Note: Descriptions are shown in the official language in which they were submitted.
6~14!)- 3r~
1 3 1 6 1 ~ 3
~ . .
--1--
MET~OD OF USING BARl FOR SECRETING
FOREIGN PROTEINS
The present invention is directed to novel D~A
constructs containing at least the translated signal
peptide portion of ~he Saccharomyces cerevisiae BARl
gene and at least one structural gene foreign to a
host cell transformed with said construct. Transfor-
mation of host organisms by such constructs will
result in expression of a primary translation product
comprising the structural protein encoded by the
foreign gene fused to the signal peptide of BARl so
that the protein is processed through the host cell
sqcretory pathway and may be secreted from the host
cell into the culture medium or the periplasmic space.
Various procaryotic and eucaryotic microorganisms have
been utilized as hosts for production of heterologous
polypeptides, i.e., polypeptides which are not
naturally produced by the host, by way o~ recombinant
DNA methodology. Various eucaryotic fungal species
are of particular interest, including SaccharomYces
cerevisiae, Schizosaccharomyces pombe, Asperqillus and
j Neurospora. In particular, much work has been done in
1 ~ 3 ~ 3
-2-
the budding yeast S. cerevisiae. Yeast cells, when
transformed with a suitable DNA construct, such as a
plasmid, have been made to express heterologous genes
contained in the plasmid. However, a major limitation
to this technology is that, in many cases, the protein
products are not secreted into the medium by the host
cells and it is thus necessary to disrupt the cells
and purify the desired protein from the various
contaminating cellular components without denaturing
or inactivating it. Thus, it is desirable to be able
to direct the transformed cells to secrete the
heterologous product which would simplify purification
of that product. Additionally, it may be desirable
for some proteins to enter a host cell secretory
pathway to facilitate proper processing, i.e.,
disulfide bond formation.
S. cerevisiae is known to secrete some of its
naturally produced proteins, although knowledge of the
process is quite limited compared to what is known
about secretion of proteins from bacteria and
mammalian cells. It appears that most of the secreted
yeast proteins are enzymes which remain in the peri-
plasmic space, although the enzymes invertase and acid
phosphatase may also be inaorporated into the cell
wall. The proteins which are known to be secreted
into the culture medium by S. cerevisiae include the
mating pheromones (~-factor and a-factor), killer
toxin, and the protein accounting for Barrier activity
(hereinafter "Barrier"). Secretion through the cell
wall into the medium iB also referred to a~ "export".
S. cerevisiae mating type ~ cells produce ~ factor
which is secreted into the culture medium, whereas a
cells produce two secre ed polypeptides, a-factor and
Barrier. The gene for ~-factor has been cloned,
sequenced, and analyzed (See Kurjan and Herskowitz,
Cell 30: 933-943 ~1982)). The signal peptide ~a short
peptide sequence believed to direct the cell to
secrete an attached protein), leader sequence
(comprising a precursor polypeptide that is cleaved
from mature ~-factor) and non-kranslated gene
sequences (including promoter and regulatory regions)
from the ~-factor gene may be used to direct the
secretion of foreign proteins produced in yeast.
(Brake et al., Proc. Natl. Acad. Sci. USA
8I:4642-4646, 1984) Expression of the ~-factor gene
is regulated by the MAT~l gene product and processing
of the ~-factor precursor into the mature protein
appears to require at least two steps, believed to be
under control of the STE13 and X~X2 genes.
In contrast to ~-factor, Barrier appears ko be
glycosylated, based on its ability to bind
concanavalin A. Barrier is produced by a cells and
expression appears to be under the control of the
MAT~2 gene. With the exception of possible signal
peptide cleavage, no processing of the Barrier
precursor has heretofore been demonstrated and the
STE13 and KEX2 genes are not believed to be involved
in the expression of Barrier.
:
Due to the above differences between the control of
expression and processing of ~-factor and Barrier,
one cannot determine a priori which of these yeast
genes is better suited to direct the secretion of a
particular foreign protPin. Because the two proteins
appear to be processed through different secretory
pathways, it would be desirable to exploit the
characteristics of the Barri~r secretion system.
It is therefore an object of the present invention to
provide DNA constructs containing a segment of the
-4-
BARl gene which codes for at least the signal peptide
and also containing a foreign structural gene which
results in expression in a microbial host of a
heterologous protein which is processed through the
secretory pathway of the host cell.
It is a further ob~ect of the present invention to
provide a method for expressing foreign genes in a
microbial host which results in a heterologous protein
or a portion thereof encoded by such a gene being
processed through the secretory pathway of the host
cell.
Another object of the present invention is to provide
a method for producing foreign proteins which are
secreted from a microbial host.
It is yet a further object of the present invention to
provide a method for producing foreign proteins by
recombinant DNA technology.
It is another object to provide a method for producing
; proteins having the amino acid sequences of human
proinsulin and insulin by recombinant DNA technology.
These and other objects will become apparent from the
following description of the specific embodiments and
claims.
The present invention is directed to DNA constructs
and methods for using same, which constructs comprise
at least the signal peptide coding sequence of the
Saccharomyces cerevisiae BARl gene, at least one
structural gene foreign to the host organism, and a
promoter which controls the expression in a host
3 3
-5-
organism of a fusion protain comprising the BARl
signal peptide and the foreign protein.
In the accompanying drawings:
FIG. 1 shows the nucleotide sequence of the BARl gene
and the derived amino acid se~uence of the primary
translation product. The MAT~2 binding site i5
underlined, the putative signal peptide cleavage site
is indicated with an arrow, and potential
glycosylation sites are marked with asterisks.
FIG. 2 is a diagram of the plasmid pZV9;
FIG. 3 illustrates the construction of plasmid p254;
FIG. 4 illustrates the construction of the plasmids
pZV30, pZV31, pZV32 and pZV33;
FIGS. 5A and 5B illustrate the construction of the
plasmid pZV50:
; FIG. 6 illustrates the construction of the plasmid
mll5;
FIG. 7 illustrates the construction of the plasmid
pZV49;
- FIG. 8 illustrates the construction o~ the plasmid
pZV134 comprising the PIl promoter:
; FIG. 9 illustrates the subcloning of a portion of the
MF~l gene;
FIG. 10 illustrates the construction of plasmid pZV75:
.
, ' ~, ,, ;
' ~ ,
13~33
FIG. 11 illustrates the construction of plasmids
comprising the TPIl promoter and BARl-MF~l fusion6;
FIG. 12 illustrates the construction of plasmid pSW22;
FIG. 13 illustrates the c:onstruction of plasmids
comprising BARl-MF~l fusions;
FIG. 14 illustrates the construction of pZV100;
~ .
FIG. 15 illustrates the construction o~ plasmid
pZV102;
FIG. 1~ illustrates the construction of the plasmid
pSW96;
FIG. 17 illustrates the construction of the plasmid
pSW97, and
FIG. 18 illustrates the construction of plasmids pSW98
and pSW99. ~ indicates the mutation at codon 25.
As used herein the term "DNA construct" means any DNA
molecule, including a plasmid, which has been modified
by human intervention in a manner such that the
nucleotide sequences in the molecule are not identical
to a sequence which is produced naturally. The term
"DNA construct" also includes clones of DNA molecules
which have b~en so modified. The terms "expression
vector" and "expression plasmid" are defined as a DNA
construct which includes a site of transcription
initiation and at least one structural gene coding for
a protein of interest which is to be expressed in a
host organism. An expression vector will usually also
contain appropriate regions such as a promoter and
terminator which direct the expression of the protein
,
, . .
