Note: Descriptions are shown in the official language in which they were submitted.
~` ` 1328840
--1--
FIBROBLAST GROWTH FACTC~ A~TAGONISTS
The present invention is directed to fibroblast
growth factor (FGF) and more particularly to FGF
antagonists produced by synthetic methods, which can be
used to reduce the effects of mammalian FGF in certain
instances.
BACKGROUND OF THE INVENTION
Both the brain and the pituitary gland have
been known to contain mitogenic factors for cultured
cells; however, until 1974, it was unclear what their
relationship was with classical pituitary hormones, such
as TSH, LH, FSH, GH and ACTH. In 1974, the purification
of a bovine growth factor called basic fibroblast growth
factor (FGF) was reported which was shown to be distinct
from pituitary hormones, Gospodarowicz, D. Nature, 249,
123-127 (1974). This growth factor is now known to have
a MW of 16,415, is basic (a pI of 9.6), and is a potent
mitogen for either normal diploid fibroblasts or
established cell lines. Purification of another
distinct growth factor, acidic brain FGF is described in
U.S. Patent No. 4,444,760 (Apr. 24, 1984). Complete
characteri~ation of this bovine acidic FGF was recently -
I reported by Esch et al., Biochemical and Biophysical
Research Communications, 133, 554-562 (1985).
Later studies confirmed that, in addition to
fibroblasts, FGF is also mitogenic for a wide variety of
¦ normal diploid mesoderm-derived and neural crest-derived
¦ cells, including granulosa cells, adrenal cortical ~ -
cells, chondrocytes, myoblasts, corneal and vascular
endothelial cells from either bovine or human origin,
vascular smooth muscle cells, and lens epithelial
cells. FGF has also been shown to substitute for
platelet-derived growth factor in its ability to support
the proliferation of fibroblasts exposed to plasma-
supplemented medium. Consistent with its ability tostimulate the proliferation of bovine and human vascular
.,
,.
.~ , ;
~,~ .
: '~
~ ~ ,, r,.` . .~
-- ~3288~
, -2-
endothelial cells, FGF has a similar activity in vivo
3 upon capillary endothelial cells; therefore, FGF is
considered an angiogenic factor.
1 SUMMARY OF THE INVENTION
;~3 5 The present invention provides FGF antagonists
which may be produced by synthetic methods and which
substantially counteract the biological effect of
mammalian FGF in certain instances.
f~ The present invention provides antagonists to
! lo basic and acidic fibroblast growth factor (FGF) which
j may be synthesized using recombinant DNA techniques or
;~ other suitable techniques, such as classical or solid
~¦ phase synthesis. Basic FGF is a 146 amino acid residue
polypeptide having the sequence set forth hereinafter.
It appears most likely that, in the native bovine FGF
molecule, none of the cysteine residues are
disulfide-bonded to each other, but that there may be
bonding of one or more of the cysteine residues to free
cysteine molecules. In any case, the present invention
¦ 20 provides biologically active peptides that supress the
j biological activity of FGF. They can be synthesized by
a recombinant DNA technique or by standard chain
elongation procedures involving stepwise addition of ~ -
amino acid residues, such as solid-phase gynthesis upon ~ -
~- 25 a solid resin support.
Pharmaceutical compositions in accordance with
invention include FGF antagonists or nontoxic salts
thereof dispersed in a pharmaceutically acceptable
liquid or solid carrier. Such pharamaceutical
compositions can be used in clinical medicine, both
~j~ human and veterinary, and in acute or chronic
administration for diagnostic or therapeutic purposes.
~1 .
1 They are useful both in vivo and in vitro in modulating
j the growth of endothelial and other related cell types.
DETAILED DESCRIPTION OF CERTAIN PREFERRED EMBODIMENTS
The invention provides antagonists to mammalian
FGF, particularly to bovine basic FGF, but also to acidic
'~' .
:, .
. ~,
~,',, ,
-3_ 13288~0
FGF, which can be readily synthesized. The nomenclature
~,used to define the peptides is that specified by
Schroder & Lubke, "The Peptides", Academic Press (1965),
wherein in accordance with conventional representation
J,5 the residue h~ving the free alpha-amino group at the
N-terminus appears to left and the residue having the
alpha-carboxyl group at the C-terminus to the right.
Where the amino acid residue has isomeric forms, it is
the L-form of the amino acid that is represented.
Bovine basic FGF has been found to be a peptide having
the following sequence:
5 10 15
Pro-Ala-Leu-Pro-Glu-Asp-Gly-Gly-Ser-Gly-Ala-Phe-Pro-Pro-Gly-
His-Phe-Lys-Asp-Pro-Lys-Arg-Leu-Tyr-Cys-Lys-Asn-Gly-Gly-Phe-
Phe-Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-Asp-Gly-Val-Arg-Glu-
Lys-Ser-Asp-Pro-His-Ile-Lys-Leu-Gln-Leu-Gln-Ala-Glu-Glu-Arg-
65 70 75
Gly-Val-Val-Ser-Ile-Lys-Gly-Val-Cys-Ala-Asn-Arg-Tyr-Leu-Ala-
Met-Lys-Glu-Asp-Gly-Arg-Leu-Leu-Ala-Ser-Lys-Cys-Val-Thr-Asp-
95 100 105 ~ --
Glu-Cys-Phe-Phe-Phe-Glu-Arg-Leu-Glu-Ser-Asn-Asn-Tyr-Asn-Thr-
110l 115 120
Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-Val-Ala-Leu-Lys-Arg-
: .,
125 130 135
Thr-Gly-Gln-Tyr-Lys-Leu-Gly-Pro-Lys-Thr-Gly-Pro-Gly-Gln-Lys-
;~ - - :. .,
~;~ 30 140 145 146
Ala-Ile-Leu-Phe-Leu-Pro-Met-Ser-Ala-Lys-Ser.
It is uncertain whether the C-terminus of the native
molecule is amidated.
The present invention provides two families of
¦ FGF antagonists which are each based upon a central -~
¦ fragment from the native hormone. The core of the first -
; is those residues appearing at positions 36-39, and the
..
, -,
~328840
--4--
core of the second is those residues appearing at
positions 107-110. In other words, relatively short
peptides containing the four residues of the first
family, as well as the tetrapeptide itself, show some
suppression of endothelial cell yrowth, when growing
under nonstimulated conditions (serum alone) and also
when serum is supplemented by the a~dition of FGF to in
vitro cell cultures. The FGF antagonism of the first
family is found to be very substantially increased by
the inclusion of N-terminal and/or C-terminal extensions
to the tetrapeptide. These extensions may comprise the
residue sequences normally found at these locations in
the native hormone, e.g., FGF(30-50) and are preferably,
but not necessarily, amidated at the C-terminus. Some
substitutions may be made in the sequence at selected
locations, as discussed hereinafter.
The basis for the antagonistic action exhibited
by these peptides is an interaction with the FGF
¦ receptor. Peptides that show antagonism to cell growth
ln vitro (including all FGF target cell types) also
prevent FGF from binding to its receptor. Again, the
minimum length of peptide contains either the core
sequence of FGF (36-39) or FGF (107-110).
¦ The second family of peptidic fragments, which
a 25 is related to the sequence of FGF (93-120), are also
antagonistic, and each contains a distinct
'~ heparin-binding site, i.e., a sequence contained within
the peptide fragment binds radioactive heparin as well
as the receptor. Because heparin is an important
element in FGF action, peptides that inhibit binding
' between FGF and heparin thereby illustrate the important
; capacity to inhibit the biological action of FGF, the
i binding of FGF to its receptor and the interaction of
, FGF with heparin. The specificity of fragments related
- 35 to FGF (24-68) and FGF (93-120) is best illustrated by
a) their effects on all three parameters of FGF action
(i.e., cell growth, heparin-binding and receptor
. ~
.
328840
interaction) and b) the observation that other FGF
; peptide fragments which do not contain one of these
tetrapeptides fail to exhibit similar activity.
~j The first family of FGF antagonist peptides
5 provided by the invention may be expressed by the
i following formula (which is based upon the naturally
occurring sequence of bovine FGF~: Tyr-Cys-Lys-Asn-
Gly-Gly-Phe-Phe-Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-Asp-
R42-Val-Arg-Glu-Lys-R47-Asp-Pro-His-Ile-Lys-Leu-Gln-
10 Leu-Gln-Ala-Glu-Glu-Arg-Gly-Val-Val-Ser-Ile-Lys-Gly-Val-Y
wherein Y is either OH or NH2. R42 may be Gly or
~ Ala or Sar, and R47 may be Ser or Ala or Thr. Sar is
-1 the abbreviation for sarcosine. Peptides having this
entire length, i.e., 45 residues, function as FGF
15 antagonists and not as partial agonists. As such, they
, suppress endothelial cell growth both in the presence of
basal FGF as well as in the presence of added F&F.
