Note: Descriptions are shown in the official language in which they were submitted.
1321963
Modification of the DNA sequence between the Shine-
Dalgarno sequence and the start codon of the trp operon
to increase protein expression
Regulation sequences of the trp operon are frequentLy
used for the expression of eukaryotic proteins in E. coli.
A DNA segment containing the promoter and the operator of
the trp operon is now commercially available.
Modifications of the regulation sequences of the trp
operon have already been disclosed. Thus, the possibility
of the incorporation of a Hind III cleavage site between
the ribosomal binding site and the start codon in the
nucleotide sequence of the regulation element of the trp
operon from Serratia marcescens, for example, is described
in German Offenlegungsschrift 3,247,922 (corresponding to
South African Patent No. 83/9519 and Published Australian
Patent Application No. 83/22832). The insertion of a Cla I
cleavage site into the corresponcling sequence of E. coLi
is disclosed in J.C. Edman et al., Nature 291 (1981) 503-
506. However, this modification alters the number of
nucleotides between the ribosomal binding site and the
start codon compared with the natural sequence.
It has now been found that a cleavage site for a restric-
tion enzyme can be inserted in the ~NA sequence between
the ribosomal binding site and the start codon by
replacement of a single nucleotide, that is to say with-
out altering the number of nucleotides. According to theinvention, the nucleoside adenosine which is located
immediately upstream of the start codon is replaced by
cytidine.
The invention thus relates to a modified DNA segment of
; the trp operon of E. coli, which is located between the
.
.
.. ~ :
~ , '; ' .
1321963
Shine-Dalgarno sequence and the first start codon and has
the DNA sequence I
5' GTATCGACC 3' (I)
3' CATAGCTGG 5'
This sequence I is connected at the 5' end of the upper
strand to the Shine-Dalgarno sequence
5' AAGG 3'
3' TTCC 5'
of the trp operon (which, at the level of the RNA, corres-
ponds to the actual ribosomal binding site~, and is
connected at the 3' end of the upper strand to the start
codon ATG.
The sequence I according to the invention is compared
below with the natural E. coli sequence and the sequence
disclosed by Edman et al., op. cit., only the upper strand,
called the "coding strand" below, being shown for reasons
of clarity:
E. coli GTA TCG ACA
Z5 Edman et al. GTA TCG AT
Sequence I GTA TCG ACC
lAlterations from the E. coli sequence are underlined.)
This replacement according to the invention of the A in
the natural sequence by C entails the following advan-
tages:
If the nucleoside guanos;ne is connected downstream of
the start codon ATG then the recognition sequence
C~CATGG
~,
:
,.
', '~ ' .
1321963
-- 3
for the restrict;on enzyme Nco I is formed. This cleavage
- site permits the insertion of DNA in the immediate neigh-
bourhood of the start codon, for example by use of
synthetic oligonucleotides of the formula II
s
5' CATGX... 3' (II)
3' Y... 5'
in which X and Y denote the first complementary nucleo-
tide pair downstream of the start codon of a structural
gene. If in this formula X represents G, and Y represents
C, then the Nco I cleavage site is retained in the liga-
tion product. If, in contrast, for example a synthetic
Linker is inserted, whose protruding sequence 5' CATG 3',
is connected to another nucleotide, then, although the
Nco I cleavage site is eliminated, on the other hand
there is complete variability with regard to the first
amino acid downstream of the start codon.
Of course, it is also possible to fill in enzymatically
the protruding ends of the DNA which has been cut with
Nco I, for example using Klenow polymerase, and to ligate
the blunt-ended DNA of the sequence III, which has thus
been obtained,
S' GTA TCG ACC ATG 3' (III)
3 CAT AGC TGG TAC 5'
with a blunt-ended sequence IV
5' X ~......... 3' (IV)
3' Y ... 5'
to give the DNA sequence V
5' GTA TCG ACC ATG X ....... 3' (V)
3' CAT AGC TGG TAC Y ... 5'
- , ,, .:
, : ~ . ....... ::-
1321963
-- 4
X and Y having the abovementioned meanings. No further
start codon for a particular structural gene which is to
be expressed is required in this. This is favorable for
the preparation of proteins shortened at the N-terminal
end, for exampLe.
Another possibility is enzymatic degradation of the pro-
truding ends, this likewise result;ng in a blunt-ended
DNA sequence VI
5' GTA TCG AC 3' (VI)
3' CAT AGC TG 5'
which can be ligated with a blunt-ended sequence VII
5' Z ATG X .......... 3' (VII)
3' Z'TAC Y ... 5'
to give the DNA sequence VIII
5' GTA TCG ACZ ATG X .......... 3' (VIII)
3' CAT AGC TGZ'TAC Y ... 5'
Z and Z' denoting any desired nucleotide pair, which can
also be dispensed with. The natural E. coli sequence is
formed when Z and Z' represent A and T respectively.