-` - 13i~.33
of interest in the host organism and an origin of
replication. Expression vectors according to the
present invention will also usually contain a
selectable marker, such as a gene for antibiotic
resistance or a nutritional marker.
The term "DNA construct" will also be considered to
include portions of the expression vector integrated
into the host chromosome.
The term "plasmid" will have its commonly accepted
meaning, i.e., an autonomously replicating DNA
construct, usually close-looped.
The term "signal peptide" refers to that portion of a
primary translation product which directs that product
into the secretory pathway of the cell which produces
it. The signal peptide is usually cleaved from the
remainder of the nascent polypeptide by a signal
peptidase during this process. A signal peptide ~s
characterized by the presence of a core of hydrophobic
amino acids, occurs at the amino terminus of the
2Q primary translation product, and is generally from
about 17 to 25 amino acides in length. Signal
peptidase cleavage sites have been characterized by
von Heinje (Eur. J. Biochem. 133:17, 1983). As used
herein, the term "signal peptide" may also refer to
functional portions of the naturally occurring signal
peptide.
The present invention provides a method ~or directing
transformed cells to direct heterologous proteins
through a secretory pathway accomplished by
transforming a host with a DNA construct containing a
foreign gene linked to the yeast BARl gene or a
portion thereof which codes at least for the BARl
' , .
signal peptide. The proteins so processed may be
secreted into the periplasmic space or the culture
medium. The yeast BARl gene codes for Barrier activ
ity which is believed to be a glycosylated protein
secreted by S. cerevisiae a cells. The secrPted
Barrier allows mating type a cells to overcome the Gl
arrest induced by ~-factor. It is believed that
Barrier may be a protease. (See Manney, ~.
Bacteriol., 155: 291-301, 1983). Transcription of the
BARl gene i5 stimulated by ~-factor. Barrier, or an
analogous activity, is not detected in ~ or ~ cells
and the BARl gene is not transcribed in these cell
types.
The sequence of 2750 base pairs encompassing the BARl
gene is shown in Figure 1, together with the derived
amino acid sequence of the primary translation
product. The ATG translation initiation site of BARl
is at position 681 of the approximately 2.75 kb
fragment shown in Figure 1 which was subcloned from a
fragment obtained from a yeast genomic library
(Nasmyth and Tatchell, Cell 19: 753-764, 1980). An
open reading frame starts with the ATG codon at +l and
extends 1761 bp in the 3' direction. The sequence of
the first 24 amino acids of the BARl primary
translation product appears to be similar to sequences
of known yeast and mammalian signal peptides. Thus,
the alanine at position ~4 may be used as a cleavage
site, as in yeast invertase and acid phosphatase.
Cleavage could also occur after amino acid 23. At
least nine potential asparagine-linked glycosylation
sites exist in the primary translation product,
although the extent of glycosylation of the mature
secreted Barrier is not yet known. The promoter and
regulatory regions of the BARl gene are located within
a region o~ approximately 6RO bp on the 5' side of the
.
~3~133
g
translation initiation codon. Full promoter function
and response to ~-factor stimulation have been
locali2ed to the ATG-proximal approximately 680 bp of
the ~' untranslated region.
The DNA constructs of the present invention will
preferably encode a cleavage site at the junction of
the Barrier and fcreign protein portions. A preferred
such site is a KEX2 cleavage site, a sequence of amino
acids which is recognized and cleaved by the product
of the S. cerevisiae KEX2 gene (Julius et al. Cell
37:1075-1080, 1984). A KEX2 site is characterized by
a pair of basic amino acids, such as lysine and
arginine. It is preferred that the sequence of the
KEX2 site be Lys-Arg or Arg-Arg The BARl primary
translation product contains two such pairs located in
the structural region: Arg-Arg at positions 177-178
and Lys-Lys at positions 404-405. As noted above, the
KEX2 gene is not involved in the processing of the
Barrier precursor protein, suggesting that the
potential processing sites are blocked by protein
conformation or glycosylation and further suggesting
that Barrier may normally be processed through a
pathway different than that used by such
KEX2-processed proteins as ~-factor. However,
- 25 applicants have found that by including a KEX2
processing site in a fusion protein comprising a
portion of the BARl gene primary translation product
comprising the signal peptide thereof, together with a
protein of interest, the fusion protein is cleaved at
the KEX2 site, resulting in secretion of the protein
of interest. It has also been found that by reducing
the efficiency of signal peptidase cleavage of the
Barrier portion of a fusion protein comprising a KEX2
cleavage site, enhanced levels of the protein of
interest are exported. The KEX2 cleavage site may be
, ~,
.. . ..
.
-
~ 3 ~
--10--
provided by the BARl sequence or the gene of interest,
or may be introduced into the fusion by linker
addition, site-specific mutagenesis, etc.
Thus, according to the present invention, a portion of
the BARl gene comprising the ATG initiakion codon and
signal peptide coding sequence thereof may be joined
to a foreign gene of intPrest and transformed into a
eukaryotic host cell. The resultant fusion gene will
include a processing site, preferably a KEX2 cleavage
site, at the junction of the BARl and ~oreign
se~uences. Such a construct may al~o comprise regula-
tory regions and the promoter from the 5' non-coding
region of the BARl gene, or may comprise regulatory
regions and/or promoters from other genes. In addi-
tion to the promoter from the BARl gene, other
promoters which may be used include the promoters ~rom
the S. cerevisiae alcohol dehydrogenase I or alcohol
; dehydrogenase II genes, the genes of the S. cerevisiaeglycolytic pathway, such as the TPIl promoter, and
corresponding genes from other species, including the
fission yeast Schizosaccharomyces ombe (Russell and
Hall, J. Biol. Chem. 258: 143-149, 1983 and Russell,
Nature 301: 167-169, 1983). The S. cerevisiae alcohol
dehydrogenase I gene has been described by Ammerer
tMethods in Enzymolo~y 101: 192-201, 1983). ~he
alcohol dehydrogenase II gene has been described by
Russell et al. (J. Biol. Chem. 258: 2674-2682, 1983).
Glycolytic genes of S. cerevisiae have been described
by Kawasaki (Ph. D. Th~sis, University of Washington,
3Q 1979), Hitzeman et al. (J. Biol. Chem. 225: 12073-
12080), 1980), Xawasaki and Fraenkel ~_iochem.
Biophys. Res. Comm. 108: 1107-1112, 1982) and ~lber
and Kawasaki (J. Mol. APPl. Genet. 1: 419-434, 1982).
.
~ 3 ~
In a pxeferred embodiment, the signal peptide coding
sequence of the BARl gene is altered to reduce the
efficiency of signal peptidase cleavage of the Barrier
portion of a fusion protein comprising a XEX2 cleavage
site. This may be accomplished by site-specific
mutagenesis of potential cleavage sites, preferably
those sites at the amino acid 23-24 (of the Barrier
prot0in sequence) juncture or at the amino acid 24-25
juncture.
Methods used to form DNA constructs according to the
present invention involve conventional techniques.
The structural BARl gene, or a portion thereof, and
the structural gene to be expressed will preferably be
under control of a single promoter. Methods of
ligation of DNA fragments are amply described and are
well within the ability of those with ordinary skill
in the art to perform. The DNA coding sequence of the
protein to be expressed may be essentially that of any
protein, particularly proteins of commercial
importance, such as interferons, insulin, proinsulin,
~-l-antitrypsin, growth factors, and tissue plasmi
nogen activator.