45 residues is not considered to be a maximum limit for
a peptide that will function as an FGF antagonist, a
20 main function of such an antagonist being simply to `
block the receptor on the endothelial cells without
causing activation. As a result, additional residues
may be added to either or both termini so long as the ~
¦ presence of these additional residues does not either -`
- 25 (a) turn the peptide into a partial FGF agonist or (b)
detract from the binding of the peptide to the receptor
an~/or to heparin so as to lessen its biological
~¦ activity as an FGF antagonist.
~¦ The second family of FGF antagonist peptides
; 30 provided by the invention may be expressed by the
following formula (which is based on the naturally
occurring sequence of bovine FGF): Phe-Phe-Phe-Glu-Arg-
Leu-Glu-Ser-Asn-Asn-Tyr-Asn-Thr-Tyr-Arg-Ser-Arg-Lys-Tyr-
Ser-Ser-Trp-Tyr-Val-Ala-Leu-Leu-Arg-Y, wherein Y is
35 either OH or NH2. Peptides having the entire 28
~ residues function as FGF antagonists, suppress] endothelial cell growth (and growth in other FGF target
.1 ` `.
.
, ~ , " : " . " ,., ,.,: , , ~ , "~ ,, . "" ,: "~
: , ~ , . , ,: - "
~ 6- 1~8~4~
cells) in the presence or absence of FGF. Peptides
shorter than 28 residues in length are effective to act
as antagonists to FGF. Furthermore, residues may be
added to either or both termini; however, such changes
may result in some receptor activation and thus turn the
peptide into an antagonist with partial growth activity.
It may be preferable to synthesize peptides
which are about 45 amino acids or greater in length by
using recombinant DNA methods. On the other hand, it
may be preferable to synthesize peptides of about 30
residues or less in length using the well-known chain
elongation techniques, such as solid-phase synthesis, as
on a Merrifield resin or the like.
To synthesize a FGF peptide by recombinant DNA,
a double-stranded DNA chain which encodes the desired
amino acid sequence is synthetically constructed. The
degeneracy of the genetic code permits a wide variety of
codon combinations to be used to form the D~A chain that
encodes the product polypeptide. Certain particular
codons are ~ore efficient for polypeptide expression in
certain types of organisms, and the selection of codons
preferably is made according to those codons which are
most efficient for expression in the type of organism
which is to serve as the host for the recombinant -~-
~ 25 vector. However, any correct set of codons should
¦ encode the desired product, even if slightly less
efficiently. Codon selection may also depend upon
vector construction considerations; for example, it may
be necessary to avoid creating a particular restriction
site in the D~A chain if, subsequent to insertion o~ the
synthetic D~A chain, the vector is to be manipulated
using a restriction enzyme that cleaves at such a site.
Also, it is necessary to avoid placing restriction sites
in the DNA chain if the host organism which is to be
transformed with the recombinant vector containing the
DNA chain is known to produce a restriction enzyme that
would cleave at such a site within the DNA chain.
_7_ 1 32 88 ~ 0
In addition to the FGF antagonist-encoding
sequences, the DNA chain that is synthesized may contain
additional sequences, depending upon vector construction
considerations. Typically, a DNA chain is synthesized
with linkers at its ends to facilitate insertion into
restriction sites within a cloning vector. The DNA
chain may be constructed so as to encode the desired
sequence as a portion of a fusion polypeptide; and if
so, it will generally contain terminal sequences that
encode amino acid residue sequences that serve as
proteolytic processing sites, whereby the desired
I polypeptide may be proteolytically cleaved from the
I remainder of the fusion polypeptide. The terminal
portions of the synthetic DNA chain may also contain
appropriate start and stop signals.
To assemble the desired DNA chain,
oligonucleotides are constructed by conventional
methods, such as procedures described in T. Manatis et
al., Cold Sprinq Harbor Laboratory Manual, Cold Spring
20 Harbor, New York (1982)(hereinafter, CSH). Sense and
antisense oligonucleotide chains, up to about 70
nucleotide residues long, are synthesized, preferably on
automated synthesizers, such as the Applied Biosystem
Inc. model 380A DNA synthesizer. The oligonucleotide
; 25 chains are constructed so that portions of the sense and
1~ antisense oligonucleotides overlap, associating with
each other through hydrogen bonding between complementary
base pairs and thereby forming double stranded chains,
in most cases with gaps in the strands. Subsequently,
the gaps in the strands are filled in and
oligonucleotides of each strand are joined end to end
with nucleotide triphosphates in the presence of
~¦ appropriate DNA polymerases and/or with ligases.
j~ As an alternative to construction of a
synthetic DNA chain through oligonucleotide synthesis,
~ when a peptide is desired that is a segment of the
! naturally occurring molecule, cDNA corresponding to the
:~A
1328840
--8--
desired FGF fragment may be prepared. A cD~A library or
an expression library is produced in a conventional
manner by reverse transcription from messenger RNA
(mRNA) from a FGF-producing cell line. To select clones
containing FGF sequences, hybridization probes
(preferably mixed probes to accommodate the degeneracy
of the genetic code) corresponding to portions of the
FGF protein are produced and used to identify cloneæ
containing such sequences. Screening of the expression
library with FGF antibodies may also be used, alone or
in conjunction with hybridization probing, to identify
or confirm the presence of FGF-encoding DNA sequences in
D~A library clones. Such techniques are taught, for
example in CSH, supra.
The double-stranded FGF-encoding DNA chain is
shortened appropriately to the desired length to create
the peptide of interest and then modified as necessary
to permit its insertion into a particular appropriate
cloning vector in mind. The cloning vector that is to
be recombined to incorporate the DNA chain is selected
appropriate to its viability and expression in a host
organism or cell line, and the manner of insertion of
¦ the DNA chain depends upon factors particular to the
host. For example, if the DNA chain is to be inserted
~ 25 into a vector for insertion into a prokaryotic cell,
¦ such as E. Coli, the DNA chain will be inserted 3' of a
~' promoter sequence, a Shine-Delgarno sequence (or ribosome
,I binding site) that is within a 5' non-translated portion
n and an ATG start codon. The ATG start codon is
30 appropriately spaced from the Shine-Delgarno sequence,
and the encoding sequence is placed in correct reading
frame with the ATG start codon. The cloning vector also
pr~vides a 3' non-translated region and a translation
termination site. For insertion into a eukaryotic cell,
35 such as a yeast cell or a cell line obtained from a
higher animal, the FGF fragment-encoding oligonucleotide
sequence is appropriately spaced from a capping site and
.
'
., , . ~ : . ~ ., , . , , .: . . : .. -- . .. . -. . . ~ . . .
13288~0
g
in correct reading frame with an ATG start signal. The
cloning vector also provides a 3' non-translated region
and a translation termination site.
Prokaryotic transformation vectors, such as
pBR322, pMB9, Col El, pCRl, RP4 and lambda-phage, are
available for inserting a DNA chain of the length
necessary to encode the FGF fragments of interest with
substantial assurance of at least some expression of the
encoded polypeptide. Typically, such vectors are
constructed or modified to have a unique restriction
site(s) appropriately positioned relative to a promoter,
such as the lac promoter. The DNA chain may be inserted
with appropriate linkers into such a restriction site,
with substantial assurance of production of FGF in a
prokaryotic cell line transformed with the recombinant
vector. To assure the proper reading frame, linkers of
various lengths may be provided at the ends of the FGF
peptide-encoding sequence. Alternatively, cassettes,
which include sequences, such as the 5' region of the
lac Z gene (including the operator, promoter,
transcription start site, Shine Delgarno sequence and
translation initiation signal), the regulatory region
from the tryptophane gene (trp operator, promoter,
ribosome binding site and translation initiator), and a
fusion gene containing these two promoters, called the
trp-lac or commonly called the Tac promoter, are
available into which a synthetic DNA chain may be
¦ conveniently inserted before the cassette is inserted
! into a cloning vector of choice.
' 30 Similarly, eukaryotic transformation vectors,
such as the cloned bovine papilloma virus genome, the
cloned genomes of the murine retroviruses, and
eukaryotic cassettes, such as the pSV-2 gpt system
(described by Mulligan and Berg, Nature 277, 108-114,
1979), the Okayama-Berg cloning system (Mol. Cell Biol.