Apart from these diverse cloning possibilities, the in-
vention offers the advantage that the expression of the
structural gene is improved to a surprising extent.
Another aspect of the invention relates to a process for
the preparation of a vector containing the trp expression
system from E. coli, which comprises cleavage of an E.
coli vector which contains the DNA sequence I tcoding
strand) followed by 5' ATGG 3' with the restriction en-
zyme Nco I and
. .
. . .
- .
.
1321963
a) l;gation of a gene structure of DNA sequence II into
the cleavage site or
b) enzymatic f;lling in of the cleavage site and lig-
ation of the DNA of the sequence III with a DNA of
the sequence IV or
c) enzymatic degradation of the protruding sequence of
the cleavage site and ligation of the DNA of the
sequence VI with the DNA of the sequence VII.
Another aspect of the invention relates to E. coli host
organisms which contain a vector obtained according to
the invention. Furthermore, the invention relates to a
process for the preparation of polypeptides composed of
genetically codable amino acids, which comprises induc-
tion, in a known manner, of expression by E. coli cellswhich have been transformed with a vector according to
the invention.
Further aspects of the invention, and their preferred
embodiments, are illustrated in detail below and set out
in the patent claims.
Figures 1 to 3 illustrate the exemplary embodiments in
detail. Thus, Figure 1 shows the preparation of the
plasmid pH 131t5 from the known plasmid ptrpL 1. Figure
2 shows the preparation of the plasmid pH 185/11, which
codes for interleukin-2, from the known plasmid p 159/6
and the plasmid pH 131/S (Figure 1). Finally, Figure 3
shows the plasmid pH 192/5 which codes for ~-interferon.
A particuLar embodiment of the invention comprises the
vector having ampicillin res;stance w;th the ~-lactamase
promoter in the same orientation as the trp promoter.
Th;s is because ;t has emerged, surpr;singly, that, owing
to the trp operon modified according to the invention,
there is not only very pronounced expression of the gene
located downstream of the start codon but also the pos-
s;bility of ;nduction of the ~-lactamase. An ;ncreased
. .
1321963
concentration of ~-lactamase confers resistance to
relatively high concentrations of ampicillin, by which
means another possibility of selection is opened up.
This makes it possible rapidly to test particularly favo-
rable promoter mutations or modifications of the nucleo-
tides in the region of the ribosomal binding site for
each protein which is to be expressed.
If the simultaneous formation of ~-lactamase is un-
1û desired, but the intention is to make use of vectors
having ampicillin resistance, it can be suppressed by
insert;on of a terminator between the structural gene for
the desired polypeptide and the structural gene for ~-
lactamase. Another embodiment of this aspect of the in-
vention accordingly comprises the insertion of a suitableterminator, preferably a bacterial terminator, between
the abovementioned genes. The terminator of the trp ope-
ron is particularly suitable, which is incorporated at a
suitable site, for example 10 to 20 nucleotides down-
stream of the stop codon (or the stop codons) for thestructural gene, or immediately upstream of the ~-
lactamase operon.
The gene construct having the trp promoter/operator
according to the invention can be incorporated in all
plasmids replicating in E. coli. It is advantageous to
use the commercially available E. col; vectors, such as
pBR 322, pBR 325, pACYC 177, pACYC 184 and pUC 8, and
their derivatives. Examples of suitable derivatives are
those plasmids from which the non-essential regions ha~e
been removed, cleavage sites or markers have been intro-
duced or have been modified.
The gene sequences II, IV, V, VII and VIII contain, with
the nucleotide pair XY, the start of any desired struc-
tural gene, for example, in the first place, a gene which
is intrinsic to the host and codes for a protein which
brings about transport into the periplasmic space or to a
., .
. ' ': ~ .
17321~53
cell membrane. It is possible in this manner to prepare
fusion proteins which can be removed from the cytoplasm,
and thus be more readily isolated, and/or be protected
from degradation by enzymes intrinsic to the cell. How-
ever, it is also possible to generate fusion proteinswhich, by reason of their insolubility, can readily be
separated from the proteins intrinsic to the celL. It is
also possible to express the desired proteins directly by
placing the structural gene immediately do~nstream of the
start codon ATG.
Examples of polypeptides which can be obtained according
to the invention are insulin, interferons, interleukins,
such as interleukin-2, hirudin or somatostatin.