After preparation of the DNA construct containing the
BARl yene or a portion thereof and the structural gene
to be expressed, the construct will be transformed
into the host organism under transforming conditions.
Techniques for transforming prokaryotes and eukaryotes
(including mammalian cells) are known in the
literature.
Preferablyl the host organism will be a strain of the
budding yeast Saccharomyces cerevisiae; however, other
fungi, including the fission yeast Schizosaccharomvces
-12-
pombe and the filamentous fungi Asperqillus nidulans
and Neurospora spp. may also be used.
The following examples are given by way of example and
not by way of limitation. Unless otherwise indicated,
standard molecular biolo~y methods were used through-
out. Restriction endonucleases were obtained from
Bethesda Research Laboratories, New England BioLabs
and Boehringer-Mannheim Bioohemicals and were used as
directed by the manufacturer, generally with the
addition of pancreatic RNase (10 ~g/ml) to digests.
T4 DNA ligase was obtained from Bethesda Research
Laboratories or Boehringer-Mannheim and was used as
directed. M13 and pUC host strains and vectors
were obtained from Bethesda Research Laboratories.
M13 cloning was done as described by Messing, Methods
n Enæymoloqy 101, 20-77 (1983). DNA polymerase I
(Klenow fragment) was used as described in Maniatis et
al., Molecular Cloninq: A Laboratory Manual, Cold
Spring Harbor Laboratory (1982). E. coli cultures
were transformed by the method of Bolivar et al., Gene
2, 95-113 (1977). S. cerevisiae cultures were trans-
formed by the method of Beggs, Nature 275, 104-108
(1978) as modified by MacKay, Methods in EnzYmoloqY
101, 325 (1983). S. pombe was transformad as
described by Russell, Nature 301, 167-169 (1983). The
mating pheromone ~-factor was prepared by the method
of Duntze et al., Eur. J. Biochem. 35: 357-365, 1973,
as modified by Manney et al., J. Cell Biol. 96: 1592
1600, l9B3 or was purchased from Sigma Chemical Co.
Oligonucleotides were synthesized on an ~pplied
Biosystems Model 380A DNA synthesizer and purified by
polyacrylamide gel electrophoresis on denaturing gels.
- 13~33
-13-
METHODS
ssay for Barrier Activity
The assay used for detection of Barrier production by
transfoxmed yeast cells relies on the ability of
Barrier to reverse the inhibition of growth of sensi-
tive a cells exposed to ~-factor. The test strain is
one that is abnormally sensitive to ~-factor, such as
strain RC629 (MATa barl), since it produces no Barrier
activity. A lawn is prepared using such a strain in a
soft agar overlay on an agar p]ate. A sufficient
quantity of ~-factor (0.05 - 0.1 unit, as assayed by
Manney, ibid.) is added to the overlay ta inhibit
growth of the cells. Transformants to be screened for
Barrier production are then spotted onto the lawn.
Secretion of Barrier by the trans~ormed cells reverses
the ~-factor growth inhibition immediately surrounding
the spot, thereby allowing the sensitive cells to
recover. The recovered cells are observed as a fringe
of growth around the normally smooth edge of the
colony o~ transformed cells. The presence o~ this
fringe indicates that the plasmid in the transformed
strain directs the expression and secretion of
Barrier.
IRI and IRC Assays
IRI and IRC assays were performed using commercial
kits obtained from Novo Industri, Bagsvaerd, Denmark.
Guinea pig anti-porcine insulin and guinea pig anti-
human C-peptide antibodies are supplied with the kits.
~,:
;
--14--
ASSAY FOR IRI
50 ~1 sample in NaFAM (0.04 M phosphate buffer pH 7.4
containing bovine serum albumin)
50 ~1 antibody (stock diluted 1:30)
16-24 hours at 4c C
50 ~1 125I-insulin (diluted 1:100)
2 hours at 4 C
50 ~1 1% StaphYlococcus aureus in NaFAM
45 min. at 0 C
Wash twice with 1% BSA/TNEN*
Centrifuge and count pellets
The different steps can be conveniently done in
microtiter dishes, until the pellets are transferred
to the scintillation vials.
ASSAY FOR IRC
50 ~1 sample in NaFAM
50 ~1 antibody (stock diluted 1:50)
16-24 hours at 4 C
50 ~1 125I-C peptide (stoc~ diluted 1:30)
2-4 hours at 4 C
50 ~1 1% S. aureus in NaFAM
45 min. 0 C
Wash twice 1% BSA/TNEN*
Centri~uge and count pellets
*TNEN is 20 mM Tris pH 8~0
100 mM NaCl
1 mM EDTA
0.5% NP-40
~ ,
13~ 6~33
-15-
ASSAY FOR ALPHA-FACTOR ACTIVITY
The assay used for detection of ~-factor export by
transformed yeast cells employs the ability of
~~factor to inhibit the growth of sensikive a cells.
The test strain (such as S. cerevisiae strain RC629
(MATa barl)) contains a mutation in the BARl gene that
prevents the production of Barrier activity and
renders the cells super-sensitive to ~-factor. A lawn
of the test strain is made in a soft agar overlay over
a plate of standard yeast selective synthetic medium
(e.g. medium lacking leucine). ~ransformants to be
screened for ~-factor export are spotted onto the lawn
and incubated at 30 D C. Secretion of ~-factor by the
transformants will cause growth inhibition in the lawn
immediately surrounding the colony. The halo of
growth inhibition in the lawn of test cells indicates
that the colony is exporting active ~-factor~ A
comparison of halo size enables one to estimate the
relative quantities of ~-factor exported by each
- transformant.
EXAMPLE 1
Expression of Proinsulin in
S. cerevisiae Using The BA~l Gene
A recombinant plasmid pool comprising the entire yeast
genome was constructed (Nasmyth and Tatchell, Cell 19:
753-764, 1980) using the shuttle vector YEpl3 (Broach
et al., Gene 8: 121-133, 1979). Yeast DNA fragments,
produced via a partial Sau 3A digestion, were inserted
into Bam HI-digested YEpl3. The plasmid pool was used
to transform S. cerevisiae strain XP635-10C (M~Ta
leu2-3 leu2-112 barl-l qal2: ATCC #20679) and trans-
formants were selected ~or leucine prototrophy and
- 1 316133
-16-
growth on a concentration of ~-factor that is
inhibitory to the a barl cells. Resultant colonies
were then screened for the ability to secrete Barrier
activity. Two colonies w~re found which carried both
leucine independence and the ability to secrete
Barrier. These colonies carried the plasmids
designated pBAR2 and pBAR3.
Plasmid DNA isolated from those two transfo~mants was
used to transform E. coli strain RRI (ATCC #31343).
Transformants were selected for ampicillin resistance.
Plasmids pBAR2 and pBAR3 were purified from the E.
coli transformants and characterized by restriction
endonucleass digestion and electrophoresis on agarose
or acrylamide gels. Plasmid pBAR2 was shown to
contain an insert of approximately 9.2 kilobases. E.
coli RRI transformed with plasmid pBAR2 has been
deposited with ATCC under accession number 39410.
Subcloning showed that the pBAR3 plasmid insert
comprised a portion of the insert of pBAR2, but
oriented in the vector in the opposite direction.
Further subcloning and screening for Barrier secretion
localized the functional BARl gene sequence to a
region of approximately 2.75 kb. This fragment
comprises the coding seguence, nontranslated trans-
cribed sequences, promoter, regulatory regions,transcription terminator, and flanking chromosomal
se~uences.