2, 161-170, 1982) and the expression cloning vector
recently described by Genetics Institute (Science 228,
13288~0
--10--
810-815, 1985), are available which provide substantial
assurance of at least some expression of the FGF peptide
in the transformed eukaryotic cell line.
Another way to produce FGF fragments of desired
length is to produce the polypeptide initally as a
segment of a gene-encoded fusion polypeptide. In such
case, the DNA chain is constructed so that the expressed
polypeptide has enzymatic processing sites flanking the
FGF fragment sequence. A FGF-fragment-encoding DNA
chain may be inserted, for example, into the
beta-galactosidase gene for insertion into E. Coli, in
which case, the expressed fusion polypeptide is
subsequently cleaved with appropriate proteolytic
enzymes to release the FGF fragment from
beta-galactosidase peptide sequences.
An advantage of inserting the FGF-fragment-
encoding sequence so that it is expressed as a cleavable
segment of a fusion polypeptide, e.g., as the
FGF-fragment sequence fused within the beta-galactosidase
peptide sequence, is that the endogenous polypeptide
, into which the FGF fragment sequence is inserted is -
generally rendered non-functional, thereby facilitating
selection for vectors encoding the fusion peptide.
The peptides can be synthesized by suitable
¦~ 25 chain elongation or coupling-type methods, such as by
exclusively solid-phase techniques, by partial
solid-phase techniques, by fragment condensation or by
classical solution couplings. The techniques of
~ exclusively solid-phase synthesis are set forth in the
- 30 textbook "Solid-Phase Peptide Synthesis", Stewart ~
Young, Pierce Chemical Co., Rockford, Illinois, 1984,
and are exemplified by the disclosure of V.S. Patent No.
~ 4,105,603, issued August 8, 1978. The fragment
-~~ condensation method of synthesis is exemplified in U.S.
35 Patent No. 3,972,859 (August 3, 1976). Other available
; syntheses are exemplified by U.S. Patent No. 3,842,067
(October 15, 1974) and U.S. Patent No. 3,862,925
(3anuary 28, 1975).
,, .
,~ ~
., -, -, - , ., . .. . - .. . .; . ,, .. .. , , .. . , ... , . :
~'' '' ' ' '' "' ' ' ' '' "'.' " . .. '.. " ' ' "' ' ': ". ' : , .. , ' ' '
1328840
--11--
Common to coupling-type syntheses is the
protection of the labile side chain groups of the
various amino acid moieties with suitable protecting
groups which will prevent a chemical reaction from
occurring at that site until the group is ultimately
removed. Usually also common is the protection of an
alpha-amino group on an amino acid or a fragment while
that entity reacts at the carboxyl group, followed by
the selective removal of the alpha-amino protecting
group to allow subsequent reaction to take place at that
location. Accordingly, it is common that, as a step in
the synthesis, an intermediate compound is produced
which includes each of the amino acid residues located
in its desired sequence-in the peptide chain with
side-chain protecting groups linked to the appropriate
residues.
¦ Such an intermediate for the first family may
have the formula:
Xl-Tyr(X2)-Cys(X4)-Lys(X7)-Asn(X8)-Gly-Gly-Phe-Phe-Leu-
20 Arg(X6)-Ile-His~X9)-Pro-Asp(X3)-Gly-Arg(X6)-Val-Asp(X3)-
R42-Val-Arg(X )-Glu(X3)-Lys(X7)-R47(X5)-Asp(X3)-Pro-
i His(X )-Ile-Lys(X )-Leu-Gln(X )-Leu-Gln(X )-Ala-Glu(X )-
3 Glu(X3)-Arg(X )-Gly-Val-Val-Ser(X )-Ile-Lys(X )-Gly-Val-
X10 . .
Such an intermediate for the second family may -
have the formula:
Xl-Phe-Phe-Phe-Glu(X3)-Arg(X6)-Leu-Glu(X3)-Ser(X5)-
~ Asn(X8)-Asn(X8)-Tyr(X2)-Asn(X8)-Thr(X5)-Tyr(X2)-
;1i Arg(X6)-Ser(X5)-Arg(X6)-Lys(X7)-Tyr(X2)-Ser(X5)-
¦ 30 Ser(X5)-Trp-Tyr(X2)-Val-Ala-Leu-Lys(X7)-Arg(X6)-X10.
~` In these formulae: Xl is either hydrogen or
an a-amino protecting group. The a-amino protecting
groups contemplated by Xl are those known to be useful
in the art of step-wise synthesi 5 of polypeptides.
Among the classes of a-amino protecting groups covered
by X are (1) acyl-type protecting groups, such as
formyl, trifluoroacetyl, phthalyl, toluenesulfonyl(Tos),
,, :
;2 . .
13288~0
-12-
benzensulfonyl, nitrophenylsulfenyl, tritylsulfenyl,
o-nitrophenoxyacetyl, chloroacetyl, acetyl, and
~-chlorobutyryl; (2) aromatic urethan-type protecting
groups, such as benzyloxycarbonyl(Z) and substituted Z,
5 such as p-chlorobenzyloxycarbonyl,
p-nitrobenzyloxycarbonyl, p-bromobenzyloxycarbonyl,
p-methoxybenzyloxycarbonyl; (3) aliphatic urethan
protecting groups, such as t-butyloxycarbonyl (BOC),
diisopropylmethyloxycarbonyl, isopropyloxycarbonyl,
10 ethoxycarbonyl, allyloxycarbonyl; (4~ cycloalkyl
urethan-type protecting groups, such as
cyclopentyloxycarbonyl, adamantyloxycarbonyl,and
cyclohexyloxycarbonyl; (5) thiourethan-type protecting
groups, such as phenylthiocarbonyl; (6) alkyl-type
15 protecting groups, such as triphenylmethyl (trityl),
benzyl;(7) trialkylsilane groups, such as
trimethylsilane. The preferred a-amino protecting group
is BOC.
~ x2 is a protecting group for the phenolic
i 20 hydroxyl group of Tyr selected from the group consisting
of tetrahydropyranyl, tert-butyl, trityl, Bzl, CBZ,
J 4Br-CBZ and 2,6-dichlorobenzyl. The preferred
, protecting group is 2,6-dichlorobenzyl. X can be
~!~ hydrogen which means that there is no protecting group
25 on the hydroxyl group.
X3 is hydrogen or an ester-forming protecting
I group for the carboxyl group of Asp or Glu and is
selected from the group consisting of Bzl, cyclohexyl, ~ -
cycloheptal, 2,6-dichlorobenzyl, methyl and ethyl.
X4 is a protecting group for Cys selected
1 from the group consisting of p-methoxy-
j~ benzyl(~eOBzl), p-methylbenzyl, acetamidomethyl, trityl
and Bzl. The most preferred protecting group is
¦ p-methoxybenzyl. x6 can also be hydrogen, meaning
that there is no protecting group on the sulfhydryl.
X5 is a protecting group for the hydroxyl -
group of Thr and Ser and is selected from the group
,J ~.
: f ~
132884~
-13-
consisting of acetyl, benzoyl, tert-butyl, trityl,
tetrahydropyranyl, Bzl, 2,6-dichlorobenzyl and CBZ. The
! preferred protecting group is Bzl. X5 can be
hydrogen, which means there is no protecting group on
the hydroxyl group.
x6 is a protecting group for the guanido
` group of Arg selected from the group consisting of
nitro, Tos, CBZ, adamantyloxycarbonyl, and BOC, or is
hydrogen;
X7 is hydrogen or a protecting group for the
side chain amino substituent of Lys. Illustrative of
1 suitable side chain amino protecting groups are
¦ 2-chlorobenzyloxycarbonyl(2-Cl-Z), Tos, CBZ,
-~ t-amyloxycarbonyl and BOC.
The selection of a side chain amino protecting
1I group is not critical except that it must be one which
3 is not removed during deprotection of the a-amino groups
¦ during the synthesis. Hence, the a-amino protecting
`3, group and the side chain amino protecting group cannot
1 20 be the same.
x8 is a protecting group for the side chain
amido group of Gln and/or Asn and is preferably xanthyl
(Xan). Optionally x8 can be hydrogen.
X9 is a protecting group for the imidazole
'J 25 nitrogen of His, such as Tos or dinitrophenyl, or may be
; hydrogen.
