exhibit a-ALDCase activity, and only ADH1 promoter, a-
ALDCase gene and HIPl terminator remain on the chromosome
in these microorganisms, with other vector portions being
excised.
(ii) Construction of pIARLl
The pIARLl was constructed from a yeast integrating
plasmid YIp5 (Prot. Natl, Acad. Sci. USA 76r 1035-1039
(1979))-
First, the G418 resistant gene fragment prepared
after cleavage of pUC4R ~produced by Pharmacia) with SalIwas inserted at the SalI site of YIp5 to construct a
plasmid pIG7.
Subsequentlyr as HIPl gene promoter + lacZ gene
fragmentr the BglII-BamHI fragment compristing the BamHI
fragment containing the lac Z gene from the plasmid
pMC1871 (produced by Pharmacia) linked to the BglII
fragment containing about 0.6 kb of the 5'-non
translation region and 0.4 kb of the translation region
of the yeast HIPl gene (Gener 38, 205-214 (1985)) was
inserted at the BamHI site of pIG7 to construct plasmid
pILG2.
The rRNA gene was cloned from the library used for
cloning of the ADHl yene by use of a 5' end-labelled
oligomer correspondîng to the nucleotide of the 4 to 32nd
from the 5'-end of the 5,8SrRNA gene (J.B.C. 252r 8118-
8125 (1977)). And ther EcoRI fragment of about 3 kb
containing a part of each of 5.BSrRNA gene and 25SrRNA
gene was introduced at the EcoRI site derived from pBR322
of pILG2 to construct a plasmid pIRL9.
ADHl promoter + a-ALDCase gene + HIPl terminator
fragment was obtained according to the method shown
below.
~2~o2~6
After cleavage of the plasmid pUAR5 having a-ALDCase
gene with HincII, the frayment was treated with Bal31 and
ligated to HindIII linker, and thereafter cleaved with
HindIII and BamHI. The a-ALDCase gene fragment obtained
5 was inserted between the BamHI and the HindIII sites of
pUC12 (produced by Pharmacia Co.), and the nucleotide
sequence was determined to obtain a plasmid pALDC3 having
about 40 bp upstream of 5'-end and the initial ATG of a-
ALDCase gene deleted. The pALDC3 was digested with BamHI
10 and made to have a blunt end with klenow fragment and
then the HindIII-SmaI fragment of pAK503 was substituted
with the a-ALDC gene fragment obtained by HindIII
digestion to construct a plasmid pAL503-3. Further, the
SphI site of the pAL503-3 was digested with SphI and then
converted to the BamHI site by Sl nuclease treatment and
BamHI linker addition, and thereafter ADHI promoter + a-
ALDCase gene fragment was obtained as BamHI-BalII
fragment.
On the other hand, the plasmid where the BamHI-SalI
fragment of pBR322 was substituted with the BamHI-SalI
fragment haviny about 0.9 kbp of the 3'-end non-
translation region and about 0.1 kb of the 3' translation
region of the HIP] gene was constructed and the above
ADHI promoter -~ a-ALDCase gene fragment was inserted at
the BamHI csite of this plasmid to construct a plasmid
pALT18 in which ADHl promoter + a-ALDCase gene + HIPl
terminater are linked in this order mentioned.
The ADHl promoter ~ a-ALDCase gene + HIPl terminator
fragment, obtained as the BarmHI fragment after digestion
30 of pALT18 with SalI and subsequent treatment with klenow
fragment, addition oE BamHI linker and BamHI digestion
was inserted at the BglII site of pIRL~ to construct the
desired plasmid pIARLI.
(5) Introduction of PIARLl into yeast and expression of
~-ALDCase
By use of the pIARL1 constructed as described above,
yeast was transformed as follows. Beer yeast IFO0751
~_ t~ $~
21
strain was cultured in YPD medium at 30C to OD600 = l.0,
and the microorganism cells were collec~ed and
transformed with pIARLl according to the lithium acetate
method. For promoting recombination in the rRNA gene
5 sequence, pIARLl was completely digested at the KpnI
within the rRNA gene sequence to be made linear before
transformation. ~fter transformation, 108 of the of the
yeast cells were suspended in l ml of YPD medium and
shaked at 30C for 18 hours, and the culture was then
lO spreaded onto YPD agar medium containing an antibiotic
G418 ~500 ~g/m). Subsequently, the plate was incubated
at 30C for 3 to 5 days to obtain colonies. In these
colonies, in addition to the transformed cells, cells
having acquired G418 resistance independently on pIARLl
15 were contained, and therefore they were transferred with
a toothpick onto the agar medium containing X-gal (51_
bromo-4'-chloro-3'-indoyl-~-D galactoside) of Ruby et al
~Method in Enzymology, vol. lOl, p. 253 ~1983)) and
incubated at 30C for 2 to 5 days. Those which color
20 formed blue colony on this plate by ~-galactosidase
activity ~Lac~ strain) were judged to be transformants.