The plasmid pBAR2 was digested with restriction endo-
nucleases Hind III and Xho I and a fragmen~ of appro-
ximately 3 kb was purified by electrophoresis throughan agarose gel. This fragment was inserted into
plasmid pUC13 which had been digested with Hind III
and Sal I. The resulting recombinant plasmid, desig-
.
i 13~133
-17-
nated pZV9 (FIG. 2), can be used to transform E. coli,
but lacks the necessary origin of replication and
selectable marker for a yeast vector. The plasmid
pZV9, in a transformant strain of E. coli RRI has been
deposited with ATCC under accession no. 532~3.
For the BARl gene to be used to direct the secretion
of proinsulin, fragments of the BARl gene comprising
the 5' regulatory region and a portion of the coding
sequence were used. The fusion of the B Rl and
proinsulin gene fragments was made in the proper
reading frame and at a point in the BARl sequence at
which the resulting fusion polypeptide may be cleaved,
preferably in vivo. Several sites in the EARl gene
are potential cleavage sites; the Arg-Arg at position
177-178 was selected as the test site of fusion with
proinsulin. Accordingly, the 5' regulatory sequences
and approximately ~00 bp of the coding sequence of
BARl were purified from plasmid pZV9 as a 1.9 kb Hind
III-Sal I fragment.
Referring to FIG. 3, there is shown a method for
subcloning human preproinsulin cDNA. A human prepro-
insulin cDNA (preBCA clone), p27, is produced by
G-tailing Pst I digested pBR327 and inserting C tailed
DNA, made by reverse transcribing total RNA from human
pancreas. Plasmid pBR327 is described by Soberon et
al., Gene 9: 287-30~ (1980) and the sequence of human
preproinsulin is reported by 8ell et al., Nature 232:
525-527 ~1979). The complete translated seguence was
cut out as a Nco I-Hga I fragment. The protruding
ends were filled in with DNA-polymerase I (Klenow
fragment), and synthetic Eco RI linkers (GGAATTCC) and
Xba I linkers (CTCTAGAG) were attached simultan~ously.
The fragment was subcloned into pUC13 (Vieira and
Messing, Gene 19: 259-258, 1982; and Messing, Meth. in
" ~3~ 33
-18-
Enzymology 101: 20-77, 1983) which had been cut with
Eco RI and Xba I. Because the addition of an Eco RI
linker at the 5' end restores the Nco I site (CCATGG)
at the initiation codon, plasmids were screened for
the presence of Eco RI, Nco I and Xba I sites flanking
a 340 bp insert. A plasmid having these properties is
termed p47, shown in FIG. 3. A proinsulin (BCA)
fragment with a blunt 5' end was generated by primer
repair synthesis (hawn et al., Nuc. Acids Res. 9:
6103-6114, 1981) of plasmid p47. Subse~uent
digestions with Xba I yielded a 270 bp fragment which
was inserted into pUC12. (Vieira and Messing, ibid.,
and Messing, ibid). The vector was prepared by
cutting with Hind III, blunting the ends with DNA
polymerase I (Klenow fragment), cutting with Xba I,
and gel purifying. The resultant vectox fragment,
comprising a blunt end and a Xba I sticky end, was
ligated to the above described BCA fragment. As
mature BCA starts with the amino acid phenylalanine
(codon TTT), blunt end ligation of the two fragments
regenerates a Hind III site at the junction. Plasmids
were screened first for the recovery of the Hind III
site and then by sequencing across the junction using
an M13 sequencing primer. Plasmid p254 had the
correct sequence.
Referring to FIG. 4, plasmid p254 was digested with
Hind III and Eco RI and the ca. 270 bp proinsulin
fragment was gel purified. The fragment ends were
blunted using DNA polymerase I (Klenow fragment) and
deoxynucleotide triphosphates. Sal I linker sequences
(GGTCGACC) were treated with T4 polynucleotide kinase
and ~-32P-ATP and were ligated to the blunted
proinsulin fragment. Digestion with Sal I and Bam HI,
; followed by electrophoresis on a 1.5% agarose gel,
~ 3~ ~ :133
--19--
yielded a proinsulin fragment with Sal I and Bam HI
cohesive ends.
The proinsulin fragment and the 1.9 kb BARl fragment
were ligated together int:o pUC13 which had been
digested with Hind III and Bam HI. This construct was
used to transform E. coli K12 (JM83).
Transformed cells were screened for ampicillin resis-
tance and production of white colonies. Further
screening by restriction endonuclease digestion using
Hind III, Bam HI, and Sal I identified a plasmid
(pZV27) containing a Hind III-Bam HI fragment o~ the
proper size and a single Sal I site.
In order to link the first amino acid of proinsulin to
the Arg-Arg potential processing site of the BARl gene
product, the intervening material in the BARl~
proinsulin fusion was deleted. A synthetic oligo~
nucleotide was used to direct the looping-out of this
extraneous material in the following manner. Refer-
ring to FIG. 4, plasmid pZV27 was digested with Hind
III and Bam HI and the ca. 2.2 Xb BARl-proinsulin
fusion fragment was gel purified. This fragment was
then inserted into the replicative form of the phage
vector M13mpll (Messing, ~ . in EnzymoloqY 101:
20-77, 1983) which had been digested with Hind III and
Bam HI. This recombinant DNA was used to transfect E.
coli K12 (JM103) (Messing, ibid.), White pla~ues were
picked and the replicative forms of the recombinant
phage were screened for the correct restriction
patterns by double enzyme digestions using Hind III +
Sal I and Sal I + Bam HI. A construct showing the
desired pattern is known as mpll-ZV29. The oligo-
nucleotide primer (sequence: 3' GG~TCTTCTAAACACTTG 5')
was labelled using ~-32P-ATP and T4 polynucleotide
131~:~33
-20-
kinase. 7.5 pmol of kinased primer was then combinPd
with 80 ng of M13 sequencing primer (Bethesda Research
Laboratories, Inc.) This mixture was annealed to 2 ~g
of single stranded mpll-ZV29 and the second strand was
extended using T4 DNA ligase and DNA polymerase I
(Klenow fragment), as described for oligonucleotide-
directed mutagenesis (two primer method) by Zoller et
al. ~Manual for Advanced Techni~ues in Molecular
Cloninq Course, Cold Spring Harbor Laboratory, 1983).
DNA prepared in this way was used to kransfect E. coli
K12 (JM103) and plaques were screened using the
kinased oligomer as probe (Zoller et al., ibid.).
Plaques so identified were used for preparation of
phage replicative form (RF) DNA (Messing, ibid.).
Restriction enzyme digestion of RF DNA identified two
clones having the proper Xba I restriction pattern
(fragments of 7.5 kb, 0.81 kb, and 0.65 kb) and
lacking a Sal 1 restriction site (which was present in
the deleted region of the BARl-proinsulin fusion).
RF DNA from these two clones was digested with Hind
III and Bam HI, and the 1.9 kb fusion fragment from
each was gel purified. These fragments were ligated
to pUC13 and YEpl3 (Broach et al., Gene 8 121-133~
1979) vectors which had been digested with Hind III
and Bam HI. pUC/BARl-proinsulin hybrid plasmids for
subsequent sequencing were used to transform E. coli
K12 (JM83~ Two of these plasmids were designated
pZV32 and pZV33~ YEpl3-derived recombinants were used
to transform E. coli RR1 (Nasmyth and Reed, Proc. Nat.
Acad. Sci. USA 77: 2119-2123~ 1980)~ Two of these
plasmids were designated pZV30 and pZV31 (Fig 4).