X is selected from the class consisting of
l OH, OCH3, esters, amides, hydrazides, -O-CH2-resin
¦ support and -NH-resin support, with the groups other
~ 30 than OH and amides being broadly considered as
J protecting groups.
~ In the formula for the intermediate, at least -
;- 1 2 3 4 5 x6 X7 x8
-1 one of X , X , X , X , X ,
;'~ X9 and X10 is a protecting group.
~t 35 In selecting a particular side chain protecting
;l group to be used iN the synthesis of the peptides, the
following rules are followed: (a) the protecting group
~ ~ .
. .,~
~ , .
1328~40
-14-
should be stable to the reagent and under the reaction
conditions selected for removing the a-amino protecting
group at each step of the synthesis, (b) the protecting
group should retain its protecting properties and not be
split off under coupling conditions, and (c) the side
chain protecting group should be removable, upon the
completion of the synthesis containing the desired amino
acid sequence, under reaction conditions that will not
alter the peptide chain.
The peptides are preferably prepared using
solid phase synthesis, such as that described by
Merrifield, J. Am Chem. Soc., 85, p 2149 (1963),
although other equivalent chemical syntheses known in
the art can also be used as previously mentioned.
Solid-phase synthesis is commenced from the C-terminal
end of the peptide by coupling a protected a-amino acid
to a suitable resin. Such a starting material can be
prepared by attaching a-amino-protected Val by an ester
linkage to a chloromethylated resin or a hydroxymethyl
20 resin, or by an amide bond to a BHA resin or MBHA ~-
resin. The preparation of the hydroxymethyl resin is
described by Bodansky et al., Che~. Ind. (London) 38,
1597-98 (1966). Chloromethylated resins are
commercially available from Bio Rad Laboratories,
Richmond, California and from Lab. Systems, Inc. The
preparation of such a resin is described by Stewart et
~ al., "Solid Phase Peptide Synthesis" (Freeman & Co., San
! Francisco 1969), Chapter 1, pp 1-6. BHA and MBHA resin
supports are commercially available and are generally ~ ~-
! 30 used only when the desired polypeptide being synthesized
has an a-carboxamide at the C-terminal.
For example, a peptide of the first family can
be prepared by coupling Val, protected by BOC, to a
chloromethylated resin according to the procedure of
Monahan and Gilon, BioPolvmer 12, pp 2513-19, 1973 when,
for example, it is desired to synthesize such a peptide
with free carboxy terminus. Following the coupling of
, - .
.. ...
~ "
13288~
-15-
BOC-Val, the a-amino protecting group is removed, as by
using trifluoroacetic acid(TFA) in methylene chloride,
TFA alone or HCl in dioxane. The deprotection is
carried out at a temperature between about OC and room
temperature. Other standard cleaving reagents and
conditions for removal of specific a-amino protecting
groups may be used as described in Schroder & Lubke,
"The Peptides", 1 pp 72-75 (Academic Press 1965).
After removal of the a-amino protecting group
of Val, the remaining a-amino- and side chain-protected
amino acids are coupled stepwise in the desired order to
obtain an intermediate compound as defined hereinbefore.
As an alternative to adding each amino acid separately
in the synthesis, some of them may be coupled to one
another prior to their addition to the solid phase
reactor. The selection of an appropriate coupling
reagent is within the skill of the art; particularly
suitable as a coupling reagent is N,N'-dicyclohexyl
j carbodiimide (DCCI).
Activating reagents used in solid phase
synthesis of the peptides are well known in the peptide
~ synthesis art. Examples of suitable activating reagents
3 are: (1) carbodiimides, such as N,N'-diisopropyl
carbodiimide, N-N'-dicyclohexylcarbodiimide(DCCI); (2)
cyanamides such as N,N'-dibenzylcyanamide; (3)
~ keteimines; (4) isoxazolium salts, such as
i N-ethyl-5-phenyl isoxazolium-3'-sulfonate; (5)
¦ monocyclic nitrogen-containing heterocyclic amides of
~, aromatic character containing one through four nitrogens
in the ring, such as imidazolides, pyrazolides, and
1,2,4-triazolides. Specific heterocyclic amides that are
useful include N,N'-carbonyl diimidazole,
N,N'-carbonyl-di-1,2,4-triazole; (6) alkoxylated
acetylene, such as ethoxyacetylene; (7) reagents which
form a mixed anhydride with the carboxyl moiety of the
amino acid, such as ethylchloroformate and
isobutylchloroformate and ~8) reagents which form an
,
,, .
1328840
-16-
active ester with the carboxyl moiety of the amino acid,
; such as nitrogen-containing heterocyclic compounds
having a hydroxy group on one ring nitrogen, e.g.
~-hydro~yphthalimide, N-hydroxysuccinimide and
5 l-hydroxybenzotriazole(HOBT). Other activating reagents
and their use in peptide coupling are described by
Schroder & Lubke supra, in Chapter III and by Kapoor, J.
Phar. Sci., 59, pp 1-27 (1970).
Each protected amino acid or amino acid
10 sequence is introduced into the solid phase reactor in
about a twofold or more excess, and the coupling may be
carried out in a medium of dimethylformamide(DMF):C~2C12
(1:1) or in DMF or CH2C12 alone. In cases where
` incomplete coupling occurs, the coupling procedure is
f 15 repeated before removal of the a-amino protecting group
prior to the coupling of the next amino acid. If
performed manually, the success of the coupling reaction
at each stage of the synthesis is monitored by the
ninhydrin reaction, as described by E. Kaiser et al.,
Anal. Biochem. 34, 595 (1970).
After the desired amino acid sequence has been
` completed, the intermediate peptide is removed from the 1-`
! resin support by treatment with a reagent, such as
liquid hydrogen fluoride, which not only cleaves the --
25 peptide from the resin but also cleaves all remaining `-
, side chain protecting groups X2, X3, X4, X5,
;I X6, X7, x8 and X9 and the a-amino protecting
group Xl to obtain the peptide. ~
As an alternative route, the intermediate -
~ 30 peptide may be separated from the resin support by -
-, alcoholysis after which the recovered C-terminal alkyl
ester is converted to the acid by hydrolysis. Any side
chain protecting groups may then be cleaved as
previously described or by other known procedures, such
35 as catalytic reduction (e.g. Pd on BaSO4). When using
hydrogen fluoride for cleaving, anisole and methylethyl
sulfide are included in the reaction vessel for
scavenging.
:~
132%8~0
-17-
The following Examples set forth preferred
methods for synthesizing FGF antagonists by the
solid-phase technique. It will of course be appreciated
that the synthesis of a correspondinyly shorter peptide
fragment is effected in the same manner by merely
eliminating the requisite number of amino acids at
either end of the chain.
EXAMPLE I
-
The synthesis of FGF(24-68)-amide having the
formula: H-Tyr-Cys-Lys-Asn-Gly-Gly-Phe-Phe-Leu-Arg-
Ile-His-Pro-Asp-Gly-Arg-Val-Asp-Gly-Val-Arg-Glu-Lys-
Ser-Asp-Pro-His-Ile-Lys-Leu-Gln-Leu-Gln-Ala-Glu-Glu-
Arg-Gly-Val-Val-Ser-Ile-Lys-Gly-Val-NH2 is conducted
in a stepwise manner using a Beckman 990 Peptide
Synthesizer and an MBHA resin. Coupling of BOC-Val to
the resin is performed by the general procedure set
forth in U.S. Patent No. 4,292,313, and it results in
the substitution of about 0.2-0.6 mmol Val per gram of
resin depending on the substitution of the MHBA resin
used.
~ 20 After deprotection and neutralization, the
¦ peptide chain is built step-by-step on the resin.
! Deprotection, neutralization and addition of each amino
acid is performed in general accordance with the
3 procedure set forth in detail in Guillemin et al. U.S.
25 Patent No. 3,904,594. The couplings are specifically
¦ carried out as set out in the following schedule.
I
,, ,'
1'
:, ,"``: ' .~ - ,-,,,, ,, ,;,~,-",,;~5~ , ,, ,",, ~ " ; " ~ ~ ~
13288~0
-18-
SCHEDULE
MIX TIMES
STEPREAGENTS A~D OPERATIONS MIN.