The invention is illustrated in detail by the examples
which follow. Reference may be made to the textbook
"Molecular Cloning" by Maniatis et al., Cold Spring Harbor
(1982), with regard to the individual process steps.
Example 1
Chromosomal E. coli DNA is cleaved with Hinf I, and the
492 bp fragmentis i~ ~ d which contains, of the t~p operon, the
promoter, operator, the structural gene of the L-peptide,
the attenuator and the codons of the trp E structural
gene for the first six amino acids. This fragment is
filled in with deoxynucleotide triphosphates by means of
Klenow po(ymerase, connected at both ends to an oligo-
nucleotide which contains a recognition sequence forHind III, and then cleaved with Hind III. The Hind
III fragment thus obtained is Ligated in the Hind III
cleavage site of pBR 322. The plasmid thus obtained is
ptrpE2-1 (J.C. Edmann et al., op. cit.). This is trans-
ferred as described into the plasmid ptrpL1.
For the conversion of this starting material into a vec-
tor according to the invention it is reacted with Cla I
:, , . . ~
"'~
;' . ~
1321963
as recommended by the manufacturer (New England Biolabs).
After incubat;on is compLete the incubation m;xture is
extracted with phenol, the organic phase is separated
off, and the DNA is precipitated by addition of 2.5 times
the volume of ethanol and incubation at -20C.
The DNA is removed by centrifugation and then treated
kith alkaline phosphatase (Boehringer Mannheim) in order
to remove 5'-phosphate residues.
The synthetically prepared ol;gonucleotide IX
5' CGACCATGGT 3' (IX)
is phosphorylated at the 5' end with the enzyme polynucA
leotide kinase and ATP. For this purpose, the synthetic
oligonucleotide is heated at 70C for 5 minutes and
then immediately cooled in an ice bath. The phosphoryl-
ation is carried out in 25 lul of buffer (50 mM tris.HCl,
pH 7.6; 10 mM MgCl2, 5 mM dithiothreitol (DTT)) with the
addition of 100 ~uM ATP and about 10 units of T4-poly-
nucleotide kinase, at 37C over the course of 30 minutes.
The reaction is stopped by addition of the sodium salt of
ethylenediaminetetraacetic acid (EDTA) to a final con-
centration of 50 ~. Excess ATP can be removed by, forexample, gel filtration on sepharose (SEPHADEX R G 50,
fine).
The oligonucleotide IX is self-complementary and can
associate with itself to give the double-stranded struc-
ture X
5' CGACCATGGT 3' (X)
TGGTACCAGC
This double-stranded oligonucleotide X has protruding
ends which allow insertion into the Cla I site of the
opened plasmid ptrpL1.
.
,
1321963
About 50 ng of the oligonucleotide are incubated with about
1 /ug of the reacted pLasmid, which has been treated with
phosphatase, in 30 ~l of buffer t50 mM tris. HCl, pH 7.4;
10 mM MgCl2, 10 mM DTT) with the addition of 1 mM ATP
and 0.1 ng/ml bovine serum albumin (BSA) at 12C for 20
hours. The plasmid pH 131/5 is obtained (Figure 1).
The reaction mixture can be used immediately for the
transformation of competent E. coli cells. SeLection is
carried out on agar plates using L broth (H.J. Miller,
Experiments in Molecular Genetics, Cold Spring Harbor,
1972) and 50 ~g/ml amp;cillin.
Since an Nco I cleavage site has been inserted in the
plasmid pH 131/5, the ampicillin-resistant colonies were
tested to see whether the plasmid DNA therein contained a
Hind III-Nco I fragment about 300 bp in size. More than
80% of the colonies had this fragment. Sequencing by the
Maxam-Gilbert method confirmed the incorporation of the
synthetic DNA fragment and the sequence of the plasmid pH
131/5 as indicated in Figure 1.
Example 2
The plasmid p 159/6 as shown in Figure 5 of German Offen-
legungsschrift 3,419,995 is incubated with the enzymes
EcoR I and Sal I, as recommended by the manufacturers,
and a 420 bp DNA fragment which contains the genetic
information for human interleukin-2 is separated off by
gel electrophoresis. The single-stranded protruding ends
are degraded w;th mung bean nuclease (Pharmacia P-L Bio-
chemicals) under the conditions recommended by the
manufacturer.