Sequencing of pZV32 and pZV33 was done by the method
of Maxam and Gilbert (Meth. in Enzymoloqy 65:57,
1980)o The BARl-proinsulin fusion was sequenced from
:
.
' ' '
~31~ ~ 33
the Bgl ~I site located approximately 190 bp to the 5'
side of the junction and from the Sau 96I site located
about 140 bp to the 3' side of the junction (in the
proinsulin gene). Data from these experiments
confirmed that the desired fusion between the BARl and
proinsulin genes had been constructed.
S. cerevisiae strain XP635~-lOC was transformed with
plasmids pZV30 and pZV31. One liter cultures were
grown in standard yeast synthetic medium lacking
leucine. After 34 hrs., ~-factor was added to a 10 ml
aliquot of each culture. After an additional lI
hours, cultures were harvested by centrifugation.
- Cell pellets and supernatants were tested for the
presence of insulin or insulin-like material. Results
of two such assays on the supernatant of a culture
transformed with plasmid pZV31 showed 3 pmole IRI
material per ml of culture medium, and 5.8 pmol IRC
material per ml of culture medium. IRI is correctly
folded insulin, proinsulin, or degradation products
thereof. IRC is free C-peptide, incorrectly folded
proinsulin, or degradation products thereo~.
EXAMPLE 2
Expression of Proinsulin in S. cerevisiae
Using The Alcohol Dehydrogenase I Promoter,
BARI ~ene, and Triose Phosphate Isomerase Terminator
The S. cerevisiae alcohol dehydrogenase I promoter
~hereinafter ADHI promoter; also known as ADCI
promoter) was tested for use in directing expression
of foreign polypeptides in conjunction with BARl
sequences. A plasmid comprising these se~uences was
constructed.
,
-
3 3
-22-
The plasmid pZV50 (FIG. 5B) comprises the S.
cerevisiae ADHI promoter, the BARl-proinsulin fusion
described above, and the terminator region o~ the S.
cerevisiae triose phosphate isomerase (TPIl) gene
(Alber and Kawasaki, J. Molec. Appl. Genet. 1:
419-434, 1982). It was constructed in the fsllowing
manner. Referring to FIG. 'SA, plasmid pAH5 (Ammerer,
ibid.) was digested with Hind III and Bam Hl and the
1.5 kb ADHI promoter fragment was gel purified. This
fragment, together with the Hind III-Eco RI polylinker
fragment from pUC13, was inserted into Eco RI, Bam
HI-digested pBR327, using T4 DNA ligase. The
resultant plasmid, designated pAM5, was digested with
Sph I and Xba I, and the approximately 0.4 kb ~DHI
promoter fragment was purified on a 2% agarose gel.
Plasmid pZV9 was digested with Xba I, and the
approximately 2 kb BARl fragment, containing the
entire BARl coding region, was similarly gel purified.
These two ~ragments, ADHI promoter and BAR1 sequence,
were ligated to Xba I, Sph I-digested YEpl3 to produce
plasmid pZV24. Digestion of pZV24 with Sph I and Bgl
II, followed by gel purification, yielded an ADHI
promoter-BARl fusion of approximately 800 bp, which
contains the ATG translation start codon, but lacks
the codons for the Arg-Arg potential processing site.
Plasmid pZV33, containing the BARl-proinsulin fusion,
was digested with Bgl II and Xba I, and the fusion
fragment (ca. 500 bp), which includes the Arg-Arg
codons, was purified.
Referring to FIG. 6, The TPIl terminator was ob~ained
from plasmid pFGl (Alber and Kawasaki, ibid.). pFGl
was digested with Eco RI, the linearized plasmid ends
were blunted using DNA polymerase I (Klenow fragment),
and Bam HI linker sequences (CGGATCCA) were added.
The fragment was digested with Bam HI and religated to
...
:
.
.
;
~ 3 ~ 3
-23-
produce plasmid pl36. The 700 bp TPIl terminator was
purified from pl36 as a Xba I-Bam HI ~ragment. This
fragment was inserted into Xba I, Bam H1-digested
YEpl3, which was then cut with Hind III, the ends
blunted using DN~ polymerase I (Klenow fragment), and
religated to produce plasmid p270. The TPIl
terminator was purified from p270 as a Xba I-Bam RI
fragment, and was inserted into Xba I, Bam HI-digested
pUC13 to yield plasmid mll5.
Referring to Figure 5B, the TPIl terminator was
removed from plasmid mll5 by digestion with Xba I and
Sst I, followed by gel purification. The three
fragments: ADHI-BARl fusion, BARl-proinsulin ~usion,
and TPIl terminator, were inserted into plasmid pUC18
(Norrander et al., Gene 26: 101-106, 1983) which had
been digested with Sph I and Sst I. This DNA was used
to transform E. coli K12 (JM83). Selection for
; ampicillin resistance and screening for production of
white colonies identified a plasmid ~pZV45) containing
the desired inserts. Plasmid pZV45 was subsequently
digested with Sph I and Bam HI, and the ADHI BARl-
proinsulin-TPI terminator sequence was gel purified.
This fragment was inserted into YEpl3 which had been
digested with Sph I and Bam HI, to produce the S.
cerevisiae expression vector pZV50.
S. cerevisiae strain XP635-lOC was transformed with
-
plasmid pZV50 and cultured and assayed as described in
Example 1 above. No IRI material was found in the
medium, and IRC material was less than 0.5 pmol per
ml. Cells extracted with 0.1% Nonide~ P-40 showed 1
pmol IRC material per ml of cell extract.
aC~ ~ ~r~
3 3
-24-
EXAMPLE 3
Expression of Proinsulin in Sch:izosaccharomyces
Using the BARl Gene and S. pombe
Alcohol Dehydrogenase Promoter
This example demonstrates the use o~ portions of the
BARl gene to direct the secretion of ~oreign
polypeptides expressed in a transformed Schizo-
saccharomyces pombe host. A plasmid was constructed
which combines the S. ombe alcohol dehydrogenase
(ADH) gene promoter with the BARl-proinsulin gene
fusion.
The S. Pombe ADH promoter was obtained from a library
of DNA fragments derived from S. pombe strain 972h
(A~CC 24843), which had been cloned into YEP13 as
~ described by Russell and Hall (J. ~iol. Chem. 258:
;; 143-149, 1983). The promoter sequence was purified
from the library as a 0.75 kb Sph I-Eco RI fragment.
; This fragment and the EGO RI~Hind III polylinker
fragment of pUC12 were ligated into YEpl3 which had
been digested with Sph I and Hind III. ~he resulting
plasmid is known as pEVP-ll.
Referring to FIG. 7 for constructing the S. pombe
expression vector, the ADH promoter was purified from
PEVP-11 as a Sph I-Xba I fragment. Plasmid pZV33 was
digested with Xba I and Bgl II and the ca. 340 bp
BAR1 fragment, which includes the ATG initiation
codon, was purified. pZV33 was digested with Bgl II
and Sst I, and the BARl-proinsulin fusion sequence was
purified. The three fragments were combined with Sph
I, Sst I-digested pUC18 to produce plasmid pZV46. As
pUC18 is not effective for transformation of S. pombe,
the plasmid was subjected to two double enzyme
digestions. An ADH promoter-BARl fusion fragment was
,~ .
~,
'.
'` ~
.. . .