1CH2C12 wash (2 times) 0.5
2 45% trifluoroacetic acid (TFA) 0.5
+ 5% 1,2-ethanedithiol in CH2C12 (1 time)
3 45% trifluoroacetic acid (TFA) 20.0
1 + 5~ 1,2-ethanedithiol in CH2C12 (1 time)
i 4 CH2C12 wash (3 times) 0.5
CH30H wash (2 times) 0.5
6 10% triethylamine (Et3N) in CH2C12 0.5
neutralization (2 times) -
7 CH30H wash (2 times) 0.5
~ 8 10~ triethylamine (Et3N) in CH2C12 0.5
i 15 neutralization (2 times)
i 9 CH30H wash (2 times) 0.5
10 CH2C12 wash (2 times) 0.5
I 11 *Boc-amino acid (1 mmole/g resin)
plus equivalent amount of 120
dicyclohexylcarbodiimide (DCC) in - -
2C12 ` ~-
, 12 CH2C12 wash (1 time) 0.5 ^-
13 50% dimethylformamide in CH2C12 0.5
wash (2 times)
25 14 10% triethylamine (Et3N) in CH2C12 0.5
wash (1 time)
CH30H wash (2 times) 0.5
16 CH2C12 wash (2 times) 0.5
i~:
1 17 25% acetic anhydride in CH2C12 20.0
(2 ml/g resin)
18 CH2C12 wash (2 times) 0.5
~; 19 CH30H wash (2 times) 0.5
* For the coupling of Asn and Gln,an 1.136
molar excess of l-hydroxybenzotriazole (HOBt) was
- included in this step.
, . ':
''.
, 1
~3288~0
-19-
Briefly, for the coupling reaction, one mmol.
of BOC-protected amino acid in methylene chloride is
used per gram of resin, plus one equivalent of 0.5 molar
DCCI in methylene chloride or 30% DMF in methylene
chloride, for two hours. When Arg is being coupled, a
mixture of 10% DMF and methylene chloride is used. Bzl
is used as the hydroxyl side-chain protecting group for
Ser and Thr. 2-chloro-benzyloxycarbonyl (2Cl-Z) is used
as the protecting group for the Lys side chain. Tos is
used to protect the guanidino group of Arg, and the Glu
or Asp carboxyl group is protected as the Bzl ester.
The phenolic hydroxyl group of Tyr is protected with
2,6-dichlorobenzyl. Asn and Gln are left unprotected.
At the end of the synthesis, the following composition
is obtained:
(Xl)Tyr(X2)-Cys(X4)-Lys(X7)-Asn-Gly-Gly-Phe-Phe-Leu-
Arg(X6)-Ile-His(X9)-Pro-Asp(X3)-Gly-Arg(X6)-Val-Asp(X3)-
Gly-Val-Arg(X6)-Glu(X3)-Lys(X7)-Ser(X53-Asp(X3)-Pro-
His(X9)-Ile-Lys(X7)-Leu-Gln-Leu-Gln-Ala-Glu(X3)-Glu(X3)-
~ Arg(X6)-Gly-Val-Val-Ser(X5)-Ile-Lys(X )-Gly-Val-
i 20 X10 wherein Xl is BOC, x2 is 2,6-dichlorobenzyl,
X3 is benyzl ester, X4 is MeOBzl, X5 is Bzl, x6
is Tos, X is 2Cl-Z, X9 is Tos and X10 is -NH-MBHA
-, resin support.
After the final Tyr residue has been coupled to
the resin, the BOC group is removed with 45~ TFA in
CH2C12. In order to cleave and deprotect the
remaining protected peptide-resin, it is treated with
1.5 ml. anisole, 0.25 ml. methylethylsulfide and 10 ml.
hydrogen fluoride (HF) per gram of peptide-resin, at
-20C. for one-half hour and at 0C. for one-half hour.
After elimination of the HF under high vacuum, the
; resin-peptide remainder is washed alternately with dry
diethyl ether and chloroform, and the peptide is then
extracted with degassed 2~ aqueous acetic acid.
- 35 Lyophilization of the acetic acid extract provides a
white fluffy material.
~., .
,', -.
,
~32~8~0
-20-
The cleaved and deprotected peptide is then
dissolved in 30% acetic acid and subjected to Sephadex
G-50 fine gel filtration.
The peptide is then further purified by CM-32
carboxymethyl cellulose (Whatman~ cation-exchange
5 chromatography(l.8x 18 cm., Vbed = 50 ml-) using a
concave gradient generated by dropping 1 L. of 004 M
NH40Ac, pH 6.5 into a mixing flask containing 400 ml.
0.01 M. NH40Ac, pH 4.5. Final purification is carried
out using preparative HPLC on a Vydec*C4 column using
10 a 0.1% TFA and acetonitrile solvent system. Purification
details are generally set forth in Ling et al. Biochem.
Biophys. Res. Commun. 95, 945 (1980). The
chromatographic fractions are carefully monitored by
TLC, and only the fractions showing substantial purity
15 are pooled.
The synthesis is repeated using a
chloromethylated resin to produce the same peptide
having a free acid C-terminus, generally following the
procedure described in BiopolYmers, 12, 2513-19 (1973)
20 to link Val to the chloromethylated resin.
I EXAMPLE II
I To determine the effectiveness of the FGF
! fragment peptide to inhibit the growth endothelial
`I cells, the peptide is tested under conditions to measure
} 25 its ability to modulate both basal cell growth and
¦ FGF-simulated cell proliferation. A bioassay was
employed of the type set forth in detail in
Gospodarowicz et al., J Cell Biol., 122, 323-333 (1985).
For each test, an initial cell density of
between about 0.3-0.5 x 104 cells per well was
i established in 24-miniwell plates. After 6-8 hours, the
cells in each well were treated with a challange dose of
FGF in the absence, or presence to a varying
concentration, of a synthetic FGF antagonist. The
precise treatment was repeated 48 hours later. On the
fifth day, the cells were digested with trypsin, and the
* trade mark
~.~
~,~,, .
1328%~
-21-
total number of cells in each well was determined using
a Coulter particle counter. Testing of the peptide
FGF(24-68)-NH2 shows full antagonist activity to both
basal cell growth and to FGF-stimulated cell growth,
with cell population being reduced by about 84% and
about 92~, respectively, at a concentration of about 100
ug/ml. Like results are obtained from the testing of
FGF(24-68)-OH, with both peptides exhibiting an ID50
of ~bout 5 micromoles.
Testing is then carried out to determine the
effect of the fragments of FGF on the binding of I125
FGF to BHK cells, in order to determine the interaction
with the receptors of FGF target cells, and is also
carried out to determine the binding of the fragments to
[ H]-heparin. FGF(24-68)-NH2, at a concentration of
lOOug/ml., reduces the amount of radioactive FGF bound
to the cells by about 54% and shows strong affinity to
~ bind heparin.
`', EXAMPLE III
¦ The synthesis of [Tyr50]-FGF(3O-5O)-NH2
having the formula: H-Phe-Phe-Leu-Arg-Ile-His-Pro-
Asp-Gly-Arg-Val-Asp-Gly-Val-Arg-Glu-Lys-Ser-Asp-Pro-
~f Tyr-NH2 is conducted in a stepwise manner using a
:i~ Beckman 99O synthesizer and an MBHA resin in the manner
¦ described in Example I. The peptide is judged to be
substantially pure using TLC and HPLC. Testing in the
manner set forth in Example II shows that the peptide
has full antagonist activity to both basal and
FGF-~timulated endothelial cell growth, reducing cell
, population by about 19~ and about 16%, respectively.
EXAMPLE IV
f The synthesis of FGF(3O-49)-NH2 having the
formula: H-Phe-Phe-Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-
f Asp-Gly-Val-Arg-Glu-Lys-Ser-Asp-Pro-NH2 is conducted
in a stepwise manner using a Beckman 99O synthesizer and
i 35 an MBHA resin in the manner described in Example I
except that cyclohexyl instead of Bzl is used to protect
~; ' - ~' ,' ,,~.-, ,,, 1'~,'""', ;,'',,.",",,~" ;~.~" ~ ",,
13288~0
-22-
Asp and Glu. The peptide is judged to be substantially
pure using TLC and HPLC. Testing in the manner set
forth in Example II shows that the peptide has full
antagonist activity to both basal and FGF-stimulated
endothelial cell growth.
EXAMPLE V
The synthesis of CTyr ]-FGF(25-68)-NH2
having the formula: H-Tyr-Lys-Asn-Gly-Gly-Phe-Phe-
Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-Asp-Gly-Val-Arg-
Glu-Lys-Ser-Asp-Pro-His-Ile-Lys-Leu-Gln-Leu-Gln-Ala-
Glu-Glu-Arg-Gly-Val-Val-Ser-Ile-Lys-Gly-Val-NH2 is
conducted in a stepwise manner using a Beckman 990
synthesizer and an MBHA resin in the manner described in
Example I. The peptide is judged to be substantially
pure using TLC and HPLC. Testing in the manner set
forth in Example II shows that the peptide has full
antagonist activity to both basal and FGF-stimulated
endothelial cell growth, reducing cell population by
about 86~ and about 95~, respectively, and that it has a
very strong binding affinity for BHK cells and heparin.