Such cells all exhibited ~-~LDCase activity of 0.8-
l.8U/mg protein. The transformant exhibiting the highest
a-ALDCase activity ~SKBl03 strain) was cultured in YPD
25 medium non-selectively for ~0 generations. The a-ALDCase
activity after cultivation was found to be 0.9 U/mg
protein, indicating that the gene exhibiting a-ALDCase
activity was stably held in the chromosome.
(6) Excision of undesired
sequence and expression of a-ALDCase qene
After non-selective cultivation of the transformant
obtained in 15) (SKBl03 strain) in YPD medium for 20 to
30 generations, the culture broth was adequately diluted
and spreaded onto the agar medium containing X-gal of
35 Ruby et al as described above. The plate was cultured at
30C for 5 to 7 days, and the strain without blue color
formation (Lac~ strain) were selected. Of these str~ins,
, ~
2~6
22
those exhibiting G418 sensitivity on YPD agar medium
~ontaining 500 ~g/ml G418 were selected. Further,
strains exhibiting a-ALDCase activity were obtained. In
these strains, as shown in (4)-(i), it may be considered
5 that, recombination occurred between the duplicated rRNA
gene sequences, whereby only ADHl promoter, a-ALDCase
gene and HIPl terminator remain on the chromosome, with
other vector portions being excised..
Of these strains, the strain exhibiting a-ALDCase
lO activity of 0.2 U/mg protein (SKBl04 strain) was cultured
in YPD medium for 40 generations and activity of 80~ or
more was maintained.
(7) Fermentation test
Fermentation tests were conducted for the SKBl03
15 strain obtained in (5~ and the SKBl04 strain obtained in
(6), and reduction of TDA in fermented wort was confirmed
according to the following method. Two kinds of yeasts
were subjected to stationary cultivation non selectively
in YPD medium at 20C for 3 days andsubsequently at 10C
20 for lO days, and the respective cells were collected by
I centrifugation at 3000 x q for 10 minutes, washed with
distilled water and then provided for fermentation test.
To a wort ad~usted to ll P was added the yeast to a
yeast addition ratio of 0.6~ (wet. w/v) and, after
25 sufficient aeration, stationary fermentation was carried
out at 10C for 8 to lO days. After completion of
fermentation, cells were removed by centrifugation at
3000 x q for 10 minutes and filtration, and the filtrate
was subjected to measurement of amount of TDA and
30 apparent extract. The results were as shown in the
following Tables. Although both cultivation and
fermentation were conducted under non-selective
conditions, marked decrease in amount of TDA in fermented
wort was seen as compared with control strain, thus
35 indicating that a-ALDCase activity was stably exhibited.
. .
7~i
23
Results of fermentation test of SKB103 strain
TDA Apparent
Strain (mg/liter) extract
IFO 0751 (~ 0.68 2.4
~ 0.69 2.2
Average 0.69 2.3
SKB 103 ~) 0.14 2.7
(~) 0.14 2.9
Average 0.14 2.8
Results of fermentation test of SKB104 strain
_ . TDA Apparent
Strain (mg/liter) extract
IFO 0751 (~) 1.02 2.3
@~ 0.94 2.2
20~verage 0.98 2.3
SKB 104 (i) 0.44 2.2
@~ 0.51 2.0
~vernge 0 48 2.1
Deposition of microorqanism
The microorganisms shown below related to the
present invention have been deposited at the Institute of
Fermentation Research, Agency of Industrial Science &
Technology, Ministry of International Trade and Industry
under the following deposition numbers under the Budapest
3 Treaty on the International Recognition of the Deposit of
Microorganisms for the Purposes of Patent Procedure.
(1) SKB101 (containing pALG5034 ) . . . FERM-BP No . 1228
(2) SKB102 (containing pALGS034 j . . . FERM-BP No. 1229
Both of (l)~and (2) were deposited on December 11,
1985.
(3) SKB104 ... FERM-BP No. 1227
(3) was deposited on December 2, 1986.