13~ î3~
-25-
purified ~rom a Hind III + Byl II digest, and a BARl-
proinsulin fusion sequence was purified from a Bgl II
+ Xba I digest. These fragments were inserted into
Hind III, Xba I-digested YEpl3 to produce S. pombe
expression vector pZV49.
one liter cultures of transformed . Pombe strain
118-4h (ATCC #20680) were grown 36 hours at 30C in
standard yeast synthetic medium (-leu D) containing
200 mg/l aspartic acid and :L00 mg/l each of histidine,
adenine, and uracil. Cu:Ltures were harvested by
centrifugation and the supernatants assayed by IRI and
IRC assays. Two samples from pZV49-transformed cells
contained 1.6 pmol/ml IRI material and 0.5 pmol/ml
IRC-reactive material, respectively. A control sample
from a culture transformed with YEpl3 contained no
detectable IRC-reactive material.
EXAMPLE 4
Export Of Alpha-Factor Using BARl Signal Peptide
The BARl signal peptide was tested for its ability to
direct the export of ~-factor from a yeast
transformant. Several plasmids containing DNA
fragments coding for fusion proteins with varying
lengths of the BARl protein and 1 or 4 copies of
mature ~-factor were constructed. ~hese plasmids were
transformed into an 3/~ diploid host strain and the
transformants assayed for ~-factor production by the
halo assay.
Plasmids pSW94, pSW95, pSW96, and pSW97 comprise the
S. cerevisiae triose phosphate isomerase (~PIl)
promoter, a 355 bp or 767 bp fragment of the BARl gene
(comprising 114 or 251 codons of the 5' end o~ the
BARl coding sequence, resp~ctively) and either one or
13~fil33
-26-
four copies of the alpha;factor (MF~l) coding
sequence. These constructs &re describad in Table l.
TABLE l
PlasmidBARl Fragment ~-factor
pSW94 355 bp 4 copies
pSW95 767 bp 4 copies
pSW96 355 bp l copy
pSW97 767 bp l copy
Plasmid pM220 (also known as pM210) was used as the
source o~ the TPIl promoter fragment. E. coli RRI
transformed with pM220 has been deposited with ATCC
under accession number 39853. Plasmid pM220 was
digasted with Eco RI and the 0.9 kb ~ragment
comprising the TPIl promoter was isolated by agarose
gel electrophoresis and the ends were blunted with DNA
polymerase I (Klenow fragment~. Kinased Xba I linkers
were added to the fragment, which was then digested
; with Bgl II and Xba I. This modified TPIl promoter
fragment was then ligated into the 3.4 kb Bgl II-Xba I
vector fragment of pDRl107 to produce pZV118. Plasmid
pDRl107 was constructed by subcloning the 900 bp Bgl
II-Eco RI TPIl promoter fragment o~ pM220 into pIC7
(Marsh, Erfle and Wykes, Gene 32: 481-485, 1984) to
generata plasmid pDRllOl. Plasmid pDRllOl was
digested with Hind III and Sph I tD isolate the 700 bp
2Q paxtial TPIl promoter fragment. Plasmid pDRllO0,
comprising the 800 bp Xba l-Bam HI TPIl terminator
; fragment of pM220 subcloned into pUC18, was cut with
Hind III and Sph I. The 700 bp partial TPIl promoter
was ligated into the linearized pDRllO0 to produce
pDRl107.
~3~ ~33
-27-
The Eco RI site at the 3' end of the TPIl promoter in
pZV118 was then destroyed. Ths plasmid was digested
with Hind III and Eco RI and the 0.9 kb fragment was
isolated and ligated to a synthetic linker constructed
by annealing oligonucleotides ZC708 (5 AATTGCTCGAGT3 )
and ~C709 (3 CGAGCTCAGATC5 ). The linker addition
eliminates the ~co RI site at the 3' terminus of the
TPIl promoter fragment and adds XhoI and Xba I sites.
This fragment was then joined to Hind III-Xba I cut
pUC13. The resultant plasmid was designated pZV134
(Figure 8).
Cloning of the yeast mating pheromone ~-factor (MF~l)
gene has been described by Kurjan and Herskowitz
(ibid). The gene was isolated in this laboratory in a
similar manner from a yeast genomic library of partial
Sau 3A fragments cloned into the Bam HI site o~ YEpl3
(Nasmyth and Tatchell, Cell 19: 753-764, 1980). From
this library, A plasmid was isolated which expressed
; ~-factor in a diploid strai~ of yeast homozygous for
the mat~2-34 mutation (Manney, et al., J. Cell. Biol.,
96: 1592, 1983). The clone contained an insert
overlapping with the MF~l gene characterized by Kurjan
and HerskowitzO This plasmid, known as pZA2, was
digested with Eco RI and the 1.7 kb fragment
containing MF~l was isolated and ligated into Eco RI
cut pUC13. The resultant plasmid, designated pl92,
was cleaved with Eco RI and the resultant 1.7 kb MF~l
fragment was isolated and digested with Mbo II. The
550 bp Mbo II-Eco RI fragment was isolated and ligated
to kinased Sal I linkers. The linkered fragment was
cut with Sal I. The resulting 0.3 kb Sal I fragment
was ligated into Sal I cut pUC~ (Vieira and Messing,
Gene, 19: 259-268, 1982) to produce a plasmid
designated p489 (Figure 9).
i3~33
-28-
A gene fusion comprising portions of the BARl (114
codons~ and MF~l coding sequence was then constructed.
Plasmid pZV24 (Example 2) was digested with Sph I and
Bgl II and the 0.8 kb ADHl promoter-BARl fragment was
isolated. Plasmid p489 was cleaved with Bam HI and
the 0.3 kb MF~l fragment was isolated. These two
fragments were joined in a t:hree part ligation to Sph
I+Bam HI cut YEpl3. The resultant plasmid was
designated pZV69 (Figure 11).
lQ A second fusion gene encoding 251 amino acids of
Barrier joined to a portion of the alpha-factor
percursor was constructed. Plasmid pZV16, containing
the 767 bp Xba I-Sal I BARl ~ragment from pZV9
(Example 1) ligated into Xba I+Sal I cut pUC13, was
linearized by digestion with Sal I. This 4.0 kb
fragment was joined with the 0.3 kb Sal I fragment
- from p489 encoding the four copies of ~-factor. A
plasmid having the BARl-MF~l fusion in the correct
orientation was designated as pZV71. The BARl-MF~l
fusion from pZV71 was then joined to the ADHl
promoter. Plasmid pZV71 was digested with Xba I and
Pst I and the 1.07 kb fragment was isolated. The ADHl
promoter was isolated as a 0.42 kb Sph I-Xba
fragment from pZV24. These two fragments were joined,
in a three part ligation, to Sph I+Pst I cut pUC18.
The resulting plasmid, pZV73, was digested with Sph I
and Bam HI and the 1.5 kb fragment comprising the
expression unit was isolated and ligated into the Sph
I+Bam HI cut YEpl3 to form pZV75 (Figure 10).
For ease of manipulation, the BARl-MF~l fusion uni~s
from pZV69 and pZV75 were subcloned with th~ TPIl
promoter into pUC18 ~Fiyure 11). Plasmid pZV69 was
digested with Eco RI and Bam HI and the Q.55 kb
fragment containing the fusion was isolated. The 0.9
- . : :
~31~33
-29-
kb TPIl promoter fragment was i~olated from pZV118 by
digestion with Hind III and Eco RI. A three part
ligation was done by using the .55 kb BAR1-MF~l
fragment, the 0.9 kb TPIl promoter fragment and pUCl9
cut with Hind III and Bam ~I. The resultant plasmid
was designated pSW59. Plasmid pZV75 was digested wikh
Eco RI and Bam HI to isolate the 954 bp BARl-MF~l
fusion fragment. This BARl-MF~l fragment was ligated
in a three part ligation with the 0~9 ~b Hind III~Eco
RI TPIl promoter fragment and pUC18 cut with Hind III
and Bam HI to generate plasmid pSW60.