EXAMPLE VI
The synthesis of ~Tyr30'50]-FGF(30-50)-OH
having the formula: H-Tyr-Phe-Leu-Arg-Ile-His-Pro-Asp-
I Gly-Arg-Val-Asp-Gly-Val-Arg-Glu-Lys-Ser-Asp-Pro-Tyr-OH
is conducted in a stepwise manner using a Beckman 990
synthesizer and a chloromethylated resin in the manner
described hereinbefore. The peptide is judged to be
substantially pure using TLC and HPLC. Testing in the
manner set forth in Example II shows that the peptide
has full antagonist activity to both basal and
FGF-stimulated endothelial cell growth.
EXAMPLE VII
The synthesis of FGF(32-53)-NH2 having the
' formula: H-Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-Asp-
Gly-Val-Arg-Glu-Lys-Ser-Asp-Pro-His-Ile-Lys-Leu-NH2 is ..
conducted in a stepwise manner using a Beckman 990
synthesizer and an MBHA resin in the manner described in
-23- 13288~0
Example I. The peptide is judged to be substantially
pure using TLC and HPLC. Testing in the manner set
forth in Example II shows that the peptide has full
antagonist activity to both basal and FGF-stimulated
endothelial cell growth.
ExAMæLE VIII
The synthesis of FGF(32-39)-NH2 having the
formula: H-Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-NH2 is
conducted in a stepwise manner using a Beckman 990
synthesizer and an MBHA resin in the manner described in
Example I. The peptide is judged to be substantially
pure using TLC and HPLC. Testing in the manner set
forth in Example II shows that the peptide has full
' antagonist activity to both basal and FGF-stimulated
endothelial cell growth, reducing cell population by
about 37% and about 11%, respectively.
EXAMPLE IX
The synthesis of FGF(24-63)-NH2 having the
formula: H-Tyr-Cys-Lys-Asn-Gly-Gly-Phe-Phe-Leu-Arg-
Ile-His-Pro-Asp-Gly-Arg-Val-Asp-Gly-Val-Arg-Glu-Lys-
~¦~ 20 Ser-Asp-Pro-His-Ile-Lys-Leu-Gln-Leu-Gln-Ala-Glu-Glu-
Arg-Gly-Val-Val-NH2 is conducted in a stepwise manner
using a Beckman 990 synthesizer and an MBHA resin in the
manner described in Example I. The peptide is judged to
' be substantially pure using TLC and HPLC. Testing in
the manner set forth in Example II shows that the
peptide has full antagonist activity to both basal and
~, FGF-stimulated endothelial cell growth.
i EXAMPLE X
The synthesis of ~Ala47~-FGF(24-63)-NH2
having the formula: H-Tyr-Cys-Lys-Asn-Gly-Gly-Phe-
' Phe-Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-Asp-Gly-Val-
Arg-Glu-Lys-Ala-Asp-Pro-His-Ile-Lys-Leu-Gln-Leu-Gln-
Ala-Glu-Glu-Arg-Gly-Val-Val-NH2 is conducted in a
-j stepwise manner using a Beckman 990 synthesizer and an
;~ 35 MBHA resin in the manner described in Example I. The
,~ peptide is judged to be substantially pure using TLC and
/
.. . .
~,'' ,
~288~0
-24-
HPLC. Testing in the manner set forth in Example II
shows that the peptide has full antagonist activity to
both basal and FGF-stimulated endothelial cell growth.
EXAMPLE XI
The synthesis of [Sar42]-FGF(36-6~)-NH2
having the formula: H-Pro-Asp-Gly-Arg-Val-Asp-Sar-
Val-Arg-Glu-Lys-Ser-Asp-Pro-His-Ile-Lys-Leu-Gln-Leu-
Gln-Ala-Glu-Glu-Arg-Gly-Val-Val-Ser-Ile-Lys-Gly-Val-NH2
is conducted in a stepwise manner using a Beckman 990
I synthesizer and an MBHA resin in the manner described in
Example I. The peptide is judged to be substantially
~ pure using TLC and HPLC. Testing in the manner set
3~ forth in Example II shows that the peptide has full
~1 antagonist activity to both basal and FGF-stimulated
3 endothelial cell growth.
~ 15 EXAMPLE XII
'3 The synthesis of [Ala42]-FGF(36-68)-NH2
having the formula: H-Pro-Asp-Gly-Arg-Val-Asp-Ala- - ;
¦~ Val-Arg-Glu-Lys-Ser-Asp-Pro-His-Ile-Lys-Leu-Gln-Leu-
~,~ Gln-Ala-Glu-Glu-Arg-Gly-Val-Val-Ser-Ile-Lys-Gly-Val-NH2 :'. .
is conducted in a stepwi~e manner using a Beckman 99O
synthesizer and an MBHA resin in the manner described in
Example I. The peptide is judged to be substantially
;~ pure using TLC and HPLC. Testing in the manner set
forth in Example II shows that the peptide has full
antagonist activity to both basal and FGF-stimulated
endothelial cell growth. -
, EXAMPLE XIII
,~ The ~ynthesis of FGF(35-50)-NH2 having the ~ -
formula: H-His-Pro-Asp-Gly-Arg-Val-Asp-Gly-Val-Arg-
Glu-Lys-Ser-Asp-Pro-His-NH2 is conducted in a stepwise
manner using a Beckman 99O synthesizer and an MBHA resin
j~ in the manner described in Example I. The peptide is
judged to be substantially pure using TLC and HPLC.
Testing in the manner set forth in Example II shows that
the peptide has full antagonist activity to both basal
and FGF-stimulated endothelial cell growth.
~ .
.~
1328840
-25-
EXAMPLE XIV
The synthesis of [Ala42, Thr47]-FGF(35-50)-NH2
having the formula: H-His-Pro-Asp-Gly-Arg-Val-Asp-Ala-
Val-Arg-Glu-Lys-Thr-Asp-Pro-His-NH2 i5 conducted in a
stepwise manner using a Beckman 990 synthesizer and an
MBHA resin in the manner described in Example I. The
peptide is judged to be substantially pure using TLC and
HPLC. Testing in the manner set forth in Example II
shows that the peptide has full antagonist activity to
both basal and FGF-stimulated endothelial cell growth.
EXAMPLE XV
The synthesis of FGF(36-39)-NH2 having the
formula: H-Pro-Asp-Gly-Arg-NH2 is conducted in a
stepwise manner using a Beckman 990 synthesizer and an
MBHA resin in the manner described in Example I. The
tetrapeptide is judged to be substantially pure using
TLC and HPLC. Testing in the manner set forth in
Example II shows that the peptide has full antagonist
activity to both basal and FGF-stimulated endothelial
cell growth, reducing cell population by about 37% and
about 54%, respectivelyO It has biological potency less
than that of FGH(24-68), exhibiting an ID50 at between
about 30 and 50 micromoles.
EXAMPLE XVI
The synthesis of FGF(93-120)-NH2 having the
formula: H-Phe-Phe-Phe-Glu-Arg-Leu-Glu-Ser-Asn-Asn-Tyr-
Asn-Thr-Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-Val-Ala-
Leu-Lys-Arg-NH2 is conducted in a stepwise manner
using a Beckman 990 synthesizer and an MBHA resin in the
manner described in Example I. The peptide is judged to
be substantially pure using TLC and HPLC. Testing in
the manner set forth in Example II shows that the
peptide has full antagonist activity to both basal and
FGF-stimulated endothelial cell growth, and that it
binds very strongly to BHK cells and heparin.
~'
, .
-26- 1~288~0
EXAMPLE XVII
The synthesis of FGF(107-110)-NH2 having the
formula: H-Arg-Ser-Arg-Lys-NH2 is conducted in a
stepwise manner using a Beck~an 990 synthesizer and an
MBHA resin in the manner described in Example I. The
peptide is judged to be substantially pure using TLC and
HPLC. Testing in the manner set forth in Example II
shows that the peptide has full antagonist activity to
both basal and FGF-stimulated endothelial cell growth.