The plasmid pH 131/5 ;s reacted with Nco I, and the pro-
truding single-stranded ends are likewise degraded with
mung bean nuclease. This is followed by incorporation of
the structural gene for interleukin-2, which is now
:, . ~ , :
,, ' ' ' ' ''": `,'' ;
,: . ' ~. :
:
- 1321963
- 10 -
blunt-ended, into the plasmid, which has been opened and
made blunt-ended, using DNA Ligase under "blunt-end" con-
ditions. Th;s results in re-formation of the NcoI cleav-
age site. Transformation into E. coli 294 is followed by
selection of the ampicillin-resistant clones which have
appropriate restriction fragments, for example an Eco RI-
Xba I fragment comprising about ~60 bp, or an Eco RI-Sac
I fragment having about 150 bp.
The nucleotide sequence was confirmed for the plasmid pH
185/11 (Figure 2) by sequencing. The Nco I restriction
site is retained in this construct.
For the expression of interleukin-2, E. coli 294 bacteria
which contain the plasmid pH 185/11 are incubated in LB
medium (H.J. Miller, op. cit.) containing 50 ~g/ml ampi-
cillin, with aeration, overnight. Then a 1:100 dilution in
M 9 medium (H.J. Miller, op. cit.) containing 1 ~g/ml
thiamine and 500 ~g/ml casamino acids is prepared. At an
OD of 0.5, induct;on can be carried out with indolyl-3-
acrylic acid to a final concentration of 15 /ug/ml. The
bacteria are removed by centrifugation after a further 2
to 3 hours. It is possible by SDS gel electrophoresis to
detect with the induced bacteria a strong protein band
which reacts with antibodies against an interleukin-2
prepared ;n accordance with German Offenlegungsschrift
3,419,995~ The band corresponds to the expected molecular
weight of interleukin-2 and does not occur with non-
induced bacteria. The biological activity of the inter-
leukin-2 can be detected in high concentration in the
induced bacteria.
The abovementioned conditions for culturing the bacteria
apply to shaken flasks. Higher concentrations of cas-
amino acids and/or L-tryptophan should be added for
fermentation to higher OD values (above 3).
:
~321963
- 11 -
Example 3
The structural gene for human ~-interferon was obtained
from a cDNA bank. The clones contain the inserts in the Pst
I site of the plasmid pBR 322. A segment of 120 bp from the
structural gene of ~-interferon was isolated by exposure
to the restriction enzymes Hinf I and Pst I. The recog-
nition sequence of the Hinf I site starts 16 nucleotides
downstream of the codon for the N-terminal methionine of
this biologically active ~-interferon.
The oligonucleotide XI, obtained by synthesis,
S' CATGAGCTACAATCTTCTTGG 3' ~XI)
3' TCGATGTTAGAAGAACCTAA 5'
Nco I Hinf I
is added onto the Hinf I end of the fragment using DNA
ligase. DNA segment XII is obtained.
Moreover, a DNA segment of 365 bp was isolated from the
structural gene of ~-interferon using Pst I and 8gl II.
This segment was cloned in the commercially available
plasmid pUC 12 which had previously been reacted with Pst
I and Bam HI. The plasmid pH 188 is obtained. After
ampl ification and re-isolation, the plasmid pH 188 is in-
cubated with Pst I and Eco RI, and the ~-;nterferon gene
fragment ;s isolated (DNA segment XIII).
The plasmid p~ 131/5 is reacted with the restriction en-
zymes Nco I and Eco RI. This is followed by incubation
of DNA segments XII and XIII with the opened plasmid in
the presence of the enzyme DNA ligase, under conditions
which result in covalent coupling of the linkages. The
expected sequence in the plasmid pH 192tS is confirmed by
restriction analysis and sequencing (Figure 3).
The process for the expression of the ~-interferon is
. .
.. . . . ..
: .: , .
:: ~
1321~63
- 12 -
analogous to Example 2. Again, a pronounced band is
detected on the electrophoresis gel after induction, this
band not being present with non-induced bacteria. The
biological activity of ~-interferon can be detected in
the extracts from the bacteria.
The structural gene for interleukin-2 was inserted in
the ~co I site of the plasmid pH 131/5 in accordance with
Example 2. After reaction of the plasmid with Eco RI,
the protruding ends were made blunt-ended by incubation
with Klenow polymerase in the presence of deoxyadenosine
triphosphate and deoxythymidine triphosphate.
Into this plasmid which has been opened and made blunt-
ended the commercially available terminator of the trp
operon (Pharmacia P-L Biochemicals) is incorporated under
"blunt-end" conditions with simultaneous ring-closure.
After growth and induction of the bacteria as described
in Example 2 and previously, the bacteria are separated
; off and lysed. SDS gel electrophoresis shows no change
in the band of the interleukin-2 protein, which has the
same intensity as in Example 2. However, the band cor-
responding to ~-lactamase exhibits a markedly lower
;ntensity.
,, . ~ .
` ~
: ~ '