In construction of expression plasmids, the source of
the 5' 116 bp of the BARl coding sequence was pSW22,
which was constructed in the following manner
(Figure 12). The BARl coding reyion found in pSW22
originated from pZV9. Plasmid pZV9 (Example 1) was
- cut with Sal I and Bam HI to isolate the 1.3 kb BARl
fragment. This fragment was subcloned into pUC13 cut
with Sal I and Bam HI to generate the plasmid
designated pZV17. Plasmid pZV17 was digested with Eco
RI to remove the 3'-most 0.5 kb of the BARl coding
region. The vector-BARl fragment was religated to
create the plasmid designated pJH66. Plasmid pJH66
was linearized with Eco RI and blunt ended with Klenow
fragment. Kinased Bam HI linkers (5 CCGGATCCGG3 )
were added and excess linkers were removed by
digestion with Bam HI before religation. The
resultant plasmid, pSW8, was cut with Sal I and Bam HI
to isolate the 824 bp fragment encoding amino acids
~52 through 525 of BARl. This BARl fragment was fused
to a fragment encoding the C-terminal portion of
substance P (Munro and Pelham, EMB0 J., 3: 30~7-3093,
1984). Plasmid pPM2, containing the synthetic
oligonucleotide sequence encoding the dimer fo~ of
substance P in M13mp8, was obtained from Munro and
3 3
-30-
Pelham. Plasmid pPM2 was linearized by digestion with
Bam HI and Sal I and ligated with the 824 bp BARl
fragment. The resultant plasmid pSW14 was digested
with Sal I and Sma I to isolate the 871 bp BARl-
substance P fragment. Plasmid pZV16 (Figure 10) was
cut with Xba I and Sal I to isolate the 767 bp 5'
coding sequence of BARl. Thi~ fragment was ligated
with the 871 bp BA~l-substance P fragment in a three
part ligation with pUC18 cut with Xba I and Sma I.
The resultant plasmid was designaked pSW15. Plasmid
pSW15 was digested with Xba I and Sma I to isolate the
1.64 kb BARl-substance P fragment. The ADHl promoter
was obtained from pRL029, comprising the 0.54 kb Sph
I-Eco RI fragment containing khe ADHl promoter and 116
bp of the BARl 5' coding region from pZV24 in pUC18.
Plasmid pRL029 was digested with Sph I and Xba I to
isolate the 0.42 kb ADHl promoter fragment. The TPIl
terminator (Alber and Kawasaki, J. Mol. AEEl. GenO 1:
419-434, 1982) was provided as a 0.7 kb Xba I+Eco RI
fragment in pUC18. The linaarized fragment containing
the TPIl terminator and pUC18 with a Klenow filled Xba
I end and an Sph I end was ligated with the 0.42 kb
ADHl promoter fragment and the 1.64 k~ BARI-substance
P fragment in a three part ligation to produce plasmid
pSW22.
, ~
Plasmid pSW94 was then constructed (Figure 13). The
2.3 kb fragment containing the BARl-substance P fusion
and the TPIl terminator was isolated from plasmid
pSW22 as an Xba I-Sst I fragment. The Hind III-Xba I
TPIl promoter fragment isolated from pZV134 was joined
to the BARl-substan~e P-TPIl terminator ~ragment in a
three part ligation with Hind III+SstI cut pUC18. The
resultant plasmid, pSW81, was cleaved with Hind III
and Eco RI to isolate the 1.02 kb fragment containing
the TPIl promoter and the 5' 116 bp of BARl. Plasmid
~3.~6~3~
-31~
pSW59 was cut with Eco RI and Bam HI to isolate the
0.55 kb BARl-MF~l fusion fragment. This fragment was
then ligated in a three part ligation with the TPIl
promoter-BARl fragment from pSW81 and YEpl3 linearized
with Hind III and Bam HI resulting in plasmid pSWg4.
The construction of pSW95 is illustrated in Figure 13.
Plasmid pSW60 was cut with Eco RI and Bam HI to
isolate the 954 bp BARl-MF~l fusion ~ragment. Plasmid
pSW81 was cut with Hind III and Eco RI to isolate the
1.02 kb TPIl promoter-BARl ~ragment which was joined
with the BARl-MF~l fusion fragment in a three part
ligation into Hind III+Bam HI cut YEpl3. ~he
resultant plasmid was designated pSW95.
TPIl promoter-BARl-MF~l fusion constructs containing
only one copy of ~-factor originated ~rom BARl-MF~l
fusions (encoding four copies of ~-factor) that
contained the TPIl promoter and ~F~l prepro sequence
(see Figures 14, 15, and 16). Plasmid pZV16 was
digested with Eco XI and Sal I. The isolated 651 bp
BARl fragment was ligated with a kinased Hind III-Eco
RI BARl specific adaptor (produced by annealing
oligonucleotides ZC566:
5 AGCTTTAACAAACGATGGCACTGGTCACTTAG and ZC567:
5 AATTCTAAGTGACCAGTGCCATCGTTTGTTAA3 ) into pUC13 cut
with Hind III and Sal I. The resultant plasmid,
pZV96, was digested with Hind III and Sal I to isolate
- the 684 bp BARl fragment. Plasmid pM220 provided the
TPIl promoter fused to the MF~l prepro ~equence.
Plasmid pM220 was digested with Bgl II and Hind III to
isolate the 1.2 kb TPIl promoter-MF~l prepro fragment.
The 3' portion of the BARl coding region was obtained
by cutting pZV9 with Sal I and Bam HI to isolate the
lo 3 kb BARl fragment. The 684 bp Hind III-Sal I BARl
fragment, the 1.2 kb Bgl II-Hind III TPIl
~3~33
promoter-MF~l prepro fragment and the 1.3 kb Sal I-Bam
HI BARl fragment were joined with YEpl3 linearized
with ~am HI in a four part ligation. The construct
with the desired orientation of promoter and MF~1-BAR
fusion was dssignated pZV100 (Figure 14).
For ease of manipulation, the truncated MF~l prepro
sequence-BARl fusion fragment from pZV100 was
subcloned into pUC13 as a 1.6 kb Pst I-Bam HI
fragment. The resultant plasmid, pZV101, was cleaved
with Pst I and Eco RI to isolate the 270 bp MF~l
prepro-BARl fragment. Plasmid pZV69 was digested with
Eco ~I and Bam HI to isolate the 0.55 kb BARl-MF~1
fusion fragment (encoding four copies of ~-factor).
This fragment and the 270 bp MF~l prepro-BARl fragment
were ligated in a three part ligation into pUC13 cut
with Pst I and Bam HI. The resultant plasmid was
designated pZV102 (Figure 15).
,;...... . . .
An expresslon unlt comprislng the TPIl promoter, a
portion of BARl, and a single copy of the ~-factor
coding sequence was then constxucted (Figure 16).