EXAMPLE XVIII
The synthesis of FGF(106-115)-NH2 having the
formula: H-Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-NH2
is conducted in a stepwise manner using a Beckman 990
synthesizer and an MBHA resin in the manner described in
Example I. The peptide is judged to be substantially
pure using TLC and HPLC. Testing in the manner set
forth in Example II shows that the peptide has full
antagonist activity to both basal and FGF-stimulated
I endothelial cell growth, and that it binds strongly to
¦ BHK cells and to heparin.
EXAMPLE XIX
Using conventional methods, described in CSH, supra.,
a synthetic FGF-fragment gene is constructed having the
following formula:
5~ AATTCATGTATTGTAAAAACGGGGGGTTC
GTACATAACATTTTTGCCCCCCAAG
TTCCTACGAATCCACCCAGATGGGCGAGTAGATGGGGTACGAGAA
~ AAGGATGCTTAGGTGGGTCTACCCGCTCATCTACCCCATGCTCTT
! AAATCCGATCCACACATCAAACTACAACTACAAGCCGAAGAACGA
TTTAGGCTAGGTGTGTAGTTTGATGTTGATGTTCGGCTTCTTGCT
GGGGTAGTATCCATCAAAGGGGTATAAG 3'
CCCCATCATAGGTAGTTTCCCCATATTCAGCT 5'
Synthesis of such a FGF-fragment-encoding DNA
chain is accomplished by synthesizing oligonucleotides
on an Applied Biosystems automatic synthesizer with
overlapping complementary sequences.
.
. ' i i ~ , , . ~,, , '; ~ , . .. .
1~288~
-27-
The overlapping oligonucleotides are fused to
form a double-stranded DNA chain, gaps being filled in
with DNA polymerase and with T4 ligase. Immediately 5'
of the FGF-fragment-encoding sequence in the sense
strand is provided an ATG start signal, which results in
an extraneous methionine being added to the N-terminus
of the e~pressed polypeptide. Immediately 3' of the
FGF-fragment-encoding sequence is a stop signal. At the
5' end is a Eco RI overhang and at the 3' end is a Sal I
overhang, whereby the synthetic DNA strand is directly
insertable in the Eco RI and Sal I site of the plasmid
pUC8, described by Vieira er al. Gene 14, 259-268
(1982). The DNA strand is annealed into the pUC8
plasmid where it is under the control of thè beta
galactosidase promoter with the ATG start signal and the
Shine Delgarno sequence retained in their natural
orientation and association with the promoter.
The recombinant vector, designated FGF(24-68),
I is transfor~ed into the DH-l strain of E. Coli by the
; calcium chloride procedure, CSH, supra.
The transformed E. Coli is cultured in L broth, --
and ampicillan-resistant strains are selected. Because
the DNA chain was inserted into the plasmid in an
~; orientation which could be expected to lead to
expression of protein product of the D~A chain, the
ampicillan-resistant colonies are screened for
reactivity with antiserum raised against FGF. These
colonies are screened by the`immunological method of
Healfman et al., Proc. Natl. Acad. Sci. USA 80, 31-35
~1983), and colonies reacting positively with FGF
antibody are further characterized. The cells,
following separation from their culture media, are
; lysed, and their supernatent obtained. Supernatent from
these transformed cells is determined by RIA to be
reactive with antibodies raised against FGF.
100 ml. of cell supernatant is obtained, and
the desired FGF(24-68) fragment is purified as described
,j , , . ..... , . , . .. .. . . ,." ., , .: .. - : : ;. .
~ 13288~0
-28-
above. Approximately 0.01 mg. of FGF(24-68), purified
to upwards of 98~i by weight of total protein, is
produced.
The biological activity of the synthetic FGF -
fragment, which contains the extraneous N-terminal
methionine residue, is tested for biological activity
with respect to ability to inhibit the growth of adult
bovine aortic arch endothelial cells in culture, using
an assay similar to that described in J. Cell Biol. 97,
1677-1685 (1983). Briefly, cells (at passage 3-10) are
seeded at a density of 2 x 10 cells/dish on plastic
tissue culture dishes and exposed to Dulbecco's modified
Eagle's medium (DMEM) supplemented with 10% calf serum.
Test samples, at a dilution ranging from 10 to
10 3, are added on day O and day 2 to the dishes. On
day 4, triplicate dishes are trypsinized and counted in
a Coulter counter. Background levels are ordinarily
I 10 cells/dish, while those exposed to specified
¦ varying concentrations of the FGF antagonist contain as
few as 10 cells/dish. For a potency assay, a log
response curve is established. For this purpose, 10
,~ microliter-aliquots of a dilution (ranging from 10 1
1 to 10 5) of the original solution made in 0.5% bovine
~3 serum albumin (BSA)/DMEM are added in triplicate.
The superfluous ~-terminal residue is removable
~ 25 by partial chemical digestion with cyanogen bromide or
i~ phenyl isothiocyanate followed by treatment with a
strong anhydrous acid, such as trifluoroacetic acid.
After subjection to such cyanogen bromide treatment, the
FGF fragment continues to substantially reduce the total
number of cells present per dish.
Exam~le XX
A plasmid, following amplification in one of
the FGF-fragment producing E. Coli clones of Example
XIX, is isolated and cleaved with Eco RI and Sal I.
This digested plasmid is electrophoresed on an agarose
gel allowing for the separation and recovery of the
.~. ,
.,; .
,. . .
: ;' " "., " .. ,'' ' ''' '.'' ,. :. ' , .: .' .' ' . ., :. ' " '' ' ~ ' "i. .`. ,., ' ;'"' ' '
1~2~84~
-29-
amplified FGF fragment insert. The insert is inserted
into the plasmid pYEp, a shuttle vector which can be
used to transform both E. Coli and Saccharomvces
cerevisiae yeast. Insertion of the synthetic DNA chain
at this point assures that the DNA sequence is under the
control of a promoter, in proper reading frame from an
ATG signal and properly spaced relative to a cap site.
The shuttle vector is used to transform URA3, a strain
of S. cerevisiae yeast from which the oratate
monophosphate decarboxylase gene is deleted.
The transformed yeast is grown in medium to
attain log growth. The yeast is separated from its
culture medium, and cell lysates are prepared. Pooled
cell lysates are determined by RIA to be reactive with
~- antibody raised against FGF, demonstrating that a
peptide containing FGF peptide segments is expressed
within the yeast cells.
The invention provides polypeptides which are
biologically active antagonists of both basic FGF and
' acidic FGF, because both have been shown to act upon the
same receptors, and -qhould be available for biological
~ and therapeutic use. The production of longer FGF
s, fragments can be carried out in both prokaryotic and
`, eukaryotic cell lines. While such synthesis is easily
I demonstrated using either bacteria or yeast cell lines,
ij 25 the synthetic genes should be insertable for expression
in cells of higher animals, such as mammalian tumor
cells. Such mammalian cells may be grown, for example,
as peritoneal tumors in host animals, and FGF fragments
harvested from the peritoneal fluid. The shorter FGF
fragments can simply be made by solid-phase or other
coupling-type synthesis.
Although the above examples demonstrate that
FGF-fragments can be synthesized through recombinant DNA
techniques, the examples do not purport to have
maximized production. It is expected that subsequent
selection of more efficient cloning vectors and host
,
,. . :
",
. ~
~2~8~
-30-
cell lines will increase the yield of FGF fragments.
Known gene amplification techniques for both eukaryotic
and prokaryotic cells may be used to increase
production. Secretion of the gene-encoded polypeptide
from the host cell line into the culture medium is also
considered to be an important factor in obtaining
synthetic FGF fragments in large quantities.
Brain and pituitary basic FGF preparations, as
reported earlier, are mitogenic for a wide variety of
normal diploid cultured cells derived from tissue
originating from the primary or secondary mesenchyme, as
well as fro~ neuroectoderm. These include rabbit
chondrocytes, bovine granulosa and adrenal cortex cells,
bovine corneal endothelial cells, capillary endothelial
cells derived from bovine adrenal cortex and human
umbilical endothelial cells. FGF antagonists are useful
biological materials for regulating in vitro growth of
, cultured cell lines and are expected to also function in
! this manner when locally administered in vivo.
Accordingly, FGF antagonist peptides have potential
therapeutic applications for treatment of
vasoproliferative diseases of the eye, e.g. diabetic
retinopathies, proliferative diseases of the kidney,
3~ e.g. glomerulonephritis, certain tumors, e.g.
chondrosarcoma, and adrenal vascularization.
Synthetic FGF antagonists or the nontoxic salts
I thereof, combined with a pharmaceutically acceptable
i carrier to form a pharmaceutical composition, may be
administered to mammals, including humans, either
~ 30 intravenously, subcutaneously, intramuscularly or
'~ orally. The required dosage will vary with the
particular condition being treated, with the severity of
the condition and with the duration of desired treatment.
Such peptides are often administered in the
~ 35 form of pharmaceutically acceptable nontoxic salts, such
3 as acid addition salts or metal complexes, e.g., with
zinc, iron or the like (which are considered as salts
~'' .
1 32%~8~1~
-31-
for purposes of this application). Illustrative of such
acid addition salts are hydrochloride, hydrobromide,
sulphate, phosphate, maleate, acetate, citrate,
benzoate, succin~te, malate, ascorbate, tartrate and the
like. If the active ingredient is to be administered in
tablet form, the tablet may contain a binder, such as
tragacanth, corn starch or gelatin; a disintegrating
agent, such as alginic acid; and a lubricant, such as
magnesium stearate. If administration in liquid form is
desired, sweetening and/or flavoring may be used, and
intravenous administration in isotonic saline, phosphate
buffer solutions or the like may be effected.
The peptides should be administered under the
guidance of a physician, and pharmaceutical compositions
will usually contain the peptide in conjunction with a
conventional, pharmaceutically-acceptable carrier.
Although the invention has been described with
regard to its preferred embodiments, which constitute
the best mode presently known to the inventors, it
should be understood that various changes and
modifications as would be obvious to one having the
ordinary skill in this art may be made without departing
from the scope of the invention which is set forth in
the claims appended hereto. Extensions which do not
change the FGF antagonist peptide into an FGF partial
agonist can be added to either or both termini, so long
as they do not significantly lessen its biological
potency as an FGF antagonist, and such polypeptides are
considered to be equivalents of those disclosed. For
example, the residue Tyr can be added at either terminus
of a synthetic FGF antagonist without substantially
affecting the biological potency of that particular
antagonist. Inaæmuch as the function of the peptide i8
primarily one of binding, it is the sequence that is
most important, and the C-terminus can be free acid,
amide or some equivelent moiety.
Specific features of the invention are
emphasized in the claims which follow.
~ .
~,
1328~
-32-
SUPPLEMENTARY DISCLOSURE
The following additional examples are provided as being
illustrative of peptides having various features of the
invention.
EXAMPLE IV A
The synthesis of bFGF(25-37)-NH2 having the formula:
H-Cys-Lys-Asn-Gly-Gly-Phe-Phe-Leu-Arg-Ile-His-
Pro-Asp-NH2 is conducted in a stepwise manner using a
Beckman 990 synthesizer and an MBHA resin in the manner
described in Example I. The peptide is judged to be
substantially pure using TLC and HPLC. Testing in the
manner set forth in Example II shows that the peptide has
some antagonist activity to basal endothelial cell growth
and has a fairly strong binding affinity for heparin and a
fair affinity for BHK cells.
EXAMPLE XVIII A
The synthesis of bFGF(106-118)-NH2 having the
formula: H-Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-Val-
Ala-Leu-NH2 is conducted in a stepwise manner using a
Beckman 990 synthesizer and an MBHA resin in the manner
described in Example I. The peptide is judged to be
substantially pure using TLC and HPLC. Testing in the
manner set forth in Example II shows that the peptide has
partial antagonist activity in mitogenic assays and
inhibits binding of bFGF to its receptor in BHK cells.
EXAMPLE XVIII B
The synthesis of bFGF(97-120)-NH2 having the
formula: H-Arg-Leu-Glu-Ser-Asn-Asn-Tyr-Asn-Thr-Tyr-Arg-
Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-Val-Ala-Leu-Lys-Arg-NH2
is conducted in a stepwise manner using a Beckman 990
synthesizer and an MBHA resin in the manner described in
Example I. The peptide is judged to be substantially pure
using TLC and HPLC. Testing is carried out using a culture
of serum-starved 3T3 cells which are incubated for 24 hours
with the bFGF peptide fragment and a challenge dose of bFGF
and then incubated for 5 hours with radioactive
[3H]-thymidine to determine whether the fragment will
... .
i,' ,,~l .
l32~s~a
-33-
inhibit the incorporation of [3H]-DNA in the cell line
which will be indicative of its inhibiting cell growth. It
is shown that the peptide exhibits very good inhibition of
bFGF-induced mitosis, and further testing shows that it
very strongly inhibits bFGF binding to BHK cells and that
it binds itself to heparin.
EXAMPLE XVIII C
The synthesis of bFGF(100-120)-NH2 having the
formula: H-Ser-Asn-Asn-Tyr-Asn-Thr-Tyr-Arg-Ser-Arg-Lys-
Tyr-Ser-Ser-Trp-Tyr-Val-Ala-Leu-Lys-Arg-NH2 is conducted
in a stepwise manner using a Beckman 990 synthesi~er and an
MBHA resin in the manner described in Example I. The
peptide is judged to be substantially pure using TLC and
HPLC. Testing is carried out using a culture of
serum-starved 3T3 cells which are incubated for 24 hours
~, with the bFGF peptids fragment and a challenge dose of bFGF
and then incubated for 5 hours with radioactive
[3H]-thymidine to determine whether the fragment will
inhibit the incorporation of [3H]-DNA in the cell line
1 which will be indicative of its inhibiting cell growth. It
I is shown that the peptide exhibits very good inhibition of
bFGF-induced mitosis, and further testing shows that it
very strongly inhibits bFGF binding to BHK cells and that
, it binds itself to heparin.
, 25 EXAMPLE XVIII D
The synthesis of bFGF(103-120)-NH2 having the
~, formula: H-Tyr-Asn-Thr-Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-
Trp-Tyr-Val-Ala-Leu-Lys-Arg-NH2 is conducted in a
stepwise manner using a Beckman 990 synthesizer and an MBHA
resin in the manner described in Example I. The peptide is
judged to be substantially pure using TLC and HPLC.
Testing is carried out using a culture of serum-starved 3T3
', cells which are incubated for 24 hours with the bFGF
', peptide fragment and a challenge dose of bFGF and then
~`~ 35 incubated for 5 hours with radioactive [3H]-thymidine to
,, determine whether the fragment will inhibit the
incorporation of [3H]-DNA in the cell line which will be
indicative of its inhibiting cell growth. It is shown that
:, -:
-, ,,. -
~' ~ i ~ j, . .
:,'." ":
1328~`0
-34-
the peptide exhibits very good inhibition of bFGF-induced
cell mitosis; further testinq shows that it very strongly
inhibits binding of bFGF to BHK cells and that it binds to
heparin~
EXAMPLE XVIII_E
The synthesis of bFGF(106-120)-NH2 having the
formula: H-Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-Val-
Ala-Leu-Lys-Arg-NH2 is conducted in a stepwise manner
using a Beckman 990 synthesizer and an MBHA resin in the
manner described in Example I. The peptide is judged to be
substantially pure using TLC and HPLC. Testing is carried
out using a culture of serum-starved 3T3 cells which are
¦ incubated for 24 hours with the bFGF peptide fragment and a
I challenge dose of bFGF and then incubated for 5 hours with
radioactive [3H]-thymidine to determine whether the
fragment will inhibit the incorporation of [3H]-DNA in
the cell line which will be indicative of its inhibiting
cell growth. It is shown that the peptide exhibits very
good inhibition of bFGF-induced cell mitosis; further
l; 20 testing shows that it very strongly inhibits binding of
¦~ bFGF to BHK cells and that it binds to heparin.
EXAMPLE XVIII F
The synthesis of bFGF(106-115)-NH2 having the
formula: H-Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-NH2
~ is conducted in a stepwise manner using a Beckman 990
-~l synthesizer and an MBHA resin in the manner described in
Example I. The peptide is judged to be substantially pure
,~ using TLC and HPLC. Testing is carried out using a culture
of serum-starved 3T3 cells which are incubated for 24 hours
;~ 30 with the bFGF peptide fragment and a challenge dose of bFGF
~; and then incubated for 5 hours
with radioactive [3H]-thymidine to determine whether the
fragment will inhibit the incorporation of [3H]-DNA in
the cell line which will be indicative of its inhibiting
cell growth. It is shown that the peptide exhibits very
good inhibition of bFGF-induced cell mitosis; further -
testing shows that it very strongly inhibits binding of
~` bFGF to BHK cells and that it binds to heparin. ~-~
",~ :
,,, ,,~j .