Plasmid pZV102 was cut with Pst I and Bam HI to
isolate the 0.82 kb MF~l prepro-BARl fragment. A 1 kb
Xind III-Pst I fragment comprising the TPIl promoter
and the truncated MF~1 prepro sequence from pM220 was
joined to the 0.82 kb MF~l prepro-BARl fragment
isolated from pZV102 in a three part ligation with
YEpl3 cut with Hind III and Bam HI~ The resultant
plasmid was designated pZV}05. Plasmid pZV105 was
cleaved with ~ind III to isolate the 1~.2 kb TPIl
promoter-MF~l prepro fragment. Plasmid pZV102 was
digested with Hind III to isolate the vector fragment
containing the terminal ~-factor copy. This 2.8 kb
vector-MF~l fragment was ligated to the 1.2 kb TPIl
promoter-MF~l prepro fragment. The plasmid with the
~3~ ~33
-33-
correct orientation and a single copy of MF~l coding
sequence was designated pSW61. Plasmid pSW61 was
linearized by a partial digestion with Hind III.
Plasmid pZV102 was digested with Hind III to isolate
the 0.3 kb BARl-MF~l fragment. This fragment was
ligated into the linearized pSW61. The plasmid with
the insert in the correct orientation at the Hind III
site 264 bp 3' to the MF~l start codon was designated
pSW70. Plasmid pSW70 was cleaved with Eco RI and Bam
HI to isolate the 361 bp BARl-MF~l fragment. Plasmid
pSW81 (Figure 13) was digested with Hind III and Eco
RI to isolate the 1.02 kb TPIl promoter-BARl ~ragment.
This fragment was joined to the BARl-MF~l fragment in
a three part ligation with YEpl3 linearized with Hind
III and Bam HI. The resultant plasmid, pSW96,
contains the TPIl promoter and 356 bp of the 5' coding
sequenca of BARl fused to one copy o~ the ~-factor
coding sequence.
The second BARl-MF~l construct containing 767 bp of
BARl fused to one copy of the MF~l coding sequence was
made using pZV75 as the source of the BARl fragment
(Figure 17). Plasmid pZV75 was digested with Eco RI
and Bam ~I to isolate the 954 bp BARl-MF~l fragment.
Plasmid pZV101, containing the MF~l prepro sequence
fused to BARl, was cut with Pst I and Eco RI to
isolate the 0.27 Xb MF~l prepro-BARl fragment. This
fragment was joined to the 954 bp BARl-MF~l ~ragment
in a three part ligation with pUC13 linearized with
Pst I and Bam HI. The resultant plasmid, pZV104, was
cleaved with Hind III to isolate the 0.70 kb BARl-MF~l
fragment. This fragment was ligated to pSW61 which
was linearized by partial digestion with Hind III.
The plasmid with the insert in the correct orientation
at the Hind III site ~64 bp 3' to the start codon of
MF~l was designated pSW74. Plasmid pSW74 was cut with
:
~3.~&13~
-34-
Eco RI and Bam HI to isolate the 73~3 bp BARl-MF~l
fragment. Plasmid pSW81 was cut with Hind III and Eco
RI to isolate the 1.02 kb TPIl promoter-BARl fragment.
This fragment was joined to the 738 bp BARI-MF~l
fragment in a three part ligation with Hind IlI+Bam HI
cut YEpl3. The resultant plasmid, pSW97, contains the
TPIl promoter and 767 bp of khe 5' end of BARl fused
to the single copy of the ~-factor coding sequence.
The ~/~ diploid S. cerevislae strain XP733 (MATa
leu2-3 leu2-112 barl-l qal-2/MATa leu2-3 leu2-112
barl-l qal2) was transforn~ed with plasmids pSW73,
pSW94 and pSW95. Plasmid pSW73 comprises the TPIl
promoter, MF~l signal peptide and prepro sequence and
the coding region for the four copies of ~-factor in
~Epl3. The transformants were spotted onto a lawn of
S. cerevisiae RC629 cells in a soft agar overlay over
a plate of selective media and incubated overnight at
30C. A comparison of halo sizes using pSW73 and the
control shows that pSW94 exports approximately 15% as
much ~-factor as pSW73.
The constructs containing BARl fused to one copy of
the MF~l coding sequence were assayed for export of
~-factor in the same manner. Plasmid pSW67,
comprising the TPIl promoter, MF~l signal peptide,
prepro and the coding region for one copy of ~-factor
in YEpl3 was used as a control for plasmids pSW96 and
pSW97. A comparison between halo sizes indicated that
pSW96 directs secretion of approximately 30 - 40% as
much ~-factor as pSW67 and pSW97 directs se~retion
of approximately 10 - 15% as much ~-factor as pSW67.
3 ~
-35-
EXAMPLE 5
MUTATION OF THE BARl SIGNAL PEPTIDE CLEAVAGE SITE
As described above, it has been found that altering
the signal peptide cleavage site of the Barrier
precursor could be expected to facilitate processing
and export of Barrier-containing fusion proteins
through the KEX2 pathway. Potential cleavage sites
are between amino acids 23 and 24 and between amino
acids 24 and 25. Thus, the DNA sequence coding for
the BARI primary kranslation product was mutated to
encode a proline residue at position 25. Plasmids
lQ pSW9R and pSW99 are YEpl3-based plasmids comprising
the S. cerevisiae TPIl promoter, a 355 bp or 767 bp
fragment of the BARl gene, including khe mutated
signal peptide cleavage site, and one copy of the
~-factor coding sequence.
The signal peptide mutation was introduced by standard
in vitro mutagenesis methods (Zoller et aI., Manual
for Advanced ~hnlg~ in Molecular Cloning Course,
Cold Spring Harbor Laboratory, 1983) using a phage M13
template and a synthetic mutagenic oligonucleotide
(sequence 5 ATTACTGCTCCTACAAACGAT3 ). The phage
template pSW54 was constructed by ligating the 0.54 kb
Sph I-Eco RI fragment of pSW22 with Sph I-Eco RI
digested M13mpl9. Following in vitro mutagenesis,
potentially mutagenized plaques were screened by
plaque hybridization with 32P-labeled mutagenic
oligonucleotide and were sequenced to confirm
the presence of the mutationO The rsplicative form of
one of the confirmed mutagenized phage, mZC634-7, was
digested with Sph I and Eco RI and the O.54 kb
fragment was isolated and ligated with Sph I+Eco RI
cut pUC18. The resulting plasmid, pSW66 (Figure 18),
was digesked with Hind III and ~ba I to remove the
c~ ~
-36-
ADHl promoter, and the fragment comprising the vector
and BARl sequences was ligated with the 0.9 kb Hind
III-Xba I TPIl promoter fragment of pZV134. This
plasmid, with the TPIl promoter and 119 bp of the 5'
end of BARl including the signal peptide cleavage
mutation, was designated pSW82.
Referring to Figure 18, plasmid pSW82 was digested
with Hind III and Eco RI and with Bgl II and Eco RI
and the resulting 1.02 kb fragments were isolated.
The Hind III-Eco RI fragment of pSW82 was ligated with
the Eco RI-Bam HI fragment of pSW74 and Hind III~Bam
HI digested YEpl3 to form pSW99. The Bgl II-Eco RI
fragment of pSW82 was ligated with the 0.30 kb Eco
RI-Bam HI fragment of pSW70 and Bam HI digested YEpl3,
to form pSW98. Plasmid pSW98 includes the TPI1
promoter, 355 bp of the 5' end of the mutagenized BARl
sequence and a single copy of the ~-factor coding
sPquence. Plasmid pSW99 contains the identical
expression unit except for having 767 bp of the
mutagenized BARl sequence.
An analysis by the halo assay showed that the cleavage
site mutation enhanced ~-factor export when using the
plasmids encoding one copy of ~-factor. Transformants
containing pSW98 exported about 50% more ~factor than
those containing pSW96, the wild-type control.
.: :
.
.
